Science.gov

Sample records for oligonucleotide phosphate acceptor

  1. Modification of end phosphate gruops in mono- and oligonucleotides.

    PubMed Central

    Shumyantzeva, V V; Sokolova, N I; Shabarova, Z A

    1976-01-01

    A method is described for selective activation of phosphomonoester end groups of oligonucleotides and nucleosidedi-(tri) phosphates via mixed anhydrides with mesitoic acid. Mixed anhydrides are synthesized in high yield and isolated by paper or DEAE-cellulose column chromatography. The ability of such anhydrides to phosphorylate different nucleophilic agents was used for synthesis of amidates, imidazolidates, esters, thioesters and pyrophosphates of mono- and oligonucleotides. Mixed anhydrides mono-, oligonucleotides and nucleosidedi-(tri)phosphates and mesitoic acid were also applied to achieve immobilization of the mono- and oligonucleotides via their end groups on hexamethylenediamine - Sepharose support. Mixed anhydrides studied may be efficiently used for affinity labeling of proteins and nucleic acids and also as material for preparating reagents for template reactions. PMID:1272808

  2. Design and synthesis of triazolyl-donor/acceptor unnatural nucleosides and oligonucleotide probes containing triazolyl-phenanthrene nucleoside.

    PubMed

    Bag, Subhendu Sekhar; Talukdar, Sangita; Das, Suman Kalyan

    2014-09-08

    In the context of abasic DNA or DNA duplex stabilization, several unnatural nucleosidic/non-nucleosidic base surrogates have been reported. Toward this end, we have designed and synthesized triazolyl-aromatic donor chomophores as unnatural nucleoside analogs. These modifications display markedly higher thermal stabilization of abasic DNA duplex in comparison to the stabilization offered by other nucleoside/non-nucleoside base surrogates reported in the literature. The same oligonucleotide probe containing triazolylphenanthrene nucleotide also offers very good stability of the self-pair duplex via π-π stacking interaction and hetero-pair duplex via charge transfer interaction when paired against triazolyl acceptor aromatic nucleoside. Moreover, the probe in the reverse sequence containing triazolylphenanthrene nucleotide has shown FRET efficiency in a chimeric DNA duplex. The triazolyl nucleotides would expectedly show stability toward exonuclease activity. This unit describes protocols for chemical synthesis of unnatural triazolyl nucleosides and one oligonucleotide probe. The unit also provides a summary of various thermal and photophysical applications of triazolylphenantherene-containing oligonucleotides. Copyright © 2014 John Wiley & Sons, Inc.

  3. Oligonucleotides with rapid turnover of the phosphate groups occur endogenously in eukaryotic cells

    SciTech Connect

    Plesner, P.; Goodchild, J.; Kalckar, H.M.; Zamecnik, P.C.

    1987-04-01

    Endogenous oligonucleotides were found in trichloroacetic acid extracts of hamster lung fibroblasts and Tetrahymena cells. Peaks of radioactivity that eluted with retention times similar to oligonucleotide markers (5- to 50-mer) were found by HPLC in cells labeled briefly with /sup 32/Pi. Only minute amounts of UV-absorbing material were detected, consistent with a rapid turnover of phosphate groups. The /sup 32/P-labeled material also migrated as oligonucleotides on 20% polyacrylamide gels; it was not hydrolyzed by alkaline phosphatase but was digested by snake venom phosphodiesterase, S1 nuclease, and pancreatic RNase and was phosphorylated by T4 polynucleotide kinase. The /sup 32/P-labeled material isolated by HPLC was alkali labile and the hydrolyzate ran as nucleotides on paper chromatography. It is concluded that the oligonucleotides are mainly oligoribonucleotides, but it is possible that oligodeoxynucleotides are also present.

  4. [Point contacts of T7 RNA polymerase in the promotor complex, as determined with phosphate-activated oligonucleotide derivatives].

    PubMed

    Filippova, S E; Ivanovskaia, M G; Romanova, E A; Tunitskaia, V L; Kochetkov, S N

    2002-01-01

    The contacts between phosphate groups of promoter DNA an Lys or His of T7 RNA polmerase (Pol) in the Pol-promoter complex were studied with single- and double- stranded oligonucleotides, which corresponded to the T7 promoter consensus and contained activated phosphate groups at position +1, +2, or -14 relative to the transcription start. To obtain reactive groups, terminal phosphates were modified with N-oxybenzotriazole (HOBT), and internucleotide phosphates were repalced with a trisubstituted pyrophosphate (TSP). The resulting derivatives produced covalent complexes with T7 Pol. Covalent bonding involved His in the case of TSP at position +1 or HOBT at position +1 or -14, and Lys in the case of TSB at position -14.

  5. [Synthesis of 11-phenoxyundecyl phosphate and its use as an acceptor substrate in the reaction with UDP-GlcNAc : polyprenyl phosphate GlcNAc-phosphotransferase from Salmonella arizona O:59].

    PubMed

    Danilov, L L; Veselovskiĭ, V V; Balagurova, N M; Druzhinina, T N

    2009-01-01

    A new scheme of synthesis of 11-phenoxyundecyl phosphate from 11-bromoundecanoic acid was suggested for its ability to react as an acceptor of 2-acetamido-2-deoxy-alpha-D-glucopyranosyl phosphate in a reaction catalyzed by UDP-N-acetylglucosamine : polyprenyl phosphate N-acetylglucosamine phosphotransferase from Salmonella arizona O:59.

  6. Changes in phosphorylation of adenosine phosphate and redox state of nicotinamide-adenine dinucleotide (phosphate) in Geobacter sulfurreducens in response to electron acceptor and anode potential variation.

    PubMed

    Rose, Nicholas D; Regan, John M

    2015-12-01

    Geobacter sulfurreducens is one of the dominant bacterial species found in biofilms growing on anodes in bioelectrochemical systems. The intracellular concentrations of reduced and oxidized forms of nicotinamide-adenine dinucleotide (NADH and NAD(+), respectively) and nicotinamide-adenine dinucleotide phosphate (NADPH and NADP(+), respectively) as well as adenosine triphosphate (ATP), adenosine diphosphate (ADP), and adenosine monophosphate (AMP) were measured in G. sulfurreducens using fumarate, Fe(III)-citrate, or anodes poised at different potentials (110, 10, -90, and -190 mV (vs. SHE)) as the electron acceptor. The ratios of CNADH/CNAD+ (0.088±0.022) and CNADPH/CNADP+ (0.268±0.098) were similar under all anode potentials tested and with Fe(III)-citrate (reduced extracellularly). Both ratios significantly increased with fumarate as the electron acceptor (0.331±0.094 for NAD and 1.96±0.37 for NADP). The adenylate energy charge (the fraction of phosphorylation in intracellular adenosine phosphates) was maintained near 0.47 under almost all conditions. Anode-growing biofilms demonstrated a significantly higher molar ratio of ATP/ADP relative to suspended cultures grown on fumarate or Fe(III)-citrate. These results provide evidence that the cellular location of reduction and not the redox potential of the electron acceptor controls the intracellular redox potential in G. sulfurreducens and that biofilm growth alters adenylate phosphorylation.

  7. [Synthesis of 11-[(2-pyridyl)amino]- and 11-[(9-anthracenylcarbonyl)amino]undecyl phosphate and investigation of their acceptor properties in the enzymic reaction catalyzed by galactosylphosphotransferases from Salmonella].

    PubMed

    Danilov, L L; Balagurova, N M; Vinnikova, A N; Utkina, N S; Torgov, V I; Kalinchuk, N A; Druzhinina, T N; Veselovsky, V V

    2014-01-01

    11-[(2-Pyridyl)amino]undecyl phosphate and 11-[(9-anthracenylcarbonyl)amino]undecyl phosphate were chemically synthesized. The abiliy of these new fluorescent derivatives of undecyl phosphate to serve as acceptor substrate of galactosyl phosphate residue in the enzymic reaction catalyzed by galactosylphosphotransferase from Salmonella anatum or Salmonella newport membrane preparation was demonstrated.

  8. Isomer-selected photoelectron spectroscopy of isolated DNA oligonucleotides: phosphate and nucleobase deprotonation at high negative charge states.

    PubMed

    Vonderach, Matthias; Ehrler, Oli T; Matheis, Katerina; Weis, Patrick; Kappes, Manfred M

    2012-05-09

    Fractionation according to ion mobility and mass-to-charge ratio has been used to select individual isomers of deprotonated DNA oligonucleotide multianions for subsequent isomer-resolved photoelectron spectroscopy (PES) in the gas phase. Isomer-resolved PE spectra have been recorded for tetranucleotides, pentanucleotides, and hexanucleotides. These were studied primarily in their highest accessible negative charge states (3-, 4-, and 5-, respectively), as provided by electrospraying from room temperature solutions. In particular, the PE spectra obtained for pentanucleotide tetraanions show evidence for two coexisting classes of gas-phase isomeric structures. We suggest that these two classes comprise: (i) species with excess electrons localized exclusively at deprotonated phosphate backbone sites and (ii) species with at least one deprotonated base (in addition to several deprotonated phosphates). By permuting the sequence of bases in various [A(5-x)T(x)](4-) and [GT(4)](4-) pentanucleotides, we have established that the second type of isomer is most likely to occur if the deprotonated base is located at the first or last position in the sequence. We have used a combination of molecular mechanics and semiempirical calculations together with a simple electrostatic model to explore the photodetachment mechanism underlying our photoelectron spectra. Comparison of predicted to measured photoelectron spectra suggests that a significant fraction of the detected electrons originates from the DNA bases (both deprotonated and neutral).

  9. Synthesis and properties of carbohydrate-phosphate backbone-modified oligonucleotide analogues and nucleic acid mimetics

    NASA Astrophysics Data System (ADS)

    Abramova, Tatyana V.; Silnikov, Vladimir N.

    2011-05-01

    Advances in the synthesis of oligo(deoxy)ribonucleotide analogues and nucleic acid mimetics made in the last decade are summarized. Attention is focused on new methods for the synthesis of derivatives with a modified ribose-phosphate backbone (phosphorothioate, boranophosphate, and nucleoside phosphonate derivatives) and derivatives devoid of the phosphate group. Among nucleic acid mimetics, conformationally restricted modified peptide nucleic acids, including those bearing a negative or positive charge, and morpholino oligomers are considered. Advantages and drawbacks of the main types of analogues as regards the complexity of the synthesis and the possibility of their application as antisense agents or reagents for hybridization analysis are compared.

  10. Characterization of Ruminococcus albus cellodextrin phosphorylase and identification of a key phenylalanine residue for acceptor specificity and affinity to the phosphate group.

    PubMed

    Sawano, Tatsuya; Saburi, Wataru; Hamura, Ken; Matsui, Hirokazu; Mori, Haruhide

    2013-09-01

    Ruminococcus albus has the ability to intracellularly degrade cello-oligosaccharides primarily via phosphorolysis. In this study, the enzymatic characteristics of R. albus cellodextrin phosphorylase (RaCDP), which is a member of glycoside hydrolase family 94, was investigated. RaCDP catalyzes the phosphorolysis of cellotriose through an ordered 'bi bi' mechanism in which cellotriose binds to RaCDP before inorganic phosphate, and then cellobiose and glucose 1-phosphate (Glc1P) are released in that order. Among the cello-oligosaccharides tested, RaCDP had the highest phosphorolytic and synthetic activities towards cellohexaose and cellopentaose, respectively. RaCDP successively transferred glucosyl residues from Glc1P to the growing cello-oligosaccharide chain, and insoluble cello-oligosaccharides comprising a mean of eight residues were produced. Sophorose, laminaribiose, β-1,4-xylobiose, β-1,4-mannobiose and cellobiitol served as acceptors for RaCDP. RaCDP had very low affinity for phosphate groups in both the phosphorolysis and synthesis directions. A sequence comparison revealed that RaCDP has Gln at position 646 where His is normally conserved in the phosphate binding sites of related enzymes. A Q646H mutant showed approximately twofold lower apparent K(m) values for inorganic phosphate and Glc1P than the wild-type. RaCDP has Phe at position 633 corresponding to Tyr and Val in the +1 subsites of cellobiose phosphorylase and N,N'-diacetylchitobiose phosphorylase, respectively. A F633Y mutant showed higher preference for cellobiose over β-1,4-mannobiose as an acceptor substrate in the synthetic reaction than the wild-type. Furthermore, the F633Y mutant showed 75- and 1100-fold lower apparent Km values for inorganic phosphate and Glc1P, respectively, in phosphorolysis and synthesis of cellotriose. © 2013 FEBS.

  11. Improving the Delivery of SOD1 Antisense Oligonucleotides to Motor Neurons Using Calcium Phosphate-Lipid Nanoparticles

    PubMed Central

    Chen, Liyu; Watson, Clare; Morsch, Marco; Cole, Nicholas J.; Chung, Roger S.; Saunders, Darren N.; Yerbury, Justin J.; Vine, Kara L.

    2017-01-01

    Amyotrophic Lateral Sclerosis (ALS) is a fatal neurodegenerative disease affecting the upper and lower motor neurons in the motor cortex and spinal cord. Abnormal accumulation of mutant superoxide dismutase I (SOD1) in motor neurons is a pathological hallmark of some forms of the disease. We have shown that the orderly progression of the disease may be explained by misfolded SOD1 cell-to-cell propagation, which is reliant upon its active endogenous synthesis. Reducing the levels of SOD1 is therefore a promising therapeutic approach. Antisense oligonucleotides (ASOs) can efficiently silence proteins with gain-of-function mutations. However, naked ASOs have a short circulation half-life and are unable to cross the blood brain barrier (BBB) warranting the use of a drug carrier for effective delivery. In this study, calcium phosphate lipid coated nanoparticles (CaP-lipid NPs) were developed for delivery of SOD1 ASO to motor neurons. The most promising nanoparticle formulation (Ca/P ratio of 100:1), had a uniform spherical core–shell morphology with an average size of 30 nm, and surface charge (ζ-potential) of −4.86 mV. The encapsulation efficiency of ASO was 48% and stability studies found the particle to be stable over a period of 20 days. In vitro experiments demonstrated that the negatively charged ASO-loaded CaP-lipid NPs could effectively deliver SOD1-targeted ASO into a mouse motor neuron-like cell line (NSC-34) through endocytosis and significantly down-regulated SOD1 expression in HEK293 cells. The CaP-lipid NPs exhibited a pH-dependant dissociation, suggesting that that the acidification of lysosomes is the likely mechanism responsible for facilitating intracellular ASO release. To demonstrate tissue specific delivery and localization of these NPs we performed in vivo microinjections into zebrafish. Successful delivery of these NPs was confirmed for the zebrafish brain, the blood stream, and the spinal cord. These results suggest that CaP-lipid NPs could

  12. 11-Phenoxyundecyl phosphate as a 2-acetamido-2-deoxy-α-d-glucopyranosyl phosphate acceptor in O-antigen repeating unit assembly of Salmonella arizonae O:59.

    PubMed

    Druzhinina, Tatyana N; Danilov, Leonid L; Torgov, Vladimir I; Utkina, Natalya S; Balagurova, Nadezhda M; Veselovsky, Vladimir V; Chizhov, Alexander O

    2010-12-10

    A synthesis of 11-phenoxyundecyl phosphate and its biochemical transformation (using GlcNAc-P transferase from Salmonella arizonae O:59 membranes catalysing transfer of GlcNc-phosphate from UDP-GlcNAc on lipid-phosphate) into P(1)-11-phenoxyundecyl, P(2)-2-acetamido-2-deoxy-α-D-glucopyranosyl diphosphate are described. Copyright © 2010 Elsevier Ltd. All rights reserved.

  13. Fluorescent mannosides serve as acceptor substrates for glycosyltransferase and sugar-1-phosphate transferase activities in Euglena gracilis membranes.

    PubMed

    Ivanova, Irina M; Nepogodiev, Sergey A; Saalbach, Gerhard; O'Neill, Ellis C; Urbaniak, Michael D; Ferguson, Michael A J; Gurcha, Sudagar S; Besra, Gurdyal S; Field, Robert A

    2017-01-13

    Synthetic hexynyl α-D-mannopyranoside and its α-1,6-linked disaccharide counterpart were fluorescently labelled through CuAAC click chemistry with 3-azido-7-hydroxycoumarin. The resulting triazolyl-coumarin adducts, which were amenable to analysis by TLC, HPLC and mass spectrometry, proved to be acceptor substrates for α-1,6-ManT activities in mycobacterial membranes, as well as α- and β-GalT activities in trypanosomal membranes, benchmarking the potential of the fluorescent acceptor approach against earlier radiochemical assays. Following on to explore the glycobiology of the benign protozoan alga Euglena gracilis, α-1,3- and α-1,2-ManT activities were detected in membrane preparations, along with GlcT, Glc-P-T and GlcNAc-P-T activities. These studies serve to demonstrate the potential of readily accessible fluorescent glycans as substrates for exploring carbohydrate active enzymes.

  14. DNA triplex formation of oligonucleotide analogues consisting of linker groups and octamer segments that have opposite sugar-phosphate backbone polarities

    SciTech Connect

    Ono, A.; Kan, Lousing ); Chingnien Chen )

    1991-10-15

    The DNA oligomer analogues 3{prime}d (CTTTCTT) 5{prime}-P4-5{prime}d(TTCTTCTT)3{prime} (4), 5{prime}d-(TTTCTTTC) 3{prime}-P2-3{prime}d(CTTTCTTT)5{prime} (5), and 5{prime}d(TTTCTTTC)3{prime}-P2-3{prime}d(CTTTCTTT)5{prime}-P4-5{prime}d-(TTCTTCTT)3{prime} (6) (P2 = {Rho}*{Rho} and P4 = {Rho}*{Rho}*{Rho}{Rho}, where {Rho} = phosphate and * = 1,3-propanediol) have been synthesized. These oligomers consist of a linker group or groups and homopyrimidine oligonucleotides which have opposite sugar-phosphate backbone polarities. These oligomer analogues are designed to form triplexes with a duplex, 5{prime}d(AAAGAAAGCCCTTTCTTTAAGAAGAA)3'{center dot} 5{prime}d(TTCTTCTTAAAGAAAGGGCTTTCTTT)3{prime} (1), which contains small homopurine clusters alternately located in both strands. The length of the linker groups, P2 and P4, was based upon a computer modeling analysis. Triplex formation by the unlinked octamers 5{prime}d(TTCTTCTT)3{prime}(2) and 5{prime}d(TTTCTTTC)3{prime} (3) and the linked oligomer analogues 4-6 with the target duplex was studied by thermal denaturation at pH 5.2. The order of stabilities of triplex formation by these oligomers was 1-5 >> 1-4 >1-(2, 3). The mixture of 1 and 6 showed two transitions corresponding to the dissociation of the third strand. These results are useful when considering the using of oligonucleotide analogues that can bind as third strands to DNA duplexes of higher complexity.

  15. Effect of phosphate activating group on oligonucleotide formation on montmorillonite: the regioselective formation of 3',5'-linked oligoadenylates

    NASA Technical Reports Server (NTRS)

    Prabahar, K. J.; Cole, T. D.; Ferris, J. P.

    1994-01-01

    The effects of amine structure on the montmorillonite-catalyzed oligomerization of the 5'-phosphoramidates of adenosine are investigated. 4-Aminopyridine derivatives yielded oligoadenylates as long as dodecamers with a regioselectivity for 3',5'-phosphodiester bond formation averaging 88%. Linear and cyclic oligomers are obtained and no A5'ppA-containing products are detected. Oligomers as long as the hexanucleotide are obtained using 2-aminobenzimidazole as the activating group. A predominance of pA2'pA is detected in the dimer fraction along with cyclic 3',5'-trimer; no A5'ppA-containing oligomers were detected. Little or no oligomer formation was observed when morpholine, piperidine, pyrazole, 1,2,4-triazole, and 2-pyridone are used as phosphate-activating groups. The effects of the structure of the phosphate activating group on the oligomer structure and chain lengths are discussed.

  16. Effect of phosphate activating group on oligonucleotide formation on montmorillonite: the regioselective formation of 3',5'-linked oligoadenylates

    NASA Technical Reports Server (NTRS)

    Prabahar, K. J.; Cole, T. D.; Ferris, J. P.

    1994-01-01

    The effects of amine structure on the montmorillonite-catalyzed oligomerization of the 5'-phosphoramidates of adenosine are investigated. 4-Aminopyridine derivatives yielded oligoadenylates as long as dodecamers with a regioselectivity for 3',5'-phosphodiester bond formation averaging 88%. Linear and cyclic oligomers are obtained and no A5'ppA-containing products are detected. Oligomers as long as the hexanucleotide are obtained using 2-aminobenzimidazole as the activating group. A predominance of pA2'pA is detected in the dimer fraction along with cyclic 3',5'-trimer; no A5'ppA-containing oligomers were detected. Little or no oligomer formation was observed when morpholine, piperidine, pyrazole, 1,2,4-triazole, and 2-pyridone are used as phosphate-activating groups. The effects of the structure of the phosphate activating group on the oligomer structure and chain lengths are discussed.

  17. [Oligonucleotides and their analogs. II. Spectra of the circular dichroism of dinucleoside phosphate analogs containing 4-thiouracil].

    PubMed

    Kritsyn, A M; Mikhaĭlov, S N; Stepanov, S V; Florent'ev, V L

    1978-01-01

    The dinucleoside phosphates analogues APpSU, SUPpA and UPpSU have been synthesised by direct thionation of DNP analogues, containing cytosine. The structure of compounds prepared was proved by UV- and PMR-spectra. The CD spectra of the DNP analogues were examined. It has been demonstrated that the "induced" dichroism contribution in the Cotton-effect of DNP was substantial in the case of stacking conformations and negligible for unstacking conformations.

  18. Polyphosphorylation and non-enzymatic template-directed ligation of oligonucleotides

    NASA Technical Reports Server (NTRS)

    Gao, K.; Orgel, L. E.; Bada, J. L. (Principal Investigator)

    2000-01-01

    Oligonucleotide 5'-polyphosphates are formed under potentially prebiotic conditions from oligonucleotide 5'-phosphates and sodium trimetaphosphate. Oligonucleotides activated as polyphosphates undergo template-directed ligation. We believe that these reactions could have produced longer oligonucleotide products from shorter substrates under prebiotic conditions.

  19. Structures of bacterial polynucleotide kinase in a Michaelis complex with GTP•Mg2+ and 5'-OH oligonucleotide and a product complex with GDP•Mg2+ and 5'-PO4 oligonucleotide reveal a mechanism of general acid-base catalysis and the determinants of phosphoacceptor recognition.

    PubMed

    Das, Ushati; Wang, Li Kai; Smith, Paul; Jacewicz, Agata; Shuman, Stewart

    2014-01-01

    Clostridium thermocellum polynucleotide kinase (CthPnk), the 5' end-healing module of a bacterial RNA repair system, catalyzes reversible phosphoryl transfer from an NTP donor to a 5'-OH polynucleotide acceptor. Here we report the crystal structures of CthPnk-D38N in a Michaelis complex with GTP•Mg(2+) and a 5'-OH oligonucleotide and a product complex with GDP•Mg(2+) and a 5'-PO4 oligonucleotide. The O5' nucleophile is situated 3.0 Å from the GTP γ phosphorus in the Michaelis complex, where it is coordinated by Asn38 and is apical to the bridging β phosphate oxygen of the GDP leaving group. In the product complex, the transferred phosphate has undergone stereochemical inversion and Asn38 coordinates the 5'-bridging phosphate oxygen of the oligonucleotide. The D38N enzyme is poised for catalysis, but cannot execute because it lacks Asp38-hereby implicated as the essential general base catalyst that abstracts a proton from the 5'-OH during the kinase reaction. Asp38 serves as a general acid catalyst during the 'reverse kinase' reaction by donating a proton to the O5' leaving group of the 5'-PO4 strand. The acceptor strand binding mode of CthPnk is distinct from that of bacteriophage T4 Pnk.

  20. Structures of bacterial polynucleotide kinase in a Michaelis complex with GTP•Mg2+ and 5′-OH oligonucleotide and a product complex with GDP•Mg2+ and 5′-PO4 oligonucleotide reveal a mechanism of general acid-base catalysis and the determinants of phosphoacceptor recognition

    PubMed Central

    Das, Ushati; Wang, Li Kai; Smith, Paul; Jacewicz, Agata; Shuman, Stewart

    2014-01-01

    Clostridium thermocellum polynucleotide kinase (CthPnk), the 5′ end-healing module of a bacterial RNA repair system, catalyzes reversible phosphoryl transfer from an NTP donor to a 5′-OH polynucleotide acceptor. Here we report the crystal structures of CthPnk-D38N in a Michaelis complex with GTP•Mg2+ and a 5′-OH oligonucleotide and a product complex with GDP•Mg2+ and a 5′-PO4 oligonucleotide. The O5′ nucleophile is situated 3.0 Å from the GTP γ phosphorus in the Michaelis complex, where it is coordinated by Asn38 and is apical to the bridging β phosphate oxygen of the GDP leaving group. In the product complex, the transferred phosphate has undergone stereochemical inversion and Asn38 coordinates the 5′-bridging phosphate oxygen of the oligonucleotide. The D38N enzyme is poised for catalysis, but cannot execute because it lacks Asp38—hereby implicated as the essential general base catalyst that abstracts a proton from the 5′-OH during the kinase reaction. Asp38 serves as a general acid catalyst during the ‘reverse kinase’ reaction by donating a proton to the O5′ leaving group of the 5′-PO4 strand. The acceptor strand binding mode of CthPnk is distinct from that of bacteriophage T4 Pnk. PMID:24150947

  1. [Synthesis and acceptor properties of 11-[(9'-anthracenyl)methoxy]undecyl phosphate and P1-{11-[(9'-anthracenyl)methoxy]undecyl}-P2-(alpha-D-galactopyranosyl) diphosphate in the enzymic reactions catalyzed by galactosylphosphotransferase and mannosyltransferase from Salmonella newport].

    PubMed

    Vinnikova, A N; Utkina, N S; Danilov, L L; Torgov, V I; Druzhinina, T N; Veselovskiĭ, V V

    2013-01-01

    Fluorescent 11-[(9'-anthracenyl)methoxy]undecyl phosphate and P1-{11-[(9'-anthracenyl)methoxy]undecyl}-P2-(alpha-D-galactopyranosyl) diphosphate were chemically synthesized for the first time. The ability of the first compound to serve as substrate-acceptor ofgalactosyl phosphate residue and the second compound of mannosyl residue in enzymic reactions catalyzed by galactosylphosphotransferase and mannosyltransferase from Salmonella newport membrane preparation was demonstrated.

  2. Photovoltaic activity of layered zirconium phosphates containing covalently grafted ruthenium tris(bipyridyl) and diquat phosphonates as electron donor/acceptor sites.

    PubMed

    Teruel, Laura; Alonso, Marina; Quintana, M Carmen; Salvador, Alvaro; Juanes, Olga; Rodriguez-Ubis, Juan Carlos; Brunet, Ernesto; García, Hermenegildo

    2009-04-28

    Two layered zirconium phosphates containing Ru(bpy)(3)(2+) mono- or diphosphonates and diquat, {Ru(bpy)(3)(2+)[]/ZrP/DQ(++)} and Ru(bpy)(3)(2+)[]/ZrP/DQ(++), covalently attached to the phosphate layers exhibit notable photovoltaic response (the maximum V(OC), J(SC), and FF were 0.093 V, 16.8 microA cm(-2) and 0.33, respectively). The photocurrent spectra indicate that the photovoltaic response is due predominantly to direct photoexcitation of gamma-ZrP host, Ru(bpy)(3)(2+) and diquat acting as hole and electron traps, respectively, for the charge separated state of the semiconductor.

  3. Pentopyranosyl Oligonucleotide Systems

    NASA Technical Reports Server (NTRS)

    Wagner, Thomas; Huyuh, Hoan K.; Krishnamurthy, Ramanarayanan; Eschenmoser, Albert

    2002-01-01

    Beta-D-Xylopyranosyl-(4 - 2 )-oligonucleotides containing adenine and thymine as nucleohases were synthesized as a part of a systematic study of the pairing properties of pentopyranosyl oligonucleotides. Contrary to earlier expectations based on qualitative conformational criteria, Beta-D-xylopyranosyl(4 - 2 )- oligonucleotides show Watson-Crick pairing comparable in strength to that shown by pyranosyl-RNA.

  4. Pentopyranosyl Oligonucleotide Systems

    NASA Technical Reports Server (NTRS)

    Wagner, Thomas; Huyuh, Hoan K.; Krishnamurthy, Ramanarayanan; Eschenmoser, Albert

    2002-01-01

    Beta-D-Xylopyranosyl-(4 - 2 )-oligonucleotides containing adenine and thymine as nucleohases were synthesized as a part of a systematic study of the pairing properties of pentopyranosyl oligonucleotides. Contrary to earlier expectations based on qualitative conformational criteria, Beta-D-xylopyranosyl(4 - 2 )- oligonucleotides show Watson-Crick pairing comparable in strength to that shown by pyranosyl-RNA.

  5. The prebiotic synthesis of deoxythymidine oligonucleotides

    NASA Technical Reports Server (NTRS)

    Stephen-Sherwood, E.; Odom, D. G.; Oro, J.

    1974-01-01

    Deoxythymidine 5 prime-triphosphate in the presence of deoxythymidine 5 prime-phosphate, cyanamide and 4-amino-5-imidazole carboxamide polymerizes under drying conditions at moderate temperatures (60 to 90 C) to yield oligonucleotides of up to four units in length. Enzymatic analysis indicated that the majority of these oligomers contained natural 3 prime-5 prime phosphodiester bonds. This reaction offers a possible method for the formation of deoxyoligonucleotides under primitive earth conditions.

  6. Alternansucrase acceptor products

    USDA-ARS?s Scientific Manuscript database

    The regioselectivity of alternansucrase (EC 2.4.1.140) differs from dextransucrase (EC 2.4.1.5) in ways that can be useful for the synthesis of novel oligosaccharide structures. For example, it has been recently shown that the major oligosaccharides produced when maltose is the acceptor include one...

  7. Pentopyranosyl Oligonucleotide Systems

    NASA Technical Reports Server (NTRS)

    Reck, Folkert; Kudick, Rene; Krishnamurthy, Ramanarayanan; Eschenmoser, Albert; Wippo, Harald

    2001-01-01

    To determine whether the remarkable chemical properties of the pyranosyl isomer of RNA as an informational Watson-Crick base-pairing system are unique to the pentopyranosyl-(4 + 2)-oligonucleotide isomer derived from the RNA-building block D-ribose, studies on the entire family of diastereoisomeric pyranosyL(4 - Z)-oligonucleotide systems deriving from D-ribose. L-lyxose. D-xylose, and L-arabinose were carried out. The result of these extended studies is unambiguous: not only pyranosyl-RNA, but all members of the pentopyranosyl(4 + 2)-oligonucleotide family are highly efficient Watson-Crick base-pairing systems. Their synthesis and pairing properties will be described in a series of publications in this journal.

  8. The delivery of therapeutic oligonucleotides

    PubMed Central

    Juliano, Rudolph L.

    2016-01-01

    The oligonucleotide therapeutics field has seen remarkable progress over the last few years with the approval of the first antisense drug and with promising developments in late stage clinical trials using siRNA or splice switching oligonucleotides. However, effective delivery of oligonucleotides to their intracellular sites of action remains a major issue. This review will describe the biological basis of oligonucleotide delivery including the nature of various tissue barriers and the mechanisms of cellular uptake and intracellular trafficking of oligonucleotides. It will then examine a variety of current approaches for enhancing the delivery of oligonucleotides. This includes molecular scale targeted ligand-oligonucleotide conjugates, lipid- and polymer-based nanoparticles, antibody conjugates and small molecules that improve oligonucleotide delivery. The merits and liabilities of these approaches will be discussed in the context of the underlying basic biology. PMID:27084936

  9. The delivery of therapeutic oligonucleotides.

    PubMed

    Juliano, Rudolph L

    2016-08-19

    The oligonucleotide therapeutics field has seen remarkable progress over the last few years with the approval of the first antisense drug and with promising developments in late stage clinical trials using siRNA or splice switching oligonucleotides. However, effective delivery of oligonucleotides to their intracellular sites of action remains a major issue. This review will describe the biological basis of oligonucleotide delivery including the nature of various tissue barriers and the mechanisms of cellular uptake and intracellular trafficking of oligonucleotides. It will then examine a variety of current approaches for enhancing the delivery of oligonucleotides. This includes molecular scale targeted ligand-oligonucleotide conjugates, lipid- and polymer-based nanoparticles, antibody conjugates and small molecules that improve oligonucleotide delivery. The merits and liabilities of these approaches will be discussed in the context of the underlying basic biology. © The Author 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  10. Candidatus Accumulibacter phosphatis clades enriched under cyclic anaerobic and microaerobic conditions simultaneously use different electron acceptors

    EPA Science Inventory

    Lab- and pilot-scale simultaneous nitrification, denitrification and phosphorus removal-sequencing batch reactors were operated under cyclic anaerobic and micro-aerobic conditions. The use of oxygen, nitrite, and nitrate as electron acceptors by Candidatus Accumulibacter phosphat...

  11. Candidatus Accumulibacter phosphatis clades enriched under cyclic anaerobic and microaerobic conditions simultaneously use different electron acceptors

    EPA Science Inventory

    Lab- and pilot-scale simultaneous nitrification, denitrification and phosphorus removal-sequencing batch reactors were operated under cyclic anaerobic and micro-aerobic conditions. The use of oxygen, nitrite, and nitrate as electron acceptors by Candidatus Accumulibacter phosphat...

  12. Cationic Nanohydrogel Particles for Therapeutic Oligonucleotide Delivery.

    PubMed

    Leber, Nadine; Nuhn, Lutz; Zentel, Rudolf

    2017-06-12

    Short pharmaceutical active oligonucleotides such as small interfering RNA (siRNA) or cytidine-phosphate-guanosine (CpG) are considered as powerful therapeutic alternatives, especially to medicate hard-to-treat diseases (e.g., liver fibrosis or cancer). Unfortunately, these molecules are equipped with poor pharmacokinetic properties that prevent them from translation. Well-defined nanosized carriers can provide opportunities to optimize their delivery and guide them to their site of action. Among several concepts, this Feature Article focuses on cationic nanohydrogel particles as a universal delivery system for small anionic molecules including siRNA and CpG. Cationic nanohydrogels are derived from preaggregated precursor block copolymers, which are further cross-linked to obtain well-defined nanoparticles of tunable sizes and with (degradable) cationic cores. Novel opportunities for oligonucleotide delivery in vitro and in vivo with respect to liver fibrosis therapies will be highlighted as well as perspectives toward modulating the immune system. In general, the approach of covalently stabilized cationic carrier systems can contribute to find advanced oligonucleotide therapeutics. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Oligonucleotide labeling methods. 3. Direct labeling of oligonucleotides employing a novel, non-nucleosidic, 2-aminobutyl-1,3-propanediol backbone.

    PubMed Central

    Nelson, P S; Kent, M; Muthini, S

    1992-01-01

    Novel CE-phosphoramidite (7a-e) and CPG (8a, c, d, e) reagents have been prepared from a unique 2-aminobutyl-1,3-propanediol backbone. The reagents have been used to directly label oligonucleotides with fluorescein, acridine, and biotin via automated DNA synthesis. The versatile 2-aminobutyl-1,3-propanediol backbone allows for labeling at any position (5', internal, and 3') during solid phase oligonucleotide synthesis. Multiple labels can be achieved by repetitive coupling cycles. Furthermore, the 3-carbon atom internucleotide phosphate distance is retained when inserted internally. Using this method, individual oligonucleotides possessing two and three different reporter molecules have been prepared. PMID:1475185

  14. The Use of Gel Electrophoresis to Study the Reactions of Activated Amino Acids with Oligonucleotides

    NASA Technical Reports Server (NTRS)

    Zieboll, Gerhard; Orgel, Leslie E.

    1994-01-01

    We have used gel electrophoresis to study the primary covalent addition of amino acids to oligonu-cleotides or their analogs and the subsequent addition of further molecules of the amino acids to generate peptides covalently linked to the oligonucleotides. We have surveyed the reactions of a variety of amino acids with the phosphoramidates derived from oligonucleotide 5 inches phosphates and ethylenediamine. We find that arginine and amino acids can interact with oligonucleotidesl through stacking interactions react most efficiently. D- and L-amino acids give indistinguishable families of products.

  15. The Use of Gel Electrophoresis to Study the Reactions of Activated Amino Acids with Oligonucleotides

    NASA Technical Reports Server (NTRS)

    Zieboll, Gerhard; Orgel, Leslie E.

    1994-01-01

    We have used gel electrophoresis to study the primary covalent addition of amino acids to oligonu-cleotides or their analogs and the subsequent addition of further molecules of the amino acids to generate peptides covalently linked to the oligonucleotides. We have surveyed the reactions of a variety of amino acids with the phosphoramidates derived from oligonucleotide 5 inches phosphates and ethylenediamine. We find that arginine and amino acids can interact with oligonucleotidesl through stacking interactions react most efficiently. D- and L-amino acids give indistinguishable families of products.

  16. Template switching between PNA and RNA oligonucleotides

    NASA Technical Reports Server (NTRS)

    Bohler, C.; Nielsen, P. E.; Orgel, L. E.; Miller, S. L. (Principal Investigator)

    1995-01-01

    The origin of the RNA world is not easily understood, as effective prebiotic syntheses of the components of RNA, the beta-ribofuranoside-5'-phosphates, are hard to envisage. Recognition of this difficulty has led to the proposal that other genetic systems, the components of which are more easily formed, may have preceded RNA. This raises the question of how transitions between one genetic system and another could occur. Peptide nucleic acid (PNA) resembles RNA in its ability to form double-helical complexes stabilized by Watson-Crick hydrogen bonding between adenine and thymine and between cytosine and guanine, but has a backbone that is held together by amide rather than by phosphodiester bonds. Oligonucleotides bases on RNA are known to act as templates that catalyse the non-enzymatic synthesis of their complements from activated mononucleotides, we now show that RNA oligonucleotides facilitate the synthesis of complementary PNA strands and vice versa. This suggests that a transition between different genetic systems can occur without loss of information.

  17. Template switching between PNA and RNA oligonucleotides

    NASA Technical Reports Server (NTRS)

    Bohler, C.; Nielsen, P. E.; Orgel, L. E.; Miller, S. L. (Principal Investigator)

    1995-01-01

    The origin of the RNA world is not easily understood, as effective prebiotic syntheses of the components of RNA, the beta-ribofuranoside-5'-phosphates, are hard to envisage. Recognition of this difficulty has led to the proposal that other genetic systems, the components of which are more easily formed, may have preceded RNA. This raises the question of how transitions between one genetic system and another could occur. Peptide nucleic acid (PNA) resembles RNA in its ability to form double-helical complexes stabilized by Watson-Crick hydrogen bonding between adenine and thymine and between cytosine and guanine, but has a backbone that is held together by amide rather than by phosphodiester bonds. Oligonucleotides bases on RNA are known to act as templates that catalyse the non-enzymatic synthesis of their complements from activated mononucleotides, we now show that RNA oligonucleotides facilitate the synthesis of complementary PNA strands and vice versa. This suggests that a transition between different genetic systems can occur without loss of information.

  18. The 1974 National Acceptors Survey.

    PubMed

    Laing, J; Phillips, J; Zablan, Z; Llorente, R; Cabigon, J

    1976-01-01

    The 1974 National Acceptors Survey in the Philippines studied 4 methods of contraception: pill, IUD, rhythm, and condom. After 1 year, 72% of IUD acceptors had an IUD in place but only 29% of condom acceptors were still using condoms. Pills and rhythm were equally effective in terms of continuation and pregnancy rates. Continuation rates were higher among acceptors at postpartum clinics than at other clnics, higher among urban respondents than rural, and higher among older respondents. Those with more children had higher continuation rates, whereas those who wanted more children had lower continuation rates. Continuation rates also increased 1) as the duration of marriage lengthened; 2) with a later age at marriage; 3) with higher educational attainment; 4) among income-contributing respondents with higher incomes; 5) among previous contraceptive users; and 6) when physicians provided the services rather than nonmedical personnel, including medical screenings. Clinic attendance, husband's occupation, whether or not there was payment, and husband's support are other factors that seemed to affect continuation rates. Contraceptive effectiveness values were higher among pill and IUD acceptors. The percentage of reduction in fertility following acceptance of a method was 74% for IUDs and 27% for condoms. Fertility reduction was great among acceptors at postpartum clinics, acceptors in central visayas, and the highly educated. Future births averted ranged, for every 100 acceptors, 208 with the IUD, 32 with the condom, and 1 each pill and rhythm. Factors affecting method selection were administrative, beliefs, and preferences. The most common complaint about provision of clinical services was that the staff should spend more time in home visits (86%).

  19. Radiolabeled oligonucleotides for antisense imaging

    PubMed Central

    Iyer, Arun K; He, Jiang

    2011-01-01

    Oligonucleotides radiolabeled with isotopes emitting γ-rays (for SPECT imaging) or positrons (for PET imaging) can be useful for targeting messenger RNA (mRNA) thereby serving as non-invasive imaging tools for detection of gene expression in vivo (antisense imaging). Radiolabeled oligonucleotides may also be used for monitoring their in vivo fate, thereby helping us better understand the barriers to its delivery for antisense targeting. These developments have led to a new area of molecular imaging and targeting, utilizing radiolabeled antisense oligonucleotides. However, the success of antisense imaging relies heavily on overcoming the barriers for its targeted delivery in vivo. Furthermore, the low ability of the radiolabeled antisense oligonucleotide to subsequently internalize into the cell and hybridize with its target mRNA poses additional challenges in realizing its potentials. This review covers the advances in the antisense imaging probe development for PET and SPECT, with an emphasis on radiolabeling strategies, stability, delivery and in vivo targeting. PMID:21822406

  20. Monitoring integrity and localization of modified single-stranded RNA oligonucleotides using ultrasensitive fluorescence methods

    PubMed Central

    Hadwiger, Philipp; Wagner, Ernst; Lamb, Don C.

    2017-01-01

    Short single-stranded oligonucleotides represent a class of promising therapeutics with diverse application areas. Antisense oligonucleotides, for example, can interfere with various processes involved in mRNA processing through complementary base pairing. Also RNA interference can be regulated by antagomirs, single-stranded siRNA and single-stranded microRNA mimics. The increased susceptibility to nucleolytic degradation of unpaired RNAs can be counteracted by chemical modification of the sugar phosphate backbone. In order to understand the dynamics of such single-stranded RNAs, we investigated their fate after exposure to cellular environment by several fluorescence spectroscopy techniques. First, we elucidated the degradation of four differently modified, dual-dye labeled short RNA oligonucleotides in HeLa cell extracts by fluorescence correlation spectroscopy, fluorescence cross-correlation spectroscopy and Förster resonance energy transfer. We observed that the integrity of the oligonucleotide sequence correlates with the extent of chemical modifications. Furthermore, the data showed that nucleolytic degradation can only be distinguished from unspecific effects like aggregation, association with cellular proteins, or intramolecular dynamics when considering multiple measurement and analysis approaches. We also investigated the localization and integrity of the four modified oligonucleotides in cultured HeLa cells using fluorescence lifetime imaging microscopy. No intracellular accumulation could be observed for unmodified oligonucleotides, while completely stabilized oligonucleotides showed strong accumulation within HeLa cells with no changes in fluorescence lifetime over 24 h. The integrity and accumulation of partly modified oligonucleotides was in accordance with their extent of modification. In highly fluorescent cells, the oligonucleotides were transported to the nucleus. The lifetime of the RNA in the cells could be explained by a balance between

  1. Construction and Evaluation of Desulfovibrio vulgaris Whole-Genome Oligonucleotide Microarrays

    SciTech Connect

    Z. He; Q. He; L. Wu; M.E. Clark; J.D. Wall; Jizhong Zhou; Matthew W. Fields

    2004-03-17

    Desulfovibrio vulgaris Hildenborough has been the focus of biochemical and physiological studies in the laboratory, and the metabolic versatility of this organism has been largely recognized, particularly the reduction of sulfate, fumarate, iron, uranium and chromium. In addition, a Desulfovibrio sp. has been shown to utilize uranium as the sole electron acceptor. D. vulgaris is a d-Proteobacterium with a genome size of 3.6 Mb and 3584 ORFs. The whole-genome microarrays of D. vulgaris have been constructed using 70mer oligonucleotides. All ORFs in the genome were represented with 3471 (97.1%) unique probes and 103 (2.9%) non-specific probes that may have cross-hybridization with other ORFs. In preparation for use of the experimental microarrays, artificial probes and targets were designed to assess specificity and sensitivity and identify optimal hybridization conditions for oligonucleotide microarrays. The results indicated that for 50mer and 70mer oligonucleotide arrays, hybridization at 45 C to 50 C, washing at 37 C and a wash time of 2.5 to 5 minutes obtained specific and strong hybridization signals. In order to evaluate the performance of the experimental microarrays, growth conditions were selected that were expected to give significant hybridization differences for different sets of genes. The initial evaluations were performed using D. vulgaris cells grown at logarithmic and stationary phases. Transcriptional analysis of D. vulgaris cells sampled during logarithmic phase growth indicated that 25% of annotated ORFs were up-regulated and 3% of annotated ORFs were downregulated compared to stationary phase cells. The up-regulated genes included ORFs predicted to be involved with acyl chain biosynthesis, amino acid ABC transporter, translational initiation factors, and ribosomal proteins. In the stationary phase growth cells, the two most up-regulated ORFs (70-fold) were annotated as a carboxynorspermidine decarboxylase and a 2C-methyl-D-erythritol-2

  2. Oligonucleotide conjugates for therapeutic applications.

    PubMed

    Winkler, Johannes

    2013-07-01

    Insufficient pharmacokinetic properties and poor cellular uptake are the main hurdles for successful therapeutic development of oligonucleotide agents. The covalent attachment of various ligands designed to influence the biodistribution and cellular uptake or for targeting specific tissues is an attractive possibility to advance therapeutic applications and to expand development options. In contrast to advanced formulations, which often consist of multiple reagents and are sensitive to a variety of preparation conditions, oligonucleotide conjugates are defined molecules, enabling structure-based analytics and quality control techniques. This review gives an overview of current developments of oligonucleotide conjugates for therapeutic applications. Attached ligands comprise peptides, proteins, carbohydrates, aptamers and small molecules, including cholesterol, tocopherol and folic acid. Important linkage types and conjugation methods are summarized. The distinct ligands directly influence biochemical parameters, uptake mechanisms and pharmacokinetic properties.

  3. Oligonucleotide conjugates for therapeutic applications

    PubMed Central

    Winkler, Johannes

    2013-01-01

    Insufficient pharmacokinetic properties and poor cellular uptake are the main hurdles for successful therapeutic development of oligonucleotide agents. The covalent attachment of various ligands designed to influence the biodistribution and cellular uptake or for targeting specific tissues is an attractive possibility to advance therapeutic applications and to expand development options. In contrast to advanced formulations, which often consist of multiple reagents and are sensitive to a variety of preparation conditions, oligonucleotide conjugates are defined molecules, enabling structure-based analytics and quality control techniques. This review gives an overview of current developments of oligonucleotide conjugates for therapeutic applications. Attached ligands comprise peptides, proteins, carbohydrates, aptamers and small molecules, including cholesterol, tocopherol and folic acid. Important linkage types and conjugation methods are summarized. The distinct ligands directly influence biochemical parameters, uptake machanisms and pharmacokinetic properties. PMID:23883124

  4. Electrochemical uranyl cation biosensor with DNA oligonucleotides as receptor layer.

    PubMed

    Jarczewska, Marta; Ziółkowski, Robert; Górski, Łukasz; Malinowska, Elżbieta

    2014-04-01

    The present study aims at the further development of the uranyl oligonucleotide-based voltammetric biosensor, which takes advantage of strong interaction between UO2(2+) and phosphate DNA backbone. Herein we report the optimization of working parameters of previously elaborated electrochemical DNA biosensor. It is shown that the sensor sensitivity is highly dependent on the oligonucleotide probe length and the incubation time of sensor in a sample solution. Consequently, the highest sensitivity was obtained for 10-nucleotide sequence and 60 min incubation time. The lower detection limit towards uranyl cation for developed biosensor was 30 nM. The influence of mixed monolayers and the possibility of developing a non-calibration device were also investigated. The selectivity of the proposed biosensor was significantly improved via elimination of adenine nucleobases from the DNA probe. Moreover, the regeneration procedure was elaborated and tested to prolong the use of the same biosensor for 4 subsequent determinations of UO2(2+).

  5. Acceptors in ZnO

    SciTech Connect

    McCluskey, Matthew D. Corolewski, Caleb D.; Lv, Jinpeng; Tarun, Marianne C.; Teklemichael, Samuel T.; Walter, Eric D.; Norton, M. Grant; Harrison, Kale W.; Ha, Su

    2015-03-21

    Zinc oxide (ZnO) has potential for a range of applications in the area of optoelectronics. The quest for p-type ZnO has focused much attention on acceptors. In this paper, Cu, N, and Li acceptor impurities are discussed. Experimental evidence indicates these point defects have acceptor levels 3.2, 1.4, and 0.8 eV above the valence-band maximum, respectively. The levels are deep because the ZnO valence band is quite low compared to conventional, non-oxide semiconductors. Using MoO{sub 2} contacts, the electrical resistivity of ZnO:Li was measured and showed behavior consistent with bulk hole conduction for temperatures above 400 K. A photoluminescence peak in ZnO nanocrystals is attributed to an acceptor, which may involve a Zn vacancy. High field (W-band) electron paramagnetic resonance measurements on the nanocrystals revealed an axial center with g{sub ⊥} = 2.0015 and g{sub //} = 2.0056, along with an isotropic center at g = 2.0035.

  6. Acceptors in ZnO

    SciTech Connect

    Mccluskey, Matthew D.; Corolewski, Caleb; Lv, Jinpeng; Tarun, Marianne C.; Teklemichael, Samuel T.; Walter, Eric D.; Norton, M. G.; Harrison, Kale W.; Ha, Su Y.

    2015-03-21

    Zinc oxide (ZnO) has potential for a range of applications in the area of optoelectronics. The quest for p-type ZnO has focused much attention on acceptors. In this paper, Cu, N, and Li acceptor impurities are discussed. Experimental evidence shows that these point defects have acceptor levels 3.2, 1.5, and 0.8 eV above the valence-band maximum, respectively. The levels are deep because the ZnO valence band is quite low compared to conventional, non-oxide semiconductors. Using MoO2 contacts, the electrical resistivity of ZnO:Li was measured and showed behavior consistent with bulk hole conduction for temperatures above 400 K. A photoluminescence peak in ZnO nanocrystals has been attributed to an acceptor, which may involve a zinc vacancy. High field (W-band) electron paramagnetic resonance measurements on the nanocrystals revealed an axial center with g = 2.0033 and g = 2.0075, along with an isotropic center at g = 2.0053.

  7. Thermodynamics of Oligonucleotide Duplex Melting

    ERIC Educational Resources Information Center

    Schreiber-Gosche, Sherrie; Edwards, Robert A.

    2009-01-01

    Melting temperatures of oligonucleotides are useful for a number of molecular biology applications, such as the polymerase chain reaction (PCR). Although melting temperatures are often calculated with simplistic empirical equations, application of thermodynamics provides more accurate melting temperatures and an opportunity for students to apply…

  8. Thermodynamics of Oligonucleotide Duplex Melting

    NASA Astrophysics Data System (ADS)

    Schreiber-Gosche, Sherrie; Edwards, Robert A.

    2009-05-01

    Melting temperatures of oligonucleotides are useful for a number of molecular biology applications, such as the polymerase chain reaction (PCR). Although melting temperatures are often calculated with simplistic empirical equations, application of thermodynamics provides more accurate melting temperatures and an opportunity for students to apply rigorous thermodynamic analysis to an important biochemical problem. Because the stacking of base pairs on top of one another is a significant factor in the energetics of oligonucleotide melting, several investigators have applied van't Hoff analysis to melting temperature data using a nearest-neighbor model and have obtained entropies and enthalpies for the stacking of bases. The present article explains how the equilibrium constant for the dissociation of strands from double-stranded oligonucleotides can be expressed in terms of the total strand concentration and thus how the total strand concentration influences the melting temperature. It also presents a simplified analysis based on the entropies and enthalpies of stacking that is manually tractable so that students can work examples to help them understand the thermodynamics of oligonucleotide melting.

  9. Molecular Mechanisms of Antisense Oligonucleotides.

    PubMed

    Crooke, Stanley T

    2017-04-01

    In 1987, when I became interested in the notion of antisense technology, I returned to my roots in RNA biochemistry and began work to understand how oligonucleotides behave in biological systems. Since 1989, my research has focused primarily on this topic, although I have been involved in most areas of research in antisense technology. I believe that the art of excellent science is to frame large important questions that are perhaps not immediately answerable with existing knowledge and methods, and then conceive a long-term (multiyear) research strategy that begins by answering the most pressing answerable questions on the path to the long-term goals. Then, a step-by-step research pathway that will address the strategic questions posed must be implemented, adjusting the plan as new things are learned. This is the approach we have taken at Ionis. Obviously, to create antisense technology, we have had to address a wide array of strategic questions, for example, the medicinal chemistry of oligonucleotides, manufacturing and analytical methods, pharmacokinetics and toxicology, as well as questions about the molecular pharmacology of antisense oligonucleotides (ASOs). Each of these endeavors has consumed nearly three decades of scientific effort, is still very much a work-in-progress, and has resulted in hundreds of publications. As a recipient of the Lifetime Achievement Award 2016 granted by the Oligonucleotide Therapeutic Society, in this note, my goal is to summarize the contributions of my group to the efforts to understand the molecular mechanisms of ASOs.

  10. Molecular Mechanisms of Antisense Oligonucleotides

    PubMed Central

    2017-01-01

    In 1987, when I became interested in the notion of antisense technology, I returned to my roots in RNA biochemistry and began work to understand how oligonucleotides behave in biological systems. Since 1989, my research has focused primarily on this topic, although I have been involved in most areas of research in antisense technology. I believe that the art of excellent science is to frame large important questions that are perhaps not immediately answerable with existing knowledge and methods, and then conceive a long-term (multiyear) research strategy that begins by answering the most pressing answerable questions on the path to the long-term goals. Then, a step-by-step research pathway that will address the strategic questions posed must be implemented, adjusting the plan as new things are learned. This is the approach we have taken at Ionis. Obviously, to create antisense technology, we have had to address a wide array of strategic questions, for example, the medicinal chemistry of oligonucleotides, manufacturing and analytical methods, pharmacokinetics and toxicology, as well as questions about the molecular pharmacology of antisense oligonucleotides (ASOs). Each of these endeavors has consumed nearly three decades of scientific effort, is still very much a work-in-progress, and has resulted in hundreds of publications. As a recipient of the Lifetime Achievement Award 2016 granted by the Oligonucleotide Therapeutic Society, in this note, my goal is to summarize the contributions of my group to the efforts to understand the molecular mechanisms of ASOs. PMID:28080221

  11. Thermodynamics of Oligonucleotide Duplex Melting

    ERIC Educational Resources Information Center

    Schreiber-Gosche, Sherrie; Edwards, Robert A.

    2009-01-01

    Melting temperatures of oligonucleotides are useful for a number of molecular biology applications, such as the polymerase chain reaction (PCR). Although melting temperatures are often calculated with simplistic empirical equations, application of thermodynamics provides more accurate melting temperatures and an opportunity for students to apply…

  12. [Acceptor activity of 4-N-acetylcytidine in the synthesis of (3'-5')-internucleotide bond catalyzed by pancreatic nuclease].

    PubMed

    Kavunenko, A P; Piaĭvinen, E A; Tikhomirova-Sidorova, N S

    1976-04-01

    Cytidine and 4-N-acetylcytidine were compared as phosphate acceptors in dinucleoside monophosphate synthesis catalyzed by pancreatic ribonuclease with uridine-2',3'-cyclophosphate and cytidine-2',3'-cyclo phosphate as phosphate donors. Because of low solubility of 4-N-acetylcytidine in water, the synthesis was carried out in aqueus-organic media. The results obtained indicate that acetylation of the exoaminogroup of cytidine decreases its acceptor activity. For the first time uridilyl-(3'-5')-4-N-acetylcytidine and cytidilyl-(3'-5')-4-N-acetylcytidine are prepared enzymatically by pancreatic ribonuclease.

  13. Electron acceptor dependence of electron shuttle secretion and extracellular electron transfer by Shewanella oneidensis MR-1.

    PubMed

    Wu, Chao; Cheng, Yuan-Yuan; Li, Bing-Bing; Li, Wen-Wei; Li, Dao-Bo; Yu, Han-Qing

    2013-05-01

    Shewanella oneidensis MR-1 is an extensively studied dissimilatory metal-reducing bacterium with a great potential for bioremediation and electricity generation. It secretes flavins as electron shuttles which play an important role in extracellular electron transfer. However, the influence of various environmental factors on the secretion of flavins is largely unknown. Here, the effects of electron acceptors, including fumarate, ferrihydrite, Fe(III)-nitrilotriacetic acid (NTA), nitrate and trimethylamine oxide (TMAO), on the secretion of flavins were investigated. The level of riboflavin and riboflavin-5'-phosphate (FMN) secreted by S. oneidensis MR-1 varied considerably with different electron acceptors. While nitrate and ferrihydrite suppressed the secretion of flavins in relative to fumarate, Fe(III)-NTA and TMAO promoted such a secretion and greatly enhanced ferrihydrite reduction and electricity generation. This work clearly demonstrates that electron acceptors could considerably affect the secretion of flavins and consequent microbial EET. Such impacts of electron acceptors in the environment deserve more attention.

  14. Selection of the acceptor medium in in vitro measurements of drug release from dermatological ointments.

    PubMed

    Gloor, M; Shabafrouz, H

    1983-01-01

    Comparative measurements of in vitro agent release using hydrophilic, intermediate, and lipophilic acceptor phases and in vivo measurements of the blanching effect with triamcinolone acetonide are reported. White petrolatum, wool alcohols ointment, and polyethylene glycol ointment served as donator phases. The results demonstrate that the lipophilic acceptor phase (isopropyl palmitate) is most representative for the in vivo acceptor phase. Conclusions cannot be drawn regarding in vivo effectiveness from measurements of agent release to the hydrophilic (phosphate buffer, pH 6) and intermediate (n-octanol) acceptor phases. In vitro measurements of agent release have a screening character and must usually be supplemented by very elaborate penetration models of the human skin for a definitive evaluation of an ointment.

  15. Phosphate salts

    MedlinePlus

    ... taken by mouth or used as enemas. Indigestion. Aluminum phosphate and calcium phosphate are FDA-permitted ingredients ... Phosphate salts containing sodium, potassium, aluminum, or calcium are LIKELY SAFE for most people when taken by mouth short-term, when sodium phosphate is inserted into the ...

  16. Oligonucleotide-based antiviral strategies.

    PubMed

    Schubert, S; Kurreck, J

    2006-01-01

    In the age of extensive global traffic systems, the close neighborhood of man and livestock in some regions of the world, as well as inadequate prevention measures and medical care in poorer countries, greatly facilitates the emergence and dissemination of new virus strains. The appearance of avian influenza viruses that can infect humans, the spread of the severe acute respiratory syndrome (SARS) virus, and the unprecedented raging of human immunodeficiency virus (HIV) illustrate the threat of a global virus pandemic. In addition, viruses like hepatitis B and C claim more than one million lives every year for want of efficient therapy. Thus, new approaches to prevent virus propagation are urgently needed. Antisense strategies are considered a very attractive means of inhibiting viral replication, as oligonucleotides can be designed to interact with any viral RNA, provided its sequence is known. The ensuing targeted destruction of viral RNA should interfere with viral replication without entailing negative effects on ongoing cellular processes. In this review, we will give some examples of the employment of antisense oligonucleotides, ribozymes, and RNA interference strategies for antiviral purposes. Currently, in spite of encouraging results in preclinical studies, only a few antisense oligonucleotides and ribozymes have turned out to be efficient antiviral compounds in clinical trials. The advent of RNA interference now seems to be refueling hopes for decisive progress in the field of therapeutic employment of antisense strategies.

  17. P-chiral oligonucleotides in biological recognition processes.

    PubMed

    Guga, Piotr

    2007-01-01

    Internucleotide phosphodiester linkages in non-modified oligonucleotides are quickly degraded by nucleolytic enzymes present in the cells and this feature practically eliminates natural DNA and RNA molecules from medical applications and from many structural and mechanistic studies. P-chiral oligonucleotide analogs, in which one of the non-bridging phosphate oxygen atoms is substituted with another heteroatom (e.g. S, Se) or a chemical group (e.g. CH3, BH3(-)), have significantly greater nuclease resistance and also offer important possibilities for detailed studies of interactions with other biomolecules at the molecular level. Notably, these substitutions do not disrupt hydrogen bonding between nucleobases and affect the overall geometry of the oligomers to only low or moderate extent, although important changes of hydration patterns and changes of interactions with metal ions are observed. Such the probes, including isotopomeric species labeled with a heavy oxygen isotope, possessing phosphorus atoms of selected absolute configurations, have been used for elucidation of the mode of action of many enzymes (nucleases, transferases, kinases), ribozymes and DNA-zymes, as well as for investigations on thermodynamic stability of nucleic acids complexes (duplexes, triplexes, i-motif) and for studies on a mechanism of conformational changes of B-Z type. They are also useful tools for analysis of interactions of the phosphoryl oxygen atoms in natural precursors with functional groups of proteins. The synthetic routes to stereodefined forms of selected types of P-chiral oligonucleotides are presented, as well as recently developed methods for their configurational analysis at micromolar concentration. Selected examples of application of diastereomerically pure P-chiral oligonucleotides for structural, biochemical and biological experiments are discussed.

  18. Novel photocleavable universal support for oligonucleotide synthesis.

    PubMed

    Anderson, Emma; Brown, Tom; Picken, Douglas

    2003-01-01

    A novel photocleavable universal support for the automated solid phase synthesis of oligonucleotides is described. The linker between the growing oligonucleotide chain and CPG support contains a nucleophilic amine protected with a photocleavable group. On exposure to UV light, this group is detached and the free amine affords cleavage of the oligonucleotide from the support. The use of long wavelength UV light avoids damage to the DNA.

  19. The prebiotic synthesis of oligonucleotides

    NASA Technical Reports Server (NTRS)

    Oro, J.; Stephen-Sherwood, E.

    1974-01-01

    This paper is primarily a review of recent developments in the abiotic synthesis of nucleotides, short chain oligonucleotides, and their mode of replication in solution. It also presents preliminary results from this laboratory on the prebiotic synthesis of thymidine oligodeoxynucleotides. A discussion, based on the physicochemical properties of RNA and DNA oligomers, relevant to the molecular evolution of these compounds leads to the tentative hypothesis that oligodeoxyribonucleotides of about 12 units may have been of sufficient length to initiate a self replicating coding system. Two models are suggested to account for the synthesis of high molecular weight oligomers using short chain templates and primers.

  20. SOAP: short oligonucleotide alignment program.

    PubMed

    Li, Ruiqiang; Li, Yingrui; Kristiansen, Karsten; Wang, Jun

    2008-03-01

    We have developed a program SOAP for efficient gapped and ungapped alignment of short oligonucleotides onto reference sequences. The program is designed to handle the huge amounts of short reads generated by parallel sequencing using the new generation Illumina-Solexa sequencing technology. SOAP is compatible with numerous applications, including single-read or pair-end resequencing, small RNA discovery and mRNA tag sequence mapping. SOAP is a command-driven program, which supports multi-threaded parallel computing, and has a batch module for multiple query sets. http://soap.genomics.org.cn.

  1. Donor assists acceptor binding and catalysis of human α1,6-fucosyltransferase.

    PubMed

    Kötzler, Miriam P; Blank, Simon; Bantleon, Frank I; Wienke, Martin; Spillner, Edzard; Meyer, Bernd

    2013-08-16

    α1,6-Core-fucosyltransferase (FUT8) is a vital enzyme in mammalian physiological and pathophysiological processes such as tumorigenesis and progress of, among others, non-small cell lung cancer and colon carcinoma. It was also shown that therapeutic antibodies have a dramatically higher efficacy if the α1,6-fucosyl residue is absent. However, specific and potent inhibitors for FUT8 and related enzymes are lacking. Hence, it is crucial to elucidate the structural basis of acceptor binding and the catalytic mechanism. We present here the first structural model of FUT8 in complex with its acceptor and donor molecules. An unusually large acceptor, i.e., a hexasaccharide from the core of N-glycans, is required as minimal structure. Acceptor substrate binding of FUT8 is being dissected experimentally by STD NMR and SPR and theoretically by molecular dynamics simulations. The acceptor binding site forms an unusually large and shallow binding site. Binding of the acceptor to the enzyme is much faster and stronger if the donor is present. This is due to strong hydrogen bonding between O6 of the proximal N-acetylglucosamine and an oxygen atom of the β-phosphate of GDP-fucose. Therefore, we propose an ordered Bi Bi mechanism for FUT8 where the donor molecule binds first. No specific amino acid is present that could act as base during catalysis. Our results indicate a donor-assisted mechanism, where an oxygen of the β-phosphate deprotonates the acceptor. Knowledge of the mechanism of FUT8 is now being used for rational design of targeted inhibitors to address metastasis and prognosis of carcinomas.

  2. Oligonucleotide therapeutics for human leukaemia.

    PubMed

    Gewirtz, A M

    1997-01-01

    The concept of antisense oligonucleotide 'therapeutics' has generated a great deal of controversy. Questions abound regarding the mechanism of action of these compounds, their reliability and their ultimate utility. These problems are compounded by the 'hype', which has attended their development, and the inability of workers in this area to meet the expectations raised by its most zealous proponents. Nevertheless, it is worth pointing out that there have been some notable gene disruption successes with this technique that have stood up to rigorous scrutiny. Our own work with c-myb as a target is perhaps a reasonable example. Though much remains to be accomplished before antisense drugs are commonly, and usefully, employed in the clinic, it is important to remember what motivates their development. Gene-targeted drugs have the promise of exquisite specificity and the potential to do much good with little toxicity. Accordingly, antisense oligonucleotides can serve as a paradigm of rational drug development. For all these reasons then, we believe that efforts should be increased to decipher the mechanism of action of antisense oligodeoxynucleotides, and to learn how they may be successfully employed in the clinic.

  3. Mutational analysis using oligonucleotide microarrays

    PubMed Central

    Hacia, J.; Collins, F.

    1999-01-01

    The development of inexpensive high throughput methods to identify individual DNA sequence differences is important to the future growth of medical genetics. This has become increasingly apparent as epidemiologists, pathologists, and clinical geneticists focus more attention on the molecular basis of complex multifactorial diseases. Such undertakings will rely upon genetic maps based upon newly discovered, common, single nucleotide polymorphisms. Furthermore, candidate gene approaches used in identifying disease associated genes necessitate screening large sequence blocks for changes tracking with the disease state. Even after such genes are isolated, large scale mutational analyses will often be needed for risk assessment studies to define the likely medical consequences of carrying a mutated gene.
This review concentrates on the use of oligonucleotide arrays for hybridisation based comparative sequence analysis. Technological advances within the past decade have made it possible to apply this technology to many different aspects of medical genetics. These applications range from the detection and scoring of single nucleotide polymorphisms to mutational analysis of large genes. Although we discuss published scientific reports, unpublished work from the private sector12 could also significantly affect the future of this technology.


Keywords: mutational analysis; oligonucleotide microarrays; DNA chips PMID:10528850

  4. Cellular Uptake and Intracellular Trafficking of Oligonucleotides: Implications for Oligonucleotide Pharmacology

    PubMed Central

    Ming, Xin; Carver, Kyle; Laing, Brian

    2014-01-01

    One of the major constraints on the therapeutic use of oligonucleotides is inefficient delivery to their sites of action in the cytosol or nucleus. Recently it has become evident that the pathways of cellular uptake and intracellular trafficking of oligonucleotides can strongly influence their pharmacological actions. Here we provide background information on the basic processes of endocytosis and trafficking and then review recent literature on targeted delivery and subcellular trafficking of oligonucleotides in that context. A variety of approaches including molecular scale ligand-oligonucleotide conjugates, ligand-targeted nanocarriers, and the use of small molecules to enhance oligonucleotide effects are discussed. PMID:24383421

  5. Transglucosylation potential of six sucrose phosphorylases toward different classes of acceptors.

    PubMed

    Aerts, Dirk; Verhaeghe, Tom F; Roman, Bart I; Stevens, Christian V; Desmet, Tom; Soetaert, Wim

    2011-09-27

    In this study, the transglucosylation potential of six sucrose phosphorylase (SP) enzymes has been compared using eighty putative acceptors from different structural classes. To increase the solubility of hydrophobic acceptors, the addition of various co-solvents was first evaluated. All enzymes were found to retain at least 50% of their activity in 25% dimethylsulfoxide, with the enzymes from Bifidobacterium adolescentis and Streptococcus mutans being the most stable. Screening of the enzymes' specificity then revealed that the vast majority of acceptors are transglucosylated very slowly by SP, at a rate that is comparable to the contaminating hydrolytic reaction. The enzyme from S. mutans displayed the narrowest acceptor specificity and the one from Leuconostoc mesenteroides NRRL B1355 the broadest. However, high activity could only be detected on l-sorbose and l-arabinose, besides the native acceptors d-fructose and phosphate. Improving the affinity for alternative acceptors by means of enzyme engineering will, therefore, be a major challenge for the commercial exploitation of the transglucosylation potential of sucrose phosphorylase.

  6. Bromodeoxyuridine-labeled oligonucleotides as tools for oligonucleotide uptake studies.

    PubMed

    Maszewska, Maria; Kobylańska, Anna; Gendaszewska-Darmach, Edyta; Koziołkiewicz, Maria

    2002-12-01

    The mechanisms by which various oligonucleotides (ODNs) and their analogs enter cells are not fully understood. A common technique used in studies on cellular uptake of ODNs is their conjugation with fluorochromes. However, fluorescently labeled ODNs may vary from the parent compounds in charge and hydrophilicity, and they may interact differently with some components of cellular membranes. In this report, we present an alternative method based on the immunofluorescent detection of ODNs with incorporated 5-bromo-2'-deoxyuridine (BrdUrd). Localization of BrdUrd-modified ODNs has been achieved using FITC-labeled anti-BrdUrd antibodies. This technique allowed determination of the differences in cellular uptake of phosphodiester (PO) and phosphorothioate (PS) ODNs and their derivatives conjugated with cholesterol and menthol. The immunocytochemical method also has shown that the cellular uptake of some ODNs may be influenced by specific sequences that are responsible for the formation of higher-order structures.

  7. Glucansucrase acceptor reactions with D-mannose

    USDA-ARS?s Scientific Manuscript database

    The main acceptor product of glucansucrases with D-mannose has not previously been identified. We used glucansucrases that form water-insoluble a-D-glucans to produce increased yields of acceptor products from D-mannose, and identified the major product as 6-O-a-D-glucopyranosyl-D-mannose. Glucansuc...

  8. Anaerobic electron acceptor chemotaxis in Shewanella putrefaciens

    NASA Technical Reports Server (NTRS)

    Nealson, K. H.; Moser, D. P.; Saffarini, D. A.

    1995-01-01

    Shewanella putrefaciens MR-1 can grow either aerobically or anaerobically at the expense of many different electron acceptors and is often found in abundance at redox interfaces in nature. Such redox interfaces are often characterized by very strong gradients of electron acceptors resulting from rapid microbial metabolism. The coincidence of S. putrefaciens abundance with environmental gradients prompted an examination of the ability of MR-1 to sense and respond to electron acceptor gradients in the laboratory. In these experiments, taxis to the majority of the electron acceptors that S. putrefaciens utilizes for anaerobic growth was seen. All anaerobic electron acceptor taxis was eliminated by the presence of oxygen, nitrate, nitrite, elemental sulfur, or dimethyl sulfoxide, even though taxis to the latter was very weak and nitrate and nitrite respiration was normal in the presence of dimethyl sulfoxide. Studies with respiratory mutants of MR-1 revealed that several electron acceptors that could not be used for anaerobic growth nevertheless elicited normal anaerobic taxis. Mutant M56, which was unable to respire nitrite, showed normal taxis to nitrite, as well as the inhibition of taxis to other electron acceptors by nitrite. These results indicate that electron acceptor taxis in S. putrefaciens does not conform to the paradigm established for Escherichia coli and several other bacteria. Carbon chemo-taxis was also unusual in this organism: of all carbon compounds tested, the only positive response observed was to formate under anaerobic conditions.

  9. Anaerobic electron acceptor chemotaxis in Shewanella putrefaciens.

    PubMed

    Nealson, K H; Moser, D P; Saffarini, D A

    1995-04-01

    Shewanella putrefaciens MR-1 can grow either aerobically or anaerobically at the expense of many different electron acceptors and is often found in abundance at redox interfaces in nature. Such redox interfaces are often characterized by very strong gradients of electron acceptors resulting from rapid microbial metabolism. The coincidence of S. putrefaciens abundance with environmental gradients prompted an examination of the ability of MR-1 to sense and respond to electron acceptor gradients in the laboratory. In these experiments, taxis to the majority of the electron acceptors that S. putrefaciens utilizes for anaerobic growth was seen. All anaerobic electron acceptor taxis was eliminated by the presence of oxygen, nitrate, nitrite, elemental sulfur, or dimethyl sulfoxide, even though taxis to the latter was very weak and nitrate and nitrite respiration was normal in the presence of dimethyl sulfoxide. Studies with respiratory mutants of MR-1 revealed that several electron acceptors that could not be used for anaerobic growth nevertheless elicited normal anaerobic taxis. Mutant M56, which was unable to respire nitrite, showed normal taxis to nitrite, as well as the inhibition of taxis to other electron acceptors by nitrite. These results indicate that electron acceptor taxis in S. putrefaciens does not conform to the paradigm established for Escherichia coli and several other bacteria. Carbon chemo-taxis was also unusual in this organism: of all carbon compounds tested, the only positive response observed was to formate under anaerobic conditions.

  10. [Recent progress and prospect in oligonucleotide therapeutics].

    PubMed

    Yoshioka, Kotaro; Kuwahara, Hiroya; Nishina, Kazutaka; Nagata, Tetsuya; Yokota, Takanori

    2015-06-01

    Remarkable progress has been made in chemical modification and nonviral delivery systems that improve the properties and efficacy of therapeutics oligonucleotides therapeutics, such as antisense oligonucleotide (ASO) and small interfering RNA(siRNA). ASOs act through various mechanisms including the degradation of mRNA by RNase H (gapmer-type ASO) and the modulation alternative splicing patterns(splice switching oligonucleotide). Recent favorable outcomes in clinical trials for cancers and genetic diseases such as familial amyloid polyneuropathy and Duchenne muscular dystrophy indicate high clinical potency of oligonucleotide therapeutics. Here we reviewed recent advances in basic properties and clinical applications of ASO and siRNA, and provide future perspective on oligonucleotide therapeutics.

  11. Structural basis for phosphatidylinositol-phosphate biosynthesis

    NASA Astrophysics Data System (ADS)

    Clarke, Oliver B.; Tomasek, David; Jorge, Carla D.; Dufrisne, Meagan Belcher; Kim, Minah; Banerjee, Surajit; Rajashankar, Kanagalaghatta R.; Shapiro, Lawrence; Hendrickson, Wayne A.; Santos, Helena; Mancia, Filippo

    2015-10-01

    Phosphatidylinositol is critical for intracellular signalling and anchoring of carbohydrates and proteins to outer cellular membranes. The defining step in phosphatidylinositol biosynthesis is catalysed by CDP-alcohol phosphotransferases, transmembrane enzymes that use CDP-diacylglycerol as donor substrate for this reaction, and either inositol in eukaryotes or inositol phosphate in prokaryotes as the acceptor alcohol. Here we report the structures of a related enzyme, the phosphatidylinositol-phosphate synthase from Renibacterium salmoninarum, with and without bound CDP-diacylglycerol to 3.6 and 2.5 Å resolution, respectively. These structures reveal the location of the acceptor site, and the molecular determinants of substrate specificity and catalysis. Functional characterization of the 40%-identical ortholog from Mycobacterium tuberculosis, a potential target for the development of novel anti-tuberculosis drugs, supports the proposed mechanism of substrate binding and catalysis. This work therefore provides a structural and functional framework to understand the mechanism of phosphatidylinositol-phosphate biosynthesis.

  12. Structural basis for phosphatidylinositol-phosphate biosynthesis

    PubMed Central

    Clarke, Oliver B.; Tomasek, David; Jorge, Carla D.; Dufrisne, Meagan Belcher; Kim, Minah; Banerjee, Surajit; Rajashankar, Kanagalaghatta R.; Shapiro, Lawrence; Hendrickson, Wayne A.; Santos, Helena; Mancia, Filippo

    2015-01-01

    Phosphatidylinositol is critical for intracellular signalling and anchoring of carbohydrates and proteins to outer cellular membranes. The defining step in phosphatidylinositol biosynthesis is catalysed by CDP-alcohol phosphotransferases, transmembrane enzymes that use CDP-diacylglycerol as donor substrate for this reaction, and either inositol in eukaryotes or inositol phosphate in prokaryotes as the acceptor alcohol. Here we report the structures of a related enzyme, the phosphatidylinositol-phosphate synthase from Renibacterium salmoninarum, with and without bound CDP-diacylglycerol to 3.6 and 2.5 Å resolution, respectively. These structures reveal the location of the acceptor site, and the molecular determinants of substrate specificity and catalysis. Functional characterization of the 40%-identical ortholog from Mycobacterium tuberculosis, a potential target for the development of novel anti-tuberculosis drugs, supports the proposed mechanism of substrate binding and catalysis. This work therefore provides a structural and functional framework to understand the mechanism of phosphatidylinositol-phosphate biosynthesis. PMID:26510127

  13. Adaptive resolution simulation of oligonucleotides.

    PubMed

    Netz, Paulo A; Potestio, Raffaello; Kremer, Kurt

    2016-12-21

    Nucleic acids are characterized by a complex hierarchical structure and a variety of interaction mechanisms with other molecules. These features suggest the need of multiscale simulation methods in order to grasp the relevant physical properties of deoxyribonucleic acid (DNA) and RNA using in silico experiments. Here we report an implementation of a dual-resolution modeling of a DNA oligonucleotide in physiological conditions; in the presented setup only the nucleotide molecule and the solvent and ions in its proximity are described at the atomistic level; in contrast, the water molecules and ions far from the DNA are represented as computationally less expensive coarse-grained particles. Through the analysis of several structural and dynamical parameters, we show that this setup reliably reproduces the physical properties of the DNA molecule as observed in reference atomistic simulations. These results represent a first step towards a realistic multiscale modeling of nucleic acids and provide a quantitatively solid ground for their simulation using dual-resolution methods.

  14. Adaptive resolution simulation of oligonucleotides

    NASA Astrophysics Data System (ADS)

    Netz, Paulo A.; Potestio, Raffaello; Kremer, Kurt

    2016-12-01

    Nucleic acids are characterized by a complex hierarchical structure and a variety of interaction mechanisms with other molecules. These features suggest the need of multiscale simulation methods in order to grasp the relevant physical properties of deoxyribonucleic acid (DNA) and RNA using in silico experiments. Here we report an implementation of a dual-resolution modeling of a DNA oligonucleotide in physiological conditions; in the presented setup only the nucleotide molecule and the solvent and ions in its proximity are described at the atomistic level; in contrast, the water molecules and ions far from the DNA are represented as computationally less expensive coarse-grained particles. Through the analysis of several structural and dynamical parameters, we show that this setup reliably reproduces the physical properties of the DNA molecule as observed in reference atomistic simulations. These results represent a first step towards a realistic multiscale modeling of nucleic acids and provide a quantitatively solid ground for their simulation using dual-resolution methods.

  15. Bright Solid-State Emission of Disilane-Bridged Donor-Acceptor-Donor and Acceptor-Donor-Acceptor Chromophores.

    PubMed

    Shimada, Masaki; Tsuchiya, Mizuho; Sakamoto, Ryota; Yamanoi, Yoshinori; Nishibori, Eiji; Sugimoto, Kunihisa; Nishihara, Hiroshi

    2016-02-24

    The development of disilane-bridged donor-acceptor-donor (D-Si-Si-A-Si-Si-D) and acceptor-donor-acceptor (A-Si-Si-D-Si-Si-A) compounds is described. Both types of compound showed strong emission (λem =ca. 500 and ca. 400 nm, respectively) in the solid state with high quantum yields (Φ: up to 0.85). Compound 4 exhibited aggregation-induced emission enhancement in solution. X-ray diffraction revealed that the crystal structures of 2, 4, and 12 had no intermolecular π-π interactions to suppress the nonradiative transition in the solid state.

  16. Fluorescence and Förster resonance energy transfer investigations on DNA oligonucleotide and PAMAM dendrimer packing interactions in dendriplexes.

    PubMed

    Alajangi, Hema Kumari; Santhiya, Deenan

    2015-04-14

    Considering the importance of short oligonucleotide packing in dendriplex-mediated gene delivery, a direct insight into the 14-mer oligonucleotide and dendrimer interactions using fluorescence and FRET techniques is the focus of this study. Fluorometric titrations of various fluorophore-tagged oligonucleotides with the first three PAMAM dendrimer generations showed a decrease in the fluorescence intensity with two break points, namely Z and Z, for each titration. The first break point for each dendrimer was identical to the neutralization point observed by basic biophysical studies for the corresponding dendrimer generations. Additionally, FRET studies on dual tagged oligonucleotide (DFT) molecules revealed a third break point at the charge ratio (Z) where there was the highest fluorescence energy transfer from the donor to the acceptor fluorophores. Altogether, dendriplex formation was considered to take place via three steps with an increase in the dendrimer concentration, where initially there was monomeric complexation at the neutralization point (Z) followed by loosely held molecular aggregation of the dendrimer (Z). In the final step, dendrimer molecular aggregates were held tightly together for the closest possible packing of the oligonucleotide molecules onto their surface. The effective molecular packing is identified by the highest FRET intensity for the dendrimer of generation 2 at a charge ratio of 0.34 (Z±).

  17. DNA Oligonucleotide Fragment Ion Rearrangements Upon Collision-Induced Dissociation

    NASA Astrophysics Data System (ADS)

    Harper, Brett; Neumann, Elizabeth K.; Solouki, Touradj

    2015-08-01

    Collision-induced dissociation (CID) of m/z-isolated w type fragment ions and an intact 5' phosphorylated DNA oligonucleotide generated rearranged product ions. Of the 21 studied w ions of various nucleotide sequences, fragment ion sizes, and charge states, 18 (~86%) generated rearranged product ions upon CID in a Synapt G2-S HDMS (Waters Corporation, Manchester, England, UK) ion mobility-mass spectrometer. Mass spectrometry (MS), ion mobility spectrometry (IMS), and theoretical modeling data suggest that purine bases can attack the free 5' phosphate group in w type ions and 5' phosphorylated DNA to generate sequence permuted [phosphopurine]- fragment ions. We propose and discuss a potential mechanism for generation of rearranged [phosphopurine]- and complementary y-B type product ions.

  18. Patterns of oligonucleotide distribution within DNA and RNA functional sites

    SciTech Connect

    Kolchanov, N.A.; Kel, A.E.; Ponomarenko, M.P.; Romachenko, A.G.; Likchachev, J.; Milanesi, L.; Lim, H.

    1993-12-31

    Patterns of short oligonucleotide distribution within DNA and RNA functional sites have been analyzed using ``Site-Video`` computer system. The group of DNA functional sites involved nucleosome binding sites, gyrase cleavage sites, promoters of E. coli and men. The group of RNA functional sites involved donor and acceptor splice sites of men, translation initiation sites of E. coli and men and translation frame shift site sites. Analysis of these samples of nucleotide sequences have been carried out by the ``Site-Video`` computer system. For each type of site specific set of patterns of oligonucleotide distribution important for the functioning and recognition have been revealed. At the same time, the number of specific patterns revealed in RNA sites was significantly higher than those in DNA sites. On the base of the results obtained, the script of functional sites for evolutionary emergency have been prompted. According to it, two types of context feature selection took place: (1) positive selection targeted to the appearance of the definite types of context features in particular regions of functional sites;and (2) negative selection targeted to the elimination of definite types of context features in particular regions of functional sites. The authors suppose that evolutionary formation of any functional site is a multistep process realized via combination of positive and negative selections. Negative selection, via fixation of a specific pattern of mutations, eliminates false signals of regulatory proteins binding with the functional site. Positive selection leads to the appearance of local context features (signals) which provide for the specificity and efficiency of the site functioning.

  19. Antisense oligonucleotide-based therapy in human erythropoietic protoporphyria.

    PubMed

    Oustric, Vincent; Manceau, Hana; Ducamp, Sarah; Soaid, Rima; Karim, Zoubida; Schmitt, Caroline; Mirmiran, Arienne; Peoc'h, Katell; Grandchamp, Bernard; Beaumont, Carole; Lyoumi, Said; Moreau-Gaudry, François; Guyonnet-Dupérat, Véronique; de Verneuil, Hubert; Marie, Joëlle; Puy, Herve; Deybach, Jean-Charles; Gouya, Laurent

    2014-04-03

    In 90% of people with erythropoietic protoporphyria (EPP), the disease results from the inheritance of a common hypomorphic FECH allele, encoding ferrochelatase, in trans to a private deleterious FECH mutation. The activity of the resulting FECH enzyme falls below the critical threshold of 35%, leading to the accumulation of free protoporphyrin IX (PPIX) in bone marrow erythroblasts and in red cells. The mechanism of low expression involves a biallelic polymorphism (c.315-48T>C) localized in intron 3. The 315-48C allele increases usage of the 3' cryptic splice site between exons 3 and 4, resulting in the transcription of an unstable mRNA with a premature stop codon, reducing the abundance of wild-type FECH mRNA, and finally reducing FECH activity. Through a candidate-sequence approach and an antisense-oligonucleotide-tiling method, we identified a sequence that, when targeted by an antisense oligonucleotide (ASO-V1), prevented usage of the cryptic splice site. In lymphoblastoid cell lines derived from symptomatic EPP subjects, transfection of ASO-V1 reduced the usage of the cryptic splice site and efficiently redirected the splicing of intron 3 toward the physiological acceptor site, thereby increasing the amount of functional FECH mRNA. Moreover, the administration of ASO-V1 into developing human erythroblasts from an overtly EPP subject markedly increased the production of WT FECH mRNA and reduced the accumulation of PPIX to a level similar to that measured in asymptomatic EPP subjects. Thus, EPP is a paradigmatic Mendelian disease in which the in vivo correction of a common single splicing defect would improve the condition of most affected individuals.

  20. Antisense Oligonucleotide-Based Therapy in Human Erythropoietic Protoporphyria

    PubMed Central

    Oustric, Vincent; Manceau, Hana; Ducamp, Sarah; Soaid, Rima; Karim, Zoubida; Schmitt, Caroline; Mirmiran, Arienne; Peoc’h, Katell; Grandchamp, Bernard; Beaumont, Carole; Lyoumi, Said; Moreau-Gaudry, François; Guyonnet-Dupérat, Véronique; de Verneuil, Hubert; Marie, Joëlle; Puy, Herve; Deybach, Jean-Charles; Gouya, Laurent

    2014-01-01

    In 90% of people with erythropoietic protoporphyria (EPP), the disease results from the inheritance of a common hypomorphic FECH allele, encoding ferrochelatase, in trans to a private deleterious FECH mutation. The activity of the resulting FECH enzyme falls below the critical threshold of 35%, leading to the accumulation of free protoporphyrin IX (PPIX) in bone marrow erythroblasts and in red cells. The mechanism of low expression involves a biallelic polymorphism (c.315−48T>C) localized in intron 3. The 315−48C allele increases usage of the 3′ cryptic splice site between exons 3 and 4, resulting in the transcription of an unstable mRNA with a premature stop codon, reducing the abundance of wild-type FECH mRNA, and finally reducing FECH activity. Through a candidate-sequence approach and an antisense-oligonucleotide-tiling method, we identified a sequence that, when targeted by an antisense oligonucleotide (ASO-V1), prevented usage of the cryptic splice site. In lymphoblastoid cell lines derived from symptomatic EPP subjects, transfection of ASO-V1 reduced the usage of the cryptic splice site and efficiently redirected the splicing of intron 3 toward the physiological acceptor site, thereby increasing the amount of functional FECH mRNA. Moreover, the administration of ASO-V1 into developing human erythroblasts from an overtly EPP subject markedly increased the production of WT FECH mRNA and reduced the accumulation of PPIX to a level similar to that measured in asymptomatic EPP subjects. Thus, EPP is a paradigmatic Mendelian disease in which the in vivo correction of a common single splicing defect would improve the condition of most affected individuals. PMID:24680888

  1. Multiplexed interfacial transduction of nucleic acid hybridization using a single color of immobilized quantum dot donor and two acceptors in fluorescence resonance energy transfer.

    PubMed

    Algar, W Russ; Krull, Ulrich J

    2010-01-01

    A multiplexed solid-phase assay for the detection of nucleic acid hybridization was developed on the basis of a single color of immobilized CdSe/ZnS quantum dot (QD) as a donor in fluorescence resonance energy transfer (FRET). This work demonstrated that two channels of detection did not necessitate two different QD donors. Two probe oligonucleotides were coimmobilized on optical fibers modified with QDs, and a sandwich assay was used to associate the acceptor dyes with interfacial hybridization events without target labeling. FRET-sensitized acceptor emission provided an analytical signal that was concentration dependent down to 10 nM. Changes in the ratio of coimmobilized probe oligonucleotides were found to yield linear changes in the relative amounts of acceptor emission. These changes were compared to previous studies that used mixed films of two QD donors for two detection channels. The analysis indicated that probe dilution effects were primarily driven by changes in acceptor number density and that QD dilution effects or changes in mean donor-acceptor distance were secondary. Hybridization kinetics were found to be consistent between different ratios of coimmobilized probes, suggesting that hybridization in this type of system occurred via the accepted model for solid-phase hybridization, where adsorption and then diffusion at the solid interface drove hybridization.

  2. Complex DNA nanostructures from oligonucleotide ensembles.

    PubMed

    Mathur, Divita; Henderson, Eric R

    2013-04-19

    The first synthetic DNA nanostructures were created by self-assembly of a small number of oligonucleotides. Introduction of the DNA origami method provided a new paradigm for designing and creating two- and three-dimensional DNA nanostructures by folding a large single-stranded DNA and 'stapling' it together with a library of oligonucleotides. Despite its power and wide-ranging implementation, the DNA origami technique suffers from some limitations. Foremost among these is the limited number of useful single-stranded scaffolds of biological origin. This report describes a new approach to creating large DNA nanostructures exclusively from synthetic oligonucleotides. The essence of this approach is to replace the single-stranded scaffold in DNA origami with a library of oligonucleotides termed "scaples" (scaffold staples). Scaples eliminate the need for scaffolds of biological origin and create new opportunities for producing larger and more diverse DNA nanostructures as well as simultaneous assembly of distinct structures in a "single-pot" reaction.

  3. Synthetic CO.sub.2 acceptor

    DOEpatents

    Lancet, Michael S.; Curran, George P.

    1981-08-18

    A synthetic CO.sub.2 acceptor consisting essentially of at least one compound selected from the group consisting of calcium oxide and calcium carbonate supported in a refractory carrier matrix, the carrier having the general formula Ca.sub.5 (SiO.sub.4).sub.2 CO.sub.3. A method for producing the synthetic CO.sub.2 acceptor is also disclosed.

  4. Antisense oligonucleotides as therapeutics for malignant diseases.

    PubMed

    Ho, P T; Parkinson, D R

    1997-04-01

    The continued progress in our understanding of the biology of neoplasia and in the identification, cloning, and sequencing of genes critical to tumor cell function permits the exploitation of this information to develop specific agents that may directly modulate the function of these genes or their protein products. Antisense oligonucleotides are being investigated as a potential therapeutic modality that takes direct advantage of molecular sequencing. The antisense approach uses short oligonucleotides designed to hybridize to a target mRNA transcript through Watson-Crick base pairing. The formation of this oligonucleotide: RNA heteroduplex results in mRNA inactivation and consequent inhibition of synthesis of the protein product. A fundamental attraction of the antisense approach is that this method potentially may be applied to any gene product, in theory, for the treatment of malignant and non-malignant diseases. However, this simple and attractive model has proven to be much more complex in practice. A number of important challenges in the preclinical development of antisense oligonucleotides have been identified, including stability, sequence length, cellular uptake, target sequence selection, appropriate negative controls, oligonucleotide: protein interactions, and cost of manufacture. Although the biological activity of an oligonucleotide against its molecular target is theoretically sequence-dependent, the animal pharmacokinetics and toxicology of phosphorothioate analogues directed against vastly disparate gene products appear relatively non-sequence-specific. In oncology, a number of clinical trials have been initiated with antisense oligonucleotides directed against molecular targets including: p53; bcl-2; raf kinase; protein kinase C-alpha; c-myb. The experience gained from these early clinical trials will be applicable to the next generation of antisense agents in development. These may include molecules with novel backbones or other structural

  5. Incorporation of an aldehyde function in oligonucleotides.

    PubMed

    Tilquin, J M; Dechamps, M; Sonveaux, E

    2001-01-01

    A nucleotide-like phosphoramidite building block that has the nucleic base replaced by the tert-butyldimethylsilyl-protected styrene glycol was synthesized. After the automatic synthesis of an oligonucleotide incorporating this synthon, the benzaldehyde function was generated by fluoride deprotection and oxidation by sodium periodate. In a similar manner, an oligonucleotide where a nucleic base was replaced by the (CH2)8CH=O chain was synthesized and conjugated with biotin derivatives.

  6. Sedimentation analysis of novel DNA structures formed by homo-oligonucleotides.

    PubMed

    Hatters, D M; Wilson, L; Atcliffe, B W; Mulhern, T D; Guzzo-Pernell, N; Howlett, G J

    2001-07-01

    Sedimentation velocity analysis has been used to examine the base-specific structural conformations and unusual hydrogen bonding patterns of model oligonucleotides. Homo-oligonucleotides composed of 8-28 residues of dA, dT, or dC nucleotides in 100 mM sodium phosphate, pH 7.4, at 20 degrees C behave as extended monomers. Comparison of experimentally determined sedimentation coefficients with theoretical values calculated for assumed helical structures show that dT and dC oligonucleotides are more compact than dA oligonucleotides. For dA oligonucleotides, the average width (1.7 nm), assuming a cylindrical model, is smaller than for control duplex DNA whereas the average rise per base (0.34 nm) is similar to that of B-DNA. For dC and dT oligonucleotides, there is an increase in the average widths (1.8 nm and 2.1 nm, respectively) whereas the average rise per base is smaller (0.28 nm and 0.23 nm, respectively). A significant shape change is observed for oligo dC(28) at lower temperatures (10 degrees C), corresponding to a fourfold decrease in axial ratio. Optical density, circular dichroism, and differential scanning calorimetry data confirm this shape change, attributable from nuclear magnetic resonance analysis to i-motif formation. Sedimentation equilibrium studies of oligo dG(8) and dG(16) reveal extensive self-association and the formation of G-quadruplexes. Continuous distribution analysis of sedimentation velocity data for oligo dG(16) identifies the presence of discrete dimers, tetramers, and dodecamers. These studies distinguish the conformational and colligative properties of the individual bases in DNA and their inherent capacity to promote specific folding pathways.

  7. Sedimentation analysis of novel DNA structures formed by homo-oligonucleotides.

    PubMed Central

    Hatters, D M; Wilson, L; Atcliffe, B W; Mulhern, T D; Guzzo-Pernell, N; Howlett, G J

    2001-01-01

    Sedimentation velocity analysis has been used to examine the base-specific structural conformations and unusual hydrogen bonding patterns of model oligonucleotides. Homo-oligonucleotides composed of 8-28 residues of dA, dT, or dC nucleotides in 100 mM sodium phosphate, pH 7.4, at 20 degrees C behave as extended monomers. Comparison of experimentally determined sedimentation coefficients with theoretical values calculated for assumed helical structures show that dT and dC oligonucleotides are more compact than dA oligonucleotides. For dA oligonucleotides, the average width (1.7 nm), assuming a cylindrical model, is smaller than for control duplex DNA whereas the average rise per base (0.34 nm) is similar to that of B-DNA. For dC and dT oligonucleotides, there is an increase in the average widths (1.8 nm and 2.1 nm, respectively) whereas the average rise per base is smaller (0.28 nm and 0.23 nm, respectively). A significant shape change is observed for oligo dC(28) at lower temperatures (10 degrees C), corresponding to a fourfold decrease in axial ratio. Optical density, circular dichroism, and differential scanning calorimetry data confirm this shape change, attributable from nuclear magnetic resonance analysis to i-motif formation. Sedimentation equilibrium studies of oligo dG(8) and dG(16) reveal extensive self-association and the formation of G-quadruplexes. Continuous distribution analysis of sedimentation velocity data for oligo dG(16) identifies the presence of discrete dimers, tetramers, and dodecamers. These studies distinguish the conformational and colligative properties of the individual bases in DNA and their inherent capacity to promote specific folding pathways. PMID:11423421

  8. Enhanced oligonucleotide-nanoparticle conjugate stability using thioctic acid modified oligonucleotides.

    PubMed

    Dougan, Jennifer A; Karlsson, Camilla; Smith, W Ewen; Graham, Duncan

    2007-01-01

    Metallic nanoparticles of gold functionalized with oligonucleotides conventionally use a terminal thiol modification and have been used in a wide range of applications. Although readily available, the oligonucleotide-nanoparticle conjugates prepared in this way suffer from a lack of stability when exposed to a variety of small molecules or elevated temperatures. If silver is used in place of gold then this lack of stability is even more pronounced. In this study we report the synthesis of highly stabilized oligonucleotide-nanoparticle conjugates using a simple oligonucleotide modification. A modified solid support was used to generate 3'-thioctic acid modified oligonucleotides by treatment with an N-hydroxysuccimidyl ester of thioctic acid. Unusually, both gold and silver nanoparticles have been investigated in this study and show that these disulphide-modified oligonucleotide probes offer significant improvements in nanoparticle stability when treated with dithiothreitol (DTT) compared with monothiol analogues. This is a significant advance in oligonucleotide-nanoparticle conjugate stability and for the first time allows silver nanoparticles to be prepared that are more stable than standard gold-thiol functionalized nanoparticles. This opens up the possibility of using silver nanoparticles functionalized with oligonucleotides as an alternative to gold.

  9. BOND: Basic OligoNucleotide Design

    PubMed Central

    2013-01-01

    Background DNA microarrays have become ubiquitous in biological and medical research. The most difficult problem that needs to be solved is the design of DNA oligonucleotides that (i) are highly specific, that is, bind only to the intended target, (ii) cover the highest possible number of genes, that is, all genes that allow such unique regions, and (iii) are computed fast. None of the existing programs meet all these criteria. Results We introduce a new approach with our software program BOND (Basic OligoNucleotide Design). According to Kane’s criteria for oligo design, BOND computes highly specific DNA oligonucleotides, for all the genes that admit unique probes, while running orders of magnitude faster than the existing programs. The same approach enables us to introduce also an evaluation procedure that correctly measures the quality of the oligonucleotides. Extensive comparison is performed to prove our claims. BOND is flexible, easy to use, requires no additional software, and is freely available for non-commercial use from http://www.csd.uwo.ca/∼ilie/BOND/. Conclusions We provide an improved solution to the important problem of oligonucleotide design, including a thorough evaluation of oligo design programs. We hope BOND will become a useful tool for researchers in biological and medical sciences by making the microarray procedures faster and more accurate. PMID:23444904

  10. An oligonucleotide hybridization approach to DNA sequencing.

    PubMed

    Khrapko, K R; Lysov YuP; Khorlyn, A A; Shick, V V; Florentiev, V L; Mirzabekov, A D

    1989-10-09

    We have proposed a DNA sequencing method based on hybridization of a DNA fragment to be sequenced with the complete set of fixed-length oligonucleotides (e.g., 4(8) = 65,536 possible 8-mers) immobilized individually as dots of a 2-D matrix [(1989) Dokl. Akad. Nauk SSSR 303, 1508-1511]. It was shown that the list of hybridizing octanucleotides is sufficient for the computer-assisted reconstruction of the structures for 80% of random-sequence fragments up to 200 bases long, based on the analysis of the octanucleotide overlapping. Here a refinement of the method and some experimental data are presented. We have performed hybridizations with oligonucleotides immobilized on a glass plate, and obtained their dissociation curves down to heptanucleotides. Other approaches, e.g., an additional hybridization of short oligonucleotides which continuously extend duplexes formed between the fragment and immobilized oligonucleotides, should considerably increase either the probability of unambiguous reconstruction, or the length of reconstructed sequences, or decrease the size of immobilized oligonucleotides.

  11. Spectroscopic (UV/VIS, Raman) and Electrophoresis Study of Cytosine-Guanine Oligonucleotide DNA Influenced by Magnetic Field.

    PubMed

    Banihashemian, Seyedeh Maryam; Periasamy, Vengadesh; Boon Tong, Goh; Abdul Rahman, Saadah

    2016-01-01

    Studying the effect of a magnetic field on oligonucleotide DNA can provide a novel DNA manipulation technique for potential application in bioengineering and medicine. In this work, the optical and electrochemical response of a 100 bases oligonucleotides DNA, cytosine-guanine (CG100), is investigated via exposure to different magnetic fields (250, 500, 750, and 1000 mT). As a result of the optical response of CG100 to the magnetic field, the ultra-violet-visible spectrum indicated a slight variation in the band gap of CG100 of about 0.3 eV. Raman spectroscopy showed a significant deviation in hydrogen and phosphate bonds' vibration after exposure to the magnetic field. Oligonucleotide DNA mobility was investigated in the external electric field using the gel electrophoresis technique, which revealed a small decrease in the migration of CG100 after exposure to the magnetic field.

  12. Spectroscopic (UV/VIS, Raman) and Electrophoresis Study of Cytosine-Guanine Oligonucleotide DNA Influenced by Magnetic Field

    PubMed Central

    Banihashemian, Seyedeh Maryam; Periasamy, Vengadesh; Boon Tong, Goh; Abdul Rahman, Saadah

    2016-01-01

    Studying the effect of a magnetic field on oligonucleotide DNA can provide a novel DNA manipulation technique for potential application in bioengineering and medicine. In this work, the optical and electrochemical response of a 100 bases oligonucleotides DNA, cytosine-guanine (CG100), is investigated via exposure to different magnetic fields (250, 500, 750, and 1000 mT). As a result of the optical response of CG100 to the magnetic field, the ultra-violet-visible spectrum indicated a slight variation in the band gap of CG100 of about 0.3 eV. Raman spectroscopy showed a significant deviation in hydrogen and phosphate bonds’ vibration after exposure to the magnetic field. Oligonucleotide DNA mobility was investigated in the external electric field using the gel electrophoresis technique, which revealed a small decrease in the migration of CG100 after exposure to the magnetic field. PMID:26999445

  13. Donor acceptor complexes of noble gases.

    PubMed

    Mück, Leonie Anna; Timoshkin, Alexey Y; von Hopffgarten, Moritz; Frenking, Gernot

    2009-03-25

    Donor-acceptor (DA) complexes of noble gases (Ng) of the general type A <-- Ng <-- D (A = Lewis acid, D = Lewis base) have been theoretically studied using ab initio and DFT methods. Chemical bonding in these compounds is realized via a 3-center 4-electron bond, which is formed by a lone pair of the noble gas, a lone pair of the donor molecule and a vacant orbital of the acceptor molecule. Detailed bonding analysis of the model compounds F(3)Al-Ng-NH(3) reveals that Ng-ammonia interaction is repulsive due to Pauli repulsion. Bonding interaction between Ng and N is mostly electrostatic. In contrast, strong orbital interactions are responsible for the attractive interactions between Ng and AlF(3). Due to the repulsive interactions with the donor molecule and a sizable reorganization energy of the acceptor molecule, optimization attempts of the A <-- Ng <-- D compounds, which feature individual donor and acceptor molecules, always lead to the dissociation of the complex and eventual formation of free Ng. To overcome this obstacle, the concept of a rigid C(3v) symmetric cryptand-type ligand, which features spacially separated pyramidalized donor and acceptor fragments, is introduced. Such "push-pull" ligands are predicted to exothermically form complexes with noble gases. These are the first examples of the thermodynamically stable Ar and Kr compounds. Application of the push-pull cryptand ligands featuring multiple (two and three) donor-acceptor induced chemical bonds is expected to yield stable complexes with virtually any electron-rich element in the periodic table.

  14. In silico screening based on predictive algorithms as a design tool for exon skipping oligonucleotides in Duchenne muscular dystrophy.

    PubMed

    Echigoya, Yusuke; Mouly, Vincent; Garcia, Luis; Yokota, Toshifumi; Duddy, William

    2015-01-01

    The use of antisense 'splice-switching' oligonucleotides to induce exon skipping represents a potential therapeutic approach to various human genetic diseases. It has achieved greatest maturity in exon skipping of the dystrophin transcript in Duchenne muscular dystrophy (DMD), for which several clinical trials are completed or ongoing, and a large body of data exists describing tested oligonucleotides and their efficacy. The rational design of an exon skipping oligonucleotide involves the choice of an antisense sequence, usually between 15 and 32 nucleotides, targeting the exon that is to be skipped. Although parameters describing the target site can be computationally estimated and several have been identified to correlate with efficacy, methods to predict efficacy are limited. Here, an in silico pre-screening approach is proposed, based on predictive statistical modelling. Previous DMD data were compiled together and, for each oligonucleotide, some 60 descriptors were considered. Statistical modelling approaches were applied to derive algorithms that predict exon skipping for a given target site. We confirmed (1) the binding energetics of the oligonucleotide to the RNA, and (2) the distance in bases of the target site from the splice acceptor site, as the two most predictive parameters, and we included these and several other parameters (while discounting many) into an in silico screening process, based on their capacity to predict high or low efficacy in either phosphorodiamidate morpholino oligomers (89% correctly predicted) and/or 2'O Methyl RNA oligonucleotides (76% correctly predicted). Predictions correlated strongly with in vitro testing for sixteen de novo PMO sequences targeting various positions on DMD exons 44 (R² 0.89) and 53 (R² 0.89), one of which represents a potential novel candidate for clinical trials. We provide these algorithms together with a computational tool that facilitates screening to predict exon skipping efficacy at each position of

  15. In Silico Screening Based on Predictive Algorithms as a Design Tool for Exon Skipping Oligonucleotides in Duchenne Muscular Dystrophy

    PubMed Central

    Echigoya, Yusuke; Mouly, Vincent; Garcia, Luis; Yokota, Toshifumi; Duddy, William

    2015-01-01

    The use of antisense ‘splice-switching’ oligonucleotides to induce exon skipping represents a potential therapeutic approach to various human genetic diseases. It has achieved greatest maturity in exon skipping of the dystrophin transcript in Duchenne muscular dystrophy (DMD), for which several clinical trials are completed or ongoing, and a large body of data exists describing tested oligonucleotides and their efficacy. The rational design of an exon skipping oligonucleotide involves the choice of an antisense sequence, usually between 15 and 32 nucleotides, targeting the exon that is to be skipped. Although parameters describing the target site can be computationally estimated and several have been identified to correlate with efficacy, methods to predict efficacy are limited. Here, an in silico pre-screening approach is proposed, based on predictive statistical modelling. Previous DMD data were compiled together and, for each oligonucleotide, some 60 descriptors were considered. Statistical modelling approaches were applied to derive algorithms that predict exon skipping for a given target site. We confirmed (1) the binding energetics of the oligonucleotide to the RNA, and (2) the distance in bases of the target site from the splice acceptor site, as the two most predictive parameters, and we included these and several other parameters (while discounting many) into an in silico screening process, based on their capacity to predict high or low efficacy in either phosphorodiamidate morpholino oligomers (89% correctly predicted) and/or 2’O Methyl RNA oligonucleotides (76% correctly predicted). Predictions correlated strongly with in vitro testing for sixteen de novo PMO sequences targeting various positions on DMD exons 44 (R2 0.89) and 53 (R2 0.89), one of which represents a potential novel candidate for clinical trials. We provide these algorithms together with a computational tool that facilitates screening to predict exon skipping efficacy at each

  16. Antisense Oligonucleotide Mediated Splice Correction of a Deep Intronic Mutation in OPA1

    PubMed Central

    Bonifert, Tobias; Gonzalez Menendez, Irene; Battke, Florian; Theurer, Yvonne; Synofzik, Matthis; Schöls, Ludger; Wissinger, Bernd

    2016-01-01

    Inherited optic neuropathies (ION) present an important cause of blindness in the European working-age population. Recently we reported the discovery of four independent families with deep intronic mutations in the main inherited optic neuropathies gene OPA1. These deep intronic mutations cause mis-splicing of the OPA1 pre-messenger-RNA transcripts by creating cryptic acceptor splice sites. As a rescue strategy we sought to prevent mis-splicing of the mutant pre-messenger-RNA by applying 2′O-methyl-antisense oligonucleotides (AONs) with a full-length phosphorothioate backbone that target the cryptic acceptor splice sites and the predicted novel branch point created by the deep intronic mutations, respectively. Transfection of patient-derived primary fibroblasts with these AONs induced correct splicing of the mutant pre-messenger-RNA in a time and concentration dependent mode of action, as detected by pyrosequencing of informative heterozygous variants. The treatment showed strong rescue effects (~55%) using the cryptic acceptor splice sites targeting AON and moderate rescue (~16%) using the branch point targeting AON. The highest efficacy of Splice correction could be observed 4 days after treatment however, significant effects were still seen 14 days post-transfection. Western blot analysis revealed increased amounts of OPA1 protein with maximum amounts at ~3 days post-treatment. In summary, we provide the first mutation-specific in vitro rescue strategy for OPA1 deficiency using synthetic AONs. PMID:27874857

  17. Intrinsically Labeled Fluorescent Oligonucleotide Probes on Quantum Dots for Transduction of Nucleic Acid Hybridization.

    PubMed

    Shahmuradyan, Anna; Krull, Ulrich J

    2016-03-15

    Quantum dots (QDs) have been widely used in chemical and biosensing due to their unique photoelectrical properties and are well suited as donors in fluorescence resonance energy transfer (FRET). Selective hybridization interactions of oligonucleotides on QDs have been determined by FRET. Typically, the QD-FRET constructs have made use of labeled targets or have implemented labeled sandwich format assays to introduce dyes in proximity to the QDs for the FRET process. The intention of this new work is to explore a method to incorporate the acceptor dye into the probe molecule. Thiazole orange (TO) derivatives are fluorescent intercalating dyes that have been used for detection of double-stranded nucleic acids. One such dye system has been reported in which single-stranded oligonucleotide probes were doubly labeled with adjacent thiazole orange derivatives. In the absence of the fully complementary (FC) oligonucleotide target, the dyes form an H-aggregate, which results in quenching of fluorescence emission due to excitonic interactions between the dyes. The hybridization of the FC target to the probe provides for dissociation of the aggregate as the dyes intercalate into the double stranded duplex, resulting in increased fluorescence. This work reports investigation of the dependence of the ratiometric signal on the type of linkage used to conjugate the dyes to the probe, the location of the dye along the length of the probe, and the distance between adjacent dye molecules. The limit of detection for 34mer and 90mer targets was found to be identical and was 10 nM (2 pmol), similar to analogous QD-FRET using labeled oligonucleotide target. The detection system could discriminate a one base pair mismatch (1BPM) target and was functional without substantial compromise of the signal in 75% serum. The 1BPM was found to reduce background signal, indicating that the structure of the mismatch affected the environment of the intercalating dyes.

  18. Electron Donor Acceptor Interactions. Final Progress Report

    SciTech Connect

    2002-08-16

    The Gordon Research Conference (GRC) on Electron Donor Acceptor Interactions was held at Salve Regina University, Newport, Rhode Island, 8/11-16/02. Emphasis was placed on current unpublished research and discussion of the future target areas in this field.

  19. Gas-phase Reactivity of meta-Benzyne Analogs Toward Small Oligonucleotides of Differing Lengths

    NASA Astrophysics Data System (ADS)

    Widjaja, Fanny; Max, Joann P.; Jin, Zhicheng; Nash, John J.; Kenttämaa, Hilkka I.

    2017-07-01

    The gas-phase reactivity of two aromatic carbon-centered σ,σ-biradicals ( meta-benzyne analogs) and a related monoradical towards small oligonucleotides of differing lengths was investigated in a Fourier-transform ion cyclotron resonance (FT-ICR) mass spectrometer coupled with laser-induced acoustic desorption (LIAD). The mono- and biradicals were positively charged to allow for manipulation in the mass spectrometer. The oligonucleotides were evaporated into the gas phase as intact neutral molecules by using LIAD. One of the biradicals was found to be unreactive. The reactive biradical reacts with dinucleoside phosphates and trinucleoside diphosphates mainly by addition to a nucleobase moiety followed by cleavage of the glycosidic bond, leading to a nucleobase radical (e.g., base-H) abstraction. In some instances, after the initial cleavage, the unquenched radical site of the biradical abstracts a hydrogen atom from the neutral fragment, which results in a net nucleobase abstraction. In sharp contrast, the related monoradical mainly undergoes facile hydrogen atom abstraction from the sugar moiety. As the size of the oligonucleotides increases, the rate of hydrogen atom abstraction from the sugar moiety by the monoradical was found to increase due to the presence of more hydrogen atom donor sites, and it is the only reaction observed for tetranucleoside triphosphates. Hence, the monoradical only attacks sugar moieties in these substrates. The biradical also shows significant attack at the sugar moiety for tetranucleoside triphosphates. This drastic change in reactivity indicates that the size of the oligonucleotides plays a key role in the outcome of these reactions. This finding is attributed to more compact conformations in the gas phase for the tetranucleoside triphosphates than for the smaller oligonucleotides, which result from stronger stabilizing interactions between the nucleobases.

  20. DETECTING LOW-LEVEL SYNTHESIS IMPURITIES IN MODIFIED PHOSPHOROTHIOATE OLIGONUCLEOTIDES USING LIQUID CHROMATOGRAPHY - HIGH RESOLUTION MASS SPECTROMETRY.

    PubMed

    Nikcevic, Irena; Wyrzykiewicz, Tadeusz K; Limbach, Patrick A

    2011-07-01

    An LC-MS method based on the use of high resolution Fourier transform ion cyclotron resonance mass spectrometry (FTIRCMS) for profiling oligonucleotides synthesis impurities is described.Oligonucleotide phosphorothioatediesters (phosphorothioate oligonucleotides), in which one of the non-bridging oxygen atoms at each phosphorus center is replaced by a sulfur atom, are now one of the most popular oligonucleotide modifications due to their ease of chemical synthesis and advantageous pharmacokinetic properties. Despite significant progress in the solid-phase oligomerization chemistry used in the manufacturing of these oligonucleotides, multiple classes of low-level impurities always accompany synthetic oligonucleotides. Liquid chromatography-mass spectrometry has emerged as a powerful technique for the identification of these synthesis impurities. However, impurity profiling, where the entire complement of low-level synthetic impurities is identified in a single analysis, is more challenging. Here we present an LC-MS method based the use of high resolution-mass spectrometry, specifically Fourier transform ion cyclotron resonance mass spectrometry (FTIRCMS or FTMS). The optimal LC-FTMS conditions, including the stationary phase and mobile phases for the separation and identification of phosphorothioate oligonucleotides, were found. The characteristics of FTMS enable charge state determination from single m/z values of low-level impurities. Charge state information then enables more accurate modeling of the detected isotopic distribution for identification of the chemical composition of the detected impurity. Using this approach, a number of phosphorothioate impurities can be detected by LC-FTMS including failure sequences carrying 3'-terminal phosphate monoester and 3'-terminal phosphorothioate monoester, incomplete backbone sulfurization and desulfurization products, high molecular weight impurities, and chloral, isobutyryl, and N(3) (2-cyanoethyl) adducts of the full

  1. DETECTING LOW-LEVEL SYNTHESIS IMPURITIES IN MODIFIED PHOSPHOROTHIOATE OLIGONUCLEOTIDES USING LIQUID CHROMATOGRAPHY – HIGH RESOLUTION MASS SPECTROMETRY

    PubMed Central

    Nikcevic, Irena; Wyrzykiewicz, Tadeusz K.; Limbach, Patrick A.

    2010-01-01

    Summary An LC-MS method based on the use of high resolution Fourier transform ion cyclotron resonance mass spectrometry (FTIRCMS) for profiling oligonucleotides synthesis impurities is described. Oligonucleotide phosphorothioatediesters (phosphorothioate oligonucleotides), in which one of the non-bridging oxygen atoms at each phosphorus center is replaced by a sulfur atom, are now one of the most popular oligonucleotide modifications due to their ease of chemical synthesis and advantageous pharmacokinetic properties. Despite significant progress in the solid-phase oligomerization chemistry used in the manufacturing of these oligonucleotides, multiple classes of low-level impurities always accompany synthetic oligonucleotides. Liquid chromatography-mass spectrometry has emerged as a powerful technique for the identification of these synthesis impurities. However, impurity profiling, where the entire complement of low-level synthetic impurities is identified in a single analysis, is more challenging. Here we present an LC-MS method based the use of high resolution-mass spectrometry, specifically Fourier transform ion cyclotron resonance mass spectrometry (FTIRCMS or FTMS). The optimal LC-FTMS conditions, including the stationary phase and mobile phases for the separation and identification of phosphorothioate oligonucleotides, were found. The characteristics of FTMS enable charge state determination from single m/z values of low-level impurities. Charge state information then enables more accurate modeling of the detected isotopic distribution for identification of the chemical composition of the detected impurity. Using this approach, a number of phosphorothioate impurities can be detected by LC-FTMS including failure sequences carrying 3′-terminal phosphate monoester and 3′-terminal phosphorothioate monoester, incomplete backbone sulfurization and desulfurization products, high molecular weight impurities, and chloral, isobutyryl, and N3 (2-cyanoethyl) adducts

  2. Oligonucleotide recombination in gram negative bacteria

    USDA-ARS?s Scientific Manuscript database

    This report describes several key aspects of a novel form of RecA-independent homologous recombination. We found that synthetic single stranded DNA oligonucleotides (oligos) introduced into bacteria by transformation can site-specifically recombine with bacterial chromosomes in the absence of any a...

  3. 5' modification of duplex DNA with a ruthenium electron donor-acceptor pair using solid-phase DNA synthesis

    NASA Technical Reports Server (NTRS)

    Frank, Natia L.; Meade, Thomas J.

    2003-01-01

    Incorporation of metalated nucleosides into DNA through covalent modification is crucial to measurement of thermal electron-transfer rates and the dependence of these rates with structure, distance, and position. Here, we report the first synthesis of an electron donor-acceptor pair of 5' metallonucleosides and their subsequent incorporation into oligonucleotides using solid-phase DNA synthesis techniques. Large-scale syntheses of metal-containing oligonucleotides are achieved using 5' modified phosporamidites containing [Ru(acac)(2)(IMPy)](2+) (acac is acetylacetonato; IMPy is 2'-iminomethylpyridyl-2'-deoxyuridine) (3) and [Ru(bpy)(2)(IMPy)](2+) (bpy is 2,2'-bipyridine; IMPy is 2'-iminomethylpyridyl-2'-deoxyuridine) (4). Duplexes formed with the metal-containing oligonucleotides exhibit thermal stability comparable to the corresponding unmetalated duplexes (T(m) of modified duplex = 49 degrees C vs T(m) of unmodified duplex = 47 degrees C). Electrochemical (3, E(1/2) = -0.04 V vs NHE; 4, E(1/2) = 1.12 V vs NHE), absorption (3, lambda(max) = 568, 369 nm; 4, lambda(max) = 480 nm), and emission (4, lambda(max) = 720 nm, tau = 55 ns, Phi = 1.2 x 10(-)(4)) data for the ruthenium-modified nucleosides and oligonucleotides indicate that incorporation into an oligonucleotide does not perturb the electronic properties of the ruthenium complex or the DNA significantly. In addition, the absence of any change in the emission properties upon metalated duplex formation suggests that the [Ru(bpy)(2)(IMPy)](2+)[Ru(acac)(2)(IMPy)](2+) pair will provide a valuable probe for DNA-mediated electron-transfer studies.

  4. Liver as a target for oligonucleotide therapeutics.

    PubMed

    Sehgal, Alfica; Vaishnaw, Akshay; Fitzgerald, Kevin

    2013-12-01

    Oligonucleotide-based therapeutics are an emerging class of drugs that hold the promise for silencing "un-druggable" targets,thus creating unique opportunities for innovative medicines. As opposed to gene therapy, oligonucleotides are considered to be more akin to small molecule therapeutics because they are small,completely synthetic in origin, do not integrate into the host genome,and have a defined duration of therapeutic activity after which effects recover to baseline. They offer a high degree of specificity at the genetic level, thereby reducing off-target effects.At the same time, they provide a strategy for targeting any gene in the genome, including transcripts that produce mutated proteins.Oligonucleotide-based therapeutics include short interfering RNA (siRNA), that degrade target mRNA through RISC mediated RNAi; anti-miRs, that target miRNAs; miRNA mimics, that regulate target mRNA; antisense oligonucleotides, that may be working through RNAseH mediated mRNA decay; mRNA upregulation,by targeting long non-coding RNAs; and oligonucleotides induced alternative splicing [1]. All these approaches require some minimal degree of homology at the nucleic acid sequence level for them to be functional. The different mechanisms of action and their relevant activity are outlined in Fig. 1. Besides homology,RNA secondary structure has also been exploited in the case of ribozymes and aptamers, which act by binding to nucleic acids or proteins, respectively. While there have been many reports of gene knockdown and gene modulation in cell lines and mice with all these methods, very few have advanced to clinical stages.The main obstacle to date has been the safe and effective intracellular delivery of these compounds in higher species, including humans. Indeed, their action requires direct interaction with DNA/RNA within the target cell so even when one solves the issues of tissue and cellular access, intracellular/intranuclear location represents yet another barrier to

  5. Formation of N-branched oligonucleotides as by-products in solid-phase oligonucleotide synthesis.

    PubMed

    Cazenave, Christian; Bathany, Katell; Rayner, Bernard

    2006-01-01

    During the synthesis of oligonucleotides by the standard phosphoramidite method using 2'-deoxycytidine- derivatized solid support, a side reaction was observed that gave rise to the formation of high molecular weight N-branched oligomers having two identical chains linked to the 3'-terminal 2'-deoxycytidine. Postsynthesis treatment with neat triethylamine trihydrofluoride selectively cleaved the phosphoramidate linkage and converted the N-branched oligomers back to the expected oligonucleotides.

  6. Vaccine perception among acceptors and non-acceptors in Sokoto State, Nigeria.

    PubMed

    Murele, Bola; Vaz, Rui; Gasasira, Alex; Mkanda, Pascal; Erbeto, Tesfaye; Okeibunor, Joseph

    2014-05-30

    Vaccine perceptions among acceptors and non-acceptors of childhood vaccination were explored. Seventy-two care givers, among them, acceptors and non-acceptors were interviewed in-depth with an interview guide that assessed vaccine acceptance, social and personality factors, and health belief model (HBM) categories in relation to oral polio vaccine (perceived susceptibility, severity, cost barriers, general barriers, benefits, knowledge, and engagement in preventative health behaviours). Community leaders were purposively selected while parents were selected on the basis of availability while ensuring the different attitude to vaccines was covered. Results showed that the HBM framework was found to be appropriate for identifying and distinguishing vaccine acceptors and non-acceptors. In addition, the HBM categories of benefits and susceptibility were found to influence oral polio vaccine acceptance. Second, the opinion of family members about the oral polio vaccine moderated the relationship between number of social ties and vaccine acceptance. Further, oral polio vaccine acceptance was related to outbreaks of paralysis of any sort, but not aggregate scores of other preventative health behaviours. Implications of this study include the investigation of vaccine acceptance in a high risk population. Research was done to investigate vaccine acceptance. Copyright © 2014 Elsevier Ltd. All rights reserved.

  7. Alteration of the Donor/Acceptor Spectrum of the (S)-Amine Transaminase from Vibrio fluvialis.

    PubMed

    Genz, Maika; Vickers, Clare; van den Bergh, Tom; Joosten, Henk-Jan; Dörr, Mark; Höhne, Matthias; Bornscheuer, Uwe T

    2015-11-11

    To alter the amine donor/acceptor spectrum of an (S)-selective amine transaminase (ATA), a library based on the Vibrio fluvialis ATA targeting four residues close to the active site (L56, W57, R415 and L417) was created. A 3DM-derived alignment comprising fold class I pyridoxal-5'-phosphate (PLP)-dependent enzymes allowed identification of positions, which were assumed to determine substrate specificity. These positions were targeted for mutagenesis with a focused alphabet of hydrophobic amino acids to convert an amine:α-keto acid transferase into an amine:aldehyde transferase. Screening of 1200 variants revealed three hits, which showed a shifted amine donor/acceptor spectrum towards aliphatic aldehydes (mainly pentanal), as well as an altered pH profile. Interestingly, all three hits, although found independently, contained the same mutation R415L and additional W57F and L417V substitutions.

  8. Studies of endogenous UDP-glucose: glycoprotein glucose-1-phosphotransferase acceptors in embryonic chick neural tissues

    SciTech Connect

    Hiller, A.M.S.

    1986-01-01

    UPD-glucose: glycoprotein glucose-1-phosphotransferase (GlcPTase) catalyzes the transfer of a Glc-1-P from UDP-Glc to high mannose-type oligosaccharides on a class of embryonic chick neutral retinal glycoproteins. The primary acceptors for this glycosylphosphotransferase were determined by incubating embryonic chick tissue sonicates with (B-/sup 32/P)UDP-Glc followed by SDS-polyacrylamine gel electrophoresis and autoradiography. The primary GlcPT ase acceptors in brain tissue have apparent subunit molecular weights of 66 and 62 kilodaltons (kd). /sup 32/P incorporation into these peptides was eliminated by excess levels of unlabeled UDP-Glc and unaffected by the inclusion of other phosphate-containing compounds, with the exception of UDP-galactose which can be converted to UDP-Glc by an endogenous epimerase.

  9. Alteration of the Donor/Acceptor Spectrum of the (S)-Amine Transaminase from Vibrio fluvialis

    PubMed Central

    Genz, Maika; Vickers, Clare; van den Bergh, Tom; Joosten, Henk-Jan; Dörr, Mark; Höhne, Matthias; Bornscheuer, Uwe T.

    2015-01-01

    To alter the amine donor/acceptor spectrum of an (S)-selective amine transaminase (ATA), a library based on the Vibrio fluvialis ATA targeting four residues close to the active site (L56, W57, R415 and L417) was created. A 3DM-derived alignment comprising fold class I pyridoxal-5′-phosphate (PLP)-dependent enzymes allowed identification of positions, which were assumed to determine substrate specificity. These positions were targeted for mutagenesis with a focused alphabet of hydrophobic amino acids to convert an amine:α-keto acid transferase into an amine:aldehyde transferase. Screening of 1200 variants revealed three hits, which showed a shifted amine donor/acceptor spectrum towards aliphatic aldehydes (mainly pentanal), as well as an altered pH profile. Interestingly, all three hits, although found independently, contained the same mutation R415L and additional W57F and L417V substitutions. PMID:26569229

  10. Chemical synthesis of long RNAs with terminal 5'-phosphate groups.

    PubMed

    Pradère, Ugo; Halloy, François; Hall, Jonathan

    2017-03-12

    Long structured RNAs are useful biochemical and biological tools. They are usually prepared enzymatically, but this precludes their site-specific modification with functional groups for chemical biology studies. One solution is to perform solid-phase synthesis of multiple RNAs loaded with 5'-terminal phosphate groups, so that RNAs can be concatenated using template ligation reactions. However, there are currently no readily available reagents suitable for the incorporation of the phosphate group into long RNAs by solid-phase synthesis. Here we describe an easy-to-prepare phosphoramidite reagent suitable for the chemical introduction of 5'-terminal phosphate groups into long RNAs. The phosphate is protected by a dinitrobenzhydryl group that serves as an essential lipophilic group for the separation of oligonucleotide by-products. The phosphate is unmasked quantitatively by brief UV irradiation. We demonstrate the value of this reagent in the preparation of a library of long structured RNAs that are site-specifically modified with functional groups.

  11. Oligonucleotide microarrays with stem-loop probes: enhancing the hybridization of nucleic acids for sensitive analysis.

    PubMed

    Mahajan, Shweta; Swami, Archana; Sethi, Dalip; Kumar, P; Gupta, K C

    2008-06-15

    We have demonstrated that the dynamics of nucleic acid hybridization in microarrays depend on the physical structure of immobilized probes. We have immobilized oligonucleotide-3'-phosphates with and without stem-loop structure on epoxylated glass surface, followed by hybridization under different conditions, viz., hybridization buffer, pH condition, temperature and ionic strength. In a comparative study, we have established that array constructed using probes with stem-loop structure displayed approximately 2.2 times higher hybridization signals than the probes without it. The stem-loop DNA array format is simple and flexible in design and thus potentially useful in various DNA diagnostic tests.

  12. Chemical ligation of oligonucleotides using an electrophilic phosphorothioester

    PubMed Central

    Oikawa, Ryota; Hayakawa, Mayu; Takamori, Shono; Kimura, Yasuaki; Abe, Naoko; Tsuji, Genichiro; Matsuda, Akira; Shuto, Satoshi; Ito, Yoshihiro

    2017-01-01

    Abstract We developed a new approach for chemical ligation of oligonucleotides using the electrophilic phosphorothioester (EPT) group. A nucleophilic phosphorothioate group on oligonucleotides was converted into the EPT group by treatment with Sanger's reagent (1-fluoro-2,4-dinitrobenzene). EPT oligonucleotides can be isolated, stored frozen, and used for the ligation reaction. The reaction of the EPT oligonucleotide and an amino-modified oligonucleotide took place without any extra reagents at pH 7.0–8.0 at room temperature, and resulted in a ligation product with a phosphoramidate bond with a 39–85% yield. This method has potential uses in biotechnology and chemical biology. PMID:28520986

  13. High Performance Magazine Acceptor Threshold Criteria

    DTIC Science & Technology

    1994-08-01

    detonation transition (DDT). To account for unknown mechanisms the term XDT is also used. Development of a design procedure to prevent SD requires...propagation walls are used to prevent sympathetic detonation between munitions stored in adjacent cells. Design of the walls, and their mitigation...effects, requires sympathetic detonation threshold criteria for acceptor munitions. This paper outlines the procedures being used to develop SD threshold

  14. Drug targeting: synthesis and endocytosis of oligonucleotide-neoglycoprotein conjugates.

    PubMed Central

    Bonfils, E; Depierreux, C; Midoux, P; Thuong, N T; Monsigny, M; Roche, A C

    1992-01-01

    Inhibition of gene expression by antisense oligonucleotides is limited by their low ability to enter cells. Knowing that sugar binding receptors, also called membrane lectins, efficiently internalize neoglycoproteins bearing the relevant sugar, 6-phosphomannose, for instance, oligonucleotides--substituted on their 5'-end with either a fluorescent probe or a radioactive label on the one hand, and bearing a thiol function on their 3'-end, on the other hand,--were coupled onto 6-phosphomannosylated proteins via a disulfide bridge. The oligonucleotide bound to 6-phosphomannosylated serum albumin is much more efficiently internalized roughly 20 times than the free oligonucleotide. Although most of the oligonucleotides are associated with vesicular compartments, oligonucleotides after releasing from the carrier by reduction of the disulfide bridge may find their way to reach the cytosol and then lead to an increase in the efficiency of the oligonucleotides. Images PMID:1408764

  15. Treatment of experimental autoimmune encephalomyelitis with antisense oligonucleotides against the low affinity neurotrophin receptor.

    PubMed

    Soilu-Hänninen, M; Epa, R; Shipham, K; Butzkueven, H; Bucci, T; Barrett, G; Bartlett, P F; Kilpatrick, T J

    2000-03-15

    Upregulated expression of the low-affinity neurotrophin receptor (p75) in the central nervous system (CNS) during experimental autoimmune encephalomyelitis (EAE) has recently been demonstrated. To investigate whether p75 plays a role in disease pathogenesis, we adopted a gene therapy approach, utilizing antisense oligonucleotides to downregulate p75 expression during EAE. Phosphorothioate antisense oligonucleotides (AS), nonsense oligonucleotides (NS) or phosphate buffered saline (PBS) were injected daily for 18 days after immunization of SJL/J (H-2s)-mice with myelin proteolipid protein (PLP) peptide 139-151. In the AS group, there was a statistically significant reduction in both the mean maximal disease score (1.85 in the AS, 2.94 in the NS and 2.75 in the PBS-groups, respectively, P < 0.025) and in the cumulative disease incidence ( approximately 60% in the AS group and approximately 90% in the control groups). Histological and immunohistochemical analysis showed reduced inflammation and demyelination, as well as reduced p75 expression at the blood-brain barrier (BBB) in the AS-treated mice in comparison with both control groups. There was no difference, however, in p75 expression on neural cells within the CNS between the three groups of mice. We conclude that p75 could play a proactive role in the pathogenesis of EAE and may exert its effect at the level of the BBB.

  16. Antisense oligonucleotides in therapy for neurodegenerative disorders.

    PubMed

    Evers, Melvin M; Toonen, Lodewijk J A; van Roon-Mom, Willeke M C

    2015-06-29

    Antisense oligonucleotides are synthetic single stranded strings of nucleic acids that bind to RNA and thereby alter or reduce expression of the target RNA. They can not only reduce expression of mutant proteins by breakdown of the targeted transcript, but also restore protein expression or modify proteins through interference with pre-mRNA splicing. There has been a recent revival of interest in the use of antisense oligonucleotides to treat several neurodegenerative disorders using different approaches to prevent disease onset or halt disease progression and the first clinical trials for spinal muscular atrophy and amyotrophic lateral sclerosis showing promising results. For these trials, intrathecal delivery is being used but direct infusion into the brain ventricles and several methods of passing the blood brain barrier after peripheral administration are also under investigation.

  17. Oligonucleotide-based therapy for neurodegenerative diseases.

    PubMed

    Magen, Iddo; Hornstein, Eran

    2014-10-10

    Molecular genetics insight into the pathogenesis of several neurodegenerative diseases, such as Alzheimer׳s disease, Parkinson׳s disease, Huntington׳s disease and amyotrophic lateral sclerosis, encourages direct interference with the activity of neurotoxic genes or the molecular activation of neuroprotective pathways. Oligonucleotide-based therapies are recently emerging as an efficient strategy for drug development and these can be employed as new treatments of neurodegenerative states. Here we review advances in this field in recent years which suggest an encouraging assessment that oligonucleotide technologies for targeting of RNAs will enable the development of new therapies and will contribute to preservation of brain integrity. Copyright © 2014 Elsevier B.V. All rights reserved.

  18. AMOD: a morpholino oligonucleotide selection tool

    PubMed Central

    Klee, Eric W.; Shim, Kyong Jin; Pickart, Michael A.; Ekker, Stephen C.; Ellis, Lynda B. M.

    2005-01-01

    AMOD is a web-based program that aids in the functional evaluation of nucleotide sequences through sequence characterization and antisense morpholino oligonucleotide (target site) selection. Submitted sequences are analyzed by translation initiation site prediction algorithms and sequence-to-sequence comparisons; results are used to characterize sequence features required for morpholino design. Within a defined subsequence, base composition and homodimerization values are computed for all putative morpholino oligonucleotides. Using these properties, morpholino candidates are selected and compared with genomic and transcriptome databases with the goal to identify target-specific enriched morpholinos. AMOD has been used at the University of Minnesota to design ∼200 morpholinos for a functional genomics screen in zebrafish. The AMOD web server and a tutorial are freely available to both academic and commercial users at . PMID:15980523

  19. Triplex-forming oligonucleotides as modulators of gene expression.

    PubMed

    Guntaka, Ramareddy V; Varma, Balwantkumar R; Weber, Karl T

    2003-01-01

    Triplex-forming oligonucleotides (TFOs) have gained prominence in the recent years because of their potential applications in antigene therapy. In particular they have been used as (i) inducers of site-specific mutations, (ii) reagents that selectively and specifically cleave target DNA, and (iii) as modulators of gene expression. In this mini-review, we have made an attempt to highlight the characteristics of these TFOs and the effects of various modifications in the phosphate backbone as well as in the purine and pyrimidine moieties, which contribute to the stability and efficiency of triplex formation. Studies to explore the mechanism of down-regulation of transcription of various genes suggest that at least some TFOs exert their effect by inhibiting binding of specific transcription factors to their cognate cis-acting elements. Recent reports indicate the presence of these potential triplex-forming DNA structures in the genomes of prokaryotes and eukaryotes that may play a major role in target site selection and chromosome segregation as well as in the cause of heritable diseases. Finally, some potential problems in the development of these TFOs as antigene therapeutic agents have also been discussed.

  20. Photoionization in micelles: Addition of charged electron acceptors

    NASA Astrophysics Data System (ADS)

    Stenland, Chris; Kevan, Larry

    The relative photoyield of the electron donor N, N, N', N'-tetramethylbenzidine (TMB), solubilized in sodium and lithium dodecyl sulfate micelles with added charged electron acceptors was investigated. It was attempted to control the acceptor distance from a charged micellar interface by differently charged acceptors, cationic dimethyl viologen and anionic ferricyanide. However, back electron transfer from both cationic and anionic acceptors was found to be efficient. Thus simple electrostatic arguments for control of the photoyield do not seem applicable. Salt effects associated with the added ionic acceptors which partially neutralize the ionic micellar interface are suggested to be an important factor.

  1. Binomial distribution-based quantitative measurement of multiple-acceptors fluorescence resonance energy transfer by partially photobleaching acceptor

    NASA Astrophysics Data System (ADS)

    Zhang, Lili; Yu, Huaina; Zhang, Jianwei; Chen, Tongsheng

    2014-06-01

    We report that binomial distribution depending on acceptor photobleaching degree can be used to characterize the proportions of various kinds of FRET (Fluorescence Resonance Energy Transfer) constructs resulted from partial acceptor photobleaching of multiple-acceptors FRET system. On this basis, we set up a rigorous quantitation theory for multiple-acceptors FRET construct named as Mb-PbFRET which is not affected by the imaging conditions and fluorophore properties. We experimentally validate Mb-PbFRET with FRET constructs consisted of one donor and two or three acceptors inside living cells on confocal and wide-field microscopes.

  2. Antisense sequence-directed cross-linking of DNA oligonucleotides by mitomycin C.

    PubMed

    Maruenda, H; Tomasz, M

    1996-01-01

    Oligodeoxyribonucleotides (ODNs) conjugated with mitomycin C (MC) via (-CH2-)n tethers of different lengths (n = 6, 12) to their terminal 5'-phosphate were synthesized, and their interaction with target complementary single-stranded DNA oligonucleotides was investigated. MC, a clinically used natural anticancer drug, is known to act as a bioreductive alkylating agent of duplex DNA with a remarkable preference for 5'-d(CG) sequences. The usual enzymatic bioreductive techniques known to trigger MC to alkylate DNA were employed in the reaction between the MC-oligonucleotide conjugates and their targets radiolabeled by 32P at their 5'-phosphate. A slow-moving radiolabeled product, detected by polyacrylamide gel electrophoresis using phosphorimaging techniques, was obtained in 15-25% yield with complementary DNA as target. Formation of these products was dependent upon complementary duplex formation. Evidence is presented that the DNA target is alkylated by the mitomycin C moiety of the ODN conjugate at the 2-amino group of a guanine base. These findings suggest that the MC-ODN conjugates may be useful specific inhibitors of cellular or viral gene expression. To our knowledge this is the first report on ODN conjugates of a reductively activated drug of known therapeutic value.

  3. Alkyl Chlorides as Hydrogen Bond Acceptors

    SciTech Connect

    Nadas, Janos I; Vukovic, Sinisa; Hay, Benjamin

    2012-01-01

    To gain an understanding of the role of an alkyl chloride as a hydrogen bond acceptor, geometries and interaction energies were calculated at the MP2/aug-cc-pVDZ level of theory for complexes between ethyl chloride and representative hydrogen donor groups. The results establish that these donors, which include hydrogen cyanide, methanol, nitrobenzene, pyrrole, acetamide, and N-methylurea, form X-H {hor_ellipsis} Cl hydrogen bonds (X = C, N, O) of weak to moderate strength, with {Delta}E values ranging from -2.8 to -5.3 kcal/mol.

  4. Template-Directed Ligation of Peptides to Oligonucleotides

    NASA Technical Reports Server (NTRS)

    Bruick, Richard K.; Dawson, Philip E.; Kent, Stephen BH; Usman, Nassim; Joyce, Gerald F.

    1996-01-01

    Synthetic oligonucleotides and peptides have enjoyed a wide range of applications in both biology and chemistry. As a consequence, oligonucleotide-peptide conjugates have received considerable attention, most notably in the development of antisense constructs with improved pharmacological properties. In addition, oligonucleotide-peptide conjugates have been used as molecular tags, in the assembly of supramolecular arrays and in the construction of encoded combinatorial libraries. To make these chimeric molecules more accessible for a broad range of investigations, we sought to develop a facile method for joining fully deprotected oligonucleotides and peptides through a stable amide bond linkage. Furthermore, we wished to make this ligation reaction addressable, enabling one to direct the ligation of specific oligonucleotide and peptide components.To confer specificity and accelerate the rate of the reaction, the ligation process was designed to be dependent on the presence of a complementary oligonucleotide template.

  5. Solid-Phase Synthesis and Hybrization Behavior of Partially 2′/3′-O-Acetylated RNA Oligonucleotides

    PubMed Central

    2014-01-01

    Synthesis of partially 2′/3′-O-acetylated oligoribonucleotides has been accomplished by using a 2′/3′-O-acetyl orthogonal protecting group strategy in which non-nucleophilic strong-base (DBU) labile nucleobase protecting groups and a UV-light cleavable linker were used. Strong-base stability of the photolabile linker allowed on-column nucleobase and phosphate deprotection, followed by a mild cleavage of the acetylated oligonucleotides from the solid support with UV light. Two 17nt oligonucleotides, which were synthesized possessing one specific internal 2′- or 3′-acetyl group, were used as synthetic standards in a recent report from this laboratory detailing the prebiotically plausible ligation of RNA oligonucleotides. In order to further investigate the effect of 2′/3′-O-acetyl groups on the stability of RNA duplex structure, two complementary bis-acetylated RNA oligonucleotides were also expediently obtained with the newly developed protocols. UV melting curves of 2′-O-acetylated RNA duplexes showed a consistent ∼3.1 °C decrease in Tm per 2′-O-acetyl group. PMID:24666354

  6. Detection of SPO11-oligonucleotide complexes from mouse testes.

    PubMed

    Pan, Jing; Keeney, Scott

    2009-01-01

    The SPO11 protein generates programmed DNA double-strand breaks (DSBs) that initiate meiotic recombination. Endonucleolytic cleavage 3' to the DSB sites releases SPO11 from DNA, leaving SPO11 covalently associated with an oligonucleotide. This chapter describes detection of the release product, SPO11-oligonucleotide complexes, from mouse testis lysates. The method for determining the size of SPO11-associated oligonucleotides is also provided.

  7. Synthesis of oligonucleotides on a soluble support

    PubMed Central

    2017-01-01

    Oligonucleotides are usually prepared in lab scale on a solid support with the aid of a fully automated synthesizer. Scaling up of the equipment has allowed industrial synthesis up to kilogram scale. In spite of this, solution-phase synthesis has received continuous interest, on one hand as a technique that could enable synthesis of even larger amounts and, on the other hand, as a gram scale laboratory synthesis without any special equipment. The synthesis on a soluble support has been regarded as an approach that could combine the advantageous features of both the solution and solid-phase syntheses. The critical step of this approach is the separation of the support-anchored oligonucleotide chain from the monomeric building block and other small molecular reagents and byproducts after each coupling, oxidation and deprotection step. The techniques applied so far include precipitation, extraction, chromatography and nanofiltration. As regards coupling, all conventional chemistries, viz. phosphoramidite, H-phosphonate and phosphotriester strategies, have been attempted. While P(III)-based phosphoramidite and H-phosphonate chemistries are almost exclusively used on a solid support, the “outdated” P(V)-based phosphotriester chemistry still offers one major advantage for the synthesis on a soluble support; the omission of the oxidation step simplifies the coupling cycle. Several of protocols developed for the soluble-supported synthesis allow the preparation of both DNA and RNA oligomers of limited length in gram scale without any special equipment, being evidently of interest for research groups that need oligonucleotides in large amounts for research purposes. However, none of them has really tested at such a scale that the feasibility of their industrial use could be critically judged. PMID:28781703

  8. The reaction of choline dehydrogenase with some electron acceptors.

    PubMed Central

    Barrett, M C; Dawson, A P

    1975-01-01

    1. The choline dehydrogenase (EC 1.1.99.1) WAS SOLUBILIZED FROM ACETONE-DRIED POWDERS OF RAT LIVER MITOCHONDRIA BY TREATMENT WITH Naja naja venom. 2. The kinetics of the reaction of enzyme with phenazine methosulphate and ubiquinone-2 as electron acceptors were investigated. 3. With both electron acceptors the reaction mechanism appears to involve a free, modified-enzyme intermediate. 4. With some electron acceptors the maximum velocity of the reaction is independent of the nature of the acceptor. With phenazine methosulphate and ubiquinone-2 as acceptors the Km value for choline is also independent of the nature of the acceptor molecule. 5. The mechanism of the Triton X-100-solubilized enzyme is apparently the smae as that for the snake venom solubilized enzyme. PMID:1218095

  9. The reaction of choline dehydrogenase with some electron acceptors.

    PubMed

    Barrett, M C; Dawson, A P

    1975-12-01

    1. The choline dehydrogenase (EC 1.1.99.1) WAS SOLUBILIZED FROM ACETONE-DRIED POWDERS OF RAT LIVER MITOCHONDRIA BY TREATMENT WITH Naja naja venom. 2. The kinetics of the reaction of enzyme with phenazine methosulphate and ubiquinone-2 as electron acceptors were investigated. 3. With both electron acceptors the reaction mechanism appears to involve a free, modified-enzyme intermediate. 4. With some electron acceptors the maximum velocity of the reaction is independent of the nature of the acceptor. With phenazine methosulphate and ubiquinone-2 as acceptors the Km value for choline is also independent of the nature of the acceptor molecule. 5. The mechanism of the Triton X-100-solubilized enzyme is apparently the smae as that for the snake venom solubilized enzyme.

  10. [Relations between the retinoic acid acceptor and teratogenesis of retinoids].

    PubMed

    Li, Zeng-Gang; Sun, Kai-Lai

    2004-09-01

    Retinoic acid can induce teratogenesis of the fetus of many animals including human, and its biological activities are induced by a serious of different retinoic acid accepters and their ligands. The retinoic acid acceptor RAR plays key roles in the teratogenesis, and the ligands of RAR are strong teratogens. The intensity sequence of the relative teratogenesis is ligandalpha, ligandbeta and ligandgamma. The ligands of the retinoic acid acceptor RXR cannot induce teratogenesis, but they can enhance the teratogenesis of the RAR stimulus. The retinoic acid acceptors can also affect the development of the fetus by adjusting the expression of the other genes. The relations between the gene mutation of the retinoic acid acceptor, various retinoic acid acceptors and their ligands and teratogenesis of retinoic acid are summarized in this article. In addition, the regulations of the retinoic acid acceptors to the other genes are also discussed.

  11. Antisense delivery using protamine–oligonucleotide particles

    PubMed Central

    Junghans, Monika; Kreuter, Jörg; Zimmer, Andreas

    2000-01-01

    Protamine, a polycationic peptide (mol. wt 4000–4500), was evaluated as a potential penetration enhancer for phosphodiester antisense oligonucleotides (ODNs). Unique complexes in the form of nanoparticles were spontaneously formed, which we call ‘proticles’. The stability of the particles and the ODNs bound into the proticles was examined in foetal calf serum and cell culture medium. FITC-labelled ODNs bound to protamine showed an increased cellular uptake into human histiocytic lymphoma U 937 cells compared to free ODNs. Proticles significantly decreased cellular growth in a cell proliferation assay using ODNs against the c-myc proto-oncogene. PMID:10773093

  12. Intramolecular donor-acceptor cyclopropane ring-opening cyclizations.

    PubMed

    Cavitt, Marchello A; Phun, Lien H; France, Stefan

    2014-02-07

    Cyclization reactions of donor-acceptor (D-A) cyclopropanes are recognized as versatile methods for construction of carbocyclic and heterocyclic scaffolds. In the literature, many examples of these polarized cyclopropanes' reactivity with nucleophiles, electrophiles, and radicals are prevalent. Although intermolecular reactivity of donor-acceptor cyclopropanes is widely reported, reviews that center on their intramolecular chemistry are rare. Thereupon, this tutorial review focalizes on new intramolecular transformations of donor-acceptor cyclopropanes for cycloisomerizations, formal cycloadditions, umpolung reactions, rearrangements and ring-opening lactonizations/lactamizations from 2009 to 2013. Furthermore, the role of D-A acceptor cyclopropanes as reactive subunits in natural product synthesis is underscored.

  13. New shallow acceptor levels in GaAs

    NASA Astrophysics Data System (ADS)

    Skromme, B. J.; Bose, S. S.; Stillman, G. E.

    1986-11-01

    Two previously unreported shallow acceptor levels with ionization energies of 25.2 and 43.2 meV, respectively, have been observed in a number of vapor phase epitaxial and metalorganic chemical vapor deposited GaAs samples grown in several different laboratories. The corresponding donor-to-acceptor and conduction band-to-acceptor transitions are identified in low temperature photoluminescence spectra by means of their temperature and excitation intensity-dependence. These levels are present as residual acceptors in high purity material, but their chemical and/or metallurgical nature has not yet been determined.

  14. Effects of electron acceptors on sulphate reduction activity in activated sludge processes.

    PubMed

    Rubio-Rincón, Francisco; Lopez-Vazquez, Carlos; Welles, Laurens; van den Brand, Tessa; Abbas, Ben; van Loosdrecht, Mark; Brdjanovic, Damir

    2017-08-01

    The concentration of sulphate present in wastewater can vary from 10 to 500 mg SO4(2-)/L. During anaerobic conditions, sulphate is reduced to sulphide by sulphate-reducing bacteria (SRB). Sulphide generation is undesired in wastewater treatment plants (WWTPs). Previous research indicated that SRB are inhibited by the presence of electron acceptors (such as O2, NO3 and NO2). However, the contact times and concentrations used in those studies are by far higher than occur in WWTPs. Since sulphide can influence the biological nitrogen and phosphorus removal processes, this research aimed to understand how the different electron acceptors commonly present in biological nutrient removal (BNR) systems can affect the proliferation of SRB. For this purpose, a culture of SRB was enriched in a sequencing batch reactor (approx. 88% of the total bacteria population). Once enriched, the SRB were exposed for 2 h to typical concentrations of electron acceptors like those observed in BNR systems. Their activity was assessed using three different types of electron donors (acetate, propionate and lactate). Oxygen was the most inhibiting electron acceptor regardless the carbon source used. After exposure to oxygen and when feeding acetate, an inactivation time in the sulphate reduction activity was observed for 1.75 h. Once the sulphate reduction activity resumed, only 60% of the original activity was recovered. It is suggested that the proliferation of SRB is most likely to occur in BNR plants with an anaerobic fraction higher than 15% and operating at sludge retention times higher than 20 days (at a temperature of 20 °C). These results can be used to implement strategies to control the growth of sulphate reducers that might compete for organic carbon with phosphate-accumulating organisms.

  15. On the effect of nuclear bridge modes on donor-acceptor electronic coupling in donor-bridge-acceptor molecules

    NASA Astrophysics Data System (ADS)

    Davis, Daly; Toroker, Maytal Caspary; Speiser, Shammai; Peskin, Uri

    2009-03-01

    We report a theoretical study of intra-molecular electronic coupling in a symmetric DBA (donor-bridge-acceptor) complex, in which a donor electronic site is coupled to an acceptor site by way of intervening orbitals of a molecular bridge unit. In the off-resonant (deep tunneling) regime of electronic transport, the lowest unoccupied molecular orbitals (MO's) of the DBA system are split into distinguishable donor/acceptor and bridge orbitals. The effect of geometrical changes at the bridge on the donor/acceptor electronic energy manifold is studied for local stretching and bending modes. It is demonstrated that the energy splitting in the manifold of donor/acceptor unoccupied MOs changes in response to such changes, as assumed in simple McConnell-type models. Limitations of the simple models are revealed where the electronic charging of the bridge orbitals correlates with increasing donor/acceptor orbital energy splitting only for stretching but not for bending bridge modes.

  16. Vanguard family planning acceptors in Senegal.

    PubMed

    Nichols, D; Ndiaye, S; Burton, N; Janowitz, B; Gueye, L; Gueye, M

    1985-01-01

    This study examines contraceptive use among clients at the three clinics providing family planning services in Dakar, Senegal in early 1983. Most clients first became interested in family planning following the birth of a child, and most are interested in spacing future pregnancies, although one-third state that they want no more children. The clinic itself was found to be an important determinant of the type of contraceptive used, with only the government-operated clinic providing a balance between IUDs, oral contraceptives, and barrier methods. Nearly half of the clients interviewed said that a lack of knowledge about contraception is the reason for the low contraceptive prevalence rates among Senegalese women; another frequently cited reason was the opposition of the husband. Most clients reported the broadcast media to be the best means of providing family planning information to potential acceptors.

  17. Antisense Oligonucleotide Therapy in Diabetic Retinopathy

    PubMed Central

    Hnik, Peter; Boyer, David S.; Grillone, Lisa R.; Clement, John G.; Henry, Scott P.; Green, Ellen A.

    2009-01-01

    Diabetic retinopathy is one of the leading causes of blindness in the United States and other parts of the world. Historically, laser photocoagulation and vitrectomy surgery have been used for the treatment of diabetic retinopathy, including diabetic macular edema. Both procedures have proven to be useful under certain conditions but have their limitations. New pathways and processes that promote diabetic retinopathy have been identified, and several new therapeutic approaches are under investigation. These new therapies may be beneficial in the treatment of diabetic retinopathy and include antivascular endothelial growth factor agents, corticosteroids, and therapies that may potentially target a number of additional diabetic retinopathy-related factors and processes, including antisense oligonucleotides. Second-generation antisense oligonucleotides, such as iCo-007, may offer a significant advantage in the treatment of diabetic retinopathy by downregulating the signal pathways of multiple growth factors that seem to play a critical role in the process of ocular angiogenesis and vascular leakage. Benefits of such molecules are expected to include the specificity of the kinase target and an extended half-life, resulting in less frequent intravitreal drug administration, resistance to molecule degradation, and a good safety profile. PMID:20144342

  18. Gene cloning based on long oligonucleotide probes

    SciTech Connect

    Wood, W.I.

    1987-01-01

    The most commonly used technique for gene cloning has been to utilize oligonucleotide probe based on protein sequence data. Of course this approach requires characterized and purified protein so that at least a portion of amino acid sequence can be determined and used to infer the corresponding DNA sequence. Based on the amino acid sequence information, either short or long oligonucleotide probes can be synthesized chemically. Long probes are typically 30-100 nucleotides long and are a single sequence based on a best guess for each codon. The long probe approach was first used to screen for three different genes: bovine trypsin inhibitor, human insulin-like growth factor I, and human factor IX. There are three advantages of long probes. (1) Any stretch of amino acid sequence 10 or longer can be used. (2) The amino acid sequence need not be absolutely correct. (3) These probes can be used to screen high-complexity libraries with fewer false positives. In spite of the uncertainties over codon selection, the long probe approach is currently the method of choice in screening for genes based on protein sequence data.

  19. BIOCONJUGATION OF OLIGONUCLEOTIDES FOR TREATING LIVER FIBROSIS

    PubMed Central

    Ye, Zhaoyang; Hajj Houssein, Houssam S.; Mahato, Ram I.

    2009-01-01

    Liver fibrosis results from chronic liver injury due to hepatitis B and C, excessive alcohol ingestion, and metal ion overload. Fibrosis culminates in cirrhosis and results in liver failure. Therefore, a potent antifibrotic therapy is in urgent need to reverse scarring and eliminate progression to cirrhosis. Although activated hepatic stellate cells (HSCs) remains the principle cell type responsible for liver fibrosis, perivascular fibroblasts of portal and central veins as well as periductular fibroblasts are other sources of fibrogenic cells. This review will critically discuss various treatment strategies for liver fibrosis, including prevention of liver injury, reduction of inflammation, inhibition of HSC activation, degradation of scar matrix, and inhibition of aberrant collagen synthesis. Oligonucleotides (ODNs) are short, single-stranded nucleic acids, which disrupt expression of target protein by binding to complementary mRNA or forming triplex with genomic DNA. Triplex forming oligonucleotides (TFOs) provide an attractive strategy for treating liver fibrosis. A series of TFOs have been developed for inhibiting the transcription of α1(I) collagen gene, which opens a new area for antifibrotic drugs. There will be in depth discussion on the use of TFOs and how different bioconjugation strategies can be utilized for their site-specific delivery to HSCs or hepatocytes for enhanced antifibrotic activities. Various insights developed in individual strategy and the need for multipronged approaches will also be discussed. PMID:18154454

  20. Quantum computing with acceptor spins in silicon

    NASA Astrophysics Data System (ADS)

    Salfi, Joe; Tong, Mengyang; Rogge, Sven; Culcer, Dimitrie

    2016-06-01

    The states of a boron acceptor near a Si/SiO2 interface, which bind two low-energy Kramers pairs, have exceptional properties for encoding quantum information and, with the aid of strain, both heavy hole and light hole-based spin qubits can be designed. Whereas a light-hole spin qubit was introduced recently (arXiv:1508.04259), here we present analytical and numerical results proving that a heavy-hole spin qubit can be reliably initialised, rotated and entangled by electrical means alone. This is due to strong Rashba-like spin-orbit interaction terms enabled by the interface inversion asymmetry. Single qubit rotations rely on electric-dipole spin resonance (EDSR), which is strongly enhanced by interface-induced spin-orbit terms. Entanglement can be accomplished by Coulomb exchange, coupling to a resonator, or spin-orbit induced dipole-dipole interactions. By analysing the qubit sensitivity to charge noise, we demonstrate that interface-induced spin-orbit terms are responsible for sweet spots in the dephasing time {T}2* as a function of the top gate electric field, which are close to maxima in the EDSR strength, where the EDSR gate has high fidelity. We show that both qubits can be described using the same starting Hamiltonian, and by comparing their properties we show that the complex interplay of bulk and interface-induced spin-orbit terms allows a high degree of electrical control and makes acceptors potential candidates for scalable quantum computation in Si.

  1. Quantum computing with acceptor spins in silicon.

    PubMed

    Salfi, Joe; Tong, Mengyang; Rogge, Sven; Culcer, Dimitrie

    2016-06-17

    The states of a boron acceptor near a Si/SiO2 interface, which bind two low-energy Kramers pairs, have exceptional properties for encoding quantum information and, with the aid of strain, both heavy hole and light hole-based spin qubits can be designed. Whereas a light-hole spin qubit was introduced recently (arXiv:1508.04259), here we present analytical and numerical results proving that a heavy-hole spin qubit can be reliably initialised, rotated and entangled by electrical means alone. This is due to strong Rashba-like spin-orbit interaction terms enabled by the interface inversion asymmetry. Single qubit rotations rely on electric-dipole spin resonance (EDSR), which is strongly enhanced by interface-induced spin-orbit terms. Entanglement can be accomplished by Coulomb exchange, coupling to a resonator, or spin-orbit induced dipole-dipole interactions. By analysing the qubit sensitivity to charge noise, we demonstrate that interface-induced spin-orbit terms are responsible for sweet spots in the dephasing time [Formula: see text] as a function of the top gate electric field, which are close to maxima in the EDSR strength, where the EDSR gate has high fidelity. We show that both qubits can be described using the same starting Hamiltonian, and by comparing their properties we show that the complex interplay of bulk and interface-induced spin-orbit terms allows a high degree of electrical control and makes acceptors potential candidates for scalable quantum computation in Si.

  2. Pyrimidine phosphorothioate oligonucleotides form triple-stranded helices and promote transcription inhibition.

    PubMed Central

    Xodo, L; Alunni-Fabbroni, M; Manzini, G; Quadrifoglio, F

    1994-01-01

    The ability of phosphorothioate (POS) oligonucleotides to recognise and bind to homopurine-homopyrimidine DNA double-stranded sites via triple helix formation has been investigated. It has been found that the homologous pyrimidine POS sequences Y11-Si (i = 0, 1,2,3,4,10), which have been obtained by an increasing sulphur substitution in the sugar-phosphate backbone of d(CTTCCTCCTCT) (Y11), and the target hairpin duplex d(GAAGGAGGAGA-T4-TCTCCTCCTTC) (h26) can form stable triple helices, as indicated by PAGE, CD and UV melting experiments. The thermal stability of the triple helices depends on the number of POS linkages in the third Y11 strand, varying from 48 degrees C (Y11, with only phosphate groups, PO2) to 31 degrees C (Y11-S10 containing exclusively thioate groups). On average, a Tm depression of about 2 degrees C per POS linkage introduced in Y11 was observed. CD data indicate that the sulphurization of the third strand results in minimal changes of triple-stranded structures. The energetics of the triplex-to-hairpin plus single-strand transition has been determined by van't Hoff analyses of the melting curves. In free energy terms, the POS triplexes h26.Y11-Si are less stable than the normal PO2 h26.Y11 triplex by values between 2.7 and 5.4 kcal/mol, depending on the number of POS linkages contained in the third strand. Phosphorothioate oligonucleotides being resistant towards several nucleases offer an interesting choice as gene blockers in antisense strategy. Thus, their ability to inhibit transcription via triple helix formation has been examined in vitro. We found that triplex-forming POS oligonucleotides of 20 bases in length (with a cytosine contents of 45%), containing either 10% or 26% thioate groups, strongly repress the transcription activity of the bacteriophage T7 RNA polymerase at pH 6.9, when used in excess compared to the target (mol oligo/mol template = 125). The here reported data are useful for designing phosphorothioate oligonucleotides

  3. Disulfide-linked oligonucleotide phosphorothioates - Novel analogues of nucleic acids

    NASA Technical Reports Server (NTRS)

    Wu, Taifeng; Orgel, Leslie E.

    1991-01-01

    The synthesis of phosphorothioate analogs of oligonucleotides by the oxidation of deoxyadenosine 3',5'-bisphosphorothioate (3) was attempted. Cyclization of 3 is much more efficient than oligomerization under all the conditions investigated. However, a preformed oligonucleotide carrying a 5'-terminal phosphorotioate group undergoes efficient chain-extension when oxidized in the presence of 3.

  4. Oligonucleotide therapies for disorders of the nervous system.

    PubMed

    Khorkova, Olga; Wahlestedt, Claes

    2017-03-01

    Oligonucleotide therapies are currently experiencing a resurgence driven by advances in backbone chemistry and discoveries of novel therapeutic pathways that can be uniquely and efficiently modulated by the oligonucleotide drugs. A quarter of a century has passed since oligonucleotides were first applied in living mammalian brain to modulate gene expression. Despite challenges in delivery to the brain, multiple oligonucleotide-based compounds are now being developed for treatment of human brain disorders by direct delivery inside the blood brain barrier (BBB). Notably, the first new central nervous system (CNS)-targeted oligonucleotide-based drug (nusinersen/Spinraza) was approved by US Food and Drug Administration (FDA) in late 2016 and several other compounds are in advanced clinical trials. Human testing of brain-targeted oligonucleotides has highlighted unusual pharmacokinetic and pharmacodynamic properties of these compounds, including complex active uptake mechanisms, low systemic exposure, extremely long half-lives, accumulation and gradual release from subcellular depots. Further work on oligonucleotide uptake, development of formulations for delivery across the BBB and relevant disease biology studies are required for further optimization of the oligonucleotide drug development process for brain applications.

  5. Voltage-gated calcium channel and antisense oligonucleotides thereto

    NASA Technical Reports Server (NTRS)

    Hruska, Keith A. (Inventor); Friedman, Peter A. (Inventor); Barry, Elizabeth L. R. (Inventor); Duncan, Randall L. (Inventor)

    1998-01-01

    An antisense oligonucleotide of 10 to 35 nucleotides in length that can hybridize with a region of the .alpha..sub.1 subunit of the SA-Cat channel gene DNA or mRNA is provided, together with pharmaceutical compositions containing and methods utilizing such antisense oligonucleotide.

  6. New acceptor-donor-acceptor (A-D-A) type copolymers for efficient organic photovoltaic devices

    NASA Astrophysics Data System (ADS)

    Ghomrasni, S.; Ayachi, S.; Alimi, K.

    2015-01-01

    Three new conjugated systems alternating acceptor-donor-acceptor (A-D-A) type copolymers have been investigated by means of Density Functional Theory (DFT) and Time-Dependent DFT (TD-DFT) at the 6-31g (d) level of theory. 4,4‧-Dimethoxy-chalcone, also called the 1,3-bis(4-methoxyphenyl)prop-2-en-1-one (BMP), has been used as a common acceptor moiety. It forced intra-molecular S⋯O interactions through alternating oligo-thiophene derivatives: 4-AlkylThiophenes (4-ATP), 4-AlkylBithiophenes (4-ABTP) and 4-Thienylene Vinylene (4-TEV) as donor moieties. The band gap, HOMO and LUMO electron distributions as well as optical properties were analyzed for each molecule. The fully optimized resulting copolymers showed low band gaps (2.2-2.8 eV) and deep HOMO energy levels ranging from -4.66 to -4.86 eV. A broad absorption [300-900 nm] covering the solar spectrum and absorption maxima ranges from 486 to 604 nm. In addition, organic photovoltaic cells (OPCs) based on alternating copolymers in bulk heterojunction (BHJ) composites with the 1-(3-methoxycarbonyl) propyl-1-phenyl-[6,6]-C61 (PCBM), as an acceptor, have been optimized. Thus, the band gap decreased to 1.62 eV, the power conversion efficiencies (PCEs) were about 3-5% and the open circuit voltage Voc of the resulting molecules decreased from 1.50 to 1.27 eV.

  7. Electron attachment to hydrated oligonucleotide dimers: guanylyl-3',5'-cytidine and cytidylyl-3',5'-guanosine.

    PubMed

    Gu, Jiande; Xie, Yaoming; Schaefer, Henry F

    2010-05-03

    The dinucleoside phosphate deoxycytidylyl-3',5'-deoxyguanosine (dCpdG) and deoxyguanylyl-3',5'-deoxycytidine (dGpdC) systems are among the largest to be studied by reliable theoretical methods. Exploring electron attachment to these subunits of DNA single strands provides significant progress toward definitive predictions of the electron affinities of DNA single strands. The adiabatic electron affinities of the oligonucleotides are found to be sequence dependent. Deoxycytidine (dC) on the 5' end, dCpdG, has larger adiabatic electron affinity (AEA, 0.90 eV) than dC on the 3' end of the oligomer (dGpdC, 0.66 eV). The geometric features, molecular orbital analyses, and charge distribution studies for the radical anions of the cytidine-containing oligonucleotides demonstrate that the excess electron in these anionic systems is dominantly located on the cytosine nucleobase moiety. The pi-stacking interaction between nucleobases G and C seems unlikely to improve the electron-capturing ability of the oligonucleotide dimers. The influence of the neighboring base on the electron-capturing ability of cytosine should be attributed to the intensified proton accepting-donating interaction between the bases. The present investigation demonstrates that the vertical detachment energies (VDEs) of the radical anions of the oligonucleotides dGpdC and dCpdG are significantly larger than those of the corresponding nucleotides. Consequently, reactions with low activation barriers, such as those for O-C sigma bond and N-glycosidic bond breakage, might be expected for the radical anions of the guanosine-cytosine mixed oligonucleotides.

  8. The spherulites™: a promising carrier for oligonucleotide delivery

    PubMed Central

    Mignet, Nathalie; Brun, Armelle; Degert, Corinne; Delord, Brigitte; Roux, Didier; Hélène, Claude; Laversanne, René; François, Jean-Christophe

    2000-01-01

    Concentric multilamellar microvesicles, named spherulites™, were evaluated as an oligonucleotide carrier. Up to 80% oligonucleotide was encapsulated in these vesicles. The study was carried out on two different spherulite™ formulations. The spherulite™ size and stability characteristics are presented. Delivery of encapsulated oligonucleotide was performed on a rat hepatocarcinoma and on a lymphoblastoid T cell line, both expressing the luciferase gene. We showed that spherulites™ were able to transfect both adherent and suspension cell lines and deliver the oligonucleotide to the nucleus. Moreover, 48–62% luciferase inhibition was obtained in the rat hepatocarcinoma cell line when the antisense oligonucleotide targeted to the luciferase coding region was encapsulated at 500 nM concentration in spherulites™ of different compositions. PMID:10931929

  9. 2'-modified nucleosides for site-specific labeling of oligonucleotides

    NASA Technical Reports Server (NTRS)

    Krider, Elizabeth S.; Miller, Jeremiah E.; Meade, Thomas J.

    2002-01-01

    We report the synthesis of 2'-modified nucleosides designed specifically for incorporating labels into oligonucleotides. Conversion of these nucleosides to phosphoramidite and solid support-bound derivatives proceeds in good yield. Large-scale synthesis of 11-mer oligonucleotides possessing the 2'-modified nucleosides is achieved using these derivatives. Thermal denaturation studies indicate that the presence of 2'-modified nucleosides in 11-mer duplexes has minimal destabilizing effects on the duplex structure when the nucleosides are placed at the duplex termini. The powerful combination of phosphoramidite and support-bound derivatives of 2'-modified nucleosides affords the large-scale preparation of an entirely new class of oligonucleotides. The ability to synthesize oligonucleotides containing label attachment sites at 3', intervening, and 5' locations of a duplex is a significant advance in the development of oligonucleotide conjugates.

  10. 2'-modified nucleosides for site-specific labeling of oligonucleotides

    NASA Technical Reports Server (NTRS)

    Krider, Elizabeth S.; Miller, Jeremiah E.; Meade, Thomas J.

    2002-01-01

    We report the synthesis of 2'-modified nucleosides designed specifically for incorporating labels into oligonucleotides. Conversion of these nucleosides to phosphoramidite and solid support-bound derivatives proceeds in good yield. Large-scale synthesis of 11-mer oligonucleotides possessing the 2'-modified nucleosides is achieved using these derivatives. Thermal denaturation studies indicate that the presence of 2'-modified nucleosides in 11-mer duplexes has minimal destabilizing effects on the duplex structure when the nucleosides are placed at the duplex termini. The powerful combination of phosphoramidite and support-bound derivatives of 2'-modified nucleosides affords the large-scale preparation of an entirely new class of oligonucleotides. The ability to synthesize oligonucleotides containing label attachment sites at 3', intervening, and 5' locations of a duplex is a significant advance in the development of oligonucleotide conjugates.

  11. Noncoding oligonucleotides: the belle of the ball in gene therapy.

    PubMed

    Shum, Ka-To; Rossi, John J

    2015-01-01

    Gene therapy carries the promise of cures for many diseases based on manipulating the expression of a person's genes toward the therapeutic goal. The relevance of noncoding oligonucleotides to human disease is attracting widespread attention. Noncoding oligonucleotides are not only involved in gene regulation, but can also be modified into therapeutic tools. There are many strategies that leverage noncoding oligonucleotides for gene therapy, including small interfering RNAs, antisense oligonucleotides, aptamers, ribozymes, decoys, and bacteriophage phi 29 RNAs. In this chapter, we will provide a broad, comprehensive overview of gene therapies that use noncoding oligonucleotides for disease treatment. The mechanism and development of each therapeutic will be described, with a particular focus on its clinical development. Finally, we will discuss the challenges associated with developing nucleic acid therapeutics and the prospects for future success.

  12. Evaluation of a new biocompatible poly(N-(morpholino ethyl methacrylate)-based copolymer for the delivery of ruthenium oligonucleotides, targeting HPV16 E6 oncogene.

    PubMed

    Reschner, Anca; Shim, Yong Ho; Dubois, Philippe; Delvenne, Philippe; Evrard, Brigitte; Marcélis, Lionel; Moucheron, Cécile; Kirsch-De Mesmaeker, Andrée; Defrancq, Eric; Raes, Martine; Piette, Jacques; Collard, Laurence; Piel, Géraldine

    2013-08-01

    This study investigates the use of a new biocompatible block copolymer poly(2-(dimethylamino)ethyl methacrylate-N-(morpholino)ethyl methacrylate (PDMAEMA-b-PMEMA) for the delivery of a particular antisense oligonucleotide targeting E6 gene from human papilloma virus. This antisense oligonucleotide was derivatized with a polyazaaromatic Ru(II) complex which, under visible illumination, is able to produce an irreversible crosslink with the complementary targeted sequence. The purpose of this study is to determine whether by the use of a suitable transfection agent, it is possible to increase the efficiency of the antisense oligonucleotide targeting E6 gene, named Ru-P-4. In a recent study, we showed that Oligofectamine transfected Ru-P-4 antisense oligonucleotide failed to inhibit efficiently the growth of cervical cancer cell line SiHa, contrarily to the Ru-P-6 antisense oligonucleotide, another sequence also targeting the E6 gene. The ability of PDMAEMA-b-PMEMA to form polyplexes with optimal physicochemical characteristics was investigated first. Then the ability of the PDMAEMA-b-PMEMA/Ru-P-4 antisense oligonucleotide polyplexes to transfect two keratinocyte cell lines (SiHa and HaCat) and the capacity of polyplexes to inhibit HPV16+ cervical cancer cell growth was evaluated. PDMAEMA-b-PMEMA base polyplexes at the optimal molar ratio of polymer nitrogen atoms to DNA phosphates (N/P), were able to deliver Ru-P-4 antisense oligonucleotide and to induce a higher growth inhibition in human cervical cancer SiHa cells, compared to other formulations based on Oligofectamine.

  13. Efficient organic dye-sensitized solar cells: molecular engineering of donor-acceptor-acceptor cationic dyes.

    PubMed

    Cheng, Ming; Yang, Xichuan; Zhao, Jianghua; Chen, Cheng; Tan, Qin; Zhang, Fuguo; Sun, Licheng

    2013-12-01

    Three metal-free donor-acceptor-acceptor sensitizers with ionized pyridine and a reference dye were synthesized, and a detailed investigation of the relationship between the dye structure and the photophysical and photoelectrochemical properties and the performance of dye-sensitized solar cells (DSSCs) is described. The ionization of pyridine results in a red shift of the absorption spectrum in comparison to that of the reference dye. This is mainly attributable to the ionization of pyridine increasing the electron-withdrawing ability of the total acceptor part. Incorporation of the strong electron-withdrawing units of pyridinium and cyano acrylic acid gives rise to optimized energy levels, resulting in a large response range of wavelengths. When attached to TiO2 film, the conduction band of TiO2 is negatively shifted to a different extent depending on the dye. This is attributed to the electron recombination rate between the TiO2 film and the electrolyte being efficiently suppressed by the introduction of long alkyl chains and thiophene units. DSSCs assembled using these dyes show efficiencies as high as 8.8 %.

  14. Impact of Thermal Annealing on Organic Photovoltaic Cells Using Regioisomeric Donor-Acceptor-Acceptor Molecules.

    PubMed

    Zhang, Tao; Han, Han; Zou, Yunlong; Lee, Ying-Chi; Oshima, Hiroya; Wong, Ken-Tsung; Holmes, Russell J

    2017-08-02

    We report a promising set of donor-acceptor-acceptor (D-A-A) electron-donor materials based on coplanar thieno[3,2-b]/[2,3-b]indole, benzo[c][1,2,5]thiadiazole, and dicyanovinylene, which are found to show broadband absorption with high extinction coefficients. The role of the regioisomeric electron-donating thienoindole moiety on the physical and structural properties is examined. Bulk heterojunction (BHJ) organic photovoltaic cells (OPVs) based on the thieno[2,3-b]indole-based electron donor NTU-2, using C70 as an electron acceptor, show a champion power conversion efficiency of 5.2% under AM 1.5G solar simulated illumination. This efficiency is limited by a low fill factor (FF), as has previously been the case in D-A-A systems. In order to identify the origin of the limited FF, further insight into donor layer charge-transport behavior is realized by examining planar heterojunction OPVs, with emphasis on the evolution of film morphology with thermal annealing. Compared to as-deposited OPVs that exhibit insufficient donor crystallinity, crystalline OPVs based on annealed thin films show an increase in the short-circuit current density, FF, and power conversion efficiency. These results suggest that that the crystallization of D-A-A molecules might not be realized spontaneously at room temperature and that further processing is needed to realize efficient charge transport in these materials.

  15. Survival of the fittest before the beginning of life: selection of the first oligonucleotide-like polymers by UV light.

    PubMed

    Mulkidjanian, Armen Y; Cherepanov, Dmitry A; Galperin, Michael Y

    2003-05-28

    A key event in the origin of life on this planet has been formation of self-replicating RNA-type molecules, which were complex enough to undergo a Darwinian-type evolution (origin of the "RNA world"). However, so far there has been no explanation of how the first RNA-like biopolymers could originate and survive on the primordial Earth. As condensation of sugar phosphates and nitrogenous bases is thermodynamically unfavorable, these compounds, if ever formed, should have undergone rapid hydrolysis. Thus, formation of oligonucleotide-like structures could have happened only if and when these structures had some selective advantage over simpler compounds. It is well known that nitrogenous bases are powerful quenchers of UV quanta and effectively protect the pentose-phosphate backbones of RNA and DNA from UV cleavage. To check if such a protection could play a role in abiogenic evolution on the primordial Earth (in the absence of the UV-protecting ozone layer), we simulated, by using Monte Carlo approach, the formation of the first oligonucleotides under continuous UV illumination. The simulations confirmed that UV irradiation could have worked as a selective factor leading to a relative enrichment of the system in longer sugar-phosphate polymers carrying nitrogenous bases as UV-protectors. Partial funneling of the UV energy into the condensation reactions could provide a further boost for the oligomerization. These results suggest that accumulation of the first polynucleotides could be explained by their abiogenic selection as the most UV-resistant biopolymers.

  16. π-Extended rigid triptycene-trisaroylenimidazoles as electron acceptors.

    PubMed

    Menke, Elisabeth H; Lami, Vincent; Vaynzof, Yana; Mastalerz, Michael

    2016-01-18

    Two soluble isomeric acceptor molecules based on a triptycene core, which is connected to three aroylenimidazole units are described. Due to the inherent threefold axis, the molecules are soluble and thus could be fully photophysically characterized in solution and film. Additionally, the preliminary results of these acceptors in organic photovoltaic devices with two different donor materials are reported.

  17. The role of deep acceptor centers in the oxidation of acceptor-doped wide-band-gap perovskites ABO3

    NASA Astrophysics Data System (ADS)

    Putilov, L. P.; Tsidilkovski, V. I.

    2017-03-01

    The impact of deep acceptor centers on defect thermodynamics and oxidation of wide-band-gap acceptor-doped perovskites without mixed-valence cations is studied. These deep centers are formed by the acceptor-bound small hole polarons whose stabilization energy can be high enough (significantly higher than the hole-acceptor Coulomb interaction energy). It is shown that the oxidation enthalpy ΔHox of oxide is determined by the energy εA of acceptor-bound states along with the formation energy EV of oxygen vacancies. The oxidation reaction is demonstrated to be either endothermic or exothermic, and the regions of εA and EV values corresponding to the positive or negative ΔHox are determined. The contribution of acceptor-bound holes to the defect thermodynamics strongly depends on the acceptor states depth εA: it becomes negligible at εA less than a certain value (at which the acceptor levels are still deep). With increasing εA, the concentration of acceptor-bound small hole polarons can reach the values comparable to the dopant content. The results are illustrated with the acceptor-doped BaZrO3 as an example. It is shown that the experimental data on the bulk hole conductivity of barium zirconate can be described both in the band transport model and in the model of hopping small polarons localized on oxygen ions away from the acceptor centers. Depending on the εA magnitude, the oxidation reaction can be either endothermic or exothermic for both mobility mechanisms.

  18. Inhibition of the respiratory chain reactions in denitrifying EBPR biomass under simultaneous presence of acetate and electron acceptor.

    PubMed

    Zafiriadis, Ilias; Kapagiannidis, Anastasios G; Ntougias, Spyridon; Aivasidis, Alexander

    2017-05-25

    In this study, the deterioration of the typical EBPR (Enhanced Biological Phosphorus Removal) process due to the simultaneous presence of electron donor (external substrate) and electron acceptor (oxygen or nitrate) was investigated by using a PAOs (Polyphosphate Accumulating Organisms)-enriched biomass grown in a modified DEPHANOX system. Intracellular and extracellular constituents were monitored in batch tests under different electron donor and acceptor conditions and specific oxygen and nitrogen uptake rates were evaluated. Results showed that phosphorus uptake was inhibited during the simultaneous presence of electron donor (acetate) and acceptor (O2/NO3(-)) in the mixed liquor. In the presence of acetate, PHAs and glycogen were produced under both aerobic and anoxic conditions irrespectively to the PHAs amount already stored intracellularly. The Krebs cycle reactions and oxidative phosphorylation provided the reduced coenzymes and energy required for PHAs synthesis when biomass polyphosphate content was low. On the contrary, polyphosphate cleavage provided the ATP required for PHAs synthesis in the presence of high biomass polyphosphate content. Inhibition of the respiratory chain reactions was observed when biomass with high polyphosphate and low PHAs content was subjected to simultaneous presence of electron donor and acceptor. PHAs utilization rather than glycogen degradation appears to favor phosphate accumulation since no polyphosphate synthesis occurred in the absence of PHAs reserves. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Acceptor impurity activation in III-nitride light emitting diodes

    SciTech Connect

    Römer, Friedhard Witzigmann, Bernd

    2015-01-12

    In this work, the role of the acceptor doping and the acceptor activation and its impact on the internal quantum efficiency (IQE) of a Gallium Nitride (GaN) based multi-quantum well light emitting diode is studied by microscopic simulation. Acceptor impurities in GaN are subject to a high activation energy which depends on the presence of proximate dopant atoms and the electric field. A combined model for the dopant ionization and activation barrier reduction has been developed and implemented in a semiconductor carrier transport simulator. By model calculations, we demonstrate the impact of the acceptor activation mechanisms on the decay of the IQE at high current densities, which is known as the efficiency droop. A major contributor to the droop is the electron leakage which is largely affected by the acceptor doping.

  20. Acceptor impurity activation in III-nitride light emitting diodes

    NASA Astrophysics Data System (ADS)

    Römer, Friedhard; Witzigmann, Bernd

    2015-01-01

    In this work, the role of the acceptor doping and the acceptor activation and its impact on the internal quantum efficiency (IQE) of a Gallium Nitride (GaN) based multi-quantum well light emitting diode is studied by microscopic simulation. Acceptor impurities in GaN are subject to a high activation energy which depends on the presence of proximate dopant atoms and the electric field. A combined model for the dopant ionization and activation barrier reduction has been developed and implemented in a semiconductor carrier transport simulator. By model calculations, we demonstrate the impact of the acceptor activation mechanisms on the decay of the IQE at high current densities, which is known as the efficiency droop. A major contributor to the droop is the electron leakage which is largely affected by the acceptor doping.

  1. Hole hopping rates in single strand oligonucleotides

    NASA Astrophysics Data System (ADS)

    Borrelli, Raffaele; Capobianco, Amedeo; Peluso, Andrea

    2014-08-01

    The rates of hole transfer between guanine and adenine in single strand DNA have been evaluated by using Fermi’s golden rule and Kubo’s generating function approach for the Franck-Condon weighted density of states. The whole sets of the normal modes and vibrational frequencies of the two nucleobases, obtained at DFT/B3LYP level of calculation, have been considered in computations. The results show that in single strand the pyramidalization/planarization mode of the amino groups of both nucleobases plays the major role. At room temperature, the Franck-Condon density of states extends over a wide range of hole site energy difference, 0-1 eV, giving some hints about the design of oligonucleotides of potential technological interest.

  2. Cellular uptake and trafficking of antisense oligonucleotides.

    PubMed

    Crooke, Stanley T; Wang, Shiyu; Vickers, Timothy A; Shen, Wen; Liang, Xue-Hai

    2017-03-01

    Antisense oligonucleotides (ASOs) modified with phosphorothioate (PS) linkages and different 2' modifications can be used either as drugs (e.g., to treat homozygous familial hypercholesterolemia and spinal muscular atrophy) or as research tools to alter gene expression. PS-ASOs can enter cells without additional modification or formulation and can be designed to mediate sequence-specific cleavage of different types of RNA (including mRNA and non-coding RNA) targeted by endogenous RNase H1. Although PS-ASOs function in both the cytoplasm and nucleus, localization to different subcellular regions can affect their therapeutic potency. Cellular uptake and intracellular distribution of PS ASOs are mediated by protein interactions. The main proteins involved in these processes have been identified, and intracellular sites in which PS ASOs are active, or inactive, cataloged.

  3. Abiotic formation of oligonucleotides on basalt surfaces

    NASA Astrophysics Data System (ADS)

    Otroshchenko, V. A.; Vasilyeva, N. V.; Kopilov, A. M.

    1985-06-01

    The complication and further evolution of abiotic syntheses products occurred under environmental influences at the prebiological stage. From this point of view, the influence of some types of irradiation on the organic molecules adsorbed on the surfaces of volcanic rocks, appeared to be of great importance. In this connection, the effect of gamma rays on the AMP molecules adsorbed on mineral surfaces such as cinders and ashes has been studied. It has been shown that they can polymerize with the formation of oligonucleotides. The treatment of oligomers obtained by venom phosphodiesterase has shown that a polymeric product has mainly 3' 5' and 2' 5' bonds between nucleotides. The results obtained have been discussed from the evolutionary aspect.

  4. Antisense Oligonucleotides: Treatment Strategies and Cellular Internalization

    PubMed Central

    Miller, Colton M.; Harris, Edward N.

    2016-01-01

    The clinical applicaton of antisense oligonucleotides (ASOs) is becoming more of a reality as several drugs have been approved for the treatment of human disorders and many others are in various phases in development and clinical trials. ASOs are short DNA/RNA oligos which are heavily modified to increase their stability in biological fluids and retain the properties of creating RNA-RNA and DNA-RNA duplexes that knock-down or correct genetic expression. This review outlines several strategies that ASOs utilize for the treatment of various congenital diseases and syndromes that develop with aging. In addition, we discuss some of the mechanisms for specific non-targeted ASO internalization within cells. PMID:28374018

  5. Conjugation of fluorescent proteins with DNA oligonucleotides.

    PubMed

    Lapiene, Vidmantas; Kukolka, Florian; Kiko, Kathrin; Arndt, Andreas; Niemeyer, Christof M

    2010-05-19

    This work describes the synthesis of covalent ssDNA conjugates of six fluorescent proteins, ECFP, EGFP, E(2)GFP, mDsRed, Dronpa, and mCherry, which were cloned with an accessible C-terminal cystein residue to enable site-selective coupling using a heterobispecific cross-linker. The resulting conjugates revealed similar fluorescence emission intensity to the unconjugated proteins, and the functionality of the tethered oligonucleotide was proven by specific Watson-Crick base pairing to cDNA-modified gold nanoparticles. Fluorescence spectroscopy analysis indicated that the fluorescence of the FP is quenched by the gold particle, and the extent of quenching varied with the intrinsic spectroscopic properties of FP as well as with the configuration of surface attachment. Since this study demonstrates that biological fluorophores can be selectively incorporated into and optically coupled with nanoparticle-based devices, applications in DNA-based nanofabrication can be foreseen.

  6. Direct oligonucleotide-photosensitizer conjugates for photochemical delivery of antisense oligonucleotides.

    PubMed

    Yuan, Ahu; Laing, Brian; Hu, Yiqiao; Ming, Xin

    2015-04-18

    Activation of photosensitizers in endosomes enables release of therapeutic macromolecules into the cytosol of the target cells for pharmacological actions. In this study, we demonstrate that direct conjugation of photosensitizers to oligonucleotides (ONs) allows spatial and temporal co-localization of the two modalities in the target cells, and thus leads to superior functional delivery of ONs. Further, light-activated delivery of an anticancer ON caused cancer cell killing via modulation of an oncogene and photodynamic therapy.

  7. Duchenne muscular dystrophy caused by a frame-shift mutation in the acceptor splice site of intron 26.

    PubMed

    Meregalli, Mirella; Maciotta, Simona; Angeloni, Valentina; Torrente, Yvan

    2016-08-11

    The dystrophin gene is the one of the largest described in human beings and mutations associated to this gene are responsible for Duchenne or Becker muscular dystrophies. Here we describe a nucleotide substitution in the acceptor splice site of intron 26 (c.3604-1G > C) carried by a 6-year-old boy who presented with a history of progressive proximal muscle weakness and elevated serum creatine kinase levels. RNA analysis showed that the first two nucleotides of the mutated intron 26 (AC) were not recognized by the splicing machinery and a new splicing site was created within exon 27, generating a premature stop codon and avoiding protein translation. The evaluation of the pathogenic effect of the mutation by mRNA analysis will be useful in the optics of an antisense oligonucleotides (AON)-based therapy.

  8. Preparation and application of triple helix forming oligonucleotides and single strand oligonucleotide donors for gene correction.

    PubMed

    Alam, Rowshon; Thazhathveetil, Arun Kalliat; Li, Hong; Seidman, Michael M

    2014-01-01

    Strategies for site-specific modulation of genomic sequences in mammalian cells require two components. One must be capable of recognizing and activating a specific target sequence in vivo, driving that site into an exploitable repair pathway. Information is transferred to the site via participation in the pathway by the second component, a donor nucleic acid, resulting in a permanent change in the target sequence. We have developed biologically active triple helix forming oligonucleotides (TFOs) as site-specific gene targeting reagents. These TFOs, linked to DNA reactive compounds (such as a cross-linking agent), activate pathways that can engage informational donors. We have used the combination of a psoralen-TFO and single strand oligonucleotide donors to generate novel cell lines with directed sequence changes at the target site. Here we describe the synthesis and purification of bioactive psoralen-linked TFOs, their co-introduction into mammalian cells with donor nucleic acids, and the identification of cells with sequence conversion of the target site. We have emphasized details in the synthesis and purification of the oligonucleotides that are essential for preparation of reagents with optimal activity.

  9. Regulation of serum phosphate

    PubMed Central

    Lederer, Eleanor

    2014-01-01

    The regulation of serum phosphate, an acknowledged risk factor for chronic kidney disease and cardiovascular mortality, is poorly understood. The discovery of fibroblast growth factor 23 (FGF23) as a key regulator of renal phosphate handling and activation of vitamin D has revolutionized our comprehension of phosphate homeostasis. Through as yet undetermined mechanisms, circulating and dietary phosphate appear to have a direct effect on FGF23 release by bone cells that, in turn, causes renal phosphate excretion and decreases intestinal phosphate absorption through a decrease in vitamin D production. Thus, the two major phosphaturic hormones, PTH and FGF23, have opposing effects on vitamin D production, placing vitamin D at the nexus of phosphate homeostasis. While our understanding of phosphate homeostasis has advanced, the factors determining regulation of serum phosphate level remain enigmatic. Diet, time of day, season, gender, age and genetics have all been identified as significant contributors to serum phosphate level. The effects of these factors on serum phosphate have major implications for what is understood as ‘normal’ and for studies of phosphate homeostasis and metabolism. Moreover, other hormonal mediators such as dopamine, insulin-like growth factor, and angiotensin II also affect renal handling of phosphate. How the major hormone effects on phosphate handling are regulated and how the effect of these other factors are integrated to yield the measurable serum phosphate are only now beginning to be studied. PMID:24973411

  10. Acceptor and Excitation Density Dependence of the Ultrafast Polaron Absorption Signal in Donor-Acceptor Organic Solar Cell Blends.

    PubMed

    Zarrabi, Nasim; Burn, Paul L; Meredith, Paul; Shaw, Paul E

    2016-07-21

    Transient absorption spectroscopy on organic semiconductor blends for solar cells typically shows efficient charge generation within ∼100 fs, accounting for the majority of the charge carriers. In this Letter, we show using transient absorption spectroscopy on blends containing a broad range of acceptor content (0.01-50% by weight) that the rise of the polaron signal is dependent on the acceptor concentration. For low acceptor content (<10% by weight), the polaron signal rises gradually over ∼1 ps with most polarons generated after 200 fs, while for higher acceptor concentrations (>10%) most polarons are generated within 200 fs. The rise time in blends with low acceptor content was also found to be sensitive to the pump fluence, decreasing with increasing excitation density. These results indicate that the sub-100 fs rise of the polaron signal is a natural consequence of both the high acceptor concentrations in many donor-acceptor blends and the high excitation densities needed for transient absorption spectroscopy, which results in a short average distance between the exciton and the donor-acceptor interface.

  11. A facile method for the construction of oligonucleotide microarrays.

    PubMed

    Sethi, Dalip; Kumar, A; Gupta, K C; Kumar, P

    2008-11-19

    In recent years, the oligonucleotide-based microarray technique has emerged as a powerful and promising tool for various molecular biological studies. Here, a facile protocol for the construction of an oligonucleotide microarray is demonstrated that involves immobilization of oligonucleotide-trimethoxysilyl conjugates onto virgin glass microslides. The projected immobilization strategy reflects high immobilization efficiency ( approximately 36-40%) and signal-to-noise ratio ( approximately 98), and hybridization efficiency ( approximately 32-35%). Using the proposed protocol, aminoalkyl, mercaptoalkyl, and phosphorylated oligonucleotides were immobilized onto virgin glass microslides. Briefly, modified oligonucleotides were reacted first with 3-glycidyloxypropyltriethoxysilane (GOPTS), and subsequently, the resultant conjugates were directly immobilized onto the virgin glass surface by making use of silanization chemistry. The constructed microarrays were then used for discrimination of base mismatches. On subjecting to different pH and thermal conditions, the microarray showed sufficient stability. Application of this chemistry to manufacture oligonucleotide probe-based microarrays for detection of bacterial meningitis is demonstrated. Single-step reaction for the formation of conjugates with the commercially available reagent (GOPTS), omission of capping step and surface modification, and efficient immobilization of oligonucleotides onto the virgin glass surface are the key features of the proposed strategy.

  12. Nucleic acid sequence detection using multiplexed oligonucleotide PCR

    DOEpatents

    Nolan, John P.; White, P. Scott

    2006-12-26

    Methods for rapidly detecting single or multiple sequence alleles in a sample nucleic acid are described. Provided are all of the oligonucleotide pairs capable of annealing specifically to a target allele and discriminating among possible sequences thereof, and ligating to each other to form an oligonucleotide complex when a particular sequence feature is present (or, alternatively, absent) in the sample nucleic acid. The design of each oligonucleotide pair permits the subsequent high-level PCR amplification of a specific amplicon when the oligonucleotide complex is formed, but not when the oligonucleotide complex is not formed. The presence or absence of the specific amplicon is used to detect the allele. Detection of the specific amplicon may be achieved using a variety of methods well known in the art, including without limitation, oligonucleotide capture onto DNA chips or microarrays, oligonucleotide capture onto beads or microspheres, electrophoresis, and mass spectrometry. Various labels and address-capture tags may be employed in the amplicon detection step of multiplexed assays, as further described herein.

  13. Regulation of Gene Expression with Double-Stranded Phosphorothioate Oligonucleotides

    NASA Astrophysics Data System (ADS)

    Bielinska, Anna; Shivdasani, Ramesh A.; Zhang, Liquan; Nabel, Gary J.

    1990-11-01

    Alteration of gene transcription by inhibition of specific transcriptional regulatory proteins is necessary for determining how these factors participate in cellular differentiation. The functions of these proteins can be antagonized by several methods, each with specific limitations. Inhibition of sequence-specific DNA-binding proteins was achieved with double-stranded (ds) phosphorothioate oligonucleotides that contained octamer or kappaB consensus sequences. The phosphorothioate oligonucleotides specifically bound either octamer transcription factor or nuclear factor (NF)-kappaB. The modified oligonucleotides accumulated in cells more effectively than standard ds oligonucleotides and modulated gene expression in a specific manner. Octamer-dependent activation of a reporter plasmid or NF-kappaB-dependent activation of the human immunodeficiency virus (HIV) enhancer was inhibited when the appropriate phosphorothioate oligonucleotide was added to a transiently transfected B cell line. Addition of phosphorothioate oligonucleotides that contained the octamer consensus to Jurkat T leukemia cells inhibited interleukin-2 (IL-2) secretion to a degree similar to that observed with a mutated octamer site in the IL-2 enhancer. The ds phosphorothioate oligonucleotides probably compete for binding of specific transcription factors and may provide anti-viral, immunosuppressive, or other therapeutic effects.

  14. Design and analysis of mismatch probes for long oligonucleotide microarrays

    SciTech Connect

    Deng, Ye; He, Zhili; Van Nostrand, Joy D.; Zhou, Jizhong

    2008-08-15

    Nonspecific hybridization is currently a major concern with microarray technology. One of most effective approaches to estimating nonspecific hybridizations in oligonucleotide microarrays is the utilization of mismatch probes; however, this approach has not been used for longer oligonucleotide probes. Here, an oligonucleotide microarray was constructed to evaluate and optimize parameters for 50-mer mismatch probe design. A perfect match (PM) and 28 mismatch (MM) probes were designed for each of ten target genes selected from three microorganisms. The microarrays were hybridized with synthesized complementary oligonucleotide targets at different temperatures (e.g., 42, 45 and 50 C). In general, the probes with evenly distributed mismatches were more distinguishable than those with randomly distributed mismatches. MM probes with 3, 4 and 5 mismatched nucleotides were differentiated for 50-mer oligonucleotide probes hybridized at 50, 45 and 42 C, respectively. Based on the experimental data generated from this study, a modified positional dependent nearest neighbor (MPDNN) model was constructed to adjust the thermodynamic parameters of matched and mismatched dimer nucleotides in the microarray environment. The MM probes with four flexible positional mismatches were designed using the newly established MPDNN model and the experimental results demonstrated that the redesigned MM probes could yield more consistent hybridizations. Conclusions: This study provides guidance on the design of MM probes for long oligonucleotides (e.g., 50 mers). The novel MPDNN model has improved the consistency for long MM probes, and this modeling method can potentially be used for the prediction of oligonucleotide microarray hybridizations.

  15. Synthesis of polycyclic aromatic hydrocarbon adducts of adenine in nucleosides and oligonucleotides

    SciTech Connect

    Kim, S.J.

    1992-01-01

    PAHs are activated metabolically to electrophilic intermediates such as diol epoxides, which bind to cellular macromolecules, particularly DNA. The dominant paradigm for the etiology of chemically induced cancer involves alterations in the structure of DNA which can cause replication errors. Synthesis of oligonucleotides bearing regiochemically and stereochemically defined PAH adducts is a prerequisite to any study of the relationships of adduct structure to mutagenicity. The first chapter introduces the history of PAH carcinogenesis studies. The second chapter contains the synthetic methodology for preparation of deoxyadenosine adducts of PAHs: benzo[a]pyrene, benz[a]anthracene, and benzo[c]phenanthrene. The nucleoside adducts were synthesized efficiently via the reaction of racemic aminotriol derivatives of PAHs with 6-fluoropurine deoxyriboside. The enantiopure PAH adducts of deoxyadenosine were obtained by HPLC separation of the diastereomers which were characterized by [sup 1]H and 2D NMR, CD, UV, and Mass spectroscopy. The third chapter describes syntheses of oligonucleotides bearing regiochemically and stereochemically defined PAH adducts of benzo[a]pyrene and benz[a]anthracene. A post-oligomerization strategy was used in which the condensation reaction between the aminotriol and a fluoronucleoside was carried out after assembling of the oligomer but before the final deprotection step. The fourth chapter describes an efficient synthesis of (+) and ([minus]) benzo[a]pyrene adducts of deoxyadenosine 3[prime]-phosphate which will be valuable as authentic standards in the Randerath [sup 32]P postlabeling procedure for identification of DNA adducts. In chapter five, a synthetic approach to PAH adducts of deoxyguanosine is discussed. A selective deprotection method is explored in which the oligonucleotide is assembled in the normal fashion except for the exocyclic amino group of the target nucleotide being protected with a labile protecting group.

  16. Phosphate Uptake by Phosphate-Starved Euglena

    PubMed Central

    BLUM, J. J.

    1966-01-01

    Phosphate-deprived Euglena acquire the ability to rapidly in-corporate added phosphate and, also, synthesize an induced acid phosphatase localized in the pellicle. The phosphate uptake system is saturated at low concentrations of phosphate and is inhibited by dinitrophenol, by low temperature, by K+, Li+, and Na+ ions, and competitively by arsenate. The orthophosphate incorporated into the cell is rapidly converted into organic forms but enough remains unesterified to suggest that the uptake is an active transport process. The data do not rule out the possibility that the induced phosphatase is involved in the transport process. PMID:5924104

  17. Optical characterization of oligonucleotide DNA influenced by magnetic fields.

    PubMed

    Banihashemian, Seyedeh Maryam; Periasamy, Vengadesh; Mohammadi, Seyed Mohammad Hossein Mousa Kazemi; Ritikos, Richard; Rahman, Saadah Abdul

    2013-09-25

    UV-VIS spectroscopic analysis of oligonucleotide DNA exposed to different magnetic fields was performed in order to investigate the relationship between DNA extinction coefficients and optical parameters according to magnetic-field strength. The results with the oligonucleotides adenine-thymine 100 mer (AT-100 DNA) and cytosine-guanine 100 mer (CG-100 DNA) indicate that the magnetic field influences DNA molar extinction coefficients and refractive indexes. The imaginary parts of the refractive index and molar extinction coefficients of the AT-100 and CG-100 DNA decreased after exposure to a magnetic field of 750 mT due to cleavage of the DNA oligonucleotides into smaller segments.

  18. Therapeutic oligonucleotides and delivery technologies: Research topics in Japan.

    PubMed

    Murakami, Masahiro

    Oligonucleotides have been gaining considerable attention as promising and effective candidate therapeutics against various diseases. This special issue is aimed at providing a better understanding of the recent progress in the development of oligonucleotide-based therapeutics to encourage further research and innovation in this field to achieve these advancements. Several Japanese scientists have been invited to contribute to this issue by describing their recent findings, overviews, insights, or commentaries on rational designing of therapeutic oligonucleotide molecules and their novel delivery technologies, especially nanocarrier systems.

  19. Method for the preparation of size marker for synthetic oligonucleotides

    SciTech Connect

    Jing, G.Z.; Liu, A.; Leung, W.C.

    1986-01-01

    Terminal deoxynucleotidyltransferase was used for the addition of (..cap alpha..-/sup 32/P)dCTP to the 3'-OH termini of oligo(dT)/sub 12-18/. A collection of oligonucleotides with chain lengths ranging continuously from 13-mer to over 100-mer was generated. The reaction mixture was then mixed with oligo(dT)/sub 12-18/ labeled with (..gamma..-/sup 32/P)ATP by T/sub 4/ polynucleotide kinase. A sequence ladder with the bottom base as 12-mer was then formed. These oligonucleotides served as size marker for the purification and identification of oligonucleotides on polyacrylamide gel.

  20. Synthesis and characterization of oligonucleotide conjugates bearing electroactive labels.

    PubMed

    Moreau, Julie; Dendane, Nabil; Schöllhorn, Bernd; Spinelli, Nicolas; Fave, Claire; Defrancq, Eric

    2013-02-15

    Oxime bond formation has been applied to the preparation of oligonucleotides labeled with electrochemical ferrocene and viologen labels. Aminooxy functionalized ferrocene and viologen derivatives were prepared by a straightforward route and efficiently conjugated with aldehyde containing oligonucleotides either at 3' or 5' end. Both labels were found to not disturb the recognition properties of the oligonucleotide. The versatility of the method was further demonstrated by preparing bi-functionalized conjugates with a disulfide at 3' end and an electrochemical label at 5' end. Copyright © 2012 Elsevier Ltd. All rights reserved.

  1. Some biochemical properties of an acyclic oligonucleotide analogue. A plausible ancestor of the DNA?

    NASA Astrophysics Data System (ADS)

    Merle, Liliane; Spach, Gérard; Merle, Yves; Sági, János; Szemzö, Attila

    1993-04-01

    As acyclic oligonucleotides have been suggested as a primitive model of DNA or RNA in prebiotic times, we compared some biochemical properties of these analogues to that of natural ones. Firstly, an acyclic analogue of deoxyribonucleoside triphosphates was tested as a potential substrate of enzymes intervening in nucleic acids synthesis. GlyTTP, a dTTP analogue with a missing 2'-methylene group is notaccepted as a substrate by either DNA polymerase or deoxynucleotidyl terminal transferase (TdT). Secondly, themodified dodecathymidylate (GlyT)12, the racemic acyclic sugar analogue of (dT)12, proved to be anefficient primer for DNA polymerase and TdT, though the associative properties of (GlyT)12 are very weak as shown by UV spectroscopy in phosphate buffer without magnesium chloride. But (GlyT)12 has the advantage to be 500-times more stable against hydrolysis by snake venom phosphodiesterase than the corresponding oligothymidylate.

  2. A paper-based resonance energy transfer nucleic acid hybridization assay using upconversion nanoparticles as donors and quantum dots as acceptors.

    PubMed

    Doughan, Samer; Uddayasankar, Uvaraj; Krull, Ulrich J

    2015-06-09

    Monodisperse aqueous upconverting nanoparticles (UCNPs) were covalently immobilized on aldehyde modified cellulose paper via reduction amination to develop a luminescence resonance energy transfer (LRET)-based nucleic acid hybridization assay. This first account of covalent immobilization of UCNPs on paper for a bioassay reports an optically responsive method that is sensitive, reproducible and robust. The immobilized UCNPs were decorated with oligonucleotide probes to capture HPRT1 housekeeping gene fragments, which in turn brought reporter conjugated quantum dots (QDs) in close proximity to the UCNPs for LRET. This sandwich assay could detect unlabeled oligonucleotide target, and had a limit of detection of 13 fmol and a dynamic range spanning nearly 3 orders of magnitude. The use of QDs, which are excellent LRET acceptors, demonstrated improved sensitivity, limit of detection, dynamic range and selectivity compared to similar assays that have used molecular fluorophores as acceptors. The selectivity of the assay was attributed to the decoration of the QDs with polyethylene glycol to eliminate non-specific adsorption. The kinetics of hybridization were determined to be diffusion limited and full signal development occurred within 3 min.

  3. Phosphate homeostasis and disorders.

    PubMed

    Manghat, P; Sodi, R; Swaminathan, R

    2014-11-01

    Recent studies of inherited disorders of phosphate metabolism have shed new light on the understanding of phosphate metabolism. Phosphate has important functions in the body and several mechanisms have evolved to regulate phosphate balance including vitamin D, parathyroid hormone and phosphatonins such as fibroblast growth factor-23 (FGF23). Disorders of phosphate homeostasis leading to hypo- and hyperphosphataemia are common and have clinical and biochemical consequences. Notably, recent studies have linked hyperphosphataemia with an increased risk of cardiovascular disease. This review outlines the recent advances in the understanding of phosphate homeostasis and describes the causes, investigation and management of hypo- and hyperphosphataemia.

  4. Microbial solubilization of phosphate

    DOEpatents

    Rogers, R.D.; Wolfram, J.H.

    1993-10-26

    A process is provided for solubilizing phosphate from phosphate containing ore by treatment with microorganisms which comprises forming an aqueous mixture of phosphate ore, microorganisms operable for solubilizing phosphate from the phosphate ore and maintaining the aqueous mixture for a period of time and under conditions operable to effect the microbial solubilization process. An aqueous solution containing soluble phosphorus can be separated from the reacted mixture by precipitation, solvent extraction, selective membrane, exchange resin or gravity methods to recover phosphate from the aqueous solution. 6 figures.

  5. Microbial solubilization of phosphate

    DOEpatents

    Rogers, Robert D.; Wolfram, James H.

    1993-01-01

    A process is provided for solubilizing phosphate from phosphate containing ore by treatment with microorganisms which comprises forming an aqueous mixture of phosphate ore, microorganisms operable for solubilizing phosphate from the phosphate ore and maintaining the aqueous mixture for a period of time and under conditions operable to effect the microbial solubilization process. An aqueous solution containing soluble phosphorous can be separated from the reacted mixture by precipitation, solvent extraction, selective membrane, exchange resin or gravity methods to recover phosphate from the aqueous solution.

  6. Atomic basis of the exquisite specificity of phosphate and sulfate transport receptors.

    PubMed

    Quiocho, F A

    1996-04-01

    We have determined, by the method of x-ray crystallography, the 1.7 A resolution three-dimensional structures of the ligand-bound form of the phosphate receptor as well as the sulfate receptor. These protein structures provide an unprecedented atomic-level understanding of the mechanism governing the exquisite specificity of each receptor. Although they lack amino acid sequence homology, both receptors have very similar three-dimensional structure. The structure consists of two globular domains separated by a deep cleft which contains the ligand-binding site. The bound phosphate and sulfate are totally devoid of water of hydration. The bound phosphate is tightly held in place by 12 hydrogen bonds, 11 with donor and 1 with acceptor groups. The acceptor group (an Asp carboxylate side chain) plays three key roles. It confers specificity by directly recognizing one proton of either the monobasic or dibasic phosphate. It also assists in the recognition of another proton of the monobasic phosphate. Finally, because of charge repulsion, it disallows binding of fully ionized sulfate. The sulfate bound to the sulfate receptor makes seven hydrogen bonds with uncharged polar groups exclusively. The absence of an acceptor group in the binding site of the sulfate receptor is not conducive to phosphate binding.

  7. Intramolecular charge transfer in donor-acceptor molecules

    SciTech Connect

    Slama-Schwok, A.; Blanchard-Desce, M.; Lehn, J.M. )

    1990-05-17

    The photophysical properties of donor-acceptor molecules, push-pull polyenes and carotenoids, have been studied by absorption and fluorescence spectroscopy. The compounds bear various acceptor and donor groups, linked together by chains of different length and structure. The position of the absorption and fluorescence maxima and their variation in solvents of increasing polarity are in agreement with long-distance intramolecular charge-transfer processes, the linker acting as a molecular wire. The effects of the linker length and structure and of the nature of acceptor and donor are presented.

  8. Three holes bound to a double acceptor - Be(+) in germanium

    NASA Technical Reports Server (NTRS)

    Haller, E. E.; Mcmurray, R. E., Jr.; Falicov, L. M.; Haegel, N. M.; Hansen, W. L.

    1983-01-01

    A double acceptor binding three holes has been observed for the first time with photoconductive far-infrared spectroscopy in beryllium-doped germanium single crystals. This new center, Be(+), has a hole binding energy of about 5 meV and is only present when free holes are generated by ionization of either neutral shallow acceptors or neutral Be double acceptors. The Be(+) center thermally ionizes above 4 K. It disappears at a uniaxial stress higher than about a billion dyn/sq cm parallel to (111) as a result of the lifting of the valence-band degeneracy.

  9. Efficient organic solar cells with helical perylene diimide electron acceptors.

    PubMed

    Zhong, Yu; Trinh, M Tuan; Chen, Rongsheng; Wang, Wei; Khlyabich, Petr P; Kumar, Bharat; Xu, Qizhi; Nam, Chang-Yong; Sfeir, Matthew Y; Black, Charles; Steigerwald, Michael L; Loo, Yueh-Lin; Xiao, Shengxiong; Ng, Fay; Zhu, X-Y; Nuckolls, Colin

    2014-10-29

    We report an efficiency of 6.1% for a solution-processed non-fullerene solar cell using a helical perylene diimide (PDI) dimer as the electron acceptor. Femtosecond transient absorption spectroscopy revealed both electron and hole transfer processes at the donor-acceptor interfaces, indicating that charge carriers are created from photogenerated excitons in both the electron donor and acceptor phases. Light-intensity-dependent current-voltage measurements suggested different recombination rates under short-circuit and open-circuit conditions.

  10. Donor–Acceptor Oligorotaxanes Made to Order

    SciTech Connect

    Basu, Subhadeep; Coskun, Ali; Friedman, Douglas C.; Olson, Mark A.; Benitez, Diego; Tkatchouk, Ekaterina; Barin, Gokhan; Yang, Jeffrey; Fahrenbach, Albert C.; Goddard, William A.; Stoddart, J. Fraser

    2011-01-01

    Five donor–acceptor oligorotaxanes made up of dumbbells composed of tetraethylene glycol chains, interspersed with three and five 1,5-dioxynaphthalene units, and terminated by 2,6-diisopropylphenoxy stoppers, have been prepared by the threading of discrete numbers of cyclobis(paraquat-p-phenylene) rings, followed by a kinetically controlled stoppering protocol that relies on click chemistry. The well-known copper(I)-catalyzed alkyne–azide cycloaddition between azide functions placed at the ends of the polyether chains and alkyne-bearing stopper precursors was employed during the final kinetically controlled template-directed synthesis of the five oligorotaxanes, which were characterized subsequently by ¹H NMR spectroscopy at low temperature (233 K) in deuterated acetonitrile. The secondary structures, as well as the conformations, of the five oligorotaxanes were unraveled by spectroscopic comparison with the dumbbell and ring components. By focusing attention on the changes in chemical shifts of some key probe protons, obtained from a wide range of low-temperature spectra, a picture emerges of a high degree of folding within the thread protons of the dumbbells of four of the five oligorotaxanes—the fifth oligorotaxane represents a control compound in effect—brought about by a combination of C[BOND]H···O and π–π stacking interactions between the π-electron-deficient bipyridinium units in the rings and the π-electron-rich 1,5-dioxynaphthalene units and polyether chains in the dumbbells. The secondary structures of a foldamer-like nature have received further support from a solid-state superstructure of a related [3]pseudorotaxane and density functional calculations performed thereon.

  11. Oligonucleotide-Functionalized Anisotropic Gold Nanoparticles

    NASA Astrophysics Data System (ADS)

    Jones, Matthew Robert

    In this thesis, we describe the properties of oligonucleotide-functionalized gold colloids under the unique set of conditions where the particles are geometrically anisotropic and have nanometer-scale dimensions. While nearly two decades of previous work elucidated numerous unexpected and emergent phenomena arising from the combination of inorganic nanoparticles with surface-bound DNA strands, virtually nothing was known about how these properties are altered when the shape of the nanoparticle core is chosen to be non-spherical. In particular, we are interested in understanding, and ultimately controlling, the ways in which these DNA-conjugated anisotropic nanostructures interact when their attraction is governed by programmable DNA hybridization events. Chapter 1 introduces the field of DNA-based materials assembly by discussing how nanoscale building blocks which present rigid, directional interactions can be thought of as possessing artificial versions of the familiar chemical principles of "bonds" and "valency". In chapter 2 we explore the fundamental interparticle binding thermodynamics of DNA-functionalized spherical and anisotropic nanoparticles, which reveals enormous preferences for collective ligand interactions occurring between flat surfaces over those that occur between curved surfaces. Using these insights, chapter 3 demonstrates that when syntheses produce mixtures of different nanoparticle shapes, the tailorable nature of DNA-mediated interparticle association can be used to selectively crystallize and purify the desired anisotropic nanostructure products, leaving spherical impurity particles behind. Chapter 4 leverages the principle that the flat facets of anisotropic particles generate directional DNA-based hybridization interactions to assemble a variety of tailorable nanoparticle superlattices whose symmetry and dimensionality are a direct consequence of the shape of the nanoparticle building block used in their construction. Chapter 5 explores

  12. Metal free columns for determination of deoxynucleotide monophosphate by liquid chromatography/mass spectrometry and application to oligonucleotide.

    PubMed

    Shibayama, Sachie; Sakamaki, Hiroshi; Yamazaki, Taichi; Takatsu, Akiko

    2015-08-07

    We have developed a highly sensitive method for the analysis of deoxynucleotide monophosphates (dNMPs), which involves the use of liquid chromatography/mass spectrometry (LC/MS) and a new metal-free column. The new column solves the problem that the phosphate group in dNMPs interacts with the metal portion of the device or column. After optimization of the analytical conditions, the limits of detection (LODs) of dNMPs were from 5.4ng/g to 6.3ng/g. Those values were 10 times lower than the LODs of previous methods. We applied the method to the determination of the base composition and the quantification of 20-mer oligonucleotide. Despite use of a very small sample amount of 14.5ng, we were able to determine the base composition, and the result was consistent with theoretical values. We were also able to quantify the mass fraction of oligonucleotide with 8.2% expanded uncertainty (k=2). By means of the developed method, we were able to analyze dNMPs with high sensitivity as well as determine the base composition and quantify the mass fraction of oligonucleotide despite use of a small amount of sample. Copyright © 2015 Elsevier B.V. All rights reserved.

  13. Sequence-dependent theory of oligonucleotide hybridization kinetics

    SciTech Connect

    Marimuthu, Karthikeyan; Chakrabarti, Raj E-mail: rajc@andrew.cmu.edu

    2014-05-07

    A theoretical approach to the prediction of the sequence and temperature-dependent rate constants for oligonucleotide hybridization reactions has been developed based on the theory of relaxation kinetics. One-sided and two-sided melting reaction mechanisms for oligonucleotide hybridization reactions have been considered, analyzed, modified, and compared to select a physically consistent as well as robust model for prediction of the relaxation times of DNA hybridization reactions that agrees with the experimental evidence. The temperature- and sequence-dependent parameters of the proposed model have been estimated using available experimental data. The relaxation time model that we developed has been combined with the nearest neighbor model of hybridization thermodynamics to estimate the temperature- and sequence-dependent rate constants of an oligonucleotide hybridization reaction. The model-predicted rate constants are compared to experimentally determined rate constants for the same oligonucleotide hybridization reactions. Finally, we consider a few important applications of kinetically controlled DNA hybridization reactions.

  14. PRACTICAL STRATEGIES FOR PROCESSING AND ANALYZING SPOTTED OLIGONUCLEOTIDE MICROARRAY DATA

    EPA Science Inventory

    Thoughtful data analysis is as important as experimental design, biological sample quality, and appropriate experimental procedures for making microarrays a useful supplement to traditional toxicology. In the present study, spotted oligonucleotide microarrays were used to profile...

  15. Methods to Characterize the Oligonucleotide Functionalization of Quantum Dots.

    PubMed

    Weichelt, Richard; Leubner, Susanne; Henning-Knechtel, Anja; Mertig, Michael; Gaponik, Nikolai; Schmidt, Thorsten-Lars; Eychmüller, Alexander

    2016-09-01

    Currently, DNA nanotechnology offers the most programmable, scalable, and accurate route for the self-assembly of matter with nanometer precision into 1, 2, or 3D structures. One example is DNA origami that is well suited to serve as a molecularly defined "breadboard", and thus, to organize various nanomaterials such as nanoparticles into hybrid systems. Since the controlled assembly of quantum dots (QDs) is of high interest in the field of photonics and other optoelectronic applications, a more detailed view on the functionalization of QDs with oligonucleotides shall be achieved. In this work, four different methods are presented to characterize the functionalization of thiol-capped cadmium telluride QDs with oligonucleotides and for the precise quantification of the number of oligonucleotides bound to the QD surface. This study enables applications requiring the self-assembly of semiconductor-oligonucleotide hybrid materials and proves the conjugation success in a simple and straightforward manner.

  16. Micro- and nano-structure based oligonucleotide sensors.

    PubMed

    Ferrier, David C; Shaver, Michael P; Hands, Philip J W

    2015-06-15

    This paper presents a review of micro- and nano-structure based oligonucleotide detection and quantification techniques. The characteristics of such devices make them very attractive for Point-of-Care or On-Site-Testing biosensing applications. Their small scale means that they can be robust and portable, their compatibility with modern CMOS electronics means that they can easily be incorporated into hand-held devices and their suitability for mass production means that, out of the different approaches to oligonucleotide detection, they are the most suitable for commercialisation. This review discusses the advantages of micro- and nano-structure based sensors and covers the various oligonucleotide detection techniques that have been developed to date. These include: Bulk Acoustic Wave and Surface Acoustic Wave devices, micro- and nano-cantilever sensors, gene Field Effect Transistors, and nanowire and nanopore based sensors. Oligonucleotide immobilisation techniques are also discussed.

  17. Reagents for the preparation of two oligonucleotides per synthesis (TOPS).

    PubMed Central

    Hardy, P M; Holland, D; Scott, S; Garman, A J; Newton, C R; McLean, M J

    1994-01-01

    In order to increase the efficiency of use of automated DNA synthesizers (i.e. the number of oligomers prepared per day), we have devised and prepared novel phosphoramidite reagents that contain a linking group which, while stable under the normal synthesis conditions, is cleaved under basic conditions. When one of these linkers is introduced at the desired position in the synthesis of an oligonucleotide, subsequent detritylation enables the synthesis of a second oligonucleotides sequence upon the first. During deprotection of the oligonucleotide with ammonium hydroxide, the chain is cleaved at either side of the points of introduction of the novel reagent, generating two oligonucleotides free in solution. These reagents are of particular use in applications where oligomers are used in pairs (such as PCR, chemical synthesis of genes etc.) and means that an automated synthesis facility can be used more efficiently, without the need for operator intervention, after the working day is over. Images PMID:8065912

  18. Highly parallel oligonucleotide purification and functionalization using reversible chemistry.

    PubMed

    York, Kerri T; Smith, Ryan C; Yang, Rob; Melnyk, Peter C; Wiley, Melissa M; Turk, Casey M; Ronaghi, Mostafa; Gunderson, Kevin L; Steemers, Frank J

    2012-01-01

    We have developed a cost-effective, highly parallel method for purification and functionalization of 5'-labeled oligonucleotides. The approach is based on 5'-hexa-His phase tag purification, followed by exchange of the hexa-His tag for a functional group using reversible reaction chemistry. These methods are suitable for large-scale (micromole to millimole) production of oligonucleotides and are amenable to highly parallel processing of many oligonucleotides individually or in high complexity pools. Examples of the preparation of 5'-biotin, 95-mer, oligonucleotide pools of >40K complexity at micromole scale are shown. These pools are prepared in up to ~16% yield and 90-99% purity. Approaches for using this method in other applications are also discussed.

  19. Highly parallel oligonucleotide purification and functionalization using reversible chemistry

    PubMed Central

    York, Kerri T.; Smith, Ryan C.; Yang, Rob; Melnyk, Peter C.; Wiley, Melissa M.; Turk, Casey M.; Ronaghi, Mostafa; Gunderson, Kevin L.; Steemers, Frank J.

    2012-01-01

    We have developed a cost-effective, highly parallel method for purification and functionalization of 5′-labeled oligonucleotides. The approach is based on 5′-hexa-His phase tag purification, followed by exchange of the hexa-His tag for a functional group using reversible reaction chemistry. These methods are suitable for large-scale (micromole to millimole) production of oligonucleotides and are amenable to highly parallel processing of many oligonucleotides individually or in high complexity pools. Examples of the preparation of 5′-biotin, 95-mer, oligonucleotide pools of >40K complexity at micromole scale are shown. These pools are prepared in up to ~16% yield and 90–99% purity. Approaches for using this method in other applications are also discussed. PMID:22039155

  20. Oligonucleotide-based theranostic nanoparticles in cancer therapy

    PubMed Central

    Shahbazi, Reza; Ozpolat, Bulent; Ulubayram, Kezban

    2016-01-01

    Theranostic approaches, combining the functionality of both therapy and imaging, have shown potential in cancer nanomedicine. Oligonucleotides such as small interfering RNA and microRNA, which are powerful therapeutic agents, have been effectively employed in theranostic systems against various cancers. Nanoparticles are used to deliver oligonucleotides into tumors by passive or active targeting while protecting the oligonucleotides from nucleases in the extracellular environment. The use of quantum dots, iron oxide nanoparticles and gold nanoparticles and tagging with contrast agents, like fluorescent dyes, optical or magnetic agents and various radioisotopes, has facilitated early detection of tumors and evaluation of therapeutic efficacy. In this article, we review the advantages of theranostic applications in cancer therapy and imaging, with special attention to oligonucleotide-based therapeutics. PMID:27102380

  1. PRACTICAL STRATEGIES FOR PROCESSING AND ANALYZING SPOTTED OLIGONUCLEOTIDE MICROARRAY DATA

    EPA Science Inventory

    Thoughtful data analysis is as important as experimental design, biological sample quality, and appropriate experimental procedures for making microarrays a useful supplement to traditional toxicology. In the present study, spotted oligonucleotide microarrays were used to profile...

  2. Tritium labeling of antisense oligonucleotides by exchange with tritiated water.

    PubMed Central

    Graham, M J; Freier, S M; Crooke, R M; Ecker, D J; Maslova, R N; Lesnik, E A

    1993-01-01

    We describe a simple, efficient, procedure for labeling oligonucleotides to high specific activity (< 1 x 10(8) cpm/mumol) by hydrogen exchange with tritiated water at the C8 positions of purines in the presence of beta-mercaptoethanol, an effective radical scavenger. Approximately 90% of the starting material is recovered as intact, labeled oligonucleotide. The radiolabeled compounds are stable in biological systems; greater than 90% of the specific activity is retained after 72 hr incubation at 37 degrees C in serum-containing media. Data obtained from in vitro cellular uptake experiments using oligonucleotides labeled by this method are similar to those obtained using 35S or 14C-labeled compounds. Because this protocol is solely dependent upon the existence of purine residues, it should be useful for radiolabeling modified as well as unmodified phosphodiester oligonucleotides. Images PMID:8367289

  3. Modulation of acceptor specificity of Ruminococcus albus cellobiose phosphorylase through site-directed mutagenesis.

    PubMed

    Hamura, Ken; Saburi, Wataru; Matsui, Hirokazu; Mori, Haruhide

    2013-09-20

    Cellobiose phosphorylase (EC 2.4.1.20, CBP) catalyzes the reversible phosphorolysis of cellobiose to α-D-glucose 1-phosphate (Glc1P) and d-glucose. Cys485, Tyr648, and Glu653 of CBP from Ruminococcus albus, situated at the +1 subsite, were mutated to modulate acceptor specificity. C485A, Y648F, and Y648V were active enough for analysis. Their acceptor specificities were compared with the wild type based on the apparent kinetic parameters determined in the presence of 10 mM Glc1P. C485A showed higher preference for D-glucosamine than the wild type. Apparent kcat/Km values of Y648F for D-mannose and 2-deoxy-D-glucose were 8.2- and 4.0-fold higher than those of the wild type, respectively. Y648V had synthetic activity toward N-acetyl-D-glucosamine, while the other variants did not. The oligosaccharide production in the presence of the same concentrations of wild type and each mutant was compared. C485A produced 4-O-β-D-glucopyranosyl-D-glucosamine from 10 mM Glc1P and D-glucosamine at a rate similar to the wild type. Y648F and Y648V produced 4-O-β-D-glucopyranosyl-D-mannose and 4-O-β-D-glucopyranosyl-N-acetyl-D-glucosamine much more rapidly than the wild type when D-mannose and N-acetyl-D-glucosamine were used as acceptors, respectively. After a 4h reaction, the amounts of 4-O-β-D-glucopyranosyl-D-mannose and 4-O-β-D-glucopyranosyl-N-acetyl-D-glucosamine produced by Y648F and Y648V were 5.9- and 12-fold higher than the wild type, respectively. Copyright © 2013 Elsevier Ltd. All rights reserved.

  4. Glucose-6-phosphate dehydrogenase

    MedlinePlus

    ... this page: //medlineplus.gov/ency/article/003671.htm Glucose-6-phosphate dehydrogenase test To use the sharing features on this page, please enable JavaScript. Glucose-6-phosphate dehydrogenase (G6PD) is a protein that ...

  5. Nitrogen is a deep acceptor in ZnO

    SciTech Connect

    Tarun, M. C.; Iqbal, M. Zafar; McCluskey, M. D.

    2011-04-14

    Zinc oxide is a promising material for blue and UV solid-state lighting devices, among other applications. Nitrogen has been regarded as a potential p-type dopant for ZnO. However, recent calculations indicate that nitrogen is a deep acceptor. This paper presents experimental evidence that nitrogen is, in fact, a deep acceptor and therefore cannot produce p-type ZnO. A broad photoluminescence (PL) emission band near 1.7 eV, with an excitation onset of ~2.2 eV, was observed, in agreement with the deep-acceptor model of the nitrogen defect. Thus the deep-acceptor behavior can be explained by the low energy of the ZnO valence band relative to the vacuum level.

  6. Nitrogen is a deep acceptor in ZnO

    DOE PAGES

    Tarun, M. C.; Iqbal, M. Zafar; McCluskey, M. D.

    2011-04-14

    Zinc oxide is a promising material for blue and UV solid-state lighting devices, among other applications. Nitrogen has been regarded as a potential p-type dopant for ZnO. However, recent calculations indicate that nitrogen is a deep acceptor. This paper presents experimental evidence that nitrogen is, in fact, a deep acceptor and therefore cannot produce p-type ZnO. A broad photoluminescence (PL) emission band near 1.7 eV, with an excitation onset of ~2.2 eV, was observed, in agreement with the deep-acceptor model of the nitrogen defect. Thus the deep-acceptor behavior can be explained by the low energy of the ZnO valence bandmore » relative to the vacuum level.« less

  7. Diagnostic Oligonucleotide Microarray Fingerprinting of Bacillus Isolates

    SciTech Connect

    Chandler, Darrell P.; Alferov, Oleg; Chernov, Boris; Daly, Don S.; Golova, Julia; Perov, Alexander N.; Protic, Miroslava; Robison, Richard; Shipma, Matthew; White, Amanda M.; Willse, Alan R.

    2006-01-01

    A diagnostic, genome-independent microbial fingerprinting method using DNA oligonucleotide microarrays was used for high-resolution differentiation between closely related Bacillus strains, including two strains of Bacillus anthracis that are monomorphic (indistinguishable) via amplified fragment length polymorphism fingerprinting techniques. Replicated hybridizations on 391-probe nonamer arrays were used to construct a prototype fingerprint library for quantitative comparisons. Descriptive analysis of the fingerprints, including phylogenetic reconstruction, is consistent with previous taxonomic organization of the genus. Newly developed statistical analysis methods were used to quantitatively compare and objectively confirm apparent differences in microarray fingerprints with the statistical rigor required for microbial forensics and clinical diagnostics. These data suggest that a relatively simple fingerprinting microarray and statistical analysis method can differentiate between species in the Bacillus cereus complex, and between strains of B. anthracis. A synthetic DNA standard was used to understand underlying microarray and process-level variability, leading to specific recommendations for the development of a standard operating procedure and/or continued technology enhancements for microbial forensics and diagnostics.

  8. SERS beacons for multiplexed oligonucleotide detection

    NASA Astrophysics Data System (ADS)

    Sun, Jian; Cullum, Brian M.

    2007-09-01

    Gold-based surface-enhanced Raman scattering (SERS) beacons have been developed, which represent a simple, biocompatible and rapid means of performing multiplexed DNA sequence detection in a non-arrayed format. These SERS beacons consist of a simple stem-loop oligonucleotide probe in its native form with one end attached to a SERS active dye molecule and the other to a gold nanoparticle, approximately 50 nm in diameter. The probe sequence is designed to achieve a stem-loop structure, with the loop portion complementary to the target sequence, similar to fluorescent molecular beacons. In the absence of the target DNA sequence, the SERS signal of the associated dye molecule is detected, representing the "ON" state of the probe. When the target sequence is hybridized to the probe, which results in an open conformation, its respective reporter dye is separated from the gold nanoparticle, producing diminished SERS signal. In this paper, the fabrication and characterization of these SERS beacons is described. We also demonstrate selective hybridization of a target sequence to one beacon in a mixture, revealing their potential for use in a multiplexed fashion.

  9. Antisense oligonucleotide therapeutics for human leukemia.

    PubMed

    Gewirtz, A M

    1998-01-01

    The development of reliable gene disruption strategies, and their application in living cells, has proven to be an extraordinary important advance for cell and molecular biologists. Using the various available approaches, the specific functions of any given gene may now be investigated directly in the relevant cell type. Application of similar experimental tools in a clinical setting might prove to be equally valuable and could well form the basis of a monumental advance in the practice of clinical medicine. This seems particularly true at the present time because much progress has been made in understanding the molecular pathogenesis of many diseases, including cancer. For these reasons a tremendous amount of interest has been generated in the use of oligodeoxynucleotides to modify gene expression. However, in spite of some notable successes which are detailed in this review, oligonucleotides have generated controversy in regard to their mechanism of action, reliability, and ultimate therapeutic utility. Nevertheless, the potential power of the "antisense" approach remains undisputed, and its ultimate therapeutic utility is far reaching. Accordingly, the problems associated with the use of these compounds are clearly worth solving. It remains the hope of many laboratories that the day will soon come when these techniques will make an important contribution to the management of chronic myelogenous leukemia and other neoplastic disorders.

  10. Antisense oligonucleotide therapeutics for human leukemia.

    PubMed

    Gewirtz, A M

    1997-01-01

    The development of reliable gene disruption strategies, and their application in living cells, has proven to be an extraordinarily important advance for cell and molecular biologists. Using the various available approaches, the specific functions of any given gene may now be investigated directly in the relevant cell type. Application of similar experimental tools in a clinical setting might prove to be equally valuable and could well form the basis of a monumental advance in the practice of clinical medicine. This seems particularly true at the present time since much progress has been made in understanding the molecular pathogenesis of many diseases, including cancer. For these reasons a tremendous amount of interest has been generated in the use of oligodeoxynucleotides to modify gene expression. However, in spite of some notable successes which are detailed in this review, oligonucleotides have generated controversy in regards to their mechanism of action, reliability, and ultimate therapeutic utility. Nevertheless, the potential power of the "antisense" approach remains undisputed, and its ultimate therapeutic utility is far reaching. Accordingly, the problems associated with the use of these compounds are clearly worth solving. It remains the hope of many laboratories that the day will soon come when these techniques will make an important contribution to the management of CML and other neoplastic disorders.

  11. Antisense Oligonucleotide Therapy for Inherited Retinal Dystrophies.

    PubMed

    Gerard, Xavier; Garanto, Alejandro; Rozet, Jean-Michel; Collin, Rob W J

    2016-01-01

    Inherited retinal dystrophies (IRDs) are an extremely heterogeneous group of genetic diseases for which currently no effective treatment strategies exist. Over the last decade, significant progress has been made utilizing gene augmentation therapy for a few genetic subtypes of IRD, although several technical challenges so far prevent a broad clinical application of this approach for other forms of IRD. Many of the mutations leading to these retinal diseases affect pre-mRNA splicing of the mutated genes . Antisense oligonucleotide (AON)-mediated splice modulation appears to be a powerful approach to correct the consequences of such mutations at the pre-mRNA level , as demonstrated by promising results in clinical trials for several inherited disorders like Duchenne muscular dystrophy, hypercholesterolemia and various types of cancer. In this mini-review, we summarize ongoing pre-clinical research on AON-based therapy for a few genetic subtypes of IRD , speculate on other potential therapeutic targets, and discuss the opportunities and challenges that lie ahead to translate splice modulation therapy for retinal disorders to the clinic.

  12. Oligonucleotide conjugates - Candidates for gene silencing therapeutics.

    PubMed

    Gooding, Matt; Malhotra, Meenakshi; Evans, James C; Darcy, Raphael; O'Driscoll, Caitriona M

    2016-10-01

    The potential therapeutic and diagnostic applications of oligonucleotides (ONs) have attracted great attention in recent years. The capability of ONs to selectively inhibit target genes through antisense and RNA interference mechanisms, without causing un-intended sideeffects has led them to be investigated for various biomedical applications, especially for the treatment of viral diseases and cancer. In recent years, many researchers have focused on enhancing the stability and target specificity of ONs by encapsulating/complexing them with polymers or lipid chains to formulate nanoparticles/nanocomplexes/micelles. Also, chemical modification of nucleic acids has emerged as an alternative to impart stability to ONs against nucleases and other degrading enzymes and proteins found in blood. In addition to chemically modifying the nucleic acids directly, another strategy that has emerged, involves conjugating polymers/peptide/aptamers/antibodies/proteins, preferably to the sense strand (3'end) of siRNAs. Conjugation to the siRNA not only enhances the stability and targeting specificity of the siRNA, but also allows for the development of self-administering siRNA formulations, with a much smaller size than what is usually observed for nanoparticle (∼200nm). This review concentrates mainly on approaches and studies involving ON-conjugates for biomedical applications.

  13. Photophysical deactivation pathways in adenine oligonucleotides.

    PubMed

    Spata, Vincent A; Matsika, Spiridoula

    2015-12-14

    In this work we study deactivation processes in adenine oligomers after absorption of UV radiation using Quantum Mechanics combined with Molecular Mechanics (QM/MM). Correlated electronic structure methods appropriate for describing the excited states are used to describe a π-stacked dimer of adenine bases incorporated into (dA)20(dT)20. The results of these calculations reveal three different types of excited state minima which play a role in deactivation processes. Within this set of minima there are minima where the excited state is localized on one adenine (monomer-like) as well as minima where the excited state is delocalized on two adenines, forming different types of excimers and bonded excimers of varying but inter-related character. The proximity of their energies reveals that the minima can decay into one another along a flat potential energy surface dependent on the interbase separation. Additionally, analysis of the emissive energies and other physical properties, including theoretical anisotropy calculations, and comparison with fluorescence experiments, provides evidence that excimers play an important role in long-lived signals in adenine oligonucleotides while the subpicosecond decay is attributed to monomer-like minima. The necessity for a close approach of the nucleobases reveals that the deactivation mechanism is tied to macro-molecular motion.

  14. Oligonucleotide and Long Polymeric DNA Encoding

    SciTech Connect

    Miller, E; Mariella Jr., R P; Christian, A T; Gardner, S N; Williams, J M

    2003-11-24

    This report summarizes the work done at Lawrence Livermore National Laboratory for the Oligonucleotide and Long Polymeric DNA Encoding project, part of the Microelectronic Bioprocesses Program at DARPA. The goal of the project was to develop a process by which long (circa 10,000 base-pair) synthetic DNA molecules could be synthesized in a timely and economic manner. During construction of the long molecule, errors in DNA sequence occur during hybridization and/or the subsequent enzymatic process. The work done on this project has resulted in a novel synthesis scheme that we call the parallel pyramid synthesis protocol, the development of a suit of computational tools to minimize and quantify errors in the synthesized DNA sequence, and experimental proof of this technique. The modeling consists of three interrelated modules: the bioinformatics code which determines the specifics of parallel pyramid synthesis for a given chain of long DNA, the thermodynamics code which tracks the products of DNA hybridization and polymerase extension during the later steps in the process, and the kinetics model which examines the temporal and spatial processes during one thermocycle. Most importantly, we conducted the first successful syntheses of a gene using small starting oligomers (tetramers). The synthesized sequence, 813 base pairs long, contained a 725 base pair gene, modified green fluorescent protein (mGFP), which has been shown to be a functional gene by cloning into cells and observing its green fluorescent product.

  15. Syntheses of oligonucleotide derivatives with P(V) porphyrin and their properties.

    PubMed

    Shimidzu, T; Segawa, H; Kitamura, M; Nimura, A

    1992-01-01

    Two types of oligonucleotide derivatives which are substituted by P(V) porphyrin at the phosphorus atom of an internucleotidic linkage and at the 5'-terminal internucleotidic linkage via a spacer were synthesized (Fig. 1), and hybridization capabilities of them with complementary oligonucleotides were evaluated. A novel method for a sensing of oligonucleotide by the fluorescence quenching via photo-induced electron transfer between the P(V) porphyrin labeled oligonucleotide and pyrene-labeled one on the oligonucleotide template is reported.

  16. Thermodynamic criteria for high hit rate antisense oligonucleotide design

    PubMed Central

    Matveeva, O. V.; Mathews, D. H.; Tsodikov, A. D.; Shabalina, S. A.; Gesteland, R. F.; Atkins, J. F.; Freier, S. M.

    2003-01-01

    Antisense oligonucleotides are used for therapeutic applications and in functional genomic studies. In practice, however, many of the oligonucleotides complementary to an mRNA have little or no antisense activity. Theoretical strategies to improve the ‘hit rate’ in antisense screens will reduce the cost of discovery and may lead to identification of antisense oligonucleotides with increased potency. Statistical analysis performed on data collected from more than 1000 experiments with phosphorothioate-modified oligonucleotides revealed that the oligo-probes, which form stable duplexes with RNA (ΔGo37 ≤ –30 kcal/mol) and have small self-interaction potential, are more frequently efficient than molecules that form less stable oligonucleotide–RNA hybrids or more stable self-structures. To achieve optimal statistical preference, the values for self-interaction should be (ΔGo37) ≥ –8 kcal/mol for inter-oligonucleotide pairing and (ΔGo37) ≥ –1.1 kcal/mol for intra-molecular pairing. Selection of oligonucleotides with these thermodynamic values in the analyzed experiments would have increased the ‘hit rate’ by as much as 6-fold. PMID:12930948

  17. An Overview of Electron Acceptors in Microbial Fuel Cells

    PubMed Central

    Ucar, Deniz; Zhang, Yifeng; Angelidaki, Irini

    2017-01-01

    Microbial fuel cells (MFC) have recently received increasing attention due to their promising potential in sustainable wastewater treatment and contaminant removal. In general, contaminants can be removed either as an electron donor via microbial catalyzed oxidization at the anode or removed at the cathode as electron acceptors through reduction. Some contaminants can also function as electron mediators at the anode or cathode. While previous studies have done a thorough assessment of electron donors, cathodic electron acceptors and mediators have not been as well described. Oxygen is widely used as an electron acceptor due to its high oxidation potential and ready availability. Recent studies, however, have begun to assess the use of different electron acceptors because of the (1) diversity of redox potential, (2) needs of alternative and more efficient cathode reaction, and (3) expanding of MFC based technologies in different areas. The aim of this review was to evaluate the performance and applicability of various electron acceptors and mediators used in MFCs. This review also evaluated the corresponding performance, advantages and disadvantages, and future potential applications of select electron acceptors (e.g., nitrate, iron, copper, perchlorate) and mediators. PMID:28469607

  18. Fullerene-bisadduct acceptors for polymer solar cells.

    PubMed

    Li, Yongfang

    2013-10-01

    Polymer solar cells (PSCs) have drawn great attention in recent years for their simple device structure, light weight, and low-cost fabrication in comparison with inorganic semiconductor solar cells. However, the power-conversion efficiency (PCE) of PSCs needs to be increased for their future application. The key issue for improving the PCE of PSCs is the design and synthesis of high-efficiency conjugated polymer donors and fullerene acceptors for the photovoltaic materials. For the acceptor materials, several fullerene-bisadduct acceptors with high LUMO energy levels have demonstrated excellent photovoltaic performance in PSCs with P3HT as a donor. In this Focus Review, recent progress in high-efficiency fullerene-bisadduct acceptors is discussed, including the bisadduct of PCBM, indene-C60 bisadduct (ICBA), indene-C70 bisadduct (IC70BA), DMPCBA, NCBA, and bisTOQC. The LUMO levels and photovoltaic performance of these bisadduct acceptors with P3HT as a donor are summarized and compared. In addition, the applications of an ICBA acceptor in new device structures and with other conjugated polymer donors than P3HT are also introduced and discussed.

  19. An Overview of Electron Acceptors in Microbial Fuel Cells.

    PubMed

    Ucar, Deniz; Zhang, Yifeng; Angelidaki, Irini

    2017-01-01

    Microbial fuel cells (MFC) have recently received increasing attention due to their promising potential in sustainable wastewater treatment and contaminant removal. In general, contaminants can be removed either as an electron donor via microbial catalyzed oxidization at the anode or removed at the cathode as electron acceptors through reduction. Some contaminants can also function as electron mediators at the anode or cathode. While previous studies have done a thorough assessment of electron donors, cathodic electron acceptors and mediators have not been as well described. Oxygen is widely used as an electron acceptor due to its high oxidation potential and ready availability. Recent studies, however, have begun to assess the use of different electron acceptors because of the (1) diversity of redox potential, (2) needs of alternative and more efficient cathode reaction, and (3) expanding of MFC based technologies in different areas. The aim of this review was to evaluate the performance and applicability of various electron acceptors and mediators used in MFCs. This review also evaluated the corresponding performance, advantages and disadvantages, and future potential applications of select electron acceptors (e.g., nitrate, iron, copper, perchlorate) and mediators.

  20. DNA surface modified gadolinium phosphate nanoparticles as MRI contrast agents.

    PubMed

    Dumont, Matthieu F; Baligand, Celine; Li, Yichen; Knowles, Elisabeth S; Meisel, Mark W; Walter, Glenn A; Talham, Daniel R

    2012-05-16

    Oligonucleotide modified gadolinium phosphate nanoparticles have been prepared and their magnetic resonance relaxivity properties measured. Nanoparticles of GdPO4·H2O were synthesized in a water/oil microemulsion using IGEPAL CO-520 as surfactant, resulting in 50 to 100 nm particles that are highly dispersible and stable in water. Using surface modification chemistry previously established for zirconium phosphonate surfaces, the particles are directly modified with 5'-phosphate terminated oligonucleotides, and the specific interaction of the divalent phosphate with Gd(3+) sites at the surface is demonstrated. The ability of the modified nanoparticles to act as MRI contrast agents was determined by performing MR relaxivity measurements at 14.1 T. Solutions of nanopure water, Feridex, and Omniscan (FDA approved contrast agents) in 0.25% agarose were used for comparison and control purposes. MRI data confirm that GdPO4·H2O nanoparticles have relaxivities (r1, r2) comparable to those of commercially available contrast agents. In addition, the data suggest that biofunctionalization of the surface of the nanoparticles does not prevent their function as MRI contrast agents.

  1. The detection of platelet derived growth factor using decoupling of quencher-oligonucleotide from aptamer/quantum dot bioconjugates

    NASA Astrophysics Data System (ADS)

    Kim, Gang-Il; Kim, Kyung-Woo; Oh, Min-Kyu; Sung, Yun-Mo

    2009-04-01

    High-sensitivity, high-specificity detection of platelet derived growth factor (PDGF)-BB was realized using the change in fluorescence resonance energy transfer (FRET) occurring between quantum dot (QD) donors and black hole quencher (BHQ) acceptors. CdSe/ZnS QD/mercaptoacetic acid (MAA)/PDGF aptamer bioconjugates were successfully synthesized using ligand exchange. Black hole quencher (BHQ)-bearing oligonucleotide molecules showing partial sequence matching to PDGF aptamer were attached to PDGF aptamers and photoluminescence (PL) quenching was obtained through FRET. By adding target PDGF-BB to the bioconjugates containing BHQs, PL recovery was detected due to detachment of BHQ-bearing oligonucleotide from the PDGF aptamer as a result of the difference in affinity to the PDGF aptamer. The detection limit of the sensor was ~0.4 nM and the linearity was maintained up to 1.6 nM in the PL intensity versus concentration curve. Measurement of PL recovery was suggested as a strong tool for high-sensitivity detection of PDGF-BB. Epidermal growth factor (EGF), the negative control molecule, did not contribute to PL recovery due to lack of binding affinity to the PDGF aptamers, which demonstrates the selectivity of the biosensor.

  2. The Impact of Heterogeneity and Dark Acceptor States on FRET: Implications for Using Fluorescent Protein Donors and Acceptors

    PubMed Central

    Vogel, Steven S.; Nguyen, Tuan A.; van der Meer, B. Wieb; Blank, Paul S.

    2012-01-01

    Förster resonance energy transfer (FRET) microscopy is widely used to study protein interactions in living cells. Typically, spectral variants of the Green Fluorescent Protein (FPs) are incorporated into proteins expressed in cells, and FRET between donor and acceptor FPs is assayed. As appreciable FRET occurs only when donors and acceptors are within 10 nm of each other, the presence of FRET can be indicative of aggregation that may denote association of interacting species. By monitoring the excited-state (fluorescence) decay of the donor in the presence and absence of acceptors, dual-component decay analysis has been used to reveal the fraction of donors that are FRET positive (i.e., in aggregates)._However, control experiments using constructs containing both a donor and an acceptor FP on the same protein repeatedly indicate that a large fraction of these donors are FRET negative, thus rendering the interpretation of dual-component analysis for aggregates between separately donor-containing and acceptor-containing proteins problematic. Using Monte-Carlo simulations and analytical expressions, two possible sources for such anomalous behavior are explored: 1) conformational heterogeneity of the proteins, such that variations in the distance separating donor and acceptor FPs and/or their relative orientations persist on time-scales long in comparison with the excited-state lifetime, and 2) FP dark states. PMID:23152925

  3. Why nature chose phosphates.

    PubMed

    Westheimer, F H

    1987-03-06

    Phosphate esters and anhydrides dominate the living world but are seldom used as intermediates by organic chemists. Phosphoric acid is specially adapted for its role in nucleic acids because it can link two nucleotides and still ionize; the resulting negative charge serves both to stabilize the diesters against hydrolysis and to retain the molecules within a lipid membrane. A similar explanation for stability and retention also holds for phosphates that are intermediary metabolites and for phosphates that serve as energy sources. Phosphates with multiple negative charges can react by way of the monomeric metaphosphate ion PO3- as an intermediate. No other residue appears to fulfill the multiple roles of phosphate in biochemistry. Stable, negatively charged phosphates react under catalysis by enzymes; organic chemists, who can only rarely use enzymatic catalysis for their reactions, need more highly reactive intermediates than phosphates.

  4. Nanogels for Oligonucleotide Delivery to the Brain

    PubMed Central

    Vinogradov, Serguei V.; Batrakova, Elena V.; Kabanov, Alexander V.

    2009-01-01

    Systemic delivery of oligonucleotides (ODN) to the central nervous system is needed for development of therapeutic and diagnostic modalities for treatment of neurodegenerative disorders. Macromolecules injected in blood are poorly transported across the blood–brain barrier (BBB) and rapidly cleared from circulation. In this work we propose a novel system for ODN delivery to the brain based on nanoscale network of cross-linked poly(ethylene glycol) and polyethylenimine (“nanogel”). The methods of synthesis of nanogel and its modification with specific targeting molecules are described. Nanogels can bind and encapsulate spontaneously negatively charged ODN, resulting in formation of stable aqueous dispersion of polyelectrolyte complex with particle sizes less than 100 nm. Using polarized monolayers of bovine brain microvessel endothelial cells as an in vitro model this study demonstrates that ODN incorporated in nanogel formulations can be effectively transported across the BBB. The transport efficacy is further increased when the surface of the nanogel is modified with transferrin or insulin. Importantly the ODN is transported across the brain microvessel cells through the transcellular pathway; after transport, ODN remains mostly incorporated in the nanogel and ODN displays little degradation compared to the free ODN. Using mouse model for biodistribution studies in vivo, this work demonstrated that as a result of incorporation into nanogel 1 h after intravenous injection the accumulation of a phosphorothioate ODN in the brain increases by over 15 fold while in liver and spleen decreases by 2-fold compared to the free ODN. Overall, this study suggests that nanogel is a promising system for delivery of ODN to the brain. PMID:14733583

  5. Biominetic High Density Lipoproteins for the Delivery of Therapeutic Oligonucleotides

    NASA Astrophysics Data System (ADS)

    Tripathy, Sushant

    Advances in nanotechnology have brought about novel inorganic and hybrid nanoparticles with unique physico-chemical properties that make them suitable for a broad range of applications---from nano-circuitry to drug delivery. A significant part of those advancements have led to ground-breaking discoveries that have changed the approaches to formulation of therapeutics against diseases, such as cancer. Now-a-days the focus does not lie solely on finding a candidate small-molecule therapeutic with minimal adverse effects, but researchers are looking up to nanoparticles to improve biodistribution and biocompatibility profile of clinically proven therapeutics. The plethora of conjugation chemistries offered by currently extant inorganic nanoparticles have, in recent years, led to great leaps in the field of biomimicry---a modality that promises high biocompatibility. Further, in the pursuit of highly specific therapeutic molecules, researchers have turned to silencing oligonucleotides and some have already brought together the strengths of nanoparticles and silencing oligonucleotides in search of an efficacious therapy for cancer with minimal adverse effects. This dissertation work focuses on such a biomimetic platform---a gold nanoparticle based high density lipoprotein biomimetic (HDL NP), for the delivery of therapeutic oligonucleotides. The first chapter of this body of work introduces the molecular target of the silencing oligonucleotides---VEGFR2, and its role in the progression of solid tumor cancers. The background information also covers important aspects of natural high density lipoproteins (HDL), especially their innate capacity to bind and deliver exogenous and endogenous silencing oligonucleotides to tissues that express their high affinity receptor SRB1. We subsequently describe the synthesis of the biomimetic HDL NP and its oligonucleotide conjugates, and establish their biocompatibility. Further on, experimental data demonstrate the efficacy of silencing

  6. Novel complex MAD phasing and RNase H structural insights using selenium oligonucleotides

    SciTech Connect

    Abdur, Rob; Gerlits, Oksana O.; Gan, Jianhua; Jiang, Jiansheng; Salon, Jozef; Kovalevsky, Andrey Y.; Chumanevich, Alexander A.; Weber, Irene T.; Huang, Zhen

    2014-02-01

    Selenium-derivatized oligonucleotides may facilitate phase determination and high-resolution structure determination for protein–nucleic acid crystallography. The Se atom-specific mutagenesis (SAM) strategy may also enhance the study of nuclease catalysis. The crystal structures of protein–nucleic acid complexes are commonly determined using selenium-derivatized proteins via MAD or SAD phasing. Here, the first protein–nucleic acid complex structure determined using selenium-derivatized nucleic acids is reported. The RNase H–RNA/DNA complex is used as an example to demonstrate the proof of principle. The high-resolution crystal structure indicates that this selenium replacement results in a local subtle unwinding of the RNA/DNA substrate duplex, thereby shifting the RNA scissile phosphate closer to the transition state of the enzyme-catalyzed reaction. It was also observed that the scissile phosphate forms a hydrogen bond to the water nucleophile and helps to position the water molecule in the structure. Consistently, it was discovered that the substitution of a single O atom by a Se atom in a guide DNA sequence can largely accelerate RNase H catalysis. These structural and catalytic studies shed new light on the guide-dependent RNA cleavage.

  7. Phosphate, inositol and polyphosphates.

    PubMed

    Livermore, Thomas M; Azevedo, Cristina; Kolozsvari, Bernadett; Wilson, Miranda S C; Saiardi, Adolfo

    2016-02-01

    Eukaryotic cells have ubiquitously utilized the myo-inositol backbone to generate a diverse array of signalling molecules. This is achieved by arranging phosphate groups around the six-carbon inositol ring. There is virtually no biological process that does not take advantage of the uniquely variable architecture of phosphorylated inositol. In inositol biology, phosphates are able to form three distinct covalent bonds: phosphoester, phosphodiester and phosphoanhydride bonds, with each providing different properties. The phosphoester bond links phosphate groups to the inositol ring, the variable arrangement of which forms the basis of the signalling capacity of the inositol phosphates. Phosphate groups can also form the structural bridge between myo-inositol and diacylglycerol through the phosphodiester bond. The resulting lipid-bound inositol phosphates, or phosphoinositides, further expand the signalling potential of this family of molecules. Finally, inositol is also notable for its ability to host more phosphates than it has carbons. These unusual organic molecules are commonly referred to as the inositol pyrophosphates (PP-IPs), due to the presence of high-energy phosphoanhydride bonds (pyro- or diphospho-). PP-IPs themselves constitute a varied family of molecules with one or more pyrophosphate moiety/ies located around the inositol. Considering the relationship between phosphate and inositol, it is no surprise that members of the inositol phosphate family also regulate cellular phosphate homoeostasis. Notably, the PP-IPs play a fundamental role in controlling the metabolism of the ancient polymeric form of phosphate, inorganic polyphosphate (polyP). Here we explore the intimate links between phosphate, inositol phosphates and polyP, speculating on the evolution of these relationships. © 2016 Authors; published by Portland Press Limited.

  8. Target mRNA inhibition by oligonucleotide drugs in man

    PubMed Central

    Lightfoot, Helen L.; Hall, Jonathan

    2012-01-01

    Oligonucleotide delivery in vivo is commonly seen as the principal hurdle to the successful development of oligonucleotide drugs. In an analysis of 26 oligonucleotide drugs recently evaluated in late-stage clinical trials we found that to date at least half have demonstrated suppression of the target mRNA and/or protein levels in the relevant cell types in man, including those present in liver, muscle, bone marrow, lung, blood and solid tumors. Overall, this strongly implies that the drugs are being delivered to the appropriate disease tissues. Strikingly we also found that the majority of the drug targets of the oligonucleotides lie outside of the drugable genome and represent new mechanisms of action not previously investigated in a clinical setting. Despite the high risk of failure of novel mechanisms of action in the clinic, a subset of the targets has been validated by the drugs. While not wishing to downplay the technical challenges of oligonucleotide delivery in vivo, here we demonstrate that target selection and validation are of equal importance for the success of this field. PMID:22989709

  9. Predicting oligonucleotide-directed mutagenesis failures in protein engineering

    PubMed Central

    Wassman, Christopher D.; Tam, Phillip Y.; Lathrop, Richard H.; Weiss, Gregory A.

    2004-01-01

    Protein engineering uses oligonucleotide-directed mutagenesis to modify DNA sequences through a two-step process of hybridization and enzymatic synthesis. Inefficient reactions confound attempts to introduce mutations, especially for the construction of vast combinatorial protein libraries. This paper applied computational approaches to the problem of inefficient mutagenesis. Several results implicated oligonucleotide annealing to non-target sites, termed ‘cross-hybridization’, as a significant contributor to mutagenesis reaction failures. Test oligonucleotides demonstrated control over reaction outcomes. A novel cross-hybridization score, quickly computable for any plasmid and oligonucleotide mixture, directly correlated with yields of deleterious mutagenesis side products. Cross-hybridization was confirmed conclusively by partial incorporation of an oligonucleotide at a predicted cross-hybridization site, and by modification of putative template secondary structure to control cross-hybridization. Even in low concentrations, cross-hybridizing species in mixtures poisoned reactions. These results provide a basis for improved mutagenesis efficiencies and increased diversities of cognate protein libraries. PMID:15585664

  10. Characteristic archaebacterial 16S rRNA oligonucleotides

    NASA Technical Reports Server (NTRS)

    McGill, T. J.; Jurka, J.; Sobieski, J. M.; Pickett, M. H.; Woese, C. R.; Fox, G. E.

    1986-01-01

    A method of analyzing 16S rRNA catalog data has been developed in which groupings at various taxonomic levels can be characterized in terms of specific "signature" oligonucleotides. This approach provides an alternative means for evaluating higher order branching possibilities and can be used to assess the phylogenetic position of isolates that are poorly placed by the usual clustering procedures. This signature approach has been applied to forty archaebacterial catalogs and every oligonucleotide with significant signature value has been identified. Sets of specific oligonucleotides were identified for every major group on a dendrogram produced by cluster analysis procedures. Signatures that would establish between group relationships were also sought and found. In the case of the Methanobacteriaceae the clustering methods suggest a specific relationship to the Methanococcaceae. This inclusion is in fact supported by six strong signature oligonucleotides. However there are also significant numbers of signature oligonucleotides supporting a specific relationship of the Methanobacteriaceae to either the Halobacteriaceae or the Methanomicrobiaceae. Thus the placement of the Methanobacteriaceae is less certain than the usual dendrograms imply. The signature approach also was used to assess the phylogenetic position of Thermoplasma acidophilum which is found to be more closely related to the methanogen/halophile Division than to the sulfur dependent Division of the archaebacteria. This does not imply however that Thermoplasma acidophilum is properly regarded as being in the methanogen/halophile Division.

  11. Characteristic archaebacterial 16S rRNA oligonucleotides.

    PubMed

    McGill, T J; Jurka, J; Sobieski, J M; Pickett, M H; Woese, C R; Fox, G E

    1986-01-01

    A method of analyzing 16S rRNA catalog data has been developed in which groupings at various taxonomic levels can be characterized in terms of specific "signature" oligonucleotides. This approach provides an alternative means for evaluating higher order branching possibilities and can be used to assess the phylogenetic position of isolates that are poorly placed by the usual clustering procedures. This signature approach has been applied to forty archaebacterial catalogs and every oligonucleotide with significant signature value has been identified. Sets of specific oligonucleotides were identified for every major group on a dendrogram produced by cluster analysis procedures. Signatures that would establish between group relationships were also sought and found. In the case of the Methanobacteriaceae the clustering methods suggest a specific relationship to the Methanococcaceae. This inclusion is in fact supported by six strong signature oligonucleotides. However there are also significant numbers of signature oligonucleotides supporting a specific relationship of the Methanobacteriaceae to either the Halobacteriaceae or the Methanomicrobiaceae. Thus the placement of the Methanobacteriaceae is less certain than the usual dendrograms imply. The signature approach also was used to assess the phylogenetic position of Thermoplasma acidophilum which is found to be more closely related to the methanogen/halophile Division than to the sulfur dependent Division of the archaebacteria. This does not imply however that Thermoplasma acidophilum is properly regarded as being in the methanogen/halophile Division.

  12. Oligonucleotide probe for detection and identification of Campylobacter pylori.

    PubMed Central

    Morotomi, M; Hoshina, S; Green, P; Neu, H C; LoGerfo, P; Watanabe, I; Mutai, M; Weinstein, I B

    1989-01-01

    We have developed a novel and practical DNA-RNA hybridization assay for the detection and identification of Campylobacter pylori in the gastric mucosa. This technique utilizes a [32P]ddATP-labeled synthetic oligonucleotide probe complementary to a nucleotide sequence present in C. pylori 16S rRNA. This probe is very sensitive and reacted with all 23 strains of C. pylori tested. It is also highly specific, since there was no cross-reactivity with the heterologous organisms Campylobacter coli, C. fetus subsp. fetus, C. jejuni, and C. laridis or with Escherichia coli. Hybridization of the oligonucleotide probe with C. pylori RNA was completely inhibited by treatment of the membrane filters with RNase but not DNase. Although a gastric mucosa tissue homogenate slightly inhibited the hybridization, as few as 10(4) C. pylori cells could be detected even in the presence of 5 mg of gastric mucosa. Gastric biopsy specimens obtained from patients referred for upper gastrointestinal tract endoscopy were tested for C. pylori infection by direct oligonucleotide hybridization, and the results were compared with those of bacteriological cultures, the urease test, and histological observations. A comparison of the urease test and the oligonucleotide hybridization results showed an excellent correlation between the two methods. The clinical usefulness of this oligonucleotide-RNA hybridization method is discussed. Images PMID:2480360

  13. A PELDOR-based nanometer distance ruler for oligonucleotides.

    PubMed

    Schiemann, Olav; Piton, Nelly; Mu, Yuguang; Stock, Gerhard; Engels, Joachim W; Prisner, Thomas F

    2004-05-12

    A pulsed electron paramagnetic resonance (EPR) spectroscopic ruler for oligonucleotides was developed using a series of duplex DNAs. The spin-labeling is accomplished during solid-phase synthesis of the oligonucleotides utilizing a palladium-catalyzed cross-coupling reaction between 5-iodo-2'-deoxyuridine and the rigid spin-label 2,2,5,5-tetramethyl-pyrrolin-1-yloxyl-3-acetylene (TPA). 4-Pulse electron double resonance (PELDOR) was then used to measure the intramolecular spin-spin distances via the dipolar coupling, yielding spin-spin distances of 19.2, 23.3, 34.7, 44.8, and 52.5 A. Employing a full-atom force field with explicit water, molecular dynamic (MD) simulations on the same spin-labeled oligonucleotides in their duplex B-form gave spin-spin distances of 19.6, 21.4, 33.0, 43.3, and 52.5 A, respectively, in very good agreement with the measured distances. This shows that the oligonucleotides adopt a B-form duplex structure also in frozen aqueous buffer solution. It also demonstrates that the combined use of site-directed spin-labeling, PELDOR experiments, and MD simulations can yield a microscopic picture about the overall structure of oligonucleotides. The technique is also applicable to more complex systems, like ribozymes or DNA/RNA-protein complexes, which are difficult to access by NMR or X-ray crystallography.

  14. Designer Metallic Acceptor-Containing Halogen Bonding: General Strategies.

    PubMed

    Zhang, Xinxing; Bowen, Kit H

    2017-03-13

    Being electrostatic interactions in nature, hydrogen bonding (HB) and halogen bonding (XB) are considered to be two parallel worlds. In principle, all the applications that HB has could also be applied to XB. However, there has been no report on a metallic XB acceptor but metal anions have been observed to be good HB acceptors. This missing mosaic piece of XB is because common metal anions are reactive for XB donors. In view of this, we propose two strategies for designing metallic acceptor-containing XB using ab initio calculations. The first one is to utilize a metal cluster anion with a high electron detachment energy, such as the superatom, Al13- as the XB acceptor. The second strategy is to design a ligand passivated/protected metal core while it still can maintain the negative charge; several exotic clusters, such as PtH5-, PtZnH5- and PtMgH5-, are utilized as examples. Based on these two strategies, we anticipate that more metallic acceptor-containing XB will be discovered.

  15. Electron acceptor-dependent respiratory and physiological stratifications in biofilms.

    PubMed

    Yang, Yonggang; Xiang, Yinbo; Sun, Guoping; Wu, Wei-Min; Xu, Meiying

    2015-01-06

    Bacterial respiration is an essential driving force in biogeochemical cycling and bioremediation processes. Electron acceptors respired by bacteria often have solid and soluble forms that typically coexist in the environment. It is important to understand how sessile bacteria attached to solid electron acceptors respond to ambient soluble alternative electron acceptors. Microbial fuel cells (MFCs) provide a useful tool to investigate this interaction. In MFCs with Shewanella decolorationis, azo dye was used as an alternative electron acceptor in the anode chamber. Different respiration patterns were observed for biofilm and planktonic cells, with planktonic cells preferred to respire with azo dye while biofilm cells respired with both the anode and azo dye. The additional azo respiration dissipated the proton accumulation within the anode biofilm. There was a large redox potential gap between the biofilms and anode surface. Changing cathodic conditions caused immediate effects on the anode potential but not on the biofilm potential. Biofilm viability showed an inverse and respiration-dependent profile when respiring with only the anode or azo dye and was enhanced when respiring with both simultaneously. These results provide new insights into the bacterial respiration strategies in environments containing multiple electron acceptors and support an electron-hopping mechanism within Shewanella electrode-respiring biofilms.

  16. Phosphate taxis in Pseudomonas aeruginosa.

    PubMed

    Kato, J; Ito, A; Nikata, T; Ohtake, H

    1992-08-01

    Pseudomonas aeruginosa was shown to be attracted to phosphate. The chemotactic response was induced by phosphate starvation. The specificity of chemoreceptors for phosphate was high so that no other tested phosphorus compounds elicited a chemotactic response as strong as that elicited by phosphate. Competition experiments showed that the chemoreceptors for phosphate appeared to be different from those for the common amino acids. Mutants constitutive for alkaline phosphatase showed the chemotactic response to phosphate regardless of whether the cells were starved for phosphate.

  17. Gut inflammation provides a respiratory electron acceptor for Salmonella

    PubMed Central

    Winter, Sebastian E.; Thiennimitr, Parameth; Winter, Maria G.; Butler, Brian P.; Huseby, Douglas L.; Crawford, Robert W.; Russell, Joseph M.; Bevins, Charles L.; Adams, L. Garry; Tsolis, Renée M.; Roth, John R.; Bäumler, Andreas J.

    2010-01-01

    Salmonella enterica serotype Typhimurium (S. Typhimurium) causes acute gut inflammation by using its virulence factors to invade the intestinal epithelium and survive in mucosal macrophages. The inflammatory response enhances the transmission success of S. Typhimurium by promoting its outgrowth in the gut lumen through unknown mechanisms. Here we show that reactive oxygen species generated during inflammation reacted with endogenous, luminal sulphur compounds (thiosulfate) to form a new respiratory electron acceptor, tetrathionate. The genes conferring the ability to utilize tetrathionate as an electron acceptor produced a growth advantage for S. Typhimurium over the competing microbiota in the lumen of the inflamed gut. We conclude that S. Typhimurium virulence factors induce host-driven production of a new electron acceptor that allows the pathogen to use respiration to compete with fermenting gut microbes. Thus, the ability to trigger intestinal inflammation is crucial for the biology of this diarrhoeal pathogen. PMID:20864996

  18. Improving Photoconductance of Fluorinated Donors with Fluorinated Acceptors

    SciTech Connect

    Garner, Logan E.; Larson, Bryon; Oosterhout, Stefan; Owczarczyk, Zbyslaw; Olson, Dana C.; Kopidakis, Nikos; Boltalina, Olga V.; Strauss, Steven H.; Braunecker, Wade A.

    2016-11-21

    This work investigates the influence of fluorination of both donor and acceptor materials on the generation of free charge carriers in small molecule donor/fullerene acceptor BHJ OPV active layers. A fluorinated and non-fluorinated small molecule analogue were synthesized and their optoelectronic properties characterized. The intrinsic photoconductance of blends of these small molecule donors was investigated using time-resolved microwave conductivity. Blends of the two donor molecules with a traditional non-fluorinated fullerene (PC70BM) as well as a fluorinated fullerene (C60(CF3)2-1) were investigated using 5% and 50% fullerene loading. We demonstrate for the first time that photoconductance in a 50:50 donor:acceptor BHJ blend using a fluorinated fullerene can actually be improved relative to a traditional non-fluorinated fullerene by fluorinating the donor molecule as well.

  19. Theory of Primary Photoexcitations in Donor-Acceptor Copolymers.

    PubMed

    Aryanpour, Karan; Dutta, Tirthankar; Huynh, Uyen N V; Vardeny, Zeev Valy; Mazumdar, Sumit

    2015-12-31

    We present a generic theory of primary photoexcitations in low band gap donor-acceptor conjugated copolymers. Because of the combined effects of strong electron correlations and broken symmetry, there is considerable mixing between a charge-transfer exciton and an energetically proximate triplet-triplet state with an overall spin singlet. The triplet-triplet state, optically forbidden in homopolymers, is allowed in donor-acceptor copolymers. For an intermediate difference in electron affinities of the donor and the acceptor, the triplet-triplet state can have a stronger oscillator strength than the charge-transfer exciton. We discuss the possibility of intramolecular singlet fission from the triplet-triplet state, and how such fission can be detected experimentally.

  20. Donor-acceptor semiconducting polymers for organic photovoltaic applications

    NASA Astrophysics Data System (ADS)

    Kularatne, Ruvini S.

    Organic solar cells hold the key for future energy demand due to their unique properties such as low cost, light weight and flexibility. A remarkable amount of effort has been done to improve the power conversion efficiencies in bulk heterojunction solar cells (BHJ). Considerable effort has been done to develop novel donor-acceptor copolymers to improve the absorbance of the copolymer in the visible to near Infrared (IR) regions and to lower the highest occupied molecular orbital (HOMO) energy level of the conjugated polymer as these properties improve the short circuit current density (J SC) and the open circuit voltage (VOC) and hence the power conversion efficiency (PCE) of the BHJ solar cells. In this dissertation, Chapter 1 describes the synthesis and photovoltaic performance of donor-acceptor semiconducting polymers that have been reported during the last decade. 9,9-Dialkyl-2,7-fluorene (FL), 2,7-carbazole (CZ), cyclopenta[2,1-b:3,4-b']dithiophene (CPDT), dithieno[3,2-b:2',3'-d]silole (DTS), dithieno[3,2- b:2',3'-d]pyrrole (DTP), benzo[1,2-b:4,5- b']dithiophene (BDT), benzo[1,2-b:4,5- b']difurane (BDF) building blocks and their donor-acceptor copolymers and their photovoltaic properties have been discussed in this chapter. Chapter 2 describes the synthesis and photovoltaic properties of two novel donor-acceptor polymers P1 and P2 containing benzodithiophene with 3,3',5-trihexylbithienyl substituents as the donor unit with Benzo[c][1,2,5]thiadiazole and 5-hexylthieno[3,4- c]pyrrole-4,6-dione as acceptor building blocks. The photovoltaic properties of the synthesized donor-acceptor polymers were investigated in bulk heterojunction solar cells with [6,6]-phenyl-C61-butyric acid methyl ester (PCBM) acceptor. Chapter 3 describes the synthesis of three novel donor-acceptor copolymers P3, P4 and P5 via Stille coupling polymerization with bithienyl substituted BDT as the donor with three different acceptors; 5,6-difluorobenzo[c][1,2,5]thiadiazole, 4,7-di(thiophen-2

  1. An overview of molecular acceptors for organic solar cells

    NASA Astrophysics Data System (ADS)

    Hudhomme, Piétrick

    2013-07-01

    Organic solar cells (OSCs) have gained serious attention during the last decade and are now considered as one of the future photovoltaic technologies for low-cost power production. The first dream of attaining 10% of power coefficient efficiency has now become a reality thanks to the development of new materials and an impressive work achieved to understand, control and optimize structure and morphology of the device. But most of the effort devoted to the development of new materials concerned the optimization of the donor material, with less attention for acceptors which to date remain dominated by fullerenes and their derivatives. This short review presents the progress in the use of non-fullerene small molecules and fullerene-based acceptors with the aim of evaluating the challenge for the next generation of acceptors in organic photovoltaics.

  2. Electron acceptor taxis and blue light effect on bacterial chemotaxis.

    PubMed

    Taylor, B L; Miller, J B; Warrick, H M; Koshland, D E

    1979-11-01

    Salmonella typhimurium and Escherichia coli from anaerobic cultures displayed tactic responses to gradients of nitrate, fumarate, and oxygen when the appropriate electron transport pathway was present. Such responses were named "electron acceptor taxis" because they are elicited by terminal electron acceptors. Mutant strains of S. typhimurium and E. coli were used to establish that functioning electron transport pathways to nitrate and fumarate are required for taxis to these compounds. Aerotaxis in S. typhimurium was blocked by 1.0 mM KCN, which inhibited oxygen uptake. Similarly, a functioning electron transport pathway was shown to be essential for the tumbling response of S. typhimurium and E. coli to intense light (290 to 530 nm). Some inhibitors and uncouplers of respiration were repellents of S. typhimurium. We propose that behavioral responses to light or electron acceptors involve electron transport-mediated perturbations of the proton motive force.

  3. Safety of antisense oligonucleotide and siRNA-based therapeutics.

    PubMed

    Chi, Xuan; Gatti, Philip; Papoian, Thomas

    2017-01-31

    Oligonucleotide-based therapy is an active area of drug development designed to treat a variety of gene-specific diseases. Two of the more promising platforms are the antisense oligonucleotides (ASOs) and short interfering RNAs (siRNAs), both of which are often directed against similar targets. In light of recent reports on clinical trials of severe thrombocytopenia with two different ASO drugs and increased peripheral neuropathy with an siRNA drug, we compared and contrasted the specific safety characteristics of these two classes of oligonucleotide therapeutic. The objectives were to assess factors that could contribute to the specific toxicities observed with these two classes of promising drugs, and get a better understanding of the potential mechanism(s) responsible for these rare, but serious, adverse events.

  4. Retro-1 Analogues Differentially Affect Oligonucleotide Delivery and Toxin Trafficking.

    PubMed

    Yang, Bing; Ming, Xin; Abdelkafi, Hajer; Pons, Valerie; Michau, Aurelien; Gillet, Daniel; Cintrat, Jean-Christophe; Barbier, Julien; Juliano, Rudy

    2016-11-21

    Retro-1 is a small molecule that displays two important biological activities: First, it blocks the actions of certain toxins by altering their intracellular trafficking. Second, it enhances the activity of oligonucleotides by releasing them from entrapment in endosomes. This raises the question of whether the two actions involve the same cellular target. Herein we report the effects of several Retro-1 analogues on both toxins and oligonucleotides. We found analogues that affect toxins but not oligonucleotides and vice-versa, while Retro-1 is the only compound that affects both. This indicates that the molecular target(s) involved in the two processes are distinct. © 2016 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. OligoFaktory: a visual tool for interactive oligonucleotide design.

    PubMed

    Schretter, Colas; Milinkovitch, Michel C

    2006-01-01

    The OligoFaktory is a set of tools for the design, on an arbitrary number of target sequences, of high-quality long oligonucleotide for micro-array, of primer pair for PCR, of siRNA and more. The user-centered interface exists in two flavours: a web portal and a standalone software for Mac OS X Tiger. A unified presentation of results provides overviews with distribution charts and relative location bar graphs, as well as detailed features for each oligonucleotide. Input and output files conform to a common XML interchange file format to allow both automatic generation of input data, archiving, and post-processing of results. The design pipeline can use BLAST servers to evaluate specificity of selected oligonucleotides. The web portal http://ueg.ulb.ac.be/oligofaktory/; the software for Macintosh: http://www.oligofaktory.org/

  6. Current progress on aptamer-targeted oligonucleotide therapeutics

    PubMed Central

    Dassie, Justin P; Giangrande, Paloma H

    2014-01-01

    Exploiting the power of the RNAi pathway through the use of therapeutic siRNA drugs has remarkable potential for treating a vast array of human disease conditions. However, difficulties in delivery of these and similar nucleic acid-based pharmacological agents to appropriate organs or tissues, remains a major impediment to their broad clinical application. Synthetic nucleic acid ligands (aptamers) have emerged as effective delivery vehicles for therapeutic oligonucleotides, including siRNAs. In this review, we summarize recent attractive developments in creatively employing cell-internalizing aptamers to deliver therapeutic oligonucleotides (e.g., siRNAs, miRNAs, anti-miRs and antisense oligos) to target cells. We also discuss advancements in aptamer-siRNA chimera technology, as well as, aptamer-functionalized nanoparticles for siRNA delivery. In addition, the challenges and future prospects of aptamer-targeted oligonucleotide drugs for clinical translation are further highlighted. PMID:24304250

  7. Zinc phosphate conversion coatings

    DOEpatents

    Sugama, T.

    1997-02-18

    Zinc phosphate conversion coatings for producing metals which exhibit enhanced corrosion prevention characteristics are prepared by the addition of a transition-metal-compound promoter comprising a manganese, iron, cobalt, nickel, or copper compound and an electrolyte such as polyacrylic acid, polymethacrylic acid, polyitaconic acid and poly-L-glutamic acid to a phosphating solution. These coatings are further improved by the incorporation of Fe ions. Thermal treatment of zinc phosphate coatings to generate {alpha}-phase anhydrous zinc phosphate improves the corrosion prevention qualities of the resulting coated metal. 33 figs.

  8. Zinc phosphate conversion coatings

    DOEpatents

    Sugama, Toshifumi

    1997-01-01

    Zinc phosphate conversion coatings for producing metals which exhibit enhanced corrosion prevention characteristics are prepared by the addition of a transition-metal-compound promoter comprising a manganese, iron, cobalt, nickel, or copper compound and an electrolyte such as polyacrylic acid, polymethacrylic acid, polyitaconic acid and poly-L-glutamic acid to a phosphating solution. These coatings are further improved by the incorporation of Fe ions. Thermal treatment of zinc phosphate coatings to generate .alpha.-phase anhydrous zinc phosphate improves the corrosion prevention qualities of the resulting coated metal.

  9. Survival of the fittest before the beginning of life: selection of the first oligonucleotide-like polymers by UV light

    PubMed Central

    Mulkidjanian, Armen Y; Cherepanov, Dmitry A; Galperin, Michael Y

    2003-01-01

    Background A key event in the origin of life on this planet has been formation of self-replicating RNA-type molecules, which were complex enough to undergo a Darwinian-type evolution (origin of the "RNA world"). However, so far there has been no explanation of how the first RNA-like biopolymers could originate and survive on the primordial Earth. Results As condensation of sugar phosphates and nitrogenous bases is thermodynamically unfavorable, these compounds, if ever formed, should have undergone rapid hydrolysis. Thus, formation of oligonucleotide-like structures could have happened only if and when these structures had some selective advantage over simpler compounds. It is well known that nitrogenous bases are powerful quenchers of UV quanta and effectively protect the pentose-phosphate backbones of RNA and DNA from UV cleavage. To check if such a protection could play a role in abiogenic evolution on the primordial Earth (in the absence of the UV-protecting ozone layer), we simulated, by using Monte Carlo approach, the formation of the first oligonucleotides under continuous UV illumination. The simulations confirmed that UV irradiation could have worked as a selective factor leading to a relative enrichment of the system in longer sugar-phosphate polymers carrying nitrogenous bases as UV-protectors. Partial funneling of the UV energy into the condensation reactions could provide a further boost for the oligomerization. Conclusion These results suggest that accumulation of the first polynucleotides could be explained by their abiogenic selection as the most UV-resistant biopolymers. PMID:12773209

  10. Donor-acceptor chemistry in the main group.

    PubMed

    Rivard, Eric

    2014-06-21

    This Perspective article summarizes recent progress from our laboratory in the isolation of reactive main group species using a general donor-acceptor protocol. A highlight of this program is the use of carbon-based donors in combination with suitable Lewis acidic acceptors to yield stable complexes of parent Group 14 element hydrides (e.g. GeH2 and H2SiGeH2). It is anticipated that this strategy could be extended to include new synthetic targets from throughout the Periodic Table with possible applications in bottom-up materials synthesis and main group element catalysis envisioned.

  11. Acceptor specificity in the transglycosylation reaction using Endo-M.

    PubMed

    Tomabechi, Yusuke; Odate, Yuki; Izumi, Ryuko; Haneda, Katsuji; Inazu, Toshiyuki

    2010-11-22

    To determine the structural specificity of the glycosyl acceptor of the transglycosylation reaction using endo-β-N-acetylglucosaminidase (ENGase) (EC 3.2.1.96) from Mucor hiemalis (Endo-M), several acceptor derivatives were designed and synthesized. The narrow regions of the 1,3-diol structure from the 4- to 6-hydroxy functions of GlcNAc were found to be essential for the transglycosylation reaction using Endo-M. Furthermore, it was determined that Endo-M strictly recognizes a 1,3-diol structure consisting of primary and secondary hydroxyl groups.

  12. Versatile functionalization of nanoelectrodes by oligonucleotides via pyrrole electrochemistry.

    PubMed

    Descamps, Emeline; Nguyen, Khoa; Bouchain-Gautier, Christelle; Filoramo, Arianna; Goux-Capes, Laurence; Goffman, Marcello; Bourgoin, Jean-Philippe; Mailley, Pascal; Livache, Thierry

    2010-11-15

    Surface modification at the nanometer scale is a challenge for the future of molecular electronics. In particular, the precise anchoring and electrical addressing of biological scaffolds such as complex DNA nanonetworks is of importance for generating bio-directed assemblies of nano-objects for nanocircuit purposes. Herein, we consider the individual modification of nanoelectrodes with different oligonucleotide sequences by an electrochemically driven co-polymerization process of pyrrole and modified oligonucleotide sequences bearing pyrrole monomers. We demonstrate that this one-step technique presents the advantages of simplicity, localization of surface modification, mechanical, biological and chemical stability of the coatings, and high lateral resolution.

  13. Finding a most likely clone ordering from oligonucleotide hybridization data

    SciTech Connect

    Newberg, L.A.

    1994-06-01

    Using an extension of a statistical model given by E. Lander and M. Waterman, the authors define the a posteriori probability of a clone ordering based upon oligonucleotide hybridization data. They give algorithms for computing the likelihood of a clone ordering and for finding a clone ordering of maximum likelihood. The dynamic programming algorithm for computing likelihoods runs in time O(mnc), where m is the number of oligonucleotide probes, n is the number of clones, and c is the coverage of the clone library. They use the Expectation-Maximization technique to maximize likelihoods. 21 refs., 3 figs.

  14. Inhibition of microRNA with antisense oligonucleotides.

    PubMed

    Esau, Christine C

    2008-01-01

    Antisense inhibition of microRNA (miRNA) function has been an important tool for uncovering miRNA biology. Chemical modification of anti-miRNA oligonucleotides (AMOs) is necessary to improve affinity for target miRNA, stabilize the AMO to nuclease degradation, and to promote tissue uptake for in vivo delivery. Here I summarize the work done to evaluate the effectiveness of various chemically modified AMOs for use in cultured cells and rodent models, and outline important issues to consider when inhibiting miRNAs with antisense oligonucleotides.

  15. Emission Anisotropy of Fluorescein Covalently Linked to Oligonucleotides

    NASA Astrophysics Data System (ADS)

    Blokhin, A. P.; Kvach, M. V.; Povedailo, V. A.; Shmanai, V. V.; Yakovlev, D. L.

    2017-03-01

    Rotational depolarization of fluorescence from fluorescein covalently linked to oligonucleotides was studied. Fluorescence anisotropy of two nucleic acids was measured as a function of the temperature-to-viscosity ratio in buffer solutions with various glycerin concentrations. It was shown that the experimental results could be satisfactorily explained by a diffusion model of an elongated molecular top with internal rotation. It was found that the coefficient of internal rotational diffusion in all instances was 1.5-2 times greater than that for rotation around the oligonucleotide axis.

  16. Ligand-bound Structures and Site-directed Mutagenesis Identify the Acceptor and Secondary Binding Sites of Streptomyces coelicolor Maltosyltransferase GlgE.

    PubMed

    Syson, Karl; Stevenson, Clare E M; Miah, Farzana; Barclay, J Elaine; Tang, Minhong; Gorelik, Andrii; Rashid, Abdul M; Lawson, David M; Bornemann, Stephen

    2016-10-07

    GlgE is a maltosyltransferase involved in α-glucan biosynthesis in bacteria that has been genetically validated as a target for tuberculosis therapies. Crystals of the Mycobacterium tuberculosis enzyme diffract at low resolution so most structural studies have been with the very similar Streptomyces coelicolor GlgE isoform 1. Although the donor binding site for α-maltose 1-phosphate had been previously structurally defined, the acceptor site had not. Using mutagenesis, kinetics, and protein crystallography of the S. coelicolor enzyme, we have now identified the +1 to +6 subsites of the acceptor/product, which overlap with the known cyclodextrin binding site. The sugar residues in the acceptor subsites +1 to +5 are oriented such that they disfavor the binding of malto-oligosaccharides that bear branches at their 6-positions, consistent with the known acceptor chain specificity of GlgE. A secondary binding site remote from the catalytic center was identified that is distinct from one reported for the M. tuberculosis enzyme. This new site is capable of binding a branched α-glucan and is most likely involved in guiding acceptors toward the donor site because its disruption kinetically compromises the ability of GlgE to extend polymeric substrates. However, disruption of this site, which is conserved in the Streptomyces venezuelae GlgE enzyme, did not affect the growth of S. venezuelae or the structure of the polymeric product. The acceptor subsites +1 to +4 in the S. coelicolor enzyme are well conserved in the M. tuberculosis enzyme so their identification could help inform the design of inhibitors with therapeutic potential. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  17. Ligand-bound Structures and Site-directed Mutagenesis Identify the Acceptor and Secondary Binding Sites of Streptomyces coelicolor Maltosyltransferase GlgE*

    PubMed Central

    Syson, Karl; Stevenson, Clare E. M.; Miah, Farzana; Barclay, J. Elaine; Tang, Minhong; Gorelik, Andrii; Rashid, Abdul M.; Lawson, David M.; Bornemann, Stephen

    2016-01-01

    GlgE is a maltosyltransferase involved in α-glucan biosynthesis in bacteria that has been genetically validated as a target for tuberculosis therapies. Crystals of the Mycobacterium tuberculosis enzyme diffract at low resolution so most structural studies have been with the very similar Streptomyces coelicolor GlgE isoform 1. Although the donor binding site for α-maltose 1-phosphate had been previously structurally defined, the acceptor site had not. Using mutagenesis, kinetics, and protein crystallography of the S. coelicolor enzyme, we have now identified the +1 to +6 subsites of the acceptor/product, which overlap with the known cyclodextrin binding site. The sugar residues in the acceptor subsites +1 to +5 are oriented such that they disfavor the binding of malto-oligosaccharides that bear branches at their 6-positions, consistent with the known acceptor chain specificity of GlgE. A secondary binding site remote from the catalytic center was identified that is distinct from one reported for the M. tuberculosis enzyme. This new site is capable of binding a branched α-glucan and is most likely involved in guiding acceptors toward the donor site because its disruption kinetically compromises the ability of GlgE to extend polymeric substrates. However, disruption of this site, which is conserved in the Streptomyces venezuelae GlgE enzyme, did not affect the growth of S. venezuelae or the structure of the polymeric product. The acceptor subsites +1 to +4 in the S. coelicolor enzyme are well conserved in the M. tuberculosis enzyme so their identification could help inform the design of inhibitors with therapeutic potential. PMID:27531751

  18. Oligonucleotide labelling using a fluorogenic "click" reaction with a hemicarboxonium salt.

    PubMed

    Maether, Marie-Pierre; Lapin, Kristie; Muntean, Andreea; Payrastre, Corinne; Escudier, Jean-Marc

    2013-10-17

    Two fluorescent streptocyanine labelled oligonucleotides have been synthesized by a simple "click" reaction between a non-fluorescent hemicarboxonium salt and aminoalkyl functionalized thymidines within the oligonucleotide and their spectrophotometric properties have been studied.

  19. Tetrathiafulvalene-based mixed-valence acceptor-donor-acceptor triads: a joint theoretical and experimental approach.

    PubMed

    Calbo, Joaquín; Aragó, Juan; Otón, Francisco; Lloveras, Vega; Mas-Torrent, Marta; Vidal-Gancedo, José; Veciana, Jaume; Rovira, Concepció; Ortí, Enrique

    2013-12-02

    This work presents a joint theoretical and experimental characterisation of the structural and electronic properties of two tetrathiafulvalene (TTF)-based acceptor-donor-acceptor triads (BQ-TTF-BQ and BTCNQ-TTF-BTCNQ; BQ is naphthoquinone and BTCNQ is benzotetracyano-p-quinodimethane) in their neutral and reduced states. The study is performed with the use of electrochemical, electron paramagnetic resonance (EPR), and UV/Vis/NIR spectroelectrochemical techniques guided by quantum-chemical calculations. Emphasis is placed on the mixed-valence properties of both triads in their radical anion states. The electrochemical and EPR results reveal that both BQ-TTF-BQ and BTCNQ-TTF-BTCNQ triads in their radical anion states behave as class-II mixed-valence compounds with significant electronic communication between the acceptor moieties. Density functional theory calculations (BLYP35/cc-pVTZ), taking into account the solvent effects, predict charge-localised species (BQ(.-)-TTF-BQ and BTCNQ(.-)-TTF-BTCNQ) as the most stable structures for the radical anion states of both triads. A stronger localisation is found both experimentally and theoretically for the BTCNQ-TTF-BTCNQ anion, in accordance with the more electron-withdrawing character of the BTCNQ acceptor. CASSCF/CASPT2 calculations suggest that the low-energy, broad absorption bands observed experimentally for the BQ-TTF-BQ and BTCNQ-TTF-BTCNQ radical anions are associated with the intervalence charge transfer (IV-CT) electronic transition and two nearby donor-to-acceptor CT excitations. The study highlights the molecular efficiency of the electron-donor TTF unit as a molecular wire connecting two acceptor redox centres. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Three Redox States of a Diradical Acceptor-Donor-Acceptor Triad: Gating the Magnetic Coupling and the Electron Delocalization.

    PubMed

    Souto, Manuel; Lloveras, Vega; Vela, Sergi; Fumanal, Maria; Ratera, Imma; Veciana, Jaume

    2016-06-16

    The diradical acceptor-donor-acceptor triad 1(••), based on two polychlorotriphenylmethyl (PTM) radicals connected through a tetrathiafulvalene(TTF)-vinylene bridge, has been synthesized. The generation of the mixed-valence radical anion, 1(•-), and triradical cation species, 1(•••+), obtained upon electrochemical reduction and oxidation, respectively, was monitored by optical and ESR spectroscopy. Interestingly, the modification of electron delocalization and magnetic coupling was observed when the charged species were generated and the changes have been rationalized by theoretical calculations.

  1. Synthesis and properties of double-stranded antisense oligonucleotides connected with a pentaerythritol linker.

    PubMed

    Shibata, Aya; Ueno, Yoshihito; Matsuda, Akira; Kitade, Yukio

    2006-01-01

    This paper describes the synthesis and properties of double-stranded antisense oligonucleotides connected with a pentaerythritol linker. We found that double-stranded antisense oligonucleotides with aminomethyl residues have high affinity for single-stranded DNA or RNA in buffer solutions both with and without MgCl(2). Thus, these oligonucleotides would be useful as antisense oligonucleotides for targeting single-stranded RNA through triplex formation.

  2. CADMIUM PHOSPHATE GLASS

    DOEpatents

    Carpenter, H.W.; Johnson, P.D.

    1963-04-01

    A method of preparing a cadmium phosphate glass that comprises providing a mixture of solid inorganic compounds of cadmuim and phosphate having vaporizable components and heating the resulting composition to a temperature of at least 850 un. Concent 85% C is presented. (AEC)

  3. Electron Acceptor-Electron Donor Interactions. XV and XVI.

    DTIC Science & Technology

    mixtures exhibit simple eutectic phase diagrams and the thermochromic effect is interpreted as a randomized structure in the liquid , whereas the solid is a...two-phase aggregate of isolated acceptor and onor crystals . The charge-transfer spectra of solutions of tungsten and molybdenum hexafluorides and iodine heptafluoride in n-hexane and cyclohexane were obtained.

  4. Development of imide- and imidazole-containing electron acceptors for use in donor-acceptor conjugated compounds and polymers

    NASA Astrophysics Data System (ADS)

    Li, Duo

    Conjugated organic compounds and polymers have attracted significant attention due to their potential application in electronic devices as semiconducting materials, such as organic solar cells (OSCs). In order to tune band gaps, donor-acceptor (D-A) structure is widely used, which has been proved to be one of the most effective strategies. This thesis consists of three parts: 1) design, syntheses and characterization of new weak acceptors based on imides and the systematic study of the structure-property relationship; (2) introduction of weak and strong acceptors in one polymer to achieve a broad coverage of light absorption and improve the power conversion efficiency (PCE); (3) modification of benzothiadiazole (BT) acceptor in order to increase the electron withdrawing ability. Imide-based electron acceptors, 4-(5-bromothiophen-2-y1)-2-(2-ethylhexyl)-9- phenyl- 1H-benzo[f]isoindole-1,3(2H)-dione (BIDO-1) and 4,9-bis(5-bromothiophen-2-yl)-2-(2-ethylhexyl)-benzo[f]isoindole-1,3-dione (BIDO-2), were designed and synthesized. In this design, naphthalene is selected as its main core to maintain a planar structure, and thienyl groups are able to facilitate the bromination reaction and lower the band gap. BIDO-1 and BIDO-2 were successfully coupled with different donors by both Suzuki cross-coupling and Stille cross-coupling reactions. Based on the energy levels and band gaps of the BIDO-containing compounds and polymers, BIDO-1 and BIDO-2 are proved to be weak electron acceptors. Pyromellitic diimide (PMDI) was also studied and found to be a stronger electron acceptor than BIDO . In order to obtain broad absorption coverage, both weak acceptor ( BIDO-2) and strong acceptor diketopyrrolopyrrole (DPP) were introduced in the same polymer. The resulting polymers show two absorption bands at 400 and 600 nm and two emission peaks at 500 and 680 nm. The band gaps of the polymers are around 1.6 eV, which is ideal for OSC application. The PCE of 1.17% was achieved. Finally

  5. Anaerobic methanotrophy in tidal wetland: Effects of electron acceptors

    NASA Astrophysics Data System (ADS)

    Lin, Li-Hung; Yu, Zih-Huei; Wang, Pei-Ling

    2016-04-01

    Wetlands have been considered to represent the largest natural source of methane emission, contributing substantially to intensify greenhouse effect. Despite in situ methanogenesis fueled by organic degradation, methanotrophy also plays a vital role in controlling the exact quantity of methane release across the air-sediment interface. As wetlands constantly experience various disturbances of anthropogenic activities, biological burrowing, tidal inundation, and plant development, rapid elemental turnover would enable various electron acceptors available for anaerobic methanotrophy. The effects of electron acceptors on stimulating anaerobic methanotrophy and the population compositions involved in carbon transformation in wetland sediments are poorly explored. In this study, sediments recovered from tidally influenced, mangrove covered wetland in northern Taiwan were incubated under the static conditions to investigate whether anaerobic methanotrophy could be stimulated by the presence of individual electron acceptors. Our results demonstrated that anaerobic methanotrophy was clearly stimulated in incubations amended with no electron acceptor, sulfate, or Fe-oxyhydroxide. No apparent methane consumption was observed in incubations with nitrate, citrate, fumarate or Mn-oxides. Anaerobic methanotrophy in incubations with no exogenous electron acceptor appears to proceed at the greatest rates, being sequentially followed by incubations with sulfate and Fe-oxyhydroxide. The presence of basal salt solution stimulated methane oxidation by a factor of 2 to 3. In addition to the direct impact of electron acceptor and basal salts, incubations with sediments retrieved from low tide period yielded a lower rate of methane oxidation than from high tide period. Overall, this study demonstrates that anaerobic methanotrophy in wetland sediments could proceed under various treatments of electron acceptors. Low sulfate content is not a critical factor in inhibiting methane

  6. Acceptor conductivity in bulk zinc oxide (0001) crystals

    NASA Astrophysics Data System (ADS)

    Adekore, Bababunmi Tolu

    ZnO is a promising wide bandgap semiconductor. Its renowned and prominent properties as its bandgap of 3.37eV at 4.2K; its very high excitonic binding energy, 60meV; its high melting temperature, 2248K constitute the basis for the recently renewed and sustained scientific interests in the material. In addition to the foregoing, the availability of bulk substrates of industrially relevant sizes provides important opportunities such as homoepitaxial deposition of the material which is a technological asset in the production of efficient optoelectronic and electronic devices. The nemesis of wide bandgap materials cannot be more exemplified than in ZnO. The notorious limitation of asymmetric doping and the haunting plague of electrically active point defects dim the bright future of the material. In this case, the search for reliable and consistent acceptor conductivity in bulk substrates has been hitherto, unsuccessful. In the dissertation that now follows, our efforts have been concerted in the search for a reliable acceptor. We have carefully investigated the science of point defects in the material, especially those responsible for the high donor conductivity. We also investigated and herein report variety of techniques of introducing acceptors into the material. We employ the most relevant and informative characterization techniques in verifying both the intended conductivity and the response of intrinsic crystals to variation in temperature and strain. And finally we explain deviations, where they exist, from ideal acceptor characteristics. Our work on reliable acceptor has been articulated in four papers. The first establishing capacitance based methods of monitoring electrically active donor defects. The second investigates the nature of anion acceptors on the oxygen sublattice. A study similar to the preceding study was conducted for cation acceptors on the zinc sublattice and reported in the third paper. Finally, an analysis of the response of the crystal to

  7. Synthesis and anti-HIV activity of thiocholesteryl-coupled phosphodiester antisense oligonucleotides incorporated into immunoliposomes.

    PubMed

    Zelphati, O; Wagner, E; Leserman, L

    1994-09-01

    Encapsulation of oligonucleotides in antibody-targeted liposomes (immunoliposomes) which bind to target cells permits intracellular delivery of the oligonucleotides. This approach circumvents problems of extracellular degradation by nucleases and poor membrane permeability which free phosphodiester oligonucleotides are subject to, but leaves unresolved the inefficiency of encapsulation of oligonucleotides in liposomes. We have coupled oligonucleotides to cholesterol via a reversible disulfide bond. This modification of oligonucleotides improved their association with immunoliposomes by a factor of about 10 in comparison to unmodified oligonucleotides. The presence of cholesteryl-modified oligonucleotides incorporated in the bilayer of liposomes did not interfere with the coupling of the targeting protein to the liposome surface. Free or cholesterol coupled oligonucleotides associated with liposomes and directed against the tat gene of HIV-1 were tested for inhibition of HIV-1 proliferation in acutely infected cells. We demonstrate that the cholesteryl-modified as well as unmodified oligonucleotides acquire the target specificity of the antibody on the liposome. Their antiviral activity when delivered into cells is sequence-specific. The activity of these modified or unmodified oligonucleotides to inhibit the replication of HIV was the same on an equimolar basis (EC50 around 0.1 microM). Cholesterol coupled oligonucleotides thus offer increased liposome association without loss of antiviral activity.

  8. Effects of fluid flow on the oligonucleotide folding in single-walled carbon nanotubes.

    PubMed

    Lim, M C G; Zhong, Z W

    2009-10-01

    This paper presents molecular-dynamics (MD) simulations of DNA oligonucleotide and water molecules translocating through carbon nanotube (CNT) channels. An induced pressure difference is applied to the system by pushing a layer of water molecules toward the flow direction to drive the oligonucleotide and other molecules. This MD simulation investigates the changes that occur in the conformation of the oligonucleotide due to water molecules in nanochannels while controlling the temperature and volume of the system in a canonical ensemble. The results show that the oligonucleotide in the (8,8)-(12,12) CNT channel forms a folded state at a lower pressure, whereas the oligonucleotide in the (10,10)-(14,14) CNT channel forms a folded state at a higher pressure instead. The van der Waals forces between the water molecules and the oligonucleotide suggest that the attraction between these two types of molecules results in the linear arrangements of the bases of the oligonucleotide. For a larger nanotube channel, the folding of the oligonucleotide is mainly dependent on the solvent (water molecules), whereas pressure, the size of the nanotube junction, and water molecules are the considering factors of the folding of the oligonucleotide at a smaller nanotube channel. For a folded oligonucleotide, the water distribution around the oligonucleotide is concentrated at a smaller range than that for the distribution around an unfolded oligonucleotide.

  9. Ratiometric detection of oligonucleotide stoichiometry on multifunctional gold nanoparticles by whispering gallery mode biosensing.

    PubMed

    Wu, F C; Wu, Y; Niu, Z; Vollmer, F

    2015-05-07

    A label-free method is developed to ratiometrically determine the stoichiometry of oligonucleotides attached to the surface of gold nanoparticle (GNP) by whispering gallery mode biosensing. Utilizing this scheme, it is furthermore shown that the stoichiometric ratio of GNP attached oligonucleotide species can be controlled by varying the concentration ratio of thiolated oligonucleotides that are used to modify the GNP.

  10. Oligonucleotide-directed mutagenesis for precision gene editing.

    PubMed

    Sauer, Noel J; Mozoruk, Jerry; Miller, Ryan B; Warburg, Zachary J; Walker, Keith A; Beetham, Peter R; Schöpke, Christian R; Gocal, Greg F W

    2016-02-01

    Differences in gene sequences, many of which are single nucleotide polymorphisms, underlie some of the most important traits in plants. With humanity facing significant challenges to increase global agricultural productivity, there is an urgent need to accelerate the development of these traits in plants. oligonucleotide-directed mutagenesis (ODM), one of the many tools of Cibus' Rapid Trait Development System (RTDS(™) ) technology, offers a rapid, precise and non-transgenic breeding alternative for trait improvement in agriculture to address this urgent need. This review explores the application of ODM as a precision genome editing technology, with emphasis on using oligonucleotides to make targeted edits in plasmid, episomal and chromosomal DNA of bacterial, fungal, mammalian and plant systems. The process of employing ODM by way of RTDS technology has been improved in many ways by utilizing a fluorescence conversion system wherein a blue fluorescent protein (BFP) can be changed to a green fluorescent protein (GFP) by editing a single nucleotide of the BFP gene (CAC→TAC; H66 to Y66). For example, dependent on oligonucleotide length, applying oligonucleotide-mediated technology to target the BFP transgene in Arabidopsis thaliana protoplasts resulted in up to 0.05% precisely edited GFP loci. Here, the development of traits in commercially relevant plant varieties to improve crop performance by genome editing technologies such as ODM, and by extension RTDS, is reviewed.

  11. Chromosome-specific painting in Cucumis species using bulked oligonucleotides

    USDA-ARS?s Scientific Manuscript database

    Chromosome-specific painting is a powerful technique in molecular cytogenetic and genome research. We developed an oligonucleotide (oligo)-based chromosome painting technique in cucumber (Cucumis sativus) that will be applicable in any plant species with a sequenced genome. Oligos specific to a sing...

  12. Construction and validation of a 45K rice oligonucleotide array

    USDA-ARS?s Scientific Manuscript database

    We have constructed and validated a 43,311 oligonucleotide (oligos, 50-70-mers) gene array (NSF 45K) based on 45,116 gene models from release 3 of The Institute for Genomic Research's rice pseudomolecules. To test the array, we generated expression profiles on light- and dark-grown rice leaf tissue...

  13. Validation of the Swine Protein-Annotated Oligonucleotide Microarray

    USDA-ARS?s Scientific Manuscript database

    The specificity and utility of the Swine Protein-Annotated Oligonucleotide Microarray, or Pigoligoarray (www.pigoligoarray.org), has been evaluated by profiling the expression of transcripts from four porcine tissues. Tools for comparative analyses of expression on the Pigoligoarray were developed i...

  14. Solid-phase-supported synthesis of morpholinoglycine oligonucleotide mimics

    PubMed Central

    Belov, Sergey S; Tarasenko, Yulia V; Silnikov, Vladimir N

    2014-01-01

    Summary An efficient solid-phase-supported peptide synthesis (SPPS) of morpholinoglycine oligonucleotide (MorGly) mimics has been developed. The proposed strategy includes a novel specially designed labile linker group containing the oxalyl residue and the 2-aminomethylmorpholino nucleoside analogues as first subunits. PMID:24991266

  15. Oligonucleotide N-alkylphosphoramidates: Synthesis and binding to polynucleotides

    SciTech Connect

    Jaeger, A.; Levy, M.J.; Hecht, S.M. )

    1988-09-20

    A few different methods for the preparation of oligonucleotide N-alkylphosphoramidates were compared directly. One of these, involving the use of protected nucleoside phosphites as building blocks, provided the requisite N-alkylphosphoramidates via oxidation of the intermediate dinucleoside methyl phosphites with iodine in the presence of the appropriate alkylamine. This method was found to have several attractive features, including the use of building blocks identical with those employed for the synthesis of DNA and compatibility with procedures and instruments employed for the stepwise synthesis of oligonucleotides by solution and solid-phase methods. This procedure was used to make several di-, tri-, and tetranucleotide N-alkylphosphoramidates derived from deoxyadenosine and thymidine; alkyl substituents included N,N-dimethyl, N-butyl, N-octyl, N-dodecyl, and N-(5-aminopentyl). The oligonucleotide N-alkylphosphoramidates were separated into their component diastereomers and characterized structurally by a number of techniques including circular dichroism, high-field {sup 1}H NMR spectroscopy, FAB mass spectrometry, and enzymatic digestion to authentic nucleosides and nucleotides. Physicochemical characterization of several di- and trinucleotide alkylphosphoramidates revealed that the adenine nucleotide analogues formed stable complexes with poly(thymidylic acid). The stabilities of these complexes were found to increase with increasing chain length of the N-alkylphosphoramidate substituents. The finding that N-alkylphosphoramidate substituents can enhance the binding of certain oligonucleotides to their complementary polynucleotides suggests the existence of a novel source of polynucleotide affinity.

  16. Differential oligonucleotide activity in cell culture versus mouse models.

    PubMed

    Wickstrom, E; Tyson, F L

    1997-01-01

    The usual course of drug discovery begins with the demonstration of compound activity in cells and, usually, a lower level of activity in animals. Successive rounds of drug design may result in a compound with sufficient activity in animals to justify clinical trials. The basic endpoints of therapeutic oligonucleotide experiments include target antigen reduction, target messenger reduction and inhibition of transformed cell proliferation or viral replication. However, one should expect oligonucleotides to exhibit pleiotropic behaviour, as do all other drugs. In an animal oligonucleotides will necessarily bind to and dissociate from all macromolecules encountered in the blood, in tissues, on cell surfaces and within cellular compartments. Contrary to expectations, oligonucleotides designed to be complementary to certain transcripts have sometimes been found moderately effective in cell-free extracts, more effective in cell culture and most effective in animal models. If greater potency against standard endpoints is reported in mouse models than was observed in cell culture, critical examination must consider alternate modes of action in animals that may not apply in cell culture. This counterintuitive paradox will be examined, based on studies of Ha-ras expression in bladder cancer, Ki-ras expression in pancreatic cancer, erbB2 expression in ovarian cancer and c-myc expression in B cell lymphoma.

  17. Regioselective immobilization of short oligonucleotides to acrylic copolymer gels.

    PubMed Central

    Timofeev, E; Kochetkova, S V; Mirzabekov, A D; Florentiev, V L

    1996-01-01

    Four types of polyacrylamide or polydimethyl-acrylamide gels for regioselective (by immobilization at the 3' end) of short oligonucleotides have been designed for use in manufacturing oligonucleotide microchips. Two of these supports contain amino or aldehyde groups in the gel, allowing coupling with oligonucleotides bearing aldehyde or amino groups, respectively, in the presence of a reducing agent. The aldehyde gel support showed a higher immobilization efficiency relative to the amino gel. Of all reducing agents tested, the best results were obtained with a pyridine-borane complex. The other supports are based on an acrylamide gel activated with glutaraldehyde or a hydroxyalkyl-functionalized gel treated with mesyl chloride. The use of dimethylacrylamide instead of acrylamide allows subsequent gel modifications in organic solvents. All the immobilization methods are easy and simple to perform, give high and reproducible yields, allow long durations of storage of the activated support, and provide high stability of attachment and low non-specific binding. Although these gel supports have been developed for preparing oligonucleotide microchips, they may be used for other purposes as well. PMID:8774893

  18. Gene expression profiling in peanut using oligonucleotide microarrays

    USDA-ARS?s Scientific Manuscript database

    Transcriptome expression analysis in peanut to date has been limited to a relatively small set of genes and only recently have a moderately significant number of ESTs been released into the public domain. Utilization of these ESTs for the oligonucleotide microarrays provides a means to investigate l...

  19. Does phosphate enhance the natural attenuation of crude oil in groundwater under defined redox conditions?

    PubMed

    Ponsin, Violaine; Mouloubou, Olsen Raïnness; Prudent, Pascale; Höhener, Patrick

    2014-11-15

    After a crude oil spill caused by a broken pipeline in 2009 to a gravel aquifer in southern France, degradation processes under various redox conditions progressively established, but at rates that predict a long life-time of the source under natural attenuation after partial source removal. In this study, we aimed at identifying the rate-limiting factors for each redox condition, with special emphasis on phosphate as limiting nutrient. The study was conducted in laboratory microcosms assembled with material collected on site: sediments, water from monitoring wells, oil and microbial sludge. Redox conditions were promoted by adding electron acceptors (either oxygen, nitrate, limonite (FeO(OH)), cryptomelane (K(Mn(4+),Mn(2+))8O16), or sulfate). For each condition, the role of phosphate was studied by repeated additions for up to 290days. The results showed a very strong stimulation of aerobic and denitrifying rates of oil degradation by phosphate, provided that oxygen and nitrate were repeatedly supplied. Phosphate caused also a marked stimulation of methanogenic degradation, and a relatively small stimulation of metal reduction. These anaerobic processes started only after marked lag phases, and phosphate shortened the lag phase for methanogenic degradation. Degradation of aromatic and aliphatic hydrocarbons with less than 8 carbons, including benzene, was confirmed even under unstimulated conditions. It is concluded that degradation rates at the site are limited by both, availability of electron acceptors and availability of phosphate needed for promoting microbial growth. Copyright © 2014 Elsevier B.V. All rights reserved.

  20. Does phosphate enhance the natural attenuation of crude oil in groundwater under defined redox conditions?

    NASA Astrophysics Data System (ADS)

    Ponsin, Violaine; Mouloubou, Olsen Raïnness; Prudent, Pascale; Höhener, Patrick

    2014-11-01

    After a crude oil spill caused by a broken pipeline in 2009 to a gravel aquifer in southern France, degradation processes under various redox conditions progressively established, but at rates that predict a long life-time of the source under natural attenuation after partial source removal. In this study, we aimed at identifying the rate-limiting factors for each redox condition, with special emphasis on phosphate as limiting nutrient. The study was conducted in laboratory microcosms assembled with material collected on site: sediments, water from monitoring wells, oil and microbial sludge. Redox conditions were promoted by adding electron acceptors (either oxygen, nitrate, limonite (FeO(OH)), cryptomelane (K(Mn4 +,Mn2 +)8O16), or sulfate). For each condition, the role of phosphate was studied by repeated additions for up to 290 days. The results showed a very strong stimulation of aerobic and denitrifying rates of oil degradation by phosphate, provided that oxygen and nitrate were repeatedly supplied. Phosphate caused also a marked stimulation of methanogenic degradation, and a relatively small stimulation of metal reduction. These anaerobic processes started only after marked lag phases, and phosphate shortened the lag phase for methanogenic degradation. Degradation of aromatic and aliphatic hydrocarbons with less than 8 carbons, including benzene, was confirmed even under unstimulated conditions. It is concluded that degradation rates at the site are limited by both, availability of electron acceptors and availability of phosphate needed for promoting microbial growth.

  1. Pentopyranosyl Oligonucleotide Systems. Part 11: Systems with Shortened Backbones: D)-beta-Ribopyranosyl-(4 yields 3 )- and (L)-alpha - Lyxopyranosyl-(4 yields 3 )-oligonucleotides

    NASA Technical Reports Server (NTRS)

    Wippo, Harald; Reck, Folkert; Kudick, Rene; Ramaseshan, Mahesh; Ceulemans, Griet; Bolli, Martin; Krishnamurthy, Ramanarayanan; Eschenmoser, Albert

    2001-01-01

    The (L)-a-lyxopyranosyl-(4'yields 3')-oligonucleotide system-a member of a pentopyranosyl oligonucleotide family containing a shortened backbone-is capable of cooperative base-pairing and of cross-pairing with DNA and RNA. In contrast, corresponding (D)-beta-ribopyransoyl-(4' yields 3')-oligonucleotides do not show base-pairing under similar conditions. We conclude that oligonucleotide systems can violate the six-bonds-per-backbone-unit rule by having five bonds instead, if their vicinally bound phosphodiester bridges can assume an antiperiplanar conformation. An additional structural feature that seems relevant to the cross-pairing capability of the (L)-a-lyxopyranosyl-(4' yields 3')-oligonucleotide system is its (small) backbone/basepair axes inclination. An inclination which is similar to that in B-DNA seems to be a prerequisite for an oligonucleotide system s capability to cross-pair with DNA.

  2. [Prebiotic phosphate: a problem insoluble in water ? ].

    PubMed

    Morchio, Renzo; Traverso, Silvano

    2005-01-01

    It is well-known that in water phosphate readily reacts with calcium, precipitating as insoluble apatite. How phosphorus could have been available for prebiotic reactions is still an open problem. We suggest that phosphorus-containing compounds might have accumulated in a hydrophobic medium, since the absence of calcium ions would have prevented them from precipitating as apatite. Hydrophobic compounds may have been synthesized on the early Earth through the polymerization of methane or through Fischer-Tropsch-type reactions. Moreover, hydrophobic compounds would have been delivered to the early Earth by extraterrestrial infall. In previous articles (Morchio and Traverso [1999], Morchio et al. [2001]) we suggested that such hydrophobic material would have formed a hydrophobic layer on the surface of the sea, which would have provided an environment thermodynamically more suitable than water for the concentration and polymerization of organic molecules fundamental to life, particularly amino acids and (pyrimidine) bases. It may be hypothesized that elemental phosphorus or phosphorus-containing compounds (such as phosphite) deriving from volcanic eruptions would have ended up raining down into the hydrophobic layer, accumulating due to the absence of calcium ions, in an environment protected against hydrolysis. Phosphorus-containing compounds might have interacted with hydrophobic molecules in the layer giving rise to polymers. In particular, phosphite might have reacted with the hydrophobic amino acids, giving rise to phosphoamino acids, which, in turn, might have interacted with pyrimidine bases (relatively abundant in the layer) giving rise to peptides and oligonucleotide-like polymers. Indeed, it has been experimentally shown (Zhou et al. [1996]) that, in an anhydrous organic medium (pyridine), dialkilphosphite reacts with amino acids to form phosphoamino acids, which interact with pyrimidine nucleosides to give nucleotides, short oligonucleotides and phosphoryl

  3. Glycoclusters on oligonucleotide and PNA scaffolds: synthesis and applications.

    PubMed

    Spinelli, Nicolas; Defrancq, Eric; Morvan, François

    2013-06-07

    Conjugation of oligonucleotides (ONs) to a variety of reporter groups has been the subject of intensive research during the last decade. Conjugation is indeed of great interest because it can be used not only to improve the existing ONs properties but also to impart new ones. In this context tremendous efforts have been made to conjugate carbohydrate moieties to ONs. Indeed carbohydrates play an important role in biological processes such as signal transduction and cell adhesion through the recognition with sugar-binding proteins (i.e. lectins) located on the surface of cells. For this reason, carbohydrate-oligonucleotide conjugates (COCs) have been first developed for improving the poor cellular uptake or tissue specific delivery of ONs through receptor-mediated endocytosis. Besides the targeted ONs delivery, carbohydrate-oligonucleotide conjugates (COCs) are also evaluated in the context of carbohydrate biochips in which surface coating with carbohydrates is achieved by using the DNA-directed immobilization strategy (DDI). Peptide nucleic acids (PNAs) have also been extensively investigated as a surrogate of DNA for diverse applications. Therefore attachment of carbohydrate moieties to this class of molecules has been studied. The aforementioned applications of COCs require mimicking of the natural processes, in which the weak individual protein-carbohydrate binding is overcome by using multivalent interactions. This tutorial review focuses on the recent advances in carbohydrate-oligonucleotide conjugates and describes the major synthetic approaches available. In addition, an overview of applications that have been developed using various scaffolds allowing multivalent interactions is provided. Finally recent results on the use of peptide nucleic acids as oligonucleotides surrogate are described.

  4. In situ synthesis of oligonucleotide arrays by using soft lithography

    NASA Astrophysics Data System (ADS)

    Xiao, P. F.; He, N. Y.; Liu, Z. C.; He, Q. G.; Sun, X.; Lu, Z. H.

    2002-12-01

    This paper describes the in situ synthesis of oligonucleotide arrays on glass surfaces by using soft lithography. In this method, based on the standard phosphoramidite chemistry protocol, the coupling was achieved by the glass slide being printed with a set of polydimethylsiloxane (PDMS) microstamps, on which was spread nucleoside monomer and tetrazole mixed solution. The elastic characteristic of PDMS allowed it to make conformal contact with the glass slide in the printing coupling. With regard to the efficiency of the printing coupling, the hybridization microscope images of 20-mer oligonucleotide synthesized via the directly drip-dropped coupling and the contact coupling were compared; the fluorescence intensities of the two methods showed no significant differences. The coupling efficiency was also investigated via an end-labelled fluorescence nucleotide method and a stepwise yield of 97% was obtained. A high-quality, high spatial resolution and large-scale PDMS stamp, which was developed by integrating 168 different microstamps on one glass substrate for synthesizing oligonucleotide arrays. The stamp was modified to improve the surface wettability by plasma discharge treatments, so that microstamps could be used to fabricate oligonucleotide arrays. A motional printing head was developed to improve the contact effect of the glass slide with different microstamps. A higher boiling point solvent was used in the printing coupling to inhibit solvent volatilization and to maintain the consistency of reagents on different features of the microstamp. An effective method was used to eliminate residual reactive nucleosides on chips with small molecules containing a hydroxyl group. A specific oligonucleotide array of four probes both matched and mismatched with the target sequence was fabricated to identify the perfect match and mismatch sequences.

  5. PHOSPHATE MANAGEMENT: FY2010 RESULTS OF PHOSPHATE PRECIPITATION TESTS

    SciTech Connect

    Hay, M.; King, W.

    2011-04-04

    The Phosphate Management program seeks to develop treatment options for caustic phosphate solutions resulting from the caustic leaching of the bismuth phosphate sludge. The SRNL subtask investigated the precipitation of phosphate salts from caustic solutions through addition of fluoride and by crystallization. The scoping tests examined the: precipitation of phosphate by the addition of sodium fluoride to form the sodium fluorophosphate double salt, Na{sub 7}F(PO{sub 4}){sub 2} {center_dot} 19H{sub 2}O, crystallization of phosphate by reducing the temperature of saturated phosphate solutions, and combinations of precipitation and crystallization. A simplified leachate simulant was used in the study produced by dissolving sodium phosphate in 1 M to 3.5 M sodium hydroxide solutions. The results show that all three processes; precipitation with sodium fluoride, crystallization, and combined precipitation/crystallization can be effective for removing large amounts of phosphate from solution. The combined process of precipitation/crystallization showed >90% removal of phosphate at all hydroxide concentrations when cooling a non-saturated phosphate solution from 65 C to 25 C. Based on the measured solubility of sodium phosphate, pH adjustment/caustic addition will also remove large amounts of phosphate from solution (>80%). For all three processes, the phosphate concentration in the caustic solution must be managed to keep the phosphate from becoming too concentrated and thereby potentially forming a solid mass of sodium phosphate after an effective phosphate removal process.

  6. Mechanisms of electron acceptor utilization: Implications for simulating anaerobic biodegradation

    USGS Publications Warehouse

    Schreiber, M.E.; Carey, G.R.; Feinstein, D.T.; Bahr, J.M.

    2004-01-01

    Simulation of biodegradation reactions within a reactive transport framework requires information on mechanisms of terminal electron acceptor processes (TEAPs). In initial modeling efforts, TEAPs were approximated as occurring sequentially, with the highest energy-yielding electron acceptors (e.g. oxygen) consumed before those that yield less energy (e.g., sulfate). Within this framework in a steady state plume, sequential electron acceptor utilization would theoretically produce methane at an organic-rich source and Fe(II) further downgradient, resulting in a limited zone of Fe(II) and methane overlap. However, contaminant plumes often display much more extensive zones of overlapping Fe(II) and methane. The extensive overlap could be caused by several abiotic and biotic processes including vertical mixing of byproducts in long-screened monitoring wells, adsorption of Fe(II) onto aquifer solids, or microscale heterogeneity in Fe(III) concentrations. Alternatively, the overlap could be due to simultaneous utilization of terminal electron acceptors. Because biodegradation rates are controlled by TEAPs, evaluating the mechanisms of electron acceptor utilization is critical for improving prediction of contaminant mass losses due to biodegradation. Using BioRedox-MT3DMS, a three-dimensional, multi-species reactive transport code, we simulated the current configurations of a BTEX plume and TEAP zones at a petroleum- contaminated field site in Wisconsin. Simulation results suggest that BTEX mass loss due to biodegradation is greatest under oxygen-reducing conditions, with smaller but similar contributions to mass loss from biodegradation under Fe(III)-reducing, sulfate-reducing, and methanogenic conditions. Results of sensitivity calculations document that BTEX losses due to biodegradation are most sensitive to the age of the plume, while the shape of the BTEX plume is most sensitive to effective porosity and rate constants for biodegradation under Fe(III)-reducing and

  7. Specific discrimination of three pathogenic Salmonella enterica subsp. enterica serotypes by carB-based oligonucleotide microarray.

    PubMed

    Shin, Hwa Hui; Hwang, Byeong Hee; Seo, Jeong Hyun; Cha, Hyung Joon

    2014-01-01

    It is important to rapidly and selectively detect and analyze pathogenic Salmonella enterica subsp. enterica in contaminated food to reduce the morbidity and mortality of Salmonella infection and to guarantee food safety. In the present work, we developed an oligonucleotide microarray containing duplicate specific capture probes based on the carB gene, which encodes the carbamoyl phosphate synthetase large subunit, as a competent biomarker evaluated by genetic analysis to selectively and efficiently detect and discriminate three S. enterica subsp. enterica serotypes: Choleraesuis, Enteritidis, and Typhimurium. Using the developed microarray system, three serotype targets were successfully analyzed in a range as low as 1.6 to 3.1 nM and were specifically discriminated from each other without nonspecific signals. In addition, the constructed microarray did not have cross-reactivity with other common pathogenic bacteria and even enabled the clear discrimination of the target Salmonella serotype from a bacterial mixture. Therefore, these results demonstrated that our novel carB-based oligonucleotide microarray can be used as an effective and specific detection system for S. enterica subsp. enterica serotypes.

  8. Specific Discrimination of Three Pathogenic Salmonella enterica subsp. enterica Serotypes by carB-Based Oligonucleotide Microarray

    PubMed Central

    Shin, Hwa Hui; Hwang, Byeong Hee; Seo, Jeong Hyun

    2014-01-01

    It is important to rapidly and selectively detect and analyze pathogenic Salmonella enterica subsp. enterica in contaminated food to reduce the morbidity and mortality of Salmonella infection and to guarantee food safety. In the present work, we developed an oligonucleotide microarray containing duplicate specific capture probes based on the carB gene, which encodes the carbamoyl phosphate synthetase large subunit, as a competent biomarker evaluated by genetic analysis to selectively and efficiently detect and discriminate three S. enterica subsp. enterica serotypes: Choleraesuis, Enteritidis, and Typhimurium. Using the developed microarray system, three serotype targets were successfully analyzed in a range as low as 1.6 to 3.1 nM and were specifically discriminated from each other without nonspecific signals. In addition, the constructed microarray did not have cross-reactivity with other common pathogenic bacteria and even enabled the clear discrimination of the target Salmonella serotype from a bacterial mixture. Therefore, these results demonstrated that our novel carB-based oligonucleotide microarray can be used as an effective and specific detection system for S. enterica subsp. enterica serotypes. PMID:24185846

  9. Oligonucleotide-Mediated Genome Editing Provides Precision and Function to Engineered Nucleases and Antibiotics in Plants[OPEN

    PubMed Central

    Sauer, Noel J.; Narváez-Vásquez, Javier; Mozoruk, Jerry; Miller, Ryan B.; Warburg, Zachary J.; Woodward, Melody J.; Mihiret, Yohannes A.; Lincoln, Tracey A.; Segami, Rosa E.; Sanders, Steven L.; Walker, Keith A.; Beetham, Peter R.; Schöpke, Christian R.; Gocal, Greg F.W.

    2016-01-01

    Here, we report a form of oligonucleotide-directed mutagenesis for precision genome editing in plants that uses single-stranded oligonucleotides (ssODNs) to precisely and efficiently generate genome edits at DNA strand lesions made by DNA double strand break reagents. Employing a transgene model in Arabidopsis (Arabidopsis thaliana), we obtained a high frequency of precise targeted genome edits when ssODNs were introduced into protoplasts that were pretreated with the glycopeptide antibiotic phleomycin, a nonspecific DNA double strand breaker. Simultaneous delivery of ssODN and a site-specific DNA double strand breaker, either transcription activator-like effector nucleases (TALENs) or clustered, regularly interspaced, short palindromic repeats (CRISPR/Cas9), resulted in a much greater targeted genome-editing frequency compared with treatment with DNA double strand-breaking reagents alone. Using this site-specific approach, we applied the combination of ssODN and CRISPR/Cas9 to develop an herbicide tolerance trait in flax (Linum usitatissimum) by precisely editing the 5′-ENOLPYRUVYLSHIKIMATE-3-PHOSPHATE SYNTHASE (EPSPS) genes. EPSPS edits occurred at sufficient frequency that we could regenerate whole plants from edited protoplasts without employing selection. These plants were subsequently determined to be tolerant to the herbicide glyphosate in greenhouse spray tests. Progeny (C1) of these plants showed the expected Mendelian segregation of EPSPS edits. Our findings show the enormous potential of using a genome-editing platform for precise, reliable trait development in crop plants. PMID:26864017

  10. Cascade energy transfer and tunable emission from nanosheet hybrids: locating acceptor molecules through chiral doping.

    PubMed

    Goudappagouda; Wakchaure, Vivek Chandrakant; Ranjeesh, Kayaramkodath Chandran; Abhai, Chalona Antony Ralph; Babu, Sukumaran Santhosh

    2017-06-27

    Light harvesting donor-acceptor assemblies are indispensable to efficiently tap photons. In an attempt to improve the light harvesting efficiency of an acceptor doped assembly, we design and synthesize a donor-acceptor-donor triad which exhibits an exceptional intramolecular energy transfer with excellent efficiency. Moreover, a facile cascade energy transfer (energy funnelling) is observed in the presence of a series of second acceptors (63-91% efficiency) with tunable emission colours. Self-assembled nanosheets formed by the triad in the presence of acceptors exhibit cascade energy transfer assisted tunable emission. In addition, use of chiral acceptors induces chirality to the triad and results in the formation of chiral nanosheets along with cascade energy transfer. Here chiral induction, nanosheet formation and cascade energy transfer in the presence of chiral acceptors are used as tools to probe the intercalation of acceptor molecules in the donor scaffold.

  11. Oligonucleotide Immobilization and Hybridization on Aldehyde-Functionalized Poly(2-hydroxyethyl methacrylate) Brushes.

    PubMed

    Bilgic, Tugba; Klok, Harm-Anton

    2015-11-09

    DNA biosensing requires high oligonucleotide binding capacity interface chemistries that can be tuned to maximize probe presentation as well as hybridization efficiency. This contribution investigates the feasibility of aldehyde-functionalized poly(2-hydroxyethyl methacrylate) (PHEMA) brush-based interfaces for oligonucleotide binding and hybridization. These polymer brushes, which allow covalent immobilization of oligonucleotides, are prepared by surface-initiated atom transfer radical polymerization (SI-ATRP) of HEMA followed by a postpolymerization oxidation step to generate side chain aldehyde groups. A series of polymer brushes covering a range of film thicknesses and grafting densities was investigated with regard to their oligonucleotide binding capacity as well as their ability to support oligonucleotide hybridization. Densely grafted brushes were found to have probe oligonucleotide binding capacities of up to ∼30 pmol/cm(2). Increasing the thickness of these densely grafted brush films, however, resulted in a decrease in the oligonucleotide binding capacity. Less densely grafted brushes possess binding capacities of ∼10 pmol/cm(2), which did not significantly depend on film thickness. The oligonucleotide hybridization efficiencies, however, were highest (93%) on those brushes that present the lowest surface concentration of the probe oligonucleotide. These results highlight the importance of optimizing the probe oligonucleotide surface concentration and binding interface chemistry. The versatility and tunability of the PHEMA-based brushes presented herein makes these films a very attractive platform for the immobilization and hybridization of oligonucleotides.

  12. Electrophoresis for genotyping: temporal thermal gradient gel electrophoresis for profiling of oligonucleotide dissociation.

    PubMed Central

    Day, I N; O'Dell, S D; Cash, I D; Humphries, S E; Weavind, G P

    1995-01-01

    Traditional use of an oligonucleotide probe to determine genotype depends on perfect base pairing to a single-stranded target which is stable to a higher temperature than when imperfect binding occurs due to a mismatch in the target sequence. Bound oligonucleotide is detected at a predetermined single temperature 'snapshot' of the melting profile, allowing the distinction of perfect from imperfect base pairing. In heterozygotes, the presence of the alternative sequence must be verified with a second oligonucleotide complementary to the variant. Here we describe a system of real-time variable temperature electrophoresis during which the oligonucleotide dissociates from its target. In 20% polyacrylamide the target strand has minimal mobility and released oligonucleotide migrates extremely quickly so that the 'freed' rather than the 'bound' is displayed. The full profile of oligonucleotide dissociation during gel electrophoresis is represented along the gel track, and a single oligonucleotide is sufficient to confirm heterozygosity, since the profile displays two separate peaks. Resolution is great, with use of short track lengths enabling analysis of dense arrays of samples. Each gel track can contain a different target or oligonucleotide and the temperature gradient can accommodate oligonucleotides of different melting temperatures. This provides a convenient system to examine the interaction of many different oligonucleotides and target sequences simultaneously and requires no prior knowledge of the mutant sequence(s) nor of oligonucleotide melting temperatures. The application of the technique is described for screening of a hotspot for mutations in the LDL receptor gene in patients with familial hypercholesterolaemia. Images PMID:7630718

  13. Acute phosphate nephropathy.

    PubMed

    Monfared, Ali; Habibzadeh, Seyed Mahmoud; Mesbah, Seyed Alireza

    2014-05-01

    We present acute phosphate nephropathy in a 28-year-old man, which was developed after a car accident due to rhabdomyolysis. Treatment of acute kidney injury was done with administration of sodium bicarbonate.

  14. Phosphate Mines, Jordan

    NASA Image and Video Library

    2008-04-21

    Jordan leading industry and export commodities are phosphate and potash, ranked in the top three in the world. These are used to make fertilizer. This image was acquired by NASA Terra satellite on September 17, 2005.

  15. Metal-phosphate binders

    DOEpatents

    Howe, Beth Ann [Lewistown, IL; Chaps-Cabrera, Jesus Guadalupe [Coahuila, MX

    2009-05-12

    A metal-phosphate binder is provided. The binder may include an aqueous phosphoric acid solution, a metal-cation donor including a metal other than aluminum, an aluminum-cation donor, and a non-carbohydrate electron donor.

  16. Cross-conjugated chromophores: synthesis of iso-polydiacetylenes with Donor/Acceptor substitution

    PubMed

    Ciulei; Tykwinski

    2000-11-16

    The iterative construction of cross-conjugated donor (D), acceptor (A), and donor-acceptor (D-A) substituted iso-polydiacetylene (iso-PDA) oligomers has been achieved utilizing palladium-catalyzed cross-coupling techniques. Structure-property relationships for these compounds have been analyzed for cross-conjugated pi-electronic communication as a result of contributions from donor, acceptor, or donor-acceptor functionalization.

  17. Phosphate control in dialysis

    PubMed Central

    Cupisti, Adamasco; Gallieni, Maurizio; Rizzo, Maria Antonietta; Caria, Stefania; Meola, Mario; Bolasco, Piergiorgio

    2013-01-01

    Prevention and correction of hyperphosphatemia is a major goal of chronic kidney disease–mineral and bone disorder (CKD–MBD) management, achievable through avoidance of a positive phosphate balance. To this aim, optimal dialysis removal, careful use of phosphate binders, and dietary phosphate control are needed to optimize the control of phosphate balance in well-nourished patients on a standard three-times-a-week hemodialysis schedule. Using a mixed diffusive–convective hemodialysis tecniques, and increasing the number and/or the duration of dialysis tecniques are all measures able to enhance phosphorus (P) mass removal through dialysis. However, dialytic removal does not equal the high P intake linked to the high dietary protein requirement of dialysis patients; hence, the use of intestinal P binders is mandatory to reduce P net intestinal absorption. Unfortunately, even a large dose of P binders is able to bind approximately 200–300 mg of P on a daily basis, so it is evident that their efficacy is limited in the case of an uncontrolled dietary P load. Hence, limitation of dietary P intake is needed to reach the goal of neutral phosphate balance in dialysis, coupled to an adequate protein intake. To this aim, patients should be informed and educated to avoid foods that are naturally rich in phosphate and also processed food with P-containing preservatives. In addition, patients should preferentially choose food with a low P-to-protein ratio. For example, patients could choose egg white or protein from a vegetable source. Finally, boiling should be the preferred cooking procedure, because it induces food demineralization, including phosphate loss. The integrated approach outlined in this article should be actively adapted as a therapeutic alliance by clinicians, dieticians, and patients for an effective control of phosphate balance in dialysis patients. PMID:24133374

  18. Phosphate control in dialysis.

    PubMed

    Cupisti, Adamasco; Gallieni, Maurizio; Rizzo, Maria Antonietta; Caria, Stefania; Meola, Mario; Bolasco, Piergiorgio

    2013-10-04

    Prevention and correction of hyperphosphatemia is a major goal of chronic kidney disease-mineral and bone disorder (CKD-MBD) management, achievable through avoidance of a positive phosphate balance. To this aim, optimal dialysis removal, careful use of phosphate binders, and dietary phosphate control are needed to optimize the control of phosphate balance in well-nourished patients on a standard three-times-a-week hemodialysis schedule. Using a mixed diffusive-convective hemodialysis tecniques, and increasing the number and/or the duration of dialysis tecniques are all measures able to enhance phosphorus (P) mass removal through dialysis. However, dialytic removal does not equal the high P intake linked to the high dietary protein requirement of dialysis patients; hence, the use of intestinal P binders is mandatory to reduce P net intestinal absorption. Unfortunately, even a large dose of P binders is able to bind approximately 200-300 mg of P on a daily basis, so it is evident that their efficacy is limited in the case of an uncontrolled dietary P load. Hence, limitation of dietary P intake is needed to reach the goal of neutral phosphate balance in dialysis, coupled to an adequate protein intake. To this aim, patients should be informed and educated to avoid foods that are naturally rich in phosphate and also processed food with P-containing preservatives. In addition, patients should preferentially choose food with a low P-to-protein ratio. For example, patients could choose egg white or protein from a vegetable source. Finally, boiling should be the preferred cooking procedure, because it induces food demineralization, including phosphate loss. The integrated approach outlined in this article should be actively adapted as a therapeutic alliance by clinicians, dieticians, and patients for an effective control of phosphate balance in dialysis patients.

  19. Fused Nonacyclic Electron Acceptors for Efficient Polymer Solar Cells.

    PubMed

    Dai, Shuixing; Zhao, Fuwen; Zhang, Qianqian; Lau, Tsz-Ki; Li, Tengfei; Liu, Kuan; Ling, Qidan; Wang, Chunru; Lu, Xinhui; You, Wei; Zhan, Xiaowei

    2017-01-25

    We design and synthesize four fused-ring electron acceptors based on 6,6,12,12-tetrakis(4-hexylphenyl)-indacenobis(dithieno[3,2-b;2',3'-d]thiophene) as the electron-rich unit and 1,1-dicyanomethylene-3-indanones with 0-2 fluorine substituents as the electron-deficient units. These four molecules exhibit broad (550-850 nm) and strong absorption with high extinction coefficients of (2.1-2.5) × 10(5) M(-1) cm(-1). Fluorine substitution downshifts the LUMO energy level, red-shifts the absorption spectrum, and enhances electron mobility. The polymer solar cells based on the fluorinated electron acceptors exhibit power conversion efficiencies as high as 11.5%, much higher than that of their nonfluorinated counterpart (7.7%). We investigate the effects of the fluorine atom number and position on electronic properties, charge transport, film morphology, and photovoltaic properties.

  20. Defect Donor and Acceptor in GaN

    SciTech Connect

    Look, D.C.; Reynolds, D.C.; Hemsky, J.W.; Sizelove, J.R.; Jones, R.L.

    1997-09-01

    High-energy (0.7{endash}1MeV) electron irradiation in GaN grown on sapphire produces shallow donors and deep or shallow acceptors at equal rates, 1{plus_minus}0.2 cm{sup {minus}1}. The data, in conjunction with theory, are consistent only with the shallow donor being the N vacancy, and the acceptor the N interstitial. The N-vacancy donor energy is 64{plus_minus}10 meV, much larger than the value of 18meV found for the residual donor (probably Si) in this material. The Hall-effect measurements also reveal a degenerate n -type layer at the GaN/sapphire interface which must be accounted for to get the proper donor activation energy. {copyright} {ital 1997} {ital The American Physical Society}

  1. An organic donor/acceptor lateral superlattice at the nanoscale.

    PubMed

    Otero, Roberto; Ecija, David; Fernandez, Gustavo; Gallego, José María; Sanchez, Luis; Martín, Nazario; Miranda, Rodolfo

    2007-09-01

    A precise control of the nanometer-scale morphology in systems containing mixtures of donor/acceptor molecules is a key factor to improve the efficiency of organic photovoltaic devices. Here we report on a scanning tunneling microscopy study of the first stages of growth of 2-[9-(1,3-dithiol-2-ylidene)anthracen-10(9H)-ylidene]-1,3-dithiole, as electron donor, and phenyl-C61-butyric acid methyl ester, as electron acceptor, on a Au(111) substrate under ultrahigh vacuum conditions. Due to differences in bonding strength with the substrate and different interactions with the Au(111) herringbone surface reconstruction, mixed thin films spontaneously segregate into a lateral superlattice of interdigitated nanoscale stripes with a characteristic width of about 10-20 nm, a morphology that has been predicted to optimize the efficiency of organic solar cells.

  2. Free Carrier Generation in Organic Photovoltaic Bulk Heterojunctions of Conjugated Polymers with Molecular Acceptors: Planar versus Spherical Acceptors

    SciTech Connect

    Nardes, Alexandre M.; Ferguson, Andrew J.; Wolfer, Pascal; Gui, Kurt; Burn, Paul L.; Meredith, Paul; Kopidakis, Nikos

    2014-03-05

    We present a comparative study of the photophysical performance of the prototypical fullerene derivative PC61BM with a planar small-molecule acceptor in an organic photovoltaic device. The small-molecule planar acceptor is 2-[{7-(9,9-di-n-propyl-9H-fluoren-2-yl)benzo[c][1,2,5]thiadiazol-4-yl}methylene]malononitrile, termed K12. We discuss photoinduced free charge-carrier generation and transport in blends of PC61BM or K12 with poly(3-n-hexylthiophene) (P3HT), surveying literature results for P3HT:PC61BM and presenting new results on P3HT:K12. For both systems we also review previous work on film structure and correlate the structural and photophysical results. In both cases, a disordered mixed phase is formed between P3HT and the acceptor, although the photophysical properties of this mixed phase differ markedly for PC61BM and K12. In the case of PC61BM the mixed phase acts as a free carrier generation region that can efficiently shuttle carriers to the pure polymer and fullerene domains. As a result, the vast majority of excitons quenched in P3HT:PC61BM blends yield free carriers detected by the contactless time-resolved microwave conductivity (TRMC) method. In contrast, approximately 85 % of the excitons quenched in P3HT:K12 do not result in free carriers over the nanosecond timescale of the TRMC experiment. We attribute this to poor electron-transport properties in the mixed P3HT:K12 phase. Here, we propose that the observed differences can be traced to the respective shapes of PC61BM and K12: the three-dimensional nature of the fullerene cage facilitates coupling between PC61BM molecules irrespective of their relative orientation, whereas for K12 strong electronic coupling is only expected for molecules oriented with their π systems parallel to each other. Comparison between the eutectic compositions of the P3HT:PC61BM and P3HT:K12 shows that the former contains enough fullerene to form a percolation pathway for electrons, whereas the latter contains a sub

  3. Current advances in fused tetrathiafulvalene donor-acceptor systems.

    PubMed

    Bergkamp, Jesse J; Decurtins, Silvio; Liu, Shi-Xia

    2015-02-21

    Electron donor (D) and acceptor (A) systems have been studied extensively. Among them, fused D-A systems have attracted much attention during the past decades. Herein, we will present the evolution of tetrathiafulvalene (TTF) fused D-A systems and their potential applications in areas such as solar cells, OFETs, molecular wires and optoelectronics just to name a few. The synthesis and electrochemical, photophysical and intrinsic properties of fused D-A systems will be described as well.

  4. 2012 ELECTRON DONOR-ACCEPTOR INTERACTIONS GORDON RESEARCH CONFERENCE, AUGUST 5-10, 2012

    SciTech Connect

    McCusker, James

    2012-08-10

    The upcoming incarnation of the Gordon Research Conference on Electron Donor Acceptor Interactions will feature sessions on classic topics including proton-coupled electron transfer, dye-sensitized solar cells, and biological electron transfer, as well as emerging areas such as quantum coherence effects in donor-acceptor interactions, spintronics, and the application of donor-acceptor interactions in chemical synthesis.

  5. Fullerene derivatives as electron acceptors for organic photovoltaic cells.

    PubMed

    Mi, Dongbo; Kim, Ji-Hoon; Kim, Hee Un; Xu, Fei; Hwang, Do-Hoon

    2014-02-01

    Energy is currently one of the most important problems humankind faces. Depletion of traditional energy sources such as coal and oil results in the need to develop new ways to create, transport, and store electricity. In this regard, the sun, which can be considered as a giant nuclear fusion reactor, represents the most powerful source of energy available in our solar system. For photovoltaic cells to gain widespread acceptance as a source of clean and renewable energy, the cost per watt of solar energy must be decreased. Organic photovoltaic cells, developed in the past two decades, have potential as alternatives to traditional inorganic semiconductor photovoltaic cells, which suffer from high environmental pollution and energy consumption during production. Organic photovoltaic cells are composed of a blended film of a conjugated-polymer donor and a soluble fullerene-derivative acceptor sandwiched between a poly(3,4-ethylenedioxythiophene):poly(styrenesulfonate)-coated indium tin oxide positive electrode and a low-work-function metal negative electrode. Considerable research efforts aim at designing and synthesizing novel fullerene derivatives as electron acceptors with up-raised lowest unoccupied molecular orbital energy, better light-harvesting properties, higher electron mobility, and better miscibility with the polymer donor for improving the power conversion efficiency of the organic photovoltaic cells. In this paper, we systematically review novel fullerene acceptors synthesized through chemical modification for enhancing the photovoltaic performance by increasing open-circuit voltage, short-circuit current, and fill factor, which determine the performance of organic photovoltaic cells.

  6. Dimethyl sulfoxide as an electron acceptor for anaerobic growth.

    PubMed

    Zinder, S H; Brock, T D

    1978-01-23

    The isolation from lake mud of a bacterium which can use dimethyl sulfoxide (DMSO) as an electron acceptor for growth is described. The isolate, called strain DL-1, was a small, gram negative, non-motile spiral. The sole product of DMSO reduction was dimethyl sulfide (DMS). Other electron acceptors used by the isolate included sulfite, thiosulfate, elemental sulfur, methionine sulfoxide, tetramethylene sulfoxide, nitrate, and oxygen (microaerophilically). Sulfate was not reduced and could not even be assimilated. Lactate or succinate could serve as electron donors, with acetate as the main product. Hydrogen could be used as an electron donor if acetate was present in the medium as a carbon source. The organism has a c-type cytochrome, and most likely uses electron transport phosphorylation during DMSO reduction. Cultures of Desulfovibrio sp., Escherichia coli, Pseudomonas aeruginosa, and Proteus vulgaris were tested for growth using DMSO as an electron acceptor, and only the Proteus strain grew. Both Proteus and strain DL-1 are versatile at coupling reductions with energy generation. There is a marked resemblance between strain DL-1 and the recently described sulfur-reducing spirillum of Wolfe and Pfennig.

  7. Design directed self-assembly of donor-acceptor polymers.

    PubMed

    Marszalek, Tomasz; Li, Mengmeng; Pisula, Wojciech

    2016-09-21

    Donor-acceptor polymers with an alternating array of donor and acceptor moieties have gained particular attention during recent years as active components of organic electronics. By implementation of suitable subunits within the conjugated backbone, these polymers can be made either electron-deficient or -rich. Additionally, their band gap and light absorption can be precisely tuned for improved light-harvesting in solar cells. On the other hand, the polymer design can also be modified to encode the desired supramolecular self-assembly in the solid-state that is essential for an unhindered transport of charge carriers. This review focuses on three major factors playing a role in the assembly of donor-acceptor polymers on surfaces which are (1) nature, geometry and substitution position of solubilizing alkyl side chains, (2) shape of the conjugated polymer defined by the backbone curvature, and (3) molecular weight which determines the conjugation length of the polymer. These factors adjust the fine balance between attractive and repulsive forces and ensure a close polymer packing important for an efficient charge hopping between neighboring chains. On the microscopic scale, an appropriate domain formation with a low density of structural defects in the solution deposited thin film is crucial for the charge transport. The charge carrier transport through such thin films is characterized by field-effect transistors as basic electronic elements.

  8. Engineered oligosaccharyltransferases with greatly relaxed acceptor site specificity

    PubMed Central

    Ollis, Anne A.; Zhang, Sheng; Fisher, Adam C.; DeLisa, Matthew P.

    2015-01-01

    The Campylobacter jejuni protein glycosylation locus (pgl) encodes machinery for asparagine-linked (N-linked) glycosylation and serves as the archetype for bacterial N-glycosylation. This machinery has been functionally transferred into Escherichia coli, thereby enabling convenient mechanistic dissection of the N-glycosylation process in this genetically tractable host. Here, we sought to identify sequence determinants in the oligosaccharyltransferase PglB that restrict its specificity to only those glycan acceptor sites containing a negatively charged residue at the −2 position relative to asparagine. This involved creation of a genetic assay named glycoSNAP (glycosylation of secreted N-linked acceptor proteins) that facilitates high-throughput screening of glycophenotypes in E. coli. Using this assay, we isolated several C. jejuni PglB variants that were capable of glycosylating an array of noncanonical acceptor sequences including one in a eukaryotic N-glycoprotein. Collectively, these results underscore the utility of glycoSNAP for shedding light on poorly understood aspects of N-glycosylation and for engineering designer N-glycosylation biocatalysts. PMID:25129029

  9. Income-generating activities for family planning acceptors.

    PubMed

    1989-07-01

    The Income Generating Activities program for Family Planning Acceptors was introduced in Indonesia in 1979. Capital input by the Indonesian National Family Planning Coordination Board and the UN Fund for Population Activities was used to set up small businesses by family planning acceptors. In 2 years, when the businesses become self-sufficient, the loans are repaid, and the money is used to set up new family planning acceptors in business. The program strengthens family planning acceptance, improves the status of women, and enhances community self-reliance. The increase in household income generated by the program raises the standards of child nutrition, encourages reliance on the survival of children, and decreases the value of large families. Approximately 18,000 Family Planning-Income Generating Activities groups are now functioning all over Indonesia, with financial assistance from the central and local governments, the World Bank, the US Agency for International Development, the UN Population Fund, the Government of the Netherlands, and the Government of Australia through the Association of South East Asian Nations.

  10. Designing of a novel dextransucrase efficient in acceptor reactions.

    PubMed

    Parlak, Mahmut; Ustek, Duran; Tanriseven, Aziz

    2014-03-11

    Dextransucrase is produced by Leuconostoc, Streptococcus and Lactobacillus Species. The enzyme synthesizes dextran and acceptor products some of which act as prebiotics that are increasingly used in such industries as food, medicine, and cosmetics. B-512F Leuconostoc mesenteroides dextransucrase (DSR-S) is the preferred enzyme in commercial production of dextran and prebiotics. In the present work, a novel dextransucrase which is efficient in prebiotics production was designed. The enzyme was produced at optimal conditions in Escherichia coli by truncation and fusion to glutathione S-transferase (GST) in the gene from Leuconostoc mesenteroides B-512 FMC. The novel enzyme (MW: 119 kDa) was active and carried out dextran biosynthesis and acceptor reactions effectively. The novel dextransucrase (fTDSR-S) was produced by truncating signal, variable, and the glucan-binding regions in the gene and fusion of gst gene at the 5' end. fTDSR-S was characterized in detail and compared to the DSR-S. Truncation and fusion resulted in an increase in fTDSR-S biosynthesis in E. coli BL21 (DE3) by 35 fold. fTDSR-S leads to production of dextran as well as increased acceptor reactions. Due to GST fusion, it was possible to immobilize fTDSR-S covalently onto Eupergit C successfully. It was also found that the size of the active site of dextransucrase is 49 amino acids shorter than that reported previously in the literature. Copyright © 2014 Elsevier Ltd. All rights reserved.

  11. Oligonucleotide probes containing pyrimidine analogs reveal diminished hydrogen bonding capacity of the DNA adduct O⁶-methyl-G in DNA duplexes.

    PubMed

    Angelov, Todor; Dahlmann, Heidi A; Sturla, Shana J

    2013-10-15

    Oligonucleotide hybridization probes containing nucleoside analogs offer a potential strategy for binding specific DNA sequences that bear pro-mutagenic O(6)-G alkylation adducts. To optimize O(6)-Me-G-targeting probes, an understanding of how base pairs with O(6)-Me-G are stabilized is needed. In this study, we compared the ability of O(6)-Me-G and G to hydrogen bond with three pyrimidine-like nucleobases (Z, 4-thio-U, and 3-deaza-C) bearing varied hydrogen bond donor and acceptor groups. We found that duplexes containing the pyrimidine analog nucleoside:G pairs were more thermodynamically stable than those containing pyrimidine analog nucleoside:O(6)-alkyl-G pairs. Thus, hydrogen bonding alone was not sufficient to impart selectivity to probes that target O(6)-G alkylation adducts in DNA.

  12. Inhibition of HTLV-III by exogenous oligonucleotides

    SciTech Connect

    Goodchild, J.; Zamecnik, P.C.

    1989-02-21

    A method is described of detecting the presence of HTLV-III virus in a sample by demonstrating inhibition of replication of the virus in cells which are normally killed by the HTLV-III virus after the cells have been (a) combined with the sample and an oligonucleotide complementary to at least one highly conserved region of the HTLV-III genome necessary for HTLV-III replication and capable of hybridizing with at least the highly conserved region, the highly conserved region of the HTLV-III genome being a nucleotide sequence present in the genomes of HTLV-III isolates and the oligonucleotide complementary to at least one highly conserved region of the HTLV-III genome necessary for HTLV-III replication being complementary to a region of the HTLV-III genome.

  13. Structure and dynamics of oligonucleotides in the gas phase.

    PubMed

    Arcella, Annalisa; Dreyer, Jens; Ippoliti, Emiliano; Ivani, Ivan; Portella, Guillem; Gabelica, Valérie; Carloni, Paolo; Orozco, Modesto

    2015-01-07

    By combining ion-mobility mass spectrometry experiments with sub-millisecond classical and ab initio molecular dynamics we fully characterized, for the first time, the dynamic ensemble of a model nucleic acid in the gas phase under electrospray ionization conditions. The studied oligonucleotide unfolds upon vaporization, loses memory of the solution structure, and explores true gas-phase conformational space. Contrary to our original expectations, the oligonucleotide shows very rich dynamics in three different timescales (multi-picosecond, nanosecond, and sub-millisecond). The shorter timescale dynamics has a quantum mechanical nature and leads to changes in the covalent structure, whereas the other two are of classical origin. Overall, this study suggests that a re-evaluation on our view of the physics of nucleic acids upon vaporization is needed. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. Detection of high-resolution Raman spectra in short oligonucleotides

    NASA Astrophysics Data System (ADS)

    Bairamov, F. B.; Poloskin, E. D.; Chernev, A. L.; Toporov, V. V.; Dubina, M. V.; Lahderanta, E.; Lipsanen, H.; Bairamov, B. Kh.

    2014-06-01

    High-resolution spectra of single-chain short oligonucleotides d(20G, 20T), where d is a deoxyribonucleoside, G is guanine, and T is thymine, have been obtained by the highly sensitive nonresonant Raman scattering method of biomacromolecules. In addition to their own multifunctional significance, short oligonucleotides attract interest as ideal model objects for revealing poorly studied peculiarities of tertiary and quaternary structures of DNA. The detection of narrow spectral lines has allowed determining the characteristic time scale and makes it possible to study the dynamics of fast relaxation processes of vibrational motions of atoms in biomacromolecules. It has been found that the FWHM of the narrowest 1355.4 cm-1 spectral line attributed to the vibrations of the dT methyl group is 14.6 cm-1. The corresponding lifetime is 0.38 ps.

  15. H5 avian influenza virus pathotyping using oligonucleotide microarray.

    PubMed

    Wang, Lih-Chiann; Huang, Dean; Cheng, Ming-Chu; Lee, Shu-Hwae; Wang, Ching-Ho

    2015-08-01

    The H5 avian influenza virus subtype has huge impact on the poultry industry. Rapid diagnosis and accurate identification of the highly pathogenic avian influenza virus and low-pathogenicity avian influenza virus is essential, especially during H5 outbreaks and surveillance. To this end, a novel and rapid strategy for H5 virus molecular pathotyping is presented. The specific hemagglutinin gene of the H5 virus and the basic amino acid number of the motif at the hemagglutinin precursor protein cleavage site were detected using oligonucleotide microarray. Highly pathogenic and low-pathogenicity avian influenza viruses in Taiwan were differentiated using 13 microarray probes with the naked eye. The detection limit reached 3.4 viral RNA copies, 1000 times more sensitive than reverse transcription polymerase chain reaction. Thus, the oligonucleotide microarray would provide an alternative H5 pathogenicity determination using the naked eye for laboratories lacking facilities. Copyright © 2015 Elsevier B.V. All rights reserved.

  16. Palladium-catalyzed modification of unprotected nucleosides, nucleotides, and oligonucleotides.

    PubMed

    Shaughnessy, Kevin H

    2015-05-22

    Synthetic modification of nucleoside structures provides access to molecules of interest as pharmaceuticals, biochemical probes, and models to study diseases. Covalent modification of the purine and pyrimidine bases is an important strategy for the synthesis of these adducts. Palladium-catalyzed cross-coupling is a powerful method to attach groups to the base heterocycles through the formation of new carbon-carbon and carbon-heteroatom bonds. In this review, approaches to palladium-catalyzed modification of unprotected nucleosides, nucleotides, and oligonucleotides are reviewed. Polar reaction media, such as water or polar aprotic solvents, allow reactions to be performed directly on the hydrophilic nucleosides and nucleotides without the need to use protecting groups. Homogeneous aqueous-phase coupling reactions catalyzed by palladium complexes of water-soluble ligands provide a general approach to the synthesis of modified nucleosides, nucleotides, and oligonucleotides.

  17. Mechanism of Oligonucleotide Uptake by Cells: Involvement of Specific receptors?

    NASA Astrophysics Data System (ADS)

    Yakubov, Leonid A.; Deeva, Elena A.; Zarytova, Valentina F.; Ivanova, Eugenia M.; Ryte, Antonina S.; Yurchenko, Lyudmila V.; Vlassov, Valentin V.

    1989-09-01

    We have investigated the interaction of oligonucleotides and their alkylating derivatives with mammalian cells. In experiments with L929 mouse fibroblast and Krebs 2 ascites carcinoma cells, it was found that cellular uptake of oligodeoxynucleotide derivatives is achieved by an endocytosis mechanism. Uptake is considerably more efficient at low oligomer concentration (< 1 μ M), because at this concentration a significant percentage of the total oligomer pool is absorbed on the cell surface and internalized by a more efficient absorptive endocytosis process. Two modified proteins were detected in mouse fibroblasts that were treated with the alkylating oligonucleotide derivatives. The binding of the oligomers to the proteins is inhibited by other oligodeoxynucleotides, single- and double-stranded DNA, and RNA. The polyanions heparin and chondroitin sulfates A and B do not inhibit binding. These observations suggest the involvement of specific receptor proteins in binding of oligomers to mammalian cells.

  18. Recursive DNA Assembly Using Protected Oligonucleotide Duplex Assisted Cloning (PODAC).

    PubMed

    Van Hove, Bob; Guidi, Chiara; De Wannemaeker, Lien; Maertens, Jo; De Mey, Marjan

    2017-06-16

    A problem rarely tackled by current DNA assembly methods is the issue of cloning additional parts into an already assembled construct. Costly PCR workflows are often hindered by repeated sequences, and restriction based strategies impose design constraints for each enzyme used. Here we present Protected Oligonucleotide Duplex Assisted Cloning (PODAC), a novel technique that makes use of an oligonucleotide duplex for iterative Golden Gate cloning using only one restriction enzyme. Methylated bases confer protection from digestion during the assembly reaction and are removed during replication in vivo, unveiling a new cloning site in the process. We used this method to efficiently and accurately assemble a biosynthetic pathway and demonstrated its robustness toward sequence repeats by constructing artificial CRISPR arrays. As PODAC is readily amenable to standardization, it would make a useful addition to the synthetic biology toolkit.

  19. More than charged base loss--revisiting the fragmentation of highly charged oligonucleotides.

    PubMed

    Nyakas, Adrien; Eberle, Rahel P; Stucki, Silvan R; Schürch, Stefan

    2014-07-01

    Tandem mass spectrometry is a well-established analytical tool for rapid and reliable characterization of oligonucleotides (ONs) and their gas-phase dissociation channels. The fragmentation mechanisms of native and modified nucleic acids upon different mass spectrometric activation techniques have been studied extensively, resulting in a comprehensive catalogue of backbone fragments. In this study, the fragmentation behavior of highly charged oligodeoxynucleotides (ODNs) comprising up to 15 nucleobases was investigated. It was found that ODNs exhibiting a charge level (ratio of the actual to the total possible charge) of 100% follow significantly altered dissociation pathways compared with low or medium charge levels if a terminal pyrimidine base (3' or 5') is present. The corresponding product ion spectra gave evidence for the extensive loss of a cyanate anion (NCO(-)), which frequently coincided with the abstraction of water from the 3'- and 5'-end in the presence of a 3'- and 5'-terminal pyrimidine nucleobase, respectively. Subsequent fragmentation of the M-NCO(-) ion by MS(3) revealed a so far unreported consecutive excision of a metaphosphate (PO3 (-))-ion for the investigated sequences. Introduction of a phosphorothioate group allowed pinpointing of PO3 (-) loss to the ultimate phosphate group. Several dissociation mechanisms for the release of NCO(-) and a metaphosphate ion were proposed and the validity of each mechanism was evaluated by the analysis of backbone- or sugar-modified ONs.

  20. Experimental design, modeling and optimization of polyplex formation between DNA oligonucleotides and branched polyethylenimine.

    PubMed

    Clima, Lilia; Ursu, Elena L; Cojocaru, Corneliu; Rotaru, Alexandru; Barboiu, Mihail; Pinteala, Mariana

    2015-09-28

    The complexes formed by DNA and polycations have received great attention owing to their potential application in gene therapy. In this study, the binding efficiency between double-stranded oligonucleotides (dsDNA) and branched polyethylenimine (B-PEI) has been quantified by processing of the images captured from the gel electrophoresis assays. The central composite experimental design has been employed to investigate the effects of controllable factors on the binding efficiency. On the basis of experimental data and the response surface methodology, a multivariate regression model has been constructed and statistically validated. The model has enabled us to predict the binding efficiency depending on experimental factors, such as concentrations of dsDNA and B-PEI as well as the initial pH of solution. The optimization of the binding process has been performed using simplex and gradient methods. The optimal conditions determined for polyplex formation have yielded a maximal binding efficiency close to 100%. In order to reveal the mechanism of complex formation at the atomic-scale, a molecular dynamic simulation has been carried out. According to the computation results, B-PEI amine hydrogen atoms have interacted with oxygen atoms from dsDNA phosphate groups. These interactions have led to the formation of hydrogen bonds between macromolecules, stabilizing the polyplex structure.

  1. Spectral, thermal and kinetic studies of charge-transfer complexes formed between the highly effective antibiotic drug metronidazole and two types of acceptors: σ- and π-acceptors

    NASA Astrophysics Data System (ADS)

    Refat, Moamen S.; Saad, Hosam A.; Adam, Abdel Majid A.

    2015-04-01

    Understanding the interaction between drugs and small inorganic or organic molecules is critical in being able to interpret the drug-receptor interactions and acting mechanism of these drugs. A combined solution and solid state study was performed to describe the complexation chemistry of drug metronidazole (MZ) which has a broad-spectrum antibacterial activity with two types of acceptors. The acceptors include, σ-acceptor (i.e., iodine) and π-acceptors (i.e., dichlorodicyanobenzoquinone (DDQ), chloranil (CHL) and picric acid (PA)). The molecular structure, spectroscopic characteristics, the binding modes as well as the thermal stability were deduced from IR, UV-vis, 1H NMR and thermal studies. The binding ratio of complexation (MZ: acceptor) was determined to be 1:2 for the iodine acceptor and 1:1 for the DDQ, CHL or PA acceptor, according to the CHN elemental analyses and spectrophotometric titrations. It has been found that the complexation with CHL and PA acceptors increases the values of enthalpy and entropy, while the complexation with DDQ and iodine acceptors decreases the values of these parameters compared with the free MZ donor.

  2. Spectral, thermal and kinetic studies of charge-transfer complexes formed between the highly effective antibiotic drug metronidazole and two types of acceptors: σ- and π-acceptors.

    PubMed

    Refat, Moamen S; Saad, Hosam A; Adam, Abdel Majid A

    2015-04-15

    Understanding the interaction between drugs and small inorganic or organic molecules is critical in being able to interpret the drug-receptor interactions and acting mechanism of these drugs. A combined solution and solid state study was performed to describe the complexation chemistry of drug metronidazole (MZ) which has a broad-spectrum antibacterial activity with two types of acceptors. The acceptors include, σ-acceptor (i.e., iodine) and π-acceptors (i.e., dichlorodicyanobenzoquinone (DDQ), chloranil (CHL) and picric acid (PA)). The molecular structure, spectroscopic characteristics, the binding modes as well as the thermal stability were deduced from IR, UV-vis, (1)H NMR and thermal studies. The binding ratio of complexation (MZ: acceptor) was determined to be 1:2 for the iodine acceptor and 1:1 for the DDQ, CHL or PA acceptor, according to the CHN elemental analyses and spectrophotometric titrations. It has been found that the complexation with CHL and PA acceptors increases the values of enthalpy and entropy, while the complexation with DDQ and iodine acceptors decreases the values of these parameters compared with the free MZ donor.

  3. Sex determination of bovine preimplantation embryos by oligonucleotide microarray.

    PubMed

    Yang, Hua; Zhong, Fagang; Yang, Yonglin; Wang, Xinhua; Liu, Shouren; Zhu, Bin

    2013-06-01

    The aim has been to set up a rapid and accurate microarray assay using sandwich mode for sex determination of bovine preimplantation embryos. Twelve sequence-specific oligonucleotide capture probes used to discriminate 12 samples were spotted onto the aldehyde-modified glass slides by Arrayer. The 2 recognition probes used to identify coding regions of the sex-determining region of the Y chromosome gene (SRY) and β-casein (CSN2) reference gene were coupled with biotin. The assay was optimized by using genomic DNA extracted from blood samples of known sex individuals. Polymerase chain reaction (PCR) was used to amplify the fragments in the HMG box region of SRY gene and CSN2 gene with sequence-specific primers. The sex of samples was identified by detecting both the SRY and CSN2 genes simultaneously in 2 reaction cells of microarrays, with the male having SRY and CSN2 signals and the female only CSN2. The sex of 20 bovine preimplantation embryos was determined by oligonucleotide microarray. The protocol was run with a blind test that showed a 100% (82/82) specificity and accuracy in sexing of leukocytes. The bovine embryos were transferred into 20 bovine recipients, with a pregnant rate of 40% (8/20). Three calves were born at term, and 5 fetuses were miscarried. Their sexes were fully in accordance with the embryonic sex predetermination predicted by oligonucleotide microarray. This suggests that the oligonucleotide microarray method of SRY gene analysis can be used in early sex prediction of bovine embryos in breeding programs.

  4. Serotyping of Human Group A Rotavirus with Oligonucleotide Probes

    DTIC Science & Technology

    1990-01-01

    Cold Spring Harbor , other oligonucleotides, HuG8Ac and HuG9Ac...HuG8Ac (5’ NY: Cold Spring Harbor Laboratory, 1988;5l1-159 CGA ACT ATC TUC TAT CTC TGT CTC T 3’) was based 9. Bastardo JW, McKimm-Bresckin JL, Sonza...Coulson BS, Unicomb LE, Pitson GA, Bishop RE Simple and specific manual. Cold Spring Harbor , NY Cold Spring Harbor Laboratory. enzyme

  5. The Design of Oligonucleotides Which Attack Specific Gene Targets

    DTIC Science & Technology

    1989-12-08

    identify by block number) FIELD GROUP SUB-GROUP ’" DNA Recognition; 06 03 Triplet helix formation, <r: " 19 ABSTRACT (Continue on reverse if necessary and...Such local triplet bonding schemes give rise to H bonding between the triplex forming oligonucleotide and the purine of the underlying Watson Crick ...identify by block number) During the first year of Navy support, we have refined our understanding of triple helix formation and in the process, have

  6. Cationic carbosilane dendrimers and oligonucleotide binding: an energetic affair

    NASA Astrophysics Data System (ADS)

    Marson, D.; Laurini, E.; Posocco, P.; Fermeglia, M.; Pricl, S.

    2015-02-01

    Generation 2 cationic carbosilane dendrimers hold great promise as internalizing agents for gene therapy as they present low toxicity and retain and internalize the genetic material as an oligonucleotide or siRNA. In this work we carried out complete in silico structural and energetical characterization of the interactions of a set of G2 carbosilane dendrimers, showing different affinity towards two single strand oligonucleotide (ODN) sequences in vitro. Our simulations predict that these four dendrimers and the relevant ODN complexes are characterized by similar size and shape, and that the molecule-specific ODN binding ability can be rationalized only by considering a critical molecular design parameter: the normalized effective binding energy ΔGbind,eff/Neff, i.e. the performance of each active individual dendrimer branch directly involved in a binding interaction.Generation 2 cationic carbosilane dendrimers hold great promise as internalizing agents for gene therapy as they present low toxicity and retain and internalize the genetic material as an oligonucleotide or siRNA. In this work we carried out complete in silico structural and energetical characterization of the interactions of a set of G2 carbosilane dendrimers, showing different affinity towards two single strand oligonucleotide (ODN) sequences in vitro. Our simulations predict that these four dendrimers and the relevant ODN complexes are characterized by similar size and shape, and that the molecule-specific ODN binding ability can be rationalized only by considering a critical molecular design parameter: the normalized effective binding energy ΔGbind,eff/Neff, i.e. the performance of each active individual dendrimer branch directly involved in a binding interaction. Electronic supplementary information (ESI) available: Additional figures and tables. See DOI: 10.1039/c4nr04510f

  7. Oligonucleotide switches and nanomaterials for intracellular mRNA sensing

    NASA Astrophysics Data System (ADS)

    Tombelli, S.; Ballestri, M.; Giambastiani, G.; Giannetti, A.; Guerrini, A.; Sotgiu, G.; Trono, C.; Tuci, G.; Varchi, G.; Baldini, F.

    2013-06-01

    We describe here the conjugation of polymethylmethacrylate nanoparticles to particular oligonucleotide switches, termed molecular beacons (MBs), as potential intracellular nanosensors. Survivin mRNA targeting MBs have been used with Atto647N and Blackberry 650 as fluorophore/quencher pair. The nanosensors have been characterized in vitro by investigating the analytical performances of the chosen molecular beacon and its functionalities after conjugation to the nanoparticles.

  8. Reduction of Uranium(VI) Phosphate during Growth of the Thermophilic Bacterium Thermoterrabacterium ferrireducens

    PubMed Central

    Khijniak, T. V.; Slobodkin, A. I.; Coker, V.; Renshaw, J. C.; Livens, F. R.; Bonch-Osmolovskaya, E. A.; Birkeland, N.-K.; Medvedeva-Lyalikova, N. N.; Lloyd, J. R.

    2005-01-01

    The thermophilic, gram-positive bacterium Thermoterrabacterium ferrireducens coupled organotrophic growth to the reduction of sparingly soluble U(VI) phosphate. X-ray powder diffraction and X-ray absorption spectroscopy analysis identified the electron acceptor in a defined medium as U(VI) phosphate [uramphite; (NH4)(UO2)(PO4) · 3H2O], while the U(IV)-containing precipitate formed during bacterial growth was identified as ningyoite [CaU(PO4)2 · H2O]. This is the first report of microbial reduction of a largely insoluble U(VI) compound. PMID:16204572

  9. Total Phosphate Influences the Rate of Hydrocarbon Degradation but Phosphate Mineralogy Shapes Microbial Community Composition in Cold-Region Calcareous Soils.

    PubMed

    Siciliano, Steven D; Chen, Tingting; Phillips, Courtney; Hamilton, Jordan; Hilger, David; Chartrand, Blaine; Grosskleg, Jay; Bradshaw, Kris; Carlson, Trevor; Peak, Derek

    2016-05-17

    Managing phosphorus bioaccessibility is critical for the bioremediation of hydrocarbons in calcareous soils. This paper explores how soil mineralogy interacts with a novel biostimulatory solution to both control phosphorus bioavailability and influence bioremediation. Two large bore infiltrators (1 m diameter) were installed at a PHC contaminated site and continuously supplied with a solution containing nutrients and an electron acceptor. Soils from eight contaminated sites were prepared and pretreated, analyzed pretrial, spiked with diesel, placed into nylon bags into the infiltrators, and removed after 3 months. From XAS, we learned that three principal phosphate phases had formed: adsorbed phosphate, brushite, and newberyite. All measures of biodegradation in the samples (in situ degradation estimates, mineralization assays, culturable bacteria, catabolic genes) varied depending upon the soil's phosphate speciation. Notably, adsorbed phosphate increased anaerobic phenanthrene degradation and bzdN catabolic gene prevalence. The dominant mineralogical constraints on community composition were the relative amounts of adsorbed phosphate, brushite, and newberyite. Overall, this study finds that total phosphate influences microbial community phenotypes whereas relative percentages of phosphate minerals influences microbial community genotype composition.

  10. Magnetite nanoparticles facilitate methane production from ethanol via acting as electron acceptors.

    PubMed

    Yang, Zhiman; Shi, Xiaoshuang; Wang, Chuanshui; Wang, Lin; Guo, Rongbo

    2015-11-12

    Potential for interspecies hydrogen transfer within paddy soil enrichments obtained via addition of magnetite nanoparticles and ethanol (named as PEM) was investigated. To do this, PEM derived from rice field of Hangzhou (named as PEM-HZ) was employed, because it offered the best methane production performance. Methane production and Fe (III) reduction proceeded in parallel in the presence of magnetite. Inhibition experiments with 2-bromoethane sulfonate (BES) or phosphate showed that interspecies hydrogen transfer and Fe (III) reduction also occurred in methane production from ethanol. 16S rRNA-based Illumina sequencing results showed that Dechloromonas, Thauera, Desulfovibrio and Clostridium were the dominant putative Fe (III) -reducers, and that hydrogenotrophic Methanobacterium accounted for about 88% of the total archaeal community. These results indicated that magnetite nanoparticles that acted as electron acceptor could facilitate rapid oxidation of ethanol by members of the Fe (III) -reducers in PEM-HZ and establishment of the syntrophic relationship of Fe (III) -reducers with Methanobacterium via interspecies hydrogen transfer. Our results could offer a model to understand the microbial interaction with magnetite from a novel angle during methanogenesis.

  11. Magnetite nanoparticles facilitate methane production from ethanol via acting as electron acceptors

    PubMed Central

    Yang, Zhiman; Shi, Xiaoshuang; Wang, Chuanshui; Wang, Lin; Guo, Rongbo

    2015-01-01

    Potential for interspecies hydrogen transfer within paddy soil enrichments obtained via addition of magnetite nanoparticles and ethanol (named as PEM) was investigated. To do this, PEM derived from rice field of Hangzhou (named as PEM-HZ) was employed, because it offered the best methane production performance. Methane production and Fe (III) reduction proceeded in parallel in the presence of magnetite. Inhibition experiments with 2-bromoethane sulfonate (BES) or phosphate showed that interspecies hydrogen transfer and Fe (III) reduction also occurred in methane production from ethanol. 16S rRNA-based Illumina sequencing results showed that Dechloromonas, Thauera, Desulfovibrio and Clostridium were the dominant putative Fe (III) -reducers, and that hydrogenotrophic Methanobacterium accounted for about 88% of the total archaeal community. These results indicated that magnetite nanoparticles that acted as electron acceptor could facilitate rapid oxidation of ethanol by members of the Fe (III) -reducers in PEM-HZ and establishment of the syntrophic relationship of Fe (III) -reducers with Methanobacterium via interspecies hydrogen transfer. Our results could offer a model to understand the microbial interaction with magnetite from a novel angle during methanogenesis. PMID:26559132

  12. Magnetite nanoparticles facilitate methane production from ethanol via acting as electron acceptors

    NASA Astrophysics Data System (ADS)

    Yang, Zhiman; Shi, Xiaoshuang; Wang, Chuanshui; Wang, Lin; Guo, Rongbo

    2015-11-01

    Potential for interspecies hydrogen transfer within paddy soil enrichments obtained via addition of magnetite nanoparticles and ethanol (named as PEM) was investigated. To do this, PEM derived from rice field of Hangzhou (named as PEM-HZ) was employed, because it offered the best methane production performance. Methane production and Fe (III) reduction proceeded in parallel in the presence of magnetite. Inhibition experiments with 2-bromoethane sulfonate (BES) or phosphate showed that interspecies hydrogen transfer and Fe (III) reduction also occurred in methane production from ethanol. 16S rRNA-based Illumina sequencing results showed that Dechloromonas, Thauera, Desulfovibrio and Clostridium were the dominant putative Fe (III) -reducers, and that hydrogenotrophic Methanobacterium accounted for about 88% of the total archaeal community. These results indicated that magnetite nanoparticles that acted as electron acceptor could facilitate rapid oxidation of ethanol by members of the Fe (III) -reducers in PEM-HZ and establishment of the syntrophic relationship of Fe (III) -reducers with Methanobacterium via interspecies hydrogen transfer. Our results could offer a model to understand the microbial interaction with magnetite from a novel angle during methanogenesis.

  13. G-Quadruplex Forming Oligonucleotides as Anti-HIV Agents.

    PubMed

    Musumeci, Domenica; Riccardi, Claudia; Montesarchio, Daniela

    2015-09-22

    Though a variety of different non-canonical nucleic acids conformations have been recognized, G-quadruplex structures are probably the structural motifs most commonly found within known oligonucleotide-based aptamers. This could be ascribed to several factors, as their large conformational diversity, marked responsiveness of their folding/unfolding processes to external stimuli, high structural compactness and chemo-enzymatic and thermodynamic stability. A number of G-quadruplex-forming oligonucleotides having relevant in vitro anti-HIV activity have been discovered in the last two decades through either SELEX or rational design approaches. Improved aptamers have been obtained by chemical modifications of natural oligonucleotides, as terminal conjugations with large hydrophobic groups, replacement of phosphodiester linkages with phosphorothioate bonds or other surrogates, insertion of base-modified monomers, etc. In turn, detailed structural studies have elucidated the peculiar architectures adopted by many G-quadruplex-based aptamers and provided insight into their mechanism of action. An overview of the state-of-the-art knowledge of the relevance of putative G-quadruplex forming sequences within the viral genome and of the most studied G-quadruplex-forming aptamers, selectively targeting HIV proteins, is here presented.

  14. Recursive construction of perfect DNA molecules from imperfect oligonucleotides.

    PubMed

    Linshiz, Gregory; Yehezkel, Tuval Ben; Kaplan, Shai; Gronau, Ilan; Ravid, Sivan; Adar, Rivka; Shapiro, Ehud

    2008-01-01

    Making faultless complex objects from potentially faulty building blocks is a fundamental challenge in computer engineering, nanotechnology and synthetic biology. Here, we show for the first time how recursion can be used to address this challenge and demonstrate a recursive procedure that constructs error-free DNA molecules and their libraries from error-prone oligonucleotides. Divide and Conquer (D&C), the quintessential recursive problem-solving technique, is applied in silico to divide the target DNA sequence into overlapping oligonucleotides short enough to be synthesized directly, albeit with errors; error-prone oligonucleotides are recursively combined in vitro, forming error-prone DNA molecules; error-free fragments of these molecules are then identified, extracted and used as new, typically longer and more accurate, inputs to another iteration of the recursive construction procedure; the entire process repeats until an error-free target molecule is formed. Our recursive construction procedure surpasses existing methods for de novo DNA synthesis in speed, precision, amenability to automation, ease of combining synthetic and natural DNA fragments, and ability to construct designer DNA libraries. It thus provides a novel and robust foundation for the design and construction of synthetic biological molecules and organisms.

  15. Microarray oligonucleotide probe designer (MOPeD): A web service.

    PubMed

    Patel, Viren C; Mondal, Kajari; Shetty, Amol Carl; Horner, Vanessa L; Bedoyan, Jirair K; Martin, Donna; Caspary, Tamara; Cutler, David J; Zwick, Michael E

    2010-11-01

    Methods of genomic selection that combine high-density oligonucleotide microarrays with next-generation DNA sequencing allow investigators to characterize genomic variation in selected portions of complex eukaryotic genomes. Yet choosing which specific oligonucleotides to be use can pose a major technical challenge. To address this issue, we have developed a software package called MOPeD (Microarray Oligonucleotide Probe Designer), which automates the process of designing genomic selection microarrays. This web-based software allows individual investigators to design custom genomic selection microarrays optimized for synthesis with Roche NimbleGen's maskless photolithography. Design parameters include uniqueness of the probe sequences, melting temperature, hairpin formation, and the presence of single nucleotide polymorphisms. We generated probe databases for the human, mouse, and rhesus macaque genomes and conducted experimental validation of MOPeD-designed microarrays in human samples by sequencing the human X chromosome exome, where relevant sequence metrics indicated superior performance relative to a microarray designed by the Roche NimbleGen proprietary algorithm. We also performed validation in the mouse to identify known mutations contained within a 487-kb region from mouse chromosome 16, the mouse chromosome 16 exome (1.7 Mb), and the mouse chromosome 12 exome (3.3 Mb). Our results suggest that the open source MOPeD software package and website (http://moped.genetics.emory.edu/) will make a valuable resource for investigators in their sequence-based studies of complex eukaryotic genomes.

  16. Therapeutic Antisense Oligonucleotides against Cancer: Hurdling to the Clinic

    NASA Astrophysics Data System (ADS)

    Moreno, Pedro; Pêgo, Ana

    2014-10-01

    Under clinical development since the early 90’s and with two successfully approved drugs (Fomivirsen and Mipomersen), oligonucleotide-based therapeutics have not yet delivered a clinical drug to the market in the cancer field. Whilst many pre-clinical data has been generated, a lack of understanding still exists on how to efficiently tackle all the different challenges presented for cancer targeting in a clinical setting. Namely, effective drug vectorization, careful choice of target gene or synergistic multi-gene targeting are surely decisive, while caution must be exerted to avoid potential toxic, often misleading off-target-effects. Here a brief overview will be given on the nucleic acid chemistry advances that established oligonucleotide technologies as a promising therapeutic alternative and ongoing cancer related clinical trials. Special attention will be given towards a perspective on the hurdles encountered specifically in the cancer field by this class of therapeutic oligonucleotides and a view on possible avenues for success is presented, with particular focus on the contribution from nanotechnology to the field.

  17. Oligonucleotide Frequencies of Barcoding Loci Can Discriminate Species across Kingdoms

    PubMed Central

    Shukla, Virendra; Tuli, Rakesh

    2010-01-01

    Background DNA barcoding refers to the use of short DNA sequences for rapid identification of species. Genetic distance or character attributes of a particular barcode locus discriminate the species. We report an efficient approach to analyze short sequence data for discrimination between species. Methodology and Principal Findings A new approach, Oligonucleotide Frequency Range (OFR) of barcode loci for species discrimination is proposed. OFR of the loci that discriminates between species was characteristic of a species, i.e., the maxima and minima within a species did not overlap with that of other species. We compared the species resolution ability of different barcode loci using p-distance, Euclidean distance of oligonucleotide frequencies, nucleotide-character based approach and OFR method. The species resolution by OFR was either higher or comparable to the other methods. A short fragment of 126 bp of internal transcribed spacer region in ribosomal RNA gene was sufficient to discriminate a majority of the species using OFR. Conclusions/Significance Oligonucleotide frequency range of a barcode locus can discriminate between species. Ability to discriminate species using very short DNA fragments may have wider applications in forensic and conservation studies. PMID:20808837

  18. Ultrathin oligonucleotide layers for fluorescence-based DNA sensors

    NASA Astrophysics Data System (ADS)

    Furch, M.; Ueberfeld, J.; Hartmann, Andreas; Bock, Daniel; Seeger, Stefan

    1996-11-01

    Preliminary investigations into the design of an affinity sensor using evanescent wave technology concentrate upon the means of immobilization of the receptor molecules. In this work DNA served as the selective recognition element. The molecular principle of a sequence-selective biosensor for DNA is based on a sandwich-hybridization assay wherein the analyte, a single-stranded (ss)DNA, bound specifically to both an immobilized capture probe and a dye-labeled oligonucleotide in free solution. The efficiency of the capture array depends on the density of highly organized oligonucleotides on the waveguide surface and correlates therefore directly with the specificity and the sensitivity of the sensor. In the present approach using the Langmuir- Blodgett technique cinnamoylbutylether-cellulose monolayers were transferred onto optical fibers or planar waveguides. These films served as matrices for the immobilization of biotinylated oligonucleotides via streptavidin. For the first time streptavidin was immobilized by that manner. The specificity of the streptavidin layer or the following bounded nucleic acid molecules were controlled by an enzyme- linked immunosorbent assay (ELISA). Finally, this application has also shown to be suitable for the detection of Salmonella, which is an important pathogen associated with acute gastroenteritidis and food borne diseases.

  19. Gene expression profiling in peanut using high density oligonucleotide microarrays

    PubMed Central

    Payton, Paxton; Kottapalli, Kameswara Rao; Rowland, Diane; Faircloth, Wilson; Guo, Baozhu; Burow, Mark; Puppala, Naveen; Gallo, Maria

    2009-01-01

    Background Transcriptome expression analysis in peanut to date has been limited to a relatively small set of genes and only recently has a significant number of ESTs been released into the public domain. Utilization of these ESTs for oligonucleotide microarrays provides a means to investigate large-scale transcript responses to a variety of developmental and environmental signals, ultimately improving our understanding of plant biology. Results We have developed a high-density oligonucleotide microarray for peanut using 49,205 publicly available ESTs and tested the utility of this array for expression profiling in a variety of peanut tissues. To identify putatively tissue-specific genes and demonstrate the utility of this array for expression profiling in a variety of peanut tissues, we compared transcript levels in pod, peg, leaf, stem, and root tissues. Results from this experiment showed 108 putatively pod-specific/abundant genes, as well as transcripts whose expression was low or undetected in pod compared to peg, leaf, stem, or root. The transcripts significantly over-represented in pod include genes responsible for seed storage proteins and desiccation (e.g., late-embryogenesis abundant proteins, aquaporins, legumin B), oil production, and cellular defense. Additionally, almost half of the pod-abundant genes represent unknown genes allowing for the possibility of associating putative function to these previously uncharacterized genes. Conclusion The peanut oligonucleotide array represents the majority of publicly available peanut ESTs and can be used as a tool for expression profiling studies in diverse tissues. PMID:19523230

  20. DNA/RNA heteroduplex oligonucleotide for highly efficient gene silencing

    PubMed Central

    Nishina, Kazutaka; Piao, Wenying; Yoshida-Tanaka, Kie; Sujino, Yumiko; Nishina, Tomoko; Yamamoto, Tsuyoshi; Nitta, Keiko; Yoshioka, Kotaro; Kuwahara, Hiroya; Yasuhara, Hidenori; Baba, Takeshi; Ono, Fumiko; Miyata, Kanjiro; Miyake, Koichi; Seth, Punit P.; Low, Audrey; Yoshida, Masayuki; Bennett, C. Frank; Kataoka, Kazunori; Mizusawa, Hidehiro; Obika, Satoshi; Yokota, Takanori

    2015-01-01

    Antisense oligonucleotides (ASOs) are recognized therapeutic agents for the modulation of specific genes at the post-transcriptional level. Similar to any medical drugs, there are opportunities to improve their efficacy and safety. Here we develop a short DNA/RNA heteroduplex oligonucleotide (HDO) with a structure different from double-stranded RNA used for short interfering RNA and single-stranded DNA used for ASO. A DNA/locked nucleotide acid gapmer duplex with an α-tocopherol-conjugated complementary RNA (Toc-HDO) is significantly more potent at reducing the expression of the targeted mRNA in liver compared with the parent single-stranded gapmer ASO. Toc-HDO also improves the phenotype in disease models more effectively. In addition, the high potency of Toc-HDO results in a reduction of liver dysfunction observed in the parent ASO at a similar silencing effect. HDO technology offers a novel concept of therapeutic oligonucleotides, and the development of this molecular design opens a new therapeutic field. PMID:26258894

  1. Engineering the specificity of trehalose phosphorylase as a general strategy for the production of glycosyl phosphates.

    PubMed

    Chen, Chao; Van der Borght, Jef; De Vreese, Rob; D'hooghe, Matthias; Soetaert, Wim; Desmet, Tom

    2014-07-25

    A two-step process is reported for the anomeric phosphorylation of galactose, using trehalose phosphorylase as biocatalyst. The monosaccharide enters this process as acceptor but can subsequently be released from the donor side, thanks to the non-reducing nature of the disaccharide intermediate. A key development was the creation of an optimized enzyme variant that displays a strict specificity (99%) for β-galactose 1-phosphate as product.

  2. Synthesis of triazole-linked oligonucleotides with high affinity to DNA complements and an analysis of their compatibility with biosystems.

    PubMed

    Varizhuk, Anna M; Kaluzhny, Dmitry N; Novikov, Roman A; Chizhov, Alexandr O; Smirnov, Igor P; Chuvilin, Andrey N; Tatarinova, Olga N; Fisunov, Gleb Y; Pozmogova, Galina E; Florentiev, Vladimir L

    2013-06-21

    New oligonucleotide analogues with triazole internucleotide linkages were synthesized, and their hybridization properties were studied. The analogues demonstrated DNA binding affinities similar to those of unmodified oligonucleotides. The modification was shown to protect the oligonucleotides from nuclease hydrolysis. The modified oligonucleotides were tested as PCR primers. Modifications remote from the 3'-terminus were tolerated by polymerases. Our results suggest that these new oligonucleotide analogues are among the most promising triazole DNA mimics characterized to date.

  3. Dynamics of iron-acceptor-pair formation in co-doped silicon

    NASA Astrophysics Data System (ADS)

    Bartel, T.; Gibaja, F.; Graf, O.; Gross, D.; Kaes, M.; Heuer, M.; Kirscht, F.; Möller, C.; Lauer, K.

    2013-11-01

    The pairing dynamics of interstitial iron and dopants in silicon co-doped with phosphorous and several acceptor types are presented. The classical picture of iron-acceptor pairing dynamics is expanded to include the thermalization of iron between different dopants. The thermalization is quantitatively described using Boltzmann statistics and different iron-acceptor binding energies. The proper understanding of the pairing dynamics of iron in co-doped silicon will provide additional information on the electronic properties of iron-acceptor pairs and may become an analytical method to quantify and differentiate acceptors in co-doped silicon.

  4. Dynamics of iron-acceptor-pair formation in co-doped silicon

    SciTech Connect

    Bartel, T.; Gibaja, F.; Graf, O.; Gross, D.; Kaes, M.; Heuer, M.; Kirscht, F.; Möller, C.; Lauer, K.

    2013-11-11

    The pairing dynamics of interstitial iron and dopants in silicon co-doped with phosphorous and several acceptor types are presented. The classical picture of iron-acceptor pairing dynamics is expanded to include the thermalization of iron between different dopants. The thermalization is quantitatively described using Boltzmann statistics and different iron-acceptor binding energies. The proper understanding of the pairing dynamics of iron in co-doped silicon will provide additional information on the electronic properties of iron-acceptor pairs and may become an analytical method to quantify and differentiate acceptors in co-doped silicon.

  5. Method for producing and regenerating a synthetic CO.sub.2 acceptor

    DOEpatents

    Lancet, Michael S [Pittsburgh, PA; Curran, George P [Pittsburgh, PA; Gorin, Everett [San Rafael, CA

    1982-01-01

    A method for producing a synthetic CO.sub.2 acceptor by feeding a mixture of finely divided silica and at least one finely divided calcium compound selected from the group consisting of calcium oxide and calcium carbonate to a fluidized bed; operating the fluidized bed at suitable conditions to produce pellets of synthetic CO.sub.2 acceptor and recovering the pellets of synthetic CO.sub.2 acceptor from the fluidized bed. Optionally, spent synthetic CO.sub.2 acceptor can be charged to the fluidized bed to produce regenerated pellets of synthetic CO.sub.2 acceptor.

  6. Method for producing and regenerating a synthetic CO[sub 2] acceptor

    DOEpatents

    Lancet, M. S.; Curran, G. P.; Gorin, E.

    1982-05-18

    A method is described for producing a synthetic CO[sub 2] acceptor by feeding a mixture of finely divided silica and at least one finely divided calcium compound selected from the group consisting of calcium oxide and calcium carbonate to a fluidized bed; operating the fluidized bed at suitable conditions to produce pellets of synthetic CO[sub 2] acceptor and recovering the pellets of synthetic CO[sub 2] acceptor from the fluidized bed. Optionally, spent synthetic CO[sub 2] acceptor can be charged to the fluidized bed to produce regenerated pellets of synthetic CO[sub 2] acceptor. 1 fig.

  7. Static magnetic field reduced exogenous oligonucleotide uptake by spermatozoa using magnetic nanoparticle gene delivery system

    NASA Astrophysics Data System (ADS)

    Katebi, Samira; Esmaeili, Abolghasem; Ghaedi, Kamran

    2016-03-01

    Spermatozoa could introduce exogenous oligonucleotides of interest to the oocyte. The most important reason of low efficiency of sperm mediated gene transfer (SMGT) is low uptake of exogenous DNA by spermatozoa. The aim of this study was to evaluate the effects of static magnetic field on exogenous oligonucleotide uptake of spermatozoa using magnetofection method. Magnetic nanoparticles (MNPs) associated with the labeled oligonucleotides were used to increase the efficiency of exogenous oligonucleotide uptake by rooster spermatozoa. We used high-field/high-gradient magnet (NdFeB) to enhance and accelerate exogenous DNA sedimentation at the spermatozoa surface. Flow cytometry analysis was performed to measure viability and percentage of exogenous oligonucleotide uptake by sperm. Flow cytometry analysis showed a significant increase in exogenous oligonucleotide uptake by rooster spermatozoa (P<0.001) when spermatozoa were incubated in exogenous oligonucleotide solution and MNPs. However, by applying static magnetic field during magnetofection method, a significant decrease in exogenous oligonucleotide uptake was observed (P<0.05). Findings of this study showed that MNPs were effective to increase exogenous oligonucleotide uptake by rooster spermatozoa; however unlike others studies, static magnetic field, was not only ineffective to enhance exogenous oligonucleotide uptake by rooster spermatozoa but also led to reduction in efficiency of magnetic nanoparticles in gene transfer.

  8. Sodium phosphate-derived calcium phosphate cements

    SciTech Connect

    Sugama, T.; Carciello, N.R. )

    1995-01-01

    Calcium phosphate cements (CPC) were synthesized by the acid-base reaction between sodium phosphate, NaH[sub 2]PO[sub 4] or -(-NaPO[sub 3]-)-[sub n], as the acid solution, and calcium aluminate cements (CAC) as the base reactant at 25 C. The extent of reactivity of -(-NaPO[sub 3]-)-[sub n] with CAC was much higher than that of NaH[sub 2]PO[sub 4], thereby resulting in a compressive strength of > 20 MPa. Sodium calcium orthophosphate (SCOP) salts as amorphous reaction products were responsible for the development of this strength. When this CPC specimen as exposed in an autoclave, in-situ amorphous [r arrow] crystal conversions, such as SCOP [r arrow] hydroxyapatite (HOAp), and Al[sub 2]O[sub 3] [center dot] xH[sub 2]O [r arrow] [gamma]-AlOOH, occurred at [approx] 100 C, while the rate of reaction of the residual CAC with the phosphate reactant was increasingly accelerated by hydrothermal catalysis. Based upon this information, the authors prepared lightweight CPC specimens by hydrothermally treating a low-density cement slurry (1.28 g/cc) consisting of CAC powder, -(-NaPO[sub 3]-)-[sub n] solution, and mullite-hollow microspheres. The characteristics of the autoclaved lightweight specimens were a compressive strength of > 9.0 MPa, water permeability of [approx] 5.0 [times] 10[sup [minus]3] milli darcy, and a low rate of alkali carbonation. The reasons for such a low carbonation rate reflected the presence of a minimum amount of residual CAC, in conjunction with the presence of HOAp and [gamma]-AlOOH phases that are unsusceptible to wet carbonation.

  9. A study of oligonucleotide occurrence distributions in DNA coding segments.

    PubMed

    Castrignanò, T; Colosimo, A; Morante, S; Parisi, V; Rossi, G C

    1997-02-21

    In this paper we present a general strategy designed to study the occurrence frequency distributions of oligonucleotides in DNA coding segments and to deal with the problem of detecting possible patterns of genomic compositional inhomogeneities and disuniformities. Identifying specific tendencies or peculiar deviations in the distributions of the effective occurrence frequencies of oligonucleotides, with respect to what can be a priori expected, is of the greatest importance in biology. Differences between expected and actual distributions may in fact suggest or confirm the existence of specific biological mechanisms related to them. Similarly, a marked deviation in the occurrence frequency of an oligonucleotide may suggest that it belongs to the class of so-called "DNA signal (target) sequences". The approach we have elaborated is innovative in various aspects. Firstly, the analysis of the genomic data is carried out in the light of the observation that the distribution of the four nucleotides along the coding regions of the genoma is biased by the existence of a well-defined "reading frame". Secondly, the "experimental" numbers found by counting the occurrences of the various oligonucleotide sequences are appropriately corrected for the many kinds of mistakes and redundancies present in the available genetic Data Bases. A methodologically significant further improvement of our approach over the existing searching strategies is represented by the fact that, in order to decide whether or not the (corrected) "experimental" value of the occurrence frequency of a given oligonucleotide is within statistical expectations, a measure of the strength of the selective pressure, having acted on it in the course of the evolution, is assigned to the sequence, in a way that takes into account both the value of the "experimental" occurrence frequency of the sequence and the magnitude of the probability that this number might be the result of statistical fluctuations. If the

  10. Toward an on-chip multiplexed nucleic acid hybridization assay using immobilized quantum dot-oligonucleotide conjugates and fluorescence resonance energy transfer

    NASA Astrophysics Data System (ADS)

    Tavares, Anthony J.; Noor, M. Omair; Algar, W. Russ; Vannoy, Charles H.; Chen, Lu; Krull, Ulrich J.

    2011-03-01

    Semiconductor quantum dots (QD) are a class of NP with photophysical properties that are ideally suited for optical multiplexing and use as donors in fluorescence resonance energy transfer (FRET). A new strategy is presented for the development of multiplexed DNA hybridization assays using immobilized QDs in a microfluidic system. Green- or red-emitting QDs were immobilized via self-assembly with a multidentate-thiol-derivatized glass slide, and subsequently conjugated with amine-terminated probe oligonucleotides using carbodiimide activation. Immobilized QD-probe conjugates were then passivated with adsorbed non-complementary oligonucleotides to achieve selectivity in microfluidic assays. Target nucleic acid sequences hybridized with QD-probe conjugates and were labeled with Cy3 or Alexa Fluor 647 as acceptor dyes for the QD donors, where FRET-sensitized dye emission provided a signal for the detection of picomolar quantities of target. The simultaneous immobilization of green- and red-emitting QDs at different ratios within a microfluidic channel was demonstrated as a step toward multiplexed assays.

  11. Improved Manganese Phosphate Coatings

    DTIC Science & Technology

    1975-04-01

    Conversion coatings 3 . Phosphating bath 20 AGrjC onln odd*. ta It .. c..soMV midP 1J.,alft. by block noc.mb) Work was conducted to determine the mechanism by...34 TABULAR DATA Table I Analyses of Solution and Coating for Phosphating Baths 4 of Di-ferlng Compositions 11 Atomic Absorption...manganese and iron phosphate coating: k * a. Mn(H 2PO4) 2 Nn-P0 4 + H3PO0 k2 k) b. 3MnHPO4 - Mn3 (P04) 2 + H3i’O4 k4 k5 c. Fe(H 2PO4) 2 -01 FeHPO4

  12. Codeine dihydrogen phosphate hemihydrate.

    PubMed

    Langes, Christoph; Gelbrich, Thomas; Griesser, Ulrich J; Kahlenberg, Volker

    2009-08-01

    The cation of the title structure [systematic name: (5alpha,6alpha)-6-hydroxy-7,8-didehydro-4,5-epoxy-3-methoxy-17-methylmorphinanium dihydrogen phosphate hemihydrate], C18H22NO3+.H2PO4-.0.5H2O, has a T-shaped conformation. The dihydrogen phosphate anions are linked by O-H...O hydrogen bonds to give an extended ribbon chain. The codeine cations are linked together by O-H...O hydrogen bonds into a zigzag chain. There are also N-H...O bonds between the two types of hydrogen-bonded units. Additionally, they are connected to one another via O...H-O-H...O bridging water molecules. The asymmetric unit contains two codeine hydrogen cations, two dihydrogen phosphate anions and one water molecule. This study shows that the water molecules are firmly bound within a complex three-dimensional hydrogen-bonded framework.

  13. Phosphate Mines, Jordan

    NASA Technical Reports Server (NTRS)

    2008-01-01

    Jordan's leading industry and export commodities are phosphate and potash, ranked in the top three in the world. These are used to make fertilizer. The Jordan Phosphate Mines Company is the sole producer, having started operations in 1935. In addition to mining activities, the company produces phosphoric acid (for fertilizers, detergents, pharmaceuticals), diammonium phosphate (for fertilizer), sulphuric acid (many uses), and aluminum fluoride (a catalyst to make aluminum and magnesium).

    The image covers an area of 27.5 x 49.4 km, was acquired on September 17, 2005, and is located near 30.8 degrees north latitude, 36.1 degrees east longitude.

    The U.S. science team is located at NASA's Jet Propulsion Laboratory, Pasadena, Calif. The Terra mission is part of NASA's Science Mission Directorate.

  14. Organic Donor-Acceptor Complexes as Novel Organic Semiconductors.

    PubMed

    Zhang, Jing; Xu, Wei; Sheng, Peng; Zhao, Guangyao; Zhu, Daoben

    2017-07-18

    Organic donor-acceptor (DA) complexes have attracted wide attention in recent decades, resulting in the rapid development of organic binary system electronics. The design and synthesis of organic DA complexes with a variety of component structures have mainly focused on metallicity (or even superconductivity), emission, or ferroelectricity studies. Further efforts have been made in high-performance electronic investigations. The chemical versatility of organic semiconductors provides DA complexes with a great number of possibilities for semiconducting applications. Organic DA complexes extend the semiconductor family and promote charge separation and transport in organic field-effect transistors (OFETs) and organic photovoltaics (OPVs). In OFETs, the organic complex serves as an active layer across extraordinary charge pathways, ensuring the efficient transport of induced charges. Although an increasing number of organic semiconductors have been reported to exhibit good p- or n-type properties (mobilities higher than 1 or even 10 cm(2) V(-1) s(-1)), critical scientific challenges remain in utilizing the advantages of existing semiconductor materials for more and wider applications while maintaining less complicated synthetic or device fabrication processes. DA complex materials have revealed new insight: their unique molecular packing and structure-property relationships. The combination of donors and acceptors could offer practical advantages compared with their unimolecular materials. First, growing crystals of DA complexes with densely packed structures will reduce impurities and traps from the self-assembly process. Second, complexes based on the original structural components could form superior mixture stacking, which can facilitate charge transport depending on the driving force in the coassembly process. Third, the effective use of organic semiconductors can lead to tunable band structures, allowing the operation mode (p- or n-type) of the transistor to be

  15. Fundamentals of phosphate transfer.

    PubMed

    Kirby, Anthony J; Nome, Faruk

    2015-07-21

    Historically, the chemistry of phosphate transfer-a class of reactions fundamental to the chemistry of Life-has been discussed almost exclusively in terms of the nucleophile and the leaving group. Reactivity always depends significantly on both factors; but recent results for reactions of phosphate triesters have shown that it can also depend strongly on the nature of the nonleaving or "spectator" groups. The extreme stabilities of fully ionised mono- and dialkyl phosphate esters can be seen as extensions of the same effect, with one or two triester OR groups replaced by O(-). Our chosen lead reaction is hydrolysis-phosphate transfer to water: because water is the medium in which biological chemistry takes place; because the half-life of a system in water is an accepted basic index of stability; and because the typical mechanisms of hydrolysis, with solvent H2O providing specific molecules to act as nucleophiles and as general acids or bases, are models for reactions involving better nucleophiles and stronger general species catalysts. Not least those available in enzyme active sites. Alkyl monoester dianions compete with alkyl diester monoanions for the slowest estimated rates of spontaneous hydrolysis. High stability at physiological pH is a vital factor in the biological roles of organic phosphates, but a significant limitation for experimental investigations. Almost all kinetic measurements of phosphate transfer reactions involving mono- and diesters have been followed by UV-visible spectroscopy using activated systems, conveniently compounds with good leaving groups. (A "good leaving group" OR* is electron-withdrawing, and can be displaced to generate an anion R*O(-) in water near pH 7.) Reactivities at normal temperatures of P-O-alkyl derivatives-better models for typical biological substrates-have typically had to be estimated: by extended extrapolation from linear free energy relationships, or from rate measurements at high temperatures. Calculation is free

  16. Discrimination of oligonucleotides of different lengths with a wild-type aerolysin nanopore

    NASA Astrophysics Data System (ADS)

    Cao, Chan; Ying, Yi-Lun; Hu, Zheng-Li; Liao, Dong-Fang; Tian, He; Long, Yi-Tao

    2016-08-01

    Protein nanopores offer an inexpensive, label-free method of analysing single oligonucleotides. The sensitivity of the approach is largely determined by the characteristics of the pore-forming protein employed, and typically relies on nanopores that have been chemically modified or incorporate molecular motors. Effective, high-resolution discrimination of oligonucleotides using wild-type biological nanopores remains difficult to achieve. Here, we show that a wild-type aerolysin nanopore can resolve individual short oligonucleotides that are 2 to 10 bases long. The sensing capabilities are attributed to the geometry of aerolysin and the electrostatic interactions between the nanopore and the oligonucleotides. We also show that the wild-type aerolysin nanopores can distinguish individual oligonucleotides from mixtures and can monitor the stepwise cleavage of oligonucleotides by exonuclease I.

  17. Nanoparticle-bridge assay for amplification-free electrical detection of oligonucleotides

    NASA Astrophysics Data System (ADS)

    Teimouri, Manouchehr

    The aim of this research is to investigate a highly sensitive, fast, inexpensive, and field-applicable amplification-free nanoparticle-based oligonucleotide detection method which does not rely on any enzymatic or signal amplification process. In this approach, target oligonucleotide strands are detected through the formation of nanoparticle satellites which make an electrical path between two electrodes. This method enables an extremely sensitive oligonucleotide detection because even a few oligonucleotide strands can form a single nanoparticle satellite which can solely generates an electrical output signal. Results showed that this oligonucleotide detection method can detect oligonucleotide single strands at concentrations as low as 50 femtomolar without any amplification process. This detection method can be implemented in many fields such as biodefense, food safety, clinical research, and forensics.

  18. Scalable amplification of strand subsets from chip-synthesized oligonucleotide libraries

    NASA Astrophysics Data System (ADS)

    Schmidt, Thorsten L.; Beliveau, Brian J.; Uca, Yavuz O.; Theilmann, Mark; da Cruz, Felipe; Wu, Chao-Ting; Shih, William M.

    2015-11-01

    Synthetic oligonucleotides are the main cost factor for studies in DNA nanotechnology, genetics and synthetic biology, which all require thousands of these at high quality. Inexpensive chip-synthesized oligonucleotide libraries can contain hundreds of thousands of distinct sequences, however only at sub-femtomole quantities per strand. Here we present a selective oligonucleotide amplification method, based on three rounds of rolling-circle amplification, that produces nanomole amounts of single-stranded oligonucleotides per millilitre reaction. In a multistep one-pot procedure, subsets of hundreds or thousands of single-stranded DNAs with different lengths can selectively be amplified and purified together. These oligonucleotides are used to fold several DNA nanostructures and as primary fluorescence in situ hybridization probes. The amplification cost is lower than other reported methods (typically around US$ 20 per nanomole total oligonucleotides produced) and is dominated by the use of commercial enzymes.

  19. Investigation of the structural organization of cationic nanoemulsion/antisense oligonucleotide complexes.

    PubMed

    Bruxel, Fernanda; Vilela, José Mario Carneiro; Andrade, Margareth Spangler; Malachias, Ângelo; Perez, Carlos A; Magalhães-Paniago, Rogério; Oliveira, Mônica Cristina; Teixeira, Helder F

    2013-12-01

    Atomic force microscopy image analysis and energy dispersive X-ray diffraction experiments were used to investigate the structural organization of cationic nanoemulsion/oligonucleotide complexes. Oligonucleotides targeting topoisomerase II gene were adsorbed on cationic nanoemulsions obtained by means of spontaneous emulsification procedure. Topographical analysis by atomic force microscopy allowed the observation of the nanoemulsion/oligonucleotide complexes through three-dimensional high-resolution images. Flattening of the oil droplets was observed, which was reduced in the complexes obtained at high amount of adsorbed oligonucleotides. In such conditions, complexes exhibit droplet size in the 600nm range. The oligonucleotides molecules were detected on the surface of the droplets, preventing their fusion during aggregation. A lamellar structure organization was identified by energy dispersive X-ray diffraction experiments. The presence of the nucleic acid molecules led to a disorganization of the lipid arrangement and an expansion in the lattice spacing, which was proportional to the amount of oligonucleotides added.

  20. Scalable amplification of strand subsets from chip-synthesized oligonucleotide libraries

    PubMed Central

    Schmidt, Thorsten L.; Beliveau, Brian J.; Uca, Yavuz O.; Theilmann, Mark; Da Cruz, Felipe; Wu, Chao-Ting; Shih, William M.

    2015-01-01

    Synthetic oligonucleotides are the main cost factor for studies in DNA nanotechnology, genetics and synthetic biology, which all require thousands of these at high quality. Inexpensive chip-synthesized oligonucleotide libraries can contain hundreds of thousands of distinct sequences, however only at sub-femtomole quantities per strand. Here we present a selective oligonucleotide amplification method, based on three rounds of rolling-circle amplification, that produces nanomole amounts of single-stranded oligonucleotides per millilitre reaction. In a multistep one-pot procedure, subsets of hundreds or thousands of single-stranded DNAs with different lengths can selectively be amplified and purified together. These oligonucleotides are used to fold several DNA nanostructures and as primary fluorescence in situ hybridization probes. The amplification cost is lower than other reported methods (typically around US$ 20 per nanomole total oligonucleotides produced) and is dominated by the use of commercial enzymes. PMID:26567534

  1. [Isolation of oligonucleotides from partial hydrolysates of DNA using template chromatography].

    PubMed

    Schott, H; Schrade, H; Watzlawick, H

    1984-03-02

    Purine oligonucleotides are adsorbed at 0 degree C on poly(vinyl alcohol)-p(dC)n-DEAE-cellulose, and pyrimidine oligonucleotides on oligo(guanylic acid) gel according to the base-pairing mechanism, if their sequences contain at least three or more homologous, consecutive guanylic or cytidylic moieties. By increasing the temperature all base-paired oligonucleotides are desorbed. With this template chromatography mixtures of defined purine- or pyrimidine oligonucleotides could be isolated from fractionated partial hydrolyzates of herring sperm DNA. Afterwards these mixtures are rechromatographed on QAE-Sephadex and/or Nucleosil C18. Using this approach oligonucleotides up to nine monomer units can be isolated either as single substances or as mixtures with defined composition on a preparative scale, which would be not possible with the already existing separation procedures when partial hydrolyzates of herring sperm DNA as starting material are used. Purity and sequence of the isolated oligonucleotides are determined by the "fingerprint" method.

  2. Polyamine-oligonucleotide conjugates: a promising direction for nucleic acid tools and therapeutics.

    PubMed

    Menzi, Mirjam; Lightfoot, Helen L; Hall, Jonathan

    2015-01-01

    Chemical modification and/or the conjugation of small functional molecules to oligonucleotides have significantly improved their biological and biophysical properties, addressing issues such as poor cell penetration, stability to nucleases and low affinity for their targets. Here, the authors review the literature reporting on the biophysical, biochemical and biological properties of one particular class of modification - polyamine-oligonucleotide conjugates. Naturally derived and synthetic polyamines have been grafted onto a variety of oligonucleotide formats, including antisense oligonucleotides and siRNAs. In many cases this has had beneficial effects on their properties such as target hybridization, nuclease resistance, cellular uptake and activity. Polyamine-oligonucleotide conjugation, therefore, represents a promising direction for the further development of oligonucleotide-based therapeutics and tools.

  3. Chemopreventive Agents from Physalis minima Function as Michael Reaction Acceptors.

    PubMed

    Men, Ruizhi; Li, Ning; Ding, Chihong; Tang, Yingzhan; Xing, Yachao; Ding, Wanjing; Ma, Zhongjun

    2016-05-01

    The fruits of some varieties of genus Physalis have been used as delicious fruits and functional food in the Northeast of China. To reveal the functional material basis, we performed bioactivity-guided phytochemical research and chemopreventive effect assay of the constituents from Physalis minima. It was demonstrated that the ethyl acetate extract of P. minima L. (EEPM) had potential quinone reductase (QR) inducing activity with induction ratio (IR, QR induction activity) value of 1.47 ± 0.24, and glutathione binding property as potential Michael reaction acceptors (with an α, β-unsaturated ketone moiety). Furthermore, bioactivity-guided phytochemical research led eight compounds (1-8), which were elucidated as 3-isopropyl-5-acetoxycyclohexene-2-one-1 (1), isophysalin B (2), physalin G (3), physalin D (4), physalin I (5), physordinose B (6), stigmasterol-3-O-β-D-glucopyranoside (7) and 5α-6β-dihydroxyphysalin R (8) on the basis of nuclear magnetic resonance spectroscopy analyses and HRESIMS. Then, isophysalin B (2) and physordinose B (6) showed significant QR inducing activity with IR value of 2.80 ± 0.19 and 2.38 ± 0.46, respectively. An ultra-performance liquid chromatographic method with glutathione as the substrate was used to detect the Michael reaction acceptors in extracts of Physalis minima (EPM)We investigated the chemical constituents of EPM guided by biological activity methodIsophysalin B (1) and physordinose B (6) showed strong quinone reductase inducing activity with induction ratio values of 2.80 ± 0.19 and 2.38 ± 0.46This study generated useful information for consumers and many encourage researchers to utilize edible fruits from Physalis as a source of phytochemicals Abbreviations used: EPM: Extracts of Physalis minima, EEPM: Ethyl acetate extract of Physalis minima L., GSH: Glutathione, MRAs: Michael reaction acceptors, QR: Quinone reductase.

  4. Chemopreventive Agents from Physalis minima Function as Michael Reaction Acceptors

    PubMed Central

    Men, Ruizhi; Li, Ning; Ding, Chihong; Tang, Yingzhan; Xing, Yachao; Ding, Wanjing; Ma, Zhongjun

    2016-01-01

    Background: The fruits of some varieties of genus Physalis have been used as delicious fruits and functional food in the Northeast of China. Materials and Methods: To reveal the functional material basis, we performed bioactivity-guided phytochemical research and chemopreventive effect assay of the constituents from Physalis minima. Results: It was demonstrated that the ethyl acetate extract of P. minima L. (EEPM) had potential quinone reductase (QR) inducing activity with induction ratio (IR, QR induction activity) value of 1.47 ± 0.24, and glutathione binding property as potential Michael reaction acceptors (with an α, β-unsaturated ketone moiety). Furthermore, bioactivity-guided phytochemical research led eight compounds (1–8), which were elucidated as 3-isopropyl-5-acetoxycyclohexene-2-one-1 (1), isophysalin B (2), physalin G (3), physalin D (4), physalin I (5), physordinose B (6), stigmasterol-3-O-β-D-glucopyranoside (7) and 5α-6β-dihydroxyphysalin R (8) on the basis of nuclear magnetic resonance spectroscopy analyses and HRESIMS. Then, isophysalin B (2) and physordinose B (6) showed significant QR inducing activity with IR value of 2.80 ± 0.19 and 2.38 ± 0.46, respectively. SUMMARY An ultra-performance liquid chromatographic method with glutathione as the substrate was used to detect the Michael reaction acceptors in extracts of Physalis minima (EPM)We investigated the chemical constituents of EPM guided by biological activity methodIsophysalin B (1) and physordinose B (6) showed strong quinone reductase inducing activity with induction ratio values of 2.80 ± 0.19 and 2.38 ± 0.46This study generated useful information for consumers and many encourage researchers to utilize edible fruits from Physalis as a source of phytochemicals Abbreviations used: EPM: Extracts of Physalis minima, EEPM: Ethyl acetate extract of Physalis minima L., GSH: Glutathione, MRAs: Michael reaction acceptors, QR: Quinone reductase. PMID:27279713

  5. Developing mixed films of immobilized oligonucleotides and quantum dots for the multiplexed detection of nucleic acid hybridization using a combination of fluorescence resonance energy transfer and direct excitation of fluorescence.

    PubMed

    Algar, W Russ; Krull, Ulrich J

    2010-04-20

    Methods have been developed for the simultaneous and selective detection of three target nucleic acid sequences based on mixed films of immobilized quantum dots (QDs) and oligonucleotide probes. CdSe/ZnS QDs were immobilized on optical fibers and conjugated with mixtures of different probe oligonucleotides. Hybridization events were detected using a combination of fluorescence from direct excitation and fluorescence sensitized by resonance energy transfer (FRET). A sandwich assay format was used to associate dye labeled reporter oligonucleotides with probe-target hybrids formed at the surface of the optical fiber. One detection channel utilized direct excitation of Pacific Blue and the two other detection channels were based on FRET. In one strategy, green emitting QDs were used as donors with Cy3 and Rhodamine Red-X acceptors. In a second strategy, green and red emitting QDs were coimmobilized and used as donors with Cy3 and Alexa Fluor 647 acceptors, respectively. Selective three-plex detection was demonstrated with both strategies. Several key design criteria that were explored to optimize the relative signal magnitude between channels included: the ratio of probe associated with direct excitation versus probes associated with FRET; the relative amounts of each FRET probe and corresponding spectral overlap; and the photoluminescence ratio between immobilized green and red emitting QDs (where applicable). Careful selection of probe sequences and lengths were important for the discrimination of single nucleotide polymorphisms in one channel without suppressing binding of target in the other two channels. This work provides a basis for the development of multiplexed biosensors that are ensemble compatible and do not require discrete sensor elements, spatial registration, sorting technology, or single molecule spectroscopy.

  6. Identification of sequence motifs in oligonucleotides whose presence is correlated with antisense activity.

    PubMed

    Matveeva, O V; Tsodikov, A D; Giddings, M; Freier, S M; Wyatt, J R; Spiridonov, A N; Shabalina, S A; Gesteland, R F; Atkins, J F

    2000-08-01

    Design of antisense oligonucleotides targeting any mRNA can be much more efficient when several activity-enhancing motifs are included and activity-decreasing motifs are avoided. This conclusion was made after statistical analysis of data collected from >1000 experiments with phosphorothioate-modified oligonucleotides. Highly significant positive correlation between the presence of motifs CCAC, TCCC, ACTC, GCCA and CTCT in the oligonucleotide and its antisense efficiency was demonstrated. In addition, negative correlation was revealed for the motifs GGGG, ACTG, AAA and TAA. It was found that the likelihood of activity of an oligonucleotide against a desired mRNA target is sequence motif content dependent.

  7. Identification of sequence motifs in oligonucleotides whose presence is correlated with antisense activity

    PubMed Central

    Matveeva, O. V.; Tsodikov, A. D.; Giddings, M.; Freier, S. M.; Wyatt, J. R.; Spiridonov, A. N.; Shabalina, S. A.; Gesteland, R. F.; Atkins, J. F.

    2000-01-01

    Design of antisense oligonucleotides targeting any mRNA can be much more efficient when several activity-enhancing motifs are included and activity-decreasing motifs are avoided. This conclusion was made after statistical analysis of data collected from >1000 experiments with phosphorothioate-modified oligonucleotides. Highly significant positive correlation between the presence of motifs CCAC, TCCC, ACTC, GCCA and CTCT in the oligonucleotide and its antisense efficiency was demonstrated. In addition, negative correlation was revealed for the motifs GGGG, ACTG, AAA and TAA. It was found that the likelihood of activity of an oligonucleotide against a desired mRNA target is sequence motif content dependent. PMID:10908347

  8. New strategies for cyclization and bicyclization of oligonucleotides by click chemistry assisted by microwaves.

    PubMed

    Lietard, Jory; Meyer, Albert; Vasseur, Jean-Jacques; Morvan, François

    2008-01-04

    The synthesis of cyclic, branched, and bicyclic oligonucleotides was performed by copper-catalyzed azide-alkyne cycloaddition assisted by microwaves in solution and on solid support. For that purpose, new phosphoramidite building blocks and new solid supports were designed to introduce alkyne and bromo functions into the same oligonucleotide by solid-phase synthesis on a DNA synthesizer. The bromine atom was then substituted by sodium azide to yield azide oligonucleotides. Cyclizations were found to be more efficient in solution than on solid support. This method allowed the efficient preparation of cyclic (6- to 20-mers), branched (with one or two dangling sequences), and bicyclic (2 x 10-mers) oligonucleotides.

  9. Use of inherently conducting polymers and pulsed amperometry in flow injection analysis to detect oligonucleotides.

    PubMed

    Wu, Yanzhe; Moulton, Simon E; Too, Chee O; Wallace, Gordon G; Zhou, Dezhi

    2004-07-01

    Pulsed amperometry has been used to detect and discriminate between different base-pair oligonucleotides using flow injection analysis with polypyrrole modified electrodes. Oligonucleotides with 20-repeat units were immobilized as the sole counter anion during polymerisation of pyrrole onto a glassy carbon (GC) electrode. The modified electrode was then used in a flow injection analysis (FIA) set-up to selectively detect complementary oligonucleotides. Results showed that complementary oligo(dG)(20) and non-complementary oligonucleotides can be distinguished by using the oligo(dC)(20) modified electrode.

  10. Inhibition of DNA Binding Proteins by Oligonucleotide-Directed Triple Helix Formation

    NASA Astrophysics Data System (ADS)

    Maher, Louis J.; Wold, Barbara; Dervan, Peter B.

    1989-08-01

    Oligonucleotides that bind to duplex DNA in a sequence-specific manner by triple helix formation offer an approach to the experimental manipulation of sequence-specific protein binding. Micromolar concentrations of pyrimidine oligodeoxyribonucleotides are shown to block recognition of double helical DNA by prokaryotic modifying enzymes and a eukaryotic transcription factor at a homopurine target site. Inhibition is sequence-specific. Oligonucleotides containing 5-methylcytosine provide substantially more efficient inhibition than oligonucleotides containing cytosine. The results have implications for gene-specific repression by oligonucleotides or their analogs.

  11. Diels-Alder cycloadditions in water for the straightforward preparation of peptide–oligonucleotide conjugates

    PubMed Central

    Marchán, Vicente; Ortega, Samuel; Pulido, Daniel; Pedroso, Enrique; Grandas, Anna

    2006-01-01

    The Diels-Alder reaction between diene-modified oligonucleotides and maleimide-derivatized peptides afforded peptide–oligonucleotide conjugates with high purity and yield. Synthesis of the reagents was easily accomplished by on-column derivatization of the corresponding peptides and oligonucleotides. The cycloaddition reaction was carried out in mild conditions, in aqueous solution at 37°C. The speed of the reaction was found to vary depending on the size of the reagents, but it can be completed in 8–10 h by reacting the diene-oligonucleotide with a small excess of maleimide-peptide. PMID:16478710

  12. [Dynamics of charge transfer along an oligonucleotide at finite temperature].

    PubMed

    Lakhno, V D; Fialko, N S

    2004-01-01

    The quantum-statistical approach was used to describe the charge transfer in nucleotide sequences. The results of numerical modeling for hole transfer in the GTTGGG sequence with background temperature noise are given. It was shown that, since guanine has an oxidation potential lower than thymine, the hole created at the G donor in this sequence passes through the thymine barrier into the guanine triplet (acceptor) at a time of approximately 10 ps at a temperature of 37 degrees C.

  13. Domestic phosphate deposits

    USGS Publications Warehouse

    McKelvey, V.E.; Cathcart, J.B.; Altschuler, Z.S.; Swanson, R.W.; Lutz, Katherine

    1953-01-01

    Most of the worlds phosphate deposits can be grouped into six types: 1) igneous apatite deposits; 2) marine phosphorites; 3) residual phosphorites; 4) river pebble deposits; 5) phosphatized rock; and 6) guano. The igneous apatites and marine phosphorites form deposits measurable in millions or billions of tons; the residual deposits are measurable in thousands or millions; and the other types generally only in thousands of tons. Igneous apatite deposits have been mined on a small scale in New York, New Jersey, and Virginia. Marine phosphorites have been mined in Montana, Idaho, Utah, Wyoming, Arkansas, Tennessee, North Carolina, South Carolina, Georgia, and Florida. Residual phosphorites have been mined in Tennessee, Pennsylvania, and Florida. River pebble has been produced in South Carolina and Florida; phosphatized rock in Tennessee and Florida; and guano in New Mexico and Texas. Present production is limited almost entirely to Florida, Tennessee, Montana, Idaho, and Wyoming. Incomplete but recently partly revised estimates indicate the presence of about 5 billion tons of phosphate deposits in the United States that is minable under present economic conditions. Deposits too lean in quality or thickness to compete with those in the western and southeastern fields probably contain tens of billions of tons.

  14. 2-O-α-D-Glucosylglycerol Phosphorylase from Bacillus selenitireducens MLS10 Possessing Hydrolytic Activity on β-D-Glucose 1-Phosphate

    PubMed Central

    Nihira, Takanori; Saito, Yuka; Ohtsubo, Ken’ichi; Nakai, Hiroyuki; Kitaoka, Motomitsu

    2014-01-01

    The glycoside hydrolase family (GH) 65 is a family of inverting phosphorylases that act on α-glucosides. A GH65 protein (Bsel_2816) from Bacillus selenitireducens MLS10 exhibited inorganic phosphate (Pi)-dependent hydrolysis of kojibiose at the rate of 0.43 s−1. No carbohydrate acted as acceptor for the reverse phosphorolysis using β-d-glucose 1-phosphate (βGlc1P) as donor. During the search for a suitable acceptor, we found that Bsel_2816 possessed hydrolytic activity on βGlc1P with a kcat of 2.8 s−1; moreover, such significant hydrolytic activity on sugar 1-phosphate had not been reported for any inverting phosphorylase. The H218O incorporation experiment and the anomeric analysis during the hydrolysis of βGlc1P revealed that the hydrolysis was due to the glucosyl-transferring reaction to a water molecule and not a phosphatase-type reaction. Glycerol was found to be the best acceptor to generate 2-O-α-d-glucosylglycerol (GG) at the rate of 180 s−1. Bsel_2816 phosphorolyzed GG through sequential Bi-Bi mechanism with a kcat of 95 s−1. We propose 2-O-α-d-glucopyranosylglycerol: phosphate β-d-glucosyltransferase as the systematic name and 2-O-α-d-glucosylglycerol phosphorylase as the short name for Bsel_2816. This is the first report describing a phosphorylase that utilizes polyols, and not carbohydrates, as suitable acceptor substrates. PMID:24466148

  15. Perylene-Diimide Based Donor-Acceptor-Donor Type Small-Molecule Acceptors for Solution-Processable Organic Solar Cells

    NASA Astrophysics Data System (ADS)

    Ganesamoorthy, Ramasamy; Vijayaraghavan, Rajagopalan; Sakthivel, Pachagounder

    2017-08-01

    Development of nonfullerene acceptors plays an important role in the commercial availability of plastic solar cells. We report herein synthesis of bay-substituted donor-acceptor-donor (D-A-D)-type perylene diimide (PDI)-based small molecules (SM-1 to SM-4) by Suzuki coupling method and their use as acceptors in bulk heterojunction organic solar cells (BHJ-OSCs) with poly(3-hexylthiophene) (P3HT) polymer donor. We varied the number of electron-rich thiophene units and the solubilizing side chains and also evaluated the optical and electrochemical properties of the small molecules. The synthesized small molecules were confirmed by Fourier-transform infrared (FT-IR) spectroscopy, nuclear magnetic resonance (NMR) spectroscopy, and high-resolution mass spectroscopy (HR-MS). The small molecules showed extensive and strong absorption in the ultraviolet-visible (UV-Vis) region up to 750 nm, with bandgap (E_{{g}}^{{opt}} ) reduced below <2 eV. The energy levels of small molecules SM-1 to SM-4 were suitable for use as electron-accepting materials. The small molecules showed good thermal stability up to 300°C. BHJ-OSCs with SM-1 and P3HT polymer donor showed maximum power conversion efficiency (PCE) of 0.19% with V oc of 0.30 V, J sc of 1.72 mA cm-2, and fill factor (FF) of 37%. The PCE decreased with the number of thiophene units. The PCE of SM-2 was lower than that of SM-1. This difference in PCE can be explained by the higher aggregation tendency of the bithiophene compared with the thiophene unit. Introduction of the solubilizing group in the bay position increased the aggregation property, leading to much lower PCE than for the small molecules without solubilizing group.

  16. New oligonucleotide microarray for rapid diagnosis of avian viral diseases.

    PubMed

    Sultankulova, Kulyaisan T; Kozhabergenov, Nurlan S; Strochkov, Vitaliy M; Burashev, Yerbol D; Shorayeva, Kamshat A; Chervyakova, Olga V; Rametov, Nurkuisa M; Sandybayev, Nurlan T; Sansyzbay, Abylay R; Orynbayev, Mukhit B

    2017-04-05

    We developed a new oligonucleotide microarray comprising 16 identical subarrays for simultaneous rapid detection of avian viruses: avian influenza virus (AIV), Newcastle disease virus (NDV), infection bronchitis virus (IBV), and infectious bursal disease virus (IBDV) in single- and mixed-virus infections. The objective of the study was to develop an oligonucleotide microarray for rapid diagnosis of avian diseases that would be used in the course of mass analysis for routine epidemiological surveillance owing to its ability to test one specimen for several infections. The paper describes the technique for rapid and simultaneous diagnosis of avian diseases such as avian influenza, Newcastle disease, infectious bronchitis and infectious bursal disease with use of oligonucleotide microarray, conditions for hybridization of fluorescent-labelled viral cDNA on the microarray and its specificity tested with use of AIV, NDV, IBV, IBDV strains as well as biomaterials from poultry. Sensitivity and specificity of the developed microarray was evaluated with use of 122 specimens of biological material: 44 cloacal swabs from sick birds and 78 tissue specimens from dead wild and domestic birds, as well as with use of 15 AIV, NDV, IBV and IBDV strains, different in their origin, epidemiological and biological characteristics (RIBSP Microbial Collection). This microarray demonstrates high diagnostic sensitivity (99.16% within 95% CI limits 97.36-100%) and specificity (100%). Specificity of the developed technique was confirmed by direct sequencing of NP and M (AIV), VP2 (IBDV), S1 (IBV), NP (NDV) gene fragments. Diagnostic effectiveness of the developed DNA microarray is 99.18% and therefore it can be used in mass survey for specific detection of AIV, NDV, IBV and IBDV circulating in the region in the course of epidemiological surveillance. Rather simple method for rapid diagnosis of avian viral diseases that several times shortens duration of assay versus classical diagnostic

  17. In vivo site-directed mutagenesis using oligonucleotides.

    PubMed

    Storici, F; Lewis, L K; Resnick, M A

    2001-08-01

    Functional characterization of the genes of higher eukaryotes has been aided by their expression in model organisms and by analyzing site-specific changes in homologous genes in model systems such as the yeast Saccharomyces cerevisiae. Modifying sequences in yeast or other organisms such that no heterologous material is retained requires in vitro mutagenesis together with subcloning. PCR-based procedures that do not involve cloning are inefficient or require multistep reactions that increase the risk of additional mutations. An alternative approach, demonstrated in yeast, relies on transformation with an oligonucleotide, but the method is restricted to the generation of mutants with a selectable phenotype. Oligonucleotides, when combined with gap repair, have also been used to modify plasmids in yeast; however, this approach is limited by restriction-site availability. We have developed a mutagenesis approach in yeast based on transformation by unpurified oligonucleotides that allows the rapid creation of site-specific DNA mutations in vivo. A two-step, cloning-free process, referred to as delitto perfetto, generates products having only the desired mutation, such as a single or multiple base change, an insertion, a small or a large deletion, or even random mutations. The system provides for multiple rounds of mutation in a window up to 200 base pairs. The process is RAD52 dependent, is not constrained by the distribution of naturally occurring restriction sites, and requires minimal DNA sequencing. Because yeast is commonly used for random and selective cloning of genomic DNA from higher eukaryotes such as yeast artificial chromosomes, the delitto perfetto strategy also provides an efficient way to create precise changes in mammalian or other DNA sequences.

  18. Avian oncogenic virus differential diagnosis in chickens using oligonucleotide microarray.

    PubMed

    Wang, Lih-Chiann; Huang, Dean; Pu, Chang-En; Wang, Ching-Ho

    2014-12-15

    Avian oncogenic viruses include the avian leukosis virus (ALV), reticuloendotheliosis virus (REV) and Marek's disease virus (MDV). Multiple oncogenic viral infections are frequently seen, with even Marek's disease vaccines reported to be contaminated with ALV and REV. The gross lesions caused by avian oncogenic viruses often overlap, making differentiation diagnosis based on histopathology difficult. The objective of this study is to develop a rapid approach to simultaneously differentiate, subgroup and pathotype the avian oncogenic viruses. The oligonucleotide microarray was employed in this study. Particular DNA sequences were recognized using specific hybridization between the DNA target and probe on the microarray, followed with colorimetric development through enzyme reaction. With 10 designed probes, ALV-A, ALV-E, ALV-J, REV, MDV pathogenic and vaccine strains were clearly discriminated on the microarray with the naked eyes. The detection limit was 27 copy numbers, which was 10-100 times lower than multiplex PCR. Of 102 field samples screened using the oligonucleotide microarray, 32 samples were positive for ALV-E, 17 samples were positive for ALV-J, 6 samples were positive for REV, 4 samples were positive for MDV, 7 samples were positive for both ALV-A and ALV-E, 5 samples were positive for ALV-A, ALV-E and ALV-J, one sample was positive for both ALV-J and MDV, and 3 samples were positive for both REV and MDV. The oligonucleotide microarray, an easy-to-use, high-specificity, high-sensitivity and extendable assay, presents a potent technique for rapid differential diagnosis of avian oncogenic viruses and the detection of multiple avian oncogenic viral infections under field conditions. Copyright © 2014 Elsevier B.V. All rights reserved.

  19. Relaxed acceptor site specificity of bacterial oligosaccharyltransferase in vivo.

    PubMed

    Schwarz, Flavio; Lizak, Christian; Fan, Yao-Yun; Fleurkens, Susanna; Kowarik, Michael; Aebi, Markus

    2011-01-01

    A number of proteobacteria carry the genetic information to perform N-linked glycosylation, but only the protein glycosylation (pgl) pathway of Campylobacter jejuni has been studied to date. Here, we report that the pgl gene cluster of Campylobacter lari encodes for a functional glycosylation machinery that can be reconstituted in Escherichia coli. We determined that the N-glycan produced in this system consisted of a linear hexasaccharide. We found that the oligosaccharyltransferase (OST) of C. lari conserved a predominant specificity for the primary sequence D/E-X(-1)-N-X(+1)-S/T (where X(-1) and X(+1) can be any amino acid but proline). At the same time, we observed that this enzyme exhibited a relaxed specificity toward the acceptor site and modified asparagine residues of a protein at sequences DANSG and NNNST. Moreover, C. lari pgl glycosylated a native E. coli protein. Bacterial N-glycosylation appears as a useful tool to establish a molecular description of how single-subunit OSTs perform selection of glycosyl acceptor sites.

  20. Donor-acceptor complexation and dehydrogenation chemistry of aminoboranes.

    PubMed

    Malcolm, Adam C; Sabourin, Kyle J; McDonald, Robert; Ferguson, Michael J; Rivard, Eric

    2012-12-03

    A series of formal donor-acceptor adducts of aminoborane (H(2)BNH(2)) and its N-substituted analogues (H(2)BNRR') were prepared: LB-H(2)BNRR'(2)-BH(3) (LB = DMAP, IPr, IPrCH(2) and PCy(3); R and R' = H, Me or tBu; IPr = [(HCNDipp)(2)C:] and Dipp = 2,6-iPr(2)C(6)H(3)). To potentially access complexes of molecular boron nitride, LB-BN-LA (LA = Lewis acid), preliminary dehydrogenation chemistry involving the parent aminoborane adducts LB-H(2)BNH(2)-BH(3) was investigated using [Rh(COD)Cl](2), CuBr, and NiBr(2) as dehydrogenation catalysts. In place of isolating the intended dehydrogenated BN donor-acceptor complexes, the formation of borazine was noted as a major product. Attempts to prepare the fluoroarylborane-capped aminoborane complexes, LB-H(2)BNH(2)-B(C(6)F(5))(3), are also described.

  1. Dissimilatory reduction of extracellular electron acceptors in anaerobic respiration.

    PubMed

    Richter, Katrin; Schicklberger, Marcus; Gescher, Johannes

    2012-02-01

    An extension of the respiratory chain to the cell surface is necessary to reduce extracellular electron acceptors like ferric iron or manganese oxides. In the past few years, more and more compounds were revealed to be reduced at the surface of the outer membrane of Gram-negative bacteria, and the list does not seem to have an end so far. Shewanella as well as Geobacter strains are model organisms to discover the biochemistry that enables the dissimilatory reduction of extracellular electron acceptors. In both cases, c-type cytochromes are essential electron-transferring proteins. They make the journey of respiratory electrons from the cytoplasmic membrane through periplasm and over the outer membrane possible. Outer membrane cytochromes have the ability to catalyze the last step of the respiratory chains. Still, recent discoveries provided evidence that they are accompanied by further factors that allow or at least facilitate extracellular reduction. This review gives a condensed overview of our current knowledge of extracellular respiration, highlights recent discoveries, and discusses critically the influence of different strategies for terminal electron transfer reactions.

  2. Glutathione Adduct Patterns of Michael-Acceptor Carbonyls.

    PubMed

    Slawik, Christian; Rickmeyer, Christiane; Brehm, Martin; Böhme, Alexander; Schüürmann, Gerrit

    2017-02-22

    Glutathione (GSH) has so far been considered to facilitate detoxification of soft organic electrophiles through covalent binding at its cysteine (Cys) thiol group, followed by stepwise catalyzed degradation and eventual elimination along the mercapturic acid pathway. Here we show that in contrast to expectation from HSAB theory, Michael-acceptor ketones, aldehydes and esters may form also single, double and triple adducts with GSH involving β-carbon attack at the much harder N-terminus of the γ-glutamyl (Glu) unit of GSH. In particular, formation of the GSH-N single adduct contradicts the traditional view that S alkylation always forms the initial reaction of GSH with Michael-acceptor carbonyls. To this end, chemoassay analyses of the adduct formation of GSH with nine α,β-unsaturated carbonyls employing high performance liquid chromatography and tandem mass spectrometry have been performed. Besides enriching the GSH adductome and potential biomarker applications, electrophilic N-terminus functio-nalization is likely to impair GSH homeostasis substantially through blocking the γ-glutamyl transferase catalysis of the first breakdown step of modified GSH, and thus its timely reconstitution. The discussion includes a comparison with cyclic adducts of GSH and furan metabolites as reported in literature, and quantum chemically calculated thermodynamics of hard-hard, hard-soft and soft-soft adducts.

  3. Conductivity of a Weyl semimetal with donor and acceptor impurities

    NASA Astrophysics Data System (ADS)

    Rodionov, Ya. I.; Syzranov, S. V.

    2015-05-01

    We study transport in a Weyl semimetal with donor and acceptor impurities. At sufficiently high temperatures transport is dominated by electron-electron interactions, while the low-temperature resistivity comes from the scattering of quasiparticles on screened impurities. Using the diagrammatic technique, we calculate the conductivity σ (T ,ω ,nA,nD) in the impurities-dominated regime as a function of temperature T , frequency ω , and the concentrations nA and nD of acceptors and donors and discuss the crossover behavior between the regimes of low and high temperatures and impurity concentrations. In a sufficiently compensated material [| nA-nD|≪ (nA+nD) ] with a small effective fine structure constant α ,σ (ω ,T ) ∝T2/(T-2-i ω .const) in a wide interval of temperatures. For very low temperatures, or in the case of an uncompensated material, the transport is effectively metallic. We discuss experimental conditions necessary for realizing each regime.

  4. Donator acceptor map for carotenoids, melatonin and vitamins.

    PubMed

    Martínez, Ana; Rodríguez-Gironés, Miguel A; Barbosa, Andrés; Costas, Miguel

    2008-09-25

    Bright yellow and red colors in animals and plants are assumed to be caused by carotenoids (CAR). In animals, these pigments are deposited in scales, skin and feathers. Together with other naturally occurring and colorless substances such as melatonin and vitamins, they are considered antioxidants due to their free-radical-scavenging properties. However, it would be better to refer to them as "antiradicals", an action that can take place either donating or accepting electrons. In this work we present quantum chemical calculations for several CAR and some colorless antioxidants, such as melatonin and vitamins A, C and E. The antiradical capacity of these substances is determined using vertical ionization energy (I), electron affinity (A), the electrodonating power (omega(-)) and the electroaccepting power (omega(+)). Using fluor and sodium as references, electron acceptance (R(a)) and electron donation (R(d)) indexes are defined. A plot of R(d) vs R(a) provides a donator acceptor map (DAM) useful to classify any substance regarding its electron donating-accepting capability. Using this DAM, a qualitative comparison among all the studied compounds is presented. According to R(d) values, vitamin E is the most effective antiradical in terms of its electron donor capacity, while the most effective antiradical in terms of its electron acceptor capacity, R(a), is astaxanthin, the reddest CAR. These results may be helpful for understanding the role played by naturally occurring pigments, acting as radical scavengers either donating or accepting electrons.

  5. Evaluation of Manganese Phosphate Coatings.

    DTIC Science & Technology

    1984-02-01

    84003 _____________ 4 . TTLE and -bitle)5. TYPE OF REPORT & PERIOD COVERED EVALUATION OF MANGANESE PHOSPHATE COATINGS Final 6. PERFORMING ORG. REPORT...rosion resistance of the Endurion phosphate was significantly superior to the 4 . basic manganese phosphate . Endurion phosphate with a Supplementary...OF CONTENTS Page STATEMENT OF THE PROBLEM 1 BACKGROUND 1 APPROACH TO THE PROBLEM 3 RESULTS 4 CONCLUSIONS 7 TABLES I. Falex Wear Life Test Procedure 8

  6. Oligonucleotide primers for PCR amplification of coelomate introns.

    PubMed

    Jarman, Simon N; Ward, Robert D; Elliott, Nicholas G

    2002-09-01

    Abstract Seven novel oligonucleotide primer pairs for polymerase chain reaction amplification of introns from nuclear genes in coelomates were designed and tested. Each pair bound to adjacent exons that are separated by a single intron in most coelomate species. The primer sets amplified introns in species as widely separated by the course of evolution as oysters (Mollusca: Protostoma) and salmon (Chordata: Deuterostoma). Each primer set was tested on a further 6 coelomate species and found to amplify introns in most cases. These primer sets may therefore be useful tools for developing nuclear DNA markers in diverse coelomate species for studies of population genetics, phylogenetics, or genome mapping.

  7. Cardiovascular and Metabolic Effects of ANGPTL3 Antisense Oligonucleotides.

    PubMed

    Graham, Mark J; Lee, Richard G; Brandt, Teresa A; Tai, Li-Jung; Fu, Wuxia; Peralta, Raechel; Yu, Rosie; Hurh, Eunju; Paz, Erika; McEvoy, Bradley W; Baker, Brenda F; Pham, Nguyen C; Digenio, Andres; Hughes, Steven G; Geary, Richard S; Witztum, Joseph L; Crooke, Rosanne M; Tsimikas, Sotirios

    2017-07-20

    Epidemiologic and genomewide association studies have linked loss-of-function variants in ANGPTL3, encoding angiopoietin-like 3, with low levels of plasma lipoproteins. We evaluated antisense oligonucleotides (ASOs) targeting Angptl3 messenger RNA (mRNA) for effects on plasma lipid levels, triglyceride clearance, liver triglyceride content, insulin sensitivity, and atherosclerosis in mice. Subsequently, 44 human participants (with triglyceride levels of either 90 to 150 mg per deciliter [1.0 to 1.7 mmol per liter] or >150 mg per deciliter, depending on the dose group) were randomly assigned to receive subcutaneous injections of placebo or an antisense oligonucleotide targeting ANGPTL3 mRNA in a single dose (20, 40, or 80 mg) or multiple doses (10, 20, 40, or 60 mg per week for 6 weeks). The main end points were safety, side-effect profile, pharmacokinetic and pharmacodynamic measures, and changes in levels of lipids and lipoproteins. The treated mice had dose-dependent reductions in levels of hepatic Angptl3 mRNA, Angptl3 protein, triglycerides, and low-density lipoprotein (LDL) cholesterol, as well as reductions in liver triglyceride content and atherosclerosis progression and increases in insulin sensitivity. After 6 weeks of treatment, persons in the multiple-dose groups had reductions in levels of ANGPTL3 protein (reductions of 46.6 to 84.5% from baseline, P<0.01 for all doses vs. placebo) and in levels of triglycerides (reductions of 33.2 to 63.1%), LDL cholesterol (1.3 to 32.9%), very-low-density lipoprotein cholesterol (27.9 to 60.0%), non-high-density lipoprotein cholesterol (10.0 to 36.6%), apolipoprotein B (3.4 to 25.7%), and apolipoprotein C-III (18.9 to 58.8%). Three participants who received the antisense oligonucleotide and three who received placebo reported dizziness or headache. There were no serious adverse events. Oligonucleotides targeting mouse Angptl3 retarded the progression of atherosclerosis and reduced levels of atherogenic lipoproteins in

  8. Oligonucleotide microarray for subtyping of influenza A viruses

    NASA Astrophysics Data System (ADS)

    Klotchenko, S. A.; Vasin, A. V.; Sandybaev, N. T.; Plotnikova, M. A.; Chervyakova, O. V.; Smirnova, E. A.; Kushnareva, E. V.; Strochkov, V. M.; Taylakova, E. T.; Egorov, V. V.; Koshemetov, J. K.; Kiselev, O. I.; Sansyzbay, A. R.

    2012-02-01

    Influenza is one of the most widespread respiratory viral diseases, infecting humans, horses, pigs, poultry and some other animal populations. Influenza A viruses (IAV) are classified into subtypes on the basis of the surface hemagglutinin (H1 to H16) and neuraminidase (N1 to N9) glycoproteins. The correct determination of IAV subtype is necessary for clinical and epidemiological studies. In this article we propose an oligonucleotide microarray for subtyping of IAV using universal one-step multisegment RT-PCR fluorescent labeling of viral gene segments. It showed to be an advanced approach for fast detection and identification of IAV.

  9. PCR amplification on microarrays of gel immobilized oligonucleotides

    DOEpatents

    Strizhkov, Boris; Tillib, Sergei; Mikhailovich, Vladimir; Mirzabekov, Andrei

    2003-11-04

    The invention relates two general methods for performing PCR amplification, combined with the detection and analysis of the PCR products on a microchip. In the first method, the amplification occurs both outside and within a plurality of gel pads on a microchip, with at least one oligonucleotide primer immobilized in a gel pad. In the second method, PCR amplification also takes place within gel pads on a microchip, but the pads are surrounded by a hydrophobic liquid such as that which separates the individual gel pads into environments which resemble micro-miniaturized test tubes.

  10. Inhibition Of Molecular And Biological Processes Using Modified Oligonucleotides

    DOEpatents

    Kozyavkin, Sergei A.; Malykh, Andrei G.; Polouchine, Nikolai N.; Slesarev, Alexei I.

    2003-04-15

    A method of inhibiting at least one molecular process in a sample, comprising administering to the sample an oligonucleotide or polynucleotide containing at least one monomeric unit having formula (I): wherein A is an organic moiety, n is at least 1, and each X is independently selected from the group consisting of --NRCOCONu, --NHCOCR.sub.2 CR.sub.2 CONu, --NHCOCR.dbd.CRCONu, and --NHCOSSCONu, wherein each R independently represents H or a substituted or unsubstituted alkyl group, and Nu represents a nucleophile, or a salt of the compound.

  11. Aptamer oligonucleotides as potential therapeutics in hematologic diseases.

    PubMed

    Li, Weibin; Zhao, Meng; Wang, Kaiyu; Yan, Huihui; Lan, XIaopeng

    2017-10-02

    Aptamers are single-stranded DNA or RNA oligonucleotides generated by a novel in vitro selection technique termed Systematic Evolution of Ligands by Exponential Enrichment (SELEX). During the past two decades, various aptamer drugs have been developed and many of them have entered into clinical trials. In the present review, we focus on aptamers as potential therapeutics for hematological diseases, including anemia of chronic inflammation (ACI) and anemia of chronic disease (ACD), hemophilia, thrombotic thrombocytopenic purpura (TTP) or VWD type-2B, and sickle cell disease (SCD), in particular, those that have entered into clinical trials. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  12. Chemically programmed cell adhesion with membrane-anchored oligonucleotides

    PubMed Central

    Selden, Nicholas S.; Todhunter, Michael E.; Jee, Noel Y.; Liu, Jennifer S.; Broaders, Kyle E.; Gartner, Zev J.

    2012-01-01

    Cell adhesion organizes the structures of tissues and mediates their mechanical, chemical, and electrical integration with their surroundings. Here, we describe a strategy for chemically controlling cell adhesion using membrane anchored single-stranded DNA oligonucleotides. The reagents are pure chemical species prepared from phosphoramidites synthesized in a single chemical step from commercially available starting materials. The approach enables rapid, efficient, tunable cell adhesion, independent of proteins or glycans, by facilitating interactions with complementary labeled surfaces or other cells. We demonstrate the utility of this approach by imaging drug-induced changes in the membrane dynamics of non-adherent human cells while chemically immobilized on a passivated glass surface. PMID:22176556

  13. On the rapid deprotection of synthetic oligonucleotides and analogs.

    PubMed Central

    Polushin, N N; Morocho, A M; Chen, B C; Cohen, J S

    1994-01-01

    The efficiency of oligodeoxynucleotide deprotection is greatly enhanced using a combination of: (a) ethanolamine, and especially a mixture of hydrazine, ethanolamine and methanol, in place of the usual aqueous ammonia; (b) tert-butylphenoxyacetyl amino protecting groups, and (c) oxalyl link between the first nucleotide and the polymeric support. The extent of base modification, particularly of C, is shown to be extremely low, and the quality of deprotected oligonucleotides is as high as in the case of ammonia deprotection. This method is also shown to be applicable to the preparation of phosphorothioate and methylphosphonate oligodeoxynucleotides and oligoribonucleotides. Images PMID:8127712

  14. Prodrugs of phosphonates and phosphates: crossing the membrane barrier.

    PubMed

    Wiemer, Andrew J; Wiemer, David F

    2015-01-01

    A substantial portion of metabolism involves transformation of phosphate esters, including pathways leading to nucleotides and oligonucleotides, carbohydrates, isoprenoids and steroids, and phosphorylated proteins. Because the natural substrates bear one or more negative charges, drugs that target these enzymes generally must be charged as well, but small charged molecules can have difficulty traversing the cell membrane by means other than endocytosis. The resulting dichotomy has stimulated a great deal of effort to develop effective prodrugs, compounds that carry little or no charge to enable them to transit biological membranes, but able to release the parent drug once inside the target cell. This chapter presents recent studies on advances in prodrug forms, along with representative examples of their application to marketed and developmental drugs.

  15. Human glucose phosphate isomerase: Exon mapping and gene structure

    SciTech Connect

    Xu, Weiming; Lee, Pauline; Beutler, E.

    1995-10-10

    The structure of the gene for human glucose phosphate isomerase (GPI) has been determined. Three GPI clones were isolated from a human genomic library by using a full-length GPI cDNA probe and were characterized. Oligonucleotides based on the known cDNA sequence were used as primers in amplification and sequence analyses. This led to the identification of the exon-intron junctions. By this approach, 18 exons and 17 introns have been identified. The exons range in size from 44 to 431 nucleotides. The intronic sequences surrounding the exons provide useful information for the identification of mutations that give rise to human GPI deficiency associated with chronic hemolytic anemia. 13 refs., 4 figs., 1 tab.

  16. Prodrugs of phosphonates and phosphates: crossing the membrane barrier

    PubMed Central

    Wiemer, Andrew J.; Wiemer, David F.

    2016-01-01

    A substantial portion of metabolism involves transformation of phosphate esters, including pathways leading to nucleotides and oligonucleotides, carbohydrates, isoprenoids and steroids, and phosphorylated proteins. Because the natural substrates bear one or more negative charges, drugs that target these enzymes generally must be charged as well but small charged molecules can have difficulty traversing the cell membrane other than by endocytosis. The resulting dichotomy has stimulated abundant effort to develop effective prodrugs, compounds that carry little or no charge to enable them to transit biological membranes but then able to release the parent drug once inside the target cell. This chapter will present recent studies on advances in prodrug forms, along with representative examples of their application to marketed and developmental drugs. PMID:25391982

  17. Mapping RNase T1-resistant oligonucleotides of avian tumor virus RNAs: sarcoma-specific oligonucleotides are near the poly(A) end and oligonucleotides common to sarcoma and transformation-defective viruses are at the poly(A) end.

    PubMed Central

    Wang, L H; Duesberg, P; Beemon, K; Vogt, P K

    1975-01-01

    The large RNase T1-resistant oligonucleotides of the nondefective (nd) Rous sarcoma virus (RSV): Prague RSV of subgroup B (PR-B), PR-C and B77 of subgroup C; of their transformation-defective (td0 deletion mutants: td PR-B, td PR-C, and td B77; and of replication-defective (rd) RSV(-) were completely or partially mapped on the 30 to 40S viral RNAs. The location of a given oligonucleotide relative to the poly(A) terminus of the viral RNAs was directly deduced from the smallest size of the poly(A)-tagged RNA fragment from which it could be isolated. Identification of distinct oligonucleotides was based on their location in the electrophoretic/chromatographic fingerprint pattern and on analysis of their RNase A-resistant fragments. The following results were obtained. (i) The number of large oligonucleotides per poly(A)-tagged ffagment increased with increasing size of the fragment. This implies that the genetic map is linear and that a given RNase T1-resistant oligonucleotides has, relative to the poly(A) end, the same location on all 30 to 40S RNA subunits of a given 60 to 70S viral RNA complex, (ii) Three sarcoma-specific oligonucleotides were identified in the RNAs of Pr-B, PR-C and B77 by comparison with the RNAs of the corresponding td viruses... Images PMID:170411

  18. Nicotinamide Adenine Dinucleotide Phosphate-Dependent Formate Dehydrogenase from Clostridium thermoaceticum: Purification and Properties

    PubMed Central

    Andreesen, Jan R.; Ljungdahl, Lars G.

    1974-01-01

    The nicotinamide adenine dinucleotide phosphate (NADP)-dependent formate dehydrogenase in Clostridium thermoaceticum used, in addition to its natural electron acceptor, methyl and benzyl viologen. The enzyme was purified to a specific activity of 34 (micromoles per minute per milligram of protein) with NADP as electron acceptor. Disc gel electrophoresis of the purified enzyme yielded two major and two minor protein bands, and during centrifugation in sucrose gradients two components of apparent molecular weights of 270,000 and 320,000 were obtained, both having formate dehydrogenase activity. The enzyme preparation catalyzed the reduction of riboflavine 5′-phosphate flavine adenine dinucleotide and methyl viologen by using reduced NADP as a source of electrons. It also had reduced NADP oxidase activity. The enzyme was strongly inhibited by cyanide and ethylenediaminetetraacetic acid. It was also inhibited by hypophosphite, an inhibition that was reversed by formate. Sulfite inhibited the activity with NADP but not with methyl viologen as acceptor. The apparent Km at 55 C and pH 7.5 for formate was 2.27 × 10−4 M with NADP and 0.83 × 10−4 with methyl viologen as acceptor. The apparent Km for NADP was 1.09 × 10−4 M and for methyl viologen was 2.35 × 10−3 M. NADP showed substrate inhibition at 5 × 10−3 M and higher concentrations. With NADP as electron acceptor, the enzyme had a broad pH optimum between 7 and 9.5. The apparent temperature optimum was 85 C. In the absence of substrates, the enzyme was stable at 70 C but was rapidly inactivated at temperatures above 73 C. The enzyme was very sensitive to oxygen but was stabilized by thiol-iron complexes and formate. PMID:4154039

  19. Identification of a High Affinity Nuclear Acceptor Site for Estrogen Receptor of Calf Uterus

    PubMed Central

    Puca, Giovanni Alfredo; Sica, Vincenzo; Nola, Ernesto

    1974-01-01

    By means of affinity chromatography, specific nuclear acceptor sites for estradiol receptors are identified in a fraction that can be solubilized from purified nuclei with 2 M NaCl. Interaction between these acceptor sites and crude or partially purified estradiol receptor shows a high association constant (over 109 M). Receptor-acceptor interaction is dependent on physiological concentrations of 17β-estradiol; it is disrupted by high ionic strength. The nuclear acceptor sites appear to be protein in nature and exist in 5- to 10-fold excess over the estrogen binding sites present in the cytosol. Single- or double-stranded DNA does not bind estrogen-receptor complexes. Acceptor sites appear to be associated with basic nuclear proteins as judged by hydroxyapatite chromatography. The nuclear acceptor sites probably represent less than 0.1% of the purified basic proteins from the nucleus. PMID:4362642

  20. The structure and bonding of iron-acceptor pairs in silicon

    SciTech Connect

    Zhao, S.; Assali, L.V.C.; Kimerling, L.C.

    1995-08-01

    The highly mobile interstitial iron and Group III impurities (B, Al, Ga, In) form iron-acceptor pairs in silicon. Based on the migration kinetics and taking host silicon as a dielectric medium, we have simulated the pairing process in a static silicon lattice. Different from the conventional point charge ionic model, our phenomenological calculations include (1) a correction that takes into account valence electron cloud polarization which adds a short range, attractive interaction in the iron-acceptor pair bonding; and (2) silicon lattice relaxation due to the atomic size difference which causes a local strain field. Our model explains qualitatively (1) trends among the iron-acceptor pairs revealing an increase of the electronic state hole emission energy with increasing principal quantum number of acceptor and decreasing pair separation distance; and (2) the stable and metastable sites and configurational symmetries of the iron-acceptor pairs. The iron-acceptor pairing and bonding mechanism is also discussed.

  1. Binding characteristics of homogeneous molecularly imprinted polymers for acyclovir using an (acceptor-donor-donor)-(donor-acceptor-acceptor) hydrogen-bond strategy, and analytical applications for serum samples.

    PubMed

    Wu, Suqin; Tan, Lei; Wang, Ganquan; Peng, Guiming; Kang, Chengcheng; Tang, Youwen

    2013-04-12

    This paper demonstrates a novel approach to assembling homogeneous molecularly imprinted polymers (MIPs) based on mimicking multiple hydrogen bonds between nucleotide bases by preparing acyclovir (ACV) as a template and using coatings grafted on silica supports. (1)H NMR studies confirmed the AAD-DDA (A for acceptor, D for donor) hydrogen-bond array between template and functional monomer, while the resultant monodisperse molecularly imprinted microspheres (MIMs) were evaluated using a binding experiment, high performance liquid chromatography (HPLC), and solid phase extraction. The Langmuir isothermal model and the Langmuir-Freundlich isothermal model suggest that ACV-MIMs have more homogeneous binding sites than MIPs prepared through normal imprinting. In contrast to previous MIP-HPLC columns, there were no apparent tailings for the ACV peaks, and ACV-MIMs had excellent specific binding properties with a Ka peak of 3.44 × 10(5)M(-1). A complete baseline separation is obtained for ACV and structurally similar compounds. This work also successfully used MIMs as a specific sorbent for capturing ACV from serum samples. The detection limit and mean recovery of ACV was 1.8 ng/mL(-1) and 95.6%, respectively, for molecularly imprinted solid phase extraction coupled with HPLC. To our knowledge, this was the first example of MIPs using AAD-DDA hydrogen bonds.

  2. Engineering frontier energy levels in donor-acceptor fluoren-9-ylidene malononitriles versus fluorenones.

    PubMed

    Homnick, Paul J; Tinkham, Jonathan S; Devaughn, Raymond; Lahti, Paul M

    2014-01-16

    Donor-acceptor molecules incorporating fluoren-9-ylidene malononitrile acceptor units conjugated to trimethoxystyrene and/or diarylamine donor units were synthesized, and their electronic spectral properties and electrochemical behaviors were evaluated by comparison to those of the analogous fluorenones. Frontier energy level and optical transition energy trends are explained based on a quantitative, modular donor-acceptor interaction model. A connectivity effect on absorption transition moment strength is also described.

  3. Oligonucleotide microarray for the identification of potential mycotoxigenic fungi

    PubMed Central

    2010-01-01

    Background Mycotoxins are secondary metabolites which are produced by numerous fungi and pose a continuous challenge to the safety and quality of food commodities in South Africa. These toxins have toxicologically relevant effects on humans and animals that eat contaminated foods. In this study, a diagnostic DNA microarray was developed for the identification of the most common food-borne fungi, as well as the genes leading to toxin production. Results A total of 40 potentially mycotoxigenic fungi isolated from different food commodities, as well as the genes that are involved in the mycotoxin synthetic pathways, were analyzed. For fungal identification, oligonucleotide probes were designed by exploiting the sequence variations of the elongation factor 1-alpha (EF-1 α) coding regions and the internal transcribed spacer (ITS) regions of the rRNA gene cassette. For the detection of fungi able to produce mycotoxins, oligonucleotide probes directed towards genes leading to toxin production from different fungal strains were identified in data available in the public domain. The probes selected for fungal identification and the probes specific for toxin producing genes were spotted onto microarray slides. Conclusions The diagnostic microarray developed can be used to identify single pure strains or cultures of potentially mycotoxigenic fungi as well as genes leading to toxin production in both laboratory samples and maize-derived foods offering an interesting potential for microbiological laboratories. PMID:20307326

  4. Gas-phase Dissociation of homo-DNA Oligonucleotides

    NASA Astrophysics Data System (ADS)

    Stucki, Silvan R.; Désiron, Camille; Nyakas, Adrien; Marti, Simon; Leumann, Christian J.; Schürch, Stefan

    2013-12-01

    Synthetic modified oligonucleotides are of interest for diagnostic and therapeutic applications, as their biological stability, pairing selectivity, and binding strength can be considerably increased by the incorporation of unnatural structural elements. Homo-DNA is an oligonucleotide homologue based on dideoxy-hexopyranosyl sugar moieties, which follows the Watson-Crick A-T and G-C base pairing system, but does not hybridize with complementary natural DNA and RNA. Homo-DNA has found application as a bioorthogonal element in templated chemistry applications. The gas-phase dissociation of homo-DNA has been investigated by ESI-MS/MS and MALDI-MS/MS, and mechanistic aspects of its gas-phase dissociation are discussed. Experiments revealed a charge state dependent preference for the loss of nucleobases, which are released either as neutrals or as anions. In contrast to DNA, nucleobase loss from homo-DNA was found to be decoupled from backbone cleavage, thus resulting in stable products. This renders an additional stage of ion activation necessary in order to generate sequence-defining fragment ions. Upon MS3 of the primary base-loss ion, homo-DNA was found to exhibit unspecific backbone dissociation resulting in a balanced distribution of all fragment ion series.

  5. Oligonucleotide bias in Bacillus subtilis: general trends and taxonomic comparisons.

    PubMed Central

    Rocha, E P; Viari, A; Danchin, A

    1998-01-01

    We present a general analysis of oligonucleotide usage in the complete genome of Bacillus subtilis . Several datasets were built in order to assign various biological contexts to the biased use of words and to reveal local asymmetries in word usage that may be coupled with replication, the control of gene expression and the restriction/modification system. This analysis was complemented by cross-comparisons with the complete genomes of Escherichia coli , Haemophilus influenzae and Methanococcus jannaschii . We have observed a large number of biased oligonucleotides for words of size up to 8, throughout the datasets and species, indicating that such long strict words play an important role as biological signals. We speculate that some of them are involved in interactions with DNA and/or RNA polymerases. An extensive analysis of palindrome abundances and distributions provides the surprising result that prophage-like elements embedded in the genome exhibit a smaller avoidance of restriction sites. This may reinforce a recently proposed hypothesis of a selfish gene phenomena in the transfer of restriction/modification systems in bacteria. PMID:9611243

  6. SOMA: a single oligonucleotide mutagenesis and cloning approach.

    PubMed

    Pfirrmann, Thorsten; Lokapally, Ashwin; Andréasson, Claes; Ljungdahl, Per; Hollemann, Thomas

    2013-01-01

    Modern biology research requires simple techniques for efficient and restriction site-independent modification of genetic material. Classical cloning and mutagenesis strategies are limited by their dependency on restriction sites and the use of complementary primer pairs. Here, we describe the Single Oligonucleotide Mutagenesis and Cloning Approach (SOMA) that is independent of restriction sites and only requires a single mutagenic oligonucleotide to modify a plasmid. We demonstrate the broad application spectrum of SOMA with three examples. First, we present a novel plasmid that in a standardized and rapid fashion can be used as a template for SOMA to generate GFP-reporters. We successfully use such a reporter to assess the in vivo knock-down quality of morpholinos in Xenopus laevis embryos. In a second example, we show how to use a SOMA-based protocol for restriction-site independent cloning to generate chimeric proteins by domain swapping between the two human hRMD5a and hRMD5b isoforms. Last, we show that SOMA simplifies the generation of randomized single-site mutagenized gene libraries. As an example we random-mutagenize a single codon affecting the catalytic activity of the yeast Ssy5 endoprotease and identify a spectrum of tolerated and non-tolerated substitutions. Thus, SOMA represents a highly efficient alternative to classical cloning and mutagenesis strategies.

  7. Fast comparison of DNA sequences by oligonucleotide profiling

    PubMed Central

    Arnau, Vicente; Gallach, Miguel; Marín, Ignacio

    2008-01-01

    Background The comparison of DNA sequences is a traditional problem in genomics and bioinformatics. Many new opportunities emerge due to the improvement of personal computers, allowing the implementation of novel strategies of analysis. Findings We describe a new program, called UVWORD, which determines the number of times that each DNA word present in a sequence (target) is found in a second sequence (source), a procedure that we have called oligonucleotide profiling. On a standard computer, the user may search for words of a size ranging from k = 1 to k = 14 nucleotides. Average counts for groups of contiguous words may also be established. The rate of analysis on standard computers is from 3.4 (k = 14) to 16 millions of words per second (1 ≤ k ≤ 8). This makes feasible the fast screening of even the longest known DNA molecules. Discussion We show that the combination of the ability of analyzing words of relatively long size, which occur very rarely by chance, and the fast speed of the program allows to perform novel types of screenings, complementary to those provided by standard programs such as BLAST. This method can be used to determine oligonucleotide content, to characterize the distribution of repetitive sequences in chromosomes, to determine the evolutionary conservation of sequences in different species, to establish regions of similar DNA among chromosomes or genomes, etc. PMID:18710530

  8. Periostin antisense oligonucleotide prevents adhesion formation after surgery in mice.

    PubMed

    Takai, Shinji; Yoshino, Masafumi; Takao, Kazumasa; Yoshikawa, Kazunori; Jin, Denan

    2017-02-01

    To study the role of periostin in adhesion formation, the effect of periostin antisense oligonucleotide (PAO) on adhesion formation was evaluated in mice. Under anesthesia, the serous membrane of the cecum was abraded, and the adhesion score and mRNA levels of periostin and its related factors were determined after surgery. Saline, 40 mg/kg of negative sense oligonucleotide (NSO), or 40 mg/kg of PAO were injected into the abdomen after surgery, and the adhesion score and mRNA levels were evaluated 14 days later. Filmy adhesion formation was observed 1 day after surgery, and the adhesion score increased gradually to 14 days. The mRNA levels of periostin, transforming growth factor (TGF)-β, and collagen I increased gradually from 3 days to 14 days. The adhesion score of PAO was significantly lower than of saline or NSO 14 days after surgery. The mRNA levels of periostin, TGF-β, and collagen I were also significantly attenuated by treatment with PAO compared with saline or NSO. Thus, these results demonstrated that the periostin mRNA level increased in the abraded cecum, and PAO prevented adhesion formation along with attenuation of the periostin mRNA level. Copyright © 2017 The Authors. Production and hosting by Elsevier B.V. All rights reserved.

  9. DOTAP/UDCA vesicles: novel approach in oligonucleotide delivery.

    PubMed

    Ruozi, Barbara; Battini, Renata; Montanari, Monica; Mucci, Adele; Tosi, Giovanni; Forni, Flavio; Vandelli, Maria Angela

    2007-03-01

    The relatively hydrophilic bile acid, ursodeoxycholic acid (UDCA), was used as an additive to DOTAP cationic liposomes to evaluate the effect on the cellular uptake of an oligonucleotide. Nuclear magnetic resonance studies were applied to estimate the relative amount of incorporated UDCA into the lipidic bilayers. DOTAP or DOTAP-UDCA vesicles (MixVes; DOTAP/UDCA molar ratios 1:0.25, 1:0.5, 1:1, and 1:2) formed complexes with 5'-fluorescein conjugated 29-mer phosphorothioate oligonucleotides (PS-ODNs) and studied using gel electrophoresis. In addition, the complexes were tested after transfection to assess the cellular uptake and the localization of the oligo in a HaCaT cell line by the use of cytofluorimetric and confocal microscopic analysis. DOTAP lipid formulated in the presence of a defined amount of UDCA forms more stable, flexible, and active MixVes. In particular, the MixVes at 1:0.25 and 1:0.5 molar ratios increase and modify the cellular uptake of PS-ODNs if compared with DOTAP liposomes 3 hours after the transfection studies. Moreover, the in vitro data suggest that these new formulations are not toxic.

  10. Multipathogen oligonucleotide microarray for environmental and biodefense applications.

    PubMed

    Sergeev, Nikolay; Distler, Margaret; Courtney, Shannon; Al-Khaldi, Sufian F; Volokhov, Dmitriy; Chizhikov, Vladimir; Rasooly, Avraham

    2004-11-01

    Food-borne pathogens are a major health problem. The large and diverse number of microbial pathogens and their virulence factors has fueled interest in technologies capable of detecting multiple pathogens and multiple virulence factors simultaneously. Some of these pathogens and their toxins have potential use as bioweapons. DNA microarray technology allows the simultaneous analysis of thousands of sequences of DNA in a relatively short time, making it appropriate for biodefense and for public health uses. This paper describes methods for using DNA microarrays to detect and analyze microbial pathogens. The FDA-1 microarray was developed for the simultaneous detection of several food-borne pathogens and their virulence factors including Listeria spp., Campylobacter spp., Staphylococcus aureus enterotoxin genes and Clostridium perfringens toxin genes. Three elements were incorporated to increase confidence in the microarray detection system: redundancy of genes, redundancy of oligonucleotide probes (oligoprobes) for a specific gene, and quality control oligoprobes to monitor array spotting and target DNA hybridization. These elements enhance the reliability of detection and reduce the chance of erroneous results due to the genetic variability of microbes or technical problems with the microarray. The results presented demonstrate the potential of oligonucleotide microarrays for detection of environmental and biodefense relevant microbial pathogens.

  11. Differentiation of the seven major lyssavirus species by oligonucleotide microarray.

    PubMed

    Xi, Jin; Guo, Huancheng; Feng, Ye; Xu, Yunbin; Shao, Mingfu; Su, Nan; Wan, Jiayu; Li, Jiping; Tu, Changchun

    2012-03-01

    An oligonucleotide microarray, LyssaChip, has been developed and verified as a highly specific diagnostic tool for differentiation of the 7 major lyssavirus species. As with conventional typing microarray methods, the LyssaChip relies on sequence differences in the 371-nucleotide region coding for the nucleoprotein. This region was amplified using nested reverse transcription-PCR primers that bind to the 7 major lyssaviruses. The LyssaChip includes 57 pairs of species typing and corresponding control oligonucleotide probes (oligoprobes) immobilized on glass slides, and it can analyze 12 samples on a single slide within 8 h. Analysis of 111 clinical brain specimens (65 from animals with suspected rabies submitted to the laboratory and 46 of butchered dog brain tissues collected from restaurants) showed that the chip method was 100% sensitive and highly consistent with the "gold standard," a fluorescent antibody test (FAT). The chip method could detect rabies virus in highly decayed brain tissues, whereas the FAT did not, and therefore the chip test may be more applicable to highly decayed brain tissues than the FAT. LyssaChip may provide a convenient and inexpensive alternative for diagnosis and differentiation of rabies and rabies-related diseases.

  12. Portable system for microbial sample preparation and oligonucleotide microarray analysis.

    SciTech Connect

    Bavykin, S. G.; Akowski, J. P.; Zakhariev, V. M.; Barsky, V. E.; Mirzabekov, A. D.; Perov, A. N.; Biochip Technology Center; Engelhardt Inst. of Molecular Biology

    2001-02-01

    We have developed a three-component system for microbial identification that consists of (i) a universal syringe-operated silica minicolumn for successive DNA and RNA isolation, fractionation, fragmentation, fluorescent labeling, and removal of excess free label and short oligonucleotides; (ii) microarrays of immobilized oligonucleotide probes for 16S rRNA identification; and (iii) a portable battery-powered device for imaging the hybridization of fluorescently labeled RNA fragments with the arrays. The minicolumn combines a guanidine thiocyanate method of nucleic acid isolation with a newly developed hydroxyl radical-based technique for DNA and RNA labeling and fragmentation. DNA and RNA can also be fractionated through differential binding of double- and single-stranded forms of nucleic acids to the silica. The procedure involves sequential washing of the column with different solutions. No vacuum filtration steps, phenol extraction, or centrifugation is required. After hybridization, the overall fluorescence pattern is captured as a digital image or as a Polaroid photo. This three-component system was used to discriminate Escherichia coli, Bacillus subtilis, Bacillus thuringiensis, and human HL60 cells. The procedure is rapid: beginning with whole cells, it takes approximately 25 min to obtain labeled DNA and RNA samples and an additional 25 min to hybridize and acquire the microarray image using a stationary image analysis system or the portable imager.

  13. TIA-1 RRM23 binding and recognition of target oligonucleotides

    PubMed Central

    Waris, Saboora; García-Mauriño, Sofía M.; Sivakumaran, Andrew; Beckham, Simone A.; Loughlin, Fionna E.; Gorospe, Myriam; Díaz-Moreno, Irene; Wilce, Matthew C.J.

    2017-01-01

    Abstract TIA-1 (T-cell restricted intracellular antigen-1) is an RNA-binding protein involved in splicing and translational repression. It mainly interacts with RNA via its second and third RNA recognition motifs (RRMs), with specificity for U-rich sequences directed by RRM2. It has recently been shown that RRM3 also contributes to binding, with preferential binding for C-rich sequences. Here we designed UC-rich and CU-rich 10-nt sequences for engagement of both RRM2 and RRM3 and demonstrated that the TIA-1 RRM23 construct preferentially binds the UC-rich RNA ligand (5΄-UUUUUACUCC-3΄). Interestingly, this binding depends on the presence of Lys274 that is C-terminal to RRM3 and binding to equivalent DNA sequences occurs with similar affinity. Small-angle X-ray scattering was used to demonstrate that, upon complex formation with target RNA or DNA, TIA-1 RRM23 adopts a compact structure, showing that both RRMs engage with the target 10-nt sequences to form the complex. We also report the crystal structure of TIA-1 RRM2 in complex with DNA to 2.3 Å resolution providing the first atomic resolution structure of any TIA protein RRM in complex with oligonucleotide. Together our data support a specific mode of TIA-1 RRM23 interaction with target oligonucleotides consistent with the role of TIA-1 in binding RNA to regulate gene expression. PMID:28184449

  14. Light-generated oligonucleotide arrays for rapid DNA sequence analysis.

    PubMed Central

    Pease, A C; Solas, D; Sullivan, E J; Cronin, M T; Holmes, C P; Fodor, S P

    1994-01-01

    In many areas of molecular biology there is a need to rapidly extract and analyze genetic information; however, current technologies for DNA sequence analysis are slow and labor intensive. We report here how modern photolithographic techniques can be used to facilitate sequence analysis by generating miniaturized arrays of densely packed oligonucleotide probes. These probe arrays, or DNA chips, can then be applied to parallel DNA hybridization analysis, directly yielding sequence information. In a preliminary experiment, a 1.28 x 1.28 cm array of 256 different octanucleotides was produced in 16 chemical reaction cycles, requiring 4 hr to complete. The hybridization pattern of fluorescently labeled oligonucleotide targets was then detected by epifluorescence microscopy. The fluorescence signals from complementary probes were 5-35 times stronger than those with single or double base-pair hybridization mismatches, demonstrating specificity in the identification of complementary sequences. This method should prove to be a powerful tool for rapid investigations in human genetics and diagnostics, pathogen detection, and DNA molecular recognition. Images PMID:8197176

  15. In vivo delivery of transcription factors with multifunctional oligonucleotides

    NASA Astrophysics Data System (ADS)

    Lee, Kunwoo; Rafi, Mohammad; Wang, Xiaojian; Aran, Kiana; Feng, Xuli; Lo Sterzo, Carlo; Tang, Richard; Lingampalli, Nithya; Kim, Hyun Jin; Murthy, Niren

    2015-07-01

    Therapeutics based on transcription factors have the potential to revolutionize medicine but have had limited clinical success as a consequence of delivery problems. The delivery of transcription factors is challenging because it requires the development of a delivery vehicle that can complex transcription factors, target cells and stimulate endosomal disruption, with minimal toxicity. Here, we present a multifunctional oligonucleotide, termed DARTs (DNA assembled recombinant transcription factors), which can deliver transcription factors with high efficiency in vivo. DARTs are composed of an oligonucleotide that contains a transcription-factor-binding sequence and hydrophobic membrane-disruptive chains that are masked by acid-cleavable galactose residues. DARTs have a unique molecular architecture, which allows them to bind transcription factors, trigger endocytosis in hepatocytes, and stimulate endosomal disruption. The DARTs have enhanced uptake in hepatocytes as a result of their galactose residues and can disrupt endosomes efficiently with minimal toxicity, because unmasking of their hydrophobic domains selectively occurs in the acidic environment of the endosome. We show that DARTs can deliver the transcription factor nuclear erythroid 2-related factor 2 (Nrf2) to the liver, catalyse the transcription of Nrf2 downstream genes, and rescue mice from acetaminophen-induced liver injury.

  16. Reproducible and inexpensive probe preparation for oligonucleotide arrays.

    PubMed

    Zhang, Y; Price, B D; Tetradis, S; Chakrabarti, S; Maulik, G; Makrigiorgos, G M

    2001-07-01

    We present a new protocol for the preparation of nucleic acids for microarray hybridization. DNA is fragmented quantitatively and reproducibly by using a hydroxyl radical-based reaction, which is initiated by hydrogen peroxide, iron(II)-EDTA and ascorbic acid. Following fragmentation, the nucleic acid fragments are densely biotinylated using a biotinylated psoralen analog plus UVA light and hybridized on microarrays. This non-enzymatic protocol circumvents several practical difficulties associated with DNA preparation for microarrays: the lack of reproducible fragmentation patterns associated with enzymatic methods; the large amount of labeled nucleic acids required by some array designs, which is often combined with a limited amount of starting material; and the high cost associated with currently used biotinylation methods. The method is applicable to any form of nucleic acid, but is particularly useful when applying double-stranded DNA on oligonucleotide arrays. Validation of this protocol is demonstrated by hybridizing PCR products with oligonucleotide-coated microspheres and PCR amplified cDNA with Affymetrix Cancer GeneChip microarrays.

  17. Calcium Phosphates and Human Beings

    NASA Astrophysics Data System (ADS)

    Dorozhkin, Sergey V.

    2006-05-01

    This article describes the general importance of calcium phosphates for human beings. The basic information on the structure and chemical properties of the biologically relevant calcium phosphates is summarized. Basic facts on the natural occurrence and the industrial use of natural calcium phosphates are discussed. Fundamental details on the presence of calcium phosphates in major calcified tissues (bones and teeth) of humans and mammals, as well as on biomaterials made of calcium phosphates are discussed. The article will be of value for chemistry teachers for expansion of their general background and point the students' attention to the rapidly growing topic of bone-substituting biomaterials.

  18. 21 CFR 184.1434 - Magnesium phosphate.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Magnesium phosphate. 184.1434 Section 184.1434 Food... Specific Substances Affirmed as GRAS § 184.1434 Magnesium phosphate. (a) Magnesium phosphate includes both magnesium phosphate, dibasic, and magnesium phosphate, tribasic. Magnesium phosphate, dibasic (MgHPO4·3H2O...

  19. 21 CFR 184.1434 - Magnesium phosphate.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 3 2014-04-01 2014-04-01 false Magnesium phosphate. 184.1434 Section 184.1434... GRAS § 184.1434 Magnesium phosphate. (a) Magnesium phosphate includes both magnesium phosphate, dibasic, and magnesium phosphate, tribasic. Magnesium phosphate, dibasic (MgHPO4·3H2O, CAS Reg. No. 7782-0975...

  20. 21 CFR 184.1434 - Magnesium phosphate.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 3 2011-04-01 2011-04-01 false Magnesium phosphate. 184.1434 Section 184.1434... Listing of Specific Substances Affirmed as GRAS § 184.1434 Magnesium phosphate. (a) Magnesium phosphate includes both magnesium phosphate, dibasic, and magnesium phosphate, tribasic. Magnesium phosphate, dibasic...

  1. 21 CFR 184.1434 - Magnesium phosphate.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 3 2012-04-01 2012-04-01 false Magnesium phosphate. 184.1434 Section 184.1434... Listing of Specific Substances Affirmed as GRAS § 184.1434 Magnesium phosphate. (a) Magnesium phosphate includes both magnesium phosphate, dibasic, and magnesium phosphate, tribasic. Magnesium phosphate, dibasic...

  2. 21 CFR 184.1434 - Magnesium phosphate.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 3 2013-04-01 2013-04-01 false Magnesium phosphate. 184.1434 Section 184.1434... Listing of Specific Substances Affirmed as GRAS § 184.1434 Magnesium phosphate. (a) Magnesium phosphate includes both magnesium phosphate, dibasic, and magnesium phosphate, tribasic. Magnesium phosphate, dibasic...

  3. Spatially Defined Oligonucleotide Arrays. Technical Report for Phase II

    SciTech Connect

    2000-06-15

    The goal of the Human Genome Project is to sequence all 3 billion base pairs of the human genome. Progress in this has been rapid; GenBank{reg_sign} finished 1994 with 286 million bases of sequence and grew by 2470 in the first quarter of 1995. The challenge to the scientific community is to understand the biological relevance of this genetic information. In most cases the sequence being generated for any single region of the genome represents the genotype of a single individual. A complete understanding of the function of specific genes and other regions of the genome and their role in human disease and development will only become apparent when the sequence of many more individuals is known. Access to genetic information is ultimately limited by the ability to screen DNA sequence. Although the pioneering sequencing methods of Sanger et al. (15) and Maxam and Gilbert (11) have become standard in virtually all molecular biology laboratories, the basic protocols remain largely unchanged. The throughput of this sequencing technology is now becoming the rate-limiting step in both large-scale sequencing projects such as the Human Genome Project and the subsequent efforts to understand genetic diversity. This has inspired the development of advanced DNA sequencing technologies (9), Incremental improvements to Sanger sequencing have been made in DNA labeling and detection. High-speed electrophoresis methods using ultrathin gels or capillary arrays are now being more widely employed. However, these methods are throughput-limited by their sequential nature and the speed and resolution of separations. This limitation will become more pronounced as the need to rapidly screen newly discovered genes for biologically relevant polymorphisms increases. An alternative to gel-based sequencing is to use high-density oligonucleotide probe arrays. Oligonucleotide probe arrays display specific oligonucleotide probes at precise locations in a high density, information-rich format (5

  4. Two acceptor levels and hopping conduction in Mn-doped GaAs

    NASA Astrophysics Data System (ADS)

    Kajikawa, Yasutomo

    2017-01-01

    By analysing the experimental data of the temperature-dependent Hall-effect measurements, an additional acceptor level has been confirmed to exist in Mn-doped p-GaAs besides the isolated substitutional Mn acceptor level. It is found that, in most of the investigated samples, the room-temperature hole concentration is governed by the additional acceptor level rather than the isolated substitutional Mn acceptor level. The concentration of the additional acceptor level is found to increase almost in proportion to the square of the concentration of the isolated substitutional Mn acceptors, suggesting that the additional acceptor level is related to Mn dimers. This suggests that the ferromagnetism observed in more heavily Mn-doped GaAs may be attributed to Mn clusters. For some of the samples in which the characteristic of nearest-neighbour hopping conduction in the substitutional Mn acceptor impurity band is evident, the hopping activation energy is deduced and is proved to increase in proportion to the cube root of the concentration of the substitutional Mn acceptors.

  5. Protected sphingosine from phytosphingosine as an efficient acceptor in glycosylation reaction.

    PubMed

    Di Benedetto, Roberta; Zanetti, Luca; Varese, Monica; Rajabi, Mehdi; Di Brisco, Riccardo; Panza, Luigi

    2014-02-07

    A convenient, simple, and high-yielding five-step synthesis of a sphingosine acceptor from phytosphingosine is reported, and its behavior in glycosylation reactions is described. Different synthetic paths to sphingosine acceptors using tetrachlorophthalimide as a protecting group for the sphingosine amino function and different glycosylation methods have been explored. Among the acceptors tested, the easiest accessible acceptor, unprotected on the two hydroxyl groups in positions 1 and 3, was regioselectively glycosylated on the primary position, the regioselectivity depending on the donor used.

  6. Process for gasification using a synthetic CO/sub 2/ acceptor

    SciTech Connect

    Lancet, M.S.; Curran, G.P.

    1980-11-04

    Conoco's gasification process uses a synthetic CO/sub 2/ acceptor consisting essentially of at least one calcium compound (either calcium oxide or calcium carbonate) supported in a refractory carrier matrix having the general formula Ca/sub 5/(SiO/sub 4/)/sub 2/CO/sub 3/. The synthetic acceptor is more effective than a natural calcium oxide acceptor during the gasification process because the thermally stable matrix causes the calcium compounds to remain in discrete particles that tend to reactivate with each passage through the process. This eliminates the need for large quantities of fresh makeup acceptor materials.

  7. Biomediated continuous release phosphate fertilizer

    DOEpatents

    Goldstein, A.H.; Rogers, R.D.

    1999-06-15

    A composition is disclosed for providing phosphate fertilizer to the root zone of plants. The composition comprises a microorganism capable of producing and secreting a solubilization agent, a carbon source for providing raw material for the microorganism to convert into the solubilization agent, and rock phosphate ore for providing a source of insoluble phosphate that is solubilized by the solubilization agent and released as soluble phosphate. The composition is provided in a physical form, such as a granule, that retains the microorganism, carbon source, and rock phosphate ore, but permits water and soluble phosphate to diffuse into the soil. A method of using the composition for providing phosphate fertilizer to plants is also disclosed. 13 figs.

  8. Biomediated continuous release phosphate fertilizer

    SciTech Connect

    Goldstein, Alan H.; Rogers, Robert D.

    1999-01-01

    A composition is disclosed for providing phosphate fertilizer to the root zone of plants. The composition comprises a microorganism capable of producing and secreting a solubilization agent, a carbon source for providing raw material for the microorganism to convert into the solubilization agent, and rock phosphate ore for providing a source of insoluble phosphate that is solubilized by the solubilization agent and released as soluble phosphate. The composition is provided in a physical form, such as a granule, that retains the microorganism, carbon source, and rock phosphate ore, but permits water and soluble phosphate to diffuse into the soil. A method of using the composition for providing phosphate fertilizer to plants is also disclosed.

  9. Renal phosphate handling: Physiology

    PubMed Central

    Prasad, Narayan; Bhadauria, Dharmendra

    2013-01-01

    Phosphorus is a common anion. It plays an important role in energy generation. Renal phosphate handling is regulated by three organs parathyroid, kidney and bone through feedback loops. These counter regulatory loops also regulate intestinal absorption and thus maintain serum phosphorus concentration in physiologic range. The parathyroid hormone, vitamin D, Fibrogenic growth factor 23 (FGF23) and klotho coreceptor are the key regulators of phosphorus balance in body. PMID:23961477

  10. Preliminary time-of-flight neutron diffraction studies of Escherichia coli ABC transport receptor phosphate-binding protein at the Protein Crystallography Station.

    PubMed

    Sippel, K H; Bacik, J; Quiocho, F A; Fisher, S Z

    2014-06-01

    Inorganic phosphate is an essential molecule for all known life. Organisms have developed many mechanisms to ensure an adequate supply, even in low-phosphate conditions. In prokaryotes phosphate transport is instigated by the phosphate-binding protein (PBP), the initial receptor for the ATP-binding cassette (ABC) phosphate transporter. In the crystal structure of the PBP-phosphate complex, the phosphate is completely desolvated and sequestered in a deep cleft and is bound by 13 hydrogen bonds: 12 to protein NH and OH donor groups and one to a carboxylate acceptor group. The carboxylate plays a key recognition role by accepting a phosphate hydrogen. PBP phosphate affinity is relatively consistent across a broad pH range, indicating the capacity to bind monobasic (H2PO4-) and dibasic (HPO4(2-)) phosphate; however, the mechanism by which it might accommodate the second hydrogen of monobasic phosphate is unclear. To answer this question, neutron diffraction studies were initiated. Large single crystals with a volume of 8 mm3 were grown and subjected to hydrogen/deuterium exchange. A 2.5 Å resolution data set was collected on the Protein Crystallography Station at the Los Alamos Neutron Science Center. Initial refinement of the neutron data shows significant nuclear density, and refinement is ongoing. This is the first report of a neutron study from this superfamily.

  11. Preliminary time-of-flight neutron diffraction studies of Escherichia coli ABC transport receptor phosphate-binding protein at the Protein Crystallography Station

    PubMed Central

    Sippel, K. H.; Bacik, J.; Quiocho, F. A.; Fisher, S. Z.

    2014-01-01

    Inorganic phosphate is an essential molecule for all known life. Organisms have developed many mechanisms to ensure an adequate supply, even in low-phosphate conditions. In prokaryotes phosphate transport is instigated by the phosphate-binding protein (PBP), the initial receptor for the ATP-binding cassette (ABC) phosphate transporter. In the crystal structure of the PBP–phosphate complex, the phosphate is completely desolvated and sequestered in a deep cleft and is bound by 13 hydrogen bonds: 12 to protein NH and OH donor groups and one to a carboxylate acceptor group. The carboxylate plays a key recognition role by accepting a phosphate hydrogen. PBP phosphate affinity is relatively consistent across a broad pH range, indicating the capacity to bind monobasic (H2PO4 −) and dibasic (HPO4 2−) phosphate; however, the mechanism by which it might accommodate the second hydrogen of monobasic phosphate is unclear. To answer this question, neutron diffraction studies were initiated. Large single crystals with a volume of 8 mm3 were grown and subjected to hydrogen/deuterium exchange. A 2.5 Å resolution data set was collected on the Protein Crystallography Station at the Los Alamos Neutron Science Center. Initial refinement of the neutron data shows significant nuclear density, and refinement is ongoing. This is the first report of a neutron study from this superfamily. PMID:24915101

  12. Ex vivo regulation of specific gene expression by nanomolar concentration of double-stranded dumbbell oligonucleotides.

    PubMed Central

    Clusel, C; Ugarte, E; Enjolras, N; Vasseur, M; Blumenfeld, M

    1993-01-01

    Inhibition of specific transcriptional regulatory proteins is a new approach to control gene expression. Transcriptional activity of DNA-binding proteins can be inhibited by the use of double-stranded (ds) oligodeoxynucleotides that compete for the binding to their specific target sequences in promoters and enhancers. As a model, we used phosphodiester dumbbell oligonucleotides containing a binding site for the liver-enriched transcription factor HNF-1 (Hepatocyte Nuclear Factor 1). Binding affinity of HNF-1 to dumbbell oligonucleotides was the same as that to ds oligonucleotides, as determined by gel retardation assays. HNF-1 dumbbells specifically inhibited in vitro transcription driven by the albumin promoter by more than 90%. HNF-1-dependent activation of a CAT reporter plasmid was specifically inhibited when the HNF-1 dumbbell oligonucleotide was added at nM concentration to transiently transfected C33 cells. On the contrary, HNF-1 ds oligonucleotides, which displayed the same activity as the dumbbell oligonucleotides in the in vitro assays, were no more effective in the ex vivo experiments. These results might reflect the increased stability of the circular dumbbell oligonucleotides towards cellular nuclease degradation, as shown in vitro with nucleolytic enzymes. Dumbbell oligonucleotides containing unmodified phosphodiester bonds may efficiently compete for binding of specific transcription factors within cells, then providing a potential therapeutic tool to control disease-causing genes. Images PMID:7688452

  13. The MOX/SUC precursor strategies: robust ways to construct functionalized oligonucleotides.

    PubMed

    Polushin, N

    2001-01-01

    The use of phosphoramidites bearing one or more methoxyoxalamido (MOX) or succinimido (SUC) reactive groups for construction of functionalized oligonucleotides is described. The efficiency of the new precursor strategy was demonstrated in the synthesis of oligonucleotide containing up to 16 imidazole residues.

  14. Nucleobase azide-ethynylribose click chemistry contributes to stabilizing oligonucleotide duplexes and stem-loop structures.

    PubMed

    Kitamura, Yoshiaki; Asakura, Ryo; Terazawa, Koki; Shibata, Aya; Ikeda, Masato; Kitade, Yukio

    2017-06-15

    The formation of 1,4-disubstituted 1,2,3-triazoles through copper-catalyzed azide-alkyne cycloaddition (CuAAC) in oligonucleotides bearing 1-deoxy-1-ethynyl-β-d-ribofuranose (R(E)) can have a positive impact on the stability of oligonucleotide duplexes and stem-loop structures. Copyright © 2017 Elsevier Ltd. All rights reserved.

  15. Synthesis of 3'-, or 5'-, or internal methacrylamido-modified oligonucleotides

    DOEpatents

    Golova, Julia B.; Chernov, Boris K.

    2010-04-27

    New modifiers were synthesized for incorporation of a methacrylic function in 3'-, 5'- and internal positions of oligonucleotides during solid phase synthesis. A modifier was used for synthesis of 5'-methacrylated oligonucleotides for preparation of microarrays by a co-polymerization method.

  16. [Computer aid design of antisense oligonucleotide in gene therapy--review].

    PubMed

    Wu, Qi-Wei; Wu, Jia-Jin

    2004-06-01

    In this paper, the situation on antisense oligonucleotide as a means of gene therapy was outlined, and the main factors impeding its progress at present was summarized. The one of main factors is the efficiency of antisense oligonucleotide as a drug and the other is the side-effect in clinical use. At the level of cell and gene, these influential factors were analyzed in detail. The main factor that makes side-effect in using antisense oligonucleotide is the difficulty to distinguish effectively homologous-gene from target gene. The another factor is the secondary structure and three-dimensional structure of target gene that seriously affect antisense oligonucleotide to arrive at target position. The third problem is what can affect antisense oligonucleotide transmission and quick annealing. How use computer technique to analyze fully the target gene of antisense oligonucleotide including the secondary structure and homology of target gene, and to design effective antisense oligonucleotide, in order to reduce its side-effect in clinical use of antisense oligonucleotide as a drug of gene therapy, and the computer-aid design method were described.

  17. Multicellular Tumor Spheroids as a Model for Assessing Delivery of Oligonucleotides in Three Dimensions

    PubMed Central

    Carver, Kyle; Ming, Xin; Juliano, Rudolph L

    2014-01-01

    Oligonucleotides have shown promise in selectively manipulating gene expression in vitro, but that success has not translated to the clinic for cancer therapy. A potential reason for this is that cells behave differently in monolayer than in the three-dimensional tumor, resulting in limited penetration and distribution of oligonucleotides in the tumor. This may be especially true when oligonucleotides are associated with nanocarriers such as lipoplexes and polyplexes, commonly used delivery vehicles for oligonucleotides. The multicellular tumor spheroid (MCTS), a three-dimensional model that closely resembles small avascular tumors and micrometastases, has been utilized as an intermediate between monolayer culture and in vivo studies for the screening of small-molecule drugs. However, spheroids have been little used for the study of various oligonucleotide delivery formulations. Here, we have evaluated the uptake and efficacy of splice-switching antisense oligonucleotides using various delivery modalities in two- and three-dimensional culture models. We find that the size of the delivery agent dramatically influences penetration into the spheroid and thus the biological effect of the oligonucleotides. We hypothesize that the MCTS model will prove to be a useful tool in the future development of oligonucleotide delivery formulations. PMID:24618852

  18. Pigment-acceptor-catalyst triads for photochemical hydrogen evolution.

    PubMed

    Kitamoto, Kyoji; Sakai, Ken

    2014-04-25

    In order to solve the problems of global warming and shortage of fossil fuels, researchers have been endeavoring to achieve artificial photosynthesis: splitting water into H2 and O2 under solar light illumination. Our group has recently invented a unique system that drives photoinduced water reduction through "Z-scheme" photosynthetic pathways. Nevertheless, that system still suffered from a low turnover number (TON) of the photocatalytic cycle (TON=4.1). We have now found and describe herein a new methodology to make significant improvements in the TON, up to around TON=14-27. For the new model systems reported herein, the quantum efficiency of the second photoinduced step in the Z-scheme photosynthesis is dramatically improved by introducing multiviologen tethers to temporarily collect the high-energy electron generated in the first photoinduced step. These are unique examples of "pigment-acceptor-catalyst triads", which demonstrate a new effective type of artificial photosynthesis.

  19. Weak localization and interaction effects in acceptor graphite intercalation compounds

    NASA Astrophysics Data System (ADS)

    Prokopov, O. I.; Ovsiienko, I. V.; Matzui, L. Yu.; Len, T. A.; Naumova, D. D.; Berkutov, I. B.; Mirzoiev, I. G.; Le Normand, F.

    2017-06-01

    The presented work is devoted to investigations of manifestation of quantum effects of weak localization and interaction of charge carriers in electrical conductivity of acceptor graphite intercalation compounds (CICs). As shown by studies intercalation leads to a decrease in the resistivity and to change the resistivity temperature coefficient from negative sign in the source graphite on a positive sign in intercalated graphite. At the low temperature for all GICs specimens the minimum in the temperature dependence of resistivity is observed. In terms of the model of charge carrier's weak localization and interaction for two-dimensional systems temperature dependence of phase relaxation time, localization radius and charge carriers screening constant for all GICs are estimated.

  20. Glycogen synthase can use glucose as an acceptor.

    PubMed

    Salsas, E; Larner, J

    1975-03-10

    Glycogen synthase purified to homogeneity from rabbit skeletal muscle is essentially free of carbohydrate and shows no activity in the absence of added acceptor. It can use glucose as a substrate converting it to a glucose disaccharide in the presence of UDP-glucose as cosubstrate. The reaction is dependent on time, and on UDP-glucose, glucose, and enzyme concentrations. The product of the single step reaction co-chromatographs in two solvent systems with maltose. The glucose disaccharide produced in the reaction with UDP-[14-C]glucose and nonradioactive glucose as well as with nonradioactive UDP-glucoes and [14-C]glucose is labeled asymmetrically. The linkage is characterized as alpha-1,4 and therefore the disaccharide is identified as maltose.

  1. Spectroscopy of donor-pi-acceptor complexes for solar cells

    NASA Astrophysics Data System (ADS)

    Himpsel, F. J.; Zegkinoglou, I.; Johnson, P. S.; Pemmaraju, C. D.; Prendergast, D.; Ragoussi, M.-E.; de la Torre, G.; Pickup, D. F.; Ortega, J. E.

    2014-03-01

    A recent improvement in the design of dye sensitized solar cells has been the combination of light absorbing, electron-donating, and electron-withdrawing groups within the same sensitizer molecule. This dye architecture has contributed to increase the energy conversion efficiency, leading to record efficiency values. Here we investigate a zinc(II)-porphyrin-based complex with triphenylamine donor groups and carboxyl linkers for the attachment to an oxide acceptor. The unoccupied orbitals of these three moieties are probed by element-selective X-ray absorption spectroscopy at the N 1s, C 1s, and Zn 2p edges, complemented by time-dependent density functional theory. The attachment of electron-donating groups to the porphyrin ring significantly delocalizes the highest occupied molecular orbital (HOMO) of the molecule. This leads to a spatial separation between the HOMO and the lowest unoccupied molecular orbital (LUMO), reducing the recombination rate of photoinduced electrons and holes.

  2. Quantum information processing using acceptors in silicon and phonon entanglement

    NASA Astrophysics Data System (ADS)

    Clark, Susan; Reinke, Charles; McGuinness, Hayden; El-Kady, Ihab

    2014-03-01

    Quantum computing with large numbers of qubits remains challenging due to the decoherence and complexity that arise as more qubits are added to a system. Here I propose a new platform for semiconductor quantum computing which may be robust to common sources of decoherence and may not be difficult to fabricate repeatedly. This system consists of a hole bound to an acceptor in silicon which has been implanted in the center of a mechanical cavity (similar to a photonic crystal cavity) and connected to other cavities by a system of waveguides. I will outline a basic entangling gate and calculations showing the promise of this platform as the ideal qubit. Sandia National Laboratories is a multi-program laboratory managed and operated by Sandia Corporation, a wholly owned subsidiary of Lockheed Martin Corporation, for the U. S. Department of Energy's National Nuclear Security Administration under contract DE-AC04-94AL85000.

  3. Donor-acceptor pair recombination in gallium sulfide

    NASA Astrophysics Data System (ADS)

    Aydinli, A.; Gasanly, N. M.; Gökşen, K.

    2000-12-01

    Low temperature photoluminescence of GaS single crystals shows three broad emission bands below 2.4 eV. Temperature and excitation light intensity dependencies of these bands reveal that all of them originate from close donor-acceptor pair recombination processes. Temperature dependence of the peak energies of two of these bands in the visible range follow, as expected, the band gap energy shift of GaS. However, the temperature dependence of the peak energy of the third band in the near infrared shows complex behavior by blueshifting at low temperatures followed by a redshift at intermediate temperatures and a second blueshift close to room temperature, which could only be explained via a configuration coordinate model. A simple model calculation indicates that the recombination centers are most likely located at the nearest neighbor lattice or interstitial sites.

  4. Oligonucleotide-modified screen-printed gold electrodes for enzyme-amplified sensing of nucleic acids.

    PubMed

    Carpini, Guido; Lucarelli, Fausto; Marrazza, Giovanna; Mascini, Marco

    2004-09-15

    An electrochemical genosensor for the detection of specific sequences of DNA has been developed using disposable screen-printed gold electrodes. Screen-printed gold electrodes were firstly modified with a mixed monolayer of a 25-mer thiol-tethered DNA probe and a spacer thiol, 6-mercapto-1-hexanol (MCH). The DNA probe sequence was internal to the sequence of the 35S promoter, which sequence is inserted in the genome of GMOs regulating the transgene expression. An enzyme-amplified detection scheme, based on the coupling of a streptavidin-alkaline phosphatase conjugate and biotinylated target sequences was then applied. The enzyme catalysed the hydrolysis of the electroinactive alpha-naphthyl phosphate to alpha-naphthol; this product is electroactive and has been detected by means of differential pulse voltammetry. The assay was, firstly, characterised using synthetic oligonucleotides. Relevant parameters, such as the probe concentration and the immobilisation time, the use of the MCH and different enzymatic conjugates, were investigated and optimised. The genosensor response was found to be linearly related to the target concentration between 0 and 25 nmol/L; the detection limit was 0.25 nmol/L. The analytical procedure was then applied for the detection of the 35S promoter sequence, which was amplified from the pBI121 plasmid by polymerase chain reaction (PCR). Hybridisation conditions (i.e., hybridisation buffer and hybridisation time) were further optimised. The selectivity of the assay was confirmed using biotinylated non-complementary amplicons and PCR blanks. The results showed that the genosensor enabled sensitive (detection limit: 1 nmol/L) and specific detection of GMO-related sequences, thus providing a useful tool for the screening analysis of bioengineered food samples.

  5. Functionalized chitosan derivatives as nonviral vectors: physicochemical properties of acylated N,N,N-trimethyl chitosan/oligonucleotide nanopolyplexes.

    PubMed

    Santos, Joyce C C; Moreno, Pedro M D; Mansur, Alexandra A P; Leiro, Victoria; Mansur, Herman S; Pêgo, Ana Paula

    2015-11-07

    Cationic polymers have recently attracted attention due to their proven potential for nonviral gene delivery. In this study, we report novel biocompatible nanocomplexes produced using chemically functionalized N,N,N-trimethyl chitosan (TMC) with different N-acyl chain lengths (C5-C18) associated with single-stranded oligonucleotides. The TMC derivatives were synthesized by covalent coupling reactions of quaternized chitosan with n-pentanoic (C5), n-decanoic (C10), and n-octadecanoic (C18) fatty acids, which were extensively characterized by Fourier transform-infrared spectroscopy (FT-IR) and proton nuclear magnetic resonance ((1)H NMR). These N-acylated TMC derivatives (TMCn) were used as cationic polymeric matrices for encapsulating anionic 18-base single-stranded thiophosphorylated oligonucleotides (ssONs), leading to the formation of polyplexes further characterized by zeta potential (ZP), dynamic light scattering (DLS), binding affinity, transfection efficiency and in vitro cytotoxicity assays. The results demonstrated that the length of the grafted hydrophobic N-acyl chain and the relative amino:phosphate groups ratio (N/P ratio) between the TMC derivatives and ssON played crucial roles in determining the physicochemical properties of the obtained nanocomplexes. While none of the tested derivatives showed appreciable cytotoxicity, the type of acyl chain had a remarkable influence on the cell transfection capacity of TMC-ssON nanocomplexes with the derivatives based on stearic acid showing the best performance based on the results of in vitro assays using a model cell line expressing luciferase (HeLa/Luc705).

  6. Recent advances in photoinduced donor/acceptor copolymerization

    NASA Astrophysics Data System (ADS)

    Jönsson, S.; Viswanathan, K.; Hoyle, C. E.; Clark, S. C.; Miller, C.; Morel, F.; Decker, C.

    1999-05-01

    Photoinitiated free radical polymerization of donor (D)/acceptor (A) type monomers has gained considerable interest due to the possibility to efficiently photopolymerize non-acrylate based systems. Furthermore, this photoinduced alternating copolymerization can be accomplished without the presence of a conventional free radical generating photoinitiator. In the past, we have shown that the structural influences in the direct photolysis of N-Alkyl and N-Arylmaleimides as well as their corresponding ground state charge transfer complexes (CTC) with suitable donors have carefully been investigated. For certain combinations of A and D type monomers, a direct photolysis of the ground state complex or the excitation of the acceptor, followed by the formation of an exciplex, has been shown to initiate the copolymerization. Herein, we show that the main route of initiation is based on inter or intra molecular H-abstraction from an excited state maleimide, whereby no exciplex formation takes place. H-abstraction will predominantly take place in systems where easily abstractable hydrogens are present. Our laser flash photolysis investigation, ESR [1] (A. Hiroshi, I. Takasi, T. Nosi, Macromol. Chem. 190 (1989) 2821) and phosphorescence emissions [2,3] (K.S. Chen, T. Foster, J.K.S. Wan, J. Phys. Chem. 84 (1980) 2473; C.J. Seliskar, S.P. McGlynn, J. Chem. Phys. 55 (1971) 4337) studies show that triplet excited states of N-alkyl substituted maleimides (RMI), which are well known strong precursors for direct H-abstractions from aliphatic ethers and secondary alcohols, are formed upon excitation. Rates of copolymerization and degrees of conversion for copolymerization of maleimide/vinyl ether pairs in air and nitrogen have been measured as a function of hydrogen abstractability of the excited triplet state MI as well as the influence of concentration and hydrogen donating effect of the hydrogen donor.

  7. Detection of oligonucleotide hybridization on a single microparticle by time-resolved fluorometry: hybridization assays on polymer particles obtained by direct solid phase assembly of the oligonucleotide probes.

    PubMed

    Hakala, H; Heinonen, P; Iitiä, A; Lönnberg, H

    1997-01-01

    Oligodeoxyribonucleotides were assembled by conventional phosphoramidite chemistry on uniformly sized (50 microns) porous glycidyl methacrylate/ethylene dimethacrylate (SINTEF) and compact polystyrene (Dynosphere) particles, the aminoalkyl side chains of which were further derivatized with DMTrO-acetyl groups. The linker was completely resistant toward ammonolytic deprotection of the base moieties. The quality of oligonucleotides was assessed by repeating the synthesis on the same particles derivatized with a cleavable ester linker. The ability of the oligonucleotide-coated particles to bind complementary sequences via hybridization was examined by following the attachment of oligonucleotides bearing a photoluminescent europium(III) chelate to the particles. The fluorescence emission was measured directly on a single particle. The effects of the following factors on the kinetics and efficiency of hybridization were studied: number of particles in a given volume of the assay solution, loading of oligonucleotide on the particle, concentration of the target oligonucleotide in solution, length of the hybridizing sequence, presence of noncomplementary sequences, and ionic strength. The fluorescence signal measured on a single particle after hybridization was observed to be proportional to the concentration of the target oligonucleotide in solution over a concentration range of 5 orders of magnitude.

  8. [Oligonucleotide derivatives in the nucleic acid hybridization analysis. I. Covalent immobilization of oligonucleotide probes onto the nylon].

    PubMed

    Dmitrienko, E V; Pyshnaia, I A; Pyshnyĭ, D V

    2010-01-01

    The features of UV-induced immobilization of oligonucleotides on a nylon membranes and the effectiveness of enzymatic labeling of immobilized probes at heterophase detection of nucleic acids are studied. Short terminal oligothymidilate (up to 10 nt) sequences are suggested to attach to the probe via a flexible ethylene glycol based linker. The presence of such fragment enhances the intensity of immobilization and reduces UV-dependent degradation of the targeted (sequence-specific) part of the probe by reducing the dose needed for the immobilization of DNA. The optimum dose of UV-irradiation is determined to be ~0.4 J/cm(2) at the wavelength 254 nm. This dose provides high level of hybridization signal for immobilized probes with various nucleotide composition of the sequence specific moiety. The amide groups of the polyamide are shown to play the key role in the photoinduced immobilization of nucleic acids, whereas the primary amino groups in the structure of PA is not the center responsible for the covalent binding of DNA by UV-irradiation, as previously believed. Various additives in the soaking solution during the membrane of UV-dependent immobilization of probes are shown to influence its effectiveness. The use of alternative to UV-irradiation system of radical generation are shown to provide the immobilization of oligonucleotides onto the nylon membrane.

  9. Optical detection and discrimination of cystic fibrosis-related genetic mutations using oligonucleotide-nanoparticle conjugates.

    PubMed

    Murphy, Deirdre; Redmond, Gareth

    2005-03-01

    Novel methods for application of oligonucleotide-gold nanoparticle conjugates to selective colorimetric detection and discrimination of cystic fibrosis (CF) related genetic mutations in model oligonucleotide systems are presented. Three-strand oligonucleotide complexes are employed, wherein two probe oligonucleotide-gold nanoparticle conjugates are linked together by a third target oligonucleotide strand bearing the CF-related mutation(s). By monitoring the temperature dependence of the optical properties of the complexes, either in solution or on silica gel plates, melting behaviors may be accurately and reproducibly compared. Using this approach, fully complementary sequences are successfully distinguished from mismatched sequences, with single base mismatch resolution, for Delta F 508, M470V, R74W and R75Q mutations.

  10. The Role Radius of Curvature Plays in Thiolated Oligonucleotide Loading on Gold Nanoparticles

    PubMed Central

    Hill, Haley D.; Millstone, Jill E.; Banholzer, Matthew J.; Mirkin, Chad A.

    2011-01-01

    We show that by correlating the radius of curvature of spherical gold nanoparticles of varying sizes with their respective thiol terminated oligonucleotide loading densities that a mathematical relationship can be derived for predicting the loading of oligonucleotides on anisotropic gold nanomaterials. This mathematical relationship was tested with gold nanorods (radius 17.5 nm, length 475 nm) where the measured number of oligonucleotides per rod (3330 ±110) was within experimental error of the predicted loading of 3244 oligonucleotides from the derivation. Additionally, we show that once gold nanoparticles reach a diameter of approximately 60 nm (and certainly 100 nm) the local surface experienced by the oligonucleotide is highly similar to that of a planar surface. PMID:19236080

  11. Interaction of the E. coli DNA G:T-mismatch endonuclease (vsr protein) with oligonucleotides containing its target sequence.

    PubMed

    Turner, D P; Connolly, B A

    2000-12-15

    The Escherichia coli vsr endonuclease recognises G:T base-pair mismatches in double-stranded DNA and initiates a repair pathway by hydrolysing the phosphate group 5' to the incorrectly paired T. The enzyme shows a preference for G:T mismatches within a particular sequence context, derived from the recognition site of the E. coli dcm DNA-methyltransferase (CC[A/T]GG). Thus, the preferred substrate for the vsr protein is (CT[A/T]GG), where the underlined T is opposed by a dG base. This paper provides quantitative data for the interaction of the vsr protein with a number of oligonucleotides containing G:T mismatches. Evaluation of specificity constant (k(st)/K(D); k(st)=rate constant for single turnover, K(D)=equilibrium dissociation constant) confirms vsr's preference for a G:T mismatch within a hemi-methylated dcm sequence, i.e. the best substrate is a duplex (both strands written in the 5'-3' orientation) composed of CT[A/T]GG and C(5Me)C[T/A]GG. Conversion of the mispaired T (underlined) to dU or the d(5Me)C to dC gave poorer substrates. No interaction was observed with oligonucleotides that lacked a G:T mismatch or did not possess a dcm sequence. An analysis of the fraction of active protein, by "reverse-titration" (i.e. adding increasing amounts of DNA to a fixed amount of protein followed by gel-mobility shift analysis) showed that less than 1% of the vsr endonuclease was able to bind to the substrate. This was confirmed using "competitive titrations" (where competitor oligonucleotides are used to displace a (32)P-labelled nucleic acid from the vsr protein) and burst kinetic analysis. This result is discussed in the light of previous in vitro and in vivo data which indicate that the MutL protein may be needed for full vsr activity. Copyright 2000 Academic Press.

  12. Recommendations for safety pharmacology evaluations of oligonucleotide-based therapeutics.

    PubMed

    Berman, Cindy L; Cannon, Keri; Cui, Yi; Kornbrust, Douglas J; Lagrutta, Armando; Sun, Sunny Z; Tepper, Jeff; Waldron, Gareth; Younis, Husam S

    2014-08-01

    This document was prepared by the Safety Pharmacology Subcommittee of the Oligonucleotide Safety Working Group (OSWG), a group of industry and regulatory scientists involved in the development and regulation of therapeutic oligonucleotides. The mission of the Subcommittee was to develop scientific recommendations for the industry regarding the appropriate scope and strategies for safety pharmacology evaluations of oligonucleotides (ONs). These recommendations are the consensus opinion of the Subcommittee and do not necessarily reflect the current expectations of regulatory authorities. 1) Safety pharmacology testing, as described in the International Conference on Harmonisation (ICH) S7 guidance, is as applicable to ONs as it is to small molecule drugs and biotherapeutics. 2) Study design considerations for ONs are similar to those for other classes of drugs. In general, as with other therapeutics, studies should evaluate the drug product administered via the clinical route. Species selection should ideally consider relevance of the model with regard to the endpoints of interest, pharmacological responsiveness, and continuity with the nonclinical development program. 3) Evaluation of potential effects in the core battery (cardiovascular, central nervous, and respiratory systems) is recommended. In general: a. In vitro human ether-a-go-go-related gene (hERG) testing does not provide any specific value and is not warranted. b. Emphasis should be placed on in vivo evaluation of cardiovascular function, typically in nonhuman primates (NHPs). c. Due to the low level of concern, neurologic and respiratory function can be assessed concurrently with cardiovascular safety pharmacology evaluation in NHPs, within repeat-dose toxicity studies, or as stand-alone studies. In the latter case, rodents are most commonly used. 4) Other dedicated safety pharmacology studies, beyond the core battery, may have limited value for ONs. Although ONs can accumulate in the kidney and liver

  13. Contrasting performance of donor-acceptor copolymer pairs in ternary blend solar cells and two-acceptor copolymers in binary blend solar cells.

    PubMed

    Khlyabich, Petr P; Rudenko, Andrey E; Burkhart, Beate; Thompson, Barry C

    2015-02-04

    Here two contrasting approaches to polymer-fullerene solar cells are compared. In the first approach, two distinct semi-random donor-acceptor copolymers are blended with phenyl-C61-butyric acid methyl ester (PC61BM) to form ternary blend solar cells. The two poly(3-hexylthiophene)-based polymers contain either the acceptor thienopyrroledione (TPD) or diketopyrrolopyrrole (DPP). In the second approach, semi-random donor-acceptor copolymers containing both TPD and DPP acceptors in the same polymer backbone, termed two-acceptor polymers, are blended with PC61BM to give binary blend solar cells. The two approaches result in bulk heterojunction solar cells that have the same molecular active-layer components but differ in the manner in which these molecular components are mixed, either by physical mixing (ternary blend) or chemical "mixing" in the two-acceptor (binary blend) case. Optical properties and photon-to-electron conversion efficiencies of the binary and ternary blends were found to have similar features and were described as a linear combination of the individual components. At the same time, significant differences were observed in the open-circuit voltage (Voc) behaviors of binary and ternary blend solar cells. While in case of two-acceptor polymers, the Voc was found to be in the range of 0.495-0.552 V, ternary blend solar cells showed behavior inherent to organic alloy formation, displaying an intermediate, composition-dependent and tunable Voc in the range from 0.582 to 0.684 V, significantly exceeding the values achieved in the two-acceptor containing binary blend solar cells. Despite the differences between the physical and chemical mixing approaches, both pathways provided solar cells with similar power conversion efficiencies, highlighting the advantages of both pathways toward highly efficient organic solar cells.

  14. Conserved cytoplasmic motifs that distinguish sub-groups of the polyprenol phosphate:N-acetylhexosamine-1-phosphate transferase family.

    PubMed

    Anderson, M S; Eveland, S S; Price, N P

    2000-10-15

    WecA, MraY and WbcO are conserved members of the polyprenol phosphate:N-acetylhexosamine-1-phosphate transferase family involved in the assembly of bacterial cell walls, and catalyze reactions involving a membrane-associated polyprenol phosphate acceptor substrate and a cytoplasmically located UDP-D-amino sugar donor. MraY, WbcO and WecA purportedly utilize different UDP-sugars, although the molecular basis of this specificity is largely unknown. However, domain variations involved in specificity are predicted to occur on the cytoplasmic side of the membrane, adjacent to conserved domains involved in the mechanistic activity, and with access to the cytoplasmically located sugar nucleotides. Conserved C-terminal domains have been identified that satisfy these criteria. Topological analyses indicate that they form the highly basic, fifth cytoplasmic loop between transmembrane regions IX and X. Four diverse loops are apparent, for MraY, WecA, WbcO and RgpG, that uniquely characterize these sub-groups of the transferase family, and a correlation is evident with the known or implied UDP-sugar specificity.

  15. D-Fructose-6-phosphate aldolase-catalyzed one-pot synthesis of iminocyclitols.

    PubMed

    Sugiyama, Masakazu; Hong, Zhangyong; Liang, Pi-Hui; Dean, Stephen M; Whalen, Lisa J; Greenberg, William A; Wong, Chi-Huey

    2007-11-28

    A one-pot chemoenzymatic method for the synthesis of a variety of new iminocyclitols from readily available, non-phosphorylated donor substrates has been developed. The method utilizes the recently discovered fructose-6-phosphate aldolase (FSA), which is functionally distinct from known aldolases in its tolerance of different donor substrates as well as acceptor substrates. Kinetic studies were performed with dihydroxyacetone (DHA), the presumed endogenous substrate for FSA, as well as hydroxy acetone (HA) and 1-hydroxy-2-butanone (HB) as donor substrates, in each case using glyceraldehyde-3-phosphate as acceptor substrate. Remarkably, FSA used the three donor substrates with equal efficiency, with kcat/KMvalues of 33, 75, and 20 M-1 s-1, respectively. This level of donor substrate tolerance is unprecedented for an aldolase. Furthermore, DHA, HA, and HB were accepted as donors in FSA-catalyzed aldol reactions with a variety of azido- and Cbz-amino aldehyde acceptors. The broad substrate tolerance of FSA and the ability to circumvent the need for phosphorylated substrates allowed for one-pot synthesis of a number of known and novel iminocyclitols in good yields, and in a very concise fashion. New iminocyclitols were assayed as inhibitors against a panel of glycosidases. Compounds 15 and 16 were specific alpha-mannosidase inhibitors, and 24 and 26 were potent and selective inhibitors of beta-N-acetylglucosaminidases in the submicromolar range. Facile access to these compounds makes them attractive core structures for further inhibitor optimization.

  16. Rapid large-scale oligonucleotide selection for microarrays.

    PubMed

    Rahmann, Sven

    2002-01-01

    We present the first algorithm that selects oligonucleotide probes (e.g. 25-mers) for microarray experiments on a large scale. For example, oligos for human genes can be found within 50 hours. This becomes possible by using the longest common substring as a specificity measure for candidate oligos. We present an algorithm based on a suffix array with additional information that is efficient both in terms of memory usage and running time to rank all candidate oligos according to their specificity. We also introduce the concept of master sequences to describe the sequences from which oligos are to be selected. Constraints such as oligo length, melting temperature, and self-complementarity are incorporated in the master sequence at a preprocessing stage and thus kept separate from the main selection problem. As a result, custom oligos can now be designed for any sequenced genome, just as the technology for on-site chip synthesis is becoming increasingly mature.

  17. Empirical evaluation of oligonucleotide probe selection for DNA microarrays.

    PubMed

    Mulle, Jennifer G; Patel, Viren C; Warren, Stephen T; Hegde, Madhuri R; Cutler, David J; Zwick, Michael E

    2010-03-29

    DNA-based microarrays are increasingly central to biomedical research. Selecting oligonucleotide sequences that will behave consistently across experiments is essential to the design, production and performance of DNA microarrays. Here our aim was to improve on probe design parameters by empirically and systematically evaluating probe performance in a multivariate context. We used experimental data from 19 array CGH hybridizations to assess the probe performance of 385,474 probes tiled in the Duchenne muscular dystrophy (DMD) region of the X chromosome. Our results demonstrate that probe melting temperature, single nucleotide polymorphisms (SNPs), and homocytosine motifs all have a strong effect on probe behavior. These findings, when incorporated into future microarray probe selection algorithms, may improve microarray performance for a wide variety of applications.

  18. OligoCalc: an online oligonucleotide properties calculator

    PubMed Central

    Kibbe, Warren A.

    2007-01-01

    We developed OligoCalc as a web-accessible, client-based computational engine for reporting DNA and RNA single-stranded and double-stranded properties, including molecular weight, solution concentration, melting temperature, estimated absorbance coefficients, inter-molecular self-complementarity estimation and intra-molecular hairpin loop formation. OligoCalc has a familiar ‘calculator’ look and feel, making it readily understandable and usable. OligoCalc incorporates three common methods for calculating oligonucleotide-melting temperatures, including a nearest-neighbor thermodynamic model for melting temperature. Since it first came online in 1997, there have been more than 900 000 accesses of OligoCalc from nearly 200 000 distinct hosts, excluding search engines. OligoCalc is available at http://basic.northwestern.edu/biotools/OligoCalc.html, with links to the full source code, usage patterns and statistics at that link as well. PMID:17452344

  19. Insights to primitive replication derived from structures of small oligonucleotides

    NASA Technical Reports Server (NTRS)

    Smith, G. K.; Fox, G. E.

    1995-01-01

    Available information on the structure of small oligonucleotides is surveyed. It is observed that even small oligomers typically exhibit defined structures over a wide range of pH and temperature. These structures rely on a plethora of non-standard base-base interactions in addition to the traditional Watson-Crick pairings. Stable duplexes, though typically antiparallel, can be parallel or staggered and perfect complementarity is not essential. These results imply that primitive template directed reactions do not require high fidelity. Hence, the extensive use of Watson-Crick complementarity in genes rather than being a direct consequence of the primitive condensation process, may instead reflect subsequent selection based on the advantage of accuracy in maintaining the primitive genetic machinery once it arose.

  20. Aptamer Oligonucleotides: Novel Potential Therapeutic Agents in Autoimmune Disease.

    PubMed

    Li, Weibin; Lan, Xiaopeng

    2015-08-01

    Aptamers are single-stranded deoxyribonucleic acid or ribonucleic acid oligonucleotides generated in vitro based on affinity for certain target molecules by a process known as Systematic Evolution of Ligands by Exponential Enrichment. Aptamers can bind their target molecules with high specificity and selectivity by means of structure compatibility, stacking of aromatic rings, electrostatic and van der Waals interactions, and hydrogen bonding. With several advantages over monoclonal antibodies and other conventional small-molecule therapeutics, such as high specificity and affinity, negligible batch to batch variation, flexible modification and stability, lack of toxicity and low immunogenicity, aptamers are becoming promising novel diagnostic and therapeutic agents. This review focuses on the development of aptamers as potential therapeutics for autoimmune diseases, including diabetes mellitus, multiple sclerosis, rheumatoid arthritis, myasthenia gravis, and systemic lupus erythematosus.

  1. Intracerebral Infusion of Antisense Oligonucleotides Into Prion-infected Mice

    PubMed Central

    Nazor Friberg, Karah; Hung, Gene; Wancewicz, Ed; Giles, Kurt; Black, Chris; Freier, Sue; Bennett, Frank; DeArmond, Stephen J; Freyman, Yevgeniy; Lessard, Pierre; Ghaemmaghami, Sina; Prusiner, Stanley B

    2012-01-01

    Mice deficient for the cellular prion protein (PrPC) do not develop prion disease; accordingly, gene-based strategies to diminish PrPC expression are of interest. We synthesized a series of chemically modified antisense oligonucleotides (ASOs) targeted against mouse Prnp messenger RNA (mRNA) and identified those that were most effective in decreasing PrPC expression. Those ASOs were also evaluated in scrapie-infected cultured cells (ScN2a) for their efficacy in diminishing the levels of the disease-causing prion protein (PrPSc). When the optimal ASO was infused intracerebrally into FVB mice over a 14-day period beginning 1 day after infection with the Rocky Mountain Laboratory (RML) strain of mouse prions, a prolongation of the incubation period of almost 2 months was observed. Whether ASOs can be used to develop an effective therapy for patients dying of Creutzfeldt–Jakob disease remains to be established. PMID:23344724

  2. Tetramerization of an RNA oligonucleotide containing a GGGG sequence.

    PubMed

    Kim, J; Cheong, C; Moore, P B

    1991-05-23

    Poly rG can form four-stranded helices. The Hoogsteen-paired quartets of G residues on which such structures depend are so stable that they will form in 5'-GMP solutions, provided that Na+ or K+ are present (see for example, refs 2-4). Telomeric DNA sequences, which are G-rich, adopt four-stranded antiparallel G-quartet conformations in vitro, and parallel tetramerization of G-rich sequences may be involved in meiosis. Here we show that RNAs containing short runs of Gs can also tetramerize. A 19-base oligonucleotide derived from the 5S RNA of Escherichia coli (strand III), 5'GCCGAUGGUAGUGUGGGGU3', forms a K(+)-stabilized tetrameric aggregate that depends on the G residues at its 3' end. This complex is so stable that it would be surprising if similar structures do not occur in nature.

  3. Targeted gene correction with 5' acridine-oligonucleotide conjugates.

    PubMed

    de Piédoue, G; Andrieu-Soler, C; Concordet, J P; Maurisse, R; Sun, J-S; Lopez, B; Kuzniak, I; Leboulch, P; Feugeas, J-P

    2007-01-01

    Single-stranded oligonucleotides (SSOs) mediate gene repair of punctual chromosomal mutations at a low frequency. We hypothesized that enhancement of DNA binding affinity of SSOs by intercalating agents may increase the number of corrected cells. Several biochemical modifications of SSOs were tested for their capability to correct a chromosomally integrated and mutated GFP reporter gene in human 293 cells. SSOs of 25 nucleotide length conjugated with acridine at their 5' end increased the efficiency of gene correction up to 10-fold compared to nonmodified SSOs. Acridine and psoralen conjugates were both evaluated, and acridine-modified SSOs were the most effective. Conjugation with acridine at the 3' end of the SSO inhibited gene correction, whereas flanking the SSO by acridine on both sides provided an intermediate level of correction. These results suggest that increasing the stability of hybridization between SSO and its target without hampering a 3' extension improves gene targeting, in agreement with the "annealing-integration" model of DNA repair.

  4. Association of branched oligonucleotides into the i-motif.

    PubMed

    Robidoux, S; Klinck, R; Gehring, K; Damha, M J

    1997-12-01

    The unique architecture of branched oligonucleotides mimicking lariat RNA introns [Wallace and Edmons, Proc. Natl. Acad. Sci. USA 80, 950-954 (1983)] was exploited to study compounds that associate as two parallel duplexes with intercalating C/C+ base pairs (i-motif DNA) [Gehring et al. Nature 363, 561-565 (1993)]. The formation of a branched cytosine tetrad was induced by joining the 5'-ends of pair of pentadeoxycytidine strands with a branching riboadenosine (rA) linker. This arrangement causes the orientation of the dC strands to be parallel, and forces the formation of a C/C+ duplex that self-associates into i-DNA. Presence of the i-motif in this structure is supported by thermal denaturation, native gel electrophoresis, CD, and NMR spectroscopy.

  5. Antisense oligonucleotide targeting midkine suppresses in vivo angiogenesis.

    PubMed

    Dai, Li-Cheng; Wang, Xiang; Yao, Xing; Lu, Yong-Liang; Ping, Jin-Liang; He, Jian-Fang

    2007-02-28

    To evaluate the effect of antisense oligonucleotide targeting midkine (MK-AS) on angiogenesis in chick chorioallantoic membrane (CAM) and in situ human hepatocellular carcinoma (HCC). An in situ human hepatocellular carcinoma (HCC) model and CAM assay were used in this experiment. The effect of MK-AS on angiogenesis was evaluated by cell proliferation assay and hematoxylin-eosin (HE) staining. MK-AS significantly inhibited human umbilical vein endothelial cells (HUVEC) and in situ human HCC growth. At the same time, MK-AS suppressed the angiogenesis both in human hepatocellular carcinoma cell line (HEPG2)-induced CAM and in situ human HCC tissues. MK-AS is an effective antiangiogenesis agent in vivo.

  6. Antisense oligonucleotide targeting midkine suppresses in vivo angiogenesis

    PubMed Central

    Dai, Li-Cheng; Wang, Xiang; Yao, Xing; Lu, Yong-Liang; Ping, Jin-Liang; He, Jian-Fang

    2007-01-01

    AIM: To evaluate the effect of antisense oligonucleotide targeting midkine (MK-AS) on angiogenesis in chick chorioallantoic membrane (CAM) and in situ human hepatocellular carcinoma (HCC). METHODS: An in situ human hepatocellular carcinoma (HCC) model and CAM assay were used in this experiment. The effect of MK-AS on angiogenesis was evaluated by cell proliferation assay and hematoxylin-eosin (HE) staining. RESULTS: MK-AS significantly inhibited human umbilical vein endothelial cells (HUVEC) and in situ human HCC growth. At the same time, MK-AS suppressed the angiogenesis both in human hepatocellular carcinoma cell line (HEPG2)-induced CAM and in situ human HCC tissues. CONCLUSION: MK-AS is an effective antiangiogenesis agent in vivo. PMID:17451201

  7. Electrochemically directed synthesis of oligonucleotides for DNA microarray fabrication

    PubMed Central

    Egeland, Ryan D.; Southern, Edwin M.

    2005-01-01

    We demonstrate a new method for making oligonucleotide microarrays by synthesis in situ. The method uses conventional DNA synthesis chemistry with an electrochemical deblocking step. Acid is delivered to specific regions on a glass slide, thus allowing nucleotide addition only at chosen sites. The acid is produced by electrochemical oxidation controlled by an array of independent microelectrodes. Deblocking is complete in a few seconds, when competing side-product reactions are minimal. We demonstrate the successful synthesis of 17mers and discrimination of single base pair mismatched hybrids. Features generated in this study are 40 μm wide, with sharply defined edges. The synthetic technique may be applicable to fabrication of other molecular arrays. PMID:16085751

  8. Triplex-forming oligonucleotide target sequences in the human genome

    PubMed Central

    Goñi, J. Ramon; de la Cruz, Xavier; Orozco, Modesto

    2004-01-01

    The existence of sequences in the human genome which can be a target for triplex formation, and accordingly are candidates for anti-gene therapies, has been studied by using bioinformatics tools. It was found that the population of triplex-forming oligonucleotide target sequences (TTS) is much more abundant than that expected from simple random models. The population of TTS is large in all the genome, without major differences between chromosomes. A wide analysis along annotated regions of the genome allows us to demonstrate that the largest relative concentration of TTS is found in regulatory regions, especially in promoter zones, which suggests a tremendous potentiality for triplex strategy in the control of gene expression. The dependence of the stability and selectivity of the triplexes on the length of the TTS is also analysed using knowledge-based rules. PMID:14726484

  9. Oligonucleotide synthesis catalyzed by the Zn/2+/ ion

    NASA Technical Reports Server (NTRS)

    Sawai, H.; Orgel, L. E.

    1975-01-01

    Results of experiments are reported in which Zn(2+) ion catalyzed the formation of oligonucleotides from nucleoside phosphorimidazolides in aqueous solution, even in the absence of a template. Specifically, the imidazolides (ImpU or ImpA) polymerized to form ImpApA, and pApA, pApApA, and pApApApA, or the analogous uracil compounds. In addition, the expected hydrolysis products of the hydrolysis of ImpA were formed (pA, imidazole). Judging from the ratio of pA(n) over pA (with and without zinc ion), this ion increased the efficiency of phosphodiester-bond formation by up to 10 times. Possible mechanisms for the reaction are tentatively proposed.

  10. Predicting the Kinetics of RNA Oligonucleotides Using Markov State Models.

    PubMed

    Pinamonti, Giovanni; Zhao, Jianbo; Condon, David E; Paul, Fabian; Noè, Frank; Turner, Douglas H; Bussi, Giovanni

    2017-02-14

    Nowadays different experimental techniques, such as single molecule or relaxation experiments, can provide dynamic properties of biomolecular systems, but the amount of detail obtainable with these methods is often limited in terms of time or spatial resolution. Here we use state-of-the-art computational techniques, namely, atomistic molecular dynamics and Markov state models, to provide insight into the rapid dynamics of short RNA oligonucleotides, to elucidate the kinetics of stacking interactions. Analysis of multiple microsecond-long simulations indicates that the main relaxation modes of such molecules can consist of transitions between alternative folded states, rather than between random coils and native structures. After properly removing structures that are artificially stabilized by known inaccuracies of the current RNA AMBER force field, the kinetic properties predicted are consistent with the time scales of previously reported relaxation experiments.

  11. Recent Methods for Purification and Structure Determination of Oligonucleotides

    PubMed Central

    Zhang, Qiulong; Lv, Huanhuan; Wang, Lili; Chen, Man; Li, Fangfei; Liang, Chao; Yu, Yuanyuan; Jiang, Feng; Lu, Aiping; Zhang, Ge

    2016-01-01

    Aptamers are single-stranded DNA or RNA oligonucleotides that can interact with target molecules through specific three-dimensional structures. The excellent features, such as high specificity and affinity for target proteins, small size, chemical stability, low immunogenicity, facile chemical synthesis, versatility in structural design and engineering, and accessible for site-specific modifications with functional moieties, make aptamers attractive molecules in the fields of clinical diagnostics and biopharmaceutical therapeutics. However, difficulties in purification and structural identification of aptamers remain a major impediment to their broad clinical application. In this mini-review, we present the recently attractive developments regarding the purification and identification of aptamers. We also discuss the advantages, limitations, and prospects for the major methods applied in purifying and identifying aptamers, which could facilitate the application of aptamers. PMID:27999357

  12. Renal Delivery of Anti-microRNA Oligonucleotides in Rats.

    PubMed

    Usa, Kristie S; Liu, Yong; Kurth, Terry; Kriegel, Alison J; Mattson, David L; Cowley, Allen W; Liang, Mingyu

    2017-01-01

    MicroRNAs are endogenous small, non-protein-coding RNA molecules that play an important role in the regulation of a wide variety of cellular functions and disease processes. A novel role for microRNAs in the development of hypertension and hypertensive tissue injury is emerging in recent studies. Development of hypertension involves multiple organ systems and cannot be modeled in vitro. Therefore, the ability to experimentally alter genes, gene products, or biological pathways, including microRNAs, in an organ-specific manner in intact animal models is particularly valuable to hypertension research. The kidney plays a central role in the long-term regulation of arterial blood pressure. In this chapter, we describe a detailed protocol for using a renal interstitial injection method to deliver anti-miR oligonucleotides to knock down microRNA specifically in the kidney in conscious rats.

  13. Oligonucleotide synthesis catalyzed by the Zn/2+/ ion

    NASA Technical Reports Server (NTRS)

    Sawai, H.; Orgel, L. E.

    1975-01-01

    Results of experiments are reported in which Zn(2+) ion catalyzed the formation of oligonucleotides from nucleoside phosphorimidazolides in aqueous solution, even in the absence of a template. Specifically, the imidazolides (ImpU or ImpA) polymerized to form ImpApA, and pApA, pApApA, and pApApApA, or the analogous uracil compounds. In addition, the expected hydrolysis products of the hydrolysis of ImpA were formed (pA, imidazole). Judging from the ratio of pA(n) over pA (with and without zinc ion), this ion increased the efficiency of phosphodiester-bond formation by up to 10 times. Possible mechanisms for the reaction are tentatively proposed.

  14. A note on oligonucleotide expression values not being normally distributed.

    PubMed

    Hardin, Johanna; Wilson, Jason

    2009-07-01

    Novel techniques for analyzing microarray data are constantly being developed. Though many of the methods contribute to biological discoveries, inability to properly evaluate the novel techniques limits their ability to advance science. Because the underlying distribution of microarray data is unknown, novel methods are typically tested against the assumed normal distribution. However, microarray data are not, in fact, normally distributed, and assuming so can have misleading consequences. Using an Affymetrix technical replicate spike-in data set, we show that oligonucleotide expression values are not normally distributed for any of the standard methods for calculating expression values. The resulting data tend to have a large proportion of skew and heavy tailed genes. Additionally, we show that standard methods can give unexpected and misleading results when the data are not well approximated by the normal distribution. Robust methods are therefore recommended when analyzing microarray data. Additionally, new techniques should be evaluated with skewed and/or heavy-tailed data distributions.

  15. Chemical synthesis of long RNAs with terminal 5′‐phosphate groups

    PubMed Central

    Pradère, Ugo; Halloy, François

    2017-01-01

    Abstract Long structured RNAs are useful biochemical and biological tools. They are usually prepared enzymatically, but this precludes their site‐specific modification with functional groups for chemical biology studies. One solution is to perform solid‐phase synthesis of multiple RNAs loaded with 5′‐terminal phosphate groups, so that RNAs can be concatenated using template ligation reactions. However, there are currently no readily available reagents suitable for the incorporation of the phosphate group into long RNAs by solid‐phase synthesis. Here we describe an easy‐to‐prepare phosphoramidite reagent suitable for the chemical introduction of 5′‐terminal phosphate groups into long RNAs. The phosphate is protected by a dinitrobenzhydryl group that serves as an essential lipophilic group for the separation of oligonucleotide by‐products. The phosphate is unmasked quantitatively by brief UV irradiation. We demonstrate the value of this reagent in the preparation of a library of long structured RNAs that are site‐specifically modified with functional groups. PMID:28295757

  16. Multi-scale exciton and electron transfer in multi-level donor-acceptor systems

    NASA Astrophysics Data System (ADS)

    Gurvitz, Shmuel; Nesterov, Alexander I.; Berman, Gennady P.

    2017-09-01

    We study theoretically the noise-assisted quantum exciton (electron) transfer (ET) in bio-complexes consisting of a single-level electron donor and an acceptor which has a complicated internal structure, and is modeled by many electron energy levels. Interactions are included between the donor and the acceptor energy levels and with the protein-solvent noisy environment. Different regions of parameters are considered, which characterize (i) the number of the acceptor levels, (ii) the acceptor ‘band-width’, and (iii) the amplitude of noise and its correlation time. Under some conditions, we derive analytical expressions for the ET rate and efficiency. We obtain equal occupation of all levels at large times, independent of the structure of the acceptor band and the noise parameters, but under the condition of non-degeneracy of the acceptor energy levels. We discuss the multi-scale dynamics of the acceptor population, and the accompanying effect of quantum coherent oscillations. We also demonstrate that for a large number of levels in the acceptor band, the efficiency of ET can be close to 100%, for both downhill and uphill transitions and for sharp and flat redox potentials.

  17. Dichotomous Role of Exciting the Donor or the Acceptor on Charge Generation in Organic Solar Cells.

    PubMed

    Hendriks, Koen H; Wijpkema, Alexandra S G; van Franeker, Jacobus J; Wienk, Martijn M; Janssen, René A J

    2016-08-10

    In organic solar cells, photoexcitation of the donor or acceptor phase can result in different efficiencies for charge generation. We investigate this difference for four different 2-pyridyl diketopyrrolopyrrole (DPP) polymer-fullerene solar cells. By comparing the external quantum efficiency spectra of the polymer solar cells fabricated with either [60]PCBM or [70]PCBM fullerene derivatives as acceptor, the efficiency of charge generation via donor excitation and acceptor excitation can both be quantified. Surprisingly, we find that to make charge transfer efficient, the offset in energy between the HOMO levels of donor and acceptor that govern charge transfer after excitation of the acceptor must be larger by ∼0.3 eV than the offset between the corresponding two LUMO levels when the donor is excited. As a consequence, the driving force required for efficient charge generation is significantly higher for excitation of the acceptor than for excitation of the donor. By comparing charge generation for a total of 16 different DPP polymers, we confirm that the minimal driving force, expressed as the photon energy loss, differs by about 0.3 eV for exciting the donor and exciting the acceptor. Marcus theory may explain the dichotomous role of exciting the donor or the acceptor on charge generation in these solar cells.

  18. Antisense oligonucleotide therapy for spinocerebellar ataxia type 2.

    PubMed

    Scoles, Daniel R; Meera, Pratap; Schneider, Matthew D; Paul, Sharan; Dansithong, Warunee; Figueroa, Karla P; Hung, Gene; Rigo, Frank; Bennett, C Frank; Otis, Thomas S; Pulst, Stefan M

    2017-04-20

    There are no disease-modifying treatments for adult human neurodegenerative diseases. Here we test RNA-targeted therapies in two mouse models of spinocerebellar ataxia type 2 (SCA2), an autosomal dominant polyglutamine disease. Both models recreate the progressive adult-onset dysfunction and degeneration of a neuronal network that are seen in patients, including decreased firing frequency of cerebellar Purkinje cells and a decline in motor function. We developed a potential therapy directed at the ATXN2 gene by screening 152 antisense oligonucleotides (ASOs). The most promising oligonucleotide, ASO7, downregulated ATXN2 mRNA and protein, which resulted in delayed onset of the SCA2 phenotype. After delivery by intracerebroventricular injection to ATXN2-Q127 mice, ASO7 localized to Purkinje cells, reduced cerebellar ATXN2 expression below 75% for more than 10 weeks without microglial activation, and reduced the levels of cerebellar ATXN2. Treatment of symptomatic mice with ASO7 improved motor function compared to saline-treated mice. ASO7 had a similar effect in the BAC-Q72 SCA2 mouse model, and in both mouse models it normalized protein levels of several SCA2-related proteins expressed in Purkinje cells, including Rgs8, Pcp2, Pcp4, Homer3, Cep76 and Fam107b. Notably, the firing frequency of Purkinje cells returned to normal even when treatment was initiated more than 12 weeks after the onset of the motor phenotype in BAC-Q72 mice. These findings support ASOs as a promising approach for treating some human neurodegenerative diseases.

  19. Dissecting the hybridization of oligonucleotides to structured complementary sequences.

    PubMed

    Peracchi, Alessio

    2016-06-01

    When oligonucleotides hybridize to long target molecules, the process is slowed by the secondary structure in the targets. The phenomenon has been analyzed in several previous studies, but many details remain poorly understood. I used a spectrofluorometric strategy, focusing on the formation/breaking of individual base pairs, to study the kinetics of association between a DNA hairpin and >20 complementary oligonucleotides ('antisenses'). Hybridization rates differed by over three orders of magnitude. Association was toehold-mediated, both for antisenses binding to the target's ends and for those designed to interact with the loop. Binding of these latter, besides being consistently slower, was affected to variable, non-uniform extents by the asymmetric loop structure. Divalent metal ions accelerated hybridization, more pronouncedly when nucleation occurred at the loop. Incorporation of locked nucleic acid (LNA) residues in the antisenses substantially improved the kinetics only when LNAs participated to the earliest hybridization steps. The effects of individual LNAs placed along the antisense indicated that the reaction transition state occurred after invading at least the first base pair of the stem. The experimental approach helps dissect hybridization reactions involving structured nucleic acids. Toehold-dependent, nucleation-invasion models appear fully appropriate for describing such reactions. Estimating the stability of nucleation complexes formed at internal toeholds is the major hurdle for the quantitative prediction of hybridization rates. While analyzing the mechanisms of a fundamental biochemical process (hybridization), this work also provides suggestions for the improvement of technologies that rely on such process. Copyright © 2016 Elsevier B.V. All rights reserved.

  20. TIA-1 RRM23 binding and recognition of target oligonucleotides.

    PubMed

    Waris, Saboora; García-Mauriño, Sofía M; Sivakumaran, Andrew; Beckham, Simone A; Loughlin, Fionna E; Gorospe, Myriam; Díaz-Moreno, Irene; Wilce, Matthew C J; Wilce, Jacqueline A

    2017-05-05

    TIA-1 (T-cell restricted intracellular antigen-1) is an RNA-binding protein involved in splicing and translational repression. It mainly interacts with RNA via its second and third RNA recognition motifs (RRMs), with specificity for U-rich sequences directed by RRM2. It has recently been shown that RRM3 also contributes to binding, with preferential binding for C-rich sequences. Here we designed UC-rich and CU-rich 10-nt sequences for engagement of both RRM2 and RRM3 and demonstrated that the TIA-1 RRM23 construct preferentially binds the UC-rich RNA ligand (5΄-UUUUUACUCC-3΄). Interestingly, this binding depends on the presence of Lys274 that is C-terminal to RRM3 and binding to equivalent DNA sequences occurs with similar affinity. Small-angle X-ray scattering was used to demonstrate that, upon complex formation with target RNA or DNA, TIA-1 RRM23 adopts a compact structure, showing that both RRMs engage with the target 10-nt sequences to form the complex. We also report the crystal structure of TIA-1 RRM2 in complex with DNA to 2.3 Å resolution providing the first atomic resolution structure of any TIA protein RRM in complex with oligonucleotide. Together our data support a specific mode of TIA-1 RRM23 interaction with target oligonucleotides consistent with the role of TIA-1 in binding RNA to regulate gene expression. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  1. Reaction between metabolically activated acetaminophen and phosphorothioate oligonucleotides.

    PubMed

    Copple, B L; Gmeiner, W M; Iversen, P L

    1995-07-01

    Assessment of toxic or mutagenic risks associated with phosphorothioate oligonucleotides (PTO) is important. In vitro and in vivo data have shown that PTOs are nontoxic and nonmutagenic. However, these studies do not address interactions between PTOs and other compounds. The sulfur on PTOs may provide a novel reactive center on a DNA molecule for drug interactions. This study chose acetaminophen (ACAP) as a model drug because ACAP is oxidized to the reactive intermediate N-acetyl-p-benzoquinone imine (NAPQI), which reacts with sulfur-containing compounds. Reaction of dCTP(S) with NAPQI or activated ACAP formed a product distinct from the reactants. Analysis of the product by fast atom bombardment mass spectroscopy gave a molecular weight consistent with NAPQI bound to a sulfur. Higher-molecular-weight products were seen on a polyacrylamide gel electrophoresis after incubation of fluorescein-labeled PTO with NAPQI. These products were not seen after incubation of a phosphodiester oligonucleotide with NAPQI. 31P NMR analysis confirmed the existence of a heterogenous mixture of adducts between a PTO and NAPQI. Nonsequence-specific PTOs of various lengths were tested for their ability to reduce ACAP toxicity. Cell viability showed that larger PTOs provided greater protection. We evaluated the ability of NAPQI to cause mutations in the LacZ gene of pBluescript plasmid which contained phosphorothioate linkages at designed locations within the gene. In addition, the ability of ACAP to cause mutations in the HGPRT locus in cells grown in dATP(S)-containing medium was measured. No mutations were seen in either assay. Based upon these results, activated ACAP is reactive with PTOs in vitro, although this interaction is nontoxic and nonmutagenic.

  2. Rise-Time of FRET-Acceptor Fluorescence Tracks Protein Folding

    PubMed Central

    Lindhoud, Simon; Westphal, Adrie H.; van Mierlo, Carlo P. M.; Visser, Antonie J. W. G.; Borst, Jan Willem

    2014-01-01

    Uniform labeling of proteins with fluorescent donor and acceptor dyes with an equimolar ratio is paramount for accurate determination of Förster resonance energy transfer (FRET) efficiencies. In practice, however, the labeled protein population contains donor-labeled molecules that have no corresponding acceptor. These FRET-inactive donors contaminate the donor fluorescence signal, which leads to underestimation of FRET efficiencies in conventional fluorescence intensity and lifetime-based FRET experiments. Such contamination is avoided if FRET efficiencies are extracted from the rise time of acceptor fluorescence upon donor excitation. The reciprocal value of the rise time of acceptor fluorescence is equal to the decay rate of the FRET-active donor fluorescence. Here, we have determined rise times of sensitized acceptor fluorescence to study the folding of double-labeled apoflavodoxin molecules and show that this approach tracks the characteristics of apoflavodoxinʼs complex folding pathway. PMID:25535076

  3. Vacancy-Induced Electronic Structure Variation of Acceptors and Correlation with Proton Conduction in Perovskite Oxides.

    PubMed

    Kim, Hye-Sung; Jang, Ahreum; Choi, Si-Young; Jung, WooChul; Chung, Sung-Yoon

    2016-10-17

    In most proton-conducing perovskite oxides, the electrostatic attraction between negatively charged acceptor dopants and protonic defects having a positive charge is known to be a major cause of retardation of proton conduction, a phenomenon that is generally referred to as proton trapping. We experimentally show that proton trapping can be suppressed by clustering of positively charged oxygen vacancies to acceptors in BaZrO3-δ and BaCeO3-δ . In particular, to ensure the vacancy-acceptor association is effective against proton trapping, the valence electron density of acceptors should not significantly vary when the oxygen vacancies cluster, based on the weak hybridization between the valence d or p orbitals of acceptors and the 2p orbitals of oxygen.

  4. Hexa-peri-hexabenzocoronene with Different Acceptor Units for Tuning Optoelectronic Properties.

    PubMed

    Keerthi, Ashok; Hou, Ian Cheng-Yi; Marszalek, Tomasz; Pisula, Wojciech; Baumgarten, Martin; Narita, Akimitsu

    2016-10-06

    Hexa-peri-hexabenzocoronene (HBC)-based donor-acceptor dyads were synthesized with three different acceptor units, through two pathways: 1) "pre-functionalization" of monobromo-substituted hexaphenylbenzene prior to the cyclodehydrogenation; and 2) "post-functionalization" of monobromo-substituted HBC after the cyclodehydrogenation. The HBC-acceptor dyads demonstrated varying degrees of intramolecular charge-transfer interactions, depending on the attached acceptor units, which allowed tuning of their photophysical and optoelectronic properties, including the energy gaps. The two synthetic pathways described here can be complementary and potentially be applied for the synthesis of nanographene-acceptor dyads with larger aromatic cores, including one-dimensionally extended graphene nanoribbons.

  5. The activation energy for Mg acceptor in the Ga-rich InGaN alloys

    NASA Astrophysics Data System (ADS)

    Zhao, Chuan-Zhen; Wei, Tong; Chen, Li-Ying; Wang, Sha-Sha; Wang, Jun

    2017-02-01

    The activation energy for Mg acceptor in InxGa1-xN alloys is investigated. It is found that there are three factors to influence the activation energy for Mg acceptor. One is the stronger dependence of the VBM of InxGa1-xN depending on In content than that of the Mg acceptor energy level. The other is the concentration of Mg acceptors. Another is the extending of the valence band-tail states into the band gap. In addition, a model based on modifying the effective mass model is developed. It is found that the model can describe the activation energy for Mg acceptor in the Ga-rich InxGa1-xN alloys well after considering the influence of the valence band-tail states.

  6. Surface Modified Gadolinium Phosphate Nanoparticles as MRI Contrast Agents

    NASA Astrophysics Data System (ADS)

    Dumont, Matthieu F.; Baligand, Celine; Knowles, Elisabeth S.; Meisel, Mark W.; Walter, Glenn A.; Talham, Daniel R.

    2012-02-01

    Nanoparticles of GdPO4H2O were synthesized in a water/oil microemulsion using IGEPAL CO-520 as surfactant resulting in 50 nm to 100 nm particles that are dispersible and stable in water. Using surface modification chemistry previously established for zirconium phosphonate surfaces,ootnotetext J. Monot et al., J. Am. Chem. Soc. 130 (2008) 6243. the particles are directly modified with 5'-phosphate terminated oligonucleotides, and the specific interaction of the divalent phosphate with Gd^3+ sites at the surface is demonstrated. The ability of the modified nanoparticles to act as MRI contrast agents was determined by performing MR relaxivity measurements at 14 T. Solutions of nanopure water, Feridex and Omniscan (FDA cleared contrast agents) in 0.25% agarose were used for comparison and control purposes. MRI data confirm that GdPO4H2O nanoparticles have relaxivities (r1,r2) comparable to commercially available contrast agents.ootnotetext H. Hifumi et al., J. Am. Chem. Soc. 128 (2006) 15090. In addition, biofunctionalization of the surface of the nanoparticles does not prevent their function as MRI contrast agents.

  7. Stereospecificity of Oligonucleotide Interactions Revisited: No Evidence for Heterochiral Hybridization and Ribozyme/DNAzyme Activity

    PubMed Central

    Hoehlig, Kai; Bethge, Lucas; Klussmann, Sven

    2015-01-01

    A major challenge for the application of RNA- or DNA-oligonucleotides in biotechnology and molecular medicine is their susceptibility to abundant nucleases. One intriguing possibility to tackle this problem is the use of mirror-image (l-)oligonucleotides. For aptamers, this concept has successfully been applied to even develop therapeutic agents, so-called Spiegelmers. However, for technologies depending on RNA/RNA or RNA/DNA hybridization, like antisense or RNA interference, it has not been possible to use mirror-image oligonucleotides because Watson-Crick base pairing of complementary strands is (thought to be) stereospecific. Many scientists consider this a general principle if not a dogma. A recent publication proposing heterochiral Watson-Crick base pairing and sequence-specific hydrolysis of natural RNA by mirror-image ribozymes or DNAzymes (and vice versa) prompted us to systematically revisit the stereospecificity of oligonucleotides hybridization and catalytic activity. Using hyperchromicity measurements we demonstrate that hybridization only occurs among homochiral anti-parallel complementary oligonucleotide strands. As expected, achiral PNA hybridizes to RNA and DNA irrespective of their chirality. In functional assays we could not confirm an alleged heterochiral hydrolytic activity of ribozymes or DNAzymes. Our results confirm a strict stereospecificity of oligonucleotide hybridization and clearly argue against the possibility to use mirror-image oligonucleotides for gene silencing or antisense applications. PMID:25679211

  8. Expression profiling using microarrays fabricated by an ink-jet oligonucleotide synthesizer.

    PubMed

    Hughes, T R; Mao, M; Jones, A R; Burchard, J; Marton, M J; Shannon, K W; Lefkowitz, S M; Ziman, M; Schelter, J M; Meyer, M R; Kobayashi, S; Davis, C; Dai, H; He, Y D; Stephaniants, S B; Cavet, G; Walker, W L; West, A; Coffey, E; Shoemaker, D D; Stoughton, R; Blanchard, A P; Friend, S H; Linsley, P S

    2001-04-01

    We describe a flexible system for gene expression profiling using arrays of tens of thousands of oligonucleotides synthesized in situ by an ink-jet printing method employing standard phosphoramidite chemistry. We have characterized the dependence of hybridization specificity and sensitivity on parameters including oligonucleotide length, hybridization stringency, sequence identity, sample abundance, and sample preparation method. We find that 60-mer oligonucleotides reliably detect transcript ratios at one copy per cell in complex biological samples, and that ink-jet arrays are compatible with several different sample amplification and labeling techniques. Furthermore, results using only a single carefully selected oligonucleotide per gene correlate closely with those obtained using complementary DNA (cDNA) arrays. Most of the genes for which measurements differ are members of gene families that can only be distinguished by oligonucleotides. Because different oligonucleotide sequences can be specified for each array, we anticipate that ink-jet oligonucleotide array technology will be useful in a wide variety of DNA microarray applications.

  9. Oligonucleotides designed to inhibit TLR9 block Herpes simplex virus type 1 infection at multiple steps.

    PubMed

    Sauter, Monica M; Gauger, Joshua J L; Brandt, Curtis R

    2014-09-01

    Herpes simplex virus type 1 (HSV-1) is an important human pathogen which requires activation of nuclear factor-kappa B (NFκB) during its replication cycle. The persistent nature of HSV-1 infection, and the emergence of drug-resistant strains, highlights the importance of research to develop new antiviral agents. Toll-like receptors (TLRs) play a prominent role during the early antiviral response by recognizing viral nucleic acid and gene products, activating NFκB, and stimulating the production of inflammatory cytokines. We demonstrate a significant effect on HSV-1 replication in ARPE-19 and Vero cells when oligonucleotides designed to inhibit TLR9 are added 2h prior to infection. A greater than 90% reduction in the yield of infectious virus was achieved at oligonucleotide concentrations of 10-20 μM. TLR9 inhibitory oligonucleotides prevented expression of essential immediate early herpes gene products as determined by immunofluorescence microscopy and Western blotting. TLR9 oligonucleotides also interfered with viral attachment and entry. A TLR9 inhibitory oligonucleotide containing five adjacent guanosine residues (G-ODN) exhibited virucidal activity and inhibited HSV-1 replication when added post-infection. The antiviral effect of the TLR9 inhibitory oligonucleotides did not depend on the presence of TLR9 protein, suggesting a mechanism of inhibition that is not TLR9 specific. TLR9 inhibitory oligonucleotides also reduced NFκB activity in nuclear extracts. Studies using these TLR inhibitors in the context of viral infection should be interpreted with caution.

  10. Properties of amphiphilic oligonucleotide films at the air/water interface and after film transfer.

    PubMed

    Keller, R; Kwak, M; de Vries, J W; Sawaryn, C; Wang, J; Anaya, M; Müllen, K; Butt, H-J; Herrmann, A; Berger, R

    2013-11-01

    The self-assembly of amphiphilic hybrid materials containing an oligonucleotide sequence at the air/water interface was investigated by means of pressure-molecular area (Π-A) isotherms. In addition, films were transferred onto solid substrates and imaged using scanning force microscopy. We used oligonucleotide molecules with lipid tails, which consisted of a single stranded oligonucleotide 11 mer containing two hydrophobically modified 5-(dodec-1-ynyl)uracil nucleobases (dU11) at the 5'-end of the oligonucleotide sequence. The air/water interface was used as confinement for the self-assembling process of dU11. Scanning force microscopy of films transferred via Langmuir-Blodgett technique revealed mono-, bi- (Π ≥ 2 mN/m) and multilayer formation (Π ≥ 30 mN/m). The first layer was 1.6 ± 0.1 nm thick. It was oriented with the hydrophilic oligonucleotide moiety facing the hydrophilic substrate while the hydrophobic alkyl chains faced air. In the second layer the oligonucleotide moiety was found to face the air. The second layer was found to cover up to 95% of the sample area. Our measurements indicated that the rearrangement of the molecules into bi- and multiple bilayers happened already at the air/water interface. Similar results were obtained with a second type of oligonucleotide amphiphile, an oligonucleotide block copolymer, which was composed of an oligonucleotide 11 mer covalently attached at the terminus to polypropyleneoxide (PPO). Copyright © 2013 Elsevier B.V. All rights reserved.

  11. Potassium acceptor doping of ZnO crystals

    SciTech Connect

    Parmar, Narendra S. Lynn, K. G.; Corolewski, Caleb D.; McCluskey, Matthew D.

    2015-05-15

    ZnO bulk single crystals were doped with potassium by diffusion at 950°C. Positron annihilation spectroscopy confirms the filling of zinc vacancies and a different trapping center for positrons. Secondary ion mass spectroscopy measurements show the diffusion of potassium up to 10 μm with concentration ∼1 × 10{sup 16} cm{sup −3}. IR measurements show a local vibrational mode (LVM) at 3226 cm{sup −1}, at a temperature of 9 K, in a potassium doped sample that was subsequently hydrogenated. The LVM is attributed to an O–H bond-stretching mode adjacent to a potassium acceptor. When deuterium substitutes for hydrogen, a peak is observed at 2378 cm{sup −1}. The O-H peak is much broader than the O-D peak, perhaps due to an unusually low vibrational lifetime. The isotopic frequency ratio is similar to values found in other hydrogen complexes. Potassium doping increases the resistivity up to 3 orders of magnitude at room temperature. The doped sample has a donor level at 0.30 eV.

  12. Effects of hydrogen on acceptor activation in ternary nitride semiconductors

    DOE PAGES

    Fioretti, Angela N.; Stokes, Adam; Young, Matthew R.; ...

    2017-02-09

    Doping control is necessary to unlock the scientific and technological potential of many materials, including ternary II-IV-nitride semiconductors, which are closely related to binary GaN. In particular, ZnSnN2 has been reported to have degenerate doping density, despite bandgap energies that are well suited for solar energy conversion. Here, we show that annealing Zn-rich Zn1+xSn1-xN2 grown with added hydrogen reduces its free electron density by orders of magnitude, down to 4 x 1016 cm-3. This experimental observation can be explained by hydrogen passivation of acceptors in Zn1+xSn1-xN2 during growth, lowering the driving force for unintentional donor formation. Lastly, these results indicatemore » that the doping control principles used in GaN can be translated to ZnSnN2, suggesting that other strategies used in binary III-Vs can be applied to accelerate the technological development of ternary II-IV-N2 materials.« less

  13. Poly(trifluoromethyl)azulenes: structures and acceptor properties

    SciTech Connect

    Clikeman, Tyler T.; Bukovsky, Eric V.; Kuvychko, Igor V.; San, Long K.; Deng, Shihu; Wang, Xue B.; Chen, Yu-Sheng; Strauss, Steven H.; Boltalina, Olga V.

    2014-07-10

    Azulene is a non-alternant, non-benzenoid aromatic hydrocarbon with an intense blue colour, a dipole moment of 1.0 D,1 positive electron affinity, and an “anomalous” emission from the second excited state in violation of Kasha’s rule.2,3 Azulene’s unique properties have potential uses in molecular switches,4,5 molecular diodes,6 organic photovoltaics,7 and charge transfer complexes.8-12 Introduction of electron-withdrawing groups to the azulenic core, such as CN,8,13,14 halogens,15-19 and CF3,20,21 can enhance certain electrical and photophysical properties. In this work, we report six new trifluoromethyl derivatives of azulene (AZUL), three isomers of AZUL(CF3)3 and three isomers of AZUL(CF3)4, and the first X-ray structure of a π-stacked donor-acceptor complex of a trifluoromethyl azulene with donor pyrene.

  14. Analysis of nonlinear optical properties in donor–acceptor materials

    SciTech Connect

    Day, Paul N.; Pachter, Ruth; Nguyen, Kiet A.

    2014-05-14

    Time-dependent density functional theory has been used to calculate nonlinear optical (NLO) properties, including the first and second hyperpolarizabilities as well as the two-photon absorption cross-section, for the donor-acceptor molecules p-nitroaniline and dimethylamino nitrostilbene, and for respective materials attached to a gold dimer. The CAMB3LYP, B3LYP, PBE0, and PBE exchange-correlation functionals all had fair but variable performance when compared to higher-level theory and to experiment. The CAMB3LYP functional had the best performance on these compounds of the functionals tested. However, our comprehensive analysis has shown that quantitative prediction of hyperpolarizabilities is still a challenge, hampered by inadequate functionals, basis sets, and solvation models, requiring further experimental characterization. Attachment of the Au{sub 2}S group to molecules already known for their relatively large NLO properties was found to further enhance the response. While our calculations show a modest enhancement for the first hyperpolarizability, the enhancement of the second hyperpolarizability is predicted to be more than an order of magnitude.

  15. Ultrafast exciton dissociation at donor/acceptor interfaces

    NASA Astrophysics Data System (ADS)

    Grancini, G.; Fazzi, D.; Binda, M.; Maiuri, M.; Petrozza, A.; Criante, L.; Perissinotto, S.; Egelhaaf, H.-J.; Brida, D.; Cerullo, G.; Lanzani, G.

    2013-09-01

    Charge generation at donor/acceptor interface is a highly debated topic in the organic photovoltaics (OPV) community. The primary photoexcited state evolution happens in few femtosecond timescale, thus making very intriguing their full understanding. In particular charge generation is believed to occur in < 200 fs, but no clear picture emerged so far. In this work we reveal for the first time the actual charge generation mechanism following in real time the exciton dissociation mechanism by means of sub-22 fs pump-probe spectroscopy. We study a low-band-gap polymer: fullerene interface as an ideal system for OPV. We demonstrate that excitons dissociation leads, on a timescale of 20-50 fs, to two byproducts: bound interfacial charge transfer states (CTS) and free charges. The branching ratio of their formation depends on the excess photon energy provided. When high energy singlet polymer states are excited, well above the optical band gap, an ultrafast hot electron transfer happens between the polymer singlet state and the interfacial hot CTS* due to the high electronic coupling between them. Hot exciton dissociation prevails then on internal energy dissipation that occurs within few hundreds of fs. By measuring the internal quantum efficiency of a prototypical device a rising trend with energy is observed, thus indicating that hot exciton dissociation effectively leads to a higher fraction of free charges.

  16. Potassium acceptor doping of ZnO crystals

    NASA Astrophysics Data System (ADS)

    Parmar, Narendra S.; Corolewski, Caleb D.; McCluskey, Matthew D.; Lynn, K. G.

    2015-05-01

    ZnO bulk single crystals were doped with potassium by diffusion at 950°C. Positron annihilation spectroscopy confirms the filling of zinc vacancies and a different trapping center for positrons. Secondary ion mass spectroscopy measurements show the diffusion of potassium up to 10 μm with concentration ˜1 × 1016 cm-3. IR measurements show a local vibrational mode (LVM) at 3226 cm-1, at a temperature of 9 K, in a potassium doped sample that was subsequently hydrogenated. The LVM is attributed to an O-H bond-stretching mode adjacent to a potassium acceptor. When deuterium substitutes for hydrogen, a peak is observed at 2378 cm-1. The O-H peak is much broader than the O-D peak, perhaps due to an unusually low vibrational lifetime. The isotopic frequency ratio is similar to values found in other hydrogen complexes. Potassium doping increases the resistivity up to 3 orders of magnitude at room temperature. The doped sample has a donor level at 0.30 eV.

  17. Serum cholesterol acceptor capacity in intrauterine growth restricted fetuses.

    PubMed

    Pecks, Ulrich; Rath, Werner; Bauerschlag, Dirk O; Maass, Nicolai; Orlikowsky, Thorsten; Mohaupt, Markus G; Escher, Geneviève

    2017-02-14

    Intrauterine growth restriction (IUGR) is an independent risk factor for the development of cardiovascular diseases later in life. The mechanisms whereby slowed intrauterine growth confers vascular risk are not clearly established. In general, a disturbed cholesterol efflux has been linked to atherosclerosis. The capacity of serum to accept cholesterol has been repeatedly evaluated in clinical studies by the use of macrophage-based cholesterol efflux assays and, if disturbed, precedes atherosclerotic diseases years before the clinical diagnosis. We now hypothesized that circulating cholesterol acceptors in IUGR sera specifically interfere with cholesterol transport mechanisms leading to diminished cholesterol efflux. RAW264.7 cells were used to determine efflux of [3H]-cholesterol in response to [umbilical cord serum (IUGR), n=20; controls (CTRL), n=20]. Cholesterol efflux was lower in IUGR as compared to controls [controls: mean 7.7% fractional [3H]-cholesterol efflux, standard deviation (SD)=0.98; IUGR: mean 6.3%, SD=0.79; P<0.0001]. Values strongly correlated to HDL (ρ=0.655, P<0.0001) and apoE (ρ=0.510, P=0.0008), and mildly to apoA1 (ρ=0.3926, P=0.0122) concentrations. Reduced cholesterol efflux in IUGR could account for the enhanced risk of developing cardiovascular diseases later in life.

  18. Terahertz Stimulated Emission from Silicon Doped by Hydrogenlike Acceptors

    NASA Astrophysics Data System (ADS)

    Pavlov, S. G.; Deßmann, N.; Shastin, V. N.; Zhukavin, R. Kh.; Redlich, B.; van der Meer, A. F. G.; Mittendorff, M.; Winnerl, S.; Abrosimov, N. V.; Riemann, H.; Hübers, H.-W.

    2014-04-01

    Stimulated emission in the terahertz frequency range has been realized from boron acceptor centers in silicon. Population inversion is achieved at resonant optical excitation on the 1Γ8+ → 1Γ7-, 1Γ6-, 4Γ8- intracenter transitions with a midinfrared free-electron laser. Lasing occurs on two intracenter transitions around 1.75 THz. The upper laser levels are the 1Γ7-, 1Γ6-, and 4Γ8- states, and the lower laser level for both emission lines is the 2Γ8+ state. In contrast to n-type intracenter silicon lasers, boron-doped silicon lasers do not involve the excited states with the longest lifetimes. Instead, the absorption cross section for the pump radiation is the dominating factor. The four-level lasing scheme implies that the deepest even-parity boron state is the 2Γ8+ state and not the 1Γ7+ split-off ground state, as indicated by other experiments. This is confirmed by infrared absorption spectroscopy of Si:B.

  19. Oligonucleotide microchips as genosensors for determinative and environmental studies in microbiology.

    PubMed Central

    Guschin, D Y; Mobarry, B K; Proudnikov, D; Stahl, D A; Rittmann, B E; Mirzabekov, A D

    1997-01-01

    The utility of parallel hybridization of environmental nucleic acids to many oligonucleotides immobilized in a matrix of polyacrylamide gel pads on a glass slide (oligonucleotide microchip) was evaluated. Oligonucleotides complementary to small-subunit rRNA sequences of selected microbial groups, encompassing key genera of nitrifying bacteria, were shown to selectively retain labeled target nucleic acid derived from either DNA or RNA forms of the target sequences. The utility of varying the probe concentration to normalize hybridization signals and the use of multicolor detection for simultaneous quantitation of multiple probe-target populations were demonstrated. PMID:9172361

  20. Resonant raman scattering in complexes of nc-Si/SiO2 quantum dots and oligonucleotides

    NASA Astrophysics Data System (ADS)

    Bairamov, F. B.; Poloskin, E. D.; Kornev, A. A.; Chernev, A. L.; Toporov, V. V.; Dubina, M. V.; Röder, C.; Sprung, C.; Lipsanen, H.; Bairamov, B. Kh.

    2014-11-01

    We report on the functionalization of nanocrystalline nc-Si/SiO2 semiconductor quantum dots (QDs) by short d(20G, 20T) oligonucleotides. The obtained complexes have been studied by Raman spectroscopy techniques with high spectral and spatial resolution. A new phenomenon of multiband resonant light scattering on single oligonucleotide molecules has been discovered, and peculiarities of this effect related to the nonradiative transfer of photoexcitation from nc-Si/SiO2 quantum dots to d(20G, 20T) oligonucleotide molecules have been revealed.