Sample records for oligonucleotide microarray based

  1. [Oligonucleotide microarray for subtyping avian influenza virus].

    PubMed

    Xueqing, Han; Xiangmei, Lin; Yihong, Hou; Shaoqiang, Wu; Jian, Liu; Lin, Mei; Guangle, Jia; Zexiao, Yang

    2008-09-01

    Avian influenza viruses are important human and animal respiratory pathogens and rapid diagnosis of novel emerging avian influenza viruses is vital for effective global influenza surveillance. We developed an oligonucleotide microarray-based method for subtyping all avian influenza virus (16 HA and 9 NA subtypes). In total 25 pairs of primers specific for different subtypes and 1 pair of universal primers were carefully designed based on the genomic sequences of influenza A viruses retrieved from GenBank database. Several multiplex RT-PCR methods were then developed, and the target cDNAs of 25 subtype viruses were amplified by RT-PCR or overlapping PCR for evaluating the microarray. Further 52 oligonucleotide probes specific for all 25 subtype viruses were designed according to published gene sequences of avian influenza viruses in amplified target cDNAs domains, and a microarray for subtyping influenza A virus was developed. Then its specificity and sensitivity were validated by using different subtype strains and 2653 samples from 49 different areas. The results showed that all the subtypes of influenza virus could be identified simultaneously on this microarray with high sensitivity, which could reach to 2.47 pfu/mL virus or 2.5 ng target DNA. Furthermore, there was no cross reaction with other avian respiratory virus. An oligonucleotide microarray-based strategy for detection of avian influenza viruses has been developed. Such a diagnostic microarray will be useful in discovering and identifying all subtypes of avian influenza virus.

  2. Specific Discrimination of Three Pathogenic Salmonella enterica subsp. enterica Serotypes by carB-Based Oligonucleotide Microarray

    PubMed Central

    Shin, Hwa Hui; Hwang, Byeong Hee; Seo, Jeong Hyun

    2014-01-01

    It is important to rapidly and selectively detect and analyze pathogenic Salmonella enterica subsp. enterica in contaminated food to reduce the morbidity and mortality of Salmonella infection and to guarantee food safety. In the present work, we developed an oligonucleotide microarray containing duplicate specific capture probes based on the carB gene, which encodes the carbamoyl phosphate synthetase large subunit, as a competent biomarker evaluated by genetic analysis to selectively and efficiently detect and discriminate three S. enterica subsp. enterica serotypes: Choleraesuis, Enteritidis, and Typhimurium. Using the developed microarray system, three serotype targets were successfully analyzed in a range as low as 1.6 to 3.1 nM and were specifically discriminated from each other without nonspecific signals. In addition, the constructed microarray did not have cross-reactivity with other common pathogenic bacteria and even enabled the clear discrimination of the target Salmonella serotype from a bacterial mixture. Therefore, these results demonstrated that our novel carB-based oligonucleotide microarray can be used as an effective and specific detection system for S. enterica subsp. enterica serotypes. PMID:24185846

  3. Specific discrimination of three pathogenic Salmonella enterica subsp. enterica serotypes by carB-based oligonucleotide microarray.

    PubMed

    Shin, Hwa Hui; Hwang, Byeong Hee; Seo, Jeong Hyun; Cha, Hyung Joon

    2014-01-01

    It is important to rapidly and selectively detect and analyze pathogenic Salmonella enterica subsp. enterica in contaminated food to reduce the morbidity and mortality of Salmonella infection and to guarantee food safety. In the present work, we developed an oligonucleotide microarray containing duplicate specific capture probes based on the carB gene, which encodes the carbamoyl phosphate synthetase large subunit, as a competent biomarker evaluated by genetic analysis to selectively and efficiently detect and discriminate three S. enterica subsp. enterica serotypes: Choleraesuis, Enteritidis, and Typhimurium. Using the developed microarray system, three serotype targets were successfully analyzed in a range as low as 1.6 to 3.1 nM and were specifically discriminated from each other without nonspecific signals. In addition, the constructed microarray did not have cross-reactivity with other common pathogenic bacteria and even enabled the clear discrimination of the target Salmonella serotype from a bacterial mixture. Therefore, these results demonstrated that our novel carB-based oligonucleotide microarray can be used as an effective and specific detection system for S. enterica subsp. enterica serotypes.

  4. Systematic validation and atomic force microscopy of non-covalent short oligonucleotide barcode microarrays.

    PubMed

    Cook, Michael A; Chan, Chi-Kin; Jorgensen, Paul; Ketela, Troy; So, Daniel; Tyers, Mike; Ho, Chi-Yip

    2008-02-06

    Molecular barcode arrays provide a powerful means to analyze cellular phenotypes in parallel through detection of short (20-60 base) unique sequence tags, or "barcodes", associated with each strain or clone in a collection. However, costs of current methods for microarray construction, whether by in situ oligonucleotide synthesis or ex situ coupling of modified oligonucleotides to the slide surface are often prohibitive to large-scale analyses. Here we demonstrate that unmodified 20mer oligonucleotide probes printed on conventional surfaces show comparable hybridization signals to covalently linked 5'-amino-modified probes. As a test case, we undertook systematic cell size analysis of the budding yeast Saccharomyces cerevisiae genome-wide deletion collection by size separation of the deletion pool followed by determination of strain abundance in size fractions by barcode arrays. We demonstrate that the properties of a 13K unique feature spotted 20 mer oligonucleotide barcode microarray compare favorably with an analogous covalently-linked oligonucleotide array. Further, cell size profiles obtained with the size selection/barcode array approach recapitulate previous cell size measurements of individual deletion strains. Finally, through atomic force microscopy (AFM), we characterize the mechanism of hybridization to unmodified barcode probes on the slide surface. These studies push the lower limit of probe size in genome-scale unmodified oligonucleotide microarray construction and demonstrate a versatile, cost-effective and reliable method for molecular barcode analysis.

  5. Systematic Validation and Atomic Force Microscopy of Non-Covalent Short Oligonucleotide Barcode Microarrays

    PubMed Central

    Cook, Michael A.; Chan, Chi-Kin; Jorgensen, Paul; Ketela, Troy; So, Daniel; Tyers, Mike; Ho, Chi-Yip

    2008-01-01

    Background Molecular barcode arrays provide a powerful means to analyze cellular phenotypes in parallel through detection of short (20–60 base) unique sequence tags, or “barcodes”, associated with each strain or clone in a collection. However, costs of current methods for microarray construction, whether by in situ oligonucleotide synthesis or ex situ coupling of modified oligonucleotides to the slide surface are often prohibitive to large-scale analyses. Methodology/Principal Findings Here we demonstrate that unmodified 20mer oligonucleotide probes printed on conventional surfaces show comparable hybridization signals to covalently linked 5′-amino-modified probes. As a test case, we undertook systematic cell size analysis of the budding yeast Saccharomyces cerevisiae genome-wide deletion collection by size separation of the deletion pool followed by determination of strain abundance in size fractions by barcode arrays. We demonstrate that the properties of a 13K unique feature spotted 20 mer oligonucleotide barcode microarray compare favorably with an analogous covalently-linked oligonucleotide array. Further, cell size profiles obtained with the size selection/barcode array approach recapitulate previous cell size measurements of individual deletion strains. Finally, through atomic force microscopy (AFM), we characterize the mechanism of hybridization to unmodified barcode probes on the slide surface. Conclusions/Significance These studies push the lower limit of probe size in genome-scale unmodified oligonucleotide microarray construction and demonstrate a versatile, cost-effective and reliable method for molecular barcode analysis. PMID:18253494

  6. DNA Microarray-based Ecotoxicological Biomarker Discovery in a Small Fish Model Species

    EPA Science Inventory

    This paper addresses several issues critical to use of zebrafish oligonucleotide microarrays for computational toxicology research on endocrine disrupting chemicals using small fish models, and more generally, the use of microarrays in aquatic toxicology.

  7. PRACTICAL STRATEGIES FOR PROCESSING AND ANALYZING SPOTTED OLIGONUCLEOTIDE MICROARRAY DATA

    EPA Science Inventory

    Thoughtful data analysis is as important as experimental design, biological sample quality, and appropriate experimental procedures for making microarrays a useful supplement to traditional toxicology. In the present study, spotted oligonucleotide microarrays were used to profile...

  8. A novel universal DNA labeling and amplification system for rapid microarray-based detection of 117 antibiotic resistance genes in Gram-positive bacteria.

    PubMed

    Strauss, Christian; Endimiani, Andrea; Perreten, Vincent

    2015-01-01

    A rapid and simple DNA labeling system has been developed for disposable microarrays and has been validated for the detection of 117 antibiotic resistance genes abundant in Gram-positive bacteria. The DNA was fragmented and amplified using phi-29 polymerase and random primers with linkers. Labeling and further amplification were then performed by classic PCR amplification using biotinylated primers specific for the linkers. The microarray developed by Perreten et al. (Perreten, V., Vorlet-Fawer, L., Slickers, P., Ehricht, R., Kuhnert, P., Frey, J., 2005. Microarray-based detection of 90 antibiotic resistance genes of gram-positive bacteria. J.Clin.Microbiol. 43, 2291-2302.) was improved by additional oligonucleotides. A total of 244 oligonucleotides (26 to 37 nucleotide length and with similar melting temperatures) were spotted on the microarray, including genes conferring resistance to clinically important antibiotic classes like β-lactams, macrolides, aminoglycosides, glycopeptides and tetracyclines. Each antibiotic resistance gene is represented by at least 2 oligonucleotides designed from consensus sequences of gene families. The specificity of the oligonucleotides and the quality of the amplification and labeling were verified by analysis of a collection of 65 strains belonging to 24 species. Association between genotype and phenotype was verified for 6 antibiotics using 77 Staphylococcus strains belonging to different species and revealed 95% test specificity and a 93% predictive value of a positive test. The DNA labeling and amplification is independent of the species and of the target genes and could be used for different types of microarrays. This system has also the advantage to detect several genes within one bacterium at once, like in Staphylococcus aureus strain BM3318, in which up to 15 genes were detected. This new microarray-based detection system offers a large potential for applications in clinical diagnostic, basic research, food safety and surveillance programs for antimicrobial resistance. Copyright © 2014 Elsevier B.V. All rights reserved.

  9. Impact of point-mutations on the hybridization affinity of surface-bound DNA/DNA and RNA/DNA oligonucleotide-duplexes: Comparison of single base mismatches and base bulges

    PubMed Central

    Naiser, Thomas; Ehler, Oliver; Kayser, Jona; Mai, Timo; Michel, Wolfgang; Ott, Albrecht

    2008-01-01

    Background The high binding specificity of short 10 to 30 mer oligonucleotide probes enables single base mismatch (MM) discrimination and thus provides the basis for genotyping and resequencing microarray applications. Recent experiments indicate that the underlying principles governing DNA microarray hybridization – and in particular MM discrimination – are not completely understood. Microarrays usually address complex mixtures of DNA targets. In order to reduce the level of complexity and to study the problem of surface-based hybridization with point defects in more detail, we performed array based hybridization experiments in well controlled and simple situations. Results We performed microarray hybridization experiments with short 16 to 40 mer target and probe lengths (in situations without competitive hybridization) in order to systematically investigate the impact of point-mutations – varying defect type and position – on the oligonucleotide duplex binding affinity. The influence of single base bulges and single base MMs depends predominantly on position – it is largest in the middle of the strand. The position-dependent influence of base bulges is very similar to that of single base MMs, however certain bulges give rise to an unexpectedly high binding affinity. Besides the defect (MM or bulge) type, which is the second contribution in importance to hybridization affinity, there is also a sequence dependence, which extends beyond the defect next-neighbor and which is difficult to quantify. Direct comparison between binding affinities of DNA/DNA and RNA/DNA duplexes shows, that RNA/DNA purine-purine MMs are more discriminating than corresponding DNA/DNA MMs. In DNA/DNA MM discrimination the affected base pair (C·G vs. A·T) is the pertinent parameter. We attribute these differences to the different structures of the duplexes (A vs. B form). Conclusion We have shown that DNA microarrays can resolve even subtle changes in hybridization affinity for simple target mixtures. We have further shown that the impact of point defects on oligonucleotide stability can be broken down to a hierarchy of effects. In order to explain our observations we propose DNA molecular dynamics – in form of zipping of the oligonucleotide duplex – to play an important role. PMID:18477387

  10. Particle-Based Microarrays of Oligonucleotides and Oligopeptides.

    PubMed

    Nesterov-Mueller, Alexander; Maerkle, Frieder; Hahn, Lothar; Foertsch, Tobias; Schillo, Sebastian; Bykovskaya, Valentina; Sedlmayr, Martyna; Weber, Laura K; Ridder, Barbara; Soehindrijo, Miriam; Muenster, Bastian; Striffler, Jakob; Bischoff, F Ralf; Breitling, Frank; Loeffler, Felix F

    2014-10-28

    In this review, we describe different methods of microarray fabrication based on the use of micro-particles/-beads and point out future tendencies in the development of particle-based arrays. First, we consider oligonucleotide bead arrays, where each bead is a carrier of one specific sequence of oligonucleotides. This bead-based array approach, appearing in the late 1990s, enabled high-throughput oligonucleotide analysis and had a large impact on genome research. Furthermore, we consider particle-based peptide array fabrication using combinatorial chemistry. In this approach, particles can directly participate in both the synthesis and the transfer of synthesized combinatorial molecules to a substrate. Subsequently, we describe in more detail the synthesis of peptide arrays with amino acid polymer particles, which imbed the amino acids inside their polymer matrix. By heating these particles, the polymer matrix is transformed into a highly viscous gel, and thereby, imbedded monomers are allowed to participate in the coupling reaction. Finally, we focus on combinatorial laser fusing of particles for the synthesis of high-density peptide arrays. This method combines the advantages of particles and combinatorial lithographic approaches.

  11. Particle-Based Microarrays of Oligonucleotides and Oligopeptides

    PubMed Central

    Nesterov-Mueller, Alexander; Maerkle, Frieder; Hahn, Lothar; Foertsch, Tobias; Schillo, Sebastian; Bykovskaya, Valentina; Sedlmayr, Martyna; Weber, Laura K.; Ridder, Barbara; Soehindrijo, Miriam; Muenster, Bastian; Striffler, Jakob; Bischoff, F. Ralf; Breitling, Frank; Loeffler, Felix F.

    2014-01-01

    In this review, we describe different methods of microarray fabrication based on the use of micro-particles/-beads and point out future tendencies in the development of particle-based arrays. First, we consider oligonucleotide bead arrays, where each bead is a carrier of one specific sequence of oligonucleotides. This bead-based array approach, appearing in the late 1990s, enabled high-throughput oligonucleotide analysis and had a large impact on genome research. Furthermore, we consider particle-based peptide array fabrication using combinatorial chemistry. In this approach, particles can directly participate in both the synthesis and the transfer of synthesized combinatorial molecules to a substrate. Subsequently, we describe in more detail the synthesis of peptide arrays with amino acid polymer particles, which imbed the amino acids inside their polymer matrix. By heating these particles, the polymer matrix is transformed into a highly viscous gel, and thereby, imbedded monomers are allowed to participate in the coupling reaction. Finally, we focus on combinatorial laser fusing of particles for the synthesis of high-density peptide arrays. This method combines the advantages of particles and combinatorial lithographic approaches. PMID:27600347

  12. Detection and identification of intestinal pathogenic bacteria by hybridization to oligonucleotide microarrays

    PubMed Central

    Jin, Lian-Qun; Li, Jun-Wen; Wang, Sheng-Qi; Chao, Fu-Huan; Wang, Xin-Wei; Yuan, Zheng-Quan

    2005-01-01

    AIM: To detect the common intestinal pathogenic bacteria quickly and accurately. METHODS: A rapid (<3 h) experimental procedure was set up based upon the gene chip technology. Target genes were amplified and hybridized by oligonucleotide microarrays. RESULTS: One hundred and seventy strains of bacteria in pure culture belonging to 11 genera were successfully discriminated under comparatively same conditions, and a series of specific hybridization maps corresponding to each kind of bacteria were obtained. When this method was applied to 26 divided cultures, 25 (96.2%) were identified. CONCLUSION: Salmonella sp., Escherichia coli, Shigella sp., Listeria monocytogenes, Vibrio parahaemolyticus, Staphylococcus aureus, Proteus sp., Bacillus cereus, Vibrio cholerae, Enterococcus faecalis, Yersinia enterocolitica, and Campylobacter jejuni can be detected and identified by our microarrays. The accuracy, range, and discrimination power of this assay can be continually improved by adding further oligonucleotides to the arrays without any significant increase of complexity or cost. PMID:16437687

  13. 16S rRNA gene-based phylogenetic microarray for simultaneous identification of members of the genus Burkholderia.

    PubMed

    Schönmann, Susan; Loy, Alexander; Wimmersberger, Céline; Sobek, Jens; Aquino, Catharine; Vandamme, Peter; Frey, Beat; Rehrauer, Hubert; Eberl, Leo

    2009-04-01

    For cultivation-independent and highly parallel analysis of members of the genus Burkholderia, an oligonucleotide microarray (phylochip) consisting of 131 hierarchically nested 16S rRNA gene-targeted oligonucleotide probes was developed. A novel primer pair was designed for selective amplification of a 1.3 kb 16S rRNA gene fragment of Burkholderia species prior to microarray analysis. The diagnostic performance of the microarray for identification and differentiation of Burkholderia species was tested with 44 reference strains of the genera Burkholderia, Pandoraea, Ralstonia and Limnobacter. Hybridization patterns based on presence/absence of probe signals were interpreted semi-automatically using the novel likelihood-based strategy of the web-tool Phylo- Detect. Eighty-eight per cent of the reference strains were correctly identified at the species level. The evaluated microarray was applied to investigate shifts in the Burkholderia community structure in acidic forest soil upon addition of cadmium, a condition that selected for Burkholderia species. The microarray results were in agreement with those obtained from phylogenetic analysis of Burkholderia 16S rRNA gene sequences recovered from the same cadmiumcontaminated soil, demonstrating the value of the Burkholderia phylochip for determinative and environmental studies.

  14. Evaluation of chronic lymphocytic leukemia by oligonucleotide-based microarray analysis uncovers novel aberrations not detected by FISH or cytogenetic analysis

    PubMed Central

    2011-01-01

    Background Cytogenetic evaluation is a key component of the diagnosis and prognosis of chronic lymphocytic leukemia (CLL). We performed oligonucleotide-based comparative genomic hybridization microarray analysis on 34 samples with CLL and known abnormal karyotypes previously determined by cytogenetics and/or fluorescence in situ hybridization (FISH). Results Using a custom designed microarray that targets >1800 genes involved in hematologic disease and other malignancies, we identified additional cryptic aberrations and novel findings in 59% of cases. These included gains and losses of genes associated with cell cycle regulation, apoptosis and susceptibility loci on 3p21.31, 5q35.2q35.3, 10q23.31q23.33, 11q22.3, and 22q11.23. Conclusions Our results show that microarray analysis will detect known aberrations, including microscopic and cryptic alterations. In addition, novel genomic changes will be uncovered that may become important prognostic predictors or treatment targets for CLL in the future. PMID:22087757

  15. Validation of the Swine Protein-Annotated Oligonucleotide Microarray

    USDA-ARS?s Scientific Manuscript database

    The specificity and utility of the Swine Protein-Annotated Oligonucleotide Microarray, or Pigoligoarray (www.pigoligoarray.org), has been evaluated by profiling the expression of transcripts from four porcine tissues. Tools for comparative analyses of expression on the Pigoligoarray were developed i...

  16. sigReannot: an oligo-set re-annotation pipeline based on similarities with the Ensembl transcripts and Unigene clusters.

    PubMed

    Casel, Pierrot; Moreews, François; Lagarrigue, Sandrine; Klopp, Christophe

    2009-07-16

    Microarray is a powerful technology enabling to monitor tens of thousands of genes in a single experiment. Most microarrays are now using oligo-sets. The design of the oligo-nucleotides is time consuming and error prone. Genome wide microarray oligo-sets are designed using as large a set of transcripts as possible in order to monitor as many genes as possible. Depending on the genome sequencing state and on the assembly state the knowledge of the existing transcripts can be very different. This knowledge evolves with the different genome builds and gene builds. Once the design is done the microarrays are often used for several years. The biologists working in EADGENE expressed the need of up-to-dated annotation files for the oligo-sets they share including information about the orthologous genes of model species, the Gene Ontology, the corresponding pathways and the chromosomal location. The results of SigReannot on a chicken micro-array used in the EADGENE project compared to the initial annotations show that 23% of the oligo-nucleotide gene annotations were not confirmed, 2% were modified and 1% were added. The interest of this up-to-date annotation procedure is demonstrated through the analysis of real data previously published. SigReannot uses the oligo-nucleotide design procedure criteria to validate the probe-gene link and the Ensembl transcripts as reference for annotation. It therefore produces a high quality annotation based on reference gene sets.

  17. SIMULATION AND VISUALIZATION OF FLOW PATTERN IN MICROARRAYS FOR LIQUID PHASE OLIGONUCLEOTIDE AND PEPTIDE SYNTHESIS

    PubMed Central

    O-Charoen, Sirimon; Srivannavit, Onnop; Gulari, Erdogan

    2008-01-01

    Microfluidic microarrays have been developed for economical and rapid parallel synthesis of oligonucleotide and peptide libraries. For a synthesis system to be reproducible and uniform, it is crucial to have a uniform reagent delivery throughout the system. Computational fluid dynamics (CFD) is used to model and simulate the microfluidic microarrays to study geometrical effects on flow patterns. By proper design geometry, flow uniformity could be obtained in every microreactor in the microarrays. PMID:17480053

  18. The illusion of specific capture: surface and solution studies of suboptimal oligonucleotide hybridization

    PubMed Central

    2013-01-01

    Background Hybridization based assays and capture systems depend on the specificity of hybridization between a probe and its intended target. A common guideline in the construction of DNA microarrays, for instance, is that avoiding complementary stretches of more than 15 nucleic acids in a 50 or 60-mer probe will eliminate sequence specific cross-hybridization reactions. Here we present a study of the behavior of partially matched oligonucleotide pairs with complementary stretches starting well below this threshold complementarity length – in silico, in solution, and at the microarray surface. The modeled behavior of pairs of oligonucleotide probes and their targets suggests that even a complementary stretch of sequence 12 nt in length would give rise to specific cross-hybridization. We designed a set of binding partners to a 50-mer oligonucleotide containing complementary stretches from 6 nt to 21 nt in length. Results Solution melting experiments demonstrate that stable partial duplexes can form when only 12 bp of complementary sequence are present; surface hybridization experiments confirm that a signal close in magnitude to full-strength signal can be obtained from hybridization of a 12 bp duplex within a 50mer oligonucleotide. Conclusions Microarray and other molecular capture strategies that rely on a 15 nt lower complementarity bound for eliminating specific cross-hybridization may not be sufficiently conservative. PMID:23445545

  19. [Research progress of probe design software of oligonucleotide microarrays].

    PubMed

    Chen, Xi; Wu, Zaoquan; Liu, Zhengchun

    2014-02-01

    DNA microarray has become an essential medical genetic diagnostic tool for its high-throughput, miniaturization and automation. The design and selection of oligonucleotide probes are critical for preparing gene chips with high quality. Several sets of probe design software have been developed and are available to perform this work now. Every set of the software aims to different target sequences and shows different advantages and limitations. In this article, the research and development of these sets of software are reviewed in line with three main criteria, including specificity, sensitivity and melting temperature (Tm). In addition, based on the experimental results from literatures, these sets of software are classified according to their applications. This review will be helpful for users to choose an appropriate probe-design software. It will also reduce the costs of microarrays, improve the application efficiency of microarrays, and promote both the research and development (R&D) and commercialization of high-performance probe design software.

  20. Experimental analysis of oligonucleotide microarray design criteria to detect deletions by comparative genomic hybridization.

    PubMed

    Flibotte, Stephane; Moerman, Donald G

    2008-10-21

    Microarray comparative genomic hybridization (CGH) is currently one of the most powerful techniques to measure DNA copy number in large genomes. In humans, microarray CGH is widely used to assess copy number variants in healthy individuals and copy number aberrations associated with various diseases, syndromes and disease susceptibility. In model organisms such as Caenorhabditis elegans (C. elegans) the technique has been applied to detect mutations, primarily deletions, in strains of interest. Although various constraints on oligonucleotide properties have been suggested to minimize non-specific hybridization and improve the data quality, there have been few experimental validations for CGH experiments. For genomic regions where strict design filters would limit the coverage it would also be useful to quantify the expected loss in data quality associated with relaxed design criteria. We have quantified the effects of filtering various oligonucleotide properties by measuring the resolving power for detecting deletions in the human and C. elegans genomes using NimbleGen microarrays. Approximately twice as many oligonucleotides are typically required to be affected by a deletion in human DNA samples in order to achieve the same statistical confidence as one would observe for a deletion in C. elegans. Surprisingly, the ability to detect deletions strongly depends on the oligonucleotide 15-mer count, which is defined as the sum of the genomic frequency of all the constituent 15-mers within the oligonucleotide. A similarity level above 80% to non-target sequences over the length of the probe produces significant cross-hybridization. We recommend the use of a fairly large melting temperature window of up to 10 degrees C, the elimination of repeat sequences, the elimination of homopolymers longer than 5 nucleotides, and a threshold of -1 kcal/mol on the oligonucleotide self-folding energy. We observed very little difference in data quality when varying the oligonucleotide length between 50 and 70, and even when using an isothermal design strategy. We have determined experimentally the effects of varying several key oligonucleotide microarray design criteria for detection of deletions in C. elegans and humans with NimbleGen's CGH technology. Our oligonucleotide design recommendations should be applicable for CGH analysis in most species.

  1. Synthesis of high-quality libraries of long (150mer) oligonucleotides by a novel depurination controlled process

    PubMed Central

    LeProust, Emily M.; Peck, Bill J.; Spirin, Konstantin; McCuen, Heather Brummel; Moore, Bridget; Namsaraev, Eugeni; Caruthers, Marvin H.

    2010-01-01

    We have achieved the ability to synthesize thousands of unique, long oligonucleotides (150mers) in fmol amounts using parallel synthesis of DNA on microarrays. The sequence accuracy of the oligonucleotides in such large-scale syntheses has been limited by the yields and side reactions of the DNA synthesis process used. While there has been significant demand for libraries of long oligos (150mer and more), the yields in conventional DNA synthesis and the associated side reactions have previously limited the availability of oligonucleotide pools to lengths <100 nt. Using novel array based depurination assays, we show that the depurination side reaction is the limiting factor for the synthesis of libraries of long oligonucleotides on Agilent Technologies’ SurePrint® DNA microarray platform. We also demonstrate how depurination can be controlled and reduced by a novel detritylation process to enable the synthesis of high quality, long (150mer) oligonucleotide libraries and we report the characterization of synthesis efficiency for such libraries. Oligonucleotide libraries prepared with this method have changed the economics and availability of several existing applications (e.g. targeted resequencing, preparation of shRNA libraries, site-directed mutagenesis), and have the potential to enable even more novel applications (e.g. high-complexity synthetic biology). PMID:20308161

  2. Derivation of Tissue-specific Functional Gene Sets to Aid Transcriptomic Analysis of Chemical Impacts on the Teleost Reproductive Axis.

    EPA Science Inventory

    Oligonucleotide microarrays are a powerful tool for unsupervised analysis of chemical impacts on biological systems. However, the lack of well annotated biological pathways for many aquatic organisms, including fish, and the poor power of microarray-based analyses to detect diffe...

  3. Optimization of single-base-pair mismatch discrimination in oligonucleotide microarrays

    NASA Technical Reports Server (NTRS)

    Urakawa, Hidetoshi; El Fantroussi, Said; Smidt, Hauke; Smoot, James C.; Tribou, Erik H.; Kelly, John J.; Noble, Peter A.; Stahl, David A.

    2003-01-01

    The discrimination between perfect-match and single-base-pair-mismatched nucleic acid duplexes was investigated by using oligonucleotide DNA microarrays and nonequilibrium dissociation rates (melting profiles). DNA and RNA versions of two synthetic targets corresponding to the 16S rRNA sequences of Staphylococcus epidermidis (38 nucleotides) and Nitrosomonas eutropha (39 nucleotides) were hybridized to perfect-match probes (18-mer and 19-mer) and to a set of probes having all possible single-base-pair mismatches. The melting profiles of all probe-target duplexes were determined in parallel by using an imposed temperature step gradient. We derived an optimum wash temperature for each probe and target by using a simple formula to calculate a discrimination index for each temperature of the step gradient. This optimum corresponded to the output of an independent analysis using a customized neural network program. These results together provide an experimental and analytical framework for optimizing mismatch discrimination among all probes on a DNA microarray.

  4. Oligonucleotide Microarray for 16S rRNA Gene-Based Detection of All Recognized Lineages of Sulfate-Reducing Prokaryotes in the Environment

    PubMed Central

    Loy, Alexander; Lehner, Angelika; Lee, Natuschka; Adamczyk, Justyna; Meier, Harald; Ernst, Jens; Schleifer, Karl-Heinz; Wagner, Michael

    2002-01-01

    For cultivation-independent detection of sulfate-reducing prokaryotes (SRPs) an oligonucleotide microarray consisting of 132 16S rRNA gene-targeted oligonucleotide probes (18-mers) having hierarchical and parallel (identical) specificity for the detection of all known lineages of sulfate-reducing prokaryotes (SRP-PhyloChip) was designed and subsequently evaluated with 41 suitable pure cultures of SRPs. The applicability of SRP-PhyloChip for diversity screening of SRPs in environmental and clinical samples was tested by using samples from periodontal tooth pockets and from the chemocline of a hypersaline cyanobacterial mat from Solar Lake (Sinai, Egypt). Consistent with previous studies, SRP-PhyloChip indicated the occurrence of Desulfomicrobium spp. in the tooth pockets and the presence of Desulfonema- and Desulfomonile-like SRPs (together with other SRPs) in the chemocline of the mat. The SRP-PhyloChip results were confirmed by several DNA microarray-independent techniques, including specific PCR amplification, cloning, and sequencing of SRP 16S rRNA genes and the genes encoding the dissimilatory (bi)sulfite reductase (dsrAB). PMID:12324358

  5. Detection and discrimination of orthopoxviruses using microarrays of immobilized oligonucleotides.

    PubMed

    Laassri, Majid; Chizhikov, Vladimir; Mikheev, Maxim; Shchelkunov, Sergei; Chumakov, Konstantin

    2003-09-01

    Variola virus (VARV), causing smallpox, is a potential biological weapon. Methods to detect VARV rapidly and to differentiate it from other viruses causing similar clinical syndromes are needed urgently. We have developed a new microarray-based method that detects simultaneously and discriminates four orthopoxvirus (OPV) species pathogenic for humans (variola, monkeypox, cowpox, and vaccinia viruses) and distinguishes them from chickenpox virus (varicella-zoster virus or VZV). The OPV gene C23L/B29R, encoding the CC-chemokine binding protein, was sequenced for 41 strains of seven species of orthopox viruses obtained from different geographical regions. Those C23L/B29R sequences and the ORF 62 sequences from 13 strains of VZV (selected from GenBank) were used to design oligonucleotide probes that were immobilized on an aldehyde-coated glass surface (a total of 57 probes). The microchip contained several unique 13-21 bases long oligonucleotide probes specific to each virus species to ensure redundancy and robustness of the assay. A region approximately 1100 bases long was amplified from samples of viral DNA and fluorescently labeled with Cy5-modified dNTPs, and single-stranded DNA was prepared by strand separation. Hybridization was carried out under plastic coverslips, resulting in a fluorescent pattern that was quantified using a confocal laser scanner. 49 known and blinded samples of OPV DNA, representing different OPV species, and two VZV strains were tested. The oligonucleotide microarray hybridization technique identified reliably and correctly all samples. This new procedure takes only 3 h, and it can be used for parallel testing of multiple samples.

  6. ASSESSMENT OF THE SWINE PROTEIN-ANNOTATED OLIGONUCLEOTIDE MICROARRAY AND UTILITY OF THE ARRAYS FOR EQTL AND TRANSCRIPTIONAL PROFILING STUDIES

    USDA-ARS?s Scientific Manuscript database

    We have evaluated the new Swine Protein-Annotated Oligonucleotide Microarray (http://www.pigoligoarray.org) by analyzing transcriptional profiles for longissimus dorsi muscle (LD), Bronchial lymph node (BLN) and Lung. Four LD samples were used to assess the stringency of hybridization conditions com...

  7. Design of oligonucleotides for microarrays and perspectives for design of multi-transcriptome arrays.

    PubMed

    Nielsen, Henrik Bjørn; Wernersson, Rasmus; Knudsen, Steen

    2003-07-01

    Optimal design of oligonucleotides for microarrays involves tedious and laborious work evaluating potential oligonucleotides relative to a series of parameters. The currently available tools for this purpose are limited in their flexibility and do not present the oligonucleotide designer with an overview of these parameters. We present here a flexible tool named OligoWiz for designing oligonucleotides for multiple purposes. OligoWiz presents a set of parameter scores in a graphical interface to facilitate an overview for the user. Additional custom parameter scores can easily be added to the program to extend the default parameters: homology, DeltaTm, low-complexity, position and GATC-only. Furthermore we present an analysis of the limitations in designing oligonucleotide sets that can detect transcripts from multiple organisms. OligoWiz is available at www.cbs.dtu.dk/services/OligoWiz/.

  8. Detection and genotyping of Entamoeba histolytica, Entamoeba dispar, Giardia lamblia, and Cryptosporidium parvum by oligonucleotide microarray.

    PubMed

    Wang, Zheng; Vora, Gary J; Stenger, David A

    2004-07-01

    Entamoeba histolytica, Giardia lamblia, and Cryptosporidium parvum are the most frequently identified protozoan parasites causing waterborne disease outbreaks. The morbidity and mortality associated with these intestinal parasitic infections warrant the development of rapid and accurate detection and genotyping methods to aid public health efforts aimed at preventing and controlling outbreaks. In this study, we describe the development of an oligonucleotide microarray capable of detecting and discriminating between E. histolytica, Entamoeba dispar, G. lamblia assemblages A and B, and C. parvum types 1 and 2 in a single assay. Unique hybridization patterns for each selected protozoan were generated by amplifying six to eight diagnostic sequences/organism by multiplex PCR; fluorescent labeling of the amplicons via primer extension; and subsequent hybridization to a set of genus-, species-, and subtype-specific covalently immobilized oligonucleotide probes. The profile-based specificity of this methodology not only permitted for the unequivocal identification of the six targeted species and subtypes, but also demonstrated its potential in identifying related species such as Cryptosporidium meleagridis and Cryptosporidium muris. In addition, sensitivity assays demonstrated lower detection limits of five trophozoites of G. lamblia. Taken together, the specificity and sensitivity of the microarray-based approach suggest that this methodology may provide a promising tool to detect and genotype protozoa from clinical and environmental samples.

  9. Oligo Design: a computer program for development of probes for oligonucleotide microarrays.

    PubMed

    Herold, Keith E; Rasooly, Avraham

    2003-12-01

    Oligonucleotide microarrays have demonstrated potential for the analysis of gene expression, genotyping, and mutational analysis. Our work focuses primarily on the detection and identification of bacteria based on known short sequences of DNA. Oligo Design, the software described here, automates several design aspects that enable the improved selection of oligonucleotides for use with microarrays for these applications. Two major features of the program are: (i) a tiling algorithm for the design of short overlapping temperature-matched oligonucleotides of variable length, which are useful for the analysis of single nucleotide polymorphisms and (ii) a set of tools for the analysis of multiple alignments of gene families and related short DNA sequences, which allow for the identification of conserved DNA sequences for PCR primer selection and variable DNA sequences for the selection of unique probes for identification. Note that the program does not address the full genome perspective but, instead, is focused on the genetic analysis of short segments of DNA. The program is Internet-enabled and includes a built-in browser and the automated ability to download sequences from GenBank by specifying the GI number. The program also includes several utilities, including audio recital of a DNA sequence (useful for verifying sequences against a written document), a random sequence generator that provides insight into the relationship between melting temperature and GC content, and a PCR calculator.

  10. A dynamic bead-based microarray for parallel DNA detection

    NASA Astrophysics Data System (ADS)

    Sochol, R. D.; Casavant, B. P.; Dueck, M. E.; Lee, L. P.; Lin, L.

    2011-05-01

    A microfluidic system has been designed and constructed by means of micromachining processes to integrate both microfluidic mixing of mobile microbeads and hydrodynamic microbead arraying capabilities on a single chip to simultaneously detect multiple bio-molecules. The prototype system has four parallel reaction chambers, which include microchannels of 18 × 50 µm2 cross-sectional area and a microfluidic mixing section of 22 cm length. Parallel detection of multiple DNA oligonucleotide sequences was achieved via molecular beacon probes immobilized on polystyrene microbeads of 16 µm diameter. Experimental results show quantitative detection of three distinct DNA oligonucleotide sequences from the Hepatitis C viral (HCV) genome with single base-pair mismatch specificity. Our dynamic bead-based microarray offers an effective microfluidic platform to increase parallelization of reactions and improve microbead handling for various biological applications, including bio-molecule detection, medical diagnostics and drug screening.

  11. Efficiency, error and yield in light-directed maskless synthesis of DNA microarrays

    PubMed Central

    2011-01-01

    Background Light-directed in situ synthesis of DNA microarrays using computer-controlled projection from a digital micromirror device--maskless array synthesis (MAS)--has proved to be successful at both commercial and laboratory scales. The chemical synthetic cycle in MAS is quite similar to that of conventional solid-phase synthesis of oligonucleotides, but the complexity of microarrays and unique synthesis kinetics on the glass substrate require a careful tuning of parameters and unique modifications to the synthesis cycle to obtain optimal deprotection and phosphoramidite coupling. In addition, unintended deprotection due to scattering and diffraction introduce insertion errors that contribute significantly to the overall error rate. Results Stepwise phosphoramidite coupling yields have been greatly improved and are now comparable to those obtained in solid phase synthesis of oligonucleotides. Extended chemical exposure in the synthesis of complex, long oligonucleotide arrays result in lower--but still high--final average yields which approach 99%. The new synthesis chemistry includes elimination of the standard oxidation until the final step, and improved coupling and light deprotection. Coupling Insertions due to stray light are the limiting factor in sequence quality for oligonucleotide synthesis for gene assembly. Diffraction and local flare are by far the largest contributors to loss of optical contrast. Conclusions Maskless array synthesis is an efficient and versatile method for synthesizing high density arrays of long oligonucleotides for hybridization- and other molecular binding-based experiments. For applications requiring high sequence purity, such as gene assembly, diffraction and flare remain significant obstacles, but can be significantly reduced with straightforward experimental strategies. PMID:22152062

  12. The detection and differentiation of canine respiratory pathogens using oligonucleotide microarrays.

    PubMed

    Wang, Lih-Chiann; Kuo, Ya-Ting; Chueh, Ling-Ling; Huang, Dean; Lin, Jiunn-Horng

    2017-05-01

    Canine respiratory diseases are commonly seen in dogs along with co-infections with multiple respiratory pathogens, including viruses and bacteria. Virus infections in even vaccinated dogs were also reported. The clinical signs caused by different respiratory etiological agents are similar, which makes differential diagnosis imperative. An oligonucleotide microarray system was developed in this study. The wild type and vaccine strains of canine distemper virus (CDV), influenza virus, canine herpesvirus (CHV), Bordetella bronchiseptica and Mycoplasma cynos were detected and differentiated simultaneously on a microarray chip. The detection limit is 10, 10, 100, 50 and 50 copy numbers for CDV, influenza virus, CHV, B. bronchiseptica and M. cynos, respectively. The clinical test results of nasal swab samples showed that the microarray had remarkably better efficacy than the multiplex PCR-agarose gel method. The positive detection rate of microarray and agarose gel was 59.0% (n=33) and 41.1% (n=23) among the 56 samples, respectively. CDV vaccine strain and pathogen co-infections were further demonstrated by the microarray but not by the multiplex PCR-agarose gel. The oligonucleotide microarray provides a highly efficient diagnosis alternative that could be applied to clinical usage, greatly assisting in disease therapy and control. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Microarray-Based Mapping for the Detection of Molecular Markers in Response to Aspergillus flavus Infection in Susceptible and Resistant Maize Lines

    USDA-ARS?s Scientific Manuscript database

    The objectives of this study were (1) to evaluate differential gene expression levels for resistance to A. flavus kernel infection in susceptible (Va35) and resistant (Mp313E) maize lines using Oligonucleotide and cDNA microarray analysis, (2) to evaluate differences in A. flavus accumulation betwee...

  14. Development and experimental validation of a 20K Atlantic cod (Gadus morhua) oligonucleotide microarray based on a collection of over 150,000 ESTs.

    PubMed

    Booman, Marije; Borza, Tudor; Feng, Charles Y; Hori, Tiago S; Higgins, Brent; Culf, Adrian; Léger, Daniel; Chute, Ian C; Belkaid, Anissa; Rise, Marlies; Gamperl, A Kurt; Hubert, Sophie; Kimball, Jennifer; Ouellette, Rodney J; Johnson, Stewart C; Bowman, Sharen; Rise, Matthew L

    2011-08-01

    The collapse of Atlantic cod (Gadus morhua) wild populations strongly impacted the Atlantic cod fishery and led to the development of cod aquaculture. In order to improve aquaculture and broodstock quality, we need to gain knowledge of genes and pathways involved in Atlantic cod responses to pathogens and other stressors. The Atlantic Cod Genomics and Broodstock Development Project has generated over 150,000 expressed sequence tags from 42 cDNA libraries representing various tissues, developmental stages, and stimuli. We used this resource to develop an Atlantic cod oligonucleotide microarray containing 20,000 unique probes. Selection of sequences from the full range of cDNA libraries enables application of the microarray for a broad spectrum of Atlantic cod functional genomics studies. We included sequences that were highly abundant in suppression subtractive hybridization (SSH) libraries, which were enriched for transcripts responsive to pathogens or other stressors. These sequences represent genes that potentially play an important role in stress and/or immune responses, making the microarray particularly useful for studies of Atlantic cod gene expression responses to immune stimuli and other stressors. To demonstrate its value, we used the microarray to analyze the Atlantic cod spleen response to stimulation with formalin-killed, atypical Aeromonas salmonicida, resulting in a gene expression profile that indicates a strong innate immune response. These results were further validated by quantitative PCR analysis and comparison to results from previous analysis of an SSH library. This study shows that the Atlantic cod 20K oligonucleotide microarray is a valuable new tool for Atlantic cod functional genomics research.

  15. In situ oligonucleotide synthesis on poly(dimethylsiloxane): a flexible substrate for microarray fabrication

    PubMed Central

    Moorcroft, Matthew J.; Meuleman, Wouter R. A.; Latham, Steven G.; Nicholls, Thomas J.; Egeland, Ryan D.; Southern, Edwin M.

    2005-01-01

    In this paper, we demonstrate in situ synthesis of oligonucleotide probes on poly(dimethylsiloxane) (PDMS) microchannels through use of conventional phosphoramidite chemistry. PDMS polymer was moulded into a series of microchannels using standard soft lithography (micro-moulding), with dimensions <100 μm. The surface of the PDMS was derivatized by exposure to ultraviolet/ozone followed by vapour phase deposition of glycidoxypropyltrimethoxysilane and reaction with poly(ethylene glycol) spacer, resulting in a reactive surface for oligonucleotide coupling. High, reproducible yields were achieved for both 6mer and 21mer probes as assessed by hybridization to fluorescent oligonucleotides. Oligonucleotide surface density was comparable with that obtained on glass substrates. These results suggest PDMS as a stable and flexible alternative to glass as a suitable substrate in the fabrication and synthesis of DNA microarrays. PMID:15870385

  16. Double stranded nucleic acid biochips

    DOEpatents

    Chernov, Boris; Golova, Julia

    2006-05-23

    This invention describes a new method of constructing double-stranded DNA (dsDNA) microarrays based on the use of pre-synthesized or natural DNA duplexes without a stem-loop structure. The complementary oligonucleotide chains are bonded together by a novel connector that includes a linker for immobilization on a matrix. A non-enzymatic method for synthesizing double-stranded nucleic acids with this novel connector enables the construction of inexpensive and robust dsDNA/dsRNA microarrays. DNA-DNA and DNA-protein interactions are investigated using the microarrays.

  17. EvOligo: A Novel Software to Design and Group Libraries of Oligonucleotides Applicable for Nucleic Acid-Based Experiments.

    PubMed

    Milewski, Marek C; Kamel, Karol; Kurzynska-Kokorniak, Anna; Chmielewski, Marcin K; Figlerowicz, Marek

    2017-10-01

    Experimental methods based on DNA and RNA hybridization, such as multiplex polymerase chain reaction, multiplex ligation-dependent probe amplification, or microarray analysis, require the use of mixtures of multiple oligonucleotides (primers or probes) in a single test tube. To provide an optimal reaction environment, minimal self- and cross-hybridization must be achieved among these oligonucleotides. To address this problem, we developed EvOligo, which is a software package that provides the means to design and group DNA and RNA molecules with defined lengths. EvOligo combines two modules. The first module performs oligonucleotide design, and the second module performs oligonucleotide grouping. The software applies a nearest-neighbor model of nucleic acid interactions coupled with a parallel evolutionary algorithm to construct individual oligonucleotides, and to group the molecules that are characterized by the weakest possible cross-interactions. To provide optimal solutions, the evolutionary algorithm sorts oligonucleotides into sets, preserves preselected parts of the oligonucleotides, and shapes their remaining parts. In addition, the oligonucleotide sets can be designed and grouped based on their melting temperatures. For the user's convenience, EvOligo is provided with a user-friendly graphical interface. EvOligo was used to design individual oligonucleotides, oligonucleotide pairs, and groups of oligonucleotide pairs that are characterized by the following parameters: (1) weaker cross-interactions between the non-complementary oligonucleotides and (2) more uniform ranges of the oligonucleotide pair melting temperatures than other available software products. In addition, in contrast to other grouping algorithms, EvOligo offers time-efficient sorting of paired and unpaired oligonucleotides based on various parameters defined by the user.

  18. Selection of optimal oligonucleotide probes for microarrays usingmultiple criteria, global alignment and parameter estimation.

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Li, Xingyuan; He, Zhili; Zhou, Jizhong

    2005-10-30

    The oligonucleotide specificity for microarray hybridizationcan be predicted by its sequence identity to non-targets, continuousstretch to non-targets, and/or binding free energy to non-targets. Mostcurrently available programs only use one or two of these criteria, whichmay choose 'false' specific oligonucleotides or miss 'true' optimalprobes in a considerable proportion. We have developed a software tool,called CommOligo using new algorithms and all three criteria forselection of optimal oligonucleotide probes. A series of filters,including sequence identity, free energy, continuous stretch, GC content,self-annealing, distance to the 3'-untranslated region (3'-UTR) andmelting temperature (Tm), are used to check each possibleoligonucleotide. A sequence identity is calculated based onmore » gapped globalalignments. A traversal algorithm is used to generate alignments for freeenergy calculation. The optimal Tm interval is determined based on probecandidates that have passed all other filters. Final probes are pickedusing a combination of user-configurable piece-wise linear functions andan iterative process. The thresholds for identity, stretch and freeenergy filters are automatically determined from experimental data by anaccessory software tool, CommOligo_PE (CommOligo Parameter Estimator).The program was used to design probes for both whole-genome and highlyhomologous sequence data. CommOligo and CommOligo_PE are freely availableto academic users upon request.« less

  19. Synthesis of 3'-, or 5'-, or internal methacrylamido-modified oligonucleotides

    DOEpatents

    Golova, Julia B.; Chernov, Boris K.

    2010-04-27

    New modifiers were synthesized for incorporation of a methacrylic function in 3'-, 5'- and internal positions of oligonucleotides during solid phase synthesis. A modifier was used for synthesis of 5'-methacrylated oligonucleotides for preparation of microarrays by a co-polymerization method.

  20. Spotting and validation of a genome wide oligonucleotide chip with duplicate measurement of each gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Thomassen, Mads; Skov, Vibe; Eiriksdottir, Freyja

    2006-06-16

    The quality of DNA microarray based gene expression data relies on the reproducibility of several steps in a microarray experiment. We have developed a spotted genome wide microarray chip with oligonucleotides printed in duplicate in order to minimise undesirable biases, thereby optimising detection of true differential expression. The validation study design consisted of an assessment of the microarray chip performance using the MessageAmp and FairPlay labelling kits. Intraclass correlation coefficient (ICC) was used to demonstrate that MessageAmp was significantly more reproducible than FairPlay. Further examinations with MessageAmp revealed the applicability of the system. The linear range of the chips wasmore » three orders of magnitude, the precision was high, as 95% of measurements deviated less than 1.24-fold from the expected value, and the coefficient of variation for relative expression was 13.6%. Relative quantitation was more reproducible than absolute quantitation and substantial reduction of variance was attained with duplicate spotting. An analysis of variance (ANOVA) demonstrated no significant day-to-day variation.« less

  1. Combined in vitro transcription and reverse transcription to amplify and label complex synthetic oligonucleotide probe libraries.

    PubMed

    Murgha, Yusuf; Beliveau, Brian; Semrau, Kassandra; Schwartz, Donald; Wu, Chao-Ting; Gulari, Erdogan; Rouillard, Jean-Marie

    2015-06-01

    Oligonucleotide microarrays allow the production of complex custom oligonucleotide libraries for nucleic acid detection-based applications such as fluorescence in situ hybridization (FISH). We have developed a PCR-free method to make single-stranded DNA (ssDNA) fluorescent probes through an intermediate RNA library. A double-stranded oligonucleotide library is amplified by transcription to create an RNA library. Next, dye- or hapten-conjugate primers are used to reverse transcribe the RNA to produce a dye-labeled cDNA library. Finally the RNA is hydrolyzed under alkaline conditions to obtain the single-stranded fluorescent probes library. Starting from unique oligonucleotide library constructs, we present two methods to produce single-stranded probe libraries. The two methods differ in the type of reverse transcription (RT) primer, the incorporation of fluorescent dye, and the purification of fluorescent probes. The first method employs dye-labeled reverse transcription primers to produce multiple differentially single-labeled probe subsets from one microarray library. The fluorescent probes are purified from excess primers by oligonucleotide-bead capture. The second method uses an RNA:DNA chimeric primer and amino-modified nucleotides to produce amino-allyl probes. The excess primers and RNA are hydrolyzed under alkaline conditions, followed by probe purification and labeling with amino-reactive dyes. The fluorescent probes created by the combination of transcription and reverse transcription can be used for FISH and to detect any RNA and DNA targets via hybridization.

  2. Direct profiling of environmental microbial populations by thermal dissociation analysis of native rRNAs hybridized to oligonucleotide microarrays

    NASA Technical Reports Server (NTRS)

    El Fantroussi, Said; Urakawa, Hidetoshi; Bernhard, Anne E.; Kelly, John J.; Noble, Peter A.; Smidt, H.; Yershov, G. M.; Stahl, David A.

    2003-01-01

    Oligonucleotide microarrays were used to profile directly extracted rRNA from environmental microbial populations without PCR amplification. In our initial inspection of two distinct estuarine study sites, the hybridization patterns were reproducible and varied between estuarine sediments of differing salinities. The determination of a thermal dissociation curve (i.e., melting profile) for each probe-target duplex provided information on hybridization specificity, which is essential for confirming adequate discrimination between target and nontarget sequences.

  3. Transcript copy number estimation using a mouse whole-genome oligonucleotide microarray

    PubMed Central

    Carter, Mark G; Sharov, Alexei A; VanBuren, Vincent; Dudekula, Dawood B; Carmack, Condie E; Nelson, Charlie; Ko, Minoru SH

    2005-01-01

    The ability to quantitatively measure the expression of all genes in a given tissue or cell with a single assay is an exciting promise of gene-expression profiling technology. An in situ-synthesized 60-mer oligonucleotide microarray designed to detect transcripts from all mouse genes was validated, as well as a set of exogenous RNA controls derived from the yeast genome (made freely available without restriction), which allow quantitative estimation of absolute endogenous transcript abundance. PMID:15998450

  4. Drop drying on surfaces determines chemical reactivity - the specific case of immobilization of oligonucleotides on microarrays

    PubMed Central

    2013-01-01

    Background Drop drying is a key factor in a wide range of technical applications, including spotted microarrays. The applied nL liquid volume provides specific reaction conditions for the immobilization of probe molecules to a chemically modified surface. Results We investigated the influence of nL and μL liquid drop volumes on the process of probe immobilization and compare the results obtained to the situation in liquid solution. In our data, we observe a strong relationship between drop drying effects on immobilization and surface chemistry. In this work, we present results on the immobilization of dye labeled 20mer oligonucleotides with and without an activating 5′-aminoheptyl linker onto a 2D epoxysilane and a 3D NHS activated hydrogel surface. Conclusions Our experiments identified two basic processes determining immobilization. First, the rate of drop drying that depends on the drop volume and the ambient relative humidity. Oligonucleotides in a dried spot react unspecifically with the surface and long reaction times are needed. 3D hydrogel surfaces allow for immobilization in a liquid environment under diffusive conditions. Here, oligonucleotide immobilization is much faster and a specific reaction with the reactive linker group is observed. Second, the effect of increasing probe concentration as a result of drop drying. On a 3D hydrogel, the increasing concentration of probe molecules in nL spotting volumes accelerates immobilization dramatically. In case of μL volumes, immobilization depends on whether the drop is allowed to dry completely. At non-drying conditions, very limited immobilization is observed due to the low oligonucleotide concentration used in microarray spotting solutions. The results of our study provide a general guideline for microarray assay development. They allow for the initial definition and further optimization of reaction conditions for the immobilization of oligonucleotides and other probe molecule classes to different surfaces in dependence of the applied spotting and reaction volume. PMID:23758982

  5. Universal Oligonucleotide Microarray for Sub-Typing of Influenza A Virus

    PubMed Central

    Ryabinin, Vladimir A.; Kostina, Elena V.; Maksakova, Galiya A.; Neverov, Alexander A.; Chumakov, Konstantin M.; Sinyakov, Alexander N.

    2011-01-01

    A universal microchip was developed for genotyping Influenza A viruses. It contains two sets of oligonucleotide probes allowing viruses to be classified by the subtypes of hemagglutinin (H1–H13, H15, H16) and neuraminidase (N1–N9). Additional sets of probes are used to detect H1N1 swine influenza viruses. Selection of probes was done in two steps. Initially, amino acid sequences specific to each subtype were identified, and then the most specific and representative oligonucleotide probes were selected. Overall, between 19 and 24 probes were used to identify each subtype of hemagglutinin (HA) and neuraminidase (NA). Genotyping included preparation of fluorescently labeled PCR amplicons of influenza virus cDNA and their hybridization to microarrays of specific oligonucleotide probes. Out of 40 samples tested, 36 unambiguously identified HA and NA subtypes of Influenza A virus. PMID:21559081

  6. Development of a high-throughput microfluidic integrated microarray for the detection of chimeric bioweapons.

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sheppod, Timothy; Satterfield, Brent; Hukari, Kyle W.

    2006-10-01

    The advancement of DNA cloning has significantly augmented the potential threat of a focused bioweapon assault, such as a terrorist attack. With current DNA cloning techniques, toxin genes from the most dangerous (but environmentally labile) bacterial or viral organism can now be selected and inserted into robust organism to produce an infinite number of deadly chimeric bioweapons. In order to neutralize such a threat, accurate detection of the expressed toxin genes, rather than classification on strain or genealogical decent of these organisms, is critical. The development of a high-throughput microarray approach will enable the detection of unknowns chimeric bioweapons. Themore » development of a high-throughput microarray approach will enable the detection of unknown bioweapons. We have developed a unique microfluidic approach to capture and concentrate these threat genes (mRNA's) upto a 30 fold concentration. These captured oligonucleotides can then be used to synthesize in situ oligonucleotide copies (cDNA probes) of the captured genes. An integrated microfluidic architecture will enable us to control flows of reagents, perform clean-up steps and finally elute nanoliter volumes of synthesized oligonucleotides probes. The integrated approach has enabled a process where chimeric or conventional bioweapons can rapidly be identified based on their toxic function, rather than being restricted to information that may not identify the critical nature of the threat.« less

  7. Cambridge Healthtech Institute's Third Annual Conference on Lab-on-a-Chip and Microarrays. 22-24 January 2001, Zurich, Switzerland.

    PubMed

    Jain, K K

    2001-02-01

    Cambridge Healthtech Institute's Third Annual Conference on Lab-on-a-Chip and Microarray technology covered the latest advances in this technology and applications in life sciences. Highlights of the meetings are reported briefly with emphasis on applications in genomics, drug discovery and molecular diagnostics. There was an emphasis on microfluidics because of the wide applications in laboratory and drug discovery. The lab-on-a-chip provides the facilities of a complete laboratory in a hand-held miniature device. Several microarray systems have been used for hybridisation and detection techniques. Oligonucleotide scanning arrays provide a versatile tool for the analysis of nucleic acid interactions and provide a platform for improving the array-based methods for investigation of antisense therapeutics. A method for analysing combinatorial DNA arrays using oligonucleotide-modified gold nanoparticle probes and a conventional scanner has considerable potential in molecular diagnostics. Various applications of microarray technology for high-throughput screening in drug discovery and single nucleotide polymorphisms (SNP) analysis were discussed. Protein chips have important applications in proteomics. With the considerable amount of data generated by the different technologies using microarrays, it is obvious that the reading of the information and its interpretation and management through the use of bioinformatics is essential. Various techniques for data analysis were presented. Biochip and microarray technology has an essential role to play in the evolving trends in healthcare, which integrate diagnosis with prevention/treatment and emphasise personalised medicines.

  8. Microelectroporation device for genomic screening

    DOEpatents

    Perroud, Thomas D.; Renzi, Ronald F.; Negrete, Oscar; Claudnic, Mark R.

    2014-09-09

    We have developed an microelectroporation device that combines microarrays of oligonucleotides, microfluidic channels, and electroporation for cell transfection and high-throughput screening applications (e.g. RNA interference screens). Microarrays allow the deposition of thousands of different oligonucleotides in microscopic spots. Microfluidic channels and microwells enable efficient loading of cells into the device and prevent cross-contamination between different oligonucleotides spots. Electroporation allows optimal transfection of nucleic acids into cells (especially hard-to-transfect cells such as primary cells) by minimizing cell death while maximizing transfection efficiency. This invention has the advantage of a higher throughput and lower cost, while preventing cross-contamination compared to conventional screening technologies. Moreover, this device does not require bulky robotic liquid handling equipment and is inherently safer given that it is a closed system.

  9. DEVELOPMENT AND VALIDATION OF A 2,000 GENE MICROARRAY FOR THE FATHEAD MINNOW, PIMEPHALES PROMELAS

    EPA Science Inventory

    The development of the gene microarray has provided the field of ecotoxicology a new tool to identify modes of action (MOA) of chemicals and chemical mixtures. Herein we describe the development and application of a 2,000 gene oligonucleotide microarray for the fathead minnow (P...

  10. A New Oligonucleotide Microarray for Detection of Pathogenic and Non-Pathogenic Legionella spp.

    PubMed Central

    Cao, Boyang; Liu, Xiangqian; Yu, Xiang; Chen, Min; Feng, Lu; Wang, Lei

    2014-01-01

    Legionella pneumophila has been recognized as the major cause of legionellosis since the discovery of the deadly disease. Legionella spp. other than L. pneumophila were later found to be responsible to many non-pneumophila infections. The non-L. pneumophila infections are likely under-detected because of a lack of effective diagnosis. In this report, we have sequenced the 16S-23S rRNA gene internal transcribed spacer (ITS) of 10 Legionella species and subspecies, including L. anisa, L. bozemanii, L. dumoffii, L. fairfieldensis, L. gormanii, L. jordanis, L. maceachernii, L. micdadei, L. pneumophila subspp. fraseri and L. pneumophila subspp. pasculleii, and developed a rapid oligonucleotide microarray detection technique accordingly to identify 12 most common Legionella spp., which consist of 11 pathogenic species of L. anisa, L. bozemanii, L. dumoffii, L. gormanii, L. jordanis, L. longbeachae, L. maceachernii, L. micdadei, and L. pneumophila (including subspp. pneumophila, subspp. fraseri, and subspp. pasculleii) and one non-pathogenic species, L. fairfieldensis. Twenty-nine probes that reproducibly detected multiple Legionella species with high specificity were included in the array. A total of 52 strains, including 30 target pathogens and 22 non-target bacteria, were used to verify the oligonucleotide microarray assay. The sensitivity of the detection was at 1.0 ng with genomic DNA or 13 CFU/100 mL with Legionella cultures. The microarray detected seven samples of air conditioner-condensed water with 100% accuracy, validating the technique as a promising method for applications in basic microbiology, clinical diagnosis, food safety, and epidemiological surveillance. The phylogenetic study based on the ITS has also revealed that the non-pathogenic L. fairfieldensis is the closest to L. pneumophila than the nine other pathogenic Legionella spp. PMID:25469776

  11. A new oligonucleotide microarray for detection of pathogenic and non-pathogenic Legionella spp.

    PubMed

    Cao, Boyang; Liu, Xiangqian; Yu, Xiang; Chen, Min; Feng, Lu; Wang, Lei

    2014-01-01

    Legionella pneumophila has been recognized as the major cause of legionellosis since the discovery of the deadly disease. Legionella spp. other than L. pneumophila were later found to be responsible to many non-pneumophila infections. The non-L. pneumophila infections are likely under-detected because of a lack of effective diagnosis. In this report, we have sequenced the 16S-23S rRNA gene internal transcribed spacer (ITS) of 10 Legionella species and subspecies, including L. anisa, L. bozemanii, L. dumoffii, L. fairfieldensis, L. gormanii, L. jordanis, L. maceachernii, L. micdadei, L. pneumophila subspp. fraseri and L. pneumophila subspp. pasculleii, and developed a rapid oligonucleotide microarray detection technique accordingly to identify 12 most common Legionella spp., which consist of 11 pathogenic species of L. anisa, L. bozemanii, L. dumoffii, L. gormanii, L. jordanis, L. longbeachae, L. maceachernii, L. micdadei, and L. pneumophila (including subspp. pneumophila, subspp. fraseri, and subspp. pasculleii) and one non-pathogenic species, L. fairfieldensis. Twenty-nine probes that reproducibly detected multiple Legionella species with high specificity were included in the array. A total of 52 strains, including 30 target pathogens and 22 non-target bacteria, were used to verify the oligonucleotide microarray assay. The sensitivity of the detection was at 1.0 ng with genomic DNA or 13 CFU/100 mL with Legionella cultures. The microarray detected seven samples of air conditioner-condensed water with 100% accuracy, validating the technique as a promising method for applications in basic microbiology, clinical diagnosis, food safety, and epidemiological surveillance. The phylogenetic study based on the ITS has also revealed that the non-pathogenic L. fairfieldensis is the closest to L. pneumophila than the nine other pathogenic Legionella spp.

  12. nuID: a universal naming scheme of oligonucleotides for Illumina, Affymetrix, and other microarrays

    PubMed Central

    Du, Pan; Kibbe, Warren A; Lin, Simon M

    2007-01-01

    Background Oligonucleotide probes that are sequence identical may have different identifiers between manufacturers and even between different versions of the same company's microarray; and sometimes the same identifier is reused and represents a completely different oligonucleotide, resulting in ambiguity and potentially mis-identification of the genes hybridizing to that probe. Results We have devised a unique, non-degenerate encoding scheme that can be used as a universal representation to identify an oligonucleotide across manufacturers. We have named the encoded representation 'nuID', for nucleotide universal identifier. Inspired by the fact that the raw sequence of the oligonucleotide is the true definition of identity for a probe, the encoding algorithm uniquely and non-degenerately transforms the sequence itself into a compact identifier (a lossless compression). In addition, we added a redundancy check (checksum) to validate the integrity of the identifier. These two steps, encoding plus checksum, result in an nuID, which is a unique, non-degenerate, permanent, robust and efficient representation of the probe sequence. For commercial applications that require the sequence identity to be confidential, we have an encryption schema for nuID. We demonstrate the utility of nuIDs for the annotation of Illumina microarrays, and we believe it has universal applicability as a source-independent naming convention for oligomers. Reviewers This article was reviewed by Itai Yanai, Rong Chen (nominated by Mark Gerstein), and Gregory Schuler (nominated by David Lipman). PMID:17540033

  13. Homogeneous versus heterogeneous probes for microbial ecological microarrays.

    PubMed

    Bae, Jin-Woo; Park, Yong-Ha

    2006-07-01

    Microbial ecological microarrays have been developed for investigating the composition and functions of microorganism communities in environmental niches. These arrays include microbial identification microarrays, which use oligonucleotides, gene fragments or microbial genomes as probes. In this article, the advantages and disadvantages of each type of probe are reviewed. Oligonucleotide probes are currently useful for probing uncultivated bacteria that are not amenable to gene fragment probing, whereas the functional gene fragments amplified randomly from microbial genomes require phylogenetic and hierarchical categorization before use as microbial identification probes, despite their high resolution for both specificity and sensitivity. Until more bacteria are sequenced and gene fragment probes are thoroughly validated, heterogeneous bacterial genome probes will provide a simple, sensitive and quantitative tool for exploring the ecosystem structure.

  14. SINGLE-BASE-PAIR MISMATCH DISCRIMINATION USING OLIGONUCLEOTIDE DNA MICROARRAYS AND MELTING PROFILES. (R829458C004)

    EPA Science Inventory

    The perspectives, information and conclusions conveyed in research project abstracts, progress reports, final reports, journal abstracts and journal publications convey the viewpoints of the principal investigator and may not represent the views and policies of ORD and EPA. Concl...

  15. High-density, microsphere-based fiber optic DNA microarrays.

    PubMed

    Epstein, Jason R; Leung, Amy P K; Lee, Kyong Hoon; Walt, David R

    2003-05-01

    A high-density fiber optic DNA microarray has been developed consisting of oligonucleotide-functionalized, 3.1-microm-diameter microspheres randomly distributed on the etched face of an imaging fiber bundle. The fiber bundles are comprised of 6000-50000 fused optical fibers and each fiber terminates with an etched well. The microwell array is capable of housing complementary-sized microspheres, each containing thousands of copies of a unique oligonucleotide probe sequence. The array fabrication process results in random microsphere placement. Determining the position of microspheres in the random array requires an optical encoding scheme. This array platform provides many advantages over other array formats. The microsphere-stock suspension concentration added to the etched fiber can be controlled to provide inherent sensor redundancy. Examining identical microspheres has a beneficial effect on the signal-to-noise ratio. As other sequences of interest are discovered, new microsphere sensing elements can be added to existing microsphere pools and new arrays can be fabricated incorporating the new sequences without altering the existing detection capabilities. These microarrays contain the smallest feature sizes (3 microm) of any DNA array, allowing interrogation of extremely small sample volumes. Reducing the feature size results in higher local target molecule concentrations, creating rapid and highly sensitive assays. The microsphere array platform is also flexible in its applications; research has included DNA-protein interaction profiles, microbial strain differentiation, and non-labeled target interrogation with molecular beacons. Fiber optic microsphere-based DNA microarrays have a simple fabrication protocol enabling their expansion into other applications, such as single cell-based assays.

  16. Microarray analysis of genes associated with cell surface NIS protein levels in breast cancer.

    PubMed

    Beyer, Sasha J; Zhang, Xiaoli; Jimenez, Rafael E; Lee, Mei-Ling T; Richardson, Andrea L; Huang, Kun; Jhiang, Sissy M

    2011-10-11

    Na+/I- symporter (NIS)-mediated iodide uptake allows radioiodine therapy for thyroid cancer. NIS is also expressed in breast tumors, raising potential for radionuclide therapy of breast cancer. However, NIS expression in most breast cancers is low and may not be sufficient for radionuclide therapy. We aimed to identify biomarkers associated with NIS expression such that mechanisms underlying NIS modulation in human breast tumors may be elucidated. Published oligonucleotide microarray data within the National Center for Biotechnology Information Gene Expression Omnibus database were analyzed to identify gene expression tightly correlated with NIS mRNA level among human breast tumors. NIS immunostaining was performed in a tissue microarray composed of 28 human breast tumors which had corresponding oligonucleotide microarray data available for each tumor such that gene expression associated with cell surface NIS protein level could be identified. NIS mRNA levels do not vary among breast tumors or when compared to normal breast tissues when detected by Affymetrix oligonucleotide microarray platforms. Cell surface NIS protein levels are much more variable than their corresponding NIS mRNA levels. Despite a limited number of breast tumors examined, our analysis identified cysteinyl-tRNA synthetase as a biomarker that is highly associated with cell surface NIS protein levels in the ER-positive breast cancer subtype. Further investigation on genes associated with cell surface NIS protein levels within each breast cancer molecular subtype may lead to novel targets for selectively increasing NIS expression/function in a subset of breast cancers patients.

  17. The Use of Atomic Force Microscopy for 3D Analysis of Nucleic Acid Hybridization on Microarrays.

    PubMed

    Dubrovin, E V; Presnova, G V; Rubtsova, M Yu; Egorov, A M; Grigorenko, V G; Yaminsky, I V

    2015-01-01

    Oligonucleotide microarrays are considered today to be one of the most efficient methods of gene diagnostics. The capability of atomic force microscopy (AFM) to characterize the three-dimensional morphology of single molecules on a surface allows one to use it as an effective tool for the 3D analysis of a microarray for the detection of nucleic acids. The high resolution of AFM offers ways to decrease the detection threshold of target DNA and increase the signal-to-noise ratio. In this work, we suggest an approach to the evaluation of the results of hybridization of gold nanoparticle-labeled nucleic acids on silicon microarrays based on an AFM analysis of the surface both in air and in liquid which takes into account of their three-dimensional structure. We suggest a quantitative measure of the hybridization results which is based on the fraction of the surface area occupied by the nanoparticles.

  18. Oligonucleotide microarray for subtyping of influenza A viruses

    NASA Astrophysics Data System (ADS)

    Klotchenko, S. A.; Vasin, A. V.; Sandybaev, N. T.; Plotnikova, M. A.; Chervyakova, O. V.; Smirnova, E. A.; Kushnareva, E. V.; Strochkov, V. M.; Taylakova, E. T.; Egorov, V. V.; Koshemetov, J. K.; Kiselev, O. I.; Sansyzbay, A. R.

    2012-02-01

    Influenza is one of the most widespread respiratory viral diseases, infecting humans, horses, pigs, poultry and some other animal populations. Influenza A viruses (IAV) are classified into subtypes on the basis of the surface hemagglutinin (H1 to H16) and neuraminidase (N1 to N9) glycoproteins. The correct determination of IAV subtype is necessary for clinical and epidemiological studies. In this article we propose an oligonucleotide microarray for subtyping of IAV using universal one-step multisegment RT-PCR fluorescent labeling of viral gene segments. It showed to be an advanced approach for fast detection and identification of IAV.

  19. An Undergraduate Laboratory Exercise to Study the Effect of Darkness on Plant Gene Expression Using DNA Microarray

    ERIC Educational Resources Information Center

    Chang, Ming-Mei; Briggs, George M.

    2007-01-01

    DNA microarrays are microscopic arrays on a solid surface, typically a glass slide, on which DNA oligonucleotides are deposited or synthesized in a high-density matrix with a predetermined spatial order. Several types of DNA microarrays have been developed and used for various biological studies. Here, we developed an undergraduate laboratory…

  20. ASSESSING THE USE OF OLIGONUCLEOTIDE MICROARRAYS FOR FATHEAD MINNOW (PIMEPHALES PROMELAS) TO EXAMINE EXPOSURE VARIABLES

    EPA Science Inventory

    Microarray technology has proven to be a useful tool for analyzing the transcriptome of various organisms representing conditions such as disease states, developmental stages, and responses to chemical exposure. Although most commercially available arrays are limited to organism...

  1. Analysis of mutations in oral poliovirus vaccine by hybridization with generic oligonucleotide microchips.

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Proudnikov, D.; Kirillov, E.; Chumakov, K.

    2000-01-01

    This paper describes use of a new technology of hybridization with a micro-array of immobilized oligonucleotides for detection and quantification of neurovirulent mutants in Oral Poliovirus Vaccine (OPV). We used a micro-array consisting of three-dimensional gel-elements containing all possible hexamers (total of 4096 probes). Hybridization of fluorescently labelled viral cDNA samples with such microchips resulted in a pattern of spots that was registered and quantified by a computer-linked CCD camera, so that the sequence of the original cDNA could be deduced. The method could reliably identify single point mutations, since each of them affected fluorescence intensity of 12 micro-array elements.more » Micro-array hybridization of DNA mixtures with varying contents of point mutants demonstrated that the method can detect as little as 10% of revertants in a population of vaccine virus. This new technology should be useful for quality control of live viral vaccines, as well as for other applications requiring identification and quantification of point mutations.« less

  2. Oligonucleotide microarray for the identification of potential mycotoxigenic fungi

    PubMed Central

    2010-01-01

    Background Mycotoxins are secondary metabolites which are produced by numerous fungi and pose a continuous challenge to the safety and quality of food commodities in South Africa. These toxins have toxicologically relevant effects on humans and animals that eat contaminated foods. In this study, a diagnostic DNA microarray was developed for the identification of the most common food-borne fungi, as well as the genes leading to toxin production. Results A total of 40 potentially mycotoxigenic fungi isolated from different food commodities, as well as the genes that are involved in the mycotoxin synthetic pathways, were analyzed. For fungal identification, oligonucleotide probes were designed by exploiting the sequence variations of the elongation factor 1-alpha (EF-1 α) coding regions and the internal transcribed spacer (ITS) regions of the rRNA gene cassette. For the detection of fungi able to produce mycotoxins, oligonucleotide probes directed towards genes leading to toxin production from different fungal strains were identified in data available in the public domain. The probes selected for fungal identification and the probes specific for toxin producing genes were spotted onto microarray slides. Conclusions The diagnostic microarray developed can be used to identify single pure strains or cultures of potentially mycotoxigenic fungi as well as genes leading to toxin production in both laboratory samples and maize-derived foods offering an interesting potential for microbiological laboratories. PMID:20307326

  3. Methylation oligonucleotide microarray: a novel tool to analyze methylation patterns

    NASA Astrophysics Data System (ADS)

    Hou, Peng; Ji, Meiju; He, Nongyao; Lu, Zuhong

    2003-04-01

    A new technique to analyze methylation patterns in several adjacent CpG sites was developed and reported here. We selected a 336bp segment of the 5"-untranslated region and the first exon of the p16Ink4a gene, which include the most densely packed CpG fragment of the islands containing 32 CpG dinucleotides, as the investigated target. The probes that include all types of methylation patterns were designed to fabricate a DNA microarray to determine the methylation patterns of seven adjacent CpG dinucleotides sites. High accuracy and reproducibility were observed in several parallel experiments. The results led us to the conclusion that the methylation oligonucleotide microarray can be applied as a novel and powerful tool to map methylation patterns and changes in multiple CpG island loci in a variety of tumors.

  4. Quantitative multiplex quantum dot in-situ hybridisation based gene expression profiling in tissue microarrays identifies prognostic genes in acute myeloid leukaemia

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tholouli, Eleni; MacDermott, Sarah; Hoyland, Judith

    2012-08-24

    Highlights: Black-Right-Pointing-Pointer Development of a quantitative high throughput in situ expression profiling method. Black-Right-Pointing-Pointer Application to a tissue microarray of 242 AML bone marrow samples. Black-Right-Pointing-Pointer Identification of HOXA4, HOXA9, Meis1 and DNMT3A as prognostic markers in AML. -- Abstract: Measurement and validation of microarray gene signatures in routine clinical samples is problematic and a rate limiting step in translational research. In order to facilitate measurement of microarray identified gene signatures in routine clinical tissue a novel method combining quantum dot based oligonucleotide in situ hybridisation (QD-ISH) and post-hybridisation spectral image analysis was used for multiplex in-situ transcript detection inmore » archival bone marrow trephine samples from patients with acute myeloid leukaemia (AML). Tissue-microarrays were prepared into which white cell pellets were spiked as a standard. Tissue microarrays were made using routinely processed bone marrow trephines from 242 patients with AML. QD-ISH was performed for six candidate prognostic genes using triplex QD-ISH for DNMT1, DNMT3A, DNMT3B, and for HOXA4, HOXA9, Meis1. Scrambled oligonucleotides were used to correct for background staining followed by normalisation of expression against the expression values for the white cell pellet standard. Survival analysis demonstrated that low expression of HOXA4 was associated with poorer overall survival (p = 0.009), whilst high expression of HOXA9 (p < 0.0001), Meis1 (p = 0.005) and DNMT3A (p = 0.04) were associated with early treatment failure. These results demonstrate application of a standardised, quantitative multiplex QD-ISH method for identification of prognostic markers in formalin-fixed paraffin-embedded clinical samples, facilitating measurement of gene expression signatures in routine clinical samples.« less

  5. Differentiation of the seven major lyssavirus species by oligonucleotide microarray.

    PubMed

    Xi, Jin; Guo, Huancheng; Feng, Ye; Xu, Yunbin; Shao, Mingfu; Su, Nan; Wan, Jiayu; Li, Jiping; Tu, Changchun

    2012-03-01

    An oligonucleotide microarray, LyssaChip, has been developed and verified as a highly specific diagnostic tool for differentiation of the 7 major lyssavirus species. As with conventional typing microarray methods, the LyssaChip relies on sequence differences in the 371-nucleotide region coding for the nucleoprotein. This region was amplified using nested reverse transcription-PCR primers that bind to the 7 major lyssaviruses. The LyssaChip includes 57 pairs of species typing and corresponding control oligonucleotide probes (oligoprobes) immobilized on glass slides, and it can analyze 12 samples on a single slide within 8 h. Analysis of 111 clinical brain specimens (65 from animals with suspected rabies submitted to the laboratory and 46 of butchered dog brain tissues collected from restaurants) showed that the chip method was 100% sensitive and highly consistent with the "gold standard," a fluorescent antibody test (FAT). The chip method could detect rabies virus in highly decayed brain tissues, whereas the FAT did not, and therefore the chip test may be more applicable to highly decayed brain tissues than the FAT. LyssaChip may provide a convenient and inexpensive alternative for diagnosis and differentiation of rabies and rabies-related diseases.

  6. Linear model for fast background subtraction in oligonucleotide microarrays.

    PubMed

    Kroll, K Myriam; Barkema, Gerard T; Carlon, Enrico

    2009-11-16

    One important preprocessing step in the analysis of microarray data is background subtraction. In high-density oligonucleotide arrays this is recognized as a crucial step for the global performance of the data analysis from raw intensities to expression values. We propose here an algorithm for background estimation based on a model in which the cost function is quadratic in a set of fitting parameters such that minimization can be performed through linear algebra. The model incorporates two effects: 1) Correlated intensities between neighboring features in the chip and 2) sequence-dependent affinities for non-specific hybridization fitted by an extended nearest-neighbor model. The algorithm has been tested on 360 GeneChips from publicly available data of recent expression experiments. The algorithm is fast and accurate. Strong correlations between the fitted values for different experiments as well as between the free-energy parameters and their counterparts in aqueous solution indicate that the model captures a significant part of the underlying physical chemistry.

  7. Automated detection and quantitation of bacterial RNA by using electrical microarrays.

    PubMed

    Elsholz, B; Wörl, R; Blohm, L; Albers, J; Feucht, H; Grunwald, T; Jürgen, B; Schweder, T; Hintsche, Rainer

    2006-07-15

    Low-density electrical 16S rRNA specific oligonucleotide microarrays and an automated analysis system have been developed for the identification and quantitation of pathogens. The pathogens are Escherichia coli, Pseudomonas aeruginosa, Enterococcus faecalis, Staphylococcus aureus, and Staphylococcus epidermidis, which are typically involved in urinary tract infections. Interdigitated gold array electrodes (IDA-electrodes), which have structures in the nanometer range, have been used for very sensitive analysis. Thiol-modified oligonucleotides are immobilized on the gold IDA as capture probes. They mediate the specific recognition of the target 16S rRNA by hybridization. Additionally three unlabeled oligonucleotides are hybridized in close proximity to the capturing site. They are supporting molecules, because they improve the RNA hybridization at the capturing site. A biotin labeled detector oligonucleotide is also allowed to hybridize to the captured RNA sequence. The biotin labels enable the binding of avidin alkaline phophatase conjugates. The phosphatase liberates the electrochemical mediator p-aminophenol from its electrically inactive phosphate derivative. The electrical signals were generated by amperometric redox cycling and detected by a unique multipotentiostat. The read out signals of the microarray are position specific current and change over time in proportion to the analyte concentration. If two additional biotins are introduced into the affinity binding complex via the supporting oligonucleotides, the sensitivity of the assays increase more than 60%. The limit of detection of Escherichia coli total RNA has been determined to be 0.5 ng/microL. The control of fluidics for variable assay formats as well as the multichannel electrical read out and data handling have all been fully automated. The fast and easy procedure does not require any amplification of the targeted nucleic acids by PCR.

  8. Application of HLA-DRB1 genotyping by oligonucleotide micro-array technology in forensic medicine.

    PubMed

    Jiang, Bin; Li, Yao; Wu, Hai; He, Xianmin; Li, Chengtao; Li, Li; Tang, Rong; Xie, Yi; Mao, Yumin

    2006-10-16

    The human leukocyte antigen (HLA) system is known to be the most complex polymorphic system in the human genome. Among all of the HLA loci, HLA-DRB1 has the second largest number of alleles. The purpose of this study is to develop an oligonucleotide micro-array based HLA-DRB1 typing system for use in forensic identification, anthropology, tissue transplantation, and other genetic research fields. The system was developed by analyzing the HLA-DRB1 (DRB1) genotypes in 1198 unrelated healthy Chinese Han individuals originating from various parts of China and residing in Shanghai, China. Polymerase chain reaction (PCR) coupled with the oligonucleotide micro-array technology was used to detect and type HLA-DRB1 alleles of the sample individuals. The reliability, sensitivity, consistency and specificity were evaluated for use in forensic identification. Furthermore, a meta-analysis was carried out by comparing the allele frequencies of the HLA-DRB1 locus with those of other Chinese Han groups, Chinese minorities and other ethnic populations. All the DNA samples yielded a 273 bp amplification product, with no other amplification products in this length range. The minimum quantity of DNA detected by this method is 15 ng in a PCR reaction system of 25 microl. The population studied appeared to be not in Hardy-Weinberg equilibrium. Observed heterozygosity (Ho), expected heterozygosity (He), expected probability of exclusion (PE), polymorphic information content (PIC), and discrimination power (DP) of the HLA-DRB1 locus from the Shanghai Han ethnic group were evaluated to be 0.8022, 0.8870, 0.7741, 0.8771, 0.9750, respectively. A total of 25 HLA-DRB1 alleles were identified. HLA-DRB1*09XX, *04XX, *12XX and *15XX were the most frequent DRB1 alleles, which were observed in 58.76% of the sample. One hundred and sixteen genotypes were found. The five most frequent genotypes were: *04XX/*04XX (0.0626), *09XX/*09XX (0.0593), *04XX/*09XX (0.0551), *09XX/*15XX (0.0384) and *08XX/*12XX (0.0351). The meta-analysis showed that there were uniquely distributed features of DRB1 alleles among various ethnic populations and among the studied population groups from various regions with the same ethnic origin. An HLA-DRB1 genotyping system has been developed and established based on the oligonucleotide micro-array technology. The HLA-DRB1 typing of the Han population in Shanghai has revealed a relatively high heterogeneity. Information obtained in this study will be useful for medical and forensic applications as well as in anthropology research. Large-scale micro-array detection is highly accurate and reliable for DNA-based HLA-DRB1 genotyping. These results suggest that HLA-DRB1 DNA polymorphisms and the database of the Shanghai Han group have useful applications in processing forensic casework (as personal identification, paternity test), tracing population migration and genetic diagnosis.

  9. Study of hepatitis B virus gene mutations with enzymatic colorimetry-based DNA microarray.

    PubMed

    Mao, Hailei; Wang, Huimin; Zhang, Donglei; Mao, Hongju; Zhao, Jianlong; Shi, Jian; Cui, Zhichu

    2006-01-01

    To establish a modified microarray method for detecting HBV gene mutations in the clinic. Site-specific oligonucleotide probes were immobilized to microarray slides and hybridized to biotin-labeled HBV gene fragments amplified from two-step PCR. Hybridized targets were transferred to nitrocellulose membranes, followed by intensity measurement using BCIP/NBT colorimetry. HBV genes from 99 Hepatitis B patients and 40 healthy blood donors were analyzed. Mutation frequencies of HBV pre-core/core and basic core promoter (BCP) regions were found to be significantly higher in the patient group (42%, 40% versus 2.5%, 5%, P < 0.01). Compared with a traditional fluorescence method, the colorimetry method exhibited the same level of sensitivity and reproducibility. An enzymatic colorimetry-based DNA microarray assay was successfully established to monitor HBV mutations. Pre-core/core and BCP mutations of HBV genes could be major causes of HBV infection in HBeAg-negative patients and could also be relevant to chronicity and aggravation of hepatitis B.

  10. Multi-Gene Detection and Identification of Mosquito-Borne RNA Viruses Using an Oligonucleotide Microarray

    PubMed Central

    Grubaugh, Nathan D.; McMenamy, Scott S.; Turell, Michael J.; Lee, John S.

    2013-01-01

    Background Arthropod-borne viruses are important emerging pathogens world-wide. Viruses transmitted by mosquitoes, such as dengue, yellow fever, and Japanese encephalitis viruses, infect hundreds of millions of people and animals each year. Global surveillance of these viruses in mosquito vectors using molecular based assays is critical for prevention and control of the associated diseases. Here, we report an oligonucleotide DNA microarray design, termed ArboChip5.1, for multi-gene detection and identification of mosquito-borne RNA viruses from the genera Flavivirus (family Flaviviridae), Alphavirus (Togaviridae), Orthobunyavirus (Bunyaviridae), and Phlebovirus (Bunyaviridae). Methodology/Principal Findings The assay utilizes targeted PCR amplification of three genes from each virus genus for electrochemical detection on a portable, field-tested microarray platform. Fifty-two viruses propagated in cell-culture were used to evaluate the specificity of the PCR primer sets and the ArboChip5.1 microarray capture probes. The microarray detected all of the tested viruses and differentiated between many closely related viruses such as members of the dengue, Japanese encephalitis, and Semliki Forest virus clades. Laboratory infected mosquitoes were used to simulate field samples and to determine the limits of detection. Additionally, we identified dengue virus type 3, Japanese encephalitis virus, Tembusu virus, Culex flavivirus, and a Quang Binh-like virus from mosquitoes collected in Thailand in 2011 and 2012. Conclusions/Significance We demonstrated that the described assay can be utilized in a comprehensive field surveillance program by the broad-range amplification and specific identification of arboviruses from infected mosquitoes. Furthermore, the microarray platform can be deployed in the field and viral RNA extraction to data analysis can occur in as little as 12 h. The information derived from the ArboChip5.1 microarray can help to establish public health priorities, detect disease outbreaks, and evaluate control programs. PMID:23967358

  11. Microarray analysis identified Puccinia striiformis f. sp. tritici genes involved in infection and sporulation.

    USDA-ARS?s Scientific Manuscript database

    Puccinia striiformis f. sp. tritici (Pst) causes stripe rust, one of the most important diseases of wheat worldwide. To identify Pst genes involved in infection and sporulation, a custom oligonucleotide Genechip was made using sequences of 442 genes selected from Pst cDNA libraries. Microarray analy...

  12. A Graphical Systems Model and Tissue-specific Functional Gene Sets to Aid Transcriptomic Analysis of Chemical Impacts on the Female Teleost Reproductive Axis

    EPA Science Inventory

    Oligonucleotide microarrays and other ‘omics’ approaches are powerful tools for unsupervised analysis of chemical impacts on biological systems. However, the lack of well annotated biological pathways for many aquatic organisms, including fish, and the poor power of microarray-b...

  13. Oligonucleotide microarray chip for the quantification of MS2, ΦX174, and adenoviruses on the multiplex analysis platform MCR 3.

    PubMed

    Lengger, Sandra; Otto, Johannes; Elsässer, Dennis; Schneider, Oliver; Tiehm, Andreas; Fleischer, Jens; Niessner, Reinhard; Seidel, Michael

    2014-05-01

    Pathogenic viruses are emerging contaminants in water which should be analyzed for water safety to preserve public health. A strategy was developed to quantify RNA and DNA viruses in parallel on chemiluminescence flow-through oligonucleotide microarrays. In order to show the proof of principle, bacteriophage MS2, ΦX174, and the human pathogenic adenovirus type 2 (hAdV2) were analyzed in spiked tap water samples on the analysis platform MCR 3. The chemiluminescence microarray imaging unit was equipped with a Peltier heater for a controlled heating of the flow cell. The efficiency and selectivity of DNA hybridization could be increased resulting in higher signal intensities and lower cross-reactivities of polymerase chain reaction (PCR) products from other viruses. The total analysis time for DNA/RNA extraction, cDNA synthesis for RNA viruses, polymerase chain reaction, single-strand separation, and oligonucleotide microarray analysis was performed in 4-4.5 h. The parallel quantification was possible in a concentration range of 9.6 × 10(5)-1.4 × 10(10) genomic units (GU)/mL for bacteriophage MS2, 1.4 × 10(5)-3.7 × 10(8) GU/mL for bacteriophage ΦX174, and 6.5 × 10(3)-1.2 × 10(5) for hAdV2, respectively, by using a measuring temperature of 40 °C. Detection limits could be calculated to 6.6 × 10(5) GU/mL for MS2, 5.3 × 10(3) GU/mL for ΦX174, and 1.5 × 10(2) GU/mL for hAdV2, respectively. Real samples of surface water and treated wastewater were tested. Generally, found concentrations of hAdV2, bacteriophage MS2, and ΦX174 were at the detection limit. Nevertheless, bacteriophages could be identified with similar results by means of quantitative PCR and oligonucleotide microarray analysis on the MCR 3.

  14. Mining microarrays for metabolic meaning: nutritional regulation of hypothalamic gene expression.

    PubMed

    Mobbs, Charles V; Yen, Kelvin; Mastaitis, Jason; Nguyen, Ha; Watson, Elizabeth; Wurmbach, Elisa; Sealfon, Stuart C; Brooks, Andrew; Salton, Stephen R J

    2004-06-01

    DNA microarray analysis has been used to investigate relative changes in the level of gene expression in the CNS, including changes that are associated with disease, injury, psychiatric disorders, drug exposure or withdrawal, and memory formation. We have used oligonucleotide microarrays to identify hypothalamic genes that respond to nutritional manipulation. In addition to commonly used microarray analysis based on criteria such as fold-regulation, we have also found that simply carrying out multiple t tests then sorting by P value constitutes a highly reliable method to detect true regulation, as assessed by real-time polymerase chain reaction (PCR), even for relatively low abundance genes or relatively low magnitude of regulation. Such analyses directly suggested novel mechanisms that mediate effects of nutritional state on neuroendocrine function and are being used to identify regulated gene products that may elucidate the metabolic pathology of obese ob/ob, lean Vgf-/Vgf-, and other models with profound metabolic impairments.

  15. Microarray Technology for the Diagnosis of Fetal Chromosomal Aberrations: Which Platform Should We Use?

    PubMed Central

    Karampetsou, Evangelia; Morrogh, Deborah; Chitty, Lyn

    2014-01-01

    The advantage of microarray (array) over conventional karyotype for the diagnosis of fetal pathogenic chromosomal anomalies has prompted the use of microarrays in prenatal diagnostics. In this review we compare the performance of different array platforms (BAC, oligonucleotide CGH, SNP) and designs (targeted, whole genome, whole genome, and targeted, custom) and discuss their advantages and disadvantages in relation to prenatal testing. We also discuss the factors to consider when implementing a microarray testing service for the diagnosis of fetal chromosomal aberrations. PMID:26237396

  16. Structured oligonucleotides for target indexing to allow single-vessel PCR amplification and solid support microarray hybridization

    PubMed Central

    Girard, Laurie D.; Boissinot, Karel; Peytavi, Régis; Boissinot, Maurice; Bergeron, Michel G.

    2014-01-01

    The combination of molecular diagnostic technologies is increasingly used to overcome limitations on sensitivity, specificity or multiplexing capabilities, and provide efficient lab-on-chip devices. Two such techniques, PCR amplification and microarray hybridization are used serially to take advantage of the high sensitivity and specificity of the former combined with high multiplexing capacities of the latter. These methods are usually performed in different buffers and reaction chambers. However, these elaborate methods have a high complexity cost related to reagent requirements, liquid storage and the number of reaction chambers to integrate into automated devices. Furthermore, microarray hybridizations have a sequence dependent efficiency not always predictable. In this work, we have developed the concept of a structured oligonucleotide probe which is activated by cleavage from polymerase exonuclease activity. This technology is called SCISSOHR for Structured Cleavage Induced Single-Stranded Oligonucleotide Hybridization Reaction. The SCISSOHR probes enable indexing the target sequence to a tag sequence. The SCISSOHR technology also allows the combination of nucleic acid amplification and microarray hybridization in a single vessel in presence of the PCR buffer only. The SCISSOHR technology uses an amplification probe that is irreversibly modified in presence of the target, releasing a single-stranded DNA tag for microarray hybridization. Each tag is composed of a 3-nucleotidesequence-dependent segment and a unique “target sequence-independent” 14-nucleotide segment allowing for optimal hybridization with minimal cross-hybridization. We evaluated the performance of five (5) PCR buffers to support microarray hybridization, compared to a conventional hybridization buffer. Finally, as a proof of concept, we developed a multiplexed assay for the amplification, detection, and identification of three (3) DNA targets. This new technology will facilitate the design of lab-on-chip microfluidic devices, while also reducing consumable costs. At term, it will allow the cost-effective automation of highly multiplexed assays for detection and identification of genetic targets. PMID:25489607

  17. Structured oligonucleotides for target indexing to allow single-vessel PCR amplification and solid support microarray hybridization.

    PubMed

    Girard, Laurie D; Boissinot, Karel; Peytavi, Régis; Boissinot, Maurice; Bergeron, Michel G

    2015-02-07

    The combination of molecular diagnostic technologies is increasingly used to overcome limitations on sensitivity, specificity or multiplexing capabilities, and provide efficient lab-on-chip devices. Two such techniques, PCR amplification and microarray hybridization are used serially to take advantage of the high sensitivity and specificity of the former combined with high multiplexing capacities of the latter. These methods are usually performed in different buffers and reaction chambers. However, these elaborate methods have high complexity and cost related to reagent requirements, liquid storage and the number of reaction chambers to integrate into automated devices. Furthermore, microarray hybridizations have a sequence dependent efficiency not always predictable. In this work, we have developed the concept of a structured oligonucleotide probe which is activated by cleavage from polymerase exonuclease activity. This technology is called SCISSOHR for Structured Cleavage Induced Single-Stranded Oligonucleotide Hybridization Reaction. The SCISSOHR probes enable indexing the target sequence to a tag sequence. The SCISSOHR technology also allows the combination of nucleic acid amplification and microarray hybridization in a single vessel in presence of the PCR buffer only. The SCISSOHR technology uses an amplification probe that is irreversibly modified in presence of the target, releasing a single-stranded DNA tag for microarray hybridization. Each tag is composed of a 3-nucleotide sequence-dependent segment and a unique "target sequence-independent" 14-nucleotide segment allowing for optimal hybridization with minimal cross-hybridization. We evaluated the performance of five (5) PCR buffers to support microarray hybridization, compared to a conventional hybridization buffer. Finally, as a proof of concept, we developed a multiplexed assay for the amplification, detection, and identification of three (3) DNA targets. This new technology will facilitate the design of lab-on-chip microfluidic devices, while also reducing consumable costs. At term, it will allow the cost-effective automation of highly multiplexed assays for detection and identification of genetic targets.

  18. Evolution of the MIDTAL microarray: the adaption and testing of oligonucleotide 18S and 28S rDNA probes and evaluation of subsequent microarray generations with Prymnesium spp. cultures and field samples.

    PubMed

    McCoy, Gary R; Touzet, Nicolas; Fleming, Gerard T A; Raine, Robin

    2015-07-01

    The toxic microalgal species Prymnesium parvum and Prymnesium polylepis are responsible for numerous fish kills causing economic stress on the aquaculture industry and, through the consumption of contaminated shellfish, can potentially impact on human health. Monitoring of toxic phytoplankton is traditionally carried out by light microscopy. However, molecular methods of identification and quantification are becoming more common place. This study documents the optimisation of the novel Microarrays for the Detection of Toxic Algae (MIDTAL) microarray from its initial stages to the final commercial version now available from Microbia Environnement (France). Existing oligonucleotide probes used in whole-cell fluorescent in situ hybridisation (FISH) for Prymnesium species from higher group probes to species-level probes were adapted and tested on the first-generation microarray. The combination and interaction of numerous other probes specific for a whole range of phytoplankton taxa also spotted on the chip surface caused high cross reactivity, resulting in false-positive results on the microarray. The probe sequences were extended for the subsequent second-generation microarray, and further adaptations of the hybridisation protocol and incubation temperatures significantly reduced false-positive readings from the first to the second-generation chip, thereby increasing the specificity of the MIDTAL microarray. Additional refinement of the subsequent third-generation microarray protocols with the addition of a poly-T amino linker to the 5' end of each probe further enhanced the microarray performance but also highlighted the importance of optimising RNA labelling efficiency when testing with natural seawater samples from Killary Harbour, Ireland.

  19. Nucleic acid sequence detection using multiplexed oligonucleotide PCR

    DOEpatents

    Nolan, John P [Santa Fe, NM; White, P Scott [Los Alamos, NM

    2006-12-26

    Methods for rapidly detecting single or multiple sequence alleles in a sample nucleic acid are described. Provided are all of the oligonucleotide pairs capable of annealing specifically to a target allele and discriminating among possible sequences thereof, and ligating to each other to form an oligonucleotide complex when a particular sequence feature is present (or, alternatively, absent) in the sample nucleic acid. The design of each oligonucleotide pair permits the subsequent high-level PCR amplification of a specific amplicon when the oligonucleotide complex is formed, but not when the oligonucleotide complex is not formed. The presence or absence of the specific amplicon is used to detect the allele. Detection of the specific amplicon may be achieved using a variety of methods well known in the art, including without limitation, oligonucleotide capture onto DNA chips or microarrays, oligonucleotide capture onto beads or microspheres, electrophoresis, and mass spectrometry. Various labels and address-capture tags may be employed in the amplicon detection step of multiplexed assays, as further described herein.

  20. Fiber-optic microarray for simultaneous detection of multiple harmful algal bloom species.

    PubMed

    Ahn, Soohyoun; Kulis, David M; Erdner, Deana L; Anderson, Donald M; Walt, David R

    2006-09-01

    Harmful algal blooms (HABs) are a serious threat to coastal resources, causing a variety of impacts on public health, regional economies, and ecosystems. Plankton analysis is a valuable component of many HAB monitoring and research programs, but the diversity of plankton poses a problem in discriminating toxic from nontoxic species using conventional detection methods. Here we describe a sensitive and specific sandwich hybridization assay that combines fiber-optic microarrays with oligonucleotide probes to detect and enumerate the HAB species Alexandrium fundyense, Alexandrium ostenfeldii, and Pseudo-nitzschia australis. Microarrays were prepared by loading oligonucleotide probe-coupled microspheres (diameter, 3 mum) onto the distal ends of chemically etched imaging fiber bundles. Hybridization of target rRNA from HAB cells to immobilized probes on the microspheres was visualized using Cy3-labeled secondary probes in a sandwich-type assay format. We applied these microarrays to the detection and enumeration of HAB cells in both cultured and field samples. Our study demonstrated a detection limit of approximately 5 cells for all three target organisms within 45 min, without a separate amplification step, in both sample types. We also developed a multiplexed microarray to detect the three HAB species simultaneously, which successfully detected the target organisms, alone and in combination, without cross-reactivity. Our study suggests that fiber-optic microarrays can be used for rapid and sensitive detection and potential enumeration of HAB species in the environment.

  1. Development and assessment of whole-genome oligonucleotide microarrays to analyze an anaerobic microbial community and its responses to oxidative stress.

    PubMed

    Scholten, Johannes C M; Culley, David E; Nie, Lei; Munn, Kyle J; Chow, Lely; Brockman, Fred J; Zhang, Weiwen

    2007-06-29

    The application of DNA microarray technology to investigate multiple-species microbial communities presents great challenges. In this study, we reported the design and quality assessment of four whole genome oligonucleotide microarrays for two syntroph bacteria, Desulfovibrio vulgaris and Syntrophobacter fumaroxidans, and two archaeal methanogens, Methanosarcina barkeri, and Methanospirillum hungatei, and their application to analyze global gene expression in a four-species microbial community in response to oxidative stress. In order to minimize the possibility of cross-hybridization, cross-genome comparison was performed to assure all probes unique to each genome so that the microarrays could provide species-level resolution. Microarray quality was validated by the good reproducibility of experimental measurements of multiple biological and analytical replicates. This study showed that S. fumaroxidans and M. hungatei responded to the oxidative stress with up-regulation of several genes known to be involved in reactive oxygen species (ROS) detoxification, such as catalase and rubrerythrin in S. fumaroxidans and thioredoxin and heat shock protein Hsp20 in M. hungatei. However, D. vulgaris seemed to be less sensitive to the oxidative stress as a member of a four-species community, since no gene involved in ROS detoxification was up-regulated. Our work demonstrated the successful application of microarrays to a multiple-species microbial community, and our preliminary results indicated that this approach could provide novel insights on the metabolism within microbial communities.

  2. Development of a rapid microarray-based DNA subtyping assay for the alleles of Shiga toxins 1 and 2 of Escherichia coli.

    PubMed

    Geue, Lutz; Stieber, Bettina; Monecke, Stefan; Engelmann, Ines; Gunzer, Florian; Slickers, Peter; Braun, Sascha D; Ehricht, Ralf

    2014-08-01

    In this study, we developed a new rapid, economic, and automated microarray-based genotyping test for the standardized subtyping of Shiga toxins 1 and 2 of Escherichia coli. The microarrays from Alere Technologies can be used in two different formats, the ArrayTube and the ArrayStrip (which enables high-throughput testing in a 96-well format). One microarray chip harbors all the gene sequences necessary to distinguish between all Stx subtypes, facilitating the identification of single and multiple subtypes within a single isolate in one experiment. Specific software was developed to automatically analyze all data obtained from the microarray. The assay was validated with 21 Shiga toxin-producing E. coli (STEC) reference strains that were previously tested by the complete set of conventional subtyping PCRs. The microarray results showed 100% concordance with the PCR results. Essentially identical results were detected when the standard DNA extraction method was replaced by a time-saving heat lysis protocol. For further validation of the microarray, we identified the Stx subtypes or combinations of the subtypes in 446 STEC field isolates of human and animal origin. In summary, this oligonucleotide array represents an excellent diagnostic tool that provides some advantages over standard PCR-based subtyping. The number of the spotted probes on the microarrays can be increased by additional probes, such as for novel alleles, species markers, or resistance genes, should the need arise. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  3. AccuTyping: new algorithms for automated analysis of data from high-throughput genotyping with oligonucleotide microarrays

    PubMed Central

    Hu, Guohong; Wang, Hui-Yun; Greenawalt, Danielle M.; Azaro, Marco A.; Luo, Minjie; Tereshchenko, Irina V.; Cui, Xiangfeng; Yang, Qifeng; Gao, Richeng; Shen, Li; Li, Honghua

    2006-01-01

    Microarray-based analysis of single nucleotide polymorphisms (SNPs) has many applications in large-scale genetic studies. To minimize the influence of experimental variation, microarray data usually need to be processed in different aspects including background subtraction, normalization and low-signal filtering before genotype determination. Although many algorithms are sophisticated for these purposes, biases are still present. In the present paper, new algorithms for SNP microarray data analysis and the software, AccuTyping, developed based on these algorithms are described. The algorithms take advantage of a large number of SNPs included in each assay, and the fact that the top and bottom 20% of SNPs can be safely treated as homozygous after sorting based on their ratios between the signal intensities. These SNPs are then used as controls for color channel normalization and background subtraction. Genotype calls are made based on the logarithms of signal intensity ratios using two cutoff values, which were determined after training the program with a dataset of ∼160 000 genotypes and validated by non-microarray methods. AccuTyping was used to determine >300 000 genotypes of DNA and sperm samples. The accuracy was shown to be >99%. AccuTyping can be downloaded from . PMID:16982644

  4. DNA microarrays for identifying fishes.

    PubMed

    Kochzius, M; Nölte, M; Weber, H; Silkenbeumer, N; Hjörleifsdottir, S; Hreggvidsson, G O; Marteinsson, V; Kappel, K; Planes, S; Tinti, F; Magoulas, A; Garcia Vazquez, E; Turan, C; Hervet, C; Campo Falgueras, D; Antoniou, A; Landi, M; Blohm, D

    2008-01-01

    In many cases marine organisms and especially their diverse developmental stages are difficult to identify by morphological characters. DNA-based identification methods offer an analytically powerful addition or even an alternative. In this study, a DNA microarray has been developed to be able to investigate its potential as a tool for the identification of fish species from European seas based on mitochondrial 16S rDNA sequences. Eleven commercially important fish species were selected for a first prototype. Oligonucleotide probes were designed based on the 16S rDNA sequences obtained from 230 individuals of 27 fish species. In addition, more than 1200 sequences of 380 species served as sequence background against which the specificity of the probes was tested in silico. Single target hybridisations with Cy5-labelled, PCR-amplified 16S rDNA fragments from each of the 11 species on microarrays containing the complete set of probes confirmed their suitability. True-positive, fluorescence signals obtained were at least one order of magnitude stronger than false-positive cross-hybridisations. Single nontarget hybridisations resulted in cross-hybridisation signals at approximately 27% of the cases tested, but all of them were at least one order of magnitude lower than true-positive signals. This study demonstrates that the 16S rDNA gene is suitable for designing oligonucleotide probes, which can be used to differentiate 11 fish species. These data are a solid basis for the second step to create a "Fish Chip" for approximately 50 fish species relevant in marine environmental and fisheries research, as well as control of fisheries products.

  5. BioconductorBuntu: a Linux distribution that implements a web-based DNA microarray analysis server.

    PubMed

    Geeleher, Paul; Morris, Dermot; Hinde, John P; Golden, Aaron

    2009-06-01

    BioconductorBuntu is a custom distribution of Ubuntu Linux that automatically installs a server-side microarray processing environment, providing a user-friendly web-based GUI to many of the tools developed by the Bioconductor Project, accessible locally or across a network. System installation is via booting off a CD image or by using a Debian package provided to upgrade an existing Ubuntu installation. In its current version, several microarray analysis pipelines are supported including oligonucleotide, dual-or single-dye experiments, including post-processing with Gene Set Enrichment Analysis. BioconductorBuntu is designed to be extensible, by server-side integration of further relevant Bioconductor modules as required, facilitated by its straightforward underlying Python-based infrastructure. BioconductorBuntu offers an ideal environment for the development of processing procedures to facilitate the analysis of next-generation sequencing datasets. BioconductorBuntu is available for download under a creative commons license along with additional documentation and a tutorial from (http://bioinf.nuigalway.ie).

  6. Development of a low-cost detection method for miRNA microarray.

    PubMed

    Li, Wei; Zhao, Botao; Jin, Youxin; Ruan, Kangcheng

    2010-04-01

    MicroRNA (miRNA) microarray is a powerful tool to explore the expression profiling of miRNA. The current detection method used in miRNA microarray is mainly fluorescence based, which usually requires costly detection system such as laser confocal scanner of tens of thousands of dollars. Recently, we developed a low-cost yet sensitive detection method for miRNA microarray based on enzyme-linked assay. In this approach, the biotinylated miRNAs were captured by the corresponding oligonucleotide probes immobilized on microarray slide; and then the biotinylated miRNAs would capture streptavidin-conjugated alkaline phosphatase. A purple-black precipitation on each biotinylated miRNA spot was produced by the enzyme catalytic reaction. It could be easily detected by a charge-coupled device digital camera mounted on a microscope, which lowers the detection cost more than 100 fold compared with that of fluorescence method. Our data showed that signal intensity of the spot correlates well with the biotinylated miRNA concentration and the detection limit for miRNAs is at least 0.4 fmol and the detection dynamic range spans about 2.5 orders of magnitude, which is comparable to that of fluorescence method.

  7. Ethical issues raised by genetic testing with oligonucleotide microarrays.

    PubMed

    Grody, Wayne W

    2003-02-01

    Because genes and alterations within them determine the identity, characteristics, and inheritance of every individual, the application of genetic science to humans has long been surrounded by apprehension, controversy, and real or perceived potential for abuse. Crude eugenics practices of the past now find a theoretical rebirth and transformation through the use of modern molecular genetic technologies for mutation detection, predictive and prenatal diagnosis, and, ultimately, gene replacement. The advent of oligonucleotide microarray analysis, in which hundreds or thousands of genes and mutations can be tested in parallel, offers tremendous promise for more accurate, sensitive, and efficient genetic testing. At the same time, however, this powerful technology dramatically increases the number and scope of ethical concerns accompanying each individual test request. This article considers the evolution and implications of these concerns, from the initial ordering of a microarray test by the physician to such issues as informed consent, privacy, confidentiality, clinical utility, discrimination, stigmatization, ethnic and population impact, and reimbursement.

  8. Issues in the analysis of oligonucleotide tiling microarrays for transcript mapping

    NASA Technical Reports Server (NTRS)

    Royce, Thomas E.; Rozowsky, Joel S.; Bertone, Paul; Samanta, Manoj; Stolc, Viktor; Weissman, Sherman; Snyder, Michael; Gerstein, Mark

    2005-01-01

    Traditional microarrays use probes complementary to known genes to quantitate the differential gene expression between two or more conditions. Genomic tiling microarray experiments differ in that probes that span a genomic region at regular intervals are used to detect the presence or absence of transcription. This difference means the same sets of biases and the methods for addressing them are unlikely to be relevant to both types of experiment. We introduce the informatics challenges arising in the analysis of tiling microarray experiments as open problems to the scientific community and present initial approaches for the analysis of this nascent technology.

  9. High-density fiber optic biosensor arrays

    NASA Astrophysics Data System (ADS)

    Epstein, Jason R.; Walt, David R.

    2002-02-01

    Novel approaches are required to coordinate the immense amounts of information derived from diverse genomes. This concept has influenced the expanded role of high-throughput DNA detection and analysis in the biological sciences. A high-density fiber optic DNA biosensor was developed consisting of oligonucleotide-functionalized, 3.1 mm diameter microspheres deposited into the etched wells on the distal face of a 500 micrometers imaging fiber bundle. Imaging fiber bundles containing thousands of optical fibers, each associated with a unique oligonucleotide probe sequence, were the foundation for an optically connected, individually addressable DNA detection platform. Different oligonucleotide-functionalized microspheres were combined in a stock solution, and randomly dispersed into the etched wells. Microsphere positions were registered from optical dyes incorporated onto the microspheres. The distribution process provided an inherent redundancy that increases the signal-to-noise ratio as the square root of the number of sensors examined. The representative amount of each probe-type in the array was dependent on their initial stock solution concentration, and as other sequences of interest arise, new microsphere elements can be added to arrays without altering the existing detection capabilities. The oligonucleotide probe sequences hybridize to fluorescently-labeled, complementary DNA target solutions. Fiber optic DNA microarray research has included DNA-protein interaction profiles, microbial strain differentiation, non-labeled target interrogation with molecular beacons, and single cell-based assays. This biosensor array is proficient in DNA detection linked to specific disease states, single nucleotide polymorphism (SNP's) discrimination, and gene expression analysis. This array platform permits multiple detection formats, provides smaller feature sizes, and enables sensor design flexibility. High-density fiber optic microarray biosensors provide a fast, reversible format with the detection limit of a few hundred molecules.

  10. Mapping of transcription factor binding regions in mammalian cells by ChIP: Comparison of array- and sequencing-based technologies

    PubMed Central

    Euskirchen, Ghia M.; Rozowsky, Joel S.; Wei, Chia-Lin; Lee, Wah Heng; Zhang, Zhengdong D.; Hartman, Stephen; Emanuelsson, Olof; Stolc, Viktor; Weissman, Sherman; Gerstein, Mark B.; Ruan, Yijun; Snyder, Michael

    2007-01-01

    Recent progress in mapping transcription factor (TF) binding regions can largely be credited to chromatin immunoprecipitation (ChIP) technologies. We compared strategies for mapping TF binding regions in mammalian cells using two different ChIP schemes: ChIP with DNA microarray analysis (ChIP-chip) and ChIP with DNA sequencing (ChIP-PET). We first investigated parameters central to obtaining robust ChIP-chip data sets by analyzing STAT1 targets in the ENCODE regions of the human genome, and then compared ChIP-chip to ChIP-PET. We devised methods for scoring and comparing results among various tiling arrays and examined parameters such as DNA microarray format, oligonucleotide length, hybridization conditions, and the use of competitor Cot-1 DNA. The best performance was achieved with high-density oligonucleotide arrays, oligonucleotides ≥50 bases (b), the presence of competitor Cot-1 DNA and hybridizations conducted in microfluidics stations. When target identification was evaluated as a function of array number, 80%–86% of targets were identified with three or more arrays. Comparison of ChIP-chip with ChIP-PET revealed strong agreement for the highest ranked targets with less overlap for the low ranked targets. With advantages and disadvantages unique to each approach, we found that ChIP-chip and ChIP-PET are frequently complementary in their relative abilities to detect STAT1 targets for the lower ranked targets; each method detected validated targets that were missed by the other method. The most comprehensive list of STAT1 binding regions is obtained by merging results from ChIP-chip and ChIP-sequencing. Overall, this study provides information for robust identification, scoring, and validation of TF targets using ChIP-based technologies. PMID:17568005

  11. A Unique Procedure to Identify Cell Surface Markers Through a Spherical Self-Organizing Map Applied to DNA Microarray Analysis.

    PubMed

    Sugii, Yuh; Kasai, Tomonari; Ikeda, Masashi; Vaidyanath, Arun; Kumon, Kazuki; Mizutani, Akifumi; Seno, Akimasa; Tokutaka, Heizo; Kudoh, Takayuki; Seno, Masaharu

    2016-01-01

    To identify cell-specific markers, we designed a DNA microarray platform with oligonucleotide probes for human membrane-anchored proteins. Human glioma cell lines were analyzed using microarray and compared with normal and fetal brain tissues. For the microarray analysis, we employed a spherical self-organizing map, which is a clustering method suitable for the conversion of multidimensional data into two-dimensional data and displays the relationship on a spherical surface. Based on the gene expression profile, the cell surface characteristics were successfully mirrored onto the spherical surface, thereby distinguishing normal brain tissue from the disease model based on the strength of gene expression. The clustered glioma-specific genes were further analyzed by polymerase chain reaction procedure and immunocytochemical staining of glioma cells. Our platform and the following procedure were successfully demonstrated to categorize the genes coding for cell surface proteins that are specific to glioma cells. Our assessment demonstrates that a spherical self-organizing map is a valuable tool for distinguishing cell surface markers and can be employed in marker discovery studies for the treatment of cancer.

  12. Optimised laser microdissection of the human ocular surface epithelial regions for microarray studies

    PubMed Central

    2013-01-01

    Background The most important challenge of performing insitu transcriptional profiling of the human ocular surface epithelial regions is obtaining samples in sufficient amounts, without contamination from adjacent tissue, as the region of interest is microscopic and closely apposed to other tissues regions. We have effectively collected ocular surface (OS) epithelial tissue samples from the Limbal Epithelial Crypt (LEC), limbus, cornea and conjunctiva of post-mortem cadaver eyes with laser microdissection (LMD) technique for gene expression studies with spotted oligonucleotide microarrays and Gene 1.0 ST arrays. Methods Human donor eyes (4 pairs for spotted oligonucleotide microarrays, 3 pairs for Gene 1.0 ST arrays) consented for research were included in this study with due ethical approval of the Nottingham Research Ethics Committee. Eye retrieval was performed within 36 hours of post-mortem period. The dissected corneoscleral buttons were immersed in OCT media and frozen in liquid nitrogen and stored at −80°C till further use. Microscopic tissue sections of interest were taken on PALM slides and stained with Toluidine Blue for laser microdissection with PALM microbeam systems. Optimisation of the laser microdissection technique was crucial for efficient and cost effective sample collection. Results The starting concentration of RNA as stipulated by the protocol of microarray platforms was taken as the cut-off concentration of RNA samples in our studies. The area of LMD tissue processed for spotted oligonucleotide microarray study ranged from 86,253 μm2 in LEC to 392,887 μm2 in LEC stroma. The RNA concentration of the LMD samples ranged from 22 to 92 pg/μl. The recommended starting concentration of the RNA samples used for Gene 1.0 ST arrays was 6 ng/5 μl. To achieve the desired RNA concentration the area of ocular surface epithelial tissue sample processed for the Gene 1.0 ST array experiments was approximately 100,0000 μm2 to 130,0000 μm2. RNA concentration of these samples ranged from 10.88 ng/12 μl to 25.8 ng/12 μl, with the RNA integrity numbers (RIN) for these samples from 3.3 to 7.9. RNA samples with RIN values below 2, that had failed to amplify satisfactorily were discarded. Conclusions The optimised protocol for sample collection and laser microdissection improved the RNA yield of the insitu ocular surface epithelial regions for effective microarray studies on spotted oligonucleotide and affymetrix platforms. PMID:24160452

  13. Soft Lithography for Oligonucleotide Arrays Fabrication

    DTIC Science & Technology

    2001-10-25

    adenosine; Abbreviated T, C, G, A respectively), the other synthesis reagents and solvents except oxidation agent (seen in Table 1) were purchased...dried by cold blowing before hybridization. Oligonucleotide arrays were hybridized in 200 nM 3’-TCC TCC GAT TCA GAG AGT CC- HEX (PE Biosystems... citrate buffer), 0.1% SDS in 0.1xSSC respectively. The probe array was scanned on the Scanarray Microarray Systems (Packard Biochip Technologies, USA

  14. Construction of a robust microarray from a non-model species (largemouth bass) using pyrosequencing technology

    PubMed Central

    Garcia-Reyero, Natàlia; Griffitt, Robert J.; Liu, Li; Kroll, Kevin J.; Farmerie, William G.; Barber, David S.; Denslow, Nancy D.

    2009-01-01

    A novel custom microarray for largemouth bass (Micropterus salmoides) was designed with sequences obtained from a normalized cDNA library using the 454 Life Sciences GS-20 pyrosequencer. This approach yielded in excess of 58 million bases of high-quality sequence. The sequence information was combined with 2,616 reads obtained by traditional suppressive subtractive hybridizations to derive a total of 31,391 unique sequences. Annotation and coding sequences were predicted for these transcripts where possible. 16,350 annotated transcripts were selected as target sequences for the design of the custom largemouth bass oligonucleotide microarray. The microarray was validated by examining the transcriptomic response in male largemouth bass exposed to 17β-œstradiol. Transcriptomic responses were assessed in liver and gonad, and indicated gene expression profiles typical of exposure to œstradiol. The results demonstrate the potential to rapidly create the tools necessary to assess large scale transcriptional responses in non-model species, paving the way for expanded impact of toxicogenomics in ecotoxicology. PMID:19936325

  15. eSensor®: A Microarray Technology Based on Electrochemical Detection of Nucleic Acids and Its Application to Cystic Fibrosis Carrier Screening

    NASA Astrophysics Data System (ADS)

    Reed, Michael R.; Coty, William A.

    We have developed a test for identification of carriers for cystic fibrosis using the eSensor® DNA detection technology. Oligonucleotide probes are deposited within self-assembled monolayers on gold electrodes arrayed upon printed circuit boards. These probes allow sequence-specific capture of amplicons containing a panel of mutation sites associated with cystic fibrosis. DNA targets are detected and mutations genotyped using a “sandwich” assay methodology employing electrochemical detection of ferrocene-labeled oligonucleotides for discrimination of carrier and non-carrier alleles. Performance of the cystic fibrosis application demonstrates sufficient accuracy and reliability for clinical diagnostic use, and the procedure can be performed by trained medical technologists available in the hospital laboratory.

  16. Towards MRI microarrays.

    PubMed

    Hall, Andrew; Mundell, Victoria J; Blanco-Andujar, Cristina; Bencsik, Martin; McHale, Glen; Newton, Michael I; Cave, Gareth W V

    2010-04-14

    Superparamagnetic iron oxide nanometre scale particles have been utilised as contrast agents to image staked target binding oligonucleotide arrays using MRI to correlate the signal intensity and T(2)* relaxation times in different NMR fluids.

  17. Microarray Detection of Duplex and Triplex DNA Binders with DNA-Modified Gold Nanoparticles

    PubMed Central

    Lytton-Jean, Abigail K. R.; Han, Min Su; Mirkin, Chad A.

    2008-01-01

    We have designed a chip-based assay, using microarray technology, for determining the relative binding affinities of duplex and triplex DNA binders. This assay combines the high discrimination capabilities afforded by DNA-modified Au nanoparticles with the high-throughput capabilities of DNA microarrays. The detection and screening of duplex DNA binders are important because these molecules, in many cases, are potential anticancer agents as well as toxins. Triplex DNA binders are also promising drug candidates. These molecules, in conjunction with triplex forming oligonucleotides, could potentially be used to achieve control of gene expression by interfering with transcription factors that bind to DNA. Therefore, the ability to screen for these molecules in a high-throughput fashion could dramatically improve the drug screening process. The assay reported here provides excellent discrimination between strong, intermediate, and weak duplex and triplex DNA binders in a high-throughput fashion. PMID:17614366

  18. Development of oligonucleotide microarrays for simultaneous multi-species identification of Phellinus tree-pathogenic fungi.

    PubMed

    Tzean, Yuh; Shu, Po-Yao; Liou, Ruey-Fen; Tzean, Shean-Shong

    2016-03-01

    Polyporoid Phellinus fungi are ubiquitously present in the environment and play an important role in shaping forest ecology. Several species of Phellinus are notorious pathogens that can affect a broad variety of tree species in forest, plantation, orchard and urban habitats; however, current detection methods are overly complex and lack the sensitivity required to identify these pathogens at the species level in a timely fashion for effective infestation control. Here, we describe eight oligonucleotide microarray platforms for the simultaneous and specific detection of 17 important Phellinus species, using probes generated from the internal transcribed spacer regions unique to each species. The sensitivity, robustness and efficiency of this Phellinus microarray system was subsequently confirmed against template DNA from two key Phellinus species, as well as field samples collected from tree roots, trunks and surrounding soil. This system can provide early, specific and convenient detection of Phellinus species for forestry, arboriculture and quarantine inspection, and could potentially help to mitigate the environmental and economic impact of Phellinus-related diseases. © 2015 The Authors. Microbial Biotechnology published by John Wiley & Sons Ltd and Society for Applied Microbiology.

  19. OY-TES-1 may regulate the malignant behavior of liver cancer via NANOG, CD9, CCND2 and CDCA3: a bioinformatic analysis combine with RNAi and oligonucleotide microarray.

    PubMed

    Hu, Qiping; Fu, Jun; Luo, Bin; Huang, Miao; Guo, Wenwen; Lin, Yongda; Xie, Xiaoxun; Xiao, Shaowen

    2015-04-01

    Given its tumor-specific expression, including liver cancer, OY-TES-1 is a potential molecular marker for the diagnosis and immunotherapy of liver cancers. However, investigations of the mechanisms and the role of OY-TES-1 in liver cancer are rare. In the present study, based on a comprehensive bioinformatic analysis combined with RNA interference (RNAi) and oligonucleotide microarray, we report for the first time that downregulation of OY-TES-1 resulted in significant changes in expression of NANOG, CD9, CCND2 and CDCA3 in the liver cancer cell line BEL-7404. NANOG, CD9, CCND2 and CDCA3 may be involved in cell proliferation, migration, invasion and apoptosis, yet also may be functionally related to each other and OY-TES-1. Among these molecules, we identified that NANOG, containing a Kazal-2 binding motif and homeobox, may be the most likely candidate protein interacting with OY-TES-1 in liver cancer. Thus, the present study may provide important information for further investigation of the roles of OY-TES-1 in liver cancer.

  20. Curation of microarray oligonucleotides and corresponding ESTs/cDNAs used for gene expression analysis in zebra finches.

    PubMed

    Lovell, Peter V; Huizinga, Nicole A; Getachew, Abel; Mees, Brianna; Friedrich, Samantha R; Wirthlin, Morgan; Mello, Claudio V

    2018-05-18

    Zebra finches are a major model organism for investigating mechanisms of vocal learning, a trait that enables spoken language in humans. The development of cDNA collections with expressed sequence tags (ESTs) and microarrays has allowed for extensive molecular characterizations of circuitry underlying vocal learning and production. However, poor database curation can lead to errors in transcriptome and bioinformatics analyses, limiting the impact of these resources. Here we used genomic alignments and synteny analysis for orthology verification to curate and reannotate ~ 35% of the oligonucleotides and corresponding ESTs/cDNAs that make-up Agilent microarrays for gene expression analysis in finches. We found that: (1) 5475 out of 43,084 oligos (a) failed to align to the zebra finch genome, (b) aligned to multiple loci, or (c) aligned to Chr_un only, and thus need to be flagged until a better genome assembly is available, or (d) reflect cloning artifacts; (2) Out of 9635 valid oligos examined further, 3120 were incorrectly named, including 1533 with no known orthologs; and (3) 2635 oligos required name update. The resulting curated dataset provides a reference for correcting gene identification errors in previous finch microarrays studies, and avoiding such errors in future studies.

  1. Design and evaluation of Actichip, a thematic microarray for the study of the actin cytoskeleton

    PubMed Central

    Muller, Jean; Mehlen, André; Vetter, Guillaume; Yatskou, Mikalai; Muller, Arnaud; Chalmel, Frédéric; Poch, Olivier; Friederich, Evelyne; Vallar, Laurent

    2007-01-01

    Background The actin cytoskeleton plays a crucial role in supporting and regulating numerous cellular processes. Mutations or alterations in the expression levels affecting the actin cytoskeleton system or related regulatory mechanisms are often associated with complex diseases such as cancer. Understanding how qualitative or quantitative changes in expression of the set of actin cytoskeleton genes are integrated to control actin dynamics and organisation is currently a challenge and should provide insights in identifying potential targets for drug discovery. Here we report the development of a dedicated microarray, the Actichip, containing 60-mer oligonucleotide probes for 327 genes selected for transcriptome analysis of the human actin cytoskeleton. Results Genomic data and sequence analysis features were retrieved from GenBank and stored in an integrative database called Actinome. From these data, probes were designed using a home-made program (CADO4MI) allowing sequence refinement and improved probe specificity by combining the complementary information recovered from the UniGene and RefSeq databases. Actichip performance was analysed by hybridisation with RNAs extracted from epithelial MCF-7 cells and human skeletal muscle. Using thoroughly standardised procedures, we obtained microarray images with excellent quality resulting in high data reproducibility. Actichip displayed a large dynamic range extending over three logs with a limit of sensitivity between one and ten copies of transcript per cell. The array allowed accurate detection of small changes in gene expression and reliable classification of samples based on the expression profiles of tissue-specific genes. When compared to two other oligonucleotide microarray platforms, Actichip showed similar sensitivity and concordant expression ratios. Moreover, Actichip was able to discriminate the highly similar actin isoforms whereas the two other platforms did not. Conclusion Our data demonstrate that Actichip is a powerful alternative to commercial high density microarrays for cytoskeleton gene profiling in normal or pathological samples. Actichip is available upon request. PMID:17727702

  2. A microarray-based genotyping and genetic mapping approach for highly heterozygous outcrossing species enables localization of a large fraction of the unassembled Populus trichocarpa genome sequence.

    PubMed

    Drost, Derek R; Novaes, Evandro; Boaventura-Novaes, Carolina; Benedict, Catherine I; Brown, Ryan S; Yin, Tongming; Tuskan, Gerald A; Kirst, Matias

    2009-06-01

    Microarrays have demonstrated significant power for genome-wide analyses of gene expression, and recently have also revolutionized the genetic analysis of segregating populations by genotyping thousands of loci in a single assay. Although microarray-based genotyping approaches have been successfully applied in yeast and several inbred plant species, their power has not been proven in an outcrossing species with extensive genetic diversity. Here we have developed methods for high-throughput microarray-based genotyping in such species using a pseudo-backcross progeny of 154 individuals of Populus trichocarpa and P. deltoides analyzed with long-oligonucleotide in situ-synthesized microarray probes. Our analysis resulted in high-confidence genotypes for 719 single-feature polymorphism (SFP) and 1014 gene expression marker (GEM) candidates. Using these genotypes and an established microsatellite (SSR) framework map, we produced a high-density genetic map comprising over 600 SFPs, GEMs and SSRs. The abundance of gene-based markers allowed us to localize over 35 million base pairs of previously unplaced whole-genome shotgun (WGS) scaffold sequence to putative locations in the genome of P. trichocarpa. A high proportion of sampled scaffolds could be verified for their placement with independently mapped SSRs, demonstrating the previously un-utilized power that high-density genotyping can provide in the context of map-based WGS sequence reassembly. Our results provide a substantial contribution to the continued improvement of the Populus genome assembly, while demonstrating the feasibility of microarray-based genotyping in a highly heterozygous population. The strategies presented are applicable to genetic mapping efforts in all plant species with similarly high levels of genetic diversity.

  3. Development of the first oligonucleotide microarray for global gene expression profiling in guinea pigs: defining the transcription signature of infectious diseases.

    PubMed

    Jain, Ruchi; Dey, Bappaditya; Tyagi, Anil K

    2012-10-02

    The Guinea pig (Cavia porcellus) is one of the most extensively used animal models to study infectious diseases. However, despite its tremendous contribution towards understanding the establishment, progression and control of a number of diseases in general and tuberculosis in particular, the lack of fully annotated guinea pig genome sequence as well as appropriate molecular reagents has severely hampered detailed genetic and immunological analysis in this animal model. By employing the cross-species hybridization technique, we have developed an oligonucleotide microarray with 44,000 features assembled from different mammalian species, which to the best of our knowledge is the first attempt to employ microarray to study the global gene expression profile in guinea pigs. To validate and demonstrate the merit of this microarray, we have studied, as an example, the expression profile of guinea pig lungs during the advanced phase of M. tuberculosis infection. A significant upregulation of 1344 genes and a marked down regulation of 1856 genes in the lungs identified a disease signature of pulmonary tuberculosis infection. We report the development of first comprehensive microarray for studying the global gene expression profile in guinea pigs and validation of its usefulness with tuberculosis as a case study. An important gap in the area of infectious diseases has been addressed and a valuable molecular tool is provided to optimally harness the potential of guinea pig model to develop better vaccines and therapies against human diseases.

  4. Replication dynamics of the yeast genome.

    PubMed

    Raghuraman, M K; Winzeler, E A; Collingwood, D; Hunt, S; Wodicka, L; Conway, A; Lockhart, D J; Davis, R W; Brewer, B J; Fangman, W L

    2001-10-05

    Oligonucleotide microarrays were used to map the detailed topography of chromosome replication in the budding yeast Saccharomyces cerevisiae. The times of replication of thousands of sites across the genome were determined by hybridizing replicated and unreplicated DNAs, isolated at different times in S phase, to the microarrays. Origin activations take place continuously throughout S phase but with most firings near mid-S phase. Rates of replication fork movement vary greatly from region to region in the genome. The two ends of each of the 16 chromosomes are highly correlated in their times of replication. This microarray approach is readily applicable to other organisms, including humans.

  5. A DNA microarray for identification of selected Korean birds based on mitochondrial cytochrome c oxidase I gene sequences.

    PubMed

    Chung, In-Hyuk; Yoo, Hye Sook; Eah, Jae-Yong; Yoon, Hyun-Kyu; Jung, Jin-Wook; Hwang, Seung Yong; Kim, Chang-Bae

    2010-10-01

    DNA barcoding with the gene encoding cytochrome c oxidase I (COI) in the mitochondrial genome has been proposed as a standard marker to identify and discover animal species. Some migratory wild birds are suspected of transmitting avian influenza and pose a threat to aircraft safety because of bird strikes. We have previously reported the COI gene sequences of 92 Korean bird species. In the present study, we developed a DNA microarray to identify 17 selected bird species on the basis of nucleotide diversity. We designed and synthesized 19 specific oligonucleotide probes; these probes were arrayed on a silylated glass slide. The length of the probes was 19-24 bps. The COI sequences amplified from the tissues of the selected birds were labeled with a fluorescent probe for microarray hybridization, and unique hybridization patterns were detected for each selected species. These patterns may be considered diagnostic patterns for species identification. This microarray system will provide a sensitive and a high-throughput method for identification of Korean birds.

  6. Customized oligonucleotide microarray gene expression-based classification of neuroblastoma patients outperforms current clinical risk stratification.

    PubMed

    Oberthuer, André; Berthold, Frank; Warnat, Patrick; Hero, Barbara; Kahlert, Yvonne; Spitz, Rüdiger; Ernestus, Karen; König, Rainer; Haas, Stefan; Eils, Roland; Schwab, Manfred; Brors, Benedikt; Westermann, Frank; Fischer, Matthias

    2006-11-01

    To develop a gene expression-based classifier for neuroblastoma patients that reliably predicts courses of the disease. Two hundred fifty-one neuroblastoma specimens were analyzed using a customized oligonucleotide microarray comprising 10,163 probes for transcripts with differential expression in clinical subgroups of the disease. Subsequently, the prediction analysis for microarrays (PAM) was applied to a first set of patients with maximally divergent clinical courses (n = 77). The classification accuracy was estimated by a complete 10-times-repeated 10-fold cross validation, and a 144-gene predictor was constructed from this set. This classifier's predictive power was evaluated in an independent second set (n = 174) by comparing results of the gene expression-based classification with those of risk stratification systems of current trials from Germany, Japan, and the United States. The first set of patients was accurately predicted by PAM (cross-validated accuracy, 99%). Within the second set, the PAM classifier significantly separated cohorts with distinct courses (3-year event-free survival [EFS] 0.86 +/- 0.03 [favorable; n = 115] v 0.52 +/- 0.07 [unfavorable; n = 59] and 3-year overall survival 0.99 +/- 0.01 v 0.84 +/- 0.05; both P < .0001) and separated risk groups of current neuroblastoma trials into subgroups with divergent outcome (NB2004: low-risk 3-year EFS 0.86 +/- 0.04 v 0.25 +/- 0.15, P < .0001; intermediate-risk 1.00 v 0.57 +/- 0.19, P = .018; high-risk 0.81 +/- 0.10 v 0.56 +/- 0.08, P = .06). In a multivariate Cox regression model, the PAM predictor classified patients of the second set more accurately than risk stratification of current trials from Germany, Japan, and the United States (P < .001; hazard ratio, 4.756 [95% CI, 2.544 to 8.893]). Integration of gene expression-based class prediction of neuroblastoma patients may improve risk estimation of current neuroblastoma trials.

  7. Refinement of light-responsive transcript lists using rice oligonucleotide arrays: evaluation of gene-redundancy.

    PubMed

    Jung, Ki-Hong; Dardick, Christopher; Bartley, Laura E; Cao, Peijian; Phetsom, Jirapa; Canlas, Patrick; Seo, Young-Su; Shultz, Michael; Ouyang, Shu; Yuan, Qiaoping; Frank, Bryan C; Ly, Eugene; Zheng, Li; Jia, Yi; Hsia, An-Ping; An, Kyungsook; Chou, Hui-Hsien; Rocke, David; Lee, Geun Cheol; Schnable, Patrick S; An, Gynheung; Buell, C Robin; Ronald, Pamela C

    2008-10-06

    Studies of gene function are often hampered by gene-redundancy, especially in organisms with large genomes such as rice (Oryza sativa). We present an approach for using transcriptomics data to focus functional studies and address redundancy. To this end, we have constructed and validated an inexpensive and publicly available rice oligonucleotide near-whole genome array, called the rice NSF45K array. We generated expression profiles for light- vs. dark-grown rice leaf tissue and validated the biological significance of the data by analyzing sources of variation and confirming expression trends with reverse transcription polymerase chain reaction. We examined trends in the data by evaluating enrichment of gene ontology terms at multiple false discovery rate thresholds. To compare data generated with the NSF45K array with published results, we developed publicly available, web-based tools (www.ricearray.org). The Oligo and EST Anatomy Viewer enables visualization of EST-based expression profiling data for all genes on the array. The Rice Multi-platform Microarray Search Tool facilitates comparison of gene expression profiles across multiple rice microarray platforms. Finally, we incorporated gene expression and biochemical pathway data to reduce the number of candidate gene products putatively participating in the eight steps of the photorespiration pathway from 52 to 10, based on expression levels of putatively functionally redundant genes. We confirmed the efficacy of this method to cope with redundancy by correctly predicting participation in photorespiration of a gene with five paralogs. Applying these methods will accelerate rice functional genomics.

  8. Extending Immunological Profiling in the Gilthead Sea Bream, Sparus aurata, by Enriched cDNA Library Analysis, Microarray Design and Initial Studies upon the Inflammatory Response to PAMPs.

    PubMed

    Boltaña, Sebastian; Castellana, Barbara; Goetz, Giles; Tort, Lluis; Teles, Mariana; Mulero, Victor; Novoa, Beatriz; Figueras, Antonio; Goetz, Frederick W; Gallardo-Escarate, Cristian; Planas, Josep V; Mackenzie, Simon

    2017-02-03

    This study describes the development and validation of an enriched oligonucleotide-microarray platform for Sparus aurata (SAQ) to provide a platform for transcriptomic studies in this species. A transcriptome database was constructed by assembly of gilthead sea bream sequences derived from public repositories of mRNA together with reads from a large collection of expressed sequence tags (EST) from two extensive targeted cDNA libraries characterizing mRNA transcripts regulated by both bacterial and viral challenge. The developed microarray was further validated by analysing monocyte/macrophage activation profiles after challenge with two Gram-negative bacterial pathogen-associated molecular patterns (PAMPs; lipopolysaccharide (LPS) and peptidoglycan (PGN)). Of the approximately 10,000 EST sequenced, we obtained a total of 6837 EST longer than 100 nt, with 3778 and 3059 EST obtained from the bacterial-primed and from the viral-primed cDNA libraries, respectively. Functional classification of contigs from the bacterial- and viral-primed cDNA libraries by Gene Ontology (GO) showed that the top five represented categories were equally represented in the two libraries: metabolism (approximately 24% of the total number of contigs), carrier proteins/membrane transport (approximately 15%), effectors/modulators and cell communication (approximately 11%), nucleoside, nucleotide and nucleic acid metabolism (approximately 7.5%) and intracellular transducers/signal transduction (approximately 5%). Transcriptome analyses using this enriched oligonucleotide platform identified differential shifts in the response to PGN and LPS in macrophage-like cells, highlighting responsive gene-cassettes tightly related to PAMP host recognition. As observed in other fish species, PGN is a powerful activator of the inflammatory response in S. aurata macrophage-like cells. We have developed and validated an oligonucleotide microarray (SAQ) that provides a platform enriched for the study of gene expression in S. aurata with an emphasis upon immunity and the immune response.

  9. Design and verification of a pangenome microarray oligonucleotide probe set for Dehalococcoides spp.

    PubMed

    Hug, Laura A; Salehi, Maryam; Nuin, Paulo; Tillier, Elisabeth R; Edwards, Elizabeth A

    2011-08-01

    Dehalococcoides spp. are an industrially relevant group of Chloroflexi bacteria capable of reductively dechlorinating contaminants in groundwater environments. Existing Dehalococcoides genomes revealed a high level of sequence identity within this group, including 98 to 100% 16S rRNA sequence identity between strains with diverse substrate specificities. Common molecular techniques for identification of microbial populations are often not applicable for distinguishing Dehalococcoides strains. Here we describe an oligonucleotide microarray probe set designed based on clustered Dehalococcoides genes from five different sources (strain DET195, CBDB1, BAV1, and VS genomes and the KB-1 metagenome). This "pangenome" probe set provides coverage of core Dehalococcoides genes as well as strain-specific genes while optimizing the potential for hybridization to closely related, previously unknown Dehalococcoides strains. The pangenome probe set was compared to probe sets designed independently for each of the five Dehalococcoides strains. The pangenome probe set demonstrated better predictability and higher detection of Dehalococcoides genes than strain-specific probe sets on nontarget strains with <99% average nucleotide identity. An in silico analysis of the expected probe hybridization against the recently released Dehalococcoides strain GT genome and additional KB-1 metagenome sequence data indicated that the pangenome probe set performs more robustly than the combined strain-specific probe sets in the detection of genes not included in the original design. The pangenome probe set represents a highly specific, universal tool for the detection and characterization of Dehalococcoides from contaminated sites. It has the potential to become a common platform for Dehalococcoides-focused research, allowing meaningful comparisons between microarray experiments regardless of the strain examined.

  10. Oligonucleotide primers, probes and molecular methods for the environmental monitoring of methanogenic archaea

    PubMed Central

    Narihiro, Takashi; Sekiguchi, Yuji

    2011-01-01

    Summary For the identification and quantification of methanogenic archaea (methanogens) in environmental samples, various oligonucleotide probes/primers targeting phylogenetic markers of methanogens, such as 16S rRNA, 16S rRNA gene and the gene for the α‐subunit of methyl coenzyme M reductase (mcrA), have been extensively developed and characterized experimentally. These oligonucleotides were designed to resolve different groups of methanogens at different taxonomic levels, and have been widely used as hybridization probes or polymerase chain reaction primers for membrane hybridization, fluorescence in situ hybridization, rRNA cleavage method, gene cloning, DNA microarray and quantitative polymerase chain reaction for studies in environmental and determinative microbiology. In this review, we present a comprehensive list of such oligonucleotide probes/primers, which enable us to determine methanogen populations in an environment quantitatively and hierarchically, with examples of the practical applications of the probes and primers. PMID:21375721

  11. Toward a new paradigm of DNA writing using a massively parallel sequencing platform and degenerate oligonucleotide

    PubMed Central

    Hwang, Byungjin; Bang, Duhee

    2016-01-01

    All synthetic DNA materials require prior programming of the building blocks of the oligonucleotide sequences. The development of a programmable microarray platform provides cost-effective and time-efficient solutions in the field of data storage using DNA. However, the scalability of the synthesis is not on par with the accelerating sequencing capacity. Here, we report on a new paradigm of generating genetic material (writing) using a degenerate oligonucleotide and optomechanical retrieval method that leverages sequencing (reading) throughput to generate the desired number of oligonucleotides. As a proof of concept, we demonstrate the feasibility of our concept in digital information storage in DNA. In simulation, the ability to store data is expected to exponentially increase with increase in degenerate space. The present study highlights the major framework change in conventional DNA writing paradigm as a sequencer itself can become a potential source of making genetic materials. PMID:27876825

  12. Toward a new paradigm of DNA writing using a massively parallel sequencing platform and degenerate oligonucleotide.

    PubMed

    Hwang, Byungjin; Bang, Duhee

    2016-11-23

    All synthetic DNA materials require prior programming of the building blocks of the oligonucleotide sequences. The development of a programmable microarray platform provides cost-effective and time-efficient solutions in the field of data storage using DNA. However, the scalability of the synthesis is not on par with the accelerating sequencing capacity. Here, we report on a new paradigm of generating genetic material (writing) using a degenerate oligonucleotide and optomechanical retrieval method that leverages sequencing (reading) throughput to generate the desired number of oligonucleotides. As a proof of concept, we demonstrate the feasibility of our concept in digital information storage in DNA. In simulation, the ability to store data is expected to exponentially increase with increase in degenerate space. The present study highlights the major framework change in conventional DNA writing paradigm as a sequencer itself can become a potential source of making genetic materials.

  13. Emerging Use of Gene Expression Microarrays in Plant Physiology

    DOE PAGES

    Wullschleger, Stan D.; Difazio, Stephen P.

    2003-01-01

    Microarrays have become an important technology for the global analysis of gene expression in humans, animals, plants, and microbes. Implemented in the context of a well-designed experiment, cDNA and oligonucleotide arrays can provide highthroughput, simultaneous analysis of transcript abundance for hundreds, if not thousands, of genes. However, despite widespread acceptance, the use of microarrays as a tool to better understand processes of interest to the plant physiologist is still being explored. To help illustrate current uses of microarrays in the plant sciences, several case studies that we believe demonstrate the emerging application of gene expression arrays in plant physiology weremore » selected from among the many posters and presentations at the 2003 Plant and Animal Genome XI Conference. Based on this survey, microarrays are being used to assess gene expression in plants exposed to the experimental manipulation of air temperature, soil water content and aluminium concentration in the root zone. Analysis often includes characterizing transcript profiles for multiple post-treatment sampling periods and categorizing genes with common patterns of response using hierarchical clustering techniques. In addition, microarrays are also providing insights into developmental changes in gene expression associated with fibre and root elongation in cotton and maize, respectively. Technical and analytical limitations of microarrays are discussed and projects attempting to advance areas of microarray design and data analysis are highlighted. Finally, although much work remains, we conclude that microarrays are a valuable tool for the plant physiologist interested in the characterization and identification of individual genes and gene families with potential application in the fields of agriculture, horticulture and forestry.« less

  14. NAIMA: target amplification strategy allowing quantitative on-chip detection of GMOs.

    PubMed

    Morisset, Dany; Dobnik, David; Hamels, Sandrine; Zel, Jana; Gruden, Kristina

    2008-10-01

    We have developed a novel multiplex quantitative DNA-based target amplification method suitable for sensitive, specific and quantitative detection on microarray. This new method named NASBA Implemented Microarray Analysis (NAIMA) was applied to GMO detection in food and feed, but its application can be extended to all fields of biology requiring simultaneous detection of low copy number DNA targets. In a first step, the use of tailed primers allows the multiplex synthesis of template DNAs in a primer extension reaction. A second step of the procedure consists of transcription-based amplification using universal primers. The cRNA product is further on directly ligated to fluorescent dyes labelled 3DNA dendrimers allowing signal amplification and hybridized without further purification on an oligonucleotide probe-based microarray for multiplex detection. Two triplex systems have been applied to test maize samples containing several transgenic lines, and NAIMA has shown to be sensitive down to two target copies and to provide quantitative data on the transgenic contents in a range of 0.1-25%. Performances of NAIMA are comparable to singleplex quantitative real-time PCR. In addition, NAIMA amplification is faster since 20 min are sufficient to achieve full amplification.

  15. NAIMA: target amplification strategy allowing quantitative on-chip detection of GMOs

    PubMed Central

    Morisset, Dany; Dobnik, David; Hamels, Sandrine; Žel, Jana; Gruden, Kristina

    2008-01-01

    We have developed a novel multiplex quantitative DNA-based target amplification method suitable for sensitive, specific and quantitative detection on microarray. This new method named NASBA Implemented Microarray Analysis (NAIMA) was applied to GMO detection in food and feed, but its application can be extended to all fields of biology requiring simultaneous detection of low copy number DNA targets. In a first step, the use of tailed primers allows the multiplex synthesis of template DNAs in a primer extension reaction. A second step of the procedure consists of transcription-based amplification using universal primers. The cRNA product is further on directly ligated to fluorescent dyes labelled 3DNA dendrimers allowing signal amplification and hybridized without further purification on an oligonucleotide probe-based microarray for multiplex detection. Two triplex systems have been applied to test maize samples containing several transgenic lines, and NAIMA has shown to be sensitive down to two target copies and to provide quantitative data on the transgenic contents in a range of 0.1–25%. Performances of NAIMA are comparable to singleplex quantitative real-time PCR. In addition, NAIMA amplification is faster since 20 min are sufficient to achieve full amplification. PMID:18710880

  16. A highly oriented hybrid microarray modified electrode fabricated by a template-free method for ultrasensitive electrochemical DNA recognition

    NASA Astrophysics Data System (ADS)

    Shi, Lei; Chu, Zhenyu; Dong, Xueliang; Jin, Wanqin; Dempsey, Eithne

    2013-10-01

    Highly oriented growth of a hybrid microarray was realized by a facile template-free method on gold substrates for the first time. The proposed formation mechanism involves an interfacial structure-directing force arising from self-assembled monolayers (SAMs) between gold substrates and hybrid crystals. Different SAMs and variable surface coverage of the assembled molecules play a critical role in the interfacial directing forces and influence the morphologies of hybrid films. A highly oriented hybrid microarray was formed on the highly aligned and vertical SAMs of 1,4-benzenedithiol molecules with rigid backbones, which afforded an intense structure-directing power for the oriented growth of hybrid crystals. Additionally, the density of the microarray could be adjusted by controlling the surface coverage of assembled molecules. Based on the hybrid microarray modified electrode with a large specific area (ca. 10 times its geometrical area), a label-free electrochemical DNA biosensor was constructed for the detection of an oligonucleotide fragment of the avian flu virus H5N1. The DNA biosensor displayed a significantly low detection limit of 5 pM (S/N = 3), a wide linear response from 10 pM to 10 nM, as well as excellent selectivity, good regeneration and high stability. We expect that the proposed template-free method can provide a new reference for the fabrication of a highly oriented hybrid array and the as-prepared microarray modified electrode will be a promising paradigm in constructing highly sensitive and selective biosensors.Highly oriented growth of a hybrid microarray was realized by a facile template-free method on gold substrates for the first time. The proposed formation mechanism involves an interfacial structure-directing force arising from self-assembled monolayers (SAMs) between gold substrates and hybrid crystals. Different SAMs and variable surface coverage of the assembled molecules play a critical role in the interfacial directing forces and influence the morphologies of hybrid films. A highly oriented hybrid microarray was formed on the highly aligned and vertical SAMs of 1,4-benzenedithiol molecules with rigid backbones, which afforded an intense structure-directing power for the oriented growth of hybrid crystals. Additionally, the density of the microarray could be adjusted by controlling the surface coverage of assembled molecules. Based on the hybrid microarray modified electrode with a large specific area (ca. 10 times its geometrical area), a label-free electrochemical DNA biosensor was constructed for the detection of an oligonucleotide fragment of the avian flu virus H5N1. The DNA biosensor displayed a significantly low detection limit of 5 pM (S/N = 3), a wide linear response from 10 pM to 10 nM, as well as excellent selectivity, good regeneration and high stability. We expect that the proposed template-free method can provide a new reference for the fabrication of a highly oriented hybrid array and the as-prepared microarray modified electrode will be a promising paradigm in constructing highly sensitive and selective biosensors. Electronic supplementary information (ESI) available: Four-probe method for determining the conductivity of the hybrid crystal (Fig. S1); stability comparisons of the hybrid films (Fig. S2); FESEM images of the hybrid microarray (Fig. S3); electrochemical characterizations of the hybrid films (Fig. S4); DFT simulations (Fig. S5); cross-sectional FESEM image of the hybrid microarray (Fig. S6); regeneration and stability tests of the DNA biosensor (Fig. S7). See DOI: 10.1039/c3nr03097k

  17. PCR amplification on microarrays of gel immobilized oligonucleotides

    DOEpatents

    Strizhkov, Boris; Tillib, Sergei; Mikhailovich, Vladimir; Mirzabekov, Andrei

    2003-11-04

    The invention relates two general methods for performing PCR amplification, combined with the detection and analysis of the PCR products on a microchip. In the first method, the amplification occurs both outside and within a plurality of gel pads on a microchip, with at least one oligonucleotide primer immobilized in a gel pad. In the second method, PCR amplification also takes place within gel pads on a microchip, but the pads are surrounded by a hydrophobic liquid such as that which separates the individual gel pads into environments which resemble micro-miniaturized test tubes.

  18. An oligonucleotide microarray to characterize multidrug resistant plasmids

    USDA-ARS?s Scientific Manuscript database

    Bacteria plasmids are fragments of extra-chromosomal double stranded deoxyribonucleic acid (DNA) that can contain a variety of genes beneficial to the host organism like antibiotic drug resistance. Many of the Enterobacteriaceae carry multiple drug resistance (MDR) genes on large plasmids of replic...

  19. Heterologous oligonucleotide microarrays for transcriptomics in a non-model species; a proof-of-concept study of drought stress in Musa

    PubMed Central

    Davey, Mark W; Graham, Neil S; Vanholme, Bartel; Swennen, Rony; May, Sean T; Keulemans, Johan

    2009-01-01

    Background 'Systems-wide' approaches such as microarray RNA-profiling are ideally suited to the study of the complex overlapping responses of plants to biotic and abiotic stresses. However, commercial microarrays are only available for a limited number of plant species and development costs are so substantial as to be prohibitive for most research groups. Here we evaluate the use of cross-hybridisation to Affymetrix oligonucleotide GeneChip® microarrays to profile the response of the banana (Musa spp.) leaf transcriptome to drought stress using a genomic DNA (gDNA)-based probe-selection strategy to improve the efficiency of detection of differentially expressed Musa transcripts. Results Following cross-hybridisation of Musa gDNA to the Rice GeneChip® Genome Array, ~33,700 gene-specific probe-sets had a sufficiently high degree of homology to be retained for transcriptomic analyses. In a proof-of-concept approach, pooled RNA representing a single biological replicate of control and drought stressed leaves of the Musa cultivar 'Cachaco' were hybridised to the Affymetrix Rice Genome Array. A total of 2,910 Musa gene homologues with a >2-fold difference in expression levels were subsequently identified. These drought-responsive transcripts included many functional classes associated with plant biotic and abiotic stress responses, as well as a range of regulatory genes known to be involved in coordinating abiotic stress responses. This latter group included members of the ERF, DREB, MYB, bZIP and bHLH transcription factor families. Fifty-two of these drought-sensitive Musa transcripts were homologous to genes underlying QTLs for drought and cold tolerance in rice, including in 2 instances QTLs associated with a single underlying gene. The list of drought-responsive transcripts also included genes identified in publicly-available comparative transcriptomics experiments. Conclusion Our results demonstrate that despite the general paucity of nucleotide sequence data in Musa and only distant phylogenetic relations to rice, gDNA probe-based cross-hybridisation to the Rice GeneChip® is a highly promising strategy to study complex biological responses and illustrates the potential of such strategies for gene discovery in non-model species. PMID:19758430

  20. Gene expression analysis of the biocontrol fungus Trichoderma harzianum in the presence of tomato plants, chitin, or glucose using a high-density oligonucleotide microarray.

    PubMed

    Samolski, Ilanit; de Luis, Alberto; Vizcaíno, Juan Antonio; Monte, Enrique; Suárez, M Belén

    2009-10-13

    It has recently been shown that the Trichoderma fungal species used for biocontrol of plant diseases are capable of interacting with plant roots directly, behaving as symbiotic microorganisms. With a view to providing further information at transcriptomic level about the early response of Trichoderma to a host plant, we developed a high-density oligonucleotide (HDO) microarray encompassing 14,081 Expressed Sequence Tag (EST)-based transcripts from eight Trichoderma spp. and 9,121 genome-derived transcripts of T. reesei, and we have used this microarray to examine the gene expression of T. harzianum either alone or in the presence of tomato plants, chitin, or glucose. Global microarray analysis revealed 1,617 probe sets showing differential expression in T. harzianum mycelia under at least one of the culture conditions tested as compared with one another. Hierarchical clustering and heat map representation showed that the expression patterns obtained in glucose medium clustered separately from the expression patterns observed in the presence of tomato plants and chitin. Annotations using the Blast2GO suite identified 85 of the 257 transcripts whose probe sets afforded up-regulated expression in response to tomato plants. Some of these transcripts were predicted to encode proteins related to Trichoderma-host (fungus or plant) associations, such as Sm1/Elp1 protein, proteases P6281 and PRA1, enchochitinase CHIT42, or QID74 protein, although previously uncharacterized genes were also identified, including those responsible for the possible biosynthesis of nitric oxide, xenobiotic detoxification, mycelium development, or those related to the formation of infection structures in plant tissues. The effectiveness of the Trichoderma HDO microarray to detect different gene responses under different growth conditions in the fungus T. harzianum strongly indicates that this tool should be useful for further assays that include different stages of plant colonization, as well as for expression studies in other Trichoderma spp. represented on it. Using this microarray, we have been able to define a number of genes probably involved in the transcriptional response of T. harzianum within the first hours of contact with tomato plant roots, which may provide new insights into the mechanisms and roles of this fungus in the Trichoderma-plant interaction.

  1. Gene expression analysis of the biocontrol fungus Trichoderma harzianum in the presence of tomato plants, chitin, or glucose using a high-density oligonucleotide microarray

    PubMed Central

    2009-01-01

    Background It has recently been shown that the Trichoderma fungal species used for biocontrol of plant diseases are capable of interacting with plant roots directly, behaving as symbiotic microorganisms. With a view to providing further information at transcriptomic level about the early response of Trichoderma to a host plant, we developed a high-density oligonucleotide (HDO) microarray encompassing 14,081 Expressed Sequence Tag (EST)-based transcripts from eight Trichoderma spp. and 9,121 genome-derived transcripts of T. reesei, and we have used this microarray to examine the gene expression of T. harzianum either alone or in the presence of tomato plants, chitin, or glucose. Results Global microarray analysis revealed 1,617 probe sets showing differential expression in T. harzianum mycelia under at least one of the culture conditions tested as compared with one another. Hierarchical clustering and heat map representation showed that the expression patterns obtained in glucose medium clustered separately from the expression patterns observed in the presence of tomato plants and chitin. Annotations using the Blast2GO suite identified 85 of the 257 transcripts whose probe sets afforded up-regulated expression in response to tomato plants. Some of these transcripts were predicted to encode proteins related to Trichoderma-host (fungus or plant) associations, such as Sm1/Elp1 protein, proteases P6281 and PRA1, enchochitinase CHIT42, or QID74 protein, although previously uncharacterized genes were also identified, including those responsible for the possible biosynthesis of nitric oxide, xenobiotic detoxification, mycelium development, or those related to the formation of infection structures in plant tissues. Conclusion The effectiveness of the Trichoderma HDO microarray to detect different gene responses under different growth conditions in the fungus T. harzianum strongly indicates that this tool should be useful for further assays that include different stages of plant colonization, as well as for expression studies in other Trichoderma spp. represented on it. Using this microarray, we have been able to define a number of genes probably involved in the transcriptional response of T. harzianum within the first hours of contact with tomato plant roots, which may provide new insights into the mechanisms and roles of this fungus in the Trichoderma-plant interaction. PMID:19825185

  2. Microarray-based gene expression profiling to elucidate effectiveness of fermented Codonopsis lanceolata in mice.

    PubMed

    Choi, Woon Yong; Kim, Ji Seon; Park, Sung Jin; Ma, Choong Je; Lee, Hyeon Yong

    2014-04-08

    In this study, the effect of Codonopsis lanceolata fermented by lactic acid on controlling gene expression levels related to obesity was observed in an oligonucleotide chip microarray. Among 8170 genes, 393 genes were up regulated and 760 genes were down regulated in feeding the fermented C. lanceolata (FCL). Another 374 genes were up regulated and 527 genes down regulated without feeding the sample. The genes were not affected by the FCL sample. It was interesting that among those genes, Chytochrome P450, Dmbt1, LOC76487, and thyroid hormones, etc., were mostly up or down regulated. These genes are more related to lipid synthesis. We could conclude that the FCL possibly controlled the gene expression levels related to lipid synthesis, which resulted in reducing obesity. However, more detailed protein expression experiments should be carried out.

  3. OCaPPI-Db: an oligonucleotide probe database for pathogen identification through hybridization capture.

    PubMed

    Gasc, Cyrielle; Constantin, Antony; Jaziri, Faouzi; Peyret, Pierre

    2017-01-01

    The detection and identification of bacterial pathogens involved in acts of bio- and agroterrorism are essential to avoid pathogen dispersal in the environment and propagation within the population. Conventional molecular methods, such as PCR amplification, DNA microarrays or shotgun sequencing, are subject to various limitations when assessing environmental samples, which can lead to inaccurate findings. We developed a hybridization capture strategy that uses a set of oligonucleotide probes to target and enrich biomarkers of interest in environmental samples. Here, we present Oligonucleotide Capture Probes for Pathogen Identification Database (OCaPPI-Db), an online capture probe database containing a set of 1,685 oligonucleotide probes allowing for the detection and identification of 30 biothreat agents up to the species level. This probe set can be used in its entirety as a comprehensive diagnostic tool or can be restricted to a set of probes targeting a specific pathogen or virulence factor according to the user's needs. : http://ocappidb.uca.works. © The Author(s) 2017. Published by Oxford University Press.

  4. Microarray Genomic Systems Development

    DTIC Science & Technology

    2008-06-01

    11 species), Escherichia coli TOP10 (7 strains), and Geobacillus stearothermophilus . Using standard molecular biology methods, we isolated genomic...comparisons. Results: Different species of bacteria, including Escherichia coli, Bacillus bacteria, and Geobacillus stearothermophilus produce qualitatively...oligonucleotides to labelled genomic DNA from a set of test samples, including eleven Bacillus species, Geobacillus stearothermophilus , and seven Escherichia

  5. A low density microarray method for the identification of human papillomavirus type 18 variants.

    PubMed

    Meza-Menchaca, Thuluz; Williams, John; Rodríguez-Estrada, Rocío B; García-Bravo, Aracely; Ramos-Ligonio, Ángel; López-Monteon, Aracely; Zepeda, Rossana C

    2013-09-26

    We describe a novel microarray based-method for the screening of oncogenic human papillomavirus 18 (HPV-18) molecular variants. Due to the fact that sequencing methodology may underestimate samples containing more than one variant we designed a specific and sensitive stacking DNA hybridization assay. This technology can be used to discriminate between three possible phylogenetic branches of HPV-18. Probes were attached covalently on glass slides and hybridized with single-stranded DNA targets. Prior to hybridization with the probes, the target strands were pre-annealed with the three auxiliary contiguous oligonucleotides flanking the target sequences. Screening HPV-18 positive cell lines and cervical samples were used to evaluate the performance of this HPV DNA microarray. Our results demonstrate that the HPV-18's variants hybridized specifically to probes, with no detection of unspecific signals. Specific probes successfully reveal detectable point mutations in these variants. The present DNA oligoarray system can be used as a reliable, sensitive and specific method for HPV-18 variant screening. Furthermore, this simple assay allows the use of inexpensive equipment, making it accessible in resource-poor settings.

  6. A Low Density Microarray Method for the Identification of Human Papillomavirus Type 18 Variants

    PubMed Central

    Meza-Menchaca, Thuluz; Williams, John; Rodríguez-Estrada, Rocío B.; García-Bravo, Aracely; Ramos-Ligonio, Ángel; López-Monteon, Aracely; Zepeda, Rossana C.

    2013-01-01

    We describe a novel microarray based-method for the screening of oncogenic human papillomavirus 18 (HPV-18) molecular variants. Due to the fact that sequencing methodology may underestimate samples containing more than one variant we designed a specific and sensitive stacking DNA hybridization assay. This technology can be used to discriminate between three possible phylogenetic branches of HPV-18. Probes were attached covalently on glass slides and hybridized with single-stranded DNA targets. Prior to hybridization with the probes, the target strands were pre-annealed with the three auxiliary contiguous oligonucleotides flanking the target sequences. Screening HPV-18 positive cell lines and cervical samples were used to evaluate the performance of this HPV DNA microarray. Our results demonstrate that the HPV-18's variants hybridized specifically to probes, with no detection of unspecific signals. Specific probes successfully reveal detectable point mutations in these variants. The present DNA oligoarray system can be used as a reliable, sensitive and specific method for HPV-18 variant screening. Furthermore, this simple assay allows the use of inexpensive equipment, making it accessible in resource-poor settings. PMID:24077317

  7. Immune and inflammatory gene signature in rat cerebrum in subarachnoid hemorrhage with microarray analysis.

    PubMed

    Lee, Chu-I; Chou, An-Kuo; Lin, Ching-Chih; Chou, Chia-Hua; Loh, Joon-Khim; Lieu, Ann-Shung; Wang, Chih-Jen; Huang, Chi-Ying F; Howng, Shen-Long; Hong, Yi-Ren

    2012-01-01

    Cerebral vasospasm following subarachnoid hemorrhage (SAH) has been studied in terms of a contraction of the major cerebral arteries, but the effect of cerebrum tissue in SAH is not yet well understood. To gain insight into the biology of SAH-expressing cerebrum, we employed oligonucleotide microarrays to characterize the gene expression profiles of cerebrum tissue at the early stage of SAH. Functional gene expression in the cerebrum was analyzed 2 h following stage 1-hemorrhage in Sprague-Dawley rats. mRNA was investigated by performing microarray and quantitative real-time PCR analyses, and protein expression was determined by Western blot analysis. In this study, 18 upregulated and 18 downregulated genes displayed at least a 1.5-fold change. Five genes were verified by real-time PCR, including three upregulated genes [prostaglandin E synthase (PGES), CD14 antigen, and tissue inhibitor of metalloproteinase 1 (TIMP1)] as well as two downregulated genes [KRAB-zinc finger protein-2 (KZF-2) and γ-aminobutyric acid B receptor 1 (GABA B receptor)]. Notably, there were functional implications for the three upregulated genes involved in the inflammatory SAH process. However, the mechanisms leading to decreased KZF-2 and GABA B receptor expression in SAH have never been characterized. We conclude that oligonucleotide microarrays have the potential for use as a method to identify candidate genes associated with SAH and to provide novel investigational targets, including genes involved in the immune and inflammatory response. Furthermore, understanding the regulation of MMP9/TIMP1 during the early stages of SAH may elucidate the pathophysiological mechanisms in SAH rats.

  8. DNA microarray-based detection and identification of Burkholderia mallei, Burkholderia pseudomallei and Burkholderia spp.

    PubMed

    Schmoock, Gernot; Ehricht, Ralf; Melzer, Falk; Rassbach, Astrid; Scholz, Holger C; Neubauer, Heinrich; Sachse, Konrad; Mota, Rinaldo Aparecido; Saqib, Muhammad; Elschner, Mandy

    2009-01-01

    We developed a rapid oligonucleotide microarray assay based on genetic markers for the accurate identification and differentiation of Burkholderia (B.) mallei and Burkholderia pseudomallei, the agents of glanders and melioidosis, respectively. These two agents were clearly identified using at least 4 independent genetic markers including 16S rRNA gene, fliC, motB and also by novel species-specific target genes, identified by in silico sequence analysis. Specific hybridization signal profiles allowed the detection and differentiation of up to 10 further Burkholderia spp., including the closely related species Burkholderia thailandensis and Burkholderia-like agents, such as Burkholderia cepacia, Burkholderia cenocepacia, Burkholderia vietnamiensis, Burkholderia ambifaria, and Burkholderia gladioli, which are often associated with cystic fibrosis (CF) lung disease. The assay was developed using the easy-to-handle and economical ArrayTube (AT) platform. A representative strain panel comprising 44 B. mallei, 32 B. pseudomallei isolates, and various Burkholderia type strains were examined to validate the test. Assay specificity was determined by examination of 40 non-Burkholderia strains.

  9. Direct on-chip DNA synthesis using electrochemically modified gold electrodes as solid support

    NASA Astrophysics Data System (ADS)

    Levrie, Karen; Jans, Karolien; Schepers, Guy; Vos, Rita; Van Dorpe, Pol; Lagae, Liesbet; Van Hoof, Chris; Van Aerschot, Arthur; Stakenborg, Tim

    2018-04-01

    DNA microarrays have propelled important advancements in the field of genomic research by enabling the monitoring of thousands of genes in parallel. The throughput can be increased even further by scaling down the microarray feature size. In this respect, microelectronics-based DNA arrays are promising as they can leverage semiconductor processing techniques with lithographic resolutions. We propose a method that enables the use of metal electrodes for de novo DNA synthesis without the need for an insulating support. By electrochemically functionalizing gold electrodes, these electrodes can act as solid support for phosphoramidite-based synthesis. The proposed method relies on the electrochemical reduction of diazonium salts, enabling site-specific incorporation of hydroxyl groups onto the metal electrodes. An automated DNA synthesizer was used to couple phosphoramidite moieties directly onto the OH-modified electrodes to obtain the desired oligonucleotide sequence. Characterization was done via cyclic voltammetry and fluorescence microscopy. Our results present a valuable proof-of-concept for the integration of solid-phase DNA synthesis with microelectronics.

  10. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hsia, Chu Chieh; Chizhikov, Vladimir E.; Yang, Amy X.

    Hepatitis B virus (HBV), hepatitis C virus (HCV), and human immunodeficiency virus type-1 (HIV-1) are transfusion-transmitted human pathogens that have a major impact on blood safety and public health worldwide. We developed a microarray multiplex assay for the simultaneous detection and discrimination of these three viruses. The microarray consists of 16 oligonucleotide probes, immobilized on a silylated glass slide. Amplicons from multiplex PCR were labeled with Cy-5 and hybridized to the microarray. The assay detected 1 International Unit (IU), 10 IU, 20 IU of HBV, HCV, and HIV-1, respectively, in a single multiplex reaction. The assay also detected and discriminatedmore » the presence of two or three of these viruses in a single sample. Our data represent a proof-of-concept for the possible use of highly sensitive multiplex microarray assay to screen and confirm the presence of these viruses in blood donors and patients.« less

  11. Designing oligo libraries taking alternative splicing into account

    NASA Astrophysics Data System (ADS)

    Shoshan, Avi; Grebinskiy, Vladimir; Magen, Avner; Scolnicov, Ariel; Fink, Eyal; Lehavi, David; Wasserman, Alon

    2001-06-01

    We have designed sequences for DNA microarrays and oligo libraries, taking alternative splicing into account. Alternative splicing is a common phenomenon, occurring in more than 25% of the human genes. In many cases, different splice variants have different functions, are expressed in different tissues or may indicate different stages of disease. When designing sequences for DNA microarrays or oligo libraries, it is very important to take into account the sequence information of all the mRNA transcripts. Therefore, when a gene has more than one transcript (as a result of alternative splicing, alternative promoter sites or alternative poly-adenylation sites), it is very important to take all of them into account in the design. We have used the LEADS transcriptome prediction system to cluster and assemble the human sequences in GenBank and design optimal oligonucleotides for all the human genes with a known mRNA sequence based on the LEADS predictions.

  12. SigReannot-mart: a query environment for expression microarray probe re-annotations.

    PubMed

    Moreews, François; Rauffet, Gaelle; Dehais, Patrice; Klopp, Christophe

    2011-01-01

    Expression microarrays are commonly used to study transcriptomes. Most of the arrays are now based on oligo-nucleotide probes. Probe design being a tedious task, it often takes place once at the beginning of the project. The oligo set is then used for several years. During this time period, the knowledge gathered by the community on the genome and the transcriptome increases and gets more precise. Therefore re-annotating the set is essential to supply the biologists with up-to-date annotations. SigReannot-mart is a query environment populated with regularly updated annotations for different oligo sets. It stores the results of the SigReannot pipeline that has mainly been used on farm and aquaculture species. It permits easy extraction in different formats using filters. It is used to compare probe sets on different criteria, to choose the set for a given experiment to mix probe sets in order to create a new one.

  13. Single-base-pair discrimination of terminal mismatches by using oligonucleotide microarrays and neural network analyses

    NASA Technical Reports Server (NTRS)

    Urakawa, Hidetoshi; Noble, Peter A.; El Fantroussi, Said; Kelly, John J.; Stahl, David A.

    2002-01-01

    The effects of single-base-pair near-terminal and terminal mismatches on the dissociation temperature (T(d)) and signal intensity of short DNA duplexes were determined by using oligonucleotide microarrays and neural network (NN) analyses. Two perfect-match probes and 29 probes having a single-base-pair mismatch at positions 1 to 5 from the 5' terminus of the probe were designed to target one of two short sequences representing 16S rRNA. Nonequilibrium dissociation rates (i.e., melting profiles) of all probe-target duplexes were determined simultaneously. Analysis of variance revealed that position of the mismatch, type of mismatch, and formamide concentration significantly affected the T(d) and signal intensity. Increasing the concentration of formamide in the washing buffer decreased the T(d) and signal intensity, and it decreased the variability of the signal. Although T(d)s of probe-target duplexes with mismatches in the first or second position were not significantly different from one another, duplexes with mismatches in the third to fifth positions had significantly lower T(d)s than those with mismatches in the first or second position. The trained NNs predicted the T(d) with high accuracies (R(2) = 0.93). However, the NNs predicted the signal intensity only moderately accurately (R(2) = 0.67), presumably due to increased noise in the signal intensity at low formamide concentrations. Sensitivity analysis revealed that the concentration of formamide explained most (75%) of the variability in T(d)s, followed by position of the mismatch (19%) and type of mismatch (6%). The results suggest that position of the mismatch at or near the 5' terminus plays a greater role in determining the T(d) and signal intensity of duplexes than the type of mismatch.

  14. [Differential gene expression in incompatible interaction between Lilium regale Wilson and Fusarium oxysporum f. sp. lilii revealed by combined SSH and microarray analysis].

    PubMed

    Rao, J; Liu, D; Zhang, N; He, H; Ge, F; Chen, C

    2014-01-01

    Fusarium wilt, caused by a soilborne pathogen Fusarium oxysporum f. sp. lilii, is the major disease of lily (Lilium L.). In order to isolate the genes differentially expressed in a resistant reaction to F. oxysporum in L. regale Wilson, a cDNA library was constructed with L. regale root during F. oxysporum infection using the suppression subtractive hybridization (SSH), and a total of 585 unique expressed sequence tags (ESTs) were obtained. Furthermore, the gene expression profiles in the incompatible interaction between L. regale and F. oxysporum were revealed by oligonucleotide microarray analysis of 585 unique ESTs comparison to the compatible interaction between a susceptible Lilium Oriental Hybrid 'Siberia' and F. oxysporum. The result of expression profile analysis indicated that the genes encoding pathogenesis-related proteins (PRs), antioxidative stress enzymes, secondary metabolism enzymes, transcription factors, signal transduction proteins as well as a large number of unknown genes were involved in early defense response of L. regale to F. oxysporum infection. Moreover, the following quantitative reverse transcription PCR (QRT-PCR) analysis confirmed reliability of the oligonucleotide microarray data. In the present study, isolation of differentially expressed genes in L. regale during response to F. oxysporum helped to uncover the molecular mechanism associated with the resistance of L. regale against F. oxysporum.

  15. Differences in X-chromosome transcriptional activity and cholesterol metabolism between placentae from swine breeds from asian and western origins

    USDA-ARS?s Scientific Manuscript database

    To gain insight into placental physiology differences between the Chinese Meishan and white composite (WC) swine breeds, short-oligonucleotide microarray gene expression profiles of gestational Day 25, 45, 65, 85, and 105 placental tissues were compared. Differential expression was determined by a ...

  16. Analysis of large-scale gene expression data.

    PubMed

    Sherlock, G

    2000-04-01

    The advent of cDNA and oligonucleotide microarray technologies has led to a paradigm shift in biological investigation, such that the bottleneck in research is shifting from data generation to data analysis. Hierarchical clustering, divisive clustering, self-organizing maps and k-means clustering have all been recently used to make sense of this mass of data.

  17. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Andersen, G.L.; He, Z.; DeSantis, T.Z.

    Microarrays have proven to be a useful and high-throughput method to provide targeted DNA sequence information for up to many thousands of specific genetic regions in a single test. A microarray consists of multiple DNA oligonucleotide probes that, under high stringency conditions, hybridize only to specific complementary nucleic acid sequences (targets). A fluorescent signal indicates the presence and, in many cases, the abundance of genetic regions of interest. In this chapter we will look at how microarrays are used in microbial ecology, especially with the recent increase in microbial community DNA sequence data. Of particular interest to microbial ecologists, phylogeneticmore » microarrays are used for the analysis of phylotypes in a community and functional gene arrays are used for the analysis of functional genes, and, by inference, phylotypes in environmental samples. A phylogenetic microarray that has been developed by the Andersen laboratory, the PhyloChip, will be discussed as an example of a microarray that targets the known diversity within the 16S rRNA gene to determine microbial community composition. Using multiple, confirmatory probes to increase the confidence of detection and a mismatch probe for every perfect match probe to minimize the effect of cross-hybridization by non-target regions, the PhyloChip is able to simultaneously identify any of thousands of taxa present in an environmental sample. The PhyloChip is shown to reveal greater diversity within a community than rRNA gene sequencing due to the placement of the entire gene product on the microarray compared with the analysis of up to thousands of individual molecules by traditional sequencing methods. A functional gene array that has been developed by the Zhou laboratory, the GeoChip, will be discussed as an example of a microarray that dynamically identifies functional activities of multiple members within a community. The recent version of GeoChip contains more than 24,000 50mer oligonucleotide probes and covers more than 10,000 gene sequences in 150 gene categories involved in carbon, nitrogen, sulfur, and phosphorus cycling, metal resistance and reduction, and organic contaminant degradation. GeoChip can be used as a generic tool for microbial community analysis, and also link microbial community structure to ecosystem functioning. Examples of the application of both arrays in different environmental samples will be described in the two subsequent sections.« less

  18. Oligonucleotide microarray analysis reveals dysregulation of energy-related metabolism in insulin-sensitive tissues of type 2 diabetes patients.

    PubMed

    Wang, M; Wang, X C; Zhao, L; Zhang, Y; Yao, L L; Lin, Y; Peng, Y D; Hu, R M

    2014-06-17

    Impaired insulin action within skeletal muscle, adipose tissue, and the liver is an important characteristic of type 2 diabetes (T2D). In order to identify common underlying defects in insulin-sensitive tissues that may be involved in the pathogenesis of T2D, the gene expression profiles of skeletal muscle, visceral adipose tissue, and liver from autopsy donors with or without T2D were examined using oligonucleotide microarrays and quantitative reverse transcriptase-PCR. Compared with controls, 691 genes were commonly dysregulated in these three insulin-sensitive tissues of humans with T2D. These co-expressed genes were enriched within the mitochondrion, with suggested involvement in energy metabolic processes such as glycolysis and gluconeogenesis, fatty acid beta oxidative, tricarboxylic acid cycle, and electron transport. Genes related to energy metabolism were mostly downregulated in diabetic skeletal muscle and visceral adipose tissue, while they were upregulated in the diabetic liver. This observed dysregulation in energy-related metabolism may be the underlying factor leading to the molecular mechanisms responsible for the insulin resistance of patients with T2D.

  19. Regulation of the activity of the promoter of RNA-induced silencing, C3PO.

    PubMed

    Sahu, Shriya; Williams, Leo; Perez, Alberto; Philip, Finly; Caso, Giuseppe; Zurawsky, Walter; Scarlata, Suzanne

    2017-09-01

    RNA-induced silencing is a process which allows cells to regulate the synthesis of specific proteins. RNA silencing is promoted by the protein C3PO (component 3 of RISC). We have previously found that phospholipase Cβ, which increases intracellular calcium levels in response to specific G protein signals, inhibits C3PO activity towards certain genes. Understanding the parameters that control C3PO activity and which genes are impacted by G protein activation would help predict which genes are more vulnerable to downregulation. Here, using a library of 10 18 oligonucleotides, we show that C3PO binds oligonucleotides with structural specificity but little sequence specificity. Alternately, C3PO hydrolyzes oligonucleotides with a rate that is sensitive to substrate stability. Importantly, we find that oligonucleotides with higher Tm values are inhibited by bound PLCβ. This finding is supported by microarray analysis in cells over-expressing PLCβ1. Taken together, this study allows predictions of the genes whose post-transcriptional regulation is responsive to the G protein/phospholipase Cβ/calcium signaling pathway. © 2017 The Protein Society.

  20. A Novel Pan-Flavivirus Detection and Identification Assay Based on RT-qPCR and Microarray

    PubMed Central

    Sachse, Konrad; Ziegler, Ute; Keller, Markus

    2017-01-01

    The genus Flavivirus includes arthropod-borne viruses responsible for a large number of infections in humans and economically important animals. While RT-PCR protocols for specific detection of most Flavivirus species are available, there has been also a demand for a broad-range Flavivirus assay covering all members of the genus. It is particularly challenging to balance specificity at genus level with equal sensitivity towards each target species. In the present study, a novel assay combining a SYBR Green-based RT-qPCR with a low-density DNA microarray has been developed. Validation experiments confirmed that the RT-qPCR exhibited roughly equal sensitivity of detection and quantification for all flaviviruses tested. These PCR products are subjected to hybridization on a microarray carrying 84 different oligonucleotide probes that represent all known Flavivirus species. This assay has been used as a screening and confirmation tool for Flavivirus presence in laboratory and field samples, and it performed successfully in international External Quality Assessment of NAT studies. Twenty-six Flavivirus strains were tested with the assay, showing equivalent or superior characteristics compared with the original or even with species-specific RT-PCRs. As an example, test results on West Nile virus detection in a panel of 340 mosquito pool samples from Greece are presented. PMID:28626758

  1. Inhibition of connective tissue growth factor (CTGF/CCN2) expression decreases the survival and myogenic differentiation of human rhabdomyosarcoma cells.

    PubMed

    Croci, Stefania; Landuzzi, Lorena; Astolfi, Annalisa; Nicoletti, Giordano; Rosolen, Angelo; Sartori, Francesca; Follo, Matilde Y; Oliver, Noelynn; De Giovanni, Carla; Nanni, Patrizia; Lollini, Pier-Luigi

    2004-03-01

    Connective tissue growth factor (CTGF/CCN2), a cysteine-rich protein of the CCN (Cyr61, CTGF, Nov) family of genes, emerged from a microarray screen of genes expressed by human rhabdomyosarcoma cells. Rhabdomyosarcoma is a soft tissue sarcoma of childhood deriving from skeletal muscle cells. In this study, we investigated the role of CTGF in rhabdomyosarcoma. Human rhabdomyosarcoma cells of the embryonal (RD/12, RD/18, CCA) and the alveolar histotype (RMZ-RC2, SJ-RH4, SJ-RH30), rhabdomyosarcoma tumor specimens, and normal skeletal muscle cells expressed CTGF. To determine the function of CTGF, we treated rhabdomyosarcoma cells with a CTGF antisense oligonucleotide or with a CTGF small interfering RNA (siRNA). Both treatments inhibited rhabdomyosarcoma cell growth, suggesting the existence of a new autocrine loop based on CTGF. CTGF antisense oligonucleotide-mediated growth inhibition was specifically due to a significant increase in apoptosis, whereas cell proliferation was unchanged. CTGF antisense oligonucleotide induced a strong decrease in the level of myogenic differentiation of rhabdomyosarcoma cells, whereas the addition of recombinant CTGF significantly increased the proportion of myosin-positive cells. CTGF emerges as a survival and differentiation factor and could be a new therapeutic target in human rhabdomyosarcoma.

  2. Rapid and reliable detection and identification of GM events using multiplex PCR coupled with oligonucleotide microarray.

    PubMed

    Xu, Xiaodan; Li, Yingcong; Zhao, Heng; Wen, Si-yuan; Wang, Sheng-qi; Huang, Jian; Huang, Kun-lun; Luo, Yun-bo

    2005-05-18

    To devise a rapid and reliable method for the detection and identification of genetically modified (GM) events, we developed a multiplex polymerase chain reaction (PCR) coupled with a DNA microarray system simultaneously aiming at many targets in a single reaction. The system included probes for screening gene, species reference gene, specific gene, construct-specific gene, event-specific gene, and internal and negative control genes. 18S rRNA was combined with species reference genes as internal controls to assess the efficiency of all reactions and to eliminate false negatives. Two sets of the multiplex PCR system were used to amplify four and five targets, respectively. Eight different structure genes could be detected and identified simultaneously for Roundup Ready soybean in a single microarray. The microarray specificity was validated by its ability to discriminate two GM maizes Bt176 and Bt11. The advantages of this method are its high specificity and greatly reduced false-positives and -negatives. The multiplex PCR coupled with microarray technology presented here is a rapid and reliable tool for the simultaneous detection of GM organism ingredients.

  3. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Farahani, Poupak; Chiu, Sally; Bowlus, Christopher L.

    Obesity is a complex disease. To date, over 100 chromosomal loci for body weight, body fat, regional white adipose tissue weight, and other obesity-related traits have been identified in humans and in animal models. For most loci, the underlying genes are not yet identified; some of these chromosomal loci will be alleles of known obesity genes, whereas many will represent alleles of unknown genes. Microarray analysis allows simultaneous multiple gene and pathway discovery. cDNA and oligonucleotide arrays are commonly used to identify differentially expressed genes by surveys of large numbers of known and unnamed genes. Two papers previously identified genesmore » differentially expressed in adipose tissue of mouse models of obesity and diabetes by analysis of hybridization to Affymetrix oligonucleotide chips.« less

  4. A functional genomics tool for the Pacific bluefin tuna: Development of a 44K oligonucleotide microarray from whole-genome sequencing data for global transcriptome analysis.

    PubMed

    Yasuike, Motoshige; Fujiwara, Atushi; Nakamura, Yoji; Iwasaki, Yuki; Nishiki, Issei; Sugaya, Takuma; Shimizu, Akio; Sano, Motohiko; Kobayashi, Takanori; Ototake, Mitsuru

    2016-02-01

    Bluefin tunas are one of the most important fishery resources worldwide. Because of high market values, bluefin tuna farming has been rapidly growing during recent years. At present, the most common form of the tuna farming is based on the stocking of wild-caught fish. Therefore, concerns have been raised about the negative impact of the tuna farming on wild stocks. Recently, the Pacific bluefin tuna (PBT), Thunnus orientalis, has succeeded in completing the reproduction cycle under aquaculture conditions, but production bottlenecks remain to be solved because of very little biological information on bluefin tunas. Functional genomics approaches promise to rapidly increase our knowledge on biological processes in the bluefin tuna. Here, we describe the development of the first 44K PBT oligonucleotide microarray (oligo-array), based on whole-genome shotgun (WGS) sequencing and large-scale expressed sequence tags (ESTs) data. In addition, we also introduce an initial 44K PBT oligo-array experiment using in vitro grown peripheral blood leukocytes (PBLs) stimulated with immunostimulants such as lipopolysaccharide (LPS: a cell wall component of Gram-negative bacteria) or polyinosinic:polycytidylic acid (poly I:C: a synthetic mimic of viral infection). This pilot 44K PBT oligo-array analysis successfully addressed distinct immune processes between LPS- and poly I:C- stimulated PBLs. Thus, we expect that this oligo-array will provide an excellent opportunity to analyze global gene expression profiles for a better understanding of diseases and stress, as well as for reproduction, development and influence of nutrition on tuna aquaculture production. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.

  5. Data-adaptive test statistics for microarray data.

    PubMed

    Mukherjee, Sach; Roberts, Stephen J; van der Laan, Mark J

    2005-09-01

    An important task in microarray data analysis is the selection of genes that are differentially expressed between different tissue samples, such as healthy and diseased. However, microarray data contain an enormous number of dimensions (genes) and very few samples (arrays), a mismatch which poses fundamental statistical problems for the selection process that have defied easy resolution. In this paper, we present a novel approach to the selection of differentially expressed genes in which test statistics are learned from data using a simple notion of reproducibility in selection results as the learning criterion. Reproducibility, as we define it, can be computed without any knowledge of the 'ground-truth', but takes advantage of certain properties of microarray data to provide an asymptotically valid guide to expected loss under the true data-generating distribution. We are therefore able to indirectly minimize expected loss, and obtain results substantially more robust than conventional methods. We apply our method to simulated and oligonucleotide array data. By request to the corresponding author.

  6. Identification of Escherichia coli O157 by Using a Novel Colorimetric Detection Method with DNA Microarrays

    PubMed Central

    Swimley, Michelle S.; Taylor, Amber W.; Dawson, Erica D.

    2011-01-01

    Abstract Shiga toxin–producing Escherichia coli O157 is a leading cause of foodborne illness worldwide. To evaluate better methods to rapidly detect and genotype E. coli O157 strains, the present study evaluated the use of ampliPHOX, a novel colorimetric detection method based on photopolymerization, for pathogen identification with DNA microarrays. A low-density DNA oligonucleotide microarray was designed to target stx1 and stx2 genes encoding Shiga toxin production, the eae gene coding for adherence membrane protein, and the per gene encoding the O157-antigen perosamine synthetase. Results from the validation experiments demonstrated that the use of ampliPHOX allowed the accurate genotyping of the tested E. coli strains, and positive hybridization signals were observed for only probes targeting virulence genes present in the reference strains. Quantification showed that the average signal-to-noise ratio values ranged from 47.73 ± 7.12 to 76.71 ± 8.33, whereas average signal-to-noise ratio values below 2.5 were determined for probes where no polymer was formed due to lack of specific hybridization. Sensitivity tests demonstrated that the sensitivity threshold for E. coli O157 detection was 100–1000 CFU/mL. Thus, the use of DNA microarrays in combination with photopolymerization allowed the rapid and accurate genotyping of E. coli O157 strains. PMID:21288130

  7. A comprehensive transcript index of the human genome generated using microarrays and computational approaches

    PubMed Central

    Schadt, Eric E; Edwards, Stephen W; GuhaThakurta, Debraj; Holder, Dan; Ying, Lisa; Svetnik, Vladimir; Leonardson, Amy; Hart, Kyle W; Russell, Archie; Li, Guoya; Cavet, Guy; Castle, John; McDonagh, Paul; Kan, Zhengyan; Chen, Ronghua; Kasarskis, Andrew; Margarint, Mihai; Caceres, Ramon M; Johnson, Jason M; Armour, Christopher D; Garrett-Engele, Philip W; Tsinoremas, Nicholas F; Shoemaker, Daniel D

    2004-01-01

    Background Computational and microarray-based experimental approaches were used to generate a comprehensive transcript index for the human genome. Oligonucleotide probes designed from approximately 50,000 known and predicted transcript sequences from the human genome were used to survey transcription from a diverse set of 60 tissues and cell lines using ink-jet microarrays. Further, expression activity over at least six conditions was more generally assessed using genomic tiling arrays consisting of probes tiled through a repeat-masked version of the genomic sequence making up chromosomes 20 and 22. Results The combination of microarray data with extensive genome annotations resulted in a set of 28,456 experimentally supported transcripts. This set of high-confidence transcripts represents the first experimentally driven annotation of the human genome. In addition, the results from genomic tiling suggest that a large amount of transcription exists outside of annotated regions of the genome and serves as an example of how this activity could be measured on a genome-wide scale. Conclusions These data represent one of the most comprehensive assessments of transcriptional activity in the human genome and provide an atlas of human gene expression over a unique set of gene predictions. Before the annotation of the human genome is considered complete, however, the previously unannotated transcriptional activity throughout the genome must be fully characterized. PMID:15461792

  8. Detecting and Genotyping Escherichia coli O157:H7 using multiplexed PCR and nucleic acid microarrays

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Call, Douglas R.; Brockman, Fred J.; Chandler, Darrell P.

    2000-12-01

    Rapid detection and characterization of food borne pathogens such as Escherichia coli O157:H7 is crucial for epidemiological investigations and food safety surveillance. As an alternative to conventional technologies, we examined the sensitivity and specificity of nucleic acid microarrays for detecting and genotyping E. coli O157:H7. The array was composed of oligonucleotide probes (25-30 mer) complementary to four virulence loci (intimin, Shiga-like toxins I and II, and hemolysin A). Target DNA was amplified from whole cells or from purified DNA via single or multiplexed polymerase chain reaction (PCR), and PCR products were hybridized to the array without further modification or purification.more » The array was 32-fold more sensitive than gel electrophoresis and capable of detecting amplification products from < 1 cell equivalent of genomic DNA (1 fg). Immunomagnetic capture, PCR and a microarray were subsequently used to detect 55 CFU ml-1 (E. coli O157:H7) from chicken rinsate without the aid of pre-enrichment. Four isolates of E. coli O157:H7 and one isolate of O91:H2, for which genotypic data were available, were unambiguously genotyped with this array. Glass based microarrays are relatively simple to construct and provide a rapid and sensitive means to detect multiplexed PCR products and the system is amenable to automation.« less

  9. Detecting and genotyping Escherichia coli O157:H7 using multiplexed PCR and nucleic acid microarrays

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Call, Douglas R.; Brockman, Fred J.; Chandler, Darrell P.

    2001-07-05

    Rapid detection and characterization of food borne pathogens such as Escherichia coli O157:H7 is crucial for epidemiological investigations and food safety surveillance. As an alternative to conventional technologies, we examined the sensitivity and specificity of nucleic acid microarrays for detecting and genotyping E. coli O157:H7. The array was composed of oligonucleotide probes (25-30 mer) complementary to four virulence loci (intimin, Shiga-like toxins I and II, and hemolysin A). Target DNA was amplified from whole cells or from purified DNA via single or multiplexed polymerase chain reaction (PCR), and PCR products were hybridized to the array without further modification or purification.more » The array was 32-fold more sensitive than gel electrophoresis and capable of detecting amplification products from < 1 cell equivalent of genomic DNA (1 fg). Immunomagnetic capture, PCR and a microarray were subsequently used to detect 55 CFUs ml-1 (E. coli O157:H7) from chicken rinsate without the aid of pre-enrichment. Four isolates of E. coli O157:H7 and one isolate of O91:H2, for which genotypic data were available, were unambiguously genotyped with this array. Glass based microarrays are relatively simple to construct and provide a rapid and sensitive means to detect multiplexed PCR products and the system is amenable to automation.« less

  10. Development and validation of a mixed-tissue oligonucleotide DNA microarray for Atlantic bluefin tuna, Thunnus thynnus (Linnaeus, 1758).

    PubMed

    Trumbić, Željka; Bekaert, Michaël; Taggart, John B; Bron, James E; Gharbi, Karim; Mladineo, Ivona

    2015-11-25

    The largest of the tuna species, Atlantic bluefin tuna (Thunnus thynnus), inhabits the North Atlantic Ocean and the Mediterranean Sea and is considered to be an endangered species, largely a consequence of overfishing. T. thynnus aquaculture, referred to as fattening or farming, is a capture based activity dependent on yearly renewal from the wild. Thus, the development of aquaculture practices independent of wild resources can provide an important contribution towards ensuring security and sustainability of this species in the longer-term. The development of such practices is today greatly assisted by large scale transcriptomic studies. We have used pyrosequencing technology to sequence a mixed-tissue normalised cDNA library, derived from adult T. thynnus. A total of 976,904 raw sequence reads were assembled into 33,105 unique transcripts having a mean length of 893 bases and an N50 of 870. Of these, 33.4% showed similarity to known proteins or gene transcripts and 86.6% of them were matched to the congeneric Pacific bluefin tuna (Thunnus orientalis) genome, compared to 70.3% for the more distantly related Nile tilapia (Oreochromis niloticus) genome. Transcript sequences were used to develop a novel 15 K Agilent oligonucleotide DNA microarray for T. thynnus and comparative tissue gene expression profiles were inferred for gill, heart, liver, ovaries and testes. Functional contrasts were strongest between gills and ovaries. Gills were particularly associated with immune system, signal transduction and cell communication, while ovaries displayed signatures of glycan biosynthesis, nucleotide metabolism, transcription, translation, replication and repair. Sequence data generated from a novel mixed-tissue T. thynnus cDNA library provide an important transcriptomic resource that can be further employed for study of various aspects of T. thynnus ecology and genomics, with strong applications in aquaculture. Tissue-specific gene expression profiles inferred through the use of novel oligo-microarray can serve in the design of new and more focused transcriptomic studies for future research of tuna physiology and assessment of the welfare in a production environment.

  11. Identifying Fishes through DNA Barcodes and Microarrays.

    PubMed

    Kochzius, Marc; Seidel, Christian; Antoniou, Aglaia; Botla, Sandeep Kumar; Campo, Daniel; Cariani, Alessia; Vazquez, Eva Garcia; Hauschild, Janet; Hervet, Caroline; Hjörleifsdottir, Sigridur; Hreggvidsson, Gudmundur; Kappel, Kristina; Landi, Monica; Magoulas, Antonios; Marteinsson, Viggo; Nölte, Manfred; Planes, Serge; Tinti, Fausto; Turan, Cemal; Venugopal, Moleyur N; Weber, Hannes; Blohm, Dietmar

    2010-09-07

    International fish trade reached an import value of 62.8 billion Euro in 2006, of which 44.6% are covered by the European Union. Species identification is a key problem throughout the life cycle of fishes: from eggs and larvae to adults in fisheries research and control, as well as processed fish products in consumer protection. This study aims to evaluate the applicability of the three mitochondrial genes 16S rRNA (16S), cytochrome b (cyt b), and cytochrome oxidase subunit I (COI) for the identification of 50 European marine fish species by combining techniques of "DNA barcoding" and microarrays. In a DNA barcoding approach, neighbour Joining (NJ) phylogenetic trees of 369 16S, 212 cyt b, and 447 COI sequences indicated that cyt b and COI are suitable for unambiguous identification, whereas 16S failed to discriminate closely related flatfish and gurnard species. In course of probe design for DNA microarray development, each of the markers yielded a high number of potentially species-specific probes in silico, although many of them were rejected based on microarray hybridisation experiments. None of the markers provided probes to discriminate the sibling flatfish and gurnard species. However, since 16S-probes were less negatively influenced by the "position of label" effect and showed the lowest rejection rate and the highest mean signal intensity, 16S is more suitable for DNA microarray probe design than cty b and COI. The large portion of rejected COI-probes after hybridisation experiments (>90%) renders the DNA barcoding marker as rather unsuitable for this high-throughput technology. Based on these data, a DNA microarray containing 64 functional oligonucleotide probes for the identification of 30 out of the 50 fish species investigated was developed. It represents the next step towards an automated and easy-to-handle method to identify fish, ichthyoplankton, and fish products.

  12. Differential Transcriptional Response to Nonassociative and Associative Components of Classical Fear Conditioning in the Amygdala and Hippocampus

    ERIC Educational Resources Information Center

    Isiegas, Carolina; Stein, Joel; Hellman, Kevin; Hannenhalli, Sridhar; Abel, Ted; Keeley, Michael B.; Wood, Marcelo A.

    2006-01-01

    Classical fear conditioning requires the recognition of conditioned stimuli (CS) and the association of the CS with an aversive stimulus. We used Affymetrix oligonucleotide microarrays to characterize changes in gene expression compared to naive mice in both the amygdala and the hippocampus 30 min after classical fear conditioning and 30 min after…

  13. Hybrid genetic algorithm-neural network: feature extraction for unpreprocessed microarray data.

    PubMed

    Tong, Dong Ling; Schierz, Amanda C

    2011-09-01

    Suitable techniques for microarray analysis have been widely researched, particularly for the study of marker genes expressed to a specific type of cancer. Most of the machine learning methods that have been applied to significant gene selection focus on the classification ability rather than the selection ability of the method. These methods also require the microarray data to be preprocessed before analysis takes place. The objective of this study is to develop a hybrid genetic algorithm-neural network (GANN) model that emphasises feature selection and can operate on unpreprocessed microarray data. The GANN is a hybrid model where the fitness value of the genetic algorithm (GA) is based upon the number of samples correctly labelled by a standard feedforward artificial neural network (ANN). The model is evaluated by using two benchmark microarray datasets with different array platforms and differing number of classes (a 2-class oligonucleotide microarray data for acute leukaemia and a 4-class complementary DNA (cDNA) microarray dataset for SRBCTs (small round blue cell tumours)). The underlying concept of the GANN algorithm is to select highly informative genes by co-evolving both the GA fitness function and the ANN weights at the same time. The novel GANN selected approximately 50% of the same genes as the original studies. This may indicate that these common genes are more biologically significant than other genes in the datasets. The remaining 50% of the significant genes identified were used to build predictive models and for both datasets, the models based on the set of genes extracted by the GANN method produced more accurate results. The results also suggest that the GANN method not only can detect genes that are exclusively associated with a single cancer type but can also explore the genes that are differentially expressed in multiple cancer types. The results show that the GANN model has successfully extracted statistically significant genes from the unpreprocessed microarray data as well as extracting known biologically significant genes. We also show that assessing the biological significance of genes based on classification accuracy may be misleading and though the GANN's set of extra genes prove to be more statistically significant than those selected by other methods, a biological assessment of these genes is highly recommended to confirm their functionality. Copyright © 2011 Elsevier B.V. All rights reserved.

  14. Plant-pathogen interactions: what microarray tells about it?

    PubMed

    Lodha, T D; Basak, J

    2012-01-01

    Plant defense responses are mediated by elementary regulatory proteins that affect expression of thousands of genes. Over the last decade, microarray technology has played a key role in deciphering the underlying networks of gene regulation in plants that lead to a wide variety of defence responses. Microarray is an important tool to quantify and profile the expression of thousands of genes simultaneously, with two main aims: (1) gene discovery and (2) global expression profiling. Several microarray technologies are currently in use; most include a glass slide platform with spotted cDNA or oligonucleotides. Till date, microarray technology has been used in the identification of regulatory genes, end-point defence genes, to understand the signal transduction processes underlying disease resistance and its intimate links to other physiological pathways. Microarray technology can be used for in-depth, simultaneous profiling of host/pathogen genes as the disease progresses from infection to resistance/susceptibility at different developmental stages of the host, which can be done in different environments, for clearer understanding of the processes involved. A thorough knowledge of plant disease resistance using successful combination of microarray and other high throughput techniques, as well as biochemical, genetic, and cell biological experiments is needed for practical application to secure and stabilize yield of many crop plants. This review starts with a brief introduction to microarray technology, followed by the basics of plant-pathogen interaction, the use of DNA microarrays over the last decade to unravel the mysteries of plant-pathogen interaction, and ends with the future prospects of this technology.

  15. Development of a genotyping microarray for Usher syndrome.

    PubMed

    Cremers, Frans P M; Kimberling, William J; Külm, Maigi; de Brouwer, Arjan P; van Wijk, Erwin; te Brinke, Heleen; Cremers, Cor W R J; Hoefsloot, Lies H; Banfi, Sandro; Simonelli, Francesca; Fleischhauer, Johannes C; Berger, Wolfgang; Kelley, Phil M; Haralambous, Elene; Bitner-Glindzicz, Maria; Webster, Andrew R; Saihan, Zubin; De Baere, Elfride; Leroy, Bart P; Silvestri, Giuliana; McKay, Gareth J; Koenekoop, Robert K; Millan, Jose M; Rosenberg, Thomas; Joensuu, Tarja; Sankila, Eeva-Marja; Weil, Dominique; Weston, Mike D; Wissinger, Bernd; Kremer, Hannie

    2007-02-01

    Usher syndrome, a combination of retinitis pigmentosa (RP) and sensorineural hearing loss with or without vestibular dysfunction, displays a high degree of clinical and genetic heterogeneity. Three clinical subtypes can be distinguished, based on the age of onset and severity of the hearing impairment, and the presence or absence of vestibular abnormalities. Thus far, eight genes have been implicated in the syndrome, together comprising 347 protein-coding exons. To improve DNA diagnostics for patients with Usher syndrome, we developed a genotyping microarray based on the arrayed primer extension (APEX) method. Allele-specific oligonucleotides corresponding to all 298 Usher syndrome-associated sequence variants known to date, 76 of which are novel, were arrayed. Approximately half of these variants were validated using original patient DNAs, which yielded an accuracy of >98%. The efficiency of the Usher genotyping microarray was tested using DNAs from 370 unrelated European and American patients with Usher syndrome. Sequence variants were identified in 64/140 (46%) patients with Usher syndrome type I, 45/189 (24%) patients with Usher syndrome type II, 6/21 (29%) patients with Usher syndrome type III and 6/20 (30%) patients with atypical Usher syndrome. The chip also identified two novel sequence variants, c.400C>T (p.R134X) in PCDH15 and c.1606T>C (p.C536S) in USH2A. The Usher genotyping microarray is a versatile and affordable screening tool for Usher syndrome. Its efficiency will improve with the addition of novel sequence variants with minimal extra costs, making it a very useful first-pass screening tool.

  16. Development of a genotyping microarray for Usher syndrome

    PubMed Central

    Cremers, Frans P M; Kimberling, William J; Külm, Maigi; de Brouwer, Arjan P; van Wijk, Erwin; te Brinke, Heleen; Cremers, Cor W R J; Hoefsloot, Lies H; Banfi, Sandro; Simonelli, Francesca; Fleischhauer, Johannes C; Berger, Wolfgang; Kelley, Phil M; Haralambous, Elene; Bitner‐Glindzicz, Maria; Webster, Andrew R; Saihan, Zubin; De Baere, Elfride; Leroy, Bart P; Silvestri, Giuliana; McKay, Gareth J; Koenekoop, Robert K; Millan, Jose M; Rosenberg, Thomas; Joensuu, Tarja; Sankila, Eeva‐Marja; Weil, Dominique; Weston, Mike D; Wissinger, Bernd; Kremer, Hannie

    2007-01-01

    Background Usher syndrome, a combination of retinitis pigmentosa (RP) and sensorineural hearing loss with or without vestibular dysfunction, displays a high degree of clinical and genetic heterogeneity. Three clinical subtypes can be distinguished, based on the age of onset and severity of the hearing impairment, and the presence or absence of vestibular abnormalities. Thus far, eight genes have been implicated in the syndrome, together comprising 347 protein‐coding exons. Methods: To improve DNA diagnostics for patients with Usher syndrome, we developed a genotyping microarray based on the arrayed primer extension (APEX) method. Allele‐specific oligonucleotides corresponding to all 298 Usher syndrome‐associated sequence variants known to date, 76 of which are novel, were arrayed. Results Approximately half of these variants were validated using original patient DNAs, which yielded an accuracy of >98%. The efficiency of the Usher genotyping microarray was tested using DNAs from 370 unrelated European and American patients with Usher syndrome. Sequence variants were identified in 64/140 (46%) patients with Usher syndrome type I, 45/189 (24%) patients with Usher syndrome type II, 6/21 (29%) patients with Usher syndrome type III and 6/20 (30%) patients with atypical Usher syndrome. The chip also identified two novel sequence variants, c.400C>T (p.R134X) in PCDH15 and c.1606T>C (p.C536S) in USH2A. Conclusion The Usher genotyping microarray is a versatile and affordable screening tool for Usher syndrome. Its efficiency will improve with the addition of novel sequence variants with minimal extra costs, making it a very useful first‐pass screening tool. PMID:16963483

  17. Strategies for comparing gene expression profiles from different microarray platforms: application to a case-control experiment.

    PubMed

    Severgnini, Marco; Bicciato, Silvio; Mangano, Eleonora; Scarlatti, Francesca; Mezzelani, Alessandra; Mattioli, Michela; Ghidoni, Riccardo; Peano, Clelia; Bonnal, Raoul; Viti, Federica; Milanesi, Luciano; De Bellis, Gianluca; Battaglia, Cristina

    2006-06-01

    Meta-analysis of microarray data is increasingly important, considering both the availability of multiple platforms using disparate technologies and the accumulation in public repositories of data sets from different laboratories. We addressed the issue of comparing gene expression profiles from two microarray platforms by devising a standardized investigative strategy. We tested this procedure by studying MDA-MB-231 cells, which undergo apoptosis on treatment with resveratrol. Gene expression profiles were obtained using high-density, short-oligonucleotide, single-color microarray platforms: GeneChip (Affymetrix) and CodeLink (Amersham). Interplatform analyses were carried out on 8414 common transcripts represented on both platforms, as identified by LocusLink ID, representing 70.8% and 88.6% of annotated GeneChip and CodeLink features, respectively. We identified 105 differentially expressed genes (DEGs) on CodeLink and 42 DEGs on GeneChip. Among them, only 9 DEGs were commonly identified by both platforms. Multiple analyses (BLAST alignment of probes with target sequences, gene ontology, literature mining, and quantitative real-time PCR) permitted us to investigate the factors contributing to the generation of platform-dependent results in single-color microarray experiments. An effective approach to cross-platform comparison involves microarrays of similar technologies, samples prepared by identical methods, and a standardized battery of bioinformatic and statistical analyses.

  18. Global gene expression profiles of Phytophthora ramorum strain pr102 in response to plant host and tissue differentiation

    Treesearch

    Caroline M. Press; Niklaus J. Grunwald

    2008-01-01

    The release of the draft genome sequence of P. ramorum strain Pr102, enabled the construction of an oligonucleotide microarray of the entire genome of Pr102. The array contains 344,680 features (oligos) that represent the transcriptome of Pr102. P. ramorum RNA was extracted from mycelium and sporangia and used to compare gene...

  19. arrayCGHbase: an analysis platform for comparative genomic hybridization microarrays

    PubMed Central

    Menten, Björn; Pattyn, Filip; De Preter, Katleen; Robbrecht, Piet; Michels, Evi; Buysse, Karen; Mortier, Geert; De Paepe, Anne; van Vooren, Steven; Vermeesch, Joris; Moreau, Yves; De Moor, Bart; Vermeulen, Stefan; Speleman, Frank; Vandesompele, Jo

    2005-01-01

    Background The availability of the human genome sequence as well as the large number of physically accessible oligonucleotides, cDNA, and BAC clones across the entire genome has triggered and accelerated the use of several platforms for analysis of DNA copy number changes, amongst others microarray comparative genomic hybridization (arrayCGH). One of the challenges inherent to this new technology is the management and analysis of large numbers of data points generated in each individual experiment. Results We have developed arrayCGHbase, a comprehensive analysis platform for arrayCGH experiments consisting of a MIAME (Minimal Information About a Microarray Experiment) supportive database using MySQL underlying a data mining web tool, to store, analyze, interpret, compare, and visualize arrayCGH results in a uniform and user-friendly format. Following its flexible design, arrayCGHbase is compatible with all existing and forthcoming arrayCGH platforms. Data can be exported in a multitude of formats, including BED files to map copy number information on the genome using the Ensembl or UCSC genome browser. Conclusion ArrayCGHbase is a web based and platform independent arrayCGH data analysis tool, that allows users to access the analysis suite through the internet or a local intranet after installation on a private server. ArrayCGHbase is available at . PMID:15910681

  20. A general framework for optimization of probes for gene expression microarray and its application to the fungus Podospora anserina.

    PubMed

    Bidard, Frédérique; Imbeaud, Sandrine; Reymond, Nancie; Lespinet, Olivier; Silar, Philippe; Clavé, Corinne; Delacroix, Hervé; Berteaux-Lecellier, Véronique; Debuchy, Robert

    2010-06-18

    The development of new microarray technologies makes custom long oligonucleotide arrays affordable for many experimental applications, notably gene expression analyses. Reliable results depend on probe design quality and selection. Probe design strategy should cope with the limited accuracy of de novo gene prediction programs, and annotation up-dating. We present a novel in silico procedure which addresses these issues and includes experimental screening, as an empirical approach is the best strategy to identify optimal probes in the in silico outcome. We used four criteria for in silico probe selection: cross-hybridization, hairpin stability, probe location relative to coding sequence end and intron position. This latter criterion is critical when exon-intron gene structure predictions for intron-rich genes are inaccurate. For each coding sequence (CDS), we selected a sub-set of four probes. These probes were included in a test microarray, which was used to evaluate the hybridization behavior of each probe. The best probe for each CDS was selected according to three experimental criteria: signal-to-noise ratio, signal reproducibility, and representative signal intensities. This procedure was applied for the development of a gene expression Agilent platform for the filamentous fungus Podospora anserina and the selection of a single 60-mer probe for each of the 10,556 P. anserina CDS. A reliable gene expression microarray version based on the Agilent 44K platform was developed with four spot replicates of each probe to increase statistical significance of analysis.

  1. Molecular Biology and Prevention of Endometrial Cancer

    DTIC Science & Technology

    2009-07-01

    us time to complete the study. Aim 2: To analyze vaginal and cervical adenocarcinomas , that have arisen in women exposed to DES in- utero , for...therapy. Methods: 1) Oligonucleotide microarray analysis was performed on a panel of endometrial cancers. 2) A subset of adenocarcinoma cases...from the International DES Registry (IDESR) was analyzed for MSI 3) A case-control study of the CASH database was performed to evaluate the

  2. GermOnline 4.0 is a genomics gateway for germline development, meiosis and the mitotic cell cycle.

    PubMed

    Lardenois, Aurélie; Gattiker, Alexandre; Collin, Olivier; Chalmel, Frédéric; Primig, Michael

    2010-01-01

    GermOnline 4.0 is a cross-species database portal focusing on high-throughput expression data relevant for germline development, the meiotic cell cycle and mitosis in healthy versus malignant cells. It is thus a source of information for life scientists as well as clinicians who are interested in gene expression and regulatory networks. The GermOnline gateway provides unlimited access to information produced with high-density oligonucleotide microarrays (3'-UTR GeneChips), genome-wide protein-DNA binding assays and protein-protein interaction studies in the context of Ensembl genome annotation. Samples used to produce high-throughput expression data and to carry out genome-wide in vivo DNA binding assays are annotated via the MIAME-compliant Multiomics Information Management and Annotation System (MIMAS 3.0). Furthermore, the Saccharomyces Genomics Viewer (SGV) was developed and integrated into the gateway. SGV is a visualization tool that outputs genome annotation and DNA-strand specific expression data produced with high-density oligonucleotide tiling microarrays (Sc_tlg GeneChips) which cover the complete budding yeast genome on both DNA strands. It facilitates the interpretation of expression levels and transcript structures determined for various cell types cultured under different growth and differentiation conditions. Database URL: www.germonline.org/

  3. GermOnline 4.0 is a genomics gateway for germline development, meiosis and the mitotic cell cycle

    PubMed Central

    Lardenois, Aurélie; Gattiker, Alexandre; Collin, Olivier; Chalmel, Frédéric; Primig, Michael

    2010-01-01

    GermOnline 4.0 is a cross-species database portal focusing on high-throughput expression data relevant for germline development, the meiotic cell cycle and mitosis in healthy versus malignant cells. It is thus a source of information for life scientists as well as clinicians who are interested in gene expression and regulatory networks. The GermOnline gateway provides unlimited access to information produced with high-density oligonucleotide microarrays (3′-UTR GeneChips), genome-wide protein–DNA binding assays and protein–protein interaction studies in the context of Ensembl genome annotation. Samples used to produce high-throughput expression data and to carry out genome-wide in vivo DNA binding assays are annotated via the MIAME-compliant Multiomics Information Management and Annotation System (MIMAS 3.0). Furthermore, the Saccharomyces Genomics Viewer (SGV) was developed and integrated into the gateway. SGV is a visualization tool that outputs genome annotation and DNA-strand specific expression data produced with high-density oligonucleotide tiling microarrays (Sc_tlg GeneChips) which cover the complete budding yeast genome on both DNA strands. It facilitates the interpretation of expression levels and transcript structures determined for various cell types cultured under different growth and differentiation conditions. Database URL: www.germonline.org/ PMID:21149299

  4. Animal Viruses Probe dataset (AVPDS) for microarray-based diagnosis and identification of viruses.

    PubMed

    Yadav, Brijesh S; Pokhriyal, Mayank; Vasishtha, Dinesh P; Sharma, Bhaskar

    2014-03-01

    AVPDS (Animal Viruses Probe dataset) is a dataset of virus-specific and conserve oligonucleotides for identification and diagnosis of viruses infecting animals. The current dataset contain 20,619 virus specific probes for 833 viruses and their subtypes and 3,988 conserved probes for 146 viral genera. Dataset of virus specific probe has been divided into two fields namely virus name and probe sequence. Similarly conserved probes for virus genera table have genus, and subgroup within genus name and probe sequence. The subgroup within genus is artificially divided subgroups with no taxonomic significance and contains probes which identifies viruses in that specific subgroup of the genus. Using this dataset we have successfully diagnosed the first case of Newcastle disease virus in sheep and reported a mixed infection of Bovine viral diarrhea and Bovine herpesvirus in cattle. These dataset also contains probes which cross reacts across species experimentally though computationally they meet specifications. These probes have been marked. We hope that this dataset will be useful in microarray-based detection of viruses. The dataset can be accessed through the link https://dl.dropboxusercontent.com/u/94060831/avpds/HOME.html.

  5. Oligonucleotide DNA microarray profiling of lung adenocarcinoma revealed significant downregulation and deletions of vasoactive intestinal peptide receptor 1.

    PubMed

    Mlakar, Vid; Strazisar, Mojca; Sok, Mihael; Glavac, Damjan

    2010-06-01

    The purpose of this study was to find novel gene(s) involved in the development of lung adenocarcinoma (AD). Using DNA microarrays, we identified 31 up-regulated and 8 downregulated genes in 12 AD. Real time PCR was used to measure expression of VIPR1 and SPP1 mRNA and possible losses or gains of genes in 32 AD. We describe significant upregulation of the SPP1 gene, downregulation of VIPR1, and losses of the VIPR1 gene. Our findings complement a proposed VIPR1 tumor suppressor role, in which deletions in the 3p22 chromosome region are an important mechanism leading to loss of the VIPR1 gene.

  6. Oligonucleotide microarray analysis of gene expression profiles followed by real-time reverse-transcriptase polymerase chain reaction assay in chronic active Epstein-Barr virus infection.

    PubMed

    Ito, Yoshinori; Shibata-Watanabe, Yukiko; Ushijima, Yoko; Kawada, Jun-Ichi; Nishiyama, Yukihiro; Kojima, Seiji; Kimura, Hiroshi

    2008-03-01

    Chronic active Epstein-Barr virus infection (CAEBV) is characterized by recurrent infectious mononucleosis-like symptoms and has high mortality and morbidity. To clarify the mechanisms of CAEBV, the gene-expression profiles of peripheral blood obtained from patients with CAEBV were investigated. Twenty genes were differentially expressed in 4 patients with CAEBV. This microarray result was verified using a real-time reverse-transcriptase polymerase chain reaction assay in a larger group of patients with CAEBV. Eventually, 3 genes were found to be significantly upregulated: guanylate binding protein 1, tumor necrosis factor-induced protein 6, and guanylate binding protein 5. These genes may be associated with the inflammatory reaction or with cell proliferation.

  7. Microarray labeling extension values: laboratory signatures for Affymetrix GeneChips

    PubMed Central

    Lee, Yun-Shien; Chen, Chun-Houh; Tsai, Chi-Neu; Tsai, Chia-Lung; Chao, Angel; Wang, Tzu-Hao

    2009-01-01

    Interlaboratory comparison of microarray data, even when using the same platform, imposes several challenges to scientists. RNA quality, RNA labeling efficiency, hybridization procedures and data-mining tools can all contribute variations in each laboratory. In Affymetrix GeneChips, about 11–20 different 25-mer oligonucleotides are used to measure the level of each transcript. Here, we report that ‘labeling extension values (LEVs)’, which are correlation coefficients between probe intensities and probe positions, are highly correlated with the gene expression levels (GEVs) on eukayotic Affymetrix microarray data. By analyzing LEVs and GEVs in the publicly available 2414 cel files of 20 Affymetrix microarray types covering 13 species, we found that correlations between LEVs and GEVs only exist in eukaryotic RNAs, but not in prokaryotic ones. Surprisingly, Affymetrix results of the same specimens that were analyzed in different laboratories could be clearly differentiated only by LEVs, leading to the identification of ‘laboratory signatures’. In the examined dataset, GSE10797, filtering out high-LEV genes did not compromise the discovery of biological processes that are constructed by differentially expressed genes. In conclusion, LEVs provide a new filtering parameter for microarray analysis of gene expression and it may improve the inter- and intralaboratory comparability of Affymetrix GeneChips data. PMID:19295132

  8. Molecular classification of benign prostatic hyperplasia: A gene expression profiling study in a rat model.

    PubMed

    Hata, Junya; Satoh, Yuichi; Akaihata, Hidenori; Hiraki, Hiroyuki; Ogawa, Soichiro; Haga, Nobuhiro; Ishibashi, Kei; Aikawa, Ken; Kojima, Yoshiyuki

    2016-07-01

    To characterize the molecular features of benign prostatic hyperplasia by carrying out a gene expression profiling analysis in a rat model. Fetal urogenital sinus isolated from 20-day-old male rat embryo was implanted into a pubertal male rat ventral prostate. The implanted urogenital sinus grew time-dependently, and the pathological findings at 3 weeks after implantation showed epithelial hyperplasia as well as stromal hyperplasia. Whole-genome oligonucleotide microarray analysis utilizing approximately 30 000 oligonucleotide probes was carried out using prostate specimens during the prostate growth process (3 weeks after implantation). Microarray analyses showed 926 upregulated (>2-fold change, P < 0.01) and 3217 downregulated genes (<0.5-fold change, P < 0.01) in benign prostatic hyperplasia specimens compared with normal prostate. Gene ontology analyses of upregulated genes showed predominant genetic themes of involvement in development (162 genes, P = 2.01 × 10(-4) ), response to stimulus (163 genes, P = 7.37 × 10(-13) ) and growth (32 genes, P = 1.93 × 10(-5) ). When we used both normal prostate and non-transplanted urogenital sinuses as controls to identify benign prostatic hyperplasia-specific genes, 507 and 406 genes were upregulated and downregulated, respectively. Functional network and pathway analyses showed that genes associated with apoptosis modulation by heat shock protein 70, interleukin-1, interleukin-2 and interleukin-5 signaling pathways, KIT signaling pathway, and secretin-like G-protein-coupled receptors, class B, were relatively activated during the growth process in the benign prostatic hyperplasia specimens. In contrast, genes associated with cholesterol biosynthesis were relatively inactivated. Our microarray analyses of the benign prostatic hyperplasia model rat might aid in clarifying the molecular mechanism of benign prostatic hyperplasia progression, and identifying molecular targets for benign prostatic hyperplasia treatment. © 2016 The Japanese Urological Association.

  9. Genome-wide profiling of gene expression in the epididymis of alpha-chlorohydrin-induced infertile rats using an oligonucleotide microarray

    PubMed Central

    2010-01-01

    Background As one of the chlorinated antifertility compounds, alpha-chlorohydrin (ACH) can inhibit glyceraldehyde-3-phosphate dehydrogenase (G3PDH) activity in epididymal sperm and affect sperm energy metabolism, maturation and fertilization, eventually leading to male infertility. Further studies demonstrated that the inhibitory effect of ACH on G3PDH is not only confined to epididymal sperm but also to the epididymis. Moreover, little investigation on gene expression changes in the epididymis after ACH treatment has been conducted. Therefore, gene expression studies may indicate new epididymal targets related to sperm maturation and fertility through the analysis of ACH-treated infertile animals. Methods Rats were treated with ACH for ten consecutive days, and then each male rat copulated with two female rats in proestrus. Then sperm maturation and other fertility parameters were analyzed. Furthermore, we identified epididymal-specific genes that are associated with fertility between control and ACH groups using an Affymetrix Rat 230 2.0 oligo-microarray. Finally, we performed RT-PCR analysis for several differentially expressed genes to validate the alteration in gene expression observed by oligonucleotide microarray. Results Among all the differentially expressed genes, we analyzed and screened the down-regulated genes associated with metabolism processes, which are considered the major targets of ACH action. Simultaneously, the genes that were up-regulated by chlorohydrin were detected. The genes that negatively regulate sperm maturation and fertility include apoptosis and immune-related genes and have not been reported previously. The overall results of PCR analysis for selected genes were consistent with the array data. Conclusions In this study, we have described the genome-wide profiles of gene expression in the epididymides of infertile rats induced by ACH, which could become potential epididymal specific targets for male contraception and infertility treatment. PMID:20409345

  10. Genome-wide profiling of gene expression in the epididymis of alpha-chlorohydrin-induced infertile rats using an oligonucleotide microarray.

    PubMed

    Xie, Shuwu; Zhu, Yan; Ma, Li; Lu, Yingying; Zhou, Jieyun; Gui, Youlun; Cao, Lin

    2010-04-22

    As one of the chlorinated antifertility compounds, alpha-chlorohydrin (ACH) can inhibit glyceraldehyde-3-phosphate dehydrogenase (G3PDH) activity in epididymal sperm and affect sperm energy metabolism, maturation and fertilization, eventually leading to male infertility. Further studies demonstrated that the inhibitory effect of ACH on G3PDH is not only confined to epididymal sperm but also to the epididymis. Moreover, little investigation on gene expression changes in the epididymis after ACH treatment has been conducted. Therefore, gene expression studies may indicate new epididymal targets related to sperm maturation and fertility through the analysis of ACH-treated infertile animals. Rats were treated with ACH for ten consecutive days, and then each male rat copulated with two female rats in proestrus. Then sperm maturation and other fertility parameters were analyzed. Furthermore, we identified epididymal-specific genes that are associated with fertility between control and ACH groups using an Affymetrix Rat 230 2.0 oligo-microarray. Finally, we performed RT-PCR analysis for several differentially expressed genes to validate the alteration in gene expression observed by oligonucleotide microarray. Among all the differentially expressed genes, we analyzed and screened the down-regulated genes associated with metabolism processes, which are considered the major targets of ACH action. Simultaneously, the genes that were up-regulated by chlorohydrin were detected. The genes that negatively regulate sperm maturation and fertility include apoptosis and immune-related genes and have not been reported previously. The overall results of PCR analysis for selected genes were consistent with the array data. In this study, we have described the genome-wide profiles of gene expression in the epididymides of infertile rats induced by ACH, which could become potential epididymal specific targets for male contraception and infertility treatment.

  11. Open-target sparse sensing of biological agents using DNA microarray

    PubMed Central

    2011-01-01

    Background Current biosensors are designed to target and react to specific nucleic acid sequences or structural epitopes. These 'target-specific' platforms require creation of new physical capture reagents when new organisms are targeted. An 'open-target' approach to DNA microarray biosensing is proposed and substantiated using laboratory generated data. The microarray consisted of 12,900 25 bp oligonucleotide capture probes derived from a statistical model trained on randomly selected genomic segments of pathogenic prokaryotic organisms. Open-target detection of organisms was accomplished using a reference library of hybridization patterns for three test organisms whose DNA sequences were not included in the design of the microarray probes. Results A multivariate mathematical model based on the partial least squares regression (PLSR) was developed to detect the presence of three test organisms in mixed samples. When all 12,900 probes were used, the model correctly detected the signature of three test organisms in all mixed samples (mean(R2)) = 0.76, CI = 0.95), with a 6% false positive rate. A sampling algorithm was then developed to sparsely sample the probe space for a minimal number of probes required to capture the hybridization imprints of the test organisms. The PLSR detection model was capable of correctly identifying the presence of the three test organisms in all mixed samples using only 47 probes (mean(R2)) = 0.77, CI = 0.95) with nearly 100% specificity. Conclusions We conceived an 'open-target' approach to biosensing, and hypothesized that a relatively small, non-specifically designed, DNA microarray is capable of identifying the presence of multiple organisms in mixed samples. Coupled with a mathematical model applied to laboratory generated data, and sparse sampling of capture probes, the prototype microarray platform was able to capture the signature of each organism in all mixed samples with high sensitivity and specificity. It was demonstrated that this new approach to biosensing closely follows the principles of sparse sensing. PMID:21801424

  12. Assessment of a direct hybridization microarray strategy for comprehensive monitoring of genetically modified organisms (GMOs).

    PubMed

    Turkec, Aydin; Lucas, Stuart J; Karacanli, Burçin; Baykut, Aykut; Yuksel, Hakki

    2016-03-01

    Detection of GMO material in crop and food samples is the primary step in GMO monitoring and regulation, with the increasing number of GM events in the world market requiring detection solutions with high multiplexing capacity. In this study, we test the suitability of a high-density oligonucleotide microarray platform for direct, quantitative detection of GMOs found in the Turkish feed market. We tested 1830 different 60nt probes designed to cover the GM cassettes from 12 different GM cultivars (3 soya, 9 maize), as well as plant species-specific and contamination controls, and developed a data analysis method aiming to provide maximum throughput and sensitivity. The system was able specifically to identify each cultivar, and in 10/12 cases was sensitive enough to detect GMO DNA at concentrations of ⩽1%. These GMOs could also be quantified using the microarray, as their fluorescence signals increased linearly with GMO concentration. Copyright © 2015 Elsevier Ltd. All rights reserved.

  13. High density DNA loading on the M13 bacteriophage provides access to colorimetric and fluorescent protein microarray biosensors.

    PubMed

    Domaille, Dylan W; Lee, Ju Hun; Cha, Jennifer N

    2013-02-28

    We report the synthesis, characterization, and protein sensing capabilities of M13 bacteriophage-DNA bioconjugates. DNA oligonucleotides were conjugated to M13 through acyl hydrazone linkages. In one case, DNAzymes retained their catalytic ability when anchored to the virus coat, and in a separate study, the dynamic nature of the hydrazone allowed for liberation of DNA from the phage under mild conditions.

  14. A general framework for optimization of probes for gene expression microarray and its application to the fungus Podospora anserina

    PubMed Central

    2010-01-01

    Background The development of new microarray technologies makes custom long oligonucleotide arrays affordable for many experimental applications, notably gene expression analyses. Reliable results depend on probe design quality and selection. Probe design strategy should cope with the limited accuracy of de novo gene prediction programs, and annotation up-dating. We present a novel in silico procedure which addresses these issues and includes experimental screening, as an empirical approach is the best strategy to identify optimal probes in the in silico outcome. Findings We used four criteria for in silico probe selection: cross-hybridization, hairpin stability, probe location relative to coding sequence end and intron position. This latter criterion is critical when exon-intron gene structure predictions for intron-rich genes are inaccurate. For each coding sequence (CDS), we selected a sub-set of four probes. These probes were included in a test microarray, which was used to evaluate the hybridization behavior of each probe. The best probe for each CDS was selected according to three experimental criteria: signal-to-noise ratio, signal reproducibility, and representative signal intensities. This procedure was applied for the development of a gene expression Agilent platform for the filamentous fungus Podospora anserina and the selection of a single 60-mer probe for each of the 10,556 P. anserina CDS. Conclusions A reliable gene expression microarray version based on the Agilent 44K platform was developed with four spot replicates of each probe to increase statistical significance of analysis. PMID:20565839

  15. A novel 4p16.3 microduplication distal to WHSC1 and WHSC2 characterized by oligonucleotide array with new phenotypic features.

    PubMed

    Cyr, Andrew B; Nimmakayalu, Manjunath; Longmuir, Susannah Q; Patil, Shivanand R; Keppler-Noreuil, Kim M; Shchelochkov, Oleg A

    2011-09-01

    Larger imbalances on chromosome 4p in the form of deletions associated with Wolf-Hirschhorn syndrome (WHS) and duplications of chromosome 4p have a defined clinical phenotype. The critical region for both these clinical disorders has been narrowed based on the genotype-phenotype correlations. However, cryptic rearrangements in this region have been reported infrequently. We report on a male patient with a microduplication of chromosome 4p, who presents with findings of macrocephaly, irregular iris pigmentation-heterochromia, and preserved linear growth in addition to overlapping features of trisomy 4p such as seizures, delayed psychomotor development, and dysmorphic features including prominent glabella, low-set ears, and short neck. Using a high-density oligonucleotide microarray, we have identified a novel submicroscopic duplication involving dosage sensitive genes TACC3, FGFR3, and LETM1. The microduplication did not involve WHSC1 and WHSC2 which are considered in the critical region for WHS and trisomy 4p. This patient's presentation and genomic findings help further delineate clinical significance of re-arrangements in the 4p16 region without the involvement of WHS critical region. Copyright © 2011 Wiley-Liss, Inc.

  16. Single molecule fluorescence microscopy for ultra-sensitive RNA expression profiling

    NASA Astrophysics Data System (ADS)

    Hesse, Jan; Jacak, Jaroslaw; Regl, Gerhard; Eichberger, Thomas; Aberger, Fritz; Schlapak, Robert; Howorka, Stefan; Muresan, Leila; Frischauf, Anna-Maria; Schütz, Gerhard J.

    2007-02-01

    We developed a microarray analysis platform for ultra-sensitive RNA expression profiling of minute samples. It utilizes a novel scanning system for single molecule fluorescence detection on cm2 size samples in combination with specialized biochips, optimized for low autofluorescence and weak unspecific adsorption. 20 μg total RNA was extracted from 10 6 cells of a human keratinocyte cell line (HaCaT) and reversely transcribed in the presence of Alexa647-aha-dUTP. 1% of the resulting labeled cDNA was used for complex hybridization to a custom-made oligonucleotide microarray representing a set of 125 different genes. For low abundant genes, individual cDNA molecules hybridized to the microarray spots could be resolved. Single cDNA molecules hybridized to the chip surface appeared as diffraction limited features in the fluorescence images. The à trous wavelet method was utilized for localization and counting of the separated cDNA signals. Subsequently, the degree of labeling of the localized cDNA molecules was determined by brightness analysis for the different genes. Variations by factors up to 6 were found, which in conventional microarray analysis would result in a misrepresentation of the relative abundance of mRNAs.

  17. Development and Use of Integrated Microarray-Based Genomic Technologies for Assessing Microbial Community Composition and Dynamics

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhou, J.; Wu, L.; Gentry, T.

    2006-04-05

    To effectively monitor microbial populations involved in various important processes, a 50-mer-based oligonucleotide microarray was developed based on known genes and pathways involved in: biodegradation, metal resistance and reduction, denitrification, nitrification, nitrogen fixation, methane oxidation, methanogenesis, carbon polymer decomposition, and sulfate reduction. This array contains approximately 2000 unique and group-specific probes with <85% similarity to their non-target sequences. Based on artificial probes, our results showed that at hybridization conditions of 50 C and 50% formamide, the 50-mer microarray hybridization can differentiate sequences having <88% similarity. Specificity tests with representative pure cultures indicated that the designed probes on the arrays appearedmore » to be specific to their corresponding target genes. Detection limits were about 5-10ng genomic DNA in the absence of background DNA, and 50-100ng ({approx}1.3{sup o} 10{sup 7} cells) in the presence background DNA. Strong linear relationships between signal intensity and target DNA and RNA concentration were observed (r{sup 2} = 0.95-0.99). Application of this microarray to naphthalene-amended enrichments and soil microcosms demonstrated that composition of the microflora varied depending on incubation conditions. While the naphthalene-degrading genes from Rhodococcus-type microorganisms were dominant in enrichments, the genes involved in naphthalene degradation from Gram-negative microorganisms such as Ralstonia, Comamonas, and Burkholderia were most abundant in the soil microcosms (as well as those for polyaromatic hydrocarbon and nitrotoluene degradation). Although naphthalene degradation is widely known and studied in Pseudomonas, Pseudomonas genes were not detected in either system. Real-time PCR analysis of 4 representative genes was consistent with microarray-based quantification (r{sup 2} = 0.95). Currently, we are also applying this microarray to the study of several different microbial communities and processes at the NABIR-FRC in Oak Ridge, TN. One project involves the monitoring of the development and dynamics of the microbial community of a fluidized bed reactor (FBR) used for reducing nitrate and the other project monitors microbial community responses to stimulation of uranium reducing populations via ethanol donor additions in situ and in a model system. Additionally, we are developing novel strategies for increasing microarray hybridization sensitivity. Finally, great improvements to our methods of probe design were made by the development of a new computer program, CommOligo. CommOligo designs unique and group-specific oligo probes for whole-genomes, metagenomes, and groups of environmental sequences and uses a new global alignment algorithm to design single or multiple probes for each gene or group. We are now using this program to design a more comprehensive functional gene array for environmental studies. Overall, our results indicate that the 50mer-based microarray technology has potential as a specific and quantitative tool to reveal the composition of microbial communities and their dynamics important to processes within contaminated environments.« less

  18. Transcriptome analysis of salinity stress responses in common wheat using a 22k oligo-DNA microarray.

    PubMed

    Kawaura, Kanako; Mochida, Keiichi; Yamazaki, Yukiko; Ogihara, Yasunari

    2006-04-01

    In this study, we constructed a 22k wheat oligo-DNA microarray. A total of 148,676 expressed sequence tags of common wheat were collected from the database of the Wheat Genomics Consortium of Japan. These were grouped into 34,064 contigs, which were then used to design an oligonucleotide DNA microarray. Following a multistep selection of the sense strand, 21,939 60-mer oligo-DNA probes were selected for attachment on the microarray slide. This 22k oligo-DNA microarray was used to examine the transcriptional response of wheat to salt stress. More than 95% of the probes gave reproducible hybridization signals when targeted with RNAs extracted from salt-treated wheat shoots and roots. With the microarray, we identified 1,811 genes whose expressions changed more than 2-fold in response to salt. These included genes known to mediate response to salt, as well as unknown genes, and they were classified into 12 major groups by hierarchical clustering. These gene expression patterns were also confirmed by real-time reverse transcription-PCR. Many of the genes with unknown function were clustered together with genes known to be involved in response to salt stress. Thus, analysis of gene expression patterns combined with gene ontology should help identify the function of the unknown genes. Also, functional analysis of these wheat genes should provide new insight into the response to salt stress. Finally, these results indicate that the 22k oligo-DNA microarray is a reliable method for monitoring global gene expression patterns in wheat.

  19. Engineering Improvements in a Bacterial Therapeutic Delivery System for Breast Cancer

    DTIC Science & Technology

    2009-09-01

    curve is observed on the other platform (Supplementary Figure 2H). Although it is not the object of this article to explore a physical explanation for...light-directed oligonucleotide microarrays using a digital micromirror array.. Nat Biotechnol, 17(10), 974–978. [12] Matveeva, O. V., Shabalina, S. A...Rouillard, J. M., Whittam, T. S., Gulari, E., Tiedje, J. M., and Hashsham, S. A. (2006) On- chip non-equilibrium dissociation curves and dissociation

  20. Single-feature polymorphism discovery in the barley transcriptome

    PubMed Central

    Rostoks, Nils; Borevitz, Justin O; Hedley, Peter E; Russell, Joanne; Mudie, Sharon; Morris, Jenny; Cardle, Linda; Marshall, David F; Waugh, Robbie

    2005-01-01

    A probe-level model for analysis of GeneChip gene-expression data is presented which identified more than 10,000 single-feature polymorphisms (SFP) between two barley genotypes. The method has good sensitivity, as 67% of known single-nucleotide polymorphisms (SNP) were called as SFPs. This method is applicable to all oligonucleotide microarray data, accounts for SNP effects in gene-expression data and represents an efficient and versatile approach for highly parallel marker identification in large genomes. PMID:15960806

  1. Multiple primer extension by DNA polymerase on a novel plastic DNA array coated with a biocompatible polymer

    PubMed Central

    Kinoshita, Kenji; Fujimoto, Kentaro; Yakabe, Toru; Saito, Shin; Hamaguchi, Yuzo; Kikuchi, Takayuki; Nonaka, Ken; Murata, Shigenori; Masuda, Daisuke; Takada, Wataru; Funaoka, Sohei; Arai, Susumu; Nakanishi, Hisao; Yokoyama, Kanehisa; Fujiwara, Kazuhiko; Matsubara, Kenichi

    2007-01-01

    DNA microarrays are routinely used to monitor gene expression profiling and single nucleotide polymorphisms (SNPs). However, for practically useful high performance, the detection sensitivity is still not adequate, leaving low expression genes undetected. To resolve this issue, we have developed a new plastic S-BIO® PrimeSurface® with a biocompatible polymer; its surface chemistry offers an extraordinarily stable thermal property for a lack of pre-activated glass slide surface. The oligonucleotides immobilized on this substrate are robust in boiling water and show no significant loss of hybridization activity during dissociation treatment. This allowed us to hybridize the templates, extend the 3′ end of the immobilized DNA primers on the S-Bio® by DNA polymerase using deoxynucleotidyl triphosphates (dNTP) as extender units, release the templates by denaturalization and use the same templates for a second round of reactions similar to that of the PCR method. By repeating this cycle, the picomolar concentration range of the template oligonucleotide can be detected as stable signals via the incorporation of labeled dUTP into primers. This method of Multiple Primer EXtension (MPEX) could be further extended as an alternative route for producing DNA microarrays for SNP analyses via simple template preparation such as reverse transcript cDNA or restriction enzyme treatment of genome DNA. PMID:17135189

  2. Remediation of petroleum hydrocarbon-contaminated sites by DNA diagnosis-based bioslurping technology.

    PubMed

    Kim, Seungjin; Krajmalnik-Brown, Rosa; Kim, Jong-Oh; Chung, Jinwook

    2014-11-01

    The application of effective remediation technologies can benefit from adequate preliminary testing, such as in lab-scale and Pilot-scale systems. Bioremediation technologies have demonstrated tremendous potential with regards to cost, but they cannot be used for all contaminated sites due to limitations in biological activity. The purpose of this study was to develop a DNA diagnostic method that reduces the time to select contaminated sites that are good candidates for bioremediation. We applied an oligonucleotide microarray method to detect and monitor genes that lead to aliphatic and aromatic degradation. Further, the bioremediation of a contaminated site, selected based on the results of the genetic diagnostic method, was achieved successfully by applying bioslurping in field tests. This gene-based diagnostic technique is a powerful tool to evaluate the potential for bioremediation in petroleum hydrocarbon contaminated soil. Copyright © 2014 Elsevier B.V. All rights reserved.

  3. Parallel characterization of anaerobic toluene- and ethylbenzene-degrading microbial consortia by PCR-denaturing gradient gel electrophoresis, RNA-DNA membrane hybridization, and DNA microarray technology

    NASA Technical Reports Server (NTRS)

    Koizumi, Yoshikazu; Kelly, John J.; Nakagawa, Tatsunori; Urakawa, Hidetoshi; El-Fantroussi, Said; Al-Muzaini, Saleh; Fukui, Manabu; Urushigawa, Yoshikuni; Stahl, David A.

    2002-01-01

    A mesophilic toluene-degrading consortium (TDC) and an ethylbenzene-degrading consortium (EDC) were established under sulfate-reducing conditions. These consortia were first characterized by denaturing gradient gel electrophoresis (DGGE) fingerprinting of PCR-amplified 16S rRNA gene fragments, followed by sequencing. The sequences of the major bands (T-1 and E-2) belonging to TDC and EDC, respectively, were affiliated with the family Desulfobacteriaceae. Another major band from EDC (E-1) was related to an uncultured non-sulfate-reducing soil bacterium. Oligonucleotide probes specific for the 16S rRNAs of target organisms corresponding to T-1, E-1, and E-2 were designed, and hybridization conditions were optimized for two analytical formats, membrane and DNA microarray hybridization. Both formats were used to characterize the TDC and EDC, and the results of both were consistent with DGGE analysis. In order to assess the utility of the microarray format for analysis of environmental samples, oil-contaminated sediments from the coast of Kuwait were analyzed. The DNA microarray successfully detected bacterial nucleic acids from these samples, but probes targeting specific groups of sulfate-reducing bacteria did not give positive signals. The results of this study demonstrate the limitations and the potential utility of DNA microarrays for microbial community analysis.

  4. Parallel Characterization of Anaerobic Toluene- and Ethylbenzene-Degrading Microbial Consortia by PCR-Denaturing Gradient Gel Electrophoresis, RNA-DNA Membrane Hybridization, and DNA Microarray Technology

    PubMed Central

    Koizumi, Yoshikazu; Kelly, John J.; Nakagawa, Tatsunori; Urakawa, Hidetoshi; El-Fantroussi, Saïd; Al-Muzaini, Saleh; Fukui, Manabu; Urushigawa, Yoshikuni; Stahl, David A.

    2002-01-01

    A mesophilic toluene-degrading consortium (TDC) and an ethylbenzene-degrading consortium (EDC) were established under sulfate-reducing conditions. These consortia were first characterized by denaturing gradient gel electrophoresis (DGGE) fingerprinting of PCR-amplified 16S rRNA gene fragments, followed by sequencing. The sequences of the major bands (T-1 and E-2) belonging to TDC and EDC, respectively, were affiliated with the family Desulfobacteriaceae. Another major band from EDC (E-1) was related to an uncultured non-sulfate-reducing soil bacterium. Oligonucleotide probes specific for the 16S rRNAs of target organisms corresponding to T-1, E-1, and E-2 were designed, and hybridization conditions were optimized for two analytical formats, membrane and DNA microarray hybridization. Both formats were used to characterize the TDC and EDC, and the results of both were consistent with DGGE analysis. In order to assess the utility of the microarray format for analysis of environmental samples, oil-contaminated sediments from the coast of Kuwait were analyzed. The DNA microarray successfully detected bacterial nucleic acids from these samples, but probes targeting specific groups of sulfate-reducing bacteria did not give positive signals. The results of this study demonstrate the limitations and the potential utility of DNA microarrays for microbial community analysis. PMID:12088997

  5. Assessing differential gene expression with small sample sizes in oligonucleotide arrays using a mean-variance model.

    PubMed

    Hu, Jianhua; Wright, Fred A

    2007-03-01

    The identification of the genes that are differentially expressed in two-sample microarray experiments remains a difficult problem when the number of arrays is very small. We discuss the implications of using ordinary t-statistics and examine other commonly used variants. For oligonucleotide arrays with multiple probes per gene, we introduce a simple model relating the mean and variance of expression, possibly with gene-specific random effects. Parameter estimates from the model have natural shrinkage properties that guard against inappropriately small variance estimates, and the model is used to obtain a differential expression statistic. A limiting value to the positive false discovery rate (pFDR) for ordinary t-tests provides motivation for our use of the data structure to improve variance estimates. Our approach performs well compared to other proposed approaches in terms of the false discovery rate.

  6. Androgen Metabolism in Progression to Androgen-Independent Prostate Cancer

    DTIC Science & Technology

    2009-06-01

    transcripts (TMPRSS2 exon 2-ERG exon 4) in 11 of 29 cases. Affymetrix oligonucleotide microarray data on these tumors versus a group of 27...medium were treated with DHT and immunoblotted. B, RT-PCR for ERG ( exon 9/10), TMPRSS2 ( exon 5/6), and PSA mRNA after DHT stimulation. C, cells in...therapeutic index CYP3A4 substrates were excluded. The treatment was ketoconazole 400 mg po TID, hydrocortisone (30 mg in AM and 10 mg in PM) and

  7. UniPROBE, update 2011: expanded content and search tools in the online database of protein-binding microarray data on protein-DNA interactions.

    PubMed

    Robasky, Kimberly; Bulyk, Martha L

    2011-01-01

    The Universal PBM Resource for Oligonucleotide-Binding Evaluation (UniPROBE) database is a centralized repository of information on the DNA-binding preferences of proteins as determined by universal protein-binding microarray (PBM) technology. Each entry for a protein (or protein complex) in UniPROBE provides the quantitative preferences for all possible nucleotide sequence variants ('words') of length k ('k-mers'), as well as position weight matrix (PWM) and graphical sequence logo representations of the k-mer data. In this update, we describe >130% expansion of the database content, incorporation of a protein BLAST (blastp) tool for finding protein sequence matches in UniPROBE, the introduction of UniPROBE accession numbers and additional database enhancements. The UniPROBE database is available at http://uniprobe.org.

  8. DNA Microarray for Detection of Macrolide Resistance Genes

    PubMed Central

    Cassone, Marco; D'Andrea, Marco M.; Iannelli, Francesco; Oggioni, Marco R.; Rossolini, Gian Maria; Pozzi, Gianni

    2006-01-01

    A DNA microarray was developed to detect bacterial genes conferring resistance to macrolides and related antibiotics. A database containing 65 nonredundant genes selected from publicly available DNA sequences was constructed and used to design 100 oligonucleotide probes that could specifically detect and discriminate all 65 genes. Probes were spotted on a glass slide, and the array was reacted with DNA templates extracted from 20 reference strains of eight different bacterial species (Streptococcus pneumoniae, Streptococcus pyogenes, Enterococcus faecalis, Enterococcus faecium, Staphylococcus aureus, Staphylococcus haemolyticus, Escherichia coli, and Bacteroides fragilis) known to harbor 29 different macrolide resistance genes. Hybridization results showed that probes reacted with, and only with, the expected DNA templates and allowed discovery of three unexpected genes, including msr(SA) in B. fragilis, an efflux gene that has not yet been described for gram-negative bacteria. PMID:16723563

  9. Characterization of Antimicrobial Resistance Patterns and Detection of Virulence Genes in Campylobacter Isolates in Italy

    PubMed Central

    Di Giannatale, Elisabetta; Di Serafino, Gabriella; Zilli, Katiuscia; Alessiani, Alessandra; Sacchini, Lorena; Garofolo, Giuliano; Aprea, Giuseppe; Marotta, Francesca

    2014-01-01

    Campylobacter has developed resistance to several antimicrobial agents over the years, including macrolides, quinolones and fluoroquinolones, becoming a significant public health hazard. A total of 145 strains derived from raw milk, chicken faeces, chicken carcasses, cattle faeces and human faeces collected from various Italian regions, were screened for antimicrobial susceptibility, molecular characterization (SmaI pulsed-field gel electrophoresis) and detection of virulence genes (sequencing and DNA microarray analysis). The prevalence of C. jejuni and C. coli was 62.75% and 37.24% respectively. Antimicrobial susceptibility revealed a high level of resistance for ciprofloxacin (62.76%), tetracycline (55.86%) and nalidixic acid (55.17%). Genotyping of Campylobacter isolates using PFGE revealed a total of 86 unique SmaI patterns. Virulence gene profiles were determined using a new microbial diagnostic microarray composed of 70-mer oligonucleotide probes targeting genes implicated in Campylobacter pathogenicity. Correspondence between PFGE and microarray clusters was observed. Comparisons of PFGE and virulence profiles reflected the high genetic diversity of the strains examined, leading us to speculate different degrees of pathogenicity inside Campylobacter populations. PMID:24556669

  10. Characterization of antimicrobial resistance patterns and detection of virulence genes in Campylobacter isolates in Italy.

    PubMed

    Di Giannatale, Elisabetta; Di Serafino, Gabriella; Zilli, Katiuscia; Alessiani, Alessandra; Sacchini, Lorena; Garofolo, Giuliano; Aprea, Giuseppe; Marotta, Francesca

    2014-02-19

    Campylobacter has developed resistance to several antimicrobial agents over the years, including macrolides, quinolones and fluoroquinolones, becoming a significant public health hazard. A total of 145 strains derived from raw milk, chicken faeces, chicken carcasses, cattle faeces and human faeces collected from various Italian regions, were screened for antimicrobial susceptibility, molecular characterization (SmaI pulsed-field gel electrophoresis) and detection of virulence genes (sequencing and DNA microarray analysis). The prevalence of C. jejuni and C. coli was 62.75% and 37.24% respectively. Antimicrobial susceptibility revealed a high level of resistance for ciprofloxacin (62.76%), tetracycline (55.86%) and nalidixic acid (55.17%). Genotyping of Campylobacter isolates using PFGE revealed a total of 86 unique SmaI patterns. Virulence gene profiles were determined using a new microbial diagnostic microarray composed of 70-mer oligonucleotide probes targeting genes implicated in Campylobacter pathogenicity. Correspondence between PFGE and microarray clusters was observed. Comparisons of PFGE and virulence profiles reflected the high genetic diversity of the strains examined, leading us to speculate different degrees of pathogenicity inside Campylobacter populations.

  11. The GermOnline cross-species systems browser provides comprehensive information on genes and gene products relevant for sexual reproduction.

    PubMed

    Gattiker, Alexandre; Niederhauser-Wiederkehr, Christa; Moore, James; Hermida, Leandro; Primig, Michael

    2007-01-01

    We report a novel release of the GermOnline knowledgebase covering genes relevant for the cell cycle, gametogenesis and fertility. GermOnline was extended into a cross-species systems browser including information on DNA sequence annotation, gene expression and the function of gene products. The database covers eight model organisms and Homo sapiens, for which complete genome annotation data are available. The database is now built around a sophisticated genome browser (Ensembl), our own microarray information management and annotation system (MIMAS) used to extensively describe experimental data obtained with high-density oligonucleotide microarrays (GeneChips) and a comprehensive system for online editing of database entries (MediaWiki). The RNA data include results from classical microarrays as well as tiling arrays that yield information on RNA expression levels, transcript start sites and lengths as well as exon composition. Members of the research community are solicited to help GermOnline curators keep database entries on genes and gene products complete and accurate. The database is accessible at http://www.germonline.org/.

  12. Genome-wide polymorphisms and development of a microarray platform to detect genetic variations in Plasmodium yoelii.

    PubMed

    Nair, Sethu C; Pattaradilokrat, Sittiporn; Zilversmit, Martine M; Dommer, Jennifer; Nagarajan, Vijayaraj; Stephens, Melissa T; Xiao, Wenming; Tan, John C; Su, Xin-Zhuan

    2014-01-01

    The rodent malaria parasite Plasmodium yoelii is an important model for studying malaria immunity and pathogenesis. One approach for studying malaria disease phenotypes is genetic mapping, which requires typing a large number of genetic markers from multiple parasite strains and/or progeny from genetic crosses. Hundreds of microsatellite (MS) markers have been developed to genotype the P. yoelii genome; however, typing a large number of MS markers can be labor intensive, time consuming, and expensive. Thus, development of high-throughput genotyping tools such as DNA microarrays that enable rapid and accurate large-scale genotyping of the malaria parasite will be highly desirable. In this study, we sequenced the genomes of two P. yoelii strains (33X and N67) and obtained a large number of single nucleotide polymorphisms (SNPs). Based on the SNPs obtained, we designed sets of oligonucleotide probes to develop a microarray that could interrogate ∼11,000 SNPs across the 14 chromosomes of the parasite in a single hybridization. Results from hybridizations of DNA samples of five P. yoelii strains or cloned lines (17XNL, YM, 33X, N67 and N67C) and two progeny from a genetic cross (N67×17XNL) to the microarray showed that the array had a high call rate (∼97%) and accuracy (99.9%) in calling SNPs, providing a simple and reliable tool for typing the P. yoelii genome. Our data show that the P. yoelii genome is highly polymorphic, although isogenic pairs of parasites were also detected. Additionally, our results indicate that the 33X parasite is a progeny of 17XNL (or YM) and an unknown parasite. The highly accurate and reliable microarray developed in this study will greatly facilitate our ability to study the genetic basis of important traits and the disease it causes. Published by Elsevier B.V.

  13. ChIP-chip.

    PubMed

    Kim, Tae Hoon; Dekker, Job

    2018-05-01

    ChIP-chip can be used to analyze protein-DNA interactions in a region-wide and genome-wide manner. DNA microarrays contain PCR products or oligonucleotide probes that are designed to represent genomic sequences. Identification of genomic sites that interact with a specific protein is based on competitive hybridization of the ChIP-enriched DNA and the input DNA to DNA microarrays. The ChIP-chip protocol can be divided into two main sections: Amplification of ChIP DNA and hybridization of ChIP DNA to arrays. A large amount of DNA is required to hybridize to DNA arrays, and hybridization to a set of multiple commercial arrays that represent the entire human genome requires two rounds of PCR amplifications. The relative hybridization intensity of ChIP DNA and that of the input DNA is used to determine whether the probe sequence is a potential site of protein-DNA interaction. Resolution of actual genomic sites bound by the protein is dependent on the size of the chromatin and on the genomic distance between the probes on the array. As with expression profiling using gene chips, ChIP-chip experiments require multiple replicates for reliable statistical measure of protein-DNA interactions. © 2018 Cold Spring Harbor Laboratory Press.

  14. Microarray-based determination of anti-inflammatory genes targeted by 6-(methylsulfinyl)hexyl isothiocyanate in macrophages.

    PubMed

    Chen, Jihua; Uto, Takuhiro; Tanigawa, Shunsuke; Yamada-Kato, Tomeo; Fujii, Makoto; Hou, DE-Xing

    2010-01-01

    6-(Methylsulfinyl)hexyl isothiocyanate (6-MSITC) is a bioactive ingredient of wasabi [Wasabia japonica (Miq.) Matsumura], which is a popular pungent spice of Japan. To evaluate the anti-inflammatory function and underlying genes targeted by 6-MSITC, gene expression profiling through DNA microarray was performed in mouse macrophages. Among 22,050 oligonucleotides, the expression levels of 406 genes were increased by ≥3-fold in lipopolysaccharide (LPS)-activated RAW264 cells, 238 gene signals of which were attenuated by 6-MSITC (≥2-fold). Expression levels of 717 genes were decreased by ≥3-fold in LPS-activated cells, of which 336 gene signals were restored by 6-MSITC (≥2-fold). Utilizing group analysis, 206 genes affected by 6-MSITC with a ≥2-fold change were classified into 35 categories relating to biological processes (81), molecular functions (108) and signaling pathways (17). The genes were further categorized as 'defense, inflammatory response, cytokine activities and receptor activities' and some were confirmed by real-time polymerase chain reaction. Ingenuity pathway analysis further revealed that wasabi 6-MSITC regulated the relevant networks of chemokines, interleukins and interferons to exert its anti-inflammatory function.

  15. Microarray-based determination of anti-inflammatory genes targeted by 6-(methylsulfinyl)hexyl isothiocyanate in macrophages

    PubMed Central

    CHEN, JIHUA; UTO, TAKUHIRO; TANIGAWA, SHUNSUKE; YAMADA-KATO, TOMEO; FUJII, MAKOTO; HOU, DE-XING

    2010-01-01

    6-(Methylsulfinyl)hexyl isothiocyanate (6-MSITC) is a bioactive ingredient of wasabi [Wasabia japonica (Miq.) Matsumura], which is a popular pungent spice of Japan. To evaluate the anti-inflammatory function and underlying genes targeted by 6-MSITC, gene expression profiling through DNA microarray was performed in mouse macrophages. Among 22,050 oligonucleotides, the expression levels of 406 genes were increased by ≥3-fold in lipopolysaccharide (LPS)-activated RAW264 cells, 238 gene signals of which were attenuated by 6-MSITC (≥2-fold). Expression levels of 717 genes were decreased by ≥3-fold in LPS-activated cells, of which 336 gene signals were restored by 6-MSITC (≥2-fold). Utilizing group analysis, 206 genes affected by 6-MSITC with a ≥2-fold change were classified into 35 categories relating to biological processes (81), molecular functions (108) and signaling pathways (17). The genes were further categorized as ‘defense, inflammatory response, cytokine activities and receptor activities’ and some were confirmed by real-time polymerase chain reaction. Ingenuity pathway analysis further revealed that wasabi 6-MSITC regulated the relevant networks of chemokines, interleukins and interferons to exert its anti-inflammatory function. PMID:23136589

  16. Bioorthogonal in Situ Hydrogels Based on Polyether Polyols for New Biosensor Materials with High Sensitivity.

    PubMed

    Herrmann, Anna; Kaufmann, Lena; Dey, Pradip; Haag, Rainer; Schedler, Uwe

    2018-04-04

    Both noncovalent and covalent encapsulations of active biomolecules, for example, proteins and oligonucleotides, for a new biosensor matrix in an in situ bioorthogonal hydrogel formation via a strain-promoted azide-alkyne cycloaddition reaction were investigated. Unspecific interaction between the gel and the biomolecules as well as protein denaturation was prevented by the bioorthogonal gel components, which ensure a uniform aqueous environment in the hydrogel network. No leaching of the active biomolecules was observed. Additionally, a much higher and also adjustable loading of biomolecules in the hydrogel matrix was achieved compared to conventional biosensor surfaces, where the sensor molecules are immobilized on monolayers (2D surfaces) or brushlike structures (3D surfaces). Spotting experiments of the hydrogel confirm the possibility to use this new surface for microarray-based multiplex applications which require very high signal-to-noise ratios.

  17. Calibration and assessment of channel-specific biases in microarray data with extended dynamical range.

    PubMed

    Bengtsson, Henrik; Jönsson, Göran; Vallon-Christersson, Johan

    2004-11-12

    Non-linearities in observed log-ratios of gene expressions, also known as intensity dependent log-ratios, can often be accounted for by global biases in the two channels being compared. Any step in a microarray process may introduce such offsets and in this article we study the biases introduced by the microarray scanner and the image analysis software. By scanning the same spotted oligonucleotide microarray at different photomultiplier tube (PMT) gains, we have identified a channel-specific bias present in two-channel microarray data. For the scanners analyzed it was in the range of 15-25 (out of 65,535). The observed bias was very stable between subsequent scans of the same array although the PMT gain was greatly adjusted. This indicates that the bias does not originate from a step preceding the scanner detector parts. The bias varies slightly between arrays. When comparing estimates based on data from the same array, but from different scanners, we have found that different scanners introduce different amounts of bias. So do various image analysis methods. We propose a scanning protocol and a constrained affine model that allows us to identify and estimate the bias in each channel. Backward transformation removes the bias and brings the channels to the same scale. The result is that systematic effects such as intensity dependent log-ratios are removed, but also that signal densities become much more similar. The average scan, which has a larger dynamical range and greater signal-to-noise ratio than individual scans, can then be obtained. The study shows that microarray scanners may introduce a significant bias in each channel. Such biases have to be calibrated for, otherwise systematic effects such as intensity dependent log-ratios will be observed. The proposed scanning protocol and calibration method is simple to use and is useful for evaluating scanner biases or for obtaining calibrated measurements with extended dynamical range and better precision. The cross-platform R package aroma, which implements all described methods, is available for free from http://www.maths.lth.se/bioinformatics/.

  18. Method for widespread microRNA-155 inhibition prolongs survival in ALS-model mice

    PubMed Central

    Koval, Erica D.; Shaner, Carey; Zhang, Peter; du Maine, Xavier; Fischer, Kimberlee; Tay, Jia; Chau, B. Nelson; Wu, Gregory F.; Miller, Timothy M.

    2013-01-01

    microRNAs (miRNAs) are dysregulated in a variety of disease states, suggesting that this newly discovered class of gene expression repressors may be viable therapeutic targets. A microarray of miRNA changes in ALS-model superoxide dismutase 1 (SOD1)G93A rodents identified 12 miRNAs as significantly changed. Six miRNAs tested in human ALS tissues were confirmed increased. Specifically, miR-155 was increased 5-fold in mice and 2-fold in human spinal cords. To test miRNA inhibition in the central nervous system (CNS) as a potential novel therapeutic, we developed oligonucleotide-based miRNA inhibitors (anti-miRs) that could inhibit miRNAs throughout the CNS and in the periphery. Anti-miR-155 caused global derepression of targets in peritoneal macrophages and, following intraventricular delivery, demonstrated widespread functional distribution in the brain and spinal cord. After treating SOD1G93A mice with anti-miR-155, we significantly extended survival by 10 days and disease duration by 15 days (38%) while a scrambled control anti-miR did not significantly improve survival or disease duration. Therefore, antisense oligonucleotides may be used to successfully inhibit miRNAs throughout the brain and spinal cord, and miR-155 is a promising new therapeutic target for human ALS. PMID:23740943

  19. Stability of non-Watson-Crick G-A/A-G base pair in synthetic DNA and RNA oligonucleotides.

    PubMed

    Ito, Yuko; Sone, Yumiko; Mizutani, Takaharu

    2004-03-01

    A non-Watson-Crick G-A/A-G base pair is found in SECIS (selenocysteine-insertion sequence) element in the 3'-untranslated region of Se-protein mRNAs and in the functional site of the hammerhead ribozyme. We studied the stability of G-A/A-G base pair (bold) in 17mer GT(U)GACGGAAACCGGAAC synthetic DNA and RNA oligonucleotides by thermal melting experiments and gel electrophoresis. The measured Tm value of DNA oligonucleotide having G-A/A-G pair showed an intermediate value (58 degrees C) between that of Watson-Crick G-C/C-G base pair (75 degrees C) and that of G-G/A-A of non-base-pair (40 degrees C). Similar thermal melting patterns were obtained with RNA oligonucleotides. This result indicates that the secondary structure of oligonucleotide having G-A/A-G base pair is looser than that of the G-C type Watson-Crick base pair. In the comparison between RNA and DNA having G-A/A-G base pair, the Tm value of the RNA oligonucleotide was 11 degrees C lower than that of DNA, indicating that DNA has a more rigid structure than RNA. The stained pattern of oligonucleotide on polyacrylamide gel clarified that the mobility of the DNA oligonucleotide G-A/A-G base pair changed according to the urea concentration from the rigid state (near the mobility of G-C/C-G oligonucleotide) in the absence of urea to the random state (near the mobility of G-G/A-A oligonucleotide) in 7 M urea. However, the RNA oligonucleotide with G-A/A-G pair moved at an intermediate mobility between that of oligonucleotide with G-C/C-G and of the oligonucleotide with G-G/A-A, and the mobility pattern did not depend on urea concentration. Thus, DNA and RNA oligonucleotides with the G-A/A-G base pair showed a pattern indicating an intermediate structure between the rigid Watson-Crick base pair and the random structure of non-base pair. RNA with G-A/A-G base pair has the intermediate structure not influenced by urea concentration. Finally, this study indicated that the intermediate rigidity imparted by Non-Watson-Crick base pair in SECIS element plays an important role in the selenocysteine expression by UGA codon.

  20. The occurrence of ESBL-producing Escherichia coli carrying aminoglycoside resistance genes in urinary tract infections in Saudi Arabia.

    PubMed

    Alyamani, Essam J; Khiyami, Anamil M; Booq, Rayan Y; Majrashi, Majed A; Bahwerth, Fayez S; Rechkina, Elena

    2017-01-06

    The infection and prevalence of extended-spectrum β-lactamases (ESBLs) is a worldwide problem, and the presence of ESBLs varies between countries. In this study, we investigated the occurrence of plasmid-mediated ESBL/AmpC/carbapenemase/aminoglycoside resistance gene expression in Escherichia coli using phenotypic and genotypic techniques. A total of 58 E. coli isolates were collected from hospitals in the city of Makkah and screened for the production of ESBL/AmpC/carbapenemase/aminoglycoside resistance genes. All samples were subjected to phenotypic and genotypic analyses. The antibiotic susceptibility of the E. coli isolates was determined using the Vitek-2 system and the minimum inhibitory concentration (MIC) assay. Antimicrobial agents tested using the Vitek 2 system and MIC assay included the expanded-spectrum (or third-generation) cephalosporins (e.g., cefoxitin, cefepime, aztreonam, cefotaxime, ceftriaxone, and ceftazidime) and carbapenems (meropenem and imipenem). Reported positive isolates were investigated using genotyping technology (oligonucleotide microarray-based assay and PCR). The genotyping investigation was focused on ESBL variants and the AmpC, carbapenemase and aminoglycoside resistance genes. E. coli was phylogenetically grouped, and the clonality of the isolates was studied using multilocus sequence typing (MLST). Our E. coli isolates exhibited different levels of resistance to ESBL drugs, including ampicillin (96.61%), cefoxitin (15.25%), ciprofloxacin (79.66%), cefepime (75.58%), aztreonam (89.83%), cefotaxime (76.27%), ceftazidime (81.36%), meropenem (0%) and imipenem (0%). Furthermore, the distribution of ESBL-producing E. coli was consistent with the data obtained using an oligonucleotide microarray-based assay and PCR genotyping against genes associated with β-lactam resistance. ST131 was the dominant sequence type lineage of the isolates and was the most uropathogenic E. coli lineage. The E. coli isolates also carried aminoglycoside resistance genes. The evolution and prevalence of ESBL-producing E. coli may be rapidly accelerating in Saudi Arabia due to the high visitation seasons (especially to the city of Makkah). The health authority in Saudi Arabia should monitor the level of drug resistance in all general hospitals to reduce the increasing trend of microbial drug resistance and the impact on patient therapy.

  1. Biological data warehousing system for identifying transcriptional regulatory sites from gene expressions of microarray data.

    PubMed

    Tsou, Ann-Ping; Sun, Yi-Ming; Liu, Chia-Lin; Huang, Hsien-Da; Horng, Jorng-Tzong; Tsai, Meng-Feng; Liu, Baw-Juine

    2006-07-01

    Identification of transcriptional regulatory sites plays an important role in the investigation of gene regulation. For this propose, we designed and implemented a data warehouse to integrate multiple heterogeneous biological data sources with data types such as text-file, XML, image, MySQL database model, and Oracle database model. The utility of the biological data warehouse in predicting transcriptional regulatory sites of coregulated genes was explored using a synexpression group derived from a microarray study. Both of the binding sites of known transcription factors and predicted over-represented (OR) oligonucleotides were demonstrated for the gene group. The potential biological roles of both known nucleotides and one OR nucleotide were demonstrated using bioassays. Therefore, the results from the wet-lab experiments reinforce the power and utility of the data warehouse as an approach to the genome-wide search for important transcription regulatory elements that are the key to many complex biological systems.

  2. Optimization of an oligonucleotide microchip for microbial identification studies: a non-equilibrium dissociation approach

    NASA Technical Reports Server (NTRS)

    Liu, W. T.; Mirzabekov, A. D.; Stahl, D. A.

    2001-01-01

    The utility of a high-density oligonucleotide microarray (microchip) for identifying strains of five closely related bacilli (Bacillus anthracis, Bacillus cereus, Bacillus mycoides, Bacillus medusa and Bacillus subtilis) was demonstrated using an approach that compares the non-equilibrium dissociation rates ('melting curves') of all probe-target duplexes simultaneously. For this study, a hierarchical set of 30 oligonucleotide probes targeting the 16S ribosomal RNA of these bacilli at multiple levels of specificity (approximate taxonomic ranks of domain, kingdom, order, genus and species) was designed and immobilized in a high-density matrix of gel pads on a glass slide. Reproducible melting curves for probes with different levels of specificity were obtained using an optimized salt concentration. Clear discrimination between perfect match (PM) and mismatch (MM) duplexes was achieved. By normalizing the signals to an internal standard (a universal probe), a more than twofold discrimination (> 2.4x) was achieved between PM and 1-MM duplexes at the dissociation temperature at which 50% of the probe-target duplexes remained intact. This provided excellent differentiation among representatives of different Bacillus species, both individually and in mixtures of two or three. The overall pattern of hybridization derived from this hierarchical probe set also provided a clear 'chip fingerprint' for each of these closely related Bacillus species.

  3. Optimization of oligonucleotide arrays and RNA amplification protocols for analysis of transcript structure and alternative splicing.

    PubMed

    Castle, John; Garrett-Engele, Phil; Armour, Christopher D; Duenwald, Sven J; Loerch, Patrick M; Meyer, Michael R; Schadt, Eric E; Stoughton, Roland; Parrish, Mark L; Shoemaker, Daniel D; Johnson, Jason M

    2003-01-01

    Microarrays offer a high-resolution means for monitoring pre-mRNA splicing on a genomic scale. We have developed a novel, unbiased amplification protocol that permits labeling of entire transcripts. Also, hybridization conditions, probe characteristics, and analysis algorithms were optimized for detection of exons, exon-intron edges, and exon junctions. These optimized protocols can be used to detect small variations and isoform mixtures, map the tissue specificity of known human alternative isoforms, and provide a robust, scalable platform for high-throughput discovery of alternative splicing.

  4. Optimization of oligonucleotide arrays and RNA amplification protocols for analysis of transcript structure and alternative splicing

    PubMed Central

    Castle, John; Garrett-Engele, Phil; Armour, Christopher D; Duenwald, Sven J; Loerch, Patrick M; Meyer, Michael R; Schadt, Eric E; Stoughton, Roland; Parrish, Mark L; Shoemaker, Daniel D; Johnson, Jason M

    2003-01-01

    Microarrays offer a high-resolution means for monitoring pre-mRNA splicing on a genomic scale. We have developed a novel, unbiased amplification protocol that permits labeling of entire transcripts. Also, hybridization conditions, probe characteristics, and analysis algorithms were optimized for detection of exons, exon-intron edges, and exon junctions. These optimized protocols can be used to detect small variations and isoform mixtures, map the tissue specificity of known human alternative isoforms, and provide a robust, scalable platform for high-throughput discovery of alternative splicing. PMID:14519201

  5. Detection of pathogenic Vibrio spp. in shellfish by using multiplex PCR and DNA microarrays.

    PubMed

    Panicker, Gitika; Call, Douglas R; Krug, Melissa J; Bej, Asim K

    2004-12-01

    This study describes the development of a gene-specific DNA microarray coupled with multiplex PCR for the comprehensive detection of pathogenic vibrios that are natural inhabitants of warm coastal waters and shellfish. Multiplex PCR with vvh and viuB for Vibrio vulnificus, with ompU, toxR, tcpI, and hlyA for V. cholerae, and with tlh, tdh, trh, and open reading frame 8 for V. parahaemolyticus helped to ensure that total and pathogenic strains, including subtypes of the three Vibrio spp., could be detected and discriminated. For DNA microarrays, oligonucleotide probes for these targeted genes were deposited onto epoxysilane-derivatized, 12-well, Teflon-masked slides by using a MicroGrid II arrayer. Amplified PCR products were hybridized to arrays at 50 degrees C and detected by using tyramide signal amplification with Alexa Fluor 546 fluorescent dye. Slides were imaged by using an arrayWoRx scanner. The detection sensitivity for pure cultures without enrichment was 10(2) to 10(3) CFU/ml, and the specificity was 100%. However, 5 h of sample enrichment followed by DNA extraction with Instagene matrix and multiplex PCR with microarray hybridization resulted in the detection of 1 CFU in 1 g of oyster tissue homogenate. Thus, enrichment of the bacterial pathogens permitted higher sensitivity in compliance with the Interstate Shellfish Sanitation Conference guideline. Application of the DNA microarray methodology to natural oysters revealed the presence of V. vulnificus (100%) and V. parahaemolyticus (83%). However, V. cholerae was not detected in natural oysters. An assay involving a combination of multiplex PCR and DNA microarray hybridization would help to ensure rapid and accurate detection of pathogenic vibrios in shellfish, thereby improving the microbiological safety of shellfish for consumers.

  6. Detection of Pathogenic Vibrio spp. in Shellfish by Using Multiplex PCR and DNA Microarrays

    PubMed Central

    Panicker, Gitika; Call, Douglas R.; Krug, Melissa J.; Bej, Asim K.

    2004-01-01

    This study describes the development of a gene-specific DNA microarray coupled with multiplex PCR for the comprehensive detection of pathogenic vibrios that are natural inhabitants of warm coastal waters and shellfish. Multiplex PCR with vvh and viuB for Vibrio vulnificus, with ompU, toxR, tcpI, and hlyA for V. cholerae, and with tlh, tdh, trh, and open reading frame 8 for V. parahaemolyticus helped to ensure that total and pathogenic strains, including subtypes of the three Vibrio spp., could be detected and discriminated. For DNA microarrays, oligonucleotide probes for these targeted genes were deposited onto epoxysilane-derivatized, 12-well, Teflon-masked slides by using a MicroGrid II arrayer. Amplified PCR products were hybridized to arrays at 50°C and detected by using tyramide signal amplification with Alexa Fluor 546 fluorescent dye. Slides were imaged by using an arrayWoRx scanner. The detection sensitivity for pure cultures without enrichment was 102 to 103 CFU/ml, and the specificity was 100%. However, 5 h of sample enrichment followed by DNA extraction with Instagene matrix and multiplex PCR with microarray hybridization resulted in the detection of 1 CFU in 1 g of oyster tissue homogenate. Thus, enrichment of the bacterial pathogens permitted higher sensitivity in compliance with the Interstate Shellfish Sanitation Conference guideline. Application of the DNA microarray methodology to natural oysters revealed the presence of V. vulnificus (100%) and V. parahaemolyticus (83%). However, V. cholerae was not detected in natural oysters. An assay involving a combination of multiplex PCR and DNA microarray hybridization would help to ensure rapid and accurate detection of pathogenic vibrios in shellfish, thereby improving the microbiological safety of shellfish for consumers. PMID:15574946

  7. Minimum probe length for unique identification of all open reading frames in a microbial genome

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sokhansanj, B A; Ng, J; Fitch, J P

    2000-03-05

    In this paper, we determine the minimum hybridization probe length to uniquely identify at least 95% of the open reading frame (ORF) in an organism. We analyze the whole genome sequences of 17 species, 11 bacteria, 4 archaea, and 2 eukaryotes. We also present a mathematical model for minimum probe length based on assuming that all ORFs are random, of constant length, and contain an equal distribution of bases. The model accurately predicts the minimum probe length for all species, but it incorrectly predicts that all ORFs may be uniquely identified. However, a probe length of just 9 bases ismore » adequate to identify over 95% of the ORFs for all 15 prokaryotic species we studied. Using a minimum probe length, while accepting that some ORFs may not be identified and that data will be lost due to hybridization error, may result in significant savings in microarray and oligonucleotide probe design.« less

  8. Dendrimeric coating of glass slides for sensitive DNA microarrays analysis

    PubMed Central

    Le Berre, Véronique; Trévisiol, Emmanuelle; Dagkessamanskaia, Adilia; Sokol, Serguei; Caminade, Anne-Marie; Majoral, Jean Pierre; Meunier, Bernard; François, Jean

    2003-01-01

    Successful use and reliability of microarray technology is highly dependent on several factors, including surface chemistry parameters and accessibility of cDNA targets to the DNA probes fixed onto the surface. Here, we show that functionalisation of glass slides with homemade dendrimers allow production of more sensitive and reliable DNA microarrays. The dendrimers are nanometric structures of size-controlled diameter with aldehyde function at their periphery. Covalent attachment of these spherical reactive chemical structures on amino-silanised glass slides generates a reactive ∼100 Å layer onto which amino-modified DNA probes are covalently bound. This new grafting chemistry leads to the formation of uniform and homogenous spots. More over, probe concentration before spotting could be reduced from 0.2 to 0.02 mg/ml with PCR products and from 20 to 5 µM with 70mer oligonucleotides without affecting signal intensities after hybridisation with Cy3- and Cy5-labelled targets. More interestingly, while the binding capacity of captured probes on dendrimer-activated glass surface (named dendrislides) is roughly similar to other functionalised glass slides from commercial sources, detection sensitivity was 2-fold higher than with other available DNA microarrays. This detection limit was estimated to 0.1 pM of cDNA targets. Altogether, these features make dendrimer-activated slides ideal for manufacturing cost-effective DNA arrays applicable for gene expression and detection of mutations. PMID:12907740

  9. Receptor-Mediated Uptake of Phosphorothioate Antisense Oligonucleotides in Different Cell Types of the Liver.

    PubMed

    Miller, Colton M; Tanowitz, Michael; Donner, Aaron J; Prakash, Thazha P; Swayze, Eric E; Harris, Edward N; Seth, Punit P

    2018-06-01

    Oligonucleotide therapeutics have emerged as a third distinct platform for drug discovery within the pharmaceutical industry. Five oligonucleotide-based drugs have been approved by the US FDA and over 100 oligonucleotides drugs are currently at different stages of human trials. Several of these oligonucleotide drugs are modified using the phosphorothioate (PS) backbone modification where one of the nonbridging oxygen atoms of the phosphodiester linkage is replaced with sulfur. In this review, we summarize our knowledge on receptor-mediated uptake of PS antisense oligonucleotides (ASOs) within different cell types of the liver-a privileged organ for the discovery of oligonucleotide-based therapeutics.

  10. Ultrasensitive Label-free Electronic Chip for DNA Analysis Using Carbon Nanotube Nanoelectrode Arrays

    NASA Technical Reports Server (NTRS)

    Li, Jun; Koehne, Jessica; Chen, Hua; Cassell, Alan; Ng, Hou Tee; Ye, Qi; Han, Jie; Meyyappan, M.

    2004-01-01

    There is a strong need for faster, cheaper, and simpler methods for nucleic acid analysis in today s clinical tests. Nanotechnologies can potentially provide solutions to these requirements by integrating nanomaterials with biofunctionalities. Dramatic improvement in the sensitivity and multiplexing can be achieved through the high-degree miniaturization. Here, we present our study in the development of an ultrasensitive label-free electronic chip for DNA/RNA analysis based on carbon nanotube nanoelectrode arrays. A reliable nanoelectrode array based on vertically aligned multi-walled carbon nanotubes (MWNTs) embedded in a SiO2 matrix is fabricated using a bottom-up approach. Characteristic nanoelectrode behavior is observed with a low-density MWNT nanoelectrode array in measuring both the bulk and surface immobilized redox species. The open-end of MWNTs are found to present similar properties as graphite edge-plane electrodes, with a wide potential window, flexible chemical functionalities, and good biocompatibility. A BRCA1 related oligonucleotide probe with 18 bases is covalently functionalized at the open ends of the MWNTs and specifically hybridized with an oligonucleotide target as well as a PCR amplicon. The guanine bases in the target molecules are employed as the signal moieties for the electrochemical measurements. Ru(bpy)3(2+) mediator is used to further amplify the guanine oxidation signal. This technique has been employed for direct electrochemical detection of label-free PCR amplicon through specific hybridization with the BRCAl probe. The detection limit is estimated to be less than approximately 1000 DNA molecules, approaching the limit of the sensitivity by laser-based fluorescence techniques in DNA microarray. This system provides a general electronic platform for rapid molecular diagnostics in applications requiring ultrahigh sensitivity, high-degree of miniaturization, simple sample preparation, and low- cost operation.

  11. Gene Expression Profiling of Gastric Cancer

    PubMed Central

    Marimuthu, Arivusudar; Jacob, Harrys K.C.; Jakharia, Aniruddha; Subbannayya, Yashwanth; Keerthikumar, Shivakumar; Kashyap, Manoj Kumar; Goel, Renu; Balakrishnan, Lavanya; Dwivedi, Sutopa; Pathare, Swapnali; Dikshit, Jyoti Bajpai; Maharudraiah, Jagadeesha; Singh, Sujay; Sameer Kumar, Ghantasala S; Vijayakumar, M.; Veerendra Kumar, Kariyanakatte Veeraiah; Premalatha, Chennagiri Shrinivasamurthy; Tata, Pramila; Hariharan, Ramesh; Roa, Juan Carlos; Prasad, T.S.K; Chaerkady, Raghothama; Kumar, Rekha Vijay; Pandey, Akhilesh

    2015-01-01

    Gastric cancer is the second leading cause of cancer death worldwide, both in men and women. A genomewide gene expression analysis was carried out to identify differentially expressed genes in gastric adenocarcinoma tissues as compared to adjacent normal tissues. We used Agilent’s whole human genome oligonucleotide microarray platform representing ~41,000 genes to carry out gene expression analysis. Two-color microarray analysis was employed to directly compare the expression of genes between tumor and normal tissues. Through this approach, we identified several previously known candidate genes along with a number of novel candidate genes in gastric cancer. Testican-1 (SPOCK1) was one of the novel molecules that was 10-fold upregulated in tumors. Using tissue microarrays, we validated the expression of testican-1 by immunohistochemical staining. It was overexpressed in 56% (160/282) of the cases tested. Pathway analysis led to the identification of several networks in which SPOCK1 was among the topmost networks of interacting genes. By gene enrichment analysis, we identified several genes involved in cell adhesion and cell proliferation to be significantly upregulated while those corresponding to metabolic pathways were significantly downregulated. The differentially expressed genes identified in this study are candidate biomarkers for gastric adenoacarcinoma. PMID:27030788

  12. An Efficient Covalent Coating on Glass Slides for Preparation of Optical Oligonucleotide Microarrays

    PubMed Central

    Pourjahed, Atefeh; Rabiee, Mohammad; Tahriri, Mohammadreza

    2013-01-01

    Objective(s): Microarrays are potential analyzing tools for genomics and proteomics researches, which is in needed of suitable substrate for coating and also hybridization of biomolecules. Materials and Methods: In this research, a thin film of oxidized agarose was prepared on the glass slides which previously coated with poly-L-lysine (PLL). Some of the aldehyde groups of the activated agarose linked covalently to PLL amine groups; also bound to the amino groups of biomolecules. These linkages were fixed by UV irradiation. The prepared substrates were compared to only agarose-coated and PLL-coated slides. Results: Results on atomic force microscope (AFM) demonstrated that agarose provided three-dimensional surface which had higher loading and bindig capacity for biomolecules than PLL-coated surface which had two-dimensional surface. In addition, the signal-to-noise ratio in hybridization reactions performed on the agarose-PLL coated substrates increased two fold and four fold compared to agarose and PLL coated substrates, respectively. Conclusion: The agarose-PLL microarrays had the highest signal (2546) and lowest background signal (205) in hybridization, suggesting that the prepared slides are suitable in analyzing wide concentration range of analytes. PMID:24570832

  13. Decreased triadin and increased calstabin2 expression in Great Danes with dilated cardiomyopathy.

    PubMed

    Oyama, M A; Chittur, S V; Reynolds, C A

    2009-01-01

    Dilated cardiomyopathy (DCM) is a common cardiac disease of Great Dane dogs, yet very little is known about the underlying molecular abnormalities that contribute to disease. Discover a set of genes that are differentially expressed in Great Dane dogs with DCM as a way to identify candidate genes for further study as well as to better understand the molecular abnormalities that underlie the disease. Three Great Dane dogs with end-stage DCM and 3 large breed control dogs. Prospective study. Transcriptional activity of 42,869 canine DNA sequences was determined with a canine-specific oligonucleotide microarray. Genome expression patterns of left ventricular tissue samples from affected Great Dane dogs were evaluated by measuring the relative amount of complementary RNA hybridization to the microarray probes and comparing it with expression from large breed dogs with noncardiac disease. Three hundred and twenty-three transcripts were differentially expressed (> or = 2-fold change). The transcript with the greatest degree of upregulation (+61.3-fold) was calstabin2 (FKBP12.6), whereas the transcript with the greatest degree of downregulation (-9.07-fold) was triadin. Calstabin2 and triadin are both regulatory components of the cardiac ryanodine receptor (RyR2) and are critical to normal intracellular Ca2+ release and excitation-contraction coupling. Great Dane dogs with DCM demonstrate abnormal calstabin2 and triadin expression. These changes likely affect Ca2+ flux within cardiac cells and may contribute to the pathophysiology of disease. Microarray-based analysis identifies calstabin2, triadin, and RyR2 function as targets of future study.

  14. Oligonucleotide-based pharmaceuticals: Non-clinical and clinical safety signals and non-clinical testing strategies.

    PubMed

    Mustonen, Enni-Kaisa; Palomäki, Tiina; Pasanen, Markku

    2017-11-01

    Antisense oligonucleotides, short interfering RNAs (siRNAs) and aptamers are oligonucleotide-based pharmaceuticals with a promising role in targeted therapies. Currently, five oligonucleotide-based pharmaceuticals have achieved marketing authorization in Europe or USA and many more are undergoing clinical testing. However, several safety concerns have been raised in non-clinical and clinical studies. Oligonucleotides share properties with both chemical and biological pharmaceuticals and therefore they pose challenges also from the regulatory point of view. We have analyzed the safety data of oligonucleotides and evaluated the applicability of current non-clinical toxicological guidelines for assessing the safety of oligonucleotide-based pharmaceuticals. Oligonucleotide-based pharmaceuticals display a similar toxicological profile, exerting adverse effects on liver and kidney, evoking hematological alterations, as well as causing immunostimulation and prolonging the coagulation time. It is possible to extrapolate some of these effects from non-clinical studies to humans. However, evaluation strategies for genotoxicity testing of "non-natural" oligonucleotides should be revised. Additionally, the selective use of surrogates and prediction of clinical endpoints for non-clinically observed immunostimulation is complicated by its multiple potential manifestations, demanding improvements in the testing strategies. Utilizing more relevant and mechanistic-based approaches and taking better account of species differences, could possibly improve the prediction of relevant immunological/proinflammatory effects in humans. Copyright © 2017 Elsevier Inc. All rights reserved.

  15. Robust diagnosis of non-Hodgkin lymphoma phenotypes validated on gene expression data from different laboratories.

    PubMed

    Bhanot, Gyan; Alexe, Gabriela; Levine, Arnold J; Stolovitzky, Gustavo

    2005-01-01

    A major challenge in cancer diagnosis from microarray data is the need for robust, accurate, classification models which are independent of the analysis techniques used and can combine data from different laboratories. We propose such a classification scheme originally developed for phenotype identification from mass spectrometry data. The method uses a robust multivariate gene selection procedure and combines the results of several machine learning tools trained on raw and pattern data to produce an accurate meta-classifier. We illustrate and validate our method by applying it to gene expression datasets: the oligonucleotide HuGeneFL microarray dataset of Shipp et al. (www.genome.wi.mit.du/MPR/lymphoma) and the Hu95Av2 Affymetrix dataset (DallaFavera's laboratory, Columbia University). Our pattern-based meta-classification technique achieves higher predictive accuracies than each of the individual classifiers , is robust against data perturbations and provides subsets of related predictive genes. Our techniques predict that combinations of some genes in the p53 pathway are highly predictive of phenotype. In particular, we find that in 80% of DLBCL cases the mRNA level of at least one of the three genes p53, PLK1 and CDK2 is elevated, while in 80% of FL cases, the mRNA level of at most one of them is elevated.

  16. Identification of transcribed sequences in Arabidopsis thaliana by using high-resolution genome tiling arrays

    PubMed Central

    Stolc, Viktor; Samanta, Manoj Pratim; Tongprasit, Waraporn; Sethi, Himanshu; Liang, Shoudan; Nelson, David C.; Hegeman, Adrian; Nelson, Clark; Rancour, David; Bednarek, Sebastian; Ulrich, Eldon L.; Zhao, Qin; Wrobel, Russell L.; Newman, Craig S.; Fox, Brian G.; Phillips, George N.; Markley, John L.; Sussman, Michael R.

    2005-01-01

    Using a maskless photolithography method, we produced DNA oligonucleotide microarrays with probe sequences tiled throughout the genome of the plant Arabidopsis thaliana. RNA expression was determined for the complete nuclear, mitochondrial, and chloroplast genomes by tiling 5 million 36-mer probes. These probes were hybridized to labeled mRNA isolated from liquid grown T87 cells, an undifferentiated Arabidopsis cell culture line. Transcripts were detected from at least 60% of the nearly 26,330 annotated genes, which included 151 predicted genes that were not identified previously by a similar genome-wide hybridization study on four different cell lines. In comparison with previously published results with 25-mer tiling arrays produced by chromium masking-based photolithography technique, 36-mer oligonucleotide probes were found to be more useful in identifying intron–exon boundaries. Using two-dimensional HPLC tandem mass spectrometry, a small-scale proteomic analysis was performed with the same cells. A large amount of strongly hybridizing RNA was found in regions “antisense” to known genes. Similarity of antisense activities between the 25-mer and 36-mer data sets suggests that it is a reproducible and inherent property of the experiments. Transcription activities were also detected for many of the intergenic regions and the small RNAs, including tRNA, small nuclear RNA, small nucleolar RNA, and microRNA. Expression of tRNAs correlates with genome-wide amino acid usage. PMID:15755812

  17. Salivary gland carcinosarcoma: oligonucleotide array CGH reveals similar genomic profiles in epithelial and mesenchymal components.

    PubMed

    Vékony, Hedy; Leemans, C René; Ylstra, Bauke; Meijer, Gerrit A; van der Waal, Isaäc; Bloemena, Elisabeth

    2009-03-01

    In this study, we present a case of parotid gland de novo carcinosarcoma. Salivary gland carcinosarcoma (or true malignant mixed tumor) is a rare biphasic neoplasm, composed of both malignant epithelial and malignant mesenchymal components. It is yet unclear whether these two phenotypes occur by collision of two independent tumors or if they are of clonal origin. To analyze the clonality of the different morphologic tumor components, oligonucleotide microarray-based comparative genomic hybridization (oaCGH) was performed on the carcinoma and the sarcoma entity separately. This technique enables a high-resolution, genome-wide overview of the chromosomal alterations in the distinct tumor elements. Analysis of both fractions showed a high number of DNA copy number changes. Losses were more prevalent than gains (82 and 49, respectively). The carcinomatous element displayed more chromosomal aberrations than the sarcomatous component. Specific amplifications of MUC20 (in mesenchymal element) and BMI-1 (in both elements) loci were observed. Overall homology between the two genomic profiles was 75%. DNA copy number profiles of the epithelial and mesenchymal components in this salivary gland carcinosarcoma displayed extensive overlap, indicating a monoclonal origin. Since losses are shared to a larger extent than gains, they seem to be more essential for initial oncogenic events. Furthermore, specific amplifications of a mucin and a Polycomb group gene imply these proteins in the tumorigenesis of carcinosarcomas.

  18. Identification of transcribed sequences in Arabidopsis thaliana by using high-resolution genome tiling arrays

    NASA Technical Reports Server (NTRS)

    Stolc, Viktor; Samanta, Manoj Pratim; Tongprasit, Waraporn; Sethi, Himanshu; Liang, Shoudan; Nelson, David C.; Hegeman, Adrian; Nelson, Clark; Rancour, David; Bednarek, Sebastian; hide

    2005-01-01

    Using a maskless photolithography method, we produced DNA oligonucleotide microarrays with probe sequences tiled throughout the genome of the plant Arabidopsis thaliana. RNA expression was determined for the complete nuclear, mitochondrial, and chloroplast genomes by tiling 5 million 36-mer probes. These probes were hybridized to labeled mRNA isolated from liquid grown T87 cells, an undifferentiated Arabidopsis cell culture line. Transcripts were detected from at least 60% of the nearly 26,330 annotated genes, which included 151 predicted genes that were not identified previously by a similar genome-wide hybridization study on four different cell lines. In comparison with previously published results with 25-mer tiling arrays produced by chromium masking-based photolithography technique, 36-mer oligonucleotide probes were found to be more useful in identifying intron-exon boundaries. Using two-dimensional HPLC tandem mass spectrometry, a small-scale proteomic analysis was performed with the same cells. A large amount of strongly hybridizing RNA was found in regions "antisense" to known genes. Similarity of antisense activities between the 25-mer and 36-mer data sets suggests that it is a reproducible and inherent property of the experiments. Transcription activities were also detected for many of the intergenic regions and the small RNAs, including tRNA, small nuclear RNA, small nucleolar RNA, and microRNA. Expression of tRNAs correlates with genome-wide amino acid usage.

  19. Recommendations of the Oligonucleotide Safety Working Group's Formulated Oligonucleotide Subcommittee for the Safety Assessment of Formulated Oligonucleotide-Based Therapeutics.

    PubMed

    Marlowe, Jennifer L; Akopian, Violetta; Karmali, Priya; Kornbrust, Douglas; Lockridge, Jennifer; Semple, Sean

    2017-08-01

    The use of lipid formulations has greatly improved the ability to effectively deliver oligonucleotides and has been instrumental in the rapid expansion of therapeutic development programs using oligonucleotide drugs. However, the development of such complex multicomponent therapeutics requires the implementation of unique, scientifically sound approaches to the nonclinical development of these drugs, based upon a hybrid of knowledge and experiences drawn from small molecule, protein, and oligonucleotide therapeutic drug development. The relative paucity of directly applicable regulatory guidance documents for oligonucleotide therapeutics in general has resulted in the generation of multiple white papers from oligonucleotide drug development experts and members of the Oligonucleotide Safety Working Group (OSWG). The members of the Formulated Oligonucleotide Subcommittee of the OSWG have utilized their collective experience working with a variety of formulations and their associated oligonucleotide payloads, as well as their insights into regulatory considerations and expectations, to generate a series of consensus recommendations for the pharmacokinetic characterization and nonclinical safety assessment of this unique class of therapeutics. It should be noted that the focus of Subcommittee discussions was on lipid nanoparticle and other types of particulate formulations of therapeutic oligonucleotides and not on conjugates or other types of modifications of oligonucleotide structure intended to facilitate delivery.

  20. Chemically functionalized gold nanoparticles: Synthesis, characterization, and applications

    NASA Astrophysics Data System (ADS)

    Daniel, Weston Lewis

    This thesis focuses on the development and application of gold nanoparticle based detection systems and biomimetic structures. Each class of modified nanoparticle has properties that are defined by its chemical moieties that interface with solution and the gold nanoparticle core. In Chapter 2, a comparison of the biomolecular composition and binding properties of various preparations of antibody oligonucleotide gold nanoparticle conjugates is presented. These constructs differed significantly in terms of their structure and binding properties. Chapter 3 reports the use of electroless gold deposition as a light scattering signal enhancer in a multiplexed, microarray-based scanometric immunoassay using the gold nanoparticle probes evaluated in Chapter 2. The use of gold development results in greater signal enhancement than the typical silver development, and multiple rounds of metal development were found to increase the resulting signal compared to one development. Chapter 4 describes an amplified scanometric detection method for human telomerase activity. Gold nanoparticles functionalized with specific oligonucleotide sequences can efficiently capture telomerase enzymes and subsequently be elongated. Both the elongated and unmodified oligonucleotide sequences are simultaneously measured. At low telomerase concentrations, elongated strands cannot be detected, but the unmodified sequences, which come from the same probe particles, can be detected because their concentration is higher, providing a novel form of amplification. Chapter 5 reports the development of a novel colorimetric nitrite and nitrate ion assay based upon gold nanoparticle probes functionalized with Griess reaction reagents. This assay takes advantage of the distance-dependent plasmonic properties of the gold nanoparticles and the ability of nitrite ion to facilitate the cross coupling of novel nanoparticle probes. The assay works on the concept of a kinetic end point and can be triggered at the EPA limit for this ion in drinking water. Finally, Chapter 6 describes the synthesis of high density lipoprotein biomimetic nanoparticles capable of binding cholesterol. These structures use a gold nanoparticle core to template the assembly of a mixed phospholipid layer and the adsorption of apolipoprotein A-I. These synthesized structures have the general size and surface composition of natural HDL and bind free cholesterol with a Kd of 4 nM.

  1. Genome Expression Pathway Analysis Tool – Analysis and visualization of microarray gene expression data under genomic, proteomic and metabolic context

    PubMed Central

    Weniger, Markus; Engelmann, Julia C; Schultz, Jörg

    2007-01-01

    Background Regulation of gene expression is relevant to many areas of biology and medicine, in the study of treatments, diseases, and developmental stages. Microarrays can be used to measure the expression level of thousands of mRNAs at the same time, allowing insight into or comparison of different cellular conditions. The data derived out of microarray experiments is highly dimensional and often noisy, and interpretation of the results can get intricate. Although programs for the statistical analysis of microarray data exist, most of them lack an integration of analysis results and biological interpretation. Results We have developed GEPAT, Genome Expression Pathway Analysis Tool, offering an analysis of gene expression data under genomic, proteomic and metabolic context. We provide an integration of statistical methods for data import and data analysis together with a biological interpretation for subsets of probes or single probes on the chip. GEPAT imports various types of oligonucleotide and cDNA array data formats. Different normalization methods can be applied to the data, afterwards data annotation is performed. After import, GEPAT offers various statistical data analysis methods, as hierarchical, k-means and PCA clustering, a linear model based t-test or chromosomal profile comparison. The results of the analysis can be interpreted by enrichment of biological terms, pathway analysis or interaction networks. Different biological databases are included, to give various information for each probe on the chip. GEPAT offers no linear work flow, but allows the usage of any subset of probes and samples as a start for a new data analysis. GEPAT relies on established data analysis packages, offers a modular approach for an easy extension, and can be run on a computer grid to allow a large number of users. It is freely available under the LGPL open source license for academic and commercial users at . Conclusion GEPAT is a modular, scalable and professional-grade software integrating analysis and interpretation of microarray gene expression data. An installation available for academic users can be found at . PMID:17543125

  2. Sex genes for genomic analysis in human brain: internal controls for comparison of probe level data extraction.

    PubMed Central

    Galfalvy, Hanga C; Erraji-Benchekroun, Loubna; Smyrniotopoulos, Peggy; Pavlidis, Paul; Ellis, Steven P; Mann, J John; Sibille, Etienne; Arango, Victoria

    2003-01-01

    Background Genomic studies of complex tissues pose unique analytical challenges for assessment of data quality, performance of statistical methods used for data extraction, and detection of differentially expressed genes. Ideally, to assess the accuracy of gene expression analysis methods, one needs a set of genes which are known to be differentially expressed in the samples and which can be used as a "gold standard". We introduce the idea of using sex-chromosome genes as an alternative to spiked-in control genes or simulations for assessment of microarray data and analysis methods. Results Expression of sex-chromosome genes were used as true internal biological controls to compare alternate probe-level data extraction algorithms (Microarray Suite 5.0 [MAS5.0], Model Based Expression Index [MBEI] and Robust Multi-array Average [RMA]), to assess microarray data quality and to establish some statistical guidelines for analyzing large-scale gene expression. These approaches were implemented on a large new dataset of human brain samples. RMA-generated gene expression values were markedly less variable and more reliable than MAS5.0 and MBEI-derived values. A statistical technique controlling the false discovery rate was applied to adjust for multiple testing, as an alternative to the Bonferroni method, and showed no evidence of false negative results. Fourteen probesets, representing nine Y- and two X-chromosome linked genes, displayed significant sex differences in brain prefrontal cortex gene expression. Conclusion In this study, we have demonstrated the use of sex genes as true biological internal controls for genomic analysis of complex tissues, and suggested analytical guidelines for testing alternate oligonucleotide microarray data extraction protocols and for adjusting multiple statistical analysis of differentially expressed genes. Our results also provided evidence for sex differences in gene expression in the brain prefrontal cortex, supporting the notion of a putative direct role of sex-chromosome genes in differentiation and maintenance of sexual dimorphism of the central nervous system. Importantly, these analytical approaches are applicable to all microarray studies that include male and female human or animal subjects. PMID:12962547

  3. Sex genes for genomic analysis in human brain: internal controls for comparison of probe level data extraction.

    PubMed

    Galfalvy, Hanga C; Erraji-Benchekroun, Loubna; Smyrniotopoulos, Peggy; Pavlidis, Paul; Ellis, Steven P; Mann, J John; Sibille, Etienne; Arango, Victoria

    2003-09-08

    Genomic studies of complex tissues pose unique analytical challenges for assessment of data quality, performance of statistical methods used for data extraction, and detection of differentially expressed genes. Ideally, to assess the accuracy of gene expression analysis methods, one needs a set of genes which are known to be differentially expressed in the samples and which can be used as a "gold standard". We introduce the idea of using sex-chromosome genes as an alternative to spiked-in control genes or simulations for assessment of microarray data and analysis methods. Expression of sex-chromosome genes were used as true internal biological controls to compare alternate probe-level data extraction algorithms (Microarray Suite 5.0 [MAS5.0], Model Based Expression Index [MBEI] and Robust Multi-array Average [RMA]), to assess microarray data quality and to establish some statistical guidelines for analyzing large-scale gene expression. These approaches were implemented on a large new dataset of human brain samples. RMA-generated gene expression values were markedly less variable and more reliable than MAS5.0 and MBEI-derived values. A statistical technique controlling the false discovery rate was applied to adjust for multiple testing, as an alternative to the Bonferroni method, and showed no evidence of false negative results. Fourteen probesets, representing nine Y- and two X-chromosome linked genes, displayed significant sex differences in brain prefrontal cortex gene expression. In this study, we have demonstrated the use of sex genes as true biological internal controls for genomic analysis of complex tissues, and suggested analytical guidelines for testing alternate oligonucleotide microarray data extraction protocols and for adjusting multiple statistical analysis of differentially expressed genes. Our results also provided evidence for sex differences in gene expression in the brain prefrontal cortex, supporting the notion of a putative direct role of sex-chromosome genes in differentiation and maintenance of sexual dimorphism of the central nervous system. Importantly, these analytical approaches are applicable to all microarray studies that include male and female human or animal subjects.

  4. Gene expression profile of blood cells for the prediction of delayed cerebral ischemia after intracranial aneurysm rupture: a pilot study in humans.

    PubMed

    Baumann, Antoine; Devaux, Yvan; Audibert, Gérard; Zhang, Lu; Bracard, Serge; Colnat-Coulbois, Sophie; Klein, Olivier; Zannad, Faiez; Charpentier, Claire; Longrois, Dan; Mertes, Paul-Michel

    2013-01-01

    Delayed cerebral ischemia (DCI) is a potentially devastating complication after intracranial aneurysm rupture and its mechanisms remain poorly elucidated. Early identification of the patients prone to developing DCI after rupture may represent a major breakthrough in its prevention and treatment. The single gene approach of DCI has demonstrated interest in humans. We hypothesized that whole genome expression profile of blood cells may be useful for better comprehension and prediction of aneurysmal DCI. Over a 35-month period, 218 patients with aneurysm rupture were included in this study. DCI was defined as the occurrence of a new delayed neurological deficit occurring within 2 weeks after aneurysm rupture with evidence of ischemia either on perfusion-diffusion MRI, CT angiography or CT perfusion imaging, or with cerebral angiography. DCI patients were matched against controls based on 4 out of 5 criteria (age, sex, Fisher grade, aneurysm location and smoking status). Genome-wide expression analysis of blood cells obtained at admission was performed by microarrays. Transcriptomic analysis was performed using long oligonucleotide microarrays representing 25,000 genes. Quantitative PCR: 1 µg of total RNA extracted was reverse-transcribed, and the resulting cDNA was diluted 10-fold before performing quantitative PCR. Microarray data were first analyzed by 'Significance Analysis of Microarrays' software which includes the Benjamini correction for multiple testing. In a second step, microarray data fold change was compared using a two-tailed, paired t test. Analysis of receiver-operating characteristic (ROC) curves and the area under the ROC curves were used for prediction analysis. Logistic regression models were used to investigate the additive value of multiple biomarkers. A total of 16 patients demonstrated DCI. Significance Analysis of Microarrays software failed to retrieve significant genes, most probably because of the heterogeneity of the patients included in the microarray experiments and the small size of the DCI population sample. Standard two-tailed paired t test and C-statistic revealed significant associations between gene expression and the occurrence of DCI: in particular, the expression of neuroregulin 1 was 1.6-fold upregulated in patients with DCI (p = 0.01) and predicted DCI with an area under the ROC curve of 0.96. Logistic regression analyses revealed a significant association between neuroregulin 1 and DCI (odds ratio 1.46, 95% confidence interval 1.02-2.09, p = 0.02). This pilot study suggests that blood cells may be a reservoir of prognostic biomarkers of DCI in patients with intracranial aneurysm rupture. Despite an evident lack of power, this study elicited neuroregulin 1, a vasoreactivity-, inflammation- and angiogenesis-related gene, as a possible candidate predictor of DCI. Larger cohort studies are needed but genome-wide microarray-based studies are promising research tools for the understanding of DCI after intracranial aneurysm rupture. © 2013 S. Karger AG, Basel.

  5. Human Leukocyte Antigen Typing Using a Knowledge Base Coupled with a High-Throughput Oligonucleotide Probe Array Analysis

    PubMed Central

    Zhang, Guang Lan; Keskin, Derin B.; Lin, Hsin-Nan; Lin, Hong Huang; DeLuca, David S.; Leppanen, Scott; Milford, Edgar L.; Reinherz, Ellis L.; Brusic, Vladimir

    2014-01-01

    Human leukocyte antigens (HLA) are important biomarkers because multiple diseases, drug toxicity, and vaccine responses reveal strong HLA associations. Current clinical HLA typing is an elimination process requiring serial testing. We present an alternative in situ synthesized DNA-based microarray method that contains hundreds of thousands of probes representing a complete overlapping set covering 1,610 clinically relevant HLA class I alleles accompanied by computational tools for assigning HLA type to 4-digit resolution. Our proof-of-concept experiment included 21 blood samples, 18 cell lines, and multiple controls. The method is accurate, robust, and amenable to automation. Typing errors were restricted to homozygous samples or those with very closely related alleles from the same locus, but readily resolved by targeted DNA sequencing validation of flagged samples. High-throughput HLA typing technologies that are effective, yet inexpensive, can be used to analyze the world’s populations, benefiting both global public health and personalized health care. PMID:25505899

  6. Protein detection using biobarcodes.

    PubMed

    Müller, Uwe R

    2006-10-01

    Over the past 50 years the development of assays for the detection of protein analytes has been driven by continuing demands for higher levels of sensitivity and multiplexing. The result has been a progression of sandwich-type immunoassays, starting with simple radioisotopic, colorimetric, or fluorescent labeling systems to include various enzymatic or nanostructure-based signal amplification schemes, with a concomitant sensitivity increase of over 1 million fold. Multiplexing of samples and tests has been enabled by microplate and microarray platforms, respectively, or lately by various molecular barcoding systems. Two different platforms have emerged as the current front-runners by combining a nucleic acid amplification step with the standard two-sided immunoassay. In both, the captured protein analyte is replaced by a multiplicity of oligonucleotides that serve as surrogate targets. One of these platforms employs DNA or RNA polymerases for the amplification step, while detection is by fluorescence. The other is based on gold nanoparticles for both amplification as well as detection. The latter technology, now termed Biobarcode, is completely enzyme-free and offers potentially much higher multiplexing power.

  7. Pentopyranosyl Oligonucleotide Systems. Part 11: Systems with Shortened Backbones: D)-beta-Ribopyranosyl-(4 yields 3 )- and (L)-alpha - Lyxopyranosyl-(4 yields 3 )-oligonucleotides

    NASA Technical Reports Server (NTRS)

    Wippo, Harald; Reck, Folkert; Kudick, Rene; Ramaseshan, Mahesh; Ceulemans, Griet; Bolli, Martin; Krishnamurthy, Ramanarayanan; Eschenmoser, Albert

    2001-01-01

    The (L)-a-lyxopyranosyl-(4'yields 3')-oligonucleotide system-a member of a pentopyranosyl oligonucleotide family containing a shortened backbone-is capable of cooperative base-pairing and of cross-pairing with DNA and RNA. In contrast, corresponding (D)-beta-ribopyransoyl-(4' yields 3')-oligonucleotides do not show base-pairing under similar conditions. We conclude that oligonucleotide systems can violate the six-bonds-per-backbone-unit rule by having five bonds instead, if their vicinally bound phosphodiester bridges can assume an antiperiplanar conformation. An additional structural feature that seems relevant to the cross-pairing capability of the (L)-a-lyxopyranosyl-(4' yields 3')-oligonucleotide system is its (small) backbone/basepair axes inclination. An inclination which is similar to that in B-DNA seems to be a prerequisite for an oligonucleotide system s capability to cross-pair with DNA.

  8. Oligonucleotide-based biosensors for in vitro diagnostics and environmental hazard detection.

    PubMed

    Jung, Il Young; Lee, Eun Hee; Suh, Ah Young; Lee, Seung Jin; Lee, Hyukjin

    2016-04-01

    Oligonucleotide-based biosensors have drawn much attention because of their broad applications in in vitro diagnostics and environmental hazard detection. They are particularly of interest to many researchers because of their high specificity as well as excellent sensitivity. Recently, oligonucleotide-based biosensors have been used to achieve not only genetic detection of targets but also the detection of small molecules, peptides, and proteins. This has further broadened the applications of these sensors in the medical and health care industry. In this review, we highlight various examples of oligonucleotide-based biosensors for the detection of diseases, drugs, and environmentally hazardous chemicals. Each example is provided with detailed schematics of the detection mechanism in addition to the supporting experimental results. Furthermore, future perspectives and new challenges in oligonucleotide-based biosensors are discussed.

  9. An automated microfluidic DNA microarray platform for genetic variant detection in inherited arrhythmic diseases.

    PubMed

    Huang, Shu-Hong; Chang, Yu-Shin; Juang, Jyh-Ming Jimmy; Chang, Kai-Wei; Tsai, Mong-Hsun; Lu, Tzu-Pin; Lai, Liang-Chuan; Chuang, Eric Y; Huang, Nien-Tsu

    2018-03-12

    In this study, we developed an automated microfluidic DNA microarray (AMDM) platform for point mutation detection of genetic variants in inherited arrhythmic diseases. The platform allows for automated and programmable reagent sequencing under precise conditions of hybridization flow and temperature control. It is composed of a commercial microfluidic control system, a microfluidic microarray device, and a temperature control unit. The automated and rapid hybridization process can be performed in the AMDM platform using Cy3 labeled oligonucleotide exons of SCN5A genetic DNA, which produces proteins associated with sodium channels abundant in the heart (cardiac) muscle cells. We then introduce a graphene oxide (GO)-assisted DNA microarray hybridization protocol to enable point mutation detection. In this protocol, a GO solution is added after the staining step to quench dyes bound to single-stranded DNA or non-perfectly matched DNA, which can improve point mutation specificity. As proof-of-concept we extracted the wild-type and mutant of exon 12 and exon 17 of SCN5A genetic DNA from patients with long QT syndrome or Brugada syndrome by touchdown PCR and performed a successful point mutation discrimination in the AMDM platform. Overall, the AMDM platform can greatly reduce laborious and time-consuming hybridization steps and prevent potential contamination. Furthermore, by introducing the reciprocating flow into the microchannel during the hybridization process, the total assay time can be reduced to 3 hours, which is 6 times faster than the conventional DNA microarray. Given the automatic assay operation, shorter assay time, and high point mutation discrimination, we believe that the AMDM platform has potential for low-cost, rapid and sensitive genetic testing in a simple and user-friendly manner, which may benefit gene screening in medical practice.

  10. Genotyping microarray (gene chip) for the ABCR (ABCA4) gene.

    PubMed

    Jaakson, K; Zernant, J; Külm, M; Hutchinson, A; Tonisson, N; Glavac, D; Ravnik-Glavac, M; Hawlina, M; Meltzer, M R; Caruso, R C; Testa, F; Maugeri, A; Hoyng, C B; Gouras, P; Simonelli, F; Lewis, R A; Lupski, J R; Cremers, F P M; Allikmets, R

    2003-11-01

    Genetic variation in the ABCR (ABCA4) gene has been associated with five distinct retinal phenotypes, including Stargardt disease/fundus flavimaculatus (STGD/FFM), cone-rod dystrophy (CRD), and age-related macular degeneration (AMD). Comparative genetic analyses of ABCR variation and diagnostics have been complicated by substantial allelic heterogeneity and by differences in screening methods. To overcome these limitations, we designed a genotyping microarray (gene chip) for ABCR that includes all approximately 400 disease-associated and other variants currently described, enabling simultaneous detection of all known ABCR variants. The ABCR genotyping microarray (the ABCR400 chip) was constructed by the arrayed primer extension (APEX) technology. Each sequence change in ABCR was included on the chip by synthesis and application of sequence-specific oligonucleotides. We validated the chip by screening 136 confirmed STGD patients and 96 healthy controls, each of whom we had analyzed previously by single strand conformation polymorphism (SSCP) technology and/or heteroduplex analysis. The microarray was >98% effective in determining the existing genetic variation and was comparable to direct sequencing in that it yielded many sequence changes undetected by SSCP. In STGD patient cohorts, the efficiency of the array to detect disease-associated alleles was between 54% and 78%, depending on the ethnic composition and degree of clinical and molecular characterization of a cohort. In addition, chip analysis suggested a high carrier frequency (up to 1:10) of ABCR variants in the general population. The ABCR genotyping microarray is a robust, cost-effective, and comprehensive screening tool for variation in one gene in which mutations are responsible for a substantial fraction of retinal disease. The ABCR chip is a prototype for the next generation of screening and diagnostic tools in ophthalmic genetics, bridging clinical and scientific research. Copyright 2003 Wiley-Liss, Inc.

  11. Chromosome r(10)(p15.3q26.12) in a newborn child: case report.

    PubMed

    Gunnarsson, Cecilia; Graffmann, Barbara; Jonasson, Jon

    2009-12-07

    Ring chromosome 10 is a rare cytogenetic finding. Of the less than 10 reported cases we have found in the literature, none was characterized using high-resolution microarray analysis. Ring chromosomes are frequently unstable due to sister chromatid exchanges and mitotic failures. When mosaicism is present, the interpretation of genotype-phenotype correlations becomes extremely difficult. We report on a newborn girl with growth retardation, microcephaly, congenital heart defects, dysmorphic features and psychomotor retardation. Karyotyping revealed a non-mosaic apparently stable ring chromosome 10 replacing one of the normal homologues in all analyzed metaphases. High-resolution oligonucleotide microarray analysis showed a de novo approximately 12.5 Mb terminal deletion 10q26.12 -> qter and a corresponding 285 kb terminal deletion of 10pter -> p15.3. This case demonstrates that an increased nuchal translucency thickness detected by early ultrasonography should preferably lead to not only QF-PCR for the diagnosis of Down syndrome but also karyotyping. In the future, microarray analysis, which needs further evaluation, might become the method of choice. The clinical phenotype of our patient was in agreement with that of patients with a terminal 10q deletion. For the purpose of genotype-phenotype analysis, there seems to be no need for a "ring syndrome" concept.

  12. Detection of Porphyromonas endodontalis, Porphyromonas gingivalis and Prevotella intermedia in primary endodontic infections in a Chinese population.

    PubMed

    Cao, H; Qi, Z; Jiang, H; Zhao, J; Liu, Z; Tang, Z

    2012-08-01

    To assess the prevalence of three black-pigmented bacterial species (Porphyromonas endodontalis, Porphyromonas gingivalis and Prevotella intermedia) using microarray technology in root canals of teeth associated with primary endodontic infections in a Chinese population. Microbial samples were taken from root canals of 80 teeth with pulp necrosis and primary endodontic infections in a Chinese population. DNA extracted from the samples was amplified by PCR with universal bacterial primers based on 16S rRNA gene sequences, and the products hybridized with the microarrays in which the specific oligonucleotide probes were added. The results of hybridization were screened by a confocal laser scanner. Pearson chi-square test and the two-sided Fisher exact test were used to analyse whether a significant association existed between the species and symptoms as well as in co-existence of two target organisms by a statistical software package (SAS 8.02). The 16S rRNA gene microarray detected at least one of the three test species in 76% of the study teeth. P. endodontalis, P. gingivalis and P. intermedia were found in 50%, 33% and 45%, respectively. A significant association was found in the presence of the pair P. endodontalis / P. gingivalis (P < 0.005). Both P. endodontalis (P <0.05) and P. gingivalis (P <0.005) had a statistically significant association with the presence of a sinus tract. The simultaneous presence of P. endodontalis and P. gingivalis was also associated with the presence of a sinus tract (P<0.005) and abscess formation (P<0.05). The three black-pigmented bacteria were prevalent in teeth with pulp necrosis and primary endodontic infections in a Chinese population. P. gingivalis and P. endodontalis were associated with the presence of sinus tract and abscess formation. © 2012 International Endodontic Journal.

  13. Construction and Validation of the Rhodobacter sphaeroides 2.4.1 DNA Microarray: Transcriptome Flexibility at Diverse Growth Modes

    PubMed Central

    Pappas, Christopher T.; Sram, Jakub; Moskvin, Oleg V.; Ivanov, Pavel S.; Mackenzie, R. Christopher; Choudhary, Madhusudan; Land, Miriam L.; Larimer, Frank W.; Kaplan, Samuel; Gomelsky, Mark

    2004-01-01

    A high-density oligonucleotide DNA microarray, a genechip, representing the 4.6-Mb genome of the facultative phototrophic proteobacterium, Rhodobacter sphaeroides 2.4.1, was custom-designed and manufactured by Affymetrix, Santa Clara, Calif. The genechip contains probe sets for 4,292 open reading frames (ORFs), 47 rRNA and tRNA genes, and 394 intergenic regions. The probe set sequences were derived from the genome annotation generated by Oak Ridge National Laboratory after extensive revision, which was based primarily upon codon usage characteristic of this GC-rich bacterium. As a result of the revision, numerous missing ORFs were uncovered, nonexistent ORFs were deleted, and misidentified start codons were corrected. To evaluate R. sphaeroides transcriptome flexibility, expression profiles for three diverse growth modes—aerobic respiration, anaerobic respiration in the dark, and anaerobic photosynthesis—were generated. Expression levels of one-fifth to one-third of the R. sphaeroides ORFs were significantly different in cells under any two growth modes. Pathways involved in energy generation and redox balance maintenance under three growth modes were reconstructed. Expression patterns of genes involved in these pathways mirrored known functional changes, suggesting that massive changes in gene expression are the major means used by R. sphaeroides in adaptation to diverse conditions. Differential expression was observed for genes encoding putative new participants in these pathways (additional photosystem genes, duplicate NADH dehydrogenase, ATP synthases), whose functionality has yet to be investigated. The DNA microarray data correlated well with data derived from quantitative reverse transcription-PCR, as well as with data from the literature, thus validating the R. sphaeroides genechip as a powerful and reliable tool for studying unprecedented metabolic versatility of this bacterium. PMID:15231807

  14. Altered gene expression in the brain and ovaries of zebrafish (Danio rerio) exposed to the aromatase inhibitor fadrozole: microarray analysis and hypothesis generation.

    PubMed

    Villeneuve, L; Wang, Rong-Lin; Bencic, David C; Biales, Adam D; Martinović, Dalma; Lazorchak, James M; Toth, Gregory; Ankley, Gerald T

    2009-08-01

    As part of a research effort examining system-wide responses of the hypothalamic-pituitary-gonadal (HPG) axis in fish to endocrine-active chemicals (EACs) with different modes of action, zebrafish (Danio rerio) were exposed to 25 or 100 microg/L of the aromatase inhibitor fadrozole for 24, 48, or 96 h. Global transcriptional response in brain and ovarian tissue of fish exposed to 25 microg/L of fadrozole was compared to that in control fish using a commercially available, 22,000-gene oligonucleotide microarray. Transcripts altered in brain were functionally linked to differentiation, development, DNA replication, and cell cycle. Additionally, multiple genes associated with the one-carbon pool by folate pathway (KEGG 00670) were significantly up-regulated. Transcripts altered in ovary were functionally linked to cell-cell adhesion, extracellular matrix, vasculogenesis, and development. Promoter motif analysis identified GATA-binding factor 2, Ikaros 2, alcohol dehydrogenase gene regulator 1, myoblast-determining factor, and several heat shock factors as being associated with coexpressed gene clusters that were differentially expressed following exposure to fadrozole. Based on the transcriptional changes observed, it was hypothesized that fadrozole elicits neurodegenerative stress in brain tissue and that fish cope with this stress through proliferation of radial glial cells. Additionally, it was hypothesized that changes of gene expression in the ovary of fadrozole-exposed zebrafish reflect disruption of oocyte maturation and ovulation because of impaired vitellogenesis. These hypotheses and others derived from the microarray results provide a foundation for future studies aimed at understanding responses of the HPG axis to EACs and other chemical stressors.

  15. Global gene expression analysis of apple fruit development from the floral bud to ripe fruit

    PubMed Central

    Janssen, Bart J; Thodey, Kate; Schaffer, Robert J; Alba, Rob; Balakrishnan, Lena; Bishop, Rebecca; Bowen, Judith H; Crowhurst, Ross N; Gleave, Andrew P; Ledger, Susan; McArtney, Steve; Pichler, Franz B; Snowden, Kimberley C; Ward, Shayna

    2008-01-01

    Background Apple fruit develop over a period of 150 days from anthesis to fully ripe. An array representing approximately 13000 genes (15726 oligonucleotides of 45–55 bases) designed from apple ESTs has been used to study gene expression over eight time points during fruit development. This analysis of gene expression lays the groundwork for a molecular understanding of fruit growth and development in apple. Results Using ANOVA analysis of the microarray data, 1955 genes showed significant changes in expression over this time course. Expression of genes is coordinated with four major patterns of expression observed: high in floral buds; high during cell division; high when starch levels and cell expansion rates peak; and high during ripening. Functional analysis associated cell cycle genes with early fruit development and three core cell cycle genes are significantly up-regulated in the early stages of fruit development. Starch metabolic genes were associated with changes in starch levels during fruit development. Comparison with microarrays of ethylene-treated apple fruit identified a group of ethylene induced genes also induced in normal fruit ripening. Comparison with fruit development microarrays in tomato has been used to identify 16 genes for which expression patterns are similar in apple and tomato and these genes may play fundamental roles in fruit development. The early phase of cell division and tissue specification that occurs in the first 35 days after pollination has been associated with up-regulation of a cluster of genes that includes core cell cycle genes. Conclusion Gene expression in apple fruit is coordinated with specific developmental stages. The array results are reproducible and comparisons with experiments in other species has been used to identify genes that may play a fundamental role in fruit development. PMID:18279528

  16. Global gene expression analysis of apple fruit development from the floral bud to ripe fruit.

    PubMed

    Janssen, Bart J; Thodey, Kate; Schaffer, Robert J; Alba, Rob; Balakrishnan, Lena; Bishop, Rebecca; Bowen, Judith H; Crowhurst, Ross N; Gleave, Andrew P; Ledger, Susan; McArtney, Steve; Pichler, Franz B; Snowden, Kimberley C; Ward, Shayna

    2008-02-17

    Apple fruit develop over a period of 150 days from anthesis to fully ripe. An array representing approximately 13000 genes (15726 oligonucleotides of 45-55 bases) designed from apple ESTs has been used to study gene expression over eight time points during fruit development. This analysis of gene expression lays the groundwork for a molecular understanding of fruit growth and development in apple. Using ANOVA analysis of the microarray data, 1955 genes showed significant changes in expression over this time course. Expression of genes is coordinated with four major patterns of expression observed: high in floral buds; high during cell division; high when starch levels and cell expansion rates peak; and high during ripening. Functional analysis associated cell cycle genes with early fruit development and three core cell cycle genes are significantly up-regulated in the early stages of fruit development. Starch metabolic genes were associated with changes in starch levels during fruit development. Comparison with microarrays of ethylene-treated apple fruit identified a group of ethylene induced genes also induced in normal fruit ripening. Comparison with fruit development microarrays in tomato has been used to identify 16 genes for which expression patterns are similar in apple and tomato and these genes may play fundamental roles in fruit development. The early phase of cell division and tissue specification that occurs in the first 35 days after pollination has been associated with up-regulation of a cluster of genes that includes core cell cycle genes. Gene expression in apple fruit is coordinated with specific developmental stages. The array results are reproducible and comparisons with experiments in other species has been used to identify genes that may play a fundamental role in fruit development.

  17. Expression of HOXB2, a retinoic acid signaling target in pancreatic cancer and pancreatic intraepithelial neoplasia.

    PubMed

    Segara, Davendra; Biankin, Andrew V; Kench, James G; Langusch, Catherine C; Dawson, Amanda C; Skalicky, David A; Gotley, David C; Coleman, Maxwell J; Sutherland, Robert L; Henshall, Susan M

    2005-05-01

    Despite significant progress in understanding the molecular pathology of pancreatic cancer and its precursor lesion: pancreatic intraepithelial neoplasia (PanIN), there remain no molecules with proven clinical utility as prognostic or therapeutic markers. Here, we used oligonucleotide microarrays to interrogate mRNA expression of pancreatic cancer tissue and normal pancreas to identify novel molecular pathways dysregulated in the development and progression of pancreatic cancer. RNA was hybridized to Affymetrix Genechip HG-U133 oligonucleotide microarrays. A relational database integrating data from publicly available resources was created to identify candidate genes potentially relevant to pancreatic cancer. The protein expression of one candidate, homeobox B2 (HOXB2), in PanIN and pancreatic cancer was assessed using immunohistochemistry. We identified aberrant expression of several components of the retinoic acid (RA) signaling pathway (RARalpha, MUC4, Id-1, MMP9, uPAR, HB-EGF, HOXB6, and HOXB2), many of which are known to be aberrantly expressed in pancreatic cancer and PanIN. HOXB2, a downstream target of RA, was up-regulated 6.7-fold in pancreatic cancer compared with normal pancreas. Immunohistochemistry revealed ectopic expression of HOXB2 in 15% of early PanIN lesions and 48 of 128 (38%) pancreatic cancer specimens. Expression of HOXB2 was associated with nonresectable tumors and was an independent predictor of poor survival in resected tumors. We identified aberrant expression of RA signaling components in pancreatic cancer, including HOXB2, which was expressed in a proportion of PanIN lesions. Ectopic expression of HOXB2 was associated with a poor prognosis for all patients with pancreatic cancer and was an independent predictor of survival in patients who underwent resection.

  18. Genomic Analysis of Vaccine-Derived Poliovirus Strains in Stool Specimens by Combination of Full-Length PCR and Oligonucleotide Microarray Hybridization

    PubMed Central

    Laassri, Majid; Dragunsky, Eugenia; Enterline, Joan; Eremeeva, Tatiana; Ivanova, Olga; Lottenbach, Kathleen; Belshe, Robert; Chumakov, Konstantin

    2005-01-01

    Sabin strains of poliovirus used in the manufacture of oral poliovirus vaccine (OPV) are prone to genetic variations that occur during growth in cell cultures and the organisms of vaccine recipients. Such derivative viruses often have increased neurovirulence and transmissibility, and in some cases they can reestablish chains of transmission in human populations. Monitoring for vaccine-derived polioviruses is an important part of the worldwide campaign to eradicate poliomyelitis. Analysis of vaccine-derived polioviruses requires, as a first step, their isolation in cell cultures, which takes significant time and may yield viral stocks that are not fully representative of the strains present in the original sample. Here we demonstrate that full-length viral cDNA can be PCR amplified directly from stool samples and immediately subjected to genomic analysis by oligonucleotide microarray hybridization and nucleotide sequencing. Most fecal samples from healthy children who received OPV were found to contain variants of Sabin vaccine viruses. Sequence changes in the 5′ untranslated region were common, as were changes in the VP1-coding region, including changes in a major antigenic site. Analysis of stool samples taken from cases of acute flaccid paralysis revealed the presence of mixtures of recombinant polioviruses, in addition to the emergence of new sequence variants. Avoiding the need for cell culture isolation dramatically shortened the time needed for identification and analysis of vaccine-derived polioviruses and could be useful for preliminary screening of clinical samples. The amplified full-length viral cDNA can be archived and used to recover live virus for further virological studies. PMID:15956413

  19. Under the influence of the active deodorant ingredient 4-hydroxy-3-methoxybenzyl alcohol, the skin bacterium Corynebacterium jeikeium moderately responds with differential gene expression.

    PubMed

    Brune, Iris; Becker, Anke; Paarmann, Daniel; Albersmeier, Andreas; Kalinowski, Jörn; Pühler, Alfred; Tauch, Andreas

    2006-12-15

    A 70mer oligonucleotide microarray was constructed to analyze genome-wide expression profiles of Corynebacterium jeikeium, a skin bacterium that is predominantly present in the human axilla and involved in axillary odor formation. Oligonucleotides representing 100% of the predicted coding regions of the C. jeikeium K411 genome were designed and spotted in quadruplicate onto epoxy-coated glass slides. The quality of the printed microarray was demonstrated by co-hybridization with fluorescently labeled cDNA probes obtained from exponentially growing C. jeikeium cultures. Accordingly, genes detected with different intensities resulting in log(2) transformed ratios greater than 0.8 or smaller than -0.8 can be regarded as differentially expressed with a confidence level greater than 99%. In an application example, we measured global changes of gene expression during growth of C. jeikeium in the presence of different concentrations of the deodorant component 4-hydroxy-3-methoxybenzyl alcohol that is active in preventing body odor formation. Global expression profiling revealed that low concentrations of 4-hydroxy-3-methoxybenzyl alcohol (0.5 and 2.5mg/ml) had almost no detectable effect on the transcriptome of C. jeikeium. A slightly higher concentration of 4-hydroxy-3-methoxybenzyl alcohol (5mg/ml) resulted in differential expression of 95 genes, 86 of which showed an enhanced expression when compared to a control culture. Besides many genes encoding proteins that apparently participate in transcription and translation, the drug resistance determinant cmx and the predicted virulence factors sapA and sapD showed significantly enhanced expression levels. Differential expression of relevant genes was validated by real-time reverse transcription PCR assays.

  20. Oligonucleotide microarray analysis of apoptosis induced by 15-methoxypinusolidic acid in microglial BV2 cells

    PubMed Central

    Choi, Y; Lim, SY; Jeong, HS; Koo, KA; Sung, SH; Kim, YC

    2009-01-01

    Background and purpose: We conducted a genome wide gene expression analysis to explore the biological aspects of 15-methoxypinusolidic acid (15-MPA) isolated from Biota orientalis and tried to confirm the suitability of 15-MPA as a therapeutic candidate for CNS injuries focusing on microglia. Experimental approach: Murine microglial BV2 cells were treated with 15-MPA, and their transcriptome was analysed by using oligonucleotide microarrays. Genes differentially expressed upon 15-MPA treatment were selected for RT-PCR (reverse transcription-polymerase chain reaction) analysis to confirm the gene expression. Inhibition of cell proliferation and induction of apoptosis by 15-MPA were examined by bromodeoxyuridine assay, Western blot analysis of poly-ADP-ribose polymerase and flow cytometry. Key results: A total of 514 genes were differentially expressed by 15-MPA treatment. Biological pathway analysis revealed that 15-MPA induced significant changes in expression of genes in the cell cycle pathway. Genes involved in growth arrest and DNA damage [gadd45α, gadd45γ and ddit3 (DNA damage-inducible transcript 3)] and cyclin-dependent kinase inhibitor (cdkn2b) were up-regulated, whereas genes involved in cell cycle progression (ccnd1, ccnd3 and ccne1), DNA replication (mcm4, orc1l and cdc6) and cell proliferation (fos and jun) were down-regulated. RT-PCR analysis for representative genes confirmed the expression levels. 15-MPA significantly reduced bromodeoxyuridine incorporation, increased poly-ADP-ribose polymerase cleavage and the number of apoptotic cells, indicating that 15-MPA induces apoptosis in BV2 cells. Conclusion and implications: 15-MPA induced apoptosis in murine microglial cells, presumably via inhibition of the cell cycle progression. As microglial activation is detrimental in CNS injuries, these data suggest a strong therapeutic potential of 15-MPA. PMID:19466985

  1. Oligonucleotide assisted light-emitting Alq3 microrods: energy transfer effect with fluorescent dyes.

    PubMed

    Cui, Chunzhi; Park, Dong Hyuk; Kim, Jeongyong; Joo, Jinsoo; Ahn, Dong June

    2013-06-14

    Oligonucleotide assisted tri(8-hydroxyquinoline) aluminium (Alq3) microrods were prepared for the first time. When hybridized with oligonucleotide labeled by Cy3 fluorescent dye, a significant photoluminescence variation of the Alq3 microrods was observed due to Förster resonance energy transfer, unlike when Cy5-oligonucleotide was used. Versatile nucleotide manipulation would open up wider applications of Alq3-based materials, based on this fundamental observation.

  2. Gene ARMADA: an integrated multi-analysis platform for microarray data implemented in MATLAB.

    PubMed

    Chatziioannou, Aristotelis; Moulos, Panagiotis; Kolisis, Fragiskos N

    2009-10-27

    The microarray data analysis realm is ever growing through the development of various tools, open source and commercial. However there is absence of predefined rational algorithmic analysis workflows or batch standardized processing to incorporate all steps, from raw data import up to the derivation of significantly differentially expressed gene lists. This absence obfuscates the analytical procedure and obstructs the massive comparative processing of genomic microarray datasets. Moreover, the solutions provided, heavily depend on the programming skills of the user, whereas in the case of GUI embedded solutions, they do not provide direct support of various raw image analysis formats or a versatile and simultaneously flexible combination of signal processing methods. We describe here Gene ARMADA (Automated Robust MicroArray Data Analysis), a MATLAB implemented platform with a Graphical User Interface. This suite integrates all steps of microarray data analysis including automated data import, noise correction and filtering, normalization, statistical selection of differentially expressed genes, clustering, classification and annotation. In its current version, Gene ARMADA fully supports 2 coloured cDNA and Affymetrix oligonucleotide arrays, plus custom arrays for which experimental details are given in tabular form (Excel spreadsheet, comma separated values, tab-delimited text formats). It also supports the analysis of already processed results through its versatile import editor. Besides being fully automated, Gene ARMADA incorporates numerous functionalities of the Statistics and Bioinformatics Toolboxes of MATLAB. In addition, it provides numerous visualization and exploration tools plus customizable export data formats for seamless integration by other analysis tools or MATLAB, for further processing. Gene ARMADA requires MATLAB 7.4 (R2007a) or higher and is also distributed as a stand-alone application with MATLAB Component Runtime. Gene ARMADA provides a highly adaptable, integrative, yet flexible tool which can be used for automated quality control, analysis, annotation and visualization of microarray data, constituting a starting point for further data interpretation and integration with numerous other tools.

  3. GeoChip 3.0: A High Throughput Tool for Analyzing Microbial Community, Composition, Structure, and Functional Activity

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    He, Zhili; Deng, Ye; Nostrand, Joy Van

    2010-05-17

    Microarray-based genomic technology has been widely used for microbial community analysis, and it is expected that microarray-based genomic technologies will revolutionize the analysis of microbial community structure, function and dynamics. A new generation of functional gene arrays (GeoChip 3.0) has been developed, with 27,812 probes covering 56,990 gene variants from 292 functional gene families involved in carbon, nitrogen, phosphorus and sulfur cycles, energy metabolism, antibiotic resistance, metal resistance, and organic contaminant degradation. Those probes were derived from 2,744, 140, and 262 species for bacteria, archaea, and fungi, respectively. GeoChip 3.0 has several other distinct features, such as a common oligomore » reference standard (CORS) for data normalization and comparison, a software package for data management and future updating, and the gyrB gene for phylogenetic analysis. Our computational evaluation of probe specificity indicated that all designed probes had a high specificity to their corresponding targets. Also, experimental analysis with synthesized oligonucleotides and genomic DNAs showed that only 0.0036percent-0.025percent false positive rates were observed, suggesting that the designed probes are highly specific under the experimental conditions examined. In addition, GeoChip 3.0 was applied to analyze soil microbial communities in a multifactor grassland ecosystem in Minnesota, USA, which demonstrated that the structure, composition, and potential activity of soil microbial communities significantly changed with the plant species diversity. All results indicate that GeoChip 3.0 is a high throughput powerful tool for studying microbial community functional structure, and linking microbial communities to ecosystem processes and functioning. To our knowledge, GeoChip 3.0 is the most comprehensive microarrays currently available for studying microbial communities associated with geobiochemical cycling, global climate change, bioenergy, agricuture, land use, ecosystem management, environmental cleanup and restoration, bioreactor systems, and human health.« less

  4. The delivery of therapeutic oligonucleotides

    PubMed Central

    Juliano, Rudolph L.

    2016-01-01

    The oligonucleotide therapeutics field has seen remarkable progress over the last few years with the approval of the first antisense drug and with promising developments in late stage clinical trials using siRNA or splice switching oligonucleotides. However, effective delivery of oligonucleotides to their intracellular sites of action remains a major issue. This review will describe the biological basis of oligonucleotide delivery including the nature of various tissue barriers and the mechanisms of cellular uptake and intracellular trafficking of oligonucleotides. It will then examine a variety of current approaches for enhancing the delivery of oligonucleotides. This includes molecular scale targeted ligand-oligonucleotide conjugates, lipid- and polymer-based nanoparticles, antibody conjugates and small molecules that improve oligonucleotide delivery. The merits and liabilities of these approaches will be discussed in the context of the underlying basic biology. PMID:27084936

  5. Identification of Cell Cycle-regulated Genes in Fission YeastD⃞

    PubMed Central

    Peng, Xu; Karuturi, R. Krishna Murthy; Miller, Lance D.; Lin, Kui; Jia, Yonghui; Kondu, Pinar; Wang, Long; Wong, Lim-Soon; Liu, Edison T.; Balasubramanian, Mohan K.; Liu, Jianhua

    2005-01-01

    Cell cycle progression is both regulated and accompanied by periodic changes in the expression levels of a large number of genes. To investigate cell cycle-regulated transcriptional programs in the fission yeast Schizosaccharomyces pombe, we developed a whole-genome oligonucleotide-based DNA microarray. Microarray analysis of both wild-type and cdc25 mutant cell cultures was performed to identify transcripts whose levels oscillated during the cell cycle. Using an unsupervised algorithm, we identified 747 genes that met the criteria for cell cycle-regulated expression. Peaks of gene expression were found to be distributed throughout the entire cell cycle. Furthermore, we found that four promoter motifs exhibited strong association with cell cycle phase-specific expression. Examination of the regulation of MCB motif-containing genes through the perturbation of DNA synthesis control/MCB-binding factor (DSC/MBF)-mediated transcription in arrested synchronous cdc10 mutant cell cultures revealed a subset of functional targets of the DSC/MBF transcription factor complex, as well as certain gene promoter requirements. Finally, we compared our data with those for the budding yeast Saccharomyces cerevisiae and found ∼140 genes that are cell cycle regulated in both yeasts, suggesting that these genes may play an evolutionarily conserved role in regulation of cell cycle-specific processes. Our complete data sets are available at http://giscompute.gis.a-star.edu.sg/~gisljh/CDC. PMID:15616197

  6. Application of an oligonucleotide microarray-based nano-amplification technique for the detection of fungal pathogens.

    PubMed

    Lu, Weiping; Gu, Dayong; Chen, Xingyun; Xiong, Renping; Liu, Ping; Yang, Nan; Zhou, Yuanguo

    2010-10-01

    The traditional techniques for diagnosis of invasive fungal infections in the clinical microbiology laboratory need improvement. These techniques are prone to delay results due to their time-consuming process, or result in misidentification of the fungus due to low sensitivity or low specificity. The aim of this study was to develop a method for the rapid detection and identification of fungal pathogens. The internal transcribed spacer two fragments of fungal ribosomal DNA were amplified using a polymerase chain reaction for all samples. Next, the products were hybridized with the probes immobilized on the surface of a microarray. These species-specific probes were designed to detect nine different clinical pathogenic fungi including Candida albicans, Candida tropocalis, Candida glabrata, Candida parapsilosis, Candida krusei, Candida lusitaniae, Candida guilliermondii, Candida keyfr, and Cryptococcus neoformans. The hybridizing signals were enhanced with gold nanoparticles and silver deposition, and detected using a flatbed scanner or visually. Fifty-nine strains of fungal pathogens, including standard and clinically isolated strains, were correctly identified by this method. The sensitivity of the assay for Candida albicans was 10 cells/mL. Ten cultures from clinical specimens and 12 clinical samples spiked with fungi were also identified correctly. This technique offers a reliable alternative to conventional methods for the detection and identification of fungal pathogens. It has higher efficiency, specificity and sensitivity compared with other methods commonly used in the clinical laboratory.

  7. [Study toward practical use of oligonucleotide therapeutics].

    PubMed

    Inoue, Takao; Yoshida, Tokuyuki

    2014-01-01

    Over the past decade, oligonucleotide-based therapeutics such as antisense oligonucleotides and small interfering RNAs (siRNAs) have been developed extensively. For example, mipomersen (Kynamro; ISIS Pharmaceuticals), which is a second-generation antisense oligonucleotide administered by subcutaneous injection, has recently been approved by the FDA for the treatment of homozygous familial hypercholesterolemia. On the other hands, methods for the evaluation of quality, efficacy and safety of oligonucleotide therapeutics have not been fully discussed. Furthermore, the regulatory guidance specific for oligonucleotide therapeutics has not been established yet. Under these circumstances, we started to collaborate with Osaka University and PMDA to discuss regulatory science focused on oligonucleotide therapeutics. Through the collaboration, we would like to propose the possible design of quality evaluation and preclinical safety-evaluation of oligonucleotide therapeutics.

  8. Detecting novel genes with sparse arrays

    PubMed Central

    Haiminen, Niina; Smit, Bart; Rautio, Jari; Vitikainen, Marika; Wiebe, Marilyn; Martinez, Diego; Chee, Christine; Kunkel, Joe; Sanchez, Charles; Nelson, Mary Anne; Pakula, Tiina; Saloheimo, Markku; Penttilä, Merja; Kivioja, Teemu

    2014-01-01

    Species-specific genes play an important role in defining the phenotype of an organism. However, current gene prediction methods can only efficiently find genes that share features such as sequence similarity or general sequence characteristics with previously known genes. Novel sequencing methods and tiling arrays can be used to find genes without prior information and they have demonstrated that novel genes can still be found from extensively studied model organisms. Unfortunately, these methods are expensive and thus are not easily applicable, e.g., to finding genes that are expressed only in very specific conditions. We demonstrate a method for finding novel genes with sparse arrays, applying it on the 33.9 Mb genome of the filamentous fungus Trichoderma reesei. Our computational method does not require normalisations between arrays and it takes into account the multiple-testing problem typical for analysis of microarray data. In contrast to tiling arrays, that use overlapping probes, only one 25mer microarray oligonucleotide probe was used for every 100 b. Thus, only relatively little space on a microarray slide was required to cover the intergenic regions of a genome. The analysis was done as a by-product of a conventional microarray experiment with no additional costs. We found at least 23 good candidates for novel transcripts that could code for proteins and all of which were expressed at high levels. Candidate genes were found to neighbour ire1 and cre1 and many other regulatory genes. Our simple, low-cost method can easily be applied to finding novel species-specific genes without prior knowledge of their sequence properties. PMID:20691772

  9. miRNA-based therapies: Strategies and delivery platforms for oligonucleotide and non-oligonucleotide agents

    PubMed Central

    Baumann, V; Winkler, J

    2015-01-01

    The discovery of microRNAs as important regulatory agents for gene expression has expanded the therapeutic opportunities for oligonucleotides. In contrast to siRNA, miRNA-targeted therapy is able to influence not only a single gene, but entire cellular pathways or processes. It is possible to supplement down regulated or non-functional miRNAs by synthetic oligonucleotides, as well as alleviating effects caused by overexpression of malignant miRNAs through artificial antagonists, either oligonucleotides or small molecules. Chemical oligonucleotide modifications together with an efficient delivery system seem to be mandatory for successful therapeutic application. While miRNA-based therapy benefits from the decades of research spent on other therapeutic oligonucleotides, there are some specific challenges associated with miRNA therapy, mainly caused by the short target sequence. The current status and recent progress of miRNA-targeted therapeutics is described and future challenges and potential applications in treatment of cancer and viral infections are discussed. PMID:25495987

  10. Profiling cellular protein complexes by proximity ligation with dual tag microarray readout.

    PubMed

    Hammond, Maria; Nong, Rachel Yuan; Ericsson, Olle; Pardali, Katerina; Landegren, Ulf

    2012-01-01

    Patterns of protein interactions provide important insights in basic biology, and their analysis plays an increasing role in drug development and diagnostics of disease. We have established a scalable technique to compare two biological samples for the levels of all pairwise interactions among a set of targeted protein molecules. The technique is a combination of the proximity ligation assay with readout via dual tag microarrays. In the proximity ligation assay protein identities are encoded as DNA sequences by attaching DNA oligonucleotides to antibodies directed against the proteins of interest. Upon binding by pairs of antibodies to proteins present in the same molecular complexes, ligation reactions give rise to reporter DNA molecules that contain the combined sequence information from the two DNA strands. The ligation reactions also serve to incorporate a sample barcode in the reporter molecules to allow for direct comparison between pairs of samples. The samples are evaluated using a dual tag microarray where information is decoded, revealing which pairs of tags that have become joined. As a proof-of-concept we demonstrate that this approach can be used to detect a set of five proteins and their pairwise interactions both in cellular lysates and in fixed tissue culture cells. This paper provides a general strategy to analyze the extent of any pairwise interactions in large sets of molecules by decoding reporter DNA strands that identify the interacting molecules.

  11. Electrochemical detection of synthetic DNA and native 16S rRNA fragments on a microarray using a biotinylated intercalator as coupling site for an enzyme label.

    PubMed

    Zimdars, Andreas; Gebala, Magdalena; Hartwich, Gerhard; Neugebauer, Sebastian; Schuhmann, Wolfgang

    2015-10-01

    The direct electrochemical detection of synthetic DNA and native 16S rRNA fragments isolated from Escherichia coli is described. Oligonucleotides are detected via selective post-labeling of double stranded DNA and DNA-RNA duplexes with a biotinylated intercalator that enables high-specific binding of a streptavidin/alkaline phosphatase conjugate. The alkaline phosphatase catalyzes formation of p-aminophenol that is subsequently oxidized at the underlying gold electrode and hence enables the detection of complementary hybridization of the DNA capture strands due to the enzymatic signal amplification. The hybridization assay was performed on microarrays consisting of 32 individually addressable gold microelectrodes. Synthetic DNA strands with sequences representing six different pathogens which are important for the diagnosis of urinary tract infections could be detected at concentrations of 60 nM. Native 16S rRNA isolated from the different pathogens could be detected at a concentration of 30 fM. Optimization of the sensing surface is described and influences on the assay performance are discussed. Copyright © 2015 Elsevier B.V. All rights reserved.

  12. Gene expression analysis of hypersensitivity to mosquito bite, chronic active EBV infection and NK/T-lymphoma/leukemia.

    PubMed

    Washio, Kana; Oka, Takashi; Abdalkader, Lamia; Muraoka, Michiko; Shimada, Akira; Oda, Megumi; Sato, Hiaki; Takata, Katsuyoshi; Kagami, Yoshitoyo; Shimizu, Norio; Kato, Seiichi; Kimura, Hiroshi; Nishizaki, Kazunori; Yoshino, Tadashi; Tsukahara, Hirokazu

    2017-11-01

    The human herpes virus, Epstein-Barr virus (EBV), is a known oncogenic virus and plays important roles in life-threatening T/NK-cell lymphoproliferative disorders (T/NK-cell LPD) such as hypersensitivity to mosquito bite (HMB), chronic active EBV infection (CAEBV), and NK/T-cell lymphoma/leukemia. During the clinical courses of HMB and CAEBV, patients frequently develop malignant lymphomas and the diseases passively progress sequentially. In the present study, gene expression of CD16 (-) CD56 (+) -, EBV (+) HMB, CAEBV, NK-lymphoma, and NK-leukemia cell lines, which were established from patients, was analyzed using oligonucleotide microarrays and compared to that of CD56 bright CD16 dim/- NK cells from healthy donors. Principal components analysis showed that CAEBV and NK-lymphoma cells were relatively closely located, indicating that they had similar expression profiles. Unsupervised hierarchal clustering analyses of microarray data and gene ontology analysis revealed specific gene clusters and identified several candidate genes responsible for disease that can be used to discriminate each category of NK-LPD and NK-cell lymphoma/leukemia.

  13. Methylation detection oligonucleotide microarray analysis: a high-resolution method for detection of CpG island methylation

    PubMed Central

    Kamalakaran, Sitharthan; Kendall, Jude; Zhao, Xiaoyue; Tang, Chunlao; Khan, Sohail; Ravi, Kandasamy; Auletta, Theresa; Riggs, Michael; Wang, Yun; Helland, Åslaug; Naume, Bjørn; Dimitrova, Nevenka; Børresen-Dale, Anne-Lise; Hicks, Jim; Lucito, Robert

    2009-01-01

    Methylation of CpG islands associated with genes can affect the expression of the proximal gene, and methylation of non-associated CpG islands correlates to genomic instability. This epigenetic modification has been shown to be important in many pathologies, from development and disease to cancer. We report the development of a novel high-resolution microarray that detects the methylation status of over 25 000 CpG islands in the human genome. Experiments were performed to demonstrate low system noise in the methodology and that the array probes have a high signal to noise ratio. Methylation measurements between different cell lines were validated demonstrating the accuracy of measurement. We then identified alterations in CpG islands, both those associated with gene promoters, as well as non-promoter-associated islands in a set of breast and ovarian tumors. We demonstrate that this methodology accurately identifies methylation profiles in cancer and in principle it can differentiate any CpG methylation alterations and can be adapted to analyze other species. PMID:19474344

  14. Oligonucleotide-based theranostic nanoparticles in cancer therapy

    PubMed Central

    Shahbazi, Reza; Ozpolat, Bulent; Ulubayram, Kezban

    2016-01-01

    Theranostic approaches, combining the functionality of both therapy and imaging, have shown potential in cancer nanomedicine. Oligonucleotides such as small interfering RNA and microRNA, which are powerful therapeutic agents, have been effectively employed in theranostic systems against various cancers. Nanoparticles are used to deliver oligonucleotides into tumors by passive or active targeting while protecting the oligonucleotides from nucleases in the extracellular environment. The use of quantum dots, iron oxide nanoparticles and gold nanoparticles and tagging with contrast agents, like fluorescent dyes, optical or magnetic agents and various radioisotopes, has facilitated early detection of tumors and evaluation of therapeutic efficacy. In this article, we review the advantages of theranostic applications in cancer therapy and imaging, with special attention to oligonucleotide-based therapeutics. PMID:27102380

  15. Rapid methods for the detection of foodborne bacterial pathogens: principles, applications, advantages and limitations

    PubMed Central

    Law, Jodi Woan-Fei; Ab Mutalib, Nurul-Syakima; Chan, Kok-Gan; Lee, Learn-Han

    2015-01-01

    The incidence of foodborne diseases has increased over the years and resulted in major public health problem globally. Foodborne pathogens can be found in various foods and it is important to detect foodborne pathogens to provide safe food supply and to prevent foodborne diseases. The conventional methods used to detect foodborne pathogen are time consuming and laborious. Hence, a variety of methods have been developed for rapid detection of foodborne pathogens as it is required in many food analyses. Rapid detection methods can be categorized into nucleic acid-based, biosensor-based and immunological-based methods. This review emphasizes on the principles and application of recent rapid methods for the detection of foodborne bacterial pathogens. Detection methods included are simple polymerase chain reaction (PCR), multiplex PCR, real-time PCR, nucleic acid sequence-based amplification (NASBA), loop-mediated isothermal amplification (LAMP) and oligonucleotide DNA microarray which classified as nucleic acid-based methods; optical, electrochemical and mass-based biosensors which classified as biosensor-based methods; enzyme-linked immunosorbent assay (ELISA) and lateral flow immunoassay which classified as immunological-based methods. In general, rapid detection methods are generally time-efficient, sensitive, specific and labor-saving. The developments of rapid detection methods are vital in prevention and treatment of foodborne diseases. PMID:25628612

  16. Identification of differentially regulated transcripts in mouse striatum following methamphetamine treatment--an oligonucleotide microarray approach.

    PubMed

    Thomas, David M; Francescutti-Verbeem, Dina M; Liu, Xiuli; Kuhn, Donald M

    2004-01-01

    Methamphetamine is an addictive drug of abuse that can produce neurotoxic effects in dopamine nerve endings of the striatum. The purpose of this study was to identify new genes that may play a role in the highly complex cascade of events associated with methamphetamine intoxication. Using Affymetrix oligonucleotide arrays, 12 488 genes were simultaneously interrogated and there were 152 whose expression levels were changed following methamphetamine treatment. The genes are grouped into broad functional categories with inflammatory/immune response elements, receptor/signal transduction components and ion channel/transport proteins among the most populated. Many genes within these categories can be linked to ion regulation and apoptosis, both of which have been implicated in methamphetamine toxicity, and numerous factors associated with microglial activation emerged with significant changes in expression. For example, brain-derived neurotrophic factor (BDNF), chemokine (C-C) receptor 6 (CCr6) and numerous chemokine transcripts were increased or decreased in expression more than 2.8-fold. These results point to activated microglia as a potential source of the reactive oxygen/nitrogen species and cytokines that have been previously associated with methamphetamine toxicity and other neurotoxic conditions.

  17. A statistical learning approach to the modeling of chromatographic retention of oligonucleotides incorporating sequence and secondary structure data

    PubMed Central

    Sturm, Marc; Quinten, Sascha; Huber, Christian G.; Kohlbacher, Oliver

    2007-01-01

    We propose a new model for predicting the retention time of oligonucleotides. The model is based on ν support vector regression using features derived from base sequence and predicted secondary structure of oligonucleotides. Because of the secondary structure information, the model is applicable even at relatively low temperatures where the secondary structure is not suppressed by thermal denaturing. This makes the prediction of oligonucleotide retention time for arbitrary temperatures possible, provided that the target temperature lies within the temperature range of the training data. We describe different possibilities of feature calculation from base sequence and secondary structure, present the results and compare our model to existing models. PMID:17567619

  18. Monovalent Streptavidin that Senses Oligonucleotides**

    PubMed Central

    Wang, Jingxian; Kostic, Natasa; Stojanovic, Milan N.

    2013-01-01

    We report a straightforward chemical route to monovalent streptavidin, a valuable reagent for imaging. The one-step process is based on a (tris)biotinylated-oligonucleotide blocking three of streptavidin’s four biotin binding sites. Further, the complex is highly sensitive to single-base differences - whereby perfectly matched oligonucleotides trigger dissociation of the biotin-streptavidin interaction at higher rates than single-base mismatches. Unique properties and ease of synthesis open wide opportunities for practical applications in imaging and biosensing. PMID:23606329

  19. Parallel gene analysis with allele-specific padlock probes and tag microarrays

    PubMed Central

    Banér, Johan; Isaksson, Anders; Waldenström, Erik; Jarvius, Jonas; Landegren, Ulf; Nilsson, Mats

    2003-01-01

    Parallel, highly specific analysis methods are required to take advantage of the extensive information about DNA sequence variation and of expressed sequences. We present a scalable laboratory technique suitable to analyze numerous target sequences in multiplexed assays. Sets of padlock probes were applied to analyze single nucleotide variation directly in total genomic DNA or cDNA for parallel genotyping or gene expression analysis. All reacted probes were then co-amplified and identified by hybridization to a standard tag oligonucleotide array. The technique was illustrated by analyzing normal and pathogenic variation within the Wilson disease-related ATP7B gene, both at the level of DNA and RNA, using allele-specific padlock probes. PMID:12930977

  20. Chromosomal microarray analysis of consecutive individuals with autism spectrum disorders or learning disability presenting for genetic services.

    PubMed

    Roberts, Jennifer L; Hovanes, Karine; Dasouki, Majed; Manzardo, Ann M; Butler, Merlin G

    2014-02-01

    Chromosomal microarray analysis is now commonly used in clinical practice to identify copy number variants (CNVs) in the human genome. We report our experience with the use of the 105 K and 180K oligonucleotide microarrays in 215 consecutive patients referred with either autism or autism spectrum disorders (ASD) or developmental delay/learning disability for genetic services at the University of Kansas Medical Center during the past 4 years (2009-2012). Of the 215 patients [140 males and 75 females (male/female ratio=1.87); 65 with ASD and 150 with learning disability], abnormal microarray results were seen in 45 individuals (21%) with a total of 49 CNVs. Of these findings, 32 represented a known diagnostic CNV contributing to the clinical presentation and 17 represented non-diagnostic CNVs (variants of unknown significance). Thirteen patients with ASD had a total of 14 CNVs, 6 CNVs recognized as diagnostic and 8 as non-diagnostic. The most common chromosome involved in the ASD group was chromosome 15. For those with a learning disability, 32 patients had a total of 35 CNVs. Twenty-six of the 35 CNVs were classified as a known diagnostic CNV, usually a deletion (n=20). Nine CNVs were classified as an unknown non-diagnostic CNV, usually a duplication (n=8). For the learning disability subgroup, chromosomes 2 and 22 were most involved. Thirteen out of 65 patients (20%) with ASD had a CNV compared with 32 out of 150 patients (21%) with a learning disability. The frequency of chromosomal microarray abnormalities compared by subject group or gender was not statistically different. A higher percentage of individuals with a learning disability had clinical findings of seizures, dysmorphic features and microcephaly, but not statistically significant. While both groups contained more males than females, a significantly higher percentage of males were present in the ASD group. © 2013 Elsevier B.V. All rights reserved.

  1. Rare genomic rearrangement in a boy with Williams-Beuren syndrome associated to XYY syndrome and intriguing behavior.

    PubMed

    Dutra, Roberta L; Piazzon, Flavia B; Zanardo, Évelin A; Costa, Thais Virginia Moura Machado; Montenegro, Marília M; Novo-Filho, Gil M; Dias, Alexandre T; Nascimento, Amom M; Kim, Chong Ae; Kulikowski, Leslie D

    2015-12-01

    Williams-Beuren syndrome (WBS) is caused by a hemizygous contiguous gene microdeletion of 1.55-1.84 Mb at 7q11.23 region. Approximately, 28 genes have been shown to contribute to classical phenotype of SWB with presence of dysmorphic facial features, supravalvular aortic stenosis (SVAS), intellectual disability, and overfriendliness. With the use of Microarray-based comparative genomic hybridization and other molecular cytogenetic techniques, is possible define with more accuracy partial or atypical deletion and refine the genotype-phenotype correlation. Here, we report on a rare genomic structural rearrangement in a boy with atypical deletion in 7q11.23 and XYY syndrome with characteristic clinical signs, but not sufficient for the diagnosis of WBS. Cytogenetic analysis of G-banding showed a karyotype 47,XYY. Analysis of DNA with the technique of MLPA (Multiplex Ligation-dependent Probe Amplification) using kits a combination of kits (P064, P036, P070, and P029) identified an atypical deletion on 7q11.23. In addition, high resolution SNP Oligonucleotide Microarray Analysis (SNP-array) confirmed the alterations found by MLPA and revealed others pathogenic CNVs, in the chromosomes 7 and X. The present report demonstrates an association not yet described in literature, between Williams-Beuren syndrome and 47,XYY. The identification of atypical deletion in 7q11.23 concomitant to additional pathogenic CNVs in others genomic regions allows a better comprehension of clinical consequences of atypical genomic rearrangements. © 2015 Wiley Periodicals, Inc.

  2. A customized gene expression microarray reveals that the brittle stem phenotype fs2 of barley is attributable to a retroelement in the HvCesA4 cellulose synthase gene.

    PubMed

    Burton, Rachel A; Ma, Gang; Baumann, Ute; Harvey, Andrew J; Shirley, Neil J; Taylor, Jillian; Pettolino, Filomena; Bacic, Antony; Beatty, Mary; Simmons, Carl R; Dhugga, Kanwarpal S; Rafalski, J Antoni; Tingey, Scott V; Fincher, Geoffrey B

    2010-08-01

    The barley (Hordeum vulgare) brittle stem mutants, fs2, designated X054 and M245, have reduced levels of crystalline cellulose compared with their parental lines Ohichi and Shiroseto. A custom-designed microarray, based on long oligonucleotide technology and including genes involved in cell wall metabolism, revealed that transcript levels of very few genes were altered in the elongation zone of stem internodes, but these included a marked decrease in mRNA for the HvCesA4 cellulose synthase gene of both mutants. In contrast, the abundance of several hundred transcripts changed in the upper, maturation zones of stem internodes, which presumably reflected pleiotropic responses to a weakened cell wall that resulted from the primary genetic lesion. Sequencing of the HvCesA4 genes revealed the presence of a 964-bp solo long terminal repeat of a Copia-like retroelement in the first intron of the HvCesA4 genes of both mutant lines. The retroelement appears to interfere with transcription of the HvCesA4 gene or with processing of the mRNA, and this is likely to account for the lower crystalline cellulose content and lower stem strength of the mutants. The HvCesA4 gene maps to a position on chromosome 1H of barley that coincides with the previously reported position of fs2.

  3. A Customized Gene Expression Microarray Reveals That the Brittle Stem Phenotype fs2 of Barley Is Attributable to a Retroelement in the HvCesA4 Cellulose Synthase Gene1[W][OA

    PubMed Central

    Burton, Rachel A.; Ma, Gang; Baumann, Ute; Harvey, Andrew J.; Shirley, Neil J.; Taylor, Jillian; Pettolino, Filomena; Bacic, Antony; Beatty, Mary; Simmons, Carl R.; Dhugga, Kanwarpal S.; Rafalski, J. Antoni; Tingey, Scott V.; Fincher, Geoffrey B.

    2010-01-01

    The barley (Hordeum vulgare) brittle stem mutants, fs2, designated X054 and M245, have reduced levels of crystalline cellulose compared with their parental lines Ohichi and Shiroseto. A custom-designed microarray, based on long oligonucleotide technology and including genes involved in cell wall metabolism, revealed that transcript levels of very few genes were altered in the elongation zone of stem internodes, but these included a marked decrease in mRNA for the HvCesA4 cellulose synthase gene of both mutants. In contrast, the abundance of several hundred transcripts changed in the upper, maturation zones of stem internodes, which presumably reflected pleiotropic responses to a weakened cell wall that resulted from the primary genetic lesion. Sequencing of the HvCesA4 genes revealed the presence of a 964-bp solo long terminal repeat of a Copia-like retroelement in the first intron of the HvCesA4 genes of both mutant lines. The retroelement appears to interfere with transcription of the HvCesA4 gene or with processing of the mRNA, and this is likely to account for the lower crystalline cellulose content and lower stem strength of the mutants. The HvCesA4 gene maps to a position on chromosome 1H of barley that coincides with the previously reported position of fs2. PMID:20530215

  4. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sun, Zhen; Department of Biochemistry and Molecular Biology, Program in Molecular Cell Biology, Zhejiang University School of Medicine, Hangzhou, Zhejiang 310058; Xiang, Wenqing

    Highlights: {yields} LNA-modified oligonucleotides can pass through the plasma membrane of cultured cells even without using transfection machinery. {yields} LNA-modified oligonucleotides passed efficiently across the cell membrane, and lipid-coating facilitated translocation from the cytoplasm to the nucleus. {yields} LNA-oligonucleotide designed to target nuclear HBV DNA efficiently suppresses HBV replication and transcription in cultured hepatic cells. -- Abstract: Silencing target genes with small regulatory RNAs is widely used to investigate gene function and therapeutic drug development. Recently, triplex-based approaches have provided another attractive means to achieve targeted gene regulation and gene manipulation at the molecular and cellular levels. Nuclear entry ofmore » oligonucleotides and enhancement of their affinity to the DNA targets are key points of such approaches. In this study, we developed lipid-based transport of a locked-nucleic-acid (LNA)-modified oligonucleotide for hepatitis B virus (HBV) DNA interference in human hepatocytes expressing HBV genomic DNA. In these cells, the LNA-modified oligonucleotides passed efficiently across the cell membrane, and lipid-coating facilitated translocation from the cytoplasm to the nucleus. The oligonucleotide specifically targeting HBV DNA clearly interfered with HBV DNA transcription as shown by a block in pregenomic RNA (pgRNA) production. The HBV DNA-targeted oligonucleotide suppressed HBV DNA replication and HBV protein production more efficiently than small interfering RNAs directed to the pgRNA. These results demonstrate that fusion with lipid can carry LNA-modified oligonucleotides to the nucleus where they regulate gene expression. Interfering with HBV DNA transcription by LNA-modified oligonucleotides has strong potential as a new strategy for HBV inhibition.« less

  5. PhyloFlu, a DNA microarray for determining the phylogenetic origin of influenza A virus gene segments and the genomic fingerprint of viral strains.

    PubMed

    Paulin, Luis F; de los D Soto-Del Río, María; Sánchez, Iván; Hernández, Jesús; Gutiérrez-Ríos, Rosa M; López-Martínez, Irma; Wong-Chew, Rosa M; Parissi-Crivelli, Aurora; Isa, P; López, Susana; Arias, Carlos F

    2014-03-01

    Recent evidence suggests that most influenza A virus gene segments can contribute to the pathogenicity of the virus. In this regard, the hemagglutinin (HA) subtype of the circulating strains has been closely surveyed, but the reassortment of internal gene segments is usually not monitored as a potential source of an increased pathogenicity. In this work, an oligonucleotide DNA microarray (PhyloFlu) designed to determine the phylogenetic origins of the eight segments of the influenza virus genome was constructed and validated. Clades were defined for each segment and also for the 16 HA and 9 neuraminidase (NA) subtypes. Viral genetic material was amplified by reverse transcription-PCR (RT-PCR) with primers specific to the conserved 5' and 3' ends of the influenza A virus genes, followed by PCR amplification with random primers and Cy3 labeling. The microarray unambiguously determined the clades for all eight influenza virus genes in 74% (28/38) of the samples. The microarray was validated with reference strains from different animal origins, as well as from human, swine, and avian viruses from field or clinical samples. In most cases, the phylogenetic clade of each segment defined its animal host of origin. The genomic fingerprint deduced by the combined information of the individual clades allowed for the determination of the time and place that strains with the same genomic pattern were previously reported. PhyloFlu is useful for characterizing and surveying the genetic diversity and variation of animal viruses circulating in different environmental niches and for obtaining a more detailed surveillance and follow up of reassortant events that can potentially modify virus pathogenicity.

  6. Near-isogenic cotton germplasm lines that differ in fiber-bundle strength have temporal differences in fiber gene expression patterns as revealed by comparative high-throughput profiling.

    PubMed

    Hinchliffe, Doug J; Meredith, William R; Yeater, Kathleen M; Kim, Hee Jin; Woodward, Andrew W; Chen, Z Jeffrey; Triplett, Barbara A

    2010-05-01

    Gene expression profiles of developing cotton (Gossypium hirsutum L.) fibers from two near-isogenic lines (NILs) that differ in fiber-bundle strength, short-fiber content, and in fewer than two genetic loci were compared using an oligonucleotide microarray. Fiber gene expression was compared at five time points spanning fiber elongation and secondary cell wall (SCW) biosynthesis. Fiber samples were collected from field plots in a randomized, complete block design, with three spatially distinct biological replications for each NIL at each time point. Microarray hybridizations were performed in a loop experimental design that allowed comparisons of fiber gene expression profiles as a function of time between the two NILs. Overall, developmental expression patterns revealed by the microarray experiment agreed with previously reported cotton fiber gene expression patterns for specific genes. Additionally, genes expressed coordinately with the onset of SCW biosynthesis in cotton fiber correlated with gene expression patterns of other SCW-producing plant tissues. Functional classification and enrichment analysis of differentially expressed genes between the two NILs revealed that genes associated with SCW biosynthesis were significantly up-regulated in fibers of the high-fiber quality line at the transition stage of cotton fiber development. For independent corroboration of the microarray results, 15 genes were selected for quantitative reverse transcription PCR analysis of fiber gene expression. These analyses, conducted over multiple field years, confirmed the temporal difference in fiber gene expression between the two NILs. We hypothesize that the loci conferring temporal differences in fiber gene expression between the NILs are important regulatory sequences that offer the potential for more targeted manipulation of cotton fiber quality.

  7. Ultrasensitive Hybridization-Based ELISA Method for the Determination of Phosphorodiamidate Morpholino Oligonucleotides in Biological samples.

    PubMed

    Burki, Umar; Straub, Volker

    2017-01-01

    Determining the concentration of oligonucleotide in biological samples such as tissue lysate and serum is essential for determining the biodistribution and pharmacokinetic profile, respectively. ELISA-based assays have shown far greater sensitivities compared to other methods such as HPLC and LC/MS. Here, we describe a novel ultrasensitive hybridization-based ELISA method for quantitating morpholino oligonucleotides in mouse tissue lysate and serum samples. The assay has a linear detection range of 5-250 pM (R2 > 0.99).

  8. Incorporation of an aldehyde function in oligonucleotides.

    PubMed

    Tilquin, J M; Dechamps, M; Sonveaux, E

    2001-01-01

    A nucleotide-like phosphoramidite building block that has the nucleic base replaced by the tert-butyldimethylsilyl-protected styrene glycol was synthesized. After the automatic synthesis of an oligonucleotide incorporating this synthon, the benzaldehyde function was generated by fluoride deprotection and oxidation by sodium periodate. In a similar manner, an oligonucleotide where a nucleic base was replaced by the (CH2)8CH=O chain was synthesized and conjugated with biotin derivatives.

  9. Rapid method to detect duplex formation in sequencing by hybridization methods

    DOEpatents

    Mirzabekov, A.D.; Timofeev, E.N.; Florentiev, V.L.; Kirillov, E.V.

    1999-01-19

    A method for determining the existence of duplexes of oligonucleotide complementary molecules is provided. A plurality of immobilized oligonucleotide molecules, each of a specific length and each having a specific base sequence, is contacted with complementary, single stranded oligonucleotide molecules to form a duplex. Each duplex facilitates intercalation of a fluorescent dye between the base planes of the duplex. The invention also provides for a method for constructing oligonucleotide matrices comprising confining light sensitive fluid to a surface and exposing the light-sensitive fluid to a light pattern. This causes the fluid exposed to the light to coalesce into discrete units and adhere to the surface. This places each of the units in contact with a set of different oligonucleotide molecules so as to allow the molecules to disperse into the units. 13 figs.

  10. Rapid method to detect duplex formation in sequencing by hybridization methods

    DOEpatents

    Mirzabekov, Andrei Darievich; Timofeev, Edward Nikolaevich; Florentiev, Vladimer Leonidovich; Kirillov, Eugene Vladislavovich

    1999-01-01

    A method for determining the existence of duplexes of oligonucleotide complementary molecules is provided whereby a plurality of immobilized oligonucleotide molecules, each of a specific length and each having a specific base sequence, is contacted with complementary, single stranded oligonucleotide molecules to form a duplex so as to facilitate intercalation of a fluorescent dye between the base planes of the duplex. The invention also provides for a method for constructing oligonucleotide matrices comprising confining light sensitive fluid to a surface, exposing said light-sensitive fluid to a light pattern so as to cause the fluid exposed to the light to coalesce into discrete units and adhere to the surface; and contacting each of the units with a set of different oligonucleotide molecules so as to allow the molecules to disperse into the units.

  11. A facile inhibitor screening of SARS coronavirus N protein using nanoparticle-based RNA oligonucleotide.

    PubMed

    Roh, Changhyun

    2012-01-01

    Hundreds of million people worldwide have been infected with severe acute respiratory syndrome (SARS), and the rate of global death from SARS has remarkably increased. Hence, the development of efficient drug treatments for the biological effects of SARS is highly needed. We have previously shown that quantum dots (QDs)-conjugated RNA oligonucleotide is sensitive to the specific recognition of the SARS-associated coronavirus (SARS-CoV) nucleocapsid (N) protein. In this study, we found that a designed biochip could analyze inhibitors of the SARS-CoV N protein using nanoparticle-based RNA oligonucleotide. Among the polyphenolic compounds examined, (-)-catechin gallate and (-)-gallocatechin gallate demonstrated a remarkable inhibition activity on SARS-CoV N protein. (-)-catechin gallate and (-)-gallocatechin gallate attenuated the binding affinity in a concentrated manner as evidenced by QDs-conjugated RNA oligonucleotide on a designed biochip. At a concentration of 0.05 μg mL(-1), (-)-catechin gallate and (-)-gallocatechin gallate showed more than 40% inhibition activity on a nanoparticle-based RNA oligonucleotide biochip system.

  12. Methods of DNA sequencing by hybridization based on optimizing concentration of matrix-bound oligonucleotide and device for carrying out same

    DOEpatents

    Khrapko, Konstantin R [Moscow, RU; Khorlin, Alexandr A [Moscow, RU; Ivanov, Igor B [Moskovskaya, RU; Ershov, Gennady M [Moscow, RU; Lysov, Jury P [Moscow, RU; Florentiev, Vladimir L [Moscow, RU; Mirzabekov, Andrei D [Moscow, RU

    1996-09-03

    A method for sequencing DNA by hybridization that includes the following steps: forming an array of oligonucleotides at such concentrations that either ensure the same dissociation temperature for all fully complementary duplexes or allows hybridization and washing of such duplexes to be conducted at the same temperature; hybridizing said oligonucleotide array with labeled test DNA; washing in duplex dissociation conditions; identifying single-base substitutions in the test DNA by analyzing the distribution of the dissociation temperatures and reconstructing the DNA nucleotide sequence based on the above analysis. A device for carrying out the method comprises a solid substrate and a matrix rigidly bound to the substrate. The matrix contains the oligonucleotide array and consists of a multiplicity of gel portions. Each gel portion contains one oligonucleotide of desired length. The gel portions are separated from one another by interstices and have a thickness not exceeding 30 .mu.m.

  13. Comparison of three microarray probe annotation pipelines: differences in strategies and their effect on downstream analysis

    PubMed Central

    Neerincx, Pieter BT; Casel, Pierrot; Prickett, Dennis; Nie, Haisheng; Watson, Michael; Leunissen, Jack AM; Groenen, Martien AM; Klopp, Christophe

    2009-01-01

    Background Reliable annotation linking oligonucleotide probes to target genes is essential for functional biological analysis of microarray experiments. We used the IMAD, OligoRAP and sigReannot pipelines to update the annotation for the ARK-Genomics Chicken 20 K array as part of a joined EADGENE/SABRE workshop. In this manuscript we compare their annotation strategies and results. Furthermore, we analyse the effect of differences in updated annotation on functional analysis for an experiment involving Eimeria infected chickens and finally we propose guidelines for optimal annotation strategies. Results IMAD, OligoRAP and sigReannot update both annotation and estimated target specificity. The 3 pipelines can assign oligos to target specificity categories although with varying degrees of resolution. Target specificity is judged based on the amount and type of oligo versus target-gene alignments (hits), which are determined by filter thresholds that users can adjust based on their experimental conditions. Linking oligos to annotation on the other hand is based on rigid rules, which differ between pipelines. For 52.7% of the oligos from a subset selected for in depth comparison all pipelines linked to one or more Ensembl genes with consensus on 44.0%. In 31.0% of the cases none of the pipelines could assign an Ensembl gene to an oligo and for the remaining 16.3% the coverage differed between pipelines. Differences in updated annotation were mainly due to different thresholds for hybridisation potential filtering of oligo versus target-gene alignments and different policies for expanding annotation using indirect links. The differences in updated annotation packages had a significant effect on GO term enrichment analysis with consensus on only 67.2% of the enriched terms. Conclusion In addition to flexible thresholds to determine target specificity, annotation tools should provide metadata describing the relationships between oligos and the annotation assigned to them. These relationships can then be used to judge the varying degrees of reliability allowing users to fine-tune the balance between reliability and coverage. This is important as it can have a significant effect on functional microarray analysis as exemplified by the lack of consensus on almost one third of the terms found with GO term enrichment analysis based on updated IMAD, OligoRAP or sigReannot annotation. PMID:19615109

  14. Comparison of three microarray probe annotation pipelines: differences in strategies and their effect on downstream analysis.

    PubMed

    Neerincx, Pieter Bt; Casel, Pierrot; Prickett, Dennis; Nie, Haisheng; Watson, Michael; Leunissen, Jack Am; Groenen, Martien Am; Klopp, Christophe

    2009-07-16

    Reliable annotation linking oligonucleotide probes to target genes is essential for functional biological analysis of microarray experiments. We used the IMAD, OligoRAP and sigReannot pipelines to update the annotation for the ARK-Genomics Chicken 20 K array as part of a joined EADGENE/SABRE workshop. In this manuscript we compare their annotation strategies and results. Furthermore, we analyse the effect of differences in updated annotation on functional analysis for an experiment involving Eimeria infected chickens and finally we propose guidelines for optimal annotation strategies. IMAD, OligoRAP and sigReannot update both annotation and estimated target specificity. The 3 pipelines can assign oligos to target specificity categories although with varying degrees of resolution. Target specificity is judged based on the amount and type of oligo versus target-gene alignments (hits), which are determined by filter thresholds that users can adjust based on their experimental conditions. Linking oligos to annotation on the other hand is based on rigid rules, which differ between pipelines.For 52.7% of the oligos from a subset selected for in depth comparison all pipelines linked to one or more Ensembl genes with consensus on 44.0%. In 31.0% of the cases none of the pipelines could assign an Ensembl gene to an oligo and for the remaining 16.3% the coverage differed between pipelines. Differences in updated annotation were mainly due to different thresholds for hybridisation potential filtering of oligo versus target-gene alignments and different policies for expanding annotation using indirect links. The differences in updated annotation packages had a significant effect on GO term enrichment analysis with consensus on only 67.2% of the enriched terms. In addition to flexible thresholds to determine target specificity, annotation tools should provide metadata describing the relationships between oligos and the annotation assigned to them. These relationships can then be used to judge the varying degrees of reliability allowing users to fine-tune the balance between reliability and coverage. This is important as it can have a significant effect on functional microarray analysis as exemplified by the lack of consensus on almost one third of the terms found with GO term enrichment analysis based on updated IMAD, OligoRAP or sigReannot annotation.

  15. Chemical genomic screening for methylation-silenced genes in gastric cancer cell lines using 5-aza-2'-deoxycytidine treatment and oligonucleotide microarray.

    PubMed

    Yamashita, Satoshi; Tsujino, Yoshimi; Moriguchi, Kazuki; Tatematsu, Masae; Ushijima, Toshikazu

    2006-01-01

    To identify novel methylation-silenced genes in gastric cancers, we carried out a chemical genomic screening, a genome-wide search for genes upregulated by treatment with a demethylating agent, 5-aza-2'-deoxycytidine (5-aza-dC). After 5-aza-dC treatment of a gastric cancer cell line (AGS) 579 genes were upregulated 16-fold or more, using an oligonucleotide microarray with 39,000 genes. From these genes, we selected 44 known genes on autosomes whose silencing in gastric cancer has not been reported. Thirty-two of these had CpG islands (CGI) in their putative promoter regions, and all of the CGI were methylated in AGS, giving an estimated number of 421+/-75 (95% confidence interval) methylation-silenced genes. Additionally, we analyzed the methylation status of 16 potential tumor-related genes with promoter CGI that were upregulated four-fold or more, and 14 of these were methylated in AGS. Methylation status of the 32 randomly selected and 16 potential tumor-related genes was analyzed in 10 primary gastric cancers, and 42 genes (ABHD9, ADFP, ALDH1A3, ANXA5, AREG, BDNF, BMP7, CAV1, CDH2, CLDN3, CTSL, EEF1A2, F2R, FADS1, FSD1, FST, FYN, GPR54, GREM1, IGFBP3, IGFBP7, IRS2, KISS1, MARK1, MLF1, MSX1, MTSS1, NT5E, PAX6, PLAGL1, PLAU, PPIC, RBP4, RORA, SCRN1, TBX3, TFAP2C, TNFSF9, ULBP2, WIF1, ZNF177 and ZNF559) were methylated in at least one primary gastric cancer. A metastasis suppressor gene, MTSS1, was located in a genomic region with frequent loss of heterozygosity (8q22), and was expressed abundantly in the normal gastric mucosa, suggesting its role in gastric carcinogenesis. (Cancer Sci 2006; 97: 64 -71). (Cancer Sci 2006; 97: 64 -71).

  16. Versatile Method for the Site-Specific Modification of DNA with Boron Clusters: Anti-Epidermal Growth Factor Receptor (EGFR) Antisense Oligonucleotide Case.

    PubMed

    Ebenryter-Olbińska, Katarzyna; Kaniowski, Damian; Sobczak, Milena; Wojtczak, Błażej A; Janczak, Sławomir; Wielgus, Ewelina; Nawrot, Barbara; Leśnikowski, Zbigniew J

    2017-11-21

    A general and convenient approach for the incorporation of different types of boron clusters into specific locations of the DNA-oligonucleotide chain based on the automated phosphoramidite method of oligonucleotide synthesis and post-synthetic "click chemistry" modification has been developed. Pronounced effects of boron-cluster modification on the physico- and biochemical properties of the antisense oligonucleotides were observed. The silencing activity of antisense oligonucleotides bearing a single boron cluster modification in the middle of the oligonucleotide chain was substantially higher than that of unmodified oligonucleotides. This finding may be of importance for the design of therapeutic nucleic acids with improved properties. The proposed synthetic methodology broadens the availability of nucleic acid-boron cluster conjugates and opens up new avenues for their potential practical use. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Scalable amplification of strand subsets from chip-synthesized oligonucleotide libraries

    PubMed Central

    Schmidt, Thorsten L.; Beliveau, Brian J.; Uca, Yavuz O.; Theilmann, Mark; Da Cruz, Felipe; Wu, Chao-Ting; Shih, William M.

    2015-01-01

    Synthetic oligonucleotides are the main cost factor for studies in DNA nanotechnology, genetics and synthetic biology, which all require thousands of these at high quality. Inexpensive chip-synthesized oligonucleotide libraries can contain hundreds of thousands of distinct sequences, however only at sub-femtomole quantities per strand. Here we present a selective oligonucleotide amplification method, based on three rounds of rolling-circle amplification, that produces nanomole amounts of single-stranded oligonucleotides per millilitre reaction. In a multistep one-pot procedure, subsets of hundreds or thousands of single-stranded DNAs with different lengths can selectively be amplified and purified together. These oligonucleotides are used to fold several DNA nanostructures and as primary fluorescence in situ hybridization probes. The amplification cost is lower than other reported methods (typically around US$ 20 per nanomole total oligonucleotides produced) and is dominated by the use of commercial enzymes. PMID:26567534

  18. A limited innate immune response is induced by a replication-defective herpes simplex virus vector following delivery to the murine central nervous system

    PubMed Central

    Zeier, Zane; Aguilar, J Santiago; Lopez, Cecilia M; Devi-Rao, G B; Watson, Zachary L; Baker, Henry V; Wagner, Edward K; Bloom, David C

    2010-01-01

    Herpes simplex virus type 1 (HSV-1)–based vectors readily transduce neurons and have a large payload capacity, making them particularly amenable to gene therapy applications within the central nervous system (CNS). Because aspects of the host responses to HSV-1 vectors in the CNS are largely unknown, we compared the host response of a nonreplicating HSV-1 vector to that of a replication-competent HSV-1 virus using microarray analysis. In parallel, HSV-1 gene expression was tracked using HSV-specific oligonucleotide-based arrays in order to correlate viral gene expression with observed changes in host response. Microarray analysis was performed following stereotactic injection into the right hippocampal formation of mice with either a replication-competent HSV-1 or a nonreplicating recombinant of HSV-1, lacking the ICP4 gene (ICP4−). Genes that demonstrated a significant change (P < .001) in expression in response to the replicating HSV-1 outnumbered those that changed in response to mock or nonreplicating vector by approximately 3-fold. Pathway analysis revealed that both the replicating and nonreplicating vectors induced robust antigen presentation but only mild interferon, chemokine, and cytokine signaling responses. The ICP4− vector was restricted in several of the Toll-like receptor-signaling pathways, indicating reduced stimulation of the innate immune response. These array analyses suggest that although the nonreplicating vector induces detectable activation of immune response pathways, the number and magnitude of the induced response is dramatically restricted compared to the replicating vector, and with the exception of antigen presentation, host gene expression induced by the non-replicating vector largely resembles mock infection. PMID:20095947

  19. Microbial distributions detected by an oligonucleotide microarray across geochemical zones associated with methane in marine sediments from the Ulleung Basin

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Briggs, Brandon R; Graw, Michael; Brodie, Eoin L

    2013-11-01

    The biogeochemical processes that occur in marine sediments on continental margins are complex; however, from one perspective they can be considered with respect to three geochemical zones based on the presence and form of methane: sulfate–methane transition (SMTZ), gas hydrate stability zone (GHSZ), and free gas zone (FGZ). These geochemical zones may harbor distinct microbial communities that are important in biogeochemical carbon cycles. The objective of this study was to describe the microbial communities in sediments from the SMTZ, GHSZ, and FGZ using molecular ecology methods (i.e. PhyloChip microarray analysis and terminal restriction fragment length polymorphism (T-RFLP)) and examining themore » results in the context of non-biological parameters in the sediments. Non-metric multidimensional scaling and multi-response permutation procedures were used to determine whether microbial community compositions were significantly different in the three geochemical zones and to correlate samples with abiotic characteristics of the sediments. This analysis indicated that microbial communities from all three zones were distinct from one another and that variables such as sulfate concentration, hydrate saturation of the nearest gas hydrate layer, and depth (or unmeasured variables associated with depth e.g. temperature, pressure) were correlated to differences between the three zones. The archaeal anaerobic methanotrophs typically attributed to performing anaerobic oxidation of methane were not detected in the SMTZ; however, the marine benthic group-B, which is often found in SMTZ, was detected. Within the GHSZ, samples that were typically closer to layers that contained higher hydrate saturation had indicator sequences related to Vibrio-type taxa. These results suggest that the biogeographic patterns of microbial communities in marine sediments are distinct based on geochemical zones defined by methane.« less

  20. A facile one-step fluorescence method for the quantitation of low-content single base deamination impurity in synthetic oligonucleotides.

    PubMed

    Su, Xiaoye; Liang, Ruiting; Stolee, Jessica A

    2018-06-05

    Oligonucleotides are being researched and developed as potential drug candidates for the treatment of a broad spectrum of diseases. The characterization of antisense oligonucleotide (ASO) impurities caused by base mutations (e.g. deamination) which are closely related to the target ASO is a significant analytical challenge. Herein, we describe a novel one-step method, utilizing a strategy that combines fluorescence-ON detection with competitive hybridization, to achieve single base mutation quantitation in extensively modified synthetic ASOs. Given that this method is highly specific and sensitive (LoQ = 4 nM), we envision that it will find utility for screening other impurities as well as sequencing modified oligonucleotides. Copyright © 2018 Elsevier B.V. All rights reserved.

  1. Characteristic Markers of the WNT Signaling Pathways Are Differentially Expressed in Osteoarthritic Cartilage

    PubMed Central

    Dehne, T.; Lindahl, A.; Brittberg, M.; Pruss, A.; Ringe, J.; Sittinger, M.; Karlsson, C.

    2012-01-01

    Objective: It is well known that expression of markers for WNT signaling is dysregulated in osteoarthritic (OA) bone. However, it is still not fully known if the expression of these markers also is affected in OA cartilage. The aim of this study was therefore to examine this issue. Methods: Human cartilage biopsies from OA and control donors were subjected to genome-wide oligonucleotide microarrays. Genes involved in WNT signaling were selected using the BioRetis database, KEGG pathway analysis was searched using DAVID software tools, and cluster analysis was performed using Genesis software. Results from the microarray analysis were verified using quantitative real-time PCR and immunohistochemistry. In order to study the impact of cytokines for the dysregulated WNT signaling, OA and control chondrocytes were stimulated with interleukin-1 and analyzed with real-time PCR for their expression of WNT-related genes. Results: Several WNT markers displayed a significantly altered expression in OA compared to normal cartilage. Interestingly, inhibitors of the canonical and planar cell polarity WNT signaling pathways displayed significantly increased expression in OA cartilage, while the Ca2+/WNT signaling pathway was activated. Both real-time PCR and immunohistochemistry verified the microarray results. Real-time PCR analysis demonstrated that interleukin-1 upregulated expression of important WNT markers. Conclusions: WNT signaling is significantly affected in OA cartilage. The result suggests that both the canonical and planar cell polarity WNT signaling pathways were partly inhibited while the Ca2+/WNT pathway was activated in OA cartilage. PMID:26069618

  2. Chromosomal microarray in clinical diagnosis: a study of 337 patients with congenital anomalies and developmental delays or intellectual disability.

    PubMed

    Sansović, Ivona; Ivankov, Ana-Maria; Bobinec, Adriana; Kero, Mijana; Barišić, Ingeborg

    2017-06-14

    To determine the diagnostic yield and criteria that could help to classify and interpret the copy number variations (CNVs) detected by chromosomal microarray (CMA) technique in patients with congenital and developmental abnormalities including dysmorphia, developmental delay (DD) or intellectual disability (ID), autism spectrum disorders (ASD) and congenital anomalies (CA). CMA analysis was performed in 337 patients with DD/ID with or without dysmorphism, ASD, and/or CA. In 30 of 337 patients, chromosomal imbalances had previously been detected by classical cytogenetic and molecular cytogenetic methods. In 73 of 337 patients, clinically relevant variants were detected and better characterized. Most of them were >1 Mb. Variants of unknown clinical significance (VOUS) were discovered in 35 patients. The most common VOUS size category was <300 kb (40.5%). Deletions and de novo imbalances were more frequent in pathogenic CNV than in VOUS category. CMA had a high diagnostic yield of 43/307, excluding patients previously detected by other methods. CMA was valuable in establishing the diagnosis in a high proportion of patients. Criteria for classification and interpretation of CNVs include CNV size and type, mode of inheritance, and genotype-phenotype correlation. Agilent ISCA v2 Human Genome 8x60 K oligonucleotide microarray format proved to be reasonable resolution for clinical use, particularly in the regions that are recommended by the International Standard Cytogenomic Array (ISCA) Consortium and associated with well-established syndromes.

  3. A microarray for assessing transcription from pelagic marine microbial taxa

    PubMed Central

    Shilova, Irina N; Robidart, Julie C; James Tripp, H; Turk-Kubo, Kendra; Wawrik, Boris; Post, Anton F; Thompson, Anne W; Ward, Bess; Hollibaugh, James T; Millard, Andy; Ostrowski, Martin; J Scanlan, David; Paerl, Ryan W; Stuart, Rhona; Zehr, Jonathan P

    2014-01-01

    Metagenomic approaches have revealed unprecedented genetic diversity within microbial communities across vast expanses of the world's oceans. Linking this genetic diversity with key metabolic and cellular activities of microbial assemblages is a fundamental challenge. Here we report on a collaborative effort to design MicroTOOLs (Microbiological Targets for Ocean Observing Laboratories), a high-density oligonucleotide microarray that targets functional genes of diverse taxa in pelagic and coastal marine microbial communities. MicroTOOLs integrates nucleotide sequence information from disparate data types: genomes, PCR-amplicons, metagenomes, and metatranscriptomes. It targets 19 400 unique sequences over 145 different genes that are relevant to stress responses and microbial metabolism across the three domains of life and viruses. MicroTOOLs was used in a proof-of-concept experiment that compared the functional responses of microbial communities following Fe and P enrichments of surface water samples from the North Pacific Subtropical Gyre. We detected transcription of 68% of the gene targets across major taxonomic groups, and the pattern of transcription indicated relief from Fe limitation and transition to N limitation in some taxa. Prochlorococcus (eHLI), Synechococcus (sub-cluster 5.3) and Alphaproteobacteria SAR11 clade (HIMB59) showed the strongest responses to the Fe enrichment. In addition, members of uncharacterized lineages also responded. The MicroTOOLs microarray provides a robust tool for comprehensive characterization of major functional groups of microbes in the open ocean, and the design can be easily amended for specific environments and research questions. PMID:24477198

  4. A microarray analysis of potential genes underlying the neurosensitivity of mice to propofol.

    PubMed

    Lowes, Damon A; Galley, Helen F; Lowe, Peter R; Rikke, Brad A; Johnson, Thomas E; Webster, Nigel R

    2005-09-01

    Establishing the mechanism of action of general anesthetics at the molecular level is difficult because of the multiple targets with which these drugs are associated. Inbred short sleep (ISS) and long sleep (ILS) mice are differentially sensitive in response to ethanol and other sedative hypnotics and contain a single quantitative trait locus (Lorp1) that accounts for the genetic variance of loss-of-righting reflex in response to propofol (LORP). In this study, we used high-density oligonucleotide microarrays to identify global gene expression and candidate genes differentially expressed within the Lorp1 region that may give insight into the molecular mechanism underlying LORP. Microarray analysis was performed using Affymetrix MG-U74Av2 Genechips and a selection of differentially expressed genes was confirmed by semiquantitative reverse transcription-polymerase chain reaction. Global expression in the brains of ILS and ISS mice revealed 3423 genes that were significantly expressed, of which 139 (4%) were differentially expressed. Analysis of genes located within the Lorp1 region showed that 26 genes were significantly expressed and that just 2 genes (7%) were differentially expressed. These genes encoded for the proteins AWP1 (associated with protein kinase 1) and "BTB (POZ) domain containing 1," whose functions are largely uncharacterized. Genes differentially expressed outside Lorp1 included seven genes with previously characterized neuronal functions and thus stand out as additional candidate genes that may be involved in mediating the neurosensitivity differences between ISS and ILS.

  5. Detection of microbial communities in continuous and discontinuous membrane bioreactor using high-density oligonucleotide Microarray

    NASA Astrophysics Data System (ADS)

    Duan, Liang; Song, Yonghui; Xia, Siqing; Hermanowicz, Slawomir W.

    2010-11-01

    This study compared the whole composition of microbial communities in continuous-flow (MBR) and batch-fed (discontinuous) (MSBR) aerobic membrane bioreactors using high-density universal 16S rRNA Microarray. The array includes 506,944 probes targeted to 8935 clusters in 16S rRNA gene sequences. The Microarray results showed that both MBR and MSBR had high microbial diversity. 1126 and 1002 bacterial subfamilies were detected and can separate as 37 and 32 phyla in MBR and MSBR, respectively. Proteobacteria was the predominant phylum, 703 and 597 subfamilies were found in two systems, which constituted 62.4% and 59.6% of the whole bacteria. Gamma- and Alpha-were the dominant classes in Proteobacteria. It occupied 38.1% and 26.3%, 31.2% and 39.2% for MBR and MSBR, respectively. Bacteroidetes, Firmicutes and Actinobacteria were the subdominant groups, occupying around 9.4% and 7.6%, 6.1% and 6.5%, 6.0% and 9.0% of the total bacteria in two reactors. Some bacterial groups such as Acidobacteria, Chloroflexi, Cyanobacteria, Verrucomicrobia and Spirochaetes also found more than 15 subfamilies. All the results indicated that the MBR system had more bacteria community diversity than MSBR's. Moreover, it was very interested that MBR and MSBR had almost the same bacterial composition except Enterobacteriaceae. 63 OTUs of Enterobacteriaceae were detected in MBR, while just 10 OTUs were found in MSBR. That's one of the reasons leading to the difference of the bacterial diversity between two bioreactors.

  6. Rapid method to detect duplex formation in sequencing by hybridization methods, a method for constructing containment structures for reagent interaction

    DOEpatents

    Mirzabekov, Andrei Darievich; Yershov, Gennadiy Moiseyevich; Guschin, Dmitry Yuryevich; Gemmell, Margaret Anne; Shick, Valentine V.; Proudnikov, Dmitri Y.; Timofeev, Edward N.

    2002-01-01

    A method for determining the existence of duplexes of oligonucleotide complementary molecules is provided whereby a plurality of immobilized oligonucleotide molecules, each of a specific length and each having a specific base sequence, is contacted with complementary, single stranded oligonucleotide molecules to form a duplex so as to facilitate intercalation of a fluorescent dye between the base planes of the duplex. The invention also provides for a method for constructing oligonucleotide matrices comprising confining light sensitive fluid to a surface, exposing said light-sensitive fluid to a light pattern so as to cause the fluid exposed to the light to polymerize into discrete units and adhere to the surface; and contacting each of the units with a set of different oligonucleotide molecules so as to allow the molecules to disperse into the units.

  7. Direct fluorescence in situ hybridization on human metaphase chromosomes using quantum dot-platinum labeled DNA probes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hwang, Gyoyeon; Biological Chemistry, Korea University of Science and Technology, 217, Gajeong-ro, Yuseong-gu, Deajeon; Lee, Hansol

    The telomere shortening in chromosomes implies the senescence, apoptosis, or oncogenic transformation of cells. Since detecting telomeres in aging and diseases like cancer, is important, the direct detection of telomeres has been a very useful biomarker. We propose a telomere detection method using a newly synthesized quantum dot (QD) based probe with oligonucleotide conjugation and direct fluorescence in situ hybridization (FISH). QD-oligonucleotides were prepared with metal coordination bonding based on platinum-guanine binding reported in our previous work. The QD-oligonucleotide conjugation method has an advantage where any sequence containing guanine at the end can be easily bound to the starting QD-Ptmore » conjugate. A synthesized telomeric oligonucleotide was bound to the QD-Pt conjugate successfully and this probe hybridized specifically on the telomere of fabricated MV-4-11 and MOLT-4 chromosomes. Additionally, the QD-telomeric oligonucleotide probe successfully detected the telomeres on the CGH metaphase slide. Due to the excellent photostability and high quantum yield of QDs, the QD-oligonucleotide probe has high fluorescence intensity when compared to the organic dye-oligonucleotide probe. Our QD-oligonucleotide probe, conjugation method of this QD probe, and hybridization protocol with the chromosomes can be a useful tool for chromosome painting and FISH. - Highlights: • We prepared a probe linked between QD and telomeric oligonucleotide with platinum-guanine bonding. • Telomeres were detected by our new telomere probes successfully in three different human metaphase chromosomes. • QDPt-DNA probe has high fluorescence intensity in comparison with organic dye-DNA probe.« less

  8. Ferrocene conjugated oligonucleotide for electrochemical detection of DNA base mismatch.

    PubMed

    Hasegawa, Yusuke; Takada, Tadao; Nakamura, Mitsunobu; Yamana, Kazushige

    2017-08-01

    We describe the synthesis, binding, and electrochemical properties of ferrocene-conjugated oligonucleotides (Fc-oligos). The key step for the preparation of Fc-oligos contains the coupling of vinylferrocene to 5-iododeoxyuridine via Heck reaction. The Fc-conjugated deoxyuridine phosphoramidite was used in the Fc-oligonucleotide synthesis. We show that thiol-modified Fc-oligos deposited onto gold electrodes possess potential ability in electrochemical detection of DNA base mismatch. Copyright © 2017 Elsevier Ltd. All rights reserved.

  9. Retention of nucleic acids in ion-pair reversed-phase high-performance liquid chromatography depends not only on base composition but also on base sequence.

    PubMed

    Qiao, Jun-Qin; Liang, Chao; Wei, Lan-Chun; Cao, Zhao-Ming; Lian, Hong-Zhen

    2016-12-01

    The study on nucleic acid retention in ion-pair reversed-phase high-performance liquid chromatography mainly focuses on size-dependence, however, other factors influencing retention behaviors have not been comprehensively clarified up to date. In this present work, the retention behaviors of oligonucleotides and double-stranded DNAs were investigated on silica-based C 18 stationary phase by ion-pair reversed-phase high-performance liquid chromatography. It is found that the retention of oligonucleotides was influenced by base composition and base sequence as well as size, and oligonucleotides prone to self-dimerization have weaker retention than those not prone to self-dimerization but with the same base composition. However, homo-oligonucleotides are suitable for the size-dependent separation as a special case of oligonucleotides. For double-stranded DNAs, the retention is also influenced by base composition and base sequence, as well as size. This may be attributed to the interaction of exposed bases in major or minor grooves with the hydrophobic alky chains of stationary phase. In addition, no specific influence of guanine and cytosine content was confirmed on retention of double-stranded DNAs. Notably, the space effect resulted from the stereostructure of nucleic acids also influences the retention behavior in ion-pair reversed-phase high-performance liquid chromatography. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. The chemical evolution of oligonucleotide therapies of clinical utility

    PubMed Central

    Khvorova, Anastasia; Watts, Jonathan K.

    2017-01-01

    After nearly 40 years of development, oligonucleotide therapeutics are nearing meaningful clinical productivity. One of the key advantages of oligonucleotide drugs is that their delivery and potency properties are derived primarily from the chemical structure of the oligonucleotide, while their target is defined by the base sequence. Thus, as oligonucleotides with a particular chemical design demonstrate appropriate distribution and safety profiles for clinical gene silencing in a particular tissue, this will open the door to the rapid development of additional drugs targeting other disease-associated genes in the same tissue. To achieve clinical productivity, the chemical architecture of the oligonucleotide needs to be optimized as a whole, using a combination of sugar, backbone, nucleobase and 3′/5′-terminal modifications. A portfolio of chemistries can be used to confer drug like properties onto the oligonucleotide as a whole, with minor chemical changes often translating into major improvements in clinical efficacy. Outstanding challenges in oligonucleotide chemical development include optimization of chemical architectures to ensure long-term safety and to enable robust clinical activity beyond the liver. PMID:28244990

  11. Automation of complex assays: pharmacogenetics of warfarin dosing.

    PubMed

    Wu, Whei-Kuo; Hujsak, Paul G; Kureshy, Fareed

    2007-10-01

    AutoGenomics, Inc. (Carlsbad, CA, USA) have developed a multiplex microarray assay for genotyping both VKORC1 and CYP2C9 using the INFINITI(™) Analyzer. Multiple alleles in each DNA sample are analyzed by polymerase chain reaction amplification, followed by detection primer extension using the INFINITI Analyzer. The INFINITI Analyzer performs single-nucleotide polymorphism (SNP) analysis using universal oligonucleotides immobilized on the biochip. To genotype broader ethnic groups, genomic DNA from whole blood was tested for nine SNPs for VKORC1 and six for CYP2C9 genotypes. Information related to all 15 SNPs is needed to determine dosing of population of diverse ethnic origin. The INFINITI system provides genotyping information for same day dosing of warfarin.

  12. SaDA: From Sampling to Data Analysis—An Extensible Open Source Infrastructure for Rapid, Robust and Automated Management and Analysis of Modern Ecological High-Throughput Microarray Data

    PubMed Central

    Singh, Kumar Saurabh; Thual, Dominique; Spurio, Roberto; Cannata, Nicola

    2015-01-01

    One of the most crucial characteristics of day-to-day laboratory information management is the collection, storage and retrieval of information about research subjects and environmental or biomedical samples. An efficient link between sample data and experimental results is absolutely important for the successful outcome of a collaborative project. Currently available software solutions are largely limited to large scale, expensive commercial Laboratory Information Management Systems (LIMS). Acquiring such LIMS indeed can bring laboratory information management to a higher level, but most of the times this requires a sufficient investment of money, time and technical efforts. There is a clear need for a light weighted open source system which can easily be managed on local servers and handled by individual researchers. Here we present a software named SaDA for storing, retrieving and analyzing data originated from microorganism monitoring experiments. SaDA is fully integrated in the management of environmental samples, oligonucleotide sequences, microarray data and the subsequent downstream analysis procedures. It is simple and generic software, and can be extended and customized for various environmental and biomedical studies. PMID:26047146

  13. UniPROBE, update 2015: new tools and content for the online database of protein-binding microarray data on protein-DNA interactions.

    PubMed

    Hume, Maxwell A; Barrera, Luis A; Gisselbrecht, Stephen S; Bulyk, Martha L

    2015-01-01

    The Universal PBM Resource for Oligonucleotide Binding Evaluation (UniPROBE) serves as a convenient source of information on published data generated using universal protein-binding microarray (PBM) technology, which provides in vitro data about the relative DNA-binding preferences of transcription factors for all possible sequence variants of a length k ('k-mers'). The database displays important information about the proteins and displays their DNA-binding specificity data in terms of k-mers, position weight matrices and graphical sequence logos. This update to the database documents the growth of UniPROBE since the last update 4 years ago, and introduces a variety of new features and tools, including a new streamlined pipeline that facilitates data deposition by universal PBM data generators in the research community, a tool that generates putative nonbinding (i.e. negative control) DNA sequences for one or more proteins and novel motifs obtained by analyzing the PBM data using the BEEML-PBM algorithm for motif inference. The UniPROBE database is available at http://uniprobe.org. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  14. cn.FARMS: a latent variable model to detect copy number variations in microarray data with a low false discovery rate.

    PubMed

    Clevert, Djork-Arné; Mitterecker, Andreas; Mayr, Andreas; Klambauer, Günter; Tuefferd, Marianne; De Bondt, An; Talloen, Willem; Göhlmann, Hinrich; Hochreiter, Sepp

    2011-07-01

    Cost-effective oligonucleotide genotyping arrays like the Affymetrix SNP 6.0 are still the predominant technique to measure DNA copy number variations (CNVs). However, CNV detection methods for microarrays overestimate both the number and the size of CNV regions and, consequently, suffer from a high false discovery rate (FDR). A high FDR means that many CNVs are wrongly detected and therefore not associated with a disease in a clinical study, though correction for multiple testing takes them into account and thereby decreases the study's discovery power. For controlling the FDR, we propose a probabilistic latent variable model, 'cn.FARMS', which is optimized by a Bayesian maximum a posteriori approach. cn.FARMS controls the FDR through the information gain of the posterior over the prior. The prior represents the null hypothesis of copy number 2 for all samples from which the posterior can only deviate by strong and consistent signals in the data. On HapMap data, cn.FARMS clearly outperformed the two most prevalent methods with respect to sensitivity and FDR. The software cn.FARMS is publicly available as a R package at http://www.bioinf.jku.at/software/cnfarms/cnfarms.html.

  15. Akt/FOXO3a signaling modulates the endothelial stress response through regulation of heat shock protein 70 expression.

    PubMed

    Kim, Hyo-Soo; Skurk, Carsten; Maatz, Henrike; Shiojima, Ichiro; Ivashchenko, Yuri; Yoon, Suk-Won; Park, Young-Bae; Walsh, Kenneth

    2005-06-01

    To identify new antiapoptotic targets of the PI3K-Akt signaling pathway in endothelial cells, adenovirus-mediated Akt1 gene transfer and oligonucleotide microarrays were used to examine Akt-regulated transcripts. DNA microarray analysis revealed that HSP70 expression underwent the greatest fold activation of 12,532 transcripts examined in human umbilical vein endothelial cells (HUVEC) transduced with constitutively active Akt1. Akt1 gene transfer increased HSP70 transcript expression by 24.8-fold as determined by quantitative PCR and promoted a dose-dependent up-regulation of HSP70 protein as determined by Western immunoblot analysis. Gene transfer of FOXO3a, a downstream target of Akt in endothelial cells, significantly suppressed both basal and stress-induced HSP70 protein expression. FOXO3a induced caspase-9-dependent apoptosis in HUVEC, and cotransduction with Ad-HSP70 rescued endothelial cells from FOXO3a-induced apoptosis under basal and stress conditions. Our results identify HSP70 as a new antiapoptotic target of Akt-FOXO3a signaling in endothelial cells that controls viability through modulation of the stress-induced intrinsic cell death pathway.

  16. SaDA: From Sampling to Data Analysis-An Extensible Open Source Infrastructure for Rapid, Robust and Automated Management and Analysis of Modern Ecological High-Throughput Microarray Data.

    PubMed

    Singh, Kumar Saurabh; Thual, Dominique; Spurio, Roberto; Cannata, Nicola

    2015-06-03

    One of the most crucial characteristics of day-to-day laboratory information management is the collection, storage and retrieval of information about research subjects and environmental or biomedical samples. An efficient link between sample data and experimental results is absolutely important for the successful outcome of a collaborative project. Currently available software solutions are largely limited to large scale, expensive commercial Laboratory Information Management Systems (LIMS). Acquiring such LIMS indeed can bring laboratory information management to a higher level, but most of the times this requires a sufficient investment of money, time and technical efforts. There is a clear need for a light weighted open source system which can easily be managed on local servers and handled by individual researchers. Here we present a software named SaDA for storing, retrieving and analyzing data originated from microorganism monitoring experiments. SaDA is fully integrated in the management of environmental samples, oligonucleotide sequences, microarray data and the subsequent downstream analysis procedures. It is simple and generic software, and can be extended and customized for various environmental and biomedical studies.

  17. Stable Gene Targeting in Human Cells Using Single-Strand Oligonucleotides with Modified Bases

    PubMed Central

    Rios, Xavier; Briggs, Adrian W.; Christodoulou, Danos; Gorham, Josh M.; Seidman, Jonathan G.; Church, George M.

    2012-01-01

    Recent advances allow multiplexed genome engineering in E. coli, employing easily designed oligonucleotides to edit multiple loci simultaneously. A similar technology in human cells would greatly expedite functional genomics, both by enhancing our ability to test how individual variants such as single nucleotide polymorphisms (SNPs) are related to specific phenotypes, and potentially allowing simultaneous mutation of multiple loci. However, oligo-mediated targeting of human cells is currently limited by low targeting efficiencies and low survival of modified cells. Using a HeLa-based EGFP-rescue reporter system we show that use of modified base analogs can increase targeting efficiency, in part by avoiding the mismatch repair machinery. We investigate the effects of oligonucleotide toxicity and find a strong correlation between the number of phosphorothioate bonds and toxicity. Stably EGFP-corrected cells were generated at a frequency of ~0.05% with an optimized oligonucleotide design combining modified bases and reduced number of phosphorothioate bonds. We provide evidence from comparative RNA-seq analysis suggesting cellular immunity induced by the oligonucleotides might contribute to the low viability of oligo-corrected cells. Further optimization of this method should allow rapid and scalable genome engineering in human cells. PMID:22615794

  18. Voltammetric behaviour of free DNA bases, methylcytosine and oligonucleotides at disposable screen printed graphite electrode platforms.

    PubMed

    Brotons, Ariadna; Mas, Luis Alcaraz; Metters, Jonathan P; Banks, Craig E; Iniesta, Jesús

    2013-09-21

    Improvements in analytical methods for the determination and quantification of methylcytosine in DNA are vital since it has the potential to be used as a biomarker to detect different diseases in the first stage such as in the case of carcinomas and sterility. In this work we utilized screen printed graphite electrodes (SPGE) for studying the electrochemical response of all free DNA bases, methylcytosine and short oligonucleotides by cyclic voltammetry (CV) and square wave voltammetry (SWV). CV and SWV responses of free DNA bases and methylcytosine have been investigated by using SPGE platforms and the feasibility of detecting and quantifying cytosine and methylcytosine as free DNA moieties has been evaluated as a function of pH, concentration and the presence of the other free DNA bases in solution simultaneously. Repeatability of using SWV has been performed for the electrochemical behavior of both 250 μM cytosine and 250 μM methylcytosine in the presence of 25 μM guanine, with coefficient of variations of 6.9% and 2.6% respectively based upon peak current (N = 5). Six-mer oligonucleotides with a sequence 5'-XXXCGC-3', where the XXX motif corresponds to TTT, TTA, TAA and AAA have been performed using SWV in 0.1 M acetate buffer pH 5.0 to explore how the DNA base position effects the electrooxidation of guanine and cytosine into the oligonucleotide. Furthermore SWV comparisons of the electrooxidation of the oligonucleotides 5'-CGCGCG-3' and its methylated 5'-mCGmCGmCG-3' have been performed with concentrations in acetate buffer solutions, and the interaction of both oligonucleotides with the graphitic surface of the SPGE has been demonstrated by fitting well-known adsorption models such as Freundlich and Langmuir kinetics according to the SWV current response of guanine, cytosine and methylcytosine into the oligonucleotide.

  19. RNA therapeutics: Beyond RNA interference and antisense oligonucleotides

    PubMed Central

    Kole, Ryszard; Krainer, Adrian R.; Altman, Sidney

    2016-01-01

    Here we discuss three RNA therapeutic technologies exploiting various oligonucleotides that bind RNA by base-pairing in a sequence-specific manner yet have different mechanisms of action and effects. RNA interference and antisense oligonucleotides downregulate gene expression by enzyme-dependent degradation of targeted mRNA. Steric blocking oligonucleotides block access of cellular machinery to pre-mRNA and mRNA without degrading the RNA. Through this mechanism, blocking oligonucleotides can redirect alternative splicing, repair defective RNA, restore protein production or also downregulate gene expression. Moreover, they can be extensively chemically modified, resulting in more drug-like properties. The ability of RNA blocking oligonucleotides to restore gene function makes them suited for treatment of genetic disorders. Positive results from clinical trials for the treatment of Duchenne muscular dystrophy show that this technology is close to realizing its clinical potential. PMID:22262036

  20. Intelligent nanomedicine integrating diagnosis and therapy

    NASA Technical Reports Server (NTRS)

    Li, Na (Inventor); Tan, Winny (Inventor)

    2012-01-01

    A method of controlling the activity of a biologically active compound. The method concerns an oligonucleotide-based compound, comprising a hairpin-forming oligonucleotide, an effector moiety physically associated with the oligonucleotide, where the effector moiety possesses a biological activity, and a regulating moiety physically associated with the oligonucleotide, where the regulating moiety controls the biological activity of the effector moiety by interacting with the effector moiety. The oligonucleotide can assume a hairpin configuration, where the effector and regulating moieties interact, or an open configuration, where the effector and regulating moieties fail to interact. Depending on the nature of the effector and regulating moieties, either configuration can result in the expression of the biological activity of the effector moiety.

  1. Correction of Spatial Bias in Oligonucleotide Array Data

    PubMed Central

    Lemieux, Sébastien

    2013-01-01

    Background. Oligonucleotide microarrays allow for high-throughput gene expression profiling assays. The technology relies on the fundamental assumption that observed hybridization signal intensities (HSIs) for each intended target, on average, correlate with their target's true concentration in the sample. However, systematic, nonbiological variation from several sources undermines this hypothesis. Background hybridization signal has been previously identified as one such important source, one manifestation of which appears in the form of spatial autocorrelation. Results. We propose an algorithm, pyn, for the elimination of spatial autocorrelation in HSIs, exploiting the duality of desirable mutual information shared by probes in a common probe set and undesirable mutual information shared by spatially proximate probes. We show that this correction procedure reduces spatial autocorrelation in HSIs; increases HSI reproducibility across replicate arrays; increases differentially expressed gene detection power; and performs better than previously published methods. Conclusions. The proposed algorithm increases both precision and accuracy, while requiring virtually no changes to users' current analysis pipelines: the correction consists merely of a transformation of raw HSIs (e.g., CEL files for Affymetrix arrays). A free, open-source implementation is provided as an R package, compatible with standard Bioconductor tools. The approach may also be tailored to other platform types and other sources of bias. PMID:23573083

  2. Time-series oligonucleotide count to assign antiviral siRNAs with long utility fit in the big data era.

    PubMed

    Wada, K; Wada, Y; Iwasaki, Y; Ikemura, T

    2017-10-01

    Oligonucleotides are key elements of nucleic acid therapeutics such as small interfering RNAs (siRNAs). Influenza and Ebolaviruses are zoonotic RNA viruses mutating very rapidly, and their sequence changes must be characterized intensively to design therapeutic oligonucleotides with long utility. Focusing on a total of 182 experimentally validated siRNAs for influenza A, B and Ebolaviruses compiled by the siRNA database, we conducted time-series analyses of occurrences of siRNA targets in these viral genomes. Reflecting their high mutation rates, occurrences of target oligonucleotides evidently fluctuate in viral populations and often disappear. Time-series analysis of the one-base changed sequences derived from each original target identified the oligonucleotide that shows a compensatory increase and will potentially become the 'awaiting-type oligonucleotide'; the combined use of this oligonucleotide with the original can provide therapeutics with long utility. This strategy is also useful for assigning diagnostic reverse transcription-PCR primers with long utility.

  3. Base-Pairing Systems Related to TNA: alpha-Threofuranosyl Oligonucleotides Containing Phosphoramidate Linkages

    NASA Technical Reports Server (NTRS)

    Meyer, Michael (Technical Monitor); Wu, Xiaolin; Guntha, Sreenivasulu; Ferenclc, Mathias; Krishnamurthy, Ramanarayanan; Eschenmoser, Albert

    2002-01-01

    (3'NH)- and (2'NH)-TNA, two isomeric phosphoramidate analogues of TNA (alpha-threofuranosyl-(3'-2') oligonucleotides), are shown to be efficient Watson-Crick base-pairing systems and to undergo intersystem crosspairing with TNA, RNA, and DNA.

  4. Nearest-neighbor thermodynamics of deoxyinosine pairs in DNA duplexes

    PubMed Central

    Watkins, Norman E.; SantaLucia, John

    2005-01-01

    Nearest-neighbor thermodynamic parameters of the ‘universal pairing base’ deoxyinosine were determined for the pairs I·C, I·A, I·T, I·G and I·I adjacent to G·C and A·T pairs. Ultraviolet absorbance melting curves were measured and non-linear regression performed on 84 oligonucleotide duplexes with 9 or 12 bp lengths. These data were combined with data for 13 inosine containing duplexes from the literature. Multiple linear regression was used to solve for the 32 nearest-neighbor unknowns. The parameters predict the Tm for all sequences within 1.2°C on average. The general trend in decreasing stability is I·C > I·A > I·T ≈ I· G > I·I. The stability trend for the base pair 5′ of the I·X pair is G·C > C·G > A·T > T·A. The stability trend for the base pair 3′ of I·X is the same. These trends indicate a complex interplay between H-bonding, nearest-neighbor stacking, and mismatch geometry. A survey of 14 tandem inosine pairs and 8 tandem self-complementary inosine pairs is also provided. These results may be used in the design of degenerate PCR primers and for degenerate microarray probes. PMID:16264087

  5. Validation of the high-throughput marker technology DArT using the model plant Arabidopsis thaliana.

    PubMed

    Wittenberg, Alexander H J; van der Lee, Theo; Cayla, Cyril; Kilian, Andrzej; Visser, Richard G F; Schouten, Henk J

    2005-08-01

    Diversity Arrays Technology (DArT) is a microarray-based DNA marker technique for genome-wide discovery and genotyping of genetic variation. DArT allows simultaneous scoring of hundreds of restriction site based polymorphisms between genotypes and does not require DNA sequence information or site-specific oligonucleotides. This paper demonstrates the potential of DArT for genetic mapping by validating the quality and molecular basis of the markers, using the model plant Arabidopsis thaliana. Restriction fragments from a genomic representation of the ecotype Landsberg erecta (Ler) were amplified by PCR, individualized by cloning and spotted onto glass slides. The arrays were then hybridized with labeled genomic representations of the ecotypes Columbia (Col) and Ler and of individuals from an F(2) population obtained from a Col x Ler cross. The scoring of markers with specialized software was highly reproducible and 107 markers could unambiguously be ordered on a genetic linkage map. The marker order on the genetic linkage map coincided with the order on the DNA sequence map. Sequencing of the Ler markers and alignment with the available Col genome sequence confirmed that the polymorphism in DArT markers is largely a result of restriction site polymorphisms.

  6. Dynamic of active microorganisms inhabiting a bioleaching industrial heap of low‐grade copper sulfide ore monitored by real‐time PCR and oligonucleotide prokaryotic acidophile microarray

    PubMed Central

    Remonsellez, Francisco; Galleguillos, Felipe; Moreno‐Paz, Mercedes; Parro, Víctor; Acosta, Mauricio; Demergasso, Cecilia

    2009-01-01

    Summary The bioleaching of metal sulfide has developed into a very important industrial process and understanding the microbial dynamic is key to advancing commercial bioleaching operations. Here we report the first quantitative description of the dynamic of active communities in an industrial bioleaching heap. Acidithiobacillus ferrooxidans was the most abundant during the first part of the leaching cycle, while the abundance of Leptospirillum ferriphilum and Ferroplasma acidiphilum increased with age of the heap. Acidithiobacillus thiooxidans kept constant throughout the leaching cycle, and Firmicutes group showed a low and a patchy distribution in the heap. The Acidiphilium‐like bacteria reached their highest abundance corresponding to the amount of autotrophs. The active microorganisms in the leaching system were determined using two RNA‐based sensitive techniques. In most cases, the 16S rRNA copy numbers of At. ferrooxidans, L. ferriphilum, At. thiooxidans and F. acidiphilum, was concomitant with the DNA copy numbers, whereas Acidiphilium‐like bacteria and some Firmicutes members did not show a clear correlation between 16S rRNA accumulation and DNA copy numbers. However, the prokaryotic acidophile microarray (PAM) analysis showed active members of Alphaproteobacteria in all samples and of Sulfobacillus genus in older ones. Also, new active groups such as Actinobacteria and Acidobacterium genus were detected by PAM. The results suggest that changes during the leaching cycle in chemical and physical conditions, such as pH and Fe3+/Fe2+ ion rate, are primary factors shaping the microbial dynamic in the heap. PMID:21255296

  7. Angubindin-1 opens the blood-brain barrier in vivo for delivery of antisense oligonucleotide to the central nervous system.

    PubMed

    Zeniya, Satoshi; Kuwahara, Hiroya; Daizo, Kaiichi; Watari, Akihiro; Kondoh, Masuo; Yoshida-Tanaka, Kie; Kaburagi, Hidetoshi; Asada, Ken; Nagata, Tetsuya; Nagahama, Masahiro; Yagi, Kiyohito; Yokota, Takanori

    2018-05-17

    Within the field of RNA therapeutics, antisense oligonucleotide-based therapeutics are a potentially powerful means of treating intractable diseases. However, if these therapeutics are used for the treatment of neurological disorders, safe yet efficient methods of delivering antisense oligonucleotides across the blood-brain barrier to the central nervous system must be developed. Here, we examined the use of angubindin-1, a binder to the tricellular tight junction, to modulate paracellular transport between brain microvascular endothelial cells in the blood-brain barrier for the delivery of antisense oligonucleotides to the central nervous system. This proof-of-concept study demonstrated that intravenously injected angubindin-1 increased the permeability of the blood-brain barrier and enabled transient delivery of subsequently administered antisense oligonucleotides into the mouse brain and spinal cord, leading to silencing of a target RNA without any overt adverse effects. We also found that two bicellular tight junction modulators did not produce such a silencing effect, suggesting that the tricellular tight junction is likely a better target for the delivery of antisense oligonucleotides than the bicellular tight junction. Our delivery strategy of modulating the tricellular tight junction in the blood-brain barrier via angubindin-1 provides a novel avenue of research for the development of antisense oligonucleotide-based therapeutics for the treatment of neurological disorders. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

  8. A high-density transcript linkage map with 1,845 expressed genes positioned by microarray-based Single Feature Polymorphisms (SFP) in Eucalyptus

    PubMed Central

    2011-01-01

    Background Technological advances are progressively increasing the application of genomics to a wider array of economically and ecologically important species. High-density maps enriched for transcribed genes facilitate the discovery of connections between genes and phenotypes. We report the construction of a high-density linkage map of expressed genes for the heterozygous genome of Eucalyptus using Single Feature Polymorphism (SFP) markers. Results SFP discovery and mapping was achieved using pseudo-testcross screening and selective mapping to simultaneously optimize linkage mapping and microarray costs. SFP genotyping was carried out by hybridizing complementary RNA prepared from 4.5 year-old trees xylem to an SFP array containing 103,000 25-mer oligonucleotide probes representing 20,726 unigenes derived from a modest size expressed sequence tags collection. An SFP-mapping microarray with 43,777 selected candidate SFP probes representing 15,698 genes was subsequently designed and used to genotype SFPs in a larger subset of the segregating population drawn by selective mapping. A total of 1,845 genes were mapped, with 884 of them ordered with high likelihood support on a framework map anchored to 180 microsatellites with average density of 1.2 cM. Using more probes per unigene increased by two-fold the likelihood of detecting segregating SFPs eventually resulting in more genes mapped. In silico validation showed that 87% of the SFPs map to the expected location on the 4.5X draft sequence of the Eucalyptus grandis genome. Conclusions The Eucalyptus 1,845 gene map is the most highly enriched map for transcriptional information for any forest tree species to date. It represents a major improvement on the number of genes previously positioned on Eucalyptus maps and provides an initial glimpse at the gene space for this global tree genome. A general protocol is proposed to build high-density transcript linkage maps in less characterized plant species by SFP genotyping with a concurrent objective of reducing microarray costs. HIgh-density gene-rich maps represent a powerful resource to assist gene discovery endeavors when used in combination with QTL and association mapping and should be especially valuable to assist the assembly of reference genome sequences soon to come for several plant and animal species. PMID:21492453

  9. The chemical evolution of oligonucleotide therapies of clinical utility.

    PubMed

    Khvorova, Anastasia; Watts, Jonathan K

    2017-03-01

    After nearly 40 years of development, oligonucleotide therapeutics are nearing meaningful clinical productivity. One of the key advantages of oligonucleotide drugs is that their delivery and potency are derived primarily from the chemical structure of the oligonucleotide whereas their target is defined by the base sequence. Thus, as oligonucleotides with a particular chemical design show appropriate distribution and safety profiles for clinical gene silencing in a particular tissue, this will open the door to the rapid development of additional drugs targeting other disease-associated genes in the same tissue. To achieve clinical productivity, the chemical architecture of the oligonucleotide needs to be optimized with a combination of sugar, backbone, nucleobase, and 3'- and 5'-terminal modifications. A portfolio of chemistries can be used to confer drug-like properties onto the oligonucleotide as a whole, with minor chemical changes often translating into major improvements in clinical efficacy. One outstanding challenge in oligonucleotide chemical development is the optimization of chemical architectures to ensure long-term safety. There are multiple designs that enable effective targeting of the liver, but a second challenge is to develop architectures that enable robust clinical efficacy in additional tissues.

  10. ELISA-BASE: An Integrated Bioinformatics Tool for Analyzing and Tracking ELISA Microarray Data

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    White, Amanda M.; Collett, James L.; Seurynck-Servoss, Shannon L.

    ELISA-BASE is an open-source database for capturing, organizing and analyzing protein enzyme-linked immunosorbent assay (ELISA) microarray data. ELISA-BASE is an extension of the BioArray Soft-ware Environment (BASE) database system, which was developed for DNA microarrays. In order to make BASE suitable for protein microarray experiments, we developed several plugins for importing and analyzing quantitative ELISA microarray data. Most notably, our Protein Microarray Analysis Tool (ProMAT) for processing quantita-tive ELISA data is now available as a plugin to the database.

  11. Multiclass cancer diagnosis using tumor gene expression signatures

    DOE PAGES

    Ramaswamy, S.; Tamayo, P.; Rifkin, R.; ...

    2001-12-11

    The optimal treatment of patients with cancer depends on establishing accurate diagnoses by using a complex combination of clinical and histopathological data. In some instances, this task is difficult or impossible because of atypical clinical presentation or histopathology. To determine whether the diagnosis of multiple common adult malignancies could be achieved purely by molecular classification, we subjected 218 tumor samples, spanning 14 common tumor types, and 90 normal tissue samples to oligonucleotide microarray gene expression analysis. The expression levels of 16,063 genes and expressed sequence tags were used to evaluate the accuracy of a multiclass classifier based on a supportmore » vector machine algorithm. Overall classification accuracy was 78%, far exceeding the accuracy of random classification (9%). Poorly differentiated cancers resulted in low-confidence predictions and could not be accurately classified according to their tissue of origin, indicating that they are molecularly distinct entities with dramatically different gene expression patterns compared with their well differentiated counterparts. Taken together, these results demonstrate the feasibility of accurate, multiclass molecular cancer classification and suggest a strategy for future clinical implementation of molecular cancer diagnostics.« less

  12. Human neural stem cell-derived cultures in three-dimensional substrates form spontaneously functional neuronal networks.

    PubMed

    Smith, Imogen; Silveirinha, Vasco; Stein, Jason L; de la Torre-Ubieta, Luis; Farrimond, Jonathan A; Williamson, Elizabeth M; Whalley, Benjamin J

    2017-04-01

    Differentiated human neural stem cells were cultured in an inert three-dimensional (3D) scaffold and, unlike two-dimensional (2D) but otherwise comparable monolayer cultures, formed spontaneously active, functional neuronal networks that responded reproducibly and predictably to conventional pharmacological treatments to reveal functional, glutamatergic synapses. Immunocytochemical and electron microscopy analysis revealed a neuronal and glial population, where markers of neuronal maturity were observed in the former. Oligonucleotide microarray analysis revealed substantial differences in gene expression conferred by culturing in a 3D vs a 2D environment. Notable and numerous differences were seen in genes coding for neuronal function, the extracellular matrix and cytoskeleton. In addition to producing functional networks, differentiated human neural stem cells grown in inert scaffolds offer several significant advantages over conventional 2D monolayers. These advantages include cost savings and improved physiological relevance, which make them better suited for use in the pharmacological and toxicological assays required for development of stem cell-based treatments and the reduction of animal use in medical research. Copyright © 2015 John Wiley & Sons, Ltd. Copyright © 2015 John Wiley & Sons, Ltd.

  13. SARS-CoV Regulates Immune Function-Related Gene Expression in Human Monocytic Cells

    PubMed Central

    Hu, Wanchung; Yen, Yu-Ting; Singh, Sher; Kao, Chuan-Liang

    2012-01-01

    Abstract Severe acute respiratory syndrome (SARS) is characterized by acute respiratory distress syndrome (ARDS) and pulmonary fibrosis, and monocytes/macrophages are the key players in the pathogenesis of SARS. In this study, we compared the transcriptional profiles of SARS coronavirus (SARS-CoV)-infected monocytic cells against that infected by coronavirus 229E (CoV-229E). Total RNA was extracted from infected DC-SIGN-transfected monocytes (THP-1-DC-SIGN) at 6 and 24 h after infection, and the gene expression was profiled in oligonucleotide-based microarrays. Analysis of immune-related gene expression profiles showed that at 24 h after SARS-CoV infection: (1) IFN-α/β-inducible and cathepsin/proteasome genes were downregulated; (2) hypoxia/hyperoxia-related genes were upregulated; and (3) TLR/TLR-signaling, cytokine/cytokine receptor-related, chemokine/chemokine receptor-related, lysosome-related, MHC/chaperon-related, and fibrosis-related genes were differentially regulated. These results elucidate that SARS-CoV infection regulates immune-related genes in monocytes/macrophages, which may be important to the pathogenesis of SARS. PMID:22876772

  14. Arrhythmogenic right ventricular cardiomyopathy in Boxer dogs is associated with calstabin2 deficiency

    PubMed Central

    Oyama, Mark A.; Reiken, Steve; Lehnart, Stephan E.; Chittur, Sridar V.; Meurs, Kathryn M.; Stern, Joshua; Marks, Andrew R.

    2010-01-01

    Objective To examine the presence and effect of calstabin2-deficiency in Boxer dogs with arrhythmogenic right ventricular cardiomyopathy (ARVC). Animals Thirteen Boxer dogs with ARVC. Materials and methods Tissue samples were collected for histopathology, oligonucleotide microarray, PCR, immunoelectrophoresis, ryanodine channel immunoprecipitation and single-channel recordings, and calstabin2 DNA sequencing. Results In cardiomyopathic Boxer dogs, myocardial calstabin2 mRNA and protein were significantly decreased as compared to healthy control dogs (calstabin2 protein normalized to tetrameric cardiac ryanodine receptor (RyR2) complex: affected, 0.51 ± 0.04; control, 3.81 ± 0.22; P < 0.0001). Calstabin2 deficiency in diseased dog hearts was associated with a significantly increased open probability of single RyR2 channels indicating intracellular Ca2+ leak. PCR-based sequencing of the promoter, exonic and splice site regions of the canine calstabin2 gene did not identify any causative mutations. Conclusions Calstabin2 deficiency is a potential mechanism of Ca2+ leak-induced ventricular arrhythmias and heart disease in Boxer dogs with ARVC. PMID:18515204

  15. SARS-CoV regulates immune function-related gene expression in human monocytic cells.

    PubMed

    Hu, Wanchung; Yen, Yu-Ting; Singh, Sher; Kao, Chuan-Liang; Wu-Hsieh, Betty A

    2012-08-01

    Severe acute respiratory syndrome (SARS) is characterized by acute respiratory distress syndrome (ARDS) and pulmonary fibrosis, and monocytes/macrophages are the key players in the pathogenesis of SARS. In this study, we compared the transcriptional profiles of SARS coronavirus (SARS-CoV)-infected monocytic cells against that infected by coronavirus 229E (CoV-229E). Total RNA was extracted from infected DC-SIGN-transfected monocytes (THP-1-DC-SIGN) at 6 and 24 h after infection, and the gene expression was profiled in oligonucleotide-based microarrays. Analysis of immune-related gene expression profiles showed that at 24 h after SARS-CoV infection: (1) IFN-α/β-inducible and cathepsin/proteasome genes were downregulated; (2) hypoxia/hyperoxia-related genes were upregulated; and (3) TLR/TLR-signaling, cytokine/cytokine receptor-related, chemokine/chemokine receptor-related, lysosome-related, MHC/chaperon-related, and fibrosis-related genes were differentially regulated. These results elucidate that SARS-CoV infection regulates immune-related genes in monocytes/macrophages, which may be important to the pathogenesis of SARS.

  16. Unveiling the transcriptional features associated with coccolithovirus infection of natural Emiliania huxleyi blooms.

    PubMed

    Pagarete, António; Le Corguillé, Gildas; Tiwari, Bela; Ogata, Hiroyuki; de Vargas, Colomban; Wilson, William H; Allen, Michael J

    2011-12-01

    Lytic viruses have been implicated in the massive cellular lysis observed during algal blooms, through which they assume a prominent role in oceanic carbon and nutrient flows. Despite their impact on biogeochemical cycling, the transcriptional dynamics of these important oceanic events is still poorly understood. Here, we employ an oligonucleotide microarray to monitor host (Emiliania huxleyi) and virus (coccolithovirus) transcriptomic features during the course of E. huxleyi blooms induced in seawater-based mesocosm enclosures. Host bloom development and subsequent coccolithovirus infection was associated with a major shift in transcriptional profile. In addition to the expected metabolic requirements typically associated with viral infection (amino acid and nucleotide metabolism, as well as transcription- and replication-associated functions), the results strongly suggest that the manipulation of lipid metabolism plays a fundamental role during host-virus interaction. The results herein reveal the scale, so far massively underestimated, of the transcriptional domination that occurs during coccolithovirus infection in the natural environment. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  17. Safety of antisense oligonucleotide and siRNA-based therapeutics.

    PubMed

    Chi, Xuan; Gatti, Philip; Papoian, Thomas

    2017-05-01

    Oligonucleotide-based therapy is an active area of drug development designed to treat a variety of gene-specific diseases. Two of the more promising platforms are the antisense oligonucleotides (ASOs) and short interfering RNAs (siRNAs), both of which are often directed against similar targets. In light of recent reports on clinical trials of severe thrombocytopenia with two different ASO drugs and increased peripheral neuropathy with an siRNA drug, we compared and contrasted the specific safety characteristics of these two classes of oligonucleotide therapeutic. The objectives were to assess factors that could contribute to the specific toxicities observed with these two classes of promising drugs, and get a better understanding of the potential mechanism(s) responsible for these rare, but serious, adverse events. Published by Elsevier Ltd.

  18. Gene expression profiling of Listeria monocytogenes strain F2365 during growth in ultrahigh-temperature-processed skim milk.

    PubMed

    Liu, Yanhong; Ream, Amy

    2008-11-01

    To study how Listeria monocytogenes survives and grows in ultrahigh-temperature-processed (UHT) skim milk, microarray technology was used to monitor the gene expression profiles of strain F2365 in UHT skim milk. Total RNA was isolated from strain F2365 in UHT skim milk after 24 h of growth at 4 degrees C, labeled with fluorescent dyes, and hybridized to "custom-made" commercial oligonucleotide (35-mers) microarray chips containing the whole genome of L. monocytogenes strain F2365. Compared to L. monocytogenes grown in brain heart infusion (BHI) broth for 24 h at 4 degrees C, 26 genes were upregulated (more-than-twofold increase) in UHT skim milk, whereas 14 genes were downregulated (less-than-twofold decrease). The upregulated genes included genes encoding transport and binding proteins, transcriptional regulators, proteins in amino acid biosynthesis and energy metabolism, protein synthesis, cell division, and hypothetical proteins. The downregulated genes included genes that encode transport and binding proteins, protein synthesis, cellular processes, cell envelope, energy metabolism, a transcriptional regulator, and an unknown protein. The gene expression changes determined by microarray assays were confirmed by real-time reverse transcriptase PCR analyses. Furthermore, cells grown in UHT skim milk displayed the same sensitivity to hydrogen peroxide as cells grown in BHI, demonstrating that the elevated levels of expression of genes encoding manganese transporter complexes in UHT skim milk did not result in changes in the oxidative stress sensitivity. To our knowledge, this report represents a novel study of global transcriptional gene expression profiling of L. monocytogenes in a liquid food.

  19. Protein profiles associated with survival in lung adenocarcinoma

    PubMed Central

    Chen, Guoan; Gharib, Tarek G; Wang, Hong; Huang, Chiang-Ching; Kuick, Rork; Thomas, Dafydd G.; Shedden, Kerby A.; Misek, David E.; Taylor, Jeremy M. G.; Giordano, Thomas J.; Kardia, Sharon L. R.; Iannettoni, Mark D.; Yee, John; Hogg, Philip J.; Orringer, Mark B.; Hanash, Samir M.; Beer, David G.

    2003-01-01

    Morphologic assessment of lung tumors is informative but insufficient to adequately predict patient outcome. We previously identified transcriptional profiles that predict patient survival, and here we identify proteins associated with patient survival in lung adenocarcinoma. A total of 682 individual protein spots were quantified in 90 lung adenocarcinomas by using quantitative two-dimensional polyacrylamide gel electrophoresis analysis. A leave-one-out cross-validation procedure using the top 20 survival-associated proteins identified by Cox modeling indicated that protein profiles as a whole can predict survival in stage I tumor patients (P = 0.01). Thirty-three of 46 survival-associated proteins were identified by using mass spectrometry. Expression of 12 candidate proteins was confirmed as tumor-derived with immunohistochemical analysis and tissue microarrays. Oligonucleotide microarray results from both the same tumors and from an independent study showed mRNAs associated with survival for 11 of 27 encoded genes. Combined analysis of protein and mRNA data revealed 11 components of the glycolysis pathway as associated with poor survival. Among these candidates, phosphoglycerate kinase 1 was associated with survival in the protein study, in both mRNA studies and in an independent validation set of 117 adenocarcinomas and squamous lung tumors using tissue microarrays. Elevated levels of phosphoglycerate kinase 1 in the serum were also significantly correlated with poor outcome in a validation set of 107 patients with lung adenocarcinomas using ELISA analysis. These studies identify new prognostic biomarkers and indicate that protein expression profiles can predict the outcome of patients with early-stage lung cancer. PMID:14573703

  20. Effect of (+)-usnic acid on mitochondrial functions as measured by mitochondria-specific oligonucleotide microarray in liver of B6C3F1 mice.

    PubMed

    Joseph, Ajay; Lee, Taewon; Moland, Carrie L; Branham, William S; Fuscoe, James C; Leakey, Julian E A; Allaben, William T; Lewis, Sherry M; Ali, Akhtar A; Desai, Varsha G

    2009-04-01

    Usnic acid is a lichen metabolite used as a weight-loss dietary supplement due to its uncoupling action on mitochondria. However, its use has been associated with severe liver disorders in some individuals. Animal studies conducted thus far evaluated the effects of usnic acid on mitochondria primarily by measuring the rate of oxygen consumption and/or ATP generation. To obtain further insight into usnic acid-mediated effects on mitochondria, we examined the expression levels of 542 genes associated with mitochondrial structure and functions in liver of B6C3F(1) female mice using a mitochondria-specific microarray. Beginning at 8 weeks of age, mice received usnic acid at 0, 60, 180, and 600 ppm in ground, irradiated 5LG6 diet for 14 days. Microarray analysis showed a significant effect of usnic acid on the expression of several genes only at the highest dose of 600 ppm. A prominent finding of the study was a significant induction of genes associated with complexes I through IV of the electron transport chain. Moreover, several genes involved in fatty acid oxidation, the Krebs cycle, apoptosis, and membrane transporters were over-expressed. Usnic acid is a lipophilic weak acid that can diffuse through mitochondrial membranes and cause a proton leak (uncoupling). The up-regulation of complexes I-IV may be a compensatory mechanism to maintain the proton gradient across the mitochondrial inner membrane. In addition, induction of fatty acid oxidation and the Krebs cycle may be an adaptive response to uncoupling of mitochondria.

  1. Mucin-mediated nanocarrier disassembly for triggered uptake of oligonucleotides as a delivery strategy for the potential treatment of mucosal tumours

    NASA Astrophysics Data System (ADS)

    Martirosyan, A.; Olesen, M. J.; Fenton, R. A.; Kjems, J.; Howard, K. A.

    2016-06-01

    This work demonstrates gastric mucin-triggered nanocarrier disassembly for release of antisense oligonucleotides and consequent unassisted cellular entry as a novel oral delivery strategy. A fluorescence activation-based reporter system was used to investigate the interaction and mucin-mediated disassembly of chitosan-based nanocarriers containing a 13-mer DNA oligonucleotide with a flanked locked RNA nucleic acid gapmer design. Gastric mucins were shown to trigger gapmer release from nanocarriers that was dependent on the interaction time, mucin concentration and N : P ratio with a maximal release at N : P 10. In contrast to siRNA, naked gapmers exhibited uptake into mucus producing HT-MTX mono-cultures and HT-MTX co-cultured with the carcinoma epithelial cell line Caco-2. Importantly, in vivo gapmer uptake was observed in epithelial tissue 30 min post-injection in murine intestinal loops. The findings present a mucosal design-based system tailored for local delivery of oligonucleotides that may maximize the effectiveness of gene silencing therapeutics within tumours at mucosal sites.This work demonstrates gastric mucin-triggered nanocarrier disassembly for release of antisense oligonucleotides and consequent unassisted cellular entry as a novel oral delivery strategy. A fluorescence activation-based reporter system was used to investigate the interaction and mucin-mediated disassembly of chitosan-based nanocarriers containing a 13-mer DNA oligonucleotide with a flanked locked RNA nucleic acid gapmer design. Gastric mucins were shown to trigger gapmer release from nanocarriers that was dependent on the interaction time, mucin concentration and N : P ratio with a maximal release at N : P 10. In contrast to siRNA, naked gapmers exhibited uptake into mucus producing HT-MTX mono-cultures and HT-MTX co-cultured with the carcinoma epithelial cell line Caco-2. Importantly, in vivo gapmer uptake was observed in epithelial tissue 30 min post-injection in murine intestinal loops. The findings present a mucosal design-based system tailored for local delivery of oligonucleotides that may maximize the effectiveness of gene silencing therapeutics within tumours at mucosal sites. Electronic supplementary information (ESI) available. See DOI: 10.1039/c5nr07206a

  2. Five omic technologies are concordant in differentiating the biochemical characteristics of the berries of five grapevine (Vitis vinifera L.) cultivars.

    PubMed

    Ghan, Ryan; Van Sluyter, Steven C; Hochberg, Uri; Degu, Asfaw; Hopper, Daniel W; Tillet, Richard L; Schlauch, Karen A; Haynes, Paul A; Fait, Aaron; Cramer, Grant R

    2015-11-16

    Grape cultivars and wines are distinguishable by their color, flavor and aroma profiles. Omic analyses (transcripts, proteins and metabolites) are powerful tools for assessing biochemical differences in biological systems. Berry skins of red- (Cabernet Sauvignon, Merlot, Pinot Noir) and white-skinned (Chardonnay, Semillon) wine grapes were harvested near optimum maturity (°Brix-to-titratable acidity ratio) from the same experimental vineyard. The cultivars were exposed to a mild, seasonal water-deficit treatment from fruit set until harvest in 2011. Identical sample aliquots were analyzed for transcripts by grapevine whole-genome oligonucleotide microarray and RNAseq technologies, proteins by nano-liquid chromatography-mass spectroscopy, and metabolites by gas chromatography-mass spectroscopy and liquid chromatography-mass spectroscopy. Principal components analysis of each of five Omic technologies showed similar results across cultivars in all Omic datasets. Comparison of the processed data of genes mapped in RNAseq and microarray data revealed a strong Pearson's correlation (0.80). The exclusion of probesets associated with genes with potential for cross-hybridization on the microarray improved the correlation to 0.93. The overall concordance of protein with transcript data was low with a Pearson's correlation of 0.27 and 0.24 for the RNAseq and microarray data, respectively. Integration of metabolite with protein and transcript data produced an expected model of phenylpropanoid biosynthesis, which distinguished red from white grapes, yet provided detail of individual cultivar differences. The mild water deficit treatment did not significantly alter the abundance of proteins or metabolites measured in the five cultivars, but did have a small effect on gene expression. The five Omic technologies were consistent in distinguishing cultivar variation. There was high concordance between transcriptomic technologies, but generally protein abundance did not correlate well with transcript abundance. The integration of multiple high-throughput Omic datasets revealed complex biochemical variation amongst five cultivars of an ancient and economically important crop species.

  3. In Silico Screening Based on Predictive Algorithms as a Design Tool for Exon Skipping Oligonucleotides in Duchenne Muscular Dystrophy

    PubMed Central

    Echigoya, Yusuke; Mouly, Vincent; Garcia, Luis; Yokota, Toshifumi; Duddy, William

    2015-01-01

    The use of antisense ‘splice-switching’ oligonucleotides to induce exon skipping represents a potential therapeutic approach to various human genetic diseases. It has achieved greatest maturity in exon skipping of the dystrophin transcript in Duchenne muscular dystrophy (DMD), for which several clinical trials are completed or ongoing, and a large body of data exists describing tested oligonucleotides and their efficacy. The rational design of an exon skipping oligonucleotide involves the choice of an antisense sequence, usually between 15 and 32 nucleotides, targeting the exon that is to be skipped. Although parameters describing the target site can be computationally estimated and several have been identified to correlate with efficacy, methods to predict efficacy are limited. Here, an in silico pre-screening approach is proposed, based on predictive statistical modelling. Previous DMD data were compiled together and, for each oligonucleotide, some 60 descriptors were considered. Statistical modelling approaches were applied to derive algorithms that predict exon skipping for a given target site. We confirmed (1) the binding energetics of the oligonucleotide to the RNA, and (2) the distance in bases of the target site from the splice acceptor site, as the two most predictive parameters, and we included these and several other parameters (while discounting many) into an in silico screening process, based on their capacity to predict high or low efficacy in either phosphorodiamidate morpholino oligomers (89% correctly predicted) and/or 2’O Methyl RNA oligonucleotides (76% correctly predicted). Predictions correlated strongly with in vitro testing for sixteen de novo PMO sequences targeting various positions on DMD exons 44 (R2 0.89) and 53 (R2 0.89), one of which represents a potential novel candidate for clinical trials. We provide these algorithms together with a computational tool that facilitates screening to predict exon skipping efficacy at each position of a target exon. PMID:25816009

  4. Synthesis and hybridization of a series of biotinylated oligonucleotides.

    PubMed Central

    Cook, A F; Vuocolo, E; Brakel, C L

    1988-01-01

    A series of oligonucleotides containing biotin-11-dUMP at various positions were synthesized and compared in quantitative, colorimetric hybridization-detection studies. A deoxyuridine phosphoramidite containing a protected allylamino sidearm was synthesized and used in standard, automated synthesis cycles to prepare oligonucleotides with allylamino residues at various positions within a standard 17-base sequence. Biotin substituents were subsequently attached to the allylamino sidearms by reaction with N-biotinyl-6-aminocaproic acid N-hydroxysuccinimide ester. These oligomers were hybridized to target DNA immobilized on microtiter wells (ELISA plates), and were detected with a streptavidin-biotinylated horseradish peroxidase complex using hydrogen peroxide as substrate and o-phenylenediamine as chromogen. We found that the sensitivity of detection of target DNA by biotin-labeled oligonucleotide probes was strongly dependent upon the position of the biotin label. Oligonucleotides containing biotin labels near or off the ends of the hybridizing sequence were more effective probes than oligonucleotides containing internal biotin labels. An additive effect of increasing numbers of biotin-dUMP residues was found for some labeling configurations. PMID:3375076

  5. Time-series oligonucleotide count to assign antiviral siRNAs with long utility fit in the big data era

    PubMed Central

    Wada, K; Wada, Y; Iwasaki, Y; Ikemura, T

    2017-01-01

    Oligonucleotides are key elements of nucleic acid therapeutics such as small interfering RNAs (siRNAs). Influenza and Ebolaviruses are zoonotic RNA viruses mutating very rapidly, and their sequence changes must be characterized intensively to design therapeutic oligonucleotides with long utility. Focusing on a total of 182 experimentally validated siRNAs for influenza A, B and Ebolaviruses compiled by the siRNA database, we conducted time-series analyses of occurrences of siRNA targets in these viral genomes. Reflecting their high mutation rates, occurrences of target oligonucleotides evidently fluctuate in viral populations and often disappear. Time-series analysis of the one-base changed sequences derived from each original target identified the oligonucleotide that shows a compensatory increase and will potentially become the ‘awaiting-type oligonucleotide’ the combined use of this oligonucleotide with the original can provide therapeutics with long utility. This strategy is also useful for assigning diagnostic reverse transcription-PCR primers with long utility. PMID:28905886

  6. Synthesis and biophysical properties of 5'-thio-2',4'-BNA/LNA oligonucleotide.

    PubMed

    Islam, Md Ariful; Fujisaka, Aki; Mori, Shohei; Ito, Kosuke Ramon; Yamaguchi, Takao; Obika, Satoshi

    2018-07-23

    Phosphorothioate modification of oligonucleotides is one of the most promising chemical modifications in nucleic acid therapeutics. Structurally similar 5'-thio or phosphorothiolate-modified nucleotides, in which the 5'-bridging oxygen atom is replaced with a sulfur atom, are attracting attention and gaining importance in oligonucleotide-based research. In our present study, we synthesized 5'-thio-2',4'-BNA/LNA monomers bearing thymine or 5-methylcytosine nucleobase. The 5'-thio-2',4'-BNA/LNA monomers were successfully incorporated into target oligonucleotides, and their nuclease stability and binding affinity with complementary strands were evaluated. Copyright © 2018 Elsevier Ltd. All rights reserved.

  7. Gene expression profiling of human mesenchymal stem cells derived from bone marrow during expansion and osteoblast differentiation.

    PubMed

    Kulterer, Birgit; Friedl, Gerald; Jandrositz, Anita; Sanchez-Cabo, Fatima; Prokesch, Andreas; Paar, Christine; Scheideler, Marcel; Windhager, Reinhard; Preisegger, Karl-Heinz; Trajanoski, Zlatko

    2007-03-12

    Human mesenchymal stem cells (MSC) with the capacity to differentiate into osteoblasts provide potential for the development of novel treatment strategies, such as improved healing of large bone defects. However, their low frequency in bone marrow necessitate ex vivo expansion for further clinical application. In this study we asked if MSC are developing in an aberrant or unwanted way during ex vivo long-term cultivation and if artificial cultivation conditions exert any influence on their stem cell maintenance. To address this question we first developed human oligonucleotide microarrays with 30.000 elements and then performed large-scale expression profiling of long-term expanded MSC and MSC during differentiation into osteoblasts. The results showed that MSC did not alter their osteogenic differentiation capacity, surface marker profile, and the expression profiles of MSC during expansion. Microarray analysis of MSC during osteogenic differentiation identified three candidate genes for further examination and functional analysis: ID4, CRYAB, and SORT1. Additionally, we were able to reconstruct the three developmental phases during osteoblast differentiation: proliferation, matrix maturation, and mineralization, and illustrate the activation of the SMAD signaling pathways by TGF-beta2 and BMPs. With a variety of assays we could show that MSC represent a cell population which can be expanded for therapeutic applications.

  8. Gene expression profiling of mucolipidosis type IV fibroblasts reveals deregulation of genes with relevant functions in lysosome physiology.

    PubMed

    Bozzato, Andrea; Barlati, Sergio; Borsani, Giuseppe

    2008-04-01

    Mucolipidosis type IV (MLIV, MIM 252650) is an autosomal recessive lysosomal storage disorder that causes mental and motor retardation as well as visual impairment. The lysosomal storage defect in MLIV is consistent with abnormalities of membrane traffic and organelle dynamics in the late endocytic pathway. MLIV is caused by mutations in the MCOLN1 gene, which codes for mucolipin-1 (MLN1), a member of the large family of transient receptor potential (TRP) cation channels. Although a number of studies have been performed on mucolipin-1, the pathological mechanisms underlying MLIV are not fully understood. To identify genes that characterize pathogenic changes in mucolipidosis type IV, we compared the expression profiles of three MLIV and three normal skin fibroblasts cell lines using oligonucleotide microarrays. Genes that were differentially expressed in patients' cells were identified. 231 genes were up-regulated, and 116 down-regulated. Real-Time RT-PCR performed on selected genes in six independent MLIV fibroblasts cell lines was generally consistent with the microarray findings. This study allowed to evidence the modulation at the transcriptional level of a discrete number of genes relevant in biological processes which are altered in the disease such as endosome/lysosome trafficking, lysosome biogenesis, organelle acidification and lipid metabolism.

  9. Successful Application of Microarray Technology to Microdissected Formalin-Fixed, Paraffin-Embedded Tissue

    PubMed Central

    Coudry, Renata A.; Meireles, Sibele I.; Stoyanova, Radka; Cooper, Harry S.; Carpino, Alan; Wang, Xianqun; Engstrom, Paul F.; Clapper, Margie L.

    2007-01-01

    The establishment of a reliable method for using RNA from formalin-fixed, paraffin-embedded (FFPE) tissue would provide an opportunity to obtain novel gene expression data from the vast amounts of archived tissue. A custom-designed 22,000 oligonucleotide array was used in the present study to compare the gene expression profile of colonic epithelial cells isolated by laser capture microdissection from FFPE-archived samples with that of the same cell population from matched frozen samples, the preferred source of RNA. Total RNA was extracted from FFPE tissues, amplified, and labeled using the Paradise Reagent System. The quality of the input RNA was assessed by the Bioanalyzer profile, reverse transcriptase-polymerase chain reaction, and agarose gel electrophoresis. The results demonstrate that it is possible to obtain reliable microarray data from FFPE samples using RNA acquired by laser capture microdissection. The concordance between matched FFPE and frozen samples was evaluated and expressed as a Pearson’s correlation coefficient, with values ranging from 0.80 to 0.97. The presence of ribosomal RNA peaks in FFPE-derived RNA was reflected by a high correlation with paired frozen samples. A set of practical recommendations for evaluating the RNA integrity and quality in FFPE samples is reported. PMID:17251338

  10. A new normalizing algorithm for BAC CGH arrays with quality control metrics.

    PubMed

    Miecznikowski, Jeffrey C; Gaile, Daniel P; Liu, Song; Shepherd, Lori; Nowak, Norma

    2011-01-01

    The main focus in pin-tip (or print-tip) microarray analysis is determining which probes, genes, or oligonucleotides are differentially expressed. Specifically in array comparative genomic hybridization (aCGH) experiments, researchers search for chromosomal imbalances in the genome. To model this data, scientists apply statistical methods to the structure of the experiment and assume that the data consist of the signal plus random noise. In this paper we propose "SmoothArray", a new method to preprocess comparative genomic hybridization (CGH) bacterial artificial chromosome (BAC) arrays and we show the effects on a cancer dataset. As part of our R software package "aCGHplus," this freely available algorithm removes the variation due to the intensity effects, pin/print-tip, the spatial location on the microarray chip, and the relative location from the well plate. removal of this variation improves the downstream analysis and subsequent inferences made on the data. Further, we present measures to evaluate the quality of the dataset according to the arrayer pins, 384-well plates, plate rows, and plate columns. We compare our method against competing methods using several metrics to measure the biological signal. With this novel normalization algorithm and quality control measures, the user can improve their inferences on datasets and pinpoint problems that may arise in their BAC aCGH technology.

  11. Genomic expression patterns of cardiac tissues from dogs with dilated cardiomyopathy.

    PubMed

    Oyama, Mark A; Chittur, Sridar

    2005-07-01

    To evaluate global genome expression patterns of left ventricular tissues from dogs with dilated cardiomyopathy (DCM). Tissues obtained from the left ventricle of 2 Doberman Pinschers with end-stage DCM and 5 healthy control dogs. Transcriptional activities of 23,851 canine DNA sequences were determined by use of an oligonucleotide microarray. Genome expression patterns of DCM tissue were evaluated by measuring the relative amount of complementary RNA hybridization to the microarray probes and comparing it with gene expression for tissues from 5 healthy control dogs. 478 transcripts were differentially expressed (> or = 2.5-fold change). In DCM tissue, expression of 173 transcripts was upregulated and expression of 305 transcripts was downregulated, compared with expression for control tissues. Of the 478 transcripts, 167 genes could be specifically identified. These genes were grouped into 1 of 8 categories on the basis of their primary physiologic function. Grouping revealed that pathways involving cellular energy production, signaling and communication, and cell structure were generally downregulated, whereas pathways involving cellular defense and stress responses were upregulated. Many previously unreported genes that may contribute to the pathophysiologic aspects of heart disease were identified. Evaluation of global expression patterns provides a molecular portrait of heart failure, yields insights into the pathophysiologic aspects of DCM, and identifies intriguing genes and pathways for further study.

  12. DNA Microarray Profiling Highlights Nrf2-Mediated Chemoprevention Targeted by Wasabi-Derived Isothiocyanates in HepG2 Cells.

    PubMed

    Trio, Phoebe Zapanta; Kawahara, Atsuyoshi; Tanigawa, Shunsuke; Sakao, Kozue; Hou, De-Xing

    2017-01-01

    6-MSITC and 6-MTITC are sulforaphane (SFN) analogs found in Japanese Wasabi. As we reported previously, Wasabi isothiocyanates (ITCs) are activators of Nrf2-antioxidant response element pathway, and also inhibitors of pro-inflammatory cyclooxygenase-2. This study is the first to assess the global changes in transcript levels by Wasabi ITCs, comparing with SFN, in HepG2 cells. We performed comparative gene expression profiling by treating HepG2 cells with ITCs, followed by DNA microarray analyses using HG-U133 plus 2.0 oligonucleotide array. Partial array data on selected gene products were confirmed by RT-PCR and Western blotting. Ingenuity Pathway Analysis (IPA) was used to identify functional subsets of genes and biologically significant network pathways. 6-MTITC showed the highest number of differentially altered (≥2 folds) gene expression, of which 114 genes were upregulated and 75 were downregulated. IPA revealed that Nrf2-mediated pathway, together with glutamate metabolism, is the common significantly modulated pathway across treatments. Interestingly, 6-MSITC exhibited the most potent effect toward Nrf2-mediated pathway. Our data suggest that 6-MSITC could exert chemopreventive role against cancer through its underlying antioxidant activity via the activation of Nrf2-mediated subsequent induction of cytoprotective genes.

  13. Increased expression of protein kinase A inhibitor alpha (PKI-alpha) and decreased PKA-regulated genes in chronic intermittent alcohol exposure.

    PubMed

    Repunte-Canonigo, Vez; Lutjens, Robert; van der Stap, Lena D; Sanna, Pietro Paolo

    2007-03-23

    Intermittent models of alcohol exposure that mimic human patterns of alcohol consumption produce profound physiological and biochemical changes and induce rapid increases in alcohol self-administration. We used high-density oligonucleotide microarrays to investigate gene expression changes during chronic intermittent alcohol exposure in three brain regions that receive mesocorticolimbic dopaminergic projections and that are believed to be involved in alcohol's reinforcing actions: the medial prefrontal cortex, the nucleus accumbens and the amygdala. An independent replication of the experiment was used for RT-PCR validation of the microarray results. The protein kinase A inhibitor alpha (PKI-alpha, Pkia), a member of the endogenous PKI family implicated in reducing nuclear PKA activity, was found to be increased in all three regions tested. Conversely, we observed a downregulation of the expression of several PKA-regulated transcripts in one or more of the brain regions studied, including the activity and neurotransmitter-regulated early gene (Ania) - 1, -3, -7, -8, the transcription factors Egr1 and NGFI-B (Nr4a1) and the neuropeptide NPY. Reduced expression of PKA-regulated genes in mesocorticolimbic projection areas may have motivational significance in the rapid increase in alcohol self-administration induced by intermittent alcohol exposure.

  14. Use of continuous/contiguous stacking hybridization as a diagnostic tool

    DOEpatents

    Mirzabekov, Andrei Darievich; Yershov, Gennadiy Moseyevich; Kirillov, Eugene Vladislavovich; Parinov, Sergei Valeryevich; Barski, Victor Evgenievich; Lysov, Yuri Petrovich

    1999-01-01

    A method for detecting disease-associated alleles in patient genetic material is provided whereby a first group of oligonucleotide molecules, synthesized to compliment base sequences of the disease associated alleles is immobilized on a predetermined position on a substrate, and then contacted with patient genetic material to form duplexes. The duplexes are then contacted with a second group of oligonucleotide molecules which are synthesized to extend the predetermined length of the oligonucleotide molecules of the first group, and where each of the oligonucleotide molecules of the second group are tagged and either incorporate universal bases or a mixture of guanine, cytosine, thymine, and adenine, or complementary nucleotide strands that are tagged with a different fluorochrome which radiates light at a predetermined wavelength. The treated substrate is then washed and the light patterns radiating therefrom are compared with predetermined light patterns of various diseases that were prepared on identical substrates.

  15. Use of continuous/contiguous stacking hybridization as a diagnostic tool

    DOEpatents

    Mirzabekov, A.D.; Yershov, G.M.; Kirillov, E.V.; Parinov, S.V.; Barski, V.E.; Lysov, Y.P.

    1999-06-01

    A method for detecting disease-associated alleles in patient genetic material is provided whereby a first group of oligonucleotide molecules, synthesized to compliment base sequences of the disease associated alleles is immobilized on a predetermined position on a substrate, and then contacted with patient genetic material to form duplexes. The duplexes are then contacted with a second group of oligonucleotide molecules which are synthesized to extend the predetermined length of the oligonucleotide molecules of the first group, and where each of the oligonucleotide molecules of the second group are tagged and either incorporate universal bases or a mixture of guanine, cytosine, thymine, and adenine, or complementary nucleotide strands that are tagged with a different fluorochrome which radiates light at a predetermined wavelength. The treated substrate is then washed and the light patterns radiating therefrom are compared with predetermined light patterns of various diseases that were prepared on identical substrates. 5 figs.

  16. Silver Nanoparticle Oligonucleotide Conjugates Based on DNA with Triple Cyclic Disulfide Moieties

    PubMed Central

    Lee, Jae-Seung; Lytton-Jean, Abigail K. R.; Hurst, Sarah J.; Mirkin, Chad A.

    2011-01-01

    We report a new strategy for preparing silver nanoparticle oligonucleotide conjugates that are based upon DNA with cyclic disulfide-anchoring groups. These particles are extremely stable and can withstand NaCl concentrations up to 1.0 M. When silver nanoparticles functionalized with complementary sequences are combined, they assemble to form DNA-linked nanoparticle networks. This assembly process is reversible with heating and is associated with a red-shifting of the particle surface plasmon resonance and a concomitant color change from yellow to pale red. Analogous to the oligonucleotide-functionalized gold nanoparticles, these particles also exhibit highly cooperative binding properties with extremely sharp melting transitions. This work is an important step towards being able to use silver nanoparticle oligonucleotide conjugates for a variety of purposes, including molecular diagnostic labels, synthons in programmable materials synthesis approaches, and functional components for nanoelectronic and plasmonic devices. PMID:17571909

  17. Measuring the binding stoichiometry of HIV-1 Gag to very-low-density oligonucleotide surfaces using surface plasmon resonance spectroscopy.

    PubMed

    Stephen, Andrew G; Datta, Siddhartha A K; Worthy, Karen M; Bindu, Lakshman; Fivash, Matthew J; Turner, Kevin B; Fabris, Daniele; Rein, Alan; Fisher, Robert J

    2007-09-01

    The interaction of the HIV Gag polyprotein with nucleic acid is a critical step in the assembly of viral particles. The Gag polyprotein is composed of the matrix (MA), capsid (CA), and nucleocapsid (NC) domains. The NC domain is required for nucleic acid interactions, and the CA domain is required for Gag-Gag interactions. Previously, we have investigated the binding of the NC protein to d(TG)(n) oligonucleotides using surface plasmon resonance (SPR) spectroscopy. We found a single NC protein is able to bind to more than one immobilized oligonucleotide, provided that the oligonucleotides are close enough together. As NC is believed to be the nucleic acid binding domain of Gag, we might expect Gag to show the same complex behavior. We wished to analyze the stoichiometry of Gag binding to oligonucleotides without this complication due to tertiary complex formation. We have therefore analyzed Gag binding to extremely low oligonucleotide density on SPR chips. Such low densities of oligonucleotides are difficult to accurately quantitate. We have determined by Fourier transform ion cyclotron (FTICR) mass spectrometry that four molecules of NC bind to d(TG)(10) (a 20-base oligonucleotide). We developed a method of calibrating low-density surfaces using NC calibration injections. Knowing the maximal response and the stoichiometry of binding, we can precisely determine the amount of oligonucleotide immobilized at these very-low-density surfaces (<1 Response Unit). Using this approach, we have measured the binding of Gag to d(TG)(10). Gag binds to a 20-mer with a stoichiometry of greater than 4. This suggests that once Gag is bound to the immobilized oligonucleotide, additional Gag molecules can bind to this complex.

  18. Within and between Whorls: Comparative Transcriptional Profiling of Aquilegia and Arabidopsis

    PubMed Central

    Voelckel, Claudia; Borevitz, Justin O.; Kramer, Elena M.; Hodges, Scott A.

    2010-01-01

    Background The genus Aquilegia is an emerging model system in plant evolutionary biology predominantly because of its wide variation in floral traits and associated floral ecology. The anatomy of the Aquilegia flower is also very distinct. There are two whorls of petaloid organs, the outer whorl of sepals and the second whorl of petals that form nectar spurs, as well as a recently evolved fifth whorl of staminodia inserted between stamens and carpels. Methodology/Principal Findings We designed an oligonucleotide microarray based on EST sequences from a mixed tissue, normalized cDNA library of an A. formosa x A. pubescens F2 population representing 17,246 unigenes. We then used this array to analyze floral gene expression in late pre-anthesis stage floral organs from a natural A. formosa population. In particular, we tested for gene expression patterns specific to each floral whorl and to combinations of whorls that correspond to traditional and modified ABC model groupings. Similar analyses were performed on gene expression data of Arabidopsis thaliana whorls previously obtained using the Ath1 gene chips (data available through The Arabidopsis Information Resource). Conclusions/Significance Our comparative gene expression analyses suggest that 1) petaloid sepals and petals of A. formosa share gene expression patterns more than either have organ-specific patterns, 2) petals of A. formosa and A. thaliana may be independently derived, 3) staminodia express B and C genes similar to stamens but the staminodium genetic program has also converged on aspects of the carpel program and 4) staminodia have unique up-regulation of regulatory genes and genes that have been implicated with defense against microbial infection and herbivory. Our study also highlights the value of comparative gene expression profiling and the Aquilegia microarray in particular for the study of floral evolution and ecology. PMID:20352114

  19. High Quality Genomic Copy Number Data from Archival Formalin-Fixed Paraffin-Embedded Leiomyosarcoma: Optimisation of Universal Linkage System Labelling

    PubMed Central

    Salawu, Abdulazeez; Ul-Hassan, Aliya; Hammond, David; Fernando, Malee; Reed, Malcolm; Sisley, Karen

    2012-01-01

    Most soft tissue sarcomas are characterized by genetic instability and frequent genomic copy number aberrations that are not subtype-specific. Oligonucleotide microarray-based Comparative Genomic Hybridisation (array CGH) is an important technique used to map genome-wide copy number aberrations, but the traditional requirement for high-quality DNA typically obtained from fresh tissue has limited its use in sarcomas. Although large archives of Formalin-fixed Paraffin-embedded (FFPE) tumour samples are available for research, the degradative effects of formalin on DNA from these tissues has made labelling and analysis by array CGH technically challenging. The Universal Linkage System (ULS) may be used for a one-step chemical labelling of such degraded DNA. We have optimised the ULS labelling protocol to perform aCGH on archived FFPE leiomyosarcoma tissues using the 180k Agilent platform. Preservation age of samples ranged from a few months to seventeen years and the DNA showed a wide range of degradation (when visualised on agarose gels). Consistently high DNA labelling efficiency and low microarray probe-to-probe variation (as measured by the derivative log ratio spread) was seen. Comparison of paired fresh and FFPE samples from identical tumours showed good correlation of CNAs detected. Furthermore, the ability to macro-dissect FFPE samples permitted the detection of CNAs that were masked in fresh tissue. Aberrations were visually confirmed using Fluorescence in situ Hybridisation. These results suggest that archival FFPE tissue, with its relative abundance and attendant clinical data may be used for effective mapping for genomic copy number aberrations in such rare tumours as leiomyosarcoma and potentially unravel clues to tumour origins, progression and ultimately, targeted treatment. PMID:23209738

  20. Part-per-trillion level detection of estradiol by competitive fluorescence immunoassay using DNA/dye conjugate as antibody multiple labels.

    PubMed

    Zhu, Shengchao; Zhang, Qin; Guo, Liang-Hong

    2008-08-22

    Fluorescent organic dyes are currently the standard signal-generating labels used in microarray quantification. However, new labeling strategies are needed to meet the demand for high sensitivity in the detection of low-abundance proteins and small molecules. In this report, a long-chain DNA/dye conjugate was used to attach multiple fluorescence labels on antibodies to improve signal intensity and immunoassay sensitivity. Compared with the 30 base-pair (bp) oligonucleotide used in our previous work [Q. Zhang, L.-H. Guo, Bioconjugate Chem. 18 (2007) 1668-1672], conjugation of a 219 bp DNA in solution with a fluorescent DNA binder SYBR Green I resulted in more than sixfold increase in signal intensity, consistent with the increase in bp number. In a direct immunoassay for the detection of goat anti-mouse IgG in a mouse IgG-coated 96-well plate, the long DNA conjugate label also produced higher fluorescence than the short one, accompanied by about 15-fold improvement in the detection limit. To demonstrate its advantage in real applications, the DNA/dye conjugate was employed in the competitive immunoassay of 17beta-estradiol, a clinically and environmentally important analyte. The biotin-terminated DNA was attached to biotinylated anti-estradiol antibody through the biotin/streptavidin/biotin bridge after the immuno-reaction was completed, followed by conjugation with SYBR Green I. The limit of detection for 17beta-estradiol is 1.9 pg mL(-1), which is 200-fold lower than the assay using fluorescein-labeled antibodies. The new multiple labeling strategy uses readily available reagents, and is also compatible with current biochip platform. It has great potential in the sensitive detection of protein and antibody microarrays.

  1. Differential transcriptomic responses of Biomphalaria glabrata (Gastropoda, Mollusca) to bacteria and metazoan parasites, Schistosoma mansoni and Echinostoma paraensei (Digenea, Platyhelminthes)

    PubMed Central

    Adema, Coen M; Hanington, Patrick C.; Lun, Cheng-Man; Rosenberg, George H.; Aragon, Anthony D; Stout, Barbara A; Richard, Mara L. Lennard; Gross, Paul S.; Loker, Eric S

    2009-01-01

    A 70-mer oligonucleotide-based microarray (1152 features) that emphasizes stress and immune responses factors was constructed to study transcriptomic responses of the snail Biomphalaria glabrata to different immune challenges. In addition to sequences with relevant putative ID and Gene Ontology (GO) annotation, the array features non-immune factors and unknown B. glabrata ESTs for functional gene discovery. The transcription profiles of B. glabrata (3 biological replicates, each a pool of 5 snails) were recorded at 12 hours post wounding, exposure to Gram negative or Gram positive bacteria (Escherichia coli and Micrococcus luteus, respectively), or infection with compatible trematode parasites (S. mansoni or E. paraensei, 20 miracidia/snail), relative to controls, using universal reference RNA. The data were subjected to Significance Analysis for Microarrays (SAM), with a false positive rate (FPR) ≤10%. Wounding yielded a modest differential expression profile (27 up/21 down) with affected features mostly dissimilar from other treatments. Partially overlapping, yet distinct expression profiles were recorded from snails challenged with E. coli (83 up/20 down) or M. luteus (120 up/42 down), mostly showing up-regulation of defense and stress-related features. Significantly altered expression of selected immune features indicates that B. glabrata detects and responds differently to compatible trematodes. Echinostoma paraensei infection was associated mostly with down regulation of many (immune-) transcripts (42 up/68 down), whereas S. mansoni exposure yielded a preponderance of up-regulated features (140 up/23 down), with only few known immune genes affected. These observations may reflect the divergent strategies developed by trematodes during their evolution as specialized pathogens of snails to negate host defense responses. Clearly, the immune defenses of B. glabrata distinguish and respond differently to various immune challenges. PMID:19962194

  2. Oligonucleotide-based therapy for neurodegenerative diseases.

    PubMed

    Magen, Iddo; Hornstein, Eran

    2014-10-10

    Molecular genetics insight into the pathogenesis of several neurodegenerative diseases, such as Alzheimer׳s disease, Parkinson׳s disease, Huntington׳s disease and amyotrophic lateral sclerosis, encourages direct interference with the activity of neurotoxic genes or the molecular activation of neuroprotective pathways. Oligonucleotide-based therapies are recently emerging as an efficient strategy for drug development and these can be employed as new treatments of neurodegenerative states. Here we review advances in this field in recent years which suggest an encouraging assessment that oligonucleotide technologies for targeting of RNAs will enable the development of new therapies and will contribute to preservation of brain integrity. Copyright © 2014 Elsevier B.V. All rights reserved.

  3. Biocompatible artificial DNA linker that is read through by DNA polymerases and is functional in Escherichia coli

    PubMed Central

    El-Sagheer, Afaf H.; Sanzone, A. Pia; Gao, Rachel; Tavassoli, Ali; Brown, Tom

    2011-01-01

    A triazole mimic of a DNA phosphodiester linkage has been produced by templated chemical ligation of oligonucleotides functionalized with 5′-azide and 3′-alkyne. The individual azide and alkyne oligonucleotides were synthesized by standard phosphoramidite methods and assembled using a straightforward ligation procedure. This highly efficient chemical equivalent of enzymatic DNA ligation has been used to assemble a 300-mer from three 100-mer oligonucleotides, demonstrating the total chemical synthesis of very long oligonucleotides. The base sequences of the DNA strands containing this artificial linkage were copied during PCR with high fidelity and a gene containing the triazole linker was functional in Escherichia coli. PMID:21709264

  4. Chemistry, mechanism and clinical status of antisense oligonucleotides and duplex RNAs

    PubMed Central

    Shen, Xiulong; Corey, David R

    2018-01-01

    Abstract RNA plays a central role in the expression of all genes. Because any sequence within RNA can be recognized by complementary base pairing, synthetic oligonucleotides and oligonucleotide mimics offer a general strategy for controlling processes that affect disease. The two primary antisense approaches for regulating expression through recognition of cellular RNAs are single-stranded antisense oligonucleotides and duplex RNAs. This review will discuss the chemical modifications and molecular mechanisms that make synthetic nucleic acid drugs possible. Lessons learned from recent clinical trials will be summarized. Ongoing clinical trials are likely to decisively test the adequacy of our current generation of antisense nucleic acid technologies and highlight areas where more basic research is needed. PMID:29240946

  5. Characterization of Deletions of the HBA and HBB Loci by Array Comparative Genomic Hybridization

    PubMed Central

    Sabath, Daniel E.; Bender, Michael A.; Sankaran, Vijay G.; Vamos, Esther; Kentsis, Alex; Yi, Hye-Son; Greisman, Harvey A.

    2017-01-01

    Thalassemia is among the most common genetic diseases worldwide. α-Thalassemia is usually caused by deletion of one or more of the duplicated HBA genes on chromosome 16. In contrast, most β-thalassemia results from point mutations that decrease or eliminate expression of the HBB gene on chromosome 11. Deletions within the HBB locus result in thalassemia or hereditary persistence of fetal Hb. Although routine diagnostic testing cannot distinguish thalassemia deletions from point mutations, deletional hereditary persistence of fetal Hb is notable for having an elevated HbF level with a normal mean corpuscular volume. A small number of deletions accounts for most α-thalassemias; in contrast, there are no predominant HBB deletions causing β-thalassemia. To facilitate the identification and characterization of deletions of the HBA and HBB globin loci, we performed array-based comparative genomic hybridization using a custom oligonucleotide microarray. We accurately mapped the breakpoints of known and previously uncharacterized HBB deletions defining previously uncharacterized deletion breakpoints by PCR amplification and sequencing. The array also successfully identified the common HBA deletions --SEA and --FIL. In summary, comparative genomic hybridization can be used to characterize deletions of the HBA and HBB loci, allowing high-resolution characterization of novel deletions that are not readily detected by PCR-based methods. PMID:26612711

  6. Current genetic methodologies in the identification of disaster victims and in forensic analysis.

    PubMed

    Ziętkiewicz, Ewa; Witt, Magdalena; Daca, Patrycja; Zebracka-Gala, Jadwiga; Goniewicz, Mariusz; Jarząb, Barbara; Witt, Michał

    2012-02-01

    This review presents the basic problems and currently available molecular techniques used for genetic profiling in disaster victim identification (DVI). The environmental conditions of a mass disaster often result in severe fragmentation, decomposition and intermixing of the remains of victims. In such cases, traditional identification based on the anthropological and physical characteristics of the victims is frequently inconclusive. This is the reason why DNA profiling became the gold standard for victim identification in mass-casualty incidents (MCIs) or any forensic cases where human remains are highly fragmented and/or degraded beyond recognition. The review provides general information about the sources of genetic material for DNA profiling, the genetic markers routinely used during genetic profiling (STR markers, mtDNA and single-nucleotide polymorphisms [SNP]) and the basic statistical approaches used in DNA-based disaster victim identification. Automated technological platforms that allow the simultaneous analysis of a multitude of genetic markers used in genetic identification (oligonucleotide microarray techniques and next-generation sequencing) are also presented. Forensic and population databases containing information on human variability, routinely used for statistical analyses, are discussed. The final part of this review is focused on recent developments, which offer particularly promising tools for forensic applications (mRNA analysis, transcriptome variation in individuals/populations and genetic profiling of specific cells separated from mixtures).

  7. The prevalence of chromosomal deletions relating to developmental delay and/or intellectual disability in human euploid blastocysts.

    PubMed

    He, Wenyin; Sun, Xiaofang; Liu, Lian; Li, Man; Jin, Hua; Wang, Wei-Hua

    2014-01-01

    Chromosomal anomalies in human embryos produced by in vitro fertilization are very common, which include numerical (aneuploidy) and structural (deletion, duplication or others) anomalies. Our previous study indicated that chromosomal deletion(s) is the most common structural anomaly accounting for approximately 8% of euploid blastocysts. It is still unknown if these deletions in human euploid blastocysts have clinical significance. In this study, we analyzed 15 previously diagnosed euploid blastocysts that had chromosomal deletion(s) using Agilent oligonucleotide DNA microarray platform and localized the gene location in each deletion. Then, we used OMIM gene map and phenotype database to investigate if these deletions are related with some important genes that cause genetic diseases, especially developmental delay or intellectual disability. As results, we found that the detectable chromosomal deletion size with Agilent microarray is above 2.38 Mb, while the deletions observed in human blastocysts are between 11.6 to 103 Mb. With OMIM gene map and phenotype database information, we found that deletions can result in loss of 81-464 genes. Out of these genes, 34-149 genes are related with known genetic problems. Furthermore, we found that 5 out of 15 samples lost genes in the deleted region, which were related to developmental delay and/or intellectual disability. In conclusion, our data indicates that all human euploid blastocysts with chromosomal deletion(s) are abnormal and transfer of these embryos may cause birth defects and/or developmental and intellectual disabilities. Therefore, the embryos with chromosomal deletion revealed by DNA microarray should not be transferred to the patients, or further gene map and/or phenotype seeking is necessary before making a final decision.

  8. Non-Small-Cell Lung Cancer Molecular Signatures Recapitulate Lung Developmental Pathways

    PubMed Central

    Borczuk, Alain C.; Gorenstein, Lyall; Walter, Kristin L.; Assaad, Adel A.; Wang, Liqun; Powell, Charles A.

    2003-01-01

    Current paradigms hold that lung carcinomas arise from pleuripotent stem cells capable of differentiation into one or several histological types. These paradigms suggest lung tumor cell ontogeny is determined by consequences of gene expression that recapitulate events important in embryonic lung development. Using oligonucleotide microarrays, we acquired gene profiles from 32 microdissected non-small-cell lung tumors. We determined the 100 top-ranked marker genes for adenocarcinoma, squamous cell, large cell, and carcinoid using nearest neighbor analysis. Results were validated by immunostaining for 11 selected proteins using a tissue microarray representing 80 tumors. Gene expression data of lung development were accessed from a publicly available dataset generated with the murine Mu11k genome microarray. Self-organized mapping identified two temporally distinct clusters of murine orthologues. Supervised clustering of lung development data showed large-cell carcinoma gene orthologues were in a cluster expressed in pseudoglandular and canalicular stages whereas adenocarcinoma homologues were predominantly in a cluster expressed later in the terminal sac and alveolar stages of murine lung development. Representative large-cell genes (E2F3, MYBL2, HDAC2, CDK4, PCNA) are expressed in the nucleus and are associated with cell cycle and proliferation. In contrast, adenocarcinoma genes are associated with lung-specific transcription pathways (SFTPB, TTF-1), cell adhesion, and signal transduction. In sum, non-small-cell lung tumors histology gene profiles suggest mechanisms relevant to ontogeny and clinical course. Adenocarcinoma genes are associated with differentiation and glandular formation whereas large-cell genes are associated with proliferation and differentiation arrest. The identification of developmentally regulated pathways active in tumorigenesis provides insights into lung carcinogenesis and suggests early steps may differ according to the eventual tumor morphology. PMID:14578194

  9. The genomic transcriptional response of female fathead minnows (Pimephales promelas) to an acute exposure to the androgen, 17β-trenbolone

    USGS Publications Warehouse

    Dorts, Jennifer; Richter, Catherine A.; Wright-Osment, Maureen K.; Ellersieck, Mark R.; Carter, Barbara J.; Tillitt, Donald E.

    2009-01-01

    We investigated the genomic transcriptional response of female fathead minnows (Pimephales promelas) to an acute (4 days) exposure to 0.1 or 1.0 ??g/L of 17??-trenbolone (TB), the active metabolite of an anabolic androgenic steroid used as a growth promoter in cattle and a contaminant of concern in aquatic systems. Our objectives were to investigate the gene expression profile induced by TB, define biomarkers of exposure to TB, and increase our understanding of the mechanisms of adverse effects of TB on fish reproduction. In female gonad tissue, microarray analysis using a 22 K oligonucleotide microarray (EcoArray Inc., Gainesville, FL) showed 99 significantly upregulated genes and 741 significantly downregulated genes in response to 1 ??g TB/L. In particular, hydroxysteroid (17??) dehydrogenase 12a (hsd17b12a), zona pellucida glycoprotein 2.2 (zp2.2), and protein inhibitor of activated STAT, 2 (pias2) were all downregulated in gonad. Q-PCR measurements in a larger sample set were consistent with the microarray results in the direction and magnitude of these changes in gene expression. However, several novel potential biomarkers were verified by Q-PCR in the same samples, but could not be validated in independent samples. In liver, Q-PCR measurements showed a significant decrease in vitellogenin 1 (vtg1) mRNA expression. In brain, cytochrome P450, family 19, subfamily A, polypeptide 1b (cyp19a1b, previously known as aromatase B) transcript levels were significantly reduced following TB exposure. Our study provides a candidate gene involved in mediating the action of TB, hsd17b12a, and two potential biomarkers sensitive to acute TB exposure, hepatic vtg1 and brain cyp19a1b.

  10. Horseradish peroxidase-labeled oligonucleotides and fluorescent tyramides for rapid detection of chromosome-specific repeat sequences.

    PubMed

    van Gijlswijk, R P; Wiegant, J; Vervenne, R; Lasan, R; Tanke, H J; Raap, A K

    1996-01-01

    We present a sensitive and rapid fluorescence in situ hybridization (FISH) strategy for detecting chromosome-specific repeat sequences. It uses horseradish peroxidase (HRP)-labeled oligonucleotide sequences in combination with fluorescent tyramide-based detection. After in situ hybridization, the HRP conjugated to the oligonucleotide probe is used to deposit fluorescently labeled tyramide molecules at the site of hybridization. The method features full chemical synthesis of probes, strong FISH signals, and short processing periods, as well as multicolor capabilities.

  11. VRP09 Reduction of Corneal Scarring Following Blast and Burn Injuries to Cornea Using siRNAs Targeting TGFb and CTGF

    DTIC Science & Technology

    2013-03-01

    oligonucleotide-based drug approaches (better than ribozymes, antisense oligonucleotides ( ASO ), or microRNAs). (4) To accomplish these objectives, we...negative control scrambled ASO (designated NC). The combination of siRNAs T1 and R1 produced a knockdown of ~80% of TGFb1 protein in the conditioned...sequences (antisense oligonucleotides, ASOs ) into rabbit corneal cells and found that technique was very effective in delivering ASOs into the stroma and

  12. VRP09 Reduction of Corneal Scarring Following Blast and Burn Injuries to Cornea Using siRNAs Targeting TGFb and CTGF

    DTIC Science & Technology

    2012-10-01

    selective of all gene-targeted, oligonucleotide-based drug approaches (better than ribozymes, antisense oligonucleotides ( ASO ), or microRNAs).(4) We will...respect to a scrambled siRNA control. For the migration assay, a circular region in the middle of the well was removed using a gel removal solution...oligonucleotides, ASOs ) into rabbit corneal cells and found that technique was very effective in delivering ASOs into the stroma and even into the endothelial cell

  13. Parasite-specific immune response in adult Drosophila melanogaster: a genomic study

    PubMed Central

    Roxström-Lindquist, Katarina; Terenius, Olle; Faye, Ingrid

    2004-01-01

    Insects of the order Diptera are vectors for parasitic diseases such as malaria, sleeping sickness and leishmania. In the search for genes encoding proteins involved in the antiparasitic response, we have used the protozoan parasite Octosporea muscaedomesticae for oral infections of adult Drosophila melanogaster. To identify parasite-specific response molecules, other flies were exposed to virus, bacteria or fungi in parallel. Analysis of gene expression patterns after 24 h of microbial challenge, using Affymetrix oligonucleotide microarrays, revealed a high degree of microbe specificity. Many serine proteases, key intermediates in the induction of insect immune responses, were uniquely expressed following infection of the different organisms. Several lysozyme genes were induced in response to Octosporea infection, while in other treatments they were not induced or downregulated. This suggests that lysozymes are important in antiparasitic defence. PMID:14749722

  14. DETECTING LOW-LEVEL SYNTHESIS IMPURITIES IN MODIFIED PHOSPHOROTHIOATE OLIGONUCLEOTIDES USING LIQUID CHROMATOGRAPHY – HIGH RESOLUTION MASS SPECTROMETRY

    PubMed Central

    Nikcevic, Irena; Wyrzykiewicz, Tadeusz K.; Limbach, Patrick A.

    2010-01-01

    Summary An LC-MS method based on the use of high resolution Fourier transform ion cyclotron resonance mass spectrometry (FTIRCMS) for profiling oligonucleotides synthesis impurities is described. Oligonucleotide phosphorothioatediesters (phosphorothioate oligonucleotides), in which one of the non-bridging oxygen atoms at each phosphorus center is replaced by a sulfur atom, are now one of the most popular oligonucleotide modifications due to their ease of chemical synthesis and advantageous pharmacokinetic properties. Despite significant progress in the solid-phase oligomerization chemistry used in the manufacturing of these oligonucleotides, multiple classes of low-level impurities always accompany synthetic oligonucleotides. Liquid chromatography-mass spectrometry has emerged as a powerful technique for the identification of these synthesis impurities. However, impurity profiling, where the entire complement of low-level synthetic impurities is identified in a single analysis, is more challenging. Here we present an LC-MS method based the use of high resolution-mass spectrometry, specifically Fourier transform ion cyclotron resonance mass spectrometry (FTIRCMS or FTMS). The optimal LC-FTMS conditions, including the stationary phase and mobile phases for the separation and identification of phosphorothioate oligonucleotides, were found. The characteristics of FTMS enable charge state determination from single m/z values of low-level impurities. Charge state information then enables more accurate modeling of the detected isotopic distribution for identification of the chemical composition of the detected impurity. Using this approach, a number of phosphorothioate impurities can be detected by LC-FTMS including failure sequences carrying 3′-terminal phosphate monoester and 3′-terminal phosphorothioate monoester, incomplete backbone sulfurization and desulfurization products, high molecular weight impurities, and chloral, isobutyryl, and N3 (2-cyanoethyl) adducts of the full length product. When compared with low resolution LC-MS, ~60% more impurities can be identified when charge state and isotopic distribution information is available and used for impurity profiling. PMID:21811394

  15. Fluorescence-based bioassays for the detection and evaluation of food materials.

    PubMed

    Nishi, Kentaro; Isobe, Shin-Ichiro; Zhu, Yun; Kiyama, Ryoiti

    2015-10-13

    We summarize here the recent progress in fluorescence-based bioassays for the detection and evaluation of food materials by focusing on fluorescent dyes used in bioassays and applications of these assays for food safety, quality and efficacy. Fluorescent dyes have been used in various bioassays, such as biosensing, cell assay, energy transfer-based assay, probing, protein/immunological assay and microarray/biochip assay. Among the arrays used in microarray/biochip assay, fluorescence-based microarrays/biochips, such as antibody/protein microarrays, bead/suspension arrays, capillary/sensor arrays, DNA microarrays/polymerase chain reaction (PCR)-based arrays, glycan/lectin arrays, immunoassay/enzyme-linked immunosorbent assay (ELISA)-based arrays, microfluidic chips and tissue arrays, have been developed and used for the assessment of allergy/poisoning/toxicity, contamination and efficacy/mechanism, and quality control/safety. DNA microarray assays have been used widely for food safety and quality as well as searches for active components. DNA microarray-based gene expression profiling may be useful for such purposes due to its advantages in the evaluation of pathway-based intracellular signaling in response to food materials.

  16. Fluorescence-Based Bioassays for the Detection and Evaluation of Food Materials

    PubMed Central

    Nishi, Kentaro; Isobe, Shin-Ichiro; Zhu, Yun; Kiyama, Ryoiti

    2015-01-01

    We summarize here the recent progress in fluorescence-based bioassays for the detection and evaluation of food materials by focusing on fluorescent dyes used in bioassays and applications of these assays for food safety, quality and efficacy. Fluorescent dyes have been used in various bioassays, such as biosensing, cell assay, energy transfer-based assay, probing, protein/immunological assay and microarray/biochip assay. Among the arrays used in microarray/biochip assay, fluorescence-based microarrays/biochips, such as antibody/protein microarrays, bead/suspension arrays, capillary/sensor arrays, DNA microarrays/polymerase chain reaction (PCR)-based arrays, glycan/lectin arrays, immunoassay/enzyme-linked immunosorbent assay (ELISA)-based arrays, microfluidic chips and tissue arrays, have been developed and used for the assessment of allergy/poisoning/toxicity, contamination and efficacy/mechanism, and quality control/safety. DNA microarray assays have been used widely for food safety and quality as well as searches for active components. DNA microarray-based gene expression profiling may be useful for such purposes due to its advantages in the evaluation of pathway-based intracellular signaling in response to food materials. PMID:26473869

  17. Visualizing Microbial Biogeochemistry: NanoSIMS and Stable Isotope Probing (Invited)

    NASA Astrophysics Data System (ADS)

    Pett-Ridge, J.; Weber, P. K.

    2009-12-01

    Linking phylogenetic information to function in microbial communities is a key challenge for microbial ecology. Isotope-labeling experiments provide a useful means to investigate the ecophysiology of microbial populations and cells in the environment and allow measurement of nutrient transfers between cell types, symbionts and consortia. The combination of Nano-Secondary Ion Mass Spectrometry (NanoSIMS) analysis, in situ labeling and high resolution microscopy allows isotopic analysis to be linked to phylogeny and morphology and holds great promise for fine-scale studies of microbial systems. In NanoSIMS analysis, samples are sputtered with an energetic primary beam (Cs+, O-) liberating secondary ions that are separated by the mass spectrometer and detected in a suite of electron multipliers. Five isotopic species may be analyzed concurrently with spatial resolution as fine as 50nm. A high sensitivity isotope ratio ‘map’ can then be generated for the analyzed area. NanoSIMS images of 13C, 15N and Mo (a nitrogenase co-factor) localization in diazotrophic cyanobacteria show how cells differentially allocate resources within filaments and allow calculation of nutrient uptake rates on a cell by cell basis. Images of AM fungal hyphae-root and cyanobacteria-rhizobia associations indicate the mobilization and sharing (stealing?) of newly fixed C and N. In a related technique, “El-FISH”, stable isotope labeled biomass is probed with oligonucleotide-elemental labels and then imaged by NanoSIMS. In microbial consortia and cyanobacterial mats, this technique helps link microbial structure and function simultaneously even in systems with unknown and uncultivated microbes. Finally, the combination of re-engineered universal 16S oligonucleotide microarrays with NanoSIMS analyses may allow microbial identity to be linked to functional roles in complex systems such as mats and cellulose degrading hindgut communities. These newly developed methods provide correlated oligonucleotide, functional enzyme and metabolic image data and should help unravel the metabolic processes of complex microbial communities in soils, biofilms and aquatic systems.

  18. Use of continuous/contiguous stacking hybridization as a diagnostic tool

    DOEpatents

    Mirzabekov, Andrei Darievich; Kirillov, Eugene Vladislavovich; Parinov, Sergei Valeryevich; Barski, Victor Evgenievich; Dubiley, Svetlana Alekseevna

    2002-01-01

    A method for detecting disease-associated alleles in patient genetic material is provided whereby a first group of oligonucleotide molecules, synthesized to compliment base sequences of the disease associated alleles is immobilized on a predetermined position on a substrate, and then contacted with patient genetic material to form duplexes. The duplexes are then contacted with a second group of oligonucleotide molecules which are synthesized to extend the predetermined length of the oligonucleotide molecules of the first group, and where each of the oligonucleotide molecules of the second group are tagged and either incorporate universal bases or a mixture of guanine, cytosine, thymine, and adenine, or complementary nucleotide strands that are tagged with a different fluorochrome which radiates light at a predetermined wavelength. The treated substrate is then washed and the light patterns radiating therefrom are compared with predetermined light patterns of various diseases that were prepared on identical substrates. A method is also provided for determining the length of a repeat sequence in DNA or RNA, and also for determining the base sequence of unknown DNA or RNA.

  19. Use of continuous/contiguous stacking hybridization as a diagnostic tool

    DOEpatents

    Mirzabekov, Andrei Darievich; Kirillov, Eugene Vladislavovich; Parinov, Sergei Valeryevich; Barski, Victor Evgenievich; Dubiley, Svetlana Alekseevna

    2000-01-01

    A method for detecting disease-associated alleles in patient genetic material is provided whereby a first group of oligonucleotide molecules, synthesized to compliment base sequences of the disease associated alleles is immobilized on a predetermined position on a substrate, and then contacted with patient genetic material to form duplexes. The duplexes are then contacted with a second group of oligonucleotide molecules which are synthesized to extend the predetermined length of the oligonucleotide molecules of the first group, and where each of the oligonucleotide molecules of the second group are tagged and either incorporate universal bases or a mixture of guanine, cytosine, thymine, and adenine, or complementary nucleotide strands that are tagged with a different fluorochrome which radiates light at a predetermined wavelength. The treated substrate is then washed and the light patterns radiating therefrom are compared with predetermined light patterns of various diseases that were prepared on identical substrates. A method is also provided for determining the length of a repeat sequence in DNA or RNA, and also for determining the base sequence of unknown DNA or RNA.

  20. Analytical Devices Based on Direct Synthesis of DNA on Paper.

    PubMed

    Glavan, Ana C; Niu, Jia; Chen, Zhen; Güder, Firat; Cheng, Chao-Min; Liu, David; Whitesides, George M

    2016-01-05

    This paper addresses a growing need in clinical diagnostics for parallel, multiplex analysis of biomarkers from small biological samples. It describes a new procedure for assembling arrays of ssDNA and proteins on paper. This method starts with the synthesis of DNA oligonucleotides covalently linked to paper and proceeds to assemble microzones of DNA-conjugated paper into arrays capable of simultaneously capturing DNA, DNA-conjugated protein antigens, and DNA-conjugated antibodies. The synthesis of ssDNA oligonucleotides on paper is convenient and effective with 32% of the oligonucleotides cleaved and eluted from the paper substrate being full-length by HPLC for a 32-mer. These ssDNA arrays can be used to detect fluorophore-linked DNA oligonucleotides in solution, and as the basis for DNA-directed assembly of arrays of DNA-conjugated capture antibodies on paper, detect protein antigens by sandwich ELISAs. Paper-anchored ssDNA arrays with different sequences can be used to assemble paper-based devices capable of detecting DNA and antibodies in the same device and enable simple microfluidic paper-based devices.

  1. G-Quadruplex Forming Oligonucleotides as Anti-HIV Agents.

    PubMed

    Musumeci, Domenica; Riccardi, Claudia; Montesarchio, Daniela

    2015-09-22

    Though a variety of different non-canonical nucleic acids conformations have been recognized, G-quadruplex structures are probably the structural motifs most commonly found within known oligonucleotide-based aptamers. This could be ascribed to several factors, as their large conformational diversity, marked responsiveness of their folding/unfolding processes to external stimuli, high structural compactness and chemo-enzymatic and thermodynamic stability. A number of G-quadruplex-forming oligonucleotides having relevant in vitro anti-HIV activity have been discovered in the last two decades through either SELEX or rational design approaches. Improved aptamers have been obtained by chemical modifications of natural oligonucleotides, as terminal conjugations with large hydrophobic groups, replacement of phosphodiester linkages with phosphorothioate bonds or other surrogates, insertion of base-modified monomers, etc. In turn, detailed structural studies have elucidated the peculiar architectures adopted by many G-quadruplex-based aptamers and provided insight into their mechanism of action. An overview of the state-of-the-art knowledge of the relevance of putative G-quadruplex forming sequences within the viral genome and of the most studied G-quadruplex-forming aptamers, selectively targeting HIV proteins, is here presented.

  2. probeBase—an online resource for rRNA-targeted oligonucleotide probes and primers: new features 2016

    PubMed Central

    Greuter, Daniel; Loy, Alexander; Horn, Matthias; Rattei, Thomas

    2016-01-01

    probeBase http://www.probebase.net is a manually maintained and curated database of rRNA-targeted oligonucleotide probes and primers. Contextual information and multiple options for evaluating in silico hybridization performance against the most recent rRNA sequence databases are provided for each oligonucleotide entry, which makes probeBase an important and frequently used resource for microbiology research and diagnostics. Here we present a major update of probeBase, which was last featured in the NAR Database Issue 2007. This update describes a complete remodeling of the database architecture and environment to accommodate computationally efficient access. Improved search functions, sequence match tools and data output now extend the opportunities for finding suitable hierarchical probe sets that target an organism or taxon at different taxonomic levels. To facilitate the identification of complementary probe sets for organisms represented by short rRNA sequence reads generated by amplicon sequencing or metagenomic analysis with next generation sequencing technologies such as Illumina and IonTorrent, we introduce a novel tool that recovers surrogate near full-length rRNA sequences for short query sequences and finds matching oligonucleotides in probeBase. PMID:26586809

  3. 2′-O-[2-[(N,N-dimethylamino)oxy]ethyl]-modified oligonucleotides inhibit expression of mRNA in vitro and in vivo

    PubMed Central

    Prakash, Thazha P.; Johnston, Joseph F.; Graham, Mark J.; Condon, Thomas P.; Manoharan, Muthiah

    2004-01-01

    Synthesis and antisense activity of oligonucleotides modified with 2′-O-[2-[(N,N-dimethylamino)oxy] ethyl] (2′-O-DMAOE) are described. The 2′-O-DMAOE-modified oligonucleotides showed superior metabolic stability in mice. The phosphorothioate oligonucleotide ‘gapmers’, with 2′-O-DMAOE- modified nucleoside residues at the ends and 2′-deoxy nucleosides residues in the central region, showed dose-dependent inhibition of mRNA expression in cell culture for two targets. ‘Gapmer’ oligonucleotides have one or two 2′-O-modified regions and a 2′-deoxyoligonucleotide phosphorothioate region that allows RNase H digestion of target mRNA. To determine the in vivo potency and efficacy, BalbC mice were treated with 2′-O-DMAOE gapmers and a dose-dependent reduction in the targeted C-raf mRNA expression was observed. Oligonucleotides with 2′-O-DMAOE modifications throughout the sequences reduced the intercellular adhesion molecule-1 (ICAM-1) protein expression very efficiently in HUVEC cells with an IC50 of 1.8 nM. The inhibition of ICAM-1 protein expression by these uniformly modified 2′-O-DMAOE oligonucleotides may be due to selective interference with the formation of the translational initiation complex. These results demonstrate that 2′-O-DMAOE- modified oligonucleotides are useful for antisense-based therapeutics when either RNase H-dependent or RNase H-independent target reduction mechanisms are employed. PMID:14762210

  4. Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3;-terminus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yeo, Hyun Koo; Lee, Jae Young

    2012-04-18

    The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapor diffusion and diffracted to 2.8 {angstrom} resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 {angstrom}, {alpha} = 91.37, {beta} = 93.21, {gamma} = 92.35{sup o}.

  5. Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus.

    PubMed

    Yeo, Hyun Koo; Lee, Jae Young

    2010-05-01

    The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapour diffusion and diffracted to 2.8 A resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 A, alpha = 91.37, beta = 93.21, gamma = 92.35 degrees .

  6. Solid-Phase Nucleic Acid Sequence-Based Amplification and Length-Scale Effects during RNA Amplification.

    PubMed

    Ma, Youlong; Teng, Feiyue; Libera, Matthew

    2018-06-05

    Solid-phase oligonucleotide amplification is of interest because of possible applications to next-generation sequencing, multiplexed microarray-based detection, and cell-free synthetic biology. Its efficiency is, however, less than that of traditional liquid-phase amplification involving unconstrained primers and enzymes, and understanding how to optimize the solid-phase amplification process remains challenging. Here, we demonstrate the concept of solid-phase nucleic acid sequence-based amplification (SP-NASBA) and use it to study the effect of tethering density on amplification efficiency. SP-NASBA involves two enzymes, avian myeloblastosis virus reverse transcriptase (AMV-RT) and RNase H, to convert tethered forward and reverse primers into tethered double-stranded DNA (ds-DNA) bridges from which RNA - amplicons can be generated by a third enzyme, T7 RNA polymerase. We create microgels on silicon surfaces using electron-beam patterning of thin-film blends of hydroxyl-terminated and biotin-terminated poly(ethylene glycol) (PEG-OH, PEG-B). The tethering density is linearly related to the PEG-B concentration, and biotinylated primers and molecular beacon detection probes are tethered to streptavidin-activated microgels. While SP-NASBA is very efficient at low tethering densities, the efficiency decreases dramatically with increasing tethering density due to three effects: (a) a reduced hybridization efficiency of tethered molecular beacon detection probes; (b) a decrease in T7 RNA polymerase efficiency; (c) inhibition of T7 RNA polymerase activity by AMV-RT.

  7. Oligo/Polynucleotide-Based Gene Modification: Strategies and Therapeutic Potential

    PubMed Central

    Sargent, R. Geoffrey; Kim, Soya

    2011-01-01

    Oligonucleotide- and polynucleotide-based gene modification strategies were developed as an alternative to transgene-based and classical gene targeting-based gene therapy approaches for treatment of genetic disorders. Unlike the transgene-based strategies, oligo/polynucleotide gene targeting approaches maintain gene integrity and the relationship between the protein coding and gene-specific regulatory sequences. Oligo/polynucleotide-based gene modification also has several advantages over classical vector-based homologous recombination approaches. These include essentially complete homology to the target sequence and the potential to rapidly engineer patient-specific oligo/polynucleotide gene modification reagents. Several oligo/polynucleotide-based approaches have been shown to successfully mediate sequence-specific modification of genomic DNA in mammalian cells. The strategies involve the use of polynucleotide small DNA fragments, triplex-forming oligonucleotides, and single-stranded oligodeoxynucleotides to mediate homologous exchange. The primary focus of this review will be on the mechanistic aspects of the small fragment homologous replacement, triplex-forming oligonucleotide-mediated, and single-stranded oligodeoxynucleotide-mediated gene modification strategies as it relates to their therapeutic potential. PMID:21417933

  8. PNA-COMBO-FISH: From combinatorial probe design in silico to vitality compatible, specific labelling of gene targets in cell nuclei

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Müller, Patrick; Rößler, Jens; Schwarz-Finsterle, Jutta

    Recently, advantages concerning targeting specificity of PCR constructed oligonucleotide FISH probes in contrast to established FISH probes, e.g. BAC clones, have been demonstrated. These techniques, however, are still using labelling protocols with DNA denaturing steps applying harsh heat treatment with or without further denaturing chemical agents. COMBO-FISH (COMBinatorial Oligonucleotide FISH) allows the design of specific oligonucleotide probe combinations in silico. Thus, being independent from primer libraries or PCR laboratory conditions, the probe sequences extracted by computer sequence data base search can also be synthesized as single stranded PNA-probes (Peptide Nucleic Acid probes). Gene targets can be specifically labelled with atmore » least about 20 PNA-probes obtaining visibly background free specimens. By using appropriately designed triplex forming oligonucleotides, the denaturing procedures can completely be omitted. These results reveal a significant step towards oligonucleotide-FISH maintaining the 3D-nanostructure and even the viability of the cell target. The method is demonstrated with the detection of Her2/neu and GRB7 genes, which are indicators in breast cancer diagnosis and therapy. - Highlights: • Denaturation free protocols preserve 3D architecture of chromosomes and nuclei. • Labelling sets are determined in silico for duplex and triplex binding. • Probes are produced chemically with freely chosen backbones and base variants. • Peptide nucleic acid backbones reduce hindering charge interactions. • Intercalating side chains stabilize binding of short oligonucleotides.« less

  9. A regenerated electrochemical biosensor for label-free detection of glucose and urea based on conformational switch of i-motif oligonucleotide probe.

    PubMed

    Gao, Zhong Feng; Chen, Dong Mei; Lei, Jing Lei; Luo, Hong Qun; Li, Nian Bing

    2015-10-15

    Improving the reproducibility of electrochemical signal remains a great challenge over the past decades. In this work, i-motif oligonucleotide probe-based electrochemical DNA (E-DNA) sensor is introduced for the first time as a regenerated sensing platform, which enhances the reproducibility of electrochemical signal, for label-free detection of glucose and urea. The addition of glucose or urea is able to activate glucose oxidase-catalyzed or urease-catalyzed reaction, inducing or destroying the formation of i-motif oligonucleotide probe. The conformational switch of oligonucleotide probe can be recorded by electrochemical impedance spectroscopy. Thus, the difference of electron transfer resistance is utilized for the quantitative determination of glucose and urea. We further demonstrate that the E-DNA sensor exhibits high selectivity, excellent stability, and remarkable regenerated ability. The human serum analysis indicates that this simple and regenerated strategy holds promising potential in future biosensing applications. Copyright © 2015 Elsevier B.V. All rights reserved.

  10. Selective Detection of Peptide-Oligonucleotide Heteroconjugates Utilizing Capillary HPLC-ICPMS

    NASA Astrophysics Data System (ADS)

    Catron, Brittany; Caruso, Joseph A.; Limbach, Patrick A.

    2012-06-01

    A method for the selective detection and quantification of peptide:oligonucleotide heteroconjugates, such as those generated by protein:nucleic acid cross-links, using capillary reversed-phase high performance liquid chromatography (cap-RPHPLC) coupled with inductively coupled plasma mass spectrometry detection (ICPMS) is described. The selective detection of phosphorus as 31P+, the only natural isotope, in peptide-oligonucleotide heteroconjugates is enabled by the elemental detection capabilities of the ICPMS. Mobile phase conditions that allow separation of heteroconjugates while maintaining ICPMS compatibility were investigated. We found that trifluoroacetic acid (TFA) mobile phases, used in conventional peptide separations, and hexafluoroisopropanol/triethylamine (HFIP/TEA) mobile phases, used in conventional oligonucleotide separations, both are compatible with ICPMS and enable heteroconjugate separation. The TFA-based separations yielded limits of detection (LOD) of ~40 ppb phosphorus, which is nearly seven times lower than the LOD for HFIP/TEA-based separations. Using the TFA mobile phase, 1-2 pmol of a model heteroconjugate were routinely separated and detected by this optimized capLC-ICPMS method.

  11. In Situ Identification of Cyanobacteria with Horseradish Peroxidase-Labeled, rRNA-Targeted Oligonucleotide Probes

    PubMed Central

    Schönhuber, Wilhelm; Zarda, Boris; Eix, Stella; Rippka, Rosmarie; Herdman, Michael; Ludwig, Wolfgang; Amann, Rudolf

    1999-01-01

    Individual cyanobacterial cells are normally identified in environmental samples only on the basis of their pigmentation and morphology. However, these criteria are often insufficient for the differentiation of species. Here, a whole-cell hybridization technique is presented that uses horseradish peroxidase (HRP)-labeled, rRNA-targeted oligonucleotides for in situ identification of cyanobacteria. This indirect method, in which the probe-conferred enzyme has to be visualized in an additional step, was necessary since fluorescently monolabeled oligonucleotides were insufficient to overstain the autofluorescence of the target cells. Initially, a nonfluorescent detection assay was developed and successfully applied to cyanobacterial mats. Later, it was demonstrated that tyramide signal amplification (TSA) resulted in fluorescent signals far above the level of autofluorescence. Furthermore, TSA-based detection of HRP was more sensitive than that based on nonfluorescent substrates. Critical points of the assay, such as cell fixation and permeabilization, specificity, and sensitivity, were systematically investigated by using four oligonucleotides newly designed to target groups of cyanobacteria. PMID:10049892

  12. Label-Free Potentiometry for Detecting DNA Hybridization Using Peptide Nucleic Acid and DNA Probes

    PubMed Central

    Goda, Tatsuro; Singi, Ankit Balram; Maeda, Yasuhiro; Matsumoto, Akira; Torimura, Masaki; Aoki, Hiroshi; Miyahara, Yuji

    2013-01-01

    Peptide nucleic acid (PNA) has outstanding affinity over DNA for complementary nucleic acid sequences by forming a PNA-DNA heterodimer upon hybridization via Watson-Crick base-pairing. To verify whether PNA probes on an electrode surface enhance sensitivity for potentiometric DNA detection or not, we conducted a comparative study on the hybridization of PNA and DNA probes on the surface of a 10-channel gold electrodes microarray. Changes in the charge density as a result of hybridization at the solution/electrode interface on the self-assembled monolayer (SAM)-formed microelectrodes were directly transformed into potentiometric signals using a high input impedance electrometer. The charge readout allows label-free, reagent-less, and multi-parallel detection of target oligonucleotides without any optical assistance. The differences in the probe lengths between 15- to 22-mer dramatically influenced on the sensitivity of the PNA and DNA sensors. Molecular type of the capturing probe did not affect the degree of potential shift. Theoretical model for charged rod-like duplex using the Gouy-Chapman equation indicates the dominant effect of electrostatic attractive forces between anionic DNA and underlying electrode at the electrolyte/electrode interface in the potentiometry. PMID:23435052

  13. Genome scale transcriptomics of baculovirus-insect interactions.

    PubMed

    Nguyen, Quan; Nielsen, Lars K; Reid, Steven

    2013-11-12

    Baculovirus-insect cell technologies are applied in the production of complex proteins, veterinary and human vaccines, gene delivery vectors' and biopesticides. Better understanding of how baculoviruses and insect cells interact would facilitate baculovirus-based production. While complete genomic sequences are available for over 58 baculovirus species, little insect genomic information is known. The release of the Bombyx mori and Plutella xylostella genomes, the accumulation of EST sequences for several Lepidopteran species, and especially the availability of two genome-scale analysis tools, namely oligonucleotide microarrays and next generation sequencing (NGS), have facilitated expression studies to generate a rich picture of insect gene responses to baculovirus infections. This review presents current knowledge on the interaction dynamics of the baculovirus-insect system' which is relatively well studied in relation to nucleocapsid transportation, apoptosis, and heat shock responses, but is still poorly understood regarding responses involved in pro-survival pathways, DNA damage pathways, protein degradation, translation, signaling pathways, RNAi pathways, and importantly metabolic pathways for energy, nucleotide and amino acid production. We discuss how the two genome-scale transcriptomic tools can be applied for studying such pathways and suggest that proteomics and metabolomics can produce complementary findings to transcriptomic studies.

  14. Focus on quantum dots as potential fluorescent probes for monitoring food toxicants and foodborne pathogens.

    PubMed

    Vinayaka, A C; Thakur, M S

    2010-06-01

    Water-soluble quantum dots (QDs) are fluorescent semiconductor nanoparticles with narrow, very specific, stable emission spectra. Therefore, the bioconjugation of these QDs for biological fluorescent labeling may be of interest due to their unique physical and optical properties as compared to organic fluorescent dyes. These intrinsic properties of QDs have been used for the sensitive detection of target analytes. From the viewpoint of ensuring food safety, there is a need to develop rapid, sensitive and specific detection techniques to monitor food toxicants in food and environmental samples. Even trace levels of these toxicants can inadvertently enter the food chain, creating severe health hazards. The present review emphasizes the application of water-soluble bioconjugated QDs for the detection of food contaminants such as pesticides, pathogenic bacterial toxins such as botulinum toxin, enterotoxins produced by Staphylococcus aureus, Escherichia coli, and for the development of oligonucleotide-based microarrays. This review also emphasizes the application of a possible resonance energy transfer phenomenon resulting from nanobiomolecular interactions obtained through the bioconjugation of QDs with biomolecules. Furthermore, the utilization of significant changes in the spectral behavior of QDs (attributed to resonance energy transfer in the bioconjugate) in future nanobiosensor development is also emphasized.

  15. Microarray-integrated optoelectrofluidic immunoassay system

    PubMed Central

    Han, Dongsik

    2016-01-01

    A microarray-based analytical platform has been utilized as a powerful tool in biological assay fields. However, an analyte depletion problem due to the slow mass transport based on molecular diffusion causes low reaction efficiency, resulting in a limitation for practical applications. This paper presents a novel method to improve the efficiency of microarray-based immunoassay via an optically induced electrokinetic phenomenon by integrating an optoelectrofluidic device with a conventional glass slide-based microarray format. A sample droplet was loaded between the microarray slide and the optoelectrofluidic device on which a photoconductive layer was deposited. Under the application of an AC voltage, optically induced AC electroosmotic flows caused by a microarray-patterned light actively enhanced the mass transport of target molecules at the multiple assay spots of the microarray simultaneously, which reduced tedious reaction time from more than 30 min to 10 min. Based on this enhancing effect, a heterogeneous immunoassay with a tiny volume of sample (5 μl) was successfully performed in the microarray-integrated optoelectrofluidic system using immunoglobulin G (IgG) and anti-IgG, resulting in improved efficiency compared to the static environment. Furthermore, the application of multiplex assays was also demonstrated by multiple protein detection. PMID:27190571

  16. Microarray-integrated optoelectrofluidic immunoassay system.

    PubMed

    Han, Dongsik; Park, Je-Kyun

    2016-05-01

    A microarray-based analytical platform has been utilized as a powerful tool in biological assay fields. However, an analyte depletion problem due to the slow mass transport based on molecular diffusion causes low reaction efficiency, resulting in a limitation for practical applications. This paper presents a novel method to improve the efficiency of microarray-based immunoassay via an optically induced electrokinetic phenomenon by integrating an optoelectrofluidic device with a conventional glass slide-based microarray format. A sample droplet was loaded between the microarray slide and the optoelectrofluidic device on which a photoconductive layer was deposited. Under the application of an AC voltage, optically induced AC electroosmotic flows caused by a microarray-patterned light actively enhanced the mass transport of target molecules at the multiple assay spots of the microarray simultaneously, which reduced tedious reaction time from more than 30 min to 10 min. Based on this enhancing effect, a heterogeneous immunoassay with a tiny volume of sample (5 μl) was successfully performed in the microarray-integrated optoelectrofluidic system using immunoglobulin G (IgG) and anti-IgG, resulting in improved efficiency compared to the static environment. Furthermore, the application of multiplex assays was also demonstrated by multiple protein detection.

  17. The MicroArray Quality Control (MAQC)-II study of common practices for the development and validation of microarray-based predictive models

    EPA Science Inventory

    The second phase of the MicroArray Quality Control (MAQC-II) project evaluated common practices for developing and validating microarray-based models aimed at predicting toxicological and clinical endpoints. Thirty-six teams developed classifiers for 13 endpoints - some easy, som...

  18. Java web tools for PCR, in silico PCR, and oligonucleotide assembly and analysis.

    PubMed

    Kalendar, Ruslan; Lee, David; Schulman, Alan H

    2011-08-01

    The polymerase chain reaction is fundamental to molecular biology and is the most important practical molecular technique for the research laboratory. We have developed and tested efficient tools for PCR primer and probe design, which also predict oligonucleotide properties based on experimental studies of PCR efficiency. The tools provide comprehensive facilities for designing primers for most PCR applications and their combinations, including standard, multiplex, long-distance, inverse, real-time, unique, group-specific, bisulphite modification assays, Overlap-Extension PCR Multi-Fragment Assembly, as well as a programme to design oligonucleotide sets for long sequence assembly by ligase chain reaction. The in silico PCR primer or probe search includes comprehensive analyses of individual primers and primer pairs. It calculates the melting temperature for standard and degenerate oligonucleotides including LNA and other modifications, provides analyses for a set of primers with prediction of oligonucleotide properties, dimer and G-quadruplex detection, linguistic complexity, and provides a dilution and resuspension calculator. Copyright © 2011 Elsevier Inc. All rights reserved.

  19. An oral oligonucleotide delivery system based on a thiolated polymer: Development and in vitro evaluation.

    PubMed

    Martien, Ronny; Hoyer, Herbert; Perera, Glen; Schnürch, Andreas Bernkop

    2011-08-01

    The purpose of this study was to develop and evaluate an oral oligonucleotide delivery system based on a thiolated polymer/reduced glutathione (GSH) system providing a protective effect toward nucleases and permeation enhancement. A polycarbophil-cysteine conjugate (PCP-Cys) was synthesized. Enzymatic degradation of a model oligonucleotide by DNase I and within freshly collected intestinal fluid was investigated in the absence and presence of PCP-Cys. Permeation studies with PCP-Cys/GSH versus control were performed in vitro on Caco-2 cell monolayers and ex vivo on rat intestinal mucosa. PCP-Cys displayed 223 ± 13.8 μmol thiol groups per gram polymer. After 4h, 61% of the free oligonucleotides were degraded by DNase I and 80% within intestinal fluid. In contrast, less than 41% (DNase I) and 60% (intestinal fluid) were degraded in the presence of 0.02% (m/v) PCP-Cys. Permeation studies revealed an 8-fold (Caco-2) and 10-fold (intestinal mucosa) increase in apparent permeability compared to buffer control. Hence, this PCP-Cys/GSH system might be a promising tool for the oral administration of oligonucleotides as it allows a significant protection toward degrading enzymes and facilitates their transport across intestinal membranes. Copyright © 2011 Elsevier B.V. All rights reserved.

  20. Improved DNA hybridization parameters by Twisted Intercalating Nucleic Acid (TINA).

    PubMed

    Schneider, Uffe Vest

    2012-01-01

    This thesis establishes oligonucleotide design rules and applications of a novel group of DNA stabilizing molecules collectively called Twisted Intercalating Nucleic Acid - TINA. Three peer-reviewed publications form the basis for the thesis. One publication describes an improved and rapid method for determination of DNA melting points and two publications describe the effects of positioning TINA molecules in parallel triplex helix and antiparallel duplex helix forming DNA structures. The third publication establishes that TINA molecules containing oligonucleotides improve an antiparallel duplex hybridization based capture assay's analytical sensitivity compared to conventionel DNA oligonucleotides. Clinical microbiology is traditionally based on pathogenic microorganisms' culture and serological tests. The introduction of DNA target amplification methods like PCR has improved the analytical sensitivity and total turn around time involved in clinical diagnostics of infections. Due to the relatively weak hybridization between the two strands of double stranded DNA, a number of nucleic acid stabilizing molecules have been developed to improve the sensitivity of DNA based diagnostics through superior binding properties. A short introduction is given to Watson-Crick and Hoogsteen based DNA binding and the derived DNA structures. A number of other nucleic acid stabilizing molecules are described. The stabilizing effect of TINA molecules on different DNA structures is discussed and considered in relation to other nucleic acid stabilizing molecules and in relation to future use of TINA containing oligonucleotides in clinical diagnostics and therapy. In conclusion, design of TINA modified oligonucleotides for antiparallel duplex helixes and parallel triplex helixes follows simple purpose dependent rules. TINA molecules are well suited for improving multiplex PCR assays and can be used as part of novel technologies. Future research should test whether combinations of TINA molecules and other nucleic acid stabilizing molecules can increase analytical sensitivity whilst maintaining nucleobase mismatch discrimination in triplex helix based diagnostic assays.

  1. Optimized synthesis of phosphorothioate oligodeoxyribonucleotides substituted with a 5′-protected thiol function and a 3′-amino group

    PubMed Central

    Aubert, Yves; Bourgerie, Sylvain; Meunier, Laurent; Mayer, Roger; Roche, Annie-Claude; Monsigny, Michel; Thuong, Nguyen T.; Asseline, Ulysse

    2000-01-01

    A new deprotection procedure enables a medium scale preparation of phosphodiester and phosphorothioate oligonucleotides substituted with a protected thiol function at their 5′-ends and an amino group at their 3′-ends in good yield (up to 72 OD units/µmol for a 19mer phosphorothioate). Syntheses of 3′-amino-substituted oligonucleotides were carried out on a modified support. A linker containing the thioacetyl moiety was manually coupled in two steps by first adding its phosphoramidite derivative in the presence of tetrazole followed by either oxidation or sulfurization to afford the bis-derivatized oligonucleotide bound to the support. Deprotection was achieved by treating the fully protected oligonucleotide with a mixture of 2,2′-dithiodipyridine and concentrated aqueous ammonia in the presence of phenol and methanol. This procedure enables (i) cleavage of the oligonucleotide from the support, releasing the oligonucleotide with a free amino group at its 3′-end, (ii) deprotection of the phosphate groups and the amino functions of the nucleic bases, as well as (iii) transformation of the 5′-terminal S-acetyl function into a dithiopyridyl group. The bis-derivatized phosphorothioate oligomer was further substituted through a two-step procedure: first, the 3′-amino group was reacted with fluorescein isothiocyanate to yield a fluoresceinylated oligonucleotide; the 5′-dithiopyridyl group was then quantitatively reduced to give a free thiol group which was then substituted by reaction with an Nα-bromoacetyl derivative of a signal peptide containing a KDEL sequence to afford a fluoresceinylated peptide–oligonucleotide conjugate. PMID:10637335

  2. Incorporation of terminal phosphorothioates into oligonucleotides.

    PubMed Central

    Alefelder, S; Patel, B K; Eckstein, F

    1998-01-01

    Considerable effort has been directed towards studying the structure and function of oligonucleotides and several approaches rely on the attachment of reporter groups to oligonucleotides. We report here the introduction of 3'- and 5'-terminal phosphorothioates into heptameric oligonucleotides and their post-synthetic modification with several reporter groups. The synthesis of terminal phosphorothioates is based on the coupling of a ribonucleoside phosphoramidite at the first or last nucleotide, respectively, which, after sulphurization, is removed by sequential oxidation of the vicinal hydroxyl groups and then beta-elimination. Product formation is of the order of 95%. The ratio of phosphorothioate- versus phosphate-terminated oligodeoxynucleotides as analysed by electrophoresis on a Hg2+gel is in general 85/15. Examples for the reactivity of the terminal phosphorothioates for conjugation with cholesterol, bimane and for sulphydryl exchange are described. PMID:9776763

  3. Rapid and accurate synthesis of TALE genes from synthetic oligonucleotides.

    PubMed

    Wang, Fenghua; Zhang, Hefei; Gao, Jingxia; Chen, Fengjiao; Chen, Sijie; Zhang, Cuizhen; Peng, Gang

    2016-01-01

    Custom synthesis of transcription activator-like effector (TALE) genes has relied upon plasmid libraries of pre-fabricated TALE-repeat monomers or oligomers. Here we describe a novel synthesis method that directly incorporates annealed synthetic oligonucleotides into the TALE-repeat units. Our approach utilizes iterative sets of oligonucleotides and a translational frame check strategy to ensure the high efficiency and accuracy of TALE-gene synthesis. TALE arrays of more than 20 repeats can be constructed, and the majority of the synthesized constructs have perfect sequences. In addition, this novel oligonucleotide-based method can readily accommodate design changes to the TALE repeats. We demonstrated an increased gene targeting efficiency against a genomic site containing a potentially methylated cytosine by incorporating non-conventional repeat variable di-residue (RVD) sequences.

  4. Genes Responsive to Low-Intensity Pulsed Ultrasound in MC3T3-E1 Preosteoblast Cells

    PubMed Central

    Tabuchi, Yoshiaki; Sugahara, Yuuki; Ikegame, Mika; Suzuki, Nobuo; Kitamura, Kei-ichiro; Kondo, Takashi

    2013-01-01

    Although low-intensity pulsed ultrasound (LIPUS) has been shown to enhance bone fracture healing, the underlying mechanism of LIPUS remains to be fully elucidated. Here, to better understand the molecular mechanism underlying cellular responses to LIPUS, we investigated gene expression profiles in mouse MC3T3-E1 preosteoblast cells exposed to LIPUS using high-density oligonucleotide microarrays and computational gene expression analysis tools. Although treatment of the cells with a single 20-min LIPUS (1.5 MHz, 30 mW/cm2) did not affect the cell growth or alkaline phosphatase activity, the treatment significantly increased the mRNA level of Bglap. Microarray analysis demonstrated that 38 genes were upregulated and 37 genes were downregulated by 1.5-fold or more in the cells at 24-h post-treatment. Ingenuity pathway analysis demonstrated that the gene network U (up) contained many upregulated genes that were mainly associated with bone morphology in the category of biological functions of skeletal and muscular system development and function. Moreover, the biological function of the gene network D (down), which contained downregulated genes, was associated with gene expression, the cell cycle and connective tissue development and function. These results should help to further clarify the molecular basis of the mechanisms of the LIPUS response in osteoblast cells. PMID:24252911

  5. Altered gene expression in conjunctival squamous cell carcinoma.

    PubMed

    Mahale, Alka; Alkatan, Hind; Alwadani, Saeed; Othman, Maha; Suarez, Maria J; Price, Antoinette; Al-Hussain, Hailah; Jastaneiah, Sabah; Yu, Wayne; Maktabi, Azza; Deepak, Edward P; Eberhart, Charles G; Asnaghi, Laura

    2016-05-01

    Conjunctival squamous cell carcinoma is a malignancy of the ocular surface. The molecular drivers responsible for the development and progression of this disease are not well understood. We therefore compared the transcriptional profiles of eight snap-frozen conjunctival squamous cell carcinomas and one in situ lesion with normal conjunctival specimens in order to identify diagnostic markers or therapeutic targets. RNA was analyzed using oligonucleotide microarrays, and a wide range of transcripts with altered expression identified, including many dysregulated in carcinomas arising at other sites. Among the upregulated genes, we observed more than 30-fold induction of the matrix metalloproteinases, MMP-9 and MMP-11, as well as a prominent increase in the mRNA level of a calcium-binding protein important for the intracellular calcium signaling, S100A2, which was induced over 20-fold in the tumor cohort. Clusterin was the most downregulated gene, with an approximately 180-fold reduction in the mRNA expression. These alterations were all confirmed by qPCR in the samples used for initial microarray analysis. In addition, immunohistochemical analysis confirmed the overexpression of MMP-11 and S100A2, as well as reductions in clusterin, in several independent in situ carcinomas of conjunctiva. These data identify a number of alterations, including upregulation of MMP-9, MMP-11, and S100A2, as well as downregulation of clusterin, associated with epithelial tumorigenesis in the ocular surface.

  6. Methoxychlor affects multiple hormone signaling pathways in the largemouth bass (Micropterus salmoides) liver

    PubMed Central

    Martyniuk, Christopher J.; Spade, Daniel J.; Blum, Jason L.; Kroll, Kevin J.; Denslow, Nancy D.

    2011-01-01

    Methoxychlor (MXC) is an organochlorine pesticide that has been shown to have estrogenic activity by activating estrogen receptors and inducing vitellogenin production in male fish. Previous studies report that exposure to MXC induces changes in mRNA abundance of reproductive genes in the liver and testes of largemouth bass (Micropterus salmoides). The objective of the present study was to better characterize the mode of action of MXC by measuring the global transcriptomic response in the male largemouth liver using an oligonucleotide microarray. Microarray analysis identified highly significant changes in the expression of 37 transcripts (p<0.001) (20 induced and 17 decreased) in the liver after MXC injection and a total of 900 expression changes (p<0.05) in transcripts with high homology to known genes. Largemouth bass estrogen receptor alpha (esr1) and androgen receptor (ar) were among the transcripts that were increased in the liver after MXC treatment. Functional enrichment analysis identified the molecular functions of steroid binding and androgen receptor activity as well as steroid hormone receptor activity as being significantly over-represented gene ontology terms. Pathway analysis identified c-fos signaling as being putatively affected through both estrogen and androgen signaling. This study provides evidence that MXC elicits transcriptional effects through the estrogen receptor as well as androgen receptor-mediated pathways in the liver. PMID:21276474

  7. Functional characterization of MAT1-1-specific mating-type genes in the homothallic ascomycete Sordaria macrospora provides new insights into essential and nonessential sexual regulators.

    PubMed

    Klix, V; Nowrousian, M; Ringelberg, C; Loros, J J; Dunlap, J C; Pöggeler, S

    2010-06-01

    Mating-type genes in fungi encode regulators of mating and sexual development. Heterothallic ascomycete species require different sets of mating-type genes to control nonself-recognition and mating of compatible partners of different mating types. Homothallic (self-fertile) species also carry mating-type genes in their genome that are essential for sexual development. To analyze the molecular basis of homothallism and the role of mating-type genes during fruiting-body development, we deleted each of the three genes, SmtA-1 (MAT1-1-1), SmtA-2 (MAT1-1-2), and SmtA-3 (MAT1-1-3), contained in the MAT1-1 part of the mating-type locus of the homothallic ascomycete species Sordaria macrospora. Phenotypic analysis of deletion mutants revealed that the PPF domain protein-encoding gene SmtA-2 is essential for sexual reproduction, whereas the alpha domain protein-encoding genes SmtA-1 and SmtA-3 play no role in fruiting-body development. By means of cross-species microarray analysis using Neurospora crassa oligonucleotide microarrays hybridized with S. macrospora targets and quantitative real-time PCR, we identified genes expressed under the control of SmtA-1 and SmtA-2. Both genes are involved in the regulation of gene expression, including that of pheromone genes.

  8. Functional Characterization of MAT1-1-Specific Mating-Type Genes in the Homothallic Ascomycete Sordaria macrospora Provides New Insights into Essential and Nonessential Sexual Regulators▿†

    PubMed Central

    Klix, V.; Nowrousian, M.; Ringelberg, C.; Loros, J. J.; Dunlap, J. C.; Pöggeler, S.

    2010-01-01

    Mating-type genes in fungi encode regulators of mating and sexual development. Heterothallic ascomycete species require different sets of mating-type genes to control nonself-recognition and mating of compatible partners of different mating types. Homothallic (self-fertile) species also carry mating-type genes in their genome that are essential for sexual development. To analyze the molecular basis of homothallism and the role of mating-type genes during fruiting-body development, we deleted each of the three genes, SmtA-1 (MAT1-1-1), SmtA-2 (MAT1-1-2), and SmtA-3 (MAT1-1-3), contained in the MAT1-1 part of the mating-type locus of the homothallic ascomycete species Sordaria macrospora. Phenotypic analysis of deletion mutants revealed that the PPF domain protein-encoding gene SmtA-2 is essential for sexual reproduction, whereas the α domain protein-encoding genes SmtA-1 and SmtA-3 play no role in fruiting-body development. By means of cross-species microarray analysis using Neurospora crassa oligonucleotide microarrays hybridized with S. macrospora targets and quantitative real-time PCR, we identified genes expressed under the control of SmtA-1 and SmtA-2. Both genes are involved in the regulation of gene expression, including that of pheromone genes. PMID:20435701

  9. Response of Desulfovibrio vulgaris to Alkaline Stress▿ †

    PubMed Central

    Stolyar, Sergey; He, Qiang; Joachimiak, Marcin P.; He, Zhili; Yang, Zamin Koo; Borglin, Sharon E.; Joyner, Dominique C.; Huang, Katherine; Alm, Eric; Hazen, Terry C.; Zhou, Jizhong; Wall, Judy D.; Arkin, Adam P.; Stahl, David A.

    2007-01-01

    The response of exponentially growing Desulfovibrio vulgaris Hildenborough to pH 10 stress was studied using oligonucleotide microarrays and a study set of mutants with genes suggested by microarray data to be involved in the alkaline stress response deleted. The data showed that the response of D. vulgaris to increased pH is generally similar to that of Escherichia coli but is apparently controlled by unique regulatory circuits since the alternative sigma factors (sigma S and sigma E) contributing to this stress response in E. coli appear to be absent in D. vulgaris. Genes previously reported to be up-regulated in E. coli were up-regulated in D. vulgaris; these genes included three ATPase genes and a tryptophan synthase gene. Transcription of chaperone and protease genes (encoding ATP-dependent Clp and La proteases and DnaK) was also elevated in D. vulgaris. As in E. coli, genes involved in flagellum synthesis were down-regulated. The transcriptional data also identified regulators, distinct from sigma S and sigma E, that are likely part of a D. vulgaris Hildenborough-specific stress response system. Characterization of a study set of mutants with genes implicated in alkaline stress response deleted confirmed that there was protective involvement of the sodium/proton antiporter NhaC-2, tryptophanase A, and two putative regulators/histidine kinases (DVU0331 and DVU2580). PMID:17921288

  10. Unusual Intron Conservation near Tissue-Regulated Exons Found by Splicing Microarrays

    PubMed Central

    Sugnet, Charles W; Srinivasan, Karpagam; Clark, Tyson A; O'Brien, Georgeann; Cline, Melissa S; Wang, Hui; Williams, Alan; Kulp, David; Blume, John E; Haussler, David; Ares, Manuel

    2006-01-01

    Alternative splicing contributes to both gene regulation and protein diversity. To discover broad relationships between regulation of alternative splicing and sequence conservation, we applied a systems approach, using oligonucleotide microarrays designed to capture splicing information across the mouse genome. In a set of 22 adult tissues, we observe differential expression of RNA containing at least two alternative splice junctions for about 40% of the 6,216 alternative events we could detect. Statistical comparisons identify 171 cassette exons whose inclusion or skipping is different in brain relative to other tissues and another 28 exons whose splicing is different in muscle. A subset of these exons is associated with unusual blocks of intron sequence whose conservation in vertebrates rivals that of protein-coding exons. By focusing on sets of exons with similar regulatory patterns, we have identified new sequence motifs implicated in brain and muscle splicing regulation. Of note is a motif that is strikingly similar to the branchpoint consensus but is located downstream of the 5′ splice site of exons included in muscle. Analysis of three paralogous membrane-associated guanylate kinase genes reveals that each contains a paralogous tissue-regulated exon with a similar tissue inclusion pattern. While the intron sequences flanking these exons remain highly conserved among mammalian orthologs, the paralogous flanking intron sequences have diverged considerably, suggesting unusually complex evolution of the regulation of alternative splicing in multigene families. PMID:16424921

  11. Transcriptome remodeling associated with chronological aging in the dinoflagellate, Karenia brevis.

    PubMed

    Johnson, Jillian G; Morey, Jeanine S; Neely, Marion G; Ryan, James C; Van Dolah, Frances M

    2012-03-01

    The toxic dinoflagellate, Karenia brevis, forms dense blooms in the Gulf of Mexico that persist for many months in coastal waters, where they can cause extensive marine animal mortalities and human health impacts. The mechanisms that enable cell survival in high density, low growth blooms, and the mechanisms leading to often rapid bloom demise are not well understood. To gain an understanding of processes that underlie chronological aging in this dinoflagellate, a microarray study was carried out to identify changes in the global transcriptome that accompany the entry and maintenance of stationary phase up to the onset of cell death. The transcriptome of K. brevis was assayed using a custom 10,263 feature oligonucleotide microarray from mid-logarithmic growth to the onset of culture demise. A total of 2958 (29%) features were differentially expressed, with the mid-stationary phase timepoint demonstrating peak changes in expression. Gene ontology enrichment analyses identified a significant shift in transcripts involved in energy acquisition, ribosome biogenesis, gene expression, stress adaptation, calcium signaling, and putative brevetoxin biosynthesis. The extensive remodeling of the transcriptome observed in the transition into a quiescent non-dividing phase appears to be indicative of a global shift in the metabolic and signaling requirements and provides the basis from which to understand the process of chronological aging in a dinoflagellate. Published by Elsevier B.V.

  12. Genomic analysis of wig-1 pathways.

    PubMed

    Sedaghat, Yalda; Mazur, Curt; Sabripour, Mahyar; Hung, Gene; Monia, Brett P

    2012-01-01

    Wig-1 is a transcription factor regulated by p53 that can interact with hnRNP A2/B1, RNA Helicase A, and dsRNAs, which plays an important role in RNA and protein stabilization. in vitro studies have shown that wig-1 binds p53 mRNA and stabilizes it by protecting it from deadenylation. Furthermore, p53 has been implicated as a causal factor in neurodegenerative diseases based in part on its selective regulatory function on gene expression, including genes which, in turn, also possess regulatory functions on gene expression. In this study we focused on the wig-1 transcription factor as a downstream p53 regulated gene and characterized the effects of wig-1 down regulation on gene expression in mouse liver and brain. Antisense oligonucleotides (ASOs) were identified that specifically target mouse wig-1 mRNA and produce a dose-dependent reduction in wig-1 mRNA levels in cell culture. These wig-1 ASOs produced marked reductions in wig-1 levels in liver following intraperitoneal administration and in brain tissue following ASO administration through a single striatal bolus injection in FVB and BACHD mice. Wig-1 suppression was well tolerated and resulted in the reduction of mutant Htt protein levels in BACHD mouse brain but had no effect on normal Htt protein levels nor p53 mRNA or protein levels. Expression microarray analysis was employed to determine the effects of wig-1 suppression on genome-wide expression in mouse liver and brain. Reduction of wig-1 caused both down regulation and up regulation of several genes, and a number of wig-1 regulated genes were identified that potentially links wig-1 various signaling pathways and diseases. Antisense oligonucleotides can effectively reduce wig-1 levels in mouse liver and brain, which results in specific changes in gene expression for pathways relevant to both the nervous system and cancer.

  13. Repression of anti-proliferative factor Tob1 in osteoarthritic cartilage

    PubMed Central

    Gebauer, Mathias; Saas, Joachim; Haag, Jochen; Dietz, Uwe; Takigawa, Masaharu; Bartnik, Eckart; Aigner, Thomas

    2005-01-01

    Osteoarthritis is the most common degenerative disorder of the modern world. However, many basic cellular features and molecular processes of the disease are poorly understood. In the present study we used oligonucleotide-based microarray analysis of genes of known or assumed relevance to the cellular phenotype to screen for relevant differences in gene expression between normal and osteoarthritic chondrocytes. Custom made oligonucleotide DNA arrays were used to screen for differentially expressed genes in normal (n = 9) and osteoarthritic (n = 10) cartilage samples. Real-time polymerase chain reaction (PCR) with gene-specific primers was used for quantification. Primary human adult articular chondrocytes and chondrosarcoma cell line HCS-2/8 were used to study changes in gene expression levels after stimulation with interleukin-1β and bone morphogenetic protein, as well as the dependence on cell differentiation. In situ hybridization with a gene-specific probe was applied to detect mRNA expression levels in fetal growth plate cartilage. Overall, more than 200 significantly regulated genes were detected between normal and osteoarthritic cartilage (P < 0.01). One of the significantly repressed genes, Tob1, encodes a protein belonging to a family involved in silencing cells in terms of proliferation and functional activity. The repression of Tob1 was confirmed by quantitative PCR and correlated to markers of chondrocyte activity and proliferation in vivo. Tob1 expression was also detected at a decreased level in isolated chondrocytes and in the chondrosarcoma cell line HCS-2/8. Again, in these cells it was negatively correlated with proliferative activity and positively with cellular differentiation. Altogether, the downregulation of the expression of Tob1 in osteoarthritic chondrocytes might be an important aspect of the cellular processes taking place during osteoarthritic cartilage degeneration. Activation, the reinitiation of proliferative activity and the loss of a stable phenotype are three major changes in osteoarthritic chondrocytes that are highly significantly correlated with the repression of Tob1 expression. PMID:15743474

  14. Genomic Analysis of wig-1 Pathways

    PubMed Central

    Sedaghat, Yalda; Mazur, Curt; Sabripour, Mahyar; Hung, Gene; Monia, Brett P.

    2012-01-01

    Background Wig-1 is a transcription factor regulated by p53 that can interact with hnRNP A2/B1, RNA Helicase A, and dsRNAs, which plays an important role in RNA and protein stabilization. in vitro studies have shown that wig-1 binds p53 mRNA and stabilizes it by protecting it from deadenylation. Furthermore, p53 has been implicated as a causal factor in neurodegenerative diseases based in part on its selective regulatory function on gene expression, including genes which, in turn, also possess regulatory functions on gene expression. In this study we focused on the wig-1 transcription factor as a downstream p53 regulated gene and characterized the effects of wig-1 down regulation on gene expression in mouse liver and brain. Methods and Results Antisense oligonucleotides (ASOs) were identified that specifically target mouse wig-1 mRNA and produce a dose-dependent reduction in wig-1 mRNA levels in cell culture. These wig-1 ASOs produced marked reductions in wig-1 levels in liver following intraperitoneal administration and in brain tissue following ASO administration through a single striatal bolus injection in FVB and BACHD mice. Wig-1 suppression was well tolerated and resulted in the reduction of mutant Htt protein levels in BACHD mouse brain but had no effect on normal Htt protein levels nor p53 mRNA or protein levels. Expression microarray analysis was employed to determine the effects of wig-1 suppression on genome-wide expression in mouse liver and brain. Reduction of wig-1 caused both down regulation and up regulation of several genes, and a number of wig-1 regulated genes were identified that potentially links wig-1 various signaling pathways and diseases. Conclusion Antisense oligonucleotides can effectively reduce wig-1 levels in mouse liver and brain, which results in specific changes in gene expression for pathways relevant to both the nervous system and cancer. PMID:22347364

  15. Multiplex amplification of large sets of human exons.

    PubMed

    Porreca, Gregory J; Zhang, Kun; Li, Jin Billy; Xie, Bin; Austin, Derek; Vassallo, Sara L; LeProust, Emily M; Peck, Bill J; Emig, Christopher J; Dahl, Fredrik; Gao, Yuan; Church, George M; Shendure, Jay

    2007-11-01

    A new generation of technologies is poised to reduce DNA sequencing costs by several orders of magnitude. But our ability to fully leverage the power of these technologies is crippled by the absence of suitable 'front-end' methods for isolating complex subsets of a mammalian genome at a scale that matches the throughput at which these platforms will routinely operate. We show that targeting oligonucleotides released from programmable microarrays can be used to capture and amplify approximately 10,000 human exons in a single multiplex reaction. Additionally, we show integration of this protocol with ultra-high-throughput sequencing for targeted variation discovery. Although the multiplex capture reaction is highly specific, we found that nonuniform capture is a key issue that will need to be resolved by additional optimization. We anticipate that highly multiplexed methods for targeted amplification will enable the comprehensive resequencing of human exons at a fraction of the cost of whole-genome resequencing.

  16. Microfabricated Fountain Pens for High-Density DNA Arrays

    PubMed Central

    Reese, Matthew O.; van Dam, R. Michae; Scherer, Axel; Quake, Stephen R.

    2003-01-01

    We used photolithographic microfabrication techniques to create very small stainless steel fountain pens that were installed in place of conventional pens on a microarray spotter. Because of the small feature size produced by the microfabricated pens, we were able to print arrays with up to 25,000 spots/cm2, significantly higher than can be achieved by other deposition methods. This feature density is sufficiently large that a standard microscope slide can contain multiple replicates of every gene in a complex organism such as a mouse or human. We tested carryover during array printing with dye solution, labeled DNA, and hybridized DNA, and we found it to be indistinguishable from background. Hybridization also showed good sequence specificity to printed oligonucleotides. In addition to improved slide capacity, the microfabrication process offers the possibility of low-cost mass-produced pens and the flexibility to include novel pen features that cannot be machined with conventional techniques. PMID:12975313

  17. Aberrant expression of the PHF14 gene in biliary tract cancer cells

    PubMed Central

    AKAZAWA, TAKAKO; YASUI, KOHICHIROH; GEN, YASUYUKI; YAMADA, NOBUHISA; TOMIE, AKIRA; DOHI, OSAMU; MITSUYOSHI, HIRONORI; YAGI, NOBUAKI; ITOH, YOSHITO; NAITO, YUJI; YOSHIKAWA, TOSHIKAZU

    2013-01-01

    DNA copy number aberrations in human biliary tract cancer (BTC) cell lines were investigated using a high-density oligonucleotide microarray. A novel homozygous deletion was detected at chromosomal region 7p21.3 in the OZ cell line. Further validation experiments using genomic PCR revealed a homozygous deletion of a single gene, plant homeodomain (PHD) finger protein 14 (PHF14). No PHF14 mRNA or protein expression was detected, thus demonstrating the absence of PHF14 expression in the OZ cell line. Although the PHD finger protein is considered to be involved in chromatin-mediated transcriptional regulation, little is known about the function of PHF14 in cancer. The present study observed that the knock down of PHF14 using small interfering RNA (siRNA) enhanced the growth of the BTC cells. These observations suggest that aberrant PHF14 expression may have a role in the tumorigenesis of BTC. PMID:23833654

  18. ASK1-dependent recruitment and activation of macrophages induce hair growth in skin wounds

    PubMed Central

    Osaka, Nao; Takahashi, Takumi; Murakami, Shiori; Matsuzawa, Atsushi; Noguchi, Takuya; Fujiwara, Takeshi; Aburatani, Hiroyuki; Moriyama, Keiji; Takeda, Kohsuke; Ichijo, Hidenori

    2007-01-01

    Apoptosis signal-regulating kinase 1 (ASK1) is a member of the mitogen-activated protein 3-kinase family that activates both c-Jun NH2-terminal kinase and p38 pathways in response to inflammatory cytokines and physicochemical stress. We report that ASK1 deficiency in mice results in dramatic retardation of wounding-induced hair regrowth in skin. Oligonucleotide microarray analysis revealed that expression of several chemotactic and activating factors for macrophages, as well as several macrophage-specific marker genes, was reduced in the skin wound area of ASK1-deficient mice. Intracutaneous transplantation of cytokine-activated bone marrow-derived macrophages strongly induced hair growth in both wild-type and ASK1-deficient mice. These findings indicate that ASK1 is required for wounding-induced infiltration and activation of macrophages, which play central roles in inflammation-dependent hair regrowth in skin. PMID:17389227

  19. Gene expression profiling in the hippocampus of learned helpless and nonhelpless rats.

    PubMed

    Kohen, R; Kirov, S; Navaja, G P; Happe, H Kevin; Hamblin, M W; Snoddy, J R; Neumaier, J F; Petty, F

    2005-01-01

    In the learned helplessness (LH) animal model of depression, failure to attempt escape from avoidable environmental stress, LH, indicates behavioral despair, whereas nonhelpless (NH) behavior reflects behavioral resilience to the effects of environmental stress. Comparing hippocampal gene expression with large-scale oligonucleotide microarrays, we found that stress-resilient (NH) rats, although behaviorally indistinguishable from controls, showed a distinct gene expression profile compared to LH, sham stressed, and naïve control animals. Genes that were confirmed as differentially expressed in the NH group by quantitative PCR strongly correlated in their levels of expression across all four animal groups. Differential expression could not be confirmed at the protein level. We identified several shared degenerate sequence motifs in the 3' untranslated region (3'UTR) of differentially expressed genes that could be a factor in this tight correlation of expression levels among differentially expressed genes.

  20. A Web-Based Multi-Database System Supporting Distributed Collaborative Management and Sharing of Microarray Experiment Information

    PubMed Central

    Burgarella, Sarah; Cattaneo, Dario; Masseroli, Marco

    2006-01-01

    We developed MicroGen, a multi-database Web based system for managing all the information characterizing spotted microarray experiments. It supports information gathering and storing according to the Minimum Information About Microarray Experiments (MIAME) standard. It also allows easy sharing of information and data among all multidisciplinary actors involved in spotted microarray experiments. PMID:17238488

  1. Current progress on aptamer-targeted oligonucleotide therapeutics

    PubMed Central

    Dassie, Justin P; Giangrande, Paloma H

    2014-01-01

    Exploiting the power of the RNAi pathway through the use of therapeutic siRNA drugs has remarkable potential for treating a vast array of human disease conditions. However, difficulties in delivery of these and similar nucleic acid-based pharmacological agents to appropriate organs or tissues, remains a major impediment to their broad clinical application. Synthetic nucleic acid ligands (aptamers) have emerged as effective delivery vehicles for therapeutic oligonucleotides, including siRNAs. In this review, we summarize recent attractive developments in creatively employing cell-internalizing aptamers to deliver therapeutic oligonucleotides (e.g., siRNAs, miRNAs, anti-miRs and antisense oligos) to target cells. We also discuss advancements in aptamer-siRNA chimera technology, as well as, aptamer-functionalized nanoparticles for siRNA delivery. In addition, the challenges and future prospects of aptamer-targeted oligonucleotide drugs for clinical translation are further highlighted. PMID:24304250

  2. Assembly of a biocompatible triazole-linked gene by one-pot click-DNA ligation

    NASA Astrophysics Data System (ADS)

    Kukwikila, Mikiembo; Gale, Nittaya; El-Sagheer, Afaf H.; Brown, Tom; Tavassoli, Ali

    2017-11-01

    The chemical synthesis of oligonucleotides and their enzyme-mediated assembly into genes and genomes has significantly advanced multiple scientific disciplines. However, these approaches are not without their shortcomings; enzymatic amplification and ligation of oligonucleotides into genes and genomes makes automation challenging, and site-specific incorporation of epigenetic information and/or modified bases into large constructs is not feasible. Here we present a fully chemical one-pot method for the assembly of oligonucleotides into a gene by click-DNA ligation. We synthesize the 335 base-pair gene that encodes the green fluorescent protein iLOV from ten functionalized oligonucleotides that contain 5ʹ-azide and 3ʹ-alkyne units. The resulting click-linked iLOV gene contains eight triazoles at the sites of chemical ligation, and yet is fully biocompatible; it is replicated by DNA polymerases in vitro and encodes a functional iLOV protein in Escherichia coli. We demonstrate the power and potential of our one-pot gene-assembly method by preparing an epigenetically modified variant of the iLOV gene.

  3. Lipophilic oligonucleotides spontaneously insert into lipid membranes, bind complementary DNA strands, and sequester into lipid-disordered domains.

    PubMed

    Bunge, Andreas; Kurz, Anke; Windeck, Anne-Kathrin; Korte, Thomas; Flasche, Wolfgang; Liebscher, Jürgen; Herrmann, Andreas; Huster, Daniel

    2007-04-10

    For the development of surface functionalized bilayers, we have synthesized lipophilic oligonucleotides to combine the molecular recognition mechanism of nucleic acids and the self-assembly characteristics of lipids in planar membranes. A lipophilic oligonucleotide consisting of 21 thymidine units and two lipophilic nucleotides with an alpha-tocopherol moiety as a lipophilic anchor was synthesized using solid-phase methods with a phosphoramadite strategy. The interaction of the water soluble lipophilic oligonucleotide with vesicular lipid membranes and its capability to bind complementary DNA strands was studied using complementary methods such as NMR, EPR, DSC, fluorescence spectroscopy, and fluorescence microscopy. This oligonucleotide inserted stably into preformed membranes from the aqueous phase. Thereby, no significant perturbation of the lipid bilayer and its stability was observed. However, the non-lipidated end of the oligonucleotide is exposed to the aqueous environment, is relatively mobile, and is free to interact with complementary DNA strands. Binding of the complementary single-stranded DNA molecules is fast and accomplished by the formation of Watson-Crick base pairs, which was confirmed by 1H NMR chemical shift analysis and fluorescence resonance energy transfer. The molecular structure of the membrane bound DNA double helix is very similar to the free double-stranded DNA. Further, the membrane bound DNA double strands also undergo regular melting. Finally, in raft-like membrane mixtures, the lipophilic oligonucleotide was shown to preferentially sequester into liquid-disordered membrane domains.

  4. Gene Silencing by Gold Nanoshell-Mediated Delivery and Laser-Triggered Release of Antisense Oligonucleotide and siRNA

    PubMed Central

    Huschka, Ryan; Barhoumi, Aoune; Liu, Qing; Roth, Jack A.; Ji, Lin; Halas, Naomi J.

    2013-01-01

    The approach of RNA interference (RNAi)- using antisense DNA or RNA oligonucleotides to silence activity of a specific pathogenic gene transcript and reduce expression of the encoded protein- is very useful in dissecting genetic function and holds significant promise as a molecular therapeutic. A major obstacle in achieving gene silencing with RNAi technology is the systemic delivery of therapeutic oligonucleotides. Here we demonstrate an engineered gold nanoshell (NS)-based therapeutic oligonucleotide delivery vehicle, designed to release its cargo on demand upon illumination with a near-infrared (NIR) laser. A poly(L)lysine peptide (PLL) epilayer covalently attached to the NS surface (NS-PLL) is used to capture intact, single-stranded antisense DNA oligonucleotides, or alternatively, double-stranded short-interfering RNA (siRNA) molecules. Controlled release of the captured therapeutic oligonucleotides in each case is accomplished by continuous wave NIR laser irradiation at 800 nm, near the resonance wavelength of the nanoshell. Fluorescently tagged oligonucleotides were used to monitor the time-dependent release process and light-triggered endosomal release. A green fluorescent protein (GFP)-expressing human lung cancer H1299 cell line was used to determine cellular uptake and gene silencing mediated by the NS-PLL carrying GFP gene-specific single-stranded DNA antisense oligonucleotide (AON-GFP), or a double-stranded siRNA (siRNA-GFP), in vitro. Light-triggered delivery resulted in ∼ 47% and ∼49% downregulation of the targeted GFP expression by AON-GFP and siRNA-GFP, respectively. Cytotoxicity induced by both the NS-PLL delivery vector and by laser irradiation is minimal, as demonstrated by a XTT cell proliferation assay. PMID:22862291

  5. A multiplex protein-free lateral flow assay for detection of microRNAs based on unmodified molecular beacons.

    PubMed

    Javani, Atefeh; Javadi-Zarnaghi, Fatemeh; Rasaee, Mohammad Javad

    2017-11-15

    Lateral flow assays (LFAs) have promising potentials for point-of-care applications. Recently, many LFAs have been reported that are based on hybridization of oligonucleotide strands. Mostly, biotinylated capture DNAs are immobilized on the surface of a nitrocellulose membrane via streptavidin interactions. During the assay, stable colorful complexes get formed that are visible by naked eyes. Here, we present an inexpensive and unique design of LFA that applies unmodified oligonucleotides at capture lines. The presented LFA do not utilize streptavidin or any other affinity protein. We employ structural switch of molecular beacons (MB) in combination with base stacking hybridization (BSH) phenomenon. The unique design of the reported LFA provided high selectivity for target oligonucleotides. We validated potential applications of the system for detection of DNA mimics of two microRNAs in multiplex assays. Copyright © 2017 Elsevier Inc. All rights reserved.

  6. Efficient self-assembly of DNA-functionalized fluorophores and gold nanoparticles with DNA functionalized silicon surfaces: the effect of oligomer spacers

    PubMed Central

    Milton, James A.; Patole, Samson; Yin, Huabing; Xiao, Qiang; Brown, Tom; Melvin, Tracy

    2013-01-01

    Although strategies for the immobilization of DNA oligonucleotides onto surfaces for bioanalytical and top-down bio-inspired nanobiofabrication approaches are well developed, the effect of introducing spacer molecules between the surface and the DNA oligonucleotide for the hybridization of nanoparticle–DNA conjugates has not been previously assessed in a quantitative manner. The hybridization efficiency of DNA oligonucleotides end-labelled with gold nanoparticles (1.4 or 10 nm diameter) with DNA sequences conjugated to silicon surfaces via hexaethylene glycol phosphate diester oligomer spacers (0, 1, 2, 6 oligomers) was found to be independent of spacer length. To quantify both the density of DNA strands attached to the surfaces and hybridization with the surface-attached DNA, new methodologies have been developed. Firstly, a simple approach based on fluorescence has been developed for determination of the immobilization density of DNA oligonucleotides. Secondly, an approach using mass spectrometry has been created to establish (i) the mean number of DNA oligonucleotides attached to the gold nanoparticles and (ii) the hybridization density of nanoparticle–oligonucleotide conjugates with the silicon surface–attached complementary sequence. These methods and results will be useful for application with nanosensors, the self-assembly of nanoelectronic devices and the attachment of nanoparticles to biomolecules for single-molecule biophysical studies. PMID:23361467

  7. A Novel Bioinformatics Strategy to Analyze Microbial Big Sequence Data for Efficient Knowledge Discovery: Batch-Learning Self-Organizing Map (BLSOM).

    PubMed

    Iwasaki, Yuki; Abe, Takashi; Wada, Kennosuke; Wada, Yoshiko; Ikemura, Toshimichi

    2013-11-20

    With the remarkable increase of genomic sequence data of microorganisms, novel tools are needed for comprehensive analyses of the big sequence data available. The self-organizing map (SOM) is an effective tool for clustering and visualizing high-dimensional data, such as oligonucleotide composition on one map. By modifying the conventional SOM, we developed batch-learning SOM (BLSOM), which allowed classification of sequence fragments (e.g., 1 kb) according to phylotypes, solely depending on oligonucleotide composition. Metagenomics studies of uncultivable microorganisms in clinical and environmental samples should allow extensive surveys of genes important in life sciences. BLSOM is most suitable for phylogenetic assignment of metagenomic sequences, because fragmental sequences can be clustered according to phylotypes, solely depending on oligonucleotide composition. We first constructed oligonucleotide BLSOMs for all available sequences from genomes of known species, and by mapping metagenomic sequences on these large-scale BLSOMs, we can predict phylotypes of individual metagenomic sequences, revealing a microbial community structure of uncultured microorganisms, including viruses. BLSOM has shown that influenza viruses isolated from humans and birds clearly differ in oligonucleotide composition. Based on this host-dependent oligonucleotide composition, we have proposed strategies for predicting directional changes of virus sequences and for surveilling potentially hazardous strains when introduced into humans from non-human sources.

  8. Comparison of RNA-seq and microarray-based models for clinical endpoint prediction.

    PubMed

    Zhang, Wenqian; Yu, Ying; Hertwig, Falk; Thierry-Mieg, Jean; Zhang, Wenwei; Thierry-Mieg, Danielle; Wang, Jian; Furlanello, Cesare; Devanarayan, Viswanath; Cheng, Jie; Deng, Youping; Hero, Barbara; Hong, Huixiao; Jia, Meiwen; Li, Li; Lin, Simon M; Nikolsky, Yuri; Oberthuer, André; Qing, Tao; Su, Zhenqiang; Volland, Ruth; Wang, Charles; Wang, May D; Ai, Junmei; Albanese, Davide; Asgharzadeh, Shahab; Avigad, Smadar; Bao, Wenjun; Bessarabova, Marina; Brilliant, Murray H; Brors, Benedikt; Chierici, Marco; Chu, Tzu-Ming; Zhang, Jibin; Grundy, Richard G; He, Min Max; Hebbring, Scott; Kaufman, Howard L; Lababidi, Samir; Lancashire, Lee J; Li, Yan; Lu, Xin X; Luo, Heng; Ma, Xiwen; Ning, Baitang; Noguera, Rosa; Peifer, Martin; Phan, John H; Roels, Frederik; Rosswog, Carolina; Shao, Susan; Shen, Jie; Theissen, Jessica; Tonini, Gian Paolo; Vandesompele, Jo; Wu, Po-Yen; Xiao, Wenzhong; Xu, Joshua; Xu, Weihong; Xuan, Jiekun; Yang, Yong; Ye, Zhan; Dong, Zirui; Zhang, Ke K; Yin, Ye; Zhao, Chen; Zheng, Yuanting; Wolfinger, Russell D; Shi, Tieliu; Malkas, Linda H; Berthold, Frank; Wang, Jun; Tong, Weida; Shi, Leming; Peng, Zhiyu; Fischer, Matthias

    2015-06-25

    Gene expression profiling is being widely applied in cancer research to identify biomarkers for clinical endpoint prediction. Since RNA-seq provides a powerful tool for transcriptome-based applications beyond the limitations of microarrays, we sought to systematically evaluate the performance of RNA-seq-based and microarray-based classifiers in this MAQC-III/SEQC study for clinical endpoint prediction using neuroblastoma as a model. We generate gene expression profiles from 498 primary neuroblastomas using both RNA-seq and 44 k microarrays. Characterization of the neuroblastoma transcriptome by RNA-seq reveals that more than 48,000 genes and 200,000 transcripts are being expressed in this malignancy. We also find that RNA-seq provides much more detailed information on specific transcript expression patterns in clinico-genetic neuroblastoma subgroups than microarrays. To systematically compare the power of RNA-seq and microarray-based models in predicting clinical endpoints, we divide the cohort randomly into training and validation sets and develop 360 predictive models on six clinical endpoints of varying predictability. Evaluation of factors potentially affecting model performances reveals that prediction accuracies are most strongly influenced by the nature of the clinical endpoint, whereas technological platforms (RNA-seq vs. microarrays), RNA-seq data analysis pipelines, and feature levels (gene vs. transcript vs. exon-junction level) do not significantly affect performances of the models. We demonstrate that RNA-seq outperforms microarrays in determining the transcriptomic characteristics of cancer, while RNA-seq and microarray-based models perform similarly in clinical endpoint prediction. Our findings may be valuable to guide future studies on the development of gene expression-based predictive models and their implementation in clinical practice.

  9. Junctions between i-motif tetramers in supramolecular structures

    PubMed Central

    Guittet, Eric; Renciuk, Daniel; Leroy, Jean-Louis

    2012-01-01

    The symmetry of i-motif tetramers gives to cytidine-rich oligonucleotides the capacity to associate into supramolecular structures (sms). In order to determine how the tetramers are linked together in such structures, we have measured by gel filtration chromatography and NMR the formation and dissociation kinetics of sms built by oligonucleotides containing two short C stretches separated by a non-cytidine-base. We show that a stretch of only two cytidines either at the 3′- or 5′-end is long enough to link the tetramers into sms. The analysis of the properties of sms formed by oligonucleotides differing by the length of the oligo-C stretches, the sequence orientation and the nature of the non-C base provides a model of the junction connecting the tetramers in sms. PMID:22362739

  10. Assessing differential expression in two-color microarrays: a resampling-based empirical Bayes approach.

    PubMed

    Li, Dongmei; Le Pape, Marc A; Parikh, Nisha I; Chen, Will X; Dye, Timothy D

    2013-01-01

    Microarrays are widely used for examining differential gene expression, identifying single nucleotide polymorphisms, and detecting methylation loci. Multiple testing methods in microarray data analysis aim at controlling both Type I and Type II error rates; however, real microarray data do not always fit their distribution assumptions. Smyth's ubiquitous parametric method, for example, inadequately accommodates violations of normality assumptions, resulting in inflated Type I error rates. The Significance Analysis of Microarrays, another widely used microarray data analysis method, is based on a permutation test and is robust to non-normally distributed data; however, the Significance Analysis of Microarrays method fold change criteria are problematic, and can critically alter the conclusion of a study, as a result of compositional changes of the control data set in the analysis. We propose a novel approach, combining resampling with empirical Bayes methods: the Resampling-based empirical Bayes Methods. This approach not only reduces false discovery rates for non-normally distributed microarray data, but it is also impervious to fold change threshold since no control data set selection is needed. Through simulation studies, sensitivities, specificities, total rejections, and false discovery rates are compared across the Smyth's parametric method, the Significance Analysis of Microarrays, and the Resampling-based empirical Bayes Methods. Differences in false discovery rates controls between each approach are illustrated through a preterm delivery methylation study. The results show that the Resampling-based empirical Bayes Methods offer significantly higher specificity and lower false discovery rates compared to Smyth's parametric method when data are not normally distributed. The Resampling-based empirical Bayes Methods also offers higher statistical power than the Significance Analysis of Microarrays method when the proportion of significantly differentially expressed genes is large for both normally and non-normally distributed data. Finally, the Resampling-based empirical Bayes Methods are generalizable to next generation sequencing RNA-seq data analysis.

  11. An oligonucleotide array for the identification and differentiation of bacteria pathogenic on potato.

    PubMed

    Fessehaie, Anania; De Boer, Solke H; Lévesque, C André

    2003-03-01

    ABSTRACT Oligonucleotides, 16 to 24 bases long, were selected from the 3' end of the 16S gene and the 16S-23S intergenic spacer regions of bacteria pathogenic on potato, including Clavibacter michiganensis subsp. sepedonicus, Ralstonia solanacearum, and the pectolytic erwinias, including Erwinia carotovora subsp. atroseptica and carotovora and E. chrysanthemi. Oligonucleotides were designed and formatted into an array by pin spotting on nylon membranes. Genomic DNA from bacterial cultures was amplified by polymerase chain reaction using conserved ribosomal primers and labeled simultaneously with digoxigenin-dUTP. Hybridization of amplicons to the array and subsequent serological detection of digoxigenin label revealed different hybridization patterns that were distinct for each species and subspecies tested. Hybridization of amplicons generally was restricted to appropriate homologous oligonucleotides and cross-hybridization with heterologous oligonucleotides was rare. Hybridization patterns were recorded as separate gray values for each hybridized spot and revealed a consistent pattern for multiple strains of each species or subspecies isolated from diverse geographical regions. In preliminary tests, bacteria could be correctly identified and detected by hybridizing to the array amplicons from mixed cultures and inoculated potato tissue.

  12. A reliable confirmation of the chemical structure of synthetic oligonucleotides: Detection of active protons in DNA oligomers by low-temperature FT infrared spectroscopy

    NASA Astrophysics Data System (ADS)

    Rozenberg, M.; Shoham, G.

    2009-01-01

    Cooling the samples allowed us to characterize solid oligonucleotides such as dimers, trimers and pentamers of cytidine, for the first time, in the IR range of the out-of-plane bending molecular modes (1000-400 cm -1) at 20 K. Especially interesting are the narrow IR bands of the out-of-plane bending ν4 NH 2 proton mode, which are apparently invisible at room temperature. This unequivocally defined and well-resolved NH 2 bending band should provide important information on the exact chemical form and hydrogen bonding interactions of cytidine amine groups. As such, this unique IR spectroscopy is suggested as a practical analytical tool to validate and characterize synthetic DNA bases and oligonucleotides. Using an approach of this type it was found that desalted oligonucleotide samples of the same nominal composition, but which had been produced by three different manufacturers, differ significantly in their IR spectra. These data suggest that the presumably identical oligonucleotides are in fact different, at least with respect to the content and nature of their NH protons.

  13. A reliable confirmation of the chemical structure of synthetic oligonucleotides: detection of active protons in DNA oligomers by low-temperature FT infrared spectroscopy.

    PubMed

    Rozenberg, M; Shoham, G

    2009-01-01

    Cooling the samples allowed us to characterize solid oligonucleotides such as dimers, trimers and pentamers of cytidine, for the first time, in the IR range of the out-of-plane bending molecular modes (1000-400 cm(-1)) at 20K. Especially interesting are the narrow IR bands of the out-of-plane bending nu(4) NH(2) proton mode, which are apparently invisible at room temperature. This unequivocally defined and well-resolved NH(2) bending band should provide important information on the exact chemical form and hydrogen bonding interactions of cytidine amine groups. As such, this unique IR spectroscopy is suggested as a practical analytical tool to validate and characterize synthetic DNA bases and oligonucleotides. Using an approach of this type it was found that desalted oligonucleotide samples of the same nominal composition, but which had been produced by three different manufacturers, differ significantly in their IR spectra. These data suggest that the presumably identical oligonucleotides are in fact different, at least with respect to the content and nature of their NH protons.

  14. Blocked recombinase polymerase amplification for mutation analysis of PIK3CA gene.

    PubMed

    Martorell, Sara; Palanca, Sarai; Maquieira, Ángel; Tortajada-Genaro, Luis A

    2018-03-01

    A blocked recombinase polymerase amplification (blocked-RPA) approach has been developed for the enrichment of mutated templates in heterogeneous specimens as tumor tissues. This isothermal amplification technique opens alternative solutions for meeting the technological demand of physician office laboratories. Herein, the detection of mutations in PIK3CA gene, such as p.E545K, and p.H1047L, is presented. The main element was an oligonucleotide (dideoxycytidine functionalized at 3'-end) which matched with wild-type sequence in the target locus. The amplification was performed operating at 37 °C during 40 min. The results demonstrated that the competition between the upstream primer and the blocker reduced the percentage of amplified wild-type allele, making the detection of the present mutation easier. For mutation discrimination, a fast hybridization assay was performed in microarray format on plastic chip and colorimetric detection. This approach enabled the reliable discrimination of specific mutations against a background of up to 95% wild-type DNA. The applicability of the method, based on the combination of blocked-RPA and low-cost chip hybridization, was successfully proven for the genotyping of various cancer cell lines as well as tumor tissues. The assignations agreed with those provided by next-generation sequencing. Therefore, these investigations would support a personalized approach to patient care based on the molecular signature of human cancers. Copyright © 2017 Elsevier Inc. All rights reserved.

  15. KUTE-BASE: storing, downloading and exporting MIAME-compliant microarray experiments in minutes rather than hours.

    PubMed

    Draghici, Sorin; Tarca, Adi L; Yu, Longfei; Ethier, Stephen; Romero, Roberto

    2008-03-01

    The BioArray Software Environment (BASE) is a very popular MIAME-compliant, web-based microarray data repository. However in BASE, like in most other microarray data repositories, the experiment annotation and raw data uploading can be very timeconsuming, especially for large microarray experiments. We developed KUTE (Karmanos Universal daTabase for microarray Experiments), as a plug-in for BASE 2.0 that addresses these issues. KUTE provides an automatic experiment annotation feature and a completely redesigned data work-flow that dramatically reduce the human-computer interaction time. For instance, in BASE 2.0 a typical Affymetrix experiment involving 100 arrays required 4 h 30 min of user interaction time forexperiment annotation, and 45 min for data upload/download. In contrast, for the same experiment, KUTE required only 28 min of user interaction time for experiment annotation, and 3.3 min for data upload/download. http://vortex.cs.wayne.edu/kute/index.html.

  16. Clustering-based spot segmentation of cDNA microarray images.

    PubMed

    Uslan, Volkan; Bucak, Ihsan Ömür

    2010-01-01

    Microarrays are utilized as that they provide useful information about thousands of gene expressions simultaneously. In this study segmentation step of microarray image processing has been implemented. Clustering-based methods, fuzzy c-means and k-means, have been applied for the segmentation step that separates the spots from the background. The experiments show that fuzzy c-means have segmented spots of the microarray image more accurately than the k-means.

  17. Surface-enhanced Raman scattering detection of DNA derived from the West Nile virus genome using magnetic capture of Raman-active gold nanoparticles

    USDA-ARS?s Scientific Manuscript database

    A model paramagnetic nanoparticle (MNP) assay is demonstrated for surface-enhanced Raman scattering (SERS) detection of DNA oligonucleotides derived from the West Nile virus (WNV) genome. Detection is based on the capture of WNV target sequences by hybridization with complementary oligonucleotide pr...

  18. Optical properties and electronic transitions of DNA oligonucleotides as a function of composition and stacking sequence.

    PubMed

    Schimelman, Jacob B; Dryden, Daniel M; Poudel, Lokendra; Krawiec, Katherine E; Ma, Yingfang; Podgornik, Rudolf; Parsegian, V Adrian; Denoyer, Linda K; Ching, Wai-Yim; Steinmetz, Nicole F; French, Roger H

    2015-02-14

    The role of base pair composition and stacking sequence in the optical properties and electronic transitions of DNA is of fundamental interest. We present and compare the optical properties of DNA oligonucleotides (AT)10, (AT)5(GC)5, and (AT-GC)5 using both ab initio methods and UV-vis molar absorbance measurements. Our data indicate a strong dependence of both the position and intensity of UV absorbance features on oligonucleotide composition and stacking sequence. The partial densities of states for each oligonucleotide indicate that the valence band edge arises from a feature associated with the PO4(3-) complex anion, and the conduction band edge arises from anti-bonding states in DNA base pairs. The results show a strong correspondence between the ab initio and experimentally determined optical properties. These results highlight the benefit of full spectral analysis of DNA, as opposed to reductive methods that consider only the 260 nm absorbance (A260) or simple purity ratios, such as A260/A230 or A260/A280, and suggest that the slope of the absorption edge onset may provide a useful metric for the degree of base pair stacking in DNA. These insights may prove useful for applications in biology, bioelectronics, and mesoscale self-assembly.

  19. Shrinkage regression-based methods for microarray missing value imputation.

    PubMed

    Wang, Hsiuying; Chiu, Chia-Chun; Wu, Yi-Ching; Wu, Wei-Sheng

    2013-01-01

    Missing values commonly occur in the microarray data, which usually contain more than 5% missing values with up to 90% of genes affected. Inaccurate missing value estimation results in reducing the power of downstream microarray data analyses. Many types of methods have been developed to estimate missing values. Among them, the regression-based methods are very popular and have been shown to perform better than the other types of methods in many testing microarray datasets. To further improve the performances of the regression-based methods, we propose shrinkage regression-based methods. Our methods take the advantage of the correlation structure in the microarray data and select similar genes for the target gene by Pearson correlation coefficients. Besides, our methods incorporate the least squares principle, utilize a shrinkage estimation approach to adjust the coefficients of the regression model, and then use the new coefficients to estimate missing values. Simulation results show that the proposed methods provide more accurate missing value estimation in six testing microarray datasets than the existing regression-based methods do. Imputation of missing values is a very important aspect of microarray data analyses because most of the downstream analyses require a complete dataset. Therefore, exploring accurate and efficient methods for estimating missing values has become an essential issue. Since our proposed shrinkage regression-based methods can provide accurate missing value estimation, they are competitive alternatives to the existing regression-based methods.

  20. Non-Enzymatic Detection of Bacterial Genomic DNA Using the Bio-Barcode Assay

    PubMed Central

    Hill, Haley D.; Vega, Rafael A.; Mirkin, Chad A.

    2011-01-01

    The detection of bacterial genomic DNA through a non-enzymatic nanomaterials based amplification method, the bio-barcode assay, is reported. The assay utilizes oligonucleotide functionalized magnetic microparticles to capture the target of interest from the sample. A critical step in the new assay involves the use of blocking oligonucleotides during heat denaturation of the double stranded DNA. These blockers bind to specific regions of the target DNA upon cooling, and prevent the duplex DNA from re-hybridizing, which allows the particle probes to bind. Following target isolation using the magnetic particles, oligonucleotide functionalized gold nanoparticles act as target recognition agents. The oligonucleotides on the nanoparticle (barcodes) act as amplification surrogates. The barcodes are then detected using the Scanometric method. The limit of detection for this assay was determined to be 2.5 femtomolar, and this is the first demonstration of a barcode type assay for the detection of double stranded, genomic DNA. PMID:17927207

  1. Secondary binding sites for heavily modified triplex forming oligonucleotides

    PubMed Central

    Cardew, Antonia S.; Brown, Tom; Fox, Keith R.

    2012-01-01

    In order to enhance DNA triple helix stability synthetic oligonucleotides have been developed that bear amino groups on the sugar or base. One of the most effective of these is bis-amino-U (B), which possesses 5-propargylamino and 2′-aminoethoxy modifications. Inclusion of this modified nucleotide not only greatly enhances triplex stability, but also increases the affinity for related sequences. We have used a restriction enzyme protection, selection and amplification assay (REPSA) to isolate sequences that are bound by the heavily modified 9-mer triplex-forming oligonucleotide B6CBT. The isolated sequences contain An tracts (n = 6), suggesting that the 5′-end of this TFO was responsible for successful triplex formation. DNase I footprinting with these sequences confirmed triple helix formation at these secondary targets and demonstrated no interaction with similar oligonucleotides containing T or 5-propargylamino-dU. PMID:22180535

  2. Determination of Minimum Training Sample Size for Microarray-Based Cancer Outcome Prediction–An Empirical Assessment

    PubMed Central

    Cheng, Ningtao; Wu, Leihong; Cheng, Yiyu

    2013-01-01

    The promise of microarray technology in providing prediction classifiers for cancer outcome estimation has been confirmed by a number of demonstrable successes. However, the reliability of prediction results relies heavily on the accuracy of statistical parameters involved in classifiers. It cannot be reliably estimated with only a small number of training samples. Therefore, it is of vital importance to determine the minimum number of training samples and to ensure the clinical value of microarrays in cancer outcome prediction. We evaluated the impact of training sample size on model performance extensively based on 3 large-scale cancer microarray datasets provided by the second phase of MicroArray Quality Control project (MAQC-II). An SSNR-based (scale of signal-to-noise ratio) protocol was proposed in this study for minimum training sample size determination. External validation results based on another 3 cancer datasets confirmed that the SSNR-based approach could not only determine the minimum number of training samples efficiently, but also provide a valuable strategy for estimating the underlying performance of classifiers in advance. Once translated into clinical routine applications, the SSNR-based protocol would provide great convenience in microarray-based cancer outcome prediction in improving classifier reliability. PMID:23861920

  3. Self-replication of chemical systems based on recognition within a double or a triple helix - A realistic hypothesis

    NASA Technical Reports Server (NTRS)

    Kanavarioti, Anastassia

    1992-01-01

    A scenario is proposed for the non-enzymatic self-replication of short RNA molecules. The self-replication of an oligopyrimidine strand is considered and the process of template-directed synthesis based on recognition within a double helix is discussed. Replication mechanisms are suggested for selected oligonucleotides. The mechanisms are based on Watson-Crick base pairing between complementary nucleotides as well as Hoogsteen base pairing between a duplex and the complementary third strand. It is suggested that self-replication based on these mechanisms may be accomplished but may result in a substantial amount of misinformation transfer when mixed oligonucleotides are used.

  4. mRNA-Based Parallel Detection of Active Methanotroph Populations by Use of a Diagnostic Microarray

    PubMed Central

    Bodrossy, Levente; Stralis-Pavese, Nancy; Konrad-Köszler, Marianne; Weilharter, Alexandra; Reichenauer, Thomas G.; Schöfer, David; Sessitsch, Angela

    2006-01-01

    A method was developed for the mRNA-based application of microbial diagnostic microarrays to detect active microbial populations. DNA- and mRNA-based analyses of environmental samples were compared and confirmed via quantitative PCR. Results indicated that mRNA-based microarray analyses may provide additional information on the composition and functioning of microbial communities. PMID:16461725

  5. [Ru(phen)2DPPZ]2+ is in contact with DNA bases when it forms a luminescent complex with single-stranded oligonucleotides.

    PubMed

    Moon, Seok Joon; Kim, Jong Moon; Choi, Ji Youn; Kim, Seog K; Lee, Je Seung; Jang, Ho G

    2005-05-01

    The luminescence intensity of the Delta- and Lambda-enantiomer of [Ru(phen)2DPPZ]2+ ([Ru(phenanthroline)2 dipyrido[3,2-a:2',3'-c]phenazine]2+) complex enhanced upon binding to double stranded DNA, which has been known as "light switch effect". The enhancement of the luminescence required the intercalation of the large ligand between DNA base pairs. In this study, we report the enhancement in the luminescence intensity when the metal complexes bind to single stranded oligonucleotides, indicating that the "light switch effect" does not require intercalation of the large DPPZ ligand. Oligonucleotides may provide a hydrophobic cavity for the [Ru(phen)2DPPZ]2+ complex to prevent the quenching by the water molecule. In the cavity, the metal complex is in contact with DNA bases as is evidenced by the observation that the excited energy of the DNA bases transfer to the bound metal complex. However, the contact of the metal complex with DNA bases is different from the stacking of DPPZ in the intercalation pocket. In addition to the normal two luminescence lifetimes, a short lifetime in the range of 1-2 ns was found for both the delta- and lambda-enantiomer of [Ru(phen)2DPPZ]2+ when complexed with single stranded oligonucleotides, which may be assigned to the metal complex that is outside of the cavity, interacting with phosphate groups of DNA.

  6. Spherical Nucleic Acids as Intracellular Agents for Nucleic Acid Based Therapeutics

    NASA Astrophysics Data System (ADS)

    Hao, Liangliang

    Recent functional discoveries on the noncoding sequences of human genome and transcriptome could lead to revolutionary treatment modalities because the noncoding RNAs (ncRNAs) can be applied as therapeutic agents to manipulate disease-causing genes. To date few nucleic acid-based therapeutics have been translated into the clinic due to challenges in the delivery of the oligonucleotide agents in an effective, cell specific, and non-toxic fashion. Unmodified oligonucleotide agents are destroyed rapidly in biological fluids by enzymatic degradation and have difficulty crossing the plasma membrane without the aid of transfection reagents, which often cause inflammatory, cytotoxic, or immunogenic side effects. Spherical nucleic acids (SNAs), nanoparticles consisting of densely organized and highly oriented oligonucleotides, pose one possible solution to circumventing these problems in both the antisense and RNA interference (RNAi) pathways. The unique three dimensional architecture of SNAs protects the bioactive oligonucleotides from unspecific degradation during delivery and supports their targeting of class A scavenger receptors and endocytosis via a lipid-raft-dependent, caveolae-mediated pathway. Owing to their unique structure, SNAs are able to cross cell membranes and regulate target genes expression as a single entity, without triggering the cellular innate immune response. Herein, my thesis has focused on understanding the interactions between SNAs and cellular components and developing SNA-based nanostructures to improve therapeutic capabilities. Specifically, I developed a novel SNA-based, nanoscale agent for delivery of therapeutic oligonucleotides to manipulate microRNAs (miRNAs), the endogenous post-transcriptional gene regulators. I investigated the role of SNAs involving miRNAs in anti-cancer or anti-inflammation responses in cells and in in vivo murine disease models via systemic injection. Furthermore, I explored using different strategies to construct novel SNA-based nanomaterials with desired properties and applying targeting moieties to the SNA platform to achieve cell type specific gene regulation effects. Due to the flexibility of the SNA approach, the SNA platform can potentially be applied to many genetic disorders through tailored target specificities.

  7. Preparation of genosensor for detection of specific DNA sequence of the hepatitis B virus

    NASA Astrophysics Data System (ADS)

    Honorato Castro, Ana C.; França, Erick G.; de Paula, Lucas F.; Soares, Marcia M. C. N.; Goulart, Luiz R.; Madurro, João M.; Brito-Madurro, Ana G.

    2014-09-01

    An electrochemical genosensor was constructed for detection of specific DNA sequence of the hepatitis B virus, based on graphite electrodes modified with poly(4-aminophenol) and incorporating a specific oligonucleotide probe. The modified electrode containing the probe was evaluated by differential pulse voltammetry, before and after incubation with the complementary oligonucleotide target. Detection was performed by monitoring oxidizable DNA bases (direct detection) or using ethidium bromide as indicator of the hybridization process (indirect detection). The device showed a detection limit for the oligonucleotide target of 2.61 nmol L-1. Indirect detection using ethidium bromide was promising in discriminating mismatches, which is a very desirable attribute for detection of disease-related point mutations. In addition, it was possible to observe differences between hybridized and non-hybridized surfaces by atomic force microscopy.

  8. Analysis of microarray leukemia data using an efficient MapReduce-based K-nearest-neighbor classifier.

    PubMed

    Kumar, Mukesh; Rath, Nitish Kumar; Rath, Santanu Kumar

    2016-04-01

    Microarray-based gene expression profiling has emerged as an efficient technique for classification, prognosis, diagnosis, and treatment of cancer. Frequent changes in the behavior of this disease generates an enormous volume of data. Microarray data satisfies both the veracity and velocity properties of big data, as it keeps changing with time. Therefore, the analysis of microarray datasets in a small amount of time is essential. They often contain a large amount of expression, but only a fraction of it comprises genes that are significantly expressed. The precise identification of genes of interest that are responsible for causing cancer are imperative in microarray data analysis. Most existing schemes employ a two-phase process such as feature selection/extraction followed by classification. In this paper, various statistical methods (tests) based on MapReduce are proposed for selecting relevant features. After feature selection, a MapReduce-based K-nearest neighbor (mrKNN) classifier is also employed to classify microarray data. These algorithms are successfully implemented in a Hadoop framework. A comparative analysis is done on these MapReduce-based models using microarray datasets of various dimensions. From the obtained results, it is observed that these models consume much less execution time than conventional models in processing big data. Copyright © 2016 Elsevier Inc. All rights reserved.

  9. THE ABRF MARG MICROARRAY SURVEY 2005: TAKING THE PULSE ON THE MICROARRAY FIELD

    EPA Science Inventory

    Over the past several years microarray technology has evolved into a critical component of any discovery based program. Since 1999, the Association of Biomolecular Resource Facilities (ABRF) Microarray Research Group (MARG) has conducted biennial surveys designed to generate a pr...

  10. Synthesis and fluorescence studies of multiple labeled oligonucleotides containing dansyl fluorophore covalently attached at 2'-terminus of cytidine via carbamate linkage.

    PubMed

    Misra, Arvind; Mishra, Satyendra; Misra, Krishna

    2004-01-01

    Synthesis of modified oligonucleotides in which the specific cytidine nucleoside analogues linked at 2'-OH position via a carbamate bond with an amino ethyl derivative of dansyl fluorophore is reported. For the multiple labeling of oligonucleotides, a strategy involving prelabeling at the monomeric level followed by solid phase assembly of oligonucleotides to obtain regiospecifically labeled probes has been described. The labeled monomer was phosphitylated using 2-cyanoethyl-N,N,N',N'-tetraisopropyl-phosphoramidite (Bis-reagent) and pyridiniumtrifluoro acetate (Py.TFA) as an activator. To ascertain the minimal number of labeled monomers required for a specific length of oligonucleotide for detection and also to assess the effect of carbamate linkage on hybridization, hexamer and 20-mer sequences were selected. Both were labeled with 1, 2, and 3 monomers at the 5'-end and hybridized with normal (unmodified) complementary sequences. As compared to midsequence or 3'-terminal labeling reported earlier, the 5'-terminal labeling has been found to have minimal contact-mediated quenching on duplex formation. This may be due to complementary deoxyguanosine (dG) rich oligonucleotide sequences or CG base pairs at a terminus that is known to yield stronger binding. This is one reason for selecting cytidine for labeling. The results may aid rational design of multiple fluorescent DNA probes for nonradioactive detection of nucleic acids.

  11. A High-throughput Assay for mRNA Silencing in Primary Cortical Neurons in vitro with Oligonucleotide Therapeutics.

    PubMed

    Alterman, Julia F; Coles, Andrew H; Hall, Lauren M; Aronin, Neil; Khvorova, Anastasia; Didiot, Marie-Cécile

    2017-08-20

    Primary neurons represent an ideal cellular system for the identification of therapeutic oligonucleotides for the treatment of neurodegenerative diseases. However, due to the sensitive nature of primary cells, the transfection of small interfering RNAs (siRNA) using classical methods is laborious and often shows low efficiency. Recent progress in oligonucleotide chemistry has enabled the development of stabilized and hydrophobically modified small interfering RNAs (hsiRNAs). This new class of oligonucleotide therapeutics shows extremely efficient self-delivery properties and supports potent and durable effects in vitro and in vivo . We have developed a high-throughput in vitro assay to identify and test hsiRNAs in primary neuronal cultures. To simply, rapidly, and accurately quantify the mRNA silencing of hundreds of hsiRNAs, we use the QuantiGene 2.0 quantitative gene expression assay. This high-throughput, 96-well plate-based assay can quantify mRNA levels directly from sample lysate. Here, we describe a method to prepare short-term cultures of mouse primary cortical neurons in a 96-well plate format for high-throughput testing of oligonucleotide therapeutics. This method supports the testing of hsiRNA libraries and the identification of potential therapeutics within just two weeks. We detail methodologies of our high throughput assay workflow from primary neuron preparation to data analysis. This method can help identify oligonucleotide therapeutics for treatment of various neurological diseases.

  12. Structures of bacterial polynucleotide kinase in a Michaelis complex with GTP•Mg2+ and 5'-OH oligonucleotide and a product complex with GDP•Mg2+ and 5'-PO4 oligonucleotide reveal a mechanism of general acid-base catalysis and the determinants of phosphoacceptor recognition.

    PubMed

    Das, Ushati; Wang, Li Kai; Smith, Paul; Jacewicz, Agata; Shuman, Stewart

    2014-01-01

    Clostridium thermocellum polynucleotide kinase (CthPnk), the 5' end-healing module of a bacterial RNA repair system, catalyzes reversible phosphoryl transfer from an NTP donor to a 5'-OH polynucleotide acceptor. Here we report the crystal structures of CthPnk-D38N in a Michaelis complex with GTP•Mg(2+) and a 5'-OH oligonucleotide and a product complex with GDP•Mg(2+) and a 5'-PO4 oligonucleotide. The O5' nucleophile is situated 3.0 Å from the GTP γ phosphorus in the Michaelis complex, where it is coordinated by Asn38 and is apical to the bridging β phosphate oxygen of the GDP leaving group. In the product complex, the transferred phosphate has undergone stereochemical inversion and Asn38 coordinates the 5'-bridging phosphate oxygen of the oligonucleotide. The D38N enzyme is poised for catalysis, but cannot execute because it lacks Asp38-hereby implicated as the essential general base catalyst that abstracts a proton from the 5'-OH during the kinase reaction. Asp38 serves as a general acid catalyst during the 'reverse kinase' reaction by donating a proton to the O5' leaving group of the 5'-PO4 strand. The acceptor strand binding mode of CthPnk is distinct from that of bacteriophage T4 Pnk.

  13. A Java-based tool for the design of classification microarrays.

    PubMed

    Meng, Da; Broschat, Shira L; Call, Douglas R

    2008-08-04

    Classification microarrays are used for purposes such as identifying strains of bacteria and determining genetic relationships to understand the epidemiology of an infectious disease. For these cases, mixed microarrays, which are composed of DNA from more than one organism, are more effective than conventional microarrays composed of DNA from a single organism. Selection of probes is a key factor in designing successful mixed microarrays because redundant sequences are inefficient and limited representation of diversity can restrict application of the microarray. We have developed a Java-based software tool, called PLASMID, for use in selecting the minimum set of probe sequences needed to classify different groups of plasmids or bacteria. The software program was successfully applied to several different sets of data. The utility of PLASMID was illustrated using existing mixed-plasmid microarray data as well as data from a virtual mixed-genome microarray constructed from different strains of Streptococcus. Moreover, use of data from expression microarray experiments demonstrated the generality of PLASMID. In this paper we describe a new software tool for selecting a set of probes for a classification microarray. While the tool was developed for the design of mixed microarrays-and mixed-plasmid microarrays in particular-it can also be used to design expression arrays. The user can choose from several clustering methods (including hierarchical, non-hierarchical, and a model-based genetic algorithm), several probe ranking methods, and several different display methods. A novel approach is used for probe redundancy reduction, and probe selection is accomplished via stepwise discriminant analysis. Data can be entered in different formats (including Excel and comma-delimited text), and dendrogram, heat map, and scatter plot images can be saved in several different formats (including jpeg and tiff). Weights generated using stepwise discriminant analysis can be stored for analysis of subsequent experimental data. Additionally, PLASMID can be used to construct virtual microarrays with genomes from public databases, which can then be used to identify an optimal set of probes.

  14. Codon usage bias and tRNA over-expression in Buchnera aphidicola after aromatic amino acid nutritional stress on its host Acyrthosiphon pisum

    PubMed Central

    Charles, Hubert; Calevro, Federica; Vinuelas, José; Fayard, Jean-Michel; Rahbe, Yvan

    2006-01-01

    Codon usage bias and relative abundances of tRNA isoacceptors were analysed in the obligate intracellular symbiotic bacterium, Buchnera aphidicola from the aphid Acyrthosiphon pisum, using a dedicated 35mer oligonucleotide microarray. Buchnera is archetypal of organisms living with minimal metabolic requirements and presents a reduced genome with high-evolutionary rate. Codonusage in Buchnera has been overcome by the high mutational bias towards AT bases. However, several lines of evidence for codon usage selection are given here. A significant correlation was found between tRNA relative abundances and codon composition of Buchnera genes. A significant codon usage bias was found for the choice of rare codons in Buchnera: C-ending codons are preferred in highly expressed genes, whereas G-ending codons are avoided. This bias is not explained by GC skew in the bacteria and might correspond to a selection for perfect matching between codon–anticodon pairs for some essential amino acids in Buchnera proteins. Nutritional stress applied to the aphid host induced a significant overexpression of most of the tRNA isoacceptors in bacteria. Although, molecular regulation of the tRNA operons in Buchnera was not investigated, a correlation between relative expression levels and organization in transcription unit was found in the genome of Buchnera. PMID:16963497

  15. Region-specific changes in gene expression in rat brain after chronic treatment with levetiracetam or phenytoin

    PubMed Central

    Hassel, Bjørnar; Taubøll, Erik; Shaw, Renee; Gjerstad, Leif; Dingledine, Ray

    2014-01-01

    Summary Purpose It is commonly assumed that antiepileptic drugs (AEDs) act similarly in the various parts of the brain as long as their molecular targets are present. A few experimental studies on metabolic effects of vigabatrin, levetiracetam, valproate, and lamotrigine have shown that these drugs may act differently in different brain regions. We examined effects of chronic treatment with levetiracetam or phenytoin on mRNA levels to detect regional drug effects in a broad, nonbiased manner. Methods mRNA levels were monitored in three brain regions with oligonucleotide-based microarrays. Results Levetiracetam (150 mg/kg for 90 days) changed the expression of 65 genes in pons/medulla oblongata, two in hippocampus, and one in frontal cortex. Phenytoin (75 mg/kg), in contrast, changed the expression of only three genes in pons/medulla oblongata, but 64 genes in hippocampus, and 327 genes in frontal cortex. Very little overlap between regions or drug treatments was observed with respect to effects on gene expression. Discussion We conclude that chronic treatment with levetiracetam or phenytoin causes region-specific and highly differential effects on gene expression in the brain. Regional effects on gene expression could reflect regional differences in molecular targets of AEDs, and they could influence the clinical profiles of AEDs. PMID:20345932

  16. Codon usage bias and tRNA over-expression in Buchnera aphidicola after aromatic amino acid nutritional stress on its host Acyrthosiphon pisum.

    PubMed

    Charles, Hubert; Calevro, Federica; Vinuelas, José; Fayard, Jean-Michel; Rahbe, Yvan

    2006-01-01

    Codon usage bias and relative abundances of tRNA isoacceptors were analysed in the obligate intracellular symbiotic bacterium, Buchnera aphidicola from the aphid Acyrthosiphon pisum, using a dedicated 35mer oligonucleotide microarray. Buchnera is archetypal of organisms living with minimal metabolic requirements and presents a reduced genome with high-evolutionary rate. Codonusage in Buchnera has been overcome by the high mutational bias towards AT bases. However, several lines of evidence for codon usage selection are given here. A significant correlation was found between tRNA relative abundances and codon composition of Buchnera genes. A significant codon usage bias was found for the choice of rare codons in Buchnera: C-ending codons are preferred in highly expressed genes, whereas G-ending codons are avoided. This bias is not explained by GC skew in the bacteria and might correspond to a selection for perfect matching between codon-anticodon pairs for some essential amino acids in Buchnera proteins. Nutritional stress applied to the aphid host induced a significant overexpression of most of the tRNA isoacceptors in bacteria. Although, molecular regulation of the tRNA operons in Buchnera was not investigated, a correlation between relative expression levels and organization in transcription unit was found in the genome of Buchnera.

  17. Humic Acid-Oxidizing, Nitrate-Reducing Bacteria in Agricultural Soils

    PubMed Central

    Van Trump, J. Ian; Wrighton, Kelly C.; Thrash, J. Cameron; Weber, Karrie A.; Andersen, Gary L.; Coates, John D.

    2011-01-01

    ABSTRACT This study demonstrates the prevalence, phylogenetic diversity, and physiology of nitrate-reducing microorganisms capable of utilizing reduced humic acids (HA) as electron donors in agricultural soils. Most probable number (MPN) enumeration of agricultural soils revealed large populations (104 to 106 cells g−1 soil) of microorganisms capable of reducing nitrate while oxidizing the reduced HA analog 2,6-anthrahydroquinone disulfonate (AH2DS) to its corresponding quinone. Nitrate-dependent HA-oxidizing organisms isolated from agricultural soils were phylogenetically diverse and included members of the Alphaproteobacteria, Betaproteobacteria, and Gammaproteobacteria. Advective up-flow columns inoculated with corn plot soil and amended with reduced HA and nitrate supported both HA oxidation and enhanced nitrate reduction relative to no-donor or oxidized HA controls. The additional electron donating capacity of reduced HA could reasonably be attributed to the oxidation of reduced functional groups. Subsequent 16S rRNA gene-based high-density oligonucleotide microarray (PhyloChip) indicated that reduced HA columns supported the development of a bacterial community enriched with members of the Acidobacteria, Firmicutes, and Betaproteobacteria relative to the no-donor control and initial inoculum. This study identifies a previously unrecognized role for HA in stimulating denitrification processes in saturated soil systems. Furthermore, this study indicates that reduced humic acids impact soil geochemistry and the indigenous bacterial community composition. PMID:21750120

  18. Revisiting adverse effects of cross-hybridization in Affymetrix gene expression data: do they matter for correlation analysis?

    PubMed

    Klebanov, Lev; Chen, Linlin; Yakovlev, Andrei

    2007-11-07

    This work was undertaken in response to a recently published paper by Okoniewski and Miller (BMC Bioinformatics 2006, 7: Article 276). The authors of that paper came to the conclusion that the process of multiple targeting in short oligonucleotide microarrays induces spurious correlations and this effect may deteriorate the inference on correlation coefficients. The design of their study and supporting simulations cast serious doubt upon the validity of this conclusion. The work by Okoniewski and Miller drove us to revisit the issue by means of experimentation with biological data and probabilistic modeling of cross-hybridization effects. We have identified two serious flaws in the study by Okoniewski and Miller: (1) The data used in their paper are not amenable to correlation analysis; (2) The proposed simulation model is inadequate for studying the effects of cross-hybridization. Using two other data sets, we have shown that removing multiply targeted probe sets does not lead to a shift in the histogram of sample correlation coefficients towards smaller values. A more realistic approach to mathematical modeling of cross-hybridization demonstrates that this process is by far more complex than the simplistic model considered by the authors. A diversity of correlation effects (such as the induction of positive or negative correlations) caused by cross-hybridization can be expected in theory but there are natural limitations on the ability to provide quantitative insights into such effects due to the fact that they are not directly observable. The proposed stochastic model is instrumental in studying general regularities in hybridization interaction between probe sets in microarray data. As the problem stands now, there is no compelling reason to believe that multiple targeting causes a large-scale effect on the correlation structure of Affymetrix gene expression data. Our analysis suggests that the observed long-range correlations in microarray data are of a biological nature rather than a technological flaw.

  19. Seasonal Changes in Bacterial and Archaeal Gene Expression Patterns across Salinity Gradients in the Columbia River Coastal Margin

    PubMed Central

    Smith, Maria W.; Herfort, Lydie; Tyrol, Kaitlin; Suciu, Dominic; Campbell, Victoria; Crump, Byron C.; Peterson, Tawnya D.; Zuber, Peter; Baptista, Antonio M.; Simon, Holly M.

    2010-01-01

    Through their metabolic activities, microbial populations mediate the impact of high gradient regions on ecological function and productivity of the highly dynamic Columbia River coastal margin (CRCM). A 2226-probe oligonucleotide DNA microarray was developed to investigate expression patterns for microbial genes involved in nitrogen and carbon metabolism in the CRCM. Initial experiments with the environmental microarrays were directed toward validation of the platform and yielded high reproducibility in multiple tests. Bioinformatic and experimental validation also indicated that >85% of the microarray probes were specific for their corresponding target genes and for a few homologs within the same microbial family. The validated probe set was used to query gene expression responses by microbial assemblages to environmental variability. Sixty-four samples from the river, estuary, plume, and adjacent ocean were collected in different seasons and analyzed to correlate the measured variability in chemical, physical and biological water parameters to differences in global gene expression profiles. The method produced robust seasonal profiles corresponding to pre-freshet spring (April) and late summer (August). Overall relative gene expression was high in both seasons and was consistent with high microbial abundance measured by total RNA, heterotrophic bacterial production, and chlorophyll a. Both seasonal patterns involved large numbers of genes that were highly expressed relative to background, yet each produced very different gene expression profiles. April patterns revealed high differential gene expression in the coastal margin samples (estuary, plume and adjacent ocean) relative to freshwater, while little differential gene expression was observed along the river-to-ocean transition in August. Microbial gene expression profiles appeared to relate, in part, to seasonal differences in nutrient availability and potential resource competition. Furthermore, our results suggest that highly-active particle-attached microbiota in the Columbia River water column may perform dissimilatory nitrate reduction (both dentrification and DNRA) within anoxic particle microniches. PMID:20967204

  20. Genomic resources for Myzus persicae: EST sequencing, SNP identification, and microarray design

    PubMed Central

    Ramsey, John S; Wilson, Alex CC; de Vos, Martin; Sun, Qi; Tamborindeguy, Cecilia; Winfield, Agnese; Malloch, Gaynor; Smith, Dawn M; Fenton, Brian; Gray, Stewart M; Jander, Georg

    2007-01-01

    Background The green peach aphid, Myzus persicae (Sulzer), is a world-wide insect pest capable of infesting more than 40 plant families, including many crop species. However, despite the significant damage inflicted by M. persicae in agricultural systems through direct feeding damage and by its ability to transmit plant viruses, limited genomic information is available for this species. Results Sequencing of 16 M. persicae cDNA libraries generated 26,669 expressed sequence tags (ESTs). Aphids for library construction were raised on Arabidopsis thaliana, Nicotiana benthamiana, Brassica oleracea, B. napus, and Physalis floridana (with and without Potato leafroll virus infection). The M. persicae cDNA libraries include ones made from sexual and asexual whole aphids, guts, heads, and salivary glands. In silico comparison of cDNA libraries identified aphid genes with tissue-specific expression patterns, and gene expression that is induced by feeding on Nicotiana benthamiana. Furthermore, 2423 genes that are novel to science and potentially aphid-specific were identified. Comparison of cDNA data from three aphid lineages identified single nucleotide polymorphisms that can be used as genetic markers and, in some cases, may represent functional differences in the protein products. In particular, non-conservative amino acid substitutions in a highly expressed gut protease may be of adaptive significance for M. persicae feeding on different host plants. The Agilent eArray platform was used to design an M. persicae oligonucleotide microarray representing over 10,000 unique genes. Conclusion New genomic resources have been developed for M. persicae, an agriculturally important insect pest. These include previously unknown sequence data, a collection of expressed genes, molecular markers, and a DNA microarray that can be used to study aphid gene expression. These resources will help elucidate the adaptations that allow M. persicae to develop compatible interactions with its host plants, complementing ongoing work illuminating plant molecular responses to phloem-feeding insects. PMID:18021414

  1. Functional Genomic Analysis of the Impact of Camelina (Camelina sativa) Meal on Atlantic Salmon (Salmo salar) Distal Intestine Gene Expression and Physiology.

    PubMed

    Brown, Tyler D; Hori, Tiago S; Xue, Xi; Ye, Chang Lin; Anderson, Derek M; Rise, Matthew L

    2016-06-01

    The inclusion of plant meals in diets of farmed Atlantic salmon can elicit inflammatory responses in the distal intestine (DI). For the present work, fish were fed a standard fish meal (FM) diet or a diet with partial replacement of FM with solvent-extracted camelina meal (CM) (8, 16, or 24 % CM inclusion) during a 16-week feeding trial. A significant decrease in growth performance was seen in fish fed all CM inclusion diets (Hixson et al. in Aquacult Nutr 22:615-630, 2016). A 4x44K oligonucleotide microarray experiment was carried out and significance analysis of microarrays (SAM) and rank products (RP) methods were used to identify differentially expressed genes between the DIs of fish fed the 24 % CM diet and those fed the FM diet. Twelve features representing six known transcripts and two unknowns were identified as CM responsive by both SAM and RP. The six known transcripts (including thioredoxin and ependymin), in addition to tgfb, mmp13, and GILT, were studied using qPCR with RNA templates from all four experimental diet groups. All six microarray-identified genes were confirmed to be CM responsive, as was tgfb and mmp13. Histopathological analyses identified signs of inflammation in the DI of salmon fed CM-containing diets, including lamina propria and sub-epithelial mucosa thickening, infiltration of eosinophilic granule cells, increased goblet cells and decreased enterocyte vacuolization. All of these were significantly altered in 24 % CM compared to all other diets, with the latter two also altered in 16 % CM compared with 8 % CM and control diet groups. Significant correlation was seen between histological parameters as well as between five of the qPCR analyzed genes and histological parameters. These molecular biomarkers of inflammation arising from long-term dietary CM exposure will be useful in the development of CM-containing diets that do not have deleterious effects on salmon growth or physiology.

  2. Comparison of small molecules and oligonucleotides that target a toxic, non-coding RNA.

    PubMed

    Costales, Matthew G; Rzuczek, Suzanne G; Disney, Matthew D

    2016-06-01

    Potential RNA targets for chemical probes and therapeutic modalities are pervasive in the transcriptome. Oligonucleotide-based therapeutics are commonly used to target RNA sequence. Small molecules are emerging as a modality to target RNA structures selectively, but their development is still in its infancy. In this work, we compare the activity of oligonucleotides and several classes of small molecules that target the non-coding r(CCUG) repeat expansion (r(CCUG)(exp)) that causes myotonic dystrophy type 2 (DM2), an incurable disease that is the second-most common cause of adult onset muscular dystrophy. Small molecule types investigated include monomers, dimers, and multivalent compounds synthesized on-site by using RNA-templated click chemistry. Oligonucleotides investigated include phosphorothioates that cleave their target and vivo-morpholinos that modulate target RNA activity via binding. We show that compounds assembled on-site that recognize structure have the highest potencies amongst small molecules and are similar in potency to a vivo-morpholino modified oligonucleotide that targets sequence. These studies are likely to impact the design of therapeutic modalities targeting other repeats expansions that cause fragile X syndrome and amyotrophic lateral sclerosis, for example. Copyright © 2016. Published by Elsevier Ltd.

  3. Chemical synthesis of oligonucleotides containing a free sulphydryl group and subsequent attachment of thiol specific probes.

    PubMed Central

    Connolly, B A; Rider, P

    1985-01-01

    Oligonucleotides containing a free sulphydryl group at their 5'-termini have been synthesised and further derivatised with thiol specific probes. The nucleotide sequence required is prepared using standard solid phase phosphoramidite techniques and an extra round of synthesis is then performed using the S-triphenylmethyl O-methoxymorpholinophosphite derivatives of 2-mercaptoethanol, 3-mercaptopropan (1) ol or 6-mercaptohexan (1) ol. After cleavage from the resin and removal of the phosphate and base protecting groups, this yields an oligonucleotide containing an S-triphenylmethyl group attached to the 5'-phosphate group via a two, three or six carbon chain. The triphenylmethyl group can be readily removed with silver nitrate to give the free thiol. With the three and six carbon chain oligonucleotides, this thiol can be used, at pH 8, for the attachment of thiol specific probes as illustrated by the reaction with fluorescent conjugates of iodoacetates and maleiimides. However, oligonucleotides containing a thiol attached to the 5'-phosphate group via a two carbon chain are unstable at pH 8 decomposing to the free 5'-phosphate and so are unsuitable for further derivatisation. PMID:4011448

  4. PNA-COMBO-FISH: From combinatorial probe design in silico to vitality compatible, specific labelling of gene targets in cell nuclei.

    PubMed

    Müller, Patrick; Rößler, Jens; Schwarz-Finsterle, Jutta; Schmitt, Eberhard; Hausmann, Michael

    2016-07-01

    Recently, advantages concerning targeting specificity of PCR constructed oligonucleotide FISH probes in contrast to established FISH probes, e.g. BAC clones, have been demonstrated. These techniques, however, are still using labelling protocols with DNA denaturing steps applying harsh heat treatment with or without further denaturing chemical agents. COMBO-FISH (COMBinatorial Oligonucleotide FISH) allows the design of specific oligonucleotide probe combinations in silico. Thus, being independent from primer libraries or PCR laboratory conditions, the probe sequences extracted by computer sequence data base search can also be synthesized as single stranded PNA-probes (Peptide Nucleic Acid probes) or TINA-DNA (Twisted Intercalating Nucleic Acids). Gene targets can be specifically labelled with at least about 20 probes obtaining visibly background free specimens. By using appropriately designed triplex forming oligonucleotides, the denaturing procedures can completely be omitted. These results reveal a significant step towards oligonucleotide-FISH maintaining the 3d-nanostructure and even the viability of the cell target. The method is demonstrated with the detection of Her2/neu and GRB7 genes, which are indicators in breast cancer diagnosis and therapy. Copyright © 2016. Published by Elsevier Inc.

  5. Correlating In Vitro Splice Switching Activity With Systemic In Vivo Delivery Using Novel ZEN-modified Oligonucleotides.

    PubMed

    Hammond, Suzan M; McClorey, Graham; Nordin, Joel Z; Godfrey, Caroline; Stenler, Sofia; Lennox, Kim A; Smith, C I Edvard; Jacobi, Ashley M; Varela, Miguel A; Lee, Yi; Behlke, Mark A; Wood, Matthew J A; Andaloussi, Samir E L

    2014-11-25

    Splice switching oligonucleotides (SSOs) induce alternative splicing of pre-mRNA and typically employ chemical modifications to increase nuclease resistance and binding affinity to target pre-mRNA. Here we describe a new SSO non-base modifier (a naphthyl-azo group, "ZEN™") to direct exon exclusion in mutant dystrophin pre-mRNA to generate functional dystrophin protein. The ZEN modifier is placed near the ends of a 2'-O-methyl (2'OMe) oligonucleotide, increasing melting temperature and potency over unmodified 2'OMe oligonucleotides. In cultured H2K cells, a ZEN-modified 2'OMe phosphorothioate (PS) oligonucleotide delivered by lipid transfection greatly enhanced dystrophin exon skipping over the same 2'OMePS SSO lacking ZEN. However, when tested using free gymnotic uptake in vitro and following systemic delivery in vivo in dystrophin deficient mdx mice, the same ZEN-modified SSO failed to enhance potency. Importantly, we show for the first time that in vivo activity of anionic SSOs is modelled in vitro only when using gymnotic delivery. ZEN is thus a novel modifier that enhances activity of SSOs in vitro but will require improved delivery methods before its in vivo clinical potential can be realized.

  6. Signaling Pathways Mediating the Induction of Apple Fruitlet Abscission1[C][W][OA

    PubMed Central

    Botton, Alessandro; Eccher, Giulia; Forcato, Claudio; Ferrarini, Alberto; Begheldo, Maura; Zermiani, Monica; Moscatello, Stefano; Battistelli, Alberto; Velasco, Riccardo; Ruperti, Benedetto; Ramina, Angelo

    2011-01-01

    Apple (Malus × domestica) represents an interesting model tree crop for studying fruit abscission. The physiological fruitlet drop occurring in this species can be easily magnified by using thinning chemicals, such as benzyladenine (BA), to obtain fruits with improved quality and marketability. Despite the economic importance of this process, the molecular determinants of apple fruitlet abscission are still unknown. In this research, BA was used to obtain fruitlet populations with different abscission potentials to be analyzed by means of a newly released 30K oligonucleotide microarray. RNAs were extracted from cortex and seed of apple fruitlets sampled over a 4-d time course, during which BA triggers fruit drop, and used for microarray hybridization. Transcriptomic profiles of persisting and abscising fruitlets were tested for statistical association with abscission potential, allowing us to identify molecular signatures strictly related to fruit destiny. A hypothetical model for apple fruitlet abscission was obtained by putting together available transcriptomic and metabolomic data. According to this model, BA treatment would establish a nutritional stress within the tree that is primarily perceived by the fruitlet cortex whose growth is blocked by resembling the ovary growth inhibition found in other species. In weaker fruits, this stress is soon visible also at the seed level, likely transduced via reactive oxygen species/sugar and hormones signaling cross talk, and followed by a block of embryogenesis and the consequent activation of the abscission zone. PMID:21037112

  7. Protective effect of bicyclol against bile duct ligation-induced hepatic fibrosis in rats.

    PubMed

    Zhen, Yong-Zhan; Li, Na-Ren; He, Hong-Wei; Zhao, Shuang-Shuang; Zhang, Guang-Ling; Hao, Xiao-Fang; Shao, Rong-Guang

    2015-06-21

    To evaluate the protective effect of bicyclol against bile duct ligation (BDL)-induced hepatic fibrosis in rats. Sprague-Dawley male rats underwent BDL and sham-operated animals were used as healthy controls. The BDL rats were divided into two groups which received sterilized PBS or bicyclol (100 mg/kg per day) orally for two consecutive weeks. Serum, urine and bile were collected for biochemical determinations. Liver tissues were collected for histological analysis and a whole genome oligonucleotide microarray assay. Reverse transcription-polymerase chain reaction and Western blotting were used to verify the expression of liver fibrosis-related genes. Treatment with bicyclol significantly reduced liver fibrosis and bile duct proliferation after BDL. The levels of alanine aminotransferase (127.7 ± 72.3 vs 230.4 ± 69.6, P < 0.05) and aspartate aminotransferase (696.8 ± 232.6 vs 1032.6 ± 165.8, P < 0.05) were also decreased by treatment with bicyclol in comparison to PBS. The expression changes of 45 fibrogenic genes and several fibrogenesis-related pathways were reversed by bicyclol in the microarray assay. Bicyclol significantly reduced liver mRNA and/or protein expression levels of collagen 1a1, matrix metalloproteinase 2, tumor necrosis factor, tissue inhibitors of metalloproteinases 2, transforming growth factor-β1 and α-smooth muscle actin. Bicyclol significantly attenuates BDL-induced liver fibrosis by reversing fibrogenic gene expression. These findings suggest that bicyclol might be an effective anti-fibrotic drug for the treatment of cholestatic liver disease.

  8. Alteration of Gene Expression Profile in Kidney of Spontaneously Hypertensive Rats Treated with Protein Hydrolysate of Blue Mussel (Mytilus edulis) by DNA Microarray Analysis

    PubMed Central

    Feng, Junli; Dai, Zhiyuan; Zhang, Yanping; Meng, Lu; Ye, Jian; Ma, Xuting

    2015-01-01

    Marine organisms are rich sources of bioactive components, which are often reported to have antihypertensive effects. However, the underlying mechanisms have yet to be fully identified. The aim of this study was to investigate the antihypertensive effect of enzymatic hydrolysis of blue mussel protein (HBMP) in rats. Peptides with in vitro ACE inhibitory activity were purified from HBMP by ultrafiltration, gel filtration chromatography and reversed-phase high performance liquid chromatography. And the amino acid sequences of isolated peptides were estimated to be Val-Trp, Leu-Gly-Trp, and Met-Val-Trp-Thr. To study its in vivo action, spontaneously hypertensive rats (SHRs) were orally administration with high- or low-dose of HBMP for 28 days. Major components of the renin-angiotensin (RAS) system in serum of SHRs from different groups were analyzed, and gene expression profiling were performed in the kidney of SHRs, using the Whole Rat Genome Oligonucleotide Microarray. Results indicated although genes involved in RAS system were not significantly altered, those related to blood coagulation system, cytokine and growth factor, and fatty acids metabolism were remarkablely changed. Several genes which were seldom reported to be implicated in pathogenesis of hypertension also showed significant expression alterations after oral administration of HBMP. These data provided valuable information for our understanding of the molecular mechanisms that underlie the potential antihypertensive activities of HBMP, and will contribute towards increased value-added utilization of blue mussel protein. PMID:26517713

  9. Transcriptional profiling of Epstein–Barr virus (EBV) genes and host cellular genes in nasal NK/T-cell lymphoma and chronic active EBV infection

    PubMed Central

    Zhang, Y; Ohyashiki, J H; Takaku, T; Shimizu, N; Ohyashiki, K

    2006-01-01

    Nasal NK/T-cell lymphoma is an aggressive subtype of non-Hodgkin lymphoma (NHL) that is closely associated with Epstein–Barr virus (EBV). The clonal expansion of EBV-infected NK or T cells is also seen in patients with chronic active EBV (CAEBV) infection, suggesting that two diseases might share a partially similar mechanism by which EBV affects host cellular gene expression. To understand the pathogenesis of EBV-associated NK/T-cell lymphoproliferative disorders (LPD) and design new therapies, we employed a novel EBV DNA microarray to compare patterns of EBV expression in six cell lines established from EBV-associated NK/T-cell LPD. We found that expression of BZLF1, which encodes the immediate-early gene product Zta, was expressed in SNK/T cells and the expression levels were preferentially high in cell lines from CAEBV infection. We also analyzsd the gene expression patterns of host cellular genes using a human oligonucleotide DNA microarray. We identified a subset of pathogenically and clinically relevant host cellular genes, including TNFRSF10D, CDK2, HSPCA, IL12A as a common molecular biological properties of EBV-associated NK/T-cell LPD and a subset of genes, such as PDCD4 as a putative contributor for disease progression. This study describes a novel approach from the aspects of viral and host gene expression, which could identify novel therapeutic targets in EBV-associated NK/T-cell LPD. PMID:16449999

  10. Francisella tularensis alters human neutrophil gene expression: insights into the molecular basis of delayed neutrophil apoptosis

    PubMed Central

    Schwartz, Justin T.; Bandyopadhyay, Sarmistha; Kobayashi, Scott D.; McCracken, Jenna; Whitney, Adeline R.; DeLeo, Frank R.; Allen, Lee-Ann H.

    2013-01-01

    We demonstrated recently that Francisella tularensis profoundly impairs human neutrophil apoptosis, but how this is achieved is largely unknown. Herein we used human oligonucleotide microarrays to test the hypothesis that changes in neutrophil gene expression contribute to this phenotype, and now demonstrate that F. tularensis live vaccine strain (LVS) caused significant changes in neutrophil gene expression over a 24 h time period relative to the uninfected controls. Of ~47,000 genes analyzed, 3,435 were significantly up- or down-regulated by LVS, including 365 unique genes associated with apoptosis and cell survival. Specific targets in this category included genes associated with the intrinsic and extrinsic apoptotic pathways (CFLAR, TNFAIP3, TNFRSF10D, SOD2, BCL2A1, BIRC4, PIM2, TNFSF10, TNFRSF10C, CASP2, and CASP8) and genes that act via the NF B pathway and other mechanisms to prolong cell viability (NFKB1, NFKB2, and RELA, IL1B, CAST, CDK2, GADD45B, BCL3, BIRC3, CDK2, IL1A, PBEF1, IL6, CXCL1, CCL4 and VEGF). The microarray data were confirmed by qPCR and pathway analysis. Moreover, we demonstrate that X-linked inhibitor of apoptosis (XIAP) protein remained abundant in PMNs over 48 h of LVS infection, whereas BAX mRNA and protein were progressively down-regulated. These data strongly suggest that antiapoptotic and pro-survival mechanisms collaborate to sustain the viability of F. tularensis infected neutrophils. PMID:22986450

  11. Oligonucleotide Microarray Analysis of Dietary-Induced Hyperlipidemia Gene Expression Profiles in Miniature Pigs

    PubMed Central

    Takahashi, Junko; Waki, Shiori; Matsumoto, Rena; Odake, Junji; Miyaji, Takayuki; Tottori, Junichi; Iwanaga, Takehiro; Iwahashi, Hitoshi

    2012-01-01

    Background Hyperlipidemia animal models have been established, but complete gene expression profiles of the transition from normal lipid levels have not been obtained. Miniature pigs are useful model animals for gene expression studies on dietary-induced hyperlipidemia because they have a similar anatomy and digestive physiology to humans, and blood samples can be obtained from them repeatedly. Methodology Two typical dietary treatments were used for dietary-induced hyperlipidemia models, by using specific pathogen-free (SPF) Clawn miniature pigs. One was a high-fat and high-cholesterol diet (HFCD) and the other was a high-fat, high-cholesterol, and high-sucrose diet (HFCSD). Microarray analyses were conducted from whole blood samples during the dietary period and from white blood cells at the end of the dietary period to evaluate the transition of expression profiles of the two dietary models. Principal Findings Variations in whole blood gene expression intensity within the HFCD or the HFCSD group were in the same range as the controls provide with normal diet at all periods. This indicates uniformity of dietary-induced hyperlipidemia for our dietary protocols. Gene ontology- (GO) based functional analyses revealed that characteristics of the common changes between HFCD and HFCSD were involved in inflammatory responses and reproduction. The correlation coefficient between whole blood and white blood cell expression profiles at 27 weeks with the HFCSD diet was significantly lower than that of the control and HFCD diet groups. This may be due to the effects of RNA originating from the tissues and/or organs. Conclusions No statistically significant differences in fasting plasma lipids and glucose levels between the HFCD and HFCSD groups were observed. However, blood RNA analyses revealed different characteristics corresponding to the dietary protocols. In this study, whole blood RNA analyses proved to be a useful tool to evaluate transitions in dietary-induced hyperlipidemia gene expression profiles in miniature pigs. PMID:22662175

  12. Cell cloning-based transcriptome analysis in Rett patients: relevance to the pathogenesis of Rett syndrome of new human MeCP2 target genes.

    PubMed

    Nectoux, J; Fichou, Y; Rosas-Vargas, H; Cagnard, N; Bahi-Buisson, N; Nusbaum, P; Letourneur, F; Chelly, J; Bienvenu, T

    2010-07-01

    More than 90% of Rett syndrome (RTT) patients have heterozygous mutations in the X-linked methyl-CpG binding protein 2 (MECP2) gene that encodes the methyl-CpG-binding protein 2, a transcriptional modulator. Because MECP2 is subjected to X chromosome inactivation (XCI), girls with RTT either express the wild-type or mutant allele in each individual cell. To test the consequences of MECP2 mutations resulting from a genome-wide transcriptional dysregulation and to identify its target genes in a system that circumvents the functional mosaicism resulting from XCI, we carried out gene expression profiling of clonal populations derived from fibroblast primary cultures expressing exclusively either the wild-type or the mutant MECP2 allele. Clonal cultures were obtained from skin biopsy of three RTT patients carrying either a non-sense or a frameshift MECP2 mutation. For each patient, gene expression profiles of wild-type and mutant clones were compared by oligonucleotide expression microarray analysis. Firstly, clustering analysis classified the RTT patients according to their genetic background and MECP2 mutation. Secondly, expression profiling by microarray analysis and quantitative RT-PCR indicated four up-regulated genes and five down-regulated genes significantly dysregulated in all our statistical analysis, including excellent potential candidate genes for the understanding of the pathophysiology of this neurodevelopmental disease. Thirdly, chromatin immunoprecipitation analysis confirmed MeCP2 binding to respective CpG islands in three out of four up-regulated candidate genes and sequencing of bisulphite-converted DNA indicated that MeCP2 preferentially binds to methylated-DNA sequences. Most importantly, the finding that at least two of these genes (BMCC1 and RNF182) were shown to be involved in cell survival and/or apoptosis may suggest that impaired MeCP2 function could alter the survival of neurons thus compromising brain function without inducing cell death.

  13. Discovery and mapping of single feature polymorphisms in wheat using Affymetrix arrays

    PubMed Central

    Bernardo, Amy N; Bradbury, Peter J; Ma, Hongxiang; Hu, Shengwa; Bowden, Robert L; Buckler, Edward S; Bai, Guihua

    2009-01-01

    Background Wheat (Triticum aestivum L.) is a staple food crop worldwide. The wheat genome has not yet been sequenced due to its huge genome size (~17,000 Mb) and high levels of repetitive sequences; the whole genome sequence may not be expected in the near future. Available linkage maps have low marker density due to limitation in available markers; therefore new technologies that detect genome-wide polymorphisms are still needed to discover a large number of new markers for construction of high-resolution maps. A high-resolution map is a critical tool for gene isolation, molecular breeding and genomic research. Single feature polymorphism (SFP) is a new microarray-based type of marker that is detected by hybridization of DNA or cRNA to oligonucleotide probes. This study was conducted to explore the feasibility of using the Affymetrix GeneChip to discover and map SFPs in the large hexaploid wheat genome. Results Six wheat varieties of diverse origins (Ning 7840, Clark, Jagger, Encruzilhada, Chinese Spring, and Opata 85) were analyzed for significant probe by variety interactions and 396 probe sets with SFPs were identified. A subset of 164 unigenes was sequenced and 54% showed polymorphism within probes. Microarray analysis of 71 recombinant inbred lines from the cross Ning 7840/Clark identified 955 SFPs and 877 of them were mapped together with 269 simple sequence repeat markers. The SFPs were randomly distributed within a chromosome but were unevenly distributed among different genomes. The B genome had the most SFPs, and the D genome had the least. Map positions of a selected set of SFPs were validated by mapping single nucleotide polymorphism using SNaPshot and comparing with expressed sequence tags mapping data. Conclusion The Affymetrix array is a cost-effective platform for SFP discovery and SFP mapping in wheat. The new high-density map constructed in this study will be a useful tool for genetic and genomic research in wheat. PMID:19480702

  14. Biominetic High Density Lipoproteins for the Delivery of Therapeutic Oligonucleotides

    NASA Astrophysics Data System (ADS)

    Tripathy, Sushant

    Advances in nanotechnology have brought about novel inorganic and hybrid nanoparticles with unique physico-chemical properties that make them suitable for a broad range of applications---from nano-circuitry to drug delivery. A significant part of those advancements have led to ground-breaking discoveries that have changed the approaches to formulation of therapeutics against diseases, such as cancer. Now-a-days the focus does not lie solely on finding a candidate small-molecule therapeutic with minimal adverse effects, but researchers are looking up to nanoparticles to improve biodistribution and biocompatibility profile of clinically proven therapeutics. The plethora of conjugation chemistries offered by currently extant inorganic nanoparticles have, in recent years, led to great leaps in the field of biomimicry---a modality that promises high biocompatibility. Further, in the pursuit of highly specific therapeutic molecules, researchers have turned to silencing oligonucleotides and some have already brought together the strengths of nanoparticles and silencing oligonucleotides in search of an efficacious therapy for cancer with minimal adverse effects. This dissertation work focuses on such a biomimetic platform---a gold nanoparticle based high density lipoprotein biomimetic (HDL NP), for the delivery of therapeutic oligonucleotides. The first chapter of this body of work introduces the molecular target of the silencing oligonucleotides---VEGFR2, and its role in the progression of solid tumor cancers. The background information also covers important aspects of natural high density lipoproteins (HDL), especially their innate capacity to bind and deliver exogenous and endogenous silencing oligonucleotides to tissues that express their high affinity receptor SRB1. We subsequently describe the synthesis of the biomimetic HDL NP and its oligonucleotide conjugates, and establish their biocompatibility. Further on, experimental data demonstrate the efficacy of silencing oligonucleotides conjugated HDL NPs in regulating the expression and function of VEGFR2 in cultured endothelial cells. Finally, the efficacy of the conjugates in two animal models of angiogenesis is presented.

  15. MicroArray Facility: a laboratory information management system with extended support for Nylon based technologies.

    PubMed

    Honoré, Paul; Granjeaud, Samuel; Tagett, Rebecca; Deraco, Stéphane; Beaudoing, Emmanuel; Rougemont, Jacques; Debono, Stéphane; Hingamp, Pascal

    2006-09-20

    High throughput gene expression profiling (GEP) is becoming a routine technique in life science laboratories. With experimental designs that repeatedly span thousands of genes and hundreds of samples, relying on a dedicated database infrastructure is no longer an option.GEP technology is a fast moving target, with new approaches constantly broadening the field diversity. This technology heterogeneity, compounded by the informatics complexity of GEP databases, means that software developments have so far focused on mainstream techniques, leaving less typical yet established techniques such as Nylon microarrays at best partially supported. MAF (MicroArray Facility) is the laboratory database system we have developed for managing the design, production and hybridization of spotted microarrays. Although it can support the widely used glass microarrays and oligo-chips, MAF was designed with the specific idiosyncrasies of Nylon based microarrays in mind. Notably single channel radioactive probes, microarray stripping and reuse, vector control hybridizations and spike-in controls are all natively supported by the software suite. MicroArray Facility is MIAME supportive and dynamically provides feedback on missing annotations to help users estimate effective MIAME compliance. Genomic data such as clone identifiers and gene symbols are also directly annotated by MAF software using standard public resources. The MAGE-ML data format is implemented for full data export. Journalized database operations (audit tracking), data anonymization, material traceability and user/project level confidentiality policies are also managed by MAF. MicroArray Facility is a complete data management system for microarray producers and end-users. Particular care has been devoted to adequately model Nylon based microarrays. The MAF system, developed and implemented in both private and academic environments, has proved a robust solution for shared facilities and industry service providers alike.

  16. MicroArray Facility: a laboratory information management system with extended support for Nylon based technologies

    PubMed Central

    Honoré, Paul; Granjeaud, Samuel; Tagett, Rebecca; Deraco, Stéphane; Beaudoing, Emmanuel; Rougemont, Jacques; Debono, Stéphane; Hingamp, Pascal

    2006-01-01

    Background High throughput gene expression profiling (GEP) is becoming a routine technique in life science laboratories. With experimental designs that repeatedly span thousands of genes and hundreds of samples, relying on a dedicated database infrastructure is no longer an option. GEP technology is a fast moving target, with new approaches constantly broadening the field diversity. This technology heterogeneity, compounded by the informatics complexity of GEP databases, means that software developments have so far focused on mainstream techniques, leaving less typical yet established techniques such as Nylon microarrays at best partially supported. Results MAF (MicroArray Facility) is the laboratory database system we have developed for managing the design, production and hybridization of spotted microarrays. Although it can support the widely used glass microarrays and oligo-chips, MAF was designed with the specific idiosyncrasies of Nylon based microarrays in mind. Notably single channel radioactive probes, microarray stripping and reuse, vector control hybridizations and spike-in controls are all natively supported by the software suite. MicroArray Facility is MIAME supportive and dynamically provides feedback on missing annotations to help users estimate effective MIAME compliance. Genomic data such as clone identifiers and gene symbols are also directly annotated by MAF software using standard public resources. The MAGE-ML data format is implemented for full data export. Journalized database operations (audit tracking), data anonymization, material traceability and user/project level confidentiality policies are also managed by MAF. Conclusion MicroArray Facility is a complete data management system for microarray producers and end-users. Particular care has been devoted to adequately model Nylon based microarrays. The MAF system, developed and implemented in both private and academic environments, has proved a robust solution for shared facilities and industry service providers alike. PMID:16987406

  17. Advanced surface-enhanced Raman gene probe systems and methods thereof

    DOEpatents

    Vo-Dinh, Tuan

    2001-01-01

    The subject invention is a series of methods and systems for using the Surface-Enhanced Raman (SER)-labeled Gene Probe for hybridization, detection and identification of SER-labeled hybridized target oligonucleotide material comprising the steps of immobilizing SER-labeled hybridized target oligonucleotide material on a support means, wherein the SER-labeled hybridized target oligonucleotide material comprise a SER label attached either to a target oligonucleotide of unknown sequence or to a gene probe of known sequence complementary to the target oligonucleotide sequence, the SER label is unique for the target oligonucleotide strands of a particular sequence wherein the SER-labeled oligonucleotide is hybridized to its complementary oligonucleotide strand, then the support means having the SER-labeled hybridized target oligonucleotide material adsorbed thereon is SERS activated with a SERS activating means, then the support means is analyzed.

  18. Clinical potential of oligonucleotide-based therapeutics in the respiratory system.

    PubMed

    Moschos, Sterghios A; Usher, Louise; Lindsay, Mark A

    2017-01-01

    The discovery of an ever-expanding plethora of coding and non-coding RNAs with nodal and causal roles in the regulation of lung physiology and disease is reinvigorating interest in the clinical utility of the oligonucleotide therapeutic class. This is strongly supported through recent advances in nucleic acids chemistry, synthetic oligonucleotide delivery and viral gene therapy that have succeeded in bringing to market at least three nucleic acid-based drugs. As a consequence, multiple new candidates such as RNA interference modulators, antisense, and splice switching compounds are now progressing through clinical evaluation. Here, manipulation of RNA for the treatment of lung disease is explored, with emphasis on robust pharmacological evidence aligned to the five pillars of drug development: exposure to the appropriate tissue, binding to the desired molecular target, evidence of the expected mode of action, activity in the relevant patient population and commercially viable value proposition. Copyright © 2016 Elsevier Inc. All rights reserved.

  19. Spot detection and image segmentation in DNA microarray data.

    PubMed

    Qin, Li; Rueda, Luis; Ali, Adnan; Ngom, Alioune

    2005-01-01

    Following the invention of microarrays in 1994, the development and applications of this technology have grown exponentially. The numerous applications of microarray technology include clinical diagnosis and treatment, drug design and discovery, tumour detection, and environmental health research. One of the key issues in the experimental approaches utilising microarrays is to extract quantitative information from the spots, which represent genes in a given experiment. For this process, the initial stages are important and they influence future steps in the analysis. Identifying the spots and separating the background from the foreground is a fundamental problem in DNA microarray data analysis. In this review, we present an overview of state-of-the-art methods for microarray image segmentation. We discuss the foundations of the circle-shaped approach, adaptive shape segmentation, histogram-based methods and the recently introduced clustering-based techniques. We analytically show that clustering-based techniques are equivalent to the one-dimensional, standard k-means clustering algorithm that utilises the Euclidean distance.

  20. Fuzzy support vector machine: an efficient rule-based classification technique for microarrays.

    PubMed

    Hajiloo, Mohsen; Rabiee, Hamid R; Anooshahpour, Mahdi

    2013-01-01

    The abundance of gene expression microarray data has led to the development of machine learning algorithms applicable for tackling disease diagnosis, disease prognosis, and treatment selection problems. However, these algorithms often produce classifiers with weaknesses in terms of accuracy, robustness, and interpretability. This paper introduces fuzzy support vector machine which is a learning algorithm based on combination of fuzzy classifiers and kernel machines for microarray classification. Experimental results on public leukemia, prostate, and colon cancer datasets show that fuzzy support vector machine applied in combination with filter or wrapper feature selection methods develops a robust model with higher accuracy than the conventional microarray classification models such as support vector machine, artificial neural network, decision trees, k nearest neighbors, and diagonal linear discriminant analysis. Furthermore, the interpretable rule-base inferred from fuzzy support vector machine helps extracting biological knowledge from microarray data. Fuzzy support vector machine as a new classification model with high generalization power, robustness, and good interpretability seems to be a promising tool for gene expression microarray classification.

  1. Phosphorothioate backbone modifications of nucleotide-based drugs are potent platelet activators

    PubMed Central

    Flierl, Ulrike; Nero, Tracy L.; Lim, Bock; Arthur, Jane F.; Yao, Yu; Jung, Stephanie M.; Gitz, Eelo; Pollitt, Alice Y.; Zaldivia, Maria T.K.; Jandrot-Perrus, Martine; Schäfer, Andreas; Nieswandt, Bernhard; Andrews, Robert K.; Parker, Michael W.; Gardiner, Elizabeth E.

    2015-01-01

    Nucleotide-based drug candidates such as antisense oligonucleotides, aptamers, immunoreceptor-activating nucleotides, or (anti)microRNAs hold great therapeutic promise for many human diseases. Phosphorothioate (PS) backbone modification of nucleotide-based drugs is common practice to protect these promising drug candidates from rapid degradation by plasma and intracellular nucleases. Effects of the changes in physicochemical properties associated with PS modification on platelets have not been elucidated so far. Here we report the unexpected binding of PS-modified oligonucleotides to platelets eliciting strong platelet activation, signaling, reactive oxygen species generation, adhesion, spreading, aggregation, and thrombus formation in vitro and in vivo. Mechanistically, the platelet-specific receptor glycoprotein VI (GPVI) mediates these platelet-activating effects. Notably, platelets from GPVI function–deficient patients do not exhibit binding of PS-modified oligonucleotides, and platelet activation is fully abolished. Our data demonstrate a novel, unexpected, PS backbone–dependent, platelet-activating effect of nucleotide-based drug candidates mediated by GPVI. This unforeseen effect should be considered in the ongoing development programs for the broad range of upcoming and promising DNA/RNA therapeutics. PMID:25646267

  2. Insertional Mutagenesis by CRISPR/Cas9 Ribonucleoprotein Gene Editing in Cells Targeted for Point Mutation Repair Directed by Short Single-Stranded DNA Oligonucleotides.

    PubMed

    Rivera-Torres, Natalia; Banas, Kelly; Bialk, Pawel; Bloh, Kevin M; Kmiec, Eric B

    2017-01-01

    CRISPR/Cas9 and single-stranded DNA oligonucleotides (ssODNs) have been used to direct the repair of a single base mutation in human genes. Here, we examine a method designed to increase the precision of RNA guided genome editing in human cells by utilizing a CRISPR/Cas9 ribonucleoprotein (RNP) complex to initiate DNA cleavage. The RNP is assembled in vitro and induces a double stranded break at a specific site surrounding the mutant base designated for correction by the ssODN. We use an integrated mutant eGFP gene, bearing a single base change rendering the expressed protein nonfunctional, as a single copy target in HCT 116 cells. We observe significant gene correction activity of the mutant base, promoted by the RNP and single-stranded DNA oligonucleotide with validation through genotypic and phenotypic readout. We demonstrate that all individual components must be present to obtain successful gene editing. Importantly, we examine the genotype of individually sorted corrected and uncorrected clonally expanded cell populations for the mutagenic footprint left by the action of these gene editing tools. While the DNA sequence of the corrected population is exact with no adjacent sequence modification, the uncorrected population exhibits heterogeneous mutagenicity with a wide variety of deletions and insertions surrounding the target site. We designate this type of DNA aberration as on-site mutagenicity. Analyses of two clonal populations bearing specific DNA insertions surrounding the target site, indicate that point mutation repair has occurred at the level of the gene. The phenotype, however, is not rescued because a section of the single-stranded oligonucleotide has been inserted altering the reading frame and generating truncated proteins. These data illustrate the importance of analysing mutagenicity in uncorrected cells. Our results also form the basis of a simple model for point mutation repair directed by a short single-stranded DNA oligonucleotides and CRISPR/Cas9 ribonucleoprotein complex.

  3. Insertional Mutagenesis by CRISPR/Cas9 Ribonucleoprotein Gene Editing in Cells Targeted for Point Mutation Repair Directed by Short Single-Stranded DNA Oligonucleotides

    PubMed Central

    Rivera-Torres, Natalia; Bialk, Pawel; Bloh, Kevin M.; Kmiec, Eric B.

    2017-01-01

    CRISPR/Cas9 and single-stranded DNA oligonucleotides (ssODNs) have been used to direct the repair of a single base mutation in human genes. Here, we examine a method designed to increase the precision of RNA guided genome editing in human cells by utilizing a CRISPR/Cas9 ribonucleoprotein (RNP) complex to initiate DNA cleavage. The RNP is assembled in vitro and induces a double stranded break at a specific site surrounding the mutant base designated for correction by the ssODN. We use an integrated mutant eGFP gene, bearing a single base change rendering the expressed protein nonfunctional, as a single copy target in HCT 116 cells. We observe significant gene correction activity of the mutant base, promoted by the RNP and single-stranded DNA oligonucleotide with validation through genotypic and phenotypic readout. We demonstrate that all individual components must be present to obtain successful gene editing. Importantly, we examine the genotype of individually sorted corrected and uncorrected clonally expanded cell populations for the mutagenic footprint left by the action of these gene editing tools. While the DNA sequence of the corrected population is exact with no adjacent sequence modification, the uncorrected population exhibits heterogeneous mutagenicity with a wide variety of deletions and insertions surrounding the target site. We designate this type of DNA aberration as on-site mutagenicity. Analyses of two clonal populations bearing specific DNA insertions surrounding the target site, indicate that point mutation repair has occurred at the level of the gene. The phenotype, however, is not rescued because a section of the single-stranded oligonucleotide has been inserted altering the reading frame and generating truncated proteins. These data illustrate the importance of analysing mutagenicity in uncorrected cells. Our results also form the basis of a simple model for point mutation repair directed by a short single-stranded DNA oligonucleotides and CRISPR/Cas9 ribonucleoprotein complex. PMID:28052104

  4. Microarray platform for omics analysis

    NASA Astrophysics Data System (ADS)

    Mecklenburg, Michael; Xie, Bin

    2001-09-01

    Microarray technology has revolutionized genetic analysis. However, limitations in genome analysis has lead to renewed interest in establishing 'omic' strategies. As we enter the post-genomic era, new microarray technologies are needed to address these new classes of 'omic' targets, such as proteins, as well as lipids and carbohydrates. We have developed a microarray platform that combines self- assembling monolayers with the biotin-streptavidin system to provide a robust, versatile immobilization scheme. A hydrophobic film is patterned on the surface creating an array of tension wells that eliminates evaporation effects thereby reducing the shear stress to which biomolecules are exposed to during immobilization. The streptavidin linker layer makes it possible to adapt and/or develop microarray based assays using virtually any class of biomolecules including: carbohydrates, peptides, antibodies, receptors, as well as them ore traditional DNA based arrays. Our microarray technology is designed to furnish seamless compatibility across the various 'omic' platforms by providing a common blueprint for fabricating and analyzing arrays. The prototype microarray uses a microscope slide footprint patterned with 2 by 96 flat wells. Data on the microarray platform will be presented.

  5. Solid phase synthesis of phosphorothioate oligonucleotides utilizing diethyldithiocarbonate disulfide (DDD) as an efficient sulfur transfer reagent.

    PubMed

    Cheruvallath, Zacharia S; Kumar, R Krishna; Rentel, Claus; Cole, Douglas L; Ravikumar, Vasulinga T

    2003-04-01

    Diethyldithiodicarbonate (DDD), a cheap and easily prepared compound, is found to be a rapid and efficient sulfurizing reagent in solid phase synthesis of phosphorothioate oligodeoxyribonucleotides via the phosphoramidite approach. Product yield and quality based on IP-LC-MS compares well with high quality oligonucleotides synthesized using phenylacetyl disulfide (PADS) which is being used for manufacture of our antisense drugs.

  6. Enzymatic production of 'monoclonal stoichiometric' single-stranded DNA oligonucleotides.

    PubMed

    Ducani, Cosimo; Kaul, Corinna; Moche, Martin; Shih, William M; Högberg, Björn

    2013-07-01

    Single-stranded oligonucleotides are important as research tools, as diagnostic probes, in gene therapy and in DNA nanotechnology. Oligonucleotides are typically produced via solid-phase synthesis, using polymer chemistries that are limited relative to what biological systems produce. The number of errors in synthetic DNA increases with oligonucleotide length, and the resulting diversity of sequences can be a problem. Here we present the 'monoclonal stoichiometric' (MOSIC) method for enzyme-mediated production of DNA oligonucleotides. We amplified oligonucleotides from clonal templates derived from single bacterial colonies and then digested cutter hairpins in the products, which released pools of oligonucleotides with precisely controlled relative stoichiometric ratios. We prepared 14-378-nucleotide MOSIC oligonucleotides either by in vitro rolling-circle amplification or by amplification of phagemid DNA in Escherichia coli. Analyses of the formation of a DNA crystal and folding of DNA nanostructures confirmed the scalability, purity and stoichiometry of the produced oligonucleotides.

  7. Enzymatic Production of Monoclonal Stoichiometric Single-Stranded DNA Oligonucleotides

    PubMed Central

    Ducani, Cosimo; Kaul, Corinna; Moche, Martin; Shih, William M.; Högberg, Björn

    2013-01-01

    Single-stranded oligonucleotides are important as research tools as probes for diagnostics and gene therapy. Today, production of oligonucleotides is done via solid-phase synthesis. However, the capabilities of current polymer chemistry are limited in comparison to what can be produced in biological systems. The errors in synthetic DNA increases with oligonucleotide length, and sequence diversity can often be a problem. Here, we present the Monoclonal Stoichiometric (MOSIC) method for enzymatic DNA oligonucleotide production. Using this method, we amplify oligonucleotides from clonal templates followed by digestion of a cutter-hairpin, resulting in pools of monoclonal oligonucleotides with precisely controlled relative stoichiometric ratios. We present data where MOSIC oligonucleotides, 14–378 nt long, were prepared either by in vitro rolling-circle amplification, or by amplification in Escherichia coli in the form of phagemid DNA. The formation of a DNA crystal and folding of DNA nanostructures confirmed the scalability, purity and stoichiometry of the produced oligonucleotides. PMID:23727986

  8. Specific DNA duplex formation at an artificial lipid bilayer: towards a new DNA biosensor technology.

    PubMed

    Werz, Emma; Korneev, Sergei; Montilla-Martinez, Malayko; Wagner, Richard; Hemmler, Roland; Walter, Claudius; Eisfeld, Jörg; Gall, Karsten; Rosemeyer, Helmut

    2012-02-01

    A novel technique is described which comprises a base-specific DNA duplex formation at a lipid bilayer-H(2) O-phase boundary layer. Two different probes of oligonucleotides both carrying a double-tailed lipid at the 5'-terminus were incorporated into stable artificial lipid bilayers separating two compartments (cis/trans-channel) of an optically transparent microfluidic sample carrier with perfusion capabilities. Both the cis- and trans-channels are filled with saline buffer. Injection of a cyanine-5-labeled target DNA sequence, which is complementary to only one of the oligonucleotide probes, into the cis-channel, followed by a thorough perfusion, leads to an immobilization of the labeled complementary oligonucleotide on the membrane as detected by single-molecule fluorescence spectroscopy and microscopy. In the case of fluorescent but non-complementary DNA sequences, no immobilized fluorescent oligonucleotide duplex could be detected on the membrane. This clearly verifies a specific duplex formation at the membrane interface. Copyright © 2012 Verlag Helvetica Chimica Acta AG, Zürich.

  9. Therapeutic Antisense Oligonucleotides against Cancer: Hurdling to the Clinic

    NASA Astrophysics Data System (ADS)

    Moreno, Pedro; Pêgo, Ana

    2014-10-01

    Under clinical development since the early 90’s and with two successfully approved drugs (Fomivirsen and Mipomersen), oligonucleotide-based therapeutics have not yet delivered a clinical drug to the market in the cancer field. Whilst many pre-clinical data has been generated, a lack of understanding still exists on how to efficiently tackle all the different challenges presented for cancer targeting in a clinical setting. Namely, effective drug vectorization, careful choice of target gene or synergistic multi-gene targeting are surely decisive, while caution must be exerted to avoid potential toxic, often misleading off-target-effects. Here a brief overview will be given on the nucleic acid chemistry advances that established oligonucleotide technologies as a promising therapeutic alternative and ongoing cancer related clinical trials. Special attention will be given towards a perspective on the hurdles encountered specifically in the cancer field by this class of therapeutic oligonucleotides and a view on possible avenues for success is presented, with particular focus on the contribution from nanotechnology to the field.

  10. Therapeutic antisense oligonucleotides against cancer: hurdling to the clinic

    PubMed Central

    Moreno, Pedro M. D.; Pêgo, Ana P.

    2014-01-01

    Under clinical development since the early 90's and with two successfully approved drugs (Fomivirsen and Mipomersen), oligonucleotide-based therapeutics has not yet delivered a clinical drug to the market in the cancer field. Whilst many pre-clinical data has been generated, a lack of understanding still exists on how to efficiently tackle all the different challenges presented for cancer targeting in a clinical setting. Namely, effective drug vectorization, careful choice of target gene or synergistic multi-gene targeting are surely decisive, while caution must be exerted to avoid potential toxic, often misleading off-target-effects. Here a brief overview will be given on the nucleic acid chemistry advances that established oligonucleotide technologies as a promising therapeutic alternative and ongoing cancer related clinical trials. Special attention will be given toward a perspective on the hurdles encountered specifically in the cancer field by this class of therapeutic oligonucleotides and a view on possible avenues for success is presented, with particular focus on the contribution from nanotechnology to the field. PMID:25353019

  11. Syntheses of prodrug-type phosphotriester oligonucleotides responsive to intracellular reducing environment for improvement of cell membrane permeability and nuclease resistance.

    PubMed

    Hayashi, Junsuke; Samezawa, Yusuke; Ochi, Yosuke; Wada, Shun-Ichi; Urata, Hidehito

    2017-07-15

    We synthesized prodrug-type phosphotriester (PTE) oligonucleotides containing the six-membered cyclic disulfide moiety by using phosphoramidite chemistry. Prodrug-type oligonucleotides named "Reducing-Environment-Dependent Uncatalyzed Chemical Transforming (REDUCT) PTE oligonucleotides" were converted into natural oligonucleotides under cytosol-mimetic reductive condition. Furthermore, the REDUCT PTE oligonucleotides were robust to nuclease digestion and exhibited good cell membrane permeability. Copyright © 2017 Elsevier Ltd. All rights reserved.

  12. Pharmacokinetic Profiling of Conjugated Therapeutic Oligonucleotides: A High-Throughput Method Based Upon Serial Blood Microsampling Coupled to Peptide Nucleic Acid Hybridization Assay.

    PubMed

    Godinho, Bruno M D C; Gilbert, James W; Haraszti, Reka A; Coles, Andrew H; Biscans, Annabelle; Roux, Loic; Nikan, Mehran; Echeverria, Dimas; Hassler, Matthew; Khvorova, Anastasia

    2017-12-01

    Therapeutic oligonucleotides, such as small interfering RNAs (siRNAs), hold great promise for the treatment of incurable genetically defined disorders by targeting cognate toxic gene products for degradation. To achieve meaningful tissue distribution and efficacy in vivo, siRNAs must be conjugated or formulated. Clear understanding of the pharmacokinetic (PK)/pharmacodynamic behavior of these compounds is necessary to optimize and characterize the performance of therapeutic oligonucleotides in vivo. In this study, we describe a simple and reproducible methodology for the evaluation of in vivo blood/plasma PK profiles and tissue distribution of oligonucleotides. The method is based on serial blood microsampling from the saphenous vein, coupled to peptide nucleic acid hybridization assay for quantification of guide strands. Performed with minimal number of animals, this method allowed unequivocal detection and sensitive quantification without the need for amplification, or further modification of the oligonucleotides. Using this methodology, we compared plasma clearances and tissue distribution profiles of two different hydrophobically modified siRNAs (hsiRNAs). Notably, cholesterol-hsiRNA presented slow plasma clearances and mainly accumulated in the liver, whereas, phosphocholine-docosahexaenoic acid-hsiRNA was rapidly cleared from the plasma and preferably accumulated in the kidney. These data suggest that the PK/biodistribution profiles of modified hsiRNAs are determined by the chemical nature of the conjugate. Importantly, the method described in this study constitutes a simple platform to conduct pilot assessments of the basic clearance and tissue distribution profiles, which can be broadly applied for evaluation of new chemical variants of siRNAs and micro-RNAs.

  13. Assessing the impact of Benzo[a]pyrene on Marine Mussels: Application of a novel targeted low density microarray complementing classical biomarker responses

    PubMed Central

    Sforzini, Susanna; Arlt, Volker M.; Barranger, Audrey; Dallas, Lorna J.; Oliveri, Caterina; Aminot, Yann; Pacchioni, Beniamina; Millino, Caterina; Lanfranchi, Gerolamo; Readman, James W.; Moore, Michael N.; Viarengo, Aldo; Jha, Awadhesh N.

    2017-01-01

    Despite the increasing use of mussels in environmental monitoring and ecotoxicological studies, their genomes and gene functions have not been thoroughly explored. Several cDNA microarrays were recently proposed for Mytilus spp., but putatively identified partial transcripts have rendered the generation of robust transcriptional responses difficult in terms of pathway identification. We developed a new low density oligonucleotide microarray with 465 probes covering the same number of genes. Target genes were selected to cover most of the well-known biological processes in the stress response documented over the last decade in bivalve species at the cellular and tissue levels. Our new ‘STressREsponse Microarray’ (STREM) platform consists of eight sub-arrays with three replicates for each target in each sub-array. To assess the potential use of the new array, we tested the effect of the ubiquitous environmental pollutant benzo[a]pyrene (B[a]P) at 5, 50, and 100 μg/L on two target tissues, the gills and digestive gland, of Mytilus galloprovincialis exposed invivo for three days. Bioaccumulation of B[a]P was also determined demonstrating exposure in both tissues. In addition to the well-known effects of B[a]P on DNA metabolism and oxidative stress, the new array data provided clues about the implication of other biological processes, such as cytoskeleton, immune response, adhesion to substrate, and mitochondrial activities. Transcriptional data were confirmed using qRT-PCR. We further investigated cellular functions and possible alterations related to biological processes highlighted by the microarray data using oxidative stress biomarkers (Lipofuscin content) and the assessment of genotoxicity. DNA damage, as measured by the alkaline comet assay, increased as a function of dose.DNA adducts measurements using 32P-postlabeling method also showed the presence of bulky DNA adducts (i.e. dG-N2-BPDE). Lipofiscin content increased significantly in B[a]P exposed mussels. Immunohistochemical analysis of tubulin and actin showed changes in cytoskeleton organisation. Our results adopting an integrated approach confirmed that the combination of newly developed transcriptomic approcah, classical biomarkers along with chemical analysis of water and tissue samples should be considered for environmental bioimonitoring and ecotoxicological studies to obtain holistic information to assess the impact of contaminants on the biota. PMID:28651000

  14. Static magnetic field reduced exogenous oligonucleotide uptake by spermatozoa using magnetic nanoparticle gene delivery system

    NASA Astrophysics Data System (ADS)

    Katebi, Samira; Esmaeili, Abolghasem; Ghaedi, Kamran

    2016-03-01

    Spermatozoa could introduce exogenous oligonucleotides of interest to the oocyte. The most important reason of low efficiency of sperm mediated gene transfer (SMGT) is low uptake of exogenous DNA by spermatozoa. The aim of this study was to evaluate the effects of static magnetic field on exogenous oligonucleotide uptake of spermatozoa using magnetofection method. Magnetic nanoparticles (MNPs) associated with the labeled oligonucleotides were used to increase the efficiency of exogenous oligonucleotide uptake by rooster spermatozoa. We used high-field/high-gradient magnet (NdFeB) to enhance and accelerate exogenous DNA sedimentation at the spermatozoa surface. Flow cytometry analysis was performed to measure viability and percentage of exogenous oligonucleotide uptake by sperm. Flow cytometry analysis showed a significant increase in exogenous oligonucleotide uptake by rooster spermatozoa (P<0.001) when spermatozoa were incubated in exogenous oligonucleotide solution and MNPs. However, by applying static magnetic field during magnetofection method, a significant decrease in exogenous oligonucleotide uptake was observed (P<0.05). Findings of this study showed that MNPs were effective to increase exogenous oligonucleotide uptake by rooster spermatozoa; however unlike others studies, static magnetic field, was not only ineffective to enhance exogenous oligonucleotide uptake by rooster spermatozoa but also led to reduction in efficiency of magnetic nanoparticles in gene transfer.

  15. Liver as a target for oligonucleotide therapeutics.

    PubMed

    Sehgal, Alfica; Vaishnaw, Akshay; Fitzgerald, Kevin

    2013-12-01

    Oligonucleotide-based therapeutics are an emerging class of drugs that hold the promise for silencing "un-druggable" targets,thus creating unique opportunities for innovative medicines. As opposed to gene therapy, oligonucleotides are considered to be more akin to small molecule therapeutics because they are small,completely synthetic in origin, do not integrate into the host genome,and have a defined duration of therapeutic activity after which effects recover to baseline. They offer a high degree of specificity at the genetic level, thereby reducing off-target effects.At the same time, they provide a strategy for targeting any gene in the genome, including transcripts that produce mutated proteins.Oligonucleotide-based therapeutics include short interfering RNA (siRNA), that degrade target mRNA through RISC mediated RNAi; anti-miRs, that target miRNAs; miRNA mimics, that regulate target mRNA; antisense oligonucleotides, that may be working through RNAseH mediated mRNA decay; mRNA upregulation,by targeting long non-coding RNAs; and oligonucleotides induced alternative splicing [1]. All these approaches require some minimal degree of homology at the nucleic acid sequence level for them to be functional. The different mechanisms of action and their relevant activity are outlined in Fig. 1. Besides homology,RNA secondary structure has also been exploited in the case of ribozymes and aptamers, which act by binding to nucleic acids or proteins, respectively. While there have been many reports of gene knockdown and gene modulation in cell lines and mice with all these methods, very few have advanced to clinical stages.The main obstacle to date has been the safe and effective intracellular delivery of these compounds in higher species, including humans. Indeed, their action requires direct interaction with DNA/RNA within the target cell so even when one solves the issues of tissue and cellular access, intracellular/intranuclear location represents yet another barrier to overcome. To date,hepatic delivery of oligonucleotides has been the area with greatest progress, and thus we have focused on liver-targeted therapeutics that have shown promise at the preclinical and/or clinical level.The liver is the largest internal organ in the body, playing a central role in metabolism, detoxification, synthesis, and secretion of major plasma proteins (carrier proteins, coagulation factors,complement components, hormones, and apolipoproteins),and iron homeostasis. It is therefore not surprising that a large number of disease targets reside in the liver where they are susceptible to modulation by oligonucleotide therapies.

  16. Fully Automated Complementary DNA Microarray Segmentation using a Novel Fuzzy-based Algorithm.

    PubMed

    Saberkari, Hamidreza; Bahrami, Sheyda; Shamsi, Mousa; Amoshahy, Mohammad Javad; Ghavifekr, Habib Badri; Sedaaghi, Mohammad Hossein

    2015-01-01

    DNA microarray is a powerful approach to study simultaneously, the expression of 1000 of genes in a single experiment. The average value of the fluorescent intensity could be calculated in a microarray experiment. The calculated intensity values are very close in amount to the levels of expression of a particular gene. However, determining the appropriate position of every spot in microarray images is a main challenge, which leads to the accurate classification of normal and abnormal (cancer) cells. In this paper, first a preprocessing approach is performed to eliminate the noise and artifacts available in microarray cells using the nonlinear anisotropic diffusion filtering method. Then, the coordinate center of each spot is positioned utilizing the mathematical morphology operations. Finally, the position of each spot is exactly determined through applying a novel hybrid model based on the principle component analysis and the spatial fuzzy c-means clustering (SFCM) algorithm. Using a Gaussian kernel in SFCM algorithm will lead to improving the quality in complementary DNA microarray segmentation. The performance of the proposed algorithm has been evaluated on the real microarray images, which is available in Stanford Microarray Databases. Results illustrate that the accuracy of microarray cells segmentation in the proposed algorithm reaches to 100% and 98% for noiseless/noisy cells, respectively.

  17. Microarray-based screening of heat shock protein inhibitors.

    PubMed

    Schax, Emilia; Walter, Johanna-Gabriela; Märzhäuser, Helene; Stahl, Frank; Scheper, Thomas; Agard, David A; Eichner, Simone; Kirschning, Andreas; Zeilinger, Carsten

    2014-06-20

    Based on the importance of heat shock proteins (HSPs) in diseases such as cancer, Alzheimer's disease or malaria, inhibitors of these chaperons are needed. Today's state-of-the-art techniques to identify HSP inhibitors are performed in microplate format, requiring large amounts of proteins and potential inhibitors. In contrast, we have developed a miniaturized protein microarray-based assay to identify novel inhibitors, allowing analysis with 300 pmol of protein. The assay is based on competitive binding of fluorescence-labeled ATP and potential inhibitors to the ATP-binding site of HSP. Therefore, the developed microarray enables the parallel analysis of different ATP-binding proteins on a single microarray. We have demonstrated the possibility of multiplexing by immobilizing full-length human HSP90α and HtpG of Helicobacter pylori on microarrays. Fluorescence-labeled ATP was competed by novel geldanamycin/reblastatin derivatives with IC50 values in the range of 0.5 nM to 4 μM and Z(*)-factors between 0.60 and 0.96. Our results demonstrate the potential of a target-oriented multiplexed protein microarray to identify novel inhibitors for different members of the HSP90 family. Copyright © 2014 Elsevier B.V. All rights reserved.

  18. Genes Involved in the Balance between Neuronal Survival and Death during Inflammation

    PubMed Central

    Glezer, Isaias; Chernomoretz, Ariel; David, Samuel; Plante, Marie-Michèle; Rivest, Serge

    2007-01-01

    Glucocorticoids are potent regulators of the innate immune response, and alteration in this inhibitory feedback has detrimental consequences for the neural tissue. This study profiled and investigated functionally candidate genes mediating this switch between cell survival and death during an acute inflammatory reaction subsequent to the absence of glucocorticoid signaling. Oligonucleotide microarray analysis revealed that following lipopolysaccharide (LPS) intracerebral administration at striatum level, more modulated genes presented transcription impairment than exacerbation upon glucocorticoid receptor blockage. Among impaired genes we identified ceruloplasmin (Cp), which plays a key role in iron metabolism and is implicated in a neurodegenative disease. Microglial and endothelial induction of Cp is a natural neuroprotective mechanism during inflammation, because Cp-deficient mice exhibited increased iron accumulation and demyelination when exposed to LPS and neurovascular reactivity to pneumococcal meningitis. This study has identified genes that can play a critical role in programming the innate immune response, helping to clarify the mechanisms leading to protection or damage during inflammatory conditions in the CNS. PMID:17375196

  19. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yeung, Y.-S.; Yip, C.-W.; Hon, C.-C.

    We have previously demonstrated that over-expression of spike protein (S) of severe acute respiratory syndrome coronavirus (SARS-CoV) or its C-terminal subunit (S2) is sufficient to induce apoptosis in vitro. To further investigate the possible roles of S2 in SARS-CoV-induced apoptosis and pathogenesis of SARS, we characterized the host expression profiles induced upon S2 over-expression in Vero E6 cells by oligonucleotide microarray analysis. Possible activation of mitochondrial apoptotic pathway in S2 expressing cells was suggested, as evidenced by the up-regulation of cytochrome c and down-regulation of the Bcl-2 family anti-apoptotic members. Inhibition of Bcl-2-related anti-apoptotic pathway was further supported by themore » diminution of S2-induced apoptosis in Vero E6 cells over-expressing Bcl-xL. In addition, modulation of CCN E2 and CDKN 1A implied the possible control of cell cycle arrest at G1/S phase. This study is expected to extend our understanding on the pathogenesis of SARS at a molecular level.« less

  20. Genome-wide transcriptional analysis of flagellar regeneration in Chlamydomonas reinhardtii identifies orthologs of ciliary disease genes

    NASA Technical Reports Server (NTRS)

    Stolc, Viktor; Samanta, Manoj Pratim; Tongprasit, Waraporn; Marshall, Wallace F.

    2005-01-01

    The important role that cilia and flagella play in human disease creates an urgent need to identify genes involved in ciliary assembly and function. The strong and specific induction of flagellar-coding genes during flagellar regeneration in Chlamydomonas reinhardtii suggests that transcriptional profiling of such cells would reveal new flagella-related genes. We have conducted a genome-wide analysis of RNA transcript levels during flagellar regeneration in Chlamydomonas by using maskless photolithography method-produced DNA oligonucleotide microarrays with unique probe sequences for all exons of the 19,803 predicted genes. This analysis represents previously uncharacterized whole-genome transcriptional activity profiling study in this important model organism. Analysis of strongly induced genes reveals a large set of known flagellar components and also identifies a number of important disease-related proteins as being involved with cilia and flagella, including the zebrafish polycystic kidney genes Qilin, Reptin, and Pontin, as well as the testis-expressed tubby-like protein TULP2.

  1. Experimental annotation of the human genome using microarray technology.

    PubMed

    Shoemaker, D D; Schadt, E E; Armour, C D; He, Y D; Garrett-Engele, P; McDonagh, P D; Loerch, P M; Leonardson, A; Lum, P Y; Cavet, G; Wu, L F; Altschuler, S J; Edwards, S; King, J; Tsang, J S; Schimmack, G; Schelter, J M; Koch, J; Ziman, M; Marton, M J; Li, B; Cundiff, P; Ward, T; Castle, J; Krolewski, M; Meyer, M R; Mao, M; Burchard, J; Kidd, M J; Dai, H; Phillips, J W; Linsley, P S; Stoughton, R; Scherer, S; Boguski, M S

    2001-02-15

    The most important product of the sequencing of a genome is a complete, accurate catalogue of genes and their products, primarily messenger RNA transcripts and their cognate proteins. Such a catalogue cannot be constructed by computational annotation alone; it requires experimental validation on a genome scale. Using 'exon' and 'tiling' arrays fabricated by ink-jet oligonucleotide synthesis, we devised an experimental approach to validate and refine computational gene predictions and define full-length transcripts on the basis of co-regulated expression of their exons. These methods can provide more accurate gene numbers and allow the detection of mRNA splice variants and identification of the tissue- and disease-specific conditions under which genes are expressed. We apply our technique to chromosome 22q under 69 experimental condition pairs, and to the entire human genome under two experimental conditions. We discuss implications for more comprehensive, consistent and reliable genome annotation, more efficient, full-length complementary DNA cloning strategies and application to complex diseases.

  2. Identification of human cell responses to benzene and benzene metabolites.

    PubMed

    Gillis, Bruce; Gavin, Igor M; Arbieva, Zarema; King, Stephen T; Jayaraman, Sundararajan; Prabhakar, Bellur S

    2007-09-01

    Benzene is a common air pollutant and confirmed carcinogen, especially in reference to the hematopoietic system. In the present study we analyzed cytokine/chemokine production by, and gene expression induction in, human peripheral blood mononuclear cells upon their exposure to the benzene metabolites catechol, hydroquinone, 1,2,4-benzenetriol, and p-benzoquinone. Protein profiling showed that benzene metabolites can stimulate the production of chemokines, the proinflammatory cytokines TNF-alpha and IL-6, and the Th2 cytokines IL-4 and IL-5. Activated cells showed concurrent suppression of anti-inflammatory cytokine IL-10 expression. We also identified changes in global gene expression patterns in response to benzene metabolite challenges by using high-density oligonucleotide microarrays. Treatment with 1,2,4-benzenetriol resulted in the suppression of genes related to the regulation of protein expression and a concomitant activation of genes that encode heat shock proteins and cytochrome P450 family members. Protein and gene expression profiling identified unique human cellular responses upon exposure to benzene and benzene metabolites.

  3. Rapid synthesis of DNA-cysteine conjugates for expressed protein ligation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lovrinovic, Marina; Niemeyer, Christof M.

    2005-09-30

    We report a rapid method for the covalent modification of commercially available amino-modified DNA oligonucleotides with a cysteine moiety. The resulting DNA-cysteine conjugates are versatile reagents for the efficient preparation of covalent DNA-protein conjugates by means of expressed protein ligation (EPL). The EPL method allows for the site-specific coupling of cysteine-modified DNA oligomers with recombinant intein-fusion proteins, the latter of which contain a C-terminal thioester enabling the mild and highly specific reaction with N-terminal cysteine compounds. We prepared a cysteine-modifier reagent in a single-step reaction which allows for the rapid and near quantitative synthesis of cysteine-DNA conjugates. The latter weremore » ligated with the green fluorescent protein mutant EYFP, recombinantly expressed as an intein-fusion protein, allowing for the mild and selective formation of EYFP-DNA conjugates in high yields of about 60%. We anticipate many applications of our approach, ranging from protein microarrays to the arising field of nanobiotechnology.« less

  4. Blackbody infrared radiative dissociation of oligonucleotide anions.

    PubMed

    Klassen, J S; Schnier, P D; Williams, E R

    1998-11-01

    The dissociation kinetics of a series of doubly deprotonated oligonucleotide 7-mers [d(A)7(2-), d(AATTAAT)2-, d(TTAATTA)2-, and d(CCGGCCG)2-] were measured using blackbody infrared radiative dissociation in a Fourier-transform mass spectrometer. The oligonucleotides dissociate first by cleavage at the glycosidic bond leading to the loss of a neutral nucleobase, followed by cleavage at the adjacent (5') phosphodiester bond to produce structurally informative a-base and w type ions. From the temperature dependence of the unimolecular dissociation rate constants, Arrhenius activation parameters in the zero-pressure limit are obtained for the loss of base. The measured Arrhenius parameters are dependent on the identity of the nucleobase. The process involving the loss of an adenine base from the dianions, d(A)7(2-), d(AATTAAT)2-, and d(TTAATTA)2- has an average activation energy (Ea) of approximately 1.0 eV and a preexponential factor (A) of 10(10) s-1. Both guanine and cytosine base loss occurs for d(CCGGCCG)2-. The average Arrhenius parameters for the loss of cytosine and guanine are Ea = 1.32 +/- 0.03 eV and A = 10(13.3 +/- 0.3) s-1. No loss of thymine was observed for mixed adenine-thymine oligonucleotides. Neither base loss nor any other fragmentation reactions occur for d(T)7(2-) over a 600 s reaction delay at 207 degrees C, a temperature close to the upper limit accessible with our instrument. The Arrhenius parameters indicate that the preferred cleavage sites for mixed oligonucleotides of similar mass-to-charge ratio will be strongly dependent on the internal energy of the precursor ions. At low internal energies (effective temperatures below 475 K), loss of adenine and subsequent cleavage of the adjacent phosphoester bonds will dominate, whereas at higher energies, preferential cleavage at C and G residues will occur. The magnitude of the A factors < or = 10(13) s-1 measured for the loss of the three nucleobases (A, G, and C) is indicative of an entropically neutral or disfavored process as the rate limiting step for this reaction.

  5. Blackbody Infrared Radiative Dissociation of Oligonucleotide Anions

    PubMed Central

    Klassen, John S.; Schnier, Paul D.; Williams, Evan R.

    2005-01-01

    The dissociation kinetics of a series of doubly deprotonated oligonucleotide 7-mers [ d(A)72-, d(AATTAAT)2−, d(TTAATTA)2−, and d(CCGGCCG)2−] were measured using blackbody infrared radiative dissociation in a Fourier-transform mass spectrometer. The oligonucleotides dissociate first by cleavage at the glycosidic bond leading to the loss of a neutral nucleobase, followed by cleavage at the adjacent (5′) phosphodiester bond to produce structurally informative a-base and w type ions. From the temperature dependence of the unimolecular dissociation rate constants, Arrhenius activation parameters in the zero-pressure limit are obtained for the loss of base. The measured Arrhenius parameters are dependent on the identity of the nucleobase. The process involving the loss of an adenine base from the dianions, d(A)72-, d(AATTAAT)2−, and d(TTAATTA)2− has an average activation energy (Ea) of ~1.0 eV and a preexponential factor (A) of 1010 s−1. Both guanine and cytosine base loss occurs for d(CCGGCCG)2−. The average Arrhenius parameters for the loss of cytosine and guanine are Ea = 1.32 ± 0.03 eV and A = 1013.3±0.3 s−1. No loss of thymine was observed for mixed adenine–thymine oligonucleotides. Neither base loss nor any other fragmentation reactions occur for d(T)72- over a 600 s reaction delay at 207 °C, a temperature close to the upper limit accessible with our instrument. The Arrhenius parameters indicate that the preferred cleavage sites for mixed oligonucleotides of similar mass-to-charge ratio will be strongly dependent on the internal energy of the precursor ions. At low internal energies (effective temperatures below 475 K), loss of adenine and subsequent cleavage of the adjacent phosphoester bonds will dominate, whereas at higher energies, preferential cleavage at C and G residues will occur. The magnitude of the A factors ≤1013 s−1 measured for the loss of the three nucleobases (A, G, and C) is indicative of an entropically neutral or disfavored process as the rate limiting step for this reaction. PMID:9794082

  6. Rhodobase, a meta-analytical tool for reconstructing gene regulatory networks in a model photosynthetic bacterium.

    PubMed

    Moskvin, Oleg V; Bolotin, Dmitry; Wang, Andrew; Ivanov, Pavel S; Gomelsky, Mark

    2011-02-01

    We present Rhodobase, a web-based meta-analytical tool for analysis of transcriptional regulation in a model anoxygenic photosynthetic bacterium, Rhodobacter sphaeroides. The gene association meta-analysis is based on the pooled data from 100 of R. sphaeroides whole-genome DNA microarrays. Gene-centric regulatory networks were visualized using the StarNet approach (Jupiter, D.C., VanBuren, V., 2008. A visual data mining tool that facilitates reconstruction of transcription regulatory networks. PLoS ONE 3, e1717) with several modifications. We developed a means to identify and visualize operons and superoperons. We designed a framework for the cross-genome search for transcription factor binding sites that takes into account high GC-content and oligonucleotide usage profile characteristic of the R. sphaeroides genome. To facilitate reconstruction of directional relationships between co-regulated genes, we screened upstream sequences (-400 to +20bp from start codons) of all genes for putative binding sites of bacterial transcription factors using a self-optimizing search method developed here. To test performance of the meta-analysis tools and transcription factor site predictions, we reconstructed selected nodes of the R. sphaeroides transcription factor-centric regulatory matrix. The test revealed regulatory relationships that correlate well with the experimentally derived data. The database of transcriptional profile correlations, the network visualization engine and the optimized search engine for transcription factor binding sites analysis are available at http://rhodobase.org. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.

  7. IMPROVING THE RELIABILITY OF MICROARRAYS FOR TOXICOLOGY RESEARCH: A COLLABORATIVE APPROACH

    EPA Science Inventory

    Microarray-based gene expression profiling is a critical tool to identify molecular biomarkers of specific chemical stressors. Although current microarray technologies have progressed from their infancy, biological and technical repeatability and reliability are often still limit...

  8. EzArray: A web-based highly automated Affymetrix expression array data management and analysis system

    PubMed Central

    Zhu, Yuerong; Zhu, Yuelin; Xu, Wei

    2008-01-01

    Background Though microarray experiments are very popular in life science research, managing and analyzing microarray data are still challenging tasks for many biologists. Most microarray programs require users to have sophisticated knowledge of mathematics, statistics and computer skills for usage. With accumulating microarray data deposited in public databases, easy-to-use programs to re-analyze previously published microarray data are in high demand. Results EzArray is a web-based Affymetrix expression array data management and analysis system for researchers who need to organize microarray data efficiently and get data analyzed instantly. EzArray organizes microarray data into projects that can be analyzed online with predefined or custom procedures. EzArray performs data preprocessing and detection of differentially expressed genes with statistical methods. All analysis procedures are optimized and highly automated so that even novice users with limited pre-knowledge of microarray data analysis can complete initial analysis quickly. Since all input files, analysis parameters, and executed scripts can be downloaded, EzArray provides maximum reproducibility for each analysis. In addition, EzArray integrates with Gene Expression Omnibus (GEO) and allows instantaneous re-analysis of published array data. Conclusion EzArray is a novel Affymetrix expression array data analysis and sharing system. EzArray provides easy-to-use tools for re-analyzing published microarray data and will help both novice and experienced users perform initial analysis of their microarray data from the location of data storage. We believe EzArray will be a useful system for facilities with microarray services and laboratories with multiple members involved in microarray data analysis. EzArray is freely available from . PMID:18218103

  9. EDGE3: A web-based solution for management and analysis of Agilent two color microarray experiments

    PubMed Central

    Vollrath, Aaron L; Smith, Adam A; Craven, Mark; Bradfield, Christopher A

    2009-01-01

    Background The ability to generate transcriptional data on the scale of entire genomes has been a boon both in the improvement of biological understanding and in the amount of data generated. The latter, the amount of data generated, has implications when it comes to effective storage, analysis and sharing of these data. A number of software tools have been developed to store, analyze, and share microarray data. However, a majority of these tools do not offer all of these features nor do they specifically target the commonly used two color Agilent DNA microarray platform. Thus, the motivating factor for the development of EDGE3 was to incorporate the storage, analysis and sharing of microarray data in a manner that would provide a means for research groups to collaborate on Agilent-based microarray experiments without a large investment in software-related expenditures or extensive training of end-users. Results EDGE3 has been developed with two major functions in mind. The first function is to provide a workflow process for the generation of microarray data by a research laboratory or a microarray facility. The second is to store, analyze, and share microarray data in a manner that doesn't require complicated software. To satisfy the first function, EDGE3 has been developed as a means to establish a well defined experimental workflow and information system for microarray generation. To satisfy the second function, the software application utilized as the user interface of EDGE3 is a web browser. Within the web browser, a user is able to access the entire functionality, including, but not limited to, the ability to perform a number of bioinformatics based analyses, collaborate between research groups through a user-based security model, and access to the raw data files and quality control files generated by the software used to extract the signals from an array image. Conclusion Here, we present EDGE3, an open-source, web-based application that allows for the storage, analysis, and controlled sharing of transcription-based microarray data generated on the Agilent DNA platform. In addition, EDGE3 provides a means for managing RNA samples and arrays during the hybridization process. EDGE3 is freely available for download at . PMID:19732451

  10. EDGE(3): a web-based solution for management and analysis of Agilent two color microarray experiments.

    PubMed

    Vollrath, Aaron L; Smith, Adam A; Craven, Mark; Bradfield, Christopher A

    2009-09-04

    The ability to generate transcriptional data on the scale of entire genomes has been a boon both in the improvement of biological understanding and in the amount of data generated. The latter, the amount of data generated, has implications when it comes to effective storage, analysis and sharing of these data. A number of software tools have been developed to store, analyze, and share microarray data. However, a majority of these tools do not offer all of these features nor do they specifically target the commonly used two color Agilent DNA microarray platform. Thus, the motivating factor for the development of EDGE(3) was to incorporate the storage, analysis and sharing of microarray data in a manner that would provide a means for research groups to collaborate on Agilent-based microarray experiments without a large investment in software-related expenditures or extensive training of end-users. EDGE(3) has been developed with two major functions in mind. The first function is to provide a workflow process for the generation of microarray data by a research laboratory or a microarray facility. The second is to store, analyze, and share microarray data in a manner that doesn't require complicated software. To satisfy the first function, EDGE3 has been developed as a means to establish a well defined experimental workflow and information system for microarray generation. To satisfy the second function, the software application utilized as the user interface of EDGE(3) is a web browser. Within the web browser, a user is able to access the entire functionality, including, but not limited to, the ability to perform a number of bioinformatics based analyses, collaborate between research groups through a user-based security model, and access to the raw data files and quality control files generated by the software used to extract the signals from an array image. Here, we present EDGE(3), an open-source, web-based application that allows for the storage, analysis, and controlled sharing of transcription-based microarray data generated on the Agilent DNA platform. In addition, EDGE(3) provides a means for managing RNA samples and arrays during the hybridization process. EDGE(3) is freely available for download at http://edge.oncology.wisc.edu/.

  11. Specific interaction of mutant p53 with regions of matrix attachment region DNA elements (MARs) with a high potential for base-unpairing

    PubMed Central

    Will, Katrin; Warnecke, Gabriele; Wiesmüller, Lisa; Deppert, Wolfgang

    1998-01-01

    Mutant, but not wild-type p53 binds with high affinity to a variety of MAR-DNA elements (MARs), suggesting that MAR-binding of mutant p53 relates to the dominant-oncogenic activities proposed for mutant p53. MARs recognized by mutant p53 share AT richness and contain variations of an AATATATTT “DNA-unwinding motif,” which enhances the structural dynamics of chromatin and promotes regional DNA base-unpairing. Mutant p53 specifically interacted with MAR-derived oligonucleotides carrying such unwinding motifs, catalyzing DNA strand separation when this motif was located within a structurally labile sequence environment. Addition of GC-clamps to the respective MAR-oligonucleotides or introducing mutations into the unwinding motif strongly reduced DNA strand separation, but supported the formation of tight complexes between mutant p53 and such oligonucleotides. We conclude that the specific interaction of mutant p53 with regions of MAR-DNA with a high potential for base-unpairing provides the basis for the high-affinity binding of mutant p53 to MAR-DNA. PMID:9811860

  12. Toward a solid-phase nucleic acid hybridization assay within microfluidic channels using immobilized quantum dots as donors in fluorescence resonance energy transfer.

    PubMed

    Chen, Lu; Algar, W Russ; Tavares, Anthony J; Krull, Ulrich J

    2011-01-01

    The optical properties and surface area of quantum dots (QDs) have made them an attractive platform for the development of nucleic acid biosensors based on fluorescence resonance energy transfer (FRET). Solid-phase assays based on FRET using mixtures of immobilized QD-oligonucleotide conjugates (QD biosensors) have been developed. The typical challenges associated with solid-phase detection strategies include non-specific adsorption, slow kinetics of hybridization, and sample manipulation. The new work herein has considered the immobilization of QD biosensors onto the surfaces of microfluidic channels in order to address these challenges. Microfluidic flow can be used to dynamically control stringency by adjustment of the potential in an electrokinetic-based microfluidics environment. The shearing force, Joule heating, and the competition between electroosmotic and electrophoretic mobilities allow the optimization of hybridization conditions, convective delivery of target to the channel surface to speed hybridization, amelioration of adsorption, and regeneration of the sensing surface. Microfluidic flow can also be used to deliver (for immobilization) and remove QD biosensors. QDs that were conjugated with two different oligonucleotide sequences were used to demonstrate feasibility. One oligonucleotide sequence on the QD was available as a linker for immobilization via hybridization with complementary oligonucleotides located on a glass surface within a microfluidic channel. A second oligonucleotide sequence on the QD served as a probe to transduce hybridization with target nucleic acid in a sample solution. A Cy3 label on the target was excited by FRET using green-emitting CdSe/ZnS QD donors and provided an analytical signal to explore this detection strategy. The immobilized QDs could be removed under denaturing conditions by disrupting the duplex that was used as the surface linker and thus allowed a new layer of QD biosensors to be re-coated within the channel for re-use of the microfluidic chip.

  13. alpha-DNA II. Synthesis of unnatural alpha-anomeric oligodeoxyribonucleotides containing the four usual bases and study of their substrate activities for nucleases.

    PubMed Central

    Morvan, F; Rayner, B; Imbach, J L; Thenet, S; Bertrand, J R; Paoletti, J; Malvy, C; Paoletti, C

    1987-01-01

    This paper describes for the first time the synthesis of alpha-oligonucleotides containing the four usual bases. Two unnatural hexadeoxyribonucleotides: alpha-[d(CpApTpGpCpG)] and alpha-[d(CpGpCpApTpG)], consisting only of alpha-anomeric nucleotide units, were obtained by an improved phosphotriester method, in solution. Starting material was the four base-protected alpha-deoxyribonucleosides 3a-d. Pyrimidine alpha-deoxynucleosides 3a and 3b were prepared by self-anomerization reactions followed by selective deprotection of sugar hydroxyles, while the two purine alpha-deoxynucleosides 3c and 3d were prepared by glycosylation reactions. In the case of guanine alpha-nucleoside derivative a supplementary base-protecting group: N,N-diphenylcarbamoyl was introduced on O6-position in order to avoid side-reactions during oligonucleotide assembling. The hexadeoxynucleotide alpha-[d(CpApTpGpCpG)] was tested as substrate of selected endo- and exonucleases. In conditions where the natural corresponding beta-hexamer was completely degradated by nuclease S1 and calf spleen phosphodiesterase, the alpha-oligonucleotide remained almost intact. PMID:3575096

  14. Functionalized bioengineered spider silk spheres improve nuclease resistance and activity of oligonucleotide therapeutics providing a strategy for cancer treatment.

    PubMed

    Kozlowska, Anna Karolina; Florczak, Anna; Smialek, Maciej; Dondajewska, Ewelina; Mackiewicz, Andrzej; Kortylewski, Marcin; Dams-Kozlowska, Hanna

    2017-09-01

    Cell-selective delivery and sensitivity to serum nucleases remain major hurdles to the clinical application of RNA-based oligonucleotide therapeutics, such as siRNA. Spider silk shows great potential as a biomaterial due to its biocompatibility and biodegradability. Self-assembling properties of silk proteins allow for processing into several different morphologies such as fibers, scaffolds, films, hydrogels, capsules and spheres. Moreover, bioengineering of spider silk protein sequences can functionalize silk by adding peptide moieties with specific features including binding or cell recognition domains. We demonstrated that modification of silk protein by adding the nucleic acid binding domain enabled the development of a novel oligonucleotide delivery system that can be utilized to improve pharmacokinetics of RNA-based therapeutics, such as CpG-siRNA. The MS2 bioengineered silk was functionalized with poly-lysine domain (KN) to generate hybrid silk MS2KN. CpG-siRNA efficiently bound to MS2KN in contrary to control MS2. Both MS2KN complexes and spheres protected CpG-siRNA from degradation by serum nucleases. CpG-siRNA molecules encapsulated into MS2KN spheres were efficiently internalized and processed by TLR9-positive macrophages. Importantly, CpG-STAT3siRNA loaded in silk spheres showed delayed and extended target gene silencing compared to naked oligonucleotides. The prolonged Stat3 silencing resulted in the more pronounced downregulation of interleukin 6 (IL-6), a proinflammatory cytokine and upstream activator of STAT3, which limits the efficacy of TLR9 immunostimulation. Our results demonstrate the feasibility of using spider silk spheres as a carrier of therapeutic nucleic acids. Moreover, the modified kinetic and activity of the CpG-STAT3siRNA embedded into silk spheres is likely to improve immunotherapeutic effects in vivo. We demonstrated that modification of silk protein by adding the nucleic acid binding domain enabled the development of a novel oligonucleotide delivery system that can be utilized to improve pharmacokinetics of RNA-based therapeutics. Although, the siRNA constructs have already given very promising results in the cancer therapy, the in vivo application of RNA-based oligonucleotide therapeutics still is limited due to their sensitivity to serum nucleases and some toxicity. We propose a carrier for RNA-based therapeutics that is made of bioengineered spider silk. We showed that functionalized bioengineered spider silk spheres not only protected RNA-based therapeutics from degradation by serum nucleases, but what is more important the embedding of siRNA into silk spheres delayed and extended target gene silencing compared with naked oligonucleotides. Moreover, we showed that plain silk spheres did not have unspecific effect on target gene levels proving not only to be non-cytotoxic but also very neutral vehicles in terms of TLR9/STAT3 activation in macrophages. We demonstrated advantages of novel delivery technology in safety and efficacy comparing with delivery of naked CpG-STAT3siRNA therapeutics. Copyright © 2017 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.

  15. Assessment of new biocompatible poly(N-(morpholino)ethyl methacrylate)-based copolymers by transfection of immortalized keratinocytes.

    PubMed

    Van Overstraeten-Schlögel, Nancy; Shim, Yong-Ho; Tevel, Virginie; Piel, Géraldine; Piette, Jacques; Dubois, Philippe; Raes, Martine

    2012-02-01

    Skin carcinomas are among the most commonly diagnosed tumors in the world. In this study, we investigated the transfection of immortalized keratinocytes, used as an in vitro model for skin carcinoma, using the antisense technology and poly(2-(dimethylamino)ethyl methacrylate) (PDMAEMA)-based copolymers. In order to improve the transfection efficiency of the classic PDMAEMA polymers, copolymers were synthesized including a poly(N-morpholino)ethylmethacrylate) (PMEMA) moiety for an improved proton-sponge effect, intended to favour the release of the oligonucleotide from the acidic endosome. These copolymers were synthesized either statistically (with alternating PDMAEMA and PMEMA fragments) or in blocks (one PDMAEMA block followed by one PMEMA block). MTT assays were performed using the PDMAEMA-PMEMA copolymers and revealed no significant cytotoxicity of these polymers at an N/P ratio of 7.3. Using fluorescent oligonucleotides and analyzing transfection efficiency by flow cytometry, we noticed no significant differences between the two kinds of copolymers. However copolymers with a higher DMAEMA content and a higher Mn were also those displaying the highest vectorization efficiency. Confocal microscopy showed that these copolymers induced a fine granular distribution of the transfected antisense oligonucleotides inside the cells. We also assessed the functionality of the transfected antisense oligonucleotide by transfecting immortalized GFP expressing keratinocytes with a GFP antisense oligonucleotide using these copolymers. A significant silencing was achieved with a PDMAEMA-PMEMA in block copolymer (Mn=41,000, 89 % PDMAEMA). Together, these results suggest that PDMAEMA-PMEMA copolymers combining low toxicity, vectorization and proton sponge properties, can be efficiently used to transfect immortalized keratinocytes and so open new perspectives in the therapy of skin carcinomas as well as of other skin diseases of genetic or immunological origin. © 2012 Informa Healthcare USA, Inc.

  16. MALDI MS analysis of oligonucleotides: desalting by functional magnetite beads using microwave-assisted extraction.

    PubMed

    Chen, Wei-Yu; Chen, Yu-Chie

    2007-11-01

    The presence of alkali cation adductions of oligonucleotides commonly deteriorates matrix-assisted laser desorption/ionization (MALDI) mass spectra. Thus, desalting is required for oligonucleotide samples prior to MALDI MS analysis in order to prevent the mass spectra from developing poor quality. In this paper, we demonstrate a new approach to extract traces of oligonucleotides from aqueous solutions containing high concentrations of salts using microwave-assisted extraction. The C18-presenting magnetite beads, capable of absorbing microwave irradiation, are used as affinity probes for oligonucleotides with the addition of triethylammonium acetate as the counterions. This new microwave-assisted extraction approach using magnetite beads as the trapping agents and as microwave-absorbers has been demonstrated to be very effective in the selective binding of oligonucleotides from aqueous solutions. The extraction of oligonucleotides from solutions onto the C18-presenting magnetite beads takes only 30 s to enrich oligonucleotides in sufficient quantities for MALDI MS analysis. After using this desalting approach, alkali cation adductions of oligonucleotides are dramatically reduced in the MALDI mass spectra. The presence of saturated NaCl (approximately 6 M) in the oligonucleotide sample is tolerated without degrading the mass spectra. The detection limit for d(A)6 is approximately 2.8 fmol.

  17. [Impact of Delivery Method on Antiviral Activity of Phosphodiester, Phosphorothioate, and Phosphoryl Guanidine Oligonucleotides in MDCK Cells Infected with H5N1 Bird Flu Virus].

    PubMed

    Levina, A S; Repkova, M N; Chelobanov, B P; Bessudnova, E V; Mazurkova, N A; Stetsenko, D A; Zarytova, V F

    2017-01-01

    We have previously described nanocomposites containing conjugates or complexes of native oligodeoxyribonucleotides with poly-L-lysine and TiO2 nanoparticles. We have shown that these nanocomposites efficiently suppressed influenza A virus reproduction in MDCK cells. Here, we have synthesized previously undescribed nanocomposites that consist of TiO2 nanoparticles and polylysine conjugates with oligonucleotides that contain phosphoryl guanidine or phosphorothioate internucleotide groups. These nanocomposites have been shown to exhibit antiviral activity in MDCK cells infected with H5N1 influenza A virus. The nanocomposites containing phosphorothioate oligonucleotides inhibited virus replication ~130-fold. More potent inhibition, i.e., ~5000-fold or ~4600-fold, has been demonstrated by nanocomposites that contain phosphoryl guanidine or phosphodiester oligonucleotides, respectively. Free oligonucleotides have been nearly inactive. The antiviral activity of oligonucleotides of all three types, when delivered by Lipofectamine, has been significantly lower compared to the oligonucleotides delivered in the nanocomposites. In the former case, the phosphoryl guanidine oligonucleotide has appeared to be the most efficient; it has inhibited the virus replication by a factor of 400. The results make it possible to consider phosphoryl guanidine oligonucleotides, along with other oligonucleotide derivatives, as potential antiviral agents against H5N1 avian flu virus.

  18. Peptide-oligonucleotide conjugates as nanoscale building blocks for assembly of an artificial three-helix protein mimic

    NASA Astrophysics Data System (ADS)

    Lou, Chenguang; Martos-Maldonado, Manuel C.; Madsen, Charlotte S.; Thomsen, Rasmus P.; Midtgaard, Søren Roi; Christensen, Niels Johan; Kjems, Jørgen; Thulstrup, Peter W.; Wengel, Jesper; Jensen, Knud J.

    2016-07-01

    Peptide-based structures can be designed to yield artificial proteins with specific folding patterns and functions. Template-based assembly of peptide units is one design option, but the use of two orthogonal self-assembly principles, oligonucleotide triple helix and a coiled coil protein domain formation have never been realized for de novo protein design. Here, we show the applicability of peptide-oligonucleotide conjugates for self-assembly of higher-ordered protein-like structures. The resulting nano-assemblies were characterized by ultraviolet-melting, gel electrophoresis, circular dichroism (CD) spectroscopy, small-angle X-ray scattering and transmission electron microscopy. These studies revealed the formation of the desired triple helix and coiled coil domains at low concentrations, while a dimer of trimers was dominating at high concentration. CD spectroscopy showed an extraordinarily high degree of α-helicity for the peptide moieties in the assemblies. The results validate the use of orthogonal self-assembly principles as a paradigm for de novo protein design.

  19. DISC-BASED IMMUNOASSAY MICROARRAYS. (R825433)

    EPA Science Inventory

    Microarray technology as applied to areas that include genomics, diagnostics, environmental, and drug discovery, is an interesting research topic for which different chip-based devices have been developed. As an alternative, we have explored the principle of compact disc-based...

  20. Solid-phase synthesis of a nucleopeptide from the linking site of adenovirus-2 nucleoprotein, -Ser(p5'CATCAT)-Gly-Asp-. Convergent versus stepwise strategy.

    PubMed Central

    Robles, J; Pedroso, E; Grandas, A

    1995-01-01

    The synthesis of a nucleopeptide with the sequence -Ser(p5'CATCAT)-Gly-Asp- has been undertaken by either convergent or stepwise solid-phase strategies, both of which use base-labile permanent protecting groups. The coupling of phosphitylated protected peptides onto oligonucleotide-resins did not afford the desired nucleopeptide, which was nevertheless obtained after oligonucleotide elongation at the hydroxyl group of the resin-bound peptide and deprotection under mild basic conditions. A preliminary study on the stability of different nucleopeptides to bases is also reported. PMID:7479079

Top