Science.gov

Sample records for oligonucleotide phosphate acceptor

  1. Oligonucleotides with rapid turnover of the phosphate groups occur endogenously in eukaryotic cells

    SciTech Connect

    Plesner, P.; Goodchild, J.; Kalckar, H.M.; Zamecnik, P.C.

    1987-04-01

    Endogenous oligonucleotides were found in trichloroacetic acid extracts of hamster lung fibroblasts and Tetrahymena cells. Peaks of radioactivity that eluted with retention times similar to oligonucleotide markers (5- to 50-mer) were found by HPLC in cells labeled briefly with /sup 32/Pi. Only minute amounts of UV-absorbing material were detected, consistent with a rapid turnover of phosphate groups. The /sup 32/P-labeled material also migrated as oligonucleotides on 20% polyacrylamide gels; it was not hydrolyzed by alkaline phosphatase but was digested by snake venom phosphodiesterase, S1 nuclease, and pancreatic RNase and was phosphorylated by T4 polynucleotide kinase. The /sup 32/P-labeled material isolated by HPLC was alkali labile and the hydrolyzate ran as nucleotides on paper chromatography. It is concluded that the oligonucleotides are mainly oligoribonucleotides, but it is possible that oligodeoxynucleotides are also present.

  2. [Point contacts of T7 RNA polymerase in the promotor complex, as determined with phosphate-activated oligonucleotide derivatives].

    PubMed

    Filippova, S E; Ivanovskaia, M G; Romanova, E A; Tunitskaia, V L; Kochetkov, S N

    2002-01-01

    The contacts between phosphate groups of promoter DNA an Lys or His of T7 RNA polmerase (Pol) in the Pol-promoter complex were studied with single- and double- stranded oligonucleotides, which corresponded to the T7 promoter consensus and contained activated phosphate groups at position +1, +2, or -14 relative to the transcription start. To obtain reactive groups, terminal phosphates were modified with N-oxybenzotriazole (HOBT), and internucleotide phosphates were repalced with a trisubstituted pyrophosphate (TSP). The resulting derivatives produced covalent complexes with T7 Pol. Covalent bonding involved His in the case of TSP at position +1 or HOBT at position +1 or -14, and Lys in the case of TSB at position -14.

  3. Changes in phosphorylation of adenosine phosphate and redox state of nicotinamide-adenine dinucleotide (phosphate) in Geobacter sulfurreducens in response to electron acceptor and anode potential variation.

    PubMed

    Rose, Nicholas D; Regan, John M

    2015-12-01

    Geobacter sulfurreducens is one of the dominant bacterial species found in biofilms growing on anodes in bioelectrochemical systems. The intracellular concentrations of reduced and oxidized forms of nicotinamide-adenine dinucleotide (NADH and NAD(+), respectively) and nicotinamide-adenine dinucleotide phosphate (NADPH and NADP(+), respectively) as well as adenosine triphosphate (ATP), adenosine diphosphate (ADP), and adenosine monophosphate (AMP) were measured in G. sulfurreducens using fumarate, Fe(III)-citrate, or anodes poised at different potentials (110, 10, -90, and -190 mV (vs. SHE)) as the electron acceptor. The ratios of CNADH/CNAD+ (0.088±0.022) and CNADPH/CNADP+ (0.268±0.098) were similar under all anode potentials tested and with Fe(III)-citrate (reduced extracellularly). Both ratios significantly increased with fumarate as the electron acceptor (0.331±0.094 for NAD and 1.96±0.37 for NADP). The adenylate energy charge (the fraction of phosphorylation in intracellular adenosine phosphates) was maintained near 0.47 under almost all conditions. Anode-growing biofilms demonstrated a significantly higher molar ratio of ATP/ADP relative to suspended cultures grown on fumarate or Fe(III)-citrate. These results provide evidence that the cellular location of reduction and not the redox potential of the electron acceptor controls the intracellular redox potential in G. sulfurreducens and that biofilm growth alters adenylate phosphorylation.

  4. Isomer-selected photoelectron spectroscopy of isolated DNA oligonucleotides: phosphate and nucleobase deprotonation at high negative charge states.

    PubMed

    Vonderach, Matthias; Ehrler, Oli T; Matheis, Katerina; Weis, Patrick; Kappes, Manfred M

    2012-05-09

    Fractionation according to ion mobility and mass-to-charge ratio has been used to select individual isomers of deprotonated DNA oligonucleotide multianions for subsequent isomer-resolved photoelectron spectroscopy (PES) in the gas phase. Isomer-resolved PE spectra have been recorded for tetranucleotides, pentanucleotides, and hexanucleotides. These were studied primarily in their highest accessible negative charge states (3-, 4-, and 5-, respectively), as provided by electrospraying from room temperature solutions. In particular, the PE spectra obtained for pentanucleotide tetraanions show evidence for two coexisting classes of gas-phase isomeric structures. We suggest that these two classes comprise: (i) species with excess electrons localized exclusively at deprotonated phosphate backbone sites and (ii) species with at least one deprotonated base (in addition to several deprotonated phosphates). By permuting the sequence of bases in various [A(5-x)T(x)](4-) and [GT(4)](4-) pentanucleotides, we have established that the second type of isomer is most likely to occur if the deprotonated base is located at the first or last position in the sequence. We have used a combination of molecular mechanics and semiempirical calculations together with a simple electrostatic model to explore the photodetachment mechanism underlying our photoelectron spectra. Comparison of predicted to measured photoelectron spectra suggests that a significant fraction of the detected electrons originates from the DNA bases (both deprotonated and neutral).

  5. Fluorescent mannosides serve as acceptor substrates for glycosyltransferase and sugar-1-phosphate transferase activities in Euglena gracilis membranes.

    PubMed

    Ivanova, Irina M; Nepogodiev, Sergey A; Saalbach, Gerhard; O'Neill, Ellis C; Urbaniak, Michael D; Ferguson, Michael A J; Gurcha, Sudagar S; Besra, Gurdyal S; Field, Robert A

    2017-01-13

    Synthetic hexynyl α-D-mannopyranoside and its α-1,6-linked disaccharide counterpart were fluorescently labelled through CuAAC click chemistry with 3-azido-7-hydroxycoumarin. The resulting triazolyl-coumarin adducts, which were amenable to analysis by TLC, HPLC and mass spectrometry, proved to be acceptor substrates for α-1,6-ManT activities in mycobacterial membranes, as well as α- and β-GalT activities in trypanosomal membranes, benchmarking the potential of the fluorescent acceptor approach against earlier radiochemical assays. Following on to explore the glycobiology of the benign protozoan alga Euglena gracilis, α-1,3- and α-1,2-ManT activities were detected in membrane preparations, along with GlcT, Glc-P-T and GlcNAc-P-T activities. These studies serve to demonstrate the potential of readily accessible fluorescent glycans as substrates for exploring carbohydrate active enzymes.

  6. DNA triplex formation of oligonucleotide analogues consisting of linker groups and octamer segments that have opposite sugar-phosphate backbone polarities

    SciTech Connect

    Ono, A.; Kan, Lousing ); Chingnien Chen )

    1991-10-15

    The DNA oligomer analogues 3{prime}d (CTTTCTT) 5{prime}-P4-5{prime}d(TTCTTCTT)3{prime} (4), 5{prime}d-(TTTCTTTC) 3{prime}-P2-3{prime}d(CTTTCTTT)5{prime} (5), and 5{prime}d(TTTCTTTC)3{prime}-P2-3{prime}d(CTTTCTTT)5{prime}-P4-5{prime}d-(TTCTTCTT)3{prime} (6) (P2 = {Rho}*{Rho} and P4 = {Rho}*{Rho}*{Rho}{Rho}, where {Rho} = phosphate and * = 1,3-propanediol) have been synthesized. These oligomers consist of a linker group or groups and homopyrimidine oligonucleotides which have opposite sugar-phosphate backbone polarities. These oligomer analogues are designed to form triplexes with a duplex, 5{prime}d(AAAGAAAGCCCTTTCTTTAAGAAGAA)3'{center dot} 5{prime}d(TTCTTCTTAAAGAAAGGGCTTTCTTT)3{prime} (1), which contains small homopurine clusters alternately located in both strands. The length of the linker groups, P2 and P4, was based upon a computer modeling analysis. Triplex formation by the unlinked octamers 5{prime}d(TTCTTCTT)3{prime}(2) and 5{prime}d(TTTCTTTC)3{prime} (3) and the linked oligomer analogues 4-6 with the target duplex was studied by thermal denaturation at pH 5.2. The order of stabilities of triplex formation by these oligomers was 1-5 >> 1-4 >1-(2, 3). The mixture of 1 and 6 showed two transitions corresponding to the dissociation of the third strand. These results are useful when considering the using of oligonucleotide analogues that can bind as third strands to DNA duplexes of higher complexity.

  7. Effect of phosphate activating group on oligonucleotide formation on montmorillonite: the regioselective formation of 3',5'-linked oligoadenylates

    NASA Technical Reports Server (NTRS)

    Prabahar, K. J.; Cole, T. D.; Ferris, J. P.

    1994-01-01

    The effects of amine structure on the montmorillonite-catalyzed oligomerization of the 5'-phosphoramidates of adenosine are investigated. 4-Aminopyridine derivatives yielded oligoadenylates as long as dodecamers with a regioselectivity for 3',5'-phosphodiester bond formation averaging 88%. Linear and cyclic oligomers are obtained and no A5'ppA-containing products are detected. Oligomers as long as the hexanucleotide are obtained using 2-aminobenzimidazole as the activating group. A predominance of pA2'pA is detected in the dimer fraction along with cyclic 3',5'-trimer; no A5'ppA-containing oligomers were detected. Little or no oligomer formation was observed when morpholine, piperidine, pyrazole, 1,2,4-triazole, and 2-pyridone are used as phosphate-activating groups. The effects of the structure of the phosphate activating group on the oligomer structure and chain lengths are discussed.

  8. [Oligonucleotides and their analogs. II. Spectra of the circular dichroism of dinucleoside phosphate analogs containing 4-thiouracil].

    PubMed

    Kritsyn, A M; Mikhaĭlov, S N; Stepanov, S V; Florent'ev, V L

    1978-01-01

    The dinucleoside phosphates analogues APpSU, SUPpA and UPpSU have been synthesised by direct thionation of DNP analogues, containing cytosine. The structure of compounds prepared was proved by UV- and PMR-spectra. The CD spectra of the DNP analogues were examined. It has been demonstrated that the "induced" dichroism contribution in the Cotton-effect of DNP was substantial in the case of stacking conformations and negligible for unstacking conformations.

  9. Polyphosphorylation and non-enzymatic template-directed ligation of oligonucleotides

    NASA Technical Reports Server (NTRS)

    Gao, K.; Orgel, L. E.; Bada, J. L. (Principal Investigator)

    2000-01-01

    Oligonucleotide 5'-polyphosphates are formed under potentially prebiotic conditions from oligonucleotide 5'-phosphates and sodium trimetaphosphate. Oligonucleotides activated as polyphosphates undergo template-directed ligation. We believe that these reactions could have produced longer oligonucleotide products from shorter substrates under prebiotic conditions.

  10. Structures of bacterial polynucleotide kinase in a Michaelis complex with GTP•Mg2+ and 5′-OH oligonucleotide and a product complex with GDP•Mg2+ and 5′-PO4 oligonucleotide reveal a mechanism of general acid-base catalysis and the determinants of phosphoacceptor recognition

    PubMed Central

    Das, Ushati; Wang, Li Kai; Smith, Paul; Jacewicz, Agata; Shuman, Stewart

    2014-01-01

    Clostridium thermocellum polynucleotide kinase (CthPnk), the 5′ end-healing module of a bacterial RNA repair system, catalyzes reversible phosphoryl transfer from an NTP donor to a 5′-OH polynucleotide acceptor. Here we report the crystal structures of CthPnk-D38N in a Michaelis complex with GTP•Mg2+ and a 5′-OH oligonucleotide and a product complex with GDP•Mg2+ and a 5′-PO4 oligonucleotide. The O5′ nucleophile is situated 3.0 Å from the GTP γ phosphorus in the Michaelis complex, where it is coordinated by Asn38 and is apical to the bridging β phosphate oxygen of the GDP leaving group. In the product complex, the transferred phosphate has undergone stereochemical inversion and Asn38 coordinates the 5′-bridging phosphate oxygen of the oligonucleotide. The D38N enzyme is poised for catalysis, but cannot execute because it lacks Asp38—hereby implicated as the essential general base catalyst that abstracts a proton from the 5′-OH during the kinase reaction. Asp38 serves as a general acid catalyst during the ‘reverse kinase’ reaction by donating a proton to the O5′ leaving group of the 5′-PO4 strand. The acceptor strand binding mode of CthPnk is distinct from that of bacteriophage T4 Pnk. PMID:24150947

  11. Pentopyranosyl Oligonucleotide Systems

    NASA Technical Reports Server (NTRS)

    Wagner, Thomas; Huyuh, Hoan K.; Krishnamurthy, Ramanarayanan; Eschenmoser, Albert

    2002-01-01

    Beta-D-Xylopyranosyl-(4 - 2 )-oligonucleotides containing adenine and thymine as nucleohases were synthesized as a part of a systematic study of the pairing properties of pentopyranosyl oligonucleotides. Contrary to earlier expectations based on qualitative conformational criteria, Beta-D-xylopyranosyl(4 - 2 )- oligonucleotides show Watson-Crick pairing comparable in strength to that shown by pyranosyl-RNA.

  12. The prebiotic synthesis of deoxythymidine oligonucleotides

    NASA Technical Reports Server (NTRS)

    Stephen-Sherwood, E.; Odom, D. G.; Oro, J.

    1974-01-01

    Deoxythymidine 5 prime-triphosphate in the presence of deoxythymidine 5 prime-phosphate, cyanamide and 4-amino-5-imidazole carboxamide polymerizes under drying conditions at moderate temperatures (60 to 90 C) to yield oligonucleotides of up to four units in length. Enzymatic analysis indicated that the majority of these oligomers contained natural 3 prime-5 prime phosphodiester bonds. This reaction offers a possible method for the formation of deoxyoligonucleotides under primitive earth conditions.

  13. Pentopyranosyl Oligonucleotide Systems

    NASA Technical Reports Server (NTRS)

    Reck, Folkert; Kudick, Rene; Krishnamurthy, Ramanarayanan; Eschenmoser, Albert; Wippo, Harald

    2001-01-01

    To determine whether the remarkable chemical properties of the pyranosyl isomer of RNA as an informational Watson-Crick base-pairing system are unique to the pentopyranosyl-(4 + 2)-oligonucleotide isomer derived from the RNA-building block D-ribose, studies on the entire family of diastereoisomeric pyranosyL(4 - Z)-oligonucleotide systems deriving from D-ribose. L-lyxose. D-xylose, and L-arabinose were carried out. The result of these extended studies is unambiguous: not only pyranosyl-RNA, but all members of the pentopyranosyl(4 + 2)-oligonucleotide family are highly efficient Watson-Crick base-pairing systems. Their synthesis and pairing properties will be described in a series of publications in this journal.

  14. The delivery of therapeutic oligonucleotides

    PubMed Central

    Juliano, Rudolph L.

    2016-01-01

    The oligonucleotide therapeutics field has seen remarkable progress over the last few years with the approval of the first antisense drug and with promising developments in late stage clinical trials using siRNA or splice switching oligonucleotides. However, effective delivery of oligonucleotides to their intracellular sites of action remains a major issue. This review will describe the biological basis of oligonucleotide delivery including the nature of various tissue barriers and the mechanisms of cellular uptake and intracellular trafficking of oligonucleotides. It will then examine a variety of current approaches for enhancing the delivery of oligonucleotides. This includes molecular scale targeted ligand-oligonucleotide conjugates, lipid- and polymer-based nanoparticles, antibody conjugates and small molecules that improve oligonucleotide delivery. The merits and liabilities of these approaches will be discussed in the context of the underlying basic biology. PMID:27084936

  15. Alternansucrase acceptor products

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The regioselectivity of alternansucrase (EC 2.4.1.140) differs from dextransucrase (EC 2.4.1.5) in ways that can be useful for the synthesis of novel oligosaccharide structures. For example, it has been recently shown that the major oligosaccharides produced when maltose is the acceptor include one...

  16. Candidatus Accumulibacter phosphatis clades enriched under cyclic anaerobic and microaerobic conditions simultaneously use different electron acceptors

    EPA Science Inventory

    Lab- and pilot-scale simultaneous nitrification, denitrification and phosphorus removal-sequencing batch reactors were operated under cyclic anaerobic and micro-aerobic conditions. The use of oxygen, nitrite, and nitrate as electron acceptors by Candidatus Accumulibacter phosphat...

  17. The Use of Gel Electrophoresis to Study the Reactions of Activated Amino Acids with Oligonucleotides

    NASA Technical Reports Server (NTRS)

    Zieboll, Gerhard; Orgel, Leslie E.

    1994-01-01

    We have used gel electrophoresis to study the primary covalent addition of amino acids to oligonu-cleotides or their analogs and the subsequent addition of further molecules of the amino acids to generate peptides covalently linked to the oligonucleotides. We have surveyed the reactions of a variety of amino acids with the phosphoramidates derived from oligonucleotide 5 inches phosphates and ethylenediamine. We find that arginine and amino acids can interact with oligonucleotidesl through stacking interactions react most efficiently. D- and L-amino acids give indistinguishable families of products.

  18. Template switching between PNA and RNA oligonucleotides

    NASA Technical Reports Server (NTRS)

    Bohler, C.; Nielsen, P. E.; Orgel, L. E.; Miller, S. L. (Principal Investigator)

    1995-01-01

    The origin of the RNA world is not easily understood, as effective prebiotic syntheses of the components of RNA, the beta-ribofuranoside-5'-phosphates, are hard to envisage. Recognition of this difficulty has led to the proposal that other genetic systems, the components of which are more easily formed, may have preceded RNA. This raises the question of how transitions between one genetic system and another could occur. Peptide nucleic acid (PNA) resembles RNA in its ability to form double-helical complexes stabilized by Watson-Crick hydrogen bonding between adenine and thymine and between cytosine and guanine, but has a backbone that is held together by amide rather than by phosphodiester bonds. Oligonucleotides bases on RNA are known to act as templates that catalyse the non-enzymatic synthesis of their complements from activated mononucleotides, we now show that RNA oligonucleotides facilitate the synthesis of complementary PNA strands and vice versa. This suggests that a transition between different genetic systems can occur without loss of information.

  19. In vivo generation of highly abundant sequence-specific oligonucleotides for antisense and triplex gene regulation.

    PubMed Central

    Noonberg, S B; Scott, G K; Garovoy, M R; Benz, C C; Hunt, C A

    1994-01-01

    Antisense and triplex oligonucleotides continue to demonstrate potential as mediators of gene-specific repression of protein synthesis. However, inefficient and heterogeneous cellular uptake, intracellular sequestration, and rapid intracellular and extracellular degradation represent obstacles to their eventual clinical utility. Efficient cellular delivery of targeted ribozymes can present similar problems. In this report we describe a system for circumventing these obstacles and producing large quantities of short, sequence-specific RNA oligonucleotides for use in these gene regulation strategies. The oligonucleotides are generated from a vector containing promoter, capping, and termination sequences from the human small nuclear U6 gene, surrounding a synthetic sequence incorporating the oligonucleotide of interest. In vivo, these oligonucleotides are produced constitutively and without cell type specificity in levels up to 5 x 10(6) copies per cell, reach steady-state levels of expression within 9 hours post-transfection, and are still readily detectable 7 days post-transfection. In addition, these oligonucleotides are retained in the nucleus, obtain a 5' gamma-monomethyl phosphate cap, and have an intracellular half-life of approximately one hour. This expression vector provides a novel and efficient method of intracellular delivery of antisense or triplex RNA oligonucleotides (and/or ribozymes) for gene regulation, as well as a cost-effective means of comparing the biological activity arising from a variety of different potential oligonucleotide sequences. Images PMID:8052538

  20. Oligonucleotide conjugates for therapeutic applications

    PubMed Central

    Winkler, Johannes

    2013-01-01

    Insufficient pharmacokinetic properties and poor cellular uptake are the main hurdles for successful therapeutic development of oligonucleotide agents. The covalent attachment of various ligands designed to influence the biodistribution and cellular uptake or for targeting specific tissues is an attractive possibility to advance therapeutic applications and to expand development options. In contrast to advanced formulations, which often consist of multiple reagents and are sensitive to a variety of preparation conditions, oligonucleotide conjugates are defined molecules, enabling structure-based analytics and quality control techniques. This review gives an overview of current developments of oligonucleotide conjugates for therapeutic applications. Attached ligands comprise peptides, proteins, carbohydrates, aptamers and small molecules, including cholesterol, tocopherol and folic acid. Important linkage types and conjugation methods are summarized. The distinct ligands directly influence biochemical parameters, uptake machanisms and pharmacokinetic properties. PMID:23883124

  1. Oligonucleotide conjugates for therapeutic applications.

    PubMed

    Winkler, Johannes

    2013-07-01

    Insufficient pharmacokinetic properties and poor cellular uptake are the main hurdles for successful therapeutic development of oligonucleotide agents. The covalent attachment of various ligands designed to influence the biodistribution and cellular uptake or for targeting specific tissues is an attractive possibility to advance therapeutic applications and to expand development options. In contrast to advanced formulations, which often consist of multiple reagents and are sensitive to a variety of preparation conditions, oligonucleotide conjugates are defined molecules, enabling structure-based analytics and quality control techniques. This review gives an overview of current developments of oligonucleotide conjugates for therapeutic applications. Attached ligands comprise peptides, proteins, carbohydrates, aptamers and small molecules, including cholesterol, tocopherol and folic acid. Important linkage types and conjugation methods are summarized. The distinct ligands directly influence biochemical parameters, uptake mechanisms and pharmacokinetic properties.

  2. Monitoring integrity and localization of modified single-stranded RNA oligonucleotides using ultrasensitive fluorescence methods

    PubMed Central

    Hadwiger, Philipp; Wagner, Ernst; Lamb, Don C.

    2017-01-01

    Short single-stranded oligonucleotides represent a class of promising therapeutics with diverse application areas. Antisense oligonucleotides, for example, can interfere with various processes involved in mRNA processing through complementary base pairing. Also RNA interference can be regulated by antagomirs, single-stranded siRNA and single-stranded microRNA mimics. The increased susceptibility to nucleolytic degradation of unpaired RNAs can be counteracted by chemical modification of the sugar phosphate backbone. In order to understand the dynamics of such single-stranded RNAs, we investigated their fate after exposure to cellular environment by several fluorescence spectroscopy techniques. First, we elucidated the degradation of four differently modified, dual-dye labeled short RNA oligonucleotides in HeLa cell extracts by fluorescence correlation spectroscopy, fluorescence cross-correlation spectroscopy and Förster resonance energy transfer. We observed that the integrity of the oligonucleotide sequence correlates with the extent of chemical modifications. Furthermore, the data showed that nucleolytic degradation can only be distinguished from unspecific effects like aggregation, association with cellular proteins, or intramolecular dynamics when considering multiple measurement and analysis approaches. We also investigated the localization and integrity of the four modified oligonucleotides in cultured HeLa cells using fluorescence lifetime imaging microscopy. No intracellular accumulation could be observed for unmodified oligonucleotides, while completely stabilized oligonucleotides showed strong accumulation within HeLa cells with no changes in fluorescence lifetime over 24 h. The integrity and accumulation of partly modified oligonucleotides was in accordance with their extent of modification. In highly fluorescent cells, the oligonucleotides were transported to the nucleus. The lifetime of the RNA in the cells could be explained by a balance between

  3. Electrochemical uranyl cation biosensor with DNA oligonucleotides as receptor layer.

    PubMed

    Jarczewska, Marta; Ziółkowski, Robert; Górski, Łukasz; Malinowska, Elżbieta

    2014-04-01

    The present study aims at the further development of the uranyl oligonucleotide-based voltammetric biosensor, which takes advantage of strong interaction between UO2(2+) and phosphate DNA backbone. Herein we report the optimization of working parameters of previously elaborated electrochemical DNA biosensor. It is shown that the sensor sensitivity is highly dependent on the oligonucleotide probe length and the incubation time of sensor in a sample solution. Consequently, the highest sensitivity was obtained for 10-nucleotide sequence and 60 min incubation time. The lower detection limit towards uranyl cation for developed biosensor was 30 nM. The influence of mixed monolayers and the possibility of developing a non-calibration device were also investigated. The selectivity of the proposed biosensor was significantly improved via elimination of adenine nucleobases from the DNA probe. Moreover, the regeneration procedure was elaborated and tested to prolong the use of the same biosensor for 4 subsequent determinations of UO2(2+).

  4. Construction and Evaluation of Desulfovibrio vulgaris Whole-Genome Oligonucleotide Microarrays

    SciTech Connect

    Z. He; Q. He; L. Wu; M.E. Clark; J.D. Wall; Jizhong Zhou; Matthew W. Fields

    2004-03-17

    Desulfovibrio vulgaris Hildenborough has been the focus of biochemical and physiological studies in the laboratory, and the metabolic versatility of this organism has been largely recognized, particularly the reduction of sulfate, fumarate, iron, uranium and chromium. In addition, a Desulfovibrio sp. has been shown to utilize uranium as the sole electron acceptor. D. vulgaris is a d-Proteobacterium with a genome size of 3.6 Mb and 3584 ORFs. The whole-genome microarrays of D. vulgaris have been constructed using 70mer oligonucleotides. All ORFs in the genome were represented with 3471 (97.1%) unique probes and 103 (2.9%) non-specific probes that may have cross-hybridization with other ORFs. In preparation for use of the experimental microarrays, artificial probes and targets were designed to assess specificity and sensitivity and identify optimal hybridization conditions for oligonucleotide microarrays. The results indicated that for 50mer and 70mer oligonucleotide arrays, hybridization at 45 C to 50 C, washing at 37 C and a wash time of 2.5 to 5 minutes obtained specific and strong hybridization signals. In order to evaluate the performance of the experimental microarrays, growth conditions were selected that were expected to give significant hybridization differences for different sets of genes. The initial evaluations were performed using D. vulgaris cells grown at logarithmic and stationary phases. Transcriptional analysis of D. vulgaris cells sampled during logarithmic phase growth indicated that 25% of annotated ORFs were up-regulated and 3% of annotated ORFs were downregulated compared to stationary phase cells. The up-regulated genes included ORFs predicted to be involved with acyl chain biosynthesis, amino acid ABC transporter, translational initiation factors, and ribosomal proteins. In the stationary phase growth cells, the two most up-regulated ORFs (70-fold) were annotated as a carboxynorspermidine decarboxylase and a 2C-methyl-D-erythritol-2

  5. Thermodynamics of Oligonucleotide Duplex Melting

    NASA Astrophysics Data System (ADS)

    Schreiber-Gosche, Sherrie; Edwards, Robert A.

    2009-05-01

    Melting temperatures of oligonucleotides are useful for a number of molecular biology applications, such as the polymerase chain reaction (PCR). Although melting temperatures are often calculated with simplistic empirical equations, application of thermodynamics provides more accurate melting temperatures and an opportunity for students to apply rigorous thermodynamic analysis to an important biochemical problem. Because the stacking of base pairs on top of one another is a significant factor in the energetics of oligonucleotide melting, several investigators have applied van't Hoff analysis to melting temperature data using a nearest-neighbor model and have obtained entropies and enthalpies for the stacking of bases. The present article explains how the equilibrium constant for the dissociation of strands from double-stranded oligonucleotides can be expressed in terms of the total strand concentration and thus how the total strand concentration influences the melting temperature. It also presents a simplified analysis based on the entropies and enthalpies of stacking that is manually tractable so that students can work examples to help them understand the thermodynamics of oligonucleotide melting.

  6. Thermodynamics of Oligonucleotide Duplex Melting

    ERIC Educational Resources Information Center

    Schreiber-Gosche, Sherrie; Edwards, Robert A.

    2009-01-01

    Melting temperatures of oligonucleotides are useful for a number of molecular biology applications, such as the polymerase chain reaction (PCR). Although melting temperatures are often calculated with simplistic empirical equations, application of thermodynamics provides more accurate melting temperatures and an opportunity for students to apply…

  7. Acceptors in ZnO

    SciTech Connect

    Mccluskey, Matthew D.; Corolewski, Caleb; Lv, Jinpeng; Tarun, Marianne C.; Teklemichael, Samuel T.; Walter, Eric D.; Norton, M. G.; Harrison, Kale W.; Ha, Su Y.

    2015-03-21

    Zinc oxide (ZnO) has potential for a range of applications in the area of optoelectronics. The quest for p-type ZnO has focused much attention on acceptors. In this paper, Cu, N, and Li acceptor impurities are discussed. Experimental evidence shows that these point defects have acceptor levels 3.2, 1.5, and 0.8 eV above the valence-band maximum, respectively. The levels are deep because the ZnO valence band is quite low compared to conventional, non-oxide semiconductors. Using MoO2 contacts, the electrical resistivity of ZnO:Li was measured and showed behavior consistent with bulk hole conduction for temperatures above 400 K. A photoluminescence peak in ZnO nanocrystals has been attributed to an acceptor, which may involve a zinc vacancy. High field (W-band) electron paramagnetic resonance measurements on the nanocrystals revealed an axial center with g = 2.0033 and g = 2.0075, along with an isotropic center at g = 2.0053.

  8. Acceptors in ZnO

    SciTech Connect

    McCluskey, Matthew D. Corolewski, Caleb D.; Lv, Jinpeng; Tarun, Marianne C.; Teklemichael, Samuel T.; Walter, Eric D.; Norton, M. Grant; Harrison, Kale W.; Ha, Su

    2015-03-21

    Zinc oxide (ZnO) has potential for a range of applications in the area of optoelectronics. The quest for p-type ZnO has focused much attention on acceptors. In this paper, Cu, N, and Li acceptor impurities are discussed. Experimental evidence indicates these point defects have acceptor levels 3.2, 1.4, and 0.8 eV above the valence-band maximum, respectively. The levels are deep because the ZnO valence band is quite low compared to conventional, non-oxide semiconductors. Using MoO{sub 2} contacts, the electrical resistivity of ZnO:Li was measured and showed behavior consistent with bulk hole conduction for temperatures above 400 K. A photoluminescence peak in ZnO nanocrystals is attributed to an acceptor, which may involve a Zn vacancy. High field (W-band) electron paramagnetic resonance measurements on the nanocrystals revealed an axial center with g{sub ⊥} = 2.0015 and g{sub //} = 2.0056, along with an isotropic center at g = 2.0035.

  9. Oligonucleotide-based antiviral strategies.

    PubMed

    Schubert, S; Kurreck, J

    2006-01-01

    In the age of extensive global traffic systems, the close neighborhood of man and livestock in some regions of the world, as well as inadequate prevention measures and medical care in poorer countries, greatly facilitates the emergence and dissemination of new virus strains. The appearance of avian influenza viruses that can infect humans, the spread of the severe acute respiratory syndrome (SARS) virus, and the unprecedented raging of human immunodeficiency virus (HIV) illustrate the threat of a global virus pandemic. In addition, viruses like hepatitis B and C claim more than one million lives every year for want of efficient therapy. Thus, new approaches to prevent virus propagation are urgently needed. Antisense strategies are considered a very attractive means of inhibiting viral replication, as oligonucleotides can be designed to interact with any viral RNA, provided its sequence is known. The ensuing targeted destruction of viral RNA should interfere with viral replication without entailing negative effects on ongoing cellular processes. In this review, we will give some examples of the employment of antisense oligonucleotides, ribozymes, and RNA interference strategies for antiviral purposes. Currently, in spite of encouraging results in preclinical studies, only a few antisense oligonucleotides and ribozymes have turned out to be efficient antiviral compounds in clinical trials. The advent of RNA interference now seems to be refueling hopes for decisive progress in the field of therapeutic employment of antisense strategies.

  10. [Acceptor activity of 4-N-acetylcytidine in the synthesis of (3'-5')-internucleotide bond catalyzed by pancreatic nuclease].

    PubMed

    Kavunenko, A P; Piaĭvinen, E A; Tikhomirova-Sidorova, N S

    1976-04-01

    Cytidine and 4-N-acetylcytidine were compared as phosphate acceptors in dinucleoside monophosphate synthesis catalyzed by pancreatic ribonuclease with uridine-2',3'-cyclophosphate and cytidine-2',3'-cyclo phosphate as phosphate donors. Because of low solubility of 4-N-acetylcytidine in water, the synthesis was carried out in aqueus-organic media. The results obtained indicate that acetylation of the exoaminogroup of cytidine decreases its acceptor activity. For the first time uridilyl-(3'-5')-4-N-acetylcytidine and cytidilyl-(3'-5')-4-N-acetylcytidine are prepared enzymatically by pancreatic ribonuclease.

  11. P-chiral oligonucleotides in biological recognition processes.

    PubMed

    Guga, Piotr

    2007-01-01

    Internucleotide phosphodiester linkages in non-modified oligonucleotides are quickly degraded by nucleolytic enzymes present in the cells and this feature practically eliminates natural DNA and RNA molecules from medical applications and from many structural and mechanistic studies. P-chiral oligonucleotide analogs, in which one of the non-bridging phosphate oxygen atoms is substituted with another heteroatom (e.g. S, Se) or a chemical group (e.g. CH3, BH3(-)), have significantly greater nuclease resistance and also offer important possibilities for detailed studies of interactions with other biomolecules at the molecular level. Notably, these substitutions do not disrupt hydrogen bonding between nucleobases and affect the overall geometry of the oligomers to only low or moderate extent, although important changes of hydration patterns and changes of interactions with metal ions are observed. Such the probes, including isotopomeric species labeled with a heavy oxygen isotope, possessing phosphorus atoms of selected absolute configurations, have been used for elucidation of the mode of action of many enzymes (nucleases, transferases, kinases), ribozymes and DNA-zymes, as well as for investigations on thermodynamic stability of nucleic acids complexes (duplexes, triplexes, i-motif) and for studies on a mechanism of conformational changes of B-Z type. They are also useful tools for analysis of interactions of the phosphoryl oxygen atoms in natural precursors with functional groups of proteins. The synthetic routes to stereodefined forms of selected types of P-chiral oligonucleotides are presented, as well as recently developed methods for their configurational analysis at micromolar concentration. Selected examples of application of diastereomerically pure P-chiral oligonucleotides for structural, biochemical and biological experiments are discussed.

  12. Selection of the acceptor medium in in vitro measurements of drug release from dermatological ointments.

    PubMed

    Gloor, M; Shabafrouz, H

    1983-01-01

    Comparative measurements of in vitro agent release using hydrophilic, intermediate, and lipophilic acceptor phases and in vivo measurements of the blanching effect with triamcinolone acetonide are reported. White petrolatum, wool alcohols ointment, and polyethylene glycol ointment served as donator phases. The results demonstrate that the lipophilic acceptor phase (isopropyl palmitate) is most representative for the in vivo acceptor phase. Conclusions cannot be drawn regarding in vivo effectiveness from measurements of agent release to the hydrophilic (phosphate buffer, pH 6) and intermediate (n-octanol) acceptor phases. In vitro measurements of agent release have a screening character and must usually be supplemented by very elaborate penetration models of the human skin for a definitive evaluation of an ointment.

  13. Electron acceptor dependence of electron shuttle secretion and extracellular electron transfer by Shewanella oneidensis MR-1.

    PubMed

    Wu, Chao; Cheng, Yuan-Yuan; Li, Bing-Bing; Li, Wen-Wei; Li, Dao-Bo; Yu, Han-Qing

    2013-05-01

    Shewanella oneidensis MR-1 is an extensively studied dissimilatory metal-reducing bacterium with a great potential for bioremediation and electricity generation. It secretes flavins as electron shuttles which play an important role in extracellular electron transfer. However, the influence of various environmental factors on the secretion of flavins is largely unknown. Here, the effects of electron acceptors, including fumarate, ferrihydrite, Fe(III)-nitrilotriacetic acid (NTA), nitrate and trimethylamine oxide (TMAO), on the secretion of flavins were investigated. The level of riboflavin and riboflavin-5'-phosphate (FMN) secreted by S. oneidensis MR-1 varied considerably with different electron acceptors. While nitrate and ferrihydrite suppressed the secretion of flavins in relative to fumarate, Fe(III)-NTA and TMAO promoted such a secretion and greatly enhanced ferrihydrite reduction and electricity generation. This work clearly demonstrates that electron acceptors could considerably affect the secretion of flavins and consequent microbial EET. Such impacts of electron acceptors in the environment deserve more attention.

  14. The prebiotic synthesis of oligonucleotides

    NASA Technical Reports Server (NTRS)

    Oro, J.; Stephen-Sherwood, E.

    1974-01-01

    This paper is primarily a review of recent developments in the abiotic synthesis of nucleotides, short chain oligonucleotides, and their mode of replication in solution. It also presents preliminary results from this laboratory on the prebiotic synthesis of thymidine oligodeoxynucleotides. A discussion, based on the physicochemical properties of RNA and DNA oligomers, relevant to the molecular evolution of these compounds leads to the tentative hypothesis that oligodeoxyribonucleotides of about 12 units may have been of sufficient length to initiate a self replicating coding system. Two models are suggested to account for the synthesis of high molecular weight oligomers using short chain templates and primers.

  15. Mutational analysis using oligonucleotide microarrays

    PubMed Central

    Hacia, J.; Collins, F.

    1999-01-01

    The development of inexpensive high throughput methods to identify individual DNA sequence differences is important to the future growth of medical genetics. This has become increasingly apparent as epidemiologists, pathologists, and clinical geneticists focus more attention on the molecular basis of complex multifactorial diseases. Such undertakings will rely upon genetic maps based upon newly discovered, common, single nucleotide polymorphisms. Furthermore, candidate gene approaches used in identifying disease associated genes necessitate screening large sequence blocks for changes tracking with the disease state. Even after such genes are isolated, large scale mutational analyses will often be needed for risk assessment studies to define the likely medical consequences of carrying a mutated gene.
This review concentrates on the use of oligonucleotide arrays for hybridisation based comparative sequence analysis. Technological advances within the past decade have made it possible to apply this technology to many different aspects of medical genetics. These applications range from the detection and scoring of single nucleotide polymorphisms to mutational analysis of large genes. Although we discuss published scientific reports, unpublished work from the private sector12 could also significantly affect the future of this technology.


Keywords: mutational analysis; oligonucleotide microarrays; DNA chips PMID:10528850

  16. Oligonucleotide therapeutics for human leukaemia.

    PubMed

    Gewirtz, A M

    1997-01-01

    The concept of antisense oligonucleotide 'therapeutics' has generated a great deal of controversy. Questions abound regarding the mechanism of action of these compounds, their reliability and their ultimate utility. These problems are compounded by the 'hype', which has attended their development, and the inability of workers in this area to meet the expectations raised by its most zealous proponents. Nevertheless, it is worth pointing out that there have been some notable gene disruption successes with this technique that have stood up to rigorous scrutiny. Our own work with c-myb as a target is perhaps a reasonable example. Though much remains to be accomplished before antisense drugs are commonly, and usefully, employed in the clinic, it is important to remember what motivates their development. Gene-targeted drugs have the promise of exquisite specificity and the potential to do much good with little toxicity. Accordingly, antisense oligonucleotides can serve as a paradigm of rational drug development. For all these reasons then, we believe that efforts should be increased to decipher the mechanism of action of antisense oligodeoxynucleotides, and to learn how they may be successfully employed in the clinic.

  17. Cellular Uptake and Intracellular Trafficking of Oligonucleotides: Implications for Oligonucleotide Pharmacology

    PubMed Central

    Ming, Xin; Carver, Kyle; Laing, Brian

    2014-01-01

    One of the major constraints on the therapeutic use of oligonucleotides is inefficient delivery to their sites of action in the cytosol or nucleus. Recently it has become evident that the pathways of cellular uptake and intracellular trafficking of oligonucleotides can strongly influence their pharmacological actions. Here we provide background information on the basic processes of endocytosis and trafficking and then review recent literature on targeted delivery and subcellular trafficking of oligonucleotides in that context. A variety of approaches including molecular scale ligand-oligonucleotide conjugates, ligand-targeted nanocarriers, and the use of small molecules to enhance oligonucleotide effects are discussed. PMID:24383421

  18. Bromodeoxyuridine-labeled oligonucleotides as tools for oligonucleotide uptake studies.

    PubMed

    Maszewska, Maria; Kobylańska, Anna; Gendaszewska-Darmach, Edyta; Koziołkiewicz, Maria

    2002-12-01

    The mechanisms by which various oligonucleotides (ODNs) and their analogs enter cells are not fully understood. A common technique used in studies on cellular uptake of ODNs is their conjugation with fluorochromes. However, fluorescently labeled ODNs may vary from the parent compounds in charge and hydrophilicity, and they may interact differently with some components of cellular membranes. In this report, we present an alternative method based on the immunofluorescent detection of ODNs with incorporated 5-bromo-2'-deoxyuridine (BrdUrd). Localization of BrdUrd-modified ODNs has been achieved using FITC-labeled anti-BrdUrd antibodies. This technique allowed determination of the differences in cellular uptake of phosphodiester (PO) and phosphorothioate (PS) ODNs and their derivatives conjugated with cholesterol and menthol. The immunocytochemical method also has shown that the cellular uptake of some ODNs may be influenced by specific sequences that are responsible for the formation of higher-order structures.

  19. Adaptive resolution simulation of oligonucleotides

    NASA Astrophysics Data System (ADS)

    Netz, Paulo A.; Potestio, Raffaello; Kremer, Kurt

    2016-12-01

    Nucleic acids are characterized by a complex hierarchical structure and a variety of interaction mechanisms with other molecules. These features suggest the need of multiscale simulation methods in order to grasp the relevant physical properties of deoxyribonucleic acid (DNA) and RNA using in silico experiments. Here we report an implementation of a dual-resolution modeling of a DNA oligonucleotide in physiological conditions; in the presented setup only the nucleotide molecule and the solvent and ions in its proximity are described at the atomistic level; in contrast, the water molecules and ions far from the DNA are represented as computationally less expensive coarse-grained particles. Through the analysis of several structural and dynamical parameters, we show that this setup reliably reproduces the physical properties of the DNA molecule as observed in reference atomistic simulations. These results represent a first step towards a realistic multiscale modeling of nucleic acids and provide a quantitatively solid ground for their simulation using dual-resolution methods.

  20. Adaptive resolution simulation of oligonucleotides.

    PubMed

    Netz, Paulo A; Potestio, Raffaello; Kremer, Kurt

    2016-12-21

    Nucleic acids are characterized by a complex hierarchical structure and a variety of interaction mechanisms with other molecules. These features suggest the need of multiscale simulation methods in order to grasp the relevant physical properties of deoxyribonucleic acid (DNA) and RNA using in silico experiments. Here we report an implementation of a dual-resolution modeling of a DNA oligonucleotide in physiological conditions; in the presented setup only the nucleotide molecule and the solvent and ions in its proximity are described at the atomistic level; in contrast, the water molecules and ions far from the DNA are represented as computationally less expensive coarse-grained particles. Through the analysis of several structural and dynamical parameters, we show that this setup reliably reproduces the physical properties of the DNA molecule as observed in reference atomistic simulations. These results represent a first step towards a realistic multiscale modeling of nucleic acids and provide a quantitatively solid ground for their simulation using dual-resolution methods.

  1. Donor assists acceptor binding and catalysis of human α1,6-fucosyltransferase.

    PubMed

    Kötzler, Miriam P; Blank, Simon; Bantleon, Frank I; Wienke, Martin; Spillner, Edzard; Meyer, Bernd

    2013-08-16

    α1,6-Core-fucosyltransferase (FUT8) is a vital enzyme in mammalian physiological and pathophysiological processes such as tumorigenesis and progress of, among others, non-small cell lung cancer and colon carcinoma. It was also shown that therapeutic antibodies have a dramatically higher efficacy if the α1,6-fucosyl residue is absent. However, specific and potent inhibitors for FUT8 and related enzymes are lacking. Hence, it is crucial to elucidate the structural basis of acceptor binding and the catalytic mechanism. We present here the first structural model of FUT8 in complex with its acceptor and donor molecules. An unusually large acceptor, i.e., a hexasaccharide from the core of N-glycans, is required as minimal structure. Acceptor substrate binding of FUT8 is being dissected experimentally by STD NMR and SPR and theoretically by molecular dynamics simulations. The acceptor binding site forms an unusually large and shallow binding site. Binding of the acceptor to the enzyme is much faster and stronger if the donor is present. This is due to strong hydrogen bonding between O6 of the proximal N-acetylglucosamine and an oxygen atom of the β-phosphate of GDP-fucose. Therefore, we propose an ordered Bi Bi mechanism for FUT8 where the donor molecule binds first. No specific amino acid is present that could act as base during catalysis. Our results indicate a donor-assisted mechanism, where an oxygen of the β-phosphate deprotonates the acceptor. Knowledge of the mechanism of FUT8 is now being used for rational design of targeted inhibitors to address metastasis and prognosis of carcinomas.

  2. Anaerobic electron acceptor chemotaxis in Shewanella putrefaciens.

    PubMed

    Nealson, K H; Moser, D P; Saffarini, D A

    1995-04-01

    Shewanella putrefaciens MR-1 can grow either aerobically or anaerobically at the expense of many different electron acceptors and is often found in abundance at redox interfaces in nature. Such redox interfaces are often characterized by very strong gradients of electron acceptors resulting from rapid microbial metabolism. The coincidence of S. putrefaciens abundance with environmental gradients prompted an examination of the ability of MR-1 to sense and respond to electron acceptor gradients in the laboratory. In these experiments, taxis to the majority of the electron acceptors that S. putrefaciens utilizes for anaerobic growth was seen. All anaerobic electron acceptor taxis was eliminated by the presence of oxygen, nitrate, nitrite, elemental sulfur, or dimethyl sulfoxide, even though taxis to the latter was very weak and nitrate and nitrite respiration was normal in the presence of dimethyl sulfoxide. Studies with respiratory mutants of MR-1 revealed that several electron acceptors that could not be used for anaerobic growth nevertheless elicited normal anaerobic taxis. Mutant M56, which was unable to respire nitrite, showed normal taxis to nitrite, as well as the inhibition of taxis to other electron acceptors by nitrite. These results indicate that electron acceptor taxis in S. putrefaciens does not conform to the paradigm established for Escherichia coli and several other bacteria. Carbon chemo-taxis was also unusual in this organism: of all carbon compounds tested, the only positive response observed was to formate under anaerobic conditions.

  3. Anaerobic electron acceptor chemotaxis in Shewanella putrefaciens

    NASA Technical Reports Server (NTRS)

    Nealson, K. H.; Moser, D. P.; Saffarini, D. A.

    1995-01-01

    Shewanella putrefaciens MR-1 can grow either aerobically or anaerobically at the expense of many different electron acceptors and is often found in abundance at redox interfaces in nature. Such redox interfaces are often characterized by very strong gradients of electron acceptors resulting from rapid microbial metabolism. The coincidence of S. putrefaciens abundance with environmental gradients prompted an examination of the ability of MR-1 to sense and respond to electron acceptor gradients in the laboratory. In these experiments, taxis to the majority of the electron acceptors that S. putrefaciens utilizes for anaerobic growth was seen. All anaerobic electron acceptor taxis was eliminated by the presence of oxygen, nitrate, nitrite, elemental sulfur, or dimethyl sulfoxide, even though taxis to the latter was very weak and nitrate and nitrite respiration was normal in the presence of dimethyl sulfoxide. Studies with respiratory mutants of MR-1 revealed that several electron acceptors that could not be used for anaerobic growth nevertheless elicited normal anaerobic taxis. Mutant M56, which was unable to respire nitrite, showed normal taxis to nitrite, as well as the inhibition of taxis to other electron acceptors by nitrite. These results indicate that electron acceptor taxis in S. putrefaciens does not conform to the paradigm established for Escherichia coli and several other bacteria. Carbon chemo-taxis was also unusual in this organism: of all carbon compounds tested, the only positive response observed was to formate under anaerobic conditions.

  4. Transglucosylation potential of six sucrose phosphorylases toward different classes of acceptors.

    PubMed

    Aerts, Dirk; Verhaeghe, Tom F; Roman, Bart I; Stevens, Christian V; Desmet, Tom; Soetaert, Wim

    2011-09-27

    In this study, the transglucosylation potential of six sucrose phosphorylase (SP) enzymes has been compared using eighty putative acceptors from different structural classes. To increase the solubility of hydrophobic acceptors, the addition of various co-solvents was first evaluated. All enzymes were found to retain at least 50% of their activity in 25% dimethylsulfoxide, with the enzymes from Bifidobacterium adolescentis and Streptococcus mutans being the most stable. Screening of the enzymes' specificity then revealed that the vast majority of acceptors are transglucosylated very slowly by SP, at a rate that is comparable to the contaminating hydrolytic reaction. The enzyme from S. mutans displayed the narrowest acceptor specificity and the one from Leuconostoc mesenteroides NRRL B1355 the broadest. However, high activity could only be detected on l-sorbose and l-arabinose, besides the native acceptors d-fructose and phosphate. Improving the affinity for alternative acceptors by means of enzyme engineering will, therefore, be a major challenge for the commercial exploitation of the transglucosylation potential of sucrose phosphorylase.

  5. DNA Oligonucleotide Fragment Ion Rearrangements Upon Collision-Induced Dissociation

    NASA Astrophysics Data System (ADS)

    Harper, Brett; Neumann, Elizabeth K.; Solouki, Touradj

    2015-08-01

    Collision-induced dissociation (CID) of m/z-isolated w type fragment ions and an intact 5' phosphorylated DNA oligonucleotide generated rearranged product ions. Of the 21 studied w ions of various nucleotide sequences, fragment ion sizes, and charge states, 18 (~86%) generated rearranged product ions upon CID in a Synapt G2-S HDMS (Waters Corporation, Manchester, England, UK) ion mobility-mass spectrometer. Mass spectrometry (MS), ion mobility spectrometry (IMS), and theoretical modeling data suggest that purine bases can attack the free 5' phosphate group in w type ions and 5' phosphorylated DNA to generate sequence permuted [phosphopurine]- fragment ions. We propose and discuss a potential mechanism for generation of rearranged [phosphopurine]- and complementary y-B type product ions.

  6. Patterns of oligonucleotide distribution within DNA and RNA functional sites

    SciTech Connect

    Kolchanov, N.A.; Kel, A.E.; Ponomarenko, M.P.; Romachenko, A.G.; Likchachev, J.; Milanesi, L.; Lim, H.

    1993-12-31

    Patterns of short oligonucleotide distribution within DNA and RNA functional sites have been analyzed using ``Site-Video`` computer system. The group of DNA functional sites involved nucleosome binding sites, gyrase cleavage sites, promoters of E. coli and men. The group of RNA functional sites involved donor and acceptor splice sites of men, translation initiation sites of E. coli and men and translation frame shift site sites. Analysis of these samples of nucleotide sequences have been carried out by the ``Site-Video`` computer system. For each type of site specific set of patterns of oligonucleotide distribution important for the functioning and recognition have been revealed. At the same time, the number of specific patterns revealed in RNA sites was significantly higher than those in DNA sites. On the base of the results obtained, the script of functional sites for evolutionary emergency have been prompted. According to it, two types of context feature selection took place: (1) positive selection targeted to the appearance of the definite types of context features in particular regions of functional sites;and (2) negative selection targeted to the elimination of definite types of context features in particular regions of functional sites. The authors suppose that evolutionary formation of any functional site is a multistep process realized via combination of positive and negative selections. Negative selection, via fixation of a specific pattern of mutations, eliminates false signals of regulatory proteins binding with the functional site. Positive selection leads to the appearance of local context features (signals) which provide for the specificity and efficiency of the site functioning.

  7. Antisense oligonucleotide-based therapy in human erythropoietic protoporphyria.

    PubMed

    Oustric, Vincent; Manceau, Hana; Ducamp, Sarah; Soaid, Rima; Karim, Zoubida; Schmitt, Caroline; Mirmiran, Arienne; Peoc'h, Katell; Grandchamp, Bernard; Beaumont, Carole; Lyoumi, Said; Moreau-Gaudry, François; Guyonnet-Dupérat, Véronique; de Verneuil, Hubert; Marie, Joëlle; Puy, Herve; Deybach, Jean-Charles; Gouya, Laurent

    2014-04-03

    In 90% of people with erythropoietic protoporphyria (EPP), the disease results from the inheritance of a common hypomorphic FECH allele, encoding ferrochelatase, in trans to a private deleterious FECH mutation. The activity of the resulting FECH enzyme falls below the critical threshold of 35%, leading to the accumulation of free protoporphyrin IX (PPIX) in bone marrow erythroblasts and in red cells. The mechanism of low expression involves a biallelic polymorphism (c.315-48T>C) localized in intron 3. The 315-48C allele increases usage of the 3' cryptic splice site between exons 3 and 4, resulting in the transcription of an unstable mRNA with a premature stop codon, reducing the abundance of wild-type FECH mRNA, and finally reducing FECH activity. Through a candidate-sequence approach and an antisense-oligonucleotide-tiling method, we identified a sequence that, when targeted by an antisense oligonucleotide (ASO-V1), prevented usage of the cryptic splice site. In lymphoblastoid cell lines derived from symptomatic EPP subjects, transfection of ASO-V1 reduced the usage of the cryptic splice site and efficiently redirected the splicing of intron 3 toward the physiological acceptor site, thereby increasing the amount of functional FECH mRNA. Moreover, the administration of ASO-V1 into developing human erythroblasts from an overtly EPP subject markedly increased the production of WT FECH mRNA and reduced the accumulation of PPIX to a level similar to that measured in asymptomatic EPP subjects. Thus, EPP is a paradigmatic Mendelian disease in which the in vivo correction of a common single splicing defect would improve the condition of most affected individuals.

  8. Antisense Oligonucleotide-Based Therapy in Human Erythropoietic Protoporphyria

    PubMed Central

    Oustric, Vincent; Manceau, Hana; Ducamp, Sarah; Soaid, Rima; Karim, Zoubida; Schmitt, Caroline; Mirmiran, Arienne; Peoc’h, Katell; Grandchamp, Bernard; Beaumont, Carole; Lyoumi, Said; Moreau-Gaudry, François; Guyonnet-Dupérat, Véronique; de Verneuil, Hubert; Marie, Joëlle; Puy, Herve; Deybach, Jean-Charles; Gouya, Laurent

    2014-01-01

    In 90% of people with erythropoietic protoporphyria (EPP), the disease results from the inheritance of a common hypomorphic FECH allele, encoding ferrochelatase, in trans to a private deleterious FECH mutation. The activity of the resulting FECH enzyme falls below the critical threshold of 35%, leading to the accumulation of free protoporphyrin IX (PPIX) in bone marrow erythroblasts and in red cells. The mechanism of low expression involves a biallelic polymorphism (c.315−48T>C) localized in intron 3. The 315−48C allele increases usage of the 3′ cryptic splice site between exons 3 and 4, resulting in the transcription of an unstable mRNA with a premature stop codon, reducing the abundance of wild-type FECH mRNA, and finally reducing FECH activity. Through a candidate-sequence approach and an antisense-oligonucleotide-tiling method, we identified a sequence that, when targeted by an antisense oligonucleotide (ASO-V1), prevented usage of the cryptic splice site. In lymphoblastoid cell lines derived from symptomatic EPP subjects, transfection of ASO-V1 reduced the usage of the cryptic splice site and efficiently redirected the splicing of intron 3 toward the physiological acceptor site, thereby increasing the amount of functional FECH mRNA. Moreover, the administration of ASO-V1 into developing human erythroblasts from an overtly EPP subject markedly increased the production of WT FECH mRNA and reduced the accumulation of PPIX to a level similar to that measured in asymptomatic EPP subjects. Thus, EPP is a paradigmatic Mendelian disease in which the in vivo correction of a common single splicing defect would improve the condition of most affected individuals. PMID:24680888

  9. Complex DNA nanostructures from oligonucleotide ensembles.

    PubMed

    Mathur, Divita; Henderson, Eric R

    2013-04-19

    The first synthetic DNA nanostructures were created by self-assembly of a small number of oligonucleotides. Introduction of the DNA origami method provided a new paradigm for designing and creating two- and three-dimensional DNA nanostructures by folding a large single-stranded DNA and 'stapling' it together with a library of oligonucleotides. Despite its power and wide-ranging implementation, the DNA origami technique suffers from some limitations. Foremost among these is the limited number of useful single-stranded scaffolds of biological origin. This report describes a new approach to creating large DNA nanostructures exclusively from synthetic oligonucleotides. The essence of this approach is to replace the single-stranded scaffold in DNA origami with a library of oligonucleotides termed "scaples" (scaffold staples). Scaples eliminate the need for scaffolds of biological origin and create new opportunities for producing larger and more diverse DNA nanostructures as well as simultaneous assembly of distinct structures in a "single-pot" reaction.

  10. Bright Solid-State Emission of Disilane-Bridged Donor-Acceptor-Donor and Acceptor-Donor-Acceptor Chromophores.

    PubMed

    Shimada, Masaki; Tsuchiya, Mizuho; Sakamoto, Ryota; Yamanoi, Yoshinori; Nishibori, Eiji; Sugimoto, Kunihisa; Nishihara, Hiroshi

    2016-02-24

    The development of disilane-bridged donor-acceptor-donor (D-Si-Si-A-Si-Si-D) and acceptor-donor-acceptor (A-Si-Si-D-Si-Si-A) compounds is described. Both types of compound showed strong emission (λem =ca. 500 and ca. 400 nm, respectively) in the solid state with high quantum yields (Φ: up to 0.85). Compound 4 exhibited aggregation-induced emission enhancement in solution. X-ray diffraction revealed that the crystal structures of 2, 4, and 12 had no intermolecular π-π interactions to suppress the nonradiative transition in the solid state.

  11. Antisense oligonucleotides as therapeutics for malignant diseases.

    PubMed

    Ho, P T; Parkinson, D R

    1997-04-01

    The continued progress in our understanding of the biology of neoplasia and in the identification, cloning, and sequencing of genes critical to tumor cell function permits the exploitation of this information to develop specific agents that may directly modulate the function of these genes or their protein products. Antisense oligonucleotides are being investigated as a potential therapeutic modality that takes direct advantage of molecular sequencing. The antisense approach uses short oligonucleotides designed to hybridize to a target mRNA transcript through Watson-Crick base pairing. The formation of this oligonucleotide: RNA heteroduplex results in mRNA inactivation and consequent inhibition of synthesis of the protein product. A fundamental attraction of the antisense approach is that this method potentially may be applied to any gene product, in theory, for the treatment of malignant and non-malignant diseases. However, this simple and attractive model has proven to be much more complex in practice. A number of important challenges in the preclinical development of antisense oligonucleotides have been identified, including stability, sequence length, cellular uptake, target sequence selection, appropriate negative controls, oligonucleotide: protein interactions, and cost of manufacture. Although the biological activity of an oligonucleotide against its molecular target is theoretically sequence-dependent, the animal pharmacokinetics and toxicology of phosphorothioate analogues directed against vastly disparate gene products appear relatively non-sequence-specific. In oncology, a number of clinical trials have been initiated with antisense oligonucleotides directed against molecular targets including: p53; bcl-2; raf kinase; protein kinase C-alpha; c-myb. The experience gained from these early clinical trials will be applicable to the next generation of antisense agents in development. These may include molecules with novel backbones or other structural

  12. Structural basis for phosphatidylinositol-phosphate biosynthesis

    PubMed Central

    Clarke, Oliver B.; Tomasek, David; Jorge, Carla D.; Dufrisne, Meagan Belcher; Kim, Minah; Banerjee, Surajit; Rajashankar, Kanagalaghatta R.; Shapiro, Lawrence; Hendrickson, Wayne A.; Santos, Helena; Mancia, Filippo

    2015-01-01

    Phosphatidylinositol is critical for intracellular signalling and anchoring of carbohydrates and proteins to outer cellular membranes. The defining step in phosphatidylinositol biosynthesis is catalysed by CDP-alcohol phosphotransferases, transmembrane enzymes that use CDP-diacylglycerol as donor substrate for this reaction, and either inositol in eukaryotes or inositol phosphate in prokaryotes as the acceptor alcohol. Here we report the structures of a related enzyme, the phosphatidylinositol-phosphate synthase from Renibacterium salmoninarum, with and without bound CDP-diacylglycerol to 3.6 and 2.5 Å resolution, respectively. These structures reveal the location of the acceptor site, and the molecular determinants of substrate specificity and catalysis. Functional characterization of the 40%-identical ortholog from Mycobacterium tuberculosis, a potential target for the development of novel anti-tuberculosis drugs, supports the proposed mechanism of substrate binding and catalysis. This work therefore provides a structural and functional framework to understand the mechanism of phosphatidylinositol-phosphate biosynthesis. PMID:26510127

  13. Structural basis for phosphatidylinositol-phosphate biosynthesis

    NASA Astrophysics Data System (ADS)

    Clarke, Oliver B.; Tomasek, David; Jorge, Carla D.; Dufrisne, Meagan Belcher; Kim, Minah; Banerjee, Surajit; Rajashankar, Kanagalaghatta R.; Shapiro, Lawrence; Hendrickson, Wayne A.; Santos, Helena; Mancia, Filippo

    2015-10-01

    Phosphatidylinositol is critical for intracellular signalling and anchoring of carbohydrates and proteins to outer cellular membranes. The defining step in phosphatidylinositol biosynthesis is catalysed by CDP-alcohol phosphotransferases, transmembrane enzymes that use CDP-diacylglycerol as donor substrate for this reaction, and either inositol in eukaryotes or inositol phosphate in prokaryotes as the acceptor alcohol. Here we report the structures of a related enzyme, the phosphatidylinositol-phosphate synthase from Renibacterium salmoninarum, with and without bound CDP-diacylglycerol to 3.6 and 2.5 Å resolution, respectively. These structures reveal the location of the acceptor site, and the molecular determinants of substrate specificity and catalysis. Functional characterization of the 40%-identical ortholog from Mycobacterium tuberculosis, a potential target for the development of novel anti-tuberculosis drugs, supports the proposed mechanism of substrate binding and catalysis. This work therefore provides a structural and functional framework to understand the mechanism of phosphatidylinositol-phosphate biosynthesis.

  14. Sedimentation analysis of novel DNA structures formed by homo-oligonucleotides.

    PubMed

    Hatters, D M; Wilson, L; Atcliffe, B W; Mulhern, T D; Guzzo-Pernell, N; Howlett, G J

    2001-07-01

    Sedimentation velocity analysis has been used to examine the base-specific structural conformations and unusual hydrogen bonding patterns of model oligonucleotides. Homo-oligonucleotides composed of 8-28 residues of dA, dT, or dC nucleotides in 100 mM sodium phosphate, pH 7.4, at 20 degrees C behave as extended monomers. Comparison of experimentally determined sedimentation coefficients with theoretical values calculated for assumed helical structures show that dT and dC oligonucleotides are more compact than dA oligonucleotides. For dA oligonucleotides, the average width (1.7 nm), assuming a cylindrical model, is smaller than for control duplex DNA whereas the average rise per base (0.34 nm) is similar to that of B-DNA. For dC and dT oligonucleotides, there is an increase in the average widths (1.8 nm and 2.1 nm, respectively) whereas the average rise per base is smaller (0.28 nm and 0.23 nm, respectively). A significant shape change is observed for oligo dC(28) at lower temperatures (10 degrees C), corresponding to a fourfold decrease in axial ratio. Optical density, circular dichroism, and differential scanning calorimetry data confirm this shape change, attributable from nuclear magnetic resonance analysis to i-motif formation. Sedimentation equilibrium studies of oligo dG(8) and dG(16) reveal extensive self-association and the formation of G-quadruplexes. Continuous distribution analysis of sedimentation velocity data for oligo dG(16) identifies the presence of discrete dimers, tetramers, and dodecamers. These studies distinguish the conformational and colligative properties of the individual bases in DNA and their inherent capacity to promote specific folding pathways.

  15. Sedimentation analysis of novel DNA structures formed by homo-oligonucleotides.

    PubMed Central

    Hatters, D M; Wilson, L; Atcliffe, B W; Mulhern, T D; Guzzo-Pernell, N; Howlett, G J

    2001-01-01

    Sedimentation velocity analysis has been used to examine the base-specific structural conformations and unusual hydrogen bonding patterns of model oligonucleotides. Homo-oligonucleotides composed of 8-28 residues of dA, dT, or dC nucleotides in 100 mM sodium phosphate, pH 7.4, at 20 degrees C behave as extended monomers. Comparison of experimentally determined sedimentation coefficients with theoretical values calculated for assumed helical structures show that dT and dC oligonucleotides are more compact than dA oligonucleotides. For dA oligonucleotides, the average width (1.7 nm), assuming a cylindrical model, is smaller than for control duplex DNA whereas the average rise per base (0.34 nm) is similar to that of B-DNA. For dC and dT oligonucleotides, there is an increase in the average widths (1.8 nm and 2.1 nm, respectively) whereas the average rise per base is smaller (0.28 nm and 0.23 nm, respectively). A significant shape change is observed for oligo dC(28) at lower temperatures (10 degrees C), corresponding to a fourfold decrease in axial ratio. Optical density, circular dichroism, and differential scanning calorimetry data confirm this shape change, attributable from nuclear magnetic resonance analysis to i-motif formation. Sedimentation equilibrium studies of oligo dG(8) and dG(16) reveal extensive self-association and the formation of G-quadruplexes. Continuous distribution analysis of sedimentation velocity data for oligo dG(16) identifies the presence of discrete dimers, tetramers, and dodecamers. These studies distinguish the conformational and colligative properties of the individual bases in DNA and their inherent capacity to promote specific folding pathways. PMID:11423421

  16. Multiplexed interfacial transduction of nucleic acid hybridization using a single color of immobilized quantum dot donor and two acceptors in fluorescence resonance energy transfer.

    PubMed

    Algar, W Russ; Krull, Ulrich J

    2010-01-01

    A multiplexed solid-phase assay for the detection of nucleic acid hybridization was developed on the basis of a single color of immobilized CdSe/ZnS quantum dot (QD) as a donor in fluorescence resonance energy transfer (FRET). This work demonstrated that two channels of detection did not necessitate two different QD donors. Two probe oligonucleotides were coimmobilized on optical fibers modified with QDs, and a sandwich assay was used to associate the acceptor dyes with interfacial hybridization events without target labeling. FRET-sensitized acceptor emission provided an analytical signal that was concentration dependent down to 10 nM. Changes in the ratio of coimmobilized probe oligonucleotides were found to yield linear changes in the relative amounts of acceptor emission. These changes were compared to previous studies that used mixed films of two QD donors for two detection channels. The analysis indicated that probe dilution effects were primarily driven by changes in acceptor number density and that QD dilution effects or changes in mean donor-acceptor distance were secondary. Hybridization kinetics were found to be consistent between different ratios of coimmobilized probes, suggesting that hybridization in this type of system occurred via the accepted model for solid-phase hybridization, where adsorption and then diffusion at the solid interface drove hybridization.

  17. Synthetic CO.sub.2 acceptor

    DOEpatents

    Lancet, Michael S.; Curran, George P.

    1981-08-18

    A synthetic CO.sub.2 acceptor consisting essentially of at least one compound selected from the group consisting of calcium oxide and calcium carbonate supported in a refractory carrier matrix, the carrier having the general formula Ca.sub.5 (SiO.sub.4).sub.2 CO.sub.3. A method for producing the synthetic CO.sub.2 acceptor is also disclosed.

  18. An oligonucleotide hybridization approach to DNA sequencing.

    PubMed

    Khrapko, K R; Lysov YuP; Khorlyn, A A; Shick, V V; Florentiev, V L; Mirzabekov, A D

    1989-10-09

    We have proposed a DNA sequencing method based on hybridization of a DNA fragment to be sequenced with the complete set of fixed-length oligonucleotides (e.g., 4(8) = 65,536 possible 8-mers) immobilized individually as dots of a 2-D matrix [(1989) Dokl. Akad. Nauk SSSR 303, 1508-1511]. It was shown that the list of hybridizing octanucleotides is sufficient for the computer-assisted reconstruction of the structures for 80% of random-sequence fragments up to 200 bases long, based on the analysis of the octanucleotide overlapping. Here a refinement of the method and some experimental data are presented. We have performed hybridizations with oligonucleotides immobilized on a glass plate, and obtained their dissociation curves down to heptanucleotides. Other approaches, e.g., an additional hybridization of short oligonucleotides which continuously extend duplexes formed between the fragment and immobilized oligonucleotides, should considerably increase either the probability of unambiguous reconstruction, or the length of reconstructed sequences, or decrease the size of immobilized oligonucleotides.

  19. Spectroscopic (UV/VIS, Raman) and Electrophoresis Study of Cytosine-Guanine Oligonucleotide DNA Influenced by Magnetic Field

    PubMed Central

    Banihashemian, Seyedeh Maryam; Periasamy, Vengadesh; Boon Tong, Goh; Abdul Rahman, Saadah

    2016-01-01

    Studying the effect of a magnetic field on oligonucleotide DNA can provide a novel DNA manipulation technique for potential application in bioengineering and medicine. In this work, the optical and electrochemical response of a 100 bases oligonucleotides DNA, cytosine-guanine (CG100), is investigated via exposure to different magnetic fields (250, 500, 750, and 1000 mT). As a result of the optical response of CG100 to the magnetic field, the ultra-violet-visible spectrum indicated a slight variation in the band gap of CG100 of about 0.3 eV. Raman spectroscopy showed a significant deviation in hydrogen and phosphate bonds’ vibration after exposure to the magnetic field. Oligonucleotide DNA mobility was investigated in the external electric field using the gel electrophoresis technique, which revealed a small decrease in the migration of CG100 after exposure to the magnetic field. PMID:26999445

  20. Oligonucleotide-based therapy for neurodegenerative diseases.

    PubMed

    Magen, Iddo; Hornstein, Eran

    2014-10-10

    Molecular genetics insight into the pathogenesis of several neurodegenerative diseases, such as Alzheimer׳s disease, Parkinson׳s disease, Huntington׳s disease and amyotrophic lateral sclerosis, encourages direct interference with the activity of neurotoxic genes or the molecular activation of neuroprotective pathways. Oligonucleotide-based therapies are recently emerging as an efficient strategy for drug development and these can be employed as new treatments of neurodegenerative states. Here we review advances in this field in recent years which suggest an encouraging assessment that oligonucleotide technologies for targeting of RNAs will enable the development of new therapies and will contribute to preservation of brain integrity.

  1. In Silico Screening Based on Predictive Algorithms as a Design Tool for Exon Skipping Oligonucleotides in Duchenne Muscular Dystrophy

    PubMed Central

    Echigoya, Yusuke; Mouly, Vincent; Garcia, Luis; Yokota, Toshifumi; Duddy, William

    2015-01-01

    The use of antisense ‘splice-switching’ oligonucleotides to induce exon skipping represents a potential therapeutic approach to various human genetic diseases. It has achieved greatest maturity in exon skipping of the dystrophin transcript in Duchenne muscular dystrophy (DMD), for which several clinical trials are completed or ongoing, and a large body of data exists describing tested oligonucleotides and their efficacy. The rational design of an exon skipping oligonucleotide involves the choice of an antisense sequence, usually between 15 and 32 nucleotides, targeting the exon that is to be skipped. Although parameters describing the target site can be computationally estimated and several have been identified to correlate with efficacy, methods to predict efficacy are limited. Here, an in silico pre-screening approach is proposed, based on predictive statistical modelling. Previous DMD data were compiled together and, for each oligonucleotide, some 60 descriptors were considered. Statistical modelling approaches were applied to derive algorithms that predict exon skipping for a given target site. We confirmed (1) the binding energetics of the oligonucleotide to the RNA, and (2) the distance in bases of the target site from the splice acceptor site, as the two most predictive parameters, and we included these and several other parameters (while discounting many) into an in silico screening process, based on their capacity to predict high or low efficacy in either phosphorodiamidate morpholino oligomers (89% correctly predicted) and/or 2’O Methyl RNA oligonucleotides (76% correctly predicted). Predictions correlated strongly with in vitro testing for sixteen de novo PMO sequences targeting various positions on DMD exons 44 (R2 0.89) and 53 (R2 0.89), one of which represents a potential novel candidate for clinical trials. We provide these algorithms together with a computational tool that facilitates screening to predict exon skipping efficacy at each

  2. In silico screening based on predictive algorithms as a design tool for exon skipping oligonucleotides in Duchenne muscular dystrophy.

    PubMed

    Echigoya, Yusuke; Mouly, Vincent; Garcia, Luis; Yokota, Toshifumi; Duddy, William

    2015-01-01

    The use of antisense 'splice-switching' oligonucleotides to induce exon skipping represents a potential therapeutic approach to various human genetic diseases. It has achieved greatest maturity in exon skipping of the dystrophin transcript in Duchenne muscular dystrophy (DMD), for which several clinical trials are completed or ongoing, and a large body of data exists describing tested oligonucleotides and their efficacy. The rational design of an exon skipping oligonucleotide involves the choice of an antisense sequence, usually between 15 and 32 nucleotides, targeting the exon that is to be skipped. Although parameters describing the target site can be computationally estimated and several have been identified to correlate with efficacy, methods to predict efficacy are limited. Here, an in silico pre-screening approach is proposed, based on predictive statistical modelling. Previous DMD data were compiled together and, for each oligonucleotide, some 60 descriptors were considered. Statistical modelling approaches were applied to derive algorithms that predict exon skipping for a given target site. We confirmed (1) the binding energetics of the oligonucleotide to the RNA, and (2) the distance in bases of the target site from the splice acceptor site, as the two most predictive parameters, and we included these and several other parameters (while discounting many) into an in silico screening process, based on their capacity to predict high or low efficacy in either phosphorodiamidate morpholino oligomers (89% correctly predicted) and/or 2'O Methyl RNA oligonucleotides (76% correctly predicted). Predictions correlated strongly with in vitro testing for sixteen de novo PMO sequences targeting various positions on DMD exons 44 (R² 0.89) and 53 (R² 0.89), one of which represents a potential novel candidate for clinical trials. We provide these algorithms together with a computational tool that facilitates screening to predict exon skipping efficacy at each position of

  3. Intrinsically Labeled Fluorescent Oligonucleotide Probes on Quantum Dots for Transduction of Nucleic Acid Hybridization.

    PubMed

    Shahmuradyan, Anna; Krull, Ulrich J

    2016-03-15

    Quantum dots (QDs) have been widely used in chemical and biosensing due to their unique photoelectrical properties and are well suited as donors in fluorescence resonance energy transfer (FRET). Selective hybridization interactions of oligonucleotides on QDs have been determined by FRET. Typically, the QD-FRET constructs have made use of labeled targets or have implemented labeled sandwich format assays to introduce dyes in proximity to the QDs for the FRET process. The intention of this new work is to explore a method to incorporate the acceptor dye into the probe molecule. Thiazole orange (TO) derivatives are fluorescent intercalating dyes that have been used for detection of double-stranded nucleic acids. One such dye system has been reported in which single-stranded oligonucleotide probes were doubly labeled with adjacent thiazole orange derivatives. In the absence of the fully complementary (FC) oligonucleotide target, the dyes form an H-aggregate, which results in quenching of fluorescence emission due to excitonic interactions between the dyes. The hybridization of the FC target to the probe provides for dissociation of the aggregate as the dyes intercalate into the double stranded duplex, resulting in increased fluorescence. This work reports investigation of the dependence of the ratiometric signal on the type of linkage used to conjugate the dyes to the probe, the location of the dye along the length of the probe, and the distance between adjacent dye molecules. The limit of detection for 34mer and 90mer targets was found to be identical and was 10 nM (2 pmol), similar to analogous QD-FRET using labeled oligonucleotide target. The detection system could discriminate a one base pair mismatch (1BPM) target and was functional without substantial compromise of the signal in 75% serum. The 1BPM was found to reduce background signal, indicating that the structure of the mismatch affected the environment of the intercalating dyes.

  4. Antisense Oligonucleotide Mediated Splice Correction of a Deep Intronic Mutation in OPA1

    PubMed Central

    Bonifert, Tobias; Gonzalez Menendez, Irene; Battke, Florian; Theurer, Yvonne; Synofzik, Matthis; Schöls, Ludger; Wissinger, Bernd

    2016-01-01

    Inherited optic neuropathies (ION) present an important cause of blindness in the European working-age population. Recently we reported the discovery of four independent families with deep intronic mutations in the main inherited optic neuropathies gene OPA1. These deep intronic mutations cause mis-splicing of the OPA1 pre-messenger-RNA transcripts by creating cryptic acceptor splice sites. As a rescue strategy we sought to prevent mis-splicing of the mutant pre-messenger-RNA by applying 2′O-methyl-antisense oligonucleotides (AONs) with a full-length phosphorothioate backbone that target the cryptic acceptor splice sites and the predicted novel branch point created by the deep intronic mutations, respectively. Transfection of patient-derived primary fibroblasts with these AONs induced correct splicing of the mutant pre-messenger-RNA in a time and concentration dependent mode of action, as detected by pyrosequencing of informative heterozygous variants. The treatment showed strong rescue effects (~55%) using the cryptic acceptor splice sites targeting AON and moderate rescue (~16%) using the branch point targeting AON. The highest efficacy of Splice correction could be observed 4 days after treatment however, significant effects were still seen 14 days post-transfection. Western blot analysis revealed increased amounts of OPA1 protein with maximum amounts at ~3 days post-treatment. In summary, we provide the first mutation-specific in vitro rescue strategy for OPA1 deficiency using synthetic AONs. PMID:27874857

  5. Oligonucleotide recombination in gram negative bacteria

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This report describes several key aspects of a novel form of RecA-independent homologous recombination. We found that synthetic single stranded DNA oligonucleotides (oligos) introduced into bacteria by transformation can site-specifically recombine with bacterial chromosomes in the absence of any a...

  6. Liver as a target for oligonucleotide therapeutics.

    PubMed

    Sehgal, Alfica; Vaishnaw, Akshay; Fitzgerald, Kevin

    2013-12-01

    Oligonucleotide-based therapeutics are an emerging class of drugs that hold the promise for silencing "un-druggable" targets,thus creating unique opportunities for innovative medicines. As opposed to gene therapy, oligonucleotides are considered to be more akin to small molecule therapeutics because they are small,completely synthetic in origin, do not integrate into the host genome,and have a defined duration of therapeutic activity after which effects recover to baseline. They offer a high degree of specificity at the genetic level, thereby reducing off-target effects.At the same time, they provide a strategy for targeting any gene in the genome, including transcripts that produce mutated proteins.Oligonucleotide-based therapeutics include short interfering RNA (siRNA), that degrade target mRNA through RISC mediated RNAi; anti-miRs, that target miRNAs; miRNA mimics, that regulate target mRNA; antisense oligonucleotides, that may be working through RNAseH mediated mRNA decay; mRNA upregulation,by targeting long non-coding RNAs; and oligonucleotides induced alternative splicing [1]. All these approaches require some minimal degree of homology at the nucleic acid sequence level for them to be functional. The different mechanisms of action and their relevant activity are outlined in Fig. 1. Besides homology,RNA secondary structure has also been exploited in the case of ribozymes and aptamers, which act by binding to nucleic acids or proteins, respectively. While there have been many reports of gene knockdown and gene modulation in cell lines and mice with all these methods, very few have advanced to clinical stages.The main obstacle to date has been the safe and effective intracellular delivery of these compounds in higher species, including humans. Indeed, their action requires direct interaction with DNA/RNA within the target cell so even when one solves the issues of tissue and cellular access, intracellular/intranuclear location represents yet another barrier to

  7. DETECTING LOW-LEVEL SYNTHESIS IMPURITIES IN MODIFIED PHOSPHOROTHIOATE OLIGONUCLEOTIDES USING LIQUID CHROMATOGRAPHY – HIGH RESOLUTION MASS SPECTROMETRY

    PubMed Central

    Nikcevic, Irena; Wyrzykiewicz, Tadeusz K.; Limbach, Patrick A.

    2010-01-01

    Summary An LC-MS method based on the use of high resolution Fourier transform ion cyclotron resonance mass spectrometry (FTIRCMS) for profiling oligonucleotides synthesis impurities is described. Oligonucleotide phosphorothioatediesters (phosphorothioate oligonucleotides), in which one of the non-bridging oxygen atoms at each phosphorus center is replaced by a sulfur atom, are now one of the most popular oligonucleotide modifications due to their ease of chemical synthesis and advantageous pharmacokinetic properties. Despite significant progress in the solid-phase oligomerization chemistry used in the manufacturing of these oligonucleotides, multiple classes of low-level impurities always accompany synthetic oligonucleotides. Liquid chromatography-mass spectrometry has emerged as a powerful technique for the identification of these synthesis impurities. However, impurity profiling, where the entire complement of low-level synthetic impurities is identified in a single analysis, is more challenging. Here we present an LC-MS method based the use of high resolution-mass spectrometry, specifically Fourier transform ion cyclotron resonance mass spectrometry (FTIRCMS or FTMS). The optimal LC-FTMS conditions, including the stationary phase and mobile phases for the separation and identification of phosphorothioate oligonucleotides, were found. The characteristics of FTMS enable charge state determination from single m/z values of low-level impurities. Charge state information then enables more accurate modeling of the detected isotopic distribution for identification of the chemical composition of the detected impurity. Using this approach, a number of phosphorothioate impurities can be detected by LC-FTMS including failure sequences carrying 3′-terminal phosphate monoester and 3′-terminal phosphorothioate monoester, incomplete backbone sulfurization and desulfurization products, high molecular weight impurities, and chloral, isobutyryl, and N3 (2-cyanoethyl) adducts

  8. Phosphate salts

    MedlinePlus

    ... sodium if you have heart disease. Fluid retention (edema): Avoid using phosphate salts that contain sodium if ... heart failure, or other conditions that can cause edema. High levels of calcium in the blood (hypercalcemia): ...

  9. Electron Donor Acceptor Interactions. Final Progress Report

    SciTech Connect

    2002-08-16

    The Gordon Research Conference (GRC) on Electron Donor Acceptor Interactions was held at Salve Regina University, Newport, Rhode Island, 8/11-16/02. Emphasis was placed on current unpublished research and discussion of the future target areas in this field.

  10. Drug targeting: synthesis and endocytosis of oligonucleotide-neoglycoprotein conjugates.

    PubMed Central

    Bonfils, E; Depierreux, C; Midoux, P; Thuong, N T; Monsigny, M; Roche, A C

    1992-01-01

    Inhibition of gene expression by antisense oligonucleotides is limited by their low ability to enter cells. Knowing that sugar binding receptors, also called membrane lectins, efficiently internalize neoglycoproteins bearing the relevant sugar, 6-phosphomannose, for instance, oligonucleotides--substituted on their 5'-end with either a fluorescent probe or a radioactive label on the one hand, and bearing a thiol function on their 3'-end, on the other hand,--were coupled onto 6-phosphomannosylated proteins via a disulfide bridge. The oligonucleotide bound to 6-phosphomannosylated serum albumin is much more efficiently internalized roughly 20 times than the free oligonucleotide. Although most of the oligonucleotides are associated with vesicular compartments, oligonucleotides after releasing from the carrier by reduction of the disulfide bridge may find their way to reach the cytosol and then lead to an increase in the efficiency of the oligonucleotides. Images PMID:1408764

  11. 5' modification of duplex DNA with a ruthenium electron donor-acceptor pair using solid-phase DNA synthesis

    NASA Technical Reports Server (NTRS)

    Frank, Natia L.; Meade, Thomas J.

    2003-01-01

    Incorporation of metalated nucleosides into DNA through covalent modification is crucial to measurement of thermal electron-transfer rates and the dependence of these rates with structure, distance, and position. Here, we report the first synthesis of an electron donor-acceptor pair of 5' metallonucleosides and their subsequent incorporation into oligonucleotides using solid-phase DNA synthesis techniques. Large-scale syntheses of metal-containing oligonucleotides are achieved using 5' modified phosporamidites containing [Ru(acac)(2)(IMPy)](2+) (acac is acetylacetonato; IMPy is 2'-iminomethylpyridyl-2'-deoxyuridine) (3) and [Ru(bpy)(2)(IMPy)](2+) (bpy is 2,2'-bipyridine; IMPy is 2'-iminomethylpyridyl-2'-deoxyuridine) (4). Duplexes formed with the metal-containing oligonucleotides exhibit thermal stability comparable to the corresponding unmetalated duplexes (T(m) of modified duplex = 49 degrees C vs T(m) of unmodified duplex = 47 degrees C). Electrochemical (3, E(1/2) = -0.04 V vs NHE; 4, E(1/2) = 1.12 V vs NHE), absorption (3, lambda(max) = 568, 369 nm; 4, lambda(max) = 480 nm), and emission (4, lambda(max) = 720 nm, tau = 55 ns, Phi = 1.2 x 10(-)(4)) data for the ruthenium-modified nucleosides and oligonucleotides indicate that incorporation into an oligonucleotide does not perturb the electronic properties of the ruthenium complex or the DNA significantly. In addition, the absence of any change in the emission properties upon metalated duplex formation suggests that the [Ru(bpy)(2)(IMPy)](2+)[Ru(acac)(2)(IMPy)](2+) pair will provide a valuable probe for DNA-mediated electron-transfer studies.

  12. Antisense oligonucleotides in therapy for neurodegenerative disorders.

    PubMed

    Evers, Melvin M; Toonen, Lodewijk J A; van Roon-Mom, Willeke M C

    2015-06-29

    Antisense oligonucleotides are synthetic single stranded strings of nucleic acids that bind to RNA and thereby alter or reduce expression of the target RNA. They can not only reduce expression of mutant proteins by breakdown of the targeted transcript, but also restore protein expression or modify proteins through interference with pre-mRNA splicing. There has been a recent revival of interest in the use of antisense oligonucleotides to treat several neurodegenerative disorders using different approaches to prevent disease onset or halt disease progression and the first clinical trials for spinal muscular atrophy and amyotrophic lateral sclerosis showing promising results. For these trials, intrathecal delivery is being used but direct infusion into the brain ventricles and several methods of passing the blood brain barrier after peripheral administration are also under investigation.

  13. Alteration of the Donor/Acceptor Spectrum of the (S)-Amine Transaminase from Vibrio fluvialis.

    PubMed

    Genz, Maika; Vickers, Clare; van den Bergh, Tom; Joosten, Henk-Jan; Dörr, Mark; Höhne, Matthias; Bornscheuer, Uwe T

    2015-11-11

    To alter the amine donor/acceptor spectrum of an (S)-selective amine transaminase (ATA), a library based on the Vibrio fluvialis ATA targeting four residues close to the active site (L56, W57, R415 and L417) was created. A 3DM-derived alignment comprising fold class I pyridoxal-5'-phosphate (PLP)-dependent enzymes allowed identification of positions, which were assumed to determine substrate specificity. These positions were targeted for mutagenesis with a focused alphabet of hydrophobic amino acids to convert an amine:α-keto acid transferase into an amine:aldehyde transferase. Screening of 1200 variants revealed three hits, which showed a shifted amine donor/acceptor spectrum towards aliphatic aldehydes (mainly pentanal), as well as an altered pH profile. Interestingly, all three hits, although found independently, contained the same mutation R415L and additional W57F and L417V substitutions.

  14. Alteration of the Donor/Acceptor Spectrum of the (S)-Amine Transaminase from Vibrio fluvialis

    PubMed Central

    Genz, Maika; Vickers, Clare; van den Bergh, Tom; Joosten, Henk-Jan; Dörr, Mark; Höhne, Matthias; Bornscheuer, Uwe T.

    2015-01-01

    To alter the amine donor/acceptor spectrum of an (S)-selective amine transaminase (ATA), a library based on the Vibrio fluvialis ATA targeting four residues close to the active site (L56, W57, R415 and L417) was created. A 3DM-derived alignment comprising fold class I pyridoxal-5′-phosphate (PLP)-dependent enzymes allowed identification of positions, which were assumed to determine substrate specificity. These positions were targeted for mutagenesis with a focused alphabet of hydrophobic amino acids to convert an amine:α-keto acid transferase into an amine:aldehyde transferase. Screening of 1200 variants revealed three hits, which showed a shifted amine donor/acceptor spectrum towards aliphatic aldehydes (mainly pentanal), as well as an altered pH profile. Interestingly, all three hits, although found independently, contained the same mutation R415L and additional W57F and L417V substitutions. PMID:26569229

  15. Determination of pKa values for deprotonable nucleobases in short model oligonucleotides.

    PubMed

    González-Olvera, Julio C; Martínez-Reyes, José; González-Jasso, Eva; Pless, Reynaldo C

    2015-11-01

    The deprotonation of ionizable nucleobases centrally placed in short model oligonucleotides was examined under different physical conditions, using UV absorption spectroscopy. The oligonucleotide sequences were designed so that only the central base would be ionized over the pH range examined. pKa values of 9.90±0.01 and 9.34±0.04 were determined for the guanine group in the oligomer d-ACAGCAC and 2'-deoxyguanosine, respectively, both at 25°C and 0.1M NaCl. Lengthening the oligonucleotide up to the tridecamer stage further increases the pKa of the central guanine moiety. Electrolyte concentration, temperature, and mixed water-ethanol solvents affect the acidity of the central base. Changes in the sequence surrounding the central guanine can also have a significant effect, especially in the case of strongly stacking sequences. The pKa values were also determined for the hepta(2'-O-methyl)ribonucleotide and the heptamer PNA of identical sequence, as well as for oligodeoxyribonucleotides with different deprotonable bases, viz. thymine, uracil, or hypoxanthine, in the central position. The results are interpreted in terms of the electric-field effect exerted on the departing proton by the negative electric charges located on the internucleotide phosphate groups, and calculations show this effect to approximately explain the magnitude of the pKa difference observed between the deoxyriboheptanucleotide and its electroneutral PNA analogue.

  16. Treatment of experimental autoimmune encephalomyelitis with antisense oligonucleotides against the low affinity neurotrophin receptor.

    PubMed

    Soilu-Hänninen, M; Epa, R; Shipham, K; Butzkueven, H; Bucci, T; Barrett, G; Bartlett, P F; Kilpatrick, T J

    2000-03-15

    Upregulated expression of the low-affinity neurotrophin receptor (p75) in the central nervous system (CNS) during experimental autoimmune encephalomyelitis (EAE) has recently been demonstrated. To investigate whether p75 plays a role in disease pathogenesis, we adopted a gene therapy approach, utilizing antisense oligonucleotides to downregulate p75 expression during EAE. Phosphorothioate antisense oligonucleotides (AS), nonsense oligonucleotides (NS) or phosphate buffered saline (PBS) were injected daily for 18 days after immunization of SJL/J (H-2s)-mice with myelin proteolipid protein (PLP) peptide 139-151. In the AS group, there was a statistically significant reduction in both the mean maximal disease score (1.85 in the AS, 2.94 in the NS and 2.75 in the PBS-groups, respectively, P < 0.025) and in the cumulative disease incidence ( approximately 60% in the AS group and approximately 90% in the control groups). Histological and immunohistochemical analysis showed reduced inflammation and demyelination, as well as reduced p75 expression at the blood-brain barrier (BBB) in the AS-treated mice in comparison with both control groups. There was no difference, however, in p75 expression on neural cells within the CNS between the three groups of mice. We conclude that p75 could play a proactive role in the pathogenesis of EAE and may exert its effect at the level of the BBB.

  17. High Performance Magazine Acceptor Threshold Criteria

    DTIC Science & Technology

    1994-08-01

    detonation transition (DDT). To account for unknown mechanisms the term XDT is also used. Development of a design procedure to prevent SD requires...propagation walls are used to prevent sympathetic detonation between munitions stored in adjacent cells. Design of the walls, and their mitigation...effects, requires sympathetic detonation threshold criteria for acceptor munitions. This paper outlines the procedures being used to develop SD threshold

  18. Chemical synthesis of long RNAs with terminal 5'-phosphate groups.

    PubMed

    Pradère, Ugo; Halloy, François; Hall, Jonathan

    2017-03-12

    Long structured RNAs are useful biochemical and biological tools. They are usually prepared enzymatically, but this precludes their site-specific modification with functional groups for chemical biology studies. One solution is to perform solid-phase synthesis of multiple RNAs loaded with 5'-terminal phosphate groups, so that RNAs can be concatenated using template ligation reactions. However, there are currently no readily available reagents suitable for the incorporation of the phosphate group into long RNAs by solid-phase synthesis. Here we describe an easy-to-prepare phosphoramidite reagent suitable for the chemical introduction of 5'-terminal phosphate groups into long RNAs. The phosphate is protected by a dinitrobenzhydryl group that serves as an essential lipophilic group for the separation of oligonucleotide by-products. The phosphate is unmasked quantitatively by brief UV irradiation. We demonstrate the value of this reagent in the preparation of a library of long structured RNAs that are site-specifically modified with functional groups.

  19. Template-Directed Ligation of Peptides to Oligonucleotides

    NASA Technical Reports Server (NTRS)

    Bruick, Richard K.; Dawson, Philip E.; Kent, Stephen BH; Usman, Nassim; Joyce, Gerald F.

    1996-01-01

    Synthetic oligonucleotides and peptides have enjoyed a wide range of applications in both biology and chemistry. As a consequence, oligonucleotide-peptide conjugates have received considerable attention, most notably in the development of antisense constructs with improved pharmacological properties. In addition, oligonucleotide-peptide conjugates have been used as molecular tags, in the assembly of supramolecular arrays and in the construction of encoded combinatorial libraries. To make these chimeric molecules more accessible for a broad range of investigations, we sought to develop a facile method for joining fully deprotected oligonucleotides and peptides through a stable amide bond linkage. Furthermore, we wished to make this ligation reaction addressable, enabling one to direct the ligation of specific oligonucleotide and peptide components.To confer specificity and accelerate the rate of the reaction, the ligation process was designed to be dependent on the presence of a complementary oligonucleotide template.

  20. Antisense sequence-directed cross-linking of DNA oligonucleotides by mitomycin C.

    PubMed

    Maruenda, H; Tomasz, M

    1996-01-01

    Oligodeoxyribonucleotides (ODNs) conjugated with mitomycin C (MC) via (-CH2-)n tethers of different lengths (n = 6, 12) to their terminal 5'-phosphate were synthesized, and their interaction with target complementary single-stranded DNA oligonucleotides was investigated. MC, a clinically used natural anticancer drug, is known to act as a bioreductive alkylating agent of duplex DNA with a remarkable preference for 5'-d(CG) sequences. The usual enzymatic bioreductive techniques known to trigger MC to alkylate DNA were employed in the reaction between the MC-oligonucleotide conjugates and their targets radiolabeled by 32P at their 5'-phosphate. A slow-moving radiolabeled product, detected by polyacrylamide gel electrophoresis using phosphorimaging techniques, was obtained in 15-25% yield with complementary DNA as target. Formation of these products was dependent upon complementary duplex formation. Evidence is presented that the DNA target is alkylated by the mitomycin C moiety of the ODN conjugate at the 2-amino group of a guanine base. These findings suggest that the MC-ODN conjugates may be useful specific inhibitors of cellular or viral gene expression. To our knowledge this is the first report on ODN conjugates of a reductively activated drug of known therapeutic value.

  1. Detection of SPO11-oligonucleotide complexes from mouse testes.

    PubMed

    Pan, Jing; Keeney, Scott

    2009-01-01

    The SPO11 protein generates programmed DNA double-strand breaks (DSBs) that initiate meiotic recombination. Endonucleolytic cleavage 3' to the DSB sites releases SPO11 from DNA, leaving SPO11 covalently associated with an oligonucleotide. This chapter describes detection of the release product, SPO11-oligonucleotide complexes, from mouse testis lysates. The method for determining the size of SPO11-associated oligonucleotides is also provided.

  2. Photoionization in micelles: Addition of charged electron acceptors

    NASA Astrophysics Data System (ADS)

    Stenland, Chris; Kevan, Larry

    The relative photoyield of the electron donor N, N, N', N'-tetramethylbenzidine (TMB), solubilized in sodium and lithium dodecyl sulfate micelles with added charged electron acceptors was investigated. It was attempted to control the acceptor distance from a charged micellar interface by differently charged acceptors, cationic dimethyl viologen and anionic ferricyanide. However, back electron transfer from both cationic and anionic acceptors was found to be efficient. Thus simple electrostatic arguments for control of the photoyield do not seem applicable. Salt effects associated with the added ionic acceptors which partially neutralize the ionic micellar interface are suggested to be an important factor.

  3. Binomial distribution-based quantitative measurement of multiple-acceptors fluorescence resonance energy transfer by partially photobleaching acceptor

    NASA Astrophysics Data System (ADS)

    Zhang, Lili; Yu, Huaina; Zhang, Jianwei; Chen, Tongsheng

    2014-06-01

    We report that binomial distribution depending on acceptor photobleaching degree can be used to characterize the proportions of various kinds of FRET (Fluorescence Resonance Energy Transfer) constructs resulted from partial acceptor photobleaching of multiple-acceptors FRET system. On this basis, we set up a rigorous quantitation theory for multiple-acceptors FRET construct named as Mb-PbFRET which is not affected by the imaging conditions and fluorophore properties. We experimentally validate Mb-PbFRET with FRET constructs consisted of one donor and two or three acceptors inside living cells on confocal and wide-field microscopes.

  4. Alkyl Chlorides as Hydrogen Bond Acceptors

    SciTech Connect

    Nadas, Janos I; Vukovic, Sinisa; Hay, Benjamin

    2012-01-01

    To gain an understanding of the role of an alkyl chloride as a hydrogen bond acceptor, geometries and interaction energies were calculated at the MP2/aug-cc-pVDZ level of theory for complexes between ethyl chloride and representative hydrogen donor groups. The results establish that these donors, which include hydrogen cyanide, methanol, nitrobenzene, pyrrole, acetamide, and N-methylurea, form X-H {hor_ellipsis} Cl hydrogen bonds (X = C, N, O) of weak to moderate strength, with {Delta}E values ranging from -2.8 to -5.3 kcal/mol.

  5. BIOCONJUGATION OF OLIGONUCLEOTIDES FOR TREATING LIVER FIBROSIS

    PubMed Central

    Ye, Zhaoyang; Hajj Houssein, Houssam S.; Mahato, Ram I.

    2009-01-01

    Liver fibrosis results from chronic liver injury due to hepatitis B and C, excessive alcohol ingestion, and metal ion overload. Fibrosis culminates in cirrhosis and results in liver failure. Therefore, a potent antifibrotic therapy is in urgent need to reverse scarring and eliminate progression to cirrhosis. Although activated hepatic stellate cells (HSCs) remains the principle cell type responsible for liver fibrosis, perivascular fibroblasts of portal and central veins as well as periductular fibroblasts are other sources of fibrogenic cells. This review will critically discuss various treatment strategies for liver fibrosis, including prevention of liver injury, reduction of inflammation, inhibition of HSC activation, degradation of scar matrix, and inhibition of aberrant collagen synthesis. Oligonucleotides (ODNs) are short, single-stranded nucleic acids, which disrupt expression of target protein by binding to complementary mRNA or forming triplex with genomic DNA. Triplex forming oligonucleotides (TFOs) provide an attractive strategy for treating liver fibrosis. A series of TFOs have been developed for inhibiting the transcription of α1(I) collagen gene, which opens a new area for antifibrotic drugs. There will be in depth discussion on the use of TFOs and how different bioconjugation strategies can be utilized for their site-specific delivery to HSCs or hepatocytes for enhanced antifibrotic activities. Various insights developed in individual strategy and the need for multipronged approaches will also be discussed. PMID:18154454

  6. Disulfide-linked oligonucleotide phosphorothioates - Novel analogues of nucleic acids

    NASA Technical Reports Server (NTRS)

    Wu, Taifeng; Orgel, Leslie E.

    1991-01-01

    The synthesis of phosphorothioate analogs of oligonucleotides by the oxidation of deoxyadenosine 3',5'-bisphosphorothioate (3) was attempted. Cyclization of 3 is much more efficient than oligomerization under all the conditions investigated. However, a preformed oligonucleotide carrying a 5'-terminal phosphorotioate group undergoes efficient chain-extension when oxidized in the presence of 3.

  7. Oligonucleotide therapies for disorders of the nervous system.

    PubMed

    Khorkova, Olga; Wahlestedt, Claes

    2017-03-01

    Oligonucleotide therapies are currently experiencing a resurgence driven by advances in backbone chemistry and discoveries of novel therapeutic pathways that can be uniquely and efficiently modulated by the oligonucleotide drugs. A quarter of a century has passed since oligonucleotides were first applied in living mammalian brain to modulate gene expression. Despite challenges in delivery to the brain, multiple oligonucleotide-based compounds are now being developed for treatment of human brain disorders by direct delivery inside the blood brain barrier (BBB). Notably, the first new central nervous system (CNS)-targeted oligonucleotide-based drug (nusinersen/Spinraza) was approved by US Food and Drug Administration (FDA) in late 2016 and several other compounds are in advanced clinical trials. Human testing of brain-targeted oligonucleotides has highlighted unusual pharmacokinetic and pharmacodynamic properties of these compounds, including complex active uptake mechanisms, low systemic exposure, extremely long half-lives, accumulation and gradual release from subcellular depots. Further work on oligonucleotide uptake, development of formulations for delivery across the BBB and relevant disease biology studies are required for further optimization of the oligonucleotide drug development process for brain applications.

  8. Voltage-gated calcium channel and antisense oligonucleotides thereto

    NASA Technical Reports Server (NTRS)

    Hruska, Keith A. (Inventor); Friedman, Peter A. (Inventor); Barry, Elizabeth L. R. (Inventor); Duncan, Randall L. (Inventor)

    1998-01-01

    An antisense oligonucleotide of 10 to 35 nucleotides in length that can hybridize with a region of the .alpha..sub.1 subunit of the SA-Cat channel gene DNA or mRNA is provided, together with pharmaceutical compositions containing and methods utilizing such antisense oligonucleotide.

  9. Pyrimidine phosphorothioate oligonucleotides form triple-stranded helices and promote transcription inhibition.

    PubMed Central

    Xodo, L; Alunni-Fabbroni, M; Manzini, G; Quadrifoglio, F

    1994-01-01

    The ability of phosphorothioate (POS) oligonucleotides to recognise and bind to homopurine-homopyrimidine DNA double-stranded sites via triple helix formation has been investigated. It has been found that the homologous pyrimidine POS sequences Y11-Si (i = 0, 1,2,3,4,10), which have been obtained by an increasing sulphur substitution in the sugar-phosphate backbone of d(CTTCCTCCTCT) (Y11), and the target hairpin duplex d(GAAGGAGGAGA-T4-TCTCCTCCTTC) (h26) can form stable triple helices, as indicated by PAGE, CD and UV melting experiments. The thermal stability of the triple helices depends on the number of POS linkages in the third Y11 strand, varying from 48 degrees C (Y11, with only phosphate groups, PO2) to 31 degrees C (Y11-S10 containing exclusively thioate groups). On average, a Tm depression of about 2 degrees C per POS linkage introduced in Y11 was observed. CD data indicate that the sulphurization of the third strand results in minimal changes of triple-stranded structures. The energetics of the triplex-to-hairpin plus single-strand transition has been determined by van't Hoff analyses of the melting curves. In free energy terms, the POS triplexes h26.Y11-Si are less stable than the normal PO2 h26.Y11 triplex by values between 2.7 and 5.4 kcal/mol, depending on the number of POS linkages contained in the third strand. Phosphorothioate oligonucleotides being resistant towards several nucleases offer an interesting choice as gene blockers in antisense strategy. Thus, their ability to inhibit transcription via triple helix formation has been examined in vitro. We found that triplex-forming POS oligonucleotides of 20 bases in length (with a cytosine contents of 45%), containing either 10% or 26% thioate groups, strongly repress the transcription activity of the bacteriophage T7 RNA polymerase at pH 6.9, when used in excess compared to the target (mol oligo/mol template = 125). The here reported data are useful for designing phosphorothioate oligonucleotides

  10. 2'-modified nucleosides for site-specific labeling of oligonucleotides

    NASA Technical Reports Server (NTRS)

    Krider, Elizabeth S.; Miller, Jeremiah E.; Meade, Thomas J.

    2002-01-01

    We report the synthesis of 2'-modified nucleosides designed specifically for incorporating labels into oligonucleotides. Conversion of these nucleosides to phosphoramidite and solid support-bound derivatives proceeds in good yield. Large-scale synthesis of 11-mer oligonucleotides possessing the 2'-modified nucleosides is achieved using these derivatives. Thermal denaturation studies indicate that the presence of 2'-modified nucleosides in 11-mer duplexes has minimal destabilizing effects on the duplex structure when the nucleosides are placed at the duplex termini. The powerful combination of phosphoramidite and support-bound derivatives of 2'-modified nucleosides affords the large-scale preparation of an entirely new class of oligonucleotides. The ability to synthesize oligonucleotides containing label attachment sites at 3', intervening, and 5' locations of a duplex is a significant advance in the development of oligonucleotide conjugates.

  11. The spherulites™: a promising carrier for oligonucleotide delivery

    PubMed Central

    Mignet, Nathalie; Brun, Armelle; Degert, Corinne; Delord, Brigitte; Roux, Didier; Hélène, Claude; Laversanne, René; François, Jean-Christophe

    2000-01-01

    Concentric multilamellar microvesicles, named spherulites™, were evaluated as an oligonucleotide carrier. Up to 80% oligonucleotide was encapsulated in these vesicles. The study was carried out on two different spherulite™ formulations. The spherulite™ size and stability characteristics are presented. Delivery of encapsulated oligonucleotide was performed on a rat hepatocarcinoma and on a lymphoblastoid T cell line, both expressing the luciferase gene. We showed that spherulites™ were able to transfect both adherent and suspension cell lines and deliver the oligonucleotide to the nucleus. Moreover, 48–62% luciferase inhibition was obtained in the rat hepatocarcinoma cell line when the antisense oligonucleotide targeted to the luciferase coding region was encapsulated at 500 nM concentration in spherulites™ of different compositions. PMID:10931929

  12. Noncoding oligonucleotides: the belle of the ball in gene therapy.

    PubMed

    Shum, Ka-To; Rossi, John J

    2015-01-01

    Gene therapy carries the promise of cures for many diseases based on manipulating the expression of a person's genes toward the therapeutic goal. The relevance of noncoding oligonucleotides to human disease is attracting widespread attention. Noncoding oligonucleotides are not only involved in gene regulation, but can also be modified into therapeutic tools. There are many strategies that leverage noncoding oligonucleotides for gene therapy, including small interfering RNAs, antisense oligonucleotides, aptamers, ribozymes, decoys, and bacteriophage phi 29 RNAs. In this chapter, we will provide a broad, comprehensive overview of gene therapies that use noncoding oligonucleotides for disease treatment. The mechanism and development of each therapeutic will be described, with a particular focus on its clinical development. Finally, we will discuss the challenges associated with developing nucleic acid therapeutics and the prospects for future success.

  13. [Relations between the retinoic acid acceptor and teratogenesis of retinoids].

    PubMed

    Li, Zeng-Gang; Sun, Kai-Lai

    2004-09-01

    Retinoic acid can induce teratogenesis of the fetus of many animals including human, and its biological activities are induced by a serious of different retinoic acid accepters and their ligands. The retinoic acid acceptor RAR plays key roles in the teratogenesis, and the ligands of RAR are strong teratogens. The intensity sequence of the relative teratogenesis is ligandalpha, ligandbeta and ligandgamma. The ligands of the retinoic acid acceptor RXR cannot induce teratogenesis, but they can enhance the teratogenesis of the RAR stimulus. The retinoic acid acceptors can also affect the development of the fetus by adjusting the expression of the other genes. The relations between the gene mutation of the retinoic acid acceptor, various retinoic acid acceptors and their ligands and teratogenesis of retinoic acid are summarized in this article. In addition, the regulations of the retinoic acid acceptors to the other genes are also discussed.

  14. The reaction of choline dehydrogenase with some electron acceptors.

    PubMed Central

    Barrett, M C; Dawson, A P

    1975-01-01

    1. The choline dehydrogenase (EC 1.1.99.1) WAS SOLUBILIZED FROM ACETONE-DRIED POWDERS OF RAT LIVER MITOCHONDRIA BY TREATMENT WITH Naja naja venom. 2. The kinetics of the reaction of enzyme with phenazine methosulphate and ubiquinone-2 as electron acceptors were investigated. 3. With both electron acceptors the reaction mechanism appears to involve a free, modified-enzyme intermediate. 4. With some electron acceptors the maximum velocity of the reaction is independent of the nature of the acceptor. With phenazine methosulphate and ubiquinone-2 as acceptors the Km value for choline is also independent of the nature of the acceptor molecule. 5. The mechanism of the Triton X-100-solubilized enzyme is apparently the smae as that for the snake venom solubilized enzyme. PMID:1218095

  15. The reaction of choline dehydrogenase with some electron acceptors.

    PubMed

    Barrett, M C; Dawson, A P

    1975-12-01

    1. The choline dehydrogenase (EC 1.1.99.1) WAS SOLUBILIZED FROM ACETONE-DRIED POWDERS OF RAT LIVER MITOCHONDRIA BY TREATMENT WITH Naja naja venom. 2. The kinetics of the reaction of enzyme with phenazine methosulphate and ubiquinone-2 as electron acceptors were investigated. 3. With both electron acceptors the reaction mechanism appears to involve a free, modified-enzyme intermediate. 4. With some electron acceptors the maximum velocity of the reaction is independent of the nature of the acceptor. With phenazine methosulphate and ubiquinone-2 as acceptors the Km value for choline is also independent of the nature of the acceptor molecule. 5. The mechanism of the Triton X-100-solubilized enzyme is apparently the smae as that for the snake venom solubilized enzyme.

  16. Electron attachment to hydrated oligonucleotide dimers: guanylyl-3',5'-cytidine and cytidylyl-3',5'-guanosine.

    PubMed

    Gu, Jiande; Xie, Yaoming; Schaefer, Henry F

    2010-05-03

    The dinucleoside phosphate deoxycytidylyl-3',5'-deoxyguanosine (dCpdG) and deoxyguanylyl-3',5'-deoxycytidine (dGpdC) systems are among the largest to be studied by reliable theoretical methods. Exploring electron attachment to these subunits of DNA single strands provides significant progress toward definitive predictions of the electron affinities of DNA single strands. The adiabatic electron affinities of the oligonucleotides are found to be sequence dependent. Deoxycytidine (dC) on the 5' end, dCpdG, has larger adiabatic electron affinity (AEA, 0.90 eV) than dC on the 3' end of the oligomer (dGpdC, 0.66 eV). The geometric features, molecular orbital analyses, and charge distribution studies for the radical anions of the cytidine-containing oligonucleotides demonstrate that the excess electron in these anionic systems is dominantly located on the cytosine nucleobase moiety. The pi-stacking interaction between nucleobases G and C seems unlikely to improve the electron-capturing ability of the oligonucleotide dimers. The influence of the neighboring base on the electron-capturing ability of cytosine should be attributed to the intensified proton accepting-donating interaction between the bases. The present investigation demonstrates that the vertical detachment energies (VDEs) of the radical anions of the oligonucleotides dGpdC and dCpdG are significantly larger than those of the corresponding nucleotides. Consequently, reactions with low activation barriers, such as those for O-C sigma bond and N-glycosidic bond breakage, might be expected for the radical anions of the guanosine-cytosine mixed oligonucleotides.

  17. Conjugation of fluorescent proteins with DNA oligonucleotides.

    PubMed

    Lapiene, Vidmantas; Kukolka, Florian; Kiko, Kathrin; Arndt, Andreas; Niemeyer, Christof M

    2010-05-19

    This work describes the synthesis of covalent ssDNA conjugates of six fluorescent proteins, ECFP, EGFP, E(2)GFP, mDsRed, Dronpa, and mCherry, which were cloned with an accessible C-terminal cystein residue to enable site-selective coupling using a heterobispecific cross-linker. The resulting conjugates revealed similar fluorescence emission intensity to the unconjugated proteins, and the functionality of the tethered oligonucleotide was proven by specific Watson-Crick base pairing to cDNA-modified gold nanoparticles. Fluorescence spectroscopy analysis indicated that the fluorescence of the FP is quenched by the gold particle, and the extent of quenching varied with the intrinsic spectroscopic properties of FP as well as with the configuration of surface attachment. Since this study demonstrates that biological fluorophores can be selectively incorporated into and optically coupled with nanoparticle-based devices, applications in DNA-based nanofabrication can be foreseen.

  18. Abiotic formation of oligonucleotides on basalt surfaces

    NASA Astrophysics Data System (ADS)

    Otroshchenko, V. A.; Vasilyeva, N. V.; Kopilov, A. M.

    1985-06-01

    The complication and further evolution of abiotic syntheses products occurred under environmental influences at the prebiological stage. From this point of view, the influence of some types of irradiation on the organic molecules adsorbed on the surfaces of volcanic rocks, appeared to be of great importance. In this connection, the effect of gamma rays on the AMP molecules adsorbed on mineral surfaces such as cinders and ashes has been studied. It has been shown that they can polymerize with the formation of oligonucleotides. The treatment of oligomers obtained by venom phosphodiesterase has shown that a polymeric product has mainly 3' 5' and 2' 5' bonds between nucleotides. The results obtained have been discussed from the evolutionary aspect.

  19. Evaluation of a new biocompatible poly(N-(morpholino ethyl methacrylate)-based copolymer for the delivery of ruthenium oligonucleotides, targeting HPV16 E6 oncogene.

    PubMed

    Reschner, Anca; Shim, Yong Ho; Dubois, Philippe; Delvenne, Philippe; Evrard, Brigitte; Marcélis, Lionel; Moucheron, Cécile; Kirsch-De Mesmaeker, Andrée; Defrancq, Eric; Raes, Martine; Piette, Jacques; Collard, Laurence; Piel, Géraldine

    2013-08-01

    This study investigates the use of a new biocompatible block copolymer poly(2-(dimethylamino)ethyl methacrylate-N-(morpholino)ethyl methacrylate (PDMAEMA-b-PMEMA) for the delivery of a particular antisense oligonucleotide targeting E6 gene from human papilloma virus. This antisense oligonucleotide was derivatized with a polyazaaromatic Ru(II) complex which, under visible illumination, is able to produce an irreversible crosslink with the complementary targeted sequence. The purpose of this study is to determine whether by the use of a suitable transfection agent, it is possible to increase the efficiency of the antisense oligonucleotide targeting E6 gene, named Ru-P-4. In a recent study, we showed that Oligofectamine transfected Ru-P-4 antisense oligonucleotide failed to inhibit efficiently the growth of cervical cancer cell line SiHa, contrarily to the Ru-P-6 antisense oligonucleotide, another sequence also targeting the E6 gene. The ability of PDMAEMA-b-PMEMA to form polyplexes with optimal physicochemical characteristics was investigated first. Then the ability of the PDMAEMA-b-PMEMA/Ru-P-4 antisense oligonucleotide polyplexes to transfect two keratinocyte cell lines (SiHa and HaCat) and the capacity of polyplexes to inhibit HPV16+ cervical cancer cell growth was evaluated. PDMAEMA-b-PMEMA base polyplexes at the optimal molar ratio of polymer nitrogen atoms to DNA phosphates (N/P), were able to deliver Ru-P-4 antisense oligonucleotide and to induce a higher growth inhibition in human cervical cancer SiHa cells, compared to other formulations based on Oligofectamine.

  20. Direct oligonucleotide-photosensitizer conjugates for photochemical delivery of antisense oligonucleotides.

    PubMed

    Yuan, Ahu; Laing, Brian; Hu, Yiqiao; Ming, Xin

    2015-04-18

    Activation of photosensitizers in endosomes enables release of therapeutic macromolecules into the cytosol of the target cells for pharmacological actions. In this study, we demonstrate that direct conjugation of photosensitizers to oligonucleotides (ONs) allows spatial and temporal co-localization of the two modalities in the target cells, and thus leads to superior functional delivery of ONs. Further, light-activated delivery of an anticancer ON caused cancer cell killing via modulation of an oncogene and photodynamic therapy.

  1. Preparation and application of triple helix forming oligonucleotides and single strand oligonucleotide donors for gene correction.

    PubMed

    Alam, Rowshon; Thazhathveetil, Arun Kalliat; Li, Hong; Seidman, Michael M

    2014-01-01

    Strategies for site-specific modulation of genomic sequences in mammalian cells require two components. One must be capable of recognizing and activating a specific target sequence in vivo, driving that site into an exploitable repair pathway. Information is transferred to the site via participation in the pathway by the second component, a donor nucleic acid, resulting in a permanent change in the target sequence. We have developed biologically active triple helix forming oligonucleotides (TFOs) as site-specific gene targeting reagents. These TFOs, linked to DNA reactive compounds (such as a cross-linking agent), activate pathways that can engage informational donors. We have used the combination of a psoralen-TFO and single strand oligonucleotide donors to generate novel cell lines with directed sequence changes at the target site. Here we describe the synthesis and purification of bioactive psoralen-linked TFOs, their co-introduction into mammalian cells with donor nucleic acids, and the identification of cells with sequence conversion of the target site. We have emphasized details in the synthesis and purification of the oligonucleotides that are essential for preparation of reagents with optimal activity.

  2. On the effect of nuclear bridge modes on donor-acceptor electronic coupling in donor-bridge-acceptor molecules

    NASA Astrophysics Data System (ADS)

    Davis, Daly; Toroker, Maytal Caspary; Speiser, Shammai; Peskin, Uri

    2009-03-01

    We report a theoretical study of intra-molecular electronic coupling in a symmetric DBA (donor-bridge-acceptor) complex, in which a donor electronic site is coupled to an acceptor site by way of intervening orbitals of a molecular bridge unit. In the off-resonant (deep tunneling) regime of electronic transport, the lowest unoccupied molecular orbitals (MO's) of the DBA system are split into distinguishable donor/acceptor and bridge orbitals. The effect of geometrical changes at the bridge on the donor/acceptor electronic energy manifold is studied for local stretching and bending modes. It is demonstrated that the energy splitting in the manifold of donor/acceptor unoccupied MOs changes in response to such changes, as assumed in simple McConnell-type models. Limitations of the simple models are revealed where the electronic charging of the bridge orbitals correlates with increasing donor/acceptor orbital energy splitting only for stretching but not for bending bridge modes.

  3. Quantum computing with acceptor spins in silicon

    NASA Astrophysics Data System (ADS)

    Salfi, Joe; Tong, Mengyang; Rogge, Sven; Culcer, Dimitrie

    2016-06-01

    The states of a boron acceptor near a Si/SiO2 interface, which bind two low-energy Kramers pairs, have exceptional properties for encoding quantum information and, with the aid of strain, both heavy hole and light hole-based spin qubits can be designed. Whereas a light-hole spin qubit was introduced recently (arXiv:1508.04259), here we present analytical and numerical results proving that a heavy-hole spin qubit can be reliably initialised, rotated and entangled by electrical means alone. This is due to strong Rashba-like spin-orbit interaction terms enabled by the interface inversion asymmetry. Single qubit rotations rely on electric-dipole spin resonance (EDSR), which is strongly enhanced by interface-induced spin-orbit terms. Entanglement can be accomplished by Coulomb exchange, coupling to a resonator, or spin-orbit induced dipole-dipole interactions. By analysing the qubit sensitivity to charge noise, we demonstrate that interface-induced spin-orbit terms are responsible for sweet spots in the dephasing time {T}2* as a function of the top gate electric field, which are close to maxima in the EDSR strength, where the EDSR gate has high fidelity. We show that both qubits can be described using the same starting Hamiltonian, and by comparing their properties we show that the complex interplay of bulk and interface-induced spin-orbit terms allows a high degree of electrical control and makes acceptors potential candidates for scalable quantum computation in Si.

  4. Quantum computing with acceptor spins in silicon.

    PubMed

    Salfi, Joe; Tong, Mengyang; Rogge, Sven; Culcer, Dimitrie

    2016-06-17

    The states of a boron acceptor near a Si/SiO2 interface, which bind two low-energy Kramers pairs, have exceptional properties for encoding quantum information and, with the aid of strain, both heavy hole and light hole-based spin qubits can be designed. Whereas a light-hole spin qubit was introduced recently (arXiv:1508.04259), here we present analytical and numerical results proving that a heavy-hole spin qubit can be reliably initialised, rotated and entangled by electrical means alone. This is due to strong Rashba-like spin-orbit interaction terms enabled by the interface inversion asymmetry. Single qubit rotations rely on electric-dipole spin resonance (EDSR), which is strongly enhanced by interface-induced spin-orbit terms. Entanglement can be accomplished by Coulomb exchange, coupling to a resonator, or spin-orbit induced dipole-dipole interactions. By analysing the qubit sensitivity to charge noise, we demonstrate that interface-induced spin-orbit terms are responsible for sweet spots in the dephasing time [Formula: see text] as a function of the top gate electric field, which are close to maxima in the EDSR strength, where the EDSR gate has high fidelity. We show that both qubits can be described using the same starting Hamiltonian, and by comparing their properties we show that the complex interplay of bulk and interface-induced spin-orbit terms allows a high degree of electrical control and makes acceptors potential candidates for scalable quantum computation in Si.

  5. A facile method for the construction of oligonucleotide microarrays.

    PubMed

    Sethi, Dalip; Kumar, A; Gupta, K C; Kumar, P

    2008-11-19

    In recent years, the oligonucleotide-based microarray technique has emerged as a powerful and promising tool for various molecular biological studies. Here, a facile protocol for the construction of an oligonucleotide microarray is demonstrated that involves immobilization of oligonucleotide-trimethoxysilyl conjugates onto virgin glass microslides. The projected immobilization strategy reflects high immobilization efficiency ( approximately 36-40%) and signal-to-noise ratio ( approximately 98), and hybridization efficiency ( approximately 32-35%). Using the proposed protocol, aminoalkyl, mercaptoalkyl, and phosphorylated oligonucleotides were immobilized onto virgin glass microslides. Briefly, modified oligonucleotides were reacted first with 3-glycidyloxypropyltriethoxysilane (GOPTS), and subsequently, the resultant conjugates were directly immobilized onto the virgin glass surface by making use of silanization chemistry. The constructed microarrays were then used for discrimination of base mismatches. On subjecting to different pH and thermal conditions, the microarray showed sufficient stability. Application of this chemistry to manufacture oligonucleotide probe-based microarrays for detection of bacterial meningitis is demonstrated. Single-step reaction for the formation of conjugates with the commercially available reagent (GOPTS), omission of capping step and surface modification, and efficient immobilization of oligonucleotides onto the virgin glass surface are the key features of the proposed strategy.

  6. Nucleic acid sequence detection using multiplexed oligonucleotide PCR

    DOEpatents

    Nolan, John P.; White, P. Scott

    2006-12-26

    Methods for rapidly detecting single or multiple sequence alleles in a sample nucleic acid are described. Provided are all of the oligonucleotide pairs capable of annealing specifically to a target allele and discriminating among possible sequences thereof, and ligating to each other to form an oligonucleotide complex when a particular sequence feature is present (or, alternatively, absent) in the sample nucleic acid. The design of each oligonucleotide pair permits the subsequent high-level PCR amplification of a specific amplicon when the oligonucleotide complex is formed, but not when the oligonucleotide complex is not formed. The presence or absence of the specific amplicon is used to detect the allele. Detection of the specific amplicon may be achieved using a variety of methods well known in the art, including without limitation, oligonucleotide capture onto DNA chips or microarrays, oligonucleotide capture onto beads or microspheres, electrophoresis, and mass spectrometry. Various labels and address-capture tags may be employed in the amplicon detection step of multiplexed assays, as further described herein.

  7. Design and analysis of mismatch probes for long oligonucleotide microarrays

    SciTech Connect

    Deng, Ye; He, Zhili; Van Nostrand, Joy D.; Zhou, Jizhong

    2008-08-15

    Nonspecific hybridization is currently a major concern with microarray technology. One of most effective approaches to estimating nonspecific hybridizations in oligonucleotide microarrays is the utilization of mismatch probes; however, this approach has not been used for longer oligonucleotide probes. Here, an oligonucleotide microarray was constructed to evaluate and optimize parameters for 50-mer mismatch probe design. A perfect match (PM) and 28 mismatch (MM) probes were designed for each of ten target genes selected from three microorganisms. The microarrays were hybridized with synthesized complementary oligonucleotide targets at different temperatures (e.g., 42, 45 and 50 C). In general, the probes with evenly distributed mismatches were more distinguishable than those with randomly distributed mismatches. MM probes with 3, 4 and 5 mismatched nucleotides were differentiated for 50-mer oligonucleotide probes hybridized at 50, 45 and 42 C, respectively. Based on the experimental data generated from this study, a modified positional dependent nearest neighbor (MPDNN) model was constructed to adjust the thermodynamic parameters of matched and mismatched dimer nucleotides in the microarray environment. The MM probes with four flexible positional mismatches were designed using the newly established MPDNN model and the experimental results demonstrated that the redesigned MM probes could yield more consistent hybridizations. Conclusions: This study provides guidance on the design of MM probes for long oligonucleotides (e.g., 50 mers). The novel MPDNN model has improved the consistency for long MM probes, and this modeling method can potentially be used for the prediction of oligonucleotide microarray hybridizations.

  8. New acceptor-donor-acceptor (A-D-A) type copolymers for efficient organic photovoltaic devices

    NASA Astrophysics Data System (ADS)

    Ghomrasni, S.; Ayachi, S.; Alimi, K.

    2015-01-01

    Three new conjugated systems alternating acceptor-donor-acceptor (A-D-A) type copolymers have been investigated by means of Density Functional Theory (DFT) and Time-Dependent DFT (TD-DFT) at the 6-31g (d) level of theory. 4,4‧-Dimethoxy-chalcone, also called the 1,3-bis(4-methoxyphenyl)prop-2-en-1-one (BMP), has been used as a common acceptor moiety. It forced intra-molecular S⋯O interactions through alternating oligo-thiophene derivatives: 4-AlkylThiophenes (4-ATP), 4-AlkylBithiophenes (4-ABTP) and 4-Thienylene Vinylene (4-TEV) as donor moieties. The band gap, HOMO and LUMO electron distributions as well as optical properties were analyzed for each molecule. The fully optimized resulting copolymers showed low band gaps (2.2-2.8 eV) and deep HOMO energy levels ranging from -4.66 to -4.86 eV. A broad absorption [300-900 nm] covering the solar spectrum and absorption maxima ranges from 486 to 604 nm. In addition, organic photovoltaic cells (OPCs) based on alternating copolymers in bulk heterojunction (BHJ) composites with the 1-(3-methoxycarbonyl) propyl-1-phenyl-[6,6]-C61 (PCBM), as an acceptor, have been optimized. Thus, the band gap decreased to 1.62 eV, the power conversion efficiencies (PCEs) were about 3-5% and the open circuit voltage Voc of the resulting molecules decreased from 1.50 to 1.27 eV.

  9. Efficient organic dye-sensitized solar cells: molecular engineering of donor-acceptor-acceptor cationic dyes.

    PubMed

    Cheng, Ming; Yang, Xichuan; Zhao, Jianghua; Chen, Cheng; Tan, Qin; Zhang, Fuguo; Sun, Licheng

    2013-12-01

    Three metal-free donor-acceptor-acceptor sensitizers with ionized pyridine and a reference dye were synthesized, and a detailed investigation of the relationship between the dye structure and the photophysical and photoelectrochemical properties and the performance of dye-sensitized solar cells (DSSCs) is described. The ionization of pyridine results in a red shift of the absorption spectrum in comparison to that of the reference dye. This is mainly attributable to the ionization of pyridine increasing the electron-withdrawing ability of the total acceptor part. Incorporation of the strong electron-withdrawing units of pyridinium and cyano acrylic acid gives rise to optimized energy levels, resulting in a large response range of wavelengths. When attached to TiO2 film, the conduction band of TiO2 is negatively shifted to a different extent depending on the dye. This is attributed to the electron recombination rate between the TiO2 film and the electrolyte being efficiently suppressed by the introduction of long alkyl chains and thiophene units. DSSCs assembled using these dyes show efficiencies as high as 8.8 %.

  10. Method for the preparation of size marker for synthetic oligonucleotides

    SciTech Connect

    Jing, G.Z.; Liu, A.; Leung, W.C.

    1986-01-01

    Terminal deoxynucleotidyltransferase was used for the addition of (..cap alpha..-/sup 32/P)dCTP to the 3'-OH termini of oligo(dT)/sub 12-18/. A collection of oligonucleotides with chain lengths ranging continuously from 13-mer to over 100-mer was generated. The reaction mixture was then mixed with oligo(dT)/sub 12-18/ labeled with (..gamma..-/sup 32/P)ATP by T/sub 4/ polynucleotide kinase. A sequence ladder with the bottom base as 12-mer was then formed. These oligonucleotides served as size marker for the purification and identification of oligonucleotides on polyacrylamide gel.

  11. Retro-1 Analogues Differentially Affect Oligonucleotide Delivery and Toxin Trafficking.

    PubMed

    Yang, Bing; Ming, Xin; Abdelkafi, Hajer; Pons, Valerie; Michau, Aurelien; Gillet, Daniel; Cintrat, Jean-Christophe; Barbier, Julien; Juliano, Rudy

    2016-11-21

    Retro-1 is a small molecule that displays two important biological activities: First, it blocks the actions of certain toxins by altering their intracellular trafficking. Second, it enhances the activity of oligonucleotides by releasing them from entrapment in endosomes. This raises the question of whether the two actions involve the same cellular target. Herein we report the effects of several Retro-1 analogues on both toxins and oligonucleotides. We found analogues that affect toxins but not oligonucleotides and vice-versa, while Retro-1 is the only compound that affects both. This indicates that the molecular target(s) involved in the two processes are distinct.

  12. Therapeutic oligonucleotides and delivery technologies: Research topics in Japan.

    PubMed

    Murakami, Masahiro

    2016-01-01

    Oligonucleotides have been gaining considerable attention as promising and effective candidate therapeutics against various diseases. This special issue is aimed at providing a better understanding of the recent progress in the development of oligonucleotide-based therapeutics to encourage further research and innovation in this field to achieve these advancements. Several Japanese scientists have been invited to contribute to this issue by describing their recent findings, overviews, insights, or commentaries on rational designing of therapeutic oligonucleotide molecules and their novel delivery technologies, especially nanocarrier systems.

  13. π-Extended rigid triptycene-trisaroylenimidazoles as electron acceptors.

    PubMed

    Menke, Elisabeth H; Lami, Vincent; Vaynzof, Yana; Mastalerz, Michael

    2016-01-18

    Two soluble isomeric acceptor molecules based on a triptycene core, which is connected to three aroylenimidazole units are described. Due to the inherent threefold axis, the molecules are soluble and thus could be fully photophysically characterized in solution and film. Additionally, the preliminary results of these acceptors in organic photovoltaic devices with two different donor materials are reported.

  14. The role of deep acceptor centers in the oxidation of acceptor-doped wide-band-gap perovskites ABO3

    NASA Astrophysics Data System (ADS)

    Putilov, L. P.; Tsidilkovski, V. I.

    2017-03-01

    The impact of deep acceptor centers on defect thermodynamics and oxidation of wide-band-gap acceptor-doped perovskites without mixed-valence cations is studied. These deep centers are formed by the acceptor-bound small hole polarons whose stabilization energy can be high enough (significantly higher than the hole-acceptor Coulomb interaction energy). It is shown that the oxidation enthalpy ΔHox of oxide is determined by the energy εA of acceptor-bound states along with the formation energy EV of oxygen vacancies. The oxidation reaction is demonstrated to be either endothermic or exothermic, and the regions of εA and EV values corresponding to the positive or negative ΔHox are determined. The contribution of acceptor-bound holes to the defect thermodynamics strongly depends on the acceptor states depth εA: it becomes negligible at εA less than a certain value (at which the acceptor levels are still deep). With increasing εA, the concentration of acceptor-bound small hole polarons can reach the values comparable to the dopant content. The results are illustrated with the acceptor-doped BaZrO3 as an example. It is shown that the experimental data on the bulk hole conductivity of barium zirconate can be described both in the band transport model and in the model of hopping small polarons localized on oxygen ions away from the acceptor centers. Depending on the εA magnitude, the oxidation reaction can be either endothermic or exothermic for both mobility mechanisms.

  15. Acceptor impurity activation in III-nitride light emitting diodes

    SciTech Connect

    Römer, Friedhard Witzigmann, Bernd

    2015-01-12

    In this work, the role of the acceptor doping and the acceptor activation and its impact on the internal quantum efficiency (IQE) of a Gallium Nitride (GaN) based multi-quantum well light emitting diode is studied by microscopic simulation. Acceptor impurities in GaN are subject to a high activation energy which depends on the presence of proximate dopant atoms and the electric field. A combined model for the dopant ionization and activation barrier reduction has been developed and implemented in a semiconductor carrier transport simulator. By model calculations, we demonstrate the impact of the acceptor activation mechanisms on the decay of the IQE at high current densities, which is known as the efficiency droop. A major contributor to the droop is the electron leakage which is largely affected by the acceptor doping.

  16. Oligonucleotide-Functionalized Anisotropic Gold Nanoparticles

    NASA Astrophysics Data System (ADS)

    Jones, Matthew Robert

    In this thesis, we describe the properties of oligonucleotide-functionalized gold colloids under the unique set of conditions where the particles are geometrically anisotropic and have nanometer-scale dimensions. While nearly two decades of previous work elucidated numerous unexpected and emergent phenomena arising from the combination of inorganic nanoparticles with surface-bound DNA strands, virtually nothing was known about how these properties are altered when the shape of the nanoparticle core is chosen to be non-spherical. In particular, we are interested in understanding, and ultimately controlling, the ways in which these DNA-conjugated anisotropic nanostructures interact when their attraction is governed by programmable DNA hybridization events. Chapter 1 introduces the field of DNA-based materials assembly by discussing how nanoscale building blocks which present rigid, directional interactions can be thought of as possessing artificial versions of the familiar chemical principles of "bonds" and "valency". In chapter 2 we explore the fundamental interparticle binding thermodynamics of DNA-functionalized spherical and anisotropic nanoparticles, which reveals enormous preferences for collective ligand interactions occurring between flat surfaces over those that occur between curved surfaces. Using these insights, chapter 3 demonstrates that when syntheses produce mixtures of different nanoparticle shapes, the tailorable nature of DNA-mediated interparticle association can be used to selectively crystallize and purify the desired anisotropic nanostructure products, leaving spherical impurity particles behind. Chapter 4 leverages the principle that the flat facets of anisotropic particles generate directional DNA-based hybridization interactions to assemble a variety of tailorable nanoparticle superlattices whose symmetry and dimensionality are a direct consequence of the shape of the nanoparticle building block used in their construction. Chapter 5 explores

  17. Some biochemical properties of an acyclic oligonucleotide analogue. A plausible ancestor of the DNA?

    NASA Astrophysics Data System (ADS)

    Merle, Liliane; Spach, Gérard; Merle, Yves; Sági, János; Szemzö, Attila

    1993-04-01

    As acyclic oligonucleotides have been suggested as a primitive model of DNA or RNA in prebiotic times, we compared some biochemical properties of these analogues to that of natural ones. Firstly, an acyclic analogue of deoxyribonucleoside triphosphates was tested as a potential substrate of enzymes intervening in nucleic acids synthesis. GlyTTP, a dTTP analogue with a missing 2'-methylene group is notaccepted as a substrate by either DNA polymerase or deoxynucleotidyl terminal transferase (TdT). Secondly, themodified dodecathymidylate (GlyT)12, the racemic acyclic sugar analogue of (dT)12, proved to be anefficient primer for DNA polymerase and TdT, though the associative properties of (GlyT)12 are very weak as shown by UV spectroscopy in phosphate buffer without magnesium chloride. But (GlyT)12 has the advantage to be 500-times more stable against hydrolysis by snake venom phosphodiesterase than the corresponding oligothymidylate.

  18. Sequence-dependent theory of oligonucleotide hybridization kinetics

    SciTech Connect

    Marimuthu, Karthikeyan; Chakrabarti, Raj E-mail: rajc@andrew.cmu.edu

    2014-05-07

    A theoretical approach to the prediction of the sequence and temperature-dependent rate constants for oligonucleotide hybridization reactions has been developed based on the theory of relaxation kinetics. One-sided and two-sided melting reaction mechanisms for oligonucleotide hybridization reactions have been considered, analyzed, modified, and compared to select a physically consistent as well as robust model for prediction of the relaxation times of DNA hybridization reactions that agrees with the experimental evidence. The temperature- and sequence-dependent parameters of the proposed model have been estimated using available experimental data. The relaxation time model that we developed has been combined with the nearest neighbor model of hybridization thermodynamics to estimate the temperature- and sequence-dependent rate constants of an oligonucleotide hybridization reaction. The model-predicted rate constants are compared to experimentally determined rate constants for the same oligonucleotide hybridization reactions. Finally, we consider a few important applications of kinetically controlled DNA hybridization reactions.

  19. Micro- and nano-structure based oligonucleotide sensors.

    PubMed

    Ferrier, David C; Shaver, Michael P; Hands, Philip J W

    2015-06-15

    This paper presents a review of micro- and nano-structure based oligonucleotide detection and quantification techniques. The characteristics of such devices make them very attractive for Point-of-Care or On-Site-Testing biosensing applications. Their small scale means that they can be robust and portable, their compatibility with modern CMOS electronics means that they can easily be incorporated into hand-held devices and their suitability for mass production means that, out of the different approaches to oligonucleotide detection, they are the most suitable for commercialisation. This review discusses the advantages of micro- and nano-structure based sensors and covers the various oligonucleotide detection techniques that have been developed to date. These include: Bulk Acoustic Wave and Surface Acoustic Wave devices, micro- and nano-cantilever sensors, gene Field Effect Transistors, and nanowire and nanopore based sensors. Oligonucleotide immobilisation techniques are also discussed.

  20. Tritium labeling of antisense oligonucleotides by exchange with tritiated water.

    PubMed Central

    Graham, M J; Freier, S M; Crooke, R M; Ecker, D J; Maslova, R N; Lesnik, E A

    1993-01-01

    We describe a simple, efficient, procedure for labeling oligonucleotides to high specific activity (< 1 x 10(8) cpm/mumol) by hydrogen exchange with tritiated water at the C8 positions of purines in the presence of beta-mercaptoethanol, an effective radical scavenger. Approximately 90% of the starting material is recovered as intact, labeled oligonucleotide. The radiolabeled compounds are stable in biological systems; greater than 90% of the specific activity is retained after 72 hr incubation at 37 degrees C in serum-containing media. Data obtained from in vitro cellular uptake experiments using oligonucleotides labeled by this method are similar to those obtained using 35S or 14C-labeled compounds. Because this protocol is solely dependent upon the existence of purine residues, it should be useful for radiolabeling modified as well as unmodified phosphodiester oligonucleotides. Images PMID:8367289

  1. PRACTICAL STRATEGIES FOR PROCESSING AND ANALYZING SPOTTED OLIGONUCLEOTIDE MICROARRAY DATA

    EPA Science Inventory

    Thoughtful data analysis is as important as experimental design, biological sample quality, and appropriate experimental procedures for making microarrays a useful supplement to traditional toxicology. In the present study, spotted oligonucleotide microarrays were used to profile...

  2. Methods to Characterize the Oligonucleotide Functionalization of Quantum Dots.

    PubMed

    Weichelt, Richard; Leubner, Susanne; Henning-Knechtel, Anja; Mertig, Michael; Gaponik, Nikolai; Schmidt, Thorsten-Lars; Eychmüller, Alexander

    2016-09-01

    Currently, DNA nanotechnology offers the most programmable, scalable, and accurate route for the self-assembly of matter with nanometer precision into 1, 2, or 3D structures. One example is DNA origami that is well suited to serve as a molecularly defined "breadboard", and thus, to organize various nanomaterials such as nanoparticles into hybrid systems. Since the controlled assembly of quantum dots (QDs) is of high interest in the field of photonics and other optoelectronic applications, a more detailed view on the functionalization of QDs with oligonucleotides shall be achieved. In this work, four different methods are presented to characterize the functionalization of thiol-capped cadmium telluride QDs with oligonucleotides and for the precise quantification of the number of oligonucleotides bound to the QD surface. This study enables applications requiring the self-assembly of semiconductor-oligonucleotide hybrid materials and proves the conjugation success in a simple and straightforward manner.

  3. Acceptor and Excitation Density Dependence of the Ultrafast Polaron Absorption Signal in Donor-Acceptor Organic Solar Cell Blends.

    PubMed

    Zarrabi, Nasim; Burn, Paul L; Meredith, Paul; Shaw, Paul E

    2016-07-21

    Transient absorption spectroscopy on organic semiconductor blends for solar cells typically shows efficient charge generation within ∼100 fs, accounting for the majority of the charge carriers. In this Letter, we show using transient absorption spectroscopy on blends containing a broad range of acceptor content (0.01-50% by weight) that the rise of the polaron signal is dependent on the acceptor concentration. For low acceptor content (<10% by weight), the polaron signal rises gradually over ∼1 ps with most polarons generated after 200 fs, while for higher acceptor concentrations (>10%) most polarons are generated within 200 fs. The rise time in blends with low acceptor content was also found to be sensitive to the pump fluence, decreasing with increasing excitation density. These results indicate that the sub-100 fs rise of the polaron signal is a natural consequence of both the high acceptor concentrations in many donor-acceptor blends and the high excitation densities needed for transient absorption spectroscopy, which results in a short average distance between the exciton and the donor-acceptor interface.

  4. SERS beacons for multiplexed oligonucleotide detection

    NASA Astrophysics Data System (ADS)

    Sun, Jian; Cullum, Brian M.

    2007-09-01

    Gold-based surface-enhanced Raman scattering (SERS) beacons have been developed, which represent a simple, biocompatible and rapid means of performing multiplexed DNA sequence detection in a non-arrayed format. These SERS beacons consist of a simple stem-loop oligonucleotide probe in its native form with one end attached to a SERS active dye molecule and the other to a gold nanoparticle, approximately 50 nm in diameter. The probe sequence is designed to achieve a stem-loop structure, with the loop portion complementary to the target sequence, similar to fluorescent molecular beacons. In the absence of the target DNA sequence, the SERS signal of the associated dye molecule is detected, representing the "ON" state of the probe. When the target sequence is hybridized to the probe, which results in an open conformation, its respective reporter dye is separated from the gold nanoparticle, producing diminished SERS signal. In this paper, the fabrication and characterization of these SERS beacons is described. We also demonstrate selective hybridization of a target sequence to one beacon in a mixture, revealing their potential for use in a multiplexed fashion.

  5. Photophysical deactivation pathways in adenine oligonucleotides.

    PubMed

    Spata, Vincent A; Matsika, Spiridoula

    2015-12-14

    In this work we study deactivation processes in adenine oligomers after absorption of UV radiation using Quantum Mechanics combined with Molecular Mechanics (QM/MM). Correlated electronic structure methods appropriate for describing the excited states are used to describe a π-stacked dimer of adenine bases incorporated into (dA)20(dT)20. The results of these calculations reveal three different types of excited state minima which play a role in deactivation processes. Within this set of minima there are minima where the excited state is localized on one adenine (monomer-like) as well as minima where the excited state is delocalized on two adenines, forming different types of excimers and bonded excimers of varying but inter-related character. The proximity of their energies reveals that the minima can decay into one another along a flat potential energy surface dependent on the interbase separation. Additionally, analysis of the emissive energies and other physical properties, including theoretical anisotropy calculations, and comparison with fluorescence experiments, provides evidence that excimers play an important role in long-lived signals in adenine oligonucleotides while the subpicosecond decay is attributed to monomer-like minima. The necessity for a close approach of the nucleobases reveals that the deactivation mechanism is tied to macro-molecular motion.

  6. Antisense oligonucleotide therapeutics for human leukemia.

    PubMed

    Gewirtz, A M

    1998-01-01

    The development of reliable gene disruption strategies, and their application in living cells, has proven to be an extraordinary important advance for cell and molecular biologists. Using the various available approaches, the specific functions of any given gene may now be investigated directly in the relevant cell type. Application of similar experimental tools in a clinical setting might prove to be equally valuable and could well form the basis of a monumental advance in the practice of clinical medicine. This seems particularly true at the present time because much progress has been made in understanding the molecular pathogenesis of many diseases, including cancer. For these reasons a tremendous amount of interest has been generated in the use of oligodeoxynucleotides to modify gene expression. However, in spite of some notable successes which are detailed in this review, oligonucleotides have generated controversy in regard to their mechanism of action, reliability, and ultimate therapeutic utility. Nevertheless, the potential power of the "antisense" approach remains undisputed, and its ultimate therapeutic utility is far reaching. Accordingly, the problems associated with the use of these compounds are clearly worth solving. It remains the hope of many laboratories that the day will soon come when these techniques will make an important contribution to the management of chronic myelogenous leukemia and other neoplastic disorders.

  7. Antisense oligonucleotide therapeutics for human leukemia.

    PubMed

    Gewirtz, A M

    1997-01-01

    The development of reliable gene disruption strategies, and their application in living cells, has proven to be an extraordinarily important advance for cell and molecular biologists. Using the various available approaches, the specific functions of any given gene may now be investigated directly in the relevant cell type. Application of similar experimental tools in a clinical setting might prove to be equally valuable and could well form the basis of a monumental advance in the practice of clinical medicine. This seems particularly true at the present time since much progress has been made in understanding the molecular pathogenesis of many diseases, including cancer. For these reasons a tremendous amount of interest has been generated in the use of oligodeoxynucleotides to modify gene expression. However, in spite of some notable successes which are detailed in this review, oligonucleotides have generated controversy in regards to their mechanism of action, reliability, and ultimate therapeutic utility. Nevertheless, the potential power of the "antisense" approach remains undisputed, and its ultimate therapeutic utility is far reaching. Accordingly, the problems associated with the use of these compounds are clearly worth solving. It remains the hope of many laboratories that the day will soon come when these techniques will make an important contribution to the management of CML and other neoplastic disorders.

  8. Antisense Oligonucleotide Therapy for Inherited Retinal Dystrophies.

    PubMed

    Gerard, Xavier; Garanto, Alejandro; Rozet, Jean-Michel; Collin, Rob W J

    2016-01-01

    Inherited retinal dystrophies (IRDs) are an extremely heterogeneous group of genetic diseases for which currently no effective treatment strategies exist. Over the last decade, significant progress has been made utilizing gene augmentation therapy for a few genetic subtypes of IRD, although several technical challenges so far prevent a broad clinical application of this approach for other forms of IRD. Many of the mutations leading to these retinal diseases affect pre-mRNA splicing of the mutated genes . Antisense oligonucleotide (AON)-mediated splice modulation appears to be a powerful approach to correct the consequences of such mutations at the pre-mRNA level , as demonstrated by promising results in clinical trials for several inherited disorders like Duchenne muscular dystrophy, hypercholesterolemia and various types of cancer. In this mini-review, we summarize ongoing pre-clinical research on AON-based therapy for a few genetic subtypes of IRD , speculate on other potential therapeutic targets, and discuss the opportunities and challenges that lie ahead to translate splice modulation therapy for retinal disorders to the clinic.

  9. Oligonucleotide conjugates - Candidates for gene silencing therapeutics.

    PubMed

    Gooding, Matt; Malhotra, Meenakshi; Evans, James C; Darcy, Raphael; O'Driscoll, Caitriona M

    2016-10-01

    The potential therapeutic and diagnostic applications of oligonucleotides (ONs) have attracted great attention in recent years. The capability of ONs to selectively inhibit target genes through antisense and RNA interference mechanisms, without causing un-intended sideeffects has led them to be investigated for various biomedical applications, especially for the treatment of viral diseases and cancer. In recent years, many researchers have focused on enhancing the stability and target specificity of ONs by encapsulating/complexing them with polymers or lipid chains to formulate nanoparticles/nanocomplexes/micelles. Also, chemical modification of nucleic acids has emerged as an alternative to impart stability to ONs against nucleases and other degrading enzymes and proteins found in blood. In addition to chemically modifying the nucleic acids directly, another strategy that has emerged, involves conjugating polymers/peptide/aptamers/antibodies/proteins, preferably to the sense strand (3'end) of siRNAs. Conjugation to the siRNA not only enhances the stability and targeting specificity of the siRNA, but also allows for the development of self-administering siRNA formulations, with a much smaller size than what is usually observed for nanoparticle (∼200nm). This review concentrates mainly on approaches and studies involving ON-conjugates for biomedical applications.

  10. Diagnostic Oligonucleotide Microarray Fingerprinting of Bacillus Isolates

    SciTech Connect

    Chandler, Darrell P.; Alferov, Oleg; Chernov, Boris; Daly, Don S.; Golova, Julia; Perov, Alexander N.; Protic, Miroslava; Robison, Richard; Shipma, Matthew; White, Amanda M.; Willse, Alan R.

    2006-01-01

    A diagnostic, genome-independent microbial fingerprinting method using DNA oligonucleotide microarrays was used for high-resolution differentiation between closely related Bacillus strains, including two strains of Bacillus anthracis that are monomorphic (indistinguishable) via amplified fragment length polymorphism fingerprinting techniques. Replicated hybridizations on 391-probe nonamer arrays were used to construct a prototype fingerprint library for quantitative comparisons. Descriptive analysis of the fingerprints, including phylogenetic reconstruction, is consistent with previous taxonomic organization of the genus. Newly developed statistical analysis methods were used to quantitatively compare and objectively confirm apparent differences in microarray fingerprints with the statistical rigor required for microbial forensics and clinical diagnostics. These data suggest that a relatively simple fingerprinting microarray and statistical analysis method can differentiate between species in the Bacillus cereus complex, and between strains of B. anthracis. A synthetic DNA standard was used to understand underlying microarray and process-level variability, leading to specific recommendations for the development of a standard operating procedure and/or continued technology enhancements for microbial forensics and diagnostics.

  11. Syntheses of oligonucleotide derivatives with P(V) porphyrin and their properties.

    PubMed

    Shimidzu, T; Segawa, H; Kitamura, M; Nimura, A

    1992-01-01

    Two types of oligonucleotide derivatives which are substituted by P(V) porphyrin at the phosphorus atom of an internucleotidic linkage and at the 5'-terminal internucleotidic linkage via a spacer were synthesized (Fig. 1), and hybridization capabilities of them with complementary oligonucleotides were evaluated. A novel method for a sensing of oligonucleotide by the fluorescence quenching via photo-induced electron transfer between the P(V) porphyrin labeled oligonucleotide and pyrene-labeled one on the oligonucleotide template is reported.

  12. A paper-based resonance energy transfer nucleic acid hybridization assay using upconversion nanoparticles as donors and quantum dots as acceptors.

    PubMed

    Doughan, Samer; Uddayasankar, Uvaraj; Krull, Ulrich J

    2015-06-09

    Monodisperse aqueous upconverting nanoparticles (UCNPs) were covalently immobilized on aldehyde modified cellulose paper via reduction amination to develop a luminescence resonance energy transfer (LRET)-based nucleic acid hybridization assay. This first account of covalent immobilization of UCNPs on paper for a bioassay reports an optically responsive method that is sensitive, reproducible and robust. The immobilized UCNPs were decorated with oligonucleotide probes to capture HPRT1 housekeeping gene fragments, which in turn brought reporter conjugated quantum dots (QDs) in close proximity to the UCNPs for LRET. This sandwich assay could detect unlabeled oligonucleotide target, and had a limit of detection of 13 fmol and a dynamic range spanning nearly 3 orders of magnitude. The use of QDs, which are excellent LRET acceptors, demonstrated improved sensitivity, limit of detection, dynamic range and selectivity compared to similar assays that have used molecular fluorophores as acceptors. The selectivity of the assay was attributed to the decoration of the QDs with polyethylene glycol to eliminate non-specific adsorption. The kinetics of hybridization were determined to be diffusion limited and full signal development occurred within 3 min.

  13. Donor–Acceptor Oligorotaxanes Made to Order

    SciTech Connect

    Basu, Subhadeep; Coskun, Ali; Friedman, Douglas C.; Olson, Mark A.; Benitez, Diego; Tkatchouk, Ekaterina; Barin, Gokhan; Yang, Jeffrey; Fahrenbach, Albert C.; Goddard, William A.; Stoddart, J. Fraser

    2011-01-01

    Five donor–acceptor oligorotaxanes made up of dumbbells composed of tetraethylene glycol chains, interspersed with three and five 1,5-dioxynaphthalene units, and terminated by 2,6-diisopropylphenoxy stoppers, have been prepared by the threading of discrete numbers of cyclobis(paraquat-p-phenylene) rings, followed by a kinetically controlled stoppering protocol that relies on click chemistry. The well-known copper(I)-catalyzed alkyne–azide cycloaddition between azide functions placed at the ends of the polyether chains and alkyne-bearing stopper precursors was employed during the final kinetically controlled template-directed synthesis of the five oligorotaxanes, which were characterized subsequently by ¹H NMR spectroscopy at low temperature (233 K) in deuterated acetonitrile. The secondary structures, as well as the conformations, of the five oligorotaxanes were unraveled by spectroscopic comparison with the dumbbell and ring components. By focusing attention on the changes in chemical shifts of some key probe protons, obtained from a wide range of low-temperature spectra, a picture emerges of a high degree of folding within the thread protons of the dumbbells of four of the five oligorotaxanes—the fifth oligorotaxane represents a control compound in effect—brought about by a combination of C[BOND]H···O and π–π stacking interactions between the π-electron-deficient bipyridinium units in the rings and the π-electron-rich 1,5-dioxynaphthalene units and polyether chains in the dumbbells. The secondary structures of a foldamer-like nature have received further support from a solid-state superstructure of a related [3]pseudorotaxane and density functional calculations performed thereon.

  14. Intramolecular charge transfer in donor-acceptor molecules

    SciTech Connect

    Slama-Schwok, A.; Blanchard-Desce, M.; Lehn, J.M. )

    1990-05-17

    The photophysical properties of donor-acceptor molecules, push-pull polyenes and carotenoids, have been studied by absorption and fluorescence spectroscopy. The compounds bear various acceptor and donor groups, linked together by chains of different length and structure. The position of the absorption and fluorescence maxima and their variation in solvents of increasing polarity are in agreement with long-distance intramolecular charge-transfer processes, the linker acting as a molecular wire. The effects of the linker length and structure and of the nature of acceptor and donor are presented.

  15. Alteration of cartilage glycosaminoglycan protein acceptor by somatomedin and cortisol.

    PubMed

    Kilgore, B S; McNatt, M L; Meador, S; Lee, J A; Hughes, E R; Elders, M J

    1979-02-01

    The effect of somatomedin and cortisol on embryonic chick cartilage in vitro indicates that somatomedin stimulates 35SO4 uptake while cortisol decreases it with no effect on glycosaminoglycan turnover. Xylosyltransferase activity is increased in crude fractions of somatomedin-treated cartilage but decreased in cortisol-treated cartilage. By using a Smith-degraded proteoglycan as an exogenous acceptor, xylosyltransferase activities from both treatments were equivalent, suggesting that the enzyme was not rate limiting. The results of xylosyltransferase assays conducted by mixing enzyme and endogenous acceptor from control, cortisol-treated and somatomedin-treated cartilage, suggest both effects to be at the level of the acceptor protein.

  16. Efficient organic solar cells with helical perylene diimide electron acceptors.

    PubMed

    Zhong, Yu; Trinh, M Tuan; Chen, Rongsheng; Wang, Wei; Khlyabich, Petr P; Kumar, Bharat; Xu, Qizhi; Nam, Chang-Yong; Sfeir, Matthew Y; Black, Charles; Steigerwald, Michael L; Loo, Yueh-Lin; Xiao, Shengxiong; Ng, Fay; Zhu, X-Y; Nuckolls, Colin

    2014-10-29

    We report an efficiency of 6.1% for a solution-processed non-fullerene solar cell using a helical perylene diimide (PDI) dimer as the electron acceptor. Femtosecond transient absorption spectroscopy revealed both electron and hole transfer processes at the donor-acceptor interfaces, indicating that charge carriers are created from photogenerated excitons in both the electron donor and acceptor phases. Light-intensity-dependent current-voltage measurements suggested different recombination rates under short-circuit and open-circuit conditions.

  17. Three holes bound to a double acceptor - Be(+) in germanium

    NASA Technical Reports Server (NTRS)

    Haller, E. E.; Mcmurray, R. E., Jr.; Falicov, L. M.; Haegel, N. M.; Hansen, W. L.

    1983-01-01

    A double acceptor binding three holes has been observed for the first time with photoconductive far-infrared spectroscopy in beryllium-doped germanium single crystals. This new center, Be(+), has a hole binding energy of about 5 meV and is only present when free holes are generated by ionization of either neutral shallow acceptors or neutral Be double acceptors. The Be(+) center thermally ionizes above 4 K. It disappears at a uniaxial stress higher than about a billion dyn/sq cm parallel to (111) as a result of the lifting of the valence-band degeneracy.

  18. Nanogels for Oligonucleotide Delivery to the Brain

    PubMed Central

    Vinogradov, Serguei V.; Batrakova, Elena V.; Kabanov, Alexander V.

    2009-01-01

    Systemic delivery of oligonucleotides (ODN) to the central nervous system is needed for development of therapeutic and diagnostic modalities for treatment of neurodegenerative disorders. Macromolecules injected in blood are poorly transported across the blood–brain barrier (BBB) and rapidly cleared from circulation. In this work we propose a novel system for ODN delivery to the brain based on nanoscale network of cross-linked poly(ethylene glycol) and polyethylenimine (“nanogel”). The methods of synthesis of nanogel and its modification with specific targeting molecules are described. Nanogels can bind and encapsulate spontaneously negatively charged ODN, resulting in formation of stable aqueous dispersion of polyelectrolyte complex with particle sizes less than 100 nm. Using polarized monolayers of bovine brain microvessel endothelial cells as an in vitro model this study demonstrates that ODN incorporated in nanogel formulations can be effectively transported across the BBB. The transport efficacy is further increased when the surface of the nanogel is modified with transferrin or insulin. Importantly the ODN is transported across the brain microvessel cells through the transcellular pathway; after transport, ODN remains mostly incorporated in the nanogel and ODN displays little degradation compared to the free ODN. Using mouse model for biodistribution studies in vivo, this work demonstrated that as a result of incorporation into nanogel 1 h after intravenous injection the accumulation of a phosphorothioate ODN in the brain increases by over 15 fold while in liver and spleen decreases by 2-fold compared to the free ODN. Overall, this study suggests that nanogel is a promising system for delivery of ODN to the brain. PMID:14733583

  19. The detection of platelet derived growth factor using decoupling of quencher-oligonucleotide from aptamer/quantum dot bioconjugates

    NASA Astrophysics Data System (ADS)

    Kim, Gang-Il; Kim, Kyung-Woo; Oh, Min-Kyu; Sung, Yun-Mo

    2009-04-01

    High-sensitivity, high-specificity detection of platelet derived growth factor (PDGF)-BB was realized using the change in fluorescence resonance energy transfer (FRET) occurring between quantum dot (QD) donors and black hole quencher (BHQ) acceptors. CdSe/ZnS QD/mercaptoacetic acid (MAA)/PDGF aptamer bioconjugates were successfully synthesized using ligand exchange. Black hole quencher (BHQ)-bearing oligonucleotide molecules showing partial sequence matching to PDGF aptamer were attached to PDGF aptamers and photoluminescence (PL) quenching was obtained through FRET. By adding target PDGF-BB to the bioconjugates containing BHQs, PL recovery was detected due to detachment of BHQ-bearing oligonucleotide from the PDGF aptamer as a result of the difference in affinity to the PDGF aptamer. The detection limit of the sensor was ~0.4 nM and the linearity was maintained up to 1.6 nM in the PL intensity versus concentration curve. Measurement of PL recovery was suggested as a strong tool for high-sensitivity detection of PDGF-BB. Epidermal growth factor (EGF), the negative control molecule, did not contribute to PL recovery due to lack of binding affinity to the PDGF aptamers, which demonstrates the selectivity of the biosensor.

  20. Biominetic High Density Lipoproteins for the Delivery of Therapeutic Oligonucleotides

    NASA Astrophysics Data System (ADS)

    Tripathy, Sushant

    Advances in nanotechnology have brought about novel inorganic and hybrid nanoparticles with unique physico-chemical properties that make them suitable for a broad range of applications---from nano-circuitry to drug delivery. A significant part of those advancements have led to ground-breaking discoveries that have changed the approaches to formulation of therapeutics against diseases, such as cancer. Now-a-days the focus does not lie solely on finding a candidate small-molecule therapeutic with minimal adverse effects, but researchers are looking up to nanoparticles to improve biodistribution and biocompatibility profile of clinically proven therapeutics. The plethora of conjugation chemistries offered by currently extant inorganic nanoparticles have, in recent years, led to great leaps in the field of biomimicry---a modality that promises high biocompatibility. Further, in the pursuit of highly specific therapeutic molecules, researchers have turned to silencing oligonucleotides and some have already brought together the strengths of nanoparticles and silencing oligonucleotides in search of an efficacious therapy for cancer with minimal adverse effects. This dissertation work focuses on such a biomimetic platform---a gold nanoparticle based high density lipoprotein biomimetic (HDL NP), for the delivery of therapeutic oligonucleotides. The first chapter of this body of work introduces the molecular target of the silencing oligonucleotides---VEGFR2, and its role in the progression of solid tumor cancers. The background information also covers important aspects of natural high density lipoproteins (HDL), especially their innate capacity to bind and deliver exogenous and endogenous silencing oligonucleotides to tissues that express their high affinity receptor SRB1. We subsequently describe the synthesis of the biomimetic HDL NP and its oligonucleotide conjugates, and establish their biocompatibility. Further on, experimental data demonstrate the efficacy of silencing

  1. Nitrogen is a deep acceptor in ZnO

    SciTech Connect

    Tarun, M. C.; Iqbal, M. Zafar; McCluskey, M. D.

    2011-04-14

    Zinc oxide is a promising material for blue and UV solid-state lighting devices, among other applications. Nitrogen has been regarded as a potential p-type dopant for ZnO. However, recent calculations indicate that nitrogen is a deep acceptor. This paper presents experimental evidence that nitrogen is, in fact, a deep acceptor and therefore cannot produce p-type ZnO. A broad photoluminescence (PL) emission band near 1.7 eV, with an excitation onset of ~2.2 eV, was observed, in agreement with the deep-acceptor model of the nitrogen defect. Thus the deep-acceptor behavior can be explained by the low energy of the ZnO valence band relative to the vacuum level.

  2. Nitrogen is a deep acceptor in ZnO

    DOE PAGES

    Tarun, M. C.; Iqbal, M. Zafar; McCluskey, M. D.

    2011-04-14

    Zinc oxide is a promising material for blue and UV solid-state lighting devices, among other applications. Nitrogen has been regarded as a potential p-type dopant for ZnO. However, recent calculations indicate that nitrogen is a deep acceptor. This paper presents experimental evidence that nitrogen is, in fact, a deep acceptor and therefore cannot produce p-type ZnO. A broad photoluminescence (PL) emission band near 1.7 eV, with an excitation onset of ~2.2 eV, was observed, in agreement with the deep-acceptor model of the nitrogen defect. Thus the deep-acceptor behavior can be explained by the low energy of the ZnO valence bandmore » relative to the vacuum level.« less

  3. Atomic basis of the exquisite specificity of phosphate and sulfate transport receptors.

    PubMed

    Quiocho, F A

    1996-04-01

    We have determined, by the method of x-ray crystallography, the 1.7 A resolution three-dimensional structures of the ligand-bound form of the phosphate receptor as well as the sulfate receptor. These protein structures provide an unprecedented atomic-level understanding of the mechanism governing the exquisite specificity of each receptor. Although they lack amino acid sequence homology, both receptors have very similar three-dimensional structure. The structure consists of two globular domains separated by a deep cleft which contains the ligand-binding site. The bound phosphate and sulfate are totally devoid of water of hydration. The bound phosphate is tightly held in place by 12 hydrogen bonds, 11 with donor and 1 with acceptor groups. The acceptor group (an Asp carboxylate side chain) plays three key roles. It confers specificity by directly recognizing one proton of either the monobasic or dibasic phosphate. It also assists in the recognition of another proton of the monobasic phosphate. Finally, because of charge repulsion, it disallows binding of fully ionized sulfate. The sulfate bound to the sulfate receptor makes seven hydrogen bonds with uncharged polar groups exclusively. The absence of an acceptor group in the binding site of the sulfate receptor is not conducive to phosphate binding.

  4. Microbial solubilization of phosphate

    DOEpatents

    Rogers, Robert D.; Wolfram, James H.

    1993-01-01

    A process is provided for solubilizing phosphate from phosphate containing ore by treatment with microorganisms which comprises forming an aqueous mixture of phosphate ore, microorganisms operable for solubilizing phosphate from the phosphate ore and maintaining the aqueous mixture for a period of time and under conditions operable to effect the microbial solubilization process. An aqueous solution containing soluble phosphorous can be separated from the reacted mixture by precipitation, solvent extraction, selective membrane, exchange resin or gravity methods to recover phosphate from the aqueous solution.

  5. Microbial solubilization of phosphate

    DOEpatents

    Rogers, R.D.; Wolfram, J.H.

    1993-10-26

    A process is provided for solubilizing phosphate from phosphate containing ore by treatment with microorganisms which comprises forming an aqueous mixture of phosphate ore, microorganisms operable for solubilizing phosphate from the phosphate ore and maintaining the aqueous mixture for a period of time and under conditions operable to effect the microbial solubilization process. An aqueous solution containing soluble phosphorus can be separated from the reacted mixture by precipitation, solvent extraction, selective membrane, exchange resin or gravity methods to recover phosphate from the aqueous solution. 6 figures.

  6. Phosphate homeostasis and disorders.

    PubMed

    Manghat, P; Sodi, R; Swaminathan, R

    2014-11-01

    Recent studies of inherited disorders of phosphate metabolism have shed new light on the understanding of phosphate metabolism. Phosphate has important functions in the body and several mechanisms have evolved to regulate phosphate balance including vitamin D, parathyroid hormone and phosphatonins such as fibroblast growth factor-23 (FGF23). Disorders of phosphate homeostasis leading to hypo- and hyperphosphataemia are common and have clinical and biochemical consequences. Notably, recent studies have linked hyperphosphataemia with an increased risk of cardiovascular disease. This review outlines the recent advances in the understanding of phosphate homeostasis and describes the causes, investigation and management of hypo- and hyperphosphataemia.

  7. Fullerene-bisadduct acceptors for polymer solar cells.

    PubMed

    Li, Yongfang

    2013-10-01

    Polymer solar cells (PSCs) have drawn great attention in recent years for their simple device structure, light weight, and low-cost fabrication in comparison with inorganic semiconductor solar cells. However, the power-conversion efficiency (PCE) of PSCs needs to be increased for their future application. The key issue for improving the PCE of PSCs is the design and synthesis of high-efficiency conjugated polymer donors and fullerene acceptors for the photovoltaic materials. For the acceptor materials, several fullerene-bisadduct acceptors with high LUMO energy levels have demonstrated excellent photovoltaic performance in PSCs with P3HT as a donor. In this Focus Review, recent progress in high-efficiency fullerene-bisadduct acceptors is discussed, including the bisadduct of PCBM, indene-C60 bisadduct (ICBA), indene-C70 bisadduct (IC70BA), DMPCBA, NCBA, and bisTOQC. The LUMO levels and photovoltaic performance of these bisadduct acceptors with P3HT as a donor are summarized and compared. In addition, the applications of an ICBA acceptor in new device structures and with other conjugated polymer donors than P3HT are also introduced and discussed.

  8. Oligonucleotide-arrayed TFT photosensor applicable for DNA chip technology.

    PubMed

    Tanaka, Tsuyoshi; Hatakeyama, Keiichi; Sawaguchi, Masahiro; Iwadate, Akihito; Mizutani, Yasushi; Sasaki, Kazuhiro; Tateishi, Naofumi; Takeyama, Haruko; Matsunaga, Tadashi

    2006-09-05

    A thin film transistor (TFT) photosensor fabricated by semiconductor integrated circuit (IC) technology was applied to DNA chip technology. The surface of the TFT photosensor was coated with TiO2 using a vapor deposition technique for the fabrication of optical filters. The immobilization of thiolated oligonucleotide probes onto a TiO2-coated TFT photosensor using gamma-aminopropyltriethoxysilane (APTES) and N-(gamma-maleimidobutyloxy) sulfosuccinimide ester (GMBS) was optimized. The coverage value of immobilized oligonucleotides reached a plateau at 33.7 pmol/cm2, which was similar to a previous analysis using radioisotope-labeled oligonucleotides. The lowest detection limits were 0.05 pmol/cm2 for quantum dot and 2.1 pmol/cm2 for Alexa Fluor 350. Furthermore, single nucleotide polymorphism (SNP) detection was examined using the oligonucleotide-arrayed TFT photosensor. A SNP present in the aldehyde dehydrogenase 2 (ALDH2) gene was used as a target. The SNPs in ALDH2*1 and ALDH2*2 target DNA were detected successfully using the TFT photosensor. DNA hybridization in the presence of both ALDH2*1 and ALDH2*2 target DNA was observed using both ALDH2*1 and ALDH2*2 detection oligonucleotides-arrayed TFT photosensor. Use of the TFT photosensor will allow the development of a disposable photodetecting device for DNA chip systems.

  9. Predicting oligonucleotide-directed mutagenesis failures in protein engineering

    PubMed Central

    Wassman, Christopher D.; Tam, Phillip Y.; Lathrop, Richard H.; Weiss, Gregory A.

    2004-01-01

    Protein engineering uses oligonucleotide-directed mutagenesis to modify DNA sequences through a two-step process of hybridization and enzymatic synthesis. Inefficient reactions confound attempts to introduce mutations, especially for the construction of vast combinatorial protein libraries. This paper applied computational approaches to the problem of inefficient mutagenesis. Several results implicated oligonucleotide annealing to non-target sites, termed ‘cross-hybridization’, as a significant contributor to mutagenesis reaction failures. Test oligonucleotides demonstrated control over reaction outcomes. A novel cross-hybridization score, quickly computable for any plasmid and oligonucleotide mixture, directly correlated with yields of deleterious mutagenesis side products. Cross-hybridization was confirmed conclusively by partial incorporation of an oligonucleotide at a predicted cross-hybridization site, and by modification of putative template secondary structure to control cross-hybridization. Even in low concentrations, cross-hybridizing species in mixtures poisoned reactions. These results provide a basis for improved mutagenesis efficiencies and increased diversities of cognate protein libraries. PMID:15585664

  10. Target mRNA inhibition by oligonucleotide drugs in man

    PubMed Central

    Lightfoot, Helen L.; Hall, Jonathan

    2012-01-01

    Oligonucleotide delivery in vivo is commonly seen as the principal hurdle to the successful development of oligonucleotide drugs. In an analysis of 26 oligonucleotide drugs recently evaluated in late-stage clinical trials we found that to date at least half have demonstrated suppression of the target mRNA and/or protein levels in the relevant cell types in man, including those present in liver, muscle, bone marrow, lung, blood and solid tumors. Overall, this strongly implies that the drugs are being delivered to the appropriate disease tissues. Strikingly we also found that the majority of the drug targets of the oligonucleotides lie outside of the drugable genome and represent new mechanisms of action not previously investigated in a clinical setting. Despite the high risk of failure of novel mechanisms of action in the clinic, a subset of the targets has been validated by the drugs. While not wishing to downplay the technical challenges of oligonucleotide delivery in vivo, here we demonstrate that target selection and validation are of equal importance for the success of this field. PMID:22989709

  11. Novel complex MAD phasing and RNase H structural insights using selenium oligonucleotides

    SciTech Connect

    Abdur, Rob; Gerlits, Oksana O.; Gan, Jianhua; Jiang, Jiansheng; Salon, Jozef; Kovalevsky, Andrey Y.; Chumanevich, Alexander A.; Weber, Irene T.; Huang, Zhen

    2014-02-01

    Selenium-derivatized oligonucleotides may facilitate phase determination and high-resolution structure determination for protein–nucleic acid crystallography. The Se atom-specific mutagenesis (SAM) strategy may also enhance the study of nuclease catalysis. The crystal structures of protein–nucleic acid complexes are commonly determined using selenium-derivatized proteins via MAD or SAD phasing. Here, the first protein–nucleic acid complex structure determined using selenium-derivatized nucleic acids is reported. The RNase H–RNA/DNA complex is used as an example to demonstrate the proof of principle. The high-resolution crystal structure indicates that this selenium replacement results in a local subtle unwinding of the RNA/DNA substrate duplex, thereby shifting the RNA scissile phosphate closer to the transition state of the enzyme-catalyzed reaction. It was also observed that the scissile phosphate forms a hydrogen bond to the water nucleophile and helps to position the water molecule in the structure. Consistently, it was discovered that the substitution of a single O atom by a Se atom in a guide DNA sequence can largely accelerate RNase H catalysis. These structural and catalytic studies shed new light on the guide-dependent RNA cleavage.

  12. Chloroquine Phosphate Oral

    MedlinePlus

    Chloroquine phosphate is in a class of drugs called antimalarials and amebicides. It is used to prevent and treat ... Chloroquine phosphate comes as a tablet to take by mouth. For prevention of malaria in adults, one dose is ...

  13. DNA surface modified gadolinium phosphate nanoparticles as MRI contrast agents.

    PubMed

    Dumont, Matthieu F; Baligand, Celine; Li, Yichen; Knowles, Elisabeth S; Meisel, Mark W; Walter, Glenn A; Talham, Daniel R

    2012-05-16

    Oligonucleotide modified gadolinium phosphate nanoparticles have been prepared and their magnetic resonance relaxivity properties measured. Nanoparticles of GdPO4·H2O were synthesized in a water/oil microemulsion using IGEPAL CO-520 as surfactant, resulting in 50 to 100 nm particles that are highly dispersible and stable in water. Using surface modification chemistry previously established for zirconium phosphonate surfaces, the particles are directly modified with 5'-phosphate terminated oligonucleotides, and the specific interaction of the divalent phosphate with Gd(3+) sites at the surface is demonstrated. The ability of the modified nanoparticles to act as MRI contrast agents was determined by performing MR relaxivity measurements at 14.1 T. Solutions of nanopure water, Feridex, and Omniscan (FDA approved contrast agents) in 0.25% agarose were used for comparison and control purposes. MRI data confirm that GdPO4·H2O nanoparticles have relaxivities (r1, r2) comparable to those of commercially available contrast agents. In addition, the data suggest that biofunctionalization of the surface of the nanoparticles does not prevent their function as MRI contrast agents.

  14. The Impact of Heterogeneity and Dark Acceptor States on FRET: Implications for Using Fluorescent Protein Donors and Acceptors

    PubMed Central

    Vogel, Steven S.; Nguyen, Tuan A.; van der Meer, B. Wieb; Blank, Paul S.

    2012-01-01

    Förster resonance energy transfer (FRET) microscopy is widely used to study protein interactions in living cells. Typically, spectral variants of the Green Fluorescent Protein (FPs) are incorporated into proteins expressed in cells, and FRET between donor and acceptor FPs is assayed. As appreciable FRET occurs only when donors and acceptors are within 10 nm of each other, the presence of FRET can be indicative of aggregation that may denote association of interacting species. By monitoring the excited-state (fluorescence) decay of the donor in the presence and absence of acceptors, dual-component decay analysis has been used to reveal the fraction of donors that are FRET positive (i.e., in aggregates)._However, control experiments using constructs containing both a donor and an acceptor FP on the same protein repeatedly indicate that a large fraction of these donors are FRET negative, thus rendering the interpretation of dual-component analysis for aggregates between separately donor-containing and acceptor-containing proteins problematic. Using Monte-Carlo simulations and analytical expressions, two possible sources for such anomalous behavior are explored: 1) conformational heterogeneity of the proteins, such that variations in the distance separating donor and acceptor FPs and/or their relative orientations persist on time-scales long in comparison with the excited-state lifetime, and 2) FP dark states. PMID:23152925

  15. Safety of antisense oligonucleotide and siRNA-based therapeutics.

    PubMed

    Chi, Xuan; Gatti, Philip; Papoian, Thomas

    2017-01-31

    Oligonucleotide-based therapy is an active area of drug development designed to treat a variety of gene-specific diseases. Two of the more promising platforms are the antisense oligonucleotides (ASOs) and short interfering RNAs (siRNAs), both of which are often directed against similar targets. In light of recent reports on clinical trials of severe thrombocytopenia with two different ASO drugs and increased peripheral neuropathy with an siRNA drug, we compared and contrasted the specific safety characteristics of these two classes of oligonucleotide therapeutic. The objectives were to assess factors that could contribute to the specific toxicities observed with these two classes of promising drugs, and get a better understanding of the potential mechanism(s) responsible for these rare, but serious, adverse events.

  16. Current progress on aptamer-targeted oligonucleotide therapeutics

    PubMed Central

    Dassie, Justin P; Giangrande, Paloma H

    2014-01-01

    Exploiting the power of the RNAi pathway through the use of therapeutic siRNA drugs has remarkable potential for treating a vast array of human disease conditions. However, difficulties in delivery of these and similar nucleic acid-based pharmacological agents to appropriate organs or tissues, remains a major impediment to their broad clinical application. Synthetic nucleic acid ligands (aptamers) have emerged as effective delivery vehicles for therapeutic oligonucleotides, including siRNAs. In this review, we summarize recent attractive developments in creatively employing cell-internalizing aptamers to deliver therapeutic oligonucleotides (e.g., siRNAs, miRNAs, anti-miRs and antisense oligos) to target cells. We also discuss advancements in aptamer-siRNA chimera technology, as well as, aptamer-functionalized nanoparticles for siRNA delivery. In addition, the challenges and future prospects of aptamer-targeted oligonucleotide drugs for clinical translation are further highlighted. PMID:24304250

  17. Versatile functionalization of nanoelectrodes by oligonucleotides via pyrrole electrochemistry.

    PubMed

    Descamps, Emeline; Nguyen, Khoa; Bouchain-Gautier, Christelle; Filoramo, Arianna; Goux-Capes, Laurence; Goffman, Marcello; Bourgoin, Jean-Philippe; Mailley, Pascal; Livache, Thierry

    2010-11-15

    Surface modification at the nanometer scale is a challenge for the future of molecular electronics. In particular, the precise anchoring and electrical addressing of biological scaffolds such as complex DNA nanonetworks is of importance for generating bio-directed assemblies of nano-objects for nanocircuit purposes. Herein, we consider the individual modification of nanoelectrodes with different oligonucleotide sequences by an electrochemically driven co-polymerization process of pyrrole and modified oligonucleotide sequences bearing pyrrole monomers. We demonstrate that this one-step technique presents the advantages of simplicity, localization of surface modification, mechanical, biological and chemical stability of the coatings, and high lateral resolution.

  18. Survival of the fittest before the beginning of life: selection of the first oligonucleotide-like polymers by UV light

    PubMed Central

    Mulkidjanian, Armen Y; Cherepanov, Dmitry A; Galperin, Michael Y

    2003-01-01

    Background A key event in the origin of life on this planet has been formation of self-replicating RNA-type molecules, which were complex enough to undergo a Darwinian-type evolution (origin of the "RNA world"). However, so far there has been no explanation of how the first RNA-like biopolymers could originate and survive on the primordial Earth. Results As condensation of sugar phosphates and nitrogenous bases is thermodynamically unfavorable, these compounds, if ever formed, should have undergone rapid hydrolysis. Thus, formation of oligonucleotide-like structures could have happened only if and when these structures had some selective advantage over simpler compounds. It is well known that nitrogenous bases are powerful quenchers of UV quanta and effectively protect the pentose-phosphate backbones of RNA and DNA from UV cleavage. To check if such a protection could play a role in abiogenic evolution on the primordial Earth (in the absence of the UV-protecting ozone layer), we simulated, by using Monte Carlo approach, the formation of the first oligonucleotides under continuous UV illumination. The simulations confirmed that UV irradiation could have worked as a selective factor leading to a relative enrichment of the system in longer sugar-phosphate polymers carrying nitrogenous bases as UV-protectors. Partial funneling of the UV energy into the condensation reactions could provide a further boost for the oligomerization. Conclusion These results suggest that accumulation of the first polynucleotides could be explained by their abiogenic selection as the most UV-resistant biopolymers. PMID:12773209

  19. Designer Metallic Acceptor-Containing Halogen Bonding: General Strategies.

    PubMed

    Zhang, Xinxing; Bowen, Kit H

    2017-03-13

    Being electrostatic interactions in nature, hydrogen bonding (HB) and halogen bonding (XB) are considered to be two parallel worlds. In principle, all the applications that HB has could also be applied to XB. However, there has been no report on a metallic XB acceptor but metal anions have been observed to be good HB acceptors. This missing mosaic piece of XB is because common metal anions are reactive for XB donors. In view of this, we propose two strategies for designing metallic acceptor-containing XB using ab initio calculations. The first one is to utilize a metal cluster anion with a high electron detachment energy, such as the superatom, Al13- as the XB acceptor. The second strategy is to design a ligand passivated/protected metal core while it still can maintain the negative charge; several exotic clusters, such as PtH5-, PtZnH5- and PtMgH5-, are utilized as examples. Based on these two strategies, we anticipate that more metallic acceptor-containing XB will be discovered.

  20. Electron acceptor-dependent respiratory and physiological stratifications in biofilms.

    PubMed

    Yang, Yonggang; Xiang, Yinbo; Sun, Guoping; Wu, Wei-Min; Xu, Meiying

    2015-01-06

    Bacterial respiration is an essential driving force in biogeochemical cycling and bioremediation processes. Electron acceptors respired by bacteria often have solid and soluble forms that typically coexist in the environment. It is important to understand how sessile bacteria attached to solid electron acceptors respond to ambient soluble alternative electron acceptors. Microbial fuel cells (MFCs) provide a useful tool to investigate this interaction. In MFCs with Shewanella decolorationis, azo dye was used as an alternative electron acceptor in the anode chamber. Different respiration patterns were observed for biofilm and planktonic cells, with planktonic cells preferred to respire with azo dye while biofilm cells respired with both the anode and azo dye. The additional azo respiration dissipated the proton accumulation within the anode biofilm. There was a large redox potential gap between the biofilms and anode surface. Changing cathodic conditions caused immediate effects on the anode potential but not on the biofilm potential. Biofilm viability showed an inverse and respiration-dependent profile when respiring with only the anode or azo dye and was enhanced when respiring with both simultaneously. These results provide new insights into the bacterial respiration strategies in environments containing multiple electron acceptors and support an electron-hopping mechanism within Shewanella electrode-respiring biofilms.

  1. Oligonucleotide labelling using a fluorogenic "click" reaction with a hemicarboxonium salt.

    PubMed

    Maether, Marie-Pierre; Lapin, Kristie; Muntean, Andreea; Payrastre, Corinne; Escudier, Jean-Marc

    2013-10-17

    Two fluorescent streptocyanine labelled oligonucleotides have been synthesized by a simple "click" reaction between a non-fluorescent hemicarboxonium salt and aminoalkyl functionalized thymidines within the oligonucleotide and their spectrophotometric properties have been studied.

  2. Why nature chose phosphates.

    PubMed

    Westheimer, F H

    1987-03-06

    Phosphate esters and anhydrides dominate the living world but are seldom used as intermediates by organic chemists. Phosphoric acid is specially adapted for its role in nucleic acids because it can link two nucleotides and still ionize; the resulting negative charge serves both to stabilize the diesters against hydrolysis and to retain the molecules within a lipid membrane. A similar explanation for stability and retention also holds for phosphates that are intermediary metabolites and for phosphates that serve as energy sources. Phosphates with multiple negative charges can react by way of the monomeric metaphosphate ion PO3- as an intermediate. No other residue appears to fulfill the multiple roles of phosphate in biochemistry. Stable, negatively charged phosphates react under catalysis by enzymes; organic chemists, who can only rarely use enzymatic catalysis for their reactions, need more highly reactive intermediates than phosphates.

  3. Validation of the Swine Protein-Annotated Oligonucleotide Microarray

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The specificity and utility of the Swine Protein-Annotated Oligonucleotide Microarray, or Pigoligoarray (www.pigoligoarray.org), has been evaluated by profiling the expression of transcripts from four porcine tissues. Tools for comparative analyses of expression on the Pigoligoarray were developed i...

  4. Gene expression profiling in peanut using oligonucleotide microarrays

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Transcriptome expression analysis in peanut to date has been limited to a relatively small set of genes and only recently have a moderately significant number of ESTs been released into the public domain. Utilization of these ESTs for the oligonucleotide microarrays provides a means to investigate l...

  5. Oligonucleotide-directed mutagenesis for precision gene editing.

    PubMed

    Sauer, Noel J; Mozoruk, Jerry; Miller, Ryan B; Warburg, Zachary J; Walker, Keith A; Beetham, Peter R; Schöpke, Christian R; Gocal, Greg F W

    2016-02-01

    Differences in gene sequences, many of which are single nucleotide polymorphisms, underlie some of the most important traits in plants. With humanity facing significant challenges to increase global agricultural productivity, there is an urgent need to accelerate the development of these traits in plants. oligonucleotide-directed mutagenesis (ODM), one of the many tools of Cibus' Rapid Trait Development System (RTDS(™) ) technology, offers a rapid, precise and non-transgenic breeding alternative for trait improvement in agriculture to address this urgent need. This review explores the application of ODM as a precision genome editing technology, with emphasis on using oligonucleotides to make targeted edits in plasmid, episomal and chromosomal DNA of bacterial, fungal, mammalian and plant systems. The process of employing ODM by way of RTDS technology has been improved in many ways by utilizing a fluorescence conversion system wherein a blue fluorescent protein (BFP) can be changed to a green fluorescent protein (GFP) by editing a single nucleotide of the BFP gene (CAC→TAC; H66 to Y66). For example, dependent on oligonucleotide length, applying oligonucleotide-mediated technology to target the BFP transgene in Arabidopsis thaliana protoplasts resulted in up to 0.05% precisely edited GFP loci. Here, the development of traits in commercially relevant plant varieties to improve crop performance by genome editing technologies such as ODM, and by extension RTDS, is reviewed.

  6. Chromosome-specific painting in Cucumis species using bulked oligonucleotides

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Chromosome-specific painting is a powerful technique in molecular cytogenetic and genome research. We developed an oligonucleotide (oligo)-based chromosome painting technique in cucumber (Cucumis sativus) that will be applicable in any plant species with a sequenced genome. Oligos specific to a sing...

  7. Solid-phase-supported synthesis of morpholinoglycine oligonucleotide mimics

    PubMed Central

    Belov, Sergey S; Tarasenko, Yulia V; Silnikov, Vladimir N

    2014-01-01

    Summary An efficient solid-phase-supported peptide synthesis (SPPS) of morpholinoglycine oligonucleotide (MorGly) mimics has been developed. The proposed strategy includes a novel specially designed labile linker group containing the oxalyl residue and the 2-aminomethylmorpholino nucleoside analogues as first subunits. PMID:24991266

  8. Regioselective immobilization of short oligonucleotides to acrylic copolymer gels.

    PubMed Central

    Timofeev, E; Kochetkova, S V; Mirzabekov, A D; Florentiev, V L

    1996-01-01

    Four types of polyacrylamide or polydimethyl-acrylamide gels for regioselective (by immobilization at the 3' end) of short oligonucleotides have been designed for use in manufacturing oligonucleotide microchips. Two of these supports contain amino or aldehyde groups in the gel, allowing coupling with oligonucleotides bearing aldehyde or amino groups, respectively, in the presence of a reducing agent. The aldehyde gel support showed a higher immobilization efficiency relative to the amino gel. Of all reducing agents tested, the best results were obtained with a pyridine-borane complex. The other supports are based on an acrylamide gel activated with glutaraldehyde or a hydroxyalkyl-functionalized gel treated with mesyl chloride. The use of dimethylacrylamide instead of acrylamide allows subsequent gel modifications in organic solvents. All the immobilization methods are easy and simple to perform, give high and reproducible yields, allow long durations of storage of the activated support, and provide high stability of attachment and low non-specific binding. Although these gel supports have been developed for preparing oligonucleotide microchips, they may be used for other purposes as well. PMID:8774893

  9. Improving Photoconductance of Fluorinated Donors with Fluorinated Acceptors

    SciTech Connect

    Garner, Logan E.; Larson, Bryon; Oosterhout, Stefan; Owczarczyk, Zbyslaw; Olson, Dana C.; Kopidakis, Nikos; Boltalina, Olga V.; Strauss, Steven H.; Braunecker, Wade A.

    2016-11-21

    This work investigates the influence of fluorination of both donor and acceptor materials on the generation of free charge carriers in small molecule donor/fullerene acceptor BHJ OPV active layers. A fluorinated and non-fluorinated small molecule analogue were synthesized and their optoelectronic properties characterized. The intrinsic photoconductance of blends of these small molecule donors was investigated using time-resolved microwave conductivity. Blends of the two donor molecules with a traditional non-fluorinated fullerene (PC70BM) as well as a fluorinated fullerene (C60(CF3)2-1) were investigated using 5% and 50% fullerene loading. We demonstrate for the first time that photoconductance in a 50:50 donor:acceptor BHJ blend using a fluorinated fullerene can actually be improved relative to a traditional non-fluorinated fullerene by fluorinating the donor molecule as well.

  10. An overview of molecular acceptors for organic solar cells

    NASA Astrophysics Data System (ADS)

    Hudhomme, Piétrick

    2013-07-01

    Organic solar cells (OSCs) have gained serious attention during the last decade and are now considered as one of the future photovoltaic technologies for low-cost power production. The first dream of attaining 10% of power coefficient efficiency has now become a reality thanks to the development of new materials and an impressive work achieved to understand, control and optimize structure and morphology of the device. But most of the effort devoted to the development of new materials concerned the optimization of the donor material, with less attention for acceptors which to date remain dominated by fullerenes and their derivatives. This short review presents the progress in the use of non-fullerene small molecules and fullerene-based acceptors with the aim of evaluating the challenge for the next generation of acceptors in organic photovoltaics.

  11. Electron acceptor taxis and blue light effect on bacterial chemotaxis.

    PubMed

    Taylor, B L; Miller, J B; Warrick, H M; Koshland, D E

    1979-11-01

    Salmonella typhimurium and Escherichia coli from anaerobic cultures displayed tactic responses to gradients of nitrate, fumarate, and oxygen when the appropriate electron transport pathway was present. Such responses were named "electron acceptor taxis" because they are elicited by terminal electron acceptors. Mutant strains of S. typhimurium and E. coli were used to establish that functioning electron transport pathways to nitrate and fumarate are required for taxis to these compounds. Aerotaxis in S. typhimurium was blocked by 1.0 mM KCN, which inhibited oxygen uptake. Similarly, a functioning electron transport pathway was shown to be essential for the tumbling response of S. typhimurium and E. coli to intense light (290 to 530 nm). Some inhibitors and uncouplers of respiration were repellents of S. typhimurium. We propose that behavioral responses to light or electron acceptors involve electron transport-mediated perturbations of the proton motive force.

  12. Gut inflammation provides a respiratory electron acceptor for Salmonella

    PubMed Central

    Winter, Sebastian E.; Thiennimitr, Parameth; Winter, Maria G.; Butler, Brian P.; Huseby, Douglas L.; Crawford, Robert W.; Russell, Joseph M.; Bevins, Charles L.; Adams, L. Garry; Tsolis, Renée M.; Roth, John R.; Bäumler, Andreas J.

    2010-01-01

    Salmonella enterica serotype Typhimurium (S. Typhimurium) causes acute gut inflammation by using its virulence factors to invade the intestinal epithelium and survive in mucosal macrophages. The inflammatory response enhances the transmission success of S. Typhimurium by promoting its outgrowth in the gut lumen through unknown mechanisms. Here we show that reactive oxygen species generated during inflammation reacted with endogenous, luminal sulphur compounds (thiosulfate) to form a new respiratory electron acceptor, tetrathionate. The genes conferring the ability to utilize tetrathionate as an electron acceptor produced a growth advantage for S. Typhimurium over the competing microbiota in the lumen of the inflamed gut. We conclude that S. Typhimurium virulence factors induce host-driven production of a new electron acceptor that allows the pathogen to use respiration to compete with fermenting gut microbes. Thus, the ability to trigger intestinal inflammation is crucial for the biology of this diarrhoeal pathogen. PMID:20864996

  13. Effects of fluid flow on the oligonucleotide folding in single-walled carbon nanotubes.

    PubMed

    Lim, M C G; Zhong, Z W

    2009-10-01

    This paper presents molecular-dynamics (MD) simulations of DNA oligonucleotide and water molecules translocating through carbon nanotube (CNT) channels. An induced pressure difference is applied to the system by pushing a layer of water molecules toward the flow direction to drive the oligonucleotide and other molecules. This MD simulation investigates the changes that occur in the conformation of the oligonucleotide due to water molecules in nanochannels while controlling the temperature and volume of the system in a canonical ensemble. The results show that the oligonucleotide in the (8,8)-(12,12) CNT channel forms a folded state at a lower pressure, whereas the oligonucleotide in the (10,10)-(14,14) CNT channel forms a folded state at a higher pressure instead. The van der Waals forces between the water molecules and the oligonucleotide suggest that the attraction between these two types of molecules results in the linear arrangements of the bases of the oligonucleotide. For a larger nanotube channel, the folding of the oligonucleotide is mainly dependent on the solvent (water molecules), whereas pressure, the size of the nanotube junction, and water molecules are the considering factors of the folding of the oligonucleotide at a smaller nanotube channel. For a folded oligonucleotide, the water distribution around the oligonucleotide is concentrated at a smaller range than that for the distribution around an unfolded oligonucleotide.

  14. Ratiometric detection of oligonucleotide stoichiometry on multifunctional gold nanoparticles by whispering gallery mode biosensing.

    PubMed

    Wu, F C; Wu, Y; Niu, Z; Vollmer, F

    2015-05-07

    A label-free method is developed to ratiometrically determine the stoichiometry of oligonucleotides attached to the surface of gold nanoparticle (GNP) by whispering gallery mode biosensing. Utilizing this scheme, it is furthermore shown that the stoichiometric ratio of GNP attached oligonucleotide species can be controlled by varying the concentration ratio of thiolated oligonucleotides that are used to modify the GNP.

  15. Synthesis and anti-HIV activity of thiocholesteryl-coupled phosphodiester antisense oligonucleotides incorporated into immunoliposomes.

    PubMed

    Zelphati, O; Wagner, E; Leserman, L

    1994-09-01

    Encapsulation of oligonucleotides in antibody-targeted liposomes (immunoliposomes) which bind to target cells permits intracellular delivery of the oligonucleotides. This approach circumvents problems of extracellular degradation by nucleases and poor membrane permeability which free phosphodiester oligonucleotides are subject to, but leaves unresolved the inefficiency of encapsulation of oligonucleotides in liposomes. We have coupled oligonucleotides to cholesterol via a reversible disulfide bond. This modification of oligonucleotides improved their association with immunoliposomes by a factor of about 10 in comparison to unmodified oligonucleotides. The presence of cholesteryl-modified oligonucleotides incorporated in the bilayer of liposomes did not interfere with the coupling of the targeting protein to the liposome surface. Free or cholesterol coupled oligonucleotides associated with liposomes and directed against the tat gene of HIV-1 were tested for inhibition of HIV-1 proliferation in acutely infected cells. We demonstrate that the cholesteryl-modified as well as unmodified oligonucleotides acquire the target specificity of the antibody on the liposome. Their antiviral activity when delivered into cells is sequence-specific. The activity of these modified or unmodified oligonucleotides to inhibit the replication of HIV was the same on an equimolar basis (EC50 around 0.1 microM). Cholesterol coupled oligonucleotides thus offer increased liposome association without loss of antiviral activity.

  16. Acceptor specificity in the transglycosylation reaction using Endo-M.

    PubMed

    Tomabechi, Yusuke; Odate, Yuki; Izumi, Ryuko; Haneda, Katsuji; Inazu, Toshiyuki

    2010-11-22

    To determine the structural specificity of the glycosyl acceptor of the transglycosylation reaction using endo-β-N-acetylglucosaminidase (ENGase) (EC 3.2.1.96) from Mucor hiemalis (Endo-M), several acceptor derivatives were designed and synthesized. The narrow regions of the 1,3-diol structure from the 4- to 6-hydroxy functions of GlcNAc were found to be essential for the transglycosylation reaction using Endo-M. Furthermore, it was determined that Endo-M strictly recognizes a 1,3-diol structure consisting of primary and secondary hydroxyl groups.

  17. Donor-acceptor chemistry in the main group.

    PubMed

    Rivard, Eric

    2014-06-21

    This Perspective article summarizes recent progress from our laboratory in the isolation of reactive main group species using a general donor-acceptor protocol. A highlight of this program is the use of carbon-based donors in combination with suitable Lewis acidic acceptors to yield stable complexes of parent Group 14 element hydrides (e.g. GeH2 and H2SiGeH2). It is anticipated that this strategy could be extended to include new synthetic targets from throughout the Periodic Table with possible applications in bottom-up materials synthesis and main group element catalysis envisioned.

  18. Glycoclusters on oligonucleotide and PNA scaffolds: synthesis and applications.

    PubMed

    Spinelli, Nicolas; Defrancq, Eric; Morvan, François

    2013-06-07

    Conjugation of oligonucleotides (ONs) to a variety of reporter groups has been the subject of intensive research during the last decade. Conjugation is indeed of great interest because it can be used not only to improve the existing ONs properties but also to impart new ones. In this context tremendous efforts have been made to conjugate carbohydrate moieties to ONs. Indeed carbohydrates play an important role in biological processes such as signal transduction and cell adhesion through the recognition with sugar-binding proteins (i.e. lectins) located on the surface of cells. For this reason, carbohydrate-oligonucleotide conjugates (COCs) have been first developed for improving the poor cellular uptake or tissue specific delivery of ONs through receptor-mediated endocytosis. Besides the targeted ONs delivery, carbohydrate-oligonucleotide conjugates (COCs) are also evaluated in the context of carbohydrate biochips in which surface coating with carbohydrates is achieved by using the DNA-directed immobilization strategy (DDI). Peptide nucleic acids (PNAs) have also been extensively investigated as a surrogate of DNA for diverse applications. Therefore attachment of carbohydrate moieties to this class of molecules has been studied. The aforementioned applications of COCs require mimicking of the natural processes, in which the weak individual protein-carbohydrate binding is overcome by using multivalent interactions. This tutorial review focuses on the recent advances in carbohydrate-oligonucleotide conjugates and describes the major synthetic approaches available. In addition, an overview of applications that have been developed using various scaffolds allowing multivalent interactions is provided. Finally recent results on the use of peptide nucleic acids as oligonucleotides surrogate are described.

  19. Phosphate, inositol and polyphosphates.

    PubMed

    Livermore, Thomas M; Azevedo, Cristina; Kolozsvari, Bernadett; Wilson, Miranda S C; Saiardi, Adolfo

    2016-02-01

    Eukaryotic cells have ubiquitously utilized the myo-inositol backbone to generate a diverse array of signalling molecules. This is achieved by arranging phosphate groups around the six-carbon inositol ring. There is virtually no biological process that does not take advantage of the uniquely variable architecture of phosphorylated inositol. In inositol biology, phosphates are able to form three distinct covalent bonds: phosphoester, phosphodiester and phosphoanhydride bonds, with each providing different properties. The phosphoester bond links phosphate groups to the inositol ring, the variable arrangement of which forms the basis of the signalling capacity of the inositol phosphates. Phosphate groups can also form the structural bridge between myo-inositol and diacylglycerol through the phosphodiester bond. The resulting lipid-bound inositol phosphates, or phosphoinositides, further expand the signalling potential of this family of molecules. Finally, inositol is also notable for its ability to host more phosphates than it has carbons. These unusual organic molecules are commonly referred to as the inositol pyrophosphates (PP-IPs), due to the presence of high-energy phosphoanhydride bonds (pyro- or diphospho-). PP-IPs themselves constitute a varied family of molecules with one or more pyrophosphate moiety/ies located around the inositol. Considering the relationship between phosphate and inositol, it is no surprise that members of the inositol phosphate family also regulate cellular phosphate homoeostasis. Notably, the PP-IPs play a fundamental role in controlling the metabolism of the ancient polymeric form of phosphate, inorganic polyphosphate (polyP). Here we explore the intimate links between phosphate, inositol phosphates and polyP, speculating on the evolution of these relationships.

  20. Pentopyranosyl Oligonucleotide Systems. Part 11: Systems with Shortened Backbones: D)-beta-Ribopyranosyl-(4 yields 3 )- and (L)-alpha - Lyxopyranosyl-(4 yields 3 )-oligonucleotides

    NASA Technical Reports Server (NTRS)

    Wippo, Harald; Reck, Folkert; Kudick, Rene; Ramaseshan, Mahesh; Ceulemans, Griet; Bolli, Martin; Krishnamurthy, Ramanarayanan; Eschenmoser, Albert

    2001-01-01

    The (L)-a-lyxopyranosyl-(4'yields 3')-oligonucleotide system-a member of a pentopyranosyl oligonucleotide family containing a shortened backbone-is capable of cooperative base-pairing and of cross-pairing with DNA and RNA. In contrast, corresponding (D)-beta-ribopyransoyl-(4' yields 3')-oligonucleotides do not show base-pairing under similar conditions. We conclude that oligonucleotide systems can violate the six-bonds-per-backbone-unit rule by having five bonds instead, if their vicinally bound phosphodiester bridges can assume an antiperiplanar conformation. An additional structural feature that seems relevant to the cross-pairing capability of the (L)-a-lyxopyranosyl-(4' yields 3')-oligonucleotide system is its (small) backbone/basepair axes inclination. An inclination which is similar to that in B-DNA seems to be a prerequisite for an oligonucleotide system s capability to cross-pair with DNA.

  1. Phosphate taxis in Pseudomonas aeruginosa.

    PubMed

    Kato, J; Ito, A; Nikata, T; Ohtake, H

    1992-08-01

    Pseudomonas aeruginosa was shown to be attracted to phosphate. The chemotactic response was induced by phosphate starvation. The specificity of chemoreceptors for phosphate was high so that no other tested phosphorus compounds elicited a chemotactic response as strong as that elicited by phosphate. Competition experiments showed that the chemoreceptors for phosphate appeared to be different from those for the common amino acids. Mutants constitutive for alkaline phosphatase showed the chemotactic response to phosphate regardless of whether the cells were starved for phosphate.

  2. Ligand-bound Structures and Site-directed Mutagenesis Identify the Acceptor and Secondary Binding Sites of Streptomyces coelicolor Maltosyltransferase GlgE*

    PubMed Central

    Syson, Karl; Stevenson, Clare E. M.; Miah, Farzana; Barclay, J. Elaine; Tang, Minhong; Gorelik, Andrii; Rashid, Abdul M.; Lawson, David M.; Bornemann, Stephen

    2016-01-01

    GlgE is a maltosyltransferase involved in α-glucan biosynthesis in bacteria that has been genetically validated as a target for tuberculosis therapies. Crystals of the Mycobacterium tuberculosis enzyme diffract at low resolution so most structural studies have been with the very similar Streptomyces coelicolor GlgE isoform 1. Although the donor binding site for α-maltose 1-phosphate had been previously structurally defined, the acceptor site had not. Using mutagenesis, kinetics, and protein crystallography of the S. coelicolor enzyme, we have now identified the +1 to +6 subsites of the acceptor/product, which overlap with the known cyclodextrin binding site. The sugar residues in the acceptor subsites +1 to +5 are oriented such that they disfavor the binding of malto-oligosaccharides that bear branches at their 6-positions, consistent with the known acceptor chain specificity of GlgE. A secondary binding site remote from the catalytic center was identified that is distinct from one reported for the M. tuberculosis enzyme. This new site is capable of binding a branched α-glucan and is most likely involved in guiding acceptors toward the donor site because its disruption kinetically compromises the ability of GlgE to extend polymeric substrates. However, disruption of this site, which is conserved in the Streptomyces venezuelae GlgE enzyme, did not affect the growth of S. venezuelae or the structure of the polymeric product. The acceptor subsites +1 to +4 in the S. coelicolor enzyme are well conserved in the M. tuberculosis enzyme so their identification could help inform the design of inhibitors with therapeutic potential. PMID:27531751

  3. Three Redox States of a Diradical Acceptor-Donor-Acceptor Triad: Gating the Magnetic Coupling and the Electron Delocalization.

    PubMed

    Souto, Manuel; Lloveras, Vega; Vela, Sergi; Fumanal, Maria; Ratera, Imma; Veciana, Jaume

    2016-06-16

    The diradical acceptor-donor-acceptor triad 1(••), based on two polychlorotriphenylmethyl (PTM) radicals connected through a tetrathiafulvalene(TTF)-vinylene bridge, has been synthesized. The generation of the mixed-valence radical anion, 1(•-), and triradical cation species, 1(•••+), obtained upon electrochemical reduction and oxidation, respectively, was monitored by optical and ESR spectroscopy. Interestingly, the modification of electron delocalization and magnetic coupling was observed when the charged species were generated and the changes have been rationalized by theoretical calculations.

  4. Zinc phosphate conversion coatings

    DOEpatents

    Sugama, T.

    1997-02-18

    Zinc phosphate conversion coatings for producing metals which exhibit enhanced corrosion prevention characteristics are prepared by the addition of a transition-metal-compound promoter comprising a manganese, iron, cobalt, nickel, or copper compound and an electrolyte such as polyacrylic acid, polymethacrylic acid, polyitaconic acid and poly-L-glutamic acid to a phosphating solution. These coatings are further improved by the incorporation of Fe ions. Thermal treatment of zinc phosphate coatings to generate {alpha}-phase anhydrous zinc phosphate improves the corrosion prevention qualities of the resulting coated metal. 33 figs.

  5. Zinc phosphate conversion coatings

    DOEpatents

    Sugama, Toshifumi

    1997-01-01

    Zinc phosphate conversion coatings for producing metals which exhibit enhanced corrosion prevention characteristics are prepared by the addition of a transition-metal-compound promoter comprising a manganese, iron, cobalt, nickel, or copper compound and an electrolyte such as polyacrylic acid, polymethacrylic acid, polyitaconic acid and poly-L-glutamic acid to a phosphating solution. These coatings are further improved by the incorporation of Fe ions. Thermal treatment of zinc phosphate coatings to generate .alpha.-phase anhydrous zinc phosphate improves the corrosion prevention qualities of the resulting coated metal.

  6. Electron Acceptor-Electron Donor Interactions. XV and XVI.

    DTIC Science & Technology

    mixtures exhibit simple eutectic phase diagrams and the thermochromic effect is interpreted as a randomized structure in the liquid , whereas the solid is a...two-phase aggregate of isolated acceptor and onor crystals . The charge-transfer spectra of solutions of tungsten and molybdenum hexafluorides and iodine heptafluoride in n-hexane and cyclohexane were obtained.

  7. Poly(trifluoromethyl)azulenes: structures and acceptor properties.

    PubMed

    Clikeman, Tyler T; Bukovsky, Eric V; Kuvychko, Igor V; San, Long K; Deng, Shihu H M; Wang, Xue-Bin; Chen, Yu-Sheng; Strauss, Steven H; Boltalina, Olga V

    2014-06-14

    Six new poly(trifluoromethyl)azulenes prepared in a single high-temperature reaction exhibit strong electron accepting properties in the gas phase and in solution and demonstrate the propensity to form regular π-stacked columns in donor-acceptor crystals when mixed with pyrene as a donor.

  8. Development of imide- and imidazole-containing electron acceptors for use in donor-acceptor conjugated compounds and polymers

    NASA Astrophysics Data System (ADS)

    Li, Duo

    Conjugated organic compounds and polymers have attracted significant attention due to their potential application in electronic devices as semiconducting materials, such as organic solar cells (OSCs). In order to tune band gaps, donor-acceptor (D-A) structure is widely used, which has been proved to be one of the most effective strategies. This thesis consists of three parts: 1) design, syntheses and characterization of new weak acceptors based on imides and the systematic study of the structure-property relationship; (2) introduction of weak and strong acceptors in one polymer to achieve a broad coverage of light absorption and improve the power conversion efficiency (PCE); (3) modification of benzothiadiazole (BT) acceptor in order to increase the electron withdrawing ability. Imide-based electron acceptors, 4-(5-bromothiophen-2-y1)-2-(2-ethylhexyl)-9- phenyl- 1H-benzo[f]isoindole-1,3(2H)-dione (BIDO-1) and 4,9-bis(5-bromothiophen-2-yl)-2-(2-ethylhexyl)-benzo[f]isoindole-1,3-dione (BIDO-2), were designed and synthesized. In this design, naphthalene is selected as its main core to maintain a planar structure, and thienyl groups are able to facilitate the bromination reaction and lower the band gap. BIDO-1 and BIDO-2 were successfully coupled with different donors by both Suzuki cross-coupling and Stille cross-coupling reactions. Based on the energy levels and band gaps of the BIDO-containing compounds and polymers, BIDO-1 and BIDO-2 are proved to be weak electron acceptors. Pyromellitic diimide (PMDI) was also studied and found to be a stronger electron acceptor than BIDO . In order to obtain broad absorption coverage, both weak acceptor ( BIDO-2) and strong acceptor diketopyrrolopyrrole (DPP) were introduced in the same polymer. The resulting polymers show two absorption bands at 400 and 600 nm and two emission peaks at 500 and 680 nm. The band gaps of the polymers are around 1.6 eV, which is ideal for OSC application. The PCE of 1.17% was achieved. Finally

  9. Acceptor conductivity in bulk zinc oxide (0001) crystals

    NASA Astrophysics Data System (ADS)

    Adekore, Bababunmi Tolu

    ZnO is a promising wide bandgap semiconductor. Its renowned and prominent properties as its bandgap of 3.37eV at 4.2K; its very high excitonic binding energy, 60meV; its high melting temperature, 2248K constitute the basis for the recently renewed and sustained scientific interests in the material. In addition to the foregoing, the availability of bulk substrates of industrially relevant sizes provides important opportunities such as homoepitaxial deposition of the material which is a technological asset in the production of efficient optoelectronic and electronic devices. The nemesis of wide bandgap materials cannot be more exemplified than in ZnO. The notorious limitation of asymmetric doping and the haunting plague of electrically active point defects dim the bright future of the material. In this case, the search for reliable and consistent acceptor conductivity in bulk substrates has been hitherto, unsuccessful. In the dissertation that now follows, our efforts have been concerted in the search for a reliable acceptor. We have carefully investigated the science of point defects in the material, especially those responsible for the high donor conductivity. We also investigated and herein report variety of techniques of introducing acceptors into the material. We employ the most relevant and informative characterization techniques in verifying both the intended conductivity and the response of intrinsic crystals to variation in temperature and strain. And finally we explain deviations, where they exist, from ideal acceptor characteristics. Our work on reliable acceptor has been articulated in four papers. The first establishing capacitance based methods of monitoring electrically active donor defects. The second investigates the nature of anion acceptors on the oxygen sublattice. A study similar to the preceding study was conducted for cation acceptors on the zinc sublattice and reported in the third paper. Finally, an analysis of the response of the crystal to

  10. Anaerobic methanotrophy in tidal wetland: Effects of electron acceptors

    NASA Astrophysics Data System (ADS)

    Lin, Li-Hung; Yu, Zih-Huei; Wang, Pei-Ling

    2016-04-01

    Wetlands have been considered to represent the largest natural source of methane emission, contributing substantially to intensify greenhouse effect. Despite in situ methanogenesis fueled by organic degradation, methanotrophy also plays a vital role in controlling the exact quantity of methane release across the air-sediment interface. As wetlands constantly experience various disturbances of anthropogenic activities, biological burrowing, tidal inundation, and plant development, rapid elemental turnover would enable various electron acceptors available for anaerobic methanotrophy. The effects of electron acceptors on stimulating anaerobic methanotrophy and the population compositions involved in carbon transformation in wetland sediments are poorly explored. In this study, sediments recovered from tidally influenced, mangrove covered wetland in northern Taiwan were incubated under the static conditions to investigate whether anaerobic methanotrophy could be stimulated by the presence of individual electron acceptors. Our results demonstrated that anaerobic methanotrophy was clearly stimulated in incubations amended with no electron acceptor, sulfate, or Fe-oxyhydroxide. No apparent methane consumption was observed in incubations with nitrate, citrate, fumarate or Mn-oxides. Anaerobic methanotrophy in incubations with no exogenous electron acceptor appears to proceed at the greatest rates, being sequentially followed by incubations with sulfate and Fe-oxyhydroxide. The presence of basal salt solution stimulated methane oxidation by a factor of 2 to 3. In addition to the direct impact of electron acceptor and basal salts, incubations with sediments retrieved from low tide period yielded a lower rate of methane oxidation than from high tide period. Overall, this study demonstrates that anaerobic methanotrophy in wetland sediments could proceed under various treatments of electron acceptors. Low sulfate content is not a critical factor in inhibiting methane

  11. Oligonucleotide Immobilization and Hybridization on Aldehyde-Functionalized Poly(2-hydroxyethyl methacrylate) Brushes.

    PubMed

    Bilgic, Tugba; Klok, Harm-Anton

    2015-11-09

    DNA biosensing requires high oligonucleotide binding capacity interface chemistries that can be tuned to maximize probe presentation as well as hybridization efficiency. This contribution investigates the feasibility of aldehyde-functionalized poly(2-hydroxyethyl methacrylate) (PHEMA) brush-based interfaces for oligonucleotide binding and hybridization. These polymer brushes, which allow covalent immobilization of oligonucleotides, are prepared by surface-initiated atom transfer radical polymerization (SI-ATRP) of HEMA followed by a postpolymerization oxidation step to generate side chain aldehyde groups. A series of polymer brushes covering a range of film thicknesses and grafting densities was investigated with regard to their oligonucleotide binding capacity as well as their ability to support oligonucleotide hybridization. Densely grafted brushes were found to have probe oligonucleotide binding capacities of up to ∼30 pmol/cm(2). Increasing the thickness of these densely grafted brush films, however, resulted in a decrease in the oligonucleotide binding capacity. Less densely grafted brushes possess binding capacities of ∼10 pmol/cm(2), which did not significantly depend on film thickness. The oligonucleotide hybridization efficiencies, however, were highest (93%) on those brushes that present the lowest surface concentration of the probe oligonucleotide. These results highlight the importance of optimizing the probe oligonucleotide surface concentration and binding interface chemistry. The versatility and tunability of the PHEMA-based brushes presented herein makes these films a very attractive platform for the immobilization and hybridization of oligonucleotides.

  12. Electrophoresis for genotyping: temporal thermal gradient gel electrophoresis for profiling of oligonucleotide dissociation.

    PubMed Central

    Day, I N; O'Dell, S D; Cash, I D; Humphries, S E; Weavind, G P

    1995-01-01

    Traditional use of an oligonucleotide probe to determine genotype depends on perfect base pairing to a single-stranded target which is stable to a higher temperature than when imperfect binding occurs due to a mismatch in the target sequence. Bound oligonucleotide is detected at a predetermined single temperature 'snapshot' of the melting profile, allowing the distinction of perfect from imperfect base pairing. In heterozygotes, the presence of the alternative sequence must be verified with a second oligonucleotide complementary to the variant. Here we describe a system of real-time variable temperature electrophoresis during which the oligonucleotide dissociates from its target. In 20% polyacrylamide the target strand has minimal mobility and released oligonucleotide migrates extremely quickly so that the 'freed' rather than the 'bound' is displayed. The full profile of oligonucleotide dissociation during gel electrophoresis is represented along the gel track, and a single oligonucleotide is sufficient to confirm heterozygosity, since the profile displays two separate peaks. Resolution is great, with use of short track lengths enabling analysis of dense arrays of samples. Each gel track can contain a different target or oligonucleotide and the temperature gradient can accommodate oligonucleotides of different melting temperatures. This provides a convenient system to examine the interaction of many different oligonucleotides and target sequences simultaneously and requires no prior knowledge of the mutant sequence(s) nor of oligonucleotide melting temperatures. The application of the technique is described for screening of a hotspot for mutations in the LDL receptor gene in patients with familial hypercholesterolaemia. Images PMID:7630718

  13. Oligonucleotide-Mediated Genome Editing Provides Precision and Function to Engineered Nucleases and Antibiotics in Plants[OPEN

    PubMed Central

    Sauer, Noel J.; Narváez-Vásquez, Javier; Mozoruk, Jerry; Miller, Ryan B.; Warburg, Zachary J.; Woodward, Melody J.; Mihiret, Yohannes A.; Lincoln, Tracey A.; Segami, Rosa E.; Sanders, Steven L.; Walker, Keith A.; Beetham, Peter R.; Schöpke, Christian R.; Gocal, Greg F.W.

    2016-01-01

    Here, we report a form of oligonucleotide-directed mutagenesis for precision genome editing in plants that uses single-stranded oligonucleotides (ssODNs) to precisely and efficiently generate genome edits at DNA strand lesions made by DNA double strand break reagents. Employing a transgene model in Arabidopsis (Arabidopsis thaliana), we obtained a high frequency of precise targeted genome edits when ssODNs were introduced into protoplasts that were pretreated with the glycopeptide antibiotic phleomycin, a nonspecific DNA double strand breaker. Simultaneous delivery of ssODN and a site-specific DNA double strand breaker, either transcription activator-like effector nucleases (TALENs) or clustered, regularly interspaced, short palindromic repeats (CRISPR/Cas9), resulted in a much greater targeted genome-editing frequency compared with treatment with DNA double strand-breaking reagents alone. Using this site-specific approach, we applied the combination of ssODN and CRISPR/Cas9 to develop an herbicide tolerance trait in flax (Linum usitatissimum) by precisely editing the 5′-ENOLPYRUVYLSHIKIMATE-3-PHOSPHATE SYNTHASE (EPSPS) genes. EPSPS edits occurred at sufficient frequency that we could regenerate whole plants from edited protoplasts without employing selection. These plants were subsequently determined to be tolerant to the herbicide glyphosate in greenhouse spray tests. Progeny (C1) of these plants showed the expected Mendelian segregation of EPSPS edits. Our findings show the enormous potential of using a genome-editing platform for precise, reliable trait development in crop plants. PMID:26864017

  14. Inhibition of HTLV-III by exogenous oligonucleotides

    SciTech Connect

    Goodchild, J.; Zamecnik, P.C.

    1989-02-21

    A method is described of detecting the presence of HTLV-III virus in a sample by demonstrating inhibition of replication of the virus in cells which are normally killed by the HTLV-III virus after the cells have been (a) combined with the sample and an oligonucleotide complementary to at least one highly conserved region of the HTLV-III genome necessary for HTLV-III replication and capable of hybridizing with at least the highly conserved region, the highly conserved region of the HTLV-III genome being a nucleotide sequence present in the genomes of HTLV-III isolates and the oligonucleotide complementary to at least one highly conserved region of the HTLV-III genome necessary for HTLV-III replication being complementary to a region of the HTLV-III genome.

  15. Palladium-catalyzed modification of unprotected nucleosides, nucleotides, and oligonucleotides.

    PubMed

    Shaughnessy, Kevin H

    2015-05-22

    Synthetic modification of nucleoside structures provides access to molecules of interest as pharmaceuticals, biochemical probes, and models to study diseases. Covalent modification of the purine and pyrimidine bases is an important strategy for the synthesis of these adducts. Palladium-catalyzed cross-coupling is a powerful method to attach groups to the base heterocycles through the formation of new carbon-carbon and carbon-heteroatom bonds. In this review, approaches to palladium-catalyzed modification of unprotected nucleosides, nucleotides, and oligonucleotides are reviewed. Polar reaction media, such as water or polar aprotic solvents, allow reactions to be performed directly on the hydrophilic nucleosides and nucleotides without the need to use protecting groups. Homogeneous aqueous-phase coupling reactions catalyzed by palladium complexes of water-soluble ligands provide a general approach to the synthesis of modified nucleosides, nucleotides, and oligonucleotides.

  16. Detection of high-resolution Raman spectra in short oligonucleotides

    NASA Astrophysics Data System (ADS)

    Bairamov, F. B.; Poloskin, E. D.; Chernev, A. L.; Toporov, V. V.; Dubina, M. V.; Lahderanta, E.; Lipsanen, H.; Bairamov, B. Kh.

    2014-06-01

    High-resolution spectra of single-chain short oligonucleotides d(20G, 20T), where d is a deoxyribonucleoside, G is guanine, and T is thymine, have been obtained by the highly sensitive nonresonant Raman scattering method of biomacromolecules. In addition to their own multifunctional significance, short oligonucleotides attract interest as ideal model objects for revealing poorly studied peculiarities of tertiary and quaternary structures of DNA. The detection of narrow spectral lines has allowed determining the characteristic time scale and makes it possible to study the dynamics of fast relaxation processes of vibrational motions of atoms in biomacromolecules. It has been found that the FWHM of the narrowest 1355.4 cm-1 spectral line attributed to the vibrations of the dT methyl group is 14.6 cm-1. The corresponding lifetime is 0.38 ps.

  17. CADMIUM PHOSPHATE GLASS

    DOEpatents

    Carpenter, H.W.; Johnson, P.D.

    1963-04-01

    A method of preparing a cadmium phosphate glass that comprises providing a mixture of solid inorganic compounds of cadmuim and phosphate having vaporizable components and heating the resulting composition to a temperature of at least 850 un. Concent 85% C is presented. (AEC)

  18. Induction of Radiosensitization by Antisense Oligonucleotide Gene Therapy

    DTIC Science & Technology

    2002-07-01

    Miraglia L and Strobl JS: Sensitization of breast cancer cells to ionizing radiation by protein kinase C inhibition. Proc. of the 9 0 ,h American Assoc...sensitizes human tumor cells to ionizing radiation . Radiat Res 129:345-350. O’Brian C, Vogel VG, Singletary SE and Ward NE (1989) Elevated protein...Antisense Oligonucleotides, Ionizing Radiation , Breast Cancer, Abbreviations: IR, ionizing radiation ; PKC, protein kinase C; MCF-7, Michigan Cancer

  19. Cationic carbosilane dendrimers and oligonucleotide binding: an energetic affair

    NASA Astrophysics Data System (ADS)

    Marson, D.; Laurini, E.; Posocco, P.; Fermeglia, M.; Pricl, S.

    2015-02-01

    Generation 2 cationic carbosilane dendrimers hold great promise as internalizing agents for gene therapy as they present low toxicity and retain and internalize the genetic material as an oligonucleotide or siRNA. In this work we carried out complete in silico structural and energetical characterization of the interactions of a set of G2 carbosilane dendrimers, showing different affinity towards two single strand oligonucleotide (ODN) sequences in vitro. Our simulations predict that these four dendrimers and the relevant ODN complexes are characterized by similar size and shape, and that the molecule-specific ODN binding ability can be rationalized only by considering a critical molecular design parameter: the normalized effective binding energy ΔGbind,eff/Neff, i.e. the performance of each active individual dendrimer branch directly involved in a binding interaction.Generation 2 cationic carbosilane dendrimers hold great promise as internalizing agents for gene therapy as they present low toxicity and retain and internalize the genetic material as an oligonucleotide or siRNA. In this work we carried out complete in silico structural and energetical characterization of the interactions of a set of G2 carbosilane dendrimers, showing different affinity towards two single strand oligonucleotide (ODN) sequences in vitro. Our simulations predict that these four dendrimers and the relevant ODN complexes are characterized by similar size and shape, and that the molecule-specific ODN binding ability can be rationalized only by considering a critical molecular design parameter: the normalized effective binding energy ΔGbind,eff/Neff, i.e. the performance of each active individual dendrimer branch directly involved in a binding interaction. Electronic supplementary information (ESI) available: Additional figures and tables. See DOI: 10.1039/c4nr04510f

  20. Sex determination of bovine preimplantation embryos by oligonucleotide microarray.

    PubMed

    Yang, Hua; Zhong, Fagang; Yang, Yonglin; Wang, Xinhua; Liu, Shouren; Zhu, Bin

    2013-06-01

    The aim has been to set up a rapid and accurate microarray assay using sandwich mode for sex determination of bovine preimplantation embryos. Twelve sequence-specific oligonucleotide capture probes used to discriminate 12 samples were spotted onto the aldehyde-modified glass slides by Arrayer. The 2 recognition probes used to identify coding regions of the sex-determining region of the Y chromosome gene (SRY) and β-casein (CSN2) reference gene were coupled with biotin. The assay was optimized by using genomic DNA extracted from blood samples of known sex individuals. Polymerase chain reaction (PCR) was used to amplify the fragments in the HMG box region of SRY gene and CSN2 gene with sequence-specific primers. The sex of samples was identified by detecting both the SRY and CSN2 genes simultaneously in 2 reaction cells of microarrays, with the male having SRY and CSN2 signals and the female only CSN2. The sex of 20 bovine preimplantation embryos was determined by oligonucleotide microarray. The protocol was run with a blind test that showed a 100% (82/82) specificity and accuracy in sexing of leukocytes. The bovine embryos were transferred into 20 bovine recipients, with a pregnant rate of 40% (8/20). Three calves were born at term, and 5 fetuses were miscarried. Their sexes were fully in accordance with the embryonic sex predetermination predicted by oligonucleotide microarray. This suggests that the oligonucleotide microarray method of SRY gene analysis can be used in early sex prediction of bovine embryos in breeding programs.

  1. Serotyping of Human Group A Rotavirus with Oligonucleotide Probes

    DTIC Science & Technology

    1990-01-01

    Cold Spring Harbor , other oligonucleotides, HuG8Ac and HuG9Ac...HuG8Ac (5’ NY: Cold Spring Harbor Laboratory, 1988;5l1-159 CGA ACT ATC TUC TAT CTC TGT CTC T 3’) was based 9. Bastardo JW, McKimm-Bresckin JL, Sonza...Coulson BS, Unicomb LE, Pitson GA, Bishop RE Simple and specific manual. Cold Spring Harbor , NY Cold Spring Harbor Laboratory. enzyme

  2. The Design of Oligonucleotides Which Attack Specific Gene Targets

    DTIC Science & Technology

    1989-12-08

    identify by block number) FIELD GROUP SUB-GROUP ’" DNA Recognition; 06 03 Triplet helix formation, <r: " 19 ABSTRACT (Continue on reverse if necessary and...Such local triplet bonding schemes give rise to H bonding between the triplex forming oligonucleotide and the purine of the underlying Watson Crick ...identify by block number) During the first year of Navy support, we have refined our understanding of triple helix formation and in the process, have

  3. Does phosphate enhance the natural attenuation of crude oil in groundwater under defined redox conditions?

    NASA Astrophysics Data System (ADS)

    Ponsin, Violaine; Mouloubou, Olsen Raïnness; Prudent, Pascale; Höhener, Patrick

    2014-11-01

    After a crude oil spill caused by a broken pipeline in 2009 to a gravel aquifer in southern France, degradation processes under various redox conditions progressively established, but at rates that predict a long life-time of the source under natural attenuation after partial source removal. In this study, we aimed at identifying the rate-limiting factors for each redox condition, with special emphasis on phosphate as limiting nutrient. The study was conducted in laboratory microcosms assembled with material collected on site: sediments, water from monitoring wells, oil and microbial sludge. Redox conditions were promoted by adding electron acceptors (either oxygen, nitrate, limonite (FeO(OH)), cryptomelane (K(Mn4 +,Mn2 +)8O16), or sulfate). For each condition, the role of phosphate was studied by repeated additions for up to 290 days. The results showed a very strong stimulation of aerobic and denitrifying rates of oil degradation by phosphate, provided that oxygen and nitrate were repeatedly supplied. Phosphate caused also a marked stimulation of methanogenic degradation, and a relatively small stimulation of metal reduction. These anaerobic processes started only after marked lag phases, and phosphate shortened the lag phase for methanogenic degradation. Degradation of aromatic and aliphatic hydrocarbons with less than 8 carbons, including benzene, was confirmed even under unstimulated conditions. It is concluded that degradation rates at the site are limited by both, availability of electron acceptors and availability of phosphate needed for promoting microbial growth.

  4. Oligonucleotide Frequencies of Barcoding Loci Can Discriminate Species across Kingdoms

    PubMed Central

    Shukla, Virendra; Tuli, Rakesh

    2010-01-01

    Background DNA barcoding refers to the use of short DNA sequences for rapid identification of species. Genetic distance or character attributes of a particular barcode locus discriminate the species. We report an efficient approach to analyze short sequence data for discrimination between species. Methodology and Principal Findings A new approach, Oligonucleotide Frequency Range (OFR) of barcode loci for species discrimination is proposed. OFR of the loci that discriminates between species was characteristic of a species, i.e., the maxima and minima within a species did not overlap with that of other species. We compared the species resolution ability of different barcode loci using p-distance, Euclidean distance of oligonucleotide frequencies, nucleotide-character based approach and OFR method. The species resolution by OFR was either higher or comparable to the other methods. A short fragment of 126 bp of internal transcribed spacer region in ribosomal RNA gene was sufficient to discriminate a majority of the species using OFR. Conclusions/Significance Oligonucleotide frequency range of a barcode locus can discriminate between species. Ability to discriminate species using very short DNA fragments may have wider applications in forensic and conservation studies. PMID:20808837

  5. Recursive construction of perfect DNA molecules from imperfect oligonucleotides.

    PubMed

    Linshiz, Gregory; Yehezkel, Tuval Ben; Kaplan, Shai; Gronau, Ilan; Ravid, Sivan; Adar, Rivka; Shapiro, Ehud

    2008-01-01

    Making faultless complex objects from potentially faulty building blocks is a fundamental challenge in computer engineering, nanotechnology and synthetic biology. Here, we show for the first time how recursion can be used to address this challenge and demonstrate a recursive procedure that constructs error-free DNA molecules and their libraries from error-prone oligonucleotides. Divide and Conquer (D&C), the quintessential recursive problem-solving technique, is applied in silico to divide the target DNA sequence into overlapping oligonucleotides short enough to be synthesized directly, albeit with errors; error-prone oligonucleotides are recursively combined in vitro, forming error-prone DNA molecules; error-free fragments of these molecules are then identified, extracted and used as new, typically longer and more accurate, inputs to another iteration of the recursive construction procedure; the entire process repeats until an error-free target molecule is formed. Our recursive construction procedure surpasses existing methods for de novo DNA synthesis in speed, precision, amenability to automation, ease of combining synthetic and natural DNA fragments, and ability to construct designer DNA libraries. It thus provides a novel and robust foundation for the design and construction of synthetic biological molecules and organisms.

  6. G-Quadruplex Forming Oligonucleotides as Anti-HIV Agents.

    PubMed

    Musumeci, Domenica; Riccardi, Claudia; Montesarchio, Daniela

    2015-09-22

    Though a variety of different non-canonical nucleic acids conformations have been recognized, G-quadruplex structures are probably the structural motifs most commonly found within known oligonucleotide-based aptamers. This could be ascribed to several factors, as their large conformational diversity, marked responsiveness of their folding/unfolding processes to external stimuli, high structural compactness and chemo-enzymatic and thermodynamic stability. A number of G-quadruplex-forming oligonucleotides having relevant in vitro anti-HIV activity have been discovered in the last two decades through either SELEX or rational design approaches. Improved aptamers have been obtained by chemical modifications of natural oligonucleotides, as terminal conjugations with large hydrophobic groups, replacement of phosphodiester linkages with phosphorothioate bonds or other surrogates, insertion of base-modified monomers, etc. In turn, detailed structural studies have elucidated the peculiar architectures adopted by many G-quadruplex-based aptamers and provided insight into their mechanism of action. An overview of the state-of-the-art knowledge of the relevance of putative G-quadruplex forming sequences within the viral genome and of the most studied G-quadruplex-forming aptamers, selectively targeting HIV proteins, is here presented.

  7. Gene expression profiling in peanut using high density oligonucleotide microarrays

    PubMed Central

    Payton, Paxton; Kottapalli, Kameswara Rao; Rowland, Diane; Faircloth, Wilson; Guo, Baozhu; Burow, Mark; Puppala, Naveen; Gallo, Maria

    2009-01-01

    Background Transcriptome expression analysis in peanut to date has been limited to a relatively small set of genes and only recently has a significant number of ESTs been released into the public domain. Utilization of these ESTs for oligonucleotide microarrays provides a means to investigate large-scale transcript responses to a variety of developmental and environmental signals, ultimately improving our understanding of plant biology. Results We have developed a high-density oligonucleotide microarray for peanut using 49,205 publicly available ESTs and tested the utility of this array for expression profiling in a variety of peanut tissues. To identify putatively tissue-specific genes and demonstrate the utility of this array for expression profiling in a variety of peanut tissues, we compared transcript levels in pod, peg, leaf, stem, and root tissues. Results from this experiment showed 108 putatively pod-specific/abundant genes, as well as transcripts whose expression was low or undetected in pod compared to peg, leaf, stem, or root. The transcripts significantly over-represented in pod include genes responsible for seed storage proteins and desiccation (e.g., late-embryogenesis abundant proteins, aquaporins, legumin B), oil production, and cellular defense. Additionally, almost half of the pod-abundant genes represent unknown genes allowing for the possibility of associating putative function to these previously uncharacterized genes. Conclusion The peanut oligonucleotide array represents the majority of publicly available peanut ESTs and can be used as a tool for expression profiling studies in diverse tissues. PMID:19523230

  8. Microarray oligonucleotide probe designer (MOPeD): A web service.

    PubMed

    Patel, Viren C; Mondal, Kajari; Shetty, Amol Carl; Horner, Vanessa L; Bedoyan, Jirair K; Martin, Donna; Caspary, Tamara; Cutler, David J; Zwick, Michael E

    2010-11-01

    Methods of genomic selection that combine high-density oligonucleotide microarrays with next-generation DNA sequencing allow investigators to characterize genomic variation in selected portions of complex eukaryotic genomes. Yet choosing which specific oligonucleotides to be use can pose a major technical challenge. To address this issue, we have developed a software package called MOPeD (Microarray Oligonucleotide Probe Designer), which automates the process of designing genomic selection microarrays. This web-based software allows individual investigators to design custom genomic selection microarrays optimized for synthesis with Roche NimbleGen's maskless photolithography. Design parameters include uniqueness of the probe sequences, melting temperature, hairpin formation, and the presence of single nucleotide polymorphisms. We generated probe databases for the human, mouse, and rhesus macaque genomes and conducted experimental validation of MOPeD-designed microarrays in human samples by sequencing the human X chromosome exome, where relevant sequence metrics indicated superior performance relative to a microarray designed by the Roche NimbleGen proprietary algorithm. We also performed validation in the mouse to identify known mutations contained within a 487-kb region from mouse chromosome 16, the mouse chromosome 16 exome (1.7 Mb), and the mouse chromosome 12 exome (3.3 Mb). Our results suggest that the open source MOPeD software package and website (http://moped.genetics.emory.edu/) will make a valuable resource for investigators in their sequence-based studies of complex eukaryotic genomes.

  9. Therapeutic Antisense Oligonucleotides against Cancer: Hurdling to the Clinic

    NASA Astrophysics Data System (ADS)

    Moreno, Pedro; Pêgo, Ana

    2014-10-01

    Under clinical development since the early 90’s and with two successfully approved drugs (Fomivirsen and Mipomersen), oligonucleotide-based therapeutics have not yet delivered a clinical drug to the market in the cancer field. Whilst many pre-clinical data has been generated, a lack of understanding still exists on how to efficiently tackle all the different challenges presented for cancer targeting in a clinical setting. Namely, effective drug vectorization, careful choice of target gene or synergistic multi-gene targeting are surely decisive, while caution must be exerted to avoid potential toxic, often misleading off-target-effects. Here a brief overview will be given on the nucleic acid chemistry advances that established oligonucleotide technologies as a promising therapeutic alternative and ongoing cancer related clinical trials. Special attention will be given towards a perspective on the hurdles encountered specifically in the cancer field by this class of therapeutic oligonucleotides and a view on possible avenues for success is presented, with particular focus on the contribution from nanotechnology to the field.

  10. More than charged base loss--revisiting the fragmentation of highly charged oligonucleotides.

    PubMed

    Nyakas, Adrien; Eberle, Rahel P; Stucki, Silvan R; Schürch, Stefan

    2014-07-01

    Tandem mass spectrometry is a well-established analytical tool for rapid and reliable characterization of oligonucleotides (ONs) and their gas-phase dissociation channels. The fragmentation mechanisms of native and modified nucleic acids upon different mass spectrometric activation techniques have been studied extensively, resulting in a comprehensive catalogue of backbone fragments. In this study, the fragmentation behavior of highly charged oligodeoxynucleotides (ODNs) comprising up to 15 nucleobases was investigated. It was found that ODNs exhibiting a charge level (ratio of the actual to the total possible charge) of 100% follow significantly altered dissociation pathways compared with low or medium charge levels if a terminal pyrimidine base (3' or 5') is present. The corresponding product ion spectra gave evidence for the extensive loss of a cyanate anion (NCO(-)), which frequently coincided with the abstraction of water from the 3'- and 5'-end in the presence of a 3'- and 5'-terminal pyrimidine nucleobase, respectively. Subsequent fragmentation of the M-NCO(-) ion by MS(3) revealed a so far unreported consecutive excision of a metaphosphate (PO3 (-))-ion for the investigated sequences. Introduction of a phosphorothioate group allowed pinpointing of PO3 (-) loss to the ultimate phosphate group. Several dissociation mechanisms for the release of NCO(-) and a metaphosphate ion were proposed and the validity of each mechanism was evaluated by the analysis of backbone- or sugar-modified ONs.

  11. [Prebiotic phosphate: a problem insoluble in water ? ].

    PubMed

    Morchio, Renzo; Traverso, Silvano

    2005-01-01

    It is well-known that in water phosphate readily reacts with calcium, precipitating as insoluble apatite. How phosphorus could have been available for prebiotic reactions is still an open problem. We suggest that phosphorus-containing compounds might have accumulated in a hydrophobic medium, since the absence of calcium ions would have prevented them from precipitating as apatite. Hydrophobic compounds may have been synthesized on the early Earth through the polymerization of methane or through Fischer-Tropsch-type reactions. Moreover, hydrophobic compounds would have been delivered to the early Earth by extraterrestrial infall. In previous articles (Morchio and Traverso [1999], Morchio et al. [2001]) we suggested that such hydrophobic material would have formed a hydrophobic layer on the surface of the sea, which would have provided an environment thermodynamically more suitable than water for the concentration and polymerization of organic molecules fundamental to life, particularly amino acids and (pyrimidine) bases. It may be hypothesized that elemental phosphorus or phosphorus-containing compounds (such as phosphite) deriving from volcanic eruptions would have ended up raining down into the hydrophobic layer, accumulating due to the absence of calcium ions, in an environment protected against hydrolysis. Phosphorus-containing compounds might have interacted with hydrophobic molecules in the layer giving rise to polymers. In particular, phosphite might have reacted with the hydrophobic amino acids, giving rise to phosphoamino acids, which, in turn, might have interacted with pyrimidine bases (relatively abundant in the layer) giving rise to peptides and oligonucleotide-like polymers. Indeed, it has been experimentally shown (Zhou et al. [1996]) that, in an anhydrous organic medium (pyridine), dialkilphosphite reacts with amino acids to form phosphoamino acids, which interact with pyrimidine nucleosides to give nucleotides, short oligonucleotides and phosphoryl

  12. Mechanisms of electron acceptor utilization: Implications for simulating anaerobic biodegradation

    USGS Publications Warehouse

    Schreiber, M.E.; Carey, G.R.; Feinstein, D.T.; Bahr, J.M.

    2004-01-01

    Simulation of biodegradation reactions within a reactive transport framework requires information on mechanisms of terminal electron acceptor processes (TEAPs). In initial modeling efforts, TEAPs were approximated as occurring sequentially, with the highest energy-yielding electron acceptors (e.g. oxygen) consumed before those that yield less energy (e.g., sulfate). Within this framework in a steady state plume, sequential electron acceptor utilization would theoretically produce methane at an organic-rich source and Fe(II) further downgradient, resulting in a limited zone of Fe(II) and methane overlap. However, contaminant plumes often display much more extensive zones of overlapping Fe(II) and methane. The extensive overlap could be caused by several abiotic and biotic processes including vertical mixing of byproducts in long-screened monitoring wells, adsorption of Fe(II) onto aquifer solids, or microscale heterogeneity in Fe(III) concentrations. Alternatively, the overlap could be due to simultaneous utilization of terminal electron acceptors. Because biodegradation rates are controlled by TEAPs, evaluating the mechanisms of electron acceptor utilization is critical for improving prediction of contaminant mass losses due to biodegradation. Using BioRedox-MT3DMS, a three-dimensional, multi-species reactive transport code, we simulated the current configurations of a BTEX plume and TEAP zones at a petroleum- contaminated field site in Wisconsin. Simulation results suggest that BTEX mass loss due to biodegradation is greatest under oxygen-reducing conditions, with smaller but similar contributions to mass loss from biodegradation under Fe(III)-reducing, sulfate-reducing, and methanogenic conditions. Results of sensitivity calculations document that BTEX losses due to biodegradation are most sensitive to the age of the plume, while the shape of the BTEX plume is most sensitive to effective porosity and rate constants for biodegradation under Fe(III)-reducing and

  13. Oligonucleotide probes containing pyrimidine analogs reveal diminished hydrogen bonding capacity of the DNA adduct O⁶-methyl-G in DNA duplexes.

    PubMed

    Angelov, Todor; Dahlmann, Heidi A; Sturla, Shana J

    2013-10-15

    Oligonucleotide hybridization probes containing nucleoside analogs offer a potential strategy for binding specific DNA sequences that bear pro-mutagenic O(6)-G alkylation adducts. To optimize O(6)-Me-G-targeting probes, an understanding of how base pairs with O(6)-Me-G are stabilized is needed. In this study, we compared the ability of O(6)-Me-G and G to hydrogen bond with three pyrimidine-like nucleobases (Z, 4-thio-U, and 3-deaza-C) bearing varied hydrogen bond donor and acceptor groups. We found that duplexes containing the pyrimidine analog nucleoside:G pairs were more thermodynamically stable than those containing pyrimidine analog nucleoside:O(6)-alkyl-G pairs. Thus, hydrogen bonding alone was not sufficient to impart selectivity to probes that target O(6)-G alkylation adducts in DNA.

  14. Synthesis of triazole-linked oligonucleotides with high affinity to DNA complements and an analysis of their compatibility with biosystems.

    PubMed

    Varizhuk, Anna M; Kaluzhny, Dmitry N; Novikov, Roman A; Chizhov, Alexandr O; Smirnov, Igor P; Chuvilin, Andrey N; Tatarinova, Olga N; Fisunov, Gleb Y; Pozmogova, Galina E; Florentiev, Vladimir L

    2013-06-21

    New oligonucleotide analogues with triazole internucleotide linkages were synthesized, and their hybridization properties were studied. The analogues demonstrated DNA binding affinities similar to those of unmodified oligonucleotides. The modification was shown to protect the oligonucleotides from nuclease hydrolysis. The modified oligonucleotides were tested as PCR primers. Modifications remote from the 3'-terminus were tolerated by polymerases. Our results suggest that these new oligonucleotide analogues are among the most promising triazole DNA mimics characterized to date.

  15. Static magnetic field reduced exogenous oligonucleotide uptake by spermatozoa using magnetic nanoparticle gene delivery system

    NASA Astrophysics Data System (ADS)

    Katebi, Samira; Esmaeili, Abolghasem; Ghaedi, Kamran

    2016-03-01

    Spermatozoa could introduce exogenous oligonucleotides of interest to the oocyte. The most important reason of low efficiency of sperm mediated gene transfer (SMGT) is low uptake of exogenous DNA by spermatozoa. The aim of this study was to evaluate the effects of static magnetic field on exogenous oligonucleotide uptake of spermatozoa using magnetofection method. Magnetic nanoparticles (MNPs) associated with the labeled oligonucleotides were used to increase the efficiency of exogenous oligonucleotide uptake by rooster spermatozoa. We used high-field/high-gradient magnet (NdFeB) to enhance and accelerate exogenous DNA sedimentation at the spermatozoa surface. Flow cytometry analysis was performed to measure viability and percentage of exogenous oligonucleotide uptake by sperm. Flow cytometry analysis showed a significant increase in exogenous oligonucleotide uptake by rooster spermatozoa (P<0.001) when spermatozoa were incubated in exogenous oligonucleotide solution and MNPs. However, by applying static magnetic field during magnetofection method, a significant decrease in exogenous oligonucleotide uptake was observed (P<0.05). Findings of this study showed that MNPs were effective to increase exogenous oligonucleotide uptake by rooster spermatozoa; however unlike others studies, static magnetic field, was not only ineffective to enhance exogenous oligonucleotide uptake by rooster spermatozoa but also led to reduction in efficiency of magnetic nanoparticles in gene transfer.

  16. PHOSPHATE MANAGEMENT: FY2010 RESULTS OF PHOSPHATE PRECIPITATION TESTS

    SciTech Connect

    Hay, M.; King, W.

    2011-04-04

    The Phosphate Management program seeks to develop treatment options for caustic phosphate solutions resulting from the caustic leaching of the bismuth phosphate sludge. The SRNL subtask investigated the precipitation of phosphate salts from caustic solutions through addition of fluoride and by crystallization. The scoping tests examined the: precipitation of phosphate by the addition of sodium fluoride to form the sodium fluorophosphate double salt, Na{sub 7}F(PO{sub 4}){sub 2} {center_dot} 19H{sub 2}O, crystallization of phosphate by reducing the temperature of saturated phosphate solutions, and combinations of precipitation and crystallization. A simplified leachate simulant was used in the study produced by dissolving sodium phosphate in 1 M to 3.5 M sodium hydroxide solutions. The results show that all three processes; precipitation with sodium fluoride, crystallization, and combined precipitation/crystallization can be effective for removing large amounts of phosphate from solution. The combined process of precipitation/crystallization showed >90% removal of phosphate at all hydroxide concentrations when cooling a non-saturated phosphate solution from 65 C to 25 C. Based on the measured solubility of sodium phosphate, pH adjustment/caustic addition will also remove large amounts of phosphate from solution (>80%). For all three processes, the phosphate concentration in the caustic solution must be managed to keep the phosphate from becoming too concentrated and thereby potentially forming a solid mass of sodium phosphate after an effective phosphate removal process.

  17. Fused Nonacyclic Electron Acceptors for Efficient Polymer Solar Cells.

    PubMed

    Dai, Shuixing; Zhao, Fuwen; Zhang, Qianqian; Lau, Tsz-Ki; Li, Tengfei; Liu, Kuan; Ling, Qidan; Wang, Chunru; Lu, Xinhui; You, Wei; Zhan, Xiaowei

    2017-01-25

    We design and synthesize four fused-ring electron acceptors based on 6,6,12,12-tetrakis(4-hexylphenyl)-indacenobis(dithieno[3,2-b;2',3'-d]thiophene) as the electron-rich unit and 1,1-dicyanomethylene-3-indanones with 0-2 fluorine substituents as the electron-deficient units. These four molecules exhibit broad (550-850 nm) and strong absorption with high extinction coefficients of (2.1-2.5) × 10(5) M(-1) cm(-1). Fluorine substitution downshifts the LUMO energy level, red-shifts the absorption spectrum, and enhances electron mobility. The polymer solar cells based on the fluorinated electron acceptors exhibit power conversion efficiencies as high as 11.5%, much higher than that of their nonfluorinated counterpart (7.7%). We investigate the effects of the fluorine atom number and position on electronic properties, charge transport, film morphology, and photovoltaic properties.

  18. An organic donor/acceptor lateral superlattice at the nanoscale.

    PubMed

    Otero, Roberto; Ecija, David; Fernandez, Gustavo; Gallego, José María; Sanchez, Luis; Martín, Nazario; Miranda, Rodolfo

    2007-09-01

    A precise control of the nanometer-scale morphology in systems containing mixtures of donor/acceptor molecules is a key factor to improve the efficiency of organic photovoltaic devices. Here we report on a scanning tunneling microscopy study of the first stages of growth of 2-[9-(1,3-dithiol-2-ylidene)anthracen-10(9H)-ylidene]-1,3-dithiole, as electron donor, and phenyl-C61-butyric acid methyl ester, as electron acceptor, on a Au(111) substrate under ultrahigh vacuum conditions. Due to differences in bonding strength with the substrate and different interactions with the Au(111) herringbone surface reconstruction, mixed thin films spontaneously segregate into a lateral superlattice of interdigitated nanoscale stripes with a characteristic width of about 10-20 nm, a morphology that has been predicted to optimize the efficiency of organic solar cells.

  19. Cross-conjugated chromophores: synthesis of iso-polydiacetylenes with Donor/Acceptor substitution

    PubMed

    Ciulei; Tykwinski

    2000-11-16

    The iterative construction of cross-conjugated donor (D), acceptor (A), and donor-acceptor (D-A) substituted iso-polydiacetylene (iso-PDA) oligomers has been achieved utilizing palladium-catalyzed cross-coupling techniques. Structure-property relationships for these compounds have been analyzed for cross-conjugated pi-electronic communication as a result of contributions from donor, acceptor, or donor-acceptor functionalization.

  20. Free Carrier Generation in Organic Photovoltaic Bulk Heterojunctions of Conjugated Polymers with Molecular Acceptors: Planar versus Spherical Acceptors

    SciTech Connect

    Nardes, Alexandre M.; Ferguson, Andrew J.; Wolfer, Pascal; Gui, Kurt; Burn, Paul L.; Meredith, Paul; Kopidakis, Nikos

    2014-03-05

    We present a comparative study of the photophysical performance of the prototypical fullerene derivative PC61BM with a planar small-molecule acceptor in an organic photovoltaic device. The small-molecule planar acceptor is 2-[{7-(9,9-di-n-propyl-9H-fluoren-2-yl)benzo[c][1,2,5]thiadiazol-4-yl}methylene]malononitrile, termed K12. We discuss photoinduced free charge-carrier generation and transport in blends of PC61BM or K12 with poly(3-n-hexylthiophene) (P3HT), surveying literature results for P3HT:PC61BM and presenting new results on P3HT:K12. For both systems we also review previous work on film structure and correlate the structural and photophysical results. In both cases, a disordered mixed phase is formed between P3HT and the acceptor, although the photophysical properties of this mixed phase differ markedly for PC61BM and K12. In the case of PC61BM the mixed phase acts as a free carrier generation region that can efficiently shuttle carriers to the pure polymer and fullerene domains. As a result, the vast majority of excitons quenched in P3HT:PC61BM blends yield free carriers detected by the contactless time-resolved microwave conductivity (TRMC) method. In contrast, approximately 85 % of the excitons quenched in P3HT:K12 do not result in free carriers over the nanosecond timescale of the TRMC experiment. We attribute this to poor electron-transport properties in the mixed P3HT:K12 phase. Here, we propose that the observed differences can be traced to the respective shapes of PC61BM and K12: the three-dimensional nature of the fullerene cage facilitates coupling between PC61BM molecules irrespective of their relative orientation, whereas for K12 strong electronic coupling is only expected for molecules oriented with their π systems parallel to each other. Comparison between the eutectic compositions of the P3HT:PC61BM and P3HT:K12 shows that the former contains enough fullerene to form a percolation pathway for electrons, whereas the latter contains a sub

  1. Engineered oligosaccharyltransferases with greatly relaxed acceptor site specificity

    PubMed Central

    Ollis, Anne A.; Zhang, Sheng; Fisher, Adam C.; DeLisa, Matthew P.

    2015-01-01

    The Campylobacter jejuni protein glycosylation locus (pgl) encodes machinery for asparagine-linked (N-linked) glycosylation and serves as the archetype for bacterial N-glycosylation. This machinery has been functionally transferred into Escherichia coli, thereby enabling convenient mechanistic dissection of the N-glycosylation process in this genetically tractable host. Here, we sought to identify sequence determinants in the oligosaccharyltransferase PglB that restrict its specificity to only those glycan acceptor sites containing a negatively charged residue at the −2 position relative to asparagine. This involved creation of a genetic assay named glycoSNAP (glycosylation of secreted N-linked acceptor proteins) that facilitates high-throughput screening of glycophenotypes in E. coli. Using this assay, we isolated several C. jejuni PglB variants that were capable of glycosylating an array of noncanonical acceptor sequences including one in a eukaryotic N-glycoprotein. Collectively, these results underscore the utility of glycoSNAP for shedding light on poorly understood aspects of N-glycosylation and for engineering designer N-glycosylation biocatalysts. PMID:25129029

  2. Income-generating activities for family planning acceptors.

    PubMed

    1989-07-01

    The Income Generating Activities program for Family Planning Acceptors was introduced in Indonesia in 1979. Capital input by the Indonesian National Family Planning Coordination Board and the UN Fund for Population Activities was used to set up small businesses by family planning acceptors. In 2 years, when the businesses become self-sufficient, the loans are repaid, and the money is used to set up new family planning acceptors in business. The program strengthens family planning acceptance, improves the status of women, and enhances community self-reliance. The increase in household income generated by the program raises the standards of child nutrition, encourages reliance on the survival of children, and decreases the value of large families. Approximately 18,000 Family Planning-Income Generating Activities groups are now functioning all over Indonesia, with financial assistance from the central and local governments, the World Bank, the US Agency for International Development, the UN Population Fund, the Government of the Netherlands, and the Government of Australia through the Association of South East Asian Nations.

  3. Design directed self-assembly of donor-acceptor polymers.

    PubMed

    Marszalek, Tomasz; Li, Mengmeng; Pisula, Wojciech

    2016-09-21

    Donor-acceptor polymers with an alternating array of donor and acceptor moieties have gained particular attention during recent years as active components of organic electronics. By implementation of suitable subunits within the conjugated backbone, these polymers can be made either electron-deficient or -rich. Additionally, their band gap and light absorption can be precisely tuned for improved light-harvesting in solar cells. On the other hand, the polymer design can also be modified to encode the desired supramolecular self-assembly in the solid-state that is essential for an unhindered transport of charge carriers. This review focuses on three major factors playing a role in the assembly of donor-acceptor polymers on surfaces which are (1) nature, geometry and substitution position of solubilizing alkyl side chains, (2) shape of the conjugated polymer defined by the backbone curvature, and (3) molecular weight which determines the conjugation length of the polymer. These factors adjust the fine balance between attractive and repulsive forces and ensure a close polymer packing important for an efficient charge hopping between neighboring chains. On the microscopic scale, an appropriate domain formation with a low density of structural defects in the solution deposited thin film is crucial for the charge transport. The charge carrier transport through such thin films is characterized by field-effect transistors as basic electronic elements.

  4. Quantum dots as FRET acceptors for highly sensitive multiplexing immunoassays

    NASA Astrophysics Data System (ADS)

    Geissler, Daniel; Hildebrandt, Niko; Charbonnière, Loïc J.; Ziessel, Raymond F.; Löhmannsröben, Hans-Gerd

    2009-02-01

    Homogeneous immunoassays have the benefit that they do not require any time-consuming separation steps. FRET is one of the most sensitive homogeneous methods used for immunoassays. Due to their extremely strong absorption over a broad wavelength range the use of quantum dots as FRET acceptors allows for large Foerster radii, an important advantage for assays in the 5 to 10 nm distance range. Moreover, because of their size-tunable emission, quantum dots of different sizes can be used with a single donor for the detection of different analytes (multiplexing). As the use of organic dyes with short fluorescence decay times as donors is known to be inefficient with quantum dot acceptors, lanthanide complexes with long luminescence decays are very efficient alternatives. In this contribution we present the application of commercially available biocompatible CdSe/ZnS core/shell quantum dots as multiplexing FRET acceptors together with a single terbium complex as donor in a homogeneous immunoassay system. Foerster radii of 10 nm and FRET efficiencies of 75 % are demonstrated. The high sensitivity of the terbium-toquantum dot FRET assay is shown by sub-100-femtomolar detection limits for two different quantum dots (emitting at 605 and 655 nm) within the same biotin-streptavidin assay. Direct comparison to the FRET immunoassay "gold standard" (FRET from Eu-TBP to APC) yields a three orders of magnitude sensitivity improvement, demonstrating the big advantages of quantum dots not only for multiplexing but also for highly sensitive nanoscale analysis.

  5. Fullerene derivatives as electron acceptors for organic photovoltaic cells.

    PubMed

    Mi, Dongbo; Kim, Ji-Hoon; Kim, Hee Un; Xu, Fei; Hwang, Do-Hoon

    2014-02-01

    Energy is currently one of the most important problems humankind faces. Depletion of traditional energy sources such as coal and oil results in the need to develop new ways to create, transport, and store electricity. In this regard, the sun, which can be considered as a giant nuclear fusion reactor, represents the most powerful source of energy available in our solar system. For photovoltaic cells to gain widespread acceptance as a source of clean and renewable energy, the cost per watt of solar energy must be decreased. Organic photovoltaic cells, developed in the past two decades, have potential as alternatives to traditional inorganic semiconductor photovoltaic cells, which suffer from high environmental pollution and energy consumption during production. Organic photovoltaic cells are composed of a blended film of a conjugated-polymer donor and a soluble fullerene-derivative acceptor sandwiched between a poly(3,4-ethylenedioxythiophene):poly(styrenesulfonate)-coated indium tin oxide positive electrode and a low-work-function metal negative electrode. Considerable research efforts aim at designing and synthesizing novel fullerene derivatives as electron acceptors with up-raised lowest unoccupied molecular orbital energy, better light-harvesting properties, higher electron mobility, and better miscibility with the polymer donor for improving the power conversion efficiency of the organic photovoltaic cells. In this paper, we systematically review novel fullerene acceptors synthesized through chemical modification for enhancing the photovoltaic performance by increasing open-circuit voltage, short-circuit current, and fill factor, which determine the performance of organic photovoltaic cells.

  6. 2012 ELECTRON DONOR-ACCEPTOR INTERACTIONS GORDON RESEARCH CONFERENCE, AUGUST 5-10, 2012

    SciTech Connect

    McCusker, James

    2012-08-10

    The upcoming incarnation of the Gordon Research Conference on Electron Donor Acceptor Interactions will feature sessions on classic topics including proton-coupled electron transfer, dye-sensitized solar cells, and biological electron transfer, as well as emerging areas such as quantum coherence effects in donor-acceptor interactions, spintronics, and the application of donor-acceptor interactions in chemical synthesis.

  7. Toward an on-chip multiplexed nucleic acid hybridization assay using immobilized quantum dot-oligonucleotide conjugates and fluorescence resonance energy transfer

    NASA Astrophysics Data System (ADS)

    Tavares, Anthony J.; Noor, M. Omair; Algar, W. Russ; Vannoy, Charles H.; Chen, Lu; Krull, Ulrich J.

    2011-03-01

    Semiconductor quantum dots (QD) are a class of NP with photophysical properties that are ideally suited for optical multiplexing and use as donors in fluorescence resonance energy transfer (FRET). A new strategy is presented for the development of multiplexed DNA hybridization assays using immobilized QDs in a microfluidic system. Green- or red-emitting QDs were immobilized via self-assembly with a multidentate-thiol-derivatized glass slide, and subsequently conjugated with amine-terminated probe oligonucleotides using carbodiimide activation. Immobilized QD-probe conjugates were then passivated with adsorbed non-complementary oligonucleotides to achieve selectivity in microfluidic assays. Target nucleic acid sequences hybridized with QD-probe conjugates and were labeled with Cy3 or Alexa Fluor 647 as acceptor dyes for the QD donors, where FRET-sensitized dye emission provided a signal for the detection of picomolar quantities of target. The simultaneous immobilization of green- and red-emitting QDs at different ratios within a microfluidic channel was demonstrated as a step toward multiplexed assays.

  8. Spectral, thermal and kinetic studies of charge-transfer complexes formed between the highly effective antibiotic drug metronidazole and two types of acceptors: σ- and π-acceptors.

    PubMed

    Refat, Moamen S; Saad, Hosam A; Adam, Abdel Majid A

    2015-04-15

    Understanding the interaction between drugs and small inorganic or organic molecules is critical in being able to interpret the drug-receptor interactions and acting mechanism of these drugs. A combined solution and solid state study was performed to describe the complexation chemistry of drug metronidazole (MZ) which has a broad-spectrum antibacterial activity with two types of acceptors. The acceptors include, σ-acceptor (i.e., iodine) and π-acceptors (i.e., dichlorodicyanobenzoquinone (DDQ), chloranil (CHL) and picric acid (PA)). The molecular structure, spectroscopic characteristics, the binding modes as well as the thermal stability were deduced from IR, UV-vis, (1)H NMR and thermal studies. The binding ratio of complexation (MZ: acceptor) was determined to be 1:2 for the iodine acceptor and 1:1 for the DDQ, CHL or PA acceptor, according to the CHN elemental analyses and spectrophotometric titrations. It has been found that the complexation with CHL and PA acceptors increases the values of enthalpy and entropy, while the complexation with DDQ and iodine acceptors decreases the values of these parameters compared with the free MZ donor.

  9. Spectral, thermal and kinetic studies of charge-transfer complexes formed between the highly effective antibiotic drug metronidazole and two types of acceptors: σ- and π-acceptors

    NASA Astrophysics Data System (ADS)

    Refat, Moamen S.; Saad, Hosam A.; Adam, Abdel Majid A.

    2015-04-01

    Understanding the interaction between drugs and small inorganic or organic molecules is critical in being able to interpret the drug-receptor interactions and acting mechanism of these drugs. A combined solution and solid state study was performed to describe the complexation chemistry of drug metronidazole (MZ) which has a broad-spectrum antibacterial activity with two types of acceptors. The acceptors include, σ-acceptor (i.e., iodine) and π-acceptors (i.e., dichlorodicyanobenzoquinone (DDQ), chloranil (CHL) and picric acid (PA)). The molecular structure, spectroscopic characteristics, the binding modes as well as the thermal stability were deduced from IR, UV-vis, 1H NMR and thermal studies. The binding ratio of complexation (MZ: acceptor) was determined to be 1:2 for the iodine acceptor and 1:1 for the DDQ, CHL or PA acceptor, according to the CHN elemental analyses and spectrophotometric titrations. It has been found that the complexation with CHL and PA acceptors increases the values of enthalpy and entropy, while the complexation with DDQ and iodine acceptors decreases the values of these parameters compared with the free MZ donor.

  10. Investigation of the structural organization of cationic nanoemulsion/antisense oligonucleotide complexes.

    PubMed

    Bruxel, Fernanda; Vilela, José Mario Carneiro; Andrade, Margareth Spangler; Malachias, Ângelo; Perez, Carlos A; Magalhães-Paniago, Rogério; Oliveira, Mônica Cristina; Teixeira, Helder F

    2013-12-01

    Atomic force microscopy image analysis and energy dispersive X-ray diffraction experiments were used to investigate the structural organization of cationic nanoemulsion/oligonucleotide complexes. Oligonucleotides targeting topoisomerase II gene were adsorbed on cationic nanoemulsions obtained by means of spontaneous emulsification procedure. Topographical analysis by atomic force microscopy allowed the observation of the nanoemulsion/oligonucleotide complexes through three-dimensional high-resolution images. Flattening of the oil droplets was observed, which was reduced in the complexes obtained at high amount of adsorbed oligonucleotides. In such conditions, complexes exhibit droplet size in the 600nm range. The oligonucleotides molecules were detected on the surface of the droplets, preventing their fusion during aggregation. A lamellar structure organization was identified by energy dispersive X-ray diffraction experiments. The presence of the nucleic acid molecules led to a disorganization of the lipid arrangement and an expansion in the lattice spacing, which was proportional to the amount of oligonucleotides added.

  11. Scalable amplification of strand subsets from chip-synthesized oligonucleotide libraries

    NASA Astrophysics Data System (ADS)

    Schmidt, Thorsten L.; Beliveau, Brian J.; Uca, Yavuz O.; Theilmann, Mark; da Cruz, Felipe; Wu, Chao-Ting; Shih, William M.

    2015-11-01

    Synthetic oligonucleotides are the main cost factor for studies in DNA nanotechnology, genetics and synthetic biology, which all require thousands of these at high quality. Inexpensive chip-synthesized oligonucleotide libraries can contain hundreds of thousands of distinct sequences, however only at sub-femtomole quantities per strand. Here we present a selective oligonucleotide amplification method, based on three rounds of rolling-circle amplification, that produces nanomole amounts of single-stranded oligonucleotides per millilitre reaction. In a multistep one-pot procedure, subsets of hundreds or thousands of single-stranded DNAs with different lengths can selectively be amplified and purified together. These oligonucleotides are used to fold several DNA nanostructures and as primary fluorescence in situ hybridization probes. The amplification cost is lower than other reported methods (typically around US$ 20 per nanomole total oligonucleotides produced) and is dominated by the use of commercial enzymes.

  12. Polyamine-oligonucleotide conjugates: a promising direction for nucleic acid tools and therapeutics.

    PubMed

    Menzi, Mirjam; Lightfoot, Helen L; Hall, Jonathan

    2015-01-01

    Chemical modification and/or the conjugation of small functional molecules to oligonucleotides have significantly improved their biological and biophysical properties, addressing issues such as poor cell penetration, stability to nucleases and low affinity for their targets. Here, the authors review the literature reporting on the biophysical, biochemical and biological properties of one particular class of modification - polyamine-oligonucleotide conjugates. Naturally derived and synthetic polyamines have been grafted onto a variety of oligonucleotide formats, including antisense oligonucleotides and siRNAs. In many cases this has had beneficial effects on their properties such as target hybridization, nuclease resistance, cellular uptake and activity. Polyamine-oligonucleotide conjugation, therefore, represents a promising direction for the further development of oligonucleotide-based therapeutics and tools.

  13. Discrimination of oligonucleotides of different lengths with a wild-type aerolysin nanopore

    NASA Astrophysics Data System (ADS)

    Cao, Chan; Ying, Yi-Lun; Hu, Zheng-Li; Liao, Dong-Fang; Tian, He; Long, Yi-Tao

    2016-08-01

    Protein nanopores offer an inexpensive, label-free method of analysing single oligonucleotides. The sensitivity of the approach is largely determined by the characteristics of the pore-forming protein employed, and typically relies on nanopores that have been chemically modified or incorporate molecular motors. Effective, high-resolution discrimination of oligonucleotides using wild-type biological nanopores remains difficult to achieve. Here, we show that a wild-type aerolysin nanopore can resolve individual short oligonucleotides that are 2 to 10 bases long. The sensing capabilities are attributed to the geometry of aerolysin and the electrostatic interactions between the nanopore and the oligonucleotides. We also show that the wild-type aerolysin nanopores can distinguish individual oligonucleotides from mixtures and can monitor the stepwise cleavage of oligonucleotides by exonuclease I.

  14. Nanoparticle-bridge assay for amplification-free electrical detection of oligonucleotides

    NASA Astrophysics Data System (ADS)

    Teimouri, Manouchehr

    The aim of this research is to investigate a highly sensitive, fast, inexpensive, and field-applicable amplification-free nanoparticle-based oligonucleotide detection method which does not rely on any enzymatic or signal amplification process. In this approach, target oligonucleotide strands are detected through the formation of nanoparticle satellites which make an electrical path between two electrodes. This method enables an extremely sensitive oligonucleotide detection because even a few oligonucleotide strands can form a single nanoparticle satellite which can solely generates an electrical output signal. Results showed that this oligonucleotide detection method can detect oligonucleotide single strands at concentrations as low as 50 femtomolar without any amplification process. This detection method can be implemented in many fields such as biodefense, food safety, clinical research, and forensics.

  15. Acute phosphate nephropathy.

    PubMed

    Monfared, Ali; Habibzadeh, Seyed Mahmoud; Mesbah, Seyed Alireza

    2014-05-01

    We present acute phosphate nephropathy in a 28-year-old man, which was developed after a car accident due to rhabdomyolysis. Treatment of acute kidney injury was done with administration of sodium bicarbonate.

  16. Metal-phosphate binders

    DOEpatents

    Howe, Beth Ann [Lewistown, IL; Chaps-Cabrera, Jesus Guadalupe [Coahuila, MX

    2009-05-12

    A metal-phosphate binder is provided. The binder may include an aqueous phosphoric acid solution, a metal-cation donor including a metal other than aluminum, an aluminum-cation donor, and a non-carbohydrate electron donor.

  17. Magnetite nanoparticles facilitate methane production from ethanol via acting as electron acceptors.

    PubMed

    Yang, Zhiman; Shi, Xiaoshuang; Wang, Chuanshui; Wang, Lin; Guo, Rongbo

    2015-11-12

    Potential for interspecies hydrogen transfer within paddy soil enrichments obtained via addition of magnetite nanoparticles and ethanol (named as PEM) was investigated. To do this, PEM derived from rice field of Hangzhou (named as PEM-HZ) was employed, because it offered the best methane production performance. Methane production and Fe (III) reduction proceeded in parallel in the presence of magnetite. Inhibition experiments with 2-bromoethane sulfonate (BES) or phosphate showed that interspecies hydrogen transfer and Fe (III) reduction also occurred in methane production from ethanol. 16S rRNA-based Illumina sequencing results showed that Dechloromonas, Thauera, Desulfovibrio and Clostridium were the dominant putative Fe (III) -reducers, and that hydrogenotrophic Methanobacterium accounted for about 88% of the total archaeal community. These results indicated that magnetite nanoparticles that acted as electron acceptor could facilitate rapid oxidation of ethanol by members of the Fe (III) -reducers in PEM-HZ and establishment of the syntrophic relationship of Fe (III) -reducers with Methanobacterium via interspecies hydrogen transfer. Our results could offer a model to understand the microbial interaction with magnetite from a novel angle during methanogenesis.

  18. Magnetite nanoparticles facilitate methane production from ethanol via acting as electron acceptors

    PubMed Central

    Yang, Zhiman; Shi, Xiaoshuang; Wang, Chuanshui; Wang, Lin; Guo, Rongbo

    2015-01-01

    Potential for interspecies hydrogen transfer within paddy soil enrichments obtained via addition of magnetite nanoparticles and ethanol (named as PEM) was investigated. To do this, PEM derived from rice field of Hangzhou (named as PEM-HZ) was employed, because it offered the best methane production performance. Methane production and Fe (III) reduction proceeded in parallel in the presence of magnetite. Inhibition experiments with 2-bromoethane sulfonate (BES) or phosphate showed that interspecies hydrogen transfer and Fe (III) reduction also occurred in methane production from ethanol. 16S rRNA-based Illumina sequencing results showed that Dechloromonas, Thauera, Desulfovibrio and Clostridium were the dominant putative Fe (III) -reducers, and that hydrogenotrophic Methanobacterium accounted for about 88% of the total archaeal community. These results indicated that magnetite nanoparticles that acted as electron acceptor could facilitate rapid oxidation of ethanol by members of the Fe (III) -reducers in PEM-HZ and establishment of the syntrophic relationship of Fe (III) -reducers with Methanobacterium via interspecies hydrogen transfer. Our results could offer a model to understand the microbial interaction with magnetite from a novel angle during methanogenesis. PMID:26559132

  19. Magnetite nanoparticles facilitate methane production from ethanol via acting as electron acceptors

    NASA Astrophysics Data System (ADS)

    Yang, Zhiman; Shi, Xiaoshuang; Wang, Chuanshui; Wang, Lin; Guo, Rongbo

    2015-11-01

    Potential for interspecies hydrogen transfer within paddy soil enrichments obtained via addition of magnetite nanoparticles and ethanol (named as PEM) was investigated. To do this, PEM derived from rice field of Hangzhou (named as PEM-HZ) was employed, because it offered the best methane production performance. Methane production and Fe (III) reduction proceeded in parallel in the presence of magnetite. Inhibition experiments with 2-bromoethane sulfonate (BES) or phosphate showed that interspecies hydrogen transfer and Fe (III) reduction also occurred in methane production from ethanol. 16S rRNA-based Illumina sequencing results showed that Dechloromonas, Thauera, Desulfovibrio and Clostridium were the dominant putative Fe (III) -reducers, and that hydrogenotrophic Methanobacterium accounted for about 88% of the total archaeal community. These results indicated that magnetite nanoparticles that acted as electron acceptor could facilitate rapid oxidation of ethanol by members of the Fe (III) -reducers in PEM-HZ and establishment of the syntrophic relationship of Fe (III) -reducers with Methanobacterium via interspecies hydrogen transfer. Our results could offer a model to understand the microbial interaction with magnetite from a novel angle during methanogenesis.

  20. Phosphate control in dialysis

    PubMed Central

    Cupisti, Adamasco; Gallieni, Maurizio; Rizzo, Maria Antonietta; Caria, Stefania; Meola, Mario; Bolasco, Piergiorgio

    2013-01-01

    Prevention and correction of hyperphosphatemia is a major goal of chronic kidney disease–mineral and bone disorder (CKD–MBD) management, achievable through avoidance of a positive phosphate balance. To this aim, optimal dialysis removal, careful use of phosphate binders, and dietary phosphate control are needed to optimize the control of phosphate balance in well-nourished patients on a standard three-times-a-week hemodialysis schedule. Using a mixed diffusive–convective hemodialysis tecniques, and increasing the number and/or the duration of dialysis tecniques are all measures able to enhance phosphorus (P) mass removal through dialysis. However, dialytic removal does not equal the high P intake linked to the high dietary protein requirement of dialysis patients; hence, the use of intestinal P binders is mandatory to reduce P net intestinal absorption. Unfortunately, even a large dose of P binders is able to bind approximately 200–300 mg of P on a daily basis, so it is evident that their efficacy is limited in the case of an uncontrolled dietary P load. Hence, limitation of dietary P intake is needed to reach the goal of neutral phosphate balance in dialysis, coupled to an adequate protein intake. To this aim, patients should be informed and educated to avoid foods that are naturally rich in phosphate and also processed food with P-containing preservatives. In addition, patients should preferentially choose food with a low P-to-protein ratio. For example, patients could choose egg white or protein from a vegetable source. Finally, boiling should be the preferred cooking procedure, because it induces food demineralization, including phosphate loss. The integrated approach outlined in this article should be actively adapted as a therapeutic alliance by clinicians, dieticians, and patients for an effective control of phosphate balance in dialysis patients. PMID:24133374

  1. Phosphate control in dialysis.

    PubMed

    Cupisti, Adamasco; Gallieni, Maurizio; Rizzo, Maria Antonietta; Caria, Stefania; Meola, Mario; Bolasco, Piergiorgio

    2013-10-04

    Prevention and correction of hyperphosphatemia is a major goal of chronic kidney disease-mineral and bone disorder (CKD-MBD) management, achievable through avoidance of a positive phosphate balance. To this aim, optimal dialysis removal, careful use of phosphate binders, and dietary phosphate control are needed to optimize the control of phosphate balance in well-nourished patients on a standard three-times-a-week hemodialysis schedule. Using a mixed diffusive-convective hemodialysis tecniques, and increasing the number and/or the duration of dialysis tecniques are all measures able to enhance phosphorus (P) mass removal through dialysis. However, dialytic removal does not equal the high P intake linked to the high dietary protein requirement of dialysis patients; hence, the use of intestinal P binders is mandatory to reduce P net intestinal absorption. Unfortunately, even a large dose of P binders is able to bind approximately 200-300 mg of P on a daily basis, so it is evident that their efficacy is limited in the case of an uncontrolled dietary P load. Hence, limitation of dietary P intake is needed to reach the goal of neutral phosphate balance in dialysis, coupled to an adequate protein intake. To this aim, patients should be informed and educated to avoid foods that are naturally rich in phosphate and also processed food with P-containing preservatives. In addition, patients should preferentially choose food with a low P-to-protein ratio. For example, patients could choose egg white or protein from a vegetable source. Finally, boiling should be the preferred cooking procedure, because it induces food demineralization, including phosphate loss. The integrated approach outlined in this article should be actively adapted as a therapeutic alliance by clinicians, dieticians, and patients for an effective control of phosphate balance in dialysis patients.

  2. Method for producing and regenerating a synthetic CO[sub 2] acceptor

    DOEpatents

    Lancet, M. S.; Curran, G. P.; Gorin, E.

    1982-05-18

    A method is described for producing a synthetic CO[sub 2] acceptor by feeding a mixture of finely divided silica and at least one finely divided calcium compound selected from the group consisting of calcium oxide and calcium carbonate to a fluidized bed; operating the fluidized bed at suitable conditions to produce pellets of synthetic CO[sub 2] acceptor and recovering the pellets of synthetic CO[sub 2] acceptor from the fluidized bed. Optionally, spent synthetic CO[sub 2] acceptor can be charged to the fluidized bed to produce regenerated pellets of synthetic CO[sub 2] acceptor. 1 fig.

  3. Method for producing and regenerating a synthetic CO.sub.2 acceptor

    DOEpatents

    Lancet, Michael S [Pittsburgh, PA; Curran, George P [Pittsburgh, PA; Gorin, Everett [San Rafael, CA

    1982-01-01

    A method for producing a synthetic CO.sub.2 acceptor by feeding a mixture of finely divided silica and at least one finely divided calcium compound selected from the group consisting of calcium oxide and calcium carbonate to a fluidized bed; operating the fluidized bed at suitable conditions to produce pellets of synthetic CO.sub.2 acceptor and recovering the pellets of synthetic CO.sub.2 acceptor from the fluidized bed. Optionally, spent synthetic CO.sub.2 acceptor can be charged to the fluidized bed to produce regenerated pellets of synthetic CO.sub.2 acceptor.

  4. Dynamics of iron-acceptor-pair formation in co-doped silicon

    SciTech Connect

    Bartel, T.; Gibaja, F.; Graf, O.; Gross, D.; Kaes, M.; Heuer, M.; Kirscht, F.; Möller, C.; Lauer, K.

    2013-11-11

    The pairing dynamics of interstitial iron and dopants in silicon co-doped with phosphorous and several acceptor types are presented. The classical picture of iron-acceptor pairing dynamics is expanded to include the thermalization of iron between different dopants. The thermalization is quantitatively described using Boltzmann statistics and different iron-acceptor binding energies. The proper understanding of the pairing dynamics of iron in co-doped silicon will provide additional information on the electronic properties of iron-acceptor pairs and may become an analytical method to quantify and differentiate acceptors in co-doped silicon.

  5. New strategies for cyclization and bicyclization of oligonucleotides by click chemistry assisted by microwaves.

    PubMed

    Lietard, Jory; Meyer, Albert; Vasseur, Jean-Jacques; Morvan, François

    2008-01-04

    The synthesis of cyclic, branched, and bicyclic oligonucleotides was performed by copper-catalyzed azide-alkyne cycloaddition assisted by microwaves in solution and on solid support. For that purpose, new phosphoramidite building blocks and new solid supports were designed to introduce alkyne and bromo functions into the same oligonucleotide by solid-phase synthesis on a DNA synthesizer. The bromine atom was then substituted by sodium azide to yield azide oligonucleotides. Cyclizations were found to be more efficient in solution than on solid support. This method allowed the efficient preparation of cyclic (6- to 20-mers), branched (with one or two dangling sequences), and bicyclic (2 x 10-mers) oligonucleotides.

  6. Properties of amphiphilic oligonucleotide films at the air/water interface and after film transfer.

    PubMed

    Keller, R; Kwak, M; de Vries, J W; Sawaryn, C; Wang, J; Anaya, M; Müllen, K; Butt, H-J; Herrmann, A; Berger, R

    2013-11-01

    The self-assembly of amphiphilic hybrid materials containing an oligonucleotide sequence at the air/water interface was investigated by means of pressure-molecular area (Π-A) isotherms. In addition, films were transferred onto solid substrates and imaged using scanning force microscopy. We used oligonucleotide molecules with lipid tails, which consisted of a single stranded oligonucleotide 11 mer containing two hydrophobically modified 5-(dodec-1-ynyl)uracil nucleobases (dU11) at the 5'-end of the oligonucleotide sequence. The air/water interface was used as confinement for the self-assembling process of dU11. Scanning force microscopy of films transferred via Langmuir-Blodgett technique revealed mono-, bi- (Π ≥ 2 mN/m) and multilayer formation (Π ≥ 30 mN/m). The first layer was 1.6 ± 0.1 nm thick. It was oriented with the hydrophilic oligonucleotide moiety facing the hydrophilic substrate while the hydrophobic alkyl chains faced air. In the second layer the oligonucleotide moiety was found to face the air. The second layer was found to cover up to 95% of the sample area. Our measurements indicated that the rearrangement of the molecules into bi- and multiple bilayers happened already at the air/water interface. Similar results were obtained with a second type of oligonucleotide amphiphile, an oligonucleotide block copolymer, which was composed of an oligonucleotide 11 mer covalently attached at the terminus to polypropyleneoxide (PPO).

  7. Diels-Alder cycloadditions in water for the straightforward preparation of peptide–oligonucleotide conjugates

    PubMed Central

    Marchán, Vicente; Ortega, Samuel; Pulido, Daniel; Pedroso, Enrique; Grandas, Anna

    2006-01-01

    The Diels-Alder reaction between diene-modified oligonucleotides and maleimide-derivatized peptides afforded peptide–oligonucleotide conjugates with high purity and yield. Synthesis of the reagents was easily accomplished by on-column derivatization of the corresponding peptides and oligonucleotides. The cycloaddition reaction was carried out in mild conditions, in aqueous solution at 37°C. The speed of the reaction was found to vary depending on the size of the reagents, but it can be completed in 8–10 h by reacting the diene-oligonucleotide with a small excess of maleimide-peptide. PMID:16478710

  8. [Dynamics of charge transfer along an oligonucleotide at finite temperature].

    PubMed

    Lakhno, V D; Fialko, N S

    2004-01-01

    The quantum-statistical approach was used to describe the charge transfer in nucleotide sequences. The results of numerical modeling for hole transfer in the GTTGGG sequence with background temperature noise are given. It was shown that, since guanine has an oxidation potential lower than thymine, the hole created at the G donor in this sequence passes through the thymine barrier into the guanine triplet (acceptor) at a time of approximately 10 ps at a temperature of 37 degrees C.

  9. Avian oncogenic virus differential diagnosis in chickens using oligonucleotide microarray.

    PubMed

    Wang, Lih-Chiann; Huang, Dean; Pu, Chang-En; Wang, Ching-Ho

    2014-12-15

    Avian oncogenic viruses include the avian leukosis virus (ALV), reticuloendotheliosis virus (REV) and Marek's disease virus (MDV). Multiple oncogenic viral infections are frequently seen, with even Marek's disease vaccines reported to be contaminated with ALV and REV. The gross lesions caused by avian oncogenic viruses often overlap, making differentiation diagnosis based on histopathology difficult. The objective of this study is to develop a rapid approach to simultaneously differentiate, subgroup and pathotype the avian oncogenic viruses. The oligonucleotide microarray was employed in this study. Particular DNA sequences were recognized using specific hybridization between the DNA target and probe on the microarray, followed with colorimetric development through enzyme reaction. With 10 designed probes, ALV-A, ALV-E, ALV-J, REV, MDV pathogenic and vaccine strains were clearly discriminated on the microarray with the naked eyes. The detection limit was 27 copy numbers, which was 10-100 times lower than multiplex PCR. Of 102 field samples screened using the oligonucleotide microarray, 32 samples were positive for ALV-E, 17 samples were positive for ALV-J, 6 samples were positive for REV, 4 samples were positive for MDV, 7 samples were positive for both ALV-A and ALV-E, 5 samples were positive for ALV-A, ALV-E and ALV-J, one sample was positive for both ALV-J and MDV, and 3 samples were positive for both REV and MDV. The oligonucleotide microarray, an easy-to-use, high-specificity, high-sensitivity and extendable assay, presents a potent technique for rapid differential diagnosis of avian oncogenic viruses and the detection of multiple avian oncogenic viral infections under field conditions.

  10. In vivo site-directed mutagenesis using oligonucleotides.

    PubMed

    Storici, F; Lewis, L K; Resnick, M A

    2001-08-01

    Functional characterization of the genes of higher eukaryotes has been aided by their expression in model organisms and by analyzing site-specific changes in homologous genes in model systems such as the yeast Saccharomyces cerevisiae. Modifying sequences in yeast or other organisms such that no heterologous material is retained requires in vitro mutagenesis together with subcloning. PCR-based procedures that do not involve cloning are inefficient or require multistep reactions that increase the risk of additional mutations. An alternative approach, demonstrated in yeast, relies on transformation with an oligonucleotide, but the method is restricted to the generation of mutants with a selectable phenotype. Oligonucleotides, when combined with gap repair, have also been used to modify plasmids in yeast; however, this approach is limited by restriction-site availability. We have developed a mutagenesis approach in yeast based on transformation by unpurified oligonucleotides that allows the rapid creation of site-specific DNA mutations in vivo. A two-step, cloning-free process, referred to as delitto perfetto, generates products having only the desired mutation, such as a single or multiple base change, an insertion, a small or a large deletion, or even random mutations. The system provides for multiple rounds of mutation in a window up to 200 base pairs. The process is RAD52 dependent, is not constrained by the distribution of naturally occurring restriction sites, and requires minimal DNA sequencing. Because yeast is commonly used for random and selective cloning of genomic DNA from higher eukaryotes such as yeast artificial chromosomes, the delitto perfetto strategy also provides an efficient way to create precise changes in mammalian or other DNA sequences.

  11. PCR amplification on microarrays of gel immobilized oligonucleotides

    DOEpatents

    Strizhkov, Boris; Tillib, Sergei; Mikhailovich, Vladimir; Mirzabekov, Andrei

    2003-11-04

    The invention relates two general methods for performing PCR amplification, combined with the detection and analysis of the PCR products on a microchip. In the first method, the amplification occurs both outside and within a plurality of gel pads on a microchip, with at least one oligonucleotide primer immobilized in a gel pad. In the second method, PCR amplification also takes place within gel pads on a microchip, but the pads are surrounded by a hydrophobic liquid such as that which separates the individual gel pads into environments which resemble micro-miniaturized test tubes.

  12. Inhibition Of Molecular And Biological Processes Using Modified Oligonucleotides

    DOEpatents

    Kozyavkin, Sergei A.; Malykh, Andrei G.; Polouchine, Nikolai N.; Slesarev, Alexei I.

    2003-04-15

    A method of inhibiting at least one molecular process in a sample, comprising administering to the sample an oligonucleotide or polynucleotide containing at least one monomeric unit having formula (I): wherein A is an organic moiety, n is at least 1, and each X is independently selected from the group consisting of --NRCOCONu, --NHCOCR.sub.2 CR.sub.2 CONu, --NHCOCR.dbd.CRCONu, and --NHCOSSCONu, wherein each R independently represents H or a substituted or unsubstituted alkyl group, and Nu represents a nucleophile, or a salt of the compound.

  13. Oligonucleotide primers for PCR amplification of coelomate introns.

    PubMed

    Jarman, Simon N; Ward, Robert D; Elliott, Nicholas G

    2002-09-01

    Abstract Seven novel oligonucleotide primer pairs for polymerase chain reaction amplification of introns from nuclear genes in coelomates were designed and tested. Each pair bound to adjacent exons that are separated by a single intron in most coelomate species. The primer sets amplified introns in species as widely separated by the course of evolution as oysters (Mollusca: Protostoma) and salmon (Chordata: Deuterostoma). Each primer set was tested on a further 6 coelomate species and found to amplify introns in most cases. These primer sets may therefore be useful tools for developing nuclear DNA markers in diverse coelomate species for studies of population genetics, phylogenetics, or genome mapping.

  14. Oligonucleotide microarray for subtyping of influenza A viruses

    NASA Astrophysics Data System (ADS)

    Klotchenko, S. A.; Vasin, A. V.; Sandybaev, N. T.; Plotnikova, M. A.; Chervyakova, O. V.; Smirnova, E. A.; Kushnareva, E. V.; Strochkov, V. M.; Taylakova, E. T.; Egorov, V. V.; Koshemetov, J. K.; Kiselev, O. I.; Sansyzbay, A. R.

    2012-02-01

    Influenza is one of the most widespread respiratory viral diseases, infecting humans, horses, pigs, poultry and some other animal populations. Influenza A viruses (IAV) are classified into subtypes on the basis of the surface hemagglutinin (H1 to H16) and neuraminidase (N1 to N9) glycoproteins. The correct determination of IAV subtype is necessary for clinical and epidemiological studies. In this article we propose an oligonucleotide microarray for subtyping of IAV using universal one-step multisegment RT-PCR fluorescent labeling of viral gene segments. It showed to be an advanced approach for fast detection and identification of IAV.

  15. Reduction of Uranium(VI) Phosphate during Growth of the Thermophilic Bacterium Thermoterrabacterium ferrireducens

    PubMed Central

    Khijniak, T. V.; Slobodkin, A. I.; Coker, V.; Renshaw, J. C.; Livens, F. R.; Bonch-Osmolovskaya, E. A.; Birkeland, N.-K.; Medvedeva-Lyalikova, N. N.; Lloyd, J. R.

    2005-01-01

    The thermophilic, gram-positive bacterium Thermoterrabacterium ferrireducens coupled organotrophic growth to the reduction of sparingly soluble U(VI) phosphate. X-ray powder diffraction and X-ray absorption spectroscopy analysis identified the electron acceptor in a defined medium as U(VI) phosphate [uramphite; (NH4)(UO2)(PO4) · 3H2O], while the U(IV)-containing precipitate formed during bacterial growth was identified as ningyoite [CaU(PO4)2 · H2O]. This is the first report of microbial reduction of a largely insoluble U(VI) compound. PMID:16204572

  16. Total Phosphate Influences the Rate of Hydrocarbon Degradation but Phosphate Mineralogy Shapes Microbial Community Composition in Cold-Region Calcareous Soils.

    PubMed

    Siciliano, Steven D; Chen, Tingting; Phillips, Courtney; Hamilton, Jordan; Hilger, David; Chartrand, Blaine; Grosskleg, Jay; Bradshaw, Kris; Carlson, Trevor; Peak, Derek

    2016-05-17

    Managing phosphorus bioaccessibility is critical for the bioremediation of hydrocarbons in calcareous soils. This paper explores how soil mineralogy interacts with a novel biostimulatory solution to both control phosphorus bioavailability and influence bioremediation. Two large bore infiltrators (1 m diameter) were installed at a PHC contaminated site and continuously supplied with a solution containing nutrients and an electron acceptor. Soils from eight contaminated sites were prepared and pretreated, analyzed pretrial, spiked with diesel, placed into nylon bags into the infiltrators, and removed after 3 months. From XAS, we learned that three principal phosphate phases had formed: adsorbed phosphate, brushite, and newberyite. All measures of biodegradation in the samples (in situ degradation estimates, mineralization assays, culturable bacteria, catabolic genes) varied depending upon the soil's phosphate speciation. Notably, adsorbed phosphate increased anaerobic phenanthrene degradation and bzdN catabolic gene prevalence. The dominant mineralogical constraints on community composition were the relative amounts of adsorbed phosphate, brushite, and newberyite. Overall, this study finds that total phosphate influences microbial community phenotypes whereas relative percentages of phosphate minerals influences microbial community genotype composition.

  17. Developing mixed films of immobilized oligonucleotides and quantum dots for the multiplexed detection of nucleic acid hybridization using a combination of fluorescence resonance energy transfer and direct excitation of fluorescence.

    PubMed

    Algar, W Russ; Krull, Ulrich J

    2010-04-20

    Methods have been developed for the simultaneous and selective detection of three target nucleic acid sequences based on mixed films of immobilized quantum dots (QDs) and oligonucleotide probes. CdSe/ZnS QDs were immobilized on optical fibers and conjugated with mixtures of different probe oligonucleotides. Hybridization events were detected using a combination of fluorescence from direct excitation and fluorescence sensitized by resonance energy transfer (FRET). A sandwich assay format was used to associate dye labeled reporter oligonucleotides with probe-target hybrids formed at the surface of the optical fiber. One detection channel utilized direct excitation of Pacific Blue and the two other detection channels were based on FRET. In one strategy, green emitting QDs were used as donors with Cy3 and Rhodamine Red-X acceptors. In a second strategy, green and red emitting QDs were coimmobilized and used as donors with Cy3 and Alexa Fluor 647 acceptors, respectively. Selective three-plex detection was demonstrated with both strategies. Several key design criteria that were explored to optimize the relative signal magnitude between channels included: the ratio of probe associated with direct excitation versus probes associated with FRET; the relative amounts of each FRET probe and corresponding spectral overlap; and the photoluminescence ratio between immobilized green and red emitting QDs (where applicable). Careful selection of probe sequences and lengths were important for the discrimination of single nucleotide polymorphisms in one channel without suppressing binding of target in the other two channels. This work provides a basis for the development of multiplexed biosensors that are ensemble compatible and do not require discrete sensor elements, spatial registration, sorting technology, or single molecule spectroscopy.

  18. Engineering the specificity of trehalose phosphorylase as a general strategy for the production of glycosyl phosphates.

    PubMed

    Chen, Chao; Van der Borght, Jef; De Vreese, Rob; D'hooghe, Matthias; Soetaert, Wim; Desmet, Tom

    2014-07-25

    A two-step process is reported for the anomeric phosphorylation of galactose, using trehalose phosphorylase as biocatalyst. The monosaccharide enters this process as acceptor but can subsequently be released from the donor side, thanks to the non-reducing nature of the disaccharide intermediate. A key development was the creation of an optimized enzyme variant that displays a strict specificity (99%) for β-galactose 1-phosphate as product.

  19. Mapping RNase T1-resistant oligonucleotides of avian tumor virus RNAs: sarcoma-specific oligonucleotides are near the poly(A) end and oligonucleotides common to sarcoma and transformation-defective viruses are at the poly(A) end.

    PubMed Central

    Wang, L H; Duesberg, P; Beemon, K; Vogt, P K

    1975-01-01

    The large RNase T1-resistant oligonucleotides of the nondefective (nd) Rous sarcoma virus (RSV): Prague RSV of subgroup B (PR-B), PR-C and B77 of subgroup C; of their transformation-defective (td0 deletion mutants: td PR-B, td PR-C, and td B77; and of replication-defective (rd) RSV(-) were completely or partially mapped on the 30 to 40S viral RNAs. The location of a given oligonucleotide relative to the poly(A) terminus of the viral RNAs was directly deduced from the smallest size of the poly(A)-tagged RNA fragment from which it could be isolated. Identification of distinct oligonucleotides was based on their location in the electrophoretic/chromatographic fingerprint pattern and on analysis of their RNase A-resistant fragments. The following results were obtained. (i) The number of large oligonucleotides per poly(A)-tagged ffagment increased with increasing size of the fragment. This implies that the genetic map is linear and that a given RNase T1-resistant oligonucleotides has, relative to the poly(A) end, the same location on all 30 to 40S RNA subunits of a given 60 to 70S viral RNA complex, (ii) Three sarcoma-specific oligonucleotides were identified in the RNAs of Pr-B, PR-C and B77 by comparison with the RNAs of the corresponding td viruses... Images PMID:170411

  20. Chemopreventive Agents from Physalis minima Function as Michael Reaction Acceptors

    PubMed Central

    Men, Ruizhi; Li, Ning; Ding, Chihong; Tang, Yingzhan; Xing, Yachao; Ding, Wanjing; Ma, Zhongjun

    2016-01-01

    Background: The fruits of some varieties of genus Physalis have been used as delicious fruits and functional food in the Northeast of China. Materials and Methods: To reveal the functional material basis, we performed bioactivity-guided phytochemical research and chemopreventive effect assay of the constituents from Physalis minima. Results: It was demonstrated that the ethyl acetate extract of P. minima L. (EEPM) had potential quinone reductase (QR) inducing activity with induction ratio (IR, QR induction activity) value of 1.47 ± 0.24, and glutathione binding property as potential Michael reaction acceptors (with an α, β-unsaturated ketone moiety). Furthermore, bioactivity-guided phytochemical research led eight compounds (1–8), which were elucidated as 3-isopropyl-5-acetoxycyclohexene-2-one-1 (1), isophysalin B (2), physalin G (3), physalin D (4), physalin I (5), physordinose B (6), stigmasterol-3-O-β-D-glucopyranoside (7) and 5α-6β-dihydroxyphysalin R (8) on the basis of nuclear magnetic resonance spectroscopy analyses and HRESIMS. Then, isophysalin B (2) and physordinose B (6) showed significant QR inducing activity with IR value of 2.80 ± 0.19 and 2.38 ± 0.46, respectively. SUMMARY An ultra-performance liquid chromatographic method with glutathione as the substrate was used to detect the Michael reaction acceptors in extracts of Physalis minima (EPM)We investigated the chemical constituents of EPM guided by biological activity methodIsophysalin B (1) and physordinose B (6) showed strong quinone reductase inducing activity with induction ratio values of 2.80 ± 0.19 and 2.38 ± 0.46This study generated useful information for consumers and many encourage researchers to utilize edible fruits from Physalis as a source of phytochemicals Abbreviations used: EPM: Extracts of Physalis minima, EEPM: Ethyl acetate extract of Physalis minima L., GSH: Glutathione, MRAs: Michael reaction acceptors, QR: Quinone reductase. PMID:27279713

  1. Light-generated oligonucleotide arrays for rapid DNA sequence analysis.

    PubMed Central

    Pease, A C; Solas, D; Sullivan, E J; Cronin, M T; Holmes, C P; Fodor, S P

    1994-01-01

    In many areas of molecular biology there is a need to rapidly extract and analyze genetic information; however, current technologies for DNA sequence analysis are slow and labor intensive. We report here how modern photolithographic techniques can be used to facilitate sequence analysis by generating miniaturized arrays of densely packed oligonucleotide probes. These probe arrays, or DNA chips, can then be applied to parallel DNA hybridization analysis, directly yielding sequence information. In a preliminary experiment, a 1.28 x 1.28 cm array of 256 different octanucleotides was produced in 16 chemical reaction cycles, requiring 4 hr to complete. The hybridization pattern of fluorescently labeled oligonucleotide targets was then detected by epifluorescence microscopy. The fluorescence signals from complementary probes were 5-35 times stronger than those with single or double base-pair hybridization mismatches, demonstrating specificity in the identification of complementary sequences. This method should prove to be a powerful tool for rapid investigations in human genetics and diagnostics, pathogen detection, and DNA molecular recognition. Images PMID:8197176

  2. Multipathogen oligonucleotide microarray for environmental and biodefense applications.

    PubMed

    Sergeev, Nikolay; Distler, Margaret; Courtney, Shannon; Al-Khaldi, Sufian F; Volokhov, Dmitriy; Chizhikov, Vladimir; Rasooly, Avraham

    2004-11-01

    Food-borne pathogens are a major health problem. The large and diverse number of microbial pathogens and their virulence factors has fueled interest in technologies capable of detecting multiple pathogens and multiple virulence factors simultaneously. Some of these pathogens and their toxins have potential use as bioweapons. DNA microarray technology allows the simultaneous analysis of thousands of sequences of DNA in a relatively short time, making it appropriate for biodefense and for public health uses. This paper describes methods for using DNA microarrays to detect and analyze microbial pathogens. The FDA-1 microarray was developed for the simultaneous detection of several food-borne pathogens and their virulence factors including Listeria spp., Campylobacter spp., Staphylococcus aureus enterotoxin genes and Clostridium perfringens toxin genes. Three elements were incorporated to increase confidence in the microarray detection system: redundancy of genes, redundancy of oligonucleotide probes (oligoprobes) for a specific gene, and quality control oligoprobes to monitor array spotting and target DNA hybridization. These elements enhance the reliability of detection and reduce the chance of erroneous results due to the genetic variability of microbes or technical problems with the microarray. The results presented demonstrate the potential of oligonucleotide microarrays for detection of environmental and biodefense relevant microbial pathogens.

  3. Periostin antisense oligonucleotide prevents adhesion formation after surgery in mice.

    PubMed

    Takai, Shinji; Yoshino, Masafumi; Takao, Kazumasa; Yoshikawa, Kazunori; Jin, Denan

    2017-02-09

    To study the role of periostin in adhesion formation, the effect of periostin antisense oligonucleotide (PAO) on adhesion formation was evaluated in mice. Under anesthesia, the serous membrane of the cecum was abraded, and the adhesion score and mRNA levels of periostin and its related factors were determined after surgery. Saline, 40 mg/kg of negative sense oligonucleotide (NSO), or 40 mg/kg of PAO were injected into the abdomen after surgery, and the adhesion score and mRNA levels were evaluated 14 days later. Filmy adhesion formation was observed 1 day after surgery, and the adhesion score increased gradually to 14 days. The mRNA levels of periostin, transforming growth factor (TGF)-β, and collagen I increased gradually from 3 days to 14 days. The adhesion score of PAO was significantly lower than of saline or NSO 14 days after surgery. The mRNA levels of periostin, TGF-β, and collagen I were also significantly attenuated by treatment with PAO compared with saline or NSO. Thus, these results demonstrated that the periostin mRNA level increased in the abraded cecum, and PAO prevented adhesion formation along with attenuation of the periostin mRNA level.

  4. Portable system for microbial sample preparation and oligonucleotide microarray analysis.

    SciTech Connect

    Bavykin, S. G.; Akowski, J. P.; Zakhariev, V. M.; Barsky, V. E.; Mirzabekov, A. D.; Perov, A. N.; Biochip Technology Center; Engelhardt Inst. of Molecular Biology

    2001-02-01

    We have developed a three-component system for microbial identification that consists of (i) a universal syringe-operated silica minicolumn for successive DNA and RNA isolation, fractionation, fragmentation, fluorescent labeling, and removal of excess free label and short oligonucleotides; (ii) microarrays of immobilized oligonucleotide probes for 16S rRNA identification; and (iii) a portable battery-powered device for imaging the hybridization of fluorescently labeled RNA fragments with the arrays. The minicolumn combines a guanidine thiocyanate method of nucleic acid isolation with a newly developed hydroxyl radical-based technique for DNA and RNA labeling and fragmentation. DNA and RNA can also be fractionated through differential binding of double- and single-stranded forms of nucleic acids to the silica. The procedure involves sequential washing of the column with different solutions. No vacuum filtration steps, phenol extraction, or centrifugation is required. After hybridization, the overall fluorescence pattern is captured as a digital image or as a Polaroid photo. This three-component system was used to discriminate Escherichia coli, Bacillus subtilis, Bacillus thuringiensis, and human HL60 cells. The procedure is rapid: beginning with whole cells, it takes approximately 25 min to obtain labeled DNA and RNA samples and an additional 25 min to hybridize and acquire the microarray image using a stationary image analysis system or the portable imager.

  5. Oligonucleotide bias in Bacillus subtilis: general trends and taxonomic comparisons.

    PubMed Central

    Rocha, E P; Viari, A; Danchin, A

    1998-01-01

    We present a general analysis of oligonucleotide usage in the complete genome of Bacillus subtilis . Several datasets were built in order to assign various biological contexts to the biased use of words and to reveal local asymmetries in word usage that may be coupled with replication, the control of gene expression and the restriction/modification system. This analysis was complemented by cross-comparisons with the complete genomes of Escherichia coli , Haemophilus influenzae and Methanococcus jannaschii . We have observed a large number of biased oligonucleotides for words of size up to 8, throughout the datasets and species, indicating that such long strict words play an important role as biological signals. We speculate that some of them are involved in interactions with DNA and/or RNA polymerases. An extensive analysis of palindrome abundances and distributions provides the surprising result that prophage-like elements embedded in the genome exhibit a smaller avoidance of restriction sites. This may reinforce a recently proposed hypothesis of a selfish gene phenomena in the transfer of restriction/modification systems in bacteria. PMID:9611243

  6. DOTAP/UDCA vesicles: novel approach in oligonucleotide delivery.

    PubMed

    Ruozi, Barbara; Battini, Renata; Montanari, Monica; Mucci, Adele; Tosi, Giovanni; Forni, Flavio; Vandelli, Maria Angela

    2007-03-01

    The relatively hydrophilic bile acid, ursodeoxycholic acid (UDCA), was used as an additive to DOTAP cationic liposomes to evaluate the effect on the cellular uptake of an oligonucleotide. Nuclear magnetic resonance studies were applied to estimate the relative amount of incorporated UDCA into the lipidic bilayers. DOTAP or DOTAP-UDCA vesicles (MixVes; DOTAP/UDCA molar ratios 1:0.25, 1:0.5, 1:1, and 1:2) formed complexes with 5'-fluorescein conjugated 29-mer phosphorothioate oligonucleotides (PS-ODNs) and studied using gel electrophoresis. In addition, the complexes were tested after transfection to assess the cellular uptake and the localization of the oligo in a HaCaT cell line by the use of cytofluorimetric and confocal microscopic analysis. DOTAP lipid formulated in the presence of a defined amount of UDCA forms more stable, flexible, and active MixVes. In particular, the MixVes at 1:0.25 and 1:0.5 molar ratios increase and modify the cellular uptake of PS-ODNs if compared with DOTAP liposomes 3 hours after the transfection studies. Moreover, the in vitro data suggest that these new formulations are not toxic.

  7. Gas-phase Dissociation of homo-DNA Oligonucleotides

    NASA Astrophysics Data System (ADS)

    Stucki, Silvan R.; Désiron, Camille; Nyakas, Adrien; Marti, Simon; Leumann, Christian J.; Schürch, Stefan

    2013-12-01

    Synthetic modified oligonucleotides are of interest for diagnostic and therapeutic applications, as their biological stability, pairing selectivity, and binding strength can be considerably increased by the incorporation of unnatural structural elements. Homo-DNA is an oligonucleotide homologue based on dideoxy-hexopyranosyl sugar moieties, which follows the Watson-Crick A-T and G-C base pairing system, but does not hybridize with complementary natural DNA and RNA. Homo-DNA has found application as a bioorthogonal element in templated chemistry applications. The gas-phase dissociation of homo-DNA has been investigated by ESI-MS/MS and MALDI-MS/MS, and mechanistic aspects of its gas-phase dissociation are discussed. Experiments revealed a charge state dependent preference for the loss of nucleobases, which are released either as neutrals or as anions. In contrast to DNA, nucleobase loss from homo-DNA was found to be decoupled from backbone cleavage, thus resulting in stable products. This renders an additional stage of ion activation necessary in order to generate sequence-defining fragment ions. Upon MS3 of the primary base-loss ion, homo-DNA was found to exhibit unspecific backbone dissociation resulting in a balanced distribution of all fragment ion series.

  8. Oligonucleotide Aptamers: New Tools for Targeted Cancer Therapy

    PubMed Central

    Sun, Hongguang; Zhu, Xun; Lu, Patrick Y; Rosato, Roberto R; Tan, Wen; Zu, Youli

    2014-01-01

    Aptamers are a class of small nucleic acid ligands that are composed of RNA or single-stranded DNA oligonucleotides and have high specificity and affinity for their targets. Similar to antibodies, aptamers interact with their targets by recognizing a specific three-dimensional structure and are thus termed “chemical antibodies.” In contrast to protein antibodies, aptamers offer unique chemical and biological characteristics based on their oligonucleotide properties. Hence, they are more suitable for the development of novel clinical applications. Aptamer technology has been widely investigated in various biomedical fields for biomarker discovery, in vitro diagnosis, in vivo imaging, and targeted therapy. This review will discuss the potential applications of aptamer technology as a new tool for targeted cancer therapy with emphasis on the development of aptamers that are able to specifically target cell surface biomarkers. Additionally, we will describe several approaches for the use of aptamers in targeted therapeutics, including aptamer-drug conjugation, aptamer-nanoparticle conjugation, aptamer-mediated targeted gene therapy, aptamer-mediated immunotherapy, and aptamer-mediated biotherapy. PMID:25093706

  9. In vivo delivery of transcription factors with multifunctional oligonucleotides

    NASA Astrophysics Data System (ADS)

    Lee, Kunwoo; Rafi, Mohammad; Wang, Xiaojian; Aran, Kiana; Feng, Xuli; Lo Sterzo, Carlo; Tang, Richard; Lingampalli, Nithya; Kim, Hyun Jin; Murthy, Niren

    2015-07-01

    Therapeutics based on transcription factors have the potential to revolutionize medicine but have had limited clinical success as a consequence of delivery problems. The delivery of transcription factors is challenging because it requires the development of a delivery vehicle that can complex transcription factors, target cells and stimulate endosomal disruption, with minimal toxicity. Here, we present a multifunctional oligonucleotide, termed DARTs (DNA assembled recombinant transcription factors), which can deliver transcription factors with high efficiency in vivo. DARTs are composed of an oligonucleotide that contains a transcription-factor-binding sequence and hydrophobic membrane-disruptive chains that are masked by acid-cleavable galactose residues. DARTs have a unique molecular architecture, which allows them to bind transcription factors, trigger endocytosis in hepatocytes, and stimulate endosomal disruption. The DARTs have enhanced uptake in hepatocytes as a result of their galactose residues and can disrupt endosomes efficiently with minimal toxicity, because unmasking of their hydrophobic domains selectively occurs in the acidic environment of the endosome. We show that DARTs can deliver the transcription factor nuclear erythroid 2-related factor 2 (Nrf2) to the liver, catalyse the transcription of Nrf2 downstream genes, and rescue mice from acetaminophen-induced liver injury.

  10. Reproducible and inexpensive probe preparation for oligonucleotide arrays.

    PubMed

    Zhang, Y; Price, B D; Tetradis, S; Chakrabarti, S; Maulik, G; Makrigiorgos, G M

    2001-07-01

    We present a new protocol for the preparation of nucleic acids for microarray hybridization. DNA is fragmented quantitatively and reproducibly by using a hydroxyl radical-based reaction, which is initiated by hydrogen peroxide, iron(II)-EDTA and ascorbic acid. Following fragmentation, the nucleic acid fragments are densely biotinylated using a biotinylated psoralen analog plus UVA light and hybridized on microarrays. This non-enzymatic protocol circumvents several practical difficulties associated with DNA preparation for microarrays: the lack of reproducible fragmentation patterns associated with enzymatic methods; the large amount of labeled nucleic acids required by some array designs, which is often combined with a limited amount of starting material; and the high cost associated with currently used biotinylation methods. The method is applicable to any form of nucleic acid, but is particularly useful when applying double-stranded DNA on oligonucleotide arrays. Validation of this protocol is demonstrated by hybridizing PCR products with oligonucleotide-coated microspheres and PCR amplified cDNA with Affymetrix Cancer GeneChip microarrays.

  11. Spatially Defined Oligonucleotide Arrays. Technical Report for Phase II

    SciTech Connect

    2000-06-15

    The goal of the Human Genome Project is to sequence all 3 billion base pairs of the human genome. Progress in this has been rapid; GenBank{reg_sign} finished 1994 with 286 million bases of sequence and grew by 2470 in the first quarter of 1995. The challenge to the scientific community is to understand the biological relevance of this genetic information. In most cases the sequence being generated for any single region of the genome represents the genotype of a single individual. A complete understanding of the function of specific genes and other regions of the genome and their role in human disease and development will only become apparent when the sequence of many more individuals is known. Access to genetic information is ultimately limited by the ability to screen DNA sequence. Although the pioneering sequencing methods of Sanger et al. (15) and Maxam and Gilbert (11) have become standard in virtually all molecular biology laboratories, the basic protocols remain largely unchanged. The throughput of this sequencing technology is now becoming the rate-limiting step in both large-scale sequencing projects such as the Human Genome Project and the subsequent efforts to understand genetic diversity. This has inspired the development of advanced DNA sequencing technologies (9), Incremental improvements to Sanger sequencing have been made in DNA labeling and detection. High-speed electrophoresis methods using ultrathin gels or capillary arrays are now being more widely employed. However, these methods are throughput-limited by their sequential nature and the speed and resolution of separations. This limitation will become more pronounced as the need to rapidly screen newly discovered genes for biologically relevant polymorphisms increases. An alternative to gel-based sequencing is to use high-density oligonucleotide probe arrays. Oligonucleotide probe arrays display specific oligonucleotide probes at precise locations in a high density, information-rich format (5

  12. Improved Manganese Phosphate Coatings

    DTIC Science & Technology

    1975-04-01

    Conversion coatings 3 . Phosphating bath 20 AGrjC onln odd*. ta It .. c..soMV midP 1J.,alft. by block noc.mb) Work was conducted to determine the mechanism by...34 TABULAR DATA Table I Analyses of Solution and Coating for Phosphating Baths 4 of Di-ferlng Compositions 11 Atomic Absorption...manganese and iron phosphate coating: k * a. Mn(H 2PO4) 2 Nn-P0 4 + H3PO0 k2 k) b. 3MnHPO4 - Mn3 (P04) 2 + H3i’O4 k4 k5 c. Fe(H 2PO4) 2 -01 FeHPO4

  13. Phosphate Mines, Jordan

    NASA Technical Reports Server (NTRS)

    2008-01-01

    Jordan's leading industry and export commodities are phosphate and potash, ranked in the top three in the world. These are used to make fertilizer. The Jordan Phosphate Mines Company is the sole producer, having started operations in 1935. In addition to mining activities, the company produces phosphoric acid (for fertilizers, detergents, pharmaceuticals), diammonium phosphate (for fertilizer), sulphuric acid (many uses), and aluminum fluoride (a catalyst to make aluminum and magnesium).

    The image covers an area of 27.5 x 49.4 km, was acquired on September 17, 2005, and is located near 30.8 degrees north latitude, 36.1 degrees east longitude.

    The U.S. science team is located at NASA's Jet Propulsion Laboratory, Pasadena, Calif. The Terra mission is part of NASA's Science Mission Directorate.

  14. Synthesis of 3'-, or 5'-, or internal methacrylamido-modified oligonucleotides

    DOEpatents

    Golova, Julia B.; Chernov, Boris K.

    2010-04-27

    New modifiers were synthesized for incorporation of a methacrylic function in 3'-, 5'- and internal positions of oligonucleotides during solid phase synthesis. A modifier was used for synthesis of 5'-methacrylated oligonucleotides for preparation of microarrays by a co-polymerization method.

  15. Ex vivo regulation of specific gene expression by nanomolar concentration of double-stranded dumbbell oligonucleotides.

    PubMed Central

    Clusel, C; Ugarte, E; Enjolras, N; Vasseur, M; Blumenfeld, M

    1993-01-01

    Inhibition of specific transcriptional regulatory proteins is a new approach to control gene expression. Transcriptional activity of DNA-binding proteins can be inhibited by the use of double-stranded (ds) oligodeoxynucleotides that compete for the binding to their specific target sequences in promoters and enhancers. As a model, we used phosphodiester dumbbell oligonucleotides containing a binding site for the liver-enriched transcription factor HNF-1 (Hepatocyte Nuclear Factor 1). Binding affinity of HNF-1 to dumbbell oligonucleotides was the same as that to ds oligonucleotides, as determined by gel retardation assays. HNF-1 dumbbells specifically inhibited in vitro transcription driven by the albumin promoter by more than 90%. HNF-1-dependent activation of a CAT reporter plasmid was specifically inhibited when the HNF-1 dumbbell oligonucleotide was added at nM concentration to transiently transfected C33 cells. On the contrary, HNF-1 ds oligonucleotides, which displayed the same activity as the dumbbell oligonucleotides in the in vitro assays, were no more effective in the ex vivo experiments. These results might reflect the increased stability of the circular dumbbell oligonucleotides towards cellular nuclease degradation, as shown in vitro with nucleolytic enzymes. Dumbbell oligonucleotides containing unmodified phosphodiester bonds may efficiently compete for binding of specific transcription factors within cells, then providing a potential therapeutic tool to control disease-causing genes. Images PMID:7688452

  16. The MOX/SUC precursor strategies: robust ways to construct functionalized oligonucleotides.

    PubMed

    Polushin, N

    2001-01-01

    The use of phosphoramidites bearing one or more methoxyoxalamido (MOX) or succinimido (SUC) reactive groups for construction of functionalized oligonucleotides is described. The efficiency of the new precursor strategy was demonstrated in the synthesis of oligonucleotide containing up to 16 imidazole residues.

  17. Donor-acceptor complexation and dehydrogenation chemistry of aminoboranes.

    PubMed

    Malcolm, Adam C; Sabourin, Kyle J; McDonald, Robert; Ferguson, Michael J; Rivard, Eric

    2012-12-03

    A series of formal donor-acceptor adducts of aminoborane (H(2)BNH(2)) and its N-substituted analogues (H(2)BNRR') were prepared: LB-H(2)BNRR'(2)-BH(3) (LB = DMAP, IPr, IPrCH(2) and PCy(3); R and R' = H, Me or tBu; IPr = [(HCNDipp)(2)C:] and Dipp = 2,6-iPr(2)C(6)H(3)). To potentially access complexes of molecular boron nitride, LB-BN-LA (LA = Lewis acid), preliminary dehydrogenation chemistry involving the parent aminoborane adducts LB-H(2)BNH(2)-BH(3) was investigated using [Rh(COD)Cl](2), CuBr, and NiBr(2) as dehydrogenation catalysts. In place of isolating the intended dehydrogenated BN donor-acceptor complexes, the formation of borazine was noted as a major product. Attempts to prepare the fluoroarylborane-capped aminoborane complexes, LB-H(2)BNH(2)-B(C(6)F(5))(3), are also described.

  18. Conductivity of a Weyl semimetal with donor and acceptor impurities

    NASA Astrophysics Data System (ADS)

    Rodionov, Ya. I.; Syzranov, S. V.

    2015-05-01

    We study transport in a Weyl semimetal with donor and acceptor impurities. At sufficiently high temperatures transport is dominated by electron-electron interactions, while the low-temperature resistivity comes from the scattering of quasiparticles on screened impurities. Using the diagrammatic technique, we calculate the conductivity σ (T ,ω ,nA,nD) in the impurities-dominated regime as a function of temperature T , frequency ω , and the concentrations nA and nD of acceptors and donors and discuss the crossover behavior between the regimes of low and high temperatures and impurity concentrations. In a sufficiently compensated material [| nA-nD|≪ (nA+nD) ] with a small effective fine structure constant α ,σ (ω ,T ) ∝T2/(T-2-i ω .const) in a wide interval of temperatures. For very low temperatures, or in the case of an uncompensated material, the transport is effectively metallic. We discuss experimental conditions necessary for realizing each regime.

  19. Glutathione Adduct Patterns of Michael-Acceptor Carbonyls.

    PubMed

    Slawik, Christian; Rickmeyer, Christiane; Brehm, Martin; Böhme, Alexander; Schüürmann, Gerrit

    2017-02-22

    Glutathione (GSH) has so far been considered to facilitate detoxification of soft organic electrophiles through covalent binding at its cysteine (Cys) thiol group, followed by stepwise catalyzed degradation and eventual elimination along the mercapturic acid pathway. Here we show that in contrast to expectation from HSAB theory, Michael-acceptor ketones, aldehydes and esters may form also single, double and triple adducts with GSH involving β-carbon attack at the much harder N-terminus of the γ-glutamyl (Glu) unit of GSH. In particular, formation of the GSH-N single adduct contradicts the traditional view that S alkylation always forms the initial reaction of GSH with Michael-acceptor carbonyls. To this end, chemoassay analyses of the adduct formation of GSH with nine α,β-unsaturated carbonyls employing high performance liquid chromatography and tandem mass spectrometry have been performed. Besides enriching the GSH adductome and potential biomarker applications, electrophilic N-terminus functio-nalization is likely to impair GSH homeostasis substantially through blocking the γ-glutamyl transferase catalysis of the first breakdown step of modified GSH, and thus its timely reconstitution. The discussion includes a comparison with cyclic adducts of GSH and furan metabolites as reported in literature, and quantum chemically calculated thermodynamics of hard-hard, hard-soft and soft-soft adducts.

  20. Dissimilatory reduction of extracellular electron acceptors in anaerobic respiration.

    PubMed

    Richter, Katrin; Schicklberger, Marcus; Gescher, Johannes

    2012-02-01

    An extension of the respiratory chain to the cell surface is necessary to reduce extracellular electron acceptors like ferric iron or manganese oxides. In the past few years, more and more compounds were revealed to be reduced at the surface of the outer membrane of Gram-negative bacteria, and the list does not seem to have an end so far. Shewanella as well as Geobacter strains are model organisms to discover the biochemistry that enables the dissimilatory reduction of extracellular electron acceptors. In both cases, c-type cytochromes are essential electron-transferring proteins. They make the journey of respiratory electrons from the cytoplasmic membrane through periplasm and over the outer membrane possible. Outer membrane cytochromes have the ability to catalyze the last step of the respiratory chains. Still, recent discoveries provided evidence that they are accompanied by further factors that allow or at least facilitate extracellular reduction. This review gives a condensed overview of our current knowledge of extracellular respiration, highlights recent discoveries, and discusses critically the influence of different strategies for terminal electron transfer reactions.

  1. [Oligonucleotide derivatives in the nucleic acid hybridization analysis. I. Covalent immobilization of oligonucleotide probes onto the nylon].

    PubMed

    Dmitrienko, E V; Pyshnaia, I A; Pyshnyĭ, D V

    2010-01-01

    The features of UV-induced immobilization of oligonucleotides on a nylon membranes and the effectiveness of enzymatic labeling of immobilized probes at heterophase detection of nucleic acids are studied. Short terminal oligothymidilate (up to 10 nt) sequences are suggested to attach to the probe via a flexible ethylene glycol based linker. The presence of such fragment enhances the intensity of immobilization and reduces UV-dependent degradation of the targeted (sequence-specific) part of the probe by reducing the dose needed for the immobilization of DNA. The optimum dose of UV-irradiation is determined to be ~0.4 J/cm(2) at the wavelength 254 nm. This dose provides high level of hybridization signal for immobilized probes with various nucleotide composition of the sequence specific moiety. The amide groups of the polyamide are shown to play the key role in the photoinduced immobilization of nucleic acids, whereas the primary amino groups in the structure of PA is not the center responsible for the covalent binding of DNA by UV-irradiation, as previously believed. Various additives in the soaking solution during the membrane of UV-dependent immobilization of probes are shown to influence its effectiveness. The use of alternative to UV-irradiation system of radical generation are shown to provide the immobilization of oligonucleotides onto the nylon membrane.

  2. Detection of oligonucleotide hybridization on a single microparticle by time-resolved fluorometry: hybridization assays on polymer particles obtained by direct solid phase assembly of the oligonucleotide probes.

    PubMed

    Hakala, H; Heinonen, P; Iitiä, A; Lönnberg, H

    1997-01-01

    Oligodeoxyribonucleotides were assembled by conventional phosphoramidite chemistry on uniformly sized (50 microns) porous glycidyl methacrylate/ethylene dimethacrylate (SINTEF) and compact polystyrene (Dynosphere) particles, the aminoalkyl side chains of which were further derivatized with DMTrO-acetyl groups. The linker was completely resistant toward ammonolytic deprotection of the base moieties. The quality of oligonucleotides was assessed by repeating the synthesis on the same particles derivatized with a cleavable ester linker. The ability of the oligonucleotide-coated particles to bind complementary sequences via hybridization was examined by following the attachment of oligonucleotides bearing a photoluminescent europium(III) chelate to the particles. The fluorescence emission was measured directly on a single particle. The effects of the following factors on the kinetics and efficiency of hybridization were studied: number of particles in a given volume of the assay solution, loading of oligonucleotide on the particle, concentration of the target oligonucleotide in solution, length of the hybridizing sequence, presence of noncomplementary sequences, and ionic strength. The fluorescence signal measured on a single particle after hybridization was observed to be proportional to the concentration of the target oligonucleotide in solution over a concentration range of 5 orders of magnitude.

  3. Oligonucleotide-modified screen-printed gold electrodes for enzyme-amplified sensing of nucleic acids.

    PubMed

    Carpini, Guido; Lucarelli, Fausto; Marrazza, Giovanna; Mascini, Marco

    2004-09-15

    An electrochemical genosensor for the detection of specific sequences of DNA has been developed using disposable screen-printed gold electrodes. Screen-printed gold electrodes were firstly modified with a mixed monolayer of a 25-mer thiol-tethered DNA probe and a spacer thiol, 6-mercapto-1-hexanol (MCH). The DNA probe sequence was internal to the sequence of the 35S promoter, which sequence is inserted in the genome of GMOs regulating the transgene expression. An enzyme-amplified detection scheme, based on the coupling of a streptavidin-alkaline phosphatase conjugate and biotinylated target sequences was then applied. The enzyme catalysed the hydrolysis of the electroinactive alpha-naphthyl phosphate to alpha-naphthol; this product is electroactive and has been detected by means of differential pulse voltammetry. The assay was, firstly, characterised using synthetic oligonucleotides. Relevant parameters, such as the probe concentration and the immobilisation time, the use of the MCH and different enzymatic conjugates, were investigated and optimised. The genosensor response was found to be linearly related to the target concentration between 0 and 25 nmol/L; the detection limit was 0.25 nmol/L. The analytical procedure was then applied for the detection of the 35S promoter sequence, which was amplified from the pBI121 plasmid by polymerase chain reaction (PCR). Hybridisation conditions (i.e., hybridisation buffer and hybridisation time) were further optimised. The selectivity of the assay was confirmed using biotinylated non-complementary amplicons and PCR blanks. The results showed that the genosensor enabled sensitive (detection limit: 1 nmol/L) and specific detection of GMO-related sequences, thus providing a useful tool for the screening analysis of bioengineered food samples.

  4. Optical detection and discrimination of cystic fibrosis-related genetic mutations using oligonucleotide-nanoparticle conjugates.

    PubMed

    Murphy, Deirdre; Redmond, Gareth

    2005-03-01

    Novel methods for application of oligonucleotide-gold nanoparticle conjugates to selective colorimetric detection and discrimination of cystic fibrosis (CF) related genetic mutations in model oligonucleotide systems are presented. Three-strand oligonucleotide complexes are employed, wherein two probe oligonucleotide-gold nanoparticle conjugates are linked together by a third target oligonucleotide strand bearing the CF-related mutation(s). By monitoring the temperature dependence of the optical properties of the complexes, either in solution or on silica gel plates, melting behaviors may be accurately and reproducibly compared. Using this approach, fully complementary sequences are successfully distinguished from mismatched sequences, with single base mismatch resolution, for Delta F 508, M470V, R74W and R75Q mutations.

  5. Functionalized chitosan derivatives as nonviral vectors: physicochemical properties of acylated N,N,N-trimethyl chitosan/oligonucleotide nanopolyplexes.

    PubMed

    Santos, Joyce C C; Moreno, Pedro M D; Mansur, Alexandra A P; Leiro, Victoria; Mansur, Herman S; Pêgo, Ana Paula

    2015-11-07

    Cationic polymers have recently attracted attention due to their proven potential for nonviral gene delivery. In this study, we report novel biocompatible nanocomplexes produced using chemically functionalized N,N,N-trimethyl chitosan (TMC) with different N-acyl chain lengths (C5-C18) associated with single-stranded oligonucleotides. The TMC derivatives were synthesized by covalent coupling reactions of quaternized chitosan with n-pentanoic (C5), n-decanoic (C10), and n-octadecanoic (C18) fatty acids, which were extensively characterized by Fourier transform-infrared spectroscopy (FT-IR) and proton nuclear magnetic resonance ((1)H NMR). These N-acylated TMC derivatives (TMCn) were used as cationic polymeric matrices for encapsulating anionic 18-base single-stranded thiophosphorylated oligonucleotides (ssONs), leading to the formation of polyplexes further characterized by zeta potential (ZP), dynamic light scattering (DLS), binding affinity, transfection efficiency and in vitro cytotoxicity assays. The results demonstrated that the length of the grafted hydrophobic N-acyl chain and the relative amino:phosphate groups ratio (N/P ratio) between the TMC derivatives and ssON played crucial roles in determining the physicochemical properties of the obtained nanocomplexes. While none of the tested derivatives showed appreciable cytotoxicity, the type of acyl chain had a remarkable influence on the cell transfection capacity of TMC-ssON nanocomplexes with the derivatives based on stearic acid showing the best performance based on the results of in vitro assays using a model cell line expressing luciferase (HeLa/Luc705).

  6. Recommendations for safety pharmacology evaluations of oligonucleotide-based therapeutics.

    PubMed

    Berman, Cindy L; Cannon, Keri; Cui, Yi; Kornbrust, Douglas J; Lagrutta, Armando; Sun, Sunny Z; Tepper, Jeff; Waldron, Gareth; Younis, Husam S

    2014-08-01

    This document was prepared by the Safety Pharmacology Subcommittee of the Oligonucleotide Safety Working Group (OSWG), a group of industry and regulatory scientists involved in the development and regulation of therapeutic oligonucleotides. The mission of the Subcommittee was to develop scientific recommendations for the industry regarding the appropriate scope and strategies for safety pharmacology evaluations of oligonucleotides (ONs). These recommendations are the consensus opinion of the Subcommittee and do not necessarily reflect the current expectations of regulatory authorities. 1) Safety pharmacology testing, as described in the International Conference on Harmonisation (ICH) S7 guidance, is as applicable to ONs as it is to small molecule drugs and biotherapeutics. 2) Study design considerations for ONs are similar to those for other classes of drugs. In general, as with other therapeutics, studies should evaluate the drug product administered via the clinical route. Species selection should ideally consider relevance of the model with regard to the endpoints of interest, pharmacological responsiveness, and continuity with the nonclinical development program. 3) Evaluation of potential effects in the core battery (cardiovascular, central nervous, and respiratory systems) is recommended. In general: a. In vitro human ether-a-go-go-related gene (hERG) testing does not provide any specific value and is not warranted. b. Emphasis should be placed on in vivo evaluation of cardiovascular function, typically in nonhuman primates (NHPs). c. Due to the low level of concern, neurologic and respiratory function can be assessed concurrently with cardiovascular safety pharmacology evaluation in NHPs, within repeat-dose toxicity studies, or as stand-alone studies. In the latter case, rodents are most commonly used. 4) Other dedicated safety pharmacology studies, beyond the core battery, may have limited value for ONs. Although ONs can accumulate in the kidney and liver

  7. Binding characteristics of homogeneous molecularly imprinted polymers for acyclovir using an (acceptor-donor-donor)-(donor-acceptor-acceptor) hydrogen-bond strategy, and analytical applications for serum samples.

    PubMed

    Wu, Suqin; Tan, Lei; Wang, Ganquan; Peng, Guiming; Kang, Chengcheng; Tang, Youwen

    2013-04-12

    This paper demonstrates a novel approach to assembling homogeneous molecularly imprinted polymers (MIPs) based on mimicking multiple hydrogen bonds between nucleotide bases by preparing acyclovir (ACV) as a template and using coatings grafted on silica supports. (1)H NMR studies confirmed the AAD-DDA (A for acceptor, D for donor) hydrogen-bond array between template and functional monomer, while the resultant monodisperse molecularly imprinted microspheres (MIMs) were evaluated using a binding experiment, high performance liquid chromatography (HPLC), and solid phase extraction. The Langmuir isothermal model and the Langmuir-Freundlich isothermal model suggest that ACV-MIMs have more homogeneous binding sites than MIPs prepared through normal imprinting. In contrast to previous MIP-HPLC columns, there were no apparent tailings for the ACV peaks, and ACV-MIMs had excellent specific binding properties with a Ka peak of 3.44 × 10(5)M(-1). A complete baseline separation is obtained for ACV and structurally similar compounds. This work also successfully used MIMs as a specific sorbent for capturing ACV from serum samples. The detection limit and mean recovery of ACV was 1.8 ng/mL(-1) and 95.6%, respectively, for molecularly imprinted solid phase extraction coupled with HPLC. To our knowledge, this was the first example of MIPs using AAD-DDA hydrogen bonds.

  8. 2-O-α-D-Glucosylglycerol Phosphorylase from Bacillus selenitireducens MLS10 Possessing Hydrolytic Activity on β-D-Glucose 1-Phosphate

    PubMed Central

    Nihira, Takanori; Saito, Yuka; Ohtsubo, Ken’ichi; Nakai, Hiroyuki; Kitaoka, Motomitsu

    2014-01-01

    The glycoside hydrolase family (GH) 65 is a family of inverting phosphorylases that act on α-glucosides. A GH65 protein (Bsel_2816) from Bacillus selenitireducens MLS10 exhibited inorganic phosphate (Pi)-dependent hydrolysis of kojibiose at the rate of 0.43 s−1. No carbohydrate acted as acceptor for the reverse phosphorolysis using β-d-glucose 1-phosphate (βGlc1P) as donor. During the search for a suitable acceptor, we found that Bsel_2816 possessed hydrolytic activity on βGlc1P with a kcat of 2.8 s−1; moreover, such significant hydrolytic activity on sugar 1-phosphate had not been reported for any inverting phosphorylase. The H218O incorporation experiment and the anomeric analysis during the hydrolysis of βGlc1P revealed that the hydrolysis was due to the glucosyl-transferring reaction to a water molecule and not a phosphatase-type reaction. Glycerol was found to be the best acceptor to generate 2-O-α-d-glucosylglycerol (GG) at the rate of 180 s−1. Bsel_2816 phosphorolyzed GG through sequential Bi-Bi mechanism with a kcat of 95 s−1. We propose 2-O-α-d-glucopyranosylglycerol: phosphate β-d-glucosyltransferase as the systematic name and 2-O-α-d-glucosylglycerol phosphorylase as the short name for Bsel_2816. This is the first report describing a phosphorylase that utilizes polyols, and not carbohydrates, as suitable acceptor substrates. PMID:24466148

  9. The structure and bonding of iron-acceptor pairs in silicon

    SciTech Connect

    Zhao, S.; Assali, L.V.C.; Kimerling, L.C.

    1995-08-01

    The highly mobile interstitial iron and Group III impurities (B, Al, Ga, In) form iron-acceptor pairs in silicon. Based on the migration kinetics and taking host silicon as a dielectric medium, we have simulated the pairing process in a static silicon lattice. Different from the conventional point charge ionic model, our phenomenological calculations include (1) a correction that takes into account valence electron cloud polarization which adds a short range, attractive interaction in the iron-acceptor pair bonding; and (2) silicon lattice relaxation due to the atomic size difference which causes a local strain field. Our model explains qualitatively (1) trends among the iron-acceptor pairs revealing an increase of the electronic state hole emission energy with increasing principal quantum number of acceptor and decreasing pair separation distance; and (2) the stable and metastable sites and configurational symmetries of the iron-acceptor pairs. The iron-acceptor pairing and bonding mechanism is also discussed.

  10. Human glucose phosphate isomerase: Exon mapping and gene structure

    SciTech Connect

    Xu, Weiming; Lee, Pauline; Beutler, E.

    1995-10-10

    The structure of the gene for human glucose phosphate isomerase (GPI) has been determined. Three GPI clones were isolated from a human genomic library by using a full-length GPI cDNA probe and were characterized. Oligonucleotides based on the known cDNA sequence were used as primers in amplification and sequence analyses. This led to the identification of the exon-intron junctions. By this approach, 18 exons and 17 introns have been identified. The exons range in size from 44 to 431 nucleotides. The intronic sequences surrounding the exons provide useful information for the identification of mutations that give rise to human GPI deficiency associated with chronic hemolytic anemia. 13 refs., 4 figs., 1 tab.

  11. Prodrugs of phosphonates and phosphates: crossing the membrane barrier.

    PubMed

    Wiemer, Andrew J; Wiemer, David F

    2015-01-01

    A substantial portion of metabolism involves transformation of phosphate esters, including pathways leading to nucleotides and oligonucleotides, carbohydrates, isoprenoids and steroids, and phosphorylated proteins. Because the natural substrates bear one or more negative charges, drugs that target these enzymes generally must be charged as well, but small charged molecules can have difficulty traversing the cell membrane by means other than endocytosis. The resulting dichotomy has stimulated a great deal of effort to develop effective prodrugs, compounds that carry little or no charge to enable them to transit biological membranes, but able to release the parent drug once inside the target cell. This chapter presents recent studies on advances in prodrug forms, along with representative examples of their application to marketed and developmental drugs.

  12. Domestic phosphate deposits

    USGS Publications Warehouse

    McKelvey, V.E.; Cathcart, J.B.; Altschuler, Z.S.; Swanson, R.W.; Lutz, Katherine

    1953-01-01

    Most of the worlds phosphate deposits can be grouped into six types: 1) igneous apatite deposits; 2) marine phosphorites; 3) residual phosphorites; 4) river pebble deposits; 5) phosphatized rock; and 6) guano. The igneous apatites and marine phosphorites form deposits measurable in millions or billions of tons; the residual deposits are measurable in thousands or millions; and the other types generally only in thousands of tons. Igneous apatite deposits have been mined on a small scale in New York, New Jersey, and Virginia. Marine phosphorites have been mined in Montana, Idaho, Utah, Wyoming, Arkansas, Tennessee, North Carolina, South Carolina, Georgia, and Florida. Residual phosphorites have been mined in Tennessee, Pennsylvania, and Florida. River pebble has been produced in South Carolina and Florida; phosphatized rock in Tennessee and Florida; and guano in New Mexico and Texas. Present production is limited almost entirely to Florida, Tennessee, Montana, Idaho, and Wyoming. Incomplete but recently partly revised estimates indicate the presence of about 5 billion tons of phosphate deposits in the United States that is minable under present economic conditions. Deposits too lean in quality or thickness to compete with those in the western and southeastern fields probably contain tens of billions of tons.

  13. Glucose-6-phosphate dehydrogenase

    MedlinePlus

    ... Elsevier Saunders; 2012:chap 42. Read More Enzyme Glucose-6-phosphate dehydrogenase deficiency Hemoglobin Review Date 2/11/2016 Updated by: ... A.M. Editorial team. Related MedlinePlus Health Topics G6PD Deficiency Browse the Encyclopedia A.D.A.M., Inc. ...

  14. Rapid large-scale oligonucleotide selection for microarrays.

    PubMed

    Rahmann, Sven

    2002-01-01

    We present the first algorithm that selects oligonucleotide probes (e.g. 25-mers) for microarray experiments on a large scale. For example, oligos for human genes can be found within 50 hours. This becomes possible by using the longest common substring as a specificity measure for candidate oligos. We present an algorithm based on a suffix array with additional information that is efficient both in terms of memory usage and running time to rank all candidate oligos according to their specificity. We also introduce the concept of master sequences to describe the sequences from which oligos are to be selected. Constraints such as oligo length, melting temperature, and self-complementarity are incorporated in the master sequence at a preprocessing stage and thus kept separate from the main selection problem. As a result, custom oligos can now be designed for any sequenced genome, just as the technology for on-site chip synthesis is becoming increasingly mature.

  15. Targeted gene correction with 5' acridine-oligonucleotide conjugates.

    PubMed

    de Piédoue, G; Andrieu-Soler, C; Concordet, J P; Maurisse, R; Sun, J-S; Lopez, B; Kuzniak, I; Leboulch, P; Feugeas, J-P

    2007-01-01

    Single-stranded oligonucleotides (SSOs) mediate gene repair of punctual chromosomal mutations at a low frequency. We hypothesized that enhancement of DNA binding affinity of SSOs by intercalating agents may increase the number of corrected cells. Several biochemical modifications of SSOs were tested for their capability to correct a chromosomally integrated and mutated GFP reporter gene in human 293 cells. SSOs of 25 nucleotide length conjugated with acridine at their 5' end increased the efficiency of gene correction up to 10-fold compared to nonmodified SSOs. Acridine and psoralen conjugates were both evaluated, and acridine-modified SSOs were the most effective. Conjugation with acridine at the 3' end of the SSO inhibited gene correction, whereas flanking the SSO by acridine on both sides provided an intermediate level of correction. These results suggest that increasing the stability of hybridization between SSO and its target without hampering a 3' extension improves gene targeting, in agreement with the "annealing-integration" model of DNA repair.

  16. Association of branched oligonucleotides into the i-motif.

    PubMed

    Robidoux, S; Klinck, R; Gehring, K; Damha, M J

    1997-12-01

    The unique architecture of branched oligonucleotides mimicking lariat RNA introns [Wallace and Edmons, Proc. Natl. Acad. Sci. USA 80, 950-954 (1983)] was exploited to study compounds that associate as two parallel duplexes with intercalating C/C+ base pairs (i-motif DNA) [Gehring et al. Nature 363, 561-565 (1993)]. The formation of a branched cytosine tetrad was induced by joining the 5'-ends of pair of pentadeoxycytidine strands with a branching riboadenosine (rA) linker. This arrangement causes the orientation of the dC strands to be parallel, and forces the formation of a C/C+ duplex that self-associates into i-DNA. Presence of the i-motif in this structure is supported by thermal denaturation, native gel electrophoresis, CD, and NMR spectroscopy.

  17. Recent Methods for Purification and Structure Determination of Oligonucleotides

    PubMed Central

    Zhang, Qiulong; Lv, Huanhuan; Wang, Lili; Chen, Man; Li, Fangfei; Liang, Chao; Yu, Yuanyuan; Jiang, Feng; Lu, Aiping; Zhang, Ge

    2016-01-01

    Aptamers are single-stranded DNA or RNA oligonucleotides that can interact with target molecules through specific three-dimensional structures. The excellent features, such as high specificity and affinity for target proteins, small size, chemical stability, low immunogenicity, facile chemical synthesis, versatility in structural design and engineering, and accessible for site-specific modifications with functional moieties, make aptamers attractive molecules in the fields of clinical diagnostics and biopharmaceutical therapeutics. However, difficulties in purification and structural identification of aptamers remain a major impediment to their broad clinical application. In this mini-review, we present the recently attractive developments regarding the purification and identification of aptamers. We also discuss the advantages, limitations, and prospects for the major methods applied in purifying and identifying aptamers, which could facilitate the application of aptamers. PMID:27999357

  18. Predicting the Kinetics of RNA Oligonucleotides Using Markov State Models.

    PubMed

    Pinamonti, Giovanni; Zhao, Jianbo; Condon, David E; Paul, Fabian; Noè, Frank; Turner, Douglas H; Bussi, Giovanni

    2017-02-14

    Nowadays different experimental techniques, such as single molecule or relaxation experiments, can provide dynamic properties of biomolecular systems, but the amount of detail obtainable with these methods is often limited in terms of time or spatial resolution. Here we use state-of-the-art computational techniques, namely, atomistic molecular dynamics and Markov state models, to provide insight into the rapid dynamics of short RNA oligonucleotides, to elucidate the kinetics of stacking interactions. Analysis of multiple microsecond-long simulations indicates that the main relaxation modes of such molecules can consist of transitions between alternative folded states, rather than between random coils and native structures. After properly removing structures that are artificially stabilized by known inaccuracies of the current RNA AMBER force field, the kinetic properties predicted are consistent with the time scales of previously reported relaxation experiments.

  19. OligoCalc: an online oligonucleotide properties calculator

    PubMed Central

    Kibbe, Warren A.

    2007-01-01

    We developed OligoCalc as a web-accessible, client-based computational engine for reporting DNA and RNA single-stranded and double-stranded properties, including molecular weight, solution concentration, melting temperature, estimated absorbance coefficients, inter-molecular self-complementarity estimation and intra-molecular hairpin loop formation. OligoCalc has a familiar ‘calculator’ look and feel, making it readily understandable and usable. OligoCalc incorporates three common methods for calculating oligonucleotide-melting temperatures, including a nearest-neighbor thermodynamic model for melting temperature. Since it first came online in 1997, there have been more than 900 000 accesses of OligoCalc from nearly 200 000 distinct hosts, excluding search engines. OligoCalc is available at http://basic.northwestern.edu/biotools/OligoCalc.html, with links to the full source code, usage patterns and statistics at that link as well. PMID:17452344

  20. Triplex-forming oligonucleotide target sequences in the human genome

    PubMed Central

    Goñi, J. Ramon; de la Cruz, Xavier; Orozco, Modesto

    2004-01-01

    The existence of sequences in the human genome which can be a target for triplex formation, and accordingly are candidates for anti-gene therapies, has been studied by using bioinformatics tools. It was found that the population of triplex-forming oligonucleotide target sequences (TTS) is much more abundant than that expected from simple random models. The population of TTS is large in all the genome, without major differences between chromosomes. A wide analysis along annotated regions of the genome allows us to demonstrate that the largest relative concentration of TTS is found in regulatory regions, especially in promoter zones, which suggests a tremendous potentiality for triplex strategy in the control of gene expression. The dependence of the stability and selectivity of the triplexes on the length of the TTS is also analysed using knowledge-based rules. PMID:14726484

  1. Insights to primitive replication derived from structures of small oligonucleotides

    NASA Technical Reports Server (NTRS)

    Smith, G. K.; Fox, G. E.

    1995-01-01

    Available information on the structure of small oligonucleotides is surveyed. It is observed that even small oligomers typically exhibit defined structures over a wide range of pH and temperature. These structures rely on a plethora of non-standard base-base interactions in addition to the traditional Watson-Crick pairings. Stable duplexes, though typically antiparallel, can be parallel or staggered and perfect complementarity is not essential. These results imply that primitive template directed reactions do not require high fidelity. Hence, the extensive use of Watson-Crick complementarity in genes rather than being a direct consequence of the primitive condensation process, may instead reflect subsequent selection based on the advantage of accuracy in maintaining the primitive genetic machinery once it arose.

  2. Empirical evaluation of oligonucleotide probe selection for DNA microarrays.

    PubMed

    Mulle, Jennifer G; Patel, Viren C; Warren, Stephen T; Hegde, Madhuri R; Cutler, David J; Zwick, Michael E

    2010-03-29

    DNA-based microarrays are increasingly central to biomedical research. Selecting oligonucleotide sequences that will behave consistently across experiments is essential to the design, production and performance of DNA microarrays. Here our aim was to improve on probe design parameters by empirically and systematically evaluating probe performance in a multivariate context. We used experimental data from 19 array CGH hybridizations to assess the probe performance of 385,474 probes tiled in the Duchenne muscular dystrophy (DMD) region of the X chromosome. Our results demonstrate that probe melting temperature, single nucleotide polymorphisms (SNPs), and homocytosine motifs all have a strong effect on probe behavior. These findings, when incorporated into future microarray probe selection algorithms, may improve microarray performance for a wide variety of applications.

  3. Oligonucleotide synthesis catalyzed by the Zn/2+/ ion

    NASA Technical Reports Server (NTRS)

    Sawai, H.; Orgel, L. E.

    1975-01-01

    Results of experiments are reported in which Zn(2+) ion catalyzed the formation of oligonucleotides from nucleoside phosphorimidazolides in aqueous solution, even in the absence of a template. Specifically, the imidazolides (ImpU or ImpA) polymerized to form ImpApA, and pApA, pApApA, and pApApApA, or the analogous uracil compounds. In addition, the expected hydrolysis products of the hydrolysis of ImpA were formed (pA, imidazole). Judging from the ratio of pA(n) over pA (with and without zinc ion), this ion increased the efficiency of phosphodiester-bond formation by up to 10 times. Possible mechanisms for the reaction are tentatively proposed.

  4. A note on oligonucleotide expression values not being normally distributed.

    PubMed

    Hardin, Johanna; Wilson, Jason

    2009-07-01

    Novel techniques for analyzing microarray data are constantly being developed. Though many of the methods contribute to biological discoveries, inability to properly evaluate the novel techniques limits their ability to advance science. Because the underlying distribution of microarray data is unknown, novel methods are typically tested against the assumed normal distribution. However, microarray data are not, in fact, normally distributed, and assuming so can have misleading consequences. Using an Affymetrix technical replicate spike-in data set, we show that oligonucleotide expression values are not normally distributed for any of the standard methods for calculating expression values. The resulting data tend to have a large proportion of skew and heavy tailed genes. Additionally, we show that standard methods can give unexpected and misleading results when the data are not well approximated by the normal distribution. Robust methods are therefore recommended when analyzing microarray data. Additionally, new techniques should be evaluated with skewed and/or heavy-tailed data distributions.

  5. Evaluation of Manganese Phosphate Coatings.

    DTIC Science & Technology

    1984-02-01

    84003 _____________ 4 . TTLE and -bitle)5. TYPE OF REPORT & PERIOD COVERED EVALUATION OF MANGANESE PHOSPHATE COATINGS Final 6. PERFORMING ORG. REPORT...rosion resistance of the Endurion phosphate was significantly superior to the 4 . basic manganese phosphate . Endurion phosphate with a Supplementary...OF CONTENTS Page STATEMENT OF THE PROBLEM 1 BACKGROUND 1 APPROACH TO THE PROBLEM 3 RESULTS 4 CONCLUSIONS 7 TABLES I. Falex Wear Life Test Procedure 8

  6. Two acceptor levels and hopping conduction in Mn-doped GaAs

    NASA Astrophysics Data System (ADS)

    Kajikawa, Yasutomo

    2017-01-01

    By analysing the experimental data of the temperature-dependent Hall-effect measurements, an additional acceptor level has been confirmed to exist in Mn-doped p-GaAs besides the isolated substitutional Mn acceptor level. It is found that, in most of the investigated samples, the room-temperature hole concentration is governed by the additional acceptor level rather than the isolated substitutional Mn acceptor level. The concentration of the additional acceptor level is found to increase almost in proportion to the square of the concentration of the isolated substitutional Mn acceptors, suggesting that the additional acceptor level is related to Mn dimers. This suggests that the ferromagnetism observed in more heavily Mn-doped GaAs may be attributed to Mn clusters. For some of the samples in which the characteristic of nearest-neighbour hopping conduction in the substitutional Mn acceptor impurity band is evident, the hopping activation energy is deduced and is proved to increase in proportion to the cube root of the concentration of the substitutional Mn acceptors.

  7. Protected sphingosine from phytosphingosine as an efficient acceptor in glycosylation reaction.

    PubMed

    Di Benedetto, Roberta; Zanetti, Luca; Varese, Monica; Rajabi, Mehdi; Di Brisco, Riccardo; Panza, Luigi

    2014-02-07

    A convenient, simple, and high-yielding five-step synthesis of a sphingosine acceptor from phytosphingosine is reported, and its behavior in glycosylation reactions is described. Different synthetic paths to sphingosine acceptors using tetrachlorophthalimide as a protecting group for the sphingosine amino function and different glycosylation methods have been explored. Among the acceptors tested, the easiest accessible acceptor, unprotected on the two hydroxyl groups in positions 1 and 3, was regioselectively glycosylated on the primary position, the regioselectivity depending on the donor used.

  8. Process for gasification using a synthetic CO/sub 2/ acceptor

    SciTech Connect

    Lancet, M.S.; Curran, G.P.

    1980-11-04

    Conoco's gasification process uses a synthetic CO/sub 2/ acceptor consisting essentially of at least one calcium compound (either calcium oxide or calcium carbonate) supported in a refractory carrier matrix having the general formula Ca/sub 5/(SiO/sub 4/)/sub 2/CO/sub 3/. The synthetic acceptor is more effective than a natural calcium oxide acceptor during the gasification process because the thermally stable matrix causes the calcium compounds to remain in discrete particles that tend to reactivate with each passage through the process. This eliminates the need for large quantities of fresh makeup acceptor materials.

  9. Spectroscopy of donor-pi-acceptor complexes for solar cells

    NASA Astrophysics Data System (ADS)

    Himpsel, F. J.; Zegkinoglou, I.; Johnson, P. S.; Pemmaraju, C. D.; Prendergast, D.; Ragoussi, M.-E.; de la Torre, G.; Pickup, D. F.; Ortega, J. E.

    2014-03-01

    A recent improvement in the design of dye sensitized solar cells has been the combination of light absorbing, electron-donating, and electron-withdrawing groups within the same sensitizer molecule. This dye architecture has contributed to increase the energy conversion efficiency, leading to record efficiency values. Here we investigate a zinc(II)-porphyrin-based complex with triphenylamine donor groups and carboxyl linkers for the attachment to an oxide acceptor. The unoccupied orbitals of these three moieties are probed by element-selective X-ray absorption spectroscopy at the N 1s, C 1s, and Zn 2p edges, complemented by time-dependent density functional theory. The attachment of electron-donating groups to the porphyrin ring significantly delocalizes the highest occupied molecular orbital (HOMO) of the molecule. This leads to a spatial separation between the HOMO and the lowest unoccupied molecular orbital (LUMO), reducing the recombination rate of photoinduced electrons and holes.

  10. Pigment-acceptor-catalyst triads for photochemical hydrogen evolution.

    PubMed

    Kitamoto, Kyoji; Sakai, Ken

    2014-04-25

    In order to solve the problems of global warming and shortage of fossil fuels, researchers have been endeavoring to achieve artificial photosynthesis: splitting water into H2 and O2 under solar light illumination. Our group has recently invented a unique system that drives photoinduced water reduction through "Z-scheme" photosynthetic pathways. Nevertheless, that system still suffered from a low turnover number (TON) of the photocatalytic cycle (TON=4.1). We have now found and describe herein a new methodology to make significant improvements in the TON, up to around TON=14-27. For the new model systems reported herein, the quantum efficiency of the second photoinduced step in the Z-scheme photosynthesis is dramatically improved by introducing multiviologen tethers to temporarily collect the high-energy electron generated in the first photoinduced step. These are unique examples of "pigment-acceptor-catalyst triads", which demonstrate a new effective type of artificial photosynthesis.

  11. Donor-acceptor pair recombination in gallium sulfide

    NASA Astrophysics Data System (ADS)

    Aydinli, A.; Gasanly, N. M.; Gökşen, K.

    2000-12-01

    Low temperature photoluminescence of GaS single crystals shows three broad emission bands below 2.4 eV. Temperature and excitation light intensity dependencies of these bands reveal that all of them originate from close donor-acceptor pair recombination processes. Temperature dependence of the peak energies of two of these bands in the visible range follow, as expected, the band gap energy shift of GaS. However, the temperature dependence of the peak energy of the third band in the near infrared shows complex behavior by blueshifting at low temperatures followed by a redshift at intermediate temperatures and a second blueshift close to room temperature, which could only be explained via a configuration coordinate model. A simple model calculation indicates that the recombination centers are most likely located at the nearest neighbor lattice or interstitial sites.

  12. Recent advances in photoinduced donor/acceptor copolymerization

    NASA Astrophysics Data System (ADS)

    Jönsson, S.; Viswanathan, K.; Hoyle, C. E.; Clark, S. C.; Miller, C.; Morel, F.; Decker, C.

    1999-05-01

    Photoinitiated free radical polymerization of donor (D)/acceptor (A) type monomers has gained considerable interest due to the possibility to efficiently photopolymerize non-acrylate based systems. Furthermore, this photoinduced alternating copolymerization can be accomplished without the presence of a conventional free radical generating photoinitiator. In the past, we have shown that the structural influences in the direct photolysis of N-Alkyl and N-Arylmaleimides as well as their corresponding ground state charge transfer complexes (CTC) with suitable donors have carefully been investigated. For certain combinations of A and D type monomers, a direct photolysis of the ground state complex or the excitation of the acceptor, followed by the formation of an exciplex, has been shown to initiate the copolymerization. Herein, we show that the main route of initiation is based on inter or intra molecular H-abstraction from an excited state maleimide, whereby no exciplex formation takes place. H-abstraction will predominantly take place in systems where easily abstractable hydrogens are present. Our laser flash photolysis investigation, ESR [1] (A. Hiroshi, I. Takasi, T. Nosi, Macromol. Chem. 190 (1989) 2821) and phosphorescence emissions [2,3] (K.S. Chen, T. Foster, J.K.S. Wan, J. Phys. Chem. 84 (1980) 2473; C.J. Seliskar, S.P. McGlynn, J. Chem. Phys. 55 (1971) 4337) studies show that triplet excited states of N-alkyl substituted maleimides (RMI), which are well known strong precursors for direct H-abstractions from aliphatic ethers and secondary alcohols, are formed upon excitation. Rates of copolymerization and degrees of conversion for copolymerization of maleimide/vinyl ether pairs in air and nitrogen have been measured as a function of hydrogen abstractability of the excited triplet state MI as well as the influence of concentration and hydrogen donating effect of the hydrogen donor.

  13. Stereospecificity of Oligonucleotide Interactions Revisited: No Evidence for Heterochiral Hybridization and Ribozyme/DNAzyme Activity

    PubMed Central

    Hoehlig, Kai; Bethge, Lucas; Klussmann, Sven

    2015-01-01

    A major challenge for the application of RNA- or DNA-oligonucleotides in biotechnology and molecular medicine is their susceptibility to abundant nucleases. One intriguing possibility to tackle this problem is the use of mirror-image (l-)oligonucleotides. For aptamers, this concept has successfully been applied to even develop therapeutic agents, so-called Spiegelmers. However, for technologies depending on RNA/RNA or RNA/DNA hybridization, like antisense or RNA interference, it has not been possible to use mirror-image oligonucleotides because Watson-Crick base pairing of complementary strands is (thought to be) stereospecific. Many scientists consider this a general principle if not a dogma. A recent publication proposing heterochiral Watson-Crick base pairing and sequence-specific hydrolysis of natural RNA by mirror-image ribozymes or DNAzymes (and vice versa) prompted us to systematically revisit the stereospecificity of oligonucleotides hybridization and catalytic activity. Using hyperchromicity measurements we demonstrate that hybridization only occurs among homochiral anti-parallel complementary oligonucleotide strands. As expected, achiral PNA hybridizes to RNA and DNA irrespective of their chirality. In functional assays we could not confirm an alleged heterochiral hydrolytic activity of ribozymes or DNAzymes. Our results confirm a strict stereospecificity of oligonucleotide hybridization and clearly argue against the possibility to use mirror-image oligonucleotides for gene silencing or antisense applications. PMID:25679211

  14. Oligonucleotides designed to inhibit TLR9 block Herpes simplex virus type 1 infection at multiple steps.

    PubMed

    Sauter, Monica M; Gauger, Joshua J L; Brandt, Curtis R

    2014-09-01

    Herpes simplex virus type 1 (HSV-1) is an important human pathogen which requires activation of nuclear factor-kappa B (NFκB) during its replication cycle. The persistent nature of HSV-1 infection, and the emergence of drug-resistant strains, highlights the importance of research to develop new antiviral agents. Toll-like receptors (TLRs) play a prominent role during the early antiviral response by recognizing viral nucleic acid and gene products, activating NFκB, and stimulating the production of inflammatory cytokines. We demonstrate a significant effect on HSV-1 replication in ARPE-19 and Vero cells when oligonucleotides designed to inhibit TLR9 are added 2h prior to infection. A greater than 90% reduction in the yield of infectious virus was achieved at oligonucleotide concentrations of 10-20 μM. TLR9 inhibitory oligonucleotides prevented expression of essential immediate early herpes gene products as determined by immunofluorescence microscopy and Western blotting. TLR9 oligonucleotides also interfered with viral attachment and entry. A TLR9 inhibitory oligonucleotide containing five adjacent guanosine residues (G-ODN) exhibited virucidal activity and inhibited HSV-1 replication when added post-infection. The antiviral effect of the TLR9 inhibitory oligonucleotides did not depend on the presence of TLR9 protein, suggesting a mechanism of inhibition that is not TLR9 specific. TLR9 inhibitory oligonucleotides also reduced NFκB activity in nuclear extracts. Studies using these TLR inhibitors in the context of viral infection should be interpreted with caution.

  15. Calcium Phosphates and Human Beings

    NASA Astrophysics Data System (ADS)

    Dorozhkin, Sergey V.

    2006-05-01

    This article describes the general importance of calcium phosphates for human beings. The basic information on the structure and chemical properties of the biologically relevant calcium phosphates is summarized. Basic facts on the natural occurrence and the industrial use of natural calcium phosphates are discussed. Fundamental details on the presence of calcium phosphates in major calcified tissues (bones and teeth) of humans and mammals, as well as on biomaterials made of calcium phosphates are discussed. The article will be of value for chemistry teachers for expansion of their general background and point the students' attention to the rapidly growing topic of bone-substituting biomaterials.

  16. 21 CFR 184.1434 - Magnesium phosphate.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 3 2012-04-01 2012-04-01 false Magnesium phosphate. 184.1434 Section 184.1434... Listing of Specific Substances Affirmed as GRAS § 184.1434 Magnesium phosphate. (a) Magnesium phosphate includes both magnesium phosphate, dibasic, and magnesium phosphate, tribasic. Magnesium phosphate,...

  17. 21 CFR 184.1434 - Magnesium phosphate.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 3 2013-04-01 2013-04-01 false Magnesium phosphate. 184.1434 Section 184.1434... Listing of Specific Substances Affirmed as GRAS § 184.1434 Magnesium phosphate. (a) Magnesium phosphate includes both magnesium phosphate, dibasic, and magnesium phosphate, tribasic. Magnesium phosphate,...

  18. 21 CFR 184.1434 - Magnesium phosphate.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 3 2014-04-01 2014-04-01 false Magnesium phosphate. 184.1434 Section 184.1434... GRAS § 184.1434 Magnesium phosphate. (a) Magnesium phosphate includes both magnesium phosphate, dibasic, and magnesium phosphate, tribasic. Magnesium phosphate, dibasic (MgHPO4·3H2O, CAS Reg. No....

  19. Preliminary time-of-flight neutron diffraction studies of Escherichia coli ABC transport receptor phosphate-binding protein at the Protein Crystallography Station

    PubMed Central

    Sippel, K. H.; Bacik, J.; Quiocho, F. A.; Fisher, S. Z.

    2014-01-01

    Inorganic phosphate is an essential molecule for all known life. Organisms have developed many mechanisms to ensure an adequate supply, even in low-phosphate conditions. In prokaryotes phosphate transport is instigated by the phosphate-binding protein (PBP), the initial receptor for the ATP-binding cassette (ABC) phosphate transporter. In the crystal structure of the PBP–phosphate complex, the phosphate is completely desolvated and sequestered in a deep cleft and is bound by 13 hydrogen bonds: 12 to protein NH and OH donor groups and one to a carboxylate acceptor group. The carboxylate plays a key recognition role by accepting a phosphate hydrogen. PBP phosphate affinity is relatively consistent across a broad pH range, indicating the capacity to bind monobasic (H2PO4 −) and dibasic (HPO4 2−) phosphate; however, the mechanism by which it might accommodate the second hydrogen of monobasic phosphate is unclear. To answer this question, neutron diffraction studies were initiated. Large single crystals with a volume of 8 mm3 were grown and subjected to hydrogen/deuterium exchange. A 2.5 Å resolution data set was collected on the Protein Crystallography Station at the Los Alamos Neutron Science Center. Initial refinement of the neutron data shows significant nuclear density, and refinement is ongoing. This is the first report of a neutron study from this superfamily. PMID:24915101

  20. Contrasting performance of donor-acceptor copolymer pairs in ternary blend solar cells and two-acceptor copolymers in binary blend solar cells.

    PubMed

    Khlyabich, Petr P; Rudenko, Andrey E; Burkhart, Beate; Thompson, Barry C

    2015-02-04

    Here two contrasting approaches to polymer-fullerene solar cells are compared. In the first approach, two distinct semi-random donor-acceptor copolymers are blended with phenyl-C61-butyric acid methyl ester (PC61BM) to form ternary blend solar cells. The two poly(3-hexylthiophene)-based polymers contain either the acceptor thienopyrroledione (TPD) or diketopyrrolopyrrole (DPP). In the second approach, semi-random donor-acceptor copolymers containing both TPD and DPP acceptors in the same polymer backbone, termed two-acceptor polymers, are blended with PC61BM to give binary blend solar cells. The two approaches result in bulk heterojunction solar cells that have the same molecular active-layer components but differ in the manner in which these molecular components are mixed, either by physical mixing (ternary blend) or chemical "mixing" in the two-acceptor (binary blend) case. Optical properties and photon-to-electron conversion efficiencies of the binary and ternary blends were found to have similar features and were described as a linear combination of the individual components. At the same time, significant differences were observed in the open-circuit voltage (Voc) behaviors of binary and ternary blend solar cells. While in case of two-acceptor polymers, the Voc was found to be in the range of 0.495-0.552 V, ternary blend solar cells showed behavior inherent to organic alloy formation, displaying an intermediate, composition-dependent and tunable Voc in the range from 0.582 to 0.684 V, significantly exceeding the values achieved in the two-acceptor containing binary blend solar cells. Despite the differences between the physical and chemical mixing approaches, both pathways provided solar cells with similar power conversion efficiencies, highlighting the advantages of both pathways toward highly efficient organic solar cells.

  1. Resonant raman scattering in complexes of nc-Si/SiO2 quantum dots and oligonucleotides

    NASA Astrophysics Data System (ADS)

    Bairamov, F. B.; Poloskin, E. D.; Kornev, A. A.; Chernev, A. L.; Toporov, V. V.; Dubina, M. V.; Röder, C.; Sprung, C.; Lipsanen, H.; Bairamov, B. Kh.

    2014-11-01

    We report on the functionalization of nanocrystalline nc-Si/SiO2 semiconductor quantum dots (QDs) by short d(20G, 20T) oligonucleotides. The obtained complexes have been studied by Raman spectroscopy techniques with high spectral and spatial resolution. A new phenomenon of multiband resonant light scattering on single oligonucleotide molecules has been discovered, and peculiarities of this effect related to the nonradiative transfer of photoexcitation from nc-Si/SiO2 quantum dots to d(20G, 20T) oligonucleotide molecules have been revealed.

  2. Method for promoting specific alignment of short oligonucleotides on nucleic acids

    DOEpatents

    Studier, F. William; Kieleczawa, Jan; Dunn, John J.

    1996-01-01

    Disclosed is a method for promoting specific alignment of short oligonucleotides on a nucleic acid polymer. The nucleic acid polymer is incubated in a solution containing a single-stranded DNA-binding protein and a plurality of oligonucleotides which are perfectly complementary to distinct but adjacent regions of a predetermined contiguous nucleotide sequence in the nucleic acid polymer. The plurality of oligonucleotides anneal to the nucleic acid polymer to form a contiguous region of double stranded nucleic acid. Specific application of the methods disclosed include priming DNA synthesis and template-directed ligation.

  3. Oligonucleotide microchips as genosensors for determinative and environmental studies in microbiology.

    PubMed Central

    Guschin, D Y; Mobarry, B K; Proudnikov, D; Stahl, D A; Rittmann, B E; Mirzabekov, A D

    1997-01-01

    The utility of parallel hybridization of environmental nucleic acids to many oligonucleotides immobilized in a matrix of polyacrylamide gel pads on a glass slide (oligonucleotide microchip) was evaluated. Oligonucleotides complementary to small-subunit rRNA sequences of selected microbial groups, encompassing key genera of nitrifying bacteria, were shown to selectively retain labeled target nucleic acid derived from either DNA or RNA forms of the target sequences. The utility of varying the probe concentration to normalize hybridization signals and the use of multicolor detection for simultaneous quantitation of multiple probe-target populations were demonstrated. PMID:9172361

  4. Oligonucleotide-mediated gene repair at DNA level: the potential applications for gene therapy.

    PubMed

    Liu, Chang-Mei; Liu, De-Pei; Liang, Chih-Chuan

    2002-10-01

    Mutations in gene sequence can cause many genetic disorders, and researchers have attempted to develop treatments or cures at the DNA level for these diseases. Several strategies including triple-helix-forming oligonucleotides (TFOs), chimeric RNA/DNA oligonucleotide (RDO), and short single-stranded oligodeoxynucleotide (ODN) have been used to correct the dysfunctional genes in situ in the chromosome. Experimental data from cells and animal models suggest that all these strategies can repair the mutations in situ at DNA level. More effective structures of oligonucleotide, efficient delivery systems, and gene correction efficiency should be improved. Development of these strategies holds great potentials for treatments of genetic defects and other disorders.

  5. Biomediated continuous release phosphate fertilizer

    DOEpatents

    Goldstein, Alan H.; Rogers, Robert D.

    1999-01-01

    A composition is disclosed for providing phosphate fertilizer to the root zone of plants. The composition comprises a microorganism capable of producing and secreting a solubilization agent, a carbon source for providing raw material for the microorganism to convert into the solubilization agent, and rock phosphate ore for providing a source of insoluble phosphate that is solubilized by the solubilization agent and released as soluble phosphate. The composition is provided in a physical form, such as a granule, that retains the microorganism, carbon source, and rock phosphate ore, but permits water and soluble phosphate to diffuse into the soil. A method of using the composition for providing phosphate fertilizer to plants is also disclosed.

  6. Biomediated continuous release phosphate fertilizer

    DOEpatents

    Goldstein, A.H.; Rogers, R.D.

    1999-06-15

    A composition is disclosed for providing phosphate fertilizer to the root zone of plants. The composition comprises a microorganism capable of producing and secreting a solubilization agent, a carbon source for providing raw material for the microorganism to convert into the solubilization agent, and rock phosphate ore for providing a source of insoluble phosphate that is solubilized by the solubilization agent and released as soluble phosphate. The composition is provided in a physical form, such as a granule, that retains the microorganism, carbon source, and rock phosphate ore, but permits water and soluble phosphate to diffuse into the soil. A method of using the composition for providing phosphate fertilizer to plants is also disclosed. 13 figs.

  7. Renal phosphate handling: Physiology

    PubMed Central

    Prasad, Narayan; Bhadauria, Dharmendra

    2013-01-01

    Phosphorus is a common anion. It plays an important role in energy generation. Renal phosphate handling is regulated by three organs parathyroid, kidney and bone through feedback loops. These counter regulatory loops also regulate intestinal absorption and thus maintain serum phosphorus concentration in physiologic range. The parathyroid hormone, vitamin D, Fibrogenic growth factor 23 (FGF23) and klotho coreceptor are the key regulators of phosphorus balance in body. PMID:23961477

  8. Carboranyl Nucleosides & Oligonucleotides for Neutron Capture Therapy Final Report

    SciTech Connect

    Schinazi, Raymond F.

    2004-12-01

    This proposal enabled us to synthesize and develop boron-rich nucleosides and oligonucleotide analogues for boron neutron capture therapy (BNCT) and the treatment of various malignancies. First, we determined the relationship between structure, cellular accumulation and tissue distribution of 5-o-carboranyl-2'-deoxyuridine (D-CDU) and its derivatives D-ribo-CU and 5-o-carboranyluracil (CU), to potentially target brain and other solid tumors for neutron capture therapy. Synthesized carborane containing nucleoside derivatives of CDU, D- and L-enantiomers of CDU, D-ribo-CU and CU were used. We measured tissue disposition in xenografted mice bearing 9479 human prostate tumors xenografts and in rats bearing 9L gliosarcoma isografts in their flanks and intracranially. The accumulation of D-CDU, 1-({beta}-L-arabinosyl)-5-o-carboranyluracil, D-ribo-CU, and CU were also studied in LnCap human prostate tumor cells and their retention was measured in male nude mice bearing LnCap and 9479 human prostate tumor xenografts. D-CDU, D-ribo-CU and CU levels were measured after administration in mice bearing 9479 human prostate tumors in their flanks. D-CDU achieved high cellular concentrations in LnCap cells and up to 2.5% of the total cellular compound was recovered in the 5'-monophosphorylated form. D-CDU cellular concentrations were similar in LnCap and 9479 tumor xenografts. Studies in tumor bearing animals indicated that increasing the number of hydroxyl moieties in the sugar constituent of the carboranyl nucleosides lead to increased rate and extent of renal elimination, a decrease in serum half-lives and an increased tissue specificity. Tumor/brain ratios were greatest for CDU and D-ribo-CU, while tumor/prostate ratios were greatest with CU. CDU and D-ribo-CU have potential for BNCT of brain malignancies, while CU may be further developed for prostate cancer. A method was developed for the solid phase synthesis of oligonucleotides containing (ocarboran-1-yl

  9. Recombination of synthetic oligonucleotides with prokaryotic chromosomes: substrate requirements of the Escherichia coli/lambdaRed and Sulfolobus acidocaldarius recombination systems.

    PubMed

    Grogan, Dennis W; Stengel, Kristy R

    2008-09-01

    In order to reveal functional properties of recombination involving short ssDNAs in hyperthermophilic archaea, we evaluated oligonucleotide-mediated transformation (OMT) in Sulfolobus acidocaldarius and Escherichia coli as a function of the molecular properties of the ssDNA substrates. Unmodified ssDNAs as short as 20-22 nt yielded recombinants in both organisms, as did longer DNAs forming as few as 2-5 base pairs on one side of the genomic mutation. The two OMT systems showed similar responses to certain end modifications of the oligonucleotides, but E. coli was found to require a 5' phosphate on 5'-limited ssDNA whereas this requirement was not evident in S. acidocaldarius. The ability of both E. coli and S. acidocaldarius to incorporate short, mismatched ssDNAs into their genomes raises questions about the biological significance of this capability, including its phylogenetic distribution among microorganisms and its impact on genome stability. These questions seem particularly relevant for S. acidocaldarius, as this archaeon has natural competence for OMT, encodes no MutSL homologues and thrives under environmental conditions that accelerate DNA decomposition.

  10. Dichotomous Role of Exciting the Donor or the Acceptor on Charge Generation in Organic Solar Cells.

    PubMed

    Hendriks, Koen H; Wijpkema, Alexandra S G; van Franeker, Jacobus J; Wienk, Martijn M; Janssen, René A J

    2016-08-10

    In organic solar cells, photoexcitation of the donor or acceptor phase can result in different efficiencies for charge generation. We investigate this difference for four different 2-pyridyl diketopyrrolopyrrole (DPP) polymer-fullerene solar cells. By comparing the external quantum efficiency spectra of the polymer solar cells fabricated with either [60]PCBM or [70]PCBM fullerene derivatives as acceptor, the efficiency of charge generation via donor excitation and acceptor excitation can both be quantified. Surprisingly, we find that to make charge transfer efficient, the offset in energy between the HOMO levels of donor and acceptor that govern charge transfer after excitation of the acceptor must be larger by ∼0.3 eV than the offset between the corresponding two LUMO levels when the donor is excited. As a consequence, the driving force required for efficient charge generation is significantly higher for excitation of the acceptor than for excitation of the donor. By comparing charge generation for a total of 16 different DPP polymers, we confirm that the minimal driving force, expressed as the photon energy loss, differs by about 0.3 eV for exciting the donor and exciting the acceptor. Marcus theory may explain the dichotomous role of exciting the donor or the acceptor on charge generation in these solar cells.

  11. Hexa-peri-hexabenzocoronene with Different Acceptor Units for Tuning Optoelectronic Properties.

    PubMed

    Keerthi, Ashok; Hou, Ian Cheng-Yi; Marszalek, Tomasz; Pisula, Wojciech; Baumgarten, Martin; Narita, Akimitsu

    2016-10-06

    Hexa-peri-hexabenzocoronene (HBC)-based donor-acceptor dyads were synthesized with three different acceptor units, through two pathways: 1) "pre-functionalization" of monobromo-substituted hexaphenylbenzene prior to the cyclodehydrogenation; and 2) "post-functionalization" of monobromo-substituted HBC after the cyclodehydrogenation. The HBC-acceptor dyads demonstrated varying degrees of intramolecular charge-transfer interactions, depending on the attached acceptor units, which allowed tuning of their photophysical and optoelectronic properties, including the energy gaps. The two synthetic pathways described here can be complementary and potentially be applied for the synthesis of nanographene-acceptor dyads with larger aromatic cores, including one-dimensionally extended graphene nanoribbons.

  12. Rise-Time of FRET-Acceptor Fluorescence Tracks Protein Folding

    PubMed Central

    Lindhoud, Simon; Westphal, Adrie H.; van Mierlo, Carlo P. M.; Visser, Antonie J. W. G.; Borst, Jan Willem

    2014-01-01

    Uniform labeling of proteins with fluorescent donor and acceptor dyes with an equimolar ratio is paramount for accurate determination of Förster resonance energy transfer (FRET) efficiencies. In practice, however, the labeled protein population contains donor-labeled molecules that have no corresponding acceptor. These FRET-inactive donors contaminate the donor fluorescence signal, which leads to underestimation of FRET efficiencies in conventional fluorescence intensity and lifetime-based FRET experiments. Such contamination is avoided if FRET efficiencies are extracted from the rise time of acceptor fluorescence upon donor excitation. The reciprocal value of the rise time of acceptor fluorescence is equal to the decay rate of the FRET-active donor fluorescence. Here, we have determined rise times of sensitized acceptor fluorescence to study the folding of double-labeled apoflavodoxin molecules and show that this approach tracks the characteristics of apoflavodoxinʼs complex folding pathway. PMID:25535076

  13. Vacancy-Induced Electronic Structure Variation of Acceptors and Correlation with Proton Conduction in Perovskite Oxides.

    PubMed

    Kim, Hye-Sung; Jang, Ahreum; Choi, Si-Young; Jung, WooChul; Chung, Sung-Yoon

    2016-10-17

    In most proton-conducing perovskite oxides, the electrostatic attraction between negatively charged acceptor dopants and protonic defects having a positive charge is known to be a major cause of retardation of proton conduction, a phenomenon that is generally referred to as proton trapping. We experimentally show that proton trapping can be suppressed by clustering of positively charged oxygen vacancies to acceptors in BaZrO3-δ and BaCeO3-δ . In particular, to ensure the vacancy-acceptor association is effective against proton trapping, the valence electron density of acceptors should not significantly vary when the oxygen vacancies cluster, based on the weak hybridization between the valence d or p orbitals of acceptors and the 2p orbitals of oxygen.

  14. Physiological and electrochemical effects of different electron acceptors on bacterial anode respiration in bioelectrochemical systems.

    PubMed

    Yang, Yonggang; Xiang, Yinbo; Xia, Chunyu; Wu, Wei-Min; Sun, Guoping; Xu, Meiying

    2014-07-01

    To understand the interactions between bacterial electrode respiration and the other ambient bacterial electron acceptor reductions, alternative electron acceptors (nitrate, Fe2O3, fumarate, azo dye MB17) were added singly or multiply into Shewanella decolorationis microbial fuel cells (MFCs). All the added electron acceptors were reduced simultaneously with current generation. Adding nitrate or MB17 resulted in more rapid cell growth, higher flavin concentration and higher biofilm metabolic viability, but lower columbic efficiency (CE) and normalized energy recovery (NER) while the CE and NER were enhanced by Fe2O3 or fumarate. The added electron acceptors also significantly influenced the cyclic voltammetry profile of anode biofilm probably via altering the cytochrome c expression. The highest power density was observed in MFCs added with MB17 due to the electron shuttle role of the naphthols from MB17 reduction. The results provided important information for MFCs applied in practical environments where contains various electron acceptors.

  15. The activation energy for Mg acceptor in the Ga-rich InGaN alloys

    NASA Astrophysics Data System (ADS)

    Zhao, Chuan-Zhen; Wei, Tong; Chen, Li-Ying; Wang, Sha-Sha; Wang, Jun

    2017-02-01

    The activation energy for Mg acceptor in InxGa1-xN alloys is investigated. It is found that there are three factors to influence the activation energy for Mg acceptor. One is the stronger dependence of the VBM of InxGa1-xN depending on In content than that of the Mg acceptor energy level. The other is the concentration of Mg acceptors. Another is the extending of the valence band-tail states into the band gap. In addition, a model based on modifying the effective mass model is developed. It is found that the model can describe the activation energy for Mg acceptor in the Ga-rich InxGa1-xN alloys well after considering the influence of the valence band-tail states.

  16. D-Fructose-6-phosphate aldolase-catalyzed one-pot synthesis of iminocyclitols.

    PubMed

    Sugiyama, Masakazu; Hong, Zhangyong; Liang, Pi-Hui; Dean, Stephen M; Whalen, Lisa J; Greenberg, William A; Wong, Chi-Huey

    2007-11-28

    A one-pot chemoenzymatic method for the synthesis of a variety of new iminocyclitols from readily available, non-phosphorylated donor substrates has been developed. The method utilizes the recently discovered fructose-6-phosphate aldolase (FSA), which is functionally distinct from known aldolases in its tolerance of different donor substrates as well as acceptor substrates. Kinetic studies were performed with dihydroxyacetone (DHA), the presumed endogenous substrate for FSA, as well as hydroxy acetone (HA) and 1-hydroxy-2-butanone (HB) as donor substrates, in each case using glyceraldehyde-3-phosphate as acceptor substrate. Remarkably, FSA used the three donor substrates with equal efficiency, with kcat/KMvalues of 33, 75, and 20 M-1 s-1, respectively. This level of donor substrate tolerance is unprecedented for an aldolase. Furthermore, DHA, HA, and HB were accepted as donors in FSA-catalyzed aldol reactions with a variety of azido- and Cbz-amino aldehyde acceptors. The broad substrate tolerance of FSA and the ability to circumvent the need for phosphorylated substrates allowed for one-pot synthesis of a number of known and novel iminocyclitols in good yields, and in a very concise fashion. New iminocyclitols were assayed as inhibitors against a panel of glycosidases. Compounds 15 and 16 were specific alpha-mannosidase inhibitors, and 24 and 26 were potent and selective inhibitors of beta-N-acetylglucosaminidases in the submicromolar range. Facile access to these compounds makes them attractive core structures for further inhibitor optimization.

  17. Aberrant splicing in the ocular albinism type 1 gene (OA1/GPR143) is corrected in vitro by morpholino antisense oligonucleotides.

    PubMed

    Vetrini, Francesco; Tammaro, Roberta; Bondanza, Sergio; Surace, Enrico M; Auricchio, Alberto; De Luca, Michele; Ballabio, Andrea; Marigo, Valeria

    2006-05-01

    An intronic point mutation was identified in the ocular albinism type 1 (OA1) gene (HUGO symbol, GPR143) in a family with the X-linked form of ocular albinism. Interestingly, the mutation creates a new acceptor splice site in intron 7 of the OA1 gene. In addition to low levels of normally spliced mRNA product of the OA1 gene, the patient samples contained also an aberrantly spliced mRNA with a 165 bp fragment of intron 7 (from position +750 to +914) inserted between exons 7 and 8. The abnormal transcript contained a premature stop codon and was unstable, as revealed by Northern blot analysis. We defined that mutation NC_000023.8:g.25288G>A generated a consensus binding motif for the splicing factor enhancer ASF/SF2, which most likely favored transcription of the aberrant mRNA. Furthermore, it activated a cryptic donor-splice site causing the inclusion between exons 7 and 8 of the 165 bp intronic fragment. Thus, the aberrant splicing is most likely explained by the generation of a de novo splicing enhancer motif. Finally, to rescue OA1 expression in the patient's melanocytes, we designed an antisense morpholino modified oligonucleotide complementary to the mutant sequence. The morpholino oligonucleotide (MO) was able to rescue OA1 expression and restore the OA1 protein level in the patient's melanocytes through skipping of the aberrant inclusion. The use of MO demonstrated that the lack of OA1 was caused by the generation of a new splice site. Furthermore, this technique will lead to new approaches to correct splice site mutations that cause human diseases.

  18. Orthogonal ion pairing reversed phase liquid chromatography purification of oligonucleotides with bulky fluorophores.

    PubMed

    Anacleto, Concordio; Ouye, Randall; Schoenbrunner, Nancy

    2014-02-14

    A dual labeled oligonucleotide used as TaqMan® or 5' nuclease probe for in vitro diagnostic has been purified through orthogonal ion-pairing reversed phase chromatography, using polymeric semi-preparative and preparative PRP-1 column. We studied the mechanism of separation of oligonucleotides using ion-pairing reversed phase chromatography. We found that elution profiles of dye labeled oligonucleotides can be controlled by use of specific ion-pairing reagents. Here, we report a method for purification of an oligonucleotide containing an internally positioned rhodamine dye using two orthogonal chromatographic steps, in which the primary step resolves mostly by differences in hydrophobicity by using a weak ion-pairing reagent, and a secondary step uses a strong ion-pairing reagent for separation of length variants. Purification is demonstrated for both 1 and 15μmol scale syntheses, and amenable to further scale up for commercial lot production.

  19. The Fidelity of Template-Directed Oligonucleotide Ligation and the Inevitability of Polymerase Function

    NASA Astrophysics Data System (ADS)

    James, Kenneth D.; Ellington, Andrew D.

    1999-08-01

    The first living systems may have employed template-directed oligonucleotide ligation for replication. The utility of oligonucleotide ligation as a mechanism for the origin and evolution of life is in part dependent on its fidelity. We have devised a method for evaluating ligation fidelity in which ligation substrates are selected from random sequence libraries. The fidelities of chemical and enzymatic ligation are compared under a variety of conditions. While reaction conditions can be found that promote high fidelity copying, departure from these conditions leads to error-prone copying. In particular, ligation reactions with shorter oligonucleotide substrates are less efficient but more faithful. These results support a model for origins in which there was selective pressure for template-directed oligonucleotide ligation to be gradually supplanted by mononucleotide polymerization.

  20. Oligonucleotide-based biosensors for in vitro diagnostics and environmental hazard detection.

    PubMed

    Jung, Il Young; Lee, Eun Hee; Suh, Ah Young; Lee, Seung Jin; Lee, Hyukjin

    2016-04-01

    Oligonucleotide-based biosensors have drawn much attention because of their broad applications in in vitro diagnostics and environmental hazard detection. They are particularly of interest to many researchers because of their high specificity as well as excellent sensitivity. Recently, oligonucleotide-based biosensors have been used to achieve not only genetic detection of targets but also the detection of small molecules, peptides, and proteins. This has further broadened the applications of these sensors in the medical and health care industry. In this review, we highlight various examples of oligonucleotide-based biosensors for the detection of diseases, drugs, and environmentally hazardous chemicals. Each example is provided with detailed schematics of the detection mechanism in addition to the supporting experimental results. Furthermore, future perspectives and new challenges in oligonucleotide-based biosensors are discussed.

  1. Functionalization of PVC membrane with ss oligonucleotides for a potentiometric biosensor.

    PubMed

    Shishkanova, T V; Volf, R; Krondak, M; Král, V

    2007-05-15

    A novel application of a single stranded (ss) oligonucleotide as an active component of polymeric membrane in an ion-selective electrode (ISE) is described. The original oligonucleotides, oligo(dA)(15), modified by cholesterol, triphenylmethyl and hexadecyl derivatives, were immobilized into poly(vinyl chloride) (PVC) membrane using extraction protocol. In parallel, the adsorption protocol was used to immobilize unmodified oligo(dA)(15) on the PVC membrane based on tridodecylmethyammonium chloride (TDDMA(+)Cl(-)). Immobilization of ss oligonucleotide probe through spacer was more effective for the potentiometric detection of the hybridization between complementary oligonucleotides. It was found that cholesterol-oligo(dA)(15) modified membranes were sensitive toward complementary oligo(dT)(15) in the concentration range 2-80 nM at pH 7. An explanation for the detection mechanism is proposed.

  2. Use of synthetic oligonucleotides for genomic DNA dot hybridization to split the DQw3 haplotype

    SciTech Connect

    Martell, M.; Le Gall, I.; Millasseau, P.; Dausset, J.; Cohen, D.

    1988-04-01

    Comparison of two different HLA-DQ..beta..gene sequences from two DR4 individuals, probably corresponding to DQw3.2 (DQR4) and DQw3.1 (DQR5) specificities, has shown several nucleotide variations. Eight oligonucleotides (24 bases long), derived from these polymorphic areas, have been synthesized. Each oligonucleotide was hybridized to BamHI-digested DNA samples from eight families with HLA-DR4 individuals. Four polymorphic BamHI fragments were detected. Two of eight oligonucleotides gave a single signal (8.9 kilobases) on DQw3.2-positive haplotypes. The authors used one of these oligonucleotides in a genomic DNA dot hybridization and detected a hybridization signal only in DQw3.2-positive individuals. A very simple test like this allows the screening of a large population sample within a very short period.

  3. Elasticity of the transition state for oligonucleotide hybridization

    PubMed Central

    Whitley, Kevin D.; Comstock, Matthew J.; Chemla, Yann R.

    2017-01-01

    Despite its fundamental importance in cellular processes and abundant use in biotechnology, we lack a detailed understanding of the kinetics of nucleic acid hybridization. In particular, the identity of the transition state, which determines the kinetics of the two-state reaction, remains poorly characterized. Here, we used optical tweezers with single-molecule fluorescence to observe directly the binding and unbinding of short oligonucleotides (7–12 nt) to a complementary strand held under constant force. Binding and unbinding rate constants measured across a wide range of forces (1.5–20 pN) deviate from the exponential force dependence expected from Bell's equation. Using a generalized force dependence model, we determined the elastic behavior of the transition state, which we find to be similar to that of the pure single-stranded state. Our results indicate that the transition state for hybridization is visited before the strands form any significant amount of native base pairs. Such a transition state supports a model in which the rate-limiting step of the hybridization reaction is the alignment of the two strands prior to base pairing. PMID:27903889

  4. Integrated Microfluidic Isolation of Aptamers Using Electrophoretic Oligonucleotide Manipulation

    PubMed Central

    Kim, Jinho; Olsen, Timothy R.; Zhu, Jing; Hilton, John P.; Yang, Kyung-Ae; Pei, Renjun; Stojanovic, Milan N.; Lin, Qiao

    2016-01-01

    We present a microfluidic approach to integrated isolation of DNA aptamers via systematic evolution of ligands by exponential enrichment (SELEX). The approach employs a microbead-based protocol for the processes of affinity selection and amplification of target-binding oligonucleotides, and an electrophoretic DNA manipulation scheme for the coupling of these processes, which are required to occur in different buffers. This achieves the full microfluidic integration of SELEX, thereby enabling highly efficient isolation of aptamers in drastically reduced times and with minimized consumption of biological material. The approach as such also offers broad target applicability by allowing selection of aptamers with respect to targets that are either surface-immobilized or solution-borne, potentially allowing aptamers to be developed as readily available affinity reagents for a wide range of targets. We demonstrate the utility of this approach on two different procedures, respectively for isolating aptamers against a surface-immobilized protein (immunoglobulin E) and a solution-phase small molecule (bisboronic acid in the presence of glucose). In both cases aptamer candidates were isolated in three rounds of SELEX within a total process time of approximately 10 hours. PMID:27217242

  5. Linear model for fast background subtraction in oligonucleotide microarrays

    PubMed Central

    2009-01-01

    Background One important preprocessing step in the analysis of microarray data is background subtraction. In high-density oligonucleotide arrays this is recognized as a crucial step for the global performance of the data analysis from raw intensities to expression values. Results We propose here an algorithm for background estimation based on a model in which the cost function is quadratic in a set of fitting parameters such that minimization can be performed through linear algebra. The model incorporates two effects: 1) Correlated intensities between neighboring features in the chip and 2) sequence-dependent affinities for non-specific hybridization fitted by an extended nearest-neighbor model. Conclusion The algorithm has been tested on 360 GeneChips from publicly available data of recent expression experiments. The algorithm is fast and accurate. Strong correlations between the fitted values for different experiments as well as between the free-energy parameters and their counterparts in aqueous solution indicate that the model captures a significant part of the underlying physical chemistry. PMID:19917117

  6. Kinetic Hairpin Oligonucleotide Blockers for Selective Amplification of Rare Mutations

    PubMed Central

    Jia, Yanwei; Sanchez, J. Aquiles; Wangh, Lawrence J.

    2014-01-01

    Detection of rare mutant alleles in an excess of wild type alleles is increasingly important in cancer diagnosis. Several methods for selective amplification of a mutant allele via the polymerase chain reaction (PCR) have been reported, but each of these methods has its own limitations. A common problem is that Taq DNA polymerase errors early during amplification generate false positive mutations which also accumulate exponentially. In this paper, we described a novel method using hairpin oligonucleotide blockers that can selectively inhibit the amplification of wild type DNA during LATE-PCR amplification. LATE-PCR generates double-stranded DNA exponentially followed by linear amplification of single-stranded DNA. The efficiency of the blocker is optimized by adjusting the LATE-PCR temperature cycling profile. We also demonstrate that it is possible to minimize false positive signals caused by Taq DNA polymerase errors by using a mismatched excess primer plus a modified PCR profile to preferentially enrich for mutant target sequences prior to the start of the exponential phase of LATE-PCR amplification. In combination these procedures permit amplification of specific KRAS mutations in the presence of more than 10,000 fold excess of wild type DNA without false positive signals. PMID:25082368

  7. Antineoplastic effect of decoy oligonucleotide derived from MGMT enhancer.

    PubMed

    Canello, Tamar; Ovadia, Haim; Refael, Miri; Zrihan, Daniel; Siegal, Tali; Lavon, Iris

    2014-01-01

    Silencing of O(6)-methylguanine-DNA-methyltransferase (MGMT) in tumors, mainly through promoter methylation, correlates with a better therapeutic response and with increased survival. Therefore, it is conceivable to consider MGMT as a potential therapeutic target for the treatment of cancers. Our previous results demonstrated the pivotal role of NF-kappaB in MGMT expression, mediated mainly through p65/NF-kappaB homodimers. Here we show that the non-canonical NF-KappaB motif (MGMT-kappaB1) within MGMT enhancer is probably the major inducer of MGMT expression following NF-kappaB activation. Thus, in an attempt to attenuate the transcription activity of MGMT in tumors we designed locked nucleic acids (LNA) modified decoy oligonucleotides corresponding to the specific sequence of MGMT-kappaB1 (MGMT-kB1-LODN). Following confirmation of the ability of MGMT-kB1-LODN to interfere with the binding of p65/NF-kappaB to the NF-KappaB motif within MGMT enhancer, the efficacy of the decoy was studied in-vitro and in-vivo. The results of these experiments show that the decoy MGMT-kB1-LODN have a substantial antineoplastic effect when used either in combination with temozolomide or as monotherapy. Our results suggest that MGMT-kB1-LODN may provide a novel strategy for cancer therapy.

  8. Integrated Microfluidic Isolation of Aptamers Using Electrophoretic Oligonucleotide Manipulation

    NASA Astrophysics Data System (ADS)

    Kim, Jinho; Olsen, Timothy R.; Zhu, Jing; Hilton, John P.; Yang, Kyung-Ae; Pei, Renjun; Stojanovic, Milan N.; Lin, Qiao

    2016-05-01

    We present a microfluidic approach to integrated isolation of DNA aptamers via systematic evolution of ligands by exponential enrichment (SELEX). The approach employs a microbead-based protocol for the processes of affinity selection and amplification of target-binding oligonucleotides, and an electrophoretic DNA manipulation scheme for the coupling of these processes, which are required to occur in different buffers. This achieves the full microfluidic integration of SELEX, thereby enabling highly efficient isolation of aptamers in drastically reduced times and with minimized consumption of biological material. The approach as such also offers broad target applicability by allowing selection of aptamers with respect to targets that are either surface-immobilized or solution-borne, potentially allowing aptamers to be developed as readily available affinity reagents for a wide range of targets. We demonstrate the utility of this approach on two different procedures, respectively for isolating aptamers against a surface-immobilized protein (immunoglobulin E) and a solution-phase small molecule (bisboronic acid in the presence of glucose). In both cases aptamer candidates were isolated in three rounds of SELEX within a total process time of approximately 10 hours.

  9. Splice-switching antisense oligonucleotides as therapeutic drugs

    PubMed Central

    Havens, Mallory A.; Hastings, Michelle L.

    2016-01-01

    Splice-switching oligonucleotides (SSOs) are short, synthetic, antisense, modified nucleic acids that base-pair with a pre-mRNA and disrupt the normal splicing repertoire of the transcript by blocking the RNA–RNA base-pairing or protein–RNA binding interactions that occur between components of the splicing machinery and the pre-mRNA. Splicing of pre-mRNA is required for the proper expression of the vast majority of protein-coding genes, and thus, targeting the process offers a means to manipulate protein production from a gene. Splicing modulation is particularly valuable in cases of disease caused by mutations that lead to disruption of normal splicing or when interfering with the normal splicing process of a gene transcript may be therapeutic. SSOs offer an effective and specific way to target and alter splicing in a therapeutic manner. Here, we discuss the different approaches used to target and alter pre-mRNA splicing with SSOs. We detail the modifications to the nucleic acids that make them promising therapeutics and discuss the challenges to creating effective SSO drugs. We highlight the development of SSOs designed to treat Duchenne muscular dystrophy and spinal muscular atrophy, which are currently being tested in clinical trials. PMID:27288447

  10. The development of bioactive triple helix-forming oligonucleotides.

    PubMed

    Seidman, Michael M; Puri, Nitin; Majumdar, Alokes; Cuenoud, Bernard; Miller, Paul S; Alam, Rowshon

    2005-11-01

    We are developing triple helix-forming oligonucleotides (TFOs) as gene targeting reagents in mammalian cells. We have described psoralen-conjugated TFOs containing 2'-O-methyl (2'OMe) and 2'-O-aminoethoxy (AE) ribose substitutions. TFOs with a cluster of 3-4 AE residues, with all other sugars as 2'OMe, were bioactive in a gene knockout assay in mammalian cells. In contrast, TFOs with one or two clustered, or three dispersed, AE residues were inactive. Thermal stability analysis of the triplexes indicated that there were only incremental differences between the active and inactive TFOs. However the active and inactive TFOs could be distinguished by their association kinetics. The bioactive TFOs showed markedly greater on-rates than the inactive TFOs. It appears that the on-rate is a better predictor of TFO bioactivity than thermal stability. Our data are consistent with a model in which a cluster of 3-4 AE residues stabilizes the nucleation event that precedes formation of a complete triplex. It is likely that triplexes in cells are much less stable than triplexes in vitro probably as a result of elution by chromatin-associated translocases and helicases. Consequently the biologic assay will favor TFOs that can bind and rebind genomic targets quickly.

  11. Molecular architectures for electrocatalytic amplification of oligonucleotide hybridization.

    PubMed

    Mir, Mònica; Alvarez, Marta; Azzaroni, Omar; Tiefenauer, Louis; Knoll, Wolfgang

    2008-09-01

    In this work, we describe a new platform suitable for electrocatalytic amplification of oligonucleotide hybridization based on the use of supramolecular bioconjugates incorporating ferrocene-labeled streptavidin. Our goals were aimed at designing a biosensing platform which could support highly reproducible and stable electrocatalytic amplification with maximum efficiency. The use of nonlabeled streptavidin as an underlying layer promotes a major improvement on the characteristics of the amplified electrochemical signal. In addition, the electrocatalytic current can be easily amplified by tuning the concentration of electron donor species in solution. Because of the fact that the redox labels are bioconjugated to the DNA strands, increasing the ionic strength does not lead to the loss of redox labels. More importantly, increasing the concentration of donors only involves the magnification of the signal without implying the permeation of donors (thus reducing the efficient electrocatalysis). This approach represents a major improvement on the use of electrocatalytically amplified DNA-sensing platforms, thus overcoming any possible limitation in connection with the reproducibility and reliability of this well-established method.

  12. Skipping multiple exons of dystrophin transcripts using cocktail antisense oligonucleotides.

    PubMed

    Echigoya, Yusuke; Yokota, Toshifumi

    2014-02-01

    Duchenne muscular dystrophy (DMD) is one of the most common and lethal genetic disorders, with 20,000 children per year born with DMD globally. DMD is caused by mutations in the dystrophin (DMD) gene. Antisense-mediated exon skipping therapy is a promising therapeutic approach that uses short DNA-like molecules called antisense oligonucleotides (AOs) to skip over/splice out the mutated part of the gene to produce a shortened but functional dystrophin protein. One major challenge has been its limited applicability. Multiple exon skipping has recently emerged as a potential solution. Indeed, many DMD patients need exon skipping of multiple exons in order to restore the reading frame, depending on how many base pairs the mutated exon(s) and adjacent exons have. Theoretically, multiple exon skipping could be used to treat approximately 90%, 80%, and 98% of DMD patients with deletion, duplication, and nonsense mutations, respectively. In addition, multiple exon skipping could be used to select deletions that optimize the functionality of the truncated dystrophin protein. The proof of concept of systemic multiple exon skipping using a cocktail of AOs has been demonstrated in dystrophic dog and mouse models. Remaining challenges include the insufficient efficacy of systemic treatment, especially for therapies that target the heart, and limited long-term safety data. Here we review recent preclinical developments in AO-mediated multiple exon skipping and discuss the remaining challenges.

  13. Template-directed synthesis of oligonucleotides under eutectic conditions

    NASA Technical Reports Server (NTRS)

    Stribling, R.; Miller, S. L.

    1991-01-01

    One of the most important sets of model prebiotic experiments consists of reactions that synthesize complementary oligonucleotides from preformed templates under nonenzymatic conditions. Most of these experiments are conducted at 4 degrees C using 0.01-0.1 M concentrations of activated nucleotide monomer and template (monomer equivalent). In an attempt to extend the conditions under which this type of reaction can occur, we have concentrated the reactants by freezing at -18 degrees C, which is close to the NaCl-H2O eutectic at -21 degrees C. The results from this set of experiments suggest that successful syntheses can occur with poly(C) concentrations as low at 5 x 10(-4) M and 2MeImpG concentrations at 10(-3) M. It was also anticipated that this mechanism might allow the previously unsuccessful poly(A)-directed synthesis of oligo(U)s to occur. However, no template effect was seen with the poly(A) and ImpU system. The failure of these conditions to allow template-directed synthesis of oligo(U)s supports the previously proposed idea that pyrimidines may not have been part of the earliest genetic material. Because of the low concentrations of monomer and template that would be expected from prebiotic syntheses, this lower temperature could be considered a more plausible geologic setting for template-directed synthesis than the standard reaction conditions.

  14. [Oligonucleotide derivatives in the nucleic acid hybridization analysis. III. Synthesis and investigation of properties of oligonucleotides, bearing bifunctional non-nucleotide insert].

    PubMed

    Kupriushkin, M S; Pyshnyĭ, D V

    2012-01-01

    Non-nucleotide phosporamidites were synthetized, having branched backbone with different position of functional groups. Obtained phosphoramidite monomers contain intercalator moiety--6-chloro-2-methoxyacridine, and additional hydroxyl residue protected with dimethoxytrityl group or with tert-butyldimethylsilyl group for post-synthetic modification. Synthesized oligothymidilates contain one or more modified units in different positions of sequence. Melting temperature and thermodynamic parameters of formation of complementary duplexes formed by modified oligonucleotides was defined (change in enthalpy and entropy). The introduction of intercalating residue causes a significant stabilization of DNA duplexes. It is shown that the efficiency of the fluorescence of acridine residue in the oligonucleotide conjugate significantly changes upon hybridization with DNA.

  15. Ultrafast exciton dissociation at donor/acceptor interfaces

    NASA Astrophysics Data System (ADS)

    Grancini, G.; Fazzi, D.; Binda, M.; Maiuri, M.; Petrozza, A.; Criante, L.; Perissinotto, S.; Egelhaaf, H.-J.; Brida, D.; Cerullo, G.; Lanzani, G.

    2013-09-01

    Charge generation at donor/acceptor interface is a highly debated topic in the organic photovoltaics (OPV) community. The primary photoexcited state evolution happens in few femtosecond timescale, thus making very intriguing their full understanding. In particular charge generation is believed to occur in < 200 fs, but no clear picture emerged so far. In this work we reveal for the first time the actual charge generation mechanism following in real time the exciton dissociation mechanism by means of sub-22 fs pump-probe spectroscopy. We study a low-band-gap polymer: fullerene interface as an ideal system for OPV. We demonstrate that excitons dissociation leads, on a timescale of 20-50 fs, to two byproducts: bound interfacial charge transfer states (CTS) and free charges. The branching ratio of their formation depends on the excess photon energy provided. When high energy singlet polymer states are excited, well above the optical band gap, an ultrafast hot electron transfer happens between the polymer singlet state and the interfacial hot CTS* due to the high electronic coupling between them. Hot exciton dissociation prevails then on internal energy dissipation that occurs within few hundreds of fs. By measuring the internal quantum efficiency of a prototypical device a rising trend with energy is observed, thus indicating that hot exciton dissociation effectively leads to a higher fraction of free charges.

  16. Potassium acceptor doping of ZnO crystals

    SciTech Connect

    Parmar, Narendra S. Lynn, K. G.; Corolewski, Caleb D.; McCluskey, Matthew D.

    2015-05-15

    ZnO bulk single crystals were doped with potassium by diffusion at 950°C. Positron annihilation spectroscopy confirms the filling of zinc vacancies and a different trapping center for positrons. Secondary ion mass spectroscopy measurements show the diffusion of potassium up to 10 μm with concentration ∼1 × 10{sup 16} cm{sup −3}. IR measurements show a local vibrational mode (LVM) at 3226 cm{sup −1}, at a temperature of 9 K, in a potassium doped sample that was subsequently hydrogenated. The LVM is attributed to an O–H bond-stretching mode adjacent to a potassium acceptor. When deuterium substitutes for hydrogen, a peak is observed at 2378 cm{sup −1}. The O-H peak is much broader than the O-D peak, perhaps due to an unusually low vibrational lifetime. The isotopic frequency ratio is similar to values found in other hydrogen complexes. Potassium doping increases the resistivity up to 3 orders of magnitude at room temperature. The doped sample has a donor level at 0.30 eV.

  17. Poly(trifluoromethyl)azulenes: structures and acceptor properties

    SciTech Connect

    Clikeman, Tyler T.; Bukovsky, Eric V.; Kuvychko, Igor V.; San, Long K.; Deng, Shihu; Wang, Xue B.; Chen, Yu-Sheng; Strauss, Steven H.; Boltalina, Olga V.

    2014-07-10

    Azulene is a non-alternant, non-benzenoid aromatic hydrocarbon with an intense blue colour, a dipole moment of 1.0 D,1 positive electron affinity, and an “anomalous” emission from the second excited state in violation of Kasha’s rule.2,3 Azulene’s unique properties have potential uses in molecular switches,4,5 molecular diodes,6 organic photovoltaics,7 and charge transfer complexes.8-12 Introduction of electron-withdrawing groups to the azulenic core, such as CN,8,13,14 halogens,15-19 and CF3,20,21 can enhance certain electrical and photophysical properties. In this work, we report six new trifluoromethyl derivatives of azulene (AZUL), three isomers of AZUL(CF3)3 and three isomers of AZUL(CF3)4, and the first X-ray structure of a π-stacked donor-acceptor complex of a trifluoromethyl azulene with donor pyrene.

  18. Analysis of nonlinear optical properties in donor–acceptor materials

    SciTech Connect

    Day, Paul N.; Pachter, Ruth; Nguyen, Kiet A.

    2014-05-14

    Time-dependent density functional theory has been used to calculate nonlinear optical (NLO) properties, including the first and second hyperpolarizabilities as well as the two-photon absorption cross-section, for the donor-acceptor molecules p-nitroaniline and dimethylamino nitrostilbene, and for respective materials attached to a gold dimer. The CAMB3LYP, B3LYP, PBE0, and PBE exchange-correlation functionals all had fair but variable performance when compared to higher-level theory and to experiment. The CAMB3LYP functional had the best performance on these compounds of the functionals tested. However, our comprehensive analysis has shown that quantitative prediction of hyperpolarizabilities is still a challenge, hampered by inadequate functionals, basis sets, and solvation models, requiring further experimental characterization. Attachment of the Au{sub 2}S group to molecules already known for their relatively large NLO properties was found to further enhance the response. While our calculations show a modest enhancement for the first hyperpolarizability, the enhancement of the second hyperpolarizability is predicted to be more than an order of magnitude.

  19. Interplay of Structure, Hydration and Thermal Stability in Formacetal Modified Oligonucleotides: RNA May Tolerate Nonionic Modifications Better than DNA

    SciTech Connect

    Kolarovic, A.; Schweizer, E; Greene, E; Gironda, M; Pallan, P; Egli, M; Rozners, E

    2009-01-01

    DNA and RNA oligonucleotides having formacetal internucleoside linkages between uridine and adenosine nucleosides have been prepared and studied using UV thermal melting, osmotic stress, and X-ray crystallography. Formacetal modifications have remarkably different effects on double helical RNA and DNAethe formacetal stabilizes the RNA helix by +0.7 C but destabilizes the DNA helix by -1.6 C per modification. The apparently hydrophobic formacetal has little effect on hydration of RNA but decreases the hydration of DNA, which suggests that at least part of the difference in thermal stability may be related to differences in hydration. A crystal structure of modified DNA shows that two isolated formacetal linkages fit almost perfectly in an A-type helix (decamer). Taken together, the data suggest that RNA may tolerate nonionic backbone modifications better than DNA. Overall, formacetal appears to be an excellent mimic of phosphate linkage in RNA and an interesting modification for potential applications in fundamental studies and RNA-based gene control strategies, such as RNA interference.

  20. [Preparative isolation of hexa-, hepta-, octa-, nona- and decapyrimidine oligonucleotides from hydrolysates of depurinated herring sperm DNA].

    PubMed

    Schott, H

    1984-02-03

    The pyrimidine oligonucleotides (dT)5; (dT)6 and the mixtures of sequence isomers (dC, dT5); (dC2, dT5); (dC3, dT4); (dC4, dT3); (dC4, dT4); (dC3, dT5); (dC2, dT6); (dC4, dT5); (dC3, dT6); (dC2, dT7); (dC5, dT5); (dC4, dT6) and (dC3, dT7) with or without terminal phosphate groups have been isolated on a preparative scale from hydrolysates of depurinated herring sperm DNA by the following procedure. Herring sperm DNA (1 kg) is chemically depurinated and partially hydrolysed to a mixture of pyrimidine nucleotides. The partial hydrolysate is first separated into a low- and a high-molecular-weight pyrimidine nucleotide mixture by column chromatography on DEAE-cellulose. The mixture of high-molecular-weight pyrimidine nucleotides is subsequently fractionated on QAE-Sephadex. Impurities which are not fully removed by column chromatography are separated by paper chromatography. The compositions of the mixtures of sequence isomers are determined from the data of column, paper and homochromatography; from absorption characteristics and by enzymatic degradation.

  1. In vitro characterization of two novel biodegradable vectors for the delivery of radiolabeled antisense oligonucleotides.

    PubMed

    von Guggenberg, Elisabeth; Shahhosseini, Soraya; Koslowsky, Ingrid; Lavasanifar, Afsaneh; Murray, David; Mercer, John

    2010-12-01

    The development of antisense oligonucleotides suitable for tumor targeting applications is hindered by low stability and bioavailability of oligonucleotides in vivo and by the absence of efficient and safe vectors for oligonucleotide delivery. Stabilization in vivo has been achieved through chemical modification of oligonucleotides by various means, but effective approaches to enhance their intracellular delivery are lacking. This study reports on the characterization in vitro of a fully phosphorothioated 20-mer oligonucleotide, complementary to p21 mRNA, radiolabeled with fluorine-18 using a thiol reactive prosthetic group. The potential of two novel synthetic block copolymers containing grafted polyamines on their hydrophobic blocks for vector-assisted cell delivery was studied in vitro. Extensive cellular uptake studies were performed in human colon carcinoma cell lines with enhanced or deficient p21 expression to evaluate and compare the uptake mechanism of naked and vectorized radiolabeled formulations. Uptake studies with the two novel biodegradable vectors showed a moderate increase in cell uptake of the radiofluorinated antisense oligonucleotide. The two vectors show, however, promising advantages over conventional lipidic vectors regarding their biocompatibility and subcellular distribution.

  2. Application of oligonucleotide array technology for the rapid detection of pathogenic bacteria of foodborne infections.

    PubMed

    Hong, Bang-Xing; Jiang, Li-Fang; Hu, Yu-Shan; Fang, Dan-Yun; Guo, Hui-Yu

    2004-09-01

    A rapid and accurate method for detection for common pathogenic bacteria in foodborne infections was established by using oligonucleotide array technology. Nylon membrane was used as the array support. A mutation region of the 23S rRNA gene was selected as the discrimination target from 14 species (genera) of bacteria causing foodborne infections and two unrelated bacterial species. A pair of universal primers was designed for PCR amplification of the 23S rRNA gene. Twenty-one species (genera)-specific oligonucleotide detection probes were synthesized and spotted onto the nylon membranes. The 23S rRNA gene amplification products of 14 species of pathogenic bacteria were hybridized to the oligonucleotide array. Hybridization results were analyzed with digoxigenin-linked enzyme reaction. Results indicated that nine species of pathogenic bacteria (Escherichia coli, Campylobacter jejuni, Shigella dysenteriae, Vibrio cholerae, Vibrio parahaemolyticus, Proteus vulgaris, Bacillus cereus, Listeria monocytogenes and Clostridium botulinum) showed high sensitivity and specificity for the oligonucleotide array. Two other species (Salmonella enterica and Yersinia enterocolitica) gave weak cross-reaction with E. coli, but the reaction did not affect their detection. After redesigning the probes, positive hybridization results were obtained with Staphylococcus aureus, but not with Clostridium perfringens and Streptococcus pyogenes. The oligonucleotide array can also be applied to samples collected in clinical settings of foodborne infections. The superiority of oligonucleotide array over other tests lies on its rapidity, accuracy and efficiency in the diagnosis, treatment and control of foodborne infections.

  3. Improving signal intensities for genes with low-expression on oligonucleotide microarrays

    PubMed Central

    Ramdas, Latha; Cogdell, David E; Jia, Jack Y; Taylor, Ellen E; Dunmire, Valerie R; Hu, Limei; Hamilton, Stanley R; Zhang, Wei

    2004-01-01

    Background DNA microarrays using long oligonucleotide probes are widely used to evaluate gene expression in biological samples. These oligonucleotides are pre-synthesized and sequence-optimized to represent specific genes with minimal cross-hybridization to homologous genes. Probe length and concentration are critical factors for signal sensitivity, particularly when genes with various expression levels are being tested. We evaluated the effects of oligonucleotide probe length and concentration on signal intensity measurements of the expression levels of genes in a target sample. Results Selected genes of various expression levels in a single cell line were hybridized to oligonucleotide arrays of four lengths and four concentrations of probes to determine how these critical parameters affected the intensity of the signal representing their expression. We found that oligonucleotides of longer length significantly increased the signals of genes with low-expression in the target. High-expressing gene signals were also boosted but to a lesser degree. Increasing the probe concentration, however, did not linearly increase the signal intensity for either low- or high-expressing genes. Conclusions We conclude that the longer the oligonuclotide probe the better the signal intensities of low expressing genes on oligonucleotide arrays. PMID:15196312

  4. Surface Modified Gadolinium Phosphate Nanoparticles as MRI Contrast Agents

    NASA Astrophysics Data System (ADS)

    Dumont, Matthieu F.; Baligand, Celine; Knowles, Elisabeth S.; Meisel, Mark W.; Walter, Glenn A.; Talham, Daniel R.

    2012-02-01

    Nanoparticles of GdPO4H2O were synthesized in a water/oil microemulsion using IGEPAL CO-520 as surfactant resulting in 50 nm to 100 nm particles that are dispersible and stable in water. Using surface modification chemistry previously established for zirconium phosphonate surfaces,ootnotetext J. Monot et al., J. Am. Chem. Soc. 130 (2008) 6243. the particles are directly modified with 5'-phosphate terminated oligonucleotides, and the specific interaction of the divalent phosphate with Gd^3+ sites at the surface is demonstrated. The ability of the modified nanoparticles to act as MRI contrast agents was determined by performing MR relaxivity measurements at 14 T. Solutions of nanopure water, Feridex and Omniscan (FDA cleared contrast agents) in 0.25% agarose were used for comparison and control purposes. MRI data confirm that GdPO4H2O nanoparticles have relaxivities (r1,r2) comparable to commercially available contrast agents.ootnotetext H. Hifumi et al., J. Am. Chem. Soc. 128 (2006) 15090. In addition, biofunctionalization of the surface of the nanoparticles does not prevent their function as MRI contrast agents.

  5. Ratiometric fluorescence transduction by hybridization after isothermal amplification for determination of zeptomole quantities of oligonucleotide biomarkers with a paper-based platform and camera-based detection.

    PubMed

    Noor, M Omair; Hrovat, David; Moazami-Goudarzi, Maryam; Espie, George S; Krull, Ulrich J

    2015-07-23

    Paper is a promising platform for the development of decentralized diagnostic assays owing to the low cost and ease of use of paper-based analytical devices (PADs). It can be challenging to detect on PADs very low concentrations of nucleic acid biomarkers of lengths as used in clinical assays. Herein we report the use of thermophilic helicase-dependent amplification (tHDA) in combination with a paper-based platform for fluorescence detection of probe-target hybridization. Paper substrates were patterned using wax printing. The cellulosic fibers were chemically derivatized with imidazole groups for the assembly of the transduction interface that consisted of immobilized quantum dot (QD)-probe oligonucleotide conjugates. Green-emitting QDs (gQDs) served as donors with Cy3 as the acceptor dye in a fluorescence resonance energy transfer (FRET)-based transduction method. After probe-target hybridization, a further hybridization event with a reporter sequence brought the Cy3 acceptor dye in close proximity to the surface of immobilized gQDs, triggering a FRET sensitized emission that served as an analytical signal. Ratiometric detection was evaluated using both an epifluorescence microscope and a low-cost iPad camera as detectors. Addition of the tHDA method for target amplification to produce sequences of ∼100 base length allowed for the detection of zmol quantities of nucleic acid targets using the two detection platforms. The ratiometric QD-FRET transduction method not only offered improved assay precision, but also lowered the limit of detection of the assay when compared with the non-ratiometric QD-FRET transduction method. The selectivity of the hybridization assays was demonstrated by the detection of single nucleotide polymorphism.

  6. Rates of primary electron transfer reactions in the photosystem I reaction center reconstituted with different quinones as the secondary acceptor

    SciTech Connect

    Kumazaki, Shigeichi; Kandori, Hideki; Yoshihara, Keitaro ); Iwaki, Masayo; Itoh, Shigeru ); Ikegamu, Isamu )

    1994-10-27

    Rates of sequential electron transfer reactions from the primary electron donor chlorophyll dimer (P700) to the electron acceptor chlorophyll a-686 (A[sub 0]) and to the secondary acceptor quinone (Q[sub [phi

  7. DNA sequence analysis by hybridization with oligonucleotide microchips: MALDI mass spectrometry identification of 5mers contiguously stacked to microchip oligonucleotides

    PubMed Central

    Stomakhin, Andrey A.; Vasiliskov, Vadim A.; Timofeev, Edward; Schulga, Dennis; Cotter, Richard J.; Mirzabekov, Andrei D.

    2000-01-01

    Matrix-assisted laser desorption ionization mass spectrometry (MALDI MS) has been applied to increase the informational output from DNA sequence analysis. It has been used to analyze DNA by hybridization with microarrays of gel-immobilized oligonucleotides extended with stacked 5mers. In model experiments, a 28 nt long DNA fragment was hybridized with 10 immobilized, overlapping 8mers. Then, in a second round of hybridization DNA–8mer duplexes were hybridized with a mixture of 10 5mers. The stability of the 5mer complex with DNA was increased to raise the melting temperature of the duplex by 10–15°C as a result of stacking interaction with 8mers. Contiguous 13 bp duplexes containing an internal break were formed. MALDI MS identified one or, in some cases, two 5mers contiguously stacked to each DNA–8mer duplex formed on the microchip. Incorporating a mass label into 5mers optimized MALDI MS monitoring. This procedure enabled us to reconstitute the sequence of a model DNA fragment and identify polymorphic nucleotides. The application of MALDI MS identification of contiguously stacked 5mers to increase the length of DNA for sequence analysis is discussed. PMID:10666462

  8. Analysis of Shewanella oneidensis Membrane Protein Expression in Response to Electron Acceptor Availability

    SciTech Connect

    Giometti, Carol S.; Khare, Tripti; Verberkmoes, Nathan; O'Loughlin, Ed; Lindberg, Carl; Thompson, Melissa; Hettich, Robert

    2006-04-05

    Shewanella oneidensis MR-1, a gram negative metal-reducing bacterium, can utilize a large number of electron acceptors. In the natural environment, S. oneidensis utilizes insoluble metal oxides as well as soluble terminal electron acceptors. The purpose of this ERSP project is to identify differentially expressed proteins associated with the membranes of S. oneidensis MR-1 cells grown with different electron acceptors, including insoluble metal oxides. We hypothesize that through the use of surface labeling, subcellular fractionation, and a combination of proteome analysis tools, proteins involved in the reduction of different terminal electron acceptors will be elucidated. We are comparing the protein profiles from cells grown with the soluble electron acceptors oxygen and fumarate and with those from cells grown with the insoluble iron oxides goethite, ferrihydrite and lepidocrocite. Comparison of the cell surface proteins isolated from cells grown with oxygen or anaerobically with fumarate revealed an increase in the abundance of over 25 proteins in anaerobic cells, including agglutination protein and flagellin proteins along with the several hypothetical proteins. In addition, the surface protein composition of cells grown with the insoluble iron oxides varies considerably from the protein composition observed with either soluble electron acceptor as well as between the different insoluble acceptors.

  9. RNA self-ligation: from oligonucleotides to full length ribozymes.

    PubMed

    Gwiazda, Slawomir; Salomon, Kristina; Appel, Bettina; Müller, Sabine

    2012-07-01

    The RNA-world-theory is one possible explanation of how life on earth has evolved. In this context it is of high interest to search for molecular systems, capable of self-organization into structures with increasing complexity. We have engineered a simple catalytic system in which two short RNA molecules can catalyze their own ligation to form a larger RNA construct. The system is based on the hairpin ribozyme using a 2',3'-cyclophosphate as activated species for ligation. 2',3'-cyclic phosphates can be easily formed and occur in many natural systems, thus being superior candidates for activated building blocks in RNA world scenarios.

  10. Synthesis and electrochemical studies of charge-transfer complexes of thiazolidine-2,4-dione with σ and π acceptors

    NASA Astrophysics Data System (ADS)

    Singh, Prashant; Kumar, Pradeep; Katyal, Anju; Kalra, Rashmi; Dass, Sujata K.; Prakash, Satya; Chandra, Ramesh

    2010-03-01

    In the present work, we report the synthesis and characterization of novel charge-transfer complexes of thiazolidine-2,4-dione (TZD) with sigma acceptor (iodine) and pi acceptors (chloranil, dichlorodicyanoquinone, picric acid and duraquinone). We also evaluated their thermal and electrochemical properties and we conclude that these complexes are frequency dependent. Charge-transfer complex between thiazolidine-2,4-dione and iodine give best conductivity. In conclusion, complex with sigma acceptors are more conducting than with pi acceptors.

  11. 2-O-[2-(Methylthio)ethyl]-Modified Oligonucleotide: An Analog of 2-O-[2-(Methoxy)ethyl]-Modified Oligonucleotide with Improved Protein Binding Properties and High Binding Affinity to Target RNA

    SciTech Connect

    Prakash, T.P.; Manoharan, M.; Fraser, A.S.; Kawasaki, A.M.; Lesnik, E.; Sioufi, N.; Leeds, J.M.; Teplova, M.; Egli, M.

    2010-03-08

    A novel 2'-modification, 2'-O-[2-(methylthio)ethyl] or 2'-O-MTE, has been incorporated into oligonucleotides and evaluated for properties relevant to antisense activity. The results were compared with the previously characterized 2'-O-[2-(methoxy)ethyl] 2'-O-MOE modification. As expected, the 2'-O-MTE modified oligonucleotides exhibited improved binding to human serum albumin compared to the 2'-O-MOE modified oligonucleotides. The 2'-O-MTE oligonucleotides maintained high binding affinity to target RNA. Nuclease digestion of 2'-O-MTE oligonucleotides showed that they have limited resistance to exonuclease degradation. We analyzed the crystal structure of a decamer DNA duplex containing the 2'-O-MTE modifcation. Analysis of the crystal structure provides insight into the improved RNA binding affinity, protein binding affinity and limited resistance of 2'-O-MTE modified oligonucleotides to exonuclease degradation.

  12. 21 CFR 184.1301 - Ferric phosphate.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 3 2014-04-01 2014-04-01 false Ferric phosphate. 184.1301 Section 184.1301 Food... GRAS § 184.1301 Ferric phosphate. (a) Ferric phosphate (ferric orthophosphate, iron (III) phosphate, Fe... from one to four molecules of water of hydration. It is prepared by reaction of sodium phosphate...

  13. Oligonucleotide facilitators may inhibit or activate a hammerhead ribozyme.

    PubMed Central

    Jankowsky, E; Schwenzer, B

    1996-01-01

    Facilitators are oligonucleotides capable of affecting hammerhead ribozyme activity by interacting with the substrate at the termini of the ribozyme. Facilitator effects were determined in vitro using a system consisting of a ribozyme with 7 nucleotides in every stem sequence and two substrates with inverted facilitator binding sequences. The effects of 9mer and 12mer RNA as well as DNA facilitators which bind either adjacent to the 3'- or 5'-end of the ribozyme were investigated. A kinetic model was developed which allows determination of the apparent dissociation constant of the ribozyme-substrate complex from single turnover reactions. We observed a decreased dissociation constant of the ribozyme-substrate complex due to facilitator addition corresponding to an additional stabilization energy of delta delta G=-1.7 kcal/mol with 3'-end facilitators. The cleavage rate constant was increased by 3'-end facilitators and decreased by 5'-end facilitators. Values for Km were slightly lowered by all facilitators and kcat was increased by 3'-end facilitators and decreased by 5'-end facilitators in our system. Generally the facilitator effects increased with the length of the facilitators and RNA provided greater effects than DNA of the same sequence. Results suggest facilitator influences on several steps of the hammerhead reaction, substrate association, cleavage and dissociation of products. Moreover, these effects are dependent in different manners on ribozyme and substrate concentration. This leads to the conclusion that there is a concentration dependence whether activation or inhibition is caused by facilitators. Conclusions are drawn with regard to the design of hammerhead ribozyme facilitator systems. PMID:8602353

  14. Correction of a Cystic Fibrosis Splicing Mutation by Antisense Oligonucleotides.

    PubMed

    Igreja, Susana; Clarke, Luka A; Botelho, Hugo M; Marques, Luís; Amaral, Margarida D

    2016-02-01

    Cystic fibrosis (CF), the most common life-threatening genetic disease in Caucasians, is caused by ∼2,000 different mutations in the CF transmembrane conductance regulator (CFTR) gene. A significant fraction of these (∼13%) affect pre-mRNA splicing for which novel therapies have been somewhat neglected. We have previously described the effect of the CFTR splicing mutation c.2657+5G>A in IVS16, showing that it originates transcripts lacking exon 16 as well as wild-type transcripts. Here, we tested an RNA-based antisense oligonucleotide (AON) strategy to correct the aberrant splicing caused by this mutation. Two AONs (AON1/2) complementary to the pre-mRNA IVS16 mutant region were designed and their effect on splicing was assessed at the RNA and protein levels, on intracellular protein localization and function. To this end, we used the 2657+5G>A mutant CFTR minigene stably expressed in HEK293 Flp-In cells that express a single copy of the transgene. RNA data from AON1-treated mutant cells show that exon 16 inclusion was almost completely restored (to 95%), also resulting in increased levels of correctly localized CFTR protein at the plasma membrane (PM) and with increased function. A novel two-color CFTR splicing reporter minigene developed here allowed the quantitative monitoring of splicing by automated microscopy localization of CFTR at the PM. The AON strategy is thus a promising therapeutic approach for the specific correction of alternative splicing.

  15. Application of heteronuclear couplings to conformational analysis of oligonucleotides

    SciTech Connect

    Zhu, G.; Live, D.; Bax, A.

    1994-12-01

    The value of vicinal coupling constants extracted from NMR spectra in deducing torsion angles for conformational analysis is well recognized. Due to the abundance of protons, their couplings have been mostly widely used. In many instances, couplings between protons and other nuclei may be a valuable complement to proton-proton couplings or, in some instances, may be the only coupling available to characterize the torsion angle about a bond. Recently, heteronuclear couplings have been used to great benefit in studies of isotopically enriched proteins, and this general approach has been extended to peptides at natural abundance. The possibility of using this approach to study oligonucleotides is also attractive but has not as yet been widely exploited. With the development of strategies for labeling such molecules, particularly RNAs, this may become an important component in conformational analysis. For DNA, labeling is less accessible, but sufficient quantities of unlabeled material are readily available for measuring these couplings at natural abundance. We chose several DNA systems to explore the usefulness of heteronuclear couplings in addressing the sugar conformation and the glycosidic torsion angle. Intensities of cross peaks in long-range HMQC experiments can be related to the couplings. Crosspeaks involving H1{prime} and C1{prime} atoms have been emphasized because of the superior shift dispersion at these positions between sugar protons and carbon atoms. Results will be shown for the self-complementary Dickerson duplex dodecamer sequence d(CGCGAATTCGCG) and for d(GGTCGG), which dimerizes to form a G-tetrad structure incorporating both syn and anti base orientations. The couplings provide a clear discrimination between presence of C3{prime}-endo and C2{prime}-endo conformations of the sugars and syn and anti bases arrangements.

  16. Optical spectroscopy of single beryllium acceptors in GaAs/AlGaAs quantum well

    NASA Astrophysics Data System (ADS)

    Petrov, P. V.; Kokurin, I. A.; Klimko, G. V.; Ivanov, S. V.; Ivánov, Yu. L.; Koenraad, P. M.; Silov, A. Yu.; Averkiev, N. S.

    2016-09-01

    We carry out microphotoluminescence measurements of an acceptor-bound exciton (A0X ) recombination in the applied magnetic field with a single impurity resolution. In order to describe the obtained spectra we develop a theoretical model taking into account a quantum well (QW) confinement, an electron-hole and hole-hole exchange interaction. By means of fitting the measured data with the model we are able to study the fine structure of individual acceptors inside the QW. The good agreement between our experiments and the model indicates that we observe single acceptors in a pure two-dimensional environment whose states are unstrained in the QW plain.

  17. Bacterial manganese reduction and growth with manganese oxide as the sole electron acceptor

    NASA Technical Reports Server (NTRS)

    Myers, Charles R.; Nealson, Kenneth H.

    1988-01-01

    Microbes that couple growth to the reduction of manganese could play an important role in the biogeochemistry of certain anaerobic environments. Such a bacterium, Alteromonas putrefaciens MR-1, couples its growth to the reduction of manganese oxides only under anaerobic conditions. The characteristics of this reduction are consistent with a biological, and not an indirect chemical, reduction of manganese, which suggest that this bacterium uses manganic oxide as a terminal electron acceptor. It can also utilize a large number of other compounds as terminal electron acceptors; this versatility could provide a distinct advantage in environments where electron-acceptor concentrations may vary.

  18. Recombinant hnRNP protein A1 and its N-terminal domain show preferential affinity for oligodeoxynucleotides homologous to intron/exon acceptor sites.

    PubMed Central

    Buvoli, M; Cobianchi, F; Biamonti, G; Riva, S

    1990-01-01

    The reported binding preference of human hnRNP protein A1 for the 3'-splice site of some introns (Swanson and Dreyfuss (1988) EMBO J. 7, 3519-3529; Mayrand and Pederson (1990) Nucleic Acids Res. 18, 3307-3318) was tested by assaying in vitro the binding of purified recombinant A1 protein (expressed in bacteria) to synthetic oligodeoxynucleotides (21-mers) of suitable sequence. In such a minimal system we find preferential binding of protein A1 to oligodeoxynucleotide sequences corresponding to the 3'-splice site of IVS1 of human beta-globin pre-mRNA and of IVS1 of Adenovirus type 2 major late transcript. Mutation studies demonstrate that the binding specificity is dependent on the known critical domains of this intron region, the AG splice site dinucleotide and polypyrimidine tract, and resides entirely in the short oligonucleotide sequence. Moreover specific binding does not require the presence of other hnRNP proteins or of snRNP particles. Studies with a truncated recombinant protein demonstrated that the minimal protein sequence determinants for A1 recognition of 3'-splice acceptor site reside entirely in the N-terminal 195 aa of the unmodified protein. Images PMID:2251120

  19. Oligonucleotide studies. Optical rotatory dispersion of five homodinucleotides.

    PubMed

    Inoue, Y; Satoh, K

    1969-08-01

    1. The optical rotatory dispersion (ORD) of five homodinucleotides, ApAp(3'), CpCp(3'), GpGp(3'), IpIp(3') and UpUp(3') (where A, C, G, I and U represent adenosine, cytidine, guanosine, inosine and uridine respectively, and p to the left of a nucleoside symbol indicates a 5'-phosphate and to the right it indicates a 3'-phosphate), were measured as a function of pH, ionic strength and Mg(2+) concentration. 2. The ORD titrations of ApAp(3') and CpCp(3'), which were made by measuring the ORD curves at closely spaced pH intervals, exhibit a maximum at approx. pH5.0 and 5.7 for ApAp(3') and CpCp(3') respectively in the profile of the magnitude of the first Cotton effect versus pH. The results indicate that the conformational rigidity of these dinucleotides depends on the ionization state of a 3'-terminal phosphate group. 3. ApAp(3') was shown to exist as an approximately 1:1 equilibrium mixture of the two major ionic species represented by Ap((-1))Ap((-1)) and Ap((-1))Ap((-2)) at pH6.16, whereas at pH7.5 it exists exclusively as a form of Ap((-1))Ap((-2)). 4. To ascertain the effects of the presence of a terminal phosphate group and of the ionization of the secondary phosphate on the conformation of adenylate dimer, we measured the ORD of ApA, ApAp(3')CH(3) and ApAp(2'). The rotatory power of the first Cotton effect in the above series of dinucleotides decreased at 20 degrees in the order ApA> ApAp(3')CH(3) approximately ApAp(3')((-1))> ApAp(2') at pH7> ApAp(3') at pH7. 5. The pH-rotation profiles were also obtained for ApAp(2'), CpCp(2') and UpUp(3'), but no corresponding maximum was observed. Although simple nearest-neighbour calculations based on the ORD data of IpIp(3') and 5'-IMP account for the observed ORD spectrum of polyinosinic acid at low salt concentration, there were large discrepancies between calculated and experimental results of the polyguanylic acid ORD even at low ionic strength. 6. The extent to which the amplitude of the Cotton effects of IpIp(3

  20. Development of LNA oligonucleotide-PCR clamping technique in investigating the community structures of plant-associated bacteria.

    PubMed

    Ikenaga, Makoto; Tabuchi, Masakazu; Oyama, Takuya; Akagi, Isao; Sakai, Masao

    2015-01-01

    Simultaneous extraction of plant organelle (mitochondria and plastid) genes during the DNA extraction step is major limitation in investigating the community structures of plant-associated bacteria. Although locked nucleic acid (LNA) oligonucleotides was designed to selectively amplify the bacterial small subunit rRNA genes by applying the PCR clamping technique, those for plastids were applicable only for particular plants, while those for mitochondria were available throughout most plants. To widen the applicable range, new LNA oligonucleotides specific for plastids were designed, and the efficacy was investigated. PCR without LNA oligonucleotides predominantly amplified the organelle genes, while bacterial genes were predominantly observed in having applied the LNA oligonucleotides. Denaturing gradient gel electrophoresis (DGGE) analysis displayed additional bacterial DGGE bands, the amplicons of which were prepared using the LNA oligonucleotides. Thus, new designed LNA oligonucleotides specific for plastids were effective and have widened the scope in investigating the community structures of plant-associated bacteria.

  1. A simple and rapid method for the preparation of homologous DNA oligonucleotide hybridization probes from heterologous gene sequences and probes.

    PubMed

    Maxwell, E S; Sarge, K D

    1988-11-30

    We describe a simple and rapid method for the preparation of homologous DNA oligonucleotide probes for hybridization analysis and/or cDNA/genomic library screening. With this method, a synthetic DNA oligonucleotide derived from a known heterologous DNA/RNA/protein sequence is annealed to an RNA preparation containing the gene transcript of interest. Any unpaired 3'-terminal oligonucleotides of the heterologous DNA primer are then removed using the 3' exonuclease activity of the DNA Polymerase I Klenow fragment before primer extension/dideoxynucleotide sequencing of the annealed RNA species with AMV reverse transcriptase. From the determined RNA sequence, a completely homologous DNA oligonucleotide probe is then prepared. This approach has been used to prepare a homologous DNA oligonucleotide probe for the successful library screening of the yeast hybRNA gene starting with a heterologous mouse hybRNA DNA oligonucleotide probe.

  2. 'Specific' oligonucleotides often recognize more than one gene: the limits of in situ hybridization applied to GABA receptors.

    PubMed

    Mladinic, M; Didelon, F; Cherubini, E; Bradbury, A

    2000-05-15

    As exquisite probes for gene sequences, oligonucleotides are one of the most powerful tools of recombinant molecular biology. In studying the GABA receptor subunits in the neonatal hippocampus we have used oligonucleotide probes in in situ hybridization and cloning techniques. The oligonucleotides used and assumed to be specific for the target gene, actually recognized more than one gene, leading to surprising and contradictory results. In particular, we found that a GABA(A)-rho specific oligonucleotide recognized an abundant, previously unknown, transcription factor in both in situ and library screening, while oligos 'specific' for GABA(A) subunits were able to recognize 30 additional unrelated genes in library screening. This suggests that positive results obtained with oligonucleotides should be interpreted with caution unless confirmed by identical results with oligonucleotides from different parts of the same gene, or cDNA library screening excludes the presence of other hybridizing species.

  3. Inositol phosphates in the environment.

    PubMed Central

    Turner, Benjamin L; Papházy, Michael J; Haygarth, Philip M; McKelvie, Ian D

    2002-01-01

    The inositol phosphates are a group of organic phosphorus compounds found widely in the natural environment, but that represent the greatest gap in our understanding of the global phosphorus cycle. They exist as inositols in various states of phosphorylation (bound to between one and six phosphate groups) and isomeric forms (e.g. myo, D-chiro, scyllo, neo), although myo-inositol hexakisphosphate is by far the most prevalent form in nature. In terrestrial environments, inositol phosphates are principally derived from plants and accumulate in soils to become the dominant class of organic phosphorus compounds. Inositol phosphates are also present in large amounts in aquatic environments, where they may contribute to eutrophication. Despite the prevalence of inositol phosphates in the environment, their cycling, mobility and bioavailability are poorly understood. This is largely related to analytical difficulties associated with the extraction, separation and detection of inositol phosphates in environmental samples. This review summarizes the current knowledge of inositol phosphates in the environment and the analytical techniques currently available for their detection in environmental samples. Recent advances in technology, such as the development of suitable chromatographic and capillary electrophoresis separation techniques, should help to elucidate some of the more pertinent questions regarding inositol phosphates in the natural environment. PMID:12028785

  4. Light weight phosphate cements

    DOEpatents

    Wagh, Arun S.; Natarajan, Ramkumar,; Kahn, David

    2010-03-09

    A sealant having a specific gravity in the range of from about 0.7 to about 1.6 for heavy oil and/or coal bed methane fields is disclosed. The sealant has a binder including an oxide or hydroxide of Al or of Fe and a phosphoric acid solution. The binder may have MgO or an oxide of Fe and/or an acid phosphate. The binder is present from about 20 to about 50% by weight of the sealant with a lightweight additive present in the range of from about 1 to about 10% by weight of said sealant, a filler, and water sufficient to provide chemically bound water present in the range of from about 9 to about 36% by weight of the sealant when set. A porous ceramic is also disclosed.

  5. Templated, layered manganese phosphate

    DOEpatents

    Thoma, Steven G.; Bonhomme, Francois R.

    2004-08-17

    A new crystalline maganese phosphate composition having an empirical formula: O). The compound was determined to crystallize in the trigonal space group P-3c1 with a=8.8706(4) .ANG., c=26.1580(2) .ANG., and V (volume)=1783 .ANG..sup.3. The structure consists of sheets of corner sharing Mn(II)O.sub.4 and PO.sub.4 tetrahedra with layers of (H.sub.3 NCH.sub.2 CH.sub.2).sub.3 N and water molecules in-between. The pronated (H.sub.3 NCH.sub.2 CH.sub.2).sub.3 N molecules provide charge balancing for the inorganic sheets. A network of hydrogen bonds between water molecules and the inorganic sheets holds the structure together.

  6. Reversal-bounded multipushdown machines. [Turing acceptors for context free languages

    NASA Technical Reports Server (NTRS)

    Baker, B. S.; Book, R. V.

    1974-01-01

    Several representations of the recursively enumerable (r.e.) sets are presented. The first states that every r.e. set is the homomorphic image of the intersection of two linear context-free languages. The second states that every r.e. set is accepted by an on-line Turing acceptor with two pushdown stores such that in every computation, each pushdown store can make at most one reversal (that is, one change from 'pushing' to 'popping'). It is shown that this automata theoretic representation cannot be strengthened by restricting the acceptors to be deterministic multitape, nondeterministic one-tape, or nondeterministic multicounter acceptors. This provides evidence that reversal bounds are not a natural measure of computational complexity for multitape Turing acceptors.

  7. Panchromatic donor-acceptor-donor conjugated oligomers for dye-sensitized solar cell applications.

    PubMed

    Stalder, Romain; Xie, Dongping; Islam, Ashraful; Han, Liyuan; Reynolds, John R; Schanze, Kirk S

    2014-06-11

    We report on a sexithienyl and two donor-acceptor-donor oligothiophenes, employing benzothiadiazole and isoindigo as electron-acceptors, each functionalized with a phosphonic acid group for anchoring onto TiO2 substrates as light-harvesting molecules for dye sensitized solar cells (DSSCs). These dyes absorb light to wavelengths as long as 700 nm, as their optical HOMO/LUMO energy gaps are reduced from 2.40 to 1.77 eV with increasing acceptor strength. The oligomers were adsorbed onto mesoporous TiO2 films on fluorine doped tin oxide (FTO)/glass substrates and incorporated into DSSCs, which show AM1.5 power conversion efficiencies (PCEs) ranging between 2.6% and 6.4%. This work demonstrates that the donor-acceptor-donor (D-A-D) molecular structures coupled to phosphonic acid anchoring groups, which have not been used in DSSCs, can lead to high PCEs.

  8. Interface-induced heavy-hole/light-hole splitting of acceptors in silicon

    SciTech Connect

    Mol, J. A.; Salfi, J.; Simmons, M. Y.; Rogge, S.; Rahman, R.; Hsueh, Y.; Klimeck, G.; Miwa, J. A.

    2015-05-18

    The energy spectrum of spin-orbit coupled states of individual sub-surface boron acceptor dopants in silicon have been investigated using scanning tunneling spectroscopy at cryogenic temperatures. The spatially resolved tunnel spectra show two resonances, which we ascribe to the heavy- and light-hole Kramers doublets. This type of broken degeneracy has recently been argued to be advantageous for the lifetime of acceptor-based qubits [R. Ruskov and C. Tahan, Phys. Rev. B 88, 064308 (2013)]. The depth dependent energy splitting between the heavy- and light-hole Kramers doublets is consistent with tight binding calculations, and is in excess of 1 meV for all acceptors within the experimentally accessible depth range (<2 nm from the surface). These results will aid the development of tunable acceptor-based qubits in silicon with long coherence times and the possibility for electrical manipulation.

  9. Preparation and spectroscopic studies on charge-transfer complexes of 2-hydroxypyridine with electron acceptors

    NASA Astrophysics Data System (ADS)

    Gaballa, Akmal S.

    2013-07-01

    The CT-interactions of electron acceptors such as iodine (I2), chloranilic acid (H2CA) and 2,3-dichloro-5,6-dicyano-p-benzoquinone (DDQ) with 2-hydroxypyridine (HPyO) have been investigated in the defined solvent. The data indicate the formation of CT-complexes with the general formula [(HPyO)(acceptor)]. The 1:1 stoichiometry of the (HPyO)-acceptors were based on elemental analysis, IR spectra and thermogravimetric analysis of the solid CT-complexes along with the photometric titration measurements for the reactions. The formation constants (KCT) for the CT-complexes are shown to be strongly dependent on the type and structure of the electron acceptors. Factors affecting the CT-processes are discussed.

  10. Preparation and spectroscopic studies on charge-transfer complexes of famciclovir drug with different electron acceptors

    NASA Astrophysics Data System (ADS)

    Gaballa, Akmal S.; Teleb, Said M.; Nour, El-Metwally

    2012-09-01

    The CT-interaction of electron acceptors such as chloranilic acid (H2CA), 2,3-dichloro-5,6-dicyano-p-benzoquinone (DDQ) and and 7,7',8,8'-tetracyano-p-quinodimethane (TCNQ) with the antiviral drug famciclovir (FCV) have been investigated spectrophotometrically in the defined solvent. The data indicate the formation of CT-complexes with the general formula [(FCV)(acceptor)]. The 1:1 stoichiometry of the (FCV)-acceptors were based on elemental analysis, IR spectra and thermogravimetric analysis of the solid CT-complexes along with the photometric titration measurements for the reactions. The formation constants (KCT) for the CT-complexes are shown to be strongly dependent on the type and structure of the electron acceptor. Factors affecting the CT-processes such as redox potentials and steric hinderance of reactants are discussed.

  11. Disassembly of micelles to impart donor and acceptor gradation to enhance organic solar cell efficiency.

    PubMed

    Arulkashmir, Arulraj; Krishnamoorthy, Kothandam

    2016-02-28

    A transparent, conducting and low surface energy surface was prepared by disassembly of anionic micelles, which altered the orientation of the donor polymer and imparted gradation between the donor and acceptor. This configuration increased the solar cell device efficiency.

  12. Time-resolved spectroscopy of the fluorescence quenching of a donor — acceptor pair by halothane

    NASA Astrophysics Data System (ADS)

    Sharma, A.; Draxler, S.; Lippitsch, M. E.

    1992-04-01

    Donor (anthracene) sensitized acceptor (perylene) fluorescence is quenched more efficiently by halothane than is intrinsic perylene fluorescence. The underlying process of dynamic fluorescence quenching is investigated by time-resolved fluorescence spectroscopy.

  13. Crystallization of calcium phosphate in polyacrylamide hydrogels containing phosphate ions

    NASA Astrophysics Data System (ADS)

    Yokoi, Taishi; Kawashita, Masakazu; Kikuta, Koichi; Ohtsuki, Chikara

    2010-08-01

    Calcium phosphate crystals were formed in polyacrylamide (PAAm) hydrogels containing phosphate ions by diffusion of calcium ions from calcium nitrate (Ca(NO 3) 2) solutions covering the gels. Changes in crystalline phases and crystal morphology of calcium phosphate, and in ion concentrations of the Ca(NO 3) 2 solutions were investigated as a function of reaction time. Single or two coexisting crystalline phases of calcium phosphate, hydroxyapatite (HAp), HAp/dicalcium phosphate dihydrate (DCPD) or octacalcium phosphate (OCP)/DCPD were formed in the gels. HAp crystals are formed near the surface of the gels. The dense HAp layer and HAp/DCPD layer prevented diffusion of calcium ions from the Ca(NO 3) 2 solution, thus formation of calcium phosphate in the gel phase was inhibited. Formation of DCPD was observed to follow the formation of OCP or HAp. The size of the OCP crystals gradually increased with reaction time, while changes in size of HAp crystals were not observed. The reaction time required for DCPD formation depended on the degree of supersaturation with respect to DCPD in the systems. DCPD formed within 1 day under high supersaturation conditions, whereas it formed at 10 days in low supersaturation conditions.

  14. Phosphate nutrition: improving low-phosphate tolerance in crops.

    PubMed

    López-Arredondo, Damar Lizbeth; Leyva-González, Marco Antonio; González-Morales, Sandra Isabel; López-Bucio, José; Herrera-Estrella, Luis

    2014-01-01

    Phosphorus is an essential nutrient that is required for all major developmental processes and reproduction in plants. It is also a major constituent of the fertilizers required to sustain high-yield agriculture. Levels of phosphate--the only form of phosphorus that can be assimilated by plants--are suboptimal in most natural and agricultural ecosystems, and when phosphate is applied as fertilizer in soils, it is rapidly immobilized owing to fixation and microbial activity. Thus, cultivated plants use only approximately 20-30% of the applied phosphate, and the rest is lost, eventually causing water eutrophication. Recent advances in the understanding of mechanisms by which wild and cultivated species adapt to low-phosphate stress and the implementation of alternative bacterial pathways for phosphorus metabolism have started to allow the design of more effective breeding and genetic engineering strategies to produce highly phosphate-efficient crops, optimize fertilizer use, and reach agricultural sustainability with a lower environmental cost. In this review, we outline the current advances in research on the complex network of plant responses to low-phosphorus stress and discuss some strategies used to manipulate genes involved in phosphate uptake, remobilization, and metabolism to develop low-phosphate-tolerant crops, which could help in designing more efficient crops.

  15. Superiorities of time-correlated single-photon counting against standard fluorimetry in exploiting the potential of fluorochromized oligonucleotide probes for biomedical investigation

    NASA Astrophysics Data System (ADS)

    Lamperti, Marco; Nardo, Luca; Bondani, Maria

    2015-05-01

    Site-specific fluorescence-resonance-energy-transfer donor-acceptor dual-labelled oligonucleotide probes are widely used in state-of-art biotechnological applications. Such applications include their usage as primers in polymerase chain reaction. However, the steady-state fluorescence intensity signal emitted by these molecular tools strongly depends from the specificities of the probe conformation. For this reason, the information which can be reliably inferred by steady-state fluorimetry performed on such samples is forcedly confined to a semi-qualitative level. Namely, fluorescent emission is frequently used as ON/OFF indicator of the probe hybridization state, i.e. detection of fluorescence signals indicates either hybridization to or detachment from the template DNA of the probe. Nonetheless, a fully quantitative analysis of their fluorescence emission properties would disclose other exciting applications of dual-labelled probes in biosensing. Here we show how time-correlated single-photon counting can be applied to get rid of the technical limitations and interpretational ambiguities plaguing the intensity analysis, and to derive information on the template DNA reaching single-base.

  16. ABAB Phthalocyanines: Scaffolds for Building Unprecedented Donor–π–Acceptor Chromophores

    PubMed Central

    Fazio, Ettore; Jaramillo‐García, Javier; Medel, María; Urbani, Maxence; Grätzel, Michael

    2016-01-01

    Abstract Unique donor–π–acceptor phthalocyanines have been synthesized through the asymmetric functionalization of an ABAB phthalocyanine, crosswise functionalized with two iodine atoms through Pd‐catalyzed cross‐coupling reactions with adequate electron‐donor and electron‐acceptor moieties. These push–pull molecules have been optically and electrochemically characterized, and their ability to perform as chromophores for dye‐sensitized solar cells has been tested. PMID:28168157

  17. Process for gasification using a synthetic CO/sub 2/ acceptor

    SciTech Connect

    Curran, G.P.; Lancet, M.S.

    1980-11-04

    A gasification process is disclosed using a synthetic CO/sub 2/ acceptor consisting essentially of at least one compound selected from the group consisting of calcium oxide and calcium carbonate supported in a refractory carrier matrix, the carrier having the general formula Ca/sub 5/(SiO/sub 4/)/sub 2/CO/sub 3/. A method for producing the synthetic CO/sub 2/ acceptor is also disclosed.

  18. An Electron Acceptor with Porphyrin and Perylene Bisimides for Efficient Non-Fullerene Solar Cells.

    PubMed

    Zhang, Andong; Li, Cheng; Yang, Fan; Zhang, Jianqi; Wang, Zhaohui; Wei, Zhixiang; Li, Weiwei

    2017-03-01

    A star-shaped electron acceptor based on porphyrin as a core and perylene bisimide as end groups was constructed for application in non-fullerene organic solar cells. The new conjugated molecule exhibits aligned energy levels, good electron mobility, and complementary absorption with a donor polymer. These advantages facilitate a high power conversion efficiency of 7.4 % in non-fullerene solar cells, which represents the highest photovoltaic performance based on porphyrin derivatives as the acceptor.

  19. Ternary Organic Solar Cells Based on Two Compatible Nonfullerene Acceptors with Power Conversion Efficiency >10.

    PubMed

    Liu, Tao; Guo, Yuan; Yi, Yuanping; Huo, Lijun; Xue, Xiaonan; Sun, Xiaobo; Fu, Huiting; Xiong, Wentao; Meng, Dong; Wang, Zhaohui; Liu, Feng; Russell, Thomas P; Sun, Yanming

    2016-12-01

    Two different nonfullerene acceptors and one copolymer are used to fabricate ternary organic solar cells (OSCs). The two acceptors show unique interactions that reduce crystallinity and form a homogeneous mixed phase in the blend film, leading to a high efficiency of ≈10.3%, the highest performance reported for nonfullerene ternary blends. This work provides a new approach to fabricate high-performance OSCs.

  20. ABAB Phthalocyanines: Scaffolds for Building Unprecedented Donor-π-Acceptor Chromophores.

    PubMed

    Fazio, Ettore; Jaramillo-García, Javier; Medel, María; Urbani, Maxence; Grätzel, Michael; Nazeerudin, Mohammad K; de la Torre, Gema; Torres, Tomas

    2017-02-01

    Unique donor-π-acceptor phthalocyanines have been synthesized through the asymmetric functionalization of an ABAB phthalocyanine, crosswise functionalized with two iodine atoms through Pd-catalyzed cross-coupling reactions with adequate electron-donor and electron-acceptor moieties. These push-pull molecules have been optically and electrochemically characterized, and their ability to perform as chromophores for dye-sensitized solar cells has been tested.

  1. Electron Donor-Acceptor Quenching and Photoinduced Electron Transfer for Coumarin Dyes.

    DTIC Science & Technology

    1983-10-31

    Mechanism of cousarin photodegradation . Ithe behavior of eoiuma dyes is water ad In aqueous detergent media,. and the effsects of medism aud, additives on...D-i36 345 ELECTRON DONOR-ACCEPTOR UENCHING AND PHOTOINDUCED i/i Ai ELECTRON TRANSFER FOR COUMARIN DYES (U) BOSTON UNIY MR DEPT OF CHEMISTRY G JONES...TYPE OF REPORT & PEIOD COVERED Electron Donor-acceptor Quenching and Photo- Technical, 1/1/82-10/31/82 induced Electron Transfer for Coumarin Dyes S

  2. Process for gasification using a synthetic CO.sub.2 acceptor

    DOEpatents

    Lancet, Michael S.; Curran, George P.

    1980-01-01

    A gasification process is disclosed using a synthetic CO.sub.2 acceptor consisting essentially of at least one compound selected from the group consisting of calcium oxide and calcium carbonate supported in a refractory carrier matrix, the carrier having the general formula Ca.sub.5 (SiO.sub.4).sub.2 CO.sub.3. A method for producing the synthetic CO.sub.2 acceptor is also disclosed.

  3. Oligonucleotide-induced alternative splicing of serotonin 2C receptor reduces food intake.

    PubMed

    Zhang, Zhaiyi; Shen, Manli; Gresch, Paul J; Ghamari-Langroudi, Masoud; Rabchevsky, Alexander G; Emeson, Ronald B; Stamm, Stefan

    2016-08-01

    The serotonin 2C receptor regulates food uptake, and its activity is regulated by alternative pre-mRNA splicing. Alternative exon skipping is predicted to generate a truncated receptor protein isoform, whose existence was confirmed with a new antiserum. The truncated receptor sequesters the full-length receptor in intracellular membranes. We developed an oligonucleotide that promotes exon inclusion, which increases the ratio of the full-length to truncated receptor protein. Decreasing the amount of truncated receptor results in the accumulation of full-length, constitutively active receptor at the cell surface. After injection into the third ventricle of mice, the oligonucleotide accumulates in the arcuate nucleus, where it changes alternative splicing of the serotonin 2C receptor and increases pro-opiomelanocortin expression. Oligonucleotide injection reduced food intake in both wild-type and ob/ob mice. Unexpectedly, the oligonucleotide crossed the blood-brain barrier and its systemic delivery reduced food intake in wild-type mice. The physiological effect of the oligonucleotide suggests that a truncated splice variant regulates the activity of the serotonin 2C receptor, indicating that therapies aimed to change pre-mRNA processing could be useful to treat hyperphagia, characteristic for disorders like Prader-Willi syndrome.

  4. Systemic peptide-mediated oligonucleotide therapy improves long-term survival in spinal muscular atrophy

    PubMed Central

    Hazell, Gareth; Shabanpoor, Fazel; Saleh, Amer F.; Bowerman, Melissa; Meijboom, Katharina E.; Zhou, Haiyan; Muntoni, Francesco; Talbot, Kevin; Gait, Michael J.; Wood, Matthew J. A.

    2016-01-01

    The development of antisense oligonucleotide therapy is an important advance in the identification of corrective therapy for neuromuscular diseases, such as spinal muscular atrophy (SMA). Because of difficulties of delivering single-stranded oligonucleotides to the CNS, current approaches have been restricted to using invasive intrathecal single-stranded oligonucleotide delivery. Here, we report an advanced peptide-oligonucleotide, Pip6a-morpholino phosphorodiamidate oligomer (PMO), which demonstrates potent efficacy in both the CNS and peripheral tissues in severe SMA mice following systemic administration. SMA results from reduced levels of the ubiquitously expressed survival motor neuron (SMN) protein because of loss-of-function mutations in the SMN1 gene. Therapeutic splice-switching oligonucleotides (SSOs) modulate exon 7 splicing of the nearly identical SMN2 gene to generate functional SMN protein. Pip6a-PMO yields SMN expression at high efficiency in peripheral and CNS tissues, resulting in profound phenotypic correction at doses an order-of-magnitude lower than required by standard naked SSOs. Survival is dramatically extended from 12 d to a mean of 456 d, with improvement in neuromuscular junction morphology, down-regulation of transcripts related to programmed cell death in the spinal cord, and normalization of circulating insulin-like growth factor 1. The potent systemic efficacy of Pip6a-PMO, targeting both peripheral as well as CNS tissues, demonstrates the high clinical potential of peptide-PMO therapy for SMA. PMID:27621445

  5. Liposome-encapsulated polyethylenimine/oligonucleotide polyplexes prepared by reverse-phase evaporation technique.

    PubMed

    Ko, Young Tag; Bickel, Ulrich

    2012-06-01

    Liposome-encapsulated polyplex system represents a promising delivery system for oligonucleotide-based therapeutics such as siRNA and asODN. Here, we report a novel method to prepare liposome-encapsulated cationic polymer/oligonucleotide polyplexes based on the reverse-phase evaporation following organic extraction of the polyplexes. The polyplexes of polyethylenimine and oligonucleotide were first formed in aqueous buffer at an N/P ratio of 6. The overall positively charged polyplexes were then mixed with the anionic phospholipids in overall organic media. The overall organic environment and electrostatic interaction between anionic phospholipids and positively charged polyplexes resulted in inverted micelle-like particles with the polyplexes in the core. After phase separation, the hydrophobic particles were recovered in organic phase. Reverse-phase evaporation of the organic solvent in the presence of hydrophilic polymer-grafted lipids resulted in a stable aqueous dispersion of hydrophilic lipid-coated particles with the polyplex in the core. Transmission electron microscopy visualization revealed spherical structures with heavily stained polyplex cores surrounded by lightly stained lipid coats. The lipid-coated polyplex particles showed colloidal stability, complete protection of the loaded oligonucleotide molecules from enzymatic degradation, and high loading efficiency of more than 80%. Thus, this technique represents an alternative method to prepare lipid-coated polyplex particles as a delivery system of oligonucleotide therapeutics.

  6. Arrays of complementary oligonucleotides for analysing the hybridisation behaviour of nucleic acids.

    PubMed Central

    Southern, E M; Case-Green, S C; Elder, J K; Johnson, M; Mir, K U; Wang, L; Williams, J C

    1994-01-01

    Arrays of oligonucleotides corresponding to a full set of complements of a known sequence can be made in a single series of base couplings in which each base in the complement is added in turn. Coupling is carried out on the surface of a solid support such as a glass plate, using a device which applies reagents in a defined area. The device is displaced by a fixed movement after each coupling reaction so that consecutive couplings overlap only a portion of previous ones. The shape and size of the device and the amount by which it is displaced at each step determines the length of the oligonucleotides. Certain shapes create arrays of oligonucleotides from mononucleotides up to a given length in a single series of couplings. The array is used in a hybridisation reaction to a labelled target sequence, and shows the hybridisation behaviour of every oligonucleotide in the target sequence with its complement in the array. Applications include sequence comparison to test for mutation, analysis of secondary structure, and optimisation of PCR primer and antisense oligonucleotide design. Images PMID:7514785

  7. An activated triple bond linker enables 'click' attachment of peptides to oligonucleotides on solid support.

    PubMed

    Wenska, Malgorzata; Alvira, Margarita; Steunenberg, Peter; Stenberg, Asa; Murtola, Merita; Strömberg, Roger

    2011-11-01

    A general procedure, based on a new activated alkyne linker, for the preparation of peptide-oligonucleotide conjugates (POCs) on solid support has been developed. With this linker, conjugation is effective at room temperature (RT) in millimolar concentration and submicromolar amounts. This is made possible since the use of a readily attachable activated triple bond linker enhances the Cu(I) catalyzed 1,3-dipolar cycloaddition ('click' reaction). The preferred scheme for conjugate preparation involves sequential conjugation to oligonucleotides on solid support of (i) an H-phosphonate-based aminolinker; (ii) the triple bond donor p-(N-propynoylamino)toluic acid (PATA); and (iii) azido-functionalized peptides. The method gives conversion of oligonucleotide to the POC on solid support, and only involves a single purification step after complete assembly. The synthesis is flexible and can be carried out without the need for specific automated synthesizers since it has been designed to utilize commercially available oligonucleotide and peptide derivatives on solid support or in solution. Methodology for the ready conversion of peptides into 'clickable' azidopeptides with the possibility of selecting either N-terminus or C-terminus connection also adds to the flexibility and usability of the method. Examples of synthesis of POCs include conjugates of oligonucleotides with peptides known to be membrane penetrating and nuclear localization signals.

  8. A novel, one-step amplification and oligonucleotide ligation procedure for multiplex genetic typing

    SciTech Connect

    Eggerding, F.A.

    1994-09-01

    A new technique, coupled amplification and oligonucleotide ligation (CAL), has been developed for simultaneous multiplex amplification and genotyping of DNA. CAL is a biphasic method which combines in one assay DNA amplification by the polymerase chain reaction (PCR) with DNA genotyping by the oligonucleotide ligation assay (OLA). By virtue of a difference in the melting temperatures of PCR primer-target DNA and OLA probe-target DNA hybrids, the method allows preferential amplification of DNA during stage I and oligonucleotide ligation during stage II of the reaction. In stage I target DNA is amplified using high-melting primers in a two-step PCR cycle that employs a 72{degrees}C anneal-elongation step. In stage II genotyping of PCR products by competitive oligonucleotide ligation with oligonucleotide probes located between PCR primers is accomplished by several cycles of denaturation at 94{degrees}C followed by anneal-ligation at 55{degrees}C. Ligation products are fluorochrome-labeled at their 3{prime}-ends and analyzed electrophoretically on a fluorescent DNA sequencer. The CAL procedure has been used for multiplex detection of 30 cystic fibrosis mutations and for analysis of ras gene point mutations. Because mutation detection occurs concurrently with target amplification, the technique is rapid, highly sensitive and specific, easily automatable, and requires minimal sample processing.

  9. Aspects of oligonucleotide and peptide sequencing with MALDI and electrospray mass spectrometry.

    PubMed

    Owens, D R; Bothner, B; Phung, Q; Harris, K; Siuzdak, G

    1998-09-01

    Biopolymer sequencing with mass spectrometry has become increasingly important and accessible with the development of matrix-assisted laser desorption/ionization (MALDI) and electrospray ionization (ESI). Here we examine the use of sequential digestion for the rapid identification of proteolytic fragments, in turn highlighting the general utility of enzymatic MALDI ladder sequencing and ESI tandem mass spectrometry. Analyses were performed on oligonucleotides ranging in size from 2 to 50 residues, on peptides ranging in size from 7 to 44 residues and on viral coat proteins. MALDI ladder sequencing using exonuclease digestion generated a uniform distribution of ions and provided complete sequence information on the oligonucleotides 2-30 nucleic acid residues long. Only partial sequence information was obtained on the longer oligonucleotides. C-terminal peptide ladder sequencing typically provided information from 4 to 7 amino acids into the peptide. Sequential digestion, or endoprotease followed by exoprotease exposure, was also successfully applied to a trypsin digest of viral proteins. Analysis of ladder sequenced peptides by LCMS generated less information than in the MALDI-MS analysis and ESI-MS2 normally provided partial sequence information on both the small oligonucleotides and peptides. In general, MALDI ladder sequencing offered information on a broader mass range of biopolymers than ESI-MS2 and was relatively straightforward to interpret, especially for oligonucleotides.

  10. Surface modification of plasmonic nanostructured materials with thiolated oligonucleotides in 10 seconds using selective microwave heating

    PubMed Central

    Abel, Biebele; Aslan, Kadir

    2013-01-01

    This study demonstrates the proof-of-principle of rapid surface modification of plasmonic nanostructured materials with oligonucleotides using low power microwave heating. Due to their interesting optical and electronic properties, silver nanoparticle films (SNFs, 2 nm thick) deposited onto glass slides were used as the model plasmonic nanostructured materials. Rapid surface modification of SNFs with oligonucleotides was carried out using two strategies (1) Strategy 1: for ss-oligonucleotides, surface hybridization and (2) Strategy 2: for ds-oligonucleotides, solution hybridization), where the samples were exposed to 10, 15, 30 and 60 seconds microwave heating. To assess the efficacy of our new rapid surface modification technique, identical experiments carried out without the microwave heating (i.e., conventional method), which requires 24 hours for the completion of the identical steps. It was found that SNFs can be modified with ss- and ds-oligonucleotides in 10 seconds, which typically requires several hours of incubation time for the chemisorption of thiol groups on to the planar metal surface using conventional techniques. PMID:23645933

  11. In vivo potentialities of EWS-Fli-1 targeted antisense oligonucleotides-nanospheres complexes.

    PubMed

    Maksimenko, Andrei; Polard, Valerie; Villemeur, Marie; Elhamess, Hind; Couvreur, Patrick; Bertrand, Jean-Remi; Aboubakar, Malam; Gottikh, Marina; Malvy, Claude

    2005-11-01

    The EWS/FLI-1 fusion gene, resulting from a t(11;22) translocation, plays a key role in the pathogenesis of Ewing sarcoma. Previously, we have shown that antisense oligonucleotides designed against EWS-Fli-1 inhibited tumor growth in nude mice provided they were delivered intratumorally by nanocapsules or by CTAB-coated nanospheres. In this study, we have used two types of nanospheres (designated as type 1 and type 2 nanospheres) stabilized with chitosan for both intratumoral and systemic administration of oligonucleotides. Inhibition of the tumor growth in vivo was found to be dependent on the carrier type as well as on antisense oligonucleotide modification. Indeed, whereas both types of nanospheres were efficient in reducing tumor growth after intratumoral injection, we have obtained only with type 2 nanospheres an antitumoral effect after intravenous injection in a preliminary experiment. Additionally, the anticancer efficacy of a localized modification of the EWS-Fli-1 phosphodiester/phosphorothioate chimeric antisense oligonucleotide was demonstrated. In cell culture the oligonucleotides inhibit cell growth by their antisense activity. Further investigations are needed in vivo to learn the mechanism of action of the complexes.

  12. Combined in vitro transcription and reverse transcription to amplify and label complex synthetic oligonucleotide probe libraries.

    PubMed

    Murgha, Yusuf; Beliveau, Brian; Semrau, Kassandra; Schwartz, Donald; Wu, Chao-Ting; Gulari, Erdogan; Rouillard, Jean-Marie

    2015-06-01

    Oligonucleotide microarrays allow the production of complex custom oligonucleotide libraries for nucleic acid detection-based applications such as fluorescence in situ hybridization (FISH). We have developed a PCR-free method to make single-stranded DNA (ssDNA) fluorescent probes through an intermediate RNA library. A double-stranded oligonucleotide library is amplified by transcription to create an RNA library. Next, dye- or hapten-conjugate primers are used to reverse transcribe the RNA to produce a dye-labeled cDNA library. Finally the RNA is hydrolyzed under alkaline conditions to obtain the single-stranded fluorescent probes library. Starting from unique oligonucleotide library constructs, we present two methods to produce single-stranded probe libraries. The two methods differ in the type of reverse transcription (RT) primer, the incorporation of fluorescent dye, and the purification of fluorescent probes. The first method employs dye-labeled reverse transcription primers to produce multiple differentially single-labeled probe subsets from one microarray library. The fluorescent probes are purified from excess primers by oligonucleotide-bead capture. The second method uses an RNA:DNA chimeric primer and amino-modified nucleotides to produce amino-allyl probes. The excess primers and RNA are hydrolyzed under alkaline conditions, followed by probe purification and labeling with amino-reactive dyes. The fluorescent probes created by the combination of transcription and reverse transcription can be used for FISH and to detect any RNA and DNA targets via hybridization.

  13. Comparison of gene coverage of mouse oligonucleotide microarray platforms

    PubMed Central

    Verdugo, Ricardo A; Medrano, Juan F

    2006-01-01

    Background The increasing use of DNA microarrays for genetical genomics studies generates a need for platforms with complete coverage of the genome. We have compared the effective gene coverage in the mouse genome of different commercial and noncommercial oligonucleotide microarray platforms by performing an in-house gene annotation of probes. We only used information about probes that is available from vendors and followed a process that any researcher may take to find the gene targeted by a given probe. In order to make consistent comparisons between platforms, probes in each microarray were annotated with an Entrez Gene id and the chromosomal position for each gene was obtained from the UCSC Genome Browser Database. Gene coverage was estimated as the percentage of Entrez Genes with a unique position in the UCSC Genome database that is tested by a given microarray platform. Results A MySQL relational database was created to store the mapping information for 25,416 mouse genes and for the probes in five microarray platforms (gene coverage level in parenthesis): Affymetrix430 2.0 (75.6%), ABI Genome Survey (81.24%), Agilent (79.33%), Codelink (78.09%), Sentrix (90.47%); and four array-ready oligosets: Sigma (47.95%), Operon v.3 (69.89%), Operon v.4 (84.03%), and MEEBO (84.03%). The differences in coverage between platforms were highly conserved across chromosomes. Differences in the number of redundant and unspecific probes were also found among arrays. The database can be queried to compare specific genomic regions using a web interface. The software used to create, update and query the database is freely available as a toolbox named ArrayGene. Conclusion The software developed here allows researchers to create updated custom databases by using public or proprietary information on genes for any organisms. ArrayGene allows easy comparisons of gene coverage between microarray platforms for any region of the genome. The comparison presented here reveals that the

  14. 21 CFR 520.823 - Erythromycin phosphate.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    .... (a) Specifications. Erythromycin phosphate is the phosphate salt of the antibiotic substance produced by the growth of Streptomyces erythreus or the same antibiotic substance produced by any other...

  15. 21 CFR 520.823 - Erythromycin phosphate.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    .... (a) Specifications. Erythromycin phosphate is the phosphate salt of the antibiotic substance produced by the growth of Streptomyces erythreus or the same antibiotic substance produced by any other...

  16. 21 CFR 520.823 - Erythromycin phosphate.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    .... (a) Specifications. Erythromycin phosphate is the phosphate salt of the antibiotic substance produced by the growth of Streptomyces erythreus or the same antibiotic substance produced by any other...

  17. 21 CFR 520.823 - Erythromycin phosphate.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    .... (a) Specifications. Erythromycin phosphate is the phosphate salt of the antibiotic substance produced by the growth of Streptomyces erythreus or the same antibiotic substance produced by any other...

  18. 21 CFR 520.823 - Erythromycin phosphate.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    .... (a) Specifications. Erythromycin phosphate is the phosphate salt of the antibiotic substance produced by the growth of Streptomyces erythreus or the same antibiotic substance produced by any other...

  19. Enhanced natural attenuation of BTEX in the nitrate-reducing environment by different electron acceptors.

    PubMed

    Zhao, Yongsheng; Qu, Dan; Hou, Zhimin; Zhou, Rui

    2015-01-01

    Enhancing natural attenuation of benzene, toluene, ethylbenzene, and xylene (BTEX) in groundwater is a potential remediation technology. This study focused on selecting appropriate electron acceptors to promote BTEX degradation in a nitrate-reducing environment. Nitrate-reducing soil was obtained from simulated BTEX-contaminated column. Enhancing experiments were conducted in the microcosm with nitrate-reducing material and simulated BTEX-polluted groundwater to investigate the promoting feasibility of adding dissolved oxygen (DO), nitrate, chelated Fe(III), and sulphate as electron acceptors. The concentrations of BTEX, electron acceptors, and their reducing products were measured. The order of promoting BTEX degradation with four electron acceptors was nitrate>sulphate>chelated Fe(III)>DO, and the first-order decay coefficients were 0.0432, 0.0333, 0.0240, and 0.0155, respectively. Nitrate, sulphate, and chelated Fe(III) enhanced attenuation. Nitrate was the most effective electron acceptor under nitrate-reducing conditions. Selecting proper electron acceptor is significant in promoting BTEX degradation according to the biogeochemical characteristics of local underground environment.

  20. Beyond Fullerenes: Designing Alternative Molecular Electron Acceptors for Solution-Processable Bulk Heterojunction Organic Photovoltaics.

    PubMed

    Sauvé, Geneviève; Fernando, Roshan

    2015-09-17

    Organic photovoltaics (OPVs) are promising candidates for providing a low cost, widespread energy source by converting sunlight into electricity. Solution-processable active layers have predominantly consisted of a conjugated polymer donor blended with a fullerene derivative as the acceptor. Although fullerene derivatives have been the acceptor of choice, they have drawbacks such as weak visible light absorption and poor energy tuning that limit overall efficiencies. This has recently fueled new research to explore alternative acceptors that would overcome those limitations. During this exploration, one question arises: what are the important design principles for developing nonfullerene acceptors? It is generally accepted that acceptors should have high electron affinity, electron mobility, and absorption coefficient in the visible and near-IR region of the spectra. In this Perspective, we argue that alternative molecular acceptors, when blended with a conjugated polymer donor, should also have large nonplanar structures to promote nanoscale phase separation, charge separation and charge transport in blend films. Additionally, new material design should address the low dielectric constant of organic semiconductors that have so far limited their widespread application.

  1. A new classification of the amino acid side chains based on doublet acceptor energy levels.

    PubMed Central

    Sneddon, S F; Morgan, R S; Brooks, C L

    1988-01-01

    We describe a new classification of the amino acid side chains based on the potential energy level at which each will accept an extra (doublet) electron. The doublet acceptor energy level, and the doublet acceptor orbital were calculated using semiempirical INDO/2-UHF molecular orbital theory. The results of these calculations show that the side chains fall into four groups. We have termed these groups repulsive, insulating, semiconducting, and attractive in accordance with where each lies on the relative energy scale. We use this classification to examine the role of residues between the donor and acceptor in modulating the rate and mechanism of electron transfer in proteins. With the calculated acceptor levels, we construct a potential barrier for those residues between the donor and acceptor. It is the area beneath this barrier that determines the decay of electronic coupling between donor and acceptor, and thus the transfer rate. We have used this schematic approach to characterize the four electron transfer pathways in myoglobin recently studied by Mayo et al. (Mayo, S.L., W.R. Ellis, R.J. Crutchley, and H.B. Gray. 1986. Science [Wash. DC]. 233:948-952). PMID:3342271

  2. Molecular helices as electron acceptors in high-performance bulk heterojunction solar cells

    DOE PAGES

    Yu M. Zhong; Nam, Chang -Yong; Trinh, M. Tuan; ...

    2015-09-18

    Despite numerous organic semiconducting materials synthesized for organic photovoltaics in the past decade, fullerenes are widely used as electron acceptors in highly efficient bulk-heterojunction solar cells. None of the non-fullerene bulk heterojunction solar cells have achieved efficiencies as high as fullerene-based solar cells. Design principles for fullerene-free acceptors remain unclear in the field. Here we report examples of helical molecular semiconductors as electron acceptors that are on par with fullerene derivatives in efficient solar cells. We achieved an 8.3% power conversion efficiency in a solar cell, which is a record high for non-fullerene bulk heterojunctions. Femtosecond transient absorption spectroscopy revealedmore » both electron and hole transfer processes at the donor–acceptor interfaces. Atomic force microscopy reveals a mesh-like network of acceptors with pores that are tens of nanometres in diameter for efficient exciton separation and charge transport. As a result, this study describes a new motif for designing highly efficient acceptors for organic solar cells.« less

  3. Molecular helices as electron acceptors in high-performance bulk heterojunction solar cells

    NASA Astrophysics Data System (ADS)

    Zhong, Yu; Trinh, M. Tuan; Chen, Rongsheng; Purdum, Geoffrey E.; Khlyabich, Petr P.; Sezen, Melda; Oh, Seokjoon; Zhu, Haiming; Fowler, Brandon; Zhang, Boyuan; Wang, Wei; Nam, Chang-Yong; Sfeir, Matthew Y.; Black, Charles T.; Steigerwald, Michael L.; Loo, Yueh-Lin; Ng, Fay; Zhu, X.-Y.; Nuckolls, Colin

    2015-09-01

    Despite numerous organic semiconducting materials synthesized for organic photovoltaics in the past decade, fullerenes are widely used as electron acceptors in highly efficient bulk-heterojunction solar cells. None of the non-fullerene bulk heterojunction solar cells have achieved efficiencies as high as fullerene-based solar cells. Design principles for fullerene-free acceptors remain unclear in the field. Here we report examples of helical molecular semiconductors as electron acceptors that are on par with fullerene derivatives in efficient solar cells. We achieved an 8.3% power conversion efficiency in a solar cell, which is a record high for non-fullerene bulk heterojunctions. Femtosecond transient absorption spectroscopy revealed both electron and hole transfer processes at the donor-acceptor interfaces. Atomic force microscopy reveals a mesh-like network of acceptors with pores that are tens of nanometres in diameter for efficient exciton separation and charge transport. This study describes a new motif for designing highly efficient acceptors for organic solar cells.

  4. Molecular helices as electron acceptors in high-performance bulk heterojunction solar cells.

    PubMed

    Zhong, Yu; Trinh, M Tuan; Chen, Rongsheng; Purdum, Geoffrey E; Khlyabich, Petr P; Sezen, Melda; Oh, Seokjoon; Zhu, Haiming; Fowler, Brandon; Zhang, Boyuan; Wang, Wei; Nam, Chang-Yong; Sfeir, Matthew Y; Black, Charles T; Steigerwald, Michael L; Loo, Yueh-Lin; Ng, Fay; Zhu, X-Y; Nuckolls, Colin

    2015-09-18

    Despite numerous organic semiconducting materials synthesized for organic photovoltaics in the past decade, fullerenes are widely used as electron acceptors in highly efficient bulk-heterojunction solar cells. None of the non-fullerene bulk heterojunction solar cells have achieved efficiencies as high as fullerene-based solar cells. Design principles for fullerene-free acceptors remain unclear in the field. Here we report examples of helical molecular semiconductors as electron acceptors that are on par with fullerene derivatives in efficient solar cells. We achieved an 8.3% power conversion efficiency in a solar cell, which is a record high for non-fullerene bulk heterojunctions. Femtosecond transient absorption spectroscopy revealed both electron and hole transfer processes at the donor-acceptor interfaces. Atomic force microscopy reveals a mesh-like network of acceptors with pores that are tens of nanometres in diameter for efficient exciton separation and charge transport. This study describes a new motif for designing highly efficient acceptors for organic solar cells.

  5. Differences in gene expression of human xylosyltransferases and determination of acceptor specificities for various proteoglycans

    SciTech Connect

    Roch, Christina; Kuhn, Joachim; Kleesiek, Knut; Goetting, Christian

    2010-01-01

    The xylosyltransferase (XT) isoforms XT-I and XT-II initiate the posttranslational glycosaminoglycan (GAG) synthesis. Here, we determined the relative expression of both isoforms in 33 human cell lines. The majority of tested cell lines showed dominant XYLT2 gene expression, while only in 23132/87, JAR, NCI-H510A and THP-1 was the XT-I mRNA expression higher. Nearly equal expression levels were detected in six cell lines. Additionally, to shed light on putative differences in acceptor specificities the acceptor properties of potential acceptor sequences were determined. Peptides were expressed as glutathione-S-transferase fusion proteins containing putative or known GAG attachment sites of in vivo proteoglycans. Kinetic analysis showed that K{sub m} and V{sub max} values for XT-I mediated xylosylation were slightly higher than those for XT-II, and that XT-I showed a lesser stringency concerning the acceptor sequence. Mutagenesis of the bikunin peptide sequence in the G-S-G attachment site and flanking regions generated potential acceptor molecules. Here, mutations on the N-terminal side and the attachment site were found to be more susceptible to a loss of acceptor function than mutations in the C-terminus. Altogether the known consensus sequence a-a-a-a-G-S-G-a-a/G-a ('a' representing Asp or Glu) for XT-I mediated xylosylation could be approved and additionally extended to apply to XT-II as well.

  6. Molecular helices as electron acceptors in high-performance bulk heterojunction solar cells

    SciTech Connect

    Yu M. Zhong; Nam, Chang -Yong; Trinh, M. Tuan; Chen, Rongsheng; Purdum, Geoffrey E.; Khlyabich, Petr P.; Sezen, Melda; Oh, Seokjoon; Zhu, Haiming; Fowler, Brandon; Zhang, Boyuan; Wang, Wei; Sfeir, Matthew Y.; Black, Charles T.; Steigerwald, Michael L.; Loo, Yueh -Lin; Ng, Fay; Zhu, X. -Y.; Nuckolls, Colin

    2015-09-18

    Despite numerous organic semiconducting materials synthesized for organic photovoltaics in the past decade, fullerenes are widely used as electron acceptors in highly efficient bulk-heterojunction solar cells. None of the non-fullerene bulk heterojunction solar cells have achieved efficiencies as high as fullerene-based solar cells. Design principles for fullerene-free acceptors remain unclear in the field. Here we report examples of helical molecular semiconductors as electron acceptors that are on par with fullerene derivatives in efficient solar cells. We achieved an 8.3% power conversion efficiency in a solar cell, which is a record high for non-fullerene bulk heterojunctions. Femtosecond transient absorption spectroscopy revealed both electron and hole transfer processes at the donor–acceptor interfaces. Atomic force microscopy reveals a mesh-like network of acceptors with pores that are tens of nanometres in diameter for efficient exciton separation and charge transport. As a result, this study describes a new motif for designing highly efficient acceptors for organic solar cells.

  7. Density and energy level of a deep-level Mg acceptor in 4H-SiC

    NASA Astrophysics Data System (ADS)

    Matsuura, Hideharu; Morine, Tatsuya; Nagamachi, Shinji

    2015-01-01

    Reliably determining the densities and energy levels of deep-level dominant acceptors in heavily doped wide-band-gap semiconductors has been a topic of recent discussion. In these discussions, the focus is on both Hall scattering factors for holes and distribution functions for acceptors. Mg acceptor levels in 4H-SiC seem to be deep, and so here the electrical properties of Mg-implanted 4H-SiC layers are studied by measuring Hall effects. The obtained Hall scattering factors are not reliable because they drop to less than 0.5 at high measurement temperatures. Moreover, the Fermi-Dirac distribution function is unsuitable for examining Mg acceptors because the obtained acceptor density is much higher than the concentration of implanted Mg atoms. However, by using a distribution function that includes the influence of the excited states of a deep-level acceptor, the density and energy level of Mg acceptors can be reliably determined.

  8. Toward a new paradigm of DNA writing using a massively parallel sequencing platform and degenerate oligonucleotide

    PubMed Central

    Hwang, Byungjin; Bang, Duhee

    2016-01-01

    All synthetic DNA materials require prior programming of the building blocks of the oligonucleotide sequences. The development of a programmable microarray platform provides cost-effective and time-efficient solutions in the field of data storage using DNA. However, the scalability of the synthesis is not on par with the accelerating sequencing capacity. Here, we report on a new paradigm of generating genetic material (writing) using a degenerate oligonucleotide and optomechanical retrieval method that leverages sequencing (reading) throughput to generate the desired number of oligonucleotides. As a proof of concept, we demonstrate the feasibility of our concept in digital information storage in DNA. In simulation, the ability to store data is expected to exponentially increase with increase in degenerate space. The present study highlights the major framework change in conventional DNA writing paradigm as a sequencer itself can become a potential source of making genetic materials. PMID:27876825

  9. Using Fluorophore-labeled Oligonucleotides to Measure Affinities of Protein-DNA Interactions

    PubMed Central

    Anderson, Brian J.; Larkin, Chris; Guja, Kip; Schildbach, Joel F.

    2011-01-01

    Changes in fluorescence emission intensity and anisotropy can reflect changes in the environment and molecular motion of a fluorophore. Researchers can capitalize on these characteristics to assess the affinity and specificity of DNA-binding proteins using fluorophore-labeled oligonucleotides. While there are many advantages to measuring binding using fluorescent oligonucleotides, there are also some distinct disadvantages. Here we describe some of the relevant issues for the novice, illustrating key points using data collected with the F plasmid relaxase domain and a variety of labeled oligonucleotides. Topics include selection of a fluorophore, experimental design using a fluorometer equipped with an automatic titrating unit, and analysis of direct binding and competition assays. PMID:19152864

  10. Streptavidin-coated gold nanoparticles: critical role of oligonucleotides on stability and fractal aggregation

    PubMed Central

    D'Agata, Roberta; Palladino, Pasquale

    2017-01-01

    Gold nanoparticles (AuNPs) exhibit unique properties that can be modulated through a tailored surface functionalization, enabling their targeted use in biochemical sensing and medical diagnostics. In particular, streptavidin-modified AuNPs are increasingly used for biosensing purposes. We report here a study of AuNPs surface-functionalized with streptavidin-biotinylated oligonucleotide, focussing on the role played by the oligonucleotide probes in the stabilization/destabilization of the functionalized nanoparticle dispersion. The behaviour of the modified AuNP dispersion as a consequence of the competitive displacement of the biotinylated oligonucleotide has been investigated and the critical role of displaced oligonucletides in triggering the quasi one-dimensional aggregation of nanoparticles is demonstrated for the first time. The thorough understanding of the fundamental properties of bioconjugated AuNPs is of great importance for the design of highly sensitive and reliable functionalized AuNP-based assays. PMID:28144559

  11. Stable triple helices formed by oligonucleotide N3'-->P5' phosphoramidates inhibit transcription elongation.

    PubMed Central

    Escudé, C; Giovannangeli, C; Sun, J S; Lloyd, D H; Chen, J K; Gryaznov, S M; Garestier, T; Hélène, C

    1996-01-01

    Oligonucleotide analogs with N3'-->P5' phosphoramidate linkages bind to the major groove of double-helical DNA at specific oligopurine.oligopyrimidine sequences. These triple-helical complexes are much more stable than those formed by oligonucleotides with natural phosphodiester linkages. Oligonucleotide phosphoramidates containing thymine and cytosine or thymine, cytosine, and guanine bind strongly to the polypurine tract of human immunodeficiency virus proviral DNA under physiological conditions. Site-specific cleavage by the Dra I restriction enzyme at the 5' end of the polypurine sequence was inhibited by triplex formation. A eukaryotic transcription assay was used to investigate the effect of oligophosphoramidate binding to the polypurine tract sequence on transcription of the type 1 human immunodeficiency virus nef gene under the control of a cytomegalovirus promoter. An efficient arrest of RNA polymerase II was observed at the specific triplex site at submicromolar concentrations. Images Fig. 2 Fig. 3 PMID:8633072

  12. Hydration-dependent dynamics of human telomeric oligonucleotides in the picosecond timescale: A neutron scattering study

    NASA Astrophysics Data System (ADS)

    Sebastiani, F.; Longo, M.; Orecchini, A.; Comez, L.; De Francesco, A.; Muthmann, M.; Teixeira, S. C. M.; Petrillo, C.; Sacchetti, F.; Paciaroni, A.

    2015-07-01

    The dynamics of the human oligonucleotide AG3(T2AG3)3 has been investigated by incoherent neutron scattering in the sub-nanosecond timescale. A hydration-dependent dynamical activation of thermal fluctuations in weakly hydrated samples was found, similar to that of protein powders. The amplitudes of such thermal fluctuations were evaluated in two different exchanged wave-vector ranges, so as to single out the different contributions from intra- and inter-nucleotide dynamics. The activation energy was calculated from the temperature-dependent characteristic times of the corresponding dynamical processes. The trends of both amplitudes and activation energies support a picture where oligonucleotides possess a larger conformational flexibility than long DNA sequences. This additional flexibility, which likely results from a significant relative chain-end contribution to the average chain dynamics, could be related to the strong structural polymorphism of the investigated oligonucleotides.

  13. Kinetic effects on signal normalization in oligonucleotide microchips with labeled immobilized probes.

    PubMed

    Pan'kov, S V; Chechetkin, V R; Somova, O G; Antonova, O V; Moiseeva, O V; Prokopenko, D V; Yurasov, R A; Gryadunov, D A; Chudinov, A V

    2009-10-01

    Among various factors affecting operation of oligonucleotide microchips, the variations in concentration and in homogeneous distribution of immobilized probes over the cells are one of the most important. The labeling of immobilized probes ensures the complete current monitoring on the probe distribution and is reliable and convenient. Using hydrogel-based oligonucleotide microchips, the applicability of Cy3-labeled immobilized probes for quality control and signal normalization after hybridization with Cy5-labeled target DNA was investigated. This study showed that proper signal normalization should be different in thermodynamic conditions and in transient regime with hybridization far from saturation. This kinetic effect holds for both hydrogel-based and surface oligonucleotide microchips. Besides proving basic features, the technique was assessed on a sampling batch of 50 microchips developed for identifying mutations responsible for rifampicin and isoniazid resistance of Mycobacterium tuberculosis.

  14. Hydration-dependent dynamics of human telomeric oligonucleotides in the picosecond timescale: A neutron scattering study

    SciTech Connect

    Sebastiani, F.; Comez, L.; Sacchetti, F.; Orecchini, A.; Petrillo, C.; Paciaroni, A.; De Francesco, A.; Teixeira, S. C. M.

    2015-07-07

    The dynamics of the human oligonucleotide AG{sub 3}(T{sub 2}AG{sub 3}){sub 3} has been investigated by incoherent neutron scattering in the sub-nanosecond timescale. A hydration-dependent dynamical activation of thermal fluctuations in weakly hydrated samples was found, similar to that of protein powders. The amplitudes of such thermal fluctuations were evaluated in two different exchanged wave-vector ranges, so as to single out the different contributions from intra- and inter-nucleotide dynamics. The activation energy was calculated from the temperature-dependent characteristic times of the corresponding dynamical processes. The trends of both amplitudes and activation energies support a picture where oligonucleotides possess a larger conformational flexibility than long DNA sequences. This additional flexibility, which likely results from a significant relative chain-end contribution to the average chain dynamics, could be related to the strong structural polymorphism of the investigated oligonucleotides.

  15. Hydrolysis of microporous polyamide-6 membranes as substrate for in situ synthesis of oligonucleotides

    NASA Astrophysics Data System (ADS)

    Tang, Jianxin; He, Nongyue; Nie, Libo; Xiao, Pengfeng; Chen, Hong

    2004-02-01

    This article provides a novel method of preparing substrate for in situ synthesis of oligonucleotide by hydrolyzing microporous polyamide-6 membranes in a 0.01 mol/l/NaOH/(H 2O-CH 3OH) mixture medium with refluxing about 36 h. Attenuated total reflectance Fourier transform infrared spectroscopy (ATR-FTIR) demonstrated the emergence of amines (NH 2) on the surface. Optimum hydrolyzing conditions were determined through the ultra-violet (UV) spectra. A pH value of 12 and a hydrolysis time of 36 h are the preferred conditions for the modification. The treated membrane can be applied to in situ synthesis of oligonucleotide and, for example, the oligonucleotide probes of 5 '-AAC CAC CAA ACA CAC-3 ' were successfully synthesized on the hydrolyzed membrane. The single step coupling efficiency determined by ultraviolet (UV) spectra is above 98%.

  16. Hydration-dependent dynamics of human telomeric oligonucleotides in the picosecond timescale: a neutron scattering study.

    PubMed

    Sebastiani, F; Longo, M; Orecchini, A; Comez, L; De Francesco, A; Muthmann, M; Teixeira, S C M; Petrillo, C; Sacchetti, F; Paciaroni, A

    2015-07-07

    The dynamics of the human oligonucleotide AG3(T2AG3)3 has been investigated by incoherent neutron scattering in the sub-nanosecond timescale. A hydration-dependent dynamical activation of thermal fluctuations in weakly hydrated samples was found, similar to that of protein powders. The amplitudes of such thermal fluctuations were evaluated in two different exchanged wave-vector ranges, so as to single out the different contributions from intra- and inter-nucleotide dynamics. The activation energy was calculated from the temperature-dependent characteristic times of the corresponding dynamical processes. The trends of both amplitudes and activation energies support a picture where oligonucleotides possess a larger conformational flexibility than long DNA sequences. This additional flexibility, which likely results from a significant relative chain-end contribution to the average chain dynamics, could be related to the strong structural polymorphism of the investigated oligonucleotides.

  17. Repair of Thalassemic Human β -globin mRNA in Mammalian Cells by Antisense Oligonucleotides

    NASA Astrophysics Data System (ADS)

    Sierakowska, Halina; Sambade, Maria J.; Agrawal, Sudhir; Kole, Ryszard

    1996-11-01

    In one form of β -thalassemia, a genetic blood disorder, a mutation in intron 2 of the β -globin gene (IVS2-654) causes aberrant splicing of β -globin pre-mRNA and, consequently, β -globin deficiency. Treatment of mammalian cells stably expressing the IVS2-654 human β -globin gene with antisense oligonucleotides targeted at the aberrant splice sites restored correct splicing in a dose-dependent fashion, generating correct human β -globin mRNA and polypeptide. Both products persisted for up to 72 hr posttreatment. The oligonucleotides modified splicing by a true antisense mechanism without overt unspecific effects on cell growth and splicing of other pre-mRNAs. This novel approach in which antisense oligonucleotides are used to restore rather than to down-regulate the activity of the target gene is applicable to other splicing mutants and is of potential clinical interest.

  18. Myelin Basic Protein and a Multiple Sclerosis-related MBP-peptide Bind to Oligonucleotides

    PubMed Central

    Rozenblum, Guido Tomás; Kaufman, Tomás; Vitullo, Alfredo Daniel

    2014-01-01

    Aptamer ligands for myelin basic protein (MBP) were obtained using the systematic evolution of ligand by exponential enrichment (SELEX) method. Two clones were isolated from a pool of oligonucleotides and tested for MBP targeting. Using purified MBP, we demonstrated the binding activity of the aptamers and we also showed the affinity of MBP for oligonucleotides of specific length. Moreover, one selected aptamer competitively inhibited the binding of an MBP-specific antibody to MBP and the aptamer was found more sensitive than a commercial antibody. In addition, we showed the ability of the aptamer to detect myelin-rich regions in paraffin-embedded mouse brain tissue. Therefore, the MBP-binding activity of the selected oligonucleotide may prove useful as a tool for life science and medical research for myelin detection and might be a good lead for testing it in autoimmune diseases such as multiple sclerosis. PMID:25202925

  19. Oligonucleotide primers, probes and molecular methods for the environmental monitoring of methanogenic archaea

    PubMed Central

    Narihiro, Takashi; Sekiguchi, Yuji

    2011-01-01

    Summary For the identification and quantification of methanogenic archaea (methanogens) in environmental samples, various oligonucleotide probes/primers targeting phylogenetic markers of methanogens, such as 16S rRNA, 16S rRNA gene and the gene for the α‐subunit of methyl coenzyme M reductase (mcrA), have been extensively developed and characterized experimentally. These oligonucleotides were designed to resolve different groups of methanogens at different taxonomic levels, and have been widely used as hybridization probes or polymerase chain reaction primers for membrane hybridization, fluorescence in situ hybridization, rRNA cleavage method, gene cloning, DNA microarray and quantitative polymerase chain reaction for studies in environmental and determinative microbiology. In this review, we present a comprehensive list of such oligonucleotide probes/primers, which enable us to determine methanogen populations in an environment quantitatively and hierarchically, with examples of the practical applications of the probes and primers. PMID:21375721

  20. Conduction electrons in acceptor-doped GaAs/GaAlAs heterostructures: a review

    NASA Astrophysics Data System (ADS)

    Zawadzki, Wlodek; Raymond, Andre; Kubisa, Maciej

    2016-05-01

    We review magneto-optical and magneto-transport effects in GaAs/GaAlAs heterostructures doped in GaAlAs barriers with donors, providing two-dimensional (2D) electron gas (2DEG) in GaAs quantum wells (QWS), and additionally doped with smaller amounts of acceptors (mostly Be atoms) in the vicinity of 2DEG. One may also deal with residual acceptors (mostly C atoms). The behavior of such systems in the presence of a magnetic field differs appreciably from those doped in the vicinity of 2DEG with donors. Three subjects related to the acceptor-doped heterostructures are considered. First is the problem of bound states of conduction electrons confined to the vicinity of negatively charged acceptors by the joint effect of a QW and an external magnetic field parallel to the growth direction. A variational theory of such states is presented, demonstrating that an electron turning around a repulsive center has discrete energies above the corresponding Landau levels. Experimental evidence for the discrete electron energies comes from the work on interband photo-magneto-luminescence, intraband cyclotron resonance and quantum magneto-transport (the Quantum Hall and Shubnikov-de Haas effects). An electron rain-down effect at weak electric fields and a boil-off effect at strong electric fields are introduced. It is demonstrated, both theoretically and experimentally, that a negatively charged acceptor can localize more than one electron. The second subject describes experiment and theory of asymmetric quantized Hall and Shubnikov-de Haas plateaus in acceptor-doped GaAs/GaAlAs heterostructures. It is shown that the main features of the plateau asymmetry can be attributed to asymmetric density of Landau states in the presence of acceptors. However, at high magnetic fields, the rain-down effect is also at work. The third subject deals with the so-called disorder modes (DMs) in the cyclotron resonance of conduction electrons. The DMs originate from random distributions of negatively

  1. A water setting tetracalcium phosphate-dicalcium phosphate dihydrate cement.

    PubMed

    Burguera, E F; Guitián, F; Chow, L C

    2004-11-01

    The development of a calcium phosphate cement, comprising tetracalcium phosphate (TTCP) and dicalcium phosphate dihydrate (DCPD), that hardens in 14 min with water as the liquid or 6 min with a 0.25 mol/L sodium phosphate solution as the liquid, without using hydroxyapatite (HA) seeds as setting accelerator, is reported. It was postulated that reduction in porosity would increase cement strength. Thus, the effects of applied pressure during the initial stages of the cement setting reaction on cement strength and porosity were studied. The cement powder comprised an equimolar mixture of TTCP and DCPD (median particle sizes 17 and 1.7 microm, respectively). Compressive strengths (CS) of samples prepared with distilled water were 47.6 +/- 2.4 MPa, 50.7 +/- 4.2 MPa, and 52.9 +/- 4.7 MPa at applied pressures of 5 MPa, 15 MPa, and 25 MPa, respectively. When phosphate solution was used, the CS values obtained were 41.5 +/- 2.3 MPa, 37.9 +/- 1.7 MPa, and 38.1 +/- 2.3 MPa at the same pressure levels. Statistical analysis of the results showed that pressure produced an improvement in CS when water was used as liquid but not when the phosphate solution was used. Compared to previously reported TTCP-DCPD cements, the greater CS values and shorter setting times together with a simplified formulation should make the present TTCP-DCPD cement a useful material as a bone substitute for clinical applications.

  2. Bolaamphiphile-based nanocomplex delivery of phosphorothioate gapmer antisense oligonucleotides as a treatment for Clostridium difficile

    PubMed Central

    Hegarty, John P; Krzeminski, Jacek; Sharma, Arun K; Guzman-Villanueva, Diana; Weissig, Volkmar; Stewart, David B

    2016-01-01

    Despite being a conceptually appealing alternative to conventional antibiotics, a major challenge toward the successful implementation of antisense treatments for bacterial infections is the development of efficient oligonucleotide delivery systems. Cationic vesicles (bolasomes) composed of dequalinium chloride (“DQAsomes”) have been used to deliver plasmid DNA across the cardiolipin-rich inner membrane of mitochondria. As cardiolipin is also a component of many bacterial membranes, we investigated the application of cationic bolasomes to bacteria as an oligonucleotide delivery system. Antisense sequences designed in silico to target the expression of essential genes of the bacterial pathogen, Clostridium difficile, were synthesized as 2′-O-methyl phosphorothioate gapmer antisense oligonucleotides (ASO). These antisense gapmers were quantitatively assessed for their ability to block mRNA translation using luciferase reporter and C. difficile protein expression plasmid constructs in a coupled transcription–translation system. Cationic bolaamphiphile compounds (dequalinium derivatives) of varying alkyl chain length were synthesized and bolasomes were prepared via probe sonication of an aqueous suspension. Bolasomes were characterized by particle size distribution, zeta potential, and binding capacities for anionic oligonucleotide. Bolasomes and antisense gapmers were combined to form antisense nanocomplexes. Anaerobic C. difficile log phase cultures were treated with serial doses of gapmer nanocomplexes or equivalent amounts of empty bolasomes for 24 hours. Antisense gapmers for four gene targets achieved nanomolar minimum inhibitory concentrations for C. difficile, with the lowest values observed for oligonucleotides targeting polymerase genes rpoB and dnaE. No inhibition of bacterial growth was observed from treatments at matched dosages of scrambled gapmer nanocomplexes or plain, oligonucleotide-free bolasomes compared to untreated control cultures. We

  3. In situ formation of an oxygen-evolving catalyst in neutral water containing phosphate and Co2+.

    PubMed

    Kanan, Matthew W; Nocera, Daniel G

    2008-08-22

    The utilization of solar energy on a large scale requires its storage. In natural photosynthesis, energy from sunlight is used to rearrange the bonds of water to oxygen and hydrogen equivalents. The realization of artificial systems that perform "water splitting" requires catalysts that produce oxygen from water without the need for excessive driving potentials. Here we report such a catalyst that forms upon the oxidative polarization of an inert indium tin oxide electrode in phosphate-buffered water containing cobalt (II) ions. A variety of analytical techniques indicates the presence of phosphate in an approximate 1:2 ratio with cobalt in this material. The pH dependence of the catalytic activity also implicates the hydrogen phosphate ion as the proton acceptor in the oxygen-producing reaction. This catalyst not only forms in situ from earth-abundant materials but also operates in neutral water under ambient conditions.

  4. Customized oligonucleotide microchips that convert multiple genetic information to simple patterns, are portable and reusable

    DOEpatents

    Mirzabekov, Andrei; Guschin, Dmitry Y.; Chik, Valentine; Drobyshev, Aleksei; Fotin, Alexander; Yershov, Gennadiy; Lysov, Yuri

    2002-01-01

    This invention relates to using customized oligonucleotide microchips as biosensors for the detection and identification of nucleic acids specific for different genes, organisms and/or individuals in the environment, in food and in biological samples. The microchips are designed to convert multiple bits of genetic information into simpler patterns of signals that are interpreted as a unit. Because of an improved method of hybridizing oligonucleotides from samples to microchips, microchips are reusable and transportable. For field study, portable laser or bar code scanners are suitable.

  5. Purification of specific chromatin regions using oligonucleotides: capture hybridization analysis of RNA targets (CHART).

    PubMed

    Davis, Christopher P; West, Jason A

    2015-01-01

    Identification of genomic binding sites and proteins associated with noncoding RNAs will lead to more complete mechanistic characterization of the regulatory activities of noncoding RNAs. Capture hybridization analysis of RNA targets (CHART) is a powerful technique wherein specific RNA molecules are isolated from cross-linked nuclear extracts using complementary, biotinylated capture oligonucleotides, allowing subsequent identification of genomic DNA and proteins cross-linked to the RNA of interest. Here, we describe the procedure for CHART and list strategies to optimize nuclear extract preparation, capture oligonucleotide design, and isolation of nucleic acids and proteins enriched through CHART.

  6. Evaluation of an rRNA-derived oligonucleotide probe for culture confirmation of Neisseria gonorrhoeae.

    PubMed Central

    Rossau, R; Duhamel, M; Van Dyck, E; Piot, P; Van Heuverswyn, H

    1990-01-01

    The reliability of an rRNA-derived oligonucleotide probe for Neisseria gonorrhoeae was tested with 187 N. gonorrhoeae isolates, 81 Neisseria meningitidis isolates, and several strains of other bacterial species. The probe proved to be 100% specific and 100% sensitive. N. gonorrhoeae cells could also be reliably identified in contaminated cultures with the oligonucleotide probe. The 2.6-megadalton cryptic plasmid used as a probe for N. gonorrhoeae was shown to be less sensitive, detecting 179 of 181 N. gonorrhoeae isolates. Images PMID:1693630

  7. Transcriptional inhibition of the bacteriophage T7 early promoter region by oligonucleotide triple helix formation.

    PubMed

    Ross, C; Samuel, M; Broitman, S L

    1992-12-30

    We have identified a purine-rich triplex binding sequence overlapping a -35 transcriptional early promoter region of the bacteriophage T7. Triplex-forming oligonucleotide designed to bind this target was annealed to T7 templates and introduced into in vitro transcription systems under conditions favoring specific initiation from this promoter. These templates demonstrated significant transcriptional inhibition relative to naked genomic templates and templates mixed with non-triplex-forming oligonucleotide. It is suggested that triplex formation along this target interferes with transcriptional initiation, and this mechanism may hold potential to disrupt bacteriophage T7 early transcription in vivo.

  8. Complementary addressed modification and cleavage of a single stranded DNA fragment with alkylating oligonucleotide derivatives.

    PubMed Central

    Vlassov, V V; Zarytova, V F; Kutiavin, I V; Mamaev, S V; Podyminogin, M A

    1986-01-01

    A single stranded DNA fragment was modified with alkylating derivatives of oligonucleotides complementary to a certain nucleotide sequences in the fragment. The derivatives carried aromatic 2-chloroethylamino groups at their 3'- or 5'-terminal nucleotide residues. Some of the derivatives carried both alkylating group and intercalating phenazine group which stabilized complementary complexes. It was found that these oligonucleotide derivatives modify the DNA fragment in a specific way near the target complementary nucleotide sequences, and the DNA fragment can be cleaved at the alkylated nucleotides positions. Alkylating derivatives carrying phenazine groups were found to be the most efficient in reaction with the DNA fragment. Images PMID:3714471

  9. [Oligonucleotide analogues bearing an acyclonucleoside linked by an internucleotide amide bond].

    PubMed

    Kochetkova, S V; Fillipova, E A; Kolganova, N A; Timofeev, E N; Florent'ev, V L

    2008-01-01

    Oligonucleotide analogues bearing an acyclocytidine linked to thymidine by an amide (3'-O-CH2-CO-N-5') bond were synthesized. Melting curves of duplexes formed by modified oligonucleotides and complementary natural oligomers were obtained and thermodynamic parameters of their formation were measured. Replacement of dCpT by a modified dinucleotide only moderately decreased the melting temperature of these modified duplexes in comparison with unmodified duplexes containing complementary natural bases. CD spectra of modified duplexes were studied, and the duplex spatial structures are discussed. The English version of the paper: Russian Journal of Bioorganic Chemistry, 2008, vol. 34, no. 2; see also http://www.maik.ru.

  10. Oligonucleotide-templated chemical reactions: pushing the boundaries of a nature-inspired process.

    PubMed

    Percivalle, Claudia; Bartolo, Jean-François; Ladame, Sylvain

    2013-01-07

    Widespread in nature, oligonucleotide-templated reactions of phosphodiester bond formation have inspired chemists who are now applying this elegant strategy to the catalysis of a broad range of otherwise inefficient reactions. This review highlights the increasing diversity of chemical reactions that can be efficiently catalysed by an oligonucleotide template, using Watson-Crick base-pairing to bring both reagents in close enough proximity to react, thus increasing significantly their effective molarity. The applications of this elegant concept for nucleic acid sensing and controlled organic synthesis will also be discussed.

  11. Sequence selective naked-eye detection of DNA harnessing extension of oligonucleotide-modified nucleotides.

    PubMed

    Verga, Daniela; Welter, Moritz; Marx, Andreas

    2016-02-01

    DNA polymerases can efficiently and sequence selectively incorporate oligonucleotide (ODN)-modified nucleotides and the incorporated oligonucleotide strand can be employed as primer in rolling circle amplification (RCA). The effective amplification of the DNA primer by Φ29 DNA polymerase allows the sequence-selective hybridisation of the amplified strand with a G-quadruplex DNA sequence that has horse radish peroxidase-like activity. Based on these findings we develop a system that allows DNA detection with single-base resolution by naked eye.

  12. Use of thiolated oligonucleotides as anti-fouling diluents in electrochemical peptide-based sensors.

    PubMed

    McQuistan, Adam; Zaitouna, Anita J; Echeverria, Elena; Lai, Rebecca Y

    2014-05-11

    We incorporated short thiolated oligonucleotides as passivating diluents in the fabrication of electrochemical peptide-based (E-PB) sensors, with the goal of creating a negatively charged layer capable of resisting non-specific adsorption of matrix contaminants. The E-PB HIV sensors fabricated using these diluents were found to be more specific and selective, while retaining attributes similar to the sensor fabricated without these diluents. Overall, these results highlight the advantages of using oligonucleotides as anti-fouling diluents in self-assembled monolayer-based sensors.

  13. Quantitative assay and subcellular distribution of enzymes acting on dolichyl phosphate in rat liver

    PubMed Central

    Ravoet, A; Amar-Costesec, A; Godelaine, D; Beaufay, H

    1981-01-01

    To establish on a quantitative basis the subcellular distribution of the enzymes that glycosylate dolichyl phosphate in rat liver, preliminary kinetic studies on the transfer of mannose, glucose, and N-acetylglucosamine-1-phosphate from the respective (14)C- labeled nucleotide sugars to exogenous dolichyl phosphate were conducted in liver microsomes. Mannosyltransferase, glucosyltransferase, and, to a lesser extent, N- acetylglucosamine-phosphotransferase were found to be very unstable at 37 degrees C in the presence of Triton X-100, which was nevertheless required to disperse the membranes and the lipid acceptor in the aqueous reaction medium. The enzymes became fairly stable in the range of 10-17 degrees C and the reactions then proceeded at a constant velocity for at least 15 min. Conditions under which the reaction products are formed in amount proportional to that of microsomes added are described. For N- acetylglucosaminephosphotransferase it was necessary to supplement the incubation medium with microsomal lipids. Subsequently, liver homogenates were fractionated by differential centrifugation, and the microsome fraction, which contained the bulk of the enzymes glycosylating dolichyl phosphate, was analyzed by isopycnic centrifugation in a sucrose gradient without any previous treatment, or after addition of digitonin. The centrifugation behavior of these enzymes was compared to that of a number of reference enzymes for the endoplasmic reticulum, the golgi complex, the plasma membranes, and mitochondria. It was very simily to that of enzymes of the endoplasmic reticulum, especially glucose-6-phosphatase. Subcellular preparations enriched in golgi complex elements, plasma membranes, outer membranes of mitochondira, or mitoplasts showed for the transferases acting on dolichyl phosphate relative activities similar to that of glucose- 6-phosphatase. It is concluded that glycosylations of dolichyl phosphate into mannose, glucose, and N-acetylglucosamine-1

  14. Recent advances in phosphate biosensors.

    PubMed

    Upadhyay, Lata Sheo Bachan; Verma, Nishant

    2015-07-01

    A number of biosensors have been developed for phosphate analysis particularly, concerning its negative impact within the environmental and biological systems. Enzymatic biosensors comprising either a single or multiple enzymatic system have been extensively used for the direct and indirect analysis of phosphate ions. Furthermore, some non-enzymatic biosensors, such as affinity-based biosensors, provide an alternative analytical approach with a higher selectivity. This article reviews the recent advances in the field of biosensor developed for phosphate estimation in clinical and environmental samples, concerning the techniques involved, and the sensitivity toward phosphate ions. The biosensors have been classified and discussed on the basis of the number of enzymes used to develop the analytical system, and a comparative analysis has been performed.

  15. Selection of a new whole cell biocatalyst for the synthesis of 2-deoxyribose 5-phosphate.

    PubMed

    Valino, Ana L; Palazzolo, Martín A; Iribarren, Adolfo M; Lewkowicz, Elizabeth

    2012-01-01

    2-deoxyribose 5-phosphate (DR5P) is a key intermediate in the biocatalyzed preparation of deoxyribonucleosides. Therefore, DR5P production by means of simpler, cleaner, and economic pathways becomes highly interesting. One strategy involves the use of bacterial whole cells containing DR5P aldolase as biocatalyst for the aldol addition between acetaldehyde and D: -glyceraldehyde 3-phosphate or glycolytic intermediates that in situ generate the acceptor substrate. In this work, diverse microorganisms capable of synthesizing DR5P were selected by screening several bacteria genera. In particular, Erwinia carotovora ATCC 33260 was identified as a new biocatalyst that afforded 14.1-mM DR5P starting from a cheap raw material like glucose.

  16. Metabolic response of Geobacter sulfurreducens towards electron donor/acceptor variation

    PubMed Central

    2010-01-01

    Background Geobacter sulfurreducens is capable of coupling the complete oxidation of organic compounds to iron reduction. The metabolic response of G. sulfurreducens towards variations in electron donors (acetate, hydrogen) and acceptors (Fe(III), fumarate) was investigated via 13C-based metabolic flux analysis. We examined the 13C-labeling patterns of proteinogenic amino acids obtained from G. sulfurreducens cultured with 13C-acetate. Results Using 13C-based metabolic flux analysis, we observed that donor and acceptor variations gave rise to differences in gluconeogenetic initiation, tricarboxylic acid cycle activity, and amino acid biosynthesis pathways. Culturing G. sulfurreducens cells with Fe(III) as the electron acceptor and acetate as the electron donor resulted in pyruvate as the primary carbon source for gluconeogenesis. When fumarate was provided as the electron acceptor and acetate as the electron donor, the flux analysis suggested that fumarate served as both an electron acceptor and, in conjunction with acetate, a carbon source. Growth on fumarate and acetate resulted in the initiation of gluconeogenesis by phosphoenolpyruvate carboxykinase and a slightly elevated flux through the oxidative tricarboxylic acid cycle as compared to growth with Fe(III) as the electron acceptor. In addition, the direction of net flux between acetyl-CoA and pyruvate was reversed during growth on fumarate relative to Fe(III), while growth in the presence of Fe(III) and acetate which provided hydrogen as an electron donor, resulted in decreased flux through the tricarboxylic acid cycle. Conclusions We gained detailed insight into the metabolism of G. sulfurreducens cells under various electron donor/acceptor conditions using 13C-based metabolic flux analysis. Our results can be used for the development of G. sulfurreducens as a chassis for a variety of applications including bioremediation and renewable biofuel production. PMID:21092215

  17. Last step in the conversion of trehalose to glycogen: a mycobacterial enzyme that transfers maltose from maltose 1-phosphate to glycogen.

    PubMed

    Elbein, Alan D; Pastuszak, Irena; Tackett, Alan J; Wilson, Tyler; Pan, Yuan T

    2010-03-26

    We show that Mycobacterium smegmatis has an enzyme catalyzing transfer of maltose from [(14)C]maltose 1-phosphate to glycogen. This enzyme was purified 90-fold from crude extracts and characterized. Maltose transfer required addition of an acceptor. Liver, oyster, or mycobacterial glycogens were the best acceptors, whereas amylopectin had good activity, but amylose was a poor acceptor. Maltosaccharides inhibited the transfer of maltose from [(14)C]maltose-1-P to glycogen because they were also acceptors of maltose, and they caused production of larger sized radioactive maltosaccharides. When maltotetraose was the acceptor, over 90% of the (14)C-labeled product was maltohexaose, and no radioactivity was in maltopentaose, demonstrating that maltose was transferred intact. Stoichiometry showed that 0.89 micromol of inorganic phosphate was produced for each micromole of maltose transferred to glycogen, and 56% of the added maltose-1-P was transferred to glycogen. This enzyme has been named alpha1,4-glucan:maltose-1-P maltosyltransferase (GMPMT). Transfer of maltose to glycogen was inhibited by micromolar amounts of inorganic phosphate or arsenate but was only slightly inhibited by millimolar concentrations of glucose-1-P, glucose-6-P, or inorganic pyrophosphate. GMPMT was compared with glycogen phosphorylase (GP). GMPMT catalyzed transfer of [(14)C]maltose-1-P, but not [(14)C]glucose-1-P, to glycogen, whereas GP transferred radioactivity from glucose-1-P but not maltose-1-P. GMPMT and GP were both inhibited by 1,4-dideoxy-1,4-imino-d-arabinitol, but only GP was inhibited by isofagomine. Because mycobacteria that contain trehalose synthase accumulate large amounts of glycogen when grown in high concentrations of trehalose, we propose that trehalose synthase, maltokinase, and GMPMT represent a new pathway of glycogen synthesis using trehalose as the source of glucose.

  18. Azide-alkyne "click" reaction performed on oligonucleotides with the universal nucleoside 7-octadiynyl-7-deaza-2'-deoxyinosine.

    PubMed

    Ming, Xin; Leonard, Peter; Heindl, Dieter; Seela, Frank

    2008-01-01

    Oligonucleotides containing 7-substituted 7-deaza-2'- deoxyinosine derivatives bearing alkynyl groups were prepared. The octa-1,7-diynyl derivative was functionalized with the non-fluorescent 3- azidocoumarin by the Huisgen-Sharpless-Meldal cycloaddition to afford a highly fluorescent oligonucleotide conjugate. The ambiguous base pairing character and the clickable side chain allows the incorporation of almost any reporter molecule to DNA.

  19. Oligonucleotides Containing Aminated 2'-Amino-LNA Nucleotides: Synthesis and Strong Binding to Complementary DNA and RNA.

    PubMed

    Lou, Chenguang; Samuelsen, Simone V; Christensen, Niels Johan; Vester, Birte; Wengel, Jesper

    2017-04-05

    Mono- and diaminated 2'-amino-LNA monomers were synthesized and introduced into oligonucleotides. Each modification imparts significant stabilization of nucleic acid duplexes and triplexes, excellent sequence selectivity, and significant nuclease resistance. Molecular modeling suggested that structural stabilization occurs via intrastrand electrostatic attraction between the protonated amino groups of the aminated 2'-amino-LNA monomers and the host oligonucleotide backbone.

  20. A reusable sensor for the label-free detection of specific oligonucleotides by surface plasmon fluorescence spectroscopy.

    PubMed

    Nöll, Gilbert; Su, Qiang; Heidel, Björn; Yu, Yaming

    2014-01-01

    The development of a reusable molecular beacon (MB)-based sensor for the label-free detection of specific oligonucleotides using surface plasmon fluorescence spectroscopy (SPFS) as the readout method is described. The MBs are chemisorbed at planar gold surfaces serving as fluorescence quenching units. Target oligonucleotides of 24 bases can be detected within a few minutes at high single-mismatch discrimination rates.

  1. 21 CFR 137.175 - Phosphated flour.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 2 2014-04-01 2014-04-01 false Phosphated flour. 137.175 Section 137.175 Food and... CONSUMPTION CEREAL FLOURS AND RELATED PRODUCTS Requirements for Specific Standardized Cereal Flours and Related Products § 137.175 Phosphated flour. Phosphated flour, phosphated white flour, and...

  2. 21 CFR 137.175 - Phosphated flour.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 2 2013-04-01 2013-04-01 false Phosphated flour. 137.175 Section 137.175 Food and... CONSUMPTION CEREAL FLOURS AND RELATED PRODUCTS Requirements for Specific Standardized Cereal Flours and Related Products § 137.175 Phosphated flour. Phosphated flour, phosphated white flour, and...

  3. 21 CFR 137.175 - Phosphated flour.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 2 2012-04-01 2012-04-01 false Phosphated flour. 137.175 Section 137.175 Food and... CONSUMPTION CEREAL FLOURS AND RELATED PRODUCTS Requirements for Specific Standardized Cereal Flours and Related Products § 137.175 Phosphated flour. Phosphated flour, phosphated white flour, and...

  4. Probing the Influence of Stereoelectronic Effects on the Biophysical Properties of Oligonucleotides: Comprehensive Analysis of the RNA Affinity, Nuclease Resistance, and Crystal Structure of Ten 2'-O-Ribonucleic Acid Modifications

    SciTech Connect

    Egli, Martin; Minasov, George; Tereshko, Valentina; Pallan, Pradeep S.; Teplova, Marianna; Inamati, Gopal B.; Lesnik, Elena A.; Owens, Steve R.; Ross, Bruce S.; Prakash, Thazha P.; Manoharan, Muthiah

    2010-03-05

    The syntheses of 10 new RNA 2'-O-modifications, their incorporation into oligonucleotides, and an evaluation of their properties such as RNA affinity and nuclease resistance relevant to antisense activity are presented. All modifications combined with the natural phosphate backbone lead to significant gains in terms of the stability of hybridization to RNA relative to the first-generation DNA phosphorothioates (PS-DNA). The nuclease resistance afforded in particular by the 2'-O-modifications carrying a positive charge surpasses that of PS-DNA. However, small electronegative 2'-O-substituents, while enhancing the RNA affinity, do not sufficiently protect against degradation by nucleases. Similarly, oligonucleotides containing 3'-terminal residues modified with the relatively large 2'-O-[2-(benzyloxy)ethyl] substituent are rapidly degraded by exonucleases, proving wrong the assumption that steric bulk will generally improve protection against nuclease digestion. To analyze the factors that contribute to the enhanced RNA affinity and nuclease resistance we determined crystal structures of self-complementary A-form DNA decamer duplexes containing single 2'-O-modified thymidines per strand. Conformational preorganization of substituents, favorable electrostatic interactions between substituent and sugar-phosphate backbone, and a stable water structure in the vicinity of the 2'-O-modification all appear to contribute to the improved RNA affinity. Close association of positively charged substituents and phosphate groups was observed in the structures with modifications that protect most effectively against nucleases. The promising properties exhibited by some of the analyzed 2'-O-modifications may warrant a more detailed evaluation of their potential for in vivo antisense applications. Chemical modification of RNA can also be expected to significantly improve the efficacy of small interfering RNAs (siRNA). Therefore, the 2'-O-modifications introduced here may benefit the

  5. Insights on the design and electron-acceptor properties of conjugated organophosphorus materials.

    PubMed

    Baumgartner, Thomas

    2014-05-20

    The development of conjugated organic materials has become a rapidly evolving field of research, particularly with a view toward practical applications in so-called organic electronics that encompass a variety of device types, such as OLEDs, OPVs, and OFETs. Almost all of these devices minimally require the presence of electron-donor and -acceptor components that act as p- and n-type semiconductors, respectively. Research over the past two decades has shown that while there is an abundant resource of organic p-type materials, suitable n-type species are few and far between. To overcome this severe bottleneck for the further development of organic electronics, researchers have identified organo-main-group avenues as valuable alternatives toward organic electron-acceptor materials that may ultimately be used as n-type components in practical devices. One particular element of interest in this context is phosphorus, which at first glance may not necessarily suggest such properties. In this Account, I provide detailed insights on the origin of the electron-acceptor properties of organophosphorus-based conjugated materials and include an overview of important molecular species that have been developed by my group and others. To this end, I explain that the electron-acceptor properties of conjugated organophosphorus materials originate from an interaction known as negative hyperconjugation. While this particular interaction creates a simply inductively withdrawing phosphoryl substituent for π-conjugated scaffolds, incorporation of a phosphorus atom as an integral part of a cyclic substructure within a π-conjugated system provides a much more complex, versatile, and consequently highly valuable tool for the tuning of the electron-acceptor properties of the materials. Notably, the degree of negative hyperconjugation can effectively be tailored in various ways via simple substitution at the phosphorus center. This is now well established for phosphole-based molecular

  6. Non-Fullerene Electron Acceptors for Use in Organic Solar Cells

    PubMed Central

    2015-01-01

    Conspectus The active layer in a solution processed organic photovoltaic device comprises a light absorbing electron donor semiconductor, typically a polymer, and an electron accepting fullerene acceptor. Although there has been huge effort targeted to optimize the absorbing, energetic, and transport properties of the donor material, fullerenes remain as the exclusive electron acceptor in all high performance devices. Very recently, some new non-fullerene acceptors have been demonstrated to outperform fullerenes in comparative devices. This Account describes this progress, discussing molecular design considerations and the structure–property relationships that are emerging. The motivation to replace fullerene acceptors stems from their synthetic inflexibility, leading to constraints in manipulating frontier energy levels, as well as poor absorption in the solar spectrum range, and an inherent tendency to undergo postfabrication crystallization, resulting in device instability. New acceptors have to address these limitations, providing tunable absorption with high extinction coefficients, thus contributing to device photocurrent. The ability to vary and optimize the lowest unoccupied molecular orbital (LUMO) energy level for a specific donor polymer is also an important requirement, ensuring minimal energy loss on electron transfer and as high an internal voltage as possible. Initially perylene diimide acceptors were evaluated as promising acceptor materials. These electron deficient aromatic molecules can exhibit good electron transport, facilitated by close packed herringbone crystal motifs, and their energy levels can be synthetically tuned. The principal drawback of this class of materials, their tendency to crystallize on too large a length scale for an optimal heterojunction nanostructure, has been shown to be overcome through introduction of conformation twisting through steric effects. This has been primarily achieved by coupling two units together

  7. Nature of the attractive interaction between proton acceptors and organic ring systems.

    PubMed

    Arras, Emmanuel; Seitsonen, Ari Paavo; Klappenberger, Florian; Barth, Johannes V

    2012-12-14

    Systematic ab initio calculations are combined with a deconvolution of electrostatic contributions to analyze the interplay between potential hydrogen bond acceptors and organic rings with C(sp(2))-H groups (benzene, pyridine and cyclopentadiene). A distinct anisotropic interaction between the ring systems and the electron lone pairs of cyanide, water and other acceptor species is revealed that favors the in-plane orientation of the proton acceptor group. In the attractive regime this interaction carries a pronounced electrostatic signature. By decomposing the electrostatic contribution into parts attributed to different subunits of the ring systems we demonstrate that a major proportion of the interaction energy gain is originating from the non-adjacent moieties, that are not in close contact with. This behavior holds equally for homocyclic, heterocyclic and non-aromatic rings but contrasts that of the ethyne molecule, taken as reference for a weak hydrogen bond donor clearly exhibiting the expected localized character. The ring interaction requires the presence of π-electron clouds and typically results in an interaction energy gain of 40 to 80 meV. Our findings suggest the proton acceptor-ring interaction as a new category of intermolecular non-covalent interactions.

  8. Catalytic reaction of cytokinin dehydrogenase: preference for quinones as electron acceptors.

    PubMed Central

    Frébortová, Jitka; Fraaije, Marco W; Galuszka, Petr; Sebela, Marek; Pec, Pavel; Hrbác, Jan; Novák, Ondrej; Bilyeu, Kristin D; English, James T; Frébort, Ivo

    2004-01-01

    The catalytic reaction of cytokinin oxidase/dehydrogenase (EC 1.5.99.12) was studied in detail using the recombinant flavoenzyme from maize. Determination of the redox potential of the covalently linked flavin cofactor revealed a relatively high potential dictating the type of electron acceptor that can be used by the enzyme. Using 2,6-dichlorophenol indophenol, 2,3-dimethoxy-5-methyl-1,4-benzoquinone or 1,4-naphthoquinone as electron acceptor, turnover rates with N6-(2-isopentenyl)adenine of approx. 150 s(-1) could be obtained. This suggests that the natural electron acceptor of the enzyme is quite probably a p-quinone or similar compound. By using the stopped-flow technique, it was found that the enzyme is rapidly reduced by N6-(2-isopentenyl)adenine (k(red)=950 s(-1)). Re-oxidation of the reduced enzyme by molecular oxygen is too slow to be of physiological relevance, confirming its classification as a dehydrogenase. Furthermore, it was established for the first time that the enzyme is capable of degrading aromatic cytokinins, although at low reaction rates. As a result, the enzyme displays a dual catalytic mode for oxidative degradation of cytokinins: a low-rate and low-substrate specificity reaction with oxygen as the electron acceptor, and high activity and strict specificity for isopentenyladenine and analogous cytokinins with some specific electron acceptors. PMID:14965342

  9. Metabolic response of Alicycliphilus denitrificans strain BC toward electron acceptor variation.

    PubMed

    Oosterkamp, Margreet J; Boeren, Sjef; Plugge, Caroline M; Schaap, Peter J; Stams, Alfons J M

    2013-10-01

    Alicycliphilus denitrificans is a versatile, ubiquitous, facultative anaerobic bacterium. Alicycliphilus denitrificans strain BC can use chlorate, nitrate, and oxygen as electron acceptor for growth. Cells display a prolonged lag-phase when transferred from nitrate to chlorate and vice versa. Furthermore, cells adapted to aerobic growth do not easily use nitrate or chlorate as electron acceptor. We further investigated these responses of strain BC by differential proteomics, transcript analysis, and enzyme activity assays. In nitrate-adapted cells transferred to chlorate and vice versa, appropriate electron acceptor reduction pathways need to be activated. In oxygen-adapted cells, adaptation to the use of chlorate or nitrate is likely difficult due to the poorly active nitrate reduction pathway and low active chlorate reduction pathway. We deduce that the Nar-type nitrate reductase of strain BC also reduces chlorate, which may result in toxic levels of chlorite if cells are transferred to chlorate. Furthermore, the activities of nitrate reductase and nitrite reductase appear to be not balanced when oxygen-adapted cells are shifted to nitrate as electron acceptor, leading to the production of a toxic amount of nitrite. These data suggest that strain BC encounters metabolic challenges in environments with fluctuations in the availability of electron acceptors. All MS data have been deposited in the ProteomeXchange with identifier PXD000258.

  10. Natural organic matter as electron acceptor: experimental evidence for its important role in anaerobic respiration

    NASA Astrophysics Data System (ADS)

    Lau, Maximilian Peter; Sander, Michael; Gelbrecht, Jörg; Hupfer, Michael

    2014-05-01

    Microbial respiration is a key driver of element cycling in oxic and anoxic environments. Upon depletion of oxygen as terminal electron acceptor (TEA), a number of anaerobic bacteria can employ alternative TEA for intracellular energy generation. Redox active quinone moieties in dissolved organic matter (DOM) are well known electron acceptors for microbial respiration. However, it remains unclear whether quinones in adsorbed and particulate OM accept electrons in a same way. In our studies we aim to understand the importance of natural organic matter (NOM) as electron acceptors for microbial energy gain and its possible implications for methanogenesis. Using a novel electrochemical approach, mediated electrochemical reduction and -oxidation, we can directly quantify reduced hydroquinone and oxidized quionone moieties in dissolved and particulate NOM samples. In a mesocosm experiment, we rewetted sediment and peat soil and followed electron transfer to the inorganic and organic electron acceptors over time. We found that inorganic and organic electron acceptor pools were depleted over the same timescales. More importantly, we showed that organic, NOM-associated electron accepting moieties represent as much as 21 40% of total TEA inventories. These findings support earlier studies that propose that the reduction of quinone moieties in particulate organic matter competitively suppresses methanogenesis in wetland soils. Our results indicate that electron transfer to organic, particulate TEA in inundated ecosystems has to be accounted for when establishing carbon budgets in and projecting greenhouse gas emissions from these systems.

  11. Origin of simultaneous donor-acceptor emission in single molecules of peryleneimide-terrylenediimide labeled polyphenylene dendrimers.

    PubMed

    Melnikov, Sergey M; Yeow, Edwin K L; Uji-i, Hiroshi; Cotlet, Mircea; Müllen, Klaus; De Schryver, Frans C; Enderlein, Jörg; Hofkens, Johan

    2007-02-01

    Förster type resonance energy transfer (FRET) in donor-acceptor peryleneimide-terrylenediimide dendrimers has been examined at the single molecule level. Very efficient energy transfer between the donor and the acceptor prevent the detection of donor emission before photobleaching of the acceptor. Indeed, in solution, on exciting the donor, only acceptor emission is detected. However, at the single molecule level, an important fraction of the investigated individual molecules (about 10-15%) show simultaneous emission from both donor and acceptor chromophores. The effect becomes apparent mostly after photobleaching of the majority of donors. Single molecule photon flux correlation measurements in combination with computer simulations and a variety of excitation conditions were used to determine the contribution of an exciton blockade to this two-color emission. Two-color defocused wide-field imaging showed that the two-color emission goes hand in hand with an unfavorable orientation between one of the donors and the acceptor chromophore.

  12. Effects of stray light on the fidelity of photodirected oligonucleotide array synthesis.

    PubMed

    Garland, Peter B; Serafinowski, Pawel J

    2002-10-01

    Fabrication of high density oligonucleotide arrays using metal on glass photolithographic masks is inflexible and expensive. Maskless methods using computer-controlled projection have been proposed and implemented, but associated stray light effects on photodirected oligonucleotide synthesis and their analysis have not been reported. We have developed a theoretical approach: it predicts that the stray light content of the output of digital micromirror devices and other spatial light modulators of similar performance (contrast ratio approximately 400) will cause extensive random base insertions. For example, use of a digital micromirror device for synthesis of a 20mer array will result in the majority of oligonucleotide chains being 21mers or 22mers. This chain lengthening effect of stray light would not be preventable when synthesis involves a directly photosensitive 5'-blocking group. If the 5'-blocking group is acid labile and released with photogenerated acid, the presence of low concentrations of weak base will prevent the effect of stray light. We have demonstrated experimentally the anticipated chain lengthening effect of stray light on photoacid-dependent synthesis of oligonucleotides and prevention of the effect by low concentrations of n-octylamine. The application of these findings should facilitate the development of maskless fabrication and availability of high density and high fidelity user-designed arrays for research applications.

  13. Development of a 37K high-density oligo-nucleotide microarray for rainbow trout

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We have constructed a rainbow trout high-density oligonucleotide microarray by using all the available tentative consensus (TC) sequences from the Rainbow Trout Gene Index database (The Computational Biology and Functional Genomics Lab., Dana Farber Cancer Institute and Harvard School of Public Heal...

  14. Identification of enterotoxigenic Escherichia coli isolates with enzyme-labeled synthetic oligonucleotide probes.

    PubMed Central

    Medon, P P; Lanser, J A; Monckton, P R; Li, P; Symons, R H

    1988-01-01

    Commercially available kits containing alkaline phosphatase-labeled oligonucleotide probes for Escherichia coli heat-stable enterotoxins (STI-H, STI-P, and STII) and the heat-labile enterotoxin were compared with bioassays and radiolabeled recombinant DNA probes to identify enterotoxigenic E. coli from 100 clinical isolates. There was very good agreement between the three methods. PMID:3053766

  15. Methods for the Preparation of Large Quantities of Complex Single-Stranded Oligonucleotide Libraries

    PubMed Central

    Murgha, Yusuf E.; Rouillard, Jean-Marie; Gulari, Erdogan

    2014-01-01

    Custom-defined oligonucleotide collections have a broad range of applications in fields of synthetic biology, targeted sequencing, and cytogenetics. Also, they are used to encode information for technologies like RNA interference, protein engineering and DNA-encoded libraries. High-throughput parallel DNA synthesis technologies developed for the manufacture of DNA microarrays can produce libraries of large numbers of different oligonucleotides, but in very limited amounts. Here, we compare three approaches to prepare large quantities of single-stranded oligonucleotide libraries derived from microarray synthesized collections. The first approach, alkaline melting of double-stranded PCR amplified libraries with a biotinylated strand captured on streptavidin coated magnetic beads results in little or no non-biotinylated ssDNA. The second method wherein the phosphorylated strand of PCR amplified libraries is nucleolyticaly hydrolyzed is recommended when small amounts of libraries are needed. The third method combining in vitro transcription of PCR amplified libraries to reverse transcription of the RNA product into single-stranded cDNA is our recommended method to produce large amounts of oligonucleotide libraries. Finally, we propose a method to remove any primer binding sequences introduced during library amplification. PMID:24733454

  16. Methods for the preparation of large quantities of complex single-stranded oligonucleotide libraries.

    PubMed

    Murgha, Yusuf E; Rouillard, Jean-Marie; Gulari, Erdogan

    2014-01-01

    Custom-defined oligonucleotide collections have a broad range of applications in fields of synthetic biology, targeted sequencing, and cytogenetics. Also, they are used to encode information for technologies like RNA interference, protein engineering and DNA-encoded libraries. High-throughput parallel DNA synthesis technologies developed for the manufacture of DNA microarrays can produce libraries of large numbers of different oligonucleotides, but in very limited amounts. Here, we compare three approaches to prepare large quantities of single-stranded oligonucleotide libraries derived from microarray synthesized collections. The first approach, alkaline melting of double-stranded PCR amplified libraries with a biotinylated strand captured on streptavidin coated magnetic beads results in little or no non-biotinylated ssDNA. The second method wherein the phosphorylated strand of PCR amplified libraries is nucleolyticaly hydrolyzed is recommended when small amounts of libraries are needed. The third method combining in vitro transcription of PCR amplified libraries to reverse transcription of the RNA product into single-stranded cDNA is our recommended method to produce large amounts of oligonucleotide libraries. Finally, we propose a method to remove any primer binding sequences introduced during library amplification.

  17. A triple-helix forming oligonucleotide targeting genomic DNA fails to induce mutation.

    PubMed

    Reshat, Reshat; Priestley, Catherine C; Gooderham, Nigel J

    2012-11-01

    Purine tracts in duplex DNA can bind oligonucleotide strands in a sequence specific manner to form triple-helix structures. Triple-helix forming oligonucleotides (TFOs) targeting supFG1 constructs have previously been shown to be mutagenic raising safety concerns for oligonucleotide-based pharmaceuticals. We have engineered a TFO, TFO27, to target the genomic Hypoxanthine-guanine phosphoribosyltransferase (HPRT) locus to define the mutagenic potential of such structures at genomic DNA. We report that TFO27 was resistant to nuclease degradation and readily binds to its target motif in a cell free system. Contrary to previous studies using the supFG1 reporter construct, TFO27 failed to induce mutation within the genomic HPRT locus. We suggest that it is possible that previous reports of triplex-mediated mutation using the supFG1 reporter construct could be confounded by DNA quadruplex formation. Although the present study indicates that a TFO targeting a genomic locus lacks mutagenic activity, it is unclear if this finding can be generalised to all TFOs and their targets. For the present, we suggest that it is prudent to avoid large purine stretches in oligonucleotide pharmaceutical design to minimise concern regarding off-target genotoxicity.

  18. Tetrahedron-structured DNA and functional oligonucleotide for construction of an electrochemical DNA-based biosensor.

    PubMed

    Bu, Nan-Nan; Tang, Chun-Xia; He, Xi-Wen; Yin, Xue-Bo

    2011-07-21

    Tetrahedron-structured DNA (ts-DNA) in combination with a functionalized oligonucleotide was used to develop a "turn-on" biosensor for Hg(2+) ions. The ts-DNA provided an improved sensitivity and was used to block the active sites.

  19. An oral oligonucleotide delivery system based on a thiolated polymer: Development and in vitro evaluation.

    PubMed

    Martien, Ronny; Hoyer, Herbert; Perera, Glen; Schnürch, Andreas Bernkop

    2011-08-01

    The purpose of this study was to develop and evaluate an oral oligonucleotide delivery system based on a thiolated polymer/reduced glutathione (GSH) system providing a protective effect toward nucleases and permeation enhancement. A polycarbophil-cysteine conjugate (PCP-Cys) was synthesized. Enzymatic degradation of a model oligonucleotide by DNase I and within freshly collected intestinal fluid was investigated in the absence and presence of PCP-Cys. Permeation studies with PCP-Cys/GSH versus control were performed in vitro on Caco-2 cell monolayers and ex vivo on rat intestinal mucosa. PCP-Cys displayed 223 ± 13.8 μmol thiol groups per gram polymer. After 4h, 61% of the free oligonucleotides were degraded by DNase I and 80% within intestinal fluid. In contrast, less than 41% (DNase I) and 60% (intestinal fluid) were degraded in the presence of 0.02% (m/v) PCP-Cys. Permeation studies revealed an 8-fold (Caco-2) and 10-fold (intestinal mucosa) increase in apparent permeability compared to buffer control. Hence, this PCP-Cys/GSH system might be a promising tool for the oral administration of oligonucleotides as it allows a significant protection toward degrading enzymes and facilitates their transport across intestinal membranes.

  20. Drug evaluation: ISIS-301012, an antisense oligonucleotide for the treatment of hypercholesterolemia.

    PubMed

    Burnett, John R

    2006-10-01

    ISIS-301012 is an antisense oligonucleotide inhibitor of apolipoprotein B-100, which is being developed by Isis Pharmaceuticals Inc for the potential treatment of hypercholesterolemia. A subcutaneous injectable formulation is currently undergoing phase 11 clinical trials, while phase I trials are underway with an oral formulation of the drug.

  1. Investigating Synthetic Oligonucleotide Targeting of Mir31 in Duchenne Muscular Dystrophy

    PubMed Central

    Hildyard, John CW; Wells, Dominic J

    2016-01-01

    Exon-skipping via synthetic antisense oligonucleotides represents one of the most promising potential therapies for Duchenne muscular dystrophy (DMD), yet this approach is highly sequence-specific and thus each oligonucleotide is of benefit to only a subset of patients. The discovery that dystrophin mRNA is subject to translational suppression by the microRNA miR31, and that miR31 is elevated in the muscle of DMD patients, raises the possibility that the same oligonucleotide chemistries employed for exon skipping could be directed toward relieving this translational block. This approach would act synergistically with exon skipping where possible, but by targeting the 3’UTR it would further be of benefit to the many DMD patients who express low levels of in-frame transcript. We here present investigations into the feasibility of combining exon skipping with several different strategies for miR31-modulation, using both in vitro models and the mdx mouse (the classical animal model of DMD), and monitoring effects on dystrophin at the transcriptional and translational level. We show that despite promising results from our cell culture model, our in vivo data failed to demonstrate similarly reproducible enhancement of dystrophin translation, suggesting that miR31-modulation may not be practical under current oligonucleotide approaches. Possible explanations for this disappointing outcome are discussed, along with suggestions for future investigations. PMID:27525173

  2. A facile inhibitor screening of SARS coronavirus N protein using nanoparticle-based RNA oligonucleotide.

    PubMed

    Roh, Changhyun

    2012-01-01

    Hundreds of million people worldwide have been infected with severe acute respiratory syndrome (SARS), and the rate of global death from SARS has remarkably increased. Hence, the development of efficient drug treatments for the biological effects of SARS is highly needed. We have previously shown that quantum dots (QDs)-conjugated RNA oligonucleotide is sensitive to the specific recognition of the SARS-associated coronavirus (SARS-CoV) nucleocapsid (N) protein. In this study, we found that a designed biochip could analyze inhibitors of the SARS-CoV N protein using nanoparticle-based RNA oligonucleotide. Among the polyphenolic compounds examined, (-)-catechin gallate and (-)-gallocatechin gallate demonstrated a remarkable inhibition activity on SARS-CoV N protein. (-)-catechin gallate and (-)-gallocatechin gallate attenuated the binding affinity in a concentrated manner as evidenced by QDs-conjugated RNA oligonucleotide on a designed biochip. At a concentration of 0.05 μg mL(-1), (-)-catechin gallate and (-)-gallocatechin gallate showed more than 40% inhibition activity on a nanoparticle-based RNA oligonucleotide biochip system.

  3. Cellular Internalization of Therapeutic Oligonucleotides by Peptide Amphiphile Nanofibers and Nanospheres.

    PubMed

    Mumcuoglu, Didem; Sardan Ekiz, Melis; Gunay, Gokhan; Tekinay, Turgay; Tekinay, Ayse B; Guler, Mustafa O

    2016-05-11

    Oligonucleotides are promising drug candidates due to the exceptionally high specificity they exhibit toward their target DNA and RNA sequences. However, their poor pharmacokinetic and pharmacodynamic properties, in conjunction with problems associated with their internalization by cells, necessitates their delivery through specialized carrier systems for efficient therapy. Here, we investigate the effects of carrier morphology on the cellular internalization mechanisms of oligonucleotides by using self-assembled fibrous or spherical peptide nanostructures. Size and geometry were both found to be important parameters for the oligonucleotide internalization process; direct penetration was determined to be the major mechanism for the internalization of nanosphere carriers, whereas nanofibers were internalized by clathrin- and dynamin-dependent endocytosis pathways. We further showed that glucose conjugation to carrier nanosystems improved cellular internalization in cancer cells due to the enhanced glucose metabolism associated with oncogenesis, and the internalization of the glucose-conjugated peptide/oligonucleotide complexes was found to be dependent on glucose transporters present on the surface of the cell membrane.

  4. Chimeric RNase H-competent oligonucleotides directed to the HIV-1 Rev response element.

    PubMed

    Prater, Chrissy E; Saleh, Anthony D; Wear, Maggie P; Miller, Paul S

    2007-08-15

    Chimeric oligo-2'-O-methylribonucleotides containing centrally located patches of contiguous 2'-deoxyribonucleotides and terminating in a nuclease resistant 3'-methylphosphonate internucleotide linkage were prepared. The oligonucleotides were targeted to the 3'-side of HIV Rev response element (RRE) stem-loop IIB RNA, which is adjacent to the high affinity Rev protein binding site and is critical to virus function. Thermal denaturation experiments showed that chimeric oligonucleotides form very stable duplexes with a complementary single-stranded RNA, and gel electrophoretic mobility shift assays (EMSA) showed that they bind with high affinity and specificity to RRE stem-loop II RNA (K(D) approximately 200 nM). The chimeric oligonucleotides promote RNase H-mediated hydrolysis of RRE stem-loop II RNA and have half-lives exceeding 24h when incubated in cell culture medium containing 10% fetal calf serum. One of the chimeric oligonucleotides inhibited RRE mediated expression of chloramphenicol acetyl transferase (CAT) approximately 60% at a concentration of 300 nM in HEK 293T cells co-transfected with p-RRE/CAT and p-Rev mammalian expression vectors.

  5. Base-Pairing Systems Related to TNA: alpha-Threofuranosyl Oligonucleotides Containing Phosphoramidate Linkages

    NASA Technical Reports Server (NTRS)

    Meyer, Michael (Technical Monitor); Wu, Xiaolin; Guntha, Sreenivasulu; Ferenclc, Mathias; Krishnamurthy, Ramanarayanan; Eschenmoser, Albert

    2002-01-01

    (3'NH)- and (2'NH)-TNA, two isomeric phosphoramidate analogues of TNA (alpha-threofuranosyl-(3'-2') oligonucleotides), are shown to be efficient Watson-Crick base-pairing systems and to undergo intersystem crosspairing with TNA, RNA, and DNA.

  6. Comparison of small molecules and oligonucleotides that target a toxic, non-coding RNA.

    PubMed

    Costales, Matthew G; Rzuczek, Suzanne G; Disney, Matthew D

    2016-06-01

    Potential RNA targets for chemical probes and therapeutic modalities are pervasive in the transcriptome. Oligonucleotide-based therapeutics are commonly used to target RNA sequence. Small molecules are emerging as a modality to target RNA structures selectively, but their development is still in its infancy. In this work, we compare the activity of oligonucleotides and several classes of small molecules that target the non-coding r(CCUG) repeat expansion (r(CCUG)(exp)) that causes myotonic dystrophy type 2 (DM2), an incurable disease that is the second-most common cause of adult onset muscular dystrophy. Small molecule types investigated include monomers, dimers, and multivalent compounds synthesized on-site by using RNA-templated click chemistry. Oligonucleotides investigated include phosphorothioates that cleave their target and vivo-morpholinos that modulate target RNA activity via binding. We show that compounds assembled on-site that recognize structure have the highest potencies amongst small molecules and are similar in potency to a vivo-morpholino modified oligonucleotide that targets sequence. These studies are likely to impact the design of therapeutic modalities targeting other repeats expansions that cause fragile X syndrome and amyotrophic lateral sclerosis, for example.

  7. Discrimination of base differences in oligonucleotides using mid-infrared spectroscopy and multivariate analysis.

    PubMed

    Kelly, Jemma G; Martin-Hirsch, Pierre L; Martin, Francis L

    2009-07-01

    Attenuated total reflection Fourier transform-infrared (ATR-FTIR) spectroscopy was employed to interrogate a panel of simple oligonucleotides designed to contain various base differences; combined with subsequent multivariate analysis, we set out to determine whether the specificity of this approach would point to a novel means for mutation detection. Oligonucleotides were designed that were 15 bases in length and contained various combinations of purines (adenine, guanine) or pyrimidines (cytosine, thymine). These were applied to 1 cm x 1 cm low-E reflective glass slides, and triplicate samples were interrogated using ATR-FTIR spectroscopy. Per oligonucleotide sample, 10 independent spectral acquisitions were obtained. Prior to multivariate analysis, infrared spectra were baseline-corrected and vector normalized over the 1750-760 cm(-1) region specific to the chemical bonds of organic molecules. Spectral categories were then analyzed using principal component analysis (PCA) followed by linear discriminant analysis (LDA). Scores plots revealed that PCA-LDA clearly segregated different oligonucleotide sequences, even in the presence of a single base difference. Loadings plots confirmed the chemical entities associated with distinguishing base differences. These results suggest that mid-IR spectroscopy might have future roles in interrogating polymorphic forms of a DNA template.

  8. Proficiency of acceptor-donor-acceptor organic dye with spiro-MeOTAD HTM on the photovoltaic performance of dye sensitized solar cell

    NASA Astrophysics Data System (ADS)

    Ramavenkateswari, K.; Venkatachalam, P.

    2016-09-01

    This work investigates the proficiency of acceptor-donor-acceptor (A-D-A) organic dye Diisopropyl azodicarboxylate (DIAC) as photosensitizer on the photovoltaic parameters of silver (Ag) doped TiO2 photoanode dye-sensitized solar cells (DSSCs) with quasi-solid state electrolyte/hole transport material (HTM) spiro-MeOTAD. TNSs (TiO2 nanosticks) photoanodes are prepared through sol-gel method and hydrothermal technique. X-ray powder diffraction (XRD), transmission electron microscope (TEM), scanning electron microscopy (SEM) and BET measurement were used to characterize the structure and morphology of TiO2 nanostructures. The Diisopropyl azodicarboxylate organic dye with TNPs-Ag@TNSs composite photoanode structure and spiro-MeOTAD HTM exhibited better power conversion efficiency (PCE).

  9. FRET study in oligopeptide-linked donor-acceptor system in PVA matrix

    NASA Astrophysics Data System (ADS)

    Shah, Sunil; Mandecki, Wlodek; Li, Ji; Gryczynski, Zygmunt; Borejdo, Julian; Gryczynski, Ignacy; Fudala, Rafal

    2016-12-01

    An oligopeptide: Lys-Gly-Pro-Arg-Ser-Leu-Ser-Gly-Lys-NH2, cleaved specifically by a matrix metalloproteinase 9 (MMP-9) at the Ser-Leu bond, was labeled on the ɛ-NH2 groups of lysine with donor (5, 6 TAMRA) and acceptor (HiLyte647) dye. The donor control was a peptide labeled with 5, 6 TAMRA only on the C-terminal lysine, and the acceptor control was free HiLyte647. Following three products were studied by dissolving in 10% (w/w) poly(vinyl alcohol) and dried on glass slides forming 200 micron films. Absorption spectra of the films show full additivity of donor and acceptor absorptions. A strong Fluorescence Resonance Energy Transfer (FRET) with an efficiency of about 85% was observed in the fluorescence emission and excitation spectra. The lifetime of the donor was shorter and heterogeneous compared with the donor control.

  10. Ultrafast Non-Förster Intramolecular Donor-Acceptor Excitation Energy Transfer.

    PubMed

    Athanasopoulos, Stavros; Alfonso Hernandez, Laura; Beljonne, David; Fernandez-Alberti, Sebastian; Tretiak, Sergei

    2017-04-06

    Ultrafast intramolecular electronic energy transfer in a conjugated donor-acceptor system is simulated using nonadiabatic excited-state molecular dynamics. After initial site-selective photoexcitation of the donor, transition density localization is monitored throughout the S2 → S1 internal conversion process, revealing an efficient unidirectional donor → acceptor energy-transfer process. Detailed analysis of the excited-state trajectories uncovers several salient features of the energy-transfer dynamics. While a weak temperature dependence is observed during the entire electronic energy relaxation, an ultrafast initially temperature-independent process allows the molecular system to approach the S2-S1 potential energy crossing seam within the first ten femtoseconds. Efficient energy transfer occurs in the absence of spectral overlap between the donor and acceptor units and is assisted by a transient delocalization phenomenon of the excited-state wave function acquiring Frenkel-exciton character at the moment of quantum transition.

  11. Molecular nitrogen acceptors in ZnO nanowires induced by nitrogen plasma annealing

    NASA Astrophysics Data System (ADS)

    Ton-That, C.; Zhu, L.; Lockrey, M. N.; Phillips, M. R.; Cowie, B. C. C.; Tadich, A.; Thomsen, L.; Khachadorian, S.; Schlichting, S.; Jankowski, N.; Hoffmann, A.

    2015-07-01

    X-ray absorption near-edge spectroscopy, photoluminescence, cathodoluminescence, and Raman spectroscopy have been used to investigate the chemical states of nitrogen dopants in ZnO nanowires. It is found that nitrogen exists in multiple states: NO,NZn, and loosely bound N2 molecule. The results establish a direct link between a donor-acceptor pair emission at 3.232 eV and the concentration of loosely bound N2. This work confirms that N2 at Zn site is a potential candidate for producing a shallow acceptor state in N-doped ZnO as theoretically predicted by Lambrecht and Boonchun [Phys. Rev. B 87, 195207 (2013), 10.1103/PhysRevB.87.195207]. Additionally, shallow acceptor states arising from NO complexes have been ruled out in this paper.

  12. Spectroscopic studies of charge transfer complexes between colchicine and some π acceptors

    NASA Astrophysics Data System (ADS)

    Arslan, Mustafa; Duymus, Hulya

    2007-07-01

    Charge transfer complexes between colchicine as donor and π acceptors such as tetracyanoethylene (TCNE), 2,3-dichloro-5,6-dicyano- p-benzoquinone (DDQ), p-chloranil ( p-CHL) have been studied spectrophotometrically in dichloromethane at 21 °C. The stoichiometry of the complexes was found to be 1:1 ratio by the Job method between donor and acceptors with the maximum absorption band at a wavelength of 535, 585 and 515 nm. The equilibrium constant and thermodynamic parameters of the complexes were determined by Benesi-Hildebrand and van't Hoff equations. Colchicine in pure form and in dosage form was applied in this study. The formation constants for the complexes were shown to be dependent on the structure of the electron acceptors used.

  13. Growth of Strain SES-3 with Arsenate and Other Diverse Electron Acceptors

    PubMed Central

    Laverman, A. M.; Blum, J. S.; Schaefer, J. K.; Phillips, E.; Lovley, D. R.; Oremland, R. S.

    1995-01-01

    The selenate-respiring bacterial strain SES-3 was able to use a variety of inorganic electron acceptors to sustain growth. SES-3 grew with the reduction of arsenate to arsenite, Fe(III) to Fe(II), or thiosulfate to sulfide. It also grew in medium in which elemental sulfur, Mn(IV), nitrite, trimethylamine N-oxide, or fumarate was provided as an electron acceptor. Growth on oxygen was microaerophilic. There was no growth with arsenite or chromate. Washed suspensions of cells grown on selenate or nitrate had a constitutive ability to reduce arsenate but were unable to reduce arsenite. These results suggest that strain SES-3 may occupy a niche as an environmental opportunist by being able to take advantage of a diversity of electron acceptors. PMID:16535143

  14. Fraction of electrons consumed in electron acceptor reduction and hydrogen thresholds as indicators of halorespiratory physiology

    SciTech Connect

    Loeffler, F.E.; Tiedje, J.M.; Sanford, R.A.

    1999-09-01

    Measurements of the hydrogen consumption threshold and the tracking of electrons transferred to the chlorinated electron acceptor (f{sub e}) reliably detected chlororespiratory physiology in both mixed cultures and pure cultures capable of using tetrachloroethene, cis-1,2-dichloroethene, vinyl chloride, 2-chlorophenol, 3-chlorobenzoate, 3-chloro-4-hydroxybenzoate, or 1,2-dichloropropane as an electron acceptor. Hydrogen was consumed to significantly lower threshold concentrations of less than 0.4 ppmv compared with the values obtained for the same cultures without a chlorinated compound as an electron acceptor. The f{sub e} values ranged from 0.63 to 0.7, values which are in good agreement with theoretical calculations based on the thermodynamics of reductive dechlorination as the terminal electron-accepting process. In contrast, a mixed methanogenic culture that cometabolized 3-chlorophenol exhibited a significantly lower f{sub e} value, 0.012.

  15. Geometry for the Primary Electron Donor and the Bacteriopheophytin Acceptor in Rhodopseudomonas viridis Photosynthetic Reaction Centers

    PubMed Central

    Tiede, D. M.; Choquet, Y.; Breton, J.

    1985-01-01

    The tetrapyrrole electron donors and acceptors (bacteriochlorophyll, BCh; bacteriopheophytin, BPh) within the bacterial photosynthetic reaction center (RC) are arranged with a specific geometry that permits rapid (picosecond time scale) electron tunneling to occur between them. Here we have measured the angle between the molecular planes of the bacteriochlorophyll dimer (primary donor), B2, and the acceptor bacteriopheophytin, H, by analyzing the dichroism of the absorption change associated with H reduction, formed by photoselection with RCs of Rhodopseudomonas viridis. This angle between molecular planes is found to be 60° ± 2. This means that the ultrafast electron tunneling must occur between donors and acceptors that are fixed by the protein to have a noncoplanar alignment. Nearly perpendicular alignments have been determined for other electron tunneling complexes involving RCs. These geometries can be contrasted with models proposed for heme-heme electron transfer complexes, which have emphasized that mutually parallel orientations should permit the most kinetically facile transfers. PMID:19431588

  16. Förster Resonance Energy Transfer between Quantum Dot Donors and Quantum Dot Acceptors.

    PubMed

    Chou, Kenny F; Dennis, Allison M

    2015-06-05

    Förster (or fluorescence) resonance energy transfer amongst semiconductor quantum dots (QDs) is reviewed, with particular interest in biosensing applications. The unique optical properties of QDs provide certain advantages and also specific challenges with regards to sensor design, compared to other FRET systems. The brightness and photostability of QDs make them attractive for highly sensitive sensing and long-term, repetitive imaging applications, respectively, but the overlapping donor and acceptor excitation signals that arise when QDs serve as both the donor and acceptor lead to high background signals from direct excitation of the acceptor. The fundamentals of FRET within a nominally homogeneous QD population as well as energy transfer between two distinct colors of QDs are discussed. Examples of successful sensors are highlighted, as is cascading FRET, which can be used for solar harvesting.

  17. Effect of cathode electron acceptors on simultaneous anaerobic sulfide and nitrate removal in microbial fuel cell.

    PubMed

    Cai, Jing; Zheng, Ping; Mahmood, Qaisar

    2016-01-01

    The current investigation reports the effect of cathode electron acceptors on simultaneous sulfide and nitrate removal in two-chamber microbial fuel cells (MFCs). Potassium permanganate and potassium ferricyanide were common cathode electron acceptors and evaluated for substrate removal and electricity generation. The abiotic MFCs produced electricity through spontaneous electrochemical oxidation of sulfide. In comparison with abiotic MFC, the biotic MFC showed better ability for simultaneous nitrate and sulfide removal along with electricity generation. Keeping external resistance of 1,000 Ω, both MFCs showed good capacities for substrate removal where nitrogen and sulfate were the main end products. The steady voltage with potassium permanganate electrodes was nearly twice that of with potassium ferricyanide. Cyclic voltammetry curves confirmed that the potassium permanganate had higher catalytic activity than potassium ferricyanide. The potassium permanganate may be a suitable choice as cathode electron acceptor for enhanced electricity generation during simultaneous treatment of sulfide and nitrate in MFCs.

  18. Rapid Energy Transfer Enabling Control of Emission Polarization in Perylene Bisimide Donor-Acceptor Triads.

    PubMed

    Menelaou, Christopher; ter Schiphorst, Jeroen; Kendhale, Amol M; Parkinson, Patrick; Debije, Michael G; Schenning, Albertus P H J; Herz, Laura M

    2015-04-02

    Materials showing rapid intramolecular energy transfer and polarization switching are of interest for both their fundamental photophysics and potential for use in real-world applications. Here, we report two donor-acceptor-donor triad dyes based on perylene-bisimide subunits, with the long axis of the donors arranged either parallel or perpendicular to that of the central acceptor. We observe rapid energy transfer (<2 ps) and effective polarization control in both dye molecules in solution. A distributed-dipole Förster model predicts the excitation energy transfer rate for the linearly arranged triad but severely underestimates it for the orthogonal case. We show that the rapid energy transfer arises from a combination of through-bond coupling and through-space transfer between donor and acceptor units. As they allow energy cascading to an excited state with controllable polarization, these triad dyes show high potential for use in luminescent solar concentrator devices.

  19. Förster Resonance Energy Transfer between Quantum Dot Donors and Quantum Dot Acceptors

    PubMed Central

    Chou, Kenny F.; Dennis, Allison M.

    2015-01-01

    Förster (or fluorescence) resonance energy transfer amongst semiconductor quantum dots (QDs) is reviewed, with particular interest in biosensing applications. The unique optical properties of QDs provide certain advantages and also specific challenges with regards to sensor design, compared to other FRET systems. The brightness and photostability of QDs make them attractive for highly sensitive sensing and long-term, repetitive imaging applications, respectively, but the overlapping donor and acceptor excitation signals that arise when QDs serve as both the donor and acceptor lead to high background signals from direct excitation of the acceptor. The fundamentals of FRET within a nominally homogeneous QD population as well as energy transfer between two distinct colors of QDs are discussed. Examples of successful sensors are highlighted, as is cascading FRET, which can be used for solar harvesting. PMID:26057041

  20. Identification of a Deep Acceptor Level in ZnO Due to Silver Doping

    NASA Astrophysics Data System (ADS)

    Chai, J.; Mendelsberg, R. J.; Reeves, R. J.; Kennedy, J.; von Wenckstern, H.; Schmidt, M.; Grundmann, M.; Doyle, K.; Myers, T. H.; Durbin, S. M.

    2010-05-01

    There remains considerable interest in the behavior of acceptors in ZnO, the ultimate goal being the realization of device grade p-type material. Silver is a candidate acceptor, and, in this study, in situ doping of silver was performed during plasma-assisted molecular beam epitaxy. Silver concentrations, as determined by ion beam analysis, ranged between 1018 cm-3and 1020 cm-3, with as much as 94% incorporated substitutionally on Zn lattice sites. Variable magnetic field Hall effect measurements detected no evidence of holes, and 4 K photoluminescence was dominated by donor bound excitons. Transient capacitance measurements, however, suggested that incorporated silver had led to the formation of an acceptor, located approximately 320 meV above the valence band edge, indicating that compensation remains a significant issue in determining the conductivity of ZnO.