Sample records for oligonucleotide probe complementary

  1. Advanced surface-enhanced Raman gene probe systems and methods thereof

    DOEpatents

    Vo-Dinh, Tuan

    2001-01-01

    The subject invention is a series of methods and systems for using the Surface-Enhanced Raman (SER)-labeled Gene Probe for hybridization, detection and identification of SER-labeled hybridized target oligonucleotide material comprising the steps of immobilizing SER-labeled hybridized target oligonucleotide material on a support means, wherein the SER-labeled hybridized target oligonucleotide material comprise a SER label attached either to a target oligonucleotide of unknown sequence or to a gene probe of known sequence complementary to the target oligonucleotide sequence, the SER label is unique for the target oligonucleotide strands of a particular sequence wherein the SER-labeled oligonucleotide is hybridized to its complementary oligonucleotide strand, then the support means having the SER-labeled hybridized target oligonucleotide material adsorbed thereon is SERS activated with a SERS activating means, then the support means is analyzed.

  2. The illusion of specific capture: surface and solution studies of suboptimal oligonucleotide hybridization

    PubMed Central

    2013-01-01

    Background Hybridization based assays and capture systems depend on the specificity of hybridization between a probe and its intended target. A common guideline in the construction of DNA microarrays, for instance, is that avoiding complementary stretches of more than 15 nucleic acids in a 50 or 60-mer probe will eliminate sequence specific cross-hybridization reactions. Here we present a study of the behavior of partially matched oligonucleotide pairs with complementary stretches starting well below this threshold complementarity length – in silico, in solution, and at the microarray surface. The modeled behavior of pairs of oligonucleotide probes and their targets suggests that even a complementary stretch of sequence 12 nt in length would give rise to specific cross-hybridization. We designed a set of binding partners to a 50-mer oligonucleotide containing complementary stretches from 6 nt to 21 nt in length. Results Solution melting experiments demonstrate that stable partial duplexes can form when only 12 bp of complementary sequence are present; surface hybridization experiments confirm that a signal close in magnitude to full-strength signal can be obtained from hybridization of a 12 bp duplex within a 50mer oligonucleotide. Conclusions Microarray and other molecular capture strategies that rely on a 15 nt lower complementarity bound for eliminating specific cross-hybridization may not be sufficiently conservative. PMID:23445545

  3. Arrays of nucleic acid probes on biological chips

    DOEpatents

    Chee, Mark; Cronin, Maureen T.; Fodor, Stephen P. A.; Huang, Xiaohua X.; Hubbell, Earl A.; Lipshutz, Robert J.; Lobban, Peter E.; Morris, MacDonald S.; Sheldon, Edward L.

    1998-11-17

    DNA chips containing arrays of oligonucleotide probes can be used to determine whether a target nucleic acid has a nucleotide sequence identical to or different from a specific reference sequence. The array of probes comprises probes exactly complementary to the reference sequence, as well as probes that differ by one or more bases from the exactly complementary probes.

  4. Specific DNA duplex formation at an artificial lipid bilayer: towards a new DNA biosensor technology.

    PubMed

    Werz, Emma; Korneev, Sergei; Montilla-Martinez, Malayko; Wagner, Richard; Hemmler, Roland; Walter, Claudius; Eisfeld, Jörg; Gall, Karsten; Rosemeyer, Helmut

    2012-02-01

    A novel technique is described which comprises a base-specific DNA duplex formation at a lipid bilayer-H(2) O-phase boundary layer. Two different probes of oligonucleotides both carrying a double-tailed lipid at the 5'-terminus were incorporated into stable artificial lipid bilayers separating two compartments (cis/trans-channel) of an optically transparent microfluidic sample carrier with perfusion capabilities. Both the cis- and trans-channels are filled with saline buffer. Injection of a cyanine-5-labeled target DNA sequence, which is complementary to only one of the oligonucleotide probes, into the cis-channel, followed by a thorough perfusion, leads to an immobilization of the labeled complementary oligonucleotide on the membrane as detected by single-molecule fluorescence spectroscopy and microscopy. In the case of fluorescent but non-complementary DNA sequences, no immobilized fluorescent oligonucleotide duplex could be detected on the membrane. This clearly verifies a specific duplex formation at the membrane interface. Copyright © 2012 Verlag Helvetica Chimica Acta AG, Zürich.

  5. Capillary electrophoresis, a method for the determination of nucleic acid ligands covalently attached to quantum dots representing a donor of Förster resonance energy transfer.

    PubMed

    Datinská, Vladimíra; Klepárník, Karel; Belšánová, Barbora; Minárik, Marek; Foret, František

    2018-05-09

    The synthesis and determination of the structure of a Förster resonance energy transfer probe intended for the detection of specific nucleic acid sequences are described here. The probe is based on the hybridization of oligonucleotide modified quantum dots with a fluorescently labeled nucleic acid sample resulting in changes of the fluorescence emission due to the energy transfer effect. The stoichiometry distribution of oligonucleotides conjugated to quantum dots was determined by capillary electrophoresis separation. The results indicate that one to four molecules of oligonucleotide are conjugated to the surface of a single nanoparticle. This conclusion is confirmed by the course of the dependence of Förster resonance energy transfer efficiency on the concentration of fluorescently labeled complementary single-stranded nucleic acid, showing saturation. While the energy transfer efficiency of the probe hybridized with complementary nucleic acid strands was 30%, negligible efficiency was observed with a non-complementary strands. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  6. Use of synthetic oligonucleotide DNA probes for the identification of Bacteroides gingivalis.

    PubMed Central

    Moncla, B J; Braham, P; Dix, K; Watanabe, S; Schwartz, D

    1990-01-01

    Six different oligonucleotide probes complementary to the hypervariable regions of 16S rRNA of Bacteroides gingivalis were tested for specificity and sensitivity against 77 field strains of B. gingivalis and 105 strains of 12 other Bacteroides species. The data demonstrated that these probes were very specific (range, 0.85 to 1.00) and sensitive (1.00). Some limited cross-reactions with other Bacteroides species were observed. Four of these probes should be useful for rapid detection and identification of B. gingivalis. Images PMID:1690217

  7. A Single Molecular Beacon Probe Is Sufficient for the Analysis of Multiple Nucleic Acid Sequences

    PubMed Central

    Gerasimova, Yulia V.; Hayson, Aaron; Ballantyne, Jack; Kolpashchikov, Dmitry M.

    2010-01-01

    Molecular beacon (MB) probes are dual-labeled hairpin-shaped oligodeoxyribonucleotides that are extensively used for real-time detection of specific RNA/DNA analytes. In the MB probe, the loop fragment is complementary to the analyte: therefore, a unique probe is required for the analysis of each new analyte sequence. The conjugation of an oligonucleotide with two dyes and subsequent purification procedures add to the cost of MB probes, thus reducing their application in multiplex formats. Here we demonstrate how one MB probe can be used for the analysis of an arbitrary nucleic acid. The approach takes advantage of two oligonucleotide adaptor strands, each of which contains a fragment complementary to the analyte and a fragment complementary to an MB probe. The presence of the analyte leads to association of MB probe and the two DNA strands in quadripartite complex. The MB probe fluorescently reports the formation of this complex. In this design, the MB does not bind the analyte directly; therefore, the MB sequence is independent of the analyte. In this study one universal MB probe was used to genotype three human polymorphic sites. This approach promises to reduce the cost of multiplex real-time assays and improve the accuracy of single-nucleotide polymorphism genotyping. PMID:20665615

  8. Array of nucleic acid probes on biological chips for diagnosis of HIV and methods of using the same

    DOEpatents

    Chee, Mark; Gingeras, Thomas R.; Fodor, Stephen P. A.; Hubble, Earl A.; Morris, MacDonald S.

    1999-01-19

    The invention provides an array of oligonucleotide probes immobilized on a solid support for analysis of a target sequence from a human immunodeficiency virus. The array comprises at least four sets of oligonucleotide probes 9 to 21 nucleotides in length. A first probe set has a probe corresponding to each nucleotide in a reference sequence from a human immunodeficiency virus. A probe is related to its corresponding nucleotide by being exactly complementary to a subsequence of the reference sequence that includes the corresponding nucleotide. Thus, each probe has a position, designated an interrogation position, that is occupied by a complementary nucleotide to the corresponding nucleotide. The three additional probe sets each have a corresponding probe for each probe in the first probe set. Thus, for each nucleotide in the reference sequence, there are four corresponding probes, one from each of the probe sets. The three corresponding probes in the three additional probe sets are identical to the corresponding probe from the first probe or a subsequence thereof that includes the interrogation position, except that the interrogation position is occupied by a different nucleotide in each of the four corresponding probes.

  9. DNA microdevice for electrochemical detection of Escherichia coli 0157:H7 molecular markers.

    PubMed

    Berganza, J; Olabarria, G; García, R; Verdoy, D; Rebollo, A; Arana, S

    2007-04-15

    An electrochemical DNA sensor based on the hybridization recognition of a single-stranded DNA (ssDNA) probe immobilized onto a gold electrode to its complementary ssDNA is presented. The DNA probe is bound on gold surface electrode by using self-assembled monolayer (SAM) technology. An optimized mixed SAM with a blocking molecule preventing the nonspecific adsorption on the electrode surface has been prepared. In this paper, a DNA biosensor is designed by means of the immobilization of a single stranded DNA probe on an electrochemical transducer surface to recognize specifically Escherichia coli (E. coli) 0157:H7 complementary target DNA sequence via cyclic voltammetry experiments. The 21 mer DNA probe including a C6 alkanethiol group at the 5' phosphate end has been synthesized to form the SAM onto the gold surface through the gold sulfur bond. The goal of this paper has been to design, characterise and optimise an electrochemical DNA sensor. In order to investigate the oligonucleotide probe immobilization and the hybridization detection, experiments with different concentration of DNA and mismatch sequences have been performed. This microdevice has demonstrated the suitability of oligonucleotide Self-assembled monolayers (SAMs) on gold as immobilization method. The DNA probes deposited on gold surface have been functional and able to detect changes in bases sequence in a 21-mer oligonucleotide.

  10. Label-Free Electrochemical Detection of the Specific Oligonucleotide Sequence of Dengue Virus Type 1 on Pencil Graphite Electrodes

    PubMed Central

    Souza, Elaine; Nascimento, Gustavo; Santana, Nataly; Ferreira, Danielly; Lima, Manoel; Natividade, Edna; Martins, Danyelly; Lima-Filho, José

    2011-01-01

    A biosensor that relies on the adsorption immobilization of the 18-mer single-stranded nucleic acid related to dengue virus gene 1 on activated pencil graphite was developed. Hybridization between the probe and its complementary oligonucleotides (the target) was investigated by monitoring guanine oxidation by differential pulse voltammetry (DPV). The pencil graphite electrode was made of ordinary pencil lead (type 4B). The polished surface of the working electrode was activated by applying a potential of 1.8 V for 5 min. Afterward, the dengue oligonucleotides probe was immobilized on the activated electrode by applying 0.5 V to the electrode in 0.5 M acetate buffer (pH 5.0) for 5 min. The hybridization process was carried out by incubating at the annealing temperature of the oligonucleotides. A time of five minutes and concentration of 1 μM were found to be the optimal conditions for probe immobilization. The electrochemical detection of annealing between the DNA probe (TS-1P) immobilized on the modified electrode, and the target (TS-1T) was achieved. The target could be quantified in a range from 1 to 40 nM with good linearity and a detection limit of 0.92 nM. The specificity of the electrochemical biosensor was tested using non-complementary sequences of dengue virus 2 and 3. PMID:22163916

  11. probeBase—an online resource for rRNA-targeted oligonucleotide probes and primers: new features 2016

    PubMed Central

    Greuter, Daniel; Loy, Alexander; Horn, Matthias; Rattei, Thomas

    2016-01-01

    probeBase http://www.probebase.net is a manually maintained and curated database of rRNA-targeted oligonucleotide probes and primers. Contextual information and multiple options for evaluating in silico hybridization performance against the most recent rRNA sequence databases are provided for each oligonucleotide entry, which makes probeBase an important and frequently used resource for microbiology research and diagnostics. Here we present a major update of probeBase, which was last featured in the NAR Database Issue 2007. This update describes a complete remodeling of the database architecture and environment to accommodate computationally efficient access. Improved search functions, sequence match tools and data output now extend the opportunities for finding suitable hierarchical probe sets that target an organism or taxon at different taxonomic levels. To facilitate the identification of complementary probe sets for organisms represented by short rRNA sequence reads generated by amplicon sequencing or metagenomic analysis with next generation sequencing technologies such as Illumina and IonTorrent, we introduce a novel tool that recovers surrogate near full-length rRNA sequences for short query sequences and finds matching oligonucleotides in probeBase. PMID:26586809

  12. Surface enhanced Raman gene probe and methods thereof

    DOEpatents

    Vo-Dinh, T.

    1998-09-29

    The subject invention disclosed herein is a new gene probe biosensor and methods based on surface enhanced Raman scattering (SERS) label detection. The SER gene probe biosensor comprises a support means, a SER gene probe having at least one oligonucleotide strand labeled with at least one SERS label, and a SERS active substrate disposed on the support means and having at least one of the SER gene probes adsorbed thereon. Biotargets such as bacterial and viral DNA, RNA and PNA are detected using a SER gene probe via hybridization to oligonucleotide strands complementary to the SER gene probe. The support means supporting the SERS active substrate includes a fiberoptic probe, an array of fiberoptic probes for performance of multiple assays and a waveguide microsensor array with charge-coupled devices or photodiode arrays. 18 figs.

  13. Surface enhanced Raman gene probe and methods thereof

    DOEpatents

    Vo-Dinh, Tuan

    1998-01-01

    The subject invention disclosed herein is a new gene probe biosensor and methods thereof based on surface enhanced Raman scattering (SERS) label detection. The SER gene probe biosensor comprises a support means, a SER gene probe having at least one oligonucleotide strand labeled with at least one SERS label, and a SERS active substrate disposed on the support means and having at least one of the SER gene probes adsorbed thereon. Biotargets such as bacterial and viral DNA, RNA and PNA are detected using a SER gene probe via hybridization to oligonucleotide strands complementary to the SER gene probe. The support means supporting the SERS active substrate includes a fiberoptic probe, an array of fiberoptic probes for performance of multiple assays and a waveguide microsensor array with charge-coupled devices or photodiode arrays.

  14. Surface enhanced Raman gene probe and methods thereof

    DOEpatents

    Vo-Dinh, T.

    1998-02-24

    The subject invention disclosed is a new gene probe biosensor and methods based on surface enhanced Raman scattering (SERS) label detection. The SER gene probe biosensor comprises a support means, a SER gene probe having at least one oligonucleotide strand labeled with at least one SERS label, and a SERS active substrate disposed on the support means and having at least one of the SER gene probes adsorbed thereon. Biotargets such as bacterial and viral DNA, RNA and PNA are detected using a SER gene probe via hybridization to oligonucleotide strands complementary to the SER gene probe. The support means includes a fiberoptic probe, an array of fiberoptic probes for performance of multiple assays and a waveguide microsensor array with charge-coupled devices or photodiode arrays. 18 figs.

  15. Surface enhanced Raman gene probe and methods thereof

    DOEpatents

    Vo-Dinh, T.

    1998-07-21

    The subject invention disclosed is a new gene probe biosensor and methods based on surface enhanced Raman scattering (SERS) label detection. The SER gene probe biosensor comprises a support means, a SER gene probe having at least one oligonucleotide strand labeled with at least one SERS label, and a SERS active substrate disposed on the support means and having at least one of the SER gene probes adsorbed. Biotargets such as bacterial and viral DNA, RNA and PNA are detected using a SER gene probe via hybridization to oligonucleotide strands complementary to the SER gene probe. The support means supporting the SERS active substrate includes a fiberoptic probe, an array of fiberoptic probes for performance of multiple assays and a waveguide microsensor array with charge-coupled devices or photodiode arrays. 18 figs.

  16. Aptamer-based electrochemical sensors with aptamer-complementary DNA oligonucleotides as probe.

    PubMed

    Lu, Ying; Li, Xianchan; Zhang, Limin; Yu, Ping; Su, Lei; Mao, Lanqun

    2008-03-15

    This study describes a facile and general strategy for the development of aptamer-based electrochemical sensors with a high specificity toward the targets and a ready regeneration feature. Very different from the existing strategies for the development of electrochemical aptasensors with the aptamers as the probes, the strategy proposed here is essentially based on the utilization of the aptamer-complementary DNA (cDNA) oligonucleotides as the probes for electrochemical sensing. In this context, the sequences at both ends of the cDNA are tailor-made to be complementary and both the redox moiety (i.e., ferrocene in this study) and thiol group are labeled onto the cDNA. The labeled cDNA are hybridized with their respective aptamers (i.e., ATP- and thrombin-binding aptamers in this study) to form double-stranded DNA (ds-DNA) and the electrochemical aptasensors are prepared by self-assembling the labeled ds-DNA onto Au electrodes. Upon target binding, the aptamers confined onto electrode surface dissociate from their respective cDNA oligonucleotides into the solution and the single-stranded cDNA could thus tend to form a hairpin structure through the hybridization of the complementary sequences at both its ends. Such a conformational change of the cDNA resulting from the target binding-induced dissociation of the aptamers essentially leads to the change in the voltammetric signal of the redox moiety labeled onto the cDNA and thus constitutes the mechanism for the electrochemical aptasensors for specific target sensing. The aptasensors demonstrated here with the cDNA as the probe are readily regenerated and show good responses toward the targets. This study may offer a new and relatively general approach to electrochemical aptasensors with good analytical properties and potential applications.

  17. Synthesis and fluorescence studies of multiple labeled oligonucleotides containing dansyl fluorophore covalently attached at 2'-terminus of cytidine via carbamate linkage.

    PubMed

    Misra, Arvind; Mishra, Satyendra; Misra, Krishna

    2004-01-01

    Synthesis of modified oligonucleotides in which the specific cytidine nucleoside analogues linked at 2'-OH position via a carbamate bond with an amino ethyl derivative of dansyl fluorophore is reported. For the multiple labeling of oligonucleotides, a strategy involving prelabeling at the monomeric level followed by solid phase assembly of oligonucleotides to obtain regiospecifically labeled probes has been described. The labeled monomer was phosphitylated using 2-cyanoethyl-N,N,N',N'-tetraisopropyl-phosphoramidite (Bis-reagent) and pyridiniumtrifluoro acetate (Py.TFA) as an activator. To ascertain the minimal number of labeled monomers required for a specific length of oligonucleotide for detection and also to assess the effect of carbamate linkage on hybridization, hexamer and 20-mer sequences were selected. Both were labeled with 1, 2, and 3 monomers at the 5'-end and hybridized with normal (unmodified) complementary sequences. As compared to midsequence or 3'-terminal labeling reported earlier, the 5'-terminal labeling has been found to have minimal contact-mediated quenching on duplex formation. This may be due to complementary deoxyguanosine (dG) rich oligonucleotide sequences or CG base pairs at a terminus that is known to yield stronger binding. This is one reason for selecting cytidine for labeling. The results may aid rational design of multiple fluorescent DNA probes for nonradioactive detection of nucleic acids.

  18. New redox-active layer create via epoxy-amine reaction - The base of genosensor for the detection of specific DNA and RNA sequences of avian influenza virus H5N1.

    PubMed

    Malecka, Kamila; Stachyra, Anna; Góra-Sochacka, Anna; Sirko, Agnieszka; Zagórski-Ostoja, Włodzimierz; Dehaen, Wim; Radecka, Hanna; Radecki, Jerzy

    2015-03-15

    This paper concerns the development of a redox-active monolayer and its application for the construction of an electrochemical genosensor designed for the detection of specific DNA and RNA oligonucleotide sequences related to the avian influenza virus (AIV) type H5N1. This new redox layer was created on a gold electrode surface step by step. Cyclic Voltammetry, Osteryoung Square-Wave Voltammetry and Differential Pulse Voltammetry were used for its characterization. This new redox-active layer was applied for the construction of the DNA biosensor. The NH2-NC3 probe (20-mer) was covalently attached to the gold electrode surface via a "click" reaction between the amine and an epoxide group. The hybridization process was monitored using the Osteryoung Square-Wave Voltammetry. The 20-mer DNA and ca. 280-mer RNA oligonucleotides were used as the targets. The constructed genosensor was capable to determine complementary oligonucleotide sequences with a detection limit in the pM range. It is able to distinguish the different position of the part RNA complementary to the DNA probe. The genosensor was very selective. The 20-mer DNA as well as the 280-mer RNA oligonucleotides without a complementary sequence generated a weak signal. Copyright © 2014 Elsevier B.V. All rights reserved.

  19. Visualization of nucleic acids with synthetic exciton-controlled fluorescent oligonucleotide probes.

    PubMed

    Wang, Dan Ohtan; Okamoto, Akimitsu

    2015-01-01

    Engineered probes to adapt new photochemical properties upon recognition of target nucleic acids offer powerful tools to DNA and RNA visualization technologies. Herein, we describe a rapid and effective visualization method of nucleic acids in both fixed and living cells with hybridization-sensitive fluorescent oligonucleotide probes. These probes are efficiently quenched in an aqueous environment due to the homodimeric, excitonic interactions between fluorophores but become highly fluorescent upon hybridization to DNA or RNA with complementary sequences. The fast hybridization kinetics and quick fluorescence activation of the new probes allow applications to simplify the conventional fluorescent in situ hybridization protocols and reduce the amount of time to process the samples. Furthermore, hybridization-sensitive fluorescence emission of the probes allows monitoring dynamic behaviors of RNA in living cells.

  20. Cadmium sulfide nanocluster-based electrochemical stripping detection of DNA hybridization.

    PubMed

    Zhu, Ningning; Zhang, Aiping; He, Pingang; Fang, Yuzhi

    2003-03-01

    A novel, sensitive electrochemical DNA hybridization detection assay, using cadmium sulfide (CdS) nanoclusters as the oligonucleotide labeling tag, is described. The assay relies on the hybridization of the target DNA with the CdS nanocluster oligonucleotide DNA probe, followed by the dissolution of the CdS nanoclusters anchored on the hybrids and the indirect determination of the dissolved cadmium ions by sensitive anodic stripping voltammetry (ASV) at a mercury-coated glassy carbon electrode (GCE). The results showed that only a complementary sequence could form a double-stranded dsDNA-CdS with the DNA probe and give an obvious electrochemical response. A three-base mismatch sequence and non-complementary sequence had negligible response. The combination of the large number of cadmium ions released from each dsDNA hybrid with the remarkable sensitivity of the electrochemical stripping analysis for cadmium at mercury-film GCE allows detection at levels as low as 0.2 pmol L(-1) of the complementary sequence of DNA.

  1. Detection of target-probe oligonucleotide hybridization using synthetic nanopore resistive pulse sensing.

    PubMed

    Booth, Marsilea Adela; Vogel, Robert; Curran, James M; Harbison, SallyAnn; Travas-Sejdic, Jadranka

    2013-07-15

    Despite the plethora of DNA sensor platforms available, a portable, sensitive, selective and economic sensor able to rival current fluorescence-based techniques would find use in many applications. In this research, probe oligonucleotide-grafted particles are used to detect target DNA in solution through a resistive pulse nanopore detection technique. Using carbodiimide chemistry, functionalized probe DNA strands are attached to carboxylated dextran-based magnetic particles. Subsequent incubation with complementary target DNA yields a change in surface properties as the two DNA strands hybridize. Particle-by-particle analysis with resistive pulse sensing is performed to detect these changes. A variable pressure method allows identification of changes in the surface charge of particles. As proof-of-principle, we demonstrate that target hybridization is selectively detected at micromolar concentrations (nanomoles of target) using resistive pulse sensing, confirmed by fluorescence and phase analysis light scattering as complementary techniques. The advantages, feasibility and limitations of using resistive pulse sensing for sample analysis are discussed. Copyright © 2013 Elsevier B.V. All rights reserved.

  2. EvOligo: A Novel Software to Design and Group Libraries of Oligonucleotides Applicable for Nucleic Acid-Based Experiments.

    PubMed

    Milewski, Marek C; Kamel, Karol; Kurzynska-Kokorniak, Anna; Chmielewski, Marcin K; Figlerowicz, Marek

    2017-10-01

    Experimental methods based on DNA and RNA hybridization, such as multiplex polymerase chain reaction, multiplex ligation-dependent probe amplification, or microarray analysis, require the use of mixtures of multiple oligonucleotides (primers or probes) in a single test tube. To provide an optimal reaction environment, minimal self- and cross-hybridization must be achieved among these oligonucleotides. To address this problem, we developed EvOligo, which is a software package that provides the means to design and group DNA and RNA molecules with defined lengths. EvOligo combines two modules. The first module performs oligonucleotide design, and the second module performs oligonucleotide grouping. The software applies a nearest-neighbor model of nucleic acid interactions coupled with a parallel evolutionary algorithm to construct individual oligonucleotides, and to group the molecules that are characterized by the weakest possible cross-interactions. To provide optimal solutions, the evolutionary algorithm sorts oligonucleotides into sets, preserves preselected parts of the oligonucleotides, and shapes their remaining parts. In addition, the oligonucleotide sets can be designed and grouped based on their melting temperatures. For the user's convenience, EvOligo is provided with a user-friendly graphical interface. EvOligo was used to design individual oligonucleotides, oligonucleotide pairs, and groups of oligonucleotide pairs that are characterized by the following parameters: (1) weaker cross-interactions between the non-complementary oligonucleotides and (2) more uniform ranges of the oligonucleotide pair melting temperatures than other available software products. In addition, in contrast to other grouping algorithms, EvOligo offers time-efficient sorting of paired and unpaired oligonucleotides based on various parameters defined by the user.

  3. A bimetallic nanocomposite modified genosensor for recognition and determination of thalassemia gene.

    PubMed

    Hamidi-Asl, Ezat; Raoof, Jahan Bakhsh; Naghizadeh, Nahid; Akhavan-Niaki, Haleh; Ojani, Reza; Banihashemi, Ali

    2016-10-01

    The main roles of DNA in the cells are to maintain and properly express genetic information. It is important to have analytical methods capable of fast and sensitive detection of DNA damage. DNA hybridization sensors are well suited for diagnostics and other purposes, including determination of bacteria and viruses. Beta thalassemias (βth) are due to mutations in the β-globin gene. In this study, an electrochemical biosensor which detects the sequences related to the β-globin gene issued from real samples amplified by polymerase chain reaction (PCR) is described for the first time. The biosensor relies on the immobilization of 20-mer single stranded oligonucleotide (probe) related to βth sequence on the carbon paste electrode (CPE) modified by 15% silver (Ag) and platinum (Pt) nanoparticles to prepare the bimetallic nanocomposite electrode and hybridization of this oligonucleotide with its complementary sequence (target). The extent of hybridization between the probe and target sequences was shown by using linear sweep voltammetry (LSV) with methylene blue (MB) as hybridization indicator. The selectivity of sensor was investigated using PCR samples containing non-complementary oligonucleotides. The detection limit of biosensor was calculated about 470.0pg/μL. Copyright © 2016 Elsevier B.V. All rights reserved.

  4. Preparation of genosensor for detection of specific DNA sequence of the hepatitis B virus

    NASA Astrophysics Data System (ADS)

    Honorato Castro, Ana C.; França, Erick G.; de Paula, Lucas F.; Soares, Marcia M. C. N.; Goulart, Luiz R.; Madurro, João M.; Brito-Madurro, Ana G.

    2014-09-01

    An electrochemical genosensor was constructed for detection of specific DNA sequence of the hepatitis B virus, based on graphite electrodes modified with poly(4-aminophenol) and incorporating a specific oligonucleotide probe. The modified electrode containing the probe was evaluated by differential pulse voltammetry, before and after incubation with the complementary oligonucleotide target. Detection was performed by monitoring oxidizable DNA bases (direct detection) or using ethidium bromide as indicator of the hybridization process (indirect detection). The device showed a detection limit for the oligonucleotide target of 2.61 nmol L-1. Indirect detection using ethidium bromide was promising in discriminating mismatches, which is a very desirable attribute for detection of disease-related point mutations. In addition, it was possible to observe differences between hybridized and non-hybridized surfaces by atomic force microscopy.

  5. ‘Protected DNA Probes’ capable of strong hybridization without removal of base protecting groups

    PubMed Central

    Ohkubo, Akihiro; Kasuya, Rintaro; Sakamoto, Kazushi; Miyata, Kenichi; Taguchi, Haruhiko; Nagasawa, Hiroshi; Tsukahara, Toshifumi; Watanobe, Takuma; Maki, Yoshiyuki; Seio, Kohji; Sekine, Mitsuo

    2008-01-01

    We propose a new strategy called the ‘Protected DNA Probes (PDP) method’ in which appropriately protected bases selectively bind to the complementary bases without the removal of their base protecting groups. Previously, we reported that 4-N-acetylcytosine oligonucleotides (ac4C) exhibited a higher hybridization affinity for ssDNA than the unmodified oligonucleotides. For the PDP strategy, we created a modified adenine base and synthesized an N-acylated deoxyadenosine mimic having 6-N-acetyl-8-aza-7-deazaadenine (ac6az8c7A). It was found that PDP containing ac4C and ac6az8c7A exhibited higher affinity for the complementary ssDNA than the corresponding unmodified DNA probes and showed similar base recognition ability. Moreover, it should be noted that this PDP strategy could guarantee highly efficient synthesis of DNA probes on controlled pore glass (CPG) with high purity and thereby could eliminate the time-consuming procedures for isolating DNA probes. This strategy could also avoid undesired base-mediated elimination of DNA probes from CPG under basic conditions such as concentrated ammonia solution prescribed for removal of base protecting groups in the previous standard approach. Here, several successful applications of this strategy to single nucleotide polymorphism detection are also described in detail using PDPs immobilized on glass plates and those prepared on CPG plates, suggesting its potential usefulness. PMID:18272535

  6. Kits for Characterization of Chromosomal Inversions Using Probes

    NASA Technical Reports Server (NTRS)

    Ray, F. Andrew (Inventor)

    2017-01-01

    A kit for the characterization of chromosomal inversions using single-stranded probes that are either all identical or all complementary to a single-stranded chromatid is described. Reporter species are attached to oligonucleotide strands designed such that they may hybridize to portions of only one of a pair of single-stranded sister chromatids which may be prepared by the CO-FISH procedure. If an inversion has occurred, these marker probes will be detected on the second sister chromatid at the same location as the inversion on the first chromatid. The kit includes non-repetitive probes that are either all identical or all complementary to at least a portion of a target DNA sequence of only one DNA strand of only one chromatid and may in some embodiments include reagents suitable for performing CO-FISH and/or reagents for hybridizing the probes to the target DNA sequence.

  7. A novel single fluorophore-labeled double-stranded oligonucleotide probe for fluorescence-enhanced nucleic acid detection based on the inherent quenching ability of deoxyguanosine bases and competitive strand-displacement reaction.

    PubMed

    Zhang, Yingwei; Tian, Jingqi; Li, Hailong; Wang, Lei; Sun, Xuping

    2012-01-01

    We develop a novel single fluorophore-labeled double-stranded oligonucleotide (OND) probe for rapid, nanostructure-free, fluorescence-enhanced nucleic acid detection for the first time. We further demonstrate such probe is able to well discriminate single-base mutation in nucleic acid. The design takes advantage of an inherent quenching ability of guanine bases. The short strand of the probe is designed with an end-labeled fluorophore that is placed adjacent to two guanines as the quencher located on the long opposite strand, resulting in great quenching of dye fluorescence. In the presence of a target complementary to the long strand of the probe, a competitive strand-displacement reaction occurs and the long strand forms a more stable duplex with the target, resulting in the two strands of the probe being separated from each other. As a consequence of this displacement, the fluorophore and the quencher are no longer in close proximity and dye fluorescence increases, signaling the presence of target.

  8. Intrinsically Labeled Fluorescent Oligonucleotide Probes on Quantum Dots for Transduction of Nucleic Acid Hybridization.

    PubMed

    Shahmuradyan, Anna; Krull, Ulrich J

    2016-03-15

    Quantum dots (QDs) have been widely used in chemical and biosensing due to their unique photoelectrical properties and are well suited as donors in fluorescence resonance energy transfer (FRET). Selective hybridization interactions of oligonucleotides on QDs have been determined by FRET. Typically, the QD-FRET constructs have made use of labeled targets or have implemented labeled sandwich format assays to introduce dyes in proximity to the QDs for the FRET process. The intention of this new work is to explore a method to incorporate the acceptor dye into the probe molecule. Thiazole orange (TO) derivatives are fluorescent intercalating dyes that have been used for detection of double-stranded nucleic acids. One such dye system has been reported in which single-stranded oligonucleotide probes were doubly labeled with adjacent thiazole orange derivatives. In the absence of the fully complementary (FC) oligonucleotide target, the dyes form an H-aggregate, which results in quenching of fluorescence emission due to excitonic interactions between the dyes. The hybridization of the FC target to the probe provides for dissociation of the aggregate as the dyes intercalate into the double stranded duplex, resulting in increased fluorescence. This work reports investigation of the dependence of the ratiometric signal on the type of linkage used to conjugate the dyes to the probe, the location of the dye along the length of the probe, and the distance between adjacent dye molecules. The limit of detection for 34mer and 90mer targets was found to be identical and was 10 nM (2 pmol), similar to analogous QD-FRET using labeled oligonucleotide target. The detection system could discriminate a one base pair mismatch (1BPM) target and was functional without substantial compromise of the signal in 75% serum. The 1BPM was found to reduce background signal, indicating that the structure of the mismatch affected the environment of the intercalating dyes.

  9. New concepts of fluorescent probes for specific detection of DNA sequences: bis-modified oligonucleotides in excimer and exciplex detection.

    PubMed

    Gbaj, A; Bichenkova, Ev; Walsh, L; Savage, He; Sardarian, Ar; Etchells, Ll; Gulati, A; Hawisa, S; Douglas, Kt

    2009-12-01

    The detection of single base mismatches in DNA is important for diagnostics, treatment of genetic diseases, and identification of single nucleotide polymorphisms. Highly sensitive, specific assays are needed to investigate genetic samples from patients. The use of a simple fluorescent nucleoside analogue in detection of DNA sequence and point mutations by hybridisation in solution is described in this study. The 5'-bispyrene and 3'-naphthalene oligonucleotide probes form an exciplex on hybridisation to target in water and the 5'-bispyrene oligonucleotide alone is an adequate probe to determine concentration of target present. It was also indicated that this system has a potential to identify mismatches and insertions. The aim of this work was to investigate experimental structures and conditions that permit strong exciplex emission for nucleic acid detectors, and show how such exciplexes can register the presence of mismatches as required in SNP analysis. This study revealed that the hybridisation of 5'-bispyrenyl fluorophore to a DNA target results in formation of a fluorescent probe with high signal intensity change and specificity for detecting a complementary target in a homogeneous system. Detection of SNP mutations using this split-probe system is a highly specific, simple, and accessible method to meet the rigorous requirements of pharmacogenomic studies. Thus, it is possible for the system to act as SNP detectors and it shows promise for future applications in genetic testing.

  10. The field effect transistor DNA biosensor based on ITO nanowires in label-free hepatitis B virus detecting compatible with CMOS technology.

    PubMed

    Shariati, Mohsen

    2018-05-15

    In this paper the field-effect transistor DNA biosensor for detecting hepatitis B virus (HBV) based on indium tin oxide nanowires (ITO NWs) in label free approach has been fabricated. Because of ITO nanowires intensive conductance and functional modified surface, the probe immobilization and target hybridization were increased strongly. The high resolution transmission electron microscopy (HRTEM) measurement showed that ITO nanowires were crystalline and less than 50nm in diameter. The single-stranded hepatitis B virus DNA (SS-DNA) was immobilized as probe on the Au-modified nanowires. The DNA targets were measured in a linear concentration range from 1fM to 10µM. The detection limit of the DNA biosensor was about 1fM. The time of the hybridization process for defined single strand was 90min. The switching ratio of the biosensor between "on" and "off" state was ~ 1.1 × 10 5 . For sensing the specificity of the biosensor, non-complementary, mismatch and complementary DNA oligonucleotide sequences were clearly discriminated. The HBV biosensor confirmed the highly satisfied specificity for differentiating complementary sequences from non-complementary and the mismatch oligonucleotides. The response time of the DNA sensor was 37s with a high reproducibility. The stability and repeatability of the DNA biosensor showed that the peak current of the biosensor retained 98% and 96% of its initial response for measurements after three and five weeks, respectively. Copyright © 2018 Elsevier B.V. All rights reserved.

  11. Use of extremely short Förster resonance energy transfer probes in real-time polymerase chain reaction

    PubMed Central

    Kutyavin, Igor V.

    2013-01-01

    Described in the article is a new approach for the sequence-specific detection of nucleic acids in real-time polymerase chain reaction (PCR) using fluorescently labeled oligonucleotide probes. The method is based on the production of PCR amplicons, which fold into dumbbell-like secondary structures carrying a specially designed ‘probe-luring’ sequence at their 5′ ends. Hybridization of this sequence to a complementary ‘anchoring’ tail introduced at the 3′ end of a fluorescent probe enables the probe to bind to its target during PCR, and the subsequent probe cleavage results in the florescence signal. As it has been shown in the study, this amplicon-endorsed and guided formation of the probe-target duplex allows the use of extremely short oligonucleotide probes, up to tetranucleotides in length. In particular, the short length of the fluorescent probes makes possible the development of a ‘universal’ probe inventory that is relatively small in size but represents all possible sequence variations. The unparalleled cost-effectiveness of the inventory approach is discussed. Despite the short length of the probes, this new method, named Angler real-time PCR, remains highly sequence specific, and the results of the study indicate that it can be effectively used for quantitative PCR and the detection of polymorphic variations. PMID:24013564

  12. Isolation of a complementary DNA clone for the human complement protein C2 and its use in the identification of a restriction fragment length polymorphism.

    PubMed Central

    Woods, D E; Edge, M D; Colten, H R

    1984-01-01

    Complementary DNA (cDNA) clones corresponding to the major histocompatibility (MHC) class III antigen, complement protein C2, have been isolated from human liver cDNA libraries with the use of a complex mixture of synthetic oligonucleotides (17 mer) that contains 576 different oligonucleotide sequences. The C2 cDNA were used to identify a DNA restriction enzyme fragment length polymorphism that provides a genetic marker within the MHC that was not detectable at the protein level. An extensive search for genomic polymorphisms using a cDNA clone for another MHC class III gene, factor B, failed to reveal any DNA variants. The genomic variants detected with the C2 cDNA probe provide an additional genetic marker for analysis of MHC-linked diseases. Images PMID:6086718

  13. New Concepts of Fluorescent Probes for Specific Detection of DNA Sequences: Bis-Modified Oligonucleotides in Excimer and Exciplex Detection

    PubMed Central

    Gbaj, A; Bichenkova, EV; Walsh, L; Savage, HE; Sardarian, AR; Etchells, LL; Gulati, A; Hawisa, S; Douglas, KT

    2009-01-01

    The detection of single base mismatches in DNA is important for diagnostics, treatment of genetic diseases, and identification of single nucleotide polymorphisms. Highly sensitive, specific assays are needed to investigate genetic samples from patients. The use of a simple fluorescent nucleoside analogue in detection of DNA sequence and point mutations by hybridisation in solution is described in this study. The 5′-bispyrene and 3′-naphthalene oligonucleotide probes form an exciplex on hybridisation to target in water and the 5′-bispyrene oligonucleotide alone is an adequate probe to determine concentration of target present. It was also indicated that this system has a potential to identify mismatches and insertions. The aim of this work was to investigate experimental structures and conditions that permit strong exciplex emission for nucleic acid detectors, and show how such exciplexes can register the presence of mismatches as required in SNP analysis. This study revealed that the hybridisation of 5′-bispyrenyl fluorophore to a DNA target results in formation of a fluorescent probe with high signal intensity change and specificity for detecting a complementary target in a homogeneous system. Detection of SNP mutations using this split-probe system is a highly specific, simple, and accessible method to meet the rigorous requirements of pharmacogenomic studies. Thus, it is possible for the system to act as SNP detectors and it shows promise for future applications in genetic testing. PMID:21483539

  14. Oligonucleotides complementary to a promoter over the region -8...+2 as transcription primers for E. coli RNA polymerase.

    PubMed Central

    Grachev, M A; Zaychikov, E F; Ivanova, E M; Komarova, N I; Kutyavin, I V; Sidelnikova, N P; Frolova, I P

    1984-01-01

    Primer-dependent transcription by E. coli RNA polymerase on T7 promoter A2 has been studied. Synthetic deoxyribonucleotides complementary to the promoter over the region -8...+2 were taken as primers. A ribonucleoside residue was present at the 3'-end of some of these oligonucleotides. The octanucleotide complementary to the region -8...-1 appeared to be an active primer. Oligonucleotides having lengths from 3 to 6 nucleotide residues complementary to the promoter over the region -4...+2 also exhibited primer activity. The latter was some 5-10 times greater in the case of oligonucleotides having a ribonucleoside residue at the 3'-end. Oligonucleotides which on complementary binding do not reach the center of phosphodiester bond synthesis, as well as the decanucleotides (-8...+2) and octanucleotides (-6...+2) of both the ribo- and deoxyribo-series were inactive as primers. Images PMID:6390344

  15. RNA-oligonucleotide quantification technique (ROQT) for the enumeration of uncultivated bacterial species in subgingival biofilms

    PubMed Central

    Teles, F.R.F.; Teles, R.P.; Siegelin, Y.; Paster, B.; Haffajee, A.D.; Socransky, S.S.

    2010-01-01

    SUMMARY Approximately 35% of the species present in subgingival biofilms are as yet uncultivated, so their role in periodontal pathogenesis is unknown. The aim of the present study was to develop a high throughput method to quantify a wide range of cultivated and uncultivated taxa in subgingival biofilm samples associated with periodontal disease or health. Oligonucleotides targeting the 16S ribosomal DNA gene were designed, synthesized and labeled with digoxigenin. These probes were hybridized with the total nucleic acids of pure cultures or subgingival biofilm samples. Target species included cultivated taxa associated with periodontal health and disease, as well as uncultivated species, such as TM7 sp OT 346, Mitsuokella sp. OT 131 and Desulfobulbus sp. OT 041. Sensitivity and specificity of the probes were determined. A Universal probe was used to assess total bacterial load. Sequences complementary to the probes were used as standards for quantification. Chemiluminescent signals were visualized after film exposure or using a CCD camera. In a pilot clinical study, 266 subgingival plaque samples from eight periodontally healthy people and 11 patients with periodontitis were examined. Probes were specific and sensitivity reached 104 cells. Fusobacterium nucleatum ss polymorphum and Actinomyces gerencseriae were the most abundant cultivated taxa in clinical samples. Among uncultivated/unrecognized species, Mitsuokella sp. OT 131 and Prevotella sp. OT 306 were the most numerous. Porphyromonas gingivalis and Desulfobulbus sp. OT 041 were only detected in patients with periodontitis. Direct hybridization of total nucleic acids using oligonucleotide probes permitted the quantification of multiple cultivated and uncultivated taxa in mixed species biofilm samples. PMID:21375703

  16. Development of dansyl-modified oligonucleotide probes responding to structural changes in a duplex.

    PubMed

    Suzuki, Yoshio; Kowata, Keiko; Komatsu, Yasuo

    2013-11-15

    We have synthesized a nonnucleoside amidite block of dansyl fluorophore to prepare dansyl-modified oligonucleotides (ONTs). The fluorescence intensities of dansyl-ONT specifically increased by the presence of adjacent guanosine residues but, significantly reduced in a dansyl-flipping duplex. These changes were caused by solvatochromism effect due to the number of guanine which is hydrophobic functional group and the external environment of dansyl group. The fluorescence intensities could be plotted as a function of the ONTs concentrations and the increase in the fluorescence was observed to equimolar concentrations of target DNA. This duplex exhibited higher melting temperature relative to the corresponding duplexes containing other base pairs. Similar changes in fluorescence could be detected upon hybridization with complementary RNAs. Thus, the dansyl-modified ONTs provide sequence specific fluorescent probe of DNA and RNA. Copyright © 2013 Elsevier Ltd. All rights reserved.

  17. Utilizing Intrinsic Properties of Polyaniline to Detect Nucleic Acid Hybridization through UV-Enhanced Electrostatic Interaction.

    PubMed

    Sengupta, Partha Pratim; Gloria, Jared N; Amato, Dahlia N; Amato, Douglas V; Patton, Derek L; Murali, Beddhu; Flynt, Alex S

    2015-10-12

    Detection of specific RNA or DNA molecules by hybridization to "probe" nucleic acids via complementary base-pairing is a powerful method for analysis of biological systems. Here we describe a strategy for transducing hybridization events through modulating intrinsic properties of the electroconductive polymer polyaniline (PANI). When DNA-based probes electrostatically interact with PANI, its fluorescence properties are increased, a phenomenon that can be enhanced by UV irradiation. Hybridization of target nucleic acids results in dissociation of probes causing PANI fluorescence to return to basal levels. By monitoring restoration of base PANI fluorescence as little as 10(-11) M (10 pM) of target oligonucleotides could be detected within 15 min of hybridization. Detection of complementary oligos was specific, with introduction of a single mismatch failing to form a target-probe duplex that would dissociate from PANI. Furthermore, this approach is robust and is capable of detecting specific RNAs in extracts from animals. This sensor system improves on previously reported strategies by transducing highly specific probe dissociation events through intrinsic properties of a conducting polymer without the need for additional labels.

  18. Electrochemical DNA biosensor for detection of porcine oligonucleotides using ruthenium(II) complex as intercalator label redox

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Halid, Nurul Izni Abdullah; Hasbullah, Siti Aishah; Heng, Lee Yook

    2014-09-03

    A DNA biosensor detection of oligonucleotides via the interactions of porcine DNA with redox active complex based on the electrochemical transduction is described. A ruthenium(II) complex, [Ru(bpy){sub 2}(PIP)]{sup 2+}, (bpy = 2,2′bipyridine, PIP = 2-phenylimidazo[4,5-f[[1,10-phenanthroline]) as DNA label has been synthesized and characterized by 1H NMR and mass spectra. The study was carried out by covalent bonding immobilization of porcine aminated DNA probes sequences on screen printed electrode (SPE) modified with succinimide-acrylic microspheres and [Ru(bpy){sub 2}(PIP)]{sup 2+} was used as electrochemical redox intercalator label to detect DNA hybridization event. Electrochemical detection was performed by cyclic voltammetry (CV) and differential pulsemore » voltammetry (DPV) over the potential range where the ruthenium (II) complex was active. The results indicate that the interaction of [Ru(bpy){sub 2}(PIP)]{sup 2+} with hybridization complementary DNA has higher response compared to single-stranded and mismatch complementary DNA.« less

  19. Reassembly of a bioluminescent protein Renilla luciferase directed through DNA hybridization.

    PubMed

    Cissell, Kyle A; Rahimi, Yasmeen; Shrestha, Suresh; Deo, Sapna K

    2009-01-01

    Reassembly of split reporter proteins, also referred to as protein complementation, is utilized in the detection of protein-protein or protein-nucleic acid interactions. In this strategy, a reporter protein is fragmented into two inactive polypeptides to which interacting/binding partners are fused. The interaction between fused partners leads to the formation of a reassembled, active reporter. In this Communication, we have presented a proof-of-concept for the detection of a target nucleic acid sequence based on the reassembly of the bioluminescent reporter Renilla luciferase (Rluc), which is driven by DNA hybridization. Although, reassembly of Rluc though protein interactions has been demonstrated by others, the Rluc reassembly through DNA hybridization has not been shown yet, which is the novelty of this work. It is well established that bioluminescence detection offers significant advantages due to the absence of any background signal. In our study, two rationally designed fragments of Rluc were conjugated to complementary oligonucleotide probes. Hybridization of the two probes with fused Rluc fragments resulted in the reassembly of the fragments, generating active Rluc, measurable by the intensity of light given off upon addition of coelenterazine. Our study also shows that the reassembly of Rluc can be inhibited by an oligonucleotide probe that competes to bind to the hybridized probe-Rluc fragment complex, indicating a potential strategy for the quantitative detection of target nucleic acid. We were able to achieve the reassembly of Rluc fused to oligonucleotide probes using femtomole amounts of the probe-fragment protein conjugate. This concentration is approximately 4 orders of magnitude less than that reported using green fluorescent protein (GFP) as the reporter. A DNA-driven Rluc reassembly study performed in a cellular matrix did not show any interference from the matrix.

  20. Precise and selective sensing of DNA-DNA hybridization by graphene/Si-nanowires diode-type biosensors.

    PubMed

    Kim, Jungkil; Park, Shin-Young; Kim, Sung; Lee, Dae Hun; Kim, Ju Hwan; Kim, Jong Min; Kang, Hee; Han, Joong-Soo; Park, Jun Woo; Lee, Hosun; Choi, Suk-Ho

    2016-08-18

    Single-Si-nanowire (NW)-based DNA sensors have been recently developed, but their sensitivity is very limited because of high noise signals, originating from small source-drain current of the single Si NW. Here, we demonstrate that chemical-vapor-deposition-grown large-scale graphene/surface-modified vertical-Si-NW-arrays junctions can be utilized as diode-type biosensors for highly-sensitive and -selective detection of specific oligonucleotides. For this, a twenty-seven-base-long synthetic oligonucleotide, which is a fragment of human DENND2D promoter sequence, is first decorated as a probe on the surface of vertical Si-NW arrays, and then the complementary oligonucleotide is hybridized to the probe. This hybridization gives rise to a doping effect on the surface of Si NWs, resulting in the increase of the current in the biosensor. The current of the biosensor increases from 19 to 120% as the concentration of the target DNA varies from 0.1 to 500 nM. In contrast, such biosensing does not come into play by the use of the oligonucleotide with incompatible or mismatched sequences. Similar results are observed from photoluminescence microscopic images and spectra. The biosensors show very-uniform current changes with standard deviations ranging ~1 to ~10% by ten-times endurance tests. These results are very promising for their applications in accurate, selective, and stable biosensing.

  1. Issues in the analysis of oligonucleotide tiling microarrays for transcript mapping

    NASA Technical Reports Server (NTRS)

    Royce, Thomas E.; Rozowsky, Joel S.; Bertone, Paul; Samanta, Manoj; Stolc, Viktor; Weissman, Sherman; Snyder, Michael; Gerstein, Mark

    2005-01-01

    Traditional microarrays use probes complementary to known genes to quantitate the differential gene expression between two or more conditions. Genomic tiling microarray experiments differ in that probes that span a genomic region at regular intervals are used to detect the presence or absence of transcription. This difference means the same sets of biases and the methods for addressing them are unlikely to be relevant to both types of experiment. We introduce the informatics challenges arising in the analysis of tiling microarray experiments as open problems to the scientific community and present initial approaches for the analysis of this nascent technology.

  2. In vitro transcription in the presence of DNA oligonucleotides can generate strong anomalous initiation sites.

    PubMed

    Chow, C W; Clark, M P; Rinaldo, J E; Chalkley, R

    1996-03-01

    In the present study, we have explored an unexpected observation in transcription initiation that is mediated by single-stranded oligonucleotides. Initially, our goal was to understand the function of different upstream regulatory elements/initiation sites in the rat xanthine dehydrogenase/oxidase (XDH/XO) promoter. We performed in vitro transcription with HeLa nuclear extracts in the presence of different double-stranded oligonucleotides against upstream elements as competitors. A new and unusual transcription initiation site was detected by primer extension. This new initiation site maps to the downstream region of the corresponding competitor. Subsequent analyses have indicated that the induction of a new transcription initiation site is anomalous which is due to the presence of a small amount of single-stranded oligonucleotide in the competitor. We found that this anomalous initiation site is insensitive to the orientation of the promoter and requires only a small amount of single-stranded oligonucleotide (< 2-fold molar excess relative to template). We surmise that a complementary interaction between the single-stranded oligonucleotide and transiently denatured promoter template may be responsible for this sequence-specific transcription initiation artifact. To study the regulation of transcription initiation by in vitro transcription approaches, we propose that one should probe the effect of removing transacting factors by adding an excess of a cognate oligonucleotide which does not bear exact sequence identity to the template.

  3. Direct fluorescence in situ hybridization on human metaphase chromosomes using quantum dot-platinum labeled DNA probes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hwang, Gyoyeon; Biological Chemistry, Korea University of Science and Technology, 217, Gajeong-ro, Yuseong-gu, Deajeon; Lee, Hansol

    The telomere shortening in chromosomes implies the senescence, apoptosis, or oncogenic transformation of cells. Since detecting telomeres in aging and diseases like cancer, is important, the direct detection of telomeres has been a very useful biomarker. We propose a telomere detection method using a newly synthesized quantum dot (QD) based probe with oligonucleotide conjugation and direct fluorescence in situ hybridization (FISH). QD-oligonucleotides were prepared with metal coordination bonding based on platinum-guanine binding reported in our previous work. The QD-oligonucleotide conjugation method has an advantage where any sequence containing guanine at the end can be easily bound to the starting QD-Ptmore » conjugate. A synthesized telomeric oligonucleotide was bound to the QD-Pt conjugate successfully and this probe hybridized specifically on the telomere of fabricated MV-4-11 and MOLT-4 chromosomes. Additionally, the QD-telomeric oligonucleotide probe successfully detected the telomeres on the CGH metaphase slide. Due to the excellent photostability and high quantum yield of QDs, the QD-oligonucleotide probe has high fluorescence intensity when compared to the organic dye-oligonucleotide probe. Our QD-oligonucleotide probe, conjugation method of this QD probe, and hybridization protocol with the chromosomes can be a useful tool for chromosome painting and FISH. - Highlights: • We prepared a probe linked between QD and telomeric oligonucleotide with platinum-guanine bonding. • Telomeres were detected by our new telomere probes successfully in three different human metaphase chromosomes. • QDPt-DNA probe has high fluorescence intensity in comparison with organic dye-DNA probe.« less

  4. Lipophilic oligonucleotides spontaneously insert into lipid membranes, bind complementary DNA strands, and sequester into lipid-disordered domains.

    PubMed

    Bunge, Andreas; Kurz, Anke; Windeck, Anne-Kathrin; Korte, Thomas; Flasche, Wolfgang; Liebscher, Jürgen; Herrmann, Andreas; Huster, Daniel

    2007-04-10

    For the development of surface functionalized bilayers, we have synthesized lipophilic oligonucleotides to combine the molecular recognition mechanism of nucleic acids and the self-assembly characteristics of lipids in planar membranes. A lipophilic oligonucleotide consisting of 21 thymidine units and two lipophilic nucleotides with an alpha-tocopherol moiety as a lipophilic anchor was synthesized using solid-phase methods with a phosphoramadite strategy. The interaction of the water soluble lipophilic oligonucleotide with vesicular lipid membranes and its capability to bind complementary DNA strands was studied using complementary methods such as NMR, EPR, DSC, fluorescence spectroscopy, and fluorescence microscopy. This oligonucleotide inserted stably into preformed membranes from the aqueous phase. Thereby, no significant perturbation of the lipid bilayer and its stability was observed. However, the non-lipidated end of the oligonucleotide is exposed to the aqueous environment, is relatively mobile, and is free to interact with complementary DNA strands. Binding of the complementary single-stranded DNA molecules is fast and accomplished by the formation of Watson-Crick base pairs, which was confirmed by 1H NMR chemical shift analysis and fluorescence resonance energy transfer. The molecular structure of the membrane bound DNA double helix is very similar to the free double-stranded DNA. Further, the membrane bound DNA double strands also undergo regular melting. Finally, in raft-like membrane mixtures, the lipophilic oligonucleotide was shown to preferentially sequester into liquid-disordered membrane domains.

  5. High-density fiber optic biosensor arrays

    NASA Astrophysics Data System (ADS)

    Epstein, Jason R.; Walt, David R.

    2002-02-01

    Novel approaches are required to coordinate the immense amounts of information derived from diverse genomes. This concept has influenced the expanded role of high-throughput DNA detection and analysis in the biological sciences. A high-density fiber optic DNA biosensor was developed consisting of oligonucleotide-functionalized, 3.1 mm diameter microspheres deposited into the etched wells on the distal face of a 500 micrometers imaging fiber bundle. Imaging fiber bundles containing thousands of optical fibers, each associated with a unique oligonucleotide probe sequence, were the foundation for an optically connected, individually addressable DNA detection platform. Different oligonucleotide-functionalized microspheres were combined in a stock solution, and randomly dispersed into the etched wells. Microsphere positions were registered from optical dyes incorporated onto the microspheres. The distribution process provided an inherent redundancy that increases the signal-to-noise ratio as the square root of the number of sensors examined. The representative amount of each probe-type in the array was dependent on their initial stock solution concentration, and as other sequences of interest arise, new microsphere elements can be added to arrays without altering the existing detection capabilities. The oligonucleotide probe sequences hybridize to fluorescently-labeled, complementary DNA target solutions. Fiber optic DNA microarray research has included DNA-protein interaction profiles, microbial strain differentiation, non-labeled target interrogation with molecular beacons, and single cell-based assays. This biosensor array is proficient in DNA detection linked to specific disease states, single nucleotide polymorphism (SNP's) discrimination, and gene expression analysis. This array platform permits multiple detection formats, provides smaller feature sizes, and enables sensor design flexibility. High-density fiber optic microarray biosensors provide a fast, reversible format with the detection limit of a few hundred molecules.

  6. Fluorescent quenching-based quantitative detection of specific DNA/RNA using a BODIPY® FL-labeled probe or primer

    PubMed Central

    Kurata, Shinya; Kanagawa, Takahiro; Yamada, Kazutaka; Torimura, Masaki; Yokomaku, Toyokazu; Kamagata, Yoichi; Kurane, Ryuichiro

    2001-01-01

    We have developed a simple method for the quantitative detection of specific DNA or RNA molecules based on the finding that BODIPY® FL fluorescence was quenched by its interaction with a uniquely positioned guanine. This approach makes use of an oligonucleotide probe or primer containing a BODIPY® FL-modified cytosine at its 5′-end. When such a probe was hybridized with a target DNA, its fluorescence was quenched by the guanine in the target, complementary to the modified cytosine, and the quench rate was proportional to the amount of target DNA. This widely applicable technique will be used directly with larger samples or in conjunction with the polymerase chain reaction to quantify small DNA samples. PMID:11239011

  7. Unlabeled oligonucleotides as internal temperature controls for genotyping by amplicon melting.

    PubMed

    Seipp, Michael T; Durtschi, Jacob D; Liew, Michael A; Williams, Jamie; Damjanovich, Kristy; Pont-Kingdon, Genevieve; Lyon, Elaine; Voelkerding, Karl V; Wittwer, Carl T

    2007-07-01

    Amplicon melting is a closed-tube method for genotyping that does not require probes, real-time analysis, or allele-specific polymerase chain reaction. However, correct differentiation of homozygous mutant and wild-type samples by melting temperature (Tm) requires high-resolution melting and closely controlled reaction conditions. When three different DNA extraction methods were used to isolate DNA from whole blood, amplicon Tm differences of 0.03 to 0.39 degrees C attributable to the extractions were observed. To correct for solution chemistry differences between samples, complementary unlabeled oligonucleotides were included as internal temperature controls to shift and scale the temperature axis of derivative melting plots. This adjustment was applied to a duplex amplicon melting assay for the methylenetetrahydrofolate reductase variants 1298A>C and 677C>T. High- and low-temperature controls bracketing the amplicon melting region decreased the Tm SD within homozygous genotypes by 47 to 82%. The amplicon melting assay was 100% concordant to an adjacent hybridization probe (HybProbe) melting assay when temperature controls were included, whereas a 3% error rate was observed without temperature correction. In conclusion, internal temperature controls increase the accuracy of genotyping by high-resolution amplicon melting and should also improve results on lower resolution instruments.

  8. Spiky gold shells on magnetic particles for DNA biosensors.

    PubMed

    Bedford, Erin E; Boujday, Souhir; Pradier, Claire-Marie; Gu, Frank X

    2018-05-15

    Combined separation and detection of biomolecules has the potential to speed up and improve the sensitivity of disease detection, environmental testing, and biomolecular analysis. In this work, we synthesized magnetic particles coated with spiky nanostructured gold shells and used them to magnetically separate out and detect oligonucleotides using SERS. The distance dependence of the SERS signal was then harnessed to detect DNA hybridization using a Raman label bound to a hairpin probe. The distance of the Raman label from the surface increased upon complementary DNA hybridization, leading to a decrease in signal intensity. This work demonstrates the use of the particles for combined separation and detection of oligonucleotides without the use of an extrinsic tag or secondary hybridization step. Copyright © 2018 Elsevier B.V. All rights reserved.

  9. Different strategies for the detection of bioagents using electrochemical and photoelectrochemical genosensors

    NASA Astrophysics Data System (ADS)

    Voccia, Diego; Bettazi, Francesca; Palchetti, Ilaria

    2015-10-01

    In recent years various kinds of biosensors for the detection of pathogens have been developed. A genosensor consists in the immobilization, onto the surface of a chosen transducer, of an oligonucleotide with a specific base sequence called capture probe. The complementary sequence (the analytical target, i.e. a specific sequence of the DNA/RNA of the pathogen) present in the sample is recognized and captured by the probe through the hybridization reaction. The evaluation of the extent of the hybridization allows one to confirm whether the sample contains the complementary sequence of the probe or not. Electrochemical transducers have received considerable attention in connection with the detection of DNA hybridization. Moreover, recently, with the emergence of novel photoelectrochemically active species and new detection schemes, photoelectrochemistry has resulted in substantial progress in its analytical performance for biosensing applications. In this paper, some examples of electrochemical genosensors for multiplexed pathogen detection are shown. Moreover, the preliminary experiments towards the development of a photoelectrochemical genosensor using a TiO2 - nanocrystal-modified ITO electrode are discussed.

  10. Visual detection of telomerase activity with a tunable dynamic range by using a gold nanoparticle probe-based hybridization protection strategy

    NASA Astrophysics Data System (ADS)

    Wang, Jiasi; Wu, Li; Ren, Jinsong; Qu, Xiaogang

    2014-01-01

    We developed a novel telomere complementary (TC) oligonucleotide modified AuNP probe (TC-AuNPs) for colorimetric analysis of telomerase activity. The mechanism of this method is that the telomerase reaction products (TRP), which can hybridize with the TC-AuNPs, are able to protect the AuNPs from the aggregation induced by salt. It is demonstrated that the colorimetric method enabled the analysis of the telomerase activity in 1000 HeLa cells with the naked eye, and down to 100 HeLa cells with the aid of UV-Vis spectroscopy. This strategy is not only convenient and sensitive, but also has a tunable dynamic range. The platform is also applicable for the initial screening of a telomerase inhibitor to discover new anticancer drugs.We developed a novel telomere complementary (TC) oligonucleotide modified AuNP probe (TC-AuNPs) for colorimetric analysis of telomerase activity. The mechanism of this method is that the telomerase reaction products (TRP), which can hybridize with the TC-AuNPs, are able to protect the AuNPs from the aggregation induced by salt. It is demonstrated that the colorimetric method enabled the analysis of the telomerase activity in 1000 HeLa cells with the naked eye, and down to 100 HeLa cells with the aid of UV-Vis spectroscopy. This strategy is not only convenient and sensitive, but also has a tunable dynamic range. The platform is also applicable for the initial screening of a telomerase inhibitor to discover new anticancer drugs. Electronic supplementary information (ESI) available. See DOI: 10.1039/c3nr05185d

  11. Sensitive detection of multiple pathogens using a single DNA probe.

    PubMed

    Nordin, Noordiana; Yusof, Nor Azah; Abdullah, Jaafar; Radu, Son; Hushiarian, Roozbeh

    2016-12-15

    A simple but promising electrochemical DNA nanosensor was designed, constructed and applied to differentiate a few food-borne pathogens. The DNA probe was initially designed to have a complementary region in Vibrio parahaemolyticus (VP) genome and to make different hybridization patterns with other selected pathogens. The sensor was based on a screen printed carbon electrode (SPCE) modified with polylactide-stabilized gold nanoparticles (PLA-AuNPs) and methylene blue (MB) was employed as the redox indicator binding better to single-stranded DNA. The immobilization and hybridization events were assessed using differential pulse voltammetry (DPV). The fabricated biosensor was able to specifically distinguish complementary, non-complementary and mismatched oligonucleotides. DNA was measured in the range of 2.0×10(-9)-2.0×10(-13)M with a detection limit of 5.3×10(-12)M. The relative standard deviation for 6 replications of DPV measurement of 0.2µM complementary DNA was 4.88%. The fabricated DNA biosensor was considered stable and portable as indicated by a recovery of more than 80% after a storage period of 6 months at 4-45°C. Cross-reactivity studies against various food-borne pathogens showed a reliably sensitive detection of VP. Copyright © 2016 Elsevier B.V. All rights reserved.

  12. Trypanosomatidae: a spliced-leader-derived probe specific for the genus Phytomonas.

    PubMed

    Teixeira, M M; Serrano, M G; Nunes, L R; Campaner, M; Buck, G A; Camargo, E P

    1996-12-01

    We probed DNA from all trypanosomatid genera by slot blot hybridization with an oligonucleotide (SL3') complementary to a sequence of the Phytomonas spliced-leader or mini-exon RNA. The 19-nucleotide probe target site was previously shown to be highly conserved among a limited number of Phytomonas isolates, but diverges in other kinetoplastid genera. Our examination of 84 isolates of various genera of trypanosomatids showed hybridization of this probe exclusively with isolates from plants or insects which could, by morphological, biochemical, and molecular criteria, be considered to belong to the genus Phytomonas. In contrast, no hybridization was observed with flagellates of the genera Blastocrithidia, Crithidia, Endotrypanum, Herpetomonas, Leptomonas, Leishmania, and Trypanosoma. The method detected DNA quantities as low as 50 ng using either radioactive or nonradioactive probes, and was effective with as few as 10(4) intact flagellates. Together, these results suggest that this probe will serve as a convenient marker for taxonomic and epidemiological studies requiring reliable identification of Phytomonas spp. in plants or in putative insect vectors.

  13. Detection with synthetic oligonucleotide probes of nucleotide sequence variations in the genes encoding enterotoxins of Escherichia coli.

    PubMed Central

    Nishibuchi, M; Murakami, A; Arita, M; Jikuya, H; Takano, J; Honda, T; Miwatani, T

    1989-01-01

    We examined variations in the genes encoding heat-stable enterotoxin (ST) and heat-labile enterotoxin (LT) in 88 strains of Escherichia coli isolated from individuals with traveler's diarrhea to find suitable sequences for use as oligonucleotide probes. Four oligonucleotide probes of the gene encoding ST of human origin (STIb or STh), one oligonucleotide probe of the gene encoding ST of porcine origin (STIa or STp), and three oligonucleotide probes of the gene encoding LT of human origin (LTIh) were used in DNA colony hybridization tests. In 15 of 22 strains possessing the STh gene and 28 of 42 strains producing LT, the sequences of all regions tested were identical to the published sequences. One region in the STh gene examined with a 18-mer probe was relatively well conserved and was shown to be closely associated with the enterotoxicity of the E. coli strains in suckling mice. This oligonucleotide, however, hybridized with strains of Vibrio cholerae O1, V. parahaemolyticus, and Yersinia enterocolitica that gave negative results in the suckling mouse assay. PMID:2685027

  14. Identifying members of the domain Archaea with rRNA-targeted oligonucleotide probes.

    PubMed

    Burggraf, S; Mayer, T; Amann, R; Schadhauser, S; Woese, C R; Stetter, K O

    1994-09-01

    Two 16S rRNA-targeted oligonucleotide probes were designed for the archaeal kingdoms Euryachaeota and Crenarchaeota. Probe specificities were evaluated by nonradioactive dot blot hybridization against selected reference organisms. The successful application of fluorescent-probe derivatives for whole-cell hybridization required organism-specific optimizations of fixation and hybridization conditions to assure probe penetration and morphological integrity of the cells. The probes allowed preliminary grouping of three new hyperthermophilic isolates. Together with other group-specific rRNA-targeted oligonucleotide probes, these probes will facilitate rapid in situ monitoring of the populations present in hydrothermal systems and support cultivation attempts.

  15. Unlabeled Oligonucleotides as Internal Temperature Controls for Genotyping by Amplicon Melting

    PubMed Central

    Seipp, Michael T.; Durtschi, Jacob D.; Liew, Michael A.; Williams, Jamie; Damjanovich, Kristy; Pont-Kingdon, Genevieve; Lyon, Elaine; Voelkerding, Karl V.; Wittwer, Carl T.

    2007-01-01

    Amplicon melting is a closed-tube method for genotyping that does not require probes, real-time analysis, or allele-specific polymerase chain reaction. However, correct differentiation of homozygous mutant and wild-type samples by melting temperature (Tm) requires high-resolution melting and closely controlled reaction conditions. When three different DNA extraction methods were used to isolate DNA from whole blood, amplicon Tm differences of 0.03 to 0.39°C attributable to the extractions were observed. To correct for solution chemistry differences between samples, complementary unlabeled oligonucleotides were included as internal temperature controls to shift and scale the temperature axis of derivative melting plots. This adjustment was applied to a duplex amplicon melting assay for the methylenetetrahydrofolate reductase variants 1298A>C and 677C>T. High- and low-temperature controls bracketing the amplicon melting region decreased the Tm SD within homozygous genotypes by 47 to 82%. The amplicon melting assay was 100% concordant to an adjacent hybridization probe (HybProbe) melting assay when temperature controls were included, whereas a 3% error rate was observed without temperature correction. In conclusion, internal temperature controls increase the accuracy of genotyping by high-resolution amplicon melting and should also improve results on lower resolution instruments. PMID:17591926

  16. Hairpin-Hairpin Molecular Beacon Interactions for Detection of Survivin mRNA in Malignant SW480 Cells.

    PubMed

    Ratajczak, Katarzyna; Krazinski, Bartlomiej E; Kowalczyk, Anna E; Dworakowska, Beata; Jakiela, Slawomir; Stobiecka, Magdalena

    2018-05-07

    Cancer biomarkers offer unique prospects for the development of cancer diagnostics and therapy. One of such biomarkers, protein survivin (Sur), exhibits strong antiapoptotic and proliferation-enhancing properties and is heavily expressed in multiple cancers. Thus, it can be utilized to provide new modalities for modulating the cell-growth rate, essential for effective cancer treatment. Herein, we have focused on the development of a new survivin-based cancer detection platform for colorectal cancer cells SW480 using a turn-on fluorescence oligonucleotide molecular beacon (MB) probe, encoded to recognize Sur messenger RNA (mRNA). Contrary to the expectations, we have found that both the complementary target oligonucleotide strands as well as the single- and double-mismatch targets, instead of exhibiting the anticipated simple random conformations, preferentially formed secondary structure motifs by folding into small-loop hairpin structures. Such a conformation may interfere with, or even undermine, the biorecognition process. To gain better understanding of the interactions involved, we have replaced the classical Tyagi-Kramer model of interactions between a straight target oligonucleotide strand and a hairpin MB with a new model to account for the hairpin-hairpin interactions as the biorecognition principle. A detailed mechanism of these interactions has been proposed. Furthermore, in experimental work, we have demonstrated an efficient transfection of malignant SW480 cells with SurMB probes containing a fluorophore Joe (SurMB-Joe) using liposomal nanocarriers. The green emission from SurMB-Joe in transfected cancer cells, due to the hybridization of the SurMB-Joe loop with Sur mRNA hairpin target, corroborates Sur overexpression. On the other hand, healthy human-colon epithelial cells CCD 841 CoN show only negligible expression of survivin mRNA. These experiments provide the proof-of-concept for distinguishing between the cancer and normal cells by the proposed hairpin-hairpin interaction method. The single nucleotide polymorphism sensitivity and a low detection limit of 26 nM (S/N = 3σ) for complementary targets have been achieved.

  17. Combined in vitro transcription and reverse transcription to amplify and label complex synthetic oligonucleotide probe libraries.

    PubMed

    Murgha, Yusuf; Beliveau, Brian; Semrau, Kassandra; Schwartz, Donald; Wu, Chao-Ting; Gulari, Erdogan; Rouillard, Jean-Marie

    2015-06-01

    Oligonucleotide microarrays allow the production of complex custom oligonucleotide libraries for nucleic acid detection-based applications such as fluorescence in situ hybridization (FISH). We have developed a PCR-free method to make single-stranded DNA (ssDNA) fluorescent probes through an intermediate RNA library. A double-stranded oligonucleotide library is amplified by transcription to create an RNA library. Next, dye- or hapten-conjugate primers are used to reverse transcribe the RNA to produce a dye-labeled cDNA library. Finally the RNA is hydrolyzed under alkaline conditions to obtain the single-stranded fluorescent probes library. Starting from unique oligonucleotide library constructs, we present two methods to produce single-stranded probe libraries. The two methods differ in the type of reverse transcription (RT) primer, the incorporation of fluorescent dye, and the purification of fluorescent probes. The first method employs dye-labeled reverse transcription primers to produce multiple differentially single-labeled probe subsets from one microarray library. The fluorescent probes are purified from excess primers by oligonucleotide-bead capture. The second method uses an RNA:DNA chimeric primer and amino-modified nucleotides to produce amino-allyl probes. The excess primers and RNA are hydrolyzed under alkaline conditions, followed by probe purification and labeling with amino-reactive dyes. The fluorescent probes created by the combination of transcription and reverse transcription can be used for FISH and to detect any RNA and DNA targets via hybridization.

  18. Repeat sequence chromosome specific nucleic acid probes and methods of preparing and using

    DOEpatents

    Weier, H.U.G.; Gray, J.W.

    1995-06-27

    A primer directed DNA amplification method to isolate efficiently chromosome-specific repeated DNA wherein degenerate oligonucleotide primers are used is disclosed. The probes produced are a heterogeneous mixture that can be used with blocking DNA as a chromosome-specific staining reagent, and/or the elements of the mixture can be screened for high specificity, size and/or high degree of repetition among other parameters. The degenerate primers are sets of primers that vary in sequence but are substantially complementary to highly repeated nucleic acid sequences, preferably clustered within the template DNA, for example, pericentromeric alpha satellite repeat sequences. The template DNA is preferably chromosome-specific. Exemplary primers and probes are disclosed. The probes of this invention can be used to determine the number of chromosomes of a specific type in metaphase spreads, in germ line and/or somatic cell interphase nuclei, micronuclei and/or in tissue sections. Also provided is a method to select arbitrarily repeat sequence probes that can be screened for chromosome-specificity. 18 figs.

  19. Repeat sequence chromosome specific nucleic acid probes and methods of preparing and using

    DOEpatents

    Weier, Heinz-Ulrich G.; Gray, Joe W.

    1995-01-01

    A primer directed DNA amplification method to isolate efficiently chromosome-specific repeated DNA wherein degenerate oligonucleotide primers are used is disclosed. The probes produced are a heterogeneous mixture that can be used with blocking DNA as a chromosome-specific staining reagent, and/or the elements of the mixture can be screened for high specificity, size and/or high degree of repetition among other parameters. The degenerate primers are sets of primers that vary in sequence but are substantially complementary to highly repeated nucleic acid sequences, preferably clustered within the template DNA, for example, pericentromeric alpha satellite repeat sequences. The template DNA is preferably chromosome-specific. Exemplary primers ard probes are disclosed. The probes of this invention can be used to determine the number of chromosomes of a specific type in metaphase spreads, in germ line and/or somatic cell interphase nuclei, micronuclei and/or in tissue sections. Also provided is a method to select arbitrarily repeat sequence probes that can be screened for chromosome-specificity.

  20. PNA-COMBO-FISH: From combinatorial probe design in silico to vitality compatible, specific labelling of gene targets in cell nuclei.

    PubMed

    Müller, Patrick; Rößler, Jens; Schwarz-Finsterle, Jutta; Schmitt, Eberhard; Hausmann, Michael

    2016-07-01

    Recently, advantages concerning targeting specificity of PCR constructed oligonucleotide FISH probes in contrast to established FISH probes, e.g. BAC clones, have been demonstrated. These techniques, however, are still using labelling protocols with DNA denaturing steps applying harsh heat treatment with or without further denaturing chemical agents. COMBO-FISH (COMBinatorial Oligonucleotide FISH) allows the design of specific oligonucleotide probe combinations in silico. Thus, being independent from primer libraries or PCR laboratory conditions, the probe sequences extracted by computer sequence data base search can also be synthesized as single stranded PNA-probes (Peptide Nucleic Acid probes) or TINA-DNA (Twisted Intercalating Nucleic Acids). Gene targets can be specifically labelled with at least about 20 probes obtaining visibly background free specimens. By using appropriately designed triplex forming oligonucleotides, the denaturing procedures can completely be omitted. These results reveal a significant step towards oligonucleotide-FISH maintaining the 3d-nanostructure and even the viability of the cell target. The method is demonstrated with the detection of Her2/neu and GRB7 genes, which are indicators in breast cancer diagnosis and therapy. Copyright © 2016. Published by Elsevier Inc.

  1. A fluorescent radioiodinated oligonucleotidic photoaffinity probe for protein labeling: synthesis and photolabeling of thrombin.

    PubMed

    Berens, C; Courtoy, P J; Sonveaux, E

    1999-01-01

    To study the interactions between oligonucleotides and proteins, an original photoaffinity radiolabeling probe has been synthesized. Starting with a 5'-pyridyldithio-3'-amino-oligonucleotide, the photophore benzophenone was first coupled to the 3' end, through acylation by an activated ester of benzoylbenzoic acid. A fluorescein molecule was grafted by alkylation of the free 5'-SH. This compound was finally radiolabeled with 125I using IodoBeads. The selective photolabeling of thrombin in a complex protein mixture by the radioiodinated probe validates this strategy to identify oligonucleotide-binding proteins.

  2. PNA-COMBO-FISH: From combinatorial probe design in silico to vitality compatible, specific labelling of gene targets in cell nuclei

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Müller, Patrick; Rößler, Jens; Schwarz-Finsterle, Jutta

    Recently, advantages concerning targeting specificity of PCR constructed oligonucleotide FISH probes in contrast to established FISH probes, e.g. BAC clones, have been demonstrated. These techniques, however, are still using labelling protocols with DNA denaturing steps applying harsh heat treatment with or without further denaturing chemical agents. COMBO-FISH (COMBinatorial Oligonucleotide FISH) allows the design of specific oligonucleotide probe combinations in silico. Thus, being independent from primer libraries or PCR laboratory conditions, the probe sequences extracted by computer sequence data base search can also be synthesized as single stranded PNA-probes (Peptide Nucleic Acid probes). Gene targets can be specifically labelled with atmore » least about 20 PNA-probes obtaining visibly background free specimens. By using appropriately designed triplex forming oligonucleotides, the denaturing procedures can completely be omitted. These results reveal a significant step towards oligonucleotide-FISH maintaining the 3D-nanostructure and even the viability of the cell target. The method is demonstrated with the detection of Her2/neu and GRB7 genes, which are indicators in breast cancer diagnosis and therapy. - Highlights: • Denaturation free protocols preserve 3D architecture of chromosomes and nuclei. • Labelling sets are determined in silico for duplex and triplex binding. • Probes are produced chemically with freely chosen backbones and base variants. • Peptide nucleic acid backbones reduce hindering charge interactions. • Intercalating side chains stabilize binding of short oligonucleotides.« less

  3. Rapid method to detect duplex formation in sequencing by hybridization methods

    DOEpatents

    Mirzabekov, A.D.; Timofeev, E.N.; Florentiev, V.L.; Kirillov, E.V.

    1999-01-19

    A method for determining the existence of duplexes of oligonucleotide complementary molecules is provided. A plurality of immobilized oligonucleotide molecules, each of a specific length and each having a specific base sequence, is contacted with complementary, single stranded oligonucleotide molecules to form a duplex. Each duplex facilitates intercalation of a fluorescent dye between the base planes of the duplex. The invention also provides for a method for constructing oligonucleotide matrices comprising confining light sensitive fluid to a surface and exposing the light-sensitive fluid to a light pattern. This causes the fluid exposed to the light to coalesce into discrete units and adhere to the surface. This places each of the units in contact with a set of different oligonucleotide molecules so as to allow the molecules to disperse into the units. 13 figs.

  4. Rapid method to detect duplex formation in sequencing by hybridization methods

    DOEpatents

    Mirzabekov, Andrei Darievich; Timofeev, Edward Nikolaevich; Florentiev, Vladimer Leonidovich; Kirillov, Eugene Vladislavovich

    1999-01-01

    A method for determining the existence of duplexes of oligonucleotide complementary molecules is provided whereby a plurality of immobilized oligonucleotide molecules, each of a specific length and each having a specific base sequence, is contacted with complementary, single stranded oligonucleotide molecules to form a duplex so as to facilitate intercalation of a fluorescent dye between the base planes of the duplex. The invention also provides for a method for constructing oligonucleotide matrices comprising confining light sensitive fluid to a surface, exposing said light-sensitive fluid to a light pattern so as to cause the fluid exposed to the light to coalesce into discrete units and adhere to the surface; and contacting each of the units with a set of different oligonucleotide molecules so as to allow the molecules to disperse into the units.

  5. Furan Decorated Nucleoside Analogues as Fluorescent Probes: synthesis, photophysical evaluation and site-specific incorporation

    PubMed Central

    Greco, Nicholas J.; Tor, Yitzhak

    2007-01-01

    The synthesis and photophysical evaluation of modified nucleoside analogues in which a five-membered heterocycle (furan, thiophene, oxazole and thiazole) is attached to the 5 position of 2′-deoxyuridine are reported. The furan containing derivative is identified as the most promising responsive nucleoside of this family due to its emission quantum efficiency and degree of sensitivity to its microenvironment. The furan moiety was then attached to the 5 position of 2′-deoxycytidine as well as the 8 position of adenosine and guanosine. Photophysical evaluation of these four furan containing nucleoside analogues reveal distinct differences in the absorption, emission and quantum efficiency depending upon the class of nucleoside (pyrimidine or purine). Comparing the photophysical properties of all furan containing nucleosides, identifies the furan thymidine analogue, 5-(fur-2-yl)-2′-deoxyuridine, as the best candidate for use as a responsive fluorescent probe in nucleic acids. 5-(fur-2-yl)-2′-deoxyuridine was then converted to the corresponding phosphoramidite and site specifically incorporated into DNA oligonucleotides with greater than 88% coupling efficiency. Such furan-modified oligonucleotides form stable duplexes upon hybridization to their complementary DNA strands and display favorable fluorescent features. PMID:18431439

  6. Label-free electrochemical genosensor based on mesoporous silica thin film.

    PubMed

    Saadaoui, Maroua; Fernández, Iñigo; Luna, Gema; Díez, Paula; Campuzano, Susana; Raouafi, Noureddine; Sánchez, Alfredo; Pingarrón, José M; Villalonga, Reynaldo

    2016-10-01

    A novel label-free electrochemical strategy for nucleic acid detection was developed by using gold electrodes coated with mesoporous silica thin films as sensing interface. The biosensing approach relies on the covalent attachment of a capture DNA probe on the surface of the silica nanopores and further hybridization with its complementary target oligonucleotide sequence, causing a diffusion hindering of an Fe(CN)6 (3-/4-) electrochemical probe through the nanochannels of the mesoporous film. This DNA-mesoporous silica thin film-modified electrodes allowed sensitive (91.7 A/M) and rapid (45 min) detection of low nanomolar levels of synthetic target DNA (25 fmol) and were successfully employed to quantify the endogenous content of Escherichia coli 16S ribosomal RNA (rRNA) directly in raw bacterial lysate samples without isolation or purification steps. Moreover, the 1-month stability demonstrated by these biosensing devices enables their advanced preparation and storage, as desired for practical real-life applications. Graphical abstract Mesoporous silica thin films as scaffolds for the development of novel label-free electrochemical genosensors to perform selective, sensitive and rapid detection of target oligonucleotide sequences. Application towards E. coli determination.

  7. Universal Oligonucleotide Microarray for Sub-Typing of Influenza A Virus

    PubMed Central

    Ryabinin, Vladimir A.; Kostina, Elena V.; Maksakova, Galiya A.; Neverov, Alexander A.; Chumakov, Konstantin M.; Sinyakov, Alexander N.

    2011-01-01

    A universal microchip was developed for genotyping Influenza A viruses. It contains two sets of oligonucleotide probes allowing viruses to be classified by the subtypes of hemagglutinin (H1–H13, H15, H16) and neuraminidase (N1–N9). Additional sets of probes are used to detect H1N1 swine influenza viruses. Selection of probes was done in two steps. Initially, amino acid sequences specific to each subtype were identified, and then the most specific and representative oligonucleotide probes were selected. Overall, between 19 and 24 probes were used to identify each subtype of hemagglutinin (HA) and neuraminidase (NA). Genotyping included preparation of fluorescently labeled PCR amplicons of influenza virus cDNA and their hybridization to microarrays of specific oligonucleotide probes. Out of 40 samples tested, 36 unambiguously identified HA and NA subtypes of Influenza A virus. PMID:21559081

  8. Fluorescent triplex-forming DNA oligonucleotides labeled with a thiazole orange dimer unit

    PubMed Central

    Ikeda, Shuji; Yanagisawa, Hiroyuki; Yuki, Mizue; Okamoto, Akimitsu

    2013-01-01

    Fluorescent probes for the detection of a double-stranded DNA were prepared by labeling a triplex-forming DNA oligonucleotide with a thiazole orange (TO) dimer unit. They belong to ECHO (exciton-controlled hybridization-sensitive fluorescent oligonucleotide) probes which we have previously reported. The excitonic interaction between the two TO molecules was expected to effectively suppress the background fluorescence of the probes. The applicability of the ECHO probes for the detection of double-stranded DNA was confirmed by examining the thermal stability and photophysical and kinetic properties of the DNA triplexes formed by the ECHO probes. PMID:23445822

  9. Rapid method to detect duplex formation in sequencing by hybridization methods, a method for constructing containment structures for reagent interaction

    DOEpatents

    Mirzabekov, Andrei Darievich; Yershov, Gennadiy Moiseyevich; Guschin, Dmitry Yuryevich; Gemmell, Margaret Anne; Shick, Valentine V.; Proudnikov, Dmitri Y.; Timofeev, Edward N.

    2002-01-01

    A method for determining the existence of duplexes of oligonucleotide complementary molecules is provided whereby a plurality of immobilized oligonucleotide molecules, each of a specific length and each having a specific base sequence, is contacted with complementary, single stranded oligonucleotide molecules to form a duplex so as to facilitate intercalation of a fluorescent dye between the base planes of the duplex. The invention also provides for a method for constructing oligonucleotide matrices comprising confining light sensitive fluid to a surface, exposing said light-sensitive fluid to a light pattern so as to cause the fluid exposed to the light to polymerize into discrete units and adhere to the surface; and contacting each of the units with a set of different oligonucleotide molecules so as to allow the molecules to disperse into the units.

  10. OCaPPI-Db: an oligonucleotide probe database for pathogen identification through hybridization capture.

    PubMed

    Gasc, Cyrielle; Constantin, Antony; Jaziri, Faouzi; Peyret, Pierre

    2017-01-01

    The detection and identification of bacterial pathogens involved in acts of bio- and agroterrorism are essential to avoid pathogen dispersal in the environment and propagation within the population. Conventional molecular methods, such as PCR amplification, DNA microarrays or shotgun sequencing, are subject to various limitations when assessing environmental samples, which can lead to inaccurate findings. We developed a hybridization capture strategy that uses a set of oligonucleotide probes to target and enrich biomarkers of interest in environmental samples. Here, we present Oligonucleotide Capture Probes for Pathogen Identification Database (OCaPPI-Db), an online capture probe database containing a set of 1,685 oligonucleotide probes allowing for the detection and identification of 30 biothreat agents up to the species level. This probe set can be used in its entirety as a comprehensive diagnostic tool or can be restricted to a set of probes targeting a specific pathogen or virulence factor according to the user's needs. : http://ocappidb.uca.works. © The Author(s) 2017. Published by Oxford University Press.

  11. DNA attachment to support structures

    DOEpatents

    Balhorn, Rodney L.; Barry, Christopher H.

    2002-01-01

    Microscopic beads or other structures are attached to nucleic acids (DNA) using a terminal transferase. The transferase adds labeled dideoxy nucleotide bases to the ends of linear strands of DNA. The labels, such as the antigens digoxigenin and biotin, bind to the antibody compounds or other appropriate complementary ligands, which are bound to the microscopic beads or other support structures. The method does not require the synthesis of a synthetic oligonucleotide probe. The method can be used to tag or label DNA even when the DNA has an unknown sequence, has blunt ends, or is a very large fragment (e.g., >500 kilobase pairs).

  12. Predicting oligonucleotide affinity to nucleic acid targets.

    PubMed Central

    Mathews, D H; Burkard, M E; Freier, S M; Wyatt, J R; Turner, D H

    1999-01-01

    A computer program, OligoWalk, is reported that predicts the equilibrium affinity of complementary DNA or RNA oligonucleotides to an RNA target. This program considers the predicted stability of the oligonucleotide-target helix and the competition with predicted secondary structure of both the target and the oligonucleotide. Both unimolecular and bimolecular oligonucleotide self structure are considered with a user-defined concentration. The application of OligoWalk is illustrated with three comparisons to experimental results drawn from the literature. PMID:10580474

  13. Targeted self-assembly of functionalized carbon nanotubes on tumors

    DOEpatents

    Scheinberg, David A.; McDevitt, Michael R.; Villa, Carlos H.; Mulvey, J. Justin

    2018-05-22

    Provided herein are methods for delivering a molecule in situ to a cell and for treating a cancer via the in situ delivery. The methods comprise contacting or administering to the cell, as two separate components, a morpholino oligonucleotide comprising a targeting moiety followed by a single wall nanotube construct comprising second morpholino oligonucleotides complementary to the first morpholino oligonucleotides and one or both of a therapeutic or diagnostic payload molecule linked to the single wall nanotube construct. Upon self-assembly of a single wall nanotube complex via hybridization of the first morpholino and second complementary morpholino oligonucleotides at the cell, the payload molecule is delivered. Also provided is the two component self-assembly single wall nanotube system and the single wall nanotube construct comprising the second component.

  14. Oligonucleotide primers, probes and molecular methods for the environmental monitoring of methanogenic archaea

    PubMed Central

    Narihiro, Takashi; Sekiguchi, Yuji

    2011-01-01

    Summary For the identification and quantification of methanogenic archaea (methanogens) in environmental samples, various oligonucleotide probes/primers targeting phylogenetic markers of methanogens, such as 16S rRNA, 16S rRNA gene and the gene for the α‐subunit of methyl coenzyme M reductase (mcrA), have been extensively developed and characterized experimentally. These oligonucleotides were designed to resolve different groups of methanogens at different taxonomic levels, and have been widely used as hybridization probes or polymerase chain reaction primers for membrane hybridization, fluorescence in situ hybridization, rRNA cleavage method, gene cloning, DNA microarray and quantitative polymerase chain reaction for studies in environmental and determinative microbiology. In this review, we present a comprehensive list of such oligonucleotide probes/primers, which enable us to determine methanogen populations in an environment quantitatively and hierarchically, with examples of the practical applications of the probes and primers. PMID:21375721

  15. Quartz crystal microbalance (QCM) affinity biosensor for genetically modified organisms (GMOs) detection.

    PubMed

    Mannelli, Ilaria; Minunni, Maria; Tombelli, Sara; Mascini, Marco

    2003-03-01

    A DNA piezoelectric sensor has been developed for the detection of genetically modified organisms (GMOs). Single stranded DNA (ssDNA) probes were immobilised on the sensor surface of a quartz crystal microbalance (QCM) device and the hybridisation between the immobilised probe and the target complementary sequence in solution was monitored. The probe sequences were internal to the sequence of the 35S promoter (P) and Nos terminator (T), which are inserted sequences in the genome of GMOs regulating the transgene expression. Two different probe immobilisation procedures were applied: (a) a thiol-dextran procedure and (b) a thiol-derivatised probe and blocking thiol procedure. The system has been optimised using synthetic oligonucleotides, which were then applied to samples of plasmidic and genomic DNA isolated from the pBI121 plasmid, certified reference materials (CRM), and real samples amplified by the polymerase chain reaction (PCR). The analytical parameters of the sensor have been investigated (sensitivity, reproducibility, lifetime etc.). The results obtained showed that both immobilisation procedures enabled sensitive and specific detection of GMOs, providing a useful tool for screening analysis in food samples.

  16. Ion-channel genosensor for the detection of specific DNA sequences derived from Plum Pox Virus in plant extracts.

    PubMed

    Malecka, Kamila; Michalczuk, Lech; Radecka, Hanna; Radecki, Jerzy

    2014-10-09

    A DNA biosensor for detection of specific oligonucleotides sequences of Plum Pox Virus (PPV) in plant extracts and buffer is proposed. The working principles of a genosensor are based on the ion-channel mechanism. The NH2-ssDNA probe was deposited onto a glassy carbon electrode surface to form an amide bond between the carboxyl group of oxidized electrode surface and amino group from ssDNA probe. The analytical signals generated as a result of hybridization were registered in Osteryoung square wave voltammetry in the presence of [Fe(CN)6]3-/4- as a redox marker. The 22-mer and 42-mer complementary ssDNA sequences derived from PPV and DNA samples from plants infected with PPV were used as targets. Similar detection limits of 2.4 pM (31.0 pg/mL) and 2.3 pM (29.5 pg/mL) in the concentration range 1-8 pM were observed in the presence of the 22-mer ssDNA and 42-mer complementary ssDNA sequences of PPV, respectively. The genosensor was capable of discriminating between samples consisting of extracts from healthy plants and leaf extracts from infected plants in the concentration range 10-50 pg/mL. The detection limit was 12.8 pg/mL. The genosensor displayed good selectivity and sensitivity. The 20-mer partially complementary DNA sequences with four complementary bases and DNA samples from healthy plants used as negative controls generated low signal.

  17. Chemoselective covalent coupling of oligonucleotide probes to self-assembled monolayers.

    PubMed

    Devaraj, Neal K; Miller, Gregory P; Ebina, Wataru; Kakaradov, Boyko; Collman, James P; Kool, Eric T; Chidsey, Christopher E D

    2005-06-22

    A chemoselective route to routinely and rapidly attach oligonucleotide probes to well-defined surfaces is presented. Cu(I) tris(benzyltriazolylmethyl)amine-catalyzed coupling of terminal acetylenes to azides on a self-assembled monolayer is used instead of traditional nucleophilic-electrophilic coupling reactions. The reaction proceeds well even in the presence of purposely introduced nucleophilic and electrophilic impurities. The density of oligonucleotide probes can be controlled by controlling the amount of azide functionality. Although most of our work was done on gold surfaces, this technique should be readily applicable to any surface on which an azide-containing monolayer can be assembled as we have preliminarily demonstrated by derivatizing azidotrimethoxysilane-modified glass slides with fluorescein-containing oligonucleotides.

  18. Antisense phosphorothioate oligonucleotides: selective killing of the intracellular parasite Leishmania amazonensis.

    PubMed

    Ramazeilles, C; Mishra, R K; Moreau, S; Pascolo, E; Toulmé, J J

    1994-08-16

    We targeted the mini-exon sequence, present at the 5' end of every mRNA of the protozoan parasite Leishmania amazonensis, by phosphorothioate oligonucleotides. A complementary 16-mer (16PS) was able to kill amastigotes--the intracellular stage of the parasite--in murine macrophages in culture. After 24 hr of incubation with 10 microM 16PS, about 30% infected macrophages were cured. The oligomer 16PS acted through antisense hybridization in a sequence-dependent way; no effect on parasites was observed with noncomplementary phosphorothioate oligonucleotides. The antisense oligonucleotide 16PS was a selective killer of the protozoans without any detrimental effect to the host macrophage. Using 16PS linked to a palmitate chain, which enabled it to complex with low density lipoproteins, improved the leishmanicidal efficiency on intracellular amastigotes, probably due to increased endocytosis. Phosphorothioate oligonucleotides complementary to the intron part of the mini-exon pre-RNA were also effective, suggesting that antisense oligomers could prevent trans-splicing in these parasites.

  19. Development of species-specific rDNA probes for Giardia by multiple fluorescent in situ hybridization combined with immunocytochemical identification of cyst wall antigens.

    PubMed

    Erlandsen, Stanley L; Jarroll, Edward; Wallis, Peter; van Keulen, Harry

    2005-08-01

    In this study, we describe the development of fluorescent oligonucleotide probes to variable regions in the small subunit of 16S rRNA in three distinct Giardia species. Sense and antisense probes (17-22 mer) to variable regions 1, 3, and 8 were labeled with digoxygenin or selected fluorochomes (FluorX, Cy3, or Cy5). Optimal results were obtained with fluorochome-labeled oligonucleotides for detection of rRNA in Giardia cysts. Specificity of fluorescent in situ hybridization (FISH) was shown using RNase digestion and high stringency to diminish the hybridization signal, and oligonucleotide probes for rRNA in Giardia lamblia, Giardia muris, and Giardia ardeae were shown to specifically stain rRNA only within cysts or trophozoites of those species. The fluorescent oligonucleotide specific for rRNA in human isolates of Giardia was positive for ten different strains. A method for simultaneous FISH detection of cysts using fluorescent antibody (genotype marker) and two oligonucleotide probes (species marker) permitted visualization of G. lamblia and G. muris cysts in the same preparation. Testing of an environmental water sample revealed the presence of FISH-positive G. lamblia cysts with a specific rDNA probe for rRNA, while negative cysts were presumed to be of animal or bird origin.

  20. Colorimetric DNA detection of transgenic plants using gold nanoparticles functionalized with L-shaped DNA probes

    NASA Astrophysics Data System (ADS)

    Nourisaeid, Elham; Mousavi, Amir; Arpanaei, Ayyoob

    2016-01-01

    In this study, a DNA colorimetric detection system based on gold nanoparticles functionalized with L-shaped DNA probes was prepared and evaluated. We investigated the hybridization efficiency of the L-shaped probes and studied the effect of nanoparticle size and the L-shaped DNA probe length on the performance of the as-prepared system. Probes were attached to the surface of gold nanoparticles using an adenine sequence. An optimal sequence of 35S rRNA gene promoter from the cauliflower mosaic virus, which is frequently used in the development of transgenic plants, and the two complementary ends of this gene were employed as model target strands and probe molecules, respectively. The spectrophotometric properties of the as-prepared systems indicated that the large NPs show better changes in the absorption spectrum and consequently present a better performance. The results of this study revealed that the probe/Au-NPs prepared using a vertical spacer containing 5 thymine oligonucleotides exhibited a stronger spectrophotometric response in comparison to that of larger probes. These results in general indicate the suitable performance of the L-shaped DNA probe-functionalized Au-NPs, and in particular emphasize the important role of the gold nanoparticle size and length of the DNA probes in enhancing the performance of such a system.

  1. Labeled nucleotide phosphate (NP) probes

    DOEpatents

    Korlach, Jonas [Ithaca, NY; Webb, Watt W [Ithaca, NY; Levene, Michael [Ithaca, NY; Turner, Stephen [Ithaca, NY; Craighead, Harold G [Ithaca, NY; Foquet, Mathieu [Ithaca, NY

    2009-02-03

    The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

  2. Conducting electrospun fibres with polyanionic grafts as highly selective, label-free, electrochemical biosensor with a low detection limit for non-Hodgkin lymphoma gene.

    PubMed

    Kerr-Phillips, Thomas E; Aydemir, Nihan; Chan, Eddie Wai Chi; Barker, David; Malmström, Jenny; Plesse, Cedric; Travas-Sejdic, Jadranka

    2018-02-15

    A highly selective, label-free sensor for the non-Hodgkin lymphoma gene, with an aM detection limit, utilizing electrochemical impedance spectroscopy (EIS) is presented. The sensor consists of a conducting electrospun fibre mat, surface-grafted with poly(acrylic acid) (PAA) brushes and a conducting polymer sensing element with covalently attached oligonucleotide probes. The sensor was fabricated from electrospun NBR rubber, embedded with poly(3,4-ethylenedioxythiophene) (PEDOT), followed by grafting poly(acrylic acid) brushes and then electrochemically polymerizing a conducting polymer monomer with ssDNA probe sequence pre-attached. The resulting non-Hodgkin lymphoma gene sensor showed a detection limit of 1aM (1 × 10 -18 mol/L), more than 400 folds lower compared to a thin-film analogue. The sensor presented extraordinary selectivity, with only 1%, 2.7% and 4.6% of the signal recorded for the fully non-complimentary, T-A and G-C base mismatch oligonucleotide sequences, respectively. We suggest that such greatly enhanced selectivity is due to the presence of negatively charged carboxylic acid moieties from PAA grafts that electrostatically repel the non-complementary and mismatch DNA sequences, overcoming the non-specific binding. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. A Highly Sensitive Oligonucleotide Hybridization Assay for Klebsiella pneumoniae Carbapenemase with the Probes on a Gold Nanoparticles Modified Glassy Carbon Electrode.

    PubMed

    Pan, Hong-zhi; Yu, Hong- Wei; Wang, Na; Zhang, Ze; Wan, Guang-Cai; Liu, Hao; Guan, Xue; Chang, Dong

    2015-01-01

    To develop a new electrochemical DNA biosensor for determination of Klebsiella pneumoniae carbapenemase, a highly sensitive and selective electrochemical biosensor for DNA detection was constructed based on a glassy carbon electrode (GCE) modified with gold nanoparticles (Au-nano). The Au-nano/GCE was characterized by scanning electromicroscopy, cyclic voltammetry, and electrochemical impedance spectroscopy. The hybridization detection was measured by differential pulse voltammetry using methylene blue as the hybridization indicator. The dynamic range of detection of the sensor for the target DNA sequences was from 1 × 10(-11) to 1 × 10(-8) M, with an LOD of 1 × 10(-12) M. The DNA biosensor had excellent specificity for distinguishing complementary DNA sequence in the presence of non-complementary and mismatched DNA sequence. The Au-nano/GCE showed significant improvement in electrochemical characteristics, and this biosensor was successfully applied for determination of K. pneumoniae.

  4. Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3;-terminus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yeo, Hyun Koo; Lee, Jae Young

    2012-04-18

    The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapor diffusion and diffracted to 2.8 {angstrom} resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 {angstrom}, {alpha} = 91.37, {beta} = 93.21, {gamma} = 92.35{sup o}.

  5. Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus.

    PubMed

    Yeo, Hyun Koo; Lee, Jae Young

    2010-05-01

    The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapour diffusion and diffracted to 2.8 A resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 A, alpha = 91.37, beta = 93.21, gamma = 92.35 degrees .

  6. Systematic validation and atomic force microscopy of non-covalent short oligonucleotide barcode microarrays.

    PubMed

    Cook, Michael A; Chan, Chi-Kin; Jorgensen, Paul; Ketela, Troy; So, Daniel; Tyers, Mike; Ho, Chi-Yip

    2008-02-06

    Molecular barcode arrays provide a powerful means to analyze cellular phenotypes in parallel through detection of short (20-60 base) unique sequence tags, or "barcodes", associated with each strain or clone in a collection. However, costs of current methods for microarray construction, whether by in situ oligonucleotide synthesis or ex situ coupling of modified oligonucleotides to the slide surface are often prohibitive to large-scale analyses. Here we demonstrate that unmodified 20mer oligonucleotide probes printed on conventional surfaces show comparable hybridization signals to covalently linked 5'-amino-modified probes. As a test case, we undertook systematic cell size analysis of the budding yeast Saccharomyces cerevisiae genome-wide deletion collection by size separation of the deletion pool followed by determination of strain abundance in size fractions by barcode arrays. We demonstrate that the properties of a 13K unique feature spotted 20 mer oligonucleotide barcode microarray compare favorably with an analogous covalently-linked oligonucleotide array. Further, cell size profiles obtained with the size selection/barcode array approach recapitulate previous cell size measurements of individual deletion strains. Finally, through atomic force microscopy (AFM), we characterize the mechanism of hybridization to unmodified barcode probes on the slide surface. These studies push the lower limit of probe size in genome-scale unmodified oligonucleotide microarray construction and demonstrate a versatile, cost-effective and reliable method for molecular barcode analysis.

  7. Microenvironmental Effect of 2'-O-(1-Pyrenylmethyl)uridine Modified Fluorescent Oligonucleotide Probes on Sensitive and Selective Detection of Target RNA.

    PubMed

    Imincan, Gülnur; Pei, Fen; Yu, Lijia; Jin, Hongwei; Zhang, Liangren; Yang, Xiaoda; Zhang, Lihe; Tang, XinJing

    2016-04-19

    2'-O-(1-Pyrenylmethyl)uridine modified oligoribonucleotides provide highly sensitive pyrene fluorescent probes for detecting specific nucleotide mutation of RNA targets. To develop more stable and cost-effective oligonucleotide probes, we investigated the local microenvironmental effects of nearby nucleobases on pyrene fluorescence in duplexes of RNAs and 2'-O-(1-pyrenylmethyl)uridine modified oligonucleotides. By incorporation of deoxyribonucleotides, ribonucleotides, 2'-MeO-nucleotides and 2'-F-nucleotides at both sides of 2'-O-(1-pyrenylmethyl)uridine (U(p)) in oligodeoxynucleotide probes, we synthesized a series of pyrene modified oligonucleotide probes. Their pyrene fluorescence emission spectra indicated that only two proximal nucleotides have a substantial effect on the pyrene fluorescence properties of these oligonucleotide probes hybridized with target RNA with an order of fluorescence sensitivity of 2'-F-nucleotides > 2'-MeO-nucleotides > ribonucleotides ≫ deoxyribonucleotides. While based on circular dichroism spectra, overall helix conformations (either A- or B-form) of the duplexes have marginal effects on the sensitivity of the probes. Instead, the local substitution reflected the propensity of the nucleotide sugar ring to adopt North type conformation and, accordingly, shifted their helix geometry toward a more A-type like conformation in local microenvironments. Thus, higher enhancement of pyrene fluorescence emission favored local A-type helix structures and more polar and hydrophobic environments (F > MeO > OH at 2' substitution) of duplex minor grooves of probes with the target RNA. Further dynamic simulation revealed that local microenvironmental effect of 2'-F-nucleotides or ribonucleotides was enough for pyrene moiety to move out of nucleobases to the minor groove of duplexes; in addition, 2'-F-nucleotide had less effect on π-stack of pyrene-modified uridine with upstream and downstream nucleobases. The present oligonucleotide probes successfully distinguished target RNA from single-mutated RNA analyte during an in vitro assay of RNA synthesis.

  8. Detection of iron-depositing Pedomicrobium species in native biofilms from the Odertal National Park by a new, specific FISH probe.

    PubMed

    Braun, Burga; Richert, Inga; Szewzyk, Ulrich

    2009-10-01

    Iron-depositing bacteria play an important role in technical water systems (water wells, distribution systems) due to their intense deposition of iron oxides and resulting clogging effects. Pedomicrobium is known as iron- and manganese-oxidizing and accumulating bacterium. The ability to detect and quantify members of this species in biofilm communities is therefore desirable. In this study the fluorescence in situ hybridization (FISH) method was used to detect Pedomicrobium in iron and manganese incrusted biofilms. Based on comparative sequence analysis, we designed and evaluated a specific oligonucleotide probe (Pedo 1250) complementary to the hypervariable region 8 of the 16S rRNA gene for Pedomicrobium. Probe specificities were tested against 3 different strains of Pedomicrobium and Sphingobium yanoikuyae as non-target organism. Using optimized conditions the probe hybridized with all tested strains of Pedomicrobium with an efficiency of 80%. The non-target organism showed no hybridization signals. The new FISH probe was applied successfully for the in situ detection of Pedomicrobium in different native, iron-depositing biofilms. The hybridization results of native bioflims using probe Pedo_1250 agreed with the results of the morphological structure of Pedomicrobium bioflims based on scanning electron microscopy.

  9. Exploring the Hybridization Thermodynamics of Spherical Nucleic Acids to Tailor Probes for Diagnostic and Therapeutic Applications

    NASA Astrophysics Data System (ADS)

    Randeria, Pratik Shailesh

    Spherical nucleic acids (SNAs), three-dimensional nanoparticle conjugates composed of densely packed and highly oriented oligonucleotides around organic or inorganic nanoparticles, are an emergent class of nanostructures that show promise as single-entity agents for intracellular messenger RNA (mRNA) detection and gene regulation. SNAs exhibit superior biocompatibility and biological properties compared to linear oligonucleotides, enabling them to overcome many of the limitations of linear oligonucleotides for use in biomedical applications. However, the origins of these biologically attractive properties are not well understood. In this dissertation, the chemistry underlying one such property is studied in detail, and the findings are applied towards the rational design of more effective SNAs for diagnostic and therapeutic applications. Chapter 1 introduces the synthesis of SNAs, the unique properties that make them superior to linear nucleic acids for biomedicine, and previously studied applications of these structures. Chapter 2 focuses on quantitatively studying the impact of the chemical structure of the SNA on its ability to hybridize multiple complementary nucleic acids. This chapter lays the groundwork for understanding the factors that govern SNA hybridization thermodynamics and how to tailor SNAs to increase their binding affinity to target mRNA strands. Chapters 3 and 4 capitalize on this knowledge to engineer probes for intracellular mRNA detection and gene regulation applications. Chapter 3 reports the development of an SNA-based probe that can simultaneously report the expression level of two different mRNA transcripts in live cells and differentiate diseased cells from non-diseased cells. Chapter 4 investigates the use of topically-applied SNAs to down-regulate a critical mediator of impaired wound healing in diabetic mice to accelerate wound closure. This study represents the first topical therapeutic application of SNA nanotechnology to treat open wounds and lays the groundwork for developing SNA-based approaches for treating any skin-related disorder with a known genetic signature. Chapter 5 summarizes the key findings and conclusions and introduces future research directions. Taken together, this work demonstrates the important, and often surprising, role nanostructure plays in controlling biological properties and supports the continued development of SNAs as probes for molecular and medical biology.

  10. Systematic Validation and Atomic Force Microscopy of Non-Covalent Short Oligonucleotide Barcode Microarrays

    PubMed Central

    Cook, Michael A.; Chan, Chi-Kin; Jorgensen, Paul; Ketela, Troy; So, Daniel; Tyers, Mike; Ho, Chi-Yip

    2008-01-01

    Background Molecular barcode arrays provide a powerful means to analyze cellular phenotypes in parallel through detection of short (20–60 base) unique sequence tags, or “barcodes”, associated with each strain or clone in a collection. However, costs of current methods for microarray construction, whether by in situ oligonucleotide synthesis or ex situ coupling of modified oligonucleotides to the slide surface are often prohibitive to large-scale analyses. Methodology/Principal Findings Here we demonstrate that unmodified 20mer oligonucleotide probes printed on conventional surfaces show comparable hybridization signals to covalently linked 5′-amino-modified probes. As a test case, we undertook systematic cell size analysis of the budding yeast Saccharomyces cerevisiae genome-wide deletion collection by size separation of the deletion pool followed by determination of strain abundance in size fractions by barcode arrays. We demonstrate that the properties of a 13K unique feature spotted 20 mer oligonucleotide barcode microarray compare favorably with an analogous covalently-linked oligonucleotide array. Further, cell size profiles obtained with the size selection/barcode array approach recapitulate previous cell size measurements of individual deletion strains. Finally, through atomic force microscopy (AFM), we characterize the mechanism of hybridization to unmodified barcode probes on the slide surface. Conclusions/Significance These studies push the lower limit of probe size in genome-scale unmodified oligonucleotide microarray construction and demonstrate a versatile, cost-effective and reliable method for molecular barcode analysis. PMID:18253494

  11. Oligonucleotides Containing Aminated 2'-Amino-LNA Nucleotides: Synthesis and Strong Binding to Complementary DNA and RNA.

    PubMed

    Lou, Chenguang; Samuelsen, Simone V; Christensen, Niels Johan; Vester, Birte; Wengel, Jesper

    2017-04-19

    Mono- and diaminated 2'-amino-LNA monomers were synthesized and introduced into oligonucleotides. Each modification imparts significant stabilization of nucleic acid duplexes and triplexes, excellent sequence selectivity, and significant nuclease resistance. Molecular modeling suggested that structural stabilization occurs via intrastrand electrostatic attraction between the protonated amino groups of the aminated 2'-amino-LNA monomers and the host oligonucleotide backbone.

  12. Interfacial transduction of nucleic acid hybridization using immobilized quantum dots as donors in fluorescence resonance energy transfer.

    PubMed

    Algar, W Russ; Krull, Ulrich J

    2009-01-06

    Fluorescence resonance energy transfer (FRET) using immobilized quantum dots (QDs) as energy donors was explored as a transduction method for the detection of nucleic acid hybridization at an interface. This research was motivated by the success of the QD-FRET-based transduction of nucleic acid hybridization in solution-phase assays. This new work represents a fundamental step toward the assembly of a biosensor, where immobilization of the selective chemistry on a surface is desired. After immobilizing QD-probe oligonucleotide conjugates on optical fibers, a demonstration of the retention of selectivity was achieved by the introduction of acceptor (Cy3)-labeled single-stranded target oligonucleotides. Hybridization generated the proximity required for FRET, and the resulting fluorescence spectra provided an analytical signal proportional to the amount of target. This research provides an important framework for the future development of nucleic acid biosensors based on QDs and FRET. The most important findings of this work are that (1) a QD-FRET solid-phase hybridization assay is viable and (2) a passivating layer of denatured bovine serum albumin alleviates nonspecific adsorption, ultimately resulting in (3) the potential for a reusable assay format and mismatch discrimination. In this, the first incarnation of a solid-phase QD-FRET hybridization assay, the limit of detection was found to be 5 nM, and the dynamic range was almost 2 orders of magnitude. Selective discrimination of the target was shown using a three-base-pairs mismatch from a fully complementary sequence. Despite a gradual loss of signal, reuse of the optical fibers over multiple cycles of hybridization and dehybridization was possible. Directions for further improvement of the analytical performance by optimizing the design of the QD-probe oligonucleotide interface are identified.

  13. Detection of Sub-fM DNA with Target Recycling and Self-Assembly Amplification on Graphene Field-Effect Biosensors

    PubMed Central

    2018-01-01

    All-electronic DNA biosensors based on graphene field-effect transistors (GFETs) offer the prospect of simple and cost-effective diagnostics. For GFET sensors based on complementary probe DNA, the sensitivity is limited by the binding affinity of the target oligonucleotide, in the nM range for 20 mer targets. We report a ∼20 000× improvement in sensitivity through the use of engineered hairpin probe DNA that allows for target recycling and hybridization chain reaction. This enables detection of 21 mer target DNA at sub-fM concentration and provides superior specificity against single-base mismatched oligomers. The work is based on a scalable fabrication process for biosensor arrays that is suitable for multiplexed detection. This approach overcomes the binding-affinity-dependent sensitivity of nucleic acid biosensors and offers a pathway toward multiplexed and label-free nucleic acid testing with high accuracy and selectivity. PMID:29768011

  14. Selection and characterization of a DNA aptamer to crystal violet.

    PubMed

    Chen, Yang; Wang, Jine; Zhang, Yajie; Xu, Lijun; Gao, Tian; Wang, Bing; Pei, Renjun

    2018-06-13

    Aptamers are short single-stranded DNA or RNA, which can be selected in vitro by systematic evolution of ligands by exponential enrichment (SELEX). In order to develop novel light-up probes to substitute G-quadruplex (G4), we selected a DNA aptamer for crystal violet (CV), a triphenylmethane light-up dye, by a modified affinity chromatography-based SELEX. The ssDNA pool was first coupled on streptavidin-coated agarose beads through a biotin labeled complementary oligonucleotide, and then the aptamer sequences would be released from agarose beads by CV affinity. This method is simple, straightforward and effective. The aptamer sequence with a low micromolar dissociation constant (Kd) and good specificity was achieved after 11 rounds of selection. The light-up properties of the CV-aptamer were also investigated, and the CV showed dramatic fluorescence enhancement. The CV-aptamer pair could be further used as a novel light-up fluorescent probe to design biosensors.

  15. Detection of Sub-fM DNA with Target Recycling and Self-Assembly Amplification on Graphene Field-Effect Biosensors.

    PubMed

    Gao, Zhaoli; Xia, Han; Zauberman, Jonathan; Tomaiuolo, Maurizio; Ping, Jinglei; Zhang, Qicheng; Ducos, Pedro; Ye, Huacheng; Wang, Sheng; Yang, Xinping; Lubna, Fahmida; Luo, Zhengtang; Ren, Li; Johnson, Alan T Charlie

    2018-06-13

    All-electronic DNA biosensors based on graphene field-effect transistors (GFETs) offer the prospect of simple and cost-effective diagnostics. For GFET sensors based on complementary probe DNA, the sensitivity is limited by the binding affinity of the target oligonucleotide, in the nM range for 20 mer targets. We report a ∼20 000× improvement in sensitivity through the use of engineered hairpin probe DNA that allows for target recycling and hybridization chain reaction. This enables detection of 21 mer target DNA at sub-fM concentration and provides superior specificity against single-base mismatched oligomers. The work is based on a scalable fabrication process for biosensor arrays that is suitable for multiplexed detection. This approach overcomes the binding-affinity-dependent sensitivity of nucleic acid biosensors and offers a pathway toward multiplexed and label-free nucleic acid testing with high accuracy and selectivity.

  16. Label-Free Potentiometry for Detecting DNA Hybridization Using Peptide Nucleic Acid and DNA Probes

    PubMed Central

    Goda, Tatsuro; Singi, Ankit Balram; Maeda, Yasuhiro; Matsumoto, Akira; Torimura, Masaki; Aoki, Hiroshi; Miyahara, Yuji

    2013-01-01

    Peptide nucleic acid (PNA) has outstanding affinity over DNA for complementary nucleic acid sequences by forming a PNA-DNA heterodimer upon hybridization via Watson-Crick base-pairing. To verify whether PNA probes on an electrode surface enhance sensitivity for potentiometric DNA detection or not, we conducted a comparative study on the hybridization of PNA and DNA probes on the surface of a 10-channel gold electrodes microarray. Changes in the charge density as a result of hybridization at the solution/electrode interface on the self-assembled monolayer (SAM)-formed microelectrodes were directly transformed into potentiometric signals using a high input impedance electrometer. The charge readout allows label-free, reagent-less, and multi-parallel detection of target oligonucleotides without any optical assistance. The differences in the probe lengths between 15- to 22-mer dramatically influenced on the sensitivity of the PNA and DNA sensors. Molecular type of the capturing probe did not affect the degree of potential shift. Theoretical model for charged rod-like duplex using the Gouy-Chapman equation indicates the dominant effect of electrostatic attractive forces between anionic DNA and underlying electrode at the electrolyte/electrode interface in the potentiometry. PMID:23435052

  17. A regenerated electrochemical biosensor for label-free detection of glucose and urea based on conformational switch of i-motif oligonucleotide probe.

    PubMed

    Gao, Zhong Feng; Chen, Dong Mei; Lei, Jing Lei; Luo, Hong Qun; Li, Nian Bing

    2015-10-15

    Improving the reproducibility of electrochemical signal remains a great challenge over the past decades. In this work, i-motif oligonucleotide probe-based electrochemical DNA (E-DNA) sensor is introduced for the first time as a regenerated sensing platform, which enhances the reproducibility of electrochemical signal, for label-free detection of glucose and urea. The addition of glucose or urea is able to activate glucose oxidase-catalyzed or urease-catalyzed reaction, inducing or destroying the formation of i-motif oligonucleotide probe. The conformational switch of oligonucleotide probe can be recorded by electrochemical impedance spectroscopy. Thus, the difference of electron transfer resistance is utilized for the quantitative determination of glucose and urea. We further demonstrate that the E-DNA sensor exhibits high selectivity, excellent stability, and remarkable regenerated ability. The human serum analysis indicates that this simple and regenerated strategy holds promising potential in future biosensing applications. Copyright © 2015 Elsevier B.V. All rights reserved.

  18. Detection of trypanosomatid Phytomonas parasitic in plants by polymerase chain reaction amplification of small subunit ribosomal DNA.

    PubMed

    Teixeira, M M; Campaner, M; Camargo, E P

    1994-01-01

    To improve the diagnosis of Phytomonas infections in plants, we developed a polymerase chain reaction (PCR) assay using synthetic oligonucleotides complementary to conserved sequences of the 18S small subunit ribosomal (SSU) gene. From 10 ng upward of DNA of cultures of Phytomonas isolated from plants, fruits, and insects, PCR amplified an 800-bp DNA band that, after restriction analysis and probe hybridization, proved to be of 18S rDNA Phytomonas origin. PCR was also done with sap samples of tomatoes experimentally infected with Phytomonas, yielding amplified 800-bp ribosomal DNA bands before any flagellate could be detected by microscopic examination of the fruit sap.

  19. Method for promoting specific alignment of short oligonucleotides on nucleic acids

    DOEpatents

    Studier, F. William; Kieleczawa, Jan; Dunn, John J.

    1996-01-01

    Disclosed is a method for promoting specific alignment of short oligonucleotides on a nucleic acid polymer. The nucleic acid polymer is incubated in a solution containing a single-stranded DNA-binding protein and a plurality of oligonucleotides which are perfectly complementary to distinct but adjacent regions of a predetermined contiguous nucleotide sequence in the nucleic acid polymer. The plurality of oligonucleotides anneal to the nucleic acid polymer to form a contiguous region of double stranded nucleic acid. Specific application of the methods disclosed include priming DNA synthesis and template-directed ligation.

  20. Horseradish peroxidase-labeled oligonucleotides and fluorescent tyramides for rapid detection of chromosome-specific repeat sequences.

    PubMed

    van Gijlswijk, R P; Wiegant, J; Vervenne, R; Lasan, R; Tanke, H J; Raap, A K

    1996-01-01

    We present a sensitive and rapid fluorescence in situ hybridization (FISH) strategy for detecting chromosome-specific repeat sequences. It uses horseradish peroxidase (HRP)-labeled oligonucleotide sequences in combination with fluorescent tyramide-based detection. After in situ hybridization, the HRP conjugated to the oligonucleotide probe is used to deposit fluorescently labeled tyramide molecules at the site of hybridization. The method features full chemical synthesis of probes, strong FISH signals, and short processing periods, as well as multicolor capabilities.

  1. Preparation and Analysis of Oligonucleotides Containing the C4′-Oxidized Abasic Site and Related Mechanistic Probes

    PubMed Central

    Kim, Jaeseung; Kreller, Cortney R.; Greenberg, Marc M.

    2005-01-01

    The C4′-oxidized abasic site (C4-AP) is produced by a variety of DNA damaging agents. This alkali labile lesion can exist in up to four diastereomeric cyclic forms, in addition to the acyclic keto-aldehyde. Synthetic oligonucleotides containing the lesion were prepared from a stable photochemical precursor. Chemical integrity of the lesion containing oligonucleotides was probed using phosphodiesterase lability. Analysis of the 3′,5′-phosphate diester of the monomeric lesion released from single diastereomers of photolabile precursors by 1H NMR indicates that isomerization of the hemiacetal and/or hemiketal is rapid. The syntheses and characterization of oligonucleotides containing configurationally stable analogues of C4-AP, which serve as mechanistic probes for deciphering the structural basis of the biochemical and biological effects of the C4′-oxidized abasic lesion, are also described. PMID:16277338

  2. Sensitive detection of mercury and copper ions by fluorescent DNA/Ag nanoclusters in guanine-rich DNA hybridization

    NASA Astrophysics Data System (ADS)

    Peng, Jun; Ling, Jian; Zhang, Xiu-Qing; Bai, Hui-Ping; Zheng, Liyan; Cao, Qiu-E.; Ding, Zhong-Tao

    2015-02-01

    In this work, we designed a new fluorescent oligonucleotides-stabilized silver nanoclusters (DNA/AgNCs) probe for sensitive detection of mercury and copper ions. This probe contains two tailored DNA sequence. One is a signal probe contains a cytosine-rich sequence template for AgNCs synthesis and link sequence at both ends. The other is a guanine-rich sequence for signal enhancement and link sequence complementary to the link sequence of the signal probe. After hybridization, the fluorescence of hybridized double-strand DNA/AgNCs is 200-fold enhanced based on the fluorescence enhancement effect of DNA/AgNCs in proximity of guanine-rich DNA sequence. The double-strand DNA/AgNCs probe is brighter and stable than that of single-strand DNA/AgNCs, and more importantly, can be used as novel fluorescent probes for detecting mercury and copper ions. Mercury and copper ions in the range of 6.0-160.0 and 6-240 nM, can be linearly detected with the detection limits of 2.1 and 3.4 nM, respectively. Our results indicated that the analytical parameters of the method for mercury and copper ions detection are much better than which using a single-strand DNA/AgNCs.

  3. Specificity tests of an oligonucleotide probe against food-outbreak salmonella for biosensor detection

    NASA Astrophysics Data System (ADS)

    Chen, I.-H.; Horikawa, S.; Xi, J.; Wikle, H. C.; Barbaree, J. M.; Chin, B. A.

    2017-05-01

    Phage based magneto-elastic (ME) biosensors have been shown to be able to rapidly detect Salmonella in various food systems to serve food pathogen monitoring purposes. In this ME biosensor platform, the free-standing strip-shaped magneto-elastic sensor is the transducer and the phage probe that recognizes Salmonella in food serves as the bio-recognition element. According to Sorokulova et al. at 2005, a developed oligonucleotide probe E2 was reported to have high specificity to Salmonella enterica Typhimurium. In the report, the specificity tests were focused in most of Enterobacterace groups outside of Salmonella family. Here, to understand the specificity of phage E2 to different Salmonella enterica serotypes within Salmonella Family, we further tested the specificity of the phage probe to thirty-two Salmonella serotypes that were present in the major foodborne outbreaks during the past ten years (according to Centers for Disease Control and Prevention). The tests were conducted through an Enzyme linked Immunosorbent Assay (ELISA) format. This assay can mimic probe immobilized conditions on the magnetoelastic biosensor platform and also enable to study the binding specificity of oligonucleotide probes toward different Salmonella while avoiding phage/ sensor lot variations. Test results confirmed that this oligonucleotide probe E2 was high specific to Salmonella Typhimurium cells but showed cross reactivity to Salmonella Tennessee and four other serotypes among the thirty-two tested Salmonella serotypes.

  4. A dual-colored ratiometric-fluorescent oligonucleotide probe for the detection of human telomerase RNA in cell extracts.

    PubMed

    Ning, Dianhua; He, Changtian; Liu, Zhengjie; Liu, Cui; Wu, Qilong; Zhao, TingTing; Liu, Renyong

    2017-05-21

    Human telomerase RNA (hTR), which is one component of telomerase, was deemed to be a biomarker to monitor tumor cells due to its different expression levels in tumor cells and normal somatic cells. Thus far, plentiful fluorescent probes have been designed to investigate nucleic acids. However, most of them are limited since they are time-consuming, require professional operators and even result in false positive signals in the cellular environment. Herein, we report a dual-colored ratiometric-fluorescent oligonucleotide probe to achieve the reliable detection of human telomerase RNA in cell extracts. The probe is constructed using a dual-labeled fluorescent oligonucleotide hybridized with target-complemented Dabcyl-labeled oligonucleotide. In the presence of the target, the dual-labeled fluorescent oligonucleotide translates into a hairpin structure, which leads to the generation of the fluorescence resonance energy transfer (FRET) phenomenon under UV excitation. Compared to conventional methods, this strategy could effectively avoid false positive signals, and it not only possesses the advantages of simplicity and high specificity but also has the merits of signal stability and distinguishable color variation. Moreover, the quantitative assay of hTR would have a far-reaching impact on the telomerase mechanism and even tumor diagnosis research.

  5. Combination of ICP-MS, capillary electrophoresis, and their hyphenation for probing Ru(III) metallodrug-DNA interactions.

    PubMed

    Foteeva, Lidia S; Matczuk, Magdalena; Pawlak, Katarzyna; Aleksenko, Svetlana S; Nosenko, Sergey V; Karandashev, Vasily K; Jarosz, Maciej; Timerbaev, Andrei R

    2017-03-01

    Determination of the DNA-binding reactivity and affinity is an important part of a successful program for the selection of metallodrug candidates. For such assaying, a range of complementary analytical techniques was proposed and tested here using one of few anticancer metal-based drugs that are currently in clinical trials, indazolium trans-[tetrachloridobis(1H-indazole)ruthenate(III), and a DNA oligonucleotide. A high reactivity of the Ru drug was confirmed in affinity capillary electrophoresis (CE) mode, where adduct formation takes place in situ (i.e., in the capillary filled with an oligonucleotide-containing electrolyte). To further characterize the binding kinetics, a drug-oligonucleotide mixture was incubated for a different period of time, followed by ultrafiltration separation into two different in molecular weight fractions (>3 and <3 kDa). The time-dependent distribution profiles of the Ru drug were then assessed by CE-inductively coupled plasma mass spectrometry (ICP-MS), revealing that at least two DNA adducts exist at equilibrium conditions. Using standalone ICP-MS, dominant equilibrium amount of the bound ruthenium was found to occur in a fraction of 5-10 kDa, which includes the oligonucleotide (ca. 6 kDa). Importantly, in all three assays, the drug was used for the first time in in-vitro studies, not in the intact form but as its active species released from the transferrin adduct at simulated cancer cytosolic conditions. This circumstance makes the established analytical platform promising to provide a detailed view on metallodrug targeting, including other possible biomolecules and ex vivo samples.

  6. Import of desired nucleic acid sequences using addressing motif of mitochondrial ribosomal 5S-rRNA for fluorescent in vivo hybridization of mitochondrial DNA and RNA.

    PubMed

    Zelenka, Jaroslav; Alán, Lukáš; Jabůrek, Martin; Ježek, Petr

    2014-04-01

    Based on the matrix-addressing sequence of mitochondrial ribosomal 5S-rRNA (termed MAM), which is naturally imported into mitochondria, we have constructed an import system for in vivo targeting of mitochondrial DNA (mtDNA) or mt-mRNA, in order to provide fluorescence hybridization of the desired sequences. Thus DNA oligonucleotides were constructed, containing the 5'-flanked T7 RNA polymerase promoter. After in vitro transcription and fluorescent labeling with Alexa Fluor(®) 488 or 647 dye, we obtained the fluorescent "L-ND5 probe" containing MAM and exemplar cargo, i.e., annealing sequence to a short portion of ND5 mRNA and to the light-strand mtDNA complementary to the heavy strand nd5 mt gene (5'-end 21 base pair sequence). For mitochondrial in vivo fluorescent hybridization, HepG2 cells were treated with dequalinium micelles, containing the fluorescent probes, bringing the probes proximally to the mitochondrial outer membrane and to the natural import system. A verification of import into the mitochondrial matrix of cultured HepG2 cells was provided by confocal microscopy colocalizations. Transfections using lipofectamine or probes without 5S-rRNA addressing MAM sequence or with MAM only were ineffective. Alternatively, the same DNA oligonucleotides with 5'-CACC overhang (substituting T7 promoter) were transcribed from the tetracycline-inducible pENTRH1/TO vector in human embryonic kidney T-REx®-293 cells, while mitochondrial matrix localization after import of the resulting unlabeled RNA was detected by PCR. The MAM-containing probe was then enriched by three-order of magnitude over the natural ND5 mRNA in the mitochondrial matrix. In conclusion, we present a proof-of-principle for mitochondrial in vivo hybridization and mitochondrial nucleic acid import.

  7. Selective Amplification of SPR Biosensor Signal for Recognition of rpoB Gene Fragments by Use of Gold Nanoparticles Modified by Thiolated DNA

    NASA Astrophysics Data System (ADS)

    Matsishin, M.; Rachkov, A.; Lopatynskyi, A.; Chegel, V.; Soldatkin, A.; El'skaya, A.

    2017-04-01

    An experimental approach for improving the sensitivity of the surface plasmon resonance (SPR) DNA hybridization sensor using gold nanoparticles (GNPs), modified by specific oligonucleotides, was elaborated. An influence of the ionic strength on the aggregation stability of unmodified GNPs and GNPs modified by the thiolated oligonucleotides was investigated by monitoring a value of light extinction at 520 nm that can be considered as a measure of a quantity of the non-aggregated GNPs. While the unmodified GNPs started to aggregate in 0.2 × saline-sodium citrate (SSC), GNPs modified by the negatively charged oligonucleotides were more stable at increasing ionic strength up to 0.5 × SSC. A bioselective element of the SPR DNA hybridization sensor was formed by immobilization on the gold sensor surface of the thiolated oligonucleotides P2, the sequence of which is a fragment of the rpoB gene of Mycobacterium tuberculosis. The injections into the measuring flow cell of the SPR spectrometer of various concentrations of GNPs modified by the complementary oligonucleotides T2-18m caused the pronounced concentration-dependent sequence-specific sensor responses. The magnitude of the sensor responses was much higher than in the case of the free standing complementary oligonucleotides. According to the obtained experimental data, the usage of GNPs modified by specific oligonucleotides can amplify the sensor response of the SPR DNA hybridization sensor in 1200 times.

  8. Ultrasensitive and label-free detection of pathogenic avian influenza DNA by using CMOS impedimetric sensors.

    PubMed

    Lai, Wei-An; Lin, Chih-Heng; Yang, Yuh-Shyong; Lu, Michael S-C

    2012-05-15

    This work presents miniaturized CMOS (complementary metal oxide semiconductor) sensors for non-faradic impedimetric detection of AIV (avian influenza virus) oligonucleotides. The signal-to-noise ratio is significantly improved by monolithic sensor integration to reduce the effect of parasitic capacitances. The use of sub-μm interdigitated microelectrodes is also beneficial for promoting the signal coupling efficiency. Capacitance changes associated with surface modification, functionalization, and DNA hybridization were extracted from the measured frequency responses based on an equivalent-circuit model. Hybridization of the AIV H5 capture and target DNA probes produced a capacitance reduction of -13.2 ± 2.1% for target DNA concentrations from 1 fM to 10 fM, while a capacitance increase was observed when H5 target DNA was replaced with non-complementary H7 target DNA. With the demonstrated superior sensing capabilities, this miniaturized CMOS sensing platform shows great potential for label-free point-of-care biosensing applications. Copyright © 2012 Elsevier B.V. All rights reserved.

  9. In situ oligonucleotide synthesis on poly(dimethylsiloxane): a flexible substrate for microarray fabrication

    PubMed Central

    Moorcroft, Matthew J.; Meuleman, Wouter R. A.; Latham, Steven G.; Nicholls, Thomas J.; Egeland, Ryan D.; Southern, Edwin M.

    2005-01-01

    In this paper, we demonstrate in situ synthesis of oligonucleotide probes on poly(dimethylsiloxane) (PDMS) microchannels through use of conventional phosphoramidite chemistry. PDMS polymer was moulded into a series of microchannels using standard soft lithography (micro-moulding), with dimensions <100 μm. The surface of the PDMS was derivatized by exposure to ultraviolet/ozone followed by vapour phase deposition of glycidoxypropyltrimethoxysilane and reaction with poly(ethylene glycol) spacer, resulting in a reactive surface for oligonucleotide coupling. High, reproducible yields were achieved for both 6mer and 21mer probes as assessed by hybridization to fluorescent oligonucleotides. Oligonucleotide surface density was comparable with that obtained on glass substrates. These results suggest PDMS as a stable and flexible alternative to glass as a suitable substrate in the fabrication and synthesis of DNA microarrays. PMID:15870385

  10. Template-Directed Ligation of Peptides to Oligonucleotides

    NASA Technical Reports Server (NTRS)

    Bruick, Richard K.; Dawson, Philip E.; Kent, Stephen BH; Usman, Nassim; Joyce, Gerald F.

    1996-01-01

    Synthetic oligonucleotides and peptides have enjoyed a wide range of applications in both biology and chemistry. As a consequence, oligonucleotide-peptide conjugates have received considerable attention, most notably in the development of antisense constructs with improved pharmacological properties. In addition, oligonucleotide-peptide conjugates have been used as molecular tags, in the assembly of supramolecular arrays and in the construction of encoded combinatorial libraries. To make these chimeric molecules more accessible for a broad range of investigations, we sought to develop a facile method for joining fully deprotected oligonucleotides and peptides through a stable amide bond linkage. Furthermore, we wished to make this ligation reaction addressable, enabling one to direct the ligation of specific oligonucleotide and peptide components.To confer specificity and accelerate the rate of the reaction, the ligation process was designed to be dependent on the presence of a complementary oligonucleotide template.

  11. Development of a Fluorescence Resonance Energy Transfer (FRET)-Based DNA Biosensor for Detection of Synthetic Oligonucleotide of Ganoderma boninense.

    PubMed

    Bakhori, Noremylia Mohd; Yusof, Nor Azah; Abdullah, Abdul Halim; Hussein, Mohd Zobir

    2013-12-12

    An optical DNA biosensor based on fluorescence resonance energy transfer (FRET) utilizing synthesized quantum dot (QD) has been developed for the detection of specific-sequence of DNA for Ganoderma boninense, an oil palm pathogen. Modified QD that contained carboxylic groups was conjugated with a single-stranded DNA probe (ssDNA) via amide-linkage. Hybridization of the target DNA with conjugated QD-ssDNA and reporter probe labeled with Cy5 allows for the detection of related synthetic DNA sequence of Ganoderma boninense gene based on FRET signals. Detection of FRET emission before and after hybridization was confirmed through the capability of the system to produce FRET at 680 nm for hybridized sandwich with complementary target DNA. No FRET emission was observed for non-complementary system. Hybridization time, temperature and effect of different concentration of target DNA were studied in order to optimize the developed system. The developed biosensor has shown high sensitivity with detection limit of 3.55 × 10-9 M. TEM results show that the particle size of QD varies in the range between 5 to 8 nm after ligand modification and conjugation with ssDNA. This approach is capable of providing a simple, rapid and sensitive method for detection of related synthetic DNA sequence of Ganoderma boninense.

  12. Development of a Fluorescence Resonance Energy Transfer (FRET)-Based DNA Biosensor for Detection of Synthetic Oligonucleotide of Ganoderma boninense.

    PubMed

    Mohd Bakhori, Noremylia; Yusof, Nor Azah; Abdullah, Abdul Halim; Hussein, Mohd Zobir

    2013-12-01

    An optical DNA biosensor based on fluorescence resonance energy transfer (FRET) utilizing synthesized quantum dot (QD) has been developed for the detection of specific-sequence of DNA for Ganoderma boninense, an oil palm pathogen. Modified QD that contained carboxylic groups was conjugated with a single-stranded DNA probe (ssDNA) via amide-linkage. Hybridization of the target DNA with conjugated QD-ssDNA and reporter probe labeled with Cy5 allows for the detection of related synthetic DNA sequence of Ganoderma boninense gene based on FRET signals. Detection of FRET emission before and after hybridization was confirmed through the capability of the system to produce FRET at 680 nm for hybridized sandwich with complementary target DNA. No FRET emission was observed for non-complementary system. Hybridization time, temperature and effect of different concentration of target DNA were studied in order to optimize the developed system. The developed biosensor has shown high sensitivity with detection limit of 3.55 × 10(-9) M. TEM results show that the particle size of QD varies in the range between 5 to 8 nm after ligand modification and conjugation with ssDNA. This approach is capable of providing a simple, rapid and sensitive method for detection of related synthetic DNA sequence of Ganoderma boninense.

  13. Method of identifying hairpin DNA probes by partial fold analysis

    DOEpatents

    Miller, Benjamin L [Penfield, NY; Strohsahl, Christopher M [Saugerties, NY

    2009-10-06

    Method of identifying molecular beacons in which a secondary structure prediction algorithm is employed to identify oligonucleotide sequences within a target gene having the requisite hairpin structure. Isolated oligonucleotides, molecular beacons prepared from those oligonucleotides, and their use are also disclosed.

  14. Method of identifying hairpin DNA probes by partial fold analysis

    DOEpatents

    Miller, Benjamin L.; Strohsahl, Christopher M.

    2008-10-28

    Methods of identifying molecular beacons in which a secondary structure prediction algorithm is employed to identify oligonucleotide sequences within a target gene having the requisite hairpin structure. Isolated oligonucleotides, molecular beacons prepared from those oligonucleotides, and their use are also disclosed.

  15. Homogeneous versus heterogeneous probes for microbial ecological microarrays.

    PubMed

    Bae, Jin-Woo; Park, Yong-Ha

    2006-07-01

    Microbial ecological microarrays have been developed for investigating the composition and functions of microorganism communities in environmental niches. These arrays include microbial identification microarrays, which use oligonucleotides, gene fragments or microbial genomes as probes. In this article, the advantages and disadvantages of each type of probe are reviewed. Oligonucleotide probes are currently useful for probing uncultivated bacteria that are not amenable to gene fragment probing, whereas the functional gene fragments amplified randomly from microbial genomes require phylogenetic and hierarchical categorization before use as microbial identification probes, despite their high resolution for both specificity and sensitivity. Until more bacteria are sequenced and gene fragment probes are thoroughly validated, heterogeneous bacterial genome probes will provide a simple, sensitive and quantitative tool for exploring the ecosystem structure.

  16. Specific 16S ribosomal RNA targeted oligonucleotide probe against Clavibacter michiganensis subsp. sepedonicus.

    PubMed

    Mirza, M S; Rademaker, J L; Janse, J D; Akkermans, A D

    1993-11-01

    In this article we report on the polymerase chain reaction amplification of a partial 16S rRNA gene from the plant pathogenic bacterium Clavibacter michiganensis subsp. sepedonicus. A partial sequence (about 400 base pairs) of the gene was determined that covered two variable regions important for oligonucleotide probe development. A specific 24mer oligonucleotide probe targeted against the V6 region of 16S rRNA was designed. Specificity of the probe was determined using dot blot hybridization. Under stringent conditions (60 degrees C), the probe hybridized with all 16 Cl. michiganensis subsp. sepedonicus strains tested. Hybridization did not occur with 32 plant pathogenic and saprophytic bacteria used as controls under the same conditions. Under less stringent conditions (55 degrees C) the related Clavibacter michiganensis subsp. insidiosus, Clavibacter michiganensis subsp. nebraskensis, and Clavibacter michiganensis subsp. tesselarius also showed hybridization. At even lower stringency (40 degrees C), all Cl. michiganensis subspecies tested including Clavibacter michiganensis subsp. michiganensis showed hybridization signal, suggesting that under these conditions the probe may be used as a species-specific probe for Cl. michiganensis.

  17. Programmable display of DNA-protein chimeras for controlling cell-hydrogel interactions via reversible intermolecular hybridization.

    PubMed

    Zhang, Zhaoyang; Li, Shihui; Chen, Niancao; Yang, Cheng; Wang, Yong

    2013-04-08

    Extensive studies have been recently carried out to achieve dynamic control of cell-material interactions primarily through physicochemical stimulation. The purpose of this study was to apply reversible intermolecular hybridization to program cell-hydrogel interactions in physiological conditions based on DNA-antibody chimeras and complementary oligonucleotides. The results showed that DNA oligonucleotides could be captured to and released from the immobilizing DNA-functionalized hydrogels with high specificity via DNA hybridization. Accordingly, DNA-antibody chimeras were captured to the hydrogels, successfully inducing specific cell attachment. The cell attachment to the hydrogels reached the plateau at approximately half an hour after the functionalized hydrogels and the cells were incubated together. The attached cells were rapidly released from the bound hydrogels when triggering complementary oligonucleotides were introduced to the system. However, the capability of the triggering complementary oligonucleotides in releasing cells was affected by the length of intermolecular hybridization. The length needed to be at least more than 20 base pairs in the current experimental setting. Notably, because the procedure of intermolecular hybridization did not involve any harsh condition, the released cells maintained the same viability as that of the cultured cells. The functionalized hydrogels also exhibited the potential to catch and release cells repeatedly. Therefore, this study demonstrates that it is promising to regulate cell-material interactions dynamically through the DNA-programmed display of DNA-protein chimeras.

  18. Synthesis and hybridization of a series of biotinylated oligonucleotides.

    PubMed Central

    Cook, A F; Vuocolo, E; Brakel, C L

    1988-01-01

    A series of oligonucleotides containing biotin-11-dUMP at various positions were synthesized and compared in quantitative, colorimetric hybridization-detection studies. A deoxyuridine phosphoramidite containing a protected allylamino sidearm was synthesized and used in standard, automated synthesis cycles to prepare oligonucleotides with allylamino residues at various positions within a standard 17-base sequence. Biotin substituents were subsequently attached to the allylamino sidearms by reaction with N-biotinyl-6-aminocaproic acid N-hydroxysuccinimide ester. These oligomers were hybridized to target DNA immobilized on microtiter wells (ELISA plates), and were detected with a streptavidin-biotinylated horseradish peroxidase complex using hydrogen peroxide as substrate and o-phenylenediamine as chromogen. We found that the sensitivity of detection of target DNA by biotin-labeled oligonucleotide probes was strongly dependent upon the position of the biotin label. Oligonucleotides containing biotin labels near or off the ends of the hybridizing sequence were more effective probes than oligonucleotides containing internal biotin labels. An additive effect of increasing numbers of biotin-dUMP residues was found for some labeling configurations. PMID:3375076

  19. Toward three-dimensional microelectronic systems: directed self-assembly of silicon microcubes via DNA surface functionalization.

    PubMed

    Lämmerhardt, Nico; Merzsch, Stephan; Ledig, Johannes; Bora, Achyut; Waag, Andreas; Tornow, Marc; Mischnick, Petra

    2013-07-02

    The huge and intelligent processing power of three-dimensional (3D) biological "processors" like the human brain with clock speeds of only 0.1 kHz is an extremely fascinating property, which is based on a massively parallel interconnect strategy. Artificial silicon microprocessors are 7 orders of magnitude faster. Nevertheless, they do not show any indication of intelligent processing power, mostly due to their very limited interconnectivity. Massively parallel interconnectivity can only be realized in three dimensions. Three-dimensional artificial processors would therefore be at the root of fabricating artificially intelligent systems. A first step in this direction would be the self-assembly of silicon based building blocks into 3D structures. We report on the self-assembly of such building blocks by molecular recognition, and on the electrical characterization of the formed assemblies. First, planar silicon substrates were functionalized with self-assembling monolayers of 3-aminopropyltrimethoxysilane for coupling of oligonucleotides (single stranded DNA) with glutaric aldehyde. The oligonucleotide immobilization was confirmed and quantified by hybridization with fluorescence-labeled complementary oligonucleotides. After the individual processing steps, the samples were analyzed by contact angle measurements, ellipsometry, atomic force microscopy, and fluorescence microscopy. Patterned DNA-functionalized layers were fabricated by microcontact printing (μCP) and photolithography. Silicon microcubes of 3 μm edge length as model objects for first 3D self-assembly experiments were fabricated out of silicon-on-insulator (SOI) wafers by a combination of reactive ion etching (RIE) and selective wet etching. The microcubes were then surface-functionalized using the same protocol as on planar substrates, and their self-assembly was demonstrated both on patterned silicon surfaces (88% correctly placed cubes), and to cube aggregates by complementary DNA functionalization and hybridization. The yield of formed aggregates was found to be about 44%, with a relative fraction of dimers of some 30%. Finally, the electrical properties of the formed dimers were characterized using probe tips inside a scanning electron microscope.

  20. [Oligonucleotide derivatives in the nucleic acid hybridization analysis. I. Covalent immobilization of oligonucleotide probes onto the nylon].

    PubMed

    Dmitrienko, E V; Pyshnaia, I A; Pyshnyĭ, D V

    2010-01-01

    The features of UV-induced immobilization of oligonucleotides on a nylon membranes and the effectiveness of enzymatic labeling of immobilized probes at heterophase detection of nucleic acids are studied. Short terminal oligothymidilate (up to 10 nt) sequences are suggested to attach to the probe via a flexible ethylene glycol based linker. The presence of such fragment enhances the intensity of immobilization and reduces UV-dependent degradation of the targeted (sequence-specific) part of the probe by reducing the dose needed for the immobilization of DNA. The optimum dose of UV-irradiation is determined to be ~0.4 J/cm(2) at the wavelength 254 nm. This dose provides high level of hybridization signal for immobilized probes with various nucleotide composition of the sequence specific moiety. The amide groups of the polyamide are shown to play the key role in the photoinduced immobilization of nucleic acids, whereas the primary amino groups in the structure of PA is not the center responsible for the covalent binding of DNA by UV-irradiation, as previously believed. Various additives in the soaking solution during the membrane of UV-dependent immobilization of probes are shown to influence its effectiveness. The use of alternative to UV-irradiation system of radical generation are shown to provide the immobilization of oligonucleotides onto the nylon membrane.

  1. Fluorescence energy transfer as a probe for nucleic acid structures and sequences.

    PubMed Central

    Mergny, J L; Boutorine, A S; Garestier, T; Belloc, F; Rougée, M; Bulychev, N V; Koshkin, A A; Bourson, J; Lebedev, A V; Valeur, B

    1994-01-01

    The primary or secondary structure of single-stranded nucleic acids has been investigated with fluorescent oligonucleotides, i.e., oligonucleotides covalently linked to a fluorescent dye. Five different chromophores were used: 2-methoxy-6-chloro-9-amino-acridine, coumarin 500, fluorescein, rhodamine and ethidium. The chemical synthesis of derivatized oligonucleotides is described. Hybridization of two fluorescent oligonucleotides to adjacent nucleic acid sequences led to fluorescence excitation energy transfer between the donor and the acceptor dyes. This phenomenon was used to probe primary and secondary structures of DNA fragments and the orientation of oligodeoxynucleotides synthesized with the alpha-anomers of nucleoside units. Fluorescence energy transfer can be used to reveal the formation of hairpin structures and the translocation of genes between two chromosomes. PMID:8152922

  2. Method for performing site-specific affinity fractionation for use in DNA sequencing

    DOEpatents

    Mirzabekov, Andrei Darievich; Lysov, Yuri Petrovich; Dubley, Svetlana A.

    1999-01-01

    A method for fractionating and sequencing DNA via affinity interaction is provided comprising contacting cleaved DNA to a first array of oligonucleotide molecules to facilitate hybridization between said cleaved DNA and the molecules; extracting the hybridized DNA from the molecules; contacting said extracted hybridized DNA with a second array of oligonucleotide molecules, wherein the oligonucleotide molecules in the second array have specified base sequences that are complementary to said extracted hybridized DNA; and attaching labeled DNA to the second array of oligonucleotide molecules, wherein the labeled re-hybridized DNA have sequences that are complementary to the oligomers. The invention further provides a method for performing multi-step conversions of the chemical structure of compounds comprising supplying an array of polyacrylamide vessels separated by hydrophobic surfaces; immobilizing a plurality of reactants, such as enzymes, in the vessels so that each vessel contains one reactant; contacting the compounds to each of the vessels in a predetermined sequence and for a sufficient time to convert the compounds to a desired state; and isolating the converted compounds from said array.

  3. Miniaturized reaction vessel system, method for performing site-specific biochemical reactions and affinity fractionation for use in DNA sequencing

    DOEpatents

    Mirzabekov, Andrei Darievich; Lysov, Yuri Petrovich; Dubley, Svetlana A.

    2000-01-01

    A method for fractionating and sequencing DNA via affinity interaction is provided comprising contacting cleaved DNA to a first array of oligonucleotide molecules to facilitate hybridization between said cleaved DNA and the molecules; extracting the hybridized DNA from the molecules; contacting said extracted hybridized DNA with a second array of oligonucleotide molecules, wherein the oligonucleotide molecules in the second array have specified base sequences that are complementary to said extracted hybridized DNA; and attaching labeled DNA to the second array of oligonucleotide molecules, wherein the labeled re-hybridized DNA have sequences that are complementary to the oligomers. The invention further provides a method for performing multi-step conversions of the chemical structure of compounds comprising supplying an array of polyacrylamide vessels separated by hydrophobic surfaces; immobilizing a plurality of reactants, such as enzymes, in the vessels so that each vessel contains one reactant; contacting the compounds to each of the vessels in a predetermined sequence and for a sufficient time to convert the compounds to a desired state; and isolating the converted compounds from said array.

  4. Method for performing site-specific affinity fractionation for use in DNA sequencing

    DOEpatents

    Mirzabekov, A.D.; Lysov, Y.P.; Dubley, S.A.

    1999-05-18

    A method for fractionating and sequencing DNA via affinity interaction is provided comprising contacting cleaved DNA to a first array of oligonucleotide molecules to facilitate hybridization between the cleaved DNA and the molecules; extracting the hybridized DNA from the molecules; contacting the extracted hybridized DNA with a second array of oligonucleotide molecules, wherein the oligonucleotide molecules in the second array have specified base sequences that are complementary to the extracted hybridized DNA; and attaching labeled DNA to the second array of oligonucleotide molecules, wherein the labeled re-hybridized DNA have sequences that are complementary to the oligomers. The invention further provides a method for performing multi-step conversions of the chemical structure of compounds comprising supplying an array of polyacrylamide vessels separated by hydrophobic surfaces; immobilizing a plurality of reactants, such as enzymes, in the vessels so that each vessel contains one reactant; contacting the compounds to each of the vessels in a predetermined sequence and for a sufficient time to convert the compounds to a desired state; and isolating the converted compounds from the array. 14 figs.

  5. [Inheritable phenotypic normalization of rodent cells transformed by simian adenovirus SA7 E1 oncogenes by singled-stranded oligonucleotides complementary to a long region of integrated oncogenes].

    PubMed

    Grineva, N I; Borovkova, T V; Sats, N V; Kurabekova, R M; Rozhitskaia, O S; Solov'ev, G Ia; Pantin, V I

    1995-08-01

    G11 mouse cells and SH2 rat cells transformed with simian adenovirus SA7 DNA showed inheritable oncogen-specific phenotypic normalization when treated with sense and antisense oligonucleotides complementary to long RNA sequences, plus or minus strands of the integrated adenovirus oncogenes E1A and E1B. Transitory treatment of the cells with the oligonucleotides in the absence of serum was shown to cause the appearance of normalized cell lines with fibroblastlike morphology, slower cell proliferation, and lack of ability to form colonies in soft agar. Proliferative activity and adhesion of the normalized cells that established cell lines were found to depend on the concentration of growth factors in the cultural medium. In some of the cell lines, an inhibition of transcription of the E1 oncogenes was observed. The normalization also produced cells that divided 2 - 5 times and died and cells that reverted to a transformed phenotype in 2 - 10 days. The latter appeared predominantly upon the action of the antisense oligonucleotides.

  6. A Single Electrochemical Probe Used for Analysis of Multiple Nucleic Acid Sequences

    PubMed Central

    Mills, Dawn M.; Calvo-Marzal, Percy; Pinzon, Jeffer M.; Armas, Stephanie; Kolpashchikov, Dmitry M.; Chumbimuni-Torres, Karin Y.

    2017-01-01

    Electrochemical hybridization sensors have been explored extensively for analysis of specific nucleic acids. However, commercialization of the platform is hindered by the need for attachment of separate oligonucleotide probes complementary to a RNA or DNA target to an electrode’s surface. Here we demonstrate that a single probe can be used to analyze several nucleic acid targets with high selectivity and low cost. The universal electrochemical four-way junction (4J)-forming (UE4J) sensor consists of a universal DNA stem-loop (USL) probe attached to the electrode’s surface and two adaptor strands (m and f) which hybridize to the USL probe and the analyte to form a 4J associate. The m adaptor strand was conjugated with a methylene blue redox marker for signal ON sensing and monitored using square wave voltammetry. We demonstrated that a single sensor can be used for detection of several different DNA/RNA sequences and can be regenerated in 30 seconds by a simple water rinse. The UE4J sensor enables a high selectivity by recognition of a single base substitution, even at room temperature. The UE4J sensor opens a venue for a re-useable universal platform that can be adopted at low cost for the analysis of DNA or RNA targets. PMID:29371782

  7. Secondary structure prediction and structure-specific sequence analysis of single-stranded DNA.

    PubMed

    Dong, F; Allawi, H T; Anderson, T; Neri, B P; Lyamichev, V I

    2001-08-01

    DNA sequence analysis by oligonucleotide binding is often affected by interference with the secondary structure of the target DNA. Here we describe an approach that improves DNA secondary structure prediction by combining enzymatic probing of DNA by structure-specific 5'-nucleases with an energy minimization algorithm that utilizes the 5'-nuclease cleavage sites as constraints. The method can identify structural differences between two DNA molecules caused by minor sequence variations such as a single nucleotide mutation. It also demonstrates the existence of long-range interactions between DNA regions separated by >300 nt and the formation of multiple alternative structures by a 244 nt DNA molecule. The differences in the secondary structure of DNA molecules revealed by 5'-nuclease probing were used to design structure-specific probes for mutation discrimination that target the regions of structural, rather than sequence, differences. We also demonstrate the performance of structure-specific 'bridge' probes complementary to non-contiguous regions of the target molecule. The structure-specific probes do not require the high stringency binding conditions necessary for methods based on mismatch formation and permit mutation detection at temperatures from 4 to 37 degrees C. Structure-specific sequence analysis is applied for mutation detection in the Mycobacterium tuberculosis katG gene and for genotyping of the hepatitis C virus.

  8. The effect of hybridization-induced secondary structure alterations on RNA detection using backscattering interferometry

    PubMed Central

    Adams, Nicholas M.; Olmsted, Ian R.; Haselton, Frederick R.; Bornhop, Darryl J.; Wright, David W.

    2013-01-01

    Backscattering interferometry (BSI) has been used to successfully monitor molecular interactions without labeling and with high sensitivity. These properties suggest that this approach might be useful for detecting biomarkers of infection. In this report, we identify interactions and characteristics of nucleic acid probes that maximize BSI signal upon binding the respiratory syncytial virus nucleocapsid gene RNA biomarker. The number of base pairs formed upon the addition of oligonucleotide probes to a solution containing the viral RNA target correlated with the BSI signal magnitude. Using RNA folding software mfold, we found that the predicted number of unpaired nucleotides in the targeted regions of the RNA sequence generally correlated with BSI sensitivity. We also demonstrated that locked nucleic acid (LNA) probes improved sensitivity approximately 4-fold compared to DNA probes of the same sequence. We attribute this enhancement in BSI performance to the increased A-form character of the LNA:RNA hybrid. A limit of detection of 624 pM, corresponding to ∼105 target molecules, was achieved using nine distinct ∼23-mer DNA probes complementary to regions distributed along the RNA target. Our results indicate that BSI has promise as an effective tool for sensitive RNA detection and provides a road map for further improving detection limits. PMID:23519610

  9. Chemical synthesis of oligonucleotides containing a free sulphydryl group and subsequent attachment of thiol specific probes.

    PubMed Central

    Connolly, B A; Rider, P

    1985-01-01

    Oligonucleotides containing a free sulphydryl group at their 5'-termini have been synthesised and further derivatised with thiol specific probes. The nucleotide sequence required is prepared using standard solid phase phosphoramidite techniques and an extra round of synthesis is then performed using the S-triphenylmethyl O-methoxymorpholinophosphite derivatives of 2-mercaptoethanol, 3-mercaptopropan (1) ol or 6-mercaptohexan (1) ol. After cleavage from the resin and removal of the phosphate and base protecting groups, this yields an oligonucleotide containing an S-triphenylmethyl group attached to the 5'-phosphate group via a two, three or six carbon chain. The triphenylmethyl group can be readily removed with silver nitrate to give the free thiol. With the three and six carbon chain oligonucleotides, this thiol can be used, at pH 8, for the attachment of thiol specific probes as illustrated by the reaction with fluorescent conjugates of iodoacetates and maleiimides. However, oligonucleotides containing a thiol attached to the 5'-phosphate group via a two carbon chain are unstable at pH 8 decomposing to the free 5'-phosphate and so are unsuitable for further derivatisation. PMID:4011448

  10. In situ identification of nocardioform actinomycetes in activated sludge using fluorescent rRNA-targeted oligonucleotide probes.

    PubMed

    Schuppler, M; Wagner, M; Schön, G; Göbel, U B

    1998-01-01

    Hitherto, few environmental samples have been investigated by a 'full cycle rRNA analysis'. Here the results of in situ hybridization experiments with specific rRNA-targeted oligonucleotide probes developed on the basis of new sequences derived from a previously described comparative 16S rRNA analysis of nocardioform actinomycetes in activated sludge are reported. Application of the specific probes enabled identification and discrimination of the distinct populations of nocardioform actinomycetes in activated sludge. One of the specific probes (DLP) detected rod-shaped bacteria which were found in 13 of the 16 investigated sludge samples from various wastewater treatment plants, suggesting their importance in the wastewater treatment process. Another probe (GLP2) hybridized with typically branched filaments of nocardioforms mainly found in samples from enhanced biological phosphorus removal plants, suggesting that these bacteria are involved in sludge foaming. The combination of in situ hybridization with fluorescently labelled rRNA-targeted oligonucleotide probes and confocal laser scanning microscopy improved the detection of nocardioform actinomycetes, which often showed only weak signals inside the activated-sludge flocs.

  11. Synthesis and biophysical properties of 5'-thio-2',4'-BNA/LNA oligonucleotide.

    PubMed

    Islam, Md Ariful; Fujisaka, Aki; Mori, Shohei; Ito, Kosuke Ramon; Yamaguchi, Takao; Obika, Satoshi

    2018-07-23

    Phosphorothioate modification of oligonucleotides is one of the most promising chemical modifications in nucleic acid therapeutics. Structurally similar 5'-thio or phosphorothiolate-modified nucleotides, in which the 5'-bridging oxygen atom is replaced with a sulfur atom, are attracting attention and gaining importance in oligonucleotide-based research. In our present study, we synthesized 5'-thio-2',4'-BNA/LNA monomers bearing thymine or 5-methylcytosine nucleobase. The 5'-thio-2',4'-BNA/LNA monomers were successfully incorporated into target oligonucleotides, and their nuclease stability and binding affinity with complementary strands were evaluated. Copyright © 2018 Elsevier Ltd. All rights reserved.

  12. 2'-O-[2-[2-(N,N-Dimethylamino)ethoxy]ethyl] Modified Antisense Oligonucleotides: Symbiosis of Charge Interaction Factors and Stereoelectronic Effects

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Prhavc, M.; Prakash, T.P.; Minasov, G.

    Oligonucleotides with a novel, 2'-O-[2-[2-(N,N-dimethylamino)ethoxy]ethyl] (2'-O-DMAEOE) modification have been synthesized. This modification, a cationic analogue of the 2'-O-(2-methoxyethyl) (2'-O-MOE) modification, exhibits high binding affinity to target RNA (but not to DNA) and exceptional resistance to nuclease degradation. Analysis of the crystal structure of a self-complementary oligonucleotide containing a single 2'-O-DMAEOE modification explains the importance of charge factors and gauche effects on the observed antisense properties. 2'-O-DMAEOE modified oligonucleotides are ideal candidates for antisense drugs.

  13. Novel strategy combining SYBR Green I with carbon nanotubes for highly sensitive detection of Salmonella typhimurium DNA.

    PubMed

    Mao, Pingdao; Ning, Yi; Li, Wenkai; Peng, Zhihui; Chen, Yongzhe; Deng, Le

    2014-01-10

    A simple, selective, sensitive and label-free fluorescent method for detecting trpS-harboring Salmonella typhimurium was developed in this study. This assay used the non-covalent interaction of single-stranded DNA (ssDNA) probes with SWNTs, since SWNTs can quench fluorescence. Fluorescence recovery (78% with 1.8 nM target DNA) was detected in the presence of target DNA as ssDNA probes detached from SWNTs hybridized with target DNA, and the resulting double-stranded DNA (dsDNA) intercalated with SYBR Green I (SG) dyes. The increasing fluorescence intensity reached 4.54-fold. In contrast, mismatched oligonucleotides (1- or 3-nt difference to the target DNA) did not contribute to significant fluorescent recovery, which demonstrated the specificity of the assay. The increasing fluorescence intensity increased 3.15-fold when purified PCR products containing complementary sequences of trpS gene were detected. These results confirmed the ability to use this assay for detecting real samples. Copyright © 2013 Elsevier Inc. All rights reserved.

  14. Fluorescent probes for nucleic Acid visualization in fixed and live cells.

    PubMed

    Boutorine, Alexandre S; Novopashina, Darya S; Krasheninina, Olga A; Nozeret, Karine; Venyaminova, Alya G

    2013-12-11

    This review analyses the literature concerning non-fluorescent and fluorescent probes for nucleic acid imaging in fixed and living cells from the point of view of their suitability for imaging intracellular native RNA and DNA. Attention is mainly paid to fluorescent probes for fluorescence microscopy imaging. Requirements for the target-binding part and the fluorophore making up the probe are formulated. In the case of native double-stranded DNA, structure-specific and sequence-specific probes are discussed. Among the latest, three classes of dsDNA-targeting molecules are described: (i) sequence-specific peptides and proteins; (ii) triplex-forming oligonucleotides and (iii) polyamide oligo(N-methylpyrrole/N-methylimidazole) minor groove binders. Polyamides seem to be the most promising targeting agents for fluorescent probe design, however, some technical problems remain to be solved, such as the relatively low sequence specificity and the high background fluorescence inside the cells. Several examples of fluorescent probe applications for DNA imaging in fixed and living cells are cited. In the case of intracellular RNA, only modified oligonucleotides can provide such sequence-specific imaging. Several approaches for designing fluorescent probes are considered: linear fluorescent probes based on modified oligonucleotide analogs, molecular beacons, binary fluorescent probes and template-directed reactions with fluorescence probe formation, FRET donor-acceptor pairs, pyrene excimers, aptamers and others. The suitability of all these methods for living cell applications is discussed.

  15. On-chip multiplexed solid-phase nucleic acid hybridization assay using spatial profiles of immobilized quantum dots and fluorescence resonance energy transfer.

    PubMed

    Noor, M Omair; Tavares, Anthony J; Krull, Ulrich J

    2013-07-25

    A microfluidic based solid-phase assay for the multiplexed detection of nucleic acid hybridization using quantum dot (QD) mediated fluorescence resonance energy transfer (FRET) is described herein. The glass surface of hybrid glass-polydimethylsiloxane (PDMS) microfluidic channels was chemically modified to assemble the biorecognition interface. Multiplexing was demonstrated using a detection system that was comprised of two colors of immobilized semi-conductor QDs and two different oligonucleotide probe sequences. Green-emitting and red-emitting QDs were paired with Cy3 and Alexa Fluor 647 (A647) labeled oligonucleotides, respectively. The QDs served as energy donors for the transduction of dye labeled oligonucleotide targets. The in-channel assembly of the biorecognition interface and the subsequent introduction of oligonucleotide targets was accomplished within minutes using a combination of electroosmotic flow and electrophoretic force. The concurrent quantification of femtomole quantities of two target sequences was possible by measuring the spatial coverage of FRET sensitized emission along the length of the channel. In previous reports, multiplexed QD-FRET hybridization assays that employed a ratiometric method for quantification had challenges associated with lower analytical sensitivity arising from both donor and acceptor dilution that resulted in reduced energy transfer pathways as compared to single-color hybridization assays. Herein, a spatial method for quantification that is based on in-channel QD-FRET profiles provided higher analytical sensitivity in the multiplexed assay format as compared to single-color hybridization assays. The selectivity of the multiplexed hybridization assays was demonstrated by discrimination between a fully-complementary sequence and a 3 base pair sequence at a contrast ratio of 8 to 1. Copyright © 2013 Elsevier B.V. All rights reserved.

  16. Self-replication of chemical systems based on recognition within a double or a triple helix - A realistic hypothesis

    NASA Technical Reports Server (NTRS)

    Kanavarioti, Anastassia

    1992-01-01

    A scenario is proposed for the non-enzymatic self-replication of short RNA molecules. The self-replication of an oligopyrimidine strand is considered and the process of template-directed synthesis based on recognition within a double helix is discussed. Replication mechanisms are suggested for selected oligonucleotides. The mechanisms are based on Watson-Crick base pairing between complementary nucleotides as well as Hoogsteen base pairing between a duplex and the complementary third strand. It is suggested that self-replication based on these mechanisms may be accomplished but may result in a substantial amount of misinformation transfer when mixed oligonucleotides are used.

  17. Surface-enhanced Raman scattering detection of DNA derived from the West Nile virus genome using magnetic capture of Raman-active gold nanoparticles

    USDA-ARS?s Scientific Manuscript database

    A model paramagnetic nanoparticle (MNP) assay is demonstrated for surface-enhanced Raman scattering (SERS) detection of DNA oligonucleotides derived from the West Nile virus (WNV) genome. Detection is based on the capture of WNV target sequences by hybridization with complementary oligonucleotide pr...

  18. Toward a solid-phase nucleic acid hybridization assay within microfluidic channels using immobilized quantum dots as donors in fluorescence resonance energy transfer.

    PubMed

    Chen, Lu; Algar, W Russ; Tavares, Anthony J; Krull, Ulrich J

    2011-01-01

    The optical properties and surface area of quantum dots (QDs) have made them an attractive platform for the development of nucleic acid biosensors based on fluorescence resonance energy transfer (FRET). Solid-phase assays based on FRET using mixtures of immobilized QD-oligonucleotide conjugates (QD biosensors) have been developed. The typical challenges associated with solid-phase detection strategies include non-specific adsorption, slow kinetics of hybridization, and sample manipulation. The new work herein has considered the immobilization of QD biosensors onto the surfaces of microfluidic channels in order to address these challenges. Microfluidic flow can be used to dynamically control stringency by adjustment of the potential in an electrokinetic-based microfluidics environment. The shearing force, Joule heating, and the competition between electroosmotic and electrophoretic mobilities allow the optimization of hybridization conditions, convective delivery of target to the channel surface to speed hybridization, amelioration of adsorption, and regeneration of the sensing surface. Microfluidic flow can also be used to deliver (for immobilization) and remove QD biosensors. QDs that were conjugated with two different oligonucleotide sequences were used to demonstrate feasibility. One oligonucleotide sequence on the QD was available as a linker for immobilization via hybridization with complementary oligonucleotides located on a glass surface within a microfluidic channel. A second oligonucleotide sequence on the QD served as a probe to transduce hybridization with target nucleic acid in a sample solution. A Cy3 label on the target was excited by FRET using green-emitting CdSe/ZnS QD donors and provided an analytical signal to explore this detection strategy. The immobilized QDs could be removed under denaturing conditions by disrupting the duplex that was used as the surface linker and thus allowed a new layer of QD biosensors to be re-coated within the channel for re-use of the microfluidic chip.

  19. Drop drying on surfaces determines chemical reactivity - the specific case of immobilization of oligonucleotides on microarrays

    PubMed Central

    2013-01-01

    Background Drop drying is a key factor in a wide range of technical applications, including spotted microarrays. The applied nL liquid volume provides specific reaction conditions for the immobilization of probe molecules to a chemically modified surface. Results We investigated the influence of nL and μL liquid drop volumes on the process of probe immobilization and compare the results obtained to the situation in liquid solution. In our data, we observe a strong relationship between drop drying effects on immobilization and surface chemistry. In this work, we present results on the immobilization of dye labeled 20mer oligonucleotides with and without an activating 5′-aminoheptyl linker onto a 2D epoxysilane and a 3D NHS activated hydrogel surface. Conclusions Our experiments identified two basic processes determining immobilization. First, the rate of drop drying that depends on the drop volume and the ambient relative humidity. Oligonucleotides in a dried spot react unspecifically with the surface and long reaction times are needed. 3D hydrogel surfaces allow for immobilization in a liquid environment under diffusive conditions. Here, oligonucleotide immobilization is much faster and a specific reaction with the reactive linker group is observed. Second, the effect of increasing probe concentration as a result of drop drying. On a 3D hydrogel, the increasing concentration of probe molecules in nL spotting volumes accelerates immobilization dramatically. In case of μL volumes, immobilization depends on whether the drop is allowed to dry completely. At non-drying conditions, very limited immobilization is observed due to the low oligonucleotide concentration used in microarray spotting solutions. The results of our study provide a general guideline for microarray assay development. They allow for the initial definition and further optimization of reaction conditions for the immobilization of oligonucleotides and other probe molecule classes to different surfaces in dependence of the applied spotting and reaction volume. PMID:23758982

  20. FRET study of G-quadruplex forming fluorescent oligonucleotide probes at the lipid monolayer interface.

    PubMed

    Swiatkowska, Angelika; Kosman, Joanna; Juskowiak, Bernard

    2016-01-05

    Spectral properties and G-quadruplex folding ability of fluorescent oligonucleotide probes at the cationic dioctadecyldimethylammonium bromide (DODAB) monolayer interface are reported. Two oligonucleotides, a 19-mer bearing thrombin binding aptamer sequence and a 21-mer with human telomeric sequence, were end-labeled with fluorescent groups (FAM and TAMRA) to give FRET probes F19T and F21T, respectively. The probes exhibited abilities to fold into a quadruplex structure and to bind metal cations (Na(+) and K(+)). Fluorescence spectra of G-quadruplex FRET probes at the monolayer interface are reported for the first time. Investigations included film balance measurements (π-A isotherms) and fluorescence spectra recording using a fiber optic accessory interfaced with a spectrofluorimeter. The effect of the presence of DODAB monolayer, metal cations and the surface pressure of monolayer on spectral behavior of FRET probes were examined. Adsorption of probe at the cationic monolayer interface resulted in the FRET signal enhancement even in the absence of metal cations. Variation in the monolayer surface pressure exerted rather modest effect on the spectral properties of probes. The fluorescence energy transfer efficiency of monolayer adsorbed probes increased significantly in the presence of sodium or potassium ion in subphase, which indicated that the probes retained their cation binding properties when adsorbed at the monolayer interface. Copyright © 2015 Elsevier B.V. All rights reserved.

  1. Development and Application of Small-Subunit rRNA Probes for Assessment of Selected Thiobacillus Species and Members of the Genus Acidiphilium

    PubMed Central

    Peccia, Jordan; Marchand, Eric A.; Silverstein, Joann; Hernandez, Mark

    2000-01-01

    Culture-dependent studies have implicated sulfur-oxidizing bacteria as the causative agents of acid mine drainage and concrete corrosion in sewers. Thiobacillus species are considered the major representatives of the acid-producing bacteria in these environments. Small-subunit rRNA genes from all of the Thiobacillus and Acidiphilium species catalogued by the Ribosomal Database Project were identified and used to design oligonucleotide DNA probes. Two oligonucleotide probes were synthesized to complement variable regions of 16S rRNA in the following acidophilic bacteria: Thiobacillus ferrooxidans and T. thiooxidans (probe Thio820) and members of the genus Acidiphilium (probe Acdp821). Using 32P radiolabels, probe specificity was characterized by hybridization dissociation temperature (Td) with membrane-immobilized RNA extracted from a suite of 21 strains representing three groups of bacteria. Fluorochrome-conjugated probes were evaluated for use with fluorescent in situ hybridization (FISH) at the experimentally determined Tds. FISH was used to identify and enumerate bacteria in laboratory reactors and environmental samples. Probing of laboratory reactors inoculated with a mixed culture of acidophilic bacteria validated the ability of the oligonucleotide probes to track specific cell numbers with time. Additionally, probing of sediments from an active acid mine drainage site in Colorado demonstrated the ability to identify numbers of active bacteria in natural environments that contain high concentrations of metals, associated precipitates, and other mineral debris. PMID:10877807

  2. nuID: a universal naming scheme of oligonucleotides for Illumina, Affymetrix, and other microarrays

    PubMed Central

    Du, Pan; Kibbe, Warren A; Lin, Simon M

    2007-01-01

    Background Oligonucleotide probes that are sequence identical may have different identifiers between manufacturers and even between different versions of the same company's microarray; and sometimes the same identifier is reused and represents a completely different oligonucleotide, resulting in ambiguity and potentially mis-identification of the genes hybridizing to that probe. Results We have devised a unique, non-degenerate encoding scheme that can be used as a universal representation to identify an oligonucleotide across manufacturers. We have named the encoded representation 'nuID', for nucleotide universal identifier. Inspired by the fact that the raw sequence of the oligonucleotide is the true definition of identity for a probe, the encoding algorithm uniquely and non-degenerately transforms the sequence itself into a compact identifier (a lossless compression). In addition, we added a redundancy check (checksum) to validate the integrity of the identifier. These two steps, encoding plus checksum, result in an nuID, which is a unique, non-degenerate, permanent, robust and efficient representation of the probe sequence. For commercial applications that require the sequence identity to be confidential, we have an encryption schema for nuID. We demonstrate the utility of nuIDs for the annotation of Illumina microarrays, and we believe it has universal applicability as a source-independent naming convention for oligomers. Reviewers This article was reviewed by Itai Yanai, Rong Chen (nominated by Mark Gerstein), and Gregory Schuler (nominated by David Lipman). PMID:17540033

  3. Relative stabilities of triple helices composed of combinations of DNA, RNA and 2'-O-methyl-RNA backbones: chimeric circular oligonucleotides as probes.

    PubMed

    Wang, S; Kool, E T

    1995-04-11

    Described is a systematic study of the effects of varied backbone structure on the stabilities of pyr.pur.pyr triple helices. The effects were measured using six circular 34 base oligonucleotides containing DNA (D), RNA (R) and/or 2'-O-methyl-RNA (M) residues designed to bind a complementary single-stranded purine target strand by triple helix formation. Eighteen different backbone combinations were studied at pH 5.5 and 7.0 by optical melting experiments and the results compared with the stabilities of the corresponding Watson-Crick duplexes. When the target purine strand is DNA, all circles form pH-dependent triple helical complexes which are considerably stronger than the duplexes alone. When RNA is the target, five of the nine complexes studied are of the pH-dependent triplex type and the other four complexes are not significantly stronger than the corresponding duplexes. The results are useful in the design of the highest affinity ligands for single- and double-stranded DNAs and RNAs and also point out novel ways to engender DNA- or RNA-selective binding.

  4. On-chip transduction of nucleic acid hybridization using spatial profiles of immobilized quantum dots and fluorescence resonance energy transfer.

    PubMed

    Tavares, Anthony J; Noor, M Omair; Vannoy, Charles H; Algar, W Russ; Krull, Ulrich J

    2012-01-03

    The glass surface of a glass-polydimethylsiloxane (PDMS) microfluidic channel was modified to develop a solid-phase assay for quantitative determination of nucleic acids. Electroosmotic flow (EOF) within channels was used to deliver and immobilize semiconductor quantum dots (QDs), and electrophoresis was used to decorate the QDs with oligonucleotide probe sequences. These processes took only minutes to complete. The QDs served as energy donors in fluorescence resonance energy transfer (FRET) for transduction of nucleic acid hybridization. Electrokinetic injection of fluorescent dye (Cy3) labeled oligonucleotide target into a microfluidic channel and subsequent hybridization (within minutes) provided the proximity for FRET, with emission from Cy3 being the analytical signal. The quantification of target concentration was achieved by measurement of the spatial length of coverage by target along a channel. Detection of femtomole quantities of target was possible with a dynamic range spanning an order of magnitude. The assay provided excellent resistance to nonspecific interactions of DNA. Further selectivity of the assay was achieved using 20% formamide, which allowed discrimination between a fully complementary target and a 3 base pair mismatch target at a contrast ratio of 4:1. © 2011 American Chemical Society

  5. Site-directed DNA crosslinking of large multisubunit protein-DNA complexes.

    PubMed

    Persinger, Jim; Bartholomew, Blaine

    2009-01-01

    Several methods have been developed to site-specifically incorporate photoreactive nucleotide analogs into DNA for the purpose of identifying the proteins and their domains that are in contact with particular regions of DNA. The synthesis of several deoxynucleotide analogs that have a photoreactive group tethered to the nucleotide base and the incorporation of these analogs into DNA are described. In a second approach, oligonucleotide with a photoreactive group attached to the phosphate backbone is chemically synthesized. The photoreactive oligonucleotide is then enzymatically incorporated into DNA by annealing it to a complementary DNA template and extending with DNA polymerase. Both approaches have been effectively used to map protein-DNA interactions in large multisubunit complexes such as the eukaryotic transcription or ATP-dependent chromatin remodeling complexes. Not only do these techniques map the binding sites of the various subunits in these complexes, but when coupled with peptide mapping also determine the protein domain that is in close proximity to the different DNA sites. The strength of these techniques is the ability to scan a large number of potential sites by making combinations of different DNA probes and is facilitated by using an immobilized DNA template for synthesis.

  6. Photonic crystals on copolymer film for label-free detection of DNA hybridization.

    PubMed

    Su, Han; Cheng, Xin R; Endo, Tatsuro; Kerman, Kagan

    2018-04-30

    The presence of a single-nucleotide polymorphism in Apolipoprotein E4 gene is implicated with the increased risk of developing Alzheimer's disease (AD). In this study, detection of AD-related DNA oligonucleotide sequence associated with Apolipoprotein E4 gene sequence was achieved using localized-surface plasmon resonance (LSPR) on 2D-Photonic crystal (2D-PC) and Au-coated 2D-PC surfaces. 2D-PC surfaces were fabricated on a flexible copolymer film using nano-imprint lithography (NIL). The film surface was then coated with a dual-functionalized polymer to react with surface immobilized DNA probe. DNA hybridization was detected by monitoring the optical responses of either a Fresnel decrease in reflectance on 2D-PC surfaces or an increase in LSPR on Au-coated 2D-PC surfaces. The change in response due to DNA hybridization on the modified surfaces was also investigated using mismatched and non-complementary oligonucleotides sequences. The proof-of-concept results are promising towards the development of 2D-PC on copolymer film surfaces as miniaturized and wearable biosensors for various diagnostic and defense applications. Copyright © 2017 Elsevier B.V. All rights reserved.

  7. [Development of a Fluorescence Probe for Live Cell Imaging].

    PubMed

    Shibata, Aya

    2017-01-01

     Probes that detect specific biological materials are indispensable tools for deepening our understanding of various cellular phenomena. In live cell imaging, the probe must emit fluorescence only when a specific substance is detected. In this paper, we introduce a new probe we developed for live cell imaging. Glutathione S-transferase (GST) activity is higher in tumor cells than in normal cells and is involved in the development of resistance to various anticancer drugs. We previously reported the development of a general strategy for the synthesis of probes for detection of GST enzymes, including fluorogenic, bioluminogenic, and 19 F-NMR probes. Arylsulfonyl groups were used as caging groups during probe design. The fluorogenic probes were successfully used to quantitate very low levels of GST activity in cell extracts and were also successfully applied to the imaging of microsomal MGST1 activity in living cells. The bioluminogenic and 19 F-NMR probes were able to detect GST activity in Escherichia coli cells. Oligonucleotide-templated reactions are powerful tools for nucleic acid sensing. This strategy exploits the target strand as a template for two functionalized probes and provides a simple molecular mechanism for multiple turnover reactions. We developed a nucleophilic aromatic substitution reaction-triggered fluorescent probe. The probe completed its reaction within 30 s of initiation and amplified the fluorescence signal from 0.5 pM target oligonucleotide by 1500 fold under isothermal conditions. Additionally, we applied the oligonucleotide-templated reaction for molecular releasing and peptide detection.

  8. Oligonucleotides as probes for studying polymerization reactions in dilute aqueous solution: II. Polycondensations

    NASA Technical Reports Server (NTRS)

    Kolb, V.; Orgel, L. E.

    1995-01-01

    We have prepared a [32P]-labeled oligonucleotide probe carrying a ureido (-NH-CO-NH2) function at its 3'-terminus. This labeled oligomer was used to study polycondensations of urea and formaldehyde and of various phenols and formaldehyde in aqueous solution. The formation of formaldehyde copolymers attached to the amido-function of the probe was monitored by gel electrophoresis. Our results are generally in agreement with those obtained using conventional techniques. Our method is suitable for monitoring potentially prebiotic polycondensation reactions involving formaldehyde.

  9. Oligonucleotides as probes for studying polymerization reactions in dilute aqueous solution. 2: Polycondensations

    NASA Technical Reports Server (NTRS)

    Kolb, Vera; Orgel, Leslie E.

    1995-01-01

    We have prepared a (P-32)-labeled oligonucleotide probe carrying a ureido (-NH-CO-NH2) function at its 3'-terminus. This labeled oligomer was used to study polycondensations of urea and formaldehyde and of various phenols and formaldehyde in aqueous solution. The formation of formaldehyde copolymers attached to the amido-function of the probe was monitored by gel electrophoresis. Our results are generally in agreement with those obtained using conventional techniques. Our method is suitable for monitoring potentially prebiotic polycondensation reactions involving formaldehyde.

  10. Java web tools for PCR, in silico PCR, and oligonucleotide assembly and analysis.

    PubMed

    Kalendar, Ruslan; Lee, David; Schulman, Alan H

    2011-08-01

    The polymerase chain reaction is fundamental to molecular biology and is the most important practical molecular technique for the research laboratory. We have developed and tested efficient tools for PCR primer and probe design, which also predict oligonucleotide properties based on experimental studies of PCR efficiency. The tools provide comprehensive facilities for designing primers for most PCR applications and their combinations, including standard, multiplex, long-distance, inverse, real-time, unique, group-specific, bisulphite modification assays, Overlap-Extension PCR Multi-Fragment Assembly, as well as a programme to design oligonucleotide sets for long sequence assembly by ligase chain reaction. The in silico PCR primer or probe search includes comprehensive analyses of individual primers and primer pairs. It calculates the melting temperature for standard and degenerate oligonucleotides including LNA and other modifications, provides analyses for a set of primers with prediction of oligonucleotide properties, dimer and G-quadruplex detection, linguistic complexity, and provides a dilution and resuspension calculator. Copyright © 2011 Elsevier Inc. All rights reserved.

  11. Development of a Fluorescence Resonance Energy Transfer (FRET)-Based DNA Biosensor for Detection of Synthetic Oligonucleotide of Ganoderma boninense

    PubMed Central

    Mohd Bakhori, Noremylia; Yusof, Nor Azah; Abdullah, Abdul Halim; Hussein, Mohd Zobir

    2013-01-01

    An optical DNA biosensor based on fluorescence resonance energy transfer (FRET) utilizing synthesized quantum dot (QD) has been developed for the detection of specific-sequence of DNA for Ganoderma boninense, an oil palm pathogen. Modified QD that contained carboxylic groups was conjugated with a single-stranded DNA probe (ssDNA) via amide-linkage. Hybridization of the target DNA with conjugated QD-ssDNA and reporter probe labeled with Cy5 allows for the detection of related synthetic DNA sequence of Ganoderma boninense gene based on FRET signals. Detection of FRET emission before and after hybridization was confirmed through the capability of the system to produce FRET at 680 nm for hybridized sandwich with complementary target DNA. No FRET emission was observed for non-complementary system. Hybridization time, temperature and effect of different concentration of target DNA were studied in order to optimize the developed system. The developed biosensor has shown high sensitivity with detection limit of 3.55 × 10−9 M. TEM results show that the particle size of QD varies in the range between 5 to 8 nm after ligand modification and conjugation with ssDNA. This approach is capable of providing a simple, rapid and sensitive method for detection of related synthetic DNA sequence of Ganoderma boninense. PMID:25587406

  12. Optimized oligonucleotide probes for DNA fingerprinting.

    PubMed

    Schäfer, R; Zischler, H; Birsner, U; Becker, A; Epplen, J T

    1988-08-01

    The three different simple repetitive oligonucleotide probes (CT)8, (CAC)5 and (TCC)5 were hybridized to a panel of human DNAs which had been digested with the restriction endonucleases Alu I, Hinf I and Mbo I. The resulting DNA fingerprints were analyzed and different parameters calculated, such as the maximal mean allele frequency and the average number of polymorphic bands per individual. The highest number of bands was obtained after hybridization of Hinf I digested DNA with (CAC)5. The probability of finding the same band pattern as in individual A in individual B is 2 x 10(-8). The DNAs of monozygous twins show indistinguishable banding patterns and the bands are inherited according to the Mendelian laws. Thus this procedure reveals informative fingerprints that can be used for individual identification, e.g. in paternity testing and in forensic applications. In most of these experiments 32P-labelled probes were employed, yet the biotinylated oligonucleotide (GACA)4 produced results which were equivalent to those obtained by hybridization with the 32P-labelled probe (GACA)4.

  13. Chemistry, mechanism and clinical status of antisense oligonucleotides and duplex RNAs

    PubMed Central

    Shen, Xiulong; Corey, David R

    2018-01-01

    Abstract RNA plays a central role in the expression of all genes. Because any sequence within RNA can be recognized by complementary base pairing, synthetic oligonucleotides and oligonucleotide mimics offer a general strategy for controlling processes that affect disease. The two primary antisense approaches for regulating expression through recognition of cellular RNAs are single-stranded antisense oligonucleotides and duplex RNAs. This review will discuss the chemical modifications and molecular mechanisms that make synthetic nucleic acid drugs possible. Lessons learned from recent clinical trials will be summarized. Ongoing clinical trials are likely to decisively test the adequacy of our current generation of antisense nucleic acid technologies and highlight areas where more basic research is needed. PMID:29240946

  14. Selection of optimal oligonucleotide probes for microarrays usingmultiple criteria, global alignment and parameter estimation.

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Li, Xingyuan; He, Zhili; Zhou, Jizhong

    2005-10-30

    The oligonucleotide specificity for microarray hybridizationcan be predicted by its sequence identity to non-targets, continuousstretch to non-targets, and/or binding free energy to non-targets. Mostcurrently available programs only use one or two of these criteria, whichmay choose 'false' specific oligonucleotides or miss 'true' optimalprobes in a considerable proportion. We have developed a software tool,called CommOligo using new algorithms and all three criteria forselection of optimal oligonucleotide probes. A series of filters,including sequence identity, free energy, continuous stretch, GC content,self-annealing, distance to the 3'-untranslated region (3'-UTR) andmelting temperature (Tm), are used to check each possibleoligonucleotide. A sequence identity is calculated based onmore » gapped globalalignments. A traversal algorithm is used to generate alignments for freeenergy calculation. The optimal Tm interval is determined based on probecandidates that have passed all other filters. Final probes are pickedusing a combination of user-configurable piece-wise linear functions andan iterative process. The thresholds for identity, stretch and freeenergy filters are automatically determined from experimental data by anaccessory software tool, CommOligo_PE (CommOligo Parameter Estimator).The program was used to design probes for both whole-genome and highlyhomologous sequence data. CommOligo and CommOligo_PE are freely availableto academic users upon request.« less

  15. Electrophoretically deposited multiwalled carbon nanotube based amperometric genosensor for E.coli detection

    NASA Astrophysics Data System (ADS)

    Bhardwaj, Hema; Solanki, Shipra; Sumana, Gajjala

    2016-04-01

    This work reports on a sensitive and selective genosensor fabrication method for Escherichia coli (E.coli) detection. The functionalized multiwalled carbon nanotubes (MWCNT) synthesized via chemical vapour deposition have been deposited electrophoretically onto indium tin oxide coated glass surface and have been utilized as matrices for the covalent immobilization of E.coli specific probe oligonucleotide that was identified from the 16s rRNA coding region of the E.coli genome. This fabricated functionalized MWCNT based platform sought to provide improved fundamental characteristics to electrode interface in terms of electro-active surface area and diffusion coefficient. Electrochemical cyclic voltammetry revealed that this genosensor exhibits a linear response to complementary DNA in the concentration range of 10-7 to 10-12 M with a detection limit of 1×10-12 M.

  16. Edesign: Primer and Enhanced Internal Probe Design Tool for Quantitative PCR Experiments and Genotyping Assays.

    PubMed

    Kimura, Yasumasa; Soma, Takahiro; Kasahara, Naoko; Delobel, Diane; Hanami, Takeshi; Tanaka, Yuki; de Hoon, Michiel J L; Hayashizaki, Yoshihide; Usui, Kengo; Harbers, Matthias

    2016-01-01

    Analytical PCR experiments preferably use internal probes for monitoring the amplification reaction and specific detection of the amplicon. Such internal probes have to be designed in close context with the amplification primers, and may require additional considerations for the detection of genetic variations. Here we describe Edesign, a new online and stand-alone tool for designing sets of PCR primers together with an internal probe for conducting quantitative real-time PCR (qPCR) and genotypic experiments. Edesign can be used for selecting standard DNA oligonucleotides like for instance TaqMan probes, but has been further extended with new functions and enhanced design features for Eprobes. Eprobes, with their single thiazole orange-labelled nucleotide, allow for highly sensitive genotypic assays because of their higher DNA binding affinity as compared to standard DNA oligonucleotides. Using new thermodynamic parameters, Edesign considers unique features of Eprobes during primer and probe design for establishing qPCR experiments and genotyping by melting curve analysis. Additional functions in Edesign allow probe design for effective discrimination between wild-type sequences and genetic variations either using standard DNA oligonucleotides or Eprobes. Edesign can be freely accessed online at http://www.dnaform.com/edesign2/, and the source code is available for download.

  17. Edesign: Primer and Enhanced Internal Probe Design Tool for Quantitative PCR Experiments and Genotyping Assays

    PubMed Central

    Kasahara, Naoko; Delobel, Diane; Hanami, Takeshi; Tanaka, Yuki; de Hoon, Michiel J. L.; Hayashizaki, Yoshihide; Usui, Kengo; Harbers, Matthias

    2016-01-01

    Analytical PCR experiments preferably use internal probes for monitoring the amplification reaction and specific detection of the amplicon. Such internal probes have to be designed in close context with the amplification primers, and may require additional considerations for the detection of genetic variations. Here we describe Edesign, a new online and stand-alone tool for designing sets of PCR primers together with an internal probe for conducting quantitative real-time PCR (qPCR) and genotypic experiments. Edesign can be used for selecting standard DNA oligonucleotides like for instance TaqMan probes, but has been further extended with new functions and enhanced design features for Eprobes. Eprobes, with their single thiazole orange-labelled nucleotide, allow for highly sensitive genotypic assays because of their higher DNA binding affinity as compared to standard DNA oligonucleotides. Using new thermodynamic parameters, Edesign considers unique features of Eprobes during primer and probe design for establishing qPCR experiments and genotyping by melting curve analysis. Additional functions in Edesign allow probe design for effective discrimination between wild-type sequences and genetic variations either using standard DNA oligonucleotides or Eprobes. Edesign can be freely accessed online at http://www.dnaform.com/edesign2/, and the source code is available for download. PMID:26863543

  18. General method for labeling siRNA by click chemistry with fluorine-18 for the purpose of PET imaging.

    PubMed

    Mercier, Frédéric; Paris, Jérôme; Kaisin, Geoffroy; Thonon, David; Flagothier, Jessica; Teller, Nathalie; Lemaire, Christian; Luxen, André

    2011-01-19

    The alkyne-azide Cu(I)-catalyzed Huisgen cycloaddition, a click-type reaction, was used to label a double-stranded oligonucleotide (siRNA) with fluorine-18. An alkyne solid support CPG for the preparation of monostranded oligonucleotides functionalized with alkyne has been developed. Two complementary azide labeling agents (1-(azidomethyl)-4-[(18)F]fluorobenzene) and 1-azido-4-(3-[(18)F]fluoropropoxy)benzene have been produced with 41% and 35% radiochemical yields (decay-corrected), respectively. After annealing with the complementary strand, the siRNA was directly labeled by click chemistry with [(18)F]fluoroazide to produce the [(18)F]-radiolabeled siRNA with excellent radiochemical yield and purity.

  19. Simple and rapid enzymatic method for the synthesis of single-strand oligonucleotides containing trifluorothymidine.

    PubMed

    Suzuki, Norihiko; Fukushima, Masakazu

    2010-11-01

    To investigate the mechanism of trifluorothymidine (TFT)-induced DNA damage, we developed an enzymatic method for the synthesis of single-strand oligonucleotides containing TFT-monophosphate residues. Sixteen-mer oligonucleotides and 14-mer 5'-phosphorylated oligonucleotides were annealed to the template of 25-mer, so as to empty one nucleotide site. TFT-triphosphate was incorporated into the site by DNA polymerase and then ligated to 5'-phosphorylated oligonucleotides by DNA ligase. The synthesized 31-mer oligonucleotides containing TFT residues were isolated from the 25-mer complementary template by denaturing polyacrylamide electrophoresis. Using these single-strand oligonucleotides containing TFT residues, the cleavage of TFT residues from DNA, using mismatch uracil-DNA glycosylase (MUG) of E.coli origin, was compared with that of 5-fluorouracil (5FU) and 5-bromodeoxyuridine (BrdU). The TFT/A pair was not cleaved by MUG, while the other pairs, namely, 5FU/A, 5FU/G, BrdU/A, BrdU/G, and TFT/G, were easily cleaved from each synthesized DNA. Thus, this method is useful for obtaining some site-specifically modified oligonucleotides.

  20. Sensitive detection of point mutation by electrochemiluminescence and DNA ligase-based assay

    NASA Astrophysics Data System (ADS)

    Zhou, Huijuan; Wu, Baoyan

    2008-12-01

    The technology of single-base mutation detection plays an increasingly important role in diagnosis and prognosis of genetic-based diseases. Here we reported a new method for the analysis of point mutations in genomic DNA through the integration of allele-specific oligonucleotide ligation assay (OLA) with magnetic beads-based electrochemiluminescence (ECL) detection scheme. In this assay the tris(bipyridine) ruthenium (TBR) labeled probe and the biotinylated probe are designed to perfectly complementary to the mutant target, thus a ligation can be generated between those two probes by Taq DNA Ligase in the presence of mutant target. If there is an allele mismatch, the ligation does not take place. The ligation products are then captured onto streptavidin-coated paramagnetic beads, and detected by measuring the ECL signal of the TBR label. Results showed that the new method held a low detection limit down to 10 fmol and was successfully applied in the identification of point mutations from ASTC-α-1, PANC-1 and normal cell lines in codon 273 of TP53 oncogene. In summary, this method provides a sensitive, cost-effective and easy operation approach for point mutation detection.

  1. Oligonucleotide probes to the 16S ribosomal RNA: implications of sequence homology and secondary structure with particular reference to the oral species Prevotella intermedia and Prevotella nigrescens.

    PubMed

    Shah, H N; Gharbia, S E; Scully, C; Finegold, S M

    1995-03-01

    Eight oligonucleotides based upon regions of the small subunit 16S ribosomal RNA gene sequences were analysed against a background of their position within the molecule and their two-dimensional structure to rationalise their use in recognising Prevotella intermedia and Prevotella nigrescens. The 41 clinical isolates from both oral and respiratory sites and two reference strains were subjected to DNA-DNA hybridisation and multilocus enzyme electrophoresis to confirm their identity. Alignment of oligonucleotide probes designated I Bi-2 to I Bi-6 (for P. intermedia) and 2Bi-2 (for P. nigrescens) with the 16S rRNA suggested that these probes lacked specificity or were constructed from hypervariable regions. A 52-mer oligonucleotide (designated Bi) reliably detected both species. Because of the high degree of concordance between the 16S rRNAs of both species, it was necessary to vary the stringency of hybridisation conditions for detection of both species. Thus probe I Bi-I recognised P. intermedia while I Bi-I detected both P. intermedia and P. nigrescens at low stringency. However, under conditions of high stringency only P. nigrescens was recognised by probe 2Bi-I. These probes were highly specific and did not hybridise with DNA from the closely related P. corporis, nor other periodontal pathogens such as Fusobacterium nucleatum, Actinobacillus actinomycetemcomitans, Treponema denticola and several pigmented species such as Prevotella melaninogenica, P. denticola, P. loescheii, Porphyromonas asaccharolytica, Py. endodontalis, Py. gingivalis, Py. levii, and Py. macacae.

  2. Synthesis and evaluation of a photoresponsive quencher for fluorescent hybridization probes.

    PubMed

    Kovaliov, Marina; Wachtel, Chaim; Yavin, Eylon; Fischer, Bilha

    2014-10-21

    Nowadays, most nucleic acid detections using fluorescent probes rely on quenching of fluorescence by energy transfer from one fluorophore to another or to a non-fluorescent molecule (quencher). The most widely used quencher in fluorescent probes is 4-((4-(dimethylamino)phenyl)azo)benzoic acid (DABCYL). We targeted a nucleoside-DABCYL analogue which could be incorporated anywhere in an oligonucleotide sequence and in any number, and used as a quencher in different hybridization sensitive probes. Specifically, we introduced a 5-(4-((dimethylamino)phenyl)azo)benzene)-2'-deoxy-uridine (dU(DAB)) quencher. The photoisomerization and dU(DAB)'s ability to quench fluorescein emission have been investigated. We incorporated dU(DAB) into a series of oligonucleotide (ON) probes including strand displacement probes, labeled with both fluorescein (FAM) and dU(DAB), and TaqMan probes bearing one or two dU(DAB) and a FAM fluorophore. We used these probes for the detection of a DNA target in real-time PCR (RT-PCR). All probes showed amplification of targeted DNA. A dU(DAB) modified TaqMan RT-PCR probe was more efficient as compared to a DABCYL bearing probe (93% vs. 87%, respectively). Furthermore, dU(DAB) had a stabilizing effect on the duplex, causing an increase in Tm up to 11 °C. In addition we showed the photoisomerisation of the azobenzene moiety of dU(DAB) and the dU(DAB) triply-labeled oligonucleotide upon irradiation. These findings suggest that dU(DAB) modified probes are promising probes for gene quantification in real-time PCR detection and as photoswitchable devices.

  3. Duplex and triplex formation of mixed pyrimidine oligonucleotides with stacking of phenyl-triazole moieties in the major groove.

    PubMed

    Andersen, Nicolai Krog; Døssing, Holger; Jensen, Frank; Vester, Birte; Nielsen, Poul

    2011-08-05

    5-(1-Phenyl-1,2,3-triazol-4-yl)-2'-deoxycytidine was synthesized from a modified CuAAC protocol and incorporated into mixed pyrimidine oligonucleotide sequences together with the corresponding 5-(1-phenyl-1,2,3-triazol-4-yl)-2'-deoxyuridine. With consecutive incorporations of the two modified nucleosides, improved duplex formation with a complementary RNA and improved triplex formation with a complementary DNA duplex were observed. The improvement is due to π-π stacking of the phenyl-triazole moieties in the major groove. The strongest stacking and most pronounced positive influence on thermal stability was found in between the uridine analogues or with the cytidine analogue placed in the 3' direction to the uridine analogue. Modeling indicated a different orientation of the phenyl-triazole moieties in the major groove to account for the difference between the two nucleotides. The modified oligonucleotides were all found to be significantly stabilized toward nucleolytic degration.

  4. Post-injection hybridization of complementary DNA strands on capillary electrophoresis platforms: a novel solution for dsDNA artifacts.

    PubMed

    McLaren, Robert S; Ensenberger, Martin G; Budowle, Bruce; Rabbach, Dawn; Fulmer, Patricia M; Sprecher, Cindy J; Bessetti, Joseph; Sundquist, Terri M; Storts, Douglas R

    2008-09-01

    Several laboratories have reported the occurrence of a split or n-1 peak at the vWA locus in PowerPlex 16 and PowerPlex ES amplification products separated on 4- and 16-capillary electrophoresis instruments. The root cause of this artifact is post-PCR reannealing of the unlabeled, unincorporated vWA primer to the 3'-end of the tetramethylrhodamine (TMR)-labeled strand of the vWA amplicon. This reannealing occurs in the capillary post-electrokinetic injection. The split peak is eliminated by incorporation into the loading cocktail of a sacrificial hybridization sequence (SHS) oligonucleotide that is complementary to the vWA primer. The SHS preferentially anneals to the primer instead of the TMR-labeled strand of the vWA amplicon. In addition, the n-10/n-18 artifact that may be seen at the vWA locus was determined to be due to double-stranded amplicon formed post-electrokinetic injection into the capillary. This was also eliminated by adding in two Complementary Oligo Targets (COT1 and COT2) in addition to the SHS oligonucleotide into the loading cocktail. These three oligonucleotides are complementary to the 33 bases at the 5'-end of the unlabeled vWA amplicon strand and the 60 bases at its 3'-end and therefore compete for hybridization to the TMR-labeled amplicon strand. Incorporation of these three oligonucleotides in the Internal Lane Standard 600 (ILS600) eliminate both the split peak and n-10/n-18 artifact in PowerPlex 16 and PowerPlex ES amplification products without affecting sizing of alleles at the vWA locus or any locus in the PowerPlex 16, PowerPlex Y, PowerPlex ES, AmpFlSTR Profiler Plus ID, AmpFlSTR Cofiler, and AmpFlSTR SGM Plus kits.

  5. Enzymatic production of 'monoclonal stoichiometric' single-stranded DNA oligonucleotides.

    PubMed

    Ducani, Cosimo; Kaul, Corinna; Moche, Martin; Shih, William M; Högberg, Björn

    2013-07-01

    Single-stranded oligonucleotides are important as research tools, as diagnostic probes, in gene therapy and in DNA nanotechnology. Oligonucleotides are typically produced via solid-phase synthesis, using polymer chemistries that are limited relative to what biological systems produce. The number of errors in synthetic DNA increases with oligonucleotide length, and the resulting diversity of sequences can be a problem. Here we present the 'monoclonal stoichiometric' (MOSIC) method for enzyme-mediated production of DNA oligonucleotides. We amplified oligonucleotides from clonal templates derived from single bacterial colonies and then digested cutter hairpins in the products, which released pools of oligonucleotides with precisely controlled relative stoichiometric ratios. We prepared 14-378-nucleotide MOSIC oligonucleotides either by in vitro rolling-circle amplification or by amplification of phagemid DNA in Escherichia coli. Analyses of the formation of a DNA crystal and folding of DNA nanostructures confirmed the scalability, purity and stoichiometry of the produced oligonucleotides.

  6. Enzymatic Production of Monoclonal Stoichiometric Single-Stranded DNA Oligonucleotides

    PubMed Central

    Ducani, Cosimo; Kaul, Corinna; Moche, Martin; Shih, William M.; Högberg, Björn

    2013-01-01

    Single-stranded oligonucleotides are important as research tools as probes for diagnostics and gene therapy. Today, production of oligonucleotides is done via solid-phase synthesis. However, the capabilities of current polymer chemistry are limited in comparison to what can be produced in biological systems. The errors in synthetic DNA increases with oligonucleotide length, and sequence diversity can often be a problem. Here, we present the Monoclonal Stoichiometric (MOSIC) method for enzymatic DNA oligonucleotide production. Using this method, we amplify oligonucleotides from clonal templates followed by digestion of a cutter-hairpin, resulting in pools of monoclonal oligonucleotides with precisely controlled relative stoichiometric ratios. We present data where MOSIC oligonucleotides, 14–378 nt long, were prepared either by in vitro rolling-circle amplification, or by amplification in Escherichia coli in the form of phagemid DNA. The formation of a DNA crystal and folding of DNA nanostructures confirmed the scalability, purity and stoichiometry of the produced oligonucleotides. PMID:23727986

  7. [Oligonucleotide derivatives in the nucleic acid hybridization analysis. III. Synthesis and investigation of properties of oligonucleotides, bearing bifunctional non-nucleotide insert].

    PubMed

    Kupriushkin, M S; Pyshnyĭ, D V

    2012-01-01

    Non-nucleotide phosporamidites were synthetized, having branched backbone with different position of functional groups. Obtained phosphoramidite monomers contain intercalator moiety--6-chloro-2-methoxyacridine, and additional hydroxyl residue protected with dimethoxytrityl group or with tert-butyldimethylsilyl group for post-synthetic modification. Synthesized oligothymidilates contain one or more modified units in different positions of sequence. Melting temperature and thermodynamic parameters of formation of complementary duplexes formed by modified oligonucleotides was defined (change in enthalpy and entropy). The introduction of intercalating residue causes a significant stabilization of DNA duplexes. It is shown that the efficiency of the fluorescence of acridine residue in the oligonucleotide conjugate significantly changes upon hybridization with DNA.

  8. Optimization of an oligonucleotide microchip for microbial identification studies: a non-equilibrium dissociation approach

    NASA Technical Reports Server (NTRS)

    Liu, W. T.; Mirzabekov, A. D.; Stahl, D. A.

    2001-01-01

    The utility of a high-density oligonucleotide microarray (microchip) for identifying strains of five closely related bacilli (Bacillus anthracis, Bacillus cereus, Bacillus mycoides, Bacillus medusa and Bacillus subtilis) was demonstrated using an approach that compares the non-equilibrium dissociation rates ('melting curves') of all probe-target duplexes simultaneously. For this study, a hierarchical set of 30 oligonucleotide probes targeting the 16S ribosomal RNA of these bacilli at multiple levels of specificity (approximate taxonomic ranks of domain, kingdom, order, genus and species) was designed and immobilized in a high-density matrix of gel pads on a glass slide. Reproducible melting curves for probes with different levels of specificity were obtained using an optimized salt concentration. Clear discrimination between perfect match (PM) and mismatch (MM) duplexes was achieved. By normalizing the signals to an internal standard (a universal probe), a more than twofold discrimination (> 2.4x) was achieved between PM and 1-MM duplexes at the dissociation temperature at which 50% of the probe-target duplexes remained intact. This provided excellent differentiation among representatives of different Bacillus species, both individually and in mixtures of two or three. The overall pattern of hybridization derived from this hierarchical probe set also provided a clear 'chip fingerprint' for each of these closely related Bacillus species.

  9. Detection and prevention of mycoplasma hominis infection

    DOEpatents

    DelVecchio, Vito G.; Gallia, Gary L.; McCleskey, Ferne K.

    1997-01-21

    The present invention is directed to a rapid and sensitive method for detecting Mycoplasma hominis using M. hominis-specific probes, oligonucleotides or antibodies. In particular a target sequence can be amplified by in vitro nucleic acid amplification techniques, detected by nucleic acid hybridization using the subject probes and oligonucleotides or detected by immunoassay using M. hominis-specific antibodies. M. hominis-specific nucleic acids which do not recognize or hybridize to genomic nucleic acid of other Mycoplasma species are also provided.

  10. Oligonucleotide-genotyping as a method of detecting the HLA-DR2 (DRw15)-Dw2, -DR2 (DRw15)-Dw12, -DR4-Dw15, and -DR4-D"KT2" haplotypes in the Japanese population.

    PubMed

    Obata, F; Ito, I; Kaneko, T; Ohkubo, M; Ishimoto, A L; Abe, A; Kashiwagi, N

    1989-05-01

    We synthesized pairs of four different oligonucleotides, F22, F29, F42, and F158, to analyse the HLA-DR2 (DRw15) and -DR4 haplotypes in the Japanese population. After enzymatically amplifying the HLA-DRB1 gene, we hybridized the oligonucleotide probes with DNA extracted from 42 donors. Hybridization was completed between F22 and the DNA of haplotype DR2 (DRw15)-Dw2, between F29 and the DNA of DR2 (DRw15)-Dw12, between F42 and the DNA of DR4-D"KT2", and between F158 and the DNA of DR4-Dw15. In keeping with the nucleotide sequences of the probes, F29 hybridized also with DNA from the DR9-Dw23 haplotype and F158 with that from some of the DRw8 haplotypes (DRw8-Dw8.3) in the Japanese population. Results of this study demonstrate that the four oligonucleotides make useful probes for detecting the haplotypes above.

  11. Designing probe from E6 genome region of human Papillomavirus 16 for sensing applications.

    PubMed

    Parmin, Nor Azizah; Hashim, Uda; Gopinath, Subash C B

    2018-02-01

    Human Papillomavirus (HPV) is a standout amongst the most commonly reported over 100 types, among them genotypes 16, 18, 31 and 45 are the high-risk HPV. Herein, we designed the oligonucleotide probe for the detection of predominant HPV type 16 for the sensing applications. Conserved amino acid sequences within E6 region of the open reading frame in the HPV genome was used as the basis to design oligonucleotide probe to detect cervical cancer. Analyses of E6 amino acid sequences from the high-risk HPVs were done to check the percentage of similarity and consensus regions that cause different cancers, including cervical cancer. Basic local alignment search tools (BLAST) have given extra statistical parameters, for example, desire values (E-values) and score bits. The probe, 'GGG GTC GGT GGA CCG GTC GAT GTA' was designed with 66.7% GC content. This oligonucleotide probe is designed with the length of 24 mer, GC percent is between 40 and 70, and the melting point (Tm) is above 50°C. The probe needed an acceptable length between 22 and 31 mer. The choice of region is identified here can be used as a probe, has implications for HPV detection techniques in biosensor especially for clinical determination of cervical cancer. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. In vitro evaluation of phosphorothioate oligonucleotides targeted to the E2 mRNA of papillomavirus: potential treatment for genital warts.

    PubMed Central

    Cowsert, L M; Fox, M C; Zon, G; Mirabelli, C K

    1993-01-01

    Papillomaviruses induce benign proliferative lesions, such as genital warts, in humans. The E2 gene product is thought to play a major role in the regulation of viral transcription and DNA replication and may represent a rational target for an antisense oligonucleotide drug action. Phosphorothioate oligonucleotides complementary to E2 mRNAs were synthesized and tested in a series of in vitro bovine papillomavirus (BPV) and human papillomavirus (HPV) models for the ability to inhibit E2 transactivation and virus-induced focus formation. The most active BPV-specific compounds were complementary to the mRNA cap region (ISIS 1751), the translation initiation region for the full-length E2 transactivator (ISIS 1753), and the translation initiation region for the E2 transrepressor mRNA (ISIS 1755). ISIS 1751 and ISIS 1753 were found to reduce E2-dependent transactivation and viral focus formation in a sequence-specific and concentration-dependent manner. ISIS 1755 increased E2 transactivation in a dose-dependent manner but had no effect on focus formation. Oligonucleotides with a chain length of 20 residues had optimal activity in the E2 transactivation assay. On the basis of the above observations, ISIS 2105, a 20-residue phosphorothioate oligonucleotide targeted to the translation initiation of both HPV type 6 (HPV-6) and HPV-11 E2 mRNA, was designed and shown to inhibit E2-dependent transactivation by HPV-11 E2 expressed from a surrogate promoter. These observations support the rationale of E2 as a target for antiviral therapy against papillomavirus infections and specifically identify ISIS 2105 as a candidate antisense oligonucleotide for the treatment of genital warts induced by HPV-6 and HPV-11. Images PMID:8383937

  13. Telomerase Responsive Delivery of Doxorubicin from Mesoporous Silica Nanoparticles in Multiple Malignancies: Therapeutic Efficacies against Experimental Aggressive Murine Lymphoma.

    PubMed

    Srivastava, Prateek; Hira, Sumit Kumar; Sharma, Amod; Kashif, Mohammad; Srivastava, Prashant; Srivastava, Divesh N Narayan; Singh, Ram Adhar; Manna, Partha Pratim

    2018-05-25

    Mammalian telomerase maintain the length and integrity of telomeres by adding the telomeric repeats to chromosome end. This work describes the telomerase responsive delivery of doxorubicin against telomerase positive human and murine cancer cells. Wrapping of doxorubicin loaded mesoporous silica nanoparticles with specific oligonucleotide sequence, containing telomeric repeat complementary sequence and a telomerase substrate primer sequence resulted slow and sustained release of doxorubicin, contiguous to the tumor cells. The DNA wrapped nano probe significantly inhibit the proliferation and enhanced the cytotoxicity in telomerase positive human and mouse tumor cells, and its function is impeded following exposure to specific telomerase inhibitor, AZT. Entrapping of doxorubicin by telomerase specific oligo, manifests enhanced apoptosis and significantly higher uptake of the drug in the tumor cells. Treatment of telomerase positive Dalton's lymphoma bearing mice with a novel and newly designed oligo wrapped nano probe, specific for mouse telomerase, significantly enhanced the survival and improved the histopathological parameters. In addition, the treatment also induced significant reduction in the number of tumor foci and restored the normal architecture of the vascularised organs, besides preventing metastasis.

  14. Rapid, sensitive and label-free detection of Shiga-toxin producing Escherichia coli O157 using carbon nanotube biosensors.

    PubMed

    Subramanian, Sowmya; Aschenbach, Konrad H; Evangelista, Jennifer P; Najjar, Mohamed Badaoui; Song, Wenxia; Gomez, Romel D

    2012-02-15

    An electronic platform to detect very small amounts of genomic DNA from bacteria without the need for PCR amplification and molecular labeling is described. The system uses carbon nanotube field-effect transistor (FET) arrays whose electrical properties are affected by minute electrical charges localized on their active regions. Two pathogenic strains of E. coli are used to evaluate the detection properties of the transistor arrays. Described herein are the results for detection of synthetic oligomers, unpurified and highly purified genomic DNA at various concentrations and their comparison against non-specific binding. In particular, the capture of genomic DNA of E. coli O157:H7 by a specific oligonucleotide probe coated onto the transistor array results in a significant shift in the threshold (gate-source) voltage (V(th)). By contrast the signal under the same procedure using a different strain, E. coli O45 that is non-complementary to the probe remained nearly constant. This work highlights the detection sensitivity and efficacy of this biosensor without stringent requirement for DNA sample preparation. Copyright © 2011 Elsevier B.V. All rights reserved.

  15. Development and use of species-specific oligonucleotide probes for differentiation of Streptococcus uberis and Streptococcus parauberis.

    PubMed Central

    Bentley, R W; Leigh, J A; Collins, M D

    1993-01-01

    Oligonucleotide probes specific for 16S rRNA and capable of differentiating Streptococcus uberis and S. parauberis from each other and other esculin-hydrolyzing streptococci were developed. Use of a mini-RNA extraction technique for gram-positive cocci associated with bovine mastitis has allowed the probes to be used for identification of esculin-hydrolyzing streptococci from two dairy herds at the Institute for Animal Health, Compton, United Kingdom. One hundred seventy-nine of 206 isolates were identified as S. uberis, 3 were identified as S. parauberis, and 24 were not identified. Isolates not identified by the probes were tested biochemically and found to be mainly Enterococcus faecium, E. faecalis, or S. bovis. Images PMID:8417033

  16. Individual sequences in large sets of gene sequences may be distinguished efficiently by combinations of shared sub-sequences

    PubMed Central

    Gibbs, Mark J; Armstrong, John S; Gibbs, Adrian J

    2005-01-01

    Background Most current DNA diagnostic tests for identifying organisms use specific oligonucleotide probes that are complementary in sequence to, and hence only hybridise with the DNA of one target species. By contrast, in traditional taxonomy, specimens are usually identified by 'dichotomous keys' that use combinations of characters shared by different members of the target set. Using one specific character for each target is the least efficient strategy for identification. Using combinations of shared bisectionally-distributed characters is much more efficient, and this strategy is most efficient when they separate the targets in a progressively binary way. Results We have developed a practical method for finding minimal sets of sub-sequences that identify individual sequences, and could be targeted by combinations of probes, so that the efficient strategy of traditional taxonomic identification could be used in DNA diagnosis. The sizes of minimal sub-sequence sets depended mostly on sequence diversity and sub-sequence length and interactions between these parameters. We found that 201 distinct cytochrome oxidase subunit-1 (CO1) genes from moths (Lepidoptera) were distinguished using only 15 sub-sequences 20 nucleotides long, whereas only 8–10 sub-sequences 6–10 nucleotides long were required to distinguish the CO1 genes of 92 species from the 9 largest orders of insects. Conclusion The presence/absence of sub-sequences in a set of gene sequences can be used like the questions in a traditional dichotomous taxonomic key; hybridisation probes complementary to such sub-sequences should provide a very efficient means for identifying individual species, subtypes or genotypes. Sequence diversity and sub-sequence length are the major factors that determine the numbers of distinguishing sub-sequences in any set of sequences. PMID:15817134

  17. DNA Origami: Folded DNA-Nanodevices That Can Direct and Interpret Cell Behavior

    PubMed Central

    Kearney, Cathal J.; Lucas, Christopher R.; O'Brien, Fergal J.; Castro, Carlos E.

    2016-01-01

    DNA origami is a DNA-based nanotechnology that utilizes programmed combinations of short complementary oligonucleotides to fold a large single strand of DNA into precise 2-D and 3-D shapes. The exquisite nanoscale shape control of this inherently biocompatible material is combined with the potential to spatially address the origami structures with diverse cargos including drugs, antibodies, nucleic acid sequences, small molecules and inorganic particles. This programmable flexibility enables the fabrication of precise nanoscale devices that have already shown great potential for biomedical applications such as: drug delivery, biosensing and synthetic nanopore formation. In this Progress Report, we will review the advances in the DNA origami field since its inception several years ago and then focus on how these DNA-nanodevices can be designed to interact with cells to direct or probe their behavior. PMID:26840503

  18. Spectroscopic study of fluorescent probes based on G-quadruplex oligonucleotides labeled with ethynylpyrenyldeoxyuridine.

    PubMed

    Switalska, Angelika; Kierzek, Ryszard; Dembska, Anna; Juskowiak, Bernard

    2017-12-01

    The design, synthesis, and spectral properties of four pyrene labeled oligonucleotide probes with G-quadruplex structure (Tel22-Tpy, Tel22-Upy, Tel22-6Upy, Tel22-18Upy) based on the 22-mer human telomeric sequence (Tel22) have been reported. Pyrene labels in the form of ethynylpyrenyldeoxyuridine have been inserted efficiently into oligodeoxynucleotides probes using phosphoramidite chemistry. The probes exhibited abilities to fold into G-quadruplex structures and to bind metal cations (Na + and K + ). Folding properties of probes and their spectral behavior were examined by recording the UV-vis, fluorescence, and CD spectra as well as by analyzing melting profiles. Fluorescence characteristics and G-quadruplex folding of probes were also studied at the interface of cationic dioctadecyldimethylammonium bromide (DODAB) monolayer. Investigations included film balance measurements (π-A isotherms) and fluorescence spectra recording using a fiber optic accessory interfaced with a spectrofluorimeter. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Identification of FVIII gene mutations in patients with hemophilia A using new combinatorial sequencing by hybridization

    PubMed Central

    Chetta, M.; Drmanac, A.; Santacroce, R.; Grandone, E.; Surrey, S.; Fortina, P.; Margaglione, M.

    2008-01-01

    BACKGROUND: Standard methods of mutation detection are time consuming in Hemophilia A (HA) rendering their application unavailable in some analysis such as prenatal diagnosis. OBJECTIVES: To evaluate the feasibility of combinatorial sequencing-by-hybridization (cSBH) as an alternative and reliable tool for mutation detection in FVIII gene. PATIENTS/METHODS: We have applied a new method of cSBH that uses two different colors for detection of multiple point mutations in the FVIII gene. The 26 exons encompassing the HA gene were analyzed in 7 newly diagnosed Italian patients and in 19 previously characterized individuals with FVIII deficiency. RESULTS: Data show that, when solution-phase TAMRA and QUASAR labeled 5-mer oligonucleotide sets mixed with unlabeled target PCR templates are co-hybridized in the presence of DNA ligase to universal 6-mer oligonucleotide probe-based arrays, a number of mutations can be successfully detected. The technique was reliable also in identifying a mutant FVIII allele in an obligate heterozygote. A novel missense mutation (Leu1843Thr) in exon 16 and three novel neutral polymorphisms are presented with an updated protocol for 2-color cSBH. CONCLUSIONS: cSBH is a reliable tool for mutation detection in FVIII gene and may represent a complementary method for the genetic screening of HA patients. PMID:20300295

  20. Detection of Non-Nucleic Acid Targets with an Unmodified Aptamer and a Fluorogenic Competitor

    PubMed Central

    Li, Na

    2010-01-01

    Aptamers are oligonucleotides that can bind to various non-nucleic acid targets, ranging from proteins to small molecules, with a specificity and affinity comparable to that of antibodies. Most aptamer-based detection strategies require modification on the aptamer, which could lead to a significant loss in its affinity and specificity to the target. Here we reported a generic strategy to design aptamer-based optical probes. An unmodified aptamer specific to the target and a fluorogenic competitor complementary to the aptamer are utilized for target recognition and signal generation, respectively. The competitor is a hairpin oligonucleotide with a fluorophore attached on one end and a quencher attached on the other. When no target is present, the competitor binds to the aptamer. However, when the target is introduced, the competitor will be displaced from the aptamer by the target, thus resulting in a target-specific decrease in fluorescence signal. Successful application of this strategy to different types of targets (small molecules and proteins) as well as different types of aptamers (DNA and RNA) has been demonstrated. Furthermore, a thermodynamics-based prediction model was established to further rationalize the optimization process. Due to its rapidness and simplicity, this aptamer-based detection strategy holds great promise in high throughput applications. PMID:20563298

  1. Development of an oligonucleotide probe for Aureobasidium pullulans based on the small-subunit rRNA gene.

    PubMed Central

    Li, S; Cullen, D; Hjort, M; Spear, R; Andrews, J H

    1996-01-01

    Aureobasidium pullulans, a cosmopolitan yeast-like fungus, colonizes leaf surfaces and has potential as a biocontrol agent of pathogens. To assess the feasibility of rRNA as a target for A. pullulans-specific oligonucleotide probes, we compared the nucleotide sequences of the small-subunit rRNA (18S) genes of 12 geographically diverse A. pullulans strains. Extreme sequence conservation was observed. The consensus A. pullulans sequence was compared with other fungal sequences to identify potential probes. A 21-mer probe which hybridized to the 12 A. pullulans strains but not to 98 other fungi, including 82 isolates from the phylloplane, was identified. A 17-mer highly specific for Cladosporium herbarum was also identified. These probes have potential in monitoring and quantifying fungi in leaf surface and other microbial communities. PMID:8633850

  2. Using oligonucleotide aptamer probes for immunostaining of formalin-fixed and paraffin-embedded tissues

    PubMed Central

    Zeng, Zihua; Zhang, Peng; Zhao, Nianxi; Sheehan, Andrea M; Tung, Ching-Hsuan; Chang, Chung-Che; Zu, Youli

    2011-01-01

    For tissue immunostaining, antibodies are currently the only clinically validated and commercially available probes. Aptamers, which belong to a class of small molecule ligands composed of short single-stranded oligonucleotides, have emerged as probes over the last several decades; however, their potential clinical value has not yet been fully explored. Using cultured cells and an RNA-based CD30 aptamer, we recently demonstrated that the synthetic aptamer is useful as a specific probe for flow cytometric detection of CD30-expressing lymphoma cells. In this study, we further validated the use of this aptamer probe for immunostaining of formalin-fixed and paraffin-embedded lymphoma tissues. Using CD30 antibody as a standard control, we demonstrated that the synthetic CD30 aptamer specifically recognized and immunostained tumor cells of classical Hodgkin lymphoma and anaplastic large cell lymphoma, but did not react with background cells within tumor sites. Notably, the CD30 aptamer probe optimally immunostained lymphoma cells with lower temperature antigen retrieval (37 vs 96°C for antibody) and shorter probing reaction times (20 vs 90 min for antibody) than typical antibody immunostaining protocols. In addition, the CD30 aptamer probe showed no nonspecific background staining of cell debris in necrotic tissue and exhibited no cross-reaction to tissues that do not express CD30, as confirmed by a standard CD30 antibody staining. Therefore, our findings indicate that the synthetic oligonucleotide CD30 aptamer can be used as a probe for immunostaining of fixed tissue sections for disease diagnosis. PMID:20693984

  3. A fiber optic biosensor for fluorimetric detection of triple-helical DNA.

    PubMed

    Uddin, A H; Piunno, P A; Hudson, R H; Damha, M J; Krull, U J

    1997-10-15

    A fiber optic biosensor was used for the fluorimetric detection of T/AT triple-helical DNA formation. The surfaces of two sets of fused silica optical fibers were functionalized with hexaethylene oxide linkers from which decaadenylic acid oligonucleotides were grown in the 3'to 5'and 5'to 3'direction, respectively, using a DNA synthesizer. Fluorescence studies of hybridization showed unequivocal hybridization between oligomers immobilized on the fibers and complementary oligonucleotides from the solution phase, as detected by fluorescence from intercalated ethidium bromide. The complementary oligonucleotide, dT10, which was expected to Watson-Crick hybridize upon cooling the system below the duplex melting temperature ( T m), provided a fluorescence intensity with a negative temperature coefficient. Upon further cooling, to the point where the pyrimidine motif T*AT triple-helix formation occurred, a fluorescence intensity change with a positive temperature coefficient was observed. The reverse-Hoogsteen T.AT triplex, which is known to form with branched nucleic acids, provided a corresponding decrease in fluorescence intensity with decreasing temperature. Full analytical signal evolution was attainable in minutes.

  4. Design and evaluation of Actichip, a thematic microarray for the study of the actin cytoskeleton

    PubMed Central

    Muller, Jean; Mehlen, André; Vetter, Guillaume; Yatskou, Mikalai; Muller, Arnaud; Chalmel, Frédéric; Poch, Olivier; Friederich, Evelyne; Vallar, Laurent

    2007-01-01

    Background The actin cytoskeleton plays a crucial role in supporting and regulating numerous cellular processes. Mutations or alterations in the expression levels affecting the actin cytoskeleton system or related regulatory mechanisms are often associated with complex diseases such as cancer. Understanding how qualitative or quantitative changes in expression of the set of actin cytoskeleton genes are integrated to control actin dynamics and organisation is currently a challenge and should provide insights in identifying potential targets for drug discovery. Here we report the development of a dedicated microarray, the Actichip, containing 60-mer oligonucleotide probes for 327 genes selected for transcriptome analysis of the human actin cytoskeleton. Results Genomic data and sequence analysis features were retrieved from GenBank and stored in an integrative database called Actinome. From these data, probes were designed using a home-made program (CADO4MI) allowing sequence refinement and improved probe specificity by combining the complementary information recovered from the UniGene and RefSeq databases. Actichip performance was analysed by hybridisation with RNAs extracted from epithelial MCF-7 cells and human skeletal muscle. Using thoroughly standardised procedures, we obtained microarray images with excellent quality resulting in high data reproducibility. Actichip displayed a large dynamic range extending over three logs with a limit of sensitivity between one and ten copies of transcript per cell. The array allowed accurate detection of small changes in gene expression and reliable classification of samples based on the expression profiles of tissue-specific genes. When compared to two other oligonucleotide microarray platforms, Actichip showed similar sensitivity and concordant expression ratios. Moreover, Actichip was able to discriminate the highly similar actin isoforms whereas the two other platforms did not. Conclusion Our data demonstrate that Actichip is a powerful alternative to commercial high density microarrays for cytoskeleton gene profiling in normal or pathological samples. Actichip is available upon request. PMID:17727702

  5. In Situ Identification of Cyanobacteria with Horseradish Peroxidase-Labeled, rRNA-Targeted Oligonucleotide Probes

    PubMed Central

    Schönhuber, Wilhelm; Zarda, Boris; Eix, Stella; Rippka, Rosmarie; Herdman, Michael; Ludwig, Wolfgang; Amann, Rudolf

    1999-01-01

    Individual cyanobacterial cells are normally identified in environmental samples only on the basis of their pigmentation and morphology. However, these criteria are often insufficient for the differentiation of species. Here, a whole-cell hybridization technique is presented that uses horseradish peroxidase (HRP)-labeled, rRNA-targeted oligonucleotides for in situ identification of cyanobacteria. This indirect method, in which the probe-conferred enzyme has to be visualized in an additional step, was necessary since fluorescently monolabeled oligonucleotides were insufficient to overstain the autofluorescence of the target cells. Initially, a nonfluorescent detection assay was developed and successfully applied to cyanobacterial mats. Later, it was demonstrated that tyramide signal amplification (TSA) resulted in fluorescent signals far above the level of autofluorescence. Furthermore, TSA-based detection of HRP was more sensitive than that based on nonfluorescent substrates. Critical points of the assay, such as cell fixation and permeabilization, specificity, and sensitivity, were systematically investigated by using four oligonucleotides newly designed to target groups of cyanobacteria. PMID:10049892

  6. Fluorogenic PNA probes

    PubMed Central

    2018-01-01

    Fluorogenic oligonucleotide probes that can produce a change in fluorescence signal upon binding to specific biomolecular targets, including nucleic acids as well as non-nucleic acid targets, such as proteins and small molecules, have applications in various important areas. These include diagnostics, drug development and as tools for studying biomolecular interactions in situ and in real time. The probes usually consist of a labeled oligonucleotide strand as a recognition element together with a mechanism for signal transduction that can translate the binding event into a measurable signal. While a number of strategies have been developed for the signal transduction, relatively little attention has been paid to the recognition element. Peptide nucleic acids (PNA) are DNA mimics with several favorable properties making them a potential alternative to natural nucleic acids for the development of fluorogenic probes, including their very strong and specific recognition and excellent chemical and biological stabilities in addition to their ability to bind to structured nucleic acid targets. In addition, the uncharged backbone of PNA allows for other unique designs that cannot be performed with oligonucleotides or analogues with negatively-charged backbones. This review aims to introduce the principle, showcase state-of-the-art technologies and update recent developments in the areas of fluorogenic PNA probes during the past 20 years. PMID:29507634

  7. An internalin a probe-based genosensor for Listeria monocytogenes detection and differentiation.

    PubMed

    Bifulco, Laura; Ingianni, Angela; Pompei, Raffaello

    2013-01-01

    Internalin A (InlA), a protein required for Listeria monocytogenes virulence, is encoded by the inlA gene, which is only found in pathogenic strains of this genus. One of the best ways to detect and confirm the pathogenicity of the strain is the detection of one of the virulence factors produced by the microorganism. This paper focuses on the design of an electrochemical genosensor used to detect the inlA gene in Listeria strains without labelling the target DNA. The electrochemical sensor was obtained by immobilising an inlA gene probe (single-stranded oligonucleotide) on the surfaces of screen-printed gold electrodes (Au-SPEs) by means of a mercaptan-activated self-assembled monolayer (SAM). The hybridisation reaction occurring on the electrode surface was electrochemically transduced by differential pulse voltammetry (DPV) using methylene blue (MB) as an indicator. The covalently immobilised single-stranded DNA was able to selectively hybridise to its complementary DNA sequences in solution to form double-stranded DNA on the gold surface. A significant decrease of the peak current of the voltammogram (DPV) upon hybridisation of immobilised ssDNA was recorded. Whole DNA samples of L. monocytogenes strains could be discriminated from other nonpathogenic Listeria species DNA with the inlA gene DNA probe genosensor.

  8. A novel, simple and rapid nondenaturing FISH (ND-FISH) technique for the detection of plant telomeres. Potential used and possible target structures detected.

    PubMed

    Cuadrado, Angeles; Golczyk, Hieronim; Jouve, Nicolás

    2009-01-01

    We report a new technique-nondenaturing FISH (ND-FISH)-for the rapid detection of plant telomeres without the need for prior denaturation of the chromosomes. In its development, two modified, synthetic oligonucleotides, 21 nt in length, fluorescently labelled at their 5' and 3' ends and complementary to either the cytidine-rich (C(3)TA(3)) or guanosine-rich (T(3)AG(3)) telomeric DNA strands, were used as probes. The high binding affinity of these probes and the short hybridization time required allows the visualization of plant telomeres in less than an hour. In tests, both probes gave strong signals visualized as double spots at both chromosome ends; this was true of both the mitotic and meiotic chromosomes of barley, wheat, rye, maize, Brachypodium distachyon and Rhoeo spathacea. They were also able to detect telomere motifs at certain intercalary sites in the chromosomes of R. spathacea. To investigate the nature of the target structures detected, the chromosomes were treated with RNase A and single strand-specific nuclease S1 before ND-FISH experiments. Signal formation was resistant to standard enzymatic treatment, but sensitive when much higher enzyme concentrations were used. The results are discussed in relation to current knowledge of telomere structure.

  9. Submolecular Structure and Orientation of Oligonucleotide Duplexes Tethered to Gold Electrodes Probed by Infrared Reflection Absorption Spectroscopy: Effect of the Electrode Potentials.

    PubMed

    Kékedy-Nagy, László; Ferapontova, Elena E; Brand, Izabella

    2017-02-23

    Unique electronic and ligand recognition properties of the DNA double helix provide basis for DNA applications in biomolecular electronic and biosensor devices. However, the relation between the structure of DNA at electrified interfaces and its electronic properties is still not well understood. Here, potential-driven changes in the submolecular structure of DNA double helices composed of either adenine-thymine (dAdT) 25 or cytosine-guanine (dGdC) 20 base pairs tethered to the gold electrodes are for the first time analyzed by in situ polarization modulation infrared reflection absorption spectroscopy (PM IRRAS) performed under the electrochemical control. It is shown that the conformation of the DNA duplexes tethered to gold electrodes via the C 6 alkanethiol linker strongly depends on the nucleic acid sequence composition. The tilt of purine and pyrimidine rings of the complementary base pairs (dAdT and dGdC) depends on the potential applied to the electrode. By contrast, neither the conformation nor orientation of the ionic in character phosphate-sugar backbone is affected by the electrode potentials. At potentials more positive than the potential of zero charge (pzc), a gradual tilting of the double helix is observed. In this tilted orientation, the planes of the complementary purine and pyrimidine rings lie ideally parallel to each other. These potentials do not affect the integral stability of the DNA double helix at the charged interface. At potentials more negative than the pzc, DNA helices adopt a vertical to the gold surface orientation. Tilt of the purine and pyrimidine rings depends on the composition of the double helix. In monolayers composed of (dAdT) 25 molecules the rings of the complementary base pairs lie parallel to each other. By contrast, the tilt of purine and pyrimidine rings in (dGdC) 20 helices depends on the potential applied to the electrode. Such potential-induced mobility of the complementary base pairs can destabilize the helix structure at a submolecular level. These pioneer results on the potential-driven changes in the submolecular structure of double stranded DNA adsorbed on conductive supports contribute to further understanding of the potential-driven sequence-specific electronic properties of surface-tethered oligonucleotides.

  10. Scalable amplification of strand subsets from chip-synthesized oligonucleotide libraries

    PubMed Central

    Schmidt, Thorsten L.; Beliveau, Brian J.; Uca, Yavuz O.; Theilmann, Mark; Da Cruz, Felipe; Wu, Chao-Ting; Shih, William M.

    2015-01-01

    Synthetic oligonucleotides are the main cost factor for studies in DNA nanotechnology, genetics and synthetic biology, which all require thousands of these at high quality. Inexpensive chip-synthesized oligonucleotide libraries can contain hundreds of thousands of distinct sequences, however only at sub-femtomole quantities per strand. Here we present a selective oligonucleotide amplification method, based on three rounds of rolling-circle amplification, that produces nanomole amounts of single-stranded oligonucleotides per millilitre reaction. In a multistep one-pot procedure, subsets of hundreds or thousands of single-stranded DNAs with different lengths can selectively be amplified and purified together. These oligonucleotides are used to fold several DNA nanostructures and as primary fluorescence in situ hybridization probes. The amplification cost is lower than other reported methods (typically around US$ 20 per nanomole total oligonucleotides produced) and is dominated by the use of commercial enzymes. PMID:26567534

  11. Coupling Molecular Beacons to Barcoded Metal Nanowires for Multiplexed, Sealed Chamber DNA Bioassays

    PubMed Central

    Stoermer, Rebecca L.; Cederquist, Kristin B.; McFarland, Sean K.; Sha, Michael Y.; Penn, Sharron G.

    2010-01-01

    We have combined molecular beacon (MB) probes with barcoded metal nanowires to enable no-wash, sealed chamber, multiplexed detection of nucleic acids. Probe design and experimental parameters important in nanowire-based MB assays are discussed. Loop regions of 24 bases and 5 base pair stem regions in the beacon probes gave optimal performance. Our results suggest that thermodynamic predictions for secondary structure stability of solution-phase MB can guide probe design for nanowire-based assays. Dengue virus-specific probes with predicted solution-phase ΔG of folding in 500 mM buffered NaCl of approximately −4 kcal/mol performed better than those with ΔG > −2 or < −6 kcal/mol. Buffered 300–500 mM NaCl was selected after comparison of several buffers previously reported for similar types of assays, and 200–500 mM NaCl was found to be the optimal ionic strength for the hybridization temperatures (25 and 50 °C) and probe designs used here. Target binding to the surface as a function of solution concentration fit a Sips isotherm with Kd = 1.7 ± 0.3 nM. The detection limit was ∼100 pM, limited by incomplete quenching. Single base mismatches could be discriminated from fully complementary targets. Oligonucleotide target sequences specific for human immunodeficiency, hepatitis C, and severe acute respiratory viruses were assayed simultaneously in a no-wash, sealed chamber, multiplexed experiment in which each of three probe sequences was attached to a different pattern of encoded nanowires. Finally, we demonstrated that probe-coated nanowires retain their selectivity and sensitivity in a triplexed assay after storage for over 3 months. PMID:17177440

  12. Fluorescent hybridization probes for nucleic acid detection.

    PubMed

    Guo, Jia; Ju, Jingyue; Turro, Nicholas J

    2012-04-01

    Due to their high sensitivity and selectivity, minimum interference with living biological systems, and ease of design and synthesis, fluorescent hybridization probes have been widely used to detect nucleic acids both in vivo and in vitro. Molecular beacons (MBs) and binary probes (BPs) are two very important hybridization probes that are designed based on well-established photophysical principles. These probes have shown particular applicability in a variety of studies, such as mRNA tracking, single nucleotide polymorphism (SNP) detection, polymerase chain reaction (PCR) monitoring, and microorganism identification. Molecular beacons are hairpin oligonucleotide probes that present distinctive fluorescent signatures in the presence and absence of their target. Binary probes consist of two fluorescently labeled oligonucleotide strands that can hybridize to adjacent regions of their target and generate distinctive fluorescence signals. These probes have been extensively studied and modified for different applications by modulating their structures or using various combinations of fluorophores, excimer-forming molecules, and metal complexes. This review describes the applicability and advantages of various hybridization probes that utilize novel and creative design to enhance their target detection sensitivity and specificity.

  13. Quantification of different Eubacterium spp. in human fecal samples with species-specific 16S rRNA-targeted oligonucleotide probes.

    PubMed

    Schwiertz, A; Le Blay, G; Blaut, M

    2000-01-01

    Species-specific 16S rRNA-targeted, Cy3 (indocarbocyanine)-labeled oligonucleotide probes were designed and validated to quantify different Eubacterium species in human fecal samples. Probes were directed at Eubacterium barkeri, E. biforme, E. contortum, E. cylindroides (two probes), E. dolichum, E. hadrum, E. lentum, E. limosum, E. moniliforme, and E. ventriosum. The specificity of the probes was tested with the type strains and a range of common intestinal bacteria. With one exception, none of the probes showed cross-hybridization under stringent conditions. The species-specific probes were applied to fecal samples obtained from 12 healthy volunteers. E. biforme, E. cylindroides, E. hadrum, E. lentum, and E. ventriosum could be determined. All other Eubacterium species for which probes had been designed were under the detection limit of 10(7) cells g (dry weight) of feces(-1). The cell counts obtained are essentially in accordance with the literature data, which are based on colony counts. This shows that whole-cell in situ hybridization with species-specific probes is a valuable tool for the enumeration of Eubacterium species in feces.

  14. Quantification of Different Eubacterium spp. in Human Fecal Samples with Species-Specific 16S rRNA-Targeted Oligonucleotide Probes

    PubMed Central

    Schwiertz, Andreas; Le Blay, Gwenaelle; Blaut, Michael

    2000-01-01

    Species-specific 16S rRNA-targeted, Cy3 (indocarbocyanine)-labeled oligonucleotide probes were designed and validated to quantify different Eubacterium species in human fecal samples. Probes were directed at Eubacterium barkeri, E. biforme, E. contortum, E. cylindroides (two probes), E. dolichum, E. hadrum, E. lentum, E. limosum, E. moniliforme, and E. ventriosum. The specificity of the probes was tested with the type strains and a range of common intestinal bacteria. With one exception, none of the probes showed cross-hybridization under stringent conditions. The species-specific probes were applied to fecal samples obtained from 12 healthy volunteers. E. biforme, E. cylindroides, E. hadrum, E. lentum, and E. ventriosum could be determined. All other Eubacterium species for which probes had been designed were under the detection limit of 107 cells g (dry weight) of feces−1. The cell counts obtained are essentially in accordance with the literature data, which are based on colony counts. This shows that whole-cell in situ hybridization with species-specific probes is a valuable tool for the enumeration of Eubacterium species in feces. PMID:10618251

  15. A label-free, PCR-free and signal-on electrochemical DNA biosensor for Leishmania major based on gold nanoleaves.

    PubMed

    Moradi, M; Sattarahmady, N; Rahi, A; Hatam, G R; Sorkhabadi, S M Rezayat; Heli, H

    2016-12-01

    Detection of leishmaniasis is important in clinical diagnoses. In the present study, identification of Leishmania parasites was performed by a label-free, PCR-free and signal-on ultrasensitive electrochemical DNA biosensor. Gold nanoleaves were firstly electrodeposited by an electrodeposition method using spermidine as a shape directing agent. The biosensor was fabricated by immobilization of a Leishmania major specific DNA probe onto gold nanoleaves, and methylene blue was employed as a marker. Hybridization of the complementary single stranded DNA sequence with the biosensor under the selected conditions was then investigated. The biosensor could detect a synthetic DNA target in a range of 1.0×10 -10 to 1.0×10 -19 molL -1 with a limit of detection of 1.8×10 -20 molL -1 , and genomic DNA in a range of 0.5-20ngμL -1 with a limit of detection of 0.07ngμL -1 . The biosensor could distinguish Leishmania major from a non-complementary-sequence oligonucleotide and the tropica species with a high selectivity. The biosensor was applicable to detect Leishmania major in patient samples. Copyright © 2016 Elsevier B.V. All rights reserved.

  16. [Research progress of probe design software of oligonucleotide microarrays].

    PubMed

    Chen, Xi; Wu, Zaoquan; Liu, Zhengchun

    2014-02-01

    DNA microarray has become an essential medical genetic diagnostic tool for its high-throughput, miniaturization and automation. The design and selection of oligonucleotide probes are critical for preparing gene chips with high quality. Several sets of probe design software have been developed and are available to perform this work now. Every set of the software aims to different target sequences and shows different advantages and limitations. In this article, the research and development of these sets of software are reviewed in line with three main criteria, including specificity, sensitivity and melting temperature (Tm). In addition, based on the experimental results from literatures, these sets of software are classified according to their applications. This review will be helpful for users to choose an appropriate probe-design software. It will also reduce the costs of microarrays, improve the application efficiency of microarrays, and promote both the research and development (R&D) and commercialization of high-performance probe design software.

  17. Dramatic Increase in the Signal and Sensitivity of Detection via Self-Assembly of Branched DNA

    PubMed Central

    Kim, Kyung-Tae; Chae, Chi-Bom

    2011-01-01

    In molecular testing using PCR, the target DNA is amplified via PCR and the sequence of interest is investigated via hybridization with short oligonucleotide capture probes that are either in a solution or immobilized on solid supports such as beads or glass slides. In this report, we report the discovery of assembly of DNA complex(es) between a capture probe and multiple strands of the PCR product. The DNA complex most likely has branched structure. The assembly of branched DNA was facilitated by the product of asymmetric PCR. The amount of branched DNA assembled was increased five fold when the asymmetric PCR product was denatured and hybridized with a capture probe all in the same PCR reaction mixture. The major branched DNA species appeared to contain three reverse strands (the strand complementary to the capture probe) and two forward strands. The DNA was sensitive to S1 nuclease suggesting that it had single-stranded gaps. Branched DNA also appeared to be assembled with the capture probes immobilized on the surface of solid support when the product of asymmetric PCR was hybridized. Assembly of the branched DNA was also increased when hybridization was performed in complete PCR reaction mixture suggesting the requirement of DNA synthesis. Integration of asymmetric PCR, heat denaturation and hybridization in the same PCR reaction mixture with the capture probes immobilized on the surface of solid support achieved dramatic increase in the signal and sensitivity of detection of DNA. Such a system should be advantageously applied for development of automated process for detection of DNA. PMID:21870112

  18. Species-Level Identification of Orthopoxviruses with an Oligonucleotide Microchip

    PubMed Central

    Lapa, Sergey; Mikheev, Maxim; Shchelkunov, Sergei; Mikhailovich, Vladimir; Sobolev, Alexander; Blinov, Vladimir; Babkin, Igor; Guskov, Alexander; Sokunova, Elena; Zasedatelev, Alexander; Sandakhchiev, Lev; Mirzabekov, Andrei

    2002-01-01

    A method for species-specific detection of orthopoxviruses pathogenic for humans and animals is described. The method is based on hybridization of a fluorescently labeled amplified DNA specimen with the oligonucleotide DNA probes immobilized on a microchip (MAGIChip). The probes identify species-specific sites within the crmB gene encoding the viral analogue of tumor necrosis factor receptor, one of the most important determinants of pathogenicity in this genus of viruses. The diagnostic procedure takes 6 h and does not require any sophisticated equipment (a portable fluorescence reader can be used). PMID:11880388

  19. PROBES FOR THE SPECIFIC DETECTION OF CRYPTOSPORIDIUM PARVUM

    EPA Science Inventory

    A probe set, consisting of two synthetic oligonucleotides each tagged with a fluorescent reporter molecule, has been developed for specific detection of Cryptosporidium parvum.Each probe strand detects ribosomal RNA from a range of isolates of this species, and the combination is...

  20. Methods of DNA sequencing by hybridization based on optimizing concentration of matrix-bound oligonucleotide and device for carrying out same

    DOEpatents

    Khrapko, Konstantin R [Moscow, RU; Khorlin, Alexandr A [Moscow, RU; Ivanov, Igor B [Moskovskaya, RU; Ershov, Gennady M [Moscow, RU; Lysov, Jury P [Moscow, RU; Florentiev, Vladimir L [Moscow, RU; Mirzabekov, Andrei D [Moscow, RU

    1996-09-03

    A method for sequencing DNA by hybridization that includes the following steps: forming an array of oligonucleotides at such concentrations that either ensure the same dissociation temperature for all fully complementary duplexes or allows hybridization and washing of such duplexes to be conducted at the same temperature; hybridizing said oligonucleotide array with labeled test DNA; washing in duplex dissociation conditions; identifying single-base substitutions in the test DNA by analyzing the distribution of the dissociation temperatures and reconstructing the DNA nucleotide sequence based on the above analysis. A device for carrying out the method comprises a solid substrate and a matrix rigidly bound to the substrate. The matrix contains the oligonucleotide array and consists of a multiplicity of gel portions. Each gel portion contains one oligonucleotide of desired length. The gel portions are separated from one another by interstices and have a thickness not exceeding 30 .mu.m.

  1. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Andersen, G.L.; He, Z.; DeSantis, T.Z.

    Microarrays have proven to be a useful and high-throughput method to provide targeted DNA sequence information for up to many thousands of specific genetic regions in a single test. A microarray consists of multiple DNA oligonucleotide probes that, under high stringency conditions, hybridize only to specific complementary nucleic acid sequences (targets). A fluorescent signal indicates the presence and, in many cases, the abundance of genetic regions of interest. In this chapter we will look at how microarrays are used in microbial ecology, especially with the recent increase in microbial community DNA sequence data. Of particular interest to microbial ecologists, phylogeneticmore » microarrays are used for the analysis of phylotypes in a community and functional gene arrays are used for the analysis of functional genes, and, by inference, phylotypes in environmental samples. A phylogenetic microarray that has been developed by the Andersen laboratory, the PhyloChip, will be discussed as an example of a microarray that targets the known diversity within the 16S rRNA gene to determine microbial community composition. Using multiple, confirmatory probes to increase the confidence of detection and a mismatch probe for every perfect match probe to minimize the effect of cross-hybridization by non-target regions, the PhyloChip is able to simultaneously identify any of thousands of taxa present in an environmental sample. The PhyloChip is shown to reveal greater diversity within a community than rRNA gene sequencing due to the placement of the entire gene product on the microarray compared with the analysis of up to thousands of individual molecules by traditional sequencing methods. A functional gene array that has been developed by the Zhou laboratory, the GeoChip, will be discussed as an example of a microarray that dynamically identifies functional activities of multiple members within a community. The recent version of GeoChip contains more than 24,000 50mer oligonucleotide probes and covers more than 10,000 gene sequences in 150 gene categories involved in carbon, nitrogen, sulfur, and phosphorus cycling, metal resistance and reduction, and organic contaminant degradation. GeoChip can be used as a generic tool for microbial community analysis, and also link microbial community structure to ecosystem functioning. Examples of the application of both arrays in different environmental samples will be described in the two subsequent sections.« less

  2. Silver-dendrimer nanocomposites as oligonucleotide labels for electrochemical stripping detection of DNA hybridization.

    PubMed

    Jin, Xin; Zhou, Ling; Zhu, Bo; Jiang, Xue; Zhu, Ningning

    2018-06-01

    Silver-dendrimer nanocomposites were synthesized and used as oligonucleotide labels for electrochemical stripping detection of DNA hybridization. The synthesized silver-dendrimer nanocomposites were characterized by UV-vis spectrophotometry, X-ray photoelectron spectroscopy (XPS) and transmission electron microscopy (TEM). Ratios of silver/dendrimer were optimized in order to obtain stable nanocomposites with maximal silver loading in the interior of a polymeric shell. The silver-dendrimer nanocomposites were attached to sequence-known DNA probes specific to colitoxin, and used to detect probe hybridization by dissolution of the silver nanoparticles in the interior of dendrimer in a diluted nitric acid, followed by measurement of Ag + ions by anodic stripping voltammetry (ASV). Use of differential pulse voltammetry for the stripping step, along with optimization of the ASV conditions, enabled a detection limit of 0.78 pM. The present strategy, in combination with dendrimer-encapsulated copper labeled oligonucleotides probe reported previously, could potentially be used to detect single or multiple DNA targets in one sample. Copyright © 2018 Elsevier B.V. All rights reserved.

  3. Use of continuous/contiguous stacking hybridization as a diagnostic tool

    DOEpatents

    Mirzabekov, Andrei Darievich; Yershov, Gennadiy Moseyevich; Kirillov, Eugene Vladislavovich; Parinov, Sergei Valeryevich; Barski, Victor Evgenievich; Lysov, Yuri Petrovich

    1999-01-01

    A method for detecting disease-associated alleles in patient genetic material is provided whereby a first group of oligonucleotide molecules, synthesized to compliment base sequences of the disease associated alleles is immobilized on a predetermined position on a substrate, and then contacted with patient genetic material to form duplexes. The duplexes are then contacted with a second group of oligonucleotide molecules which are synthesized to extend the predetermined length of the oligonucleotide molecules of the first group, and where each of the oligonucleotide molecules of the second group are tagged and either incorporate universal bases or a mixture of guanine, cytosine, thymine, and adenine, or complementary nucleotide strands that are tagged with a different fluorochrome which radiates light at a predetermined wavelength. The treated substrate is then washed and the light patterns radiating therefrom are compared with predetermined light patterns of various diseases that were prepared on identical substrates.

  4. Use of continuous/contiguous stacking hybridization as a diagnostic tool

    DOEpatents

    Mirzabekov, A.D.; Yershov, G.M.; Kirillov, E.V.; Parinov, S.V.; Barski, V.E.; Lysov, Y.P.

    1999-06-01

    A method for detecting disease-associated alleles in patient genetic material is provided whereby a first group of oligonucleotide molecules, synthesized to compliment base sequences of the disease associated alleles is immobilized on a predetermined position on a substrate, and then contacted with patient genetic material to form duplexes. The duplexes are then contacted with a second group of oligonucleotide molecules which are synthesized to extend the predetermined length of the oligonucleotide molecules of the first group, and where each of the oligonucleotide molecules of the second group are tagged and either incorporate universal bases or a mixture of guanine, cytosine, thymine, and adenine, or complementary nucleotide strands that are tagged with a different fluorochrome which radiates light at a predetermined wavelength. The treated substrate is then washed and the light patterns radiating therefrom are compared with predetermined light patterns of various diseases that were prepared on identical substrates. 5 figs.

  5. Silver Nanoparticle Oligonucleotide Conjugates Based on DNA with Triple Cyclic Disulfide Moieties

    PubMed Central

    Lee, Jae-Seung; Lytton-Jean, Abigail K. R.; Hurst, Sarah J.; Mirkin, Chad A.

    2011-01-01

    We report a new strategy for preparing silver nanoparticle oligonucleotide conjugates that are based upon DNA with cyclic disulfide-anchoring groups. These particles are extremely stable and can withstand NaCl concentrations up to 1.0 M. When silver nanoparticles functionalized with complementary sequences are combined, they assemble to form DNA-linked nanoparticle networks. This assembly process is reversible with heating and is associated with a red-shifting of the particle surface plasmon resonance and a concomitant color change from yellow to pale red. Analogous to the oligonucleotide-functionalized gold nanoparticles, these particles also exhibit highly cooperative binding properties with extremely sharp melting transitions. This work is an important step towards being able to use silver nanoparticle oligonucleotide conjugates for a variety of purposes, including molecular diagnostic labels, synthons in programmable materials synthesis approaches, and functional components for nanoelectronic and plasmonic devices. PMID:17571909

  6. Molecular diversity, cultivation, and improved detection by fluorescent in situ hybridization of a dominant group of human gut bacteria related to Roseburia spp. or Eubacterium rectale.

    PubMed

    Aminov, Rustam I; Walker, Alan W; Duncan, Sylvia H; Harmsen, Hermie J M; Welling, Gjalt W; Flint, Harry J

    2006-09-01

    Phylogenetic analysis was used to compare 16S rRNA sequences from 19 cultured human gut strains of Roseburia and Eubacterium rectale with 356 related sequences derived from clone libraries. The cultured strains were found to represent five of the six phylotypes identified. A new oligonucleotide probe, Rrec584, and the previous group probe Rint623, when used in conjunction with a new helper oligonucleotide, each recognized an average of 7% of bacteria detected by the eubacterial probe Eub338 in feces from 10 healthy volunteers. Most of the diversity within this important group of butyrate-producing gut bacteria can apparently be retrieved through cultivation.

  7. Molecular Diversity, Cultivation, and Improved Detection by Fluorescent In Situ Hybridization of a Dominant Group of Human Gut Bacteria Related to Roseburia spp. or Eubacterium rectale

    PubMed Central

    Aminov, Rustam I.; Walker, Alan W.; Duncan, Sylvia H.; Harmsen, Hermie J. M.; Welling, Gjalt W.; Flint, Harry J.

    2006-01-01

    Phylogenetic analysis was used to compare 16S rRNA sequences from 19 cultured human gut strains of Roseburia and Eubacterium rectale with 356 related sequences derived from clone libraries. The cultured strains were found to represent five of the six phylotypes identified. A new oligonucleotide probe, Rrec584, and the previous group probe Rint623, when used in conjunction with a new helper oligonucleotide, each recognized an average of 7% of bacteria detected by the eubacterial probe Eub338 in feces from 10 healthy volunteers. Most of the diversity within this important group of butyrate-producing gut bacteria can apparently be retrieved through cultivation. PMID:16957265

  8. Quantitative surface-enhanced resonance Raman scattering of phthalocyanine-labelled oligonucleotides

    PubMed Central

    Macaskill, A.; Chernonosov, A. A.; Koval, V. V.; Lukyanets, E. A.; Fedorova, O. S.; Smith, W. E.; Faulds, K.; Graham, D.

    2007-01-01

    The evaluation of phthalocyanine labels for the surface-enhanced resonance Raman scattering (SERRS) detection of oligonucleotides is reported. Three phthalocyanine-labelled oligonucleotides were assessed, each containing a different metal centre. Detection limits for each labelled oligonucleotide were determined using two excitation frequencies where possible. Limits of detection as low as 2.8 × 10−11 mol. dm−3 were obtained which are comparable to standard fluorescently labelled probes used in previous SERRS studies. The identification of two phthalocyanine-labelled oligonucleotides without separation was also demonstrated indicating their suitability for multiplexing. This study extends the range of labels suitable for quantitative surface-enhanced resonance Raman scattering with silver nanoparticles and offers more flexibility and choice when considering SERRS for quantitative DNA detection. PMID:17289751

  9. DNA biosensors implemented on PNA-functionalized microstructured optical fibers Bragg gratings

    NASA Astrophysics Data System (ADS)

    Candiani, A.; Giannetti, S.; Cucinotta, A.; Bertucci, A.; Manicardi, A.; Konstantaki, M.; Margulis, W.; Pissadakis, S.; Corradini, R.; Selleri, S.

    2013-05-01

    A novel DNA sensing platform based on a Peptide Nucleic Acid - functionalized Microstructured Optical Fibers gratings has been demonstrated. The inner surface of different MOFs has been functionalized using PNA probes, OligoNucleotides mimic that are well suited for specific DNA target sequences detection. The hybrid sensing systems were tested for optical DNA detection of targets of relevance in biomedical application, using the cystic fibrosis gene mutation, and food-analysis, using the genomic DNA from genetic modified organism soy flour. After the solutions of DNA molecules has been infiltrated inside the fibers capillaries and hybridization has occurred, oligonucleotidefunctionalized gold nanoparticles were infiltrated and used to form a sandwich-like system to achieve signal amplification. Spectral measurements of the reflected signal reveal a clear wavelength shift of the reflected modes when the infiltrated complementary DNA matches with the PNA probes placed on the inner fiber surface. Measurements have also been made using the mismatched DNA solution for the c, containing a single nucleotide polymorphism, showing no significant changes in the reflected spectrum. Several experiments have been carried out demonstrating the reproducibility of the results and the high selectivity of the sensors, showing the simplicity and the potential of this approach.

  10. Electrochemical detection of the MT-ND6 gene and its enzymatic digestion: application in human genomic sample.

    PubMed

    Mazloum-Ardakani, Mohammad; Ahmadi, Roya; Heidari, Mohammad Mehdi; Sheikh-Mohseni, Mohammad Ali

    2014-06-15

    A simple electrochemical biosensor was developed for the detection of the mitochondrial NADH dehydrogenase 6 gene (MT-ND6) and its enzymatic digestion by BamHI enzyme. This biosensor was fabricated by modification of a glassy carbon electrode with gold nanoparticles (AuNPs/GCE) and a probe oligonucleotide (ssDNA/AuNPs/GCE). The probe, which is a thiolated segment of the MT-ND6 gene, was deposited by self-assembling immobilization on AuNPs/GCE. Two indicators including methylene blue (MB) and neutral red (NR) were used as the electroactive indicators and the electrochemical response of the modified electrode was measured by differential pulse voltammetry. The proposed biosensor can detect the complementary sequences of the MT-ND6 gene. Also the modified electrode was used for the detection of an enzymatic digestion process by BamHI enzyme. The electrochemical biosensor can detect the MT-ND6 gene and its enzymatic digestion in polymerase chain reaction (PCR)-amplified DNA extracted from human blood. Also the biosensor was used directly for detection of the MT-ND6 gene in all of the human genome. Copyright © 2014 Elsevier Inc. All rights reserved.

  11. Sensitive and specific miRNA detection method using SplintR Ligase

    PubMed Central

    Jin, Jingmin; Vaud, Sophie; Zhelkovsky, Alexander M.; Posfai, Janos; McReynolds, Larry A.

    2016-01-01

    We describe a simple, specific and sensitive microRNA (miRNA) detection method that utilizes Chlorella virus DNA ligase (SplintR® Ligase). This two-step method involves ligation of adjacent DNA oligonucleotides hybridized to a miRNA followed by real-time quantitative PCR (qPCR). SplintR Ligase is 100X faster than either T4 DNA Ligase or T4 RNA Ligase 2 for RNA splinted DNA ligation. Only a 4–6 bp overlap between a DNA probe and miRNA was required for efficient ligation by SplintR Ligase. This property allows more flexibility in designing miRNA-specific ligation probes than methods that use reverse transcriptase for cDNA synthesis of miRNA. The qPCR SplintR ligation assay is sensitive; it can detect a few thousand molecules of miR-122. For miR-122 detection the SplintR qPCR assay, using a FAM labeled double quenched DNA probe, was at least 40× more sensitive than the TaqMan assay. The SplintR method, when coupled with NextGen sequencing, allowed multiplex detection of miRNAs from brain, kidney, testis and liver. The SplintR qPCR assay is specific; individual let-7 miRNAs that differ by one nucleotide are detected. The rapid kinetics and ability to ligate DNA probes hybridized to RNA with short complementary sequences makes SplintR Ligase a useful enzyme for miRNA detection. PMID:27154271

  12. Controllable molecular motors engineered from myosin and RNA

    NASA Astrophysics Data System (ADS)

    Omabegho, Tosan; Gurel, Pinar S.; Cheng, Clarence Y.; Kim, Laura Y.; Ruijgrok, Paul V.; Das, Rhiju; Alushin, Gregory M.; Bryant, Zev

    2018-01-01

    Engineering biomolecular motors can provide direct tests of structure-function relationships and customized components for controlling molecular transport in artificial systems1 or in living cells2. Previously, synthetic nucleic acid motors3-5 and modified natural protein motors6-10 have been developed in separate complementary strategies to achieve tunable and controllable motor function. Integrating protein and nucleic-acid components to form engineered nucleoprotein motors may enable additional sophisticated functionalities. However, this potential has only begun to be explored in pioneering work harnessing DNA scaffolds to dictate the spacing, number and composition of tethered protein motors11-15. Here, we describe myosin motors that incorporate RNA lever arms, forming hybrid assemblies in which conformational changes in the protein motor domain are amplified and redirected by nucleic acid structures. The RNA lever arm geometry determines the speed and direction of motor transport and can be dynamically controlled using programmed transitions in the lever arm structure7,9. We have characterized the hybrid motors using in vitro motility assays, single-molecule tracking, cryo-electron microscopy and structural probing16. Our designs include nucleoprotein motors that reversibly change direction in response to oligonucleotides that drive strand-displacement17 reactions. In multimeric assemblies, the controllable motors walk processively along actin filaments at speeds of 10-20 nm s-1. Finally, to illustrate the potential for multiplexed addressable control, we demonstrate sequence-specific responses of RNA variants to oligonucleotide signals.

  13. Identification of Brucella spp. by using the polymerase chain reaction.

    PubMed Central

    Herman, L; De Ridder, H

    1992-01-01

    The application of two synthetic oligonucleotides as probes and as primers in the polymerase chain reaction is presented for a specific, sensitive, and quick identification of Brucella spp. The specific oligonucleotide sequences were chosen on the basis of a 16S rRNA sequence alignment between Brucella abortus and Agrobacterium tumefaciens. Images PMID:1377903

  14. Optimization of single-base-pair mismatch discrimination in oligonucleotide microarrays

    NASA Technical Reports Server (NTRS)

    Urakawa, Hidetoshi; El Fantroussi, Said; Smidt, Hauke; Smoot, James C.; Tribou, Erik H.; Kelly, John J.; Noble, Peter A.; Stahl, David A.

    2003-01-01

    The discrimination between perfect-match and single-base-pair-mismatched nucleic acid duplexes was investigated by using oligonucleotide DNA microarrays and nonequilibrium dissociation rates (melting profiles). DNA and RNA versions of two synthetic targets corresponding to the 16S rRNA sequences of Staphylococcus epidermidis (38 nucleotides) and Nitrosomonas eutropha (39 nucleotides) were hybridized to perfect-match probes (18-mer and 19-mer) and to a set of probes having all possible single-base-pair mismatches. The melting profiles of all probe-target duplexes were determined in parallel by using an imposed temperature step gradient. We derived an optimum wash temperature for each probe and target by using a simple formula to calculate a discrimination index for each temperature of the step gradient. This optimum corresponded to the output of an independent analysis using a customized neural network program. These results together provide an experimental and analytical framework for optimizing mismatch discrimination among all probes on a DNA microarray.

  15. The utilization of SiNWs/AuNPs-modified indium tin oxide (ITO) in fabrication of electrochemical DNA sensor.

    PubMed

    Rashid, Jahwarhar Izuan Abdul; Yusof, Nor Azah; Abdullah, Jaafar; Hashim, Uda; Hajian, Reza

    2014-12-01

    This work describes the incorporation of SiNWs/AuNPs composite as a sensing material for DNA detection on indium tin-oxide (ITO) coated glass slide. The morphology of SiNWs/AuNPs composite as the modifier layer on ITO was studied by scanning electron microscopy (SEM) and energy dispersive X-ray spectroscopy (EDX). The morphological studies clearly showed that SiNWs were successfully decorated with 20 nm-AuNPs using self-assembly monolayer (SAM) technique. The effective surface area for SiNWs/AuNPs-modified ITO enhanced about 10 times compared with bare ITO electrode. SiNWs/AuNPs nanocomposite was further explored as a matrix for DNA probe immobilization in detection of dengue virus as a bio-sensing model to evaluate its performance in electrochemical sensors. The hybridization of complementary DNA was monitored by differential pulse voltammetry (DPV) using methylene blue (MB) as the redox indicator. The fabricated biosensor was able to discriminate significantly complementary, non-complementary and single-base mismatch oligonucleotides. The electrochemical biosensor was sensitive to target DNA related to dengue virus in the range of 9.0-178.0 ng/ml with detection limit of 3.5 ng/ml. In addition, SiNWs/AuNPs-modified ITO, regenerated up to 8 times and its stability was up to 10 weeks at 4°C in silica gel. Copyright © 2014 Elsevier B.V. All rights reserved.

  16. Chimeric RNase H–Competent Oligonucleotides Directed to the HIV-1 Rev Response Element

    PubMed Central

    Prater, Chrissy E.; Saleh, Anthony D.; Wear, Maggie P.; Miller, Paul S.

    2007-01-01

    Chimeric oligo-2′-O-methylribonucleotides containing centrally located patches of contiguous 2′-deoxyribonucleotides and terminating in a nuclease resistant 3′-methylphosphonate internucleotide linkage were prepared. The oligonucleotides were targeted to the 3′-side of HIV Rev response element (RRE) stem-loop IIB RNA, which is adjacent to the high affinity Rev protein binding site and is critical to virus function. Thermal denaturation experiments showed that chimeric oligonucleotides form very stable duplexes with a complementary single-stranded RNA, and gel electrophoretic mobility shift assays (EMSA) showed that they bind with high affinity and specificity to RRE stem-loop II RNA (KD approximately 200 nM). The chimeric oligonucleotides promote RNase H-mediated hydrolysis of RRE stem-loop II RNA and have half lives exceeding 24 h when incubated in cell culture medium containing 10% fetal calf serum. One of the chimeric oligonucleotides inhibited RRE mediated expression of chloramphenicol acetyl transferase (CAT) approximately 60% at a concentration of 300 nM in HEK 293T cells co-transfected with p-RRE/CAT and p-Rev mammalian expression vectors. PMID:17566743

  17. Oligonucleotide-Gold Nanoparticle Networks for Detection of Cryptosporidium parvum Heat Shock Protein 70 mRNA ▿

    PubMed Central

    Javier, David J.; Castellanos-Gonzalez, Alejandro; Weigum, Shannon E.; White, A. Clinton; Richards-Kortum, Rebecca

    2009-01-01

    We report on a novel strategy for the detection of mRNA targets derived from Cryptosporidium parvum oocysts by the use of oligonucleotide-gold nanoparticles. Gold nanoparticles are functionalized with oligonucleotides which are complementary to unique sequences present on the heat shock protein 70 (HSP70) DNA/RNA target. The results indicate that the presence of HPS70 targets of increasing complexity causes the formation of oligonucleotide-gold nanoparticle networks which can be visually monitored via a simple colorimetric readout measured by a total internal reflection imaging setup. Furthermore, the induced expression of HSP70 mRNA in Cryptosporidium parvum oocysts via a simple heat shock process provides nonenzymatic amplification such that the HSP70 mRNA derived from as few as 5 × 103 purified C. parvum oocysts was successfully detected. Taken together, these results support the use of oligonucleotide-gold nanoparticles for the molecular diagnosis of cryptosporidiosis, offering new opportunities for the further development of point-of-care diagnostic assays with low-cost, robust reagents and simple colorimetric detection. PMID:19828740

  18. Rapid purification of circular DNA by triplex-mediated affinity capture

    DOEpatents

    Ji, Huamin; Smith, Lloyd M.

    1997-01-01

    A single-step capture of a target supercoiled double-stranded DNA molecule is accomplished by forming a local triple-helix among two strands of the supercoiled circular DNA and an oligonucleotide probe. The oligonucleotide is bound to an immobilizing support which facilitates the immobilization and purification of target DNA molecules. Non-target DNA molecules and other contaminating cellular material are easily removed by washing. The triple-helical structure is destabilized by raising the pH, leaving purified target DNA in the supernatant and reusable affinity capture oligonucleotide secured to the immobilizing support.

  19. Oligonucleotides as probes for studying polymerization reactions in dilute aqueous solution

    NASA Technical Reports Server (NTRS)

    Kolb, V.; Orgel, L. E.; Miller, S. L. (Principal Investigator)

    1994-01-01

    We have prepared a [32P]-labled oligonucleotide probe carrying a free primary amine at its 3'-terminus. This probe is used to initiate polymerization of aziridine (ethyleneimine) in aqueous solution. The nature of the oligomeric products and the kinetics of their formation are then monitored by gel electrophoresis. Our results are generally consistent with those obtained using conventional techniques. We have also investigated the effect of polyanionic templates on the rate of oligomerization of aziridine. We find that water-soluble polyanions generally accelerate the polymerization. The sodium salt of polymethacrylic acid is the most effective of the templates that we studied. The methods introduced in this paper should be applicable to a variety of polymerization reactions in aqueous solution. They should greatly simplify the screening of potentially prebiotic polymerization reactions.

  20. Visualization of mcr mRNA in a methanogen by fluorescence in situ hybridization with an oligonucleotide probe and two-pass tyramide signal amplification (two-pass TSA-FISH).

    PubMed

    Kubota, Kengo; Ohashi, Akiyoshi; Imachi, Hiroyuki; Harada, Hideki

    2006-09-01

    Two-pass tyramide signal amplification-fluorescence in situ hybridization (two-pass TSA-FISH) with a horseradish peroxidase (HRP)-labeled oligonucleotide probe was applied to detect prokaryotic mRNA. In this study, mRNA of a key enzyme for methanogenesis, methyl coenzyme M reductase (mcr), in Methanococcus vannielii was targeted. Applicability of mRNA-targeted probes to in situ hybridization was verified by Clone-FISH. It was observed that sensitivity of two-pass TSA-FISH was significantly higher than that of TSA-FISH, which was further increased by the addition of dextran sulphate in TSA working solution. Signals from two-pass TSA-FISH were more reliable compared to the weak, spotty signals yielded by TSA-FISH.

  1. MALDI MS analysis of oligonucleotides: desalting by functional magnetite beads using microwave-assisted extraction.

    PubMed

    Chen, Wei-Yu; Chen, Yu-Chie

    2007-11-01

    The presence of alkali cation adductions of oligonucleotides commonly deteriorates matrix-assisted laser desorption/ionization (MALDI) mass spectra. Thus, desalting is required for oligonucleotide samples prior to MALDI MS analysis in order to prevent the mass spectra from developing poor quality. In this paper, we demonstrate a new approach to extract traces of oligonucleotides from aqueous solutions containing high concentrations of salts using microwave-assisted extraction. The C18-presenting magnetite beads, capable of absorbing microwave irradiation, are used as affinity probes for oligonucleotides with the addition of triethylammonium acetate as the counterions. This new microwave-assisted extraction approach using magnetite beads as the trapping agents and as microwave-absorbers has been demonstrated to be very effective in the selective binding of oligonucleotides from aqueous solutions. The extraction of oligonucleotides from solutions onto the C18-presenting magnetite beads takes only 30 s to enrich oligonucleotides in sufficient quantities for MALDI MS analysis. After using this desalting approach, alkali cation adductions of oligonucleotides are dramatically reduced in the MALDI mass spectra. The presence of saturated NaCl (approximately 6 M) in the oligonucleotide sample is tolerated without degrading the mass spectra. The detection limit for d(A)6 is approximately 2.8 fmol.

  2. Selection and application of strand displacement probes for a fumonisin B1 aptamer

    USDA-ARS?s Scientific Manuscript database

    Fumonisin B1 (FB1) is a toxin produced by Fusarium moniliforme, mainly on contaminated maize and maize products. In this study a solid surface chain displacement strategy was used to isolate oligonucleotide displacement probes for a FB1 aptamer. The probes were used as the basis for the development ...

  3. A direct detection of Escherichia coli genomic DNA using gold nanoprobes

    PubMed Central

    2012-01-01

    Background In situation like diagnosis of clinical and forensic samples there exists a need for highly sensitive, rapid and specific DNA detection methods. Though conventional DNA amplification using PCR can provide fast results, it is not widely practised in diagnostic laboratories partially because it requires skilled personnel and expensive equipment. To overcome these limitations nanoparticles have been explored as signalling probes for ultrasensitive DNA detection that can be used in field applications. Among the nanomaterials, gold nanoparticles (AuNPs) have been extensively used mainly because of its optical property and ability to get functionalized with a variety of biomolecules. Results We report a protocol for the use of gold nanoparticles functionalized with single stranded oligonucleotide (AuNP- oligo probe) as visual detection probes for rapid and specific detection of Escherichia coli. The AuNP- oligo probe on hybridization with target DNA containing complementary sequences remains red whereas test samples without complementary DNA sequences to the probe turns purple due to acid induced aggregation of AuNP- oligo probes. The color change of the solution is observed visually by naked eye demonstrating direct and rapid detection of the pathogenic Escherichia coli from its genomic DNA without the need for PCR amplification. The limit of detection was ~54 ng for unamplified genomic DNA. The method requires less than 30 minutes to complete after genomic DNA extraction. However, by using unamplified enzymatic digested genomic DNA, the detection limit of 11.4 ng was attained. Results of UV-Vis spectroscopic measurement and AFM imaging further support the hypothesis of aggregation based visual discrimination. To elucidate its utility in medical diagnostic, the assay was validated on clinical strains of pathogenic Escherichia coli obtained from local hospitals and spiked urine samples. It was found to be 100% sensitive and proves to be highly specific without any cross reaction with non-Escherichia coli strains. Conclusion This work gives entry into a new class of DNA/gold nanoparticles hybrid materials which might have optical property that can be controlled for application in diagnostics. We note that it should be possible to extend this strategy easily for developing new types of DNA biosensor for point of care detection. The salient feature of this approach includes low-cost, robust reagents and simple colorimetric detection of pathogen. PMID:22309695

  4. Superiorities of time-correlated single-photon counting against standard fluorimetry in exploiting the potential of fluorochromized oligonucleotide probes for biomedical investigation

    NASA Astrophysics Data System (ADS)

    Lamperti, Marco; Nardo, Luca; Bondani, Maria

    2015-05-01

    Site-specific fluorescence-resonance-energy-transfer donor-acceptor dual-labelled oligonucleotide probes are widely used in state-of-art biotechnological applications. Such applications include their usage as primers in polymerase chain reaction. However, the steady-state fluorescence intensity signal emitted by these molecular tools strongly depends from the specificities of the probe conformation. For this reason, the information which can be reliably inferred by steady-state fluorimetry performed on such samples is forcedly confined to a semi-qualitative level. Namely, fluorescent emission is frequently used as ON/OFF indicator of the probe hybridization state, i.e. detection of fluorescence signals indicates either hybridization to or detachment from the template DNA of the probe. Nonetheless, a fully quantitative analysis of their fluorescence emission properties would disclose other exciting applications of dual-labelled probes in biosensing. Here we show how time-correlated single-photon counting can be applied to get rid of the technical limitations and interpretational ambiguities plaguing the intensity analysis, and to derive information on the template DNA reaching single-base.

  5. Relative quantification of 40 nucleic acid sequences by multiplex ligation-dependent probe amplification

    PubMed Central

    Schouten, Jan P.; McElgunn, Cathal J.; Waaijer, Raymond; Zwijnenburg, Danny; Diepvens, Filip; Pals, Gerard

    2002-01-01

    We describe a new method for relative quantification of 40 different DNA sequences in an easy to perform reaction requiring only 20 ng of human DNA. Applications shown of this multiplex ligation-dependent probe amplification (MLPA) technique include the detection of exon deletions and duplications in the human BRCA1, MSH2 and MLH1 genes, detection of trisomies such as Down’s syndrome, characterisation of chromosomal aberrations in cell lines and tumour samples and SNP/mutation detection. Relative quantification of mRNAs by MLPA will be described elsewhere. In MLPA, not sample nucleic acids but probes added to the samples are amplified and quantified. Amplification of probes by PCR depends on the presence of probe target sequences in the sample. Each probe consists of two oligonucleotides, one synthetic and one M13 derived, that hybridise to adjacent sites of the target sequence. Such hybridised probe oligonucleotides are ligated, permitting subsequent amplification. All ligated probes have identical end sequences, permitting simultaneous PCR amplification using only one primer pair. Each probe gives rise to an amplification product of unique size between 130 and 480 bp. Probe target sequences are small (50–70 nt). The prerequisite of a ligation reaction provides the opportunity to discriminate single nucleotide differences. PMID:12060695

  6. Relative quantification of 40 nucleic acid sequences by multiplex ligation-dependent probe amplification.

    PubMed

    Schouten, Jan P; McElgunn, Cathal J; Waaijer, Raymond; Zwijnenburg, Danny; Diepvens, Filip; Pals, Gerard

    2002-06-15

    We describe a new method for relative quantification of 40 different DNA sequences in an easy to perform reaction requiring only 20 ng of human DNA. Applications shown of this multiplex ligation-dependent probe amplification (MLPA) technique include the detection of exon deletions and duplications in the human BRCA1, MSH2 and MLH1 genes, detection of trisomies such as Down's syndrome, characterisation of chromosomal aberrations in cell lines and tumour samples and SNP/mutation detection. Relative quantification of mRNAs by MLPA will be described elsewhere. In MLPA, not sample nucleic acids but probes added to the samples are amplified and quantified. Amplification of probes by PCR depends on the presence of probe target sequences in the sample. Each probe consists of two oligonucleotides, one synthetic and one M13 derived, that hybridise to adjacent sites of the target sequence. Such hybridised probe oligonucleotides are ligated, permitting subsequent amplification. All ligated probes have identical end sequences, permitting simultaneous PCR amplification using only one primer pair. Each probe gives rise to an amplification product of unique size between 130 and 480 bp. Probe target sequences are small (50-70 nt). The prerequisite of a ligation reaction provides the opportunity to discriminate single nucleotide differences.

  7. Biorecognition by DNA oligonucleotides after Exposure to Photoresists and Resist Removers

    PubMed Central

    Dean, Stacey L.; Morrow, Thomas J.; Patrick, Sue; Li, Mingwei; Clawson, Gary; Mayer, Theresa S.; Keating, Christine D.

    2013-01-01

    Combining biological molecules with integrated circuit technology is of considerable interest for next generation sensors and biomedical devices. Current lithographic microfabrication methods, however, were developed for compatibility with silicon technology rather than bioorganic molecules and consequently it cannot be assumed that biomolecules will remain attached and intact during on-chip processing. Here, we evaluate the effects of three common photoresists (Microposit S1800 series, PMGI SF6, and Megaposit SPR 3012) and two photoresist removers (acetone and 1165 remover) on the ability of surface-immobilized DNA oligonucleotides to selectively recognize their reverse-complementary sequence. Two common DNA immobilization methods were compared: adsorption of 5′-thiolated sequences directly to gold nanowires and covalent attachment of 5′-thiolated sequences to surface amines on silica coated nanowires. We found that acetone had deleterious effects on selective hybridization as compared to 1165 remover, presumably due to incomplete resist removal. Use of the PMGI photoresist, which involves a high temperature bake step, was detrimental to the later performance of nanowire-bound DNA in hybridization assays, especially for DNA attached via thiol adsorption. The other three photoresists did not substantially degrade DNA binding capacity or selectivity for complementary DNA sequences. To determine if the lithographic steps caused more subtle damage, we also tested oligonucleotides containing a single base mismatch. Finally, a two-step photolithographic process was developed and used in combination with dielectrophoretic nanowire assembly to produce an array of doubly-contacted, electrically isolated individual nanowire components on a chip. Post-fabrication fluorescence imaging indicated that nanowire-bound DNA was present and able to selectively bind complementary strands. PMID:23952639

  8. Competitive Reporter Monitored Amplification (CMA) - Quantification of Molecular Targets by Real Time Monitoring of Competitive Reporter Hybridization

    PubMed Central

    Ullrich, Thomas; Ermantraut, Eugen; Schulz, Torsten; Steinmetzer, Katrin

    2012-01-01

    Background State of the art molecular diagnostic tests are based on the sensitive detection and quantification of nucleic acids. However, currently established diagnostic tests are characterized by elaborate and expensive technical solutions hindering the development of simple, affordable and compact point-of-care molecular tests. Methodology and Principal Findings The described competitive reporter monitored amplification allows the simultaneous amplification and quantification of multiple nucleic acid targets by polymerase chain reaction. Target quantification is accomplished by real-time detection of amplified nucleic acids utilizing a capture probe array and specific reporter probes. The reporter probes are fluorescently labeled oligonucleotides that are complementary to the respective capture probes on the array and to the respective sites of the target nucleic acids in solution. Capture probes and amplified target compete for reporter probes. Increasing amplicon concentration leads to decreased fluorescence signal at the respective capture probe position on the array which is measured after each cycle of amplification. In order to observe reporter probe hybridization in real-time without any additional washing steps, we have developed a mechanical fluorescence background displacement technique. Conclusions and Significance The system presented in this paper enables simultaneous detection and quantification of multiple targets. Moreover, the presented fluorescence background displacement technique provides a generic solution for real time monitoring of binding events of fluorescently labelled ligands to surface immobilized probes. With the model assay for the detection of human immunodeficiency virus type 1 and 2 (HIV 1/2), we have been able to observe the amplification kinetics of five targets simultaneously and accommodate two additional hybridization controls with a simple instrument set-up. The ability to accommodate multiple controls and targets into a single assay and to perform the assay on simple and robust instrumentation is a prerequisite for the development of novel molecular point of care tests. PMID:22539973

  9. Discriminating DNA mismatches by electrochemical and gravimetric techniques.

    PubMed

    Mazouz, Zouhour; Fourati, Najla; Zerrouki, Chouki; Ommezine, Asma; Rebhi, Lamia; Yaakoubi, Nourdin; Kalfat, Rafik; Othmane, Ali

    2013-10-15

    A silicon nitride functionalized electrode and a 104 MHz lithium tantalate (LiTaO₃) surface acoustic wave (SAW) sensor have been used to investigate target-probe recognition processes. Electrochemical and gravimetric measurements have been considered to monitor hybridization of single base mismatch (SBM) in synthetic oligonucleotides and single-nucleotide polymorphisms ApoE in real clinical genotypes. Obvious discrimination of SBM in nucleotides has been shown by both gravimetric and electrochemical techniques, without labeling nor amplification. Investigations on mismatches nature and position have also been considered. For guanine-adenine (GA), guanine-thymine (GT) and guanine-guanine (GG) mismatches, the sensors responses present a dependence upon positions. Considering the capacitance variations and hybridization rates, results showed that gravimetric transduction is more sensitive than electrochemical one. Moreover, the highest value of GT hybridization rate (in the middle position) was found in accordance with the nearest-neighbor model, where the considered configuration appears as the most thermodynamically stable. For the real samples, where the electrochemical transduction, by combining capacitance and flat-band potential measurements, were found more sensitive, the results show that the realized sensor permits an unambiguous discrimination of recognition between fully complementary, non-complementary and single base mismatched targets, and even between the combination of differently matched strands. Copyright © 2013 Elsevier B.V. All rights reserved.

  10. Typing of artiodactyl MHC-DRB genes with the help of intronic simple repeated DNA sequences.

    PubMed

    Schwaiger, F W; Buitkamp, J; Weyers, E; Epplen, J T

    1993-02-01

    An efficient oligonucleotide typing method for the highly polymorphic MHC-DRB genes is described for artiodactyls like cattle, sheep and goat. By means of the polymerase chain reaction, the second exon of MHC-DRB is amplified as well as part of the adjacent intron containing a mixed simple repeat sequence. Using this primer combination we were able to amplify the MHC-DRB exons 2 and adjacent introns from all of the investigated 10 species of the family of Bovidae and giraffes. Therefore, the DRB genes of novel artiodactyl species can also be readily studied. Oligonucleotide probes specific for the polymorphisms of ungulate DRB genes are used with which sequences differing in at least one single base can be distinguished. Exonic polymorphism was found to be correlated with the allele lengths and the patterns of the repeat structures. Hence oligonucleotide probes specific for different simple repeats and polymorphic positions serve also for typing across species barriers. The strict correlation of sequence length and exonic polymorphism permits a preselection of specific oligonucleotides for hybridization. Thus more than 20 alleles can already be differentiated from each of the three species.

  11. Application of a unique server-based oligonucleotide probe selection tool toward a novel biosensor for the detection of Streptococcus pyogenes.

    PubMed

    Nugen, Sam R; Leonard, Barbara; Baeumner, Antje J

    2007-05-15

    We developed a software program for the rapid selection of detection probes to be used in nucleic acid-based assays. In comparison to commercially available software packages, our program allows the addition of oligotags as required by nucleic acid sequence-based amplification (NASBA) as well as automatic BLAST searches for all probe/primer pairs. We then demonstrated the usefulness of the program by designing a novel lateral flow biosensor for Streptococcus pyogenes that does not rely on amplification methods such as the polymerase chain reaction (PCR) or NASBA to obtain low limits of detection, but instead uses multiple reporter and capture probes per target sequence and an instantaneous amplification via dye-encapsulating liposomes. These assays will decrease the detection time to just a 20 min hybridization reaction and avoid costly enzymatic gene amplification reactions. The lateral flow assay was developed quantifying the 16S rRNA from S. pyogenes by designing reporter and capture probes that specifically hybridize with the RNA and form a sandwich. DNA reporter probes were tagged with dye-encapsulating liposomes, biotinylated DNA oligonucleotides were used as capture probes. From the initial number of capture and reporter probes chosen, a combination of two capture and three reporter probes were found to provide optimal signal generation and significant enhancement over single capture/reporter probe combinations. The selectivity of the biosensor was proven by analyzing organisms closely related to S. pyogenes, such as other Streptococcus and Enterococcus species. All probes had been selected by the software program within minutes and no iterative optimization and re-design of the oligonucleotides was required which enabled a very rapid biosensor prototyping. While the sensitivity obtained with the biosensor was only 135 ng, future experiments will decrease this significantly by the addition of more reporter and capture probes for either the same rRNA or a different nucleic acid target molecule. This will lead to the possibility of detecting S. pyogenes with a rugged assay that does not require a cell culturing or gene amplification step and will therefore enable rapid, specific and sensitive onsite testing.

  12. GeneChip{sup {trademark}} screening assay for cystic fibrosis mutations

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cronn, M.T.; Miyada, C.G.; Fucini, R.V.

    1994-09-01

    GeneChip{sup {trademark}} assays are based on high density, carefully designed arrays of short oligonucleotide probes (13-16 bases) built directly on derivatized silica substrates. DNA target sequence analysis is achieved by hybridizing fluorescently labeled amplification products to these arrays. Fluorescent hybridization signals located within the probe array are translated into target sequence information using the known probe sequence at each array feature. The mutation screening assay for cystic fibrosis includes sets of oligonucleotide probes designed to detect numerous different mutations that have been described in 14 exons and one intron of the CFTR gene. Each mutation site is addressed by amore » sub-array of at least 40 probe sequences, half designed to detect the wild type gene sequence and half designed to detect the reported mutant sequence. Hybridization with homozygous mutant, homozygous wild type or heterozygous targets results in distinctive hybridization patterns within a sub-array, permitting specific discrimination of each mutation. The GeneChip probe arrays are very small (approximately 1 cm{sup 2}). There miniature size coupled with their high information content make GeneChip probe arrays a useful and practical means for providing CF mutation analysis in a clinical setting.« less

  13. Label-free liquid crystal biosensor based on specific oligonucleotide probes for heavy metal ions.

    PubMed

    Yang, Shengyuan; Wu, Chao; Tan, Hui; Wu, Yan; Liao, Shuzhen; Wu, Zhaoyang; Shen, Guoli; Yu, Ruqin

    2013-01-02

    In this study, to enhance the capability of metal ions disturbing the orientation of liquid crystals (LCs), we designed a new label-free LC biosensor for the highly selective and sensitive detection of heavy metal ions. This strategy makes use of the target-induced DNA conformational change to enhance the disruption of target molecules for the orientation of LC leading to an amplified optical signal. The Hg(2+) ion, which possesses a unique property to bind specifically to two DNA thymine (T) bases, is used as a model heavy metal ion. In the presence of Hg(2+), the specific oligonucleotide probes form a conformational reorganization of the oligonucleotide probes from hairpin structure to duplex-like complexes. The duplex-like complexes are then bound on the triethoxysilylbutyraldehyde/N,N-dimethyl-N-octadecyl (3-aminopropyl) trimethoxysilyl chloride (TEA/DMOAP)-coated substrate modified with capture probes, which can greatly distort the orientational profile of LC, making the optical image of LC cell birefringent as a result. The optical signal of LC sensor has a visible change at the Hg(2+) concentration of low to 0.1 nM, showing good detection sensitivity. The cost-effective LC sensing method can translate the concentration signal of heavy metal ions in solution into the presence of DNA duplexes and is expected to be a sensitive detection platform for heavy metal ions and other small molecule monitors.

  14. Oligonucleotide microarray for the identification of potential mycotoxigenic fungi

    PubMed Central

    2010-01-01

    Background Mycotoxins are secondary metabolites which are produced by numerous fungi and pose a continuous challenge to the safety and quality of food commodities in South Africa. These toxins have toxicologically relevant effects on humans and animals that eat contaminated foods. In this study, a diagnostic DNA microarray was developed for the identification of the most common food-borne fungi, as well as the genes leading to toxin production. Results A total of 40 potentially mycotoxigenic fungi isolated from different food commodities, as well as the genes that are involved in the mycotoxin synthetic pathways, were analyzed. For fungal identification, oligonucleotide probes were designed by exploiting the sequence variations of the elongation factor 1-alpha (EF-1 α) coding regions and the internal transcribed spacer (ITS) regions of the rRNA gene cassette. For the detection of fungi able to produce mycotoxins, oligonucleotide probes directed towards genes leading to toxin production from different fungal strains were identified in data available in the public domain. The probes selected for fungal identification and the probes specific for toxin producing genes were spotted onto microarray slides. Conclusions The diagnostic microarray developed can be used to identify single pure strains or cultures of potentially mycotoxigenic fungi as well as genes leading to toxin production in both laboratory samples and maize-derived foods offering an interesting potential for microbiological laboratories. PMID:20307326

  15. A rapid method for detection of genetically modified organisms based on magnetic separation and surface-enhanced Raman scattering.

    PubMed

    Guven, Burcu; Boyacı, İsmail Hakkı; Tamer, Ugur; Çalık, Pınar

    2012-01-07

    In this study, a new method combining magnetic separation (MS) and surface-enhanced Raman scattering (SERS) was developed to detect genetically modified organisms (GMOs). An oligonucleotide probe which is specific for 35 S DNA target was immobilized onto gold coated magnetic nanospheres to form oligonucleotide-coated nanoparticles. A self assembled monolayer was formed on gold nanorods using 5,5'-dithiobis (2-nitrobenzoic acid) (DTNB) and the second probe of the 35 S DNA target was immobilized on the activated nanorod surfaces. Probes on the nanoparticles were hybridized with the target oligonucleotide. Optimization parameters for hybridization were investigated by high performance liquid chromatography. Optimum hybridization parameters were determined as: 4 μM probe concentration, 20 min immobilization time, 30 min hybridization time, 55 °C hybridization temperature, 750 mM buffer salt concentration and pH: 7.4. Quantification of the target concentration was performed via SERS spectra of DTNB on the nanorods. The correlation between the target concentration and the SERS signal was found to be linear within the range of 25-100 nM. The analyses were performed with only one hybridization step in 40 min. Real sample analysis was conducted using Bt-176 maize sample. The results showed that the developed MS-SERS assay is capable of detecting GMOs in a rapid and selective manner. This journal is © The Royal Society of Chemistry 2012

  16. DNA/RNA heteroduplex oligonucleotide for highly efficient gene silencing

    PubMed Central

    Nishina, Kazutaka; Piao, Wenying; Yoshida-Tanaka, Kie; Sujino, Yumiko; Nishina, Tomoko; Yamamoto, Tsuyoshi; Nitta, Keiko; Yoshioka, Kotaro; Kuwahara, Hiroya; Yasuhara, Hidenori; Baba, Takeshi; Ono, Fumiko; Miyata, Kanjiro; Miyake, Koichi; Seth, Punit P.; Low, Audrey; Yoshida, Masayuki; Bennett, C. Frank; Kataoka, Kazunori; Mizusawa, Hidehiro; Obika, Satoshi; Yokota, Takanori

    2015-01-01

    Antisense oligonucleotides (ASOs) are recognized therapeutic agents for the modulation of specific genes at the post-transcriptional level. Similar to any medical drugs, there are opportunities to improve their efficacy and safety. Here we develop a short DNA/RNA heteroduplex oligonucleotide (HDO) with a structure different from double-stranded RNA used for short interfering RNA and single-stranded DNA used for ASO. A DNA/locked nucleotide acid gapmer duplex with an α-tocopherol-conjugated complementary RNA (Toc-HDO) is significantly more potent at reducing the expression of the targeted mRNA in liver compared with the parent single-stranded gapmer ASO. Toc-HDO also improves the phenotype in disease models more effectively. In addition, the high potency of Toc-HDO results in a reduction of liver dysfunction observed in the parent ASO at a similar silencing effect. HDO technology offers a novel concept of therapeutic oligonucleotides, and the development of this molecular design opens a new therapeutic field. PMID:26258894

  17. Efficient self-assembly of DNA-functionalized fluorophores and gold nanoparticles with DNA functionalized silicon surfaces: the effect of oligomer spacers

    PubMed Central

    Milton, James A.; Patole, Samson; Yin, Huabing; Xiao, Qiang; Brown, Tom; Melvin, Tracy

    2013-01-01

    Although strategies for the immobilization of DNA oligonucleotides onto surfaces for bioanalytical and top-down bio-inspired nanobiofabrication approaches are well developed, the effect of introducing spacer molecules between the surface and the DNA oligonucleotide for the hybridization of nanoparticle–DNA conjugates has not been previously assessed in a quantitative manner. The hybridization efficiency of DNA oligonucleotides end-labelled with gold nanoparticles (1.4 or 10 nm diameter) with DNA sequences conjugated to silicon surfaces via hexaethylene glycol phosphate diester oligomer spacers (0, 1, 2, 6 oligomers) was found to be independent of spacer length. To quantify both the density of DNA strands attached to the surfaces and hybridization with the surface-attached DNA, new methodologies have been developed. Firstly, a simple approach based on fluorescence has been developed for determination of the immobilization density of DNA oligonucleotides. Secondly, an approach using mass spectrometry has been created to establish (i) the mean number of DNA oligonucleotides attached to the gold nanoparticles and (ii) the hybridization density of nanoparticle–oligonucleotide conjugates with the silicon surface–attached complementary sequence. These methods and results will be useful for application with nanosensors, the self-assembly of nanoelectronic devices and the attachment of nanoparticles to biomolecules for single-molecule biophysical studies. PMID:23361467

  18. Rapid purification of circular DNA by triplex-mediated affinity capture

    DOEpatents

    Ji, H.; Smith, L.M.

    1997-01-07

    A single-step capture of a target supercoiled double-stranded DNA molecule is accomplished by forming a local triple-helix among two strands of the supercoiled circular DNA and an oligonucleotide probe. The oligonucleotide is bound to an immobilizing support which facilitates the immobilization and purification of target DNA molecules. Non-target DNA molecules and other contaminating cellular material are easily removed by washing. The triple-helical structure is destabilized by raising the pH, leaving purified target DNA in the supernatant and reusable affinity capture oligonucleotide secured to the immobilizing support. 3 figs.

  19. Ferrocene-oligonucleotide conjugates for electrochemical probing of DNA.

    PubMed Central

    Ihara, T; Maruo, Y; Takenaka, S; Takagi, M

    1996-01-01

    Toward the development of a universal, sensitive and convenient method of DNA (or RNA) detection, electrochemically active oligonucleotides were prepared by covalent linkage of a ferrocenyl group to the 5'-aminohexyl-terminated synthetic oligonucleotides. Using these electrochemically active probes, we have been able to demonstrate the detection of DNA and RNA at femtomole levels by HPLC equipped with an ordinary electrochemical detector (ECD) [Takenaka,S., Uto,Y., Kondo,H., Ihara,T. and Takagi,M. (1994) Anal. Biochem., 218, 436-443]. Thermodynamic and electrochemical studies of the interaction between the probes and the targets are presented here. The thermodynamics obtained revealed that the conjugation stabilizes the triple-helix complexes by 2-3 kcal mol-1 (1-2 orders increment in binding constant) at 298 K, which corresponds to the effect of elongation of additional several base triplets. The main cause of this thermodynamic stabilization by the conjugation is likely to be the overall conformational change of whole structure of the conjugate rather than the additional local interaction. The redox potential of the probe was independent of the target structure, which is either single- or double stranded. However, the potential is slightly dependent (with a 10-30 mV negative shift on complexation) on the extra sequence in the target, probably because the individual sequence is capable of contacting or interacting with the ferrocenyl group in a slightly different way from each other. This small potential shift itself, however, does not cause any inconvenience on practical applications in detecting the probes by using ECD. These results lead to the conclusion that the redox-active probes are very useful for the microanalysis of nucleic acids due to the stability of the complexes, high detection sensitivity and wide applicability to the target structures (DNA and RNA; single- and double strands) and the sequences. PMID:8932383

  20. DETECTION OF DNA DAMAGE USING A FIBEROPTIC BIOSENSOR

    EPA Science Inventory

    A rapid and sensitive fiber optic biosensor assay for radiation-induced DNA damage is reported. For this assay, a biotin-labeled capture oligonucleotide (38 mer) was immobilized to an avidin-coated quartz fiber. Hybridization of a dye-labeled complementary sequence was observed...

  1. Experimental study of the evanescent-wave photonic sensors response in presence of molecular beacon conformational changes.

    PubMed

    Ruiz-Tórtola, Ángela; Prats-Quílez, Francisco; Gónzalez-Lucas, Daniel; Bañuls, María-José; Maquieira, Ángel; Wheeler, Guy; Dalmay, Tamas; Griol, Amadeu; Hurtado, Juan; Bohlmann, Helge; Götzen, Reiner; García-Rupérez, Jaime

    2018-04-17

    An experimental study of the influence of the conformational change suffered by molecular beacon (MB) probes -upon the biorecognition of nucleic acid target oligonucleotides over evanescent wave photonic sensors- is reported. To this end, high sensitivity photonic sensors based on silicon photonic bandgap (PBG) structures were used, where the MB probes were immobilized via their 5' termination. Those MBs incorporate a biotin moiety close to their 3' termination in order to selectively bind a streptavidin molecule to them. The different photonic sensing responses obtained towards the target oligonucleotide detection, when the streptavidin molecule was bound to the MB probes or not, demonstrate the conformational change suffered by the MB upon hybridization, which promotes the displacement of the streptavidin molecule away from the surface of the photonic sensing structure. Schematic diagram of the PBG sensing structure on which the streptavidin-labeled MB probes were immobilized. This article is protected by copyright. All rights reserved.

  2. DNA-based species detection capabilities using laser transmission spectroscopy

    PubMed Central

    Mahon, A. R.; Barnes, M. A.; Li, F.; Egan, S. P.; Tanner, C. E.; Ruggiero, S. T.; Feder, J. L.; Lodge, D. M.

    2013-01-01

    Early detection of invasive species is critical for effective biocontrol to mitigate potential ecological and economic damage. Laser transmission spectroscopy (LTS) is a powerful solution offering real-time, DNA-based species detection in the field. LTS can measure the size, shape and number of nanoparticles in a solution and was used here to detect size shifts resulting from hybridization of the polymerase chain reaction product to nanoparticles functionalized with species-specific oligonucleotide probes or with the species-specific oligonucleotide probes alone. We carried out a series of DNA detection experiments using the invasive freshwater quagga mussel (Dreissena bugensis) to evaluate the capability of the LTS platform for invasive species detection. Specifically, we tested LTS sensitivity to (i) DNA concentrations of a single target species, (ii) the presence of a target species within a mixed sample of other closely related species, (iii) species-specific functionalized nanoparticles versus species-specific oligonucleotide probes alone, and (iv) amplified DNA fragments versus unamplified genomic DNA. We demonstrate that LTS is a highly sensitive technique for rapid target species detection, with detection limits in the picomolar range, capable of successful identification in multispecies samples containing target and non-target species DNA. These results indicate that the LTS DNA detection platform will be useful for field application of target species. Additionally, we find that LTS detection is effective with species-specific oligonucleotide tags alone or when they are attached to polystyrene nanobeads and with both amplified and unamplified DNA, indicating that the technique may also have versatility for broader applications. PMID:23015524

  3. Detection and discrimination of orthopoxviruses using microarrays of immobilized oligonucleotides.

    PubMed

    Laassri, Majid; Chizhikov, Vladimir; Mikheev, Maxim; Shchelkunov, Sergei; Chumakov, Konstantin

    2003-09-01

    Variola virus (VARV), causing smallpox, is a potential biological weapon. Methods to detect VARV rapidly and to differentiate it from other viruses causing similar clinical syndromes are needed urgently. We have developed a new microarray-based method that detects simultaneously and discriminates four orthopoxvirus (OPV) species pathogenic for humans (variola, monkeypox, cowpox, and vaccinia viruses) and distinguishes them from chickenpox virus (varicella-zoster virus or VZV). The OPV gene C23L/B29R, encoding the CC-chemokine binding protein, was sequenced for 41 strains of seven species of orthopox viruses obtained from different geographical regions. Those C23L/B29R sequences and the ORF 62 sequences from 13 strains of VZV (selected from GenBank) were used to design oligonucleotide probes that were immobilized on an aldehyde-coated glass surface (a total of 57 probes). The microchip contained several unique 13-21 bases long oligonucleotide probes specific to each virus species to ensure redundancy and robustness of the assay. A region approximately 1100 bases long was amplified from samples of viral DNA and fluorescently labeled with Cy5-modified dNTPs, and single-stranded DNA was prepared by strand separation. Hybridization was carried out under plastic coverslips, resulting in a fluorescent pattern that was quantified using a confocal laser scanner. 49 known and blinded samples of OPV DNA, representing different OPV species, and two VZV strains were tested. The oligonucleotide microarray hybridization technique identified reliably and correctly all samples. This new procedure takes only 3 h, and it can be used for parallel testing of multiple samples.

  4. Heated oligonucleotide ligation assay (HOLA): an affordable single nucleotide polymorphism assay.

    PubMed

    Black, W C; Gorrochotegui-Escalante, N; Duteau, N M

    2006-03-01

    Most single nucleotide polymorphism (SNP) detection requires expensive equipment and reagents. The oligonucleotide ligation assay (OLA) is an inexpensive SNP assay that detects ligation between a biotinylated "allele-specific detector" and a 3' fluorescein-labeled "reporter" oligonucleotide. No ligation occurs unless the 3' detector nucleotide is complementary to the SNP nucleotide. The original OLA used chemical denaturation and neutralization. Heated OLA (HOLA) instead uses a thermal stable ligase and cycles of denaturing and hybridization for ligation and SNP detection. The cost per genotype is approximately US$1.25 with two-allele SNPs or approximately US$1.75 with three-allele SNPs. We illustrate the development of HOLA for SNP detection in the Early Trypsin and Abundant Trypsin loci in the mosquito Aedes aegypti (L.) and at the a-glycerophosphate dehydrogenase locus in the mosquito Anopheles gambiae s.s.

  5. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rosatelli, M.C.; Faa, V.; Sardu, R.

    This study reports the molecular characterization of [beta]-thalassemia in the Sardinian population. Three thousand [beta]-thalassemia chromosomes from prospective parents presenting at the genetic service were initially analyzed by dot blot analysis with oligonucleotide probes complementary to the most common [beta]-thalassemia mutations in the Mediterranean at-risk populations. The mutation which remained uncharacterized by this approach were defined by denaturing gradient gel electrophoresis (DGGE) followed by direct sequence analysis on amplified DNA. The authors reconfirmed that the predominant mutation in the Sardinian population is the codon 39 nonsense mutation, which accounts for 95.7% of the [beta]-thalassemia chromosomes. The other two relatively commonmore » mutations are frameshifts at codon 6 (2.1%) and at codon 76 (0.7%), relatively uncommon in other Mediterranean-origin populations. In this study they have detected a novel [beta]-thalassemia mutation, i.e., a frameshift at codon 1, in three [beta]-thalassemia chromosomes. The DGGE procedure followed by direct sequencing on amplified DNA is a powerful approach for the characterization of unknown mutations in this genetic system.« less

  6. Portable evanescent wave fiber biosensor for highly sensitive detection of Shigella

    NASA Astrophysics Data System (ADS)

    Xiao, Rui; Rong, Zhen; Long, Feng; Liu, Qiqi

    2014-11-01

    A portable evanescent wave fiber biosensor was developed to achieve the rapid and highly sensitive detection of Shigella. In this study, a DNA probe was covalently immobilized onto fiber-optic biosensors that can hybridize with a fluorescently labeled complementary DNA. The sensitivity of detection for synthesized oligonucleotides can reach 10-10 M. The surface of the sensor can be regenerated with 0.5% sodium dodecyl sulfate solution (pH 1.9) for over 30 times without significant deterioration of performance. The total analysis time for a single sample, including the time for measurement and surface regeneration, was less than 6 min. We employed real-time polymerase chain reaction (PCR) and compared the results of both methods to investigate the actual Shigella DNA detection capability of the fiber-optic biosensor. The fiber-optic biosensor could detect as low as 102 colony-forming unit/mL Shigella. This finding was comparable with that by real-time PCR, which suggests that this method is a potential alternative to existing detection methods.

  7. MicroRNA profiling of the murine hematopoietic system

    PubMed Central

    Monticelli, Silvia; Ansel, K Mark; Xiao, Changchun; Socci, Nicholas D; Krichevsky, Anna M; Thai, To-Ha; Rajewsky, Nikolaus; Marks, Debora S; Sander, Chris; Rajewsky, Klaus; Rao, Anjana; Kosik, Kenneth S

    2005-01-01

    Background MicroRNAs (miRNAs) are a class of recently discovered noncoding RNA genes that post-transcriptionally regulate gene expression. It is becoming clear that miRNAs play an important role in the regulation of gene expression during development. However, in mammals, expression data are principally based on whole tissue analysis and are still very incomplete. Results We used oligonucleotide arrays to analyze miRNA expression in the murine hematopoietic system. Complementary oligonucleotides capable of hybridizing to 181 miRNAs were immobilized on a membrane and probed with radiolabeled RNA derived from low molecular weight fractions of total RNA from several different hematopoietic and neuronal cells. This method allowed us to analyze cell type-specific patterns of miRNA expression and to identify miRNAs that might be important for cell lineage specification and/or cell effector functions. Conclusion This is the first report of systematic miRNA gene profiling in cells of the hematopoietic system. As expected, miRNA expression patterns were very different between hematopoietic and non-hematopoietic cells, with further subtle differences observed within the hematopoietic group. Interestingly, the most pronounced similarities were observed among fully differentiated effector cells (Th1 and Th2 lymphocytes and mast cells) and precursors at comparable stages of differentiation (double negative thymocytes and pro-B cells), suggesting that in addition to regulating the process of commitment to particular cellular lineages, miRNAs might have an important general role in the mechanism of cell differentiation and maintenance of cell identity. PMID:16086853

  8. Effect on embryos of injection of phosphorothioate-modified oligonucleotides into pregnant mice.

    PubMed

    Gaudette, M F; Hampikian, G; Metelev, V; Agrawal, S; Crain, W R

    1993-01-01

    Phosphorothioate-modified oligonucleotides were injected into pregnant female mice to assess the effect on developing embryos. Injections were carried out during two different time periods, one when embryos were in preimplantation stages of development (about 3.5 days of development) and the other after implantation, when both a fetus and placenta are present (from days 9.5 to 11.5 of development). Three different phosphorothioate-modified oligonucleotides were injected. One, which had a sequence not present in the mouse genome, was used to ask whether nonspecific toxic or teratogenic effects on embryos result from treatment of the mother. A second was complementary to the mRNA of the testis-determining factor gene Sry and was used to ask whether a specific developmental pathway (i.e., sex determination) could be disrupted in embryos in vivo. The third was the complement of the anti-Sry sequence. None of these oligonucleotides reduced the frequency of successful pregnancy after mating or the average litter size from that observed in controls animals. Furthermore, examination of 291 pups or fetuses from all oligonucleotide-injected pregnant females revealed no developmental defects regardless of which sequence was used. It is concluded that injection of phosphorothioate-modified oligonucleotides into pregnant females according to the protocols described here is not toxic or teratogenic to embryos in a nonspecific way. Also, anti-Sry oligonucleotides did not influence sex determination in embryos, although there are several possible explanations for this.

  9. Soft Lithography for Oligonucleotide Arrays Fabrication

    DTIC Science & Technology

    2001-10-25

    adenosine; Abbreviated T, C, G, A respectively), the other synthesis reagents and solvents except oxidation agent (seen in Table 1) were purchased...dried by cold blowing before hybridization. Oligonucleotide arrays were hybridized in 200 nM 3’-TCC TCC GAT TCA GAG AGT CC- HEX (PE Biosystems... citrate buffer), 0.1% SDS in 0.1xSSC respectively. The probe array was scanned on the Scanarray Microarray Systems (Packard Biochip Technologies, USA

  10. Oligonucleotide gap-fill ligation for mutation detection and sequencing in situ

    PubMed Central

    Mignardi, Marco; Mezger, Anja; Qian, Xiaoyan; La Fleur, Linnea; Botling, Johan; Larsson, Chatarina; Nilsson, Mats

    2015-01-01

    In clinical diagnostics a great need exists for targeted in situ multiplex nucleic acid analysis as the mutational status can offer guidance for effective treatment. One well-established method uses padlock probes for mutation detection and multiplex expression analysis directly in cells and tissues. Here, we use oligonucleotide gap-fill ligation to further increase specificity and to capture molecular substrates for in situ sequencing. Short oligonucleotides are joined at both ends of a padlock gap probe by two ligation events and are then locally amplified by target-primed rolling circle amplification (RCA) preserving spatial information. We demonstrate the specific detection of the A3243G mutation of mitochondrial DNA and we successfully characterize a single nucleotide variant in the ACTB mRNA in cells by in situ sequencing of RCA products generated by padlock gap-fill ligation. To demonstrate the clinical applicability of our assay, we show specific detection of a point mutation in the EGFR gene in fresh frozen and formalin-fixed, paraffin-embedded (FFPE) lung cancer samples and confirm the detected mutation by in situ sequencing. This approach presents several advantages over conventional padlock probes allowing simpler assay design for multiplexed mutation detection to screen for the presence of mutations in clinically relevant mutational hotspots directly in situ. PMID:26240388

  11. Preparation and characterization of zinc oxide nanoparticles and their sensor applications for electrochemical monitoring of nucleic acid hybridization.

    PubMed

    Yumak, Tugrul; Kuralay, Filiz; Muti, Mihrican; Sinag, Ali; Erdem, Arzum; Abaci, Serdar

    2011-09-01

    In this study, ZnO nanoparticles (ZNP) of approximately 30 nm in size were synthesized by the hydrothermal method and characterized by X-ray diffraction (XRD), Braun-Emmet-Teller (BET) N2 adsorption analysis and transmission electron microscopy (TEM). ZnO nanoparticles enriched with poly(vinylferrocenium) (PVF+) modified single-use graphite electrodes were then developed for the electrochemical monitoring of nucleic acid hybridization related to the Hepatitis B Virus (HBV). Firstly, the surfaces of polymer modified and polymer-ZnO nanoparticle modified single-use pencil graphite electrodes (PGEs) were characterized using scanning electron microscopy (SEM). The electrochemical behavior of these electrodes was also investigated using differential pulse voltammetry (DPV) and electrochemical impedance spectroscopy (EIS). Subsequently, the polymer-ZnO nanoparticle modified PGEs were evaluated for the electrochemical detection of DNA based on the changes at the guanine oxidation signals. Various modifications in DNA oligonucleotides and probe concentrations were examined in order to optimize the electrochemical signals that were generated by means of nucleic acid hybridization. After the optimization studies, the sequence-selective DNA hybridization was investigated in the case of a complementary amino linked probe (target), or noncomplementary (NC) sequences, or target and mismatch (MM) mixture in the ratio of (1:1). Copyright © 2011 Elsevier B.V. All rights reserved.

  12. Identification of Type VI Collagen Synthesizing Cells in Human Diabetic Glomerulosclerosis Using Renal Biopsy Sections

    PubMed Central

    Razzaque, Mohammed Shawkat; Koji, Takehiko; Harada, Takashi; Taguchi, Takashi

    1997-01-01

    Although the role of extracellular matrices in the development of glomerulosclerosis has been discussed widely, the cellular origin of type VI collagen in diabetic nephropathy (DN) has remained relatively unexplored. This study reports the distribution and cellular origin of type VI collagen in DN. Type VI collagen‐specific oligonucleotide probes and monoclonal antibody were used to assess the relative expression of mRNA for \\alpha1 (VI) chain and its translated protein in paraffin‐embedded renal biopsy sections of DN. By immunohistochemistry, compared to the control, increased deposition of type VI collagen was noted in the diffuse and nodular lesions of diabetic glomeruli. For cellular localization of type VI collagen mRNA, paraffin‐embedded renal sections of the control and DN were hybridized in situ with digoxigenin (Dig)‐labeled antisense oligo‐DNA probe complementary to a part of \\alpha1 (VI) mRNA. In comparison to the control kidney sections, increased numbers of intraglomerular cells (both mesangial and epithelial cells) were positive for α1 (VI) mRNA in renal biopsy sections of DN. From the results, we conclude that overexpression of type VI collagen by intraglomerular cells with its increased deposition might significantly contribute to the glomerulosclerosis found in DN. PMID:9497854

  13. smiFISH and FISH-quant - a flexible single RNA detection approach with super-resolution capability.

    PubMed

    Tsanov, Nikolay; Samacoits, Aubin; Chouaib, Racha; Traboulsi, Abdel-Meneem; Gostan, Thierry; Weber, Christian; Zimmer, Christophe; Zibara, Kazem; Walter, Thomas; Peter, Marion; Bertrand, Edouard; Mueller, Florian

    2016-12-15

    Single molecule FISH (smFISH) allows studying transcription and RNA localization by imaging individual mRNAs in single cells. We present smiFISH (single molecule inexpensive FISH), an easy to use and flexible RNA visualization and quantification approach that uses unlabelled primary probes and a fluorescently labelled secondary detector oligonucleotide. The gene-specific probes are unlabelled and can therefore be synthesized at low cost, thus allowing to use more probes per mRNA resulting in a substantial increase in detection efficiency. smiFISH is also flexible since differently labelled secondary detector probes can be used with the same primary probes. We demonstrate that this flexibility allows multicolor labelling without the need to synthesize new probe sets. We further demonstrate that the use of a specific acrydite detector oligonucleotide allows smiFISH to be combined with expansion microscopy, enabling the resolution of transcripts in 3D below the diffraction limit on a standard microscope. Lastly, we provide improved, fully automated software tools from probe-design to quantitative analysis of smFISH images. In short, we provide a complete workflow to obtain automatically counts of individual RNA molecules in single cells. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  14. Kit for detecting nucleic acid sequences using competitive hybridization probes

    DOEpatents

    Lucas, Joe N.; Straume, Tore; Bogen, Kenneth T.

    2001-01-01

    A kit is provided for detecting a target nucleic acid sequence in a sample, the kit comprising: a first hybridization probe which includes a nucleic acid sequence that is sufficiently complementary to selectively hybridize to a first portion of the target sequence, the first hybridization probe including a first complexing agent for forming a binding pair with a second complexing agent; and a second hybridization probe which includes a nucleic acid sequence that is sufficiently complementary to selectively hybridize to a second portion of the target sequence to which the first hybridization probe does not selectively hybridize, the second hybridization probe including a detectable marker; a third hybridization probe which includes a nucleic acid sequence that is sufficiently complementary to selectively hybridize to a first portion of the target sequence, the third hybridization probe including the same detectable marker as the second hybridization probe; and a fourth hybridization probe which includes a nucleic acid sequence that is sufficiently complementary to selectively hybridize to a second portion of the target sequence to which the third hybridization probe does not selectively hybridize, the fourth hybridization probe including the first complexing agent for forming a binding pair with the second complexing agent; wherein the first and second hybridization probes are capable of simultaneously hybridizing to the target sequence and the third and fourth hybridization probes are capable of simultaneously hybridizing to the target sequence, the detectable marker is not present on the first or fourth hybridization probes and the first, second, third, and fourth hybridization probes each include a competitive nucleic acid sequence which is sufficiently complementary to a third portion of the target sequence that the competitive sequences of the first, second, third, and fourth hybridization probes compete with each other to hybridize to the third portion of the target sequence.

  15. DNA - peptide polyelectrolyte complexes: Phase control by hybridization

    NASA Astrophysics Data System (ADS)

    Vieregg, Jeffrey; Lueckheide, Michael; Marciel, Amanda; Leon, Lorraine; Tirrell, Matthew

    DNA is one of the most highly-charged molecules known, and interacts strongly with charged molecules in the cell. Condensation of long double-stranded DNA is one of the classic problems of biophysics, but the polyelectrolyte behavior of short and/or single-stranded nucleic acids has attracted far less study despite its importance for both biological and engineered systems. We report here studies of DNA oligonucleotides complexed with cationic peptides and polyamines. As seen previously for longer sequences, double-stranded oligonucleotides form solid precipitates, but single-stranded oligonucleotides instead undergo liquid-liquid phase separation to form coacervate droplets. Complexed oligonucleotides remain competent for hybridization, and display sequence-dependent environmental response. We observe similar behavior for RNA oligonucleotides, and methylphosphonate substitution of the DNA backbone indicates that nucleic acid charge density controls whether liquid or solid complexes are formed. Liquid-liquid phase separations of this type have been implicated in formation of membraneless organelles in vivo, and have been suggested as protocells in early life scenarios; oligonucleotides offer an excellent method to probe the physics controlling these phenomena.

  16. Design of ultrasensitive bisphenol A-aptamer based on platinum nanoparticles loading to polyethyleneimine-functionalized carbon nanotubes.

    PubMed

    Derikvandi, Zeinab; Abbasi, Amir Reza; Roushani, Mahmoud; Derikvand, Zohreh; Azadbakht, Azadeh

    2016-11-01

    Here, a highly sensitive electrochemical aptasensor based on a novel signal amplification strategy for the determination of bisphenol A (BPA) was developed. Construction of the aptasensor began with the deposition of highly dispersed platinum nanoparticles (PtNPs)/acid-oxidized carbon nanotubes (CNTs-COOH) functionalized with polyethyleneimine (PEI) at the surface of glassy carbon (PtNPs/PEI/CNTs-COOH/GC) electrode. After immobilizing the amine-capped capture probe (ssDNA1) through the covalent amide bonds formed by the carboxyl groups on the nanotubes and the amino groups on the oligonucleotides, we employed a designed complementary BPA-aptamer (ssDNA2) as a detection probe to hybridize with the ssDNA1. By adding BPA as a target, the aptamer specifically bound to BPA and its end folded into a BPA-binding junction. Because of steric/conformational restrictions caused by aptamer-BPA complex formation at the surface of modified electrode, the interfacial electron transfer of [Fe(CN)6](3-/4-) as a probe was blocked. Sensitive quantitative detection of BPA was carried out by monitoring the decrease of differential pulse voltammetric responses of [Fe(CN)6](3-/4-) peak current with increasing BPA concentrations. The newly developed aptasensor embraced a number of attractive features such as ease of fabrication, low detection limit, excellent selectivity, good stability and a wide linear range with respect to BPA. Copyright © 2016 Elsevier Inc. All rights reserved.

  17. Glowing locked nucleic acids: brightly fluorescent probes for detection of nucleic acids in cells.

    PubMed

    Østergaard, Michael E; Cheguru, Pallavi; Papasani, Madhusudhan R; Hill, Rodney A; Hrdlicka, Patrick J

    2010-10-13

    Fluorophore-modified oligonucleotides have found widespread use in genomics and enable detection of single-nucleotide polymorphisms, real-time monitoring of PCR, and imaging of mRNA in living cells. Hybridization probes modified with polarity-sensitive fluorophores and molecular beacons (MBs) are among the most popular approaches to produce hybridization-induced increases in fluorescence intensity for nucleic acid detection. In the present study, we demonstrate that the 2'-N-(pyren-1-yl)carbonyl-2'-amino locked nucleic acid (LNA) monomer X is a highly versatile building block for generation of efficient hybridization probes and quencher-free MBs. The hybridization and fluorescence properties of these Glowing LNA probes are efficiently modulated and optimized by changes in probe backbone chemistry and architecture. Correctly designed probes are shown to exhibit (a) high affinity toward RNA targets, (b) excellent mismatch discrimination, (c) high biostability, and (d) pronounced hybridization-induced increases in fluorescence intensity leading to formation of brightly fluorescent duplexes with unprecedented emission quantum yields (Φ(F) = 0.45-0.89) among pyrene-labeled oligonucleotides. Finally, specific binding between messenger RNA and multilabeled quencher-free MBs based on Glowing LNA monomers is demonstrated (a) using in vitro transcription assays and (b) by quantitative fluorometric assays and direct microscopic observation of probes bound to mRNA in its native form. These features render Glowing LNA as promising diagnostic probes for biomedical applications.

  18. Discrimination of heterogenous mRNAs encoding strychnine-sensitive glycine receptors in Xenopus oocytes by antisense oligonucleotides.

    PubMed Central

    Akagi, H; Patton, D E; Miledi, R

    1989-01-01

    Three synthetic oligodeoxynucleotides complementary to different parts of an RNA encoding a glycine receptor subunit were used to discriminate heterogenous mRNAs coding for glycine receptors in adult and neonatal rat spinal cord. Injection of the three antisense oligonucleotides into Xenopus oocytes specifically inhibited the expression of glycine receptors by adult spinal cord mRNA. In contrast, the antisense oligonucleotides were much less potent in inhibiting the expression of glycine receptors encoded by neonatal spinal cord mRNA. Northern blot analysis revealed that the oligonucleotides hybridized mostly to an adult cord transcript of approximately 10 kilobases in size. This band was also present in neonatal spinal cord mRNA but its density was about one-fourth of the adult cord message. There was no intense band in the low molecular weight position (approximately 2 kilobases), the existence of which was expected from electrophysiological studies with size-fractionated mRNA of neonatal spinal cord. Our results suggest that in the rat spinal cord there are at least three different types of mRNAs encoding functional strychnine-sensitive glycine receptors. Images PMID:2479016

  19. Use of continuous/contiguous stacking hybridization as a diagnostic tool

    DOEpatents

    Mirzabekov, Andrei Darievich; Kirillov, Eugene Vladislavovich; Parinov, Sergei Valeryevich; Barski, Victor Evgenievich; Dubiley, Svetlana Alekseevna

    2002-01-01

    A method for detecting disease-associated alleles in patient genetic material is provided whereby a first group of oligonucleotide molecules, synthesized to compliment base sequences of the disease associated alleles is immobilized on a predetermined position on a substrate, and then contacted with patient genetic material to form duplexes. The duplexes are then contacted with a second group of oligonucleotide molecules which are synthesized to extend the predetermined length of the oligonucleotide molecules of the first group, and where each of the oligonucleotide molecules of the second group are tagged and either incorporate universal bases or a mixture of guanine, cytosine, thymine, and adenine, or complementary nucleotide strands that are tagged with a different fluorochrome which radiates light at a predetermined wavelength. The treated substrate is then washed and the light patterns radiating therefrom are compared with predetermined light patterns of various diseases that were prepared on identical substrates. A method is also provided for determining the length of a repeat sequence in DNA or RNA, and also for determining the base sequence of unknown DNA or RNA.

  20. Use of continuous/contiguous stacking hybridization as a diagnostic tool

    DOEpatents

    Mirzabekov, Andrei Darievich; Kirillov, Eugene Vladislavovich; Parinov, Sergei Valeryevich; Barski, Victor Evgenievich; Dubiley, Svetlana Alekseevna

    2000-01-01

    A method for detecting disease-associated alleles in patient genetic material is provided whereby a first group of oligonucleotide molecules, synthesized to compliment base sequences of the disease associated alleles is immobilized on a predetermined position on a substrate, and then contacted with patient genetic material to form duplexes. The duplexes are then contacted with a second group of oligonucleotide molecules which are synthesized to extend the predetermined length of the oligonucleotide molecules of the first group, and where each of the oligonucleotide molecules of the second group are tagged and either incorporate universal bases or a mixture of guanine, cytosine, thymine, and adenine, or complementary nucleotide strands that are tagged with a different fluorochrome which radiates light at a predetermined wavelength. The treated substrate is then washed and the light patterns radiating therefrom are compared with predetermined light patterns of various diseases that were prepared on identical substrates. A method is also provided for determining the length of a repeat sequence in DNA or RNA, and also for determining the base sequence of unknown DNA or RNA.

  1. Targeting the r(CGG) repeats that cause FXTAS with modularly assembled small molecules and oligonucleotides.

    PubMed

    Tran, Tuan; Childs-Disney, Jessica L; Liu, Biao; Guan, Lirui; Rzuczek, Suzanne; Disney, Matthew D

    2014-04-18

    We designed small molecules that bind the structure of the RNA that causes fragile X-associated tremor ataxia syndrome (FXTAS), an incurable neuromuscular disease. FXTAS is caused by an expanded r(CGG) repeat (r(CGG)(exp)) that inactivates a protein regulator of alternative pre-mRNA splicing. Our designed compounds modulate r(CGG)(exp) toxicity in cellular models of FXTAS, and pull-down experiments confirm that they bind r(CGG)(exp) in vivo. Importantly, compound binding does not affect translation of the downstream open reading frame (ORF). We compared molecular recognition properties of our optimal compound to oligonucleotides. Studies show that r(CGG)(exp)'s self-structure is a significant energetic barrier for oligonucleotide binding. A fully modified 2'-OMethyl phosphorothioate is incapable of completely reversing an FXTAS-associated splicing defect and inhibits translation of the downstream ORF, which could have deleterious effects. Taken together, these studies suggest that a small molecule that recognizes structure may be more well suited for targeting highly structured RNAs that require strand invasion by a complementary oligonucleotide.

  2. Targeting the r(CGG) Repeats That Cause FXTAS with Modularly Assembled Small Molecules and Oligonucleotides

    PubMed Central

    2015-01-01

    We designed small molecules that bind the structure of the RNA that causes fragile X-associated tremor ataxia syndrome (FXTAS), an incurable neuromuscular disease. FXTAS is caused by an expanded r(CGG) repeat (r(CGG)exp) that inactivates a protein regulator of alternative pre-mRNA splicing. Our designed compounds modulate r(CGG)exp toxicity in cellular models of FXTAS, and pull-down experiments confirm that they bind r(CGG)expin vivo. Importantly, compound binding does not affect translation of the downstream open reading frame (ORF). We compared molecular recognition properties of our optimal compound to oligonucleotides. Studies show that r(CGG)exp’s self-structure is a significant energetic barrier for oligonucleotide binding. A fully modified 2′-OMethyl phosphorothioate is incapable of completely reversing an FXTAS-associated splicing defect and inhibits translation of the downstream ORF, which could have deleterious effects. Taken together, these studies suggest that a small molecule that recognizes structure may be more well suited for targeting highly structured RNAs that require strand invasion by a complementary oligonucleotide. PMID:24506227

  3. Culture-independent quantification of physiologically-active microbial groups in fermented foods using rRNA-targeted oligonucleotide probes: application to pozol, a Mexican lactic acid fermented maize dough.

    PubMed

    Ampe, F; ben Omar, N; Guyot, J P

    1999-07-01

    Nine phylogenetic oligonucleotide probes were used to describe at the genus level the microbial community responsible for the spontaneous fermentation of maize, leading to the production of Mexican pozol. Ribosomal RNAs of specific groups and genera, in particular, lactic acid bacteria, were quantified using a culture-independent approach. In the early stage of the fermentation, Lactococcus and Leuconostoc appeared to be the dominant genera. A contrario, these represented minor genera at the end of the fermentation when Lactobacillus dominated the process. In addition, eukaryotes seemed to play a significant role throughout the fermentation and enterobacteria could be detected by this method.

  4. eSensor®: A Microarray Technology Based on Electrochemical Detection of Nucleic Acids and Its Application to Cystic Fibrosis Carrier Screening

    NASA Astrophysics Data System (ADS)

    Reed, Michael R.; Coty, William A.

    We have developed a test for identification of carriers for cystic fibrosis using the eSensor® DNA detection technology. Oligonucleotide probes are deposited within self-assembled monolayers on gold electrodes arrayed upon printed circuit boards. These probes allow sequence-specific capture of amplicons containing a panel of mutation sites associated with cystic fibrosis. DNA targets are detected and mutations genotyped using a “sandwich” assay methodology employing electrochemical detection of ferrocene-labeled oligonucleotides for discrimination of carrier and non-carrier alleles. Performance of the cystic fibrosis application demonstrates sufficient accuracy and reliability for clinical diagnostic use, and the procedure can be performed by trained medical technologists available in the hospital laboratory.

  5. RNA-Catalyzed RNA Ligation on an External RNA Template

    NASA Technical Reports Server (NTRS)

    McGinness, Kathleen E.; Joyce, Gerald F.

    2002-01-01

    Variants of the hc ligase ribozyme, which catalyzes ligation of the 3' end of an RNA substrate to the 5' end of the ribozyme, were utilized to evolve a ribozyme that catalyzes ligation reactions on an external RNA template. The evolved ribozyme catalyzes the joining of an oligonucleotide 3'-hydroxyl to the 5'-triphosphate of an RNA hairpin molecule. The ribozyme can also utilize various substrate sequences, demonstrating a largely sequence-independent mechanism for substrate recognition. The ribozyme also carries out the ligation of two oligonucleotides that are bound at adjacent positions on a complementary template. Finally, it catalyzes addition of mononucleoside '5-triphosphates onto the '3 end of an oligonucleotide primer in a template-dependent manner. The development of ribozymes that catalyze polymerase-type reactions contributes to the notion that an RNA world could have existed during the early history of life on Earth.

  6. Paper-based solid-phase multiplexed nucleic acid hybridization assay with tunable dynamic range using immobilized quantum dots as donors in fluorescence resonance energy transfer.

    PubMed

    Noor, M Omair; Krull, Ulrich J

    2013-08-06

    A multiplexed solid-phase nucleic acid hybridization assay on a paper-based platform is presented using multicolor immobilized quantum dots (QDs) as donors in fluorescence resonance energy transfer (FRET). The surface of paper was modified with imidazole groups to immobilize two types of QD-probe oligonucleotide conjugates that were assembled in solution. Green-emitting QDs (gQDs) and red-emitting QDs (rQDs) served as donors with Cy3 and Alexa Fluor 647 (A647) acceptors. The gQD/Cy3 FRET pair served as an internal standard, while the rQD/A647 FRET pair served as a detection channel, combining the control and analytical test zones in one physical location. Hybridization of dye-labeled oligonucleotide targets provided the proximity for FRET sensitized emission from the acceptor dyes, which served as an analytical signal. Hybridization assays in the multicolor format provided a limit of detection of 90 fmol and an upper limit of dynamic range of 3.5 pmol. The use of an array of detection zones was designed to provide improved analytical figures of merit compared to that which could be achieved on one type of array design in terms of relative concentration of multicolor QDs. The hybridization assays showed excellent resistance to nonspecific adsorption of oligonucleotides. Selectivity of the two-plex hybridization assay was demonstrated by single nucleotide polymorphism (SNP) detection at a contrast ratio of 50:1. Additionally, it is shown that the use of preformed QD-probe oligonucleotide conjugates and consideration of the relative number density of the two types of QD-probe conjugates in the two-color assay format is advantageous to maximize assay sensitivity and the upper limit of dynamic range.

  7. Prebiotic chemistry and nucleic acid replication

    NASA Technical Reports Server (NTRS)

    Orgel, L. E.; Lohrmann, R.

    1974-01-01

    Recent work is reviewed on some reactions that could have occurred on the primitive earth and that could have played a part in the evolution of a self-replicating system. The transition from the primitive atmosphere to the simplest replicating molecules is considered in four stages: (1) the formation of a 'prebiotic soup' of organic precursors, including the purine and pyrimidine bases and the pentose sugars; (2) the condensation of these precursors and inorganic phosphate to form monomeric nucleotides and activated nucleotide derivatives; (3) the polymerization of nucleotide derivatives to oligonucleotides; and (4) the complementary replication of oligonucleotides in a template-directed process that depends on Watson-Crick base pairing.

  8. Visualization of sporopollenin-containing pathogenic green micro-alga Prototheca wickerhamii by fluorescent in situ hybridization (FISH).

    PubMed

    Ueno, Ryohei

    2009-04-01

    Fluorescent in situ hybridization (FISH) using taxon-specific, rRNA-targeted oligonucleotide probes is one of the most powerful tools for the rapid identification of harmful microorganisms. However, eukaryotic algal cells do not always allow FISH probes to permeate over their cell walls. Members of the pathogenic micro-algal genus Prototheca are characterized by their distinctive cell-wall component, sporopollenin, an extremely tough biopolymer that resists acid and alkaline hydrolysis, enzyme attack, and acetolysis. To our knowledge, there has been no report of the successful permeation by the oligonucleotide probes over the cell walls of unicellular green micro-algae, which contain sporopollenin. The DNA probes passed through the cell wall of Prototheca wickerhamii after treating the algal cells with cetyltrimethylammonium bromide (CTAB). Most cells in the middle logarithmic growth phase culture fluoresced when hybridized with the rRNA-targeted universal probe for eukaryotes, though individual cells included in this culture differed in the level of cell-wall vulnerability to attack by the polysaccharide-degrading enzyme, thus reflecting the different stages of the life cycle. This is the first report regarding the visualization of sporopollenin-containing, green micro-algal cells by FISH.

  9. Electrochemical product detection of an asymmetric convective polymerase chain reaction.

    PubMed

    Duwensee, Heiko; Mix, Maren; Stubbe, Marco; Gimsa, Jan; Adler, Marcel; Flechsig, Gerd-Uwe

    2009-10-15

    For the first time, we describe the application of heated microwires for an asymmetric convective polymerase chain reaction (PCR) in a modified PCR tube in a small volume. The partly single-stranded product was labeled with the electrochemically active compound osmium tetroxide bipyridine using a partially complementary protective strand with five mismatches compared to the single-stranded product. The labeled product could be successfully detected at a gold electrode modified with a complementary single-stranded capture probe immobilized via a thiol-linker. Our simple thermo-convective PCR yielded electrochemically detectable products after only 5-10 min. A significant discrimination between complementary and non-complementary target was possible using different immobilized capture probes. The total product yield was approx. half the amount of the classical thermocycler PCR. Numerical simulations describing the thermally driven convective PCR explain the received data. Discrimination between complementary capture probes and non-complementary capture probes was performed using square-wave voltammetry. The coupling of asymmetric thermo-convective PCR with electrochemical detection is very promising for future compact DNA sensor devices.

  10. A method for high-throughput production of sequence-verified DNA libraries and strain collections.

    PubMed

    Smith, Justin D; Schlecht, Ulrich; Xu, Weihong; Suresh, Sundari; Horecka, Joe; Proctor, Michael J; Aiyar, Raeka S; Bennett, Richard A O; Chu, Angela; Li, Yong Fuga; Roy, Kevin; Davis, Ronald W; Steinmetz, Lars M; Hyman, Richard W; Levy, Sasha F; St Onge, Robert P

    2017-02-13

    The low costs of array-synthesized oligonucleotide libraries are empowering rapid advances in quantitative and synthetic biology. However, high synthesis error rates, uneven representation, and lack of access to individual oligonucleotides limit the true potential of these libraries. We have developed a cost-effective method called Recombinase Directed Indexing (REDI), which involves integration of a complex library into yeast, site-specific recombination to index library DNA, and next-generation sequencing to identify desired clones. We used REDI to generate a library of ~3,300 DNA probes that exhibited > 96% purity and remarkable uniformity (> 95% of probes within twofold of the median abundance). Additionally, we created a collection of ~9,000 individually accessible CRISPR interference yeast strains for > 99% of genes required for either fermentative or respiratory growth, demonstrating the utility of REDI for rapid and cost-effective creation of strain collections from oligonucleotide pools. Our approach is adaptable to any complex DNA library, and fundamentally changes how these libraries can be parsed, maintained, propagated, and characterized. © 2017 The Authors. Published under the terms of the CC BY 4.0 license.

  11. 5-Fluoro pyrimidines: labels to probe DNA and RNA secondary structures by 1D 19F NMR spectroscopy

    PubMed Central

    Puffer, Barbara; Kreutz, Christoph; Rieder, Ulrike; Ebert, Marc-Olivier; Konrat, Robert; Micura, Ronald

    2009-01-01

    19F NMR spectroscopy has proved to be a valuable tool to monitor functionally important conformational transitions of nucleic acids. Here, we present a systematic investigation on the application of 5-fluoro pyrimidines to probe DNA and RNA secondary structures. Oligonucleotides with the propensity to adapt secondary structure equilibria were chosen as model systems and analyzed by 1D 19F and 1H NMR spectroscopy. A comparison with the unmodified analogs revealed that the equilibrium characteristics of the bistable DNA and RNA oligonucleotides were hardly affected upon fluorine substitution at C5 of pyrimidines. This observation was in accordance with UV spectroscopic melting experiments which demonstrated that single 5-fluoro substitutions in double helices lead to comparable thermodynamic stabilities. Thus, 5-fluoro pyrimidine labeling of DNA and RNA can be reliably applied for NMR based nucleic acid secondary structure evaluation. Furthermore, we developed a facile synthetic route towards 5-fluoro cytidine phosphoramidites that enables their convenient site-specific incorporation into oligonucleotides by solid-phase synthesis. PMID:19843610

  12. 5-Fluoro pyrimidines: labels to probe DNA and RNA secondary structures by 1D 19F NMR spectroscopy.

    PubMed

    Puffer, Barbara; Kreutz, Christoph; Rieder, Ulrike; Ebert, Marc-Olivier; Konrat, Robert; Micura, Ronald

    2009-12-01

    (19)F NMR spectroscopy has proved to be a valuable tool to monitor functionally important conformational transitions of nucleic acids. Here, we present a systematic investigation on the application of 5-fluoro pyrimidines to probe DNA and RNA secondary structures. Oligonucleotides with the propensity to adapt secondary structure equilibria were chosen as model systems and analyzed by 1D (19)F and (1)H NMR spectroscopy. A comparison with the unmodified analogs revealed that the equilibrium characteristics of the bistable DNA and RNA oligonucleotides were hardly affected upon fluorine substitution at C5 of pyrimidines. This observation was in accordance with UV spectroscopic melting experiments which demonstrated that single 5-fluoro substitutions in double helices lead to comparable thermodynamic stabilities. Thus, 5-fluoro pyrimidine labeling of DNA and RNA can be reliably applied for NMR based nucleic acid secondary structure evaluation. Furthermore, we developed a facile synthetic route towards 5-fluoro cytidine phosphoramidites that enables their convenient site-specific incorporation into oligonucleotides by solid-phase synthesis.

  13. Development of the Large-Scale Oligonucleotide Chip for the Diagnosis of Plant Viruses and its Practical Use

    PubMed Central

    Nam, Moon; Kim, Jeong-Seon; Lim, Seungmo; Park, Chung Youl; Kim, Jeong-Gyu; Choi, Hong-Soo; Lim, Hyoun-Sub; Moon, Jae Sun; Lee, Su-Heon

    2014-01-01

    A large-scale oligonucleotide (LSON) chip was developed for the detection of the plant viruses with known genetic information. The LSON chip contains two sets of 3,978 probes for 538 species of targets including plant viruses, satellite RNAs and viroids. A hundred forty thousand probes, consisting of isolate-, species- and genus-specific probes respectively, are designed from 20,000 of independent nucleotide sequence of plant viruses. Based on the economic importance, the amount of genome information, and the number of strains and/or isolates, one to fifty-one probes for each target virus are selected and spotted on the chip. The standard and field samples for the analysis of the LSON chip have been prepared and tested by RT-PCR. The probe’s specific and/or nonspecific reaction patterns by LSON chip allow us to diagnose the unidentified viruses. Thus, the LSON chip in this study could be highly useful for the detection of unexpected plant viruses, the monitoring of emerging viruses and the fluctuation of the population of major viruses in each plant. PMID:25288985

  14. A G-quadruplex based fluorescent oligonucleotide turn-on probe towards iodides detection in real samples.

    PubMed

    Li, Qian; Li, Shuaihua; Chen, Xiu; Bian, Liujiao

    2017-09-01

    A basket-type G-quadruplex (GQ) fluorescent oligonucleotide (OND) probe is designed to detect iodides dependent on thymine-Hg(II)-thymine (T-Hg(II)-T) base pairs and the intrinsic fluorescence quenching capacity of GQ. In the presence of Hg(II) ions (Hg 2+ ), the two hexachloro-fluorescein-labeled ONDs form a hairpin structure and the fluorophores are dragged close to the GQ, leading to fluorescence quenching of the probe due to photoinduced electron transfer. Upon addition of iodide anions, Hg 2+ are extracted from T-Hg(II)-T complexes which attributes to the stronger binding with iodide anions, resulting in the fluorescence recovery. Through performing the fluorescence quenching and recovery processes, this probe developed a fluorescence turn-on sensor for iodide anions determination over a linear range of 20-200nmol/L with a limit of detection of 5nmol/L. The practical use of the turn-on technology was demonstrated by its application in determination of iodides in water, food, pharmaceutical products and biological samples. Copyright © 2017 Elsevier Ltd. All rights reserved.

  15. Sensitive detection of unlabeled oligonucleotides using a paired surface plasma waves biosensor.

    PubMed

    Li, Ying-Chang; Chiou, Chiuan-Chian; Luo, Ji-Dung; Chen, Wei-Ju; Su, Li-Chen; Chang, Ying-Feng; Chang, Yu-Sun; Lai, Chao-Sung; Lee, Cheng-Chung; Chou, Chien

    2012-05-15

    Detection of unlabeled oligonucleotides using surface plasmon resonance (SPR) is difficult because of the oligonucleotides' relatively lower molecular weight compared with proteins. In this paper, we describe a method for detecting unlabeled oligonucleotides at low concentration using a paired surface plasma waves biosensor (PSPWB). The biosensor uses a sensor chip with an immobilized probe to detect a target oligonucleotide via sequence-specific hybridization. PSPWB measures the demodulated amplitude of the heterodyne signal in real time. In the meantime, the ratio of the amplitudes between the detected output signal and reference can reduce the excess noise from the laser intensity fluctuation. Also, the common-path propagation of p and s waves cancels the common phase noise induced by temperature variation. Thus, a high signal-to-noise ratio (SNR) of the heterodyne signal is detected. The sequence specificity of oligonucleotide hybridization ensures that the platform is precisely discriminating between target and non-target oligonucleotides. Under optimized experimental conditions, the detected heterodyne signal increases linearly with the logarithm of the concentration of target oligonucleotide over the range 0.5-500 pM. The detection limit is 0.5 pM in this experiment. In addition, the non-target oligonucleotide at concentrations of 10 pM and 10nM generated signals only slightly higher than background, indicating the high selectivity and specificity of this method. Different length of perfectly matched oligonucleotide targets at 10-mer, 15-mer and 20-mer were identified at the concentration of 150 pM. Copyright © 2012 Elsevier B.V. All rights reserved.

  16. Design and verification of a pangenome microarray oligonucleotide probe set for Dehalococcoides spp.

    PubMed

    Hug, Laura A; Salehi, Maryam; Nuin, Paulo; Tillier, Elisabeth R; Edwards, Elizabeth A

    2011-08-01

    Dehalococcoides spp. are an industrially relevant group of Chloroflexi bacteria capable of reductively dechlorinating contaminants in groundwater environments. Existing Dehalococcoides genomes revealed a high level of sequence identity within this group, including 98 to 100% 16S rRNA sequence identity between strains with diverse substrate specificities. Common molecular techniques for identification of microbial populations are often not applicable for distinguishing Dehalococcoides strains. Here we describe an oligonucleotide microarray probe set designed based on clustered Dehalococcoides genes from five different sources (strain DET195, CBDB1, BAV1, and VS genomes and the KB-1 metagenome). This "pangenome" probe set provides coverage of core Dehalococcoides genes as well as strain-specific genes while optimizing the potential for hybridization to closely related, previously unknown Dehalococcoides strains. The pangenome probe set was compared to probe sets designed independently for each of the five Dehalococcoides strains. The pangenome probe set demonstrated better predictability and higher detection of Dehalococcoides genes than strain-specific probe sets on nontarget strains with <99% average nucleotide identity. An in silico analysis of the expected probe hybridization against the recently released Dehalococcoides strain GT genome and additional KB-1 metagenome sequence data indicated that the pangenome probe set performs more robustly than the combined strain-specific probe sets in the detection of genes not included in the original design. The pangenome probe set represents a highly specific, universal tool for the detection and characterization of Dehalococcoides from contaminated sites. It has the potential to become a common platform for Dehalococcoides-focused research, allowing meaningful comparisons between microarray experiments regardless of the strain examined.

  17. Oligo Design: a computer program for development of probes for oligonucleotide microarrays.

    PubMed

    Herold, Keith E; Rasooly, Avraham

    2003-12-01

    Oligonucleotide microarrays have demonstrated potential for the analysis of gene expression, genotyping, and mutational analysis. Our work focuses primarily on the detection and identification of bacteria based on known short sequences of DNA. Oligo Design, the software described here, automates several design aspects that enable the improved selection of oligonucleotides for use with microarrays for these applications. Two major features of the program are: (i) a tiling algorithm for the design of short overlapping temperature-matched oligonucleotides of variable length, which are useful for the analysis of single nucleotide polymorphisms and (ii) a set of tools for the analysis of multiple alignments of gene families and related short DNA sequences, which allow for the identification of conserved DNA sequences for PCR primer selection and variable DNA sequences for the selection of unique probes for identification. Note that the program does not address the full genome perspective but, instead, is focused on the genetic analysis of short segments of DNA. The program is Internet-enabled and includes a built-in browser and the automated ability to download sequences from GenBank by specifying the GI number. The program also includes several utilities, including audio recital of a DNA sequence (useful for verifying sequences against a written document), a random sequence generator that provides insight into the relationship between melting temperature and GC content, and a PCR calculator.

  18. Oligonucleotide probes functionalization of nanogap electrodes.

    PubMed

    Zaffino, Rosa Letizia; Mir, Mònica; Samitier, Josep

    2017-11-01

    Nanogap electrodes have attracted a lot of consideration as promising platform for molecular electronic and biomolecules detection. This is mainly for their higher aspect ratio, and because their electrical properties are easily accessed by current-voltage measurements. Nevertheless, application of standard current-voltages measurements used to characterize nanogap response, and/or to modify specific nanogap electrodes properties, represents an issue. Since the strength of electrical fields in nanoscaled devices can reach high values, even at low voltages. Here, we analyzed the effects induced by different methods of surface modification of nanogap electrodes, in test-voltage application, employed for the electrical detection of a desoxyribonucleic acid (DNA) target. Nanogap electrodes were functionalized with two antisymmetric oligo-probes designed to have 20 terminal bases complementary to the edges of the target, which after hybridization bridges the nanogap, closing the electrical circuit. Two methods of functionalization were studied for this purpose; a random self-assembling of a mixture of the two oligo-probes (OPs) used in the platform, and a selective method that controls the position of each OP at selected side of nanogap electrodes. We used for this aim, the electrophoretic effect induced on negatively charged probes by the application of an external direct current voltage. The results obtained with both functionalization methods where characterized and compared in terms of electrode surface covering, calculated by using voltammetry analysis. Moreover, we contrasted the electrical detection of a DNA target in the nanogap platform either in site-selective and in randomly assembled nanogap. According to our results, a denser, although not selective surface functionalization, is advantageous for such kind of applications. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. Ultrasensitive and selective signal-on electrochemical DNA detection via exonuclease III catalysis and hybridization chain reaction amplification.

    PubMed

    Ren, Wang; Gao, Zhong Feng; Li, Nian Bing; Luo, Hong Qun

    2015-01-15

    This work reported a novel, ultrasensitive, and selective platform for electrochemical detection of DNA, employing an integration of exonuclease III (Exo-III) assisted target recycling and hybridization chain reaction (HCR) for the dual signal amplification strategy. The hairpin capture probe DNA (C-DNA) with an Exo-III 3' overhang end was self-assembled on a gold electrode. In the presence of target DNA (T-DNA), C-DNA hybridized with the T-DNA to form a duplex region, exposing its 5' complementary sequence (initiator). Exo-III was applied to selectively digest duplex region from its 3-hydroxyl termini until the duplex was fully consumed, leaving the remnant initiator. The intact T-DNA spontaneously dissociated from the structure and then initiated the next hybridization process as a result of catalysis of the Exo-III. HCR event was triggered by the initiator and two hairpin helper signal probes labeled with methylene blue, facilitating the polymerization of oligonucleotides into a long nicked dsDNA molecule. The numerous exposed remnant initiators can trigger more HCR events. Because of integration of dual signal amplification and the specific HCR process reaction, the resultant sensor showed a high sensitivity for the detection of the target DNA in a linear range from 1.0 fM to 1.0 nM, and a detection limit as low as 0.2 fM. The proposed dual signal amplification strategy provides a powerful tool for detecting different sequences of target DNA by changing the sequence of capture probe and signal probes, holding a great potential for early diagnosis in gene-related diseases. Copyright © 2014 Elsevier B.V. All rights reserved.

  20. Non-Enzymatic Detection of Bacterial Genomic DNA Using the Bio-Barcode Assay

    PubMed Central

    Hill, Haley D.; Vega, Rafael A.; Mirkin, Chad A.

    2011-01-01

    The detection of bacterial genomic DNA through a non-enzymatic nanomaterials based amplification method, the bio-barcode assay, is reported. The assay utilizes oligonucleotide functionalized magnetic microparticles to capture the target of interest from the sample. A critical step in the new assay involves the use of blocking oligonucleotides during heat denaturation of the double stranded DNA. These blockers bind to specific regions of the target DNA upon cooling, and prevent the duplex DNA from re-hybridizing, which allows the particle probes to bind. Following target isolation using the magnetic particles, oligonucleotide functionalized gold nanoparticles act as target recognition agents. The oligonucleotides on the nanoparticle (barcodes) act as amplification surrogates. The barcodes are then detected using the Scanometric method. The limit of detection for this assay was determined to be 2.5 femtomolar, and this is the first demonstration of a barcode type assay for the detection of double stranded, genomic DNA. PMID:17927207

  1. Enzymatic production of single-molecule FISH and RNA capture probes.

    PubMed

    Gaspar, Imre; Wippich, Frank; Ephrussi, Anne

    2017-10-01

    Arrays of singly labeled short oligonucleotides that hybridize to a specific target revolutionized RNA biology, enabling quantitative, single-molecule microscopy analysis and high-efficiency RNA/RNP capture. Here, we describe a simple and efficient method that allows flexible functionalization of inexpensive DNA oligonucleotides by different fluorescent dyes or biotin using terminal deoxynucleotidyl transferase and custom-made functional group conjugated dideoxy-UTP. We show that (i) all steps of the oligonucleotide labeling-including conjugation, enzymatic synthesis, and product purification-can be performed in a standard biology laboratory, (ii) the process yields >90%, often >95% labeled product with minimal carryover of impurities, and (iii) the oligonucleotides can be labeled with different dyes or biotin, allowing single-molecule FISH, RNA affinity purification, and Northern blot analysis to be performed. © 2017 Gaspar et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  2. Quantification of the Flavonoid-Degrading Bacterium Eubacterium ramulus in Human Fecal Samples with a Species-Specific Oligonucleotide Hybridization Probe

    PubMed Central

    Simmering, Rainer; Kleessen, Brigitta; Blaut, Michael

    1999-01-01

    To investigate the occurrence of the flavonoid-degrading bacterium Eubacterium ramulus in the human intestinal tract, an oligonucleotide probe designated S-S-E.ram-0997-a-A-18 was designed and validated, with over 90 bacterial strains representing the dominant described human fecal flora. Application of S-S-E.ram-0997-a-A-18 to fecal samples from 20 subjects indicated the presence of E. ramulus in each individual tested in numbers from 4.4 × 107 to 2.0 × 109 cells/g of fecal dry mass. Six fecal E. ramulus isolates were recognized by S-S-E.ram-0997-a-A-18 but exhibited different band patterns when analyzed by randomly amplified polymorphic DNA. PMID:10427069

  3. Poly(o-phenylenediamine) colloid-quenched fluorescent oligonucleotide as a probe for fluorescence-enhanced nucleic acid detection.

    PubMed

    Tian, Jingqi; Li, Hailong; Luo, Yonglan; Wang, Lei; Zhang, Yingwei; Sun, Xuping

    2011-02-01

    In this Letter, we demonstrate that chemical oxidation polymerization of o-phenylenediamine (OPD) by potassium bichromate at room temperature results in the formation of submicrometer-scale poly(o-phenylenediamine) (POPD) colloids. Such colloids can absorb and quench dye-labeled single-stranded DNA (ssDNA) very effectively. In the presence of a target, a hybridization event occurs, which produces a double-stranded DNA (dsDNA) that detaches from the POPD surface, leading to recovery of dye fluorescence. With the use of an oligonucleotide (OND) sequence associated with human immunodeficiency virus (HIV) as a model system, we demonstrate the proof of concept that POPD colloid-quenched fluorescent OND can be used as a probe for fluorescence-enhanced nucleic acid detection with selectivity down to single-base mismatch.

  4. Identification of the bacterial endosymbionts of the marine ciliate Euplotes magnicirratus (Ciliophora, Hypotrichia) and proposal of 'Candidatus Devosia euplotis'.

    PubMed

    Vannini, Claudia; Rosati, Giovanna; Verni, Franco; Petroni, Giulio

    2004-07-01

    This paper reports the identification of bacterial endosymbionts that inhabit the cytoplasm of the marine ciliated protozoon Euplotes magnicirratus. Ultrastructural and full-cycle rRNA approaches were used to reveal the identity of these bacteria. Based on analysis of 16S rRNA gene sequences, evolutionary trees were constructed; these placed the endosymbiont in the genus Devosia in the alpha-Proteobacteria. The validity of this finding was also shown by fluorescence in situ hybridization with a Devosia-specific oligonucleotide probe. Differences at the 16S rRNA gene level (which allowed the construction of a species-specific oligonucleotide probe) and the peculiar habitat indicate that the endosymbiont represents a novel species. As its cultivation has not been successful to date, the provisional name 'Candidatus Devosia euplotis' is proposed. The species- and group-specific probes designed in this study could represent convenient tools for the detection of 'Candidatus Devosia euplotis' and Devosia-like bacteria in the environment.

  5. Intermolecular G-quadruplex structure-based fluorescent DNA detection system.

    PubMed

    Zhou, Hui; Wu, Zai-Sheng; Shen, Guo-Li; Yu, Ru-Qin

    2013-03-15

    Adopting multi-donors to pair with one acceptor could improve the performance of fluorogenic detection probes. However, common dyes (e.g., fluorescein) in close proximity to each other would self-quench the fluorescence, and the fluorescence is difficult to restore. In this contribution, we constructed a novel "multi-donors-to-one acceptor" fluorescent DNA detection system by means of the intermolecular G-quadruplex (IGQ) structure-based fluorescence signal enhancement combined with the hairpin oligonucleotide. The novel IGQ-hairpin system was characterized using the p53 gene as the model target DNA. The proposed system showed an improved assay performance due to the introduction of IGQ-structure into fluorescent signaling probes, which could inhibit the background fluorescence and increase fluorescence restoration amplitude of fluoresceins upon target DNA hybridization. The proof-of-concept scheme is expected to provide new insight into the potential of G-quadruplex structure and promote the application of fluorescent oligonucleotide probes in fundamental research, diagnosis, and treatment of genetic diseases. Copyright © 2012 Elsevier B.V. All rights reserved.

  6. Use of 16S rRNA-targeted oligonucleotide probes to investigate the distribution of sulphate-reducing bacteria in estuarine sediments.

    PubMed

    Purdy, K J.; Nedwell, D B.; Embley, T M.; Takii, S

    2001-07-01

    The distribution of sulphate-reducing bacteria (SRBs) in three anaerobic sediments, one predominantly freshwater and low sulphate and two predominantly marine and high sulphate, on the River Tama, Tokyo, Japan, was investigated using 16S rRNA-targeted oligonucleotide probes. Hybridisation results and sulphate reduction measurements indicated that SRBs are a minor part of the bacterial population in the freshwater sediments. Only Desulfobulbus and Desulfobacterium were detected, representing 1.6% of the general bacterial probe signal. In contrast, the SRB community detected at the two marine-dominated sites was larger and more diverse, representing 10-11.4% of the bacterial signal and with Desulfobacter, Desulfovibrio, Desulfobulbus and Desulfobacterium detected. In contrast to previous reports our results suggest that Desulfovibrio may not always be the most abundant SRB in anaerobic sediments. Acetate-utilising Desulfobacter were the dominant SRB in the marine-dominated sediments, and Desulfobulbus and Desulfobacterium were active in low-sulphate sediments, where they may utilise electron acceptors other than sulphate.

  7. The detection of HBV DNA with gold-coated iron oxide nanoparticle gene probes

    NASA Astrophysics Data System (ADS)

    Xi, Dong; Luo, XiaoPing; Lu, QiangHua; Yao, KaiLun; Liu, ZuLi; Ning, Qin

    2008-03-01

    Gold-coated iron oxide nanoparticle Hepatitis B virus (HBV) DNA probes were prepared, and their application for HBV DNA measurement was studied. Gold-coated iron oxide nanoparticles were prepared by the citrate reduction of tetra-chloroauric acid in the presence of iron oxide nanoparticles which were added as seeds. With a fluorescence-based method, the maximal surface coverage of hexaethiol 30-mer oligonucleotides and the maximal percentage of hybridization strands on gold-coated iron oxide nanoparticles were (120 ± 8) oligonucleotides per nanoparticle, and (14 ± 2%), respectively, which were comparable with those of (132 ± 10) and (22 ± 3%) in Au nanoparticle groups. Large network aggregates were formed when gold-coated iron oxide nanoparticle HBV DNA gene probe was applied to detect HBV DNA molecules as evidenced by transmission electron microscopy and the high specificity was verified by blot hybridization. Our results further suggested that detecting DNA with iron oxide nanoparticles and magnetic separator was feasible and might be an alternative effective method.

  8. Microchip method for the enrichment of specific DNA sequences

    DOEpatents

    Mirzabekov, A.D.; Lysov, Y.P.; Shick, V.V.; Dubiley, S.A.

    1998-12-22

    A method for enriching specific genetic material sequences is provided, whereby oligonucleotide molecules complementary to the desired genetic material is first used to isolate the genetic material from a first source of genomic material. Then the genetic material is used as a label to isolate similar genetic sequences from other sources. 4 figs.

  9. Microchip method for the enrichment of specific DNA sequences

    DOEpatents

    Mirzabekov, Andrei Darievich; Lysov, Yuri Petrovich; Shick, Valentine Vladimirovich; Dubiley, Svetlana Alekseevna

    1998-01-01

    A method for enriching specific genetic material sequences is provided, whereby oligonucleotide molecules complementary to the desired genetic material is first used to isolate the genetic material from a first source of genomic material. Then the genetic material is used as a label to isolate similar genetic sequences from other sources.

  10. Influence of liquid medium and surface morphology on the response of QCM during immobilization and hybridization of short oligonucleotides.

    PubMed

    Ha, Tai Hwan; Kim, Sunhee; Lim, Geunbae; Kim, Kwan

    2004-09-15

    With the goal of developing a quartz crystal microbalance (QCM)-based DNA sensor, we have conducted an in situ QCM study along with fluorescence measurements using oligonucleotides (15-mer) as a model single-stranded DNA (ss-DNA) in two different aqueous buffer solutions; the sequence of 15-mer is a part of iduronate-2-sulphate exon whose mutation is known to cause Hunter syndrome, and the 15-mer is thiolated to be immobilized on the Au-coated quartz substrate. The fluorescence data indicate that the initial immobilization as well as the subsequent hybridization with a complementary strand is hardly dependent on the kind of buffer solution. In contrast, the mass increases deducible from the decrease of QCM frequency via the Sauerbrey equation are 2.7-6.2 and 3.0-4.4 times larger than the actual mass increases, as reflected in the fluorescence measurements, for the immobilization and the subsequent hybridization processes, respectively. Such an overestimation is attributed to the trapping of solvent as well as the formation of quite a rigid hydration layer associated with the higher viscosities and/or densities of the buffer solutions. Another noteworthy observation is the excessively large frequency change that occurs when the gold electrode is deposited in advance with Au nanoparticles. This clearly illustrates that the QCM detection of DNA hybridization is also affected greatly by the surface morphology of the electrode. These enlarged signals are altogether presumed to be advantageous when using a QCM system as an in situ probing device in DNA sensors.

  11. High-density, microsphere-based fiber optic DNA microarrays.

    PubMed

    Epstein, Jason R; Leung, Amy P K; Lee, Kyong Hoon; Walt, David R

    2003-05-01

    A high-density fiber optic DNA microarray has been developed consisting of oligonucleotide-functionalized, 3.1-microm-diameter microspheres randomly distributed on the etched face of an imaging fiber bundle. The fiber bundles are comprised of 6000-50000 fused optical fibers and each fiber terminates with an etched well. The microwell array is capable of housing complementary-sized microspheres, each containing thousands of copies of a unique oligonucleotide probe sequence. The array fabrication process results in random microsphere placement. Determining the position of microspheres in the random array requires an optical encoding scheme. This array platform provides many advantages over other array formats. The microsphere-stock suspension concentration added to the etched fiber can be controlled to provide inherent sensor redundancy. Examining identical microspheres has a beneficial effect on the signal-to-noise ratio. As other sequences of interest are discovered, new microsphere sensing elements can be added to existing microsphere pools and new arrays can be fabricated incorporating the new sequences without altering the existing detection capabilities. These microarrays contain the smallest feature sizes (3 microm) of any DNA array, allowing interrogation of extremely small sample volumes. Reducing the feature size results in higher local target molecule concentrations, creating rapid and highly sensitive assays. The microsphere array platform is also flexible in its applications; research has included DNA-protein interaction profiles, microbial strain differentiation, and non-labeled target interrogation with molecular beacons. Fiber optic microsphere-based DNA microarrays have a simple fabrication protocol enabling their expansion into other applications, such as single cell-based assays.

  12. Dissecting the hybridization of oligonucleotides to structured complementary sequences.

    PubMed

    Peracchi, Alessio

    2016-06-01

    When oligonucleotides hybridize to long target molecules, the process is slowed by the secondary structure in the targets. The phenomenon has been analyzed in several previous studies, but many details remain poorly understood. I used a spectrofluorometric strategy, focusing on the formation/breaking of individual base pairs, to study the kinetics of association between a DNA hairpin and >20 complementary oligonucleotides ('antisenses'). Hybridization rates differed by over three orders of magnitude. Association was toehold-mediated, both for antisenses binding to the target's ends and for those designed to interact with the loop. Binding of these latter, besides being consistently slower, was affected to variable, non-uniform extents by the asymmetric loop structure. Divalent metal ions accelerated hybridization, more pronouncedly when nucleation occurred at the loop. Incorporation of locked nucleic acid (LNA) residues in the antisenses substantially improved the kinetics only when LNAs participated to the earliest hybridization steps. The effects of individual LNAs placed along the antisense indicated that the reaction transition state occurred after invading at least the first base pair of the stem. The experimental approach helps dissect hybridization reactions involving structured nucleic acids. Toehold-dependent, nucleation-invasion models appear fully appropriate for describing such reactions. Estimating the stability of nucleation complexes formed at internal toeholds is the major hurdle for the quantitative prediction of hybridization rates. While analyzing the mechanisms of a fundamental biochemical process (hybridization), this work also provides suggestions for the improvement of technologies that rely on such process. Copyright © 2016 Elsevier B.V. All rights reserved.

  13. Specificity Re-evaluation of Oligonucleotide Probes for the Detection of Marine Picoplankton by Tyramide Signal Amplification-Fluorescent In Situ Hybridization.

    PubMed

    Riou, Virginie; Périot, Marine; Biegala, Isabelle C

    2017-01-01

    Oligonucleotide probes are increasingly being used to characterize natural microbial assemblages by Tyramide Signal Amplification-Fluorescent in situ Hybridization (TSA-FISH, or CAtalysed Reporter Deposition CARD-FISH). In view of the fast-growing rRNA databases, we re-evaluated the in silico specificity of eleven bacterial and eukaryotic probes and competitor frequently used for the quantification of marine picoplankton. We performed tests on cell cultures to decrease the risk for non-specific hybridization, before they are used on environmental samples. The probes were confronted to recent databases and hybridization conditions were tested against target strains matching perfectly with the probes, and against the closest non-target strains presenting one to four mismatches. We increased the hybridization stringency from 55 to 65% formamide for the Eub338+EubII+EubIII probe mix to be specific to the Eubacteria domain. In addition, we found that recent changes in the Gammaproteobacteria classification decreased the specificity of Gam42a probe, and that the Roseo536R and Ros537 probes were not specific to, and missed part of the Roseobacter clade. Changes in stringency conditions were important for bacterial probes; these induced, respectively, a significant increase, in Eubacteria and Roseobacter and no significant changes in Gammaproteobacteria concentrations from the investigated natural environment. We confirmed the eukaryotic probes original conditions, and propose the Euk1209+NChlo01+Chlo02 probe mix to target the largest picoeukaryotic diversity. Experiences acquired through these investigations leads us to propose the use of seven steps protocol for complete FISH probe specificity check-up to improve data quality in environmental studies.

  14. Direct profiling of environmental microbial populations by thermal dissociation analysis of native rRNAs hybridized to oligonucleotide microarrays

    NASA Technical Reports Server (NTRS)

    El Fantroussi, Said; Urakawa, Hidetoshi; Bernhard, Anne E.; Kelly, John J.; Noble, Peter A.; Smidt, H.; Yershov, G. M.; Stahl, David A.

    2003-01-01

    Oligonucleotide microarrays were used to profile directly extracted rRNA from environmental microbial populations without PCR amplification. In our initial inspection of two distinct estuarine study sites, the hybridization patterns were reproducible and varied between estuarine sediments of differing salinities. The determination of a thermal dissociation curve (i.e., melting profile) for each probe-target duplex provided information on hybridization specificity, which is essential for confirming adequate discrimination between target and nontarget sequences.

  15. Molecular diagnostics using magnetic nanobeads

    NASA Astrophysics Data System (ADS)

    Zardán Gómez de la Torre, Teresa; Strömberg, Mattias; Göransson, Jenny; Gunnarsson, Klas; Nilsson, Mats; Svedlindh, Peter; Strømme, Maria

    2010-01-01

    In this paper, we investigate the volume-amplified magnetic nanobead detection assay with respect to bead size, bead concentration and bead oligonucleotide surface coverage in order to improve the understanding of the underlying microscopic mechanisms. It has been shown that: (i) the immobilization efficiency of the beads depends on the surface coverage of oligonucleotides, (ii) by using lower amounts of probe-tagged beads, detection sensitivity can be improved and (iii) using small enough beads enables both turn-off and turn-on detection. Finally, biplex detection was demonstrated.

  16. Evaluation of sequence alignments and oligonucleotide probes with respect to three-dimensional structure of ribosomal RNA using ARB software package

    PubMed Central

    Kumar, Yadhu; Westram, Ralf; Kipfer, Peter; Meier, Harald; Ludwig, Wolfgang

    2006-01-01

    Background Availability of high-resolution RNA crystal structures for the 30S and 50S ribosomal subunits and the subsequent validation of comparative secondary structure models have prompted the biologists to use three-dimensional structure of ribosomal RNA (rRNA) for evaluating sequence alignments of rRNA genes. Furthermore, the secondary and tertiary structural features of rRNA are highly useful and successfully employed in designing rRNA targeted oligonucleotide probes intended for in situ hybridization experiments. RNA3D, a program to combine sequence alignment information with three-dimensional structure of rRNA was developed. Integration into ARB software package, which is used extensively by the scientific community for phylogenetic analysis and molecular probe designing, has substantially extended the functionality of ARB software suite with 3D environment. Results Three-dimensional structure of rRNA is visualized in OpenGL 3D environment with the abilities to change the display and overlay information onto the molecule, dynamically. Phylogenetic information derived from the multiple sequence alignments can be overlaid onto the molecule structure in a real time. Superimposition of both statistical and non-statistical sequence associated information onto the rRNA 3D structure can be done using customizable color scheme, which is also applied to a textual sequence alignment for reference. Oligonucleotide probes designed by ARB probe design tools can be mapped onto the 3D structure along with the probe accessibility models for evaluation with respect to secondary and tertiary structural conformations of rRNA. Conclusion Visualization of three-dimensional structure of rRNA in an intuitive display provides the biologists with the greater possibilities to carry out structure based phylogenetic analysis. Coupled with secondary structure models of rRNA, RNA3D program aids in validating the sequence alignments of rRNA genes and evaluating probe target sites. Superimposition of the information derived from the multiple sequence alignment onto the molecule dynamically allows the researchers to observe any sequence inherited characteristics (phylogenetic information) in real-time environment. The extended ARB software package is made freely available for the scientific community via . PMID:16672074

  17. Aminosilane functionalizations of mesoporous oxidized silicon for oligonucleotide synthesis and detection

    PubMed Central

    De Stefano, Luca; Oliviero, Giorgia; Amato, Jussara; Borbone, Nicola; Piccialli, Gennaro; Mayol, Luciano; Rendina, Ivo; Terracciano, Monica; Rea, Ilaria

    2013-01-01

    Direct solid phase synthesis of peptides and oligonucleotides (ONs) requires high chemical stability of the support material. In this work, we have investigated the passivation ability of porous oxidized silicon multilayered structures by two aminosilane compounds, 3-aminopropyltriethoxysilane and 3-aminopropyldimethylethoxysilane (APDMES), for optical label-free ON biosensor fabrication. We have also studied by spectroscopic reflectometry the hybridization between a 13 bases ON, directly grown on the aminosilane modified porous oxidized silicon by in situ synthesis, and its complementary sequence. Even if the results show that both devices are stable to the chemicals (carbonate/methanol) used, the porous silica structure passivated by APDMES reveals higher functionalization degree due to less steric hindrance of pores. PMID:23536541

  18. Triple helix purification and sequencing

    DOEpatents

    Wang, Renfeng; Smith, Lloyd M.; Tong, Xinchun E.

    1995-01-01

    Disclosed herein are methods, kits, and equipment for purifying single stranded circular DNA and then using the DNA for DNA sequencing purposes. Templates are provided with an insert having a hybridization region. An elongated oligonucleotide has two regions that are complementary to the insert and the oligo is bound to a magnetic anchor. The oligo hybridizes to the insert on two sides to form a stable triple helix complex. The anchor can then be used to drag the template out of solution using a magnet. The system can purify sequencing templates, and if desired the triple helix complex can be opened up to a double helix so that the oligonucleotide will act as a primer for further DNA synthesis.

  19. Triazole-linked DNA as a primer surrogate in the synthesis of first-strand cDNA.

    PubMed

    Fujino, Tomoko; Yasumoto, Ken-ichi; Yamazaki, Naomi; Hasome, Ai; Sogawa, Kazuhiro; Isobe, Hiroyuki

    2011-11-04

    A phosphate-eliminated nonnatural oligonucleotide serves as a primer surrogate in reverse transcription reaction of mRNA. Despite of the nonnatural triazole linkages in the surrogate, the reverse transcriptase effectively elongated cDNA sequences on the 3'-downstream of the primer by transcription of the complementary sequence of mRNA. A structure-activity comparison with the reference natural oligonucleotides shows the superior priming activity of the surrogate containing triazole-linkages. The nonnatural linkages also protect the transcribed cDNA from digestion reactions with 5'-exonuclease and enable us to remove noise transcripts of unknown origins. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Triple helix purification and sequencing

    DOEpatents

    Wang, R.; Smith, L.M.; Tong, X.E.

    1995-03-28

    Disclosed herein are methods, kits, and equipment for purifying single stranded circular DNA and then using the DNA for DNA sequencing purposes. Templates are provided with an insert having a hybridization region. An elongated oligonucleotide has two regions that are complementary to the insert and the oligo is bound to a magnetic anchor. The oligo hybridizes to the insert on two sides to form a stable triple helix complex. The anchor can then be used to drag the template out of solution using a magnet. The system can purify sequencing templates, and if desired the triple helix complex can be opened up to a double helix so that the oligonucleotide will act as a primer for further DNA synthesis. 4 figures.

  1. Development of a 16S rRNA-targeted fluorescence in situ hybridization probe for quantification of the ammonia-oxidizer Nitrosotalea devanaterra and its relatives.

    PubMed

    Restrepo-Ortiz, C X; Merbt, S N; Barrero-Canossa, J; Fuchs, B M; Casamayor, E O

    2018-04-28

    The Thaumarchaeota SAGMCG-1 group and, in particular, members of the genus Nitrosotalea have high occurrence in acidic soils, the rhizosphere, groundwater and oligotrophic lakes, and play a potential role in nitrogen cycling. In this study, the specific oligonucleotide fluorescence in situ hybridization probe SAG357 was designed for this Thaumarchaeota group based on the available 16S rRNA gene sequences in databases, and included the ammonia-oxidizing species Nitrosotalea devanaterra. Cell permeabilization for catalyzed reporter deposition fluorescence in situ detection and the hybridization conditions were optimized on enrichment cultures of the target species N. devanaterra, as well as the non-target ammonia-oxidizing archaeon Nitrosopumilus maritimus. Probe specificity was improved with a competitor oligonucleotide, and fluorescence intensity and cell visualization were enhanced by the design and application of two adjacent helpers. Probe performance was tested in soil samples along a pH gradient, and counting results matched the expected in situ distributions. Probe SAG357 and the CARD-FISH protocol developed in the present study will help to improve the current understanding of the ecology and physiology of N. devanaterra and its relatives in natural environments. Copyright © 2018 Elsevier GmbH. All rights reserved.

  2. Non-crosslinking gold nanoprobe-LAMP for simple, colorimetric, and specific detection of Salmonella typhi

    NASA Astrophysics Data System (ADS)

    Bozorgmehr, Ali; Yazdanparast, Razieh; Mollasalehi, Hamidreza

    2016-12-01

    In this study, we developed a non-crosslinking gold nanoprobe loop-mediated isothermal amplification (LAMP) method for nanodiagnosis of bacterial typhoid fever source, Salmonella typhi. Therefore, a unique region in the S. typhi genomic DNA was targeted for LAMP amplification using a specific set of four precisely designed primers. Also, for specific colorimetric visualization of the amplicons, a thiolated oligonucleotide probe, complementary to the single-stranded loop region of the amplicons between F2 and F1C segments, was designed. The probe was bound to the surface of gold nanoparticles via covalent bonds. Increasing the salt concentration in the detection reaction medium led to aggregation of nanoprobes in the blank and the negative vessels in a time-dependent form. That was followed by a change in the surface plasmon resonance (SPR) leading to blue/black color that was observable by the naked eyes after about 5 min. Meanwhile, the original pink/red color was retained in the positive sample due to the large interparticle spaces and the stability against the ionic strength elevation which persisted for about 30 min. The whole process of DNA extraction, amplification, and detection took less than 2 h with a sensitivity of 20 CFU/ml. The developed gold nanoprobe-LAMP could serve as a simple, rapid, and cost-effective method for nanodiagnosis of S. typhi in point-of-need applications.

  3. Cholecystokinin and tyrosine hydroxylase messenger RNAs in neurons of rat mesencephalon: peptide/monoamine coexistence studies using in situ hybridization combined with immunocytochemistry.

    PubMed

    Seroogy, K; Schalling, M; Brené, S; Dagerlind, A; Chai, S Y; Hökfelt, T; Persson, H; Brownstein, M; Huan, R; Dixon, J

    1989-01-01

    The cellular localization of neurons expressing cholecystokinin (CCK) and tyrosine hydroxylase (TH) mRNAs was analysed in rat ventral mesencephalon using in situ hybridization techniques with both complementary DNA and synthetic oligonucleotide probes. Cell bodies distributed throughout the substantia nigra, ventral tegmental area, interfascicular nucleus, midline raphe nuclei, and central and ventral periaqueductal grey matter were found to contain CCK mRNA or TH mRNA as indicated by high densities of grains overlying the perikarya. The in situ hybridization technique was combined with immunocytochemistry on the same tissue section to localize the peptide or enzyme within its respective mRNA-containing somata. In addition, the presence of TH immunoreactivity was demonstrated within cell bodies labeled for CCK mRNA and immunostaining for CCK was detected within TH mRNA-containing neurons. In the medial geniculate nucleus a strong labeling for CCKmRNA was observed, in spite of the fact that so far no CCK-like immunoreactivity has been demonstrated in perikarya in this nucleus. The specificity of the probes was verified by RNA blot hybridization. These results confirm recent double-labeling immunocytochemical studies and further characterize the coexistence of CCK and TH at the level of their mRNAs as well as their post-translational products in a large population of mesencephalic dopamine neurons known to project to forebrain areas.

  4. Serotype determination of Salmonella by xTAG assay.

    PubMed

    Zheng, Zhibei; Zheng, Wei; Wang, Haoqiu; Pan, Jincao; Pu, Xiaoying

    2017-10-01

    Currently, no protocols or commercial kits are available to determine the serotypes of Salmonella by using Luminex MAGPIX®. In this study, an xTAG assay for serotype determination of Salmonella suitable for Luminex MAGPIX® is described and 228 Salmonella isolates were serotype determined by this xTAG assay. The xTAG assay consists of two steps: 1) Multiplex PCR to amplify simultaneously O, H and Vi antigen genes of Salmonella, and 2) Magplex-TAG™ microsphere hybridization to identify accurately the specific PCR products of different antigens. Compared with the serotyping results of traditional serum agglutination test, the sensitivity and specificity of the xTAG assay were 95.1% and 100%, respectively. The agreement rate of these two assays was 95.2%. Compared with Luminex xMAP® Salmonella Serotyping Assay (SSA) kit, the advantages of this xTAG assay are: First, the magnetic beads make it applicable to both the Luminex®100/200™ and MAGPIX® systems. Second, only primers rather than both primers and probes are needed in the xTAG assay, and the process of coupling antigen-specific oligonucleotide probes to beads is circumvented, which make the xTAG assay convenient to be utilized by other laboratories. The xTAG assay may serve as a rapid alternative or complementary method for traditional Salmonella serotyping tests, especially for laboratories that utilize the MAGPIX® systems. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. A simple, rapid and inexpensive method for localization of Tomato yellow leaf curl virus and Potato leafroll virus in plant and insect vectors.

    PubMed

    Ghanim, Murad; Brumin, Marina; Popovski, Smadar

    2009-08-01

    A simple, rapid, inexpensive method for the localization of virus transcripts in plant and insect vector tissues is reported here. The method based on fluorescent in situ hybridization using short DNA oligonucleotides complementary to an RNA segment representing a virus transcript in the infected plant or insect vector. The DNA probe harbors a fluorescent molecule at its 5' or 3' ends. The protocol: simple fixation, hybridization, minimal washing and confocal microscopy, provides a highly specific signal. The reliability of the protocol was tested by localizing two phloem-limited plant virus transcripts in infected plants and insect tissues: Tomato yellow leaf curl virus (TYLCV) (Begomovirus: Geminiviridae), exclusively transmitted by the whitefly Bemisia tabaci (Gennadius) in a circulative non-propagative manner, and Potato leafroll virus (Polerovirus: Luteoviridae), similarly transmitted by the aphid Myzus persicae (Sulzer). Transcripts for both viruses were localized specifically to the phloem sieve elements of infected plants, while negative controls showed no signal. TYLCV transcripts were also localized to the digestive tract of B. tabaci, confirming TYLCV route of transmission. Compared to previous methods for localizing virus transcripts in plant and insect tissues that include complex steps for in-vitro probe preparation or antibody raising, tissue fixation, block preparation, sectioning and hybridization, the method described below provides very reliable, convincing, background-free results with much less time, effort and cost.

  6. Multiplex Identification of Microbes ▿ †

    PubMed Central

    Hyman, Richard W.; St.Onge, Robert P.; Allen, Edward A.; Miranda, Molly; Aparicio, Ana Maria; Fukushima, Marilyn; Davis, Ronald W.

    2010-01-01

    We have adapted molecular inversion probe technology to identify microbes in a highly multiplexed procedure. This procedure does not require growth of the microbes. Rather, the technology employs DNA homology twice: once for the molecular probe to hybridize to its homologous DNA and again for the 20-mer oligonucleotide barcode on the molecular probe to hybridize to a commercially available molecular barcode array. As proof of concept, we have designed, tested, and employed 192 molecular probes for 40 microbes. While these particular molecular probes are aimed at our interest in the microbes in the human vagina, this molecular probe method could be employed to identify the microbes in any ecological niche. PMID:20418427

  7. Chemical probes of the conformation of DNA modified by cis-diamminedichloroplatinum(II)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Marrot, L.; Leng, M.

    The purpose of this work was to analyze at the nucleotide level the distortions induced by the binding of cis-diamminedichloroplatinum(II) (cis-DDP) to DNA by means of chemical probes. In order to test the chemical probes, experiments were first carried out on two platinated oligonucleotides. It has been verified by circular dichroism and gel electrophoresis that the binding of cis-DDP to an AG or to a GTG site within a double-stranded oligonucleotide distorts the double helix. The reactivity of the oligonucleotide platinated at the GTG site with chloroacetaldehyde, diethyl pyrocarbonate, and osmium tetraoxide, respectively, suggests a local denaturation of the doublemore » helix. The 5'G residue and the T residue within the adduct are no longer paired, while the 3'G residue is paired. The double helix is more distorted (but not denatured) at the 5' side of the adduct than at the 3' side. The reactivities of the chemical probes with six platinated DNA restriction fragments show that even at a relatively high level of platination only a few base pairs are unpaired but the double helix is largely distorted. No local denaturation has been detected at the GG sites separated from the nearest GG or AG sites by at least three base pairs. The AG sites separated from the nearest AG or GG sites by at least three base pairs do not denature the double helix locally when they are in the sequences puAG/pyTC. It is suggested that the distortion within these sequences is induced by adducts located further away along the DNA fragments, these sequences not being the major sites for the binding of cis-DDP.« less

  8. Binding of DNA hairpins to an assembler-strand as part of a primordial translation device

    NASA Astrophysics Data System (ADS)

    Baumann, Ulrich

    1987-09-01

    A crucial event in the process leading to the origin of life is the emergence of a simple translation device. To approach experimental realization of this device the binding ability of short DNA hairpins to complementary oligonucleotides fixed on a solid support was investigated. The binding is achieved by base pairing between the loop nucleotides of the hairpins containing different numbers of adenosine residues and oligothymidylates covalently linked to cellulose. The loop has to consist of at least five nucleotides to achieve binding. The exact number of established base pairs was determined in two ways. First, the elution temperatures of hairpins and those of oligoadenylates which had the length of the loop were compared. Secondly, the architecture of the loop was analyzed by means of the single-strand-specific nuclease from mung bean acting as structural probe. Onlyn-2 of n loop nucleotides of a hairpin are able to form base pairs. Therefore, a strong evidence for the formation of a triplet of base pairs between primeval tRNA and mRNA sufficient to stabilize the complex enzyme-free is given.

  9. Modified rare earth semiconductor oxide as a new nucleotide probe.

    PubMed

    Shrestha, S; Mills, C E; Lewington, J; Tsang, S C

    2006-12-28

    Recent rapid developments in biological analysis, medical diagnosis, pharmaceutical industry, and environmental control fuel the urgent need for recognition of particular DNA sequences from samples. Currently, DNA detection techniques use radiochemical, enzymatic, fluorescent, or electrochemiluminescent methods; however, these techniques require costly labeled DNA and highly skilled and cumbersome procedure, which prohibit any in-situ monitoring. Here, we report that hybridization of surface-immobilized single-stranded oligonucleotide on praseodymium oxide (evaluated as a biosensor surface for the first time) with complimentary strands in solution provokes a significant shift of electrical impedance curve. This shift is attributed to a change in electrical characteristics through modification of surface charge of the underlying modified praseodymium oxide upon hybridization with the complementary oligonucelotide strand. On the other hand, using a noncomplementary single strand in solution does not create an equivalent change in the impedance value. This result clearly suggests that a new and simple electrochemical technique based on the change in electrical properties of the modified praseodymium oxide semiconductor surface upon recognition and transduction of a biological event without using labeled species is revealed.

  10. Oligonucleotide fingerprinting of rRNA genes for analysis of fungal community composition.

    PubMed

    Valinsky, Lea; Della Vedova, Gianluca; Jiang, Tao; Borneman, James

    2002-12-01

    Thorough assessments of fungal diversity are currently hindered by technological limitations. Here we describe a new method for identifying fungi, oligonucleotide fingerprinting of rRNA genes (OFRG). ORFG sorts arrayed rRNA gene (ribosomal DNA [rDNA]) clones into taxonomic clusters through a series of hybridization experiments, each using a single oligonucleotide probe. A simulated annealing algorithm was used to design an OFRG probe set for fungal rDNA. Analysis of 1,536 fungal rDNA clones derived from soil generated 455 clusters. A pairwise sequence analysis showed that clones with average sequence identities of 99.2% were grouped into the same cluster. To examine the accuracy of the taxonomic identities produced by this OFRG experiment, we determined the nucleotide sequences for 117 clones distributed throughout the tree. For all but two of these clones, the taxonomic identities generated by this OFRG experiment were consistent with those generated by a nucleotide sequence analysis. Eighty-eight percent of the clones were affiliated with Ascomycota, while 12% belonged to BASIDIOMYCOTA: A large fraction of the clones were affiliated with the genera Fusarium (404 clones) and Raciborskiomyces (176 clones). Smaller assemblages of clones had high sequence identities to the Alternaria, Ascobolus, Chaetomium, Cryptococcus, and Rhizoctonia clades.

  11. Custom oligonucleotide array-based CGH: a reliable diagnostic tool for detection of exonic copy-number changes in multiple targeted genes

    PubMed Central

    Vasson, Aurélie; Leroux, Céline; Orhant, Lucie; Boimard, Mathieu; Toussaint, Aurélie; Leroy, Chrystel; Commere, Virginie; Ghiotti, Tiffany; Deburgrave, Nathalie; Saillour, Yoann; Atlan, Isabelle; Fouveaut, Corinne; Beldjord, Cherif; Valleix, Sophie; Leturcq, France; Dodé, Catherine; Bienvenu, Thierry; Chelly, Jamel; Cossée, Mireille

    2013-01-01

    The frequency of disease-related large rearrangements (referred to as copy-number mutations, CNMs) varies among genes, and search for these mutations has an important place in diagnostic strategies. In recent years, CGH method using custom-designed high-density oligonucleotide-based arrays allowed the development of a powerful tool for detection of alterations at the level of exons and made it possible to provide flexibility through the possibility of modeling chips. The aim of our study was to test custom-designed oligonucleotide CGH array in a diagnostic laboratory setting that analyses several genes involved in various genetic diseases, and to compare it with conventional strategies. To this end, we designed a 12-plex CGH array (135k; 135 000 probes/subarray) (Roche Nimblegen) with exonic and intronic oligonucleotide probes covering 26 genes routinely analyzed in the laboratory. We tested control samples with known CNMs and patients for whom genetic causes underlying their disorders were unknown. The contribution of this technique is undeniable. Indeed, it appeared reproducible, reliable and sensitive enough to detect heterozygous single-exon deletions or duplications, complex rearrangements and somatic mosaicism. In addition, it improves reliability of CNM detection and allows determination of boundaries precisely enough to direct targeted sequencing of breakpoints. All of these points, associated with the possibility of a simultaneous analysis of several genes and scalability ‘homemade' make it a valuable tool as a new diagnostic approach of CNMs. PMID:23340513

  12. Effect of structure variation of the aptamer-DNA duplex probe on the performance of displacement-based electrochemical aptamer sensors.

    PubMed

    Pang, Jie; Zhang, Ziping; Jin, Haizhu

    2016-03-15

    Electrochemical aptamer-based (E-AB) sensors employing electrode-immobilized, redox-tagged aptamer probes have emerged as a promising platform for the sensitive and quick detection of target analytes ranging from small molecules to proteins. Signal generation in this class of sensor is linked to change in electron transfer efficiency upon binding-induced change in flexibility/conformation of the aptamer probe. Because of this signaling mechanism, signal gains of these sensors can be improved by employing a displacement-based recognition system, which links target binding with a large-scale flexibility/conformation shift from the aptamer-DNA duplex to the single-stranded DNA or the native aptamer. Despite the relatively large number of displacement-based E-AB sensor samples, little attention has been paid to the structure variation of the aptamer-DNA duplex probe. Here we detail the effects of complementary length and position of the aptamer-DNA duplex probe on the performance of a model displacement-based E-AB sensor for ATP. We find that, greater background suppression and signal gain are observed with longer complementary length of the aptamer-DNA duplex probe. However, sensor equilibration time slows monotonically with increasing complementary length; and with too many target binding sites in aptamer sequence being occupied by the complementary DNA, the aptamer-target binding does not occur and no signal gain observed. We also demonstrate that signal gain of the displacement-based E-AB sensor is strongly dependent on the complementary position of the aptamer-DNA duplex probe, with complementary position located at the electrode-attached or redox-tagged end of the duplex probe, larger background suppression and signal increase than that of the middle position are observed. These results highlight the importance of rational structure design of the aptamer-DNA duplex probe and provide new insights into the optimization of displacement-based E-AB sensors. Copyright © 2015 Elsevier B.V. All rights reserved.

  13. Development and validation of an automated, microscopy-based method for enumeration of groups of intestinal bacteria.

    PubMed

    Jansen, G J; Wildeboer-Veloo, A C; Tonk, R H; Franks, A H; Welling, G W

    1999-09-01

    An automated microscopy-based method using fluorescently labelled 16S rRNA-targeted oligonucleotide probes directed against the predominant groups of intestinal bacteria was developed and validated. The method makes use of the Leica 600HR image analysis system, a Kodak MegaPlus camera model 1.4 and a servo-controlled Leica DM/RXA ultra-violet microscope. Software for automated image acquisition and analysis was developed and tested. The performance of the method was validated using a set of four fluorescent oligonucleotide probes: a universal probe for the detection of all bacterial species, one probe specific for Bifidobacterium spp., a digenus-probe specific for Bacteroides spp. and Prevotella spp. and a trigenus-probe specific for Ruminococcus spp., Clostridium spp. and Eubacterium spp. A nucleic acid stain, 4',6-diamidino-2-phenylindole (DAPI), was also included in the validation. In order to quantify the assay-error, one faecal sample was measured 20 times using each separate probe. Thereafter faecal samples of 20 different volunteers were measured following the same procedure in order to quantify the error due to individual-related differences in gut flora composition. It was concluded that the combination of automated microscopy and fluorescent whole-cell hybridisation enables distinction in gut flora-composition between volunteers at a significant level. With this method it is possible to process 48 faecal samples overnight, with coefficients of variation ranging from 0.07 to 0.30.

  14. Template switching between PNA and RNA oligonucleotides

    NASA Technical Reports Server (NTRS)

    Bohler, C.; Nielsen, P. E.; Orgel, L. E.; Miller, S. L. (Principal Investigator)

    1995-01-01

    The origin of the RNA world is not easily understood, as effective prebiotic syntheses of the components of RNA, the beta-ribofuranoside-5'-phosphates, are hard to envisage. Recognition of this difficulty has led to the proposal that other genetic systems, the components of which are more easily formed, may have preceded RNA. This raises the question of how transitions between one genetic system and another could occur. Peptide nucleic acid (PNA) resembles RNA in its ability to form double-helical complexes stabilized by Watson-Crick hydrogen bonding between adenine and thymine and between cytosine and guanine, but has a backbone that is held together by amide rather than by phosphodiester bonds. Oligonucleotides bases on RNA are known to act as templates that catalyse the non-enzymatic synthesis of their complements from activated mononucleotides, we now show that RNA oligonucleotides facilitate the synthesis of complementary PNA strands and vice versa. This suggests that a transition between different genetic systems can occur without loss of information.

  15. Photouncaged Sequence-specific Interstrand DNA Cross-Linking with Photolabile 4-oxo-enal-modified Oligonucleotides

    PubMed Central

    Sun, Jingjing; Tang, Xinjing

    2015-01-01

    DNA cross-linking technology is an attractive tool for the detection, regulation, and manipulation of genes. In this study, a series of photolabile 4-oxo-enal-modified oligonucleotides functionalized with photosensitive ο-nitrobenzyl derivatives were rationally designed as a new kind of photocaged cross-linking agents. A comprehensive evaluation of cross-linking reactions for different nucleobases in complementary strands under different conditions suggested that the modified DNA oligonucleotides tended to form interstrand cross-linking to nucleobases with the potential of thymidine > guanosine » cytidine ~ adenosine. Different from previous literature reports that cytidine and adenosine were preferential cross-linked nucleobases with 4-oxo-enal moieties, our study represents the first example of DNA cross-linking for T and G selectivity using 4-oxo-enal moiety. The cross-linked adducts were identified and their cross-linking mechanism was also illustrated. This greatly expands the applications of 4-oxo-enal derivatives in the studies of DNA damage and RNA structure PMID:26020694

  16. Photouncaged Sequence-specific Interstrand DNA Cross-Linking with Photolabile 4-oxo-enal-modified Oligonucleotides.

    PubMed

    Sun, Jingjing; Tang, Xinjing

    2015-05-28

    DNA cross-linking technology is an attractive tool for the detection, regulation, and manipulation of genes. In this study, a series of photolabile 4-oxo-enal-modified oligonucleotides functionalized with photosensitive ο-nitrobenzyl derivatives were rationally designed as a new kind of photocaged cross-linking agents. A comprehensive evaluation of cross-linking reactions for different nucleobases in complementary strands under different conditions suggested that the modified DNA oligonucleotides tended to form interstrand cross-linking to nucleobases with the potential of thymidine > guanosine » cytidine ~ adenosine. Different from previous literature reports that cytidine and adenosine were preferential cross-linked nucleobases with 4-oxo-enal moieties, our study represents the first example of DNA cross-linking for T and G selectivity using 4-oxo-enal moiety. The cross-linked adducts were identified and their cross-linking mechanism was also illustrated. This greatly expands the applications of 4-oxo-enal derivatives in the studies of DNA damage and RNA structure.

  17. Development of mercury (II) ion biosensors based on mercury-specific oligonucleotide probes.

    PubMed

    Li, Lanying; Wen, Yanli; Xu, Li; Xu, Qin; Song, Shiping; Zuo, Xiaolei; Yan, Juan; Zhang, Weijia; Liu, Gang

    2016-01-15

    Mercury (II) ion (Hg(2+)) contamination can be accumulated along the food chain and cause serious threat to the public health. Plenty of research effort thus has been devoted to the development of fast, sensitive and selective biosensors for monitoring Hg(2+). Thymine was demonstrated to specifically combine with Hg(2+) and form a thymine-Hg(2+)-thymine (T-Hg(2+)-T) structure, with binding constant even higher than T-A Watson-Crick pair in DNA duplex. Recently, various novel Hg(2+) biosensors have been developed based on T-rich Mercury-Specific Oligonucleotide (MSO) probes, and exhibited advanced selectivity and excellent sensitivity for Hg(2+) detection. In this review, we explained recent development of MSO-based Hg(2+) biosensors mainly in 3 groups: fluorescent biosensors, colorimetric biosensors and electrochemical biosensors. Copyright © 2015 Elsevier B.V. All rights reserved.

  18. Oligonucleotide-arrayed TFT photosensor applicable for DNA chip technology.

    PubMed

    Tanaka, Tsuyoshi; Hatakeyama, Keiichi; Sawaguchi, Masahiro; Iwadate, Akihito; Mizutani, Yasushi; Sasaki, Kazuhiro; Tateishi, Naofumi; Takeyama, Haruko; Matsunaga, Tadashi

    2006-09-05

    A thin film transistor (TFT) photosensor fabricated by semiconductor integrated circuit (IC) technology was applied to DNA chip technology. The surface of the TFT photosensor was coated with TiO2 using a vapor deposition technique for the fabrication of optical filters. The immobilization of thiolated oligonucleotide probes onto a TiO2-coated TFT photosensor using gamma-aminopropyltriethoxysilane (APTES) and N-(gamma-maleimidobutyloxy) sulfosuccinimide ester (GMBS) was optimized. The coverage value of immobilized oligonucleotides reached a plateau at 33.7 pmol/cm2, which was similar to a previous analysis using radioisotope-labeled oligonucleotides. The lowest detection limits were 0.05 pmol/cm2 for quantum dot and 2.1 pmol/cm2 for Alexa Fluor 350. Furthermore, single nucleotide polymorphism (SNP) detection was examined using the oligonucleotide-arrayed TFT photosensor. A SNP present in the aldehyde dehydrogenase 2 (ALDH2) gene was used as a target. The SNPs in ALDH2*1 and ALDH2*2 target DNA were detected successfully using the TFT photosensor. DNA hybridization in the presence of both ALDH2*1 and ALDH2*2 target DNA was observed using both ALDH2*1 and ALDH2*2 detection oligonucleotides-arrayed TFT photosensor. Use of the TFT photosensor will allow the development of a disposable photodetecting device for DNA chip systems. (c) 2006 Wiley Periodicals, Inc.

  19. Diatomaceous Fungal and Bacterial Building Blocks for Material Synthesis

    DTIC Science & Technology

    2008-04-08

    Thalassiosira-templated metallic microshells. Thalassiosira, only 1mM rhodamine 6G (d) lmM, (e) I piM ,(f 100 nM R6G. 4 concentrations gave detectable...hybridized with a 27-mer 7 oligonucleotide containing a 7-mer TAG GAA TAG TTA TA AT OTT ATT AGO complementary region 2, which produces TAIOATCCTTA TACAATAATCC

  20. Isolation and Identification of Post-Transcriptional Gene Silencing-Related Micro-RNAs by Functionalized Silicon Nanowire Field-effect Transistor

    NASA Astrophysics Data System (ADS)

    Chen, Kuan-I.; Pan, Chien-Yuan; Li, Keng-Hui; Huang, Ying-Chih; Lu, Chia-Wei; Tang, Chuan-Yi; Su, Ya-Wen; Tseng, Ling-Wei; Tseng, Kun-Chang; Lin, Chi-Yun; Chen, Chii-Dong; Lin, Shih-Shun; Chen, Yit-Tsong

    2015-11-01

    Many transcribed RNAs are non-coding RNAs, including microRNAs (miRNAs), which bind to complementary sequences on messenger RNAs to regulate the translation efficacy. Therefore, identifying the miRNAs expressed in cells/organisms aids in understanding genetic control in cells/organisms. In this report, we determined the binding of oligonucleotides to a receptor-modified silicon nanowire field-effect transistor (SiNW-FET) by monitoring the changes in conductance of the SiNW-FET. We first modified a SiNW-FET with a DNA probe to directly and selectively detect the complementary miRNA in cell lysates. This SiNW-FET device has 7-fold higher sensitivity than reverse transcription-quantitative polymerase chain reaction in detecting the corresponding miRNA. Next, we anchored viral p19 proteins, which bind the double-strand small RNAs (ds-sRNAs), on the SiNW-FET. By perfusing the device with synthesized ds-sRNAs of different pairing statuses, the dissociation constants revealed that the nucleotides at the 3‧-overhangs and pairings at the terminus are important for the interactions. After perfusing the total RNA mixture extracted from Nicotiana benthamiana across the device, this device could enrich the ds-sRNAs for sequence analysis. Finally, this bionanoelectronic SiNW-FET, which is able to isolate and identify the interacting protein-RNA, adds an additional tool in genomic technology for the future study of direct biomolecular interactions.

  1. Modulating nanoparticle superlattice structure using proteins with tunable bond distributions

    DOE PAGES

    McMillan, Janet R.; Brodin, Jeffrey D.; Millan, Jaime A.; ...

    2017-01-25

    Here, we investigate the use of proteins with tunable DNA modification distributions to modulate nanoparticle superlattice structure. Using Beta-galactosidase (βgal) as a model system, we have employed the orthogonal chemical reactivities of surface amines and thiols to synthesize protein-DNA conjugates with 36 evenly distributed or 8 specifically positioned oligonucleotides. When assembled into crystalline superlattices with AuNPs, we find that the distribution of DNA modifications modulates the favored structure: βgal with uniformly distributed DNA bonding elements results in body-centered cubic crystals, whereas DNA functionalization of cysteines results in AB 2 packing. We probe the role of protein oligonucleotide number and conjugatemore » size on this observation, which revealed the importance of oligonucleotide distribution and number in this observed assembly behavior. These results indicate that proteins with defined DNA-modification patterns are powerful tools to control the nanoparticle superlattices architecture, and establish the importance of oligonucleotide distribution in the assembly behavior of protein-DNA conjugates.« less

  2. Synthesis and conformational properties of oligonucleotides incorporating 2'-O-phosphorylated ribonucleotides as structural motifs of pre-tRNA splicing intermediates.

    PubMed

    Tsuruoka, H; Shohda, K; Wada, T; Sekine, M

    2000-11-03

    To synthesize oligonucleotides containing 2'-O-phosphate groups, four kinds of ribonucleoside 3'-phosphoramidite building blocks 6a-d having the bis(2-cyano-1,1-dimethylethoxy)thiophosphoryl (BCMETP) group were prepared according to our previous phosphorylation procedure. These phosphoramidite units 6a-d were not contaminated with 3'-regioisomers and were successfully applied to solid-phase synthesis to give oligodeoxyuridylates 15, 16 and oligouridylates 21, 22. Self-complementary Drew-Dickerson DNA 12mers 24-28 replaced by a 2'-O-phosphorylated ribonucleotide at various positions were similarly synthesized. In these syntheses, it turned out that KI(3) was the most effective reagent for oxidative desulfurization of the initially generated thiophosphate group to the phosphate group on polymer supports. Without using this conversion step, a tridecadeoxyuridylate 17 incorporating a 2'-O-thiophosphorylated uridine derivative was also synthesized. To investigate the effect of the 2'-phosphate group on the thermal stability and 3D-structure of DNA(RNA) duplexes, T(m) measurement of the self-complementary oligonucleotides obtained and MD simulation of heptamer duplexes 33-36 were carried out. According to these analyses, it was suggested that the nucleoside ribose moiety phosphorylated at the 2'-hydroxyl function predominantly preferred C2'-endo to C3'-endo conformation in DNA duplexes so that it did not significantly affect the stability of the DNA duplex. On the other hand, the 2'-modified ribose moiety was expelled to give a C3'-endo conformation in RNA duplexes so that the RNA duplexes were extremely destabilized.

  3. Comparison of small molecules and oligonucleotides that target a toxic, non-coding RNA.

    PubMed

    Costales, Matthew G; Rzuczek, Suzanne G; Disney, Matthew D

    2016-06-01

    Potential RNA targets for chemical probes and therapeutic modalities are pervasive in the transcriptome. Oligonucleotide-based therapeutics are commonly used to target RNA sequence. Small molecules are emerging as a modality to target RNA structures selectively, but their development is still in its infancy. In this work, we compare the activity of oligonucleotides and several classes of small molecules that target the non-coding r(CCUG) repeat expansion (r(CCUG)(exp)) that causes myotonic dystrophy type 2 (DM2), an incurable disease that is the second-most common cause of adult onset muscular dystrophy. Small molecule types investigated include monomers, dimers, and multivalent compounds synthesized on-site by using RNA-templated click chemistry. Oligonucleotides investigated include phosphorothioates that cleave their target and vivo-morpholinos that modulate target RNA activity via binding. We show that compounds assembled on-site that recognize structure have the highest potencies amongst small molecules and are similar in potency to a vivo-morpholino modified oligonucleotide that targets sequence. These studies are likely to impact the design of therapeutic modalities targeting other repeats expansions that cause fragile X syndrome and amyotrophic lateral sclerosis, for example. Copyright © 2016. Published by Elsevier Ltd.

  4. Efficient transfer of information from hexitol nucleic acids to RNA during nonenzymatic oligomerization

    NASA Technical Reports Server (NTRS)

    Kozlov, I. A.; De Bouvere, B.; Van Aerschot, A.; Herdewijn, P.; Orgel, L. E.

    1999-01-01

    Hexitol nucleic acids (HNAs) are DNA analogues that contain the standard nucleoside bases attached to a phosphorylated 1,5-anhydrohexitol backbone. We find that HNAs support efficient information transfer in nonensymatic template-directed reactions. HNA heterosequences appeared to be superior to the corresponding DNA heterosequences in facilitating synthesis of complementary oligonucleotides from nucleoside-5'-phosphoro-2-methyl imidazolides.

  5. Electron transfer of plurimodified DNA SAMs.

    PubMed

    Rospigliosi, Alessandro; Ehlich, Rudolf; Hoerber, Heinrich; Middelberg, Anton; Moggridge, Geoff

    2007-07-17

    An STM-based current-voltage (I/V) investigation of deoxyribonucleic acid (DNA) 18 base pair (bp) oligonucleotide monolayers on gold is presented. Three bases of each of the immobilized and complementary strands were modified with either iodine or phenylethylene moieties. The oligonucleotides were immobilized on template stripped gold (tsg) surfaces and characterized by atomic force microscopy (AFM) and scanning tunneling microscopy (STM). AFM imaging showed that monolayers of the expected height were formed. A comparative study of normal, halogenated, and phenyl-modified DNA was made with the STM in tunneling spectroscopy (TS) mode. I/V spectroscopic measurements in the range +/-250 mV on both single- and double-stranded (ds) DNA monolayers (modified and unmodified) showed that for negative substrate bias (U(sub)) electron transfer is more efficient through a phenyl-modified monolayer than through normal or halogenated DNA. This effect was particularly clear below a threshold bias of -100 mV. For positive U(sub), unmodified ds DNA was found to conduct slightly better than the modified strands. This is presumably caused by greater order in the unmodified versus modified DNA monolayers. Modifications on the immobilized (thiolated) strand seem to improve electron transport through the DNA monolayer more than modifications on the complementary (not surface-bound) strand.

  6. Partial 16S rRNA primary structure of five Actinomyces species: phylogenetic implications and development of an Actinomyces israelii-specific oligonucleotide probe.

    PubMed

    Stackebrandt, E; Charfreitag, O

    1990-01-01

    The intra- and intergeneric relationships of the genus Actinomyces were determined by comparing long 16S rRNA sequences, generated by reverse transcriptase. All species formed a phylogenetically coherent cluster in which Actinomyces bovis, A. viscosus, A. naeslundii, A. odontolyticus and A. israelii constituted genetically well defined species. A. israelii DSM 43322 (serotype 2) was not closely related to three other strains of this species (serotype 1) and, as judged from phylogenetic distances, could be accommodated within A. naeslundii, or represent a new species. In contrast to previous findings, members of the genus Actinomyces appear to be related to Bifidobacterium bifidum. Sequence information was used to develop an oligonucleotide probe for the A. israelii serotype 1 strains, which did not react with the serotype 2 strain or with rRNA from strains of eight Actinomyces species.

  7. Versatile design and synthesis platform for visualizing genomes with Oligopaint FISH probes

    PubMed Central

    Beliveau, Brian J.; Joyce, Eric F.; Apostolopoulos, Nicholas; Yilmaz, Feyza; Fonseka, Chamith Y.; McCole, Ruth B.; Chang, Yiming; Li, Jin Billy; Senaratne, Tharanga Niroshini; Williams, Benjamin R.; Rouillard, Jean-Marie; Wu, Chao-ting

    2012-01-01

    A host of observations demonstrating the relationship between nuclear architecture and processes such as gene expression have led to a number of new technologies for interrogating chromosome positioning. Whereas some of these technologies reconstruct intermolecular interactions, others have enhanced our ability to visualize chromosomes in situ. Here, we describe an oligonucleotide- and PCR-based strategy for fluorescence in situ hybridization (FISH) and a bioinformatic platform that enables this technology to be extended to any organism whose genome has been sequenced. The oligonucleotide probes are renewable, highly efficient, and able to robustly label chromosomes in cell culture, fixed tissues, and metaphase spreads. Our method gives researchers precise control over the sequences they target and allows for single and multicolor imaging of regions ranging from tens of kilobases to megabases with the same basic protocol. We anticipate this technology will lead to an enhanced ability to visualize interphase and metaphase chromosomes. PMID:23236188

  8. Silver ions-mediated conformational switch: facile design of structure-controllable nucleic acid probes.

    PubMed

    Wang, Yongxiang; Li, Jishan; Wang, Hao; Jin, Jianyu; Liu, Jinhua; Wang, Kemin; Tan, Weihong; Yang, Ronghua

    2010-08-01

    Conformationally constraint nucleic acid probes were usually designed by forming an intramolecular duplex based on Watson-Crick hydrogen bonds. The disadvantages of these approaches are the inflexibility and instability in complex environment of the Watson-Crick-based duplex. We report that this hydrogen bonding pattern can be replaced by metal-ligation between specific metal ions and the natural bases. To demonstrate the feasibility of this principle, two linear oligonucleotides and silver ions were examined as models for DNA hybridization assay and adenosine triphosphate detection. The both nucleic acids contain target binding sequences in the middle and cytosine (C)-rich sequences at the lateral portions. The strong interaction between Ag(+) ions and cytosines forms stable C-Ag(+)-C structures, which promises the oligonucleotides to form conformationally constraint formations. In the presence of its target, interaction between the loop sequences and the target unfolds the C-Ag(+)-C structures, and the corresponding probes unfolding can be detected by a change in their fluorescence emission. We discuss the thermodynamic and kinetic opportunities that are provided by using Ag(+) ion complexes instead of traditional Watson-Crick-based duplex. In particular, the intrinsic feature of the metal-ligation motif facilitates the design of functional nucleic acids probes by independently varying the concentration of Ag(+) ions in the medium.

  9. Surface modification of poly(dimethylsiloxane) (PDMS) microchannels with DNA capture-probes for potential use in microfluidic DNA analysis systems

    NASA Astrophysics Data System (ADS)

    Khodakov, Dmitriy A.; Thredgold, Leigh D.; Lenehan, Claire E.; Andersson, Gunther A.; Kobus, Hilton; Ellis, Amanda V.

    2011-12-01

    Poly(dimethylsiloxane) (PDMS) is an elastomeric material used for microfluidic devices and is especially suited to medical and forensic applications. This is due to its relatively low cost, ease of fabrication, excellent optical transmission characteristics and its ability to support electroosmotic flow, required during electrophoretic separations. These aspects combined with its large range of surface modification chemistries, make PDMS an attractive substrate in microfluidic devices for, in particular, DNA separation. Here, we report the successful wet chemical surface modification of PDMS microchannels using a simple three step method to produce an isothiocyanate-terminated surface. Initially, PDMS was oxygen plasma treated to produce a silanol-terminated surface, this was then reacted with 3-aminopropyltriethoxysilane with subsequent reaction of the now amine-terminated surface with p-phenylenediisothiocyanate. Water contact angle measurements both before and after modification showed a reduction in hydrophobicity from 101o for native PDMS to 94o for the isothiocyante-terminated PDMS. The isothiocyanate-terminated surface was then coupled with an amineterminated single-stranded DNA (ssDNA) oligonucleotide capture probe via a thiourea linkage. Confirmation of capture probe attachment was observed using fluorescent microscopy after hybridization of the capture probes with fluorescently labeled complimentary ssDNA oligonucleotides.

  10. Functionalization of silicon oxide using supercritical fluid deposition of 3,4-epoxybutyltrimethoxysilane for the immobilization of amino-modified oligonucleotide

    NASA Astrophysics Data System (ADS)

    Rull, Jordi; Nonglaton, Guillaume; Costa, Guillaume; Fontelaye, Caroline; Marchi-Delapierre, Caroline; Ménage, Stéphane; Marchand, Gilles

    2015-11-01

    The functionalization of silicon oxide based substrates using silanes is generally performed through liquid phase methodologies. These processes involve a huge quantity of potentially toxic solvents and present some important disadvantages for the functionalization of microdevices or porous materials, for example the low diffusion. To overcome this drawback, solvent-free methodologies like molecular vapor deposition (MVD) or supercritical fluid deposition (SFD) have been developed. In this paper, the deposition process of 3,4-epoxybutyltrimethoxysilane (EBTMOS) on silicon oxide using supercritical carbon dioxide (scCO2) as a solvent is studied for the first time. The oxirane ring of epoxy silanes readily reacts with amine group and is of particular interest for the grafting of amino-modified oligonucleotides or antibodies for diagnostic application. Then the ability of this specific EBTMOS layer to react with amine functions has been evaluated using the immobilization of amino-modified oligonucleotide probes. The presence of the probes is revealed by fluorescence using hybridization with a fluorescent target oligonucleotide. The performances of SFD of EBTMOS have been optimized and then compared with the dip coating and molecular vapor deposition methods, evidencing a better grafting efficiency and homogeneity, a lower reaction time in addition to the eco-friendly properties of the supercritical carbon dioxide. The epoxysilane layers have been characterized by surface enhanced ellipsometric contrast optical technique, atomic force microscopy, multiple internal reflection infrared spectroscopy and X-ray photoelectron spectroscopy. The shelf life of the 3,4-epoxybutyltrimethoxysilane coating layer has also been studied. Finally, two different strategies of NH2-oligonucleotide grafting on EBTMOS coating layer have been compared, i.e. reductive amination and nucleophilic substitution, SN2. This EBTMOS based coating layer can be used for a wide range of applications such as the preparation of new supported and recoverable catalysts and new integrated silicon microdevices for healthcare purposes.

  11. Electroactive chitosan nanoparticles for the detection of single-nucleotide polymorphisms using peptide nucleic acids.

    PubMed

    Kerman, Kagan; Saito, Masato; Tamiya, Eiichi

    2008-08-01

    Here we report an electrochemical biosensor that would allow for simple and rapid analysis of nucleic acids in combination with nuclease activity on nucleic acids and electroactive bionanoparticles. The detection of single-nucleotide polymorphisms (SNPs) using PNA probes takes advantage of the significant structural and physicochemical differences between the full hybrids and SNPs in PNA/DNA and DNA/DNA duplexes. Ferrocene-conjugated chitosan nanoparticles (Chi-Fc) were used as the electroactive indicator of hybridization. Chi-Fc had no affinity towards the neutral PNA probe immobilized on a gold electrode (AuE) surface. When the PNA probe on the electrode surface hybridized with a full-complementary target DNA, Chi-Fc electrostatically attached to the negatively-charged phosphate backbone of DNA on the surface and gave rise to a high electrochemical oxidation signal from ferrocene at approximately 0.30 V. Exposing the surface to a single-stranded DNA specific nuclease, Nuclease S1, was found to be very effective for removing the nonspecifically adsorbed SNP DNA. An SNP in the target DNA to PNA made it susceptible to the enzymatic digestion. After the enzymatic digestion and subsequent exposure to Chi-Fc, the presence of SNPs was determined by monitoring the changes in the electrical current response of Chi-Fc. The method provided a detection limit of 1 fM (S/N = 3) for the target DNA oligonucleotide. Additionally, asymmetric PCR was employed to detect the presence of genetically modified organism (GMO) in standard Roundup Ready soybean samples. PNA-mediated PCR amplification of real DNA samples was performed to detect SNPs related to alcohol dehydrogenase (ALDH). Chitosan nanoparticles are promising biomaterials for various analytical and pharmaceutical applications.

  12. Oligonucleotide Array for Identification and Detection of Pythium Species†

    PubMed Central

    Tambong, J. T.; de Cock, A. W. A. M.; Tinker, N. A.; Lévesque, C. A.

    2006-01-01

    A DNA array containing 172 oligonucleotides complementary to specific diagnostic regions of internal transcribed spacers (ITS) of more than 100 species was developed for identification and detection of Pythium species. All of the species studied, with the exception of Pythium ostracodes, exhibited a positive hybridization reaction with at least one corresponding species-specific oligonucleotide. Hybridization patterns were distinct for each species. The array hybridization patterns included cluster-specific oligonucleotides that facilitated the recognition of species, including new ones, belonging to groups such as those producing filamentous or globose sporangia. BLAST analyses against 500 publicly available Pythium sequences in GenBank confirmed that species-specific oligonucleotides were unique to all of the available strains of each species, of which there were numerous economically important ones. GenBank entries of newly described species that are not putative synonyms showed no homology to sequences of the spotted species-specific oligonucleotides, but most new species did match some of the cluster-specific oligonucleotides. Further verification of the specificity of the DNA array was done with 50 additional Pythium isolates obtained by soil dilution plating. The hybridization patterns obtained were consistent with the identification of these isolates based on morphology and ITS sequence analyses. In another blind test, total DNA of the same soil samples was amplified and hybridized on the array, and the results were compared to those of 130 Pythium isolates obtained by soil dilution plating and root baiting. The 13 species detected by the DNA array corresponded to the isolates obtained by a combination of soil dilution plating and baiting, except for one new species that was not represented on the array. We conclude that the reported DNA array is a reliable tool for identification and detection of the majority of Pythium species in environmental samples. Simultaneous detection and identification of multiple species of soilborne pathogens such as Pythium species could be a major step forward for epidemiological and ecological studies. PMID:16597974

  13. Programmable oligonucleotide probes design and applications for in situ and in vivo RNA imaging in cells

    NASA Astrophysics Data System (ADS)

    Cheglakov, Zoya

    Unequal spreading of mRNA is a frequent experience observed in varied cell lines. The study of cellular processes dynamics and precise localization of mRNAs offers a vital toolbox to target specific proteins in precise cytoplasmic areas and provides a convenient instrument to uncover their mechanisms and functions. Latest methodological innovations have allowed imaging of a single mRNA molecule in situ and in vivo. Today, Fluorescent In Situ Hybridization (FISH) methods allow the studying of mRNA expression and offer a vital toolbox for accurate biological models. Studies enable analysis of the dynamics of an individual mRNA, have uncovered the multiplex RNA transport systems. With all current approaches, a single mRNA tracking in the mammalian cells is still challenging. This thesis describes mRNA detection methods based on programmable fluorophore-labeled DNA structures complimentary to native targets providing an accurate mRNA imaging in mammalian cells. First method represents beta-actin (ACTB) transcripts in situ detection in human cells, the technique strategy is based on programmable DNA probes, amplified by rolling circle amplification (RCA). The method reports precise localization of molecule of interest with an accuracy of a single-cell. Visualization and localization of specific endogenous mRNA molecules in real-time in vivo has the promising to innovate cellular biology studies, medical analysis and to provide a vital toolbox in drugs invention area. Second method described in this thesis represents miR-21 miRNA detection within a single live-cell resolution. The method using fluorophore-labeled short synthetic DNAs probes forming a stem-loop shape and generating Fluorescent Resonance Energy Transfer (FRET) as a result of target-probes hybridization. Catalytic nucleic acid (DNAzymes) probes are cooperative tool for precise detection of different mRNA targets. With assistance of a complementary fluorophore-quencher labeled substrate, the DNAzymes provide a beneficial strategy for simultaneous tracking readily accomplished by multicolor imaging with diverse fluorescent tags. The third method in this thesis will demonstrate the advantage of DNAzymes probes amplification, and offers potential strategy to monitor miRNAs in mammalian live cells.

  14. Detecting RNA/DNA hybridization using double-labeled donor probes with enhanced fluorescence resonance energy transfer signals.

    PubMed

    Okamura, Yukio; Watanabe, Yuichiro

    2006-01-01

    Fluorescence resonance energy transfer (FRET) occurs when two fluorophores are in close proximity, and the emission energy of a donor fluorophore is transferred to excite an acceptor fluorophore. Using such fluorescently labeled oligonucleotides as FRET probes, makes possible specific detection of RNA molecules even if similar sequences are present in the environment. A higher ratio of signal to background fluorescence is required for more sensitive probe detection. We found that double-labeled donor probes labeled with BODIPY dye resulted in a remarkable increase in fluorescence intensity compared to single-labeled donor probes used in conventional FRET. Application of this double-labeled donor system can improve a variety of FRET techniques.

  15. Boron nitride nanotubes for gene silencing.

    PubMed

    Şen, Özlem; Çobandede, Zehra; Emanet, Melis; Bayrak, Ömer Faruk; Çulha, Mustafa

    2017-09-01

    Non-viral gene delivery is increasingly investigated as an alternative to viral vectors due to low toxicity and immunogenicity, easy preparation, tissue specificity, and ability to transfer larger sizes of genes. In this study, boron nitride nanotubes (BNNTs) are functionalized with oligonucleotides (oligo-BNNTs). The morpholinos complementary to the oligonucleotides attached to the BNNTs (morpholino/oligo-BNNTs) are hybridized to silence the luciferase gene. The morpholino/oligo-BNNTs conjugates are administered to luciferase-expressing cells (MDA-MB-231-luc2) and the luciferase activity is monitored. The luciferase activity is decreased when MDA-MB-231-luc2 cells were treated with morpholino/oligo-BNNTs. The study suggests that BNNTs can be used as a potential vector to transfect cells. BNNTs are potential new nanocarriers for gene delivery applications. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. Biology of Symbioses between Marine Invertebrates and Intracellular Bacteria

    DTIC Science & Technology

    1990-01-30

    bisphosphate carboxylase We designed from published sequence information oligonucleotide primers which are complementary to conserved regions on RubisCO ...large and small subunit genes. These primers were used successfully to amplify using polymerase chain reaction (PCR) specific regions of RubisCO ...for the large subunit of ribulose bisphosphate carboxylase/oxygenase ( RubisCO ) to symbiont DNA shows that the symbionts from both deep-sea and shallow

  17. Structural properties of oligonucleotide monolayers on gold surfaces probed by fluorescence investigations.

    PubMed

    Rant, Ulrich; Arinaga, Kenji; Fujita, Shozo; Yokoyama, Naoki; Abstreiter, Gerhard; Tornow, Marc

    2004-11-09

    We present optical investigations on the conformation of oligonucleotide layers on Au surfaces. Our studies concentrate on the effect of varying surface coverage densities on the structural properties of layers of 12- and 24mer single-stranded DNA, tethered to the Au surface at one end while being labeled with a fluorescent marker at the opposing end. The distance-dependent energy transfer from the marker dye to the metal surface, which causes quenching of the observed fluorescence, is used to provide information on the orientation of the DNA strands relative to the surface. Variations in the oligonucleotide coverage density, as determined from electrochemical quantification, over 2 orders of magnitude are achieved by employing different preparation conditions. The observed enhancement in fluorescence intensity with increasing DNA coverage can be related to a model involving mutual steric interactions of oligonucleotides on the surface, as well as fluorescence quenching theory. Finally, the applicability of the presented concepts for investigations of heterogeneous monolayers is demonstrated by means of studying the coadsorption of mercaptohexanol onto DNA-modified Au surfaces.

  18. Characterization of Chromosomal Inversions Using Anti-Parallel Probes

    NASA Technical Reports Server (NTRS)

    Ray, F. Andrew (Inventor)

    2015-01-01

    A method for the characterization of chromosomal inversions using anti-parallel probes is described. Reporter species are attached to oligonucleotide strands designed such that they may hybridize to portions of only one of a pair of single-stranded sister chromatids which may be prepared by the CO-FISH procedure. If an inversion has occurred, these marker probes will be detected on the second sister chromatid at the same location as the inversion on the first chromatid. Further, one or more reporter species are replaced with anti-parallel probes that hybridize at known locations along the second sister chromatid such that the position and size of the inversion may be identified/estimated.

  19. Direct measurements of intermolecular forces by chemical force microscopy

    NASA Astrophysics Data System (ADS)

    Vezenov, Dmitri Vitalievich

    1999-12-01

    Detailed description of intermolecular forces is key to understanding a wide range of phenomena from molecular recognition to materials failure. The unique features of atomic force microscopy (AFM) to make point contact force measurements with ultra high sensitivity and to generate spatial maps of surface topography and forces have been extended to include measurements between well-defined organic molecular groups. Chemical modification of AFM probes with self-assembled monolayers (SAMs) was used to make them sensitive to specific molecular interactions. This novel chemical force microscopy (CFM) technique was used to probe forces between different molecular groups in a range of environments (vacuum, organic liquids and aqueous solutions); measure surface energetics on a nanometer scale; determine pK values of the surface acid and base groups; measure forces to stretch and unbind a short synthetic DNA duplex and map the spatial distribution of specific functional groups and their ionization state. Studies of adhesion forces demonstrated the important contribution of hydrogen bonding to interactions between simple organic functionalities. The chemical identity of the tip and substrate surfaces as well as the medium had a dramatic effect on adhesion between model monolayers. A direct correlation between surface free energy and adhesion forces was established. The adhesion between epoxy polymer and model mixed SAMs varied with the amount of hydrogen bonding component in the monolayers. A consistent interpretation of CFM measurements in polar solvents was provided by contact mechanics models and intermolecular force components theory. Forces between tips and surfaces functionalized with SAMs terminating in acid or base groups depended on their ionization state. A novel method of force titration was introduced for highly local characterization of the pK's of surface functional groups. The pH-dependent changes in friction forces were exploited to map spatially the changes in ionization state on SAM surfaces. The phase contrast in tapping mode AFM between chemically distinct monolayer regions and corresponding adhesion forces were found to be directly correlated. Thus, both friction and intermittent contact CFM images could be interpreted in terms of the strength of intermolecular interactions. CFM was also used to probe biomolecular interactions. Separation forces between complementary oligonucleotide strands were significantly larger than the forces measured between noncomplementary strands and were consistent with the unbinding of a single DNA duplex. CFM data provided a direct measure of the forces required to elastically deform, structurally-transform and separate well-defined, synthetic duplexes into single strand oligonucleotides.

  20. Visualization and Enumeration of Marine Planktonic Archaea and Bacteria by Using Polyribonucleotide Probes and Fluorescent In Situ Hybridization

    PubMed Central

    DeLong, Edward F.; Taylor, Lance Trent; Marsh, Terence L.; Preston, Christina M.

    1999-01-01

    Fluorescent in situ hybridization (FISH) using rRNA-specific oligonucleotide probes has emerged as a popular technique for identifying individual microbial cells. In natural samples, however, the signal derived from fluor-labeled oligonucleotide probes often is undetectable above background fluorescence in many cells. To circumvent this difficulty, we applied fluorochrome-labeled polyribonucleotide probes to identify and enumerate marine planktonic archaea and bacteria. The approach greatly enhanced the sensitivity and applicability of FISH with seawater samples, allowing confident identification and enumeration of planktonic cells to ocean depths of 3,400 m. Quantitative whole-cell hybridization experiments using these probes accounted for 90 to 100% of the total 4′,6-diamidino-2-phenylindole (DAPI)-stained cells in most samples. As predicted in a previous study (R. Massana, A. E. Murray, C. M. Preston, and E. F. DeLong, Appl. Environ. Microbiol. 63:50–56, 1997), group I and II marine archaea predominate in different zones in the water column, with maximal cell densities of 105/ml. The high cell densities of archaea, extending from surface waters to abyssal depths, suggest that they represent a large and significant fraction of the total picoplankton biomass in coastal ocean waters. The data also show that the vast majority of planktonic prokaryotes contain significant numbers of ribosomes, rendering them easily detectable with polyribonucleotide probes. These results imply that the majority of planktonic cells visualized by DAPI do not represent lysed cells or “ghosts,” as was suggested in a previous report. PMID:10584017

  1. High Boron-loaded DNA-Oligomers as Potential Boron Neutron Capture Therapy and Antisense Oligonucleotide Dual-Action Anticancer Agents.

    PubMed

    Kaniowski, Damian; Ebenryter-Olbińska, Katarzyna; Sobczak, Milena; Wojtczak, Błażej; Janczak, Sławomir; Leśnikowski, Zbigniew J; Nawrot, Barbara

    2017-08-23

    Boron cluster-modified therapeutic nucleic acids with improved properties are of interest in gene therapy and in cancer boron neutron capture therapy (BNCT). High metallacarborane-loaded antisense oligonucleotides (ASOs) targeting epidermal growth factor receptor (EGFR) were synthesized through post-synthetic Cu (I)-assisted "click" conjugation of alkyne-modified DNA-oligonucleotides with a boron cluster alkyl azide component. The obtained oligomers exhibited increased lipophilicity compared to their non-modified precursors, while their binding affinity to complementary DNA and RNA strands was slightly decreased. Multiple metallacarborane residues present in the oligonucleotide chain, each containing 18 B-H groups, enabled the use of IR spectroscopy as a convenient analytical method for these oligomers based on the diagnostic B-H signal at 2400-2650 cm -1 . The silencing activity of boron cluster-modified ASOs used at higher concentrations was similar to that of unmodified oligonucleotides. The screened ASOs, when used in low concentrations (up to 50 μM), exhibited pro-oxidative properties by inducing ROS production and an increase in mitochondrial activities in HeLa cells. In contrast, when used at higher concentrations, the ASOs exhibited anti-oxidative properties by lowering ROS species levels. In the HeLa cells (tested in the MTT assay) treated (without lipofectamine) or transfected with the screened compounds, the mitochondrial activity remained equal to the control level or only slightly changed (±30%). These findings may be useful in the design of dual-action boron cluster-modified therapeutic nucleic acids with combined antisense and anti-oxidant properties.

  2. Evolution of the MIDTAL microarray: the adaption and testing of oligonucleotide 18S and 28S rDNA probes and evaluation of subsequent microarray generations with Prymnesium spp. cultures and field samples.

    PubMed

    McCoy, Gary R; Touzet, Nicolas; Fleming, Gerard T A; Raine, Robin

    2015-07-01

    The toxic microalgal species Prymnesium parvum and Prymnesium polylepis are responsible for numerous fish kills causing economic stress on the aquaculture industry and, through the consumption of contaminated shellfish, can potentially impact on human health. Monitoring of toxic phytoplankton is traditionally carried out by light microscopy. However, molecular methods of identification and quantification are becoming more common place. This study documents the optimisation of the novel Microarrays for the Detection of Toxic Algae (MIDTAL) microarray from its initial stages to the final commercial version now available from Microbia Environnement (France). Existing oligonucleotide probes used in whole-cell fluorescent in situ hybridisation (FISH) for Prymnesium species from higher group probes to species-level probes were adapted and tested on the first-generation microarray. The combination and interaction of numerous other probes specific for a whole range of phytoplankton taxa also spotted on the chip surface caused high cross reactivity, resulting in false-positive results on the microarray. The probe sequences were extended for the subsequent second-generation microarray, and further adaptations of the hybridisation protocol and incubation temperatures significantly reduced false-positive readings from the first to the second-generation chip, thereby increasing the specificity of the MIDTAL microarray. Additional refinement of the subsequent third-generation microarray protocols with the addition of a poly-T amino linker to the 5' end of each probe further enhanced the microarray performance but also highlighted the importance of optimising RNA labelling efficiency when testing with natural seawater samples from Killary Harbour, Ireland.

  3. DNA hybridization detection on electrical microarrays using coulostatic pulse technique.

    PubMed

    Dharuman, V; Nebling, E; Grunwald, T; Albers, J; Blohm, L; Elsholz, B; Wörl, R; Hintsche, R

    2006-12-15

    We demonstrated a novel application of transient coulostatic pulse technique for the detection of label free DNA hybridization on nm-sized gold interdigitated ultramicroelectrode arrays (Au-IDA) made in silicon technology. The array consists of eight different positions with an Au-IDA pair at each position arranged on the Si-based Biochip. Immobilization of capture probes onto the Au-IDA was accomplished by self-assembling of thiol-modified oligonucleotides. Target hybridization was indicated by a change in the magnitude of the time dependant potential relaxation curve in presence of electroactive Fe(CN)(6)(3-) in the phosphate buffer solution. While complementary DNA hybridization showed 50% increase in the relaxation potential, the non-complementary DNA showed a negligible change. A constant behaviour was noted for all positions. The dsDNA specific intercalating molecule, methylene blue, was found to be enhancing the discrimination effect. The changes in the relaxation potential curves were further corroborated following the ELISA like experiments using ExtraAvidine alkaline phosphatase labelling and redox recycling of para-aminophenol phosphate at IDAs. The coulostatic pulse technique was shown to be useful for identifying DNA sequences from brain tumour gene CK20, human herpes simplex virus, cytomegalovirus, Epstein-Barr virus and M13 phage. Compared to the hybridization of short chain ONTs (27 mers), the hybridization of long chain M13 phage DNA showed three times higher increase in the relaxation curves. The method is fast enough to monitor hybridization interactions in milli or microsecond time scales and is well suitable for miniaturization and integration compared to the common impedance techniques for developing capacitative DNA sensors.

  4. 4-amino-1H-benzo[g]quinazoline-2-one: a fluorescent analog of cytosine to probe protonation sites in triplex forming oligonucleotides.

    PubMed

    Godde, F; Toulmé, J J; Moreau, S

    2000-08-01

    We developed a new fluorescent analog of cytosine, the 4-amino-1H-benzo[g]quinazoline-2-one, which constitute a probe sensitive to pH. The 2'-O-Me ribonucleoside derivative of this heterocycle was synthesized and exhibited a fluorescence emission centered at 456 nm, characterized by four major excitation maxima (250, 300, 320 and 370 nm) and a fluorescence quantum yield of Phi = 0.62 at pH 7.1. The fluorescence emission maximum shifted from 456 to 492 nm when pH was decreased from 7.1 to 2.1. The pK(a) (4) was close to that of cytosine (4.17). When introduced in triplex forming oligonucleotides this new nucleoside can be used to reveal the protonation state of triplets in triple-stranded structures. Complex formation was detected by a significant quenching of fluorescence emission (approximately 88%) and the N-3 protonation of the quinazoline ring by a shift of the emission maximum from 485 to 465 nm. Using this probe we unambiguously showed that triplex formation of the pyrimidine motif does not require the protonation of all 4-amino-2-one pyrimidine rings.

  5. Composition for nucleic acid sequencing

    DOEpatents

    Korlach, Jonas [Ithaca, NY; Webb, Watt W [Ithaca, NY; Levene, Michael [Ithaca, NY; Turner, Stephen [Ithaca, NY; Craighead, Harold G [Ithaca, NY; Foquet, Mathieu [Ithaca, NY

    2008-08-26

    The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

  6. Method for sequencing nucleic acid molecules

    DOEpatents

    Korlach, Jonas; Webb, Watt W.; Levene, Michael; Turner, Stephen; Craighead, Harold G.; Foquet, Mathieu

    2006-06-06

    The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

  7. Method for sequencing nucleic acid molecules

    DOEpatents

    Korlach, Jonas; Webb, Watt W.; Levene, Michael; Turner, Stephen; Craighead, Harold G.; Foquet, Mathieu

    2006-05-30

    The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

  8. Nearest-neighbor thermodynamics of deoxyinosine pairs in DNA duplexes

    PubMed Central

    Watkins, Norman E.; SantaLucia, John

    2005-01-01

    Nearest-neighbor thermodynamic parameters of the ‘universal pairing base’ deoxyinosine were determined for the pairs I·C, I·A, I·T, I·G and I·I adjacent to G·C and A·T pairs. Ultraviolet absorbance melting curves were measured and non-linear regression performed on 84 oligonucleotide duplexes with 9 or 12 bp lengths. These data were combined with data for 13 inosine containing duplexes from the literature. Multiple linear regression was used to solve for the 32 nearest-neighbor unknowns. The parameters predict the Tm for all sequences within 1.2°C on average. The general trend in decreasing stability is I·C > I·A > I·T ≈ I· G > I·I. The stability trend for the base pair 5′ of the I·X pair is G·C > C·G > A·T > T·A. The stability trend for the base pair 3′ of I·X is the same. These trends indicate a complex interplay between H-bonding, nearest-neighbor stacking, and mismatch geometry. A survey of 14 tandem inosine pairs and 8 tandem self-complementary inosine pairs is also provided. These results may be used in the design of degenerate PCR primers and for degenerate microarray probes. PMID:16264087

  9. A high-throughput assay for the comprehensive profiling of DNA ligase fidelity

    PubMed Central

    Lohman, Gregory J. S.; Bauer, Robert J.; Nichols, Nicole M.; Mazzola, Laurie; Bybee, Joanna; Rivizzigno, Danielle; Cantin, Elizabeth; Evans, Thomas C.

    2016-01-01

    DNA ligases have broad application in molecular biology, from traditional cloning methods to modern synthetic biology and molecular diagnostics protocols. Ligation-based detection of polynucleotide sequences can be achieved by the ligation of probe oligonucleotides when annealed to a complementary target sequence. In order to achieve a high sensitivity and low background, the ligase must efficiently join correctly base-paired substrates, while discriminating against the ligation of substrates containing even one mismatched base pair. In the current study, we report the use of capillary electrophoresis to rapidly generate mismatch fidelity profiles that interrogate all 256 possible base-pair combinations at a ligation junction in a single experiment. Rapid screening of ligase fidelity in a 96-well plate format has allowed the study of ligase fidelity in unprecedented depth. As an example of this new method, herein we report the ligation fidelity of Thermus thermophilus DNA ligase at a range of temperatures, buffer pH and monovalent cation strength. This screen allows the selection of reaction conditions that maximize fidelity without sacrificing activity, while generating a profile of specific mismatches that ligate detectably under each set of conditions. PMID:26365241

  10. A high-throughput assay for the comprehensive profiling of DNA ligase fidelity.

    PubMed

    Lohman, Gregory J S; Bauer, Robert J; Nichols, Nicole M; Mazzola, Laurie; Bybee, Joanna; Rivizzigno, Danielle; Cantin, Elizabeth; Evans, Thomas C

    2016-01-29

    DNA ligases have broad application in molecular biology, from traditional cloning methods to modern synthetic biology and molecular diagnostics protocols. Ligation-based detection of polynucleotide sequences can be achieved by the ligation of probe oligonucleotides when annealed to a complementary target sequence. In order to achieve a high sensitivity and low background, the ligase must efficiently join correctly base-paired substrates, while discriminating against the ligation of substrates containing even one mismatched base pair. In the current study, we report the use of capillary electrophoresis to rapidly generate mismatch fidelity profiles that interrogate all 256 possible base-pair combinations at a ligation junction in a single experiment. Rapid screening of ligase fidelity in a 96-well plate format has allowed the study of ligase fidelity in unprecedented depth. As an example of this new method, herein we report the ligation fidelity of Thermus thermophilus DNA ligase at a range of temperatures, buffer pH and monovalent cation strength. This screen allows the selection of reaction conditions that maximize fidelity without sacrificing activity, while generating a profile of specific mismatches that ligate detectably under each set of conditions. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  11. Oligonucleotide PIK3CA/Chromosome 3 Dual in Situ Hybridization Automated Assay with Improved Signals, One-Hour Hybridization, and No Use of Blocking DNA.

    PubMed

    Zhang, Wenjun; Hubbard, Antony; Baca-Parkinson, Leslie; Stanislaw, Stacey; Vladich, Frank; Robida, Mark D; Grille, James G; Maxwell, Daniel; Tsao, Tsu-Shuen; Carroll, William; Gardner, Tracie; Clements, June; Singh, Shalini; Tang, Lei

    2015-09-01

    The PIK3CA gene at chromosome 3q26.32 was found to be amplified in up to 45% of patients with squamous cell carcinoma of the lung. The strong correlation between PIK3CA amplification and increased phosphatidylinositol 3-kinase (PI3K) pathway activities suggested that PIK3CA gene copy number is a potential predictive biomarker for PI3K inhibitors. Currently, all microscopic assessments of PIK3CA and chromosome 3 (CHR3) copy numbers use fluorescence in situ hybridization. PIK3CA probes are derived from bacterial artificial chromosomes whereas CHR3 probes are derived mainly from the plasmid pHS05. These manual fluorescence in situ hybridization assays mandate 12- to 18-hour hybridization and use of blocking DNA from human sources. Moreover, fluorescence in situ hybridization studies provide limited morphologic assessment and suffer from signal decay. We developed an oligonucleotide-based bright-field in situ hybridization assay that overcomes these shortcomings. This assay requires only a 1-hour hybridization with no need for blocking DNA followed by indirect chromogenic detection. Oligonucleotide probes produced discrete and uniform CHR3 stains superior to those from the pHS05 plasmid. This assay achieved successful staining in 100% of the 195 lung squamous cell carcinoma resections and in 94% of the 33 fine-needle aspirates. This robust automated bright-field dual in situ hybridization assay for the simultaneous detection of PIK3CA and CHR3 centromere provides a potential clinical diagnostic method to assess PIK3CA gene abnormality in lung tumors. Copyright © 2015 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

  12. Experimental analysis of oligonucleotide microarray design criteria to detect deletions by comparative genomic hybridization.

    PubMed

    Flibotte, Stephane; Moerman, Donald G

    2008-10-21

    Microarray comparative genomic hybridization (CGH) is currently one of the most powerful techniques to measure DNA copy number in large genomes. In humans, microarray CGH is widely used to assess copy number variants in healthy individuals and copy number aberrations associated with various diseases, syndromes and disease susceptibility. In model organisms such as Caenorhabditis elegans (C. elegans) the technique has been applied to detect mutations, primarily deletions, in strains of interest. Although various constraints on oligonucleotide properties have been suggested to minimize non-specific hybridization and improve the data quality, there have been few experimental validations for CGH experiments. For genomic regions where strict design filters would limit the coverage it would also be useful to quantify the expected loss in data quality associated with relaxed design criteria. We have quantified the effects of filtering various oligonucleotide properties by measuring the resolving power for detecting deletions in the human and C. elegans genomes using NimbleGen microarrays. Approximately twice as many oligonucleotides are typically required to be affected by a deletion in human DNA samples in order to achieve the same statistical confidence as one would observe for a deletion in C. elegans. Surprisingly, the ability to detect deletions strongly depends on the oligonucleotide 15-mer count, which is defined as the sum of the genomic frequency of all the constituent 15-mers within the oligonucleotide. A similarity level above 80% to non-target sequences over the length of the probe produces significant cross-hybridization. We recommend the use of a fairly large melting temperature window of up to 10 degrees C, the elimination of repeat sequences, the elimination of homopolymers longer than 5 nucleotides, and a threshold of -1 kcal/mol on the oligonucleotide self-folding energy. We observed very little difference in data quality when varying the oligonucleotide length between 50 and 70, and even when using an isothermal design strategy. We have determined experimentally the effects of varying several key oligonucleotide microarray design criteria for detection of deletions in C. elegans and humans with NimbleGen's CGH technology. Our oligonucleotide design recommendations should be applicable for CGH analysis in most species.

  13. Identification of transcribed sequences in Arabidopsis thaliana by using high-resolution genome tiling arrays

    PubMed Central

    Stolc, Viktor; Samanta, Manoj Pratim; Tongprasit, Waraporn; Sethi, Himanshu; Liang, Shoudan; Nelson, David C.; Hegeman, Adrian; Nelson, Clark; Rancour, David; Bednarek, Sebastian; Ulrich, Eldon L.; Zhao, Qin; Wrobel, Russell L.; Newman, Craig S.; Fox, Brian G.; Phillips, George N.; Markley, John L.; Sussman, Michael R.

    2005-01-01

    Using a maskless photolithography method, we produced DNA oligonucleotide microarrays with probe sequences tiled throughout the genome of the plant Arabidopsis thaliana. RNA expression was determined for the complete nuclear, mitochondrial, and chloroplast genomes by tiling 5 million 36-mer probes. These probes were hybridized to labeled mRNA isolated from liquid grown T87 cells, an undifferentiated Arabidopsis cell culture line. Transcripts were detected from at least 60% of the nearly 26,330 annotated genes, which included 151 predicted genes that were not identified previously by a similar genome-wide hybridization study on four different cell lines. In comparison with previously published results with 25-mer tiling arrays produced by chromium masking-based photolithography technique, 36-mer oligonucleotide probes were found to be more useful in identifying intron–exon boundaries. Using two-dimensional HPLC tandem mass spectrometry, a small-scale proteomic analysis was performed with the same cells. A large amount of strongly hybridizing RNA was found in regions “antisense” to known genes. Similarity of antisense activities between the 25-mer and 36-mer data sets suggests that it is a reproducible and inherent property of the experiments. Transcription activities were also detected for many of the intergenic regions and the small RNAs, including tRNA, small nuclear RNA, small nucleolar RNA, and microRNA. Expression of tRNAs correlates with genome-wide amino acid usage. PMID:15755812

  14. Multiplexed interfacial transduction of nucleic acid hybridization using a single color of immobilized quantum dot donor and two acceptors in fluorescence resonance energy transfer.

    PubMed

    Algar, W Russ; Krull, Ulrich J

    2010-01-01

    A multiplexed solid-phase assay for the detection of nucleic acid hybridization was developed on the basis of a single color of immobilized CdSe/ZnS quantum dot (QD) as a donor in fluorescence resonance energy transfer (FRET). This work demonstrated that two channels of detection did not necessitate two different QD donors. Two probe oligonucleotides were coimmobilized on optical fibers modified with QDs, and a sandwich assay was used to associate the acceptor dyes with interfacial hybridization events without target labeling. FRET-sensitized acceptor emission provided an analytical signal that was concentration dependent down to 10 nM. Changes in the ratio of coimmobilized probe oligonucleotides were found to yield linear changes in the relative amounts of acceptor emission. These changes were compared to previous studies that used mixed films of two QD donors for two detection channels. The analysis indicated that probe dilution effects were primarily driven by changes in acceptor number density and that QD dilution effects or changes in mean donor-acceptor distance were secondary. Hybridization kinetics were found to be consistent between different ratios of coimmobilized probes, suggesting that hybridization in this type of system occurred via the accepted model for solid-phase hybridization, where adsorption and then diffusion at the solid interface drove hybridization.

  15. Fiber-optic microarray for simultaneous detection of multiple harmful algal bloom species.

    PubMed

    Ahn, Soohyoun; Kulis, David M; Erdner, Deana L; Anderson, Donald M; Walt, David R

    2006-09-01

    Harmful algal blooms (HABs) are a serious threat to coastal resources, causing a variety of impacts on public health, regional economies, and ecosystems. Plankton analysis is a valuable component of many HAB monitoring and research programs, but the diversity of plankton poses a problem in discriminating toxic from nontoxic species using conventional detection methods. Here we describe a sensitive and specific sandwich hybridization assay that combines fiber-optic microarrays with oligonucleotide probes to detect and enumerate the HAB species Alexandrium fundyense, Alexandrium ostenfeldii, and Pseudo-nitzschia australis. Microarrays were prepared by loading oligonucleotide probe-coupled microspheres (diameter, 3 mum) onto the distal ends of chemically etched imaging fiber bundles. Hybridization of target rRNA from HAB cells to immobilized probes on the microspheres was visualized using Cy3-labeled secondary probes in a sandwich-type assay format. We applied these microarrays to the detection and enumeration of HAB cells in both cultured and field samples. Our study demonstrated a detection limit of approximately 5 cells for all three target organisms within 45 min, without a separate amplification step, in both sample types. We also developed a multiplexed microarray to detect the three HAB species simultaneously, which successfully detected the target organisms, alone and in combination, without cross-reactivity. Our study suggests that fiber-optic microarrays can be used for rapid and sensitive detection and potential enumeration of HAB species in the environment.

  16. Identification of transcribed sequences in Arabidopsis thaliana by using high-resolution genome tiling arrays

    NASA Technical Reports Server (NTRS)

    Stolc, Viktor; Samanta, Manoj Pratim; Tongprasit, Waraporn; Sethi, Himanshu; Liang, Shoudan; Nelson, David C.; Hegeman, Adrian; Nelson, Clark; Rancour, David; Bednarek, Sebastian; hide

    2005-01-01

    Using a maskless photolithography method, we produced DNA oligonucleotide microarrays with probe sequences tiled throughout the genome of the plant Arabidopsis thaliana. RNA expression was determined for the complete nuclear, mitochondrial, and chloroplast genomes by tiling 5 million 36-mer probes. These probes were hybridized to labeled mRNA isolated from liquid grown T87 cells, an undifferentiated Arabidopsis cell culture line. Transcripts were detected from at least 60% of the nearly 26,330 annotated genes, which included 151 predicted genes that were not identified previously by a similar genome-wide hybridization study on four different cell lines. In comparison with previously published results with 25-mer tiling arrays produced by chromium masking-based photolithography technique, 36-mer oligonucleotide probes were found to be more useful in identifying intron-exon boundaries. Using two-dimensional HPLC tandem mass spectrometry, a small-scale proteomic analysis was performed with the same cells. A large amount of strongly hybridizing RNA was found in regions "antisense" to known genes. Similarity of antisense activities between the 25-mer and 36-mer data sets suggests that it is a reproducible and inherent property of the experiments. Transcription activities were also detected for many of the intergenic regions and the small RNAs, including tRNA, small nuclear RNA, small nucleolar RNA, and microRNA. Expression of tRNAs correlates with genome-wide amino acid usage.

  17. Folding- and Dynamics-Based Electrochemical DNA Sensors.

    PubMed

    Lai, Rebecca Y

    2017-01-01

    A number of electrochemical DNA sensors based on the target-induced change in the conformation and/or flexibility of surface-bound oligonucleotides have been developed in recent years. These sensors, which are often termed E-DNA sensors, are comprised of an oligonucleotide probe modified with a redox label (e.g., methylene blue) at one terminus and attached to a gold electrode via a thiol-gold bond at the other. Binding of the target to the DNA probe changes its structure and dynamics, which, in turn, influences the efficiency of electron transfer to the interrogating electrode. Since electrochemically active contaminants are less common, these sensors are resistant to false-positive signals arising from the nonspecific adsorption of contaminants and perform well even when employed directly in serum, whole blood, and other realistically complex sample matrices. Moreover, because all of the sensor components are chemisorbed to the electrode, the E-DNA sensors are essentially label-free and readily reusable. To date, these sensors have achieved state-of-the-art sensitivity, while offering the unprecedented selectivity, reusability, and the operational convenience of direct electrochemical detection. This chapter reviews the recent advances in the development of both "signal-off" and "signal-on" E-DNA sensors. Critical aspects that dictate the stability and performance of these sensors are also addressed so as to provide a realistic overview of this oligonucleotide detection platform. © 2017 Elsevier Inc. All rights reserved.

  18. Development of a high-throughput microfluidic integrated microarray for the detection of chimeric bioweapons.

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sheppod, Timothy; Satterfield, Brent; Hukari, Kyle W.

    2006-10-01

    The advancement of DNA cloning has significantly augmented the potential threat of a focused bioweapon assault, such as a terrorist attack. With current DNA cloning techniques, toxin genes from the most dangerous (but environmentally labile) bacterial or viral organism can now be selected and inserted into robust organism to produce an infinite number of deadly chimeric bioweapons. In order to neutralize such a threat, accurate detection of the expressed toxin genes, rather than classification on strain or genealogical decent of these organisms, is critical. The development of a high-throughput microarray approach will enable the detection of unknowns chimeric bioweapons. Themore » development of a high-throughput microarray approach will enable the detection of unknown bioweapons. We have developed a unique microfluidic approach to capture and concentrate these threat genes (mRNA's) upto a 30 fold concentration. These captured oligonucleotides can then be used to synthesize in situ oligonucleotide copies (cDNA probes) of the captured genes. An integrated microfluidic architecture will enable us to control flows of reagents, perform clean-up steps and finally elute nanoliter volumes of synthesized oligonucleotides probes. The integrated approach has enabled a process where chimeric or conventional bioweapons can rapidly be identified based on their toxic function, rather than being restricted to information that may not identify the critical nature of the threat.« less

  19. APPLICATION OF FISH AND MICROAUTORADIOGRAPHY TO DETERMINE MICROBIAL COMMUNITY STRUCTURE AND ACTIVITY IN SOIL

    EPA Science Inventory

    Fluorescence in situ hybridization (FISH) with rRNA-targeted oligonucleotide probes is a well established technique for identifying populations of microorganisms at various taxonomic levels in natural and engineered systems. The strength of this technique over alternative nuclei...

  20. Development of a Flow Cytometry-Based Method for Rapid Detection of Escherichia coli and Shigella Spp. Using an Oligonucleotide Probe

    PubMed Central

    Xue, Yong; Wilkes, Jon G.; Moskal, Ted J.; Williams, Anna J.; Cooper, Willie M.; Nayak, Rajesh; Rafii, Fatemeh; Buzatu, Dan A.

    2016-01-01

    Standard methods to detect Escherichia coli contamination in food use the polymerase chain reaction (PCR) and agar culture plates. These methods require multiple incubation steps and take a long time to results. An improved rapid flow-cytometry based detection method was developed, using a fluorescence-labeled oligonucleotide probe specifically binding a16S rRNA sequence. The method positively detected 51 E. coli isolates as well as 4 Shigella species. All 27 non-E. coli strains tested gave negative results. Comparison of the new genetic assay with a total plate count (TPC) assay and agar plate counting indicated similar sensitivity, agreement between cytometry cell and colony counts. This method can detect a small number of E.coli cells in the presence of large numbers of other bacteria. This method can be used for rapid, economical, and stable detection of E. coli and Shigella contamination in the food industry and other contexts. PMID:26913737

  1. Droplet Digital Enzyme-Linked Oligonucleotide Hybridization Assay for Absolute RNA Quantification.

    PubMed

    Guan, Weihua; Chen, Liben; Rane, Tushar D; Wang, Tza-Huei

    2015-09-03

    We present a continuous-flow droplet-based digital Enzyme-Linked Oligonucleotide Hybridization Assay (droplet digital ELOHA) for sensitive detection and absolute quantification of RNA molecules. Droplet digital ELOHA incorporates direct hybridization and single enzyme reaction via the formation of single probe-RNA-probe (enzyme) complex on magnetic beads. It enables RNA detection without reverse transcription and PCR amplification processes. The magnetic beads are subsequently encapsulated into a large number of picoliter-sized droplets with enzyme substrates in a continuous-flow device. This device is capable of generating droplets at high-throughput. It also integrates in-line enzymatic incubation and detection of fluorescent products. Our droplet digital ELOHA is able to accurately quantify (differentiate 40% difference) as few as ~600 RNA molecules in a 1 mL sample (equivalent to 1 aM or lower) without molecular replication. The absolute quantification ability of droplet digital ELOHA is demonstrated with the analysis of clinical Neisseria gonorrhoeae 16S rRNA to show its potential value in real complex samples.

  2. Droplet Digital Enzyme-Linked Oligonucleotide Hybridization Assay for Absolute RNA Quantification

    PubMed Central

    Guan, Weihua; Chen, Liben; Rane, Tushar D.; Wang, Tza-Huei

    2015-01-01

    We present a continuous-flow droplet-based digital Enzyme-Linked Oligonucleotide Hybridization Assay (droplet digital ELOHA) for sensitive detection and absolute quantification of RNA molecules. Droplet digital ELOHA incorporates direct hybridization and single enzyme reaction via the formation of single probe-RNA-probe (enzyme) complex on magnetic beads. It enables RNA detection without reverse transcription and PCR amplification processes. The magnetic beads are subsequently encapsulated into a large number of picoliter-sized droplets with enzyme substrates in a continuous-flow device. This device is capable of generating droplets at high-throughput. It also integrates in-line enzymatic incubation and detection of fluorescent products. Our droplet digital ELOHA is able to accurately quantify (differentiate 40% difference) as few as ~600 RNA molecules in a 1 mL sample (equivalent to 1 aM or lower) without molecular replication. The absolute quantification ability of droplet digital ELOHA is demonstrated with the analysis of clinical Neisseria gonorrhoeae 16S rRNA to show its potential value in real complex samples. PMID:26333806

  3. Development of a Flow Cytometry-Based Method for Rapid Detection of Escherichia coli and Shigella Spp. Using an Oligonucleotide Probe.

    PubMed

    Xue, Yong; Wilkes, Jon G; Moskal, Ted J; Williams, Anna J; Cooper, Willie M; Nayak, Rajesh; Rafii, Fatemeh; Buzatu, Dan A

    2016-01-01

    Standard methods to detect Escherichia coli contamination in food use the polymerase chain reaction (PCR) and agar culture plates. These methods require multiple incubation steps and take a long time to results. An improved rapid flow-cytometry based detection method was developed, using a fluorescence-labeled oligonucleotide probe specifically binding a16S rRNA sequence. The method positively detected 51 E. coli isolates as well as 4 Shigella species. All 27 non-E. coli strains tested gave negative results. Comparison of the new genetic assay with a total plate count (TPC) assay and agar plate counting indicated similar sensitivity, agreement between cytometry cell and colony counts. This method can detect a small number of E.coli cells in the presence of large numbers of other bacteria. This method can be used for rapid, economical, and stable detection of E. coli and Shigella contamination in the food industry and other contexts.

  4. Droplet Digital Enzyme-Linked Oligonucleotide Hybridization Assay for Absolute RNA Quantification

    NASA Astrophysics Data System (ADS)

    Guan, Weihua; Chen, Liben; Rane, Tushar D.; Wang, Tza-Huei

    2015-09-01

    We present a continuous-flow droplet-based digital Enzyme-Linked Oligonucleotide Hybridization Assay (droplet digital ELOHA) for sensitive detection and absolute quantification of RNA molecules. Droplet digital ELOHA incorporates direct hybridization and single enzyme reaction via the formation of single probe-RNA-probe (enzyme) complex on magnetic beads. It enables RNA detection without reverse transcription and PCR amplification processes. The magnetic beads are subsequently encapsulated into a large number of picoliter-sized droplets with enzyme substrates in a continuous-flow device. This device is capable of generating droplets at high-throughput. It also integrates in-line enzymatic incubation and detection of fluorescent products. Our droplet digital ELOHA is able to accurately quantify (differentiate 40% difference) as few as ~600 RNA molecules in a 1 mL sample (equivalent to 1 aM or lower) without molecular replication. The absolute quantification ability of droplet digital ELOHA is demonstrated with the analysis of clinical Neisseria gonorrhoeae 16S rRNA to show its potential value in real complex samples.

  5. Pretargeted Molecular Imaging and Radioimmunotherapy

    PubMed Central

    Goldenberg, David M.; Chang, Chien-Hsing; Rossi, Edmund A.; J, William; McBride; Sharkey, Robert M.

    2012-01-01

    Pretargeting is a multi-step process that first has an unlabeled bispecific antibody (bsMAb) localize within a tumor by virtue of its anti-tumor binding site(s) before administering a small, fast-clearing radiolabeled compound that then attaches to the other portion of the bsMAb. The compound's rapid clearance significantly reduces radiation exposure outside of the tumor and its small size permits speedy delivery to the tumor, creating excellent tumor/nontumor ratios in less than 1 hour. Haptens that bind to an anti-hapten antibody, biotin that binds to streptavidin, or an oligonucleotide binding to a complementary oligonucleotide sequence have all been radiolabeled for use by pretargeting. This review will focus on a highly flexible anti-hapten bsMAb platform that has been used to target a variety of radionuclides to image (SPECT and PET) as well as treat tumors. PMID:22737190

  6. Sequence selective capture, release and analysis of DNA using a magnetic microbead-assisted toehold-mediated DNA strand displacement reaction.

    PubMed

    Khodakov, Dmitriy A; Khodakova, Anastasia S; Linacre, Adrian; Ellis, Amanda V

    2014-07-21

    This paper reports on the modification of magnetic beads with oligonucleotide capture probes with a specially designed pendant toehold (overhang) aimed specifically to capture double-stranded PCR products. After capture, the PCR products were selectively released from the magnetic beads by means of a toehold-mediated strand displacement reaction using short artificial oligonucleotide triggers and analysed using capillary electrophoresis. The approach was successfully shown on two genes widely used in human DNA genotyping, namely human c-fms (macrophage colony-stimulating factor) proto-oncogene for the CSF-1 receptor (CSF1PO) and amelogenin.

  7. [Individual identification of cadaver parts after a bomb explosion using oligonucleotide fingerprinting by (GTG)5].

    PubMed

    Kondo, T; Ohshima, T

    1998-01-01

    A blind shell suddenly and unexpectedly exploded, and 20 dismembered human remains were discovered. DNA fingerprint was performed to determine whether the 20 human remains were derived from one person or not. DNA was isolated from each of the remains and digested by the restriction enzyme Hinf I and Hae III and hybridized with the oligonucleotide probe (GTG)5. DNA fingerprint using Hinf I demonstrated the same band pattern in 17 out of the 20 remains. However, in the remaining 3 samples, two novel strange bands were observed. DNA fingerprint using Hae III showed completely identical pattern in all of the remains.

  8. Recent patents on self-quenching DNA probes.

    PubMed

    Knemeyer, Jens-Peter; Marmé, Nicole

    2007-01-01

    In this review, we report on patents concerning self-quenching DNA probes for assaying DNA during or after amplification as well as for direct assaying DNA or RNA, for example in living cells. Usually the probes consist of fluorescently labeled oligonucleotides whose fluorescence is quenched in the absence of the matching target DNA. Thereby the fluorescence quenching is based on fluorescence resonance energy transfer (FRET), photoinduced electron transfer (PET), or electronically interactions between dye and quencher. However, upon hybridization to the target or after the degradation during a PCR, the fluorescence of the dye is restored. Although the presented probes were originally developed for use in homogeneous assay formats, most of them are also appropriate to improve surface-based assay methods. In particular we describe patents for self-quenching primers, self-quenching probes for TaqMan assays, probes based on G-quartets, Molecular Beacons, Smart Probes, and Pleiades Probes.

  9. Parallel gene analysis with allele-specific padlock probes and tag microarrays

    PubMed Central

    Banér, Johan; Isaksson, Anders; Waldenström, Erik; Jarvius, Jonas; Landegren, Ulf; Nilsson, Mats

    2003-01-01

    Parallel, highly specific analysis methods are required to take advantage of the extensive information about DNA sequence variation and of expressed sequences. We present a scalable laboratory technique suitable to analyze numerous target sequences in multiplexed assays. Sets of padlock probes were applied to analyze single nucleotide variation directly in total genomic DNA or cDNA for parallel genotyping or gene expression analysis. All reacted probes were then co-amplified and identified by hybridization to a standard tag oligonucleotide array. The technique was illustrated by analyzing normal and pathogenic variation within the Wilson disease-related ATP7B gene, both at the level of DNA and RNA, using allele-specific padlock probes. PMID:12930977

  10. Colorimetry and SERS dual-mode detection of telomerase activity: combining rapid screening with high sensitivity

    NASA Astrophysics Data System (ADS)

    Zong, Shenfei; Wang, Zhuyuan; Chen, Hui; Hu, Guohua; Liu, Min; Chen, Peng; Cui, Yiping

    2014-01-01

    As an important biomarker and therapeutic target, telomerase has attracted considerable attention concerning its detection and monitoring. Here, we present a colorimetry and surface enhanced Raman scattering (SERS) dual-mode telomerase activity detection method, which has several distinctive advantages. First, colorimetric functionality allows rapid preliminary discrimination of telomerase activity by the naked eye. Second, the employment of SERS technique results in greatly improved detection sensitivity. Third, the combination of colorimetry and SERS into one detection system can ensure highly efficacious and sensitive screening of numerous samples. Besides, the avoidance of polymerase chain reaction (PCR) procedures further guarantees fine reliability and simplicity. Generally, the presented method is realized by an ``elongate and capture'' procedure. To be specific, gold nanoparticles modified with Raman molecules and telomeric repeat complementary oligonucleotide are employed as the colorimetric-SERS bifunctional reporting nanotag, while magnetic nanoparticles functionalized with telomerase substrate oligonucleotide are used as the capturing substrate. Telomerase can synthesize and elongate telomeric repeats onto the capturing substrate. The elongated telomeric repeats subsequently facilitate capturing of the reporting nanotag via hybridization between telomeric repeat and its complementary strand. The captured nanotags can cause a significant difference in the color and SERS intensity of the magnetically separated sediments. Thus both the color and SERS can be used as indicators of the telomerase activity. With fast screening ability and outstanding sensitivity, we anticipate that this method would greatly promote practical application of telomerase-based early-stage cancer diagnosis.As an important biomarker and therapeutic target, telomerase has attracted considerable attention concerning its detection and monitoring. Here, we present a colorimetry and surface enhanced Raman scattering (SERS) dual-mode telomerase activity detection method, which has several distinctive advantages. First, colorimetric functionality allows rapid preliminary discrimination of telomerase activity by the naked eye. Second, the employment of SERS technique results in greatly improved detection sensitivity. Third, the combination of colorimetry and SERS into one detection system can ensure highly efficacious and sensitive screening of numerous samples. Besides, the avoidance of polymerase chain reaction (PCR) procedures further guarantees fine reliability and simplicity. Generally, the presented method is realized by an ``elongate and capture'' procedure. To be specific, gold nanoparticles modified with Raman molecules and telomeric repeat complementary oligonucleotide are employed as the colorimetric-SERS bifunctional reporting nanotag, while magnetic nanoparticles functionalized with telomerase substrate oligonucleotide are used as the capturing substrate. Telomerase can synthesize and elongate telomeric repeats onto the capturing substrate. The elongated telomeric repeats subsequently facilitate capturing of the reporting nanotag via hybridization between telomeric repeat and its complementary strand. The captured nanotags can cause a significant difference in the color and SERS intensity of the magnetically separated sediments. Thus both the color and SERS can be used as indicators of the telomerase activity. With fast screening ability and outstanding sensitivity, we anticipate that this method would greatly promote practical application of telomerase-based early-stage cancer diagnosis. Electronic supplementary information (ESI) available: TEM images of individual MB@Au NPs, results of dynamic light scattering analysis and extinction spectrum obtained using colorimetry detection. See DOI: 10.1039/c3nr04942f

  11. A new general model for predicting melting thermodynamics of complementary and mismatched B-form duplexes containing locked nucleic acids: application to probe design for digital PCR detection of somatic mutations.

    PubMed

    Hughesman, Curtis; Fakhfakh, Kareem; Bidshahri, Roza; Lund, H Louise; Haynes, Charles

    2015-02-17

    Advances in real-time polymerase chain reaction (PCR), as well as the emergence of digital PCR (dPCR) and useful modified nucleotide chemistries, including locked nucleic acids (LNAs), have created the potential to improve and expand clinical applications of PCR through their ability to better quantify and differentiate amplification products, but fully realizing this potential will require robust methods for designing dual-labeled hydrolysis probes and predicting their hybridization thermodynamics as a function of their sequence, chemistry, and template complementarity. We present here a nearest-neighbor thermodynamic model that accurately predicts the melting thermodynamics of a short oligonucleotide duplexed either to its perfect complement or to a template containing mismatched base pairs. The model may be applied to pure-DNA duplexes or to duplexes for which one strand contains any number and pattern of LNA substitutions. Perturbations to duplex stability arising from mismatched DNA:DNA or LNA:DNA base pairs are treated at the Gibbs energy level to maintain statistical significance in the regressed model parameters. This approach, when combined with the model's accounting of the temperature dependencies of the melting enthalpy and entropy, permits accurate prediction of T(m) values for pure-DNA homoduplexes or LNA-substituted heteroduplexes containing one or two independent mismatched base pairs. Terms accounting for changes in solution conditions and terminal addition of fluorescent dyes and quenchers are then introduced so that the model may be used to accurately predict and thereby tailor the T(m) of a pure-DNA or LNA-substituted hydrolysis probe when duplexed either to its perfect-match template or to a template harboring a noncomplementary base. The model, which builds on classic nearest-neighbor thermodynamics, should therefore be of use to clinicians and biologists who require probes that distinguish and quantify two closely related alleles in either a quantitative PCR or dPCR assay. This potential is demonstrated by using the model to design allele-specific probes that completely discriminate and quantify clinically relevant mutant alleles (BRAF V600E and KIT D816V) in a dPCR assay.

  12. FLUORESCENT IN SITU DETECTION OF ENCEPHALITOZOON HELLEM SPORES WITH A 6-CARBOXYFLUORESCEIN-LABELED RNA-TARGETED OLIGONUCLEOTIDE PROBE

    EPA Science Inventory

    A fluorescent in situ hybridization assay has been developed for the detection of the human-pathogenic microsporidian, Encephalitozoon hellem, in water samples using epifluorescence microscopy. The assay employs a 19-nucleotide species-specific 6-carboxyfluorescein-labeled oligo...

  13. Identification of clinically relevant viridans streptococci by an oligonucleotide array.

    PubMed

    Chen, Chao Chien; Teng, Lee Jene; Kaiung, Seng; Chang, Tsung Chain

    2005-04-01

    Viridans streptococci (VS) are common etiologic agents of subacute infective endocarditis and are capable of causing a variety of pyogenic infections. Many species of VS are difficult to differentiate by phenotypic traits. An oligonucleotide array based on 16S-23S rRNA gene intergenic spacer (ITS) sequences was developed to identify 11 clinically relevant VS. These 11 species were Streptococcus anginosus, S. constellatus, S. gordonii, S. intermedius, S. mitis, S. mutans, S. oralis, S. parasanguinis, S. salivarius, S. sanguinis, and S. uberis. The method consisted of PCR amplification of the ITS regions by using a pair of universal primers, followed by hybridization of the digoxigenin-labeled PCR products to a panel of species-specific oligonucleotides immobilized on a nylon membrane. After 120 strains of the 11 species of VG and 91 strains of other bacteria were tested, the sensitivity and specificity of the oligonucleotide array were found to be 100% (120 of 120 strains) and 95.6% (87 of 91 strains), respectively. S. pneumoniae cross-hybridized to the probes used for the identification of S. mitis, and simple biochemical tests such as optochin susceptibility or bile solubility should be used to differentiate S. pneumoniae from S. mitis. In conclusion, identification of species of VS by use of the present oligonucleotide array is accurate and could be used as an alternative reliable method for species identification of strains of VS.

  14. Uprobe: a genome-wide universal probe resource for comparative physical mapping in vertebrates.

    PubMed

    Kellner, Wendy A; Sullivan, Robert T; Carlson, Brian H; Thomas, James W

    2005-01-01

    Interspecies comparisons are important for deciphering the functional content and evolution of genomes. The expansive array of >70 public vertebrate genomic bacterial artificial chromosome (BAC) libraries can provide a means of comparative mapping, sequencing, and functional analysis of targeted chromosomal segments that is independent and complementary to whole-genome sequencing. However, at the present time, no complementary resource exists for the efficient targeted physical mapping of the majority of these BAC libraries. Universal overgo-hybridization probes, designed from regions of sequenced genomes that are highly conserved between species, have been demonstrated to be an effective resource for the isolation of orthologous regions from multiple BAC libraries in parallel. Here we report the application of the universal probe design principal across entire genomes, and the subsequent creation of a complementary probe resource, Uprobe, for screening vertebrate BAC libraries. Uprobe currently consists of whole-genome sets of universal overgo-hybridization probes designed for screening mammalian or avian/reptilian libraries. Retrospective analysis, experimental validation of the probe design process on a panel of representative BAC libraries, and estimates of probe coverage across the genome indicate that the majority of all eutherian and avian/reptilian genes or regions of interest can be isolated using Uprobe. Future implementation of the universal probe design strategy will be used to create an expanded number of whole-genome probe sets that will encompass all vertebrate genomes.

  15. Targeted Elimination of PCDH-PC Expressing Prostate Cancer Cells for Control of Hormone-Resistant Prostate Cancer

    DTIC Science & Technology

    2007-11-01

    SDS-PAGE gel . The Western blot made from this gel was probed with antibody that recognizes the myc-tag. When compared to the extracts from the...SDS-PAGE gel and blotted onto a filter. The filter was probed with an anti-myc antibody. The levels of myc-tagged PCDH-PC protein in cells co...Specific Aim 2. Design and test antisense oligonucleotides ( ASOs ) that suppress PCDH-PC expression in prostate cancer cells. Work Done: We used

  16. Decoy Oligonucleotide Rescues IGF1R Expression from MicroRNA-223 Suppression

    PubMed Central

    Wang, Rong; He, Bao Mei; Qi, Bing; Xu, Chang Jun; Wu, Xing Zhong

    2013-01-01

    A mature miRNA generally suppresses hundreds of mRNA targets. To evaluate the selective effect of synthetic oligonucleotide decoys on hsa-miR-223 activity, reporters containing 3’ untranslated regions (UTR) of IGF1R, FOXO1, POLR3G, FOXO3, CDC27, FBXW7 and PAXIP1 mRNAs were constructed for the luciferase assay. The oligonucleotide decoys were designed and synthesized according to mature miR-223 sequence and its target mRNA sequence. Quantitative RT-PCR & western analysis were used to measure miR-223-targeted mRNA expression, Interestingly, apart from the antisense oligonucleotide, decoy nucleotides which were complementary to the 5’, central or 3’ region of mature miR-223 suppressed miR-223 targeting the 3’UTR of IGF1R, FOXO1, FOXO3, CDC27, POLR3G, and FBXW7 mRNAs and rescued the expression of these genes to varying degrees from miR-223 suppression at both mRNA and protein levels. All decoys had no effect on PAXIP1 which was not targeted by miR-223. The decoy 1 that was based on the sequence of IGF1R 3’UTR rescued the expression of IGF1R more significantly than other decoy nucleotides except the antisense decoy 4. Decoy 1 also rescued the expression of FOXO3 and POLR3G of which their 3’UTRs have similar binding sites for miR-223 with IGF1R 3’UTR. However decoy 1 failed to recover Sp1, CDC27 and FBXW7 expression. These data support that the sequence-specific decoy oligonucleotides might represent exogenous competing RNA which selectively inhibits microRNA targeting. PMID:24324762

  17. Decoy oligonucleotide rescues IGF1R expression from MicroRNA-223 suppression.

    PubMed

    Wu, Li Hui; Cai, Qian Qian; Dong, Yi Wei; Wang, Rong; He, Bao Mei; Qi, Bing; Xu, Chang Jun; Wu, Xing Zhong

    2013-01-01

    A mature miRNA generally suppresses hundreds of mRNA targets. To evaluate the selective effect of synthetic oligonucleotide decoys on hsa-miR-223 activity, reporters containing 3' untranslated regions (UTR) of IGF1R, FOXO1, POLR3G, FOXO3, CDC27, FBXW7 and PAXIP1 mRNAs were constructed for the luciferase assay. The oligonucleotide decoys were designed and synthesized according to mature miR-223 sequence and its target mRNA sequence. Quantitative RT-PCR & western analysis were used to measure miR-223-targeted mRNA expression, Interestingly, apart from the antisense oligonucleotide, decoy nucleotides which were complementary to the 5', central or 3' region of mature miR-223 suppressed miR-223 targeting the 3'UTR of IGF1R, FOXO1, FOXO3, CDC27, POLR3G, and FBXW7 mRNAs and rescued the expression of these genes to varying degrees from miR-223 suppression at both mRNA and protein levels. All decoys had no effect on PAXIP1 which was not targeted by miR-223. The decoy 1 that was based on the sequence of IGF1R 3'UTR rescued the expression of IGF1R more significantly than other decoy nucleotides except the antisense decoy 4. Decoy 1 also rescued the expression of FOXO3 and POLR3G of which their 3'UTRs have similar binding sites for miR-223 with IGF1R 3'UTR. However decoy 1 failed to recover Sp1, CDC27 and FBXW7 expression. These data support that the sequence-specific decoy oligonucleotides might represent exogenous competing RNA which selectively inhibits microRNA targeting.

  18. Growth Suppression and Therapy Sensitization of Breast Cancer

    DTIC Science & Technology

    2000-07-01

    determined by performed on two independent occasions. PCR amplification of a given housekeeping gene have been shown to correspond to determinations of...h incubation in the presence or absence of 1 mM cisplatin expressed housekeeping gene, dihydrofolate reductase (DHFR). (Platinol, aqueous solution at... G3PDH :j G3PDH Figure 9. A549 cells were treated with 3 different antisense oligonucleotides complementary to JNKI mRNA (including the active antisense

  19. Active oligonucleotides incorporating alkylating an agent as potential sequence- and base selective modifier of gene expression.

    PubMed

    Sasaki, S

    2001-04-01

    A number of cross-linking (alkylating) agents have been developed and incorporated into the oligonulceotides for sequence selective control of gene expression. Recently, potential application of such active oligonucleotides has been expanding from use for improvement of inhibition efficiency to new biotechnology that may enable chemical alteration of genetic information. These interests in active oligonucleotides have encouraged the generation of new cross-linking agents that exhibit high efficiency for application of either in vitro or in vivo. This mini review summarizes structures of alkylating agents, in particular, a new basic skeleton for cross-linking, a 2'-deoxyribose derivative of 2-amino-6-vinylpurine that has been recently developed by the author's group. The 2-amino-6-vinylpurine has been shown to form a complex with cytidine under acidic conditions, and brings the vinyl and the amino reactive groups into proximity to achieve efficient alkylation. A new strategy was designed so that the reactivity of 2-amino-6-vinylpurine can be induced from the corresponding phenylsulfoxide derivative within a duplex with the complementary strand. The validity of the new strategy has been proven by achievement of cytidine-selective cross-linking with remarkably efficiency.

  20. The Status of Exon Skipping as a Therapeutic Approach to Duchenne Muscular Dystrophy

    PubMed Central

    Lu, Qi-Long; Yokota, Toshifumi; Takeda, Shin'ichi; Garcia, Luis; Muntoni, Francesco; Partridge, Terence

    2011-01-01

    Duchenne muscular dystrophy (DMD) is associated with mutations in the dystrophin gene that disrupt the open reading frame whereas the milder Becker's form is associated with mutations which leave an in-frame mRNA transcript that can be translated into a protein that includes the N- and C- terminal functional domains. It has been shown that by excluding specific exons at, or adjacent to, frame-shifting mutations, open reading frame can be restored to an out-of-frame mRNA, leading to the production of a partially functional Becker-like dystrophin protein. Such targeted exclusion can be achieved by administration of oligonucleotides that are complementary to sequences that are crucial to normal splicing of the exon into the transcript. This principle has been validated in mouse and canine models of DMD with a number of variants of oligonucleotide analogue chemistries and by transduction with adeno-associated virus (AAV)-small nuclear RNA (snRNA) reagents encoding the antisense sequence. Two different oligonucleotide agents are now being investigated in human trials for splicing out of exon 51 with some early indications of success at the biochemical level. PMID:20978473

  1. UniPROBE, update 2011: expanded content and search tools in the online database of protein-binding microarray data on protein-DNA interactions.

    PubMed

    Robasky, Kimberly; Bulyk, Martha L

    2011-01-01

    The Universal PBM Resource for Oligonucleotide-Binding Evaluation (UniPROBE) database is a centralized repository of information on the DNA-binding preferences of proteins as determined by universal protein-binding microarray (PBM) technology. Each entry for a protein (or protein complex) in UniPROBE provides the quantitative preferences for all possible nucleotide sequence variants ('words') of length k ('k-mers'), as well as position weight matrix (PWM) and graphical sequence logo representations of the k-mer data. In this update, we describe >130% expansion of the database content, incorporation of a protein BLAST (blastp) tool for finding protein sequence matches in UniPROBE, the introduction of UniPROBE accession numbers and additional database enhancements. The UniPROBE database is available at http://uniprobe.org.

  2. Real-time PCR detection of Vibrio vulnificus in oysters: comparison of oligonucleotide primers and probes targeting vvhA.

    PubMed

    Panicker, Gitika; Bej, Asim K

    2005-10-01

    We compared three sets of oligonucleotide primers and two probes designed for Vibrio vulnificus hemolysin A gene (vvhA) for TaqMan-based real-time PCR method enabling specific detection of Vibrio vulnificus in oysters. Two of three sets of primers with a probe were specific for the detection of all 81 V. vulnificus isolates by TaqMan PCR. The 25 nonvibrio and 12 other vibrio isolates tested were negative. However, the third set of primers, F-vvh1059 and R-vvh1159, with the P-vvh1109 probe, although positive for all V. vulnificus isolates, also exhibited positive cycle threshold (C(T)) values for other Vibrio spp. Optimization of the TaqMan PCR assay using F-vvh785/R-vvh990 or F-vvh731/R-vvh1113 primers and the P-vvh874 probe detected 1 pg of purified DNA and 10(3) V. vulnificus CFU/ml in pure cultures. The enriched oyster tissue homogenate did not exhibit detectable inhibition to the TaqMan PCR amplification of vvhA. Detection of 3 x 10(3) CFU V. vulnificus, resulting from a 5-h enrichment of an initial inoculum of 1 CFU/g of oyster tissue homogenate, was achieved with F-vvh785/R-vvh990 or F-vvh731/R-vvh1113 primers and P-vvh875 probe. The application of the TaqMan PCR using these primers and probe, exhibited detection of V. vulnificus on 5-h-enriched natural oysters harvested from the Gulf of Mexico. Selection of appropriate primers and a probe on vvhA for TaqMan-PCR-based detection of V. vulnificus in post-harvest-treated oysters would help avoid false-positive results, thus ensuring a steady supply of safe oysters to consumers and reducing V. vulnificus-related illnesses and deaths.

  3. A Simpler Nucleic Acid

    NASA Technical Reports Server (NTRS)

    Orgel, Leslie

    2000-01-01

    It has been supposed that for a nucleic acid analog to pair with RNA it must, like RNA, have a backbone with at least a sixatom repeat; a shorter backbone presumably would not stretch far enough to bind RNA properly. The Eschenmoser group has shown, however, that this first impression is incorrect.As they report in their new paper, Eschenmoser and co-workers ( I ) have now synthesized a substantial number of these polymers, which are called (L)-a-threofuranosyl oligonucleotides or TNAs. They are composed of bases linked to a threose sugar-phosphate backbone, with phosphodiester bonds connecting the nucleotides. The investigators discovered that pairs of complementary TNAs do indeed form stable Watson-Crick double helices and, perhaps more importantly, that TNAs form stable double helices with complementary RNAs and DNAs.

  4. Nucleic acid analysis using terminal-phosphate-labeled nucleotides

    DOEpatents

    Korlach, Jonas [Ithaca, NY; Webb, Watt W [Ithaca, NY; Levene, Michael [Ithaca, NY; Turner, Stephen [Ithaca, NY; Craighead, Harold G [Ithaca, NY; Foquet, Mathieu [Ithaca, NY

    2008-04-22

    The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

  5. Prediction of the optimum hybridization conditions of dot-blot-SNP analysis using estimated melting temperature of oligonucleotide probes.

    PubMed

    Shiokai, Sachiko; Kitashiba, Hiroyasu; Nishio, Takeshi

    2010-08-01

    Although the dot-blot-SNP technique is a simple cost-saving technique suitable for genotyping of many plant individuals, optimization of hybridization and washing conditions for each SNP marker requires much time and labor. For prediction of the optimum hybridization conditions for each probe, we compared T (m) values estimated from nucleotide sequences using the DINAMelt web server, measured T (m) values, and hybridization conditions yielding allele-specific signals. The estimated T (m) values were comparable to the measured T (m) values with small differences of less than 3 degrees C for most of the probes. There were differences of approximately 14 degrees C between the specific signal detection conditions and estimated T (m) values. Change of one level of SSC concentrations of 0.1, 0.2, 0.5, and 1.0x SSC corresponded to a difference of approximately 5 degrees C in optimum signal detection temperature. Increasing the sensitivity of signal detection by shortening the exposure time to X-ray film changed the optimum hybridization condition for specific signal detection. Addition of competitive oligonucleotides to the hybridization mixture increased the suitable hybridization conditions by 1.8. Based on these results, optimum hybridization conditions for newly produced dot-blot-SNP markers will become predictable.

  6. Genotyping of single nucleotide polymorphism by probe-gated silica nanoparticles.

    PubMed

    Ercan, Meltem; Ozalp, Veli C; Tuna, Bilge G

    2017-11-15

    The development of simple, reliable, and rapid approaches for molecular detection of common mutations is important for prevention and early diagnosis of genetic diseases, including Thalessemia. Oligonucleotide-gated mesoporous nanoparticles-based analysis is a new platform for mutation detection that has the advantages of sensitivity, rapidity, accuracy, and convenience. A specific mutation in β-thalassemia, one of the most prevalent inherited diseases in several countries, was used as model disease in this study. An assay for detection of IVS110 point mutation (A > G reversion) was developed by designing probe-gated mesoporous silica nanoparticles (MCM-41) loaded with reporter fluorescein molecules. The silica nanoparticles were characterized by AFM, TEM and BET analysis for having 180 nm diameter and 2.83 nm pore size regular hexagonal shape. Amine group functionalized nanoparticles were analysed with FTIR technique. Mutated and normal sequence probe oligonucleotides)about 12.7 nmol per mg nanoparticles) were used to entrap reporter fluorescein molecules inside the pores and hybridization with single stranded DNA targets amplified by PCR gave different fluorescent signals for mutated targets. Samples from IVS110 mutated and normal patients resulted in statistically significant differences when the assay procedure were applied. Copyright © 2017 Elsevier Inc. All rights reserved.

  7. Correction of Spatial Bias in Oligonucleotide Array Data

    PubMed Central

    Lemieux, Sébastien

    2013-01-01

    Background. Oligonucleotide microarrays allow for high-throughput gene expression profiling assays. The technology relies on the fundamental assumption that observed hybridization signal intensities (HSIs) for each intended target, on average, correlate with their target's true concentration in the sample. However, systematic, nonbiological variation from several sources undermines this hypothesis. Background hybridization signal has been previously identified as one such important source, one manifestation of which appears in the form of spatial autocorrelation. Results. We propose an algorithm, pyn, for the elimination of spatial autocorrelation in HSIs, exploiting the duality of desirable mutual information shared by probes in a common probe set and undesirable mutual information shared by spatially proximate probes. We show that this correction procedure reduces spatial autocorrelation in HSIs; increases HSI reproducibility across replicate arrays; increases differentially expressed gene detection power; and performs better than previously published methods. Conclusions. The proposed algorithm increases both precision and accuracy, while requiring virtually no changes to users' current analysis pipelines: the correction consists merely of a transformation of raw HSIs (e.g., CEL files for Affymetrix arrays). A free, open-source implementation is provided as an R package, compatible with standard Bioconductor tools. The approach may also be tailored to other platform types and other sources of bias. PMID:23573083

  8. Growth Suppression and Therapy Sensitization of Breast Cancer

    DTIC Science & Technology

    1999-07-01

    northern analysis, the same membrane was hybridized successively with JNKI probe, JNK2 probe and the G3PDH probe. Figure 10. A549 cells were treated with the...90 0 00 z SO E 40 04. z 20 to JNK2 Oligonucleotide n* 47 JNK1AS TREATED 2 JNlK2AS TREATED. 0) c a 0 mRNA mRNA JNK1 J&,I ~R JNK1 JNK2 JNK2 G3PDH SI... G3PDH 48 iil vý 0 z z Z O! zz C13~ A.LOR 496 Reference #28 PREFERENTIAL PLATINATION OF AN ACTIVATED CELLULAR PROMOTER BY CIS-DIAMMINEDICHLOROPLATINUM

  9. Natural antisense transcript-targeted regulation of inducible nitric oxide synthase mRNA levels.

    PubMed

    Yoshigai, Emi; Hara, Takafumi; Araki, Yoshiro; Tanaka, Yoshito; Oishi, Masaharu; Tokuhara, Katsuji; Kaibori, Masaki; Okumura, Tadayoshi; Kwon, A-Hon; Nishizawa, Mikio

    2013-04-01

    Natural antisense transcripts (asRNAs) are frequently transcribed from mammalian genes. Recently, we found that non-coding asRNAs are transcribed from the 3' untranslated region (3'UTR) of the rat and mouse genes encoding inducible nitric oxide synthase (iNOS), which catalyzes the production of the inflammatory mediator nitric oxide. The iNOS asRNA stabilizes iNOS mRNA by interacting with the mRNA 3'UTR. Furthermore, single-stranded 'sense' oligonucleotides corresponding to the iNOS mRNA sequence were found to reduce iNOS mRNA levels by interfering with mRNA-asRNA interactions in rat hepatocytes. This method was named natural antisense transcript-targeted regulation (NATRE) technology. In this study, we detected human iNOS asRNA expressed in hepatocarcinoma and colon carcinoma tissues. The human iNOS asRNA harbored a sequence complementary to an evolutionarily conserved region of the iNOS mRNA 3'UTR. When introduced into hepatocytes, iNOS sense oligonucleotides that were modified by substitution with partial phosphorothioate bonds and locked nucleic acids or 2'-O-methyl nucleic acids greatly reduced levels of iNOS mRNA and iNOS protein. Moreover, sense oligonucleotides and short interfering RNAs decreased iNOS mRNA to comparable levels. These results suggest that NATRE technology using iNOS sense oligonucleotides could potentially be used to treat human inflammatory diseases and cancers by reducing iNOS mRNA levels. Copyright © 2013 Elsevier Inc. All rights reserved.

  10. Hit-Validation Methodologies for Ligands Isolated from DNA-Encoded Chemical Libraries.

    PubMed

    Zimmermann, Gunther; Li, Yizhou; Rieder, Ulrike; Mattarella, Martin; Neri, Dario; Scheuermann, Jörg

    2017-05-04

    DNA-encoded chemical libraries (DECLs) are large collections of compounds linked to DNA fragments, serving as amplifiable barcodes, which can be screened on target proteins of interest. In typical DECL selections, preferential binders are identified by high-throughput DNA sequencing, by comparing their frequency before and after the affinity capture step. Hits identified in this procedure need to be confirmed, by resynthesis and by performing affinity measurements. In this article we present new methods based on hybridization of oligonucleotide conjugates with fluorescently labeled complementary oligonucleotides; these facilitate the determination of affinity constants and kinetic dissociation constants. The experimental procedures were demonstrated with acetazolamide, a binder to carbonic anhydrase IX with a dissociation constant in the nanomolar range. The detection of binding events was compatible not only with fluorescence polarization methodologies, but also with Alphascreen technology and with microscale thermophoresis. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Molecular replication

    NASA Technical Reports Server (NTRS)

    Orgel, L. E.

    1986-01-01

    The object of our research program is to understand how polynucleotide replication originated on the primitive Earth. This is a central issue in studies of the origins of life, since a process similar to modern DNA and RNA synthesis is likely to have formed the basis for the most primitive system of genetic information transfer. The major conclusion of studies so far is that a preformed polynucleotide template under many different experimental conditions will facilitate the synthesis of a new oligonucleotide with a sequence complementary to that of the template. It has been shown, for example, that poly(C) facilitates the synthesis of long oligo(G)s and that the short template CCGCC facilities the synthesis of its complement GGCGG. Very recently we have shown that template-directed synthesis is not limited to the standard oligonucleotide substrates. Nucleic acid-like molecules with a pyrophosphate group replacing the phosphate of the standard nucleic acid backbone are readily synthesized from deoxynucleotide 3'-5'-diphosphates on appropriate templates.

  12. Antisense Oligonucleotide-Mediated Transcript Knockdown in Zebrafish.

    PubMed

    Pauli, Andrea; Montague, Tessa G; Lennox, Kim A; Behlke, Mark A; Schier, Alexander F

    2015-01-01

    Antisense oligonucleotides (ASOs) are synthetic, single-strand RNA-DNA hybrids that induce catalytic degradation of complementary cellular RNAs via RNase H. ASOs are widely used as gene knockdown reagents in tissue culture and in Xenopus and mouse model systems. To test their effectiveness in zebrafish, we targeted 20 developmental genes and compared the morphological changes with mutant and morpholino (MO)-induced phenotypes. ASO-mediated transcript knockdown reproduced the published loss-of-function phenotypes for oep, chordin, dnd, ctnnb2, bmp7a, alk8, smad2 and smad5 in a dosage-sensitive manner. ASOs knocked down both maternal and zygotic transcripts, as well as the long noncoding RNA (lncRNA) MALAT1. ASOs were only effective within a narrow concentration range and were toxic at higher concentrations. Despite this drawback, quantitation of knockdown efficiency and the ability to degrade lncRNAs make ASOs a useful knockdown reagent in zebrafish.

  13. Development of highly sensitive electrochemical genosensor based on multiwalled carbon nanotubes-chitosan-bismuth and lead sulfide nanoparticles for the detection of pathogenic Aeromonas.

    PubMed

    Fernandes, António Maximiano; Abdalhai, Mandour H; Ji, Jian; Xi, Bing-Wen; Xie, Jun; Sun, Jiadi; Noeline, Rasoamandrary; Lee, Byong H; Sun, Xiulan

    2015-01-15

    In this paper, we reported the construction of new high sensitive electrochemical genosensor based on multiwalled carbon nanotubes-chitosan-bismuth complex (MWCNT-Chi-Bi) and lead sulfide nanoparticles for the detection of pathogenic Aeromonas. Lead sulfide nanoparticles capped with 5'-(NH2) oligonucleotides thought amide bond was used as signalizing probe DNA (sz-DNA) and thiol-modified oligonucleotides sequence was used as fixing probe DNA (fDNA). The two probes hybridize with target Aeromonas DNA (tDNA) sequence (fDNA-tDNA-szDNA). The signal of hybridization is detected by differential pulse voltammetry (DPV) after electrodeposition of released lead nanoparticles (PbS) from sz-DNA on the surface of glass carbon electrode decorated with MWCNT-Chi-Bi, which improves the deposition and traducing electrical signal. The optimization of incubation time, hybridization temperature, deposition potential, deposition time and the specificity of the probes were investigated. Our results showed the highest sensibility to detect the target gene when compared with related biosensors and polymerase chain reaction (PCR). The detection limit for this biosensor was 1.0×10(-14) M. We could detect lower than 10(2) CFU mL(-1) of Aeromonas in spiked tap water. This method is rapid and sensitive for the detection of pathogenic bacteria and would become a potential application in biomedical diagnosis, food safety and environmental monitoring. Copyright © 2014 Elsevier B.V. All rights reserved.

  14. Chemically functionalized gold nanoparticles: Synthesis, characterization, and applications

    NASA Astrophysics Data System (ADS)

    Daniel, Weston Lewis

    This thesis focuses on the development and application of gold nanoparticle based detection systems and biomimetic structures. Each class of modified nanoparticle has properties that are defined by its chemical moieties that interface with solution and the gold nanoparticle core. In Chapter 2, a comparison of the biomolecular composition and binding properties of various preparations of antibody oligonucleotide gold nanoparticle conjugates is presented. These constructs differed significantly in terms of their structure and binding properties. Chapter 3 reports the use of electroless gold deposition as a light scattering signal enhancer in a multiplexed, microarray-based scanometric immunoassay using the gold nanoparticle probes evaluated in Chapter 2. The use of gold development results in greater signal enhancement than the typical silver development, and multiple rounds of metal development were found to increase the resulting signal compared to one development. Chapter 4 describes an amplified scanometric detection method for human telomerase activity. Gold nanoparticles functionalized with specific oligonucleotide sequences can efficiently capture telomerase enzymes and subsequently be elongated. Both the elongated and unmodified oligonucleotide sequences are simultaneously measured. At low telomerase concentrations, elongated strands cannot be detected, but the unmodified sequences, which come from the same probe particles, can be detected because their concentration is higher, providing a novel form of amplification. Chapter 5 reports the development of a novel colorimetric nitrite and nitrate ion assay based upon gold nanoparticle probes functionalized with Griess reaction reagents. This assay takes advantage of the distance-dependent plasmonic properties of the gold nanoparticles and the ability of nitrite ion to facilitate the cross coupling of novel nanoparticle probes. The assay works on the concept of a kinetic end point and can be triggered at the EPA limit for this ion in drinking water. Finally, Chapter 6 describes the synthesis of high density lipoprotein biomimetic nanoparticles capable of binding cholesterol. These structures use a gold nanoparticle core to template the assembly of a mixed phospholipid layer and the adsorption of apolipoprotein A-I. These synthesized structures have the general size and surface composition of natural HDL and bind free cholesterol with a Kd of 4 nM.

  15. G-quadruplexes as novel cis-elements controlling transcription during embryonic development.

    PubMed

    David, Aldana P; Margarit, Ezequiel; Domizi, Pablo; Banchio, Claudia; Armas, Pablo; Calcaterra, Nora B

    2016-05-19

    G-quadruplexes are dynamic structures folded in G-rich single-stranded DNA regions. These structures have been recognized as a potential nucleic acid based mechanism for regulating multiple cellular processes such as replication, transcription and genomic maintenance. So far, their transcriptional role in vivo during vertebrate embryonic development has not yet been addressed. Here, we performed an in silico search to find conserved putative G-quadruplex sequences (PQSs) within proximal promoter regions of human, mouse and zebrafish developmental genes. Among the PQSs able to fold in vitro as G-quadruplex, those present in nog3, col2a1 and fzd5 promoters were selected for further studies. In cellulo studies revealed that the selected G-quadruplexes affected the transcription of luciferase controlled by the SV40 nonrelated promoter. G-quadruplex disruption in vivo by microinjection in zebrafish embryos of either small ligands or DNA oligonucleotides complementary to the selected PQSs resulted in lower transcription of the targeted genes. Moreover, zebrafish embryos and larvae phenotypes caused by the presence of complementary oligonucleotides fully resembled those ones reported for nog3, col2a1 and fzd5 morphants. To our knowledge, this is the first work revealing in vivo the role of conserved G-quadruplexes in the embryonic development, one of the most regulated processes of the vertebrates biology. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  16. G-quadruplexes as novel cis-elements controlling transcription during embryonic development

    PubMed Central

    David, Aldana P.; Margarit, Ezequiel; Domizi, Pablo; Banchio, Claudia; Armas, Pablo; Calcaterra, Nora B.

    2016-01-01

    G-quadruplexes are dynamic structures folded in G-rich single-stranded DNA regions. These structures have been recognized as a potential nucleic acid based mechanism for regulating multiple cellular processes such as replication, transcription and genomic maintenance. So far, their transcriptional role in vivo during vertebrate embryonic development has not yet been addressed. Here, we performed an in silico search to find conserved putative G-quadruplex sequences (PQSs) within proximal promoter regions of human, mouse and zebrafish developmental genes. Among the PQSs able to fold in vitro as G-quadruplex, those present in nog3, col2a1 and fzd5 promoters were selected for further studies. In cellulo studies revealed that the selected G-quadruplexes affected the transcription of luciferase controlled by the SV40 nonrelated promoter. G-quadruplex disruption in vivo by microinjection in zebrafish embryos of either small ligands or DNA oligonucleotides complementary to the selected PQSs resulted in lower transcription of the targeted genes. Moreover, zebrafish embryos and larvae phenotypes caused by the presence of complementary oligonucleotides fully resembled those ones reported for nog3, col2a1 and fzd5 morphants. To our knowledge, this is the first work revealing in vivo the role of conserved G-quadruplexes in the embryonic development, one of the most regulated processes of the vertebrates biology. PMID:26773060

  17. Two Successive Reactions on a DNA Template: A Strategy for Improving Background and Specificity in Nucleic Acid Detection

    PubMed Central

    Franzini, Raphael M.

    2015-01-01

    We report a new strategy for template-mediated fluorogenic chemistry that results in enhanced performance for the fluorescence detection of nucleic acids. In this approach, two successive templated reactions are required to induce a fluorescence signal, rather than only one. These novel fluorescein-labeled oligonucleotide probes, termed 2-STAR probes, contain two quencher groups tethered by separate reductively cleavable linkers. When a 2-STAR quenched probe binds adjacent to either two successive mono triphenyl-phosphine (TPP)-DNAs or a dual TPP-DNA, the two quenchers are released, resulting in a fluorescence signal. Because of the requirement for two consecutive reactions, 2-STAR probes display an unprecedented level of sequence-specificity for template-mediated probe designs. At the same time, background emission generated by off-template reactions or incomplete quenching is among the lowest of any fluorogenic reactive probes for the detection of DNA or RNA. PMID:21294182

  18. Time-Resolved Nucleic Acid Hybridization Beacons Utilizing Unimolecular and Toehold-Mediated Strand Displacement Designs.

    PubMed

    Massey, Melissa; Ancona, Mario G; Medintz, Igor L; Algar, W Russ

    2015-12-01

    Nucleic acid hybridization probes are sought after for numerous assay and imaging applications. These probes are often limited by the properties of fluorescent dyes, prompting the development of new probes where dyes are paired with novel or nontraditional luminescent materials. Luminescent terbium complexes are an example of such a material, and these complexes offer several unique spectroscopic advantages. Here, we demonstrate two nonstem-loop designs for light-up nucleic acid hybridization beacons that utilize time-resolved Förster resonance energy transfer (TR-FRET) between a luminescent Lumi4-Tb cryptate (Tb) donor and a fluorescent reporter dye, where time-resolved emission from the dye provides an analytical signal. Both designs are based on probe oligonucleotides that are labeled at their opposite termini with Tb and a fluorescent reporter dye. In one design, a probe is partially blocked with a quencher dye-labeled oligonucleotide, and target hybridization is signaled through toehold-mediated strand displacement and loss of a competitive FRET pathway. In the other design, the intrinsic folding properties of an unblocked probe are utilized in combination with a temporal mechanism for signaling target hybridization. This temporal mechanism is based on a recently elucidated "sweet spot" for TR-FRET measurements and exploits distance control over FRET efficiencies to shift the Tb lifetime within or outside the time-gated detection window for measurements. Both the blocked and unblocked beacons offer nanomolar (femtomole) detection limits, response times on the order of minutes, multiplexing through the use of different reporter dyes, and detection in complex matrices such as serum and blood. The blocked beacons offer better mismatch selectivity, whereas the unblocked beacons are simpler in design. The temporal mechanism of signaling utilized with the unblocked beacons also plays a significant role with the blocked beacons and represents a new and effective strategy for developing FRET probes for bioassays.

  19. Single-tube, non-isotopic, multiplex PCR/OLA assay and sequence-coded separation for simultaneous screening of 31 cystic fibrosis mutations

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Brinson, E.C.; Adriano, T.; Bloch, W.

    1994-09-01

    We have developed a rapid, single-tube, non-isotopic assay that screens a patient sample for the presence of 31 cystic fibrosis (CF) mutations. This assay can identify these mutations in a single reaction tube and a single electrophoresis run. Sample preparation is a simple, boil-and-go procedure, completed in less than an hour. The assay is composed of a 15-plex PCR, followed by a 61-plex oligonucleotide ligation assay (OLA), and incorporates a novel detection scheme, Sequence Coded Separation. Initially, the multiplex PCR amplifies 15 relevant segments of the CFTR gene, simultaneously. These PCR amplicons serve as templates for the multiplex OLA, whichmore » detects the normal or mutant allele at all loci, simultaneously. Each polymorphic site is interrogated by three oligonucleotide probes, a common probe and two allele-specific probes. Each common probe is tagged with a fluorescent dye, and the competing normal and mutant allelic probes incorporate different, non-nucleotide, mobility modifiers. These modifiers are composed of hexaethylene oxide (HEO) units, incorporated as HEO phosphoramidite monomers during automated DNA synthesis. The OLA is based on both probe hybridization and the ability of DNA ligase to discriminate single base mismatches at the junction between paired probes. Each single tube assay is electrophoresed in a single gel lane of a 4-color fluorescent DNA sequencer (Applied Biosystems, Model 373A). Each of the ligation products is identified by its unique combination of electrophoretic mobility and one of three colors. The fourth color is reserved for the in-lane size standard, used by GENESCAN{sup TM} software (Applied Biosystems) to size the OLA electrophoresis products. The Genotyper{sub TM} software (Applied Biosystems) decodes these Sequence-Coded-Separation data to create a patient summary report for all loci tested.« less

  20. Identification of characteristic oligonucleotides in the bacterial 16S ribosomal RNA sequence dataset

    NASA Technical Reports Server (NTRS)

    Zhang, Zhengdong; Willson, Richard C.; Fox, George E.

    2002-01-01

    MOTIVATION: The phylogenetic structure of the bacterial world has been intensively studied by comparing sequences of 16S ribosomal RNA (16S rRNA). This database of sequences is now widely used to design probes for the detection of specific bacteria or groups of bacteria one at a time. The success of such methods reflects the fact that there are local sequence segments that are highly characteristic of particular organisms or groups of organisms. It is not clear, however, the extent to which such signature sequences exist in the 16S rRNA dataset. A better understanding of the numbers and distribution of highly informative oligonucleotide sequences may facilitate the design of hybridization arrays that can characterize the phylogenetic position of an unknown organism or serve as the basis for the development of novel approaches for use in bacterial identification. RESULTS: A computer-based algorithm that characterizes the extent to which any individual oligonucleotide sequence in 16S rRNA is characteristic of any particular bacterial grouping was developed. A measure of signature quality, Q(s), was formulated and subsequently calculated for every individual oligonucleotide sequence in the size range of 5-11 nucleotides and for 15mers with reference to each cluster and subcluster in a 929 organism representative phylogenetic tree. Subsequently, the perfect signature sequences were compared to the full set of 7322 sequences to see how common false positives were. The work completed here establishes beyond any doubt that highly characteristic oligonucleotides exist in the bacterial 16S rRNA sequence dataset in large numbers. Over 16,000 15mers were identified that might be useful as signatures. Signature oligonucleotides are available for over 80% of the nodes in the representative tree.

  1. Energy transfer of nucleic acid products

    NASA Astrophysics Data System (ADS)

    Jung, Paul M.; Hu, Hsiang-Yun; Khalil, Omar S.

    1995-04-01

    Fluorescence energy transfer was investigated as a homogeneous detection method for the gapped ligase chain reaction (G-LCR). Oligonucleotides of a Chlamydia trachomatic G-LCR probe set were labeled with fluorescein as the donor and Texas Red as the acceptor fluorophore. Amplification and detection of 10 molecules of synthetic target was demonstrated in spiked urine samples.

  2. RNA splicing process analysis for identifying antisense oligonucleotide inhibitors with padlock probe-based isothermal amplification.

    PubMed

    Ren, Xiaojun; Deng, Ruijie; Wang, Lida; Zhang, Kaixiang; Li, Jinghong

    2017-08-01

    RNA splicing, which mainly involves two transesterification steps, is a fundamental process of gene expression and its abnormal regulation contributes to serious genetic diseases. Antisense oligonucleotides (ASOs) are genetic control tools that can be used to specifically control genes through alteration of the RNA splicing pathway. Despite intensive research, how ASOs or various other factors influence the multiple processes of RNA splicing still remains obscure. This is largely due to an inability to analyze the splicing efficiency of each step in the RNA splicing process with high sensitivity. We addressed this limitation by introducing a padlock probe-based isothermal amplification assay to achieve quantification of the specific products in different splicing steps. With this amplified assay, the roles that ASOs play in RNA splicing inhibition in the first and second steps could be distinguished. We identified that 5'-ASO could block RNA splicing by inhibiting the first step, while 3'-ASO could block RNA splicing by inhibiting the second step. This method provides a versatile tool for assisting efficient ASO design and discovering new splicing modulators and therapeutic drugs.

  3. A Cytidine Phosphoramidite with Protected Nitroxide Spin Label: Synthesis of a Full-Length TAR RNA and Investigation by In-Line Probing and EPR Spectroscopy.

    PubMed

    Weinrich, Timo; Jaumann, Eva A; Scheffer, Ute; Prisner, Thomas F; Göbel, Michael W

    2018-04-20

    EPR studies on RNA are complicated by three major obstacles related to the chemical nature of nitroxide spin labels: Decomposition while oligonucleotides are chemically synthesized, further decay during enzymatic strand ligation, and undetected changes in conformational equilibria due to the steric demand of the label. Herein possible solutions for all three problems are presented: A 2-nitrobenzyloxymethyl protective group for nitroxides that is stable under all conditions of chemical RNA synthesis and can be removed photochemically. By careful selection of ligation sites and splint oligonucleotides, high yields were achieved in the assembly of a full-length HIV-1 TAR RNA labeled with two protected nitroxide groups. PELDOR measurements on spin-labeled TAR in the absence and presence of arginine amide indicated arrest of interhelical motions on ligand binding. Finally, even minor changes in conformation due to the presence of spin labels are detected with high sensitivity by in-line probing. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. Simultaneous direct detection of Shiga-toxin producing Escherichia coli (STEC) strains by optical biosensing with oligonucleotide-functionalized gold nanoparticles

    NASA Astrophysics Data System (ADS)

    Quintela, Irwin A.; de Los Reyes, Benildo G.; Lin, Chih-Sheng; Wu, Vivian C. H.

    2015-01-01

    A simultaneous direct detection of Shiga-toxin producing strains of E. coli (STEC; ``Big Six'' - O26, O45, O103, O111, O121, and O145) as well as O157 strains by optical biosensing with oligonucleotide-functionalized gold nanoparticles (AuNPs) was developed. Initially, conserved regions of stx genes were amplified by asymmetric polymerase chain reaction (asPCR). Pairs of single stranded thiol-modified oligonucleotides (30-mer) were immobilized onto AuNPs and used as probes to capture regions of stx1 (119-bp) and/or stx2 (104-bp) genes from STEC strains. DNA samples from pure cultures and food samples were sandwich hybridized with AuNP-oligo probes at optimal conditions (50 °C, 30 min). A complex was formed from the hybridization of AuNP-probes and target DNA fragments that retained the initial red color of the reaction solutions. For non-target DNA, a color change from red to purplish-blue was observed following an increase in salt concentration, thus providing the basis of simultaneous direct colorimetric detection of target DNA in the samples. Enrichment and pooling systems were incorporated to efficiently process a large number of food samples (ground beef and blueberries) and detection of live targets. The detection limit was <1 log CFU g-1, requiring less than 1 h to complete after DNA sample preparation with 100% specificity. Gel electrophoresis verified AuNP-DNA hybridization while spectrophotometric data and transmission electron microscope (TEM) images supported color discrimination based on the occurrence of molecular aggregation. In conclusion, the significant features of this approach took advantage of the unique colorimetric properties of AuNPs as a low-cost and simple approach yet with high specificity for simultaneous detection of STEC strains.A simultaneous direct detection of Shiga-toxin producing strains of E. coli (STEC; ``Big Six'' - O26, O45, O103, O111, O121, and O145) as well as O157 strains by optical biosensing with oligonucleotide-functionalized gold nanoparticles (AuNPs) was developed. Initially, conserved regions of stx genes were amplified by asymmetric polymerase chain reaction (asPCR). Pairs of single stranded thiol-modified oligonucleotides (30-mer) were immobilized onto AuNPs and used as probes to capture regions of stx1 (119-bp) and/or stx2 (104-bp) genes from STEC strains. DNA samples from pure cultures and food samples were sandwich hybridized with AuNP-oligo probes at optimal conditions (50 °C, 30 min). A complex was formed from the hybridization of AuNP-probes and target DNA fragments that retained the initial red color of the reaction solutions. For non-target DNA, a color change from red to purplish-blue was observed following an increase in salt concentration, thus providing the basis of simultaneous direct colorimetric detection of target DNA in the samples. Enrichment and pooling systems were incorporated to efficiently process a large number of food samples (ground beef and blueberries) and detection of live targets. The detection limit was <1 log CFU g-1, requiring less than 1 h to complete after DNA sample preparation with 100% specificity. Gel electrophoresis verified AuNP-DNA hybridization while spectrophotometric data and transmission electron microscope (TEM) images supported color discrimination based on the occurrence of molecular aggregation. In conclusion, the significant features of this approach took advantage of the unique colorimetric properties of AuNPs as a low-cost and simple approach yet with high specificity for simultaneous detection of STEC strains. Electronic supplementary information (ESI) available. See DOI: 10.1039/c4nr05869k

  5. Methods and compositions for efficient nucleic acid sequencing

    DOEpatents

    Drmanac, Radoje

    2006-07-04

    Disclosed are novel methods and compositions for rapid and highly efficient nucleic acid sequencing based upon hybridization with two sets of small oligonucleotide probes of known sequences. Extremely large nucleic acid molecules, including chromosomes and non-amplified RNA, may be sequenced without prior cloning or subcloning steps. The methods of the invention also solve various current problems associated with sequencing technology such as, for example, high noise to signal ratios and difficult discrimination, attaching many nucleic acid fragments to a surface, preparing many, longer or more complex probes and labelling more species.

  6. Methods and compositions for efficient nucleic acid sequencing

    DOEpatents

    Drmanac, Radoje

    2002-01-01

    Disclosed are novel methods and compositions for rapid and highly efficient nucleic acid sequencing based upon hybridization with two sets of small oligonucleotide probes of known sequences. Extremely large nucleic acid molecules, including chromosomes and non-amplified RNA, may be sequenced without prior cloning or subcloning steps. The methods of the invention also solve various current problems associated with sequencing technology such as, for example, high noise to signal ratios and difficult discrimination, attaching many nucleic acid fragments to a surface, preparing many, longer or more complex probes and labelling more species.

  7. Characterization of toxin-producing cyanobacteria by using an oligonucleotide probe containing a tandemly repeated heptamer.

    PubMed Central

    Rouhiainen, L; Sivonen, K; Buikema, W J; Haselkorn, R

    1995-01-01

    Cyanobacteria produce toxins that kill animals. The two main classes of cyanobacterial toxins are cyclic peptides that cause liver damage and alkaloids that block nerve transmission. Many toxin-producing strains from Finnish lakes were brought into axenic culture, and their toxins were characterized. Restriction fragment length polymorphism analysis, probing with a short tandemly repeated DNA sequence found at many locations in the chromosome of Anabaena sp. strain PCC 7120, distinguishes hepatotoxic Anabaena isolates from neurotoxin-producing strains and from Nostoc spp. PMID:7592362

  8. Single-base-pair discrimination of terminal mismatches by using oligonucleotide microarrays and neural network analyses

    NASA Technical Reports Server (NTRS)

    Urakawa, Hidetoshi; Noble, Peter A.; El Fantroussi, Said; Kelly, John J.; Stahl, David A.

    2002-01-01

    The effects of single-base-pair near-terminal and terminal mismatches on the dissociation temperature (T(d)) and signal intensity of short DNA duplexes were determined by using oligonucleotide microarrays and neural network (NN) analyses. Two perfect-match probes and 29 probes having a single-base-pair mismatch at positions 1 to 5 from the 5' terminus of the probe were designed to target one of two short sequences representing 16S rRNA. Nonequilibrium dissociation rates (i.e., melting profiles) of all probe-target duplexes were determined simultaneously. Analysis of variance revealed that position of the mismatch, type of mismatch, and formamide concentration significantly affected the T(d) and signal intensity. Increasing the concentration of formamide in the washing buffer decreased the T(d) and signal intensity, and it decreased the variability of the signal. Although T(d)s of probe-target duplexes with mismatches in the first or second position were not significantly different from one another, duplexes with mismatches in the third to fifth positions had significantly lower T(d)s than those with mismatches in the first or second position. The trained NNs predicted the T(d) with high accuracies (R(2) = 0.93). However, the NNs predicted the signal intensity only moderately accurately (R(2) = 0.67), presumably due to increased noise in the signal intensity at low formamide concentrations. Sensitivity analysis revealed that the concentration of formamide explained most (75%) of the variability in T(d)s, followed by position of the mismatch (19%) and type of mismatch (6%). The results suggest that position of the mismatch at or near the 5' terminus plays a greater role in determining the T(d) and signal intensity of duplexes than the type of mismatch.

  9. New Gene Cassettes for Trimethoprim Resistance, dfr13, and Streptomycin-Spectinomycin Resistance, aadA4, Inserted on a Class 1 Integron

    PubMed Central

    Adrian, Peter V.; Thomson, Christopher J.; Klugman, Keith P.; Amyes, Sebastian G. B.

    2000-01-01

    In a previous survey of 357 trimethoprim-resistant isolates of aerobic gram-negative bacteria from commensal fecal flora, hybridization experiments showed that 25% (90 of 357) of the isolates failed to hybridize to specific oligonucleotide probes for dihydrofolate reductase types 1, 2b, 3, 5, 6, 7, 8, 9, 10, and 12. Subsequent cloning and sequencing of a plasmid-borne trimethoprim resistance gene from one of these isolates revealed a new dihydrofolate reductase gene, dfr13, which occurred as a cassette integrated in a site-specific manner in a class 1 integron. The gene product shared 84% amino acid identity with dfr12 and exhibited a trimethoprim inhibition profile similar to that of dfr12. Gene probing experiments with an oligonucleotide probe specific for this gene showed that 12.3% (44 of 357) of the isolates which did not hybridize to probes for other dihydrofolate reductases hybridized to this probe. Immediately downstream of dfr13, a new cassette, an aminoglycoside resistance gene of the class AADA [ANT(3")(9)-I], which encodes streptomycin-spectinomycin resistance, was identified. This gene shares 57% identity with the consensus aadA1 (ant(3")-Ia) and has been called aadA4 (ant(3")-Id). The 3′ end of the aadA4 cassette was truncated by IS26, which was contiguous with a truncated form of Tn3. On the same plasmid, pUK2381, a second copy of IS26 was associated with sul2, which suggests that both integrase and transposase activities have played major roles in the arrangement and dissemination of antibiotic resistance genes dfr13, aadA4, blaTEM-1, and sul2. PMID:10639362

  10. The waning of the WIMP? A review of models, searches, and constraints

    NASA Astrophysics Data System (ADS)

    Arcadi, Giorgio; Dutra, Maíra; Ghosh, Pradipta; Lindner, Manfred; Mambrini, Yann; Pierre, Mathias; Profumo, Stefano; Queiroz, Farinaldo S.

    2018-03-01

    Weakly Interacting Massive Particles (WIMPs) are among the best-motivated dark matter candidates. No conclusive signal, despite an extensive search program that combines, often in a complementary way, direct, indirect, and collider probes, has been detected so far. This situation might change in near future due to the advent of one/multi-TON Direct Detection experiments. We thus, find it timely to provide a review of the WIMP paradigm with focus on a few models which can be probed at best by these facilities. Collider and Indirect Detection, nevertheless, will not be neglected when they represent a complementary probe.

  11. Genomic expression patterns of cardiac tissues from dogs with dilated cardiomyopathy.

    PubMed

    Oyama, Mark A; Chittur, Sridar

    2005-07-01

    To evaluate global genome expression patterns of left ventricular tissues from dogs with dilated cardiomyopathy (DCM). Tissues obtained from the left ventricle of 2 Doberman Pinschers with end-stage DCM and 5 healthy control dogs. Transcriptional activities of 23,851 canine DNA sequences were determined by use of an oligonucleotide microarray. Genome expression patterns of DCM tissue were evaluated by measuring the relative amount of complementary RNA hybridization to the microarray probes and comparing it with gene expression for tissues from 5 healthy control dogs. 478 transcripts were differentially expressed (> or = 2.5-fold change). In DCM tissue, expression of 173 transcripts was upregulated and expression of 305 transcripts was downregulated, compared with expression for control tissues. Of the 478 transcripts, 167 genes could be specifically identified. These genes were grouped into 1 of 8 categories on the basis of their primary physiologic function. Grouping revealed that pathways involving cellular energy production, signaling and communication, and cell structure were generally downregulated, whereas pathways involving cellular defense and stress responses were upregulated. Many previously unreported genes that may contribute to the pathophysiologic aspects of heart disease were identified. Evaluation of global expression patterns provides a molecular portrait of heart failure, yields insights into the pathophysiologic aspects of DCM, and identifies intriguing genes and pathways for further study.

  12. Visual detection of multidrug resistance gene in living cell using the molecular beacon imaging

    NASA Astrophysics Data System (ADS)

    Zhou, Qiumei; Ma, Yi; Gu, Yueqing

    2014-09-01

    A major problem in cancer treatment is the development of resistance to chemotherapeutic agents in tumor cells. Detection of effective prognostic biomarkers and targets are of crucial importance to the management of individualized therapies. However, quantitative analysis of the drug resistance gene had been difficult because of technical limitations. In this study, we designed and used a special hairpin deoxyribonucleic acid (DNA), which served as a beacon for detecting human drug resistance indicater. Upon hybridizing with the target mRNA, the hairpin DNA modified gold nanoparticle beacons (hDAuNP beacons) release the fluorophores attached at 5'end of the oligonucleotide sequence. The fluorescence properties of the beacon before and after the hybridization with the complementary DNA were confirmed in vitro. The hDAuNP beacons could be taken up by living cells with low inherent cytotoxicity and higher stability. hDAuNP beacon imaged by confocal laser scanning microscopy to detect the resistance gene expression. The detected fluorescence in MCF7and MCF7/ADR cells correlates with the specific drug resistance gene expression, which is consistent with the result from Q-PCR. Thus, this approach overcame many of the challenges of previous techniques by creating highly sensitive and effective intracellular probes for monitoring gene expression.

  13. cDNA nucleotide sequence coding for stearoyl-CoA desaturase and its expression in the zebrafish (Danio rerio) embryo.

    PubMed

    Hsieh, S L; Liu, R W; Wu, C H; Cheng, W T; Kuo, Ching-Ming

    2003-12-01

    A cDNA sequence of stearoyl-CoA desaturase (SCD) was determined from zebrafish (Danio rerio) and compared to the corresponding genes in several teleosts. Zebrafish SCD cDNA has a size of 1,061 bp, encodes a polypeptide of 325 amino acids, and shares 88, 85, 84, and 83% similarities with tilapia (Oreochromis mossambicus), grass carp (Ctenopharyngodon idella), common carp (Cyprinus carpio), and milkfish (Chanos chanos), respectively. This 1,061 bp sequence specifies a protein that, in common with other fatty acid desaturases, contains three histidine boxes, believed to be involved in catalysis. These observations suggested that SCD genes are highly conserved. In addition, an oligonucleotide probe complementary to zebrafish SCD mRNA was hybridized to mRNA of approximately 396 bases with Northern blot analysis. The Northern blot and RT-PCR analyses showed that the SCD mRNA was expressed predominantly in the liver, intestine, gill, and muscle, while a lower level was found in the brain. Furthermore, we utilized whole-mount in situ hybridization and real-time quantitative RT-PCR to identify expression of the zebrafish SCD gene at five different stages of development. This revealed that very high levels of transcripts were found in zebrafish at all stages during embryogenesis and early development. Copyright 2003 Wiley-Liss, Inc.

  14. Structured oligonucleotides for target indexing to allow single-vessel PCR amplification and solid support microarray hybridization

    PubMed Central

    Girard, Laurie D.; Boissinot, Karel; Peytavi, Régis; Boissinot, Maurice; Bergeron, Michel G.

    2014-01-01

    The combination of molecular diagnostic technologies is increasingly used to overcome limitations on sensitivity, specificity or multiplexing capabilities, and provide efficient lab-on-chip devices. Two such techniques, PCR amplification and microarray hybridization are used serially to take advantage of the high sensitivity and specificity of the former combined with high multiplexing capacities of the latter. These methods are usually performed in different buffers and reaction chambers. However, these elaborate methods have a high complexity cost related to reagent requirements, liquid storage and the number of reaction chambers to integrate into automated devices. Furthermore, microarray hybridizations have a sequence dependent efficiency not always predictable. In this work, we have developed the concept of a structured oligonucleotide probe which is activated by cleavage from polymerase exonuclease activity. This technology is called SCISSOHR for Structured Cleavage Induced Single-Stranded Oligonucleotide Hybridization Reaction. The SCISSOHR probes enable indexing the target sequence to a tag sequence. The SCISSOHR technology also allows the combination of nucleic acid amplification and microarray hybridization in a single vessel in presence of the PCR buffer only. The SCISSOHR technology uses an amplification probe that is irreversibly modified in presence of the target, releasing a single-stranded DNA tag for microarray hybridization. Each tag is composed of a 3-nucleotidesequence-dependent segment and a unique “target sequence-independent” 14-nucleotide segment allowing for optimal hybridization with minimal cross-hybridization. We evaluated the performance of five (5) PCR buffers to support microarray hybridization, compared to a conventional hybridization buffer. Finally, as a proof of concept, we developed a multiplexed assay for the amplification, detection, and identification of three (3) DNA targets. This new technology will facilitate the design of lab-on-chip microfluidic devices, while also reducing consumable costs. At term, it will allow the cost-effective automation of highly multiplexed assays for detection and identification of genetic targets. PMID:25489607

  15. Structured oligonucleotides for target indexing to allow single-vessel PCR amplification and solid support microarray hybridization.

    PubMed

    Girard, Laurie D; Boissinot, Karel; Peytavi, Régis; Boissinot, Maurice; Bergeron, Michel G

    2015-02-07

    The combination of molecular diagnostic technologies is increasingly used to overcome limitations on sensitivity, specificity or multiplexing capabilities, and provide efficient lab-on-chip devices. Two such techniques, PCR amplification and microarray hybridization are used serially to take advantage of the high sensitivity and specificity of the former combined with high multiplexing capacities of the latter. These methods are usually performed in different buffers and reaction chambers. However, these elaborate methods have high complexity and cost related to reagent requirements, liquid storage and the number of reaction chambers to integrate into automated devices. Furthermore, microarray hybridizations have a sequence dependent efficiency not always predictable. In this work, we have developed the concept of a structured oligonucleotide probe which is activated by cleavage from polymerase exonuclease activity. This technology is called SCISSOHR for Structured Cleavage Induced Single-Stranded Oligonucleotide Hybridization Reaction. The SCISSOHR probes enable indexing the target sequence to a tag sequence. The SCISSOHR technology also allows the combination of nucleic acid amplification and microarray hybridization in a single vessel in presence of the PCR buffer only. The SCISSOHR technology uses an amplification probe that is irreversibly modified in presence of the target, releasing a single-stranded DNA tag for microarray hybridization. Each tag is composed of a 3-nucleotide sequence-dependent segment and a unique "target sequence-independent" 14-nucleotide segment allowing for optimal hybridization with minimal cross-hybridization. We evaluated the performance of five (5) PCR buffers to support microarray hybridization, compared to a conventional hybridization buffer. Finally, as a proof of concept, we developed a multiplexed assay for the amplification, detection, and identification of three (3) DNA targets. This new technology will facilitate the design of lab-on-chip microfluidic devices, while also reducing consumable costs. At term, it will allow the cost-effective automation of highly multiplexed assays for detection and identification of genetic targets.

  16. Detection of human papillomavirus (HPV) DNA in human prostatic tissues by polymerase chain reaction (PCR).

    PubMed

    Sarkar, F H; Sakr, W A; Li, Y W; Sreepathi, P; Crissman, J D

    1993-01-01

    Human papillomavirus (HPV) infections are strongly linked to the pathogenesis of uterine cervical neoplasms, and have been implicated in other cancers of the female genital tract. In contrast, the association of HPV with the cancers of the male urogenital tract is less evident, except in anal and penile cancers. However, recent studies reporting the prevalence of HPV infections in human prostate cancers (60-100% HPV 16 positive vs. no infection of HPV) have raised controversies regarding the prevalence of HPV in benign and neoplastic human prostate. We investigated the prevalence of HPV infections in prostatic intraepithelial neoplasia (PIN) and prostatic adenocarcinomas in 23 surgically resected prostates. Polymerase chain reaction (PCR) was used to amplify HPV 6b/11, 16, and 18 specific DNA sequences, using type specific HPV primers selected from the transforming gene E6-E7. The areas of PIN and cancer in 6 microns H&E stained tissue sections were identified, and respective areas of PIN and cancer were isolated from the adjacent serial sections and used for DNA amplification and HPV detection (Fig. 1). Our results demonstrated the presence of HPV 16 in three carcinomas (13%), using type specific primers in PCR amplified samples. We were not able to demonstrate the presence of other HPV types (HPV 6b/11 or HPV 18) in any of the samples using specific primers. Two of these prostates showed relatively strong positive signals by dot blot analysis, when hybridized with a 32P-labeled HPV 16 type specific oligonucleotide probe. One more sample showed weak positivity, when hybridized with a 32P-labeled HPV 16 type specific oligonucleotide probe. Subsequently, we have confirmed these results by Southern hybridization of the samples transferred to nylon membrane after agarose gel electrophoresis and detected by HPV 16 type specific oligonucleotide probe, using chemiluminescent assay. We, therefore, conclude that HPV infections of the prostate in general are not as common as has been previously claimed by other investigators.

  17. Double stranded nucleic acid biochips

    DOEpatents

    Chernov, Boris; Golova, Julia

    2006-05-23

    This invention describes a new method of constructing double-stranded DNA (dsDNA) microarrays based on the use of pre-synthesized or natural DNA duplexes without a stem-loop structure. The complementary oligonucleotide chains are bonded together by a novel connector that includes a linker for immobilization on a matrix. A non-enzymatic method for synthesizing double-stranded nucleic acids with this novel connector enables the construction of inexpensive and robust dsDNA/dsRNA microarrays. DNA-DNA and DNA-protein interactions are investigated using the microarrays.

  18. Clustered regularly interspaced short palindromic repeats (CRISPRs) analysis of members of the Mycobacterium tuberculosis complex.

    PubMed

    Botelho, Ana; Canto, Ana; Leão, Célia; Cunha, Mónica V

    2015-01-01

    Typical CRISPR (clustered, regularly interspaced, short palindromic repeat) regions are constituted by short direct repeats (DRs), interspersed with similarly sized non-repetitive spacers, derived from transmissible genetic elements, acquired when the cell is challenged with foreign DNA. The analysis of the structure, in number and nature, of CRISPR spacers is a valuable tool for molecular typing since these loci are polymorphic among strains, originating characteristic signatures. The existence of CRISPR structures in the genome of the members of Mycobacterium tuberculosis complex (MTBC) enabled the development of a genotyping method, based on the analysis of the presence or absence of 43 oligonucleotide spacers separated by conserved DRs. This method, called spoligotyping, consists on PCR amplification of the DR chromosomal region and recognition after hybridization of the spacers that are present. The workflow beneath this methodology implies that the PCR products are brought onto a membrane containing synthetic oligonucleotides that have complementary sequences to the spacer sequences. Lack of hybridization of the PCR products to a specific oligonucleotide sequence indicates absence of the correspondent spacer sequence in the examined strain. Spoligotyping gained great notoriety as a robust identification and typing tool for members of MTBC, enabling multiple epidemiological studies on human and animal tuberculosis.

  19. Cy3 and Cy5 dyes attached to oligonucleotide terminus stabilize DNA duplexes: predictive thermodynamic model.

    PubMed

    Moreira, Bernardo G; You, Yong; Owczarzy, Richard

    2015-03-01

    Cyanine dyes are important chemical modifications of oligonucleotides exhibiting intensive and stable fluorescence at visible light wavelengths. When Cy3 or Cy5 dye is attached to 5' end of a DNA duplex, the dye stacks on the terminal base pair and stabilizes the duplex. Using optical melting experiments, we have determined thermodynamic parameters that can predict the effects of the dyes on duplex stability quantitatively (ΔG°, Tm). Both Cy dyes enhance duplex formation by 1.2 kcal/mol on average, however, this Gibbs energy contribution is sequence-dependent. If the Cy5 is attached to a pyrimidine nucleotide of pyrimidine-purine base pair, the stabilization is larger compared to the attachment to a purine nucleotide. This is likely due to increased stacking interactions of the dye to the purine of the complementary strand. Dangling (unpaired) nucleotides at duplex terminus are also known to enhance duplex stability. Stabilization originated from the Cy dyes is significantly larger than the stabilization due to the presence of dangling nucleotides. If both the dangling base and Cy3 are present, their thermodynamic contributions are approximately additive. New thermodynamic parameters improve predictions of duplex folding, which will help design oligonucleotide sequences for biophysical, biological, engineering, and nanotechnology applications. Copyright © 2015. Published by Elsevier B.V.

  20. Genetic characterization of an alloalbumin, albumin Kashmir, using gene amplification and allele-specific oligonucleotides.

    PubMed Central

    Savva, D; Tárnoky, A L; Vickers, M F

    1990-01-01

    The molecular basis for albumin Kashmir was studied using the polymerase chain reaction to amplify a DNA fragment containing codon 501 in exon 12 of the human albumin gene. Southern blots of the amplified DNA were hybridized to oligonucleotide probes specific either for the normal allele of albumin or for albumin Kashmir. The results provide strong evidence that codon 501 in albumin Kashmir is AAG (lysine) instead of GAG (glutamic acid), thus confirming the protein sequences reported. This approach was used to characterize a bisalbuminaemic individual as a carrier for albumin Kashmir. Similar strategies may be devised to study the molecular basis and to identify carriers of other alloalbumins. Images Fig. 1. Fig. 2. PMID:2317208

  1. Minimum probe length for unique identification of all open reading frames in a microbial genome

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sokhansanj, B A; Ng, J; Fitch, J P

    2000-03-05

    In this paper, we determine the minimum hybridization probe length to uniquely identify at least 95% of the open reading frame (ORF) in an organism. We analyze the whole genome sequences of 17 species, 11 bacteria, 4 archaea, and 2 eukaryotes. We also present a mathematical model for minimum probe length based on assuming that all ORFs are random, of constant length, and contain an equal distribution of bases. The model accurately predicts the minimum probe length for all species, but it incorrectly predicts that all ORFs may be uniquely identified. However, a probe length of just 9 bases ismore » adequate to identify over 95% of the ORFs for all 15 prokaryotic species we studied. Using a minimum probe length, while accepting that some ORFs may not be identified and that data will be lost due to hybridization error, may result in significant savings in microarray and oligonucleotide probe design.« less

  2. Inhibition of B cell proliferation by antisense DNA to both alpha and beta forms of Fc epsilon R II.

    PubMed

    Bhatti, L; Behle, K; Stevens, R H

    1992-10-01

    Epstein-Barr Virus (EBV) infection activates B lymphocyte proliferation through partially understood mechanisms, resulting in phenotypic changes, including the appearance of new antigens. One such antigen is Fc epsilon R II/CD-23 which may be relevant for B cell proliferation. We have used anti-sense oligonucleotides to study the importance of the two forms of this molecule for proliferation in the EBV-transformed, Fc epsilon R II +ve lymphoblastoid B cell line, RPMI 8866. Anti-sense oligodeoxynucleotides were generated to the two forms of Fc epsilon R II; Fc epsilon R IIa (alpha) and IIb (beta) which differ only in their intracytoplasmic domains. Addition of increasing concentrations of anti-sense oligonucleotides, ranging from 1 to 30 microM, significantly decreased cellular proliferation as measured by the incorporation of [3H]thymidine (inhibition range 8-88%). Optimum inhibition of cellular proliferation was apparent at 15 microM concentration of both anti-sense Fc epsilon R IIa and IIb (Fc epsilon R IIa, mean +/- SE = 75 +/- 7% inhibition, p less than 0.001; Fc epsilon R IIb, mean +/- SE = 71 +/- 7% inhibition, p less than 0.001). Anti-sense oligonucleotides complementary to the common part of Fc epsilon R II resulted in a similar inhibition of proliferation. Sense oligonucleotides did not induce significant inhibition. Preincubation of sense and anti-sense oligonucleotides resulted in an abrogation of proliferation inhibition. Moreover, none of these oligonucleotides had any effect on a Fc epsilon R II -ve cell line. Incubation with both anti-sense IIa and IIb resulted in additive, but not synergistic inhibition of proliferation. Addition of soluble Fc epsilon R II did not reverse inhibition of proliferation, suggesting that membrane-bound or intracellular rather than soluble Fc epsilon R II was important for the induced proliferation. Analysis of cell surface expression for Fc epsilon II indicated that while there was a pronounced effect on cell number following incubation with anti-sense oligonucleotides, surface expression of Fc epsilon R II was consistent as measured over different time points. PCR analysis revealed that while most cells expressed either the alpha or the beta form of Fc epsilon R II, EBV-transformed cell lines, particularly RPMI 8866, were found to express both alpha and beta forms simultaneously. This may constitute a mechanism whereby EBV infection confers an immortal state to the cell, resulting in its uncontrolled proliferation. Cell lines expressing only one receptor form, either alpha or beta, were unaffected after incubation with anti-sense oligonucleotides.(ABSTRACT TRUNCATED AT 400 WORDS)

  3. Multiplexed screening assay for mRNA combining nuclease protection with luminescent array detection.

    PubMed

    Martel, Ralph R; Botros, Ihab W; Rounseville, Matthew P; Hinton, James P; Staples, Robin R; Morales, David A; Farmer, John B; Seligmann, Bruce E

    2002-11-01

    The principles and performance are described for the ArrayPlate mRNA assay, a multiplexed mRNA assay for high-throughput and high-content screening and drug development. THP-1 monocytes grown and subjected to compound treatments in 96-well plates were subjected to a multiplexed nuclease protection assay in situ. The nuclease protection assay destroyed all cell-derived mRNA, but left intact stoichiometric amounts of 16 target-specific oligonucleotide probes. Upon transfer of processed cell lysates to a microplate that contained a 16-element oligonucleotide array at the bottom of each well, the various probe species were separated by immobilization at predefined elements of the array. Quantitative detection of array-bound probes was by enzyme-mediated chemiluminescence. A high-resolution charge-coupled device imager was used for the simultaneous readout of all 1536 array elements in a 96-well plate. For the measurement of 16 genes in samples of 25000 cells, the average standard deviation from well to well within a plate was 8.6% of signal intensity and was 10.8% from plate to plate. Assay response was linear and reproducibility was constant for all detected genes in samples ranging from 1000 to 50000 cells. When THP-1 monocytes were differentiated with phorbol ester and subsequently activated with bacterial lipopolysaccharide that contained different concentrations of dexamethasone, dose-dependent effects of dexamethasone on the mRNA levels of several genes were observed.

  4. Cleavable DNA-protein hybrid molecular beacon: A novel efficient signal translator for sensitive fluorescence anisotropy bioassay.

    PubMed

    Hu, Pan; Yang, Bin

    2016-01-15

    Due to its unique features such as high sensitivity, homogeneous format, and independence on fluorescent intensity, fluorescence anisotropy (FA) assay has become a hotspot of study in oligonucleotide-based bioassays. However, until now most FA probes require carefully customized structure designs, and thus are neither generalizable for different sensing systems nor effective to obtain sufficient signal response. To address this issue, a cleavable DNA-protein hybrid molecular beacon was successfully engineered for signal amplified FA bioassay, via combining the unique stable structure of molecular beacon and the large molecular mass of streptavidin. Compared with single DNA strand probe or conventional molecular beacon, the DNA-protein hybrid molecular beacon exhibited a much higher FA value, which was potential to obtain high signal-background ratio in sensing process. As proof-of-principle, this novel DNA-protein hybrid molecular beacon was further applied for FA bioassay using DNAzyme-Pb(2+) as a model sensing system. This FA assay approach could selectively detect as low as 0.5nM Pb(2+) in buffer solution, and also be successful for real samples analysis with good recovery values. Compatible with most of oligonucleotide probes' designs and enzyme-based signal amplification strategies, the molecular beacon can serve as a novel signal translator to expand the application prospect of FA technology in various bioassays. Copyright © 2015 Elsevier B.V. All rights reserved.

  5. Impact of point-mutations on the hybridization affinity of surface-bound DNA/DNA and RNA/DNA oligonucleotide-duplexes: Comparison of single base mismatches and base bulges

    PubMed Central

    Naiser, Thomas; Ehler, Oliver; Kayser, Jona; Mai, Timo; Michel, Wolfgang; Ott, Albrecht

    2008-01-01

    Background The high binding specificity of short 10 to 30 mer oligonucleotide probes enables single base mismatch (MM) discrimination and thus provides the basis for genotyping and resequencing microarray applications. Recent experiments indicate that the underlying principles governing DNA microarray hybridization – and in particular MM discrimination – are not completely understood. Microarrays usually address complex mixtures of DNA targets. In order to reduce the level of complexity and to study the problem of surface-based hybridization with point defects in more detail, we performed array based hybridization experiments in well controlled and simple situations. Results We performed microarray hybridization experiments with short 16 to 40 mer target and probe lengths (in situations without competitive hybridization) in order to systematically investigate the impact of point-mutations – varying defect type and position – on the oligonucleotide duplex binding affinity. The influence of single base bulges and single base MMs depends predominantly on position – it is largest in the middle of the strand. The position-dependent influence of base bulges is very similar to that of single base MMs, however certain bulges give rise to an unexpectedly high binding affinity. Besides the defect (MM or bulge) type, which is the second contribution in importance to hybridization affinity, there is also a sequence dependence, which extends beyond the defect next-neighbor and which is difficult to quantify. Direct comparison between binding affinities of DNA/DNA and RNA/DNA duplexes shows, that RNA/DNA purine-purine MMs are more discriminating than corresponding DNA/DNA MMs. In DNA/DNA MM discrimination the affected base pair (C·G vs. A·T) is the pertinent parameter. We attribute these differences to the different structures of the duplexes (A vs. B form). Conclusion We have shown that DNA microarrays can resolve even subtle changes in hybridization affinity for simple target mixtures. We have further shown that the impact of point defects on oligonucleotide stability can be broken down to a hierarchy of effects. In order to explain our observations we propose DNA molecular dynamics – in form of zipping of the oligonucleotide duplex – to play an important role. PMID:18477387

  6. DNA microarrays for identifying fishes.

    PubMed

    Kochzius, M; Nölte, M; Weber, H; Silkenbeumer, N; Hjörleifsdottir, S; Hreggvidsson, G O; Marteinsson, V; Kappel, K; Planes, S; Tinti, F; Magoulas, A; Garcia Vazquez, E; Turan, C; Hervet, C; Campo Falgueras, D; Antoniou, A; Landi, M; Blohm, D

    2008-01-01

    In many cases marine organisms and especially their diverse developmental stages are difficult to identify by morphological characters. DNA-based identification methods offer an analytically powerful addition or even an alternative. In this study, a DNA microarray has been developed to be able to investigate its potential as a tool for the identification of fish species from European seas based on mitochondrial 16S rDNA sequences. Eleven commercially important fish species were selected for a first prototype. Oligonucleotide probes were designed based on the 16S rDNA sequences obtained from 230 individuals of 27 fish species. In addition, more than 1200 sequences of 380 species served as sequence background against which the specificity of the probes was tested in silico. Single target hybridisations with Cy5-labelled, PCR-amplified 16S rDNA fragments from each of the 11 species on microarrays containing the complete set of probes confirmed their suitability. True-positive, fluorescence signals obtained were at least one order of magnitude stronger than false-positive cross-hybridisations. Single nontarget hybridisations resulted in cross-hybridisation signals at approximately 27% of the cases tested, but all of them were at least one order of magnitude lower than true-positive signals. This study demonstrates that the 16S rDNA gene is suitable for designing oligonucleotide probes, which can be used to differentiate 11 fish species. These data are a solid basis for the second step to create a "Fish Chip" for approximately 50 fish species relevant in marine environmental and fisheries research, as well as control of fisheries products.

  7. Locus-specific oligonucleotide probes increase the usefulness of inter-Alu polymorphisms

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jarnik, M.; Tang, J.Q.; Korab-Laskowska, M.

    1994-09-01

    Most of the mapping approaches are based on single-locus codominant markers of known location. Their multiplex ratio, defined as the number of loci that can be simultaneously tested, is typically one. An increased multiplex ratio was obtained by typing anonymous polymorphisms using PCR primers anchored in ubiquitous Alu-repeats. These so called alumorphs are revealed by inter-Alu-PCR and seen as the presence or absence of an amplified band of a given length. We decided to map alumorphs and to develop locus-specific oligonucleotide (LSO) probes to facilitate their use and transfer among different laboratories. We studied the segregation of alumorphs in eightmore » CEPH families, using two distinct Alu-primers, both directing PCR between the repeats in a tail-to-tail orientation. The segregating bands were assigned to chromosomal locations by two-point linkage analysis with CEPH markers (V6.0). They were excised from dried gels, reamplified, cloned and sequenced. The resulting LSOs were used as hybridization probes (i) to confirm chromosomal assignments in a human/hamster somatic cell hybrid panel, and (ii) to group certain allelic length variants, originally coded as separate dominant markres, into more informative codominant loci. These codominants were then placed by multipoint analysis on a microsatellite Genethon map. Finally, the LSO probes were used as polymorphic STSs, to identify by hybridization the corresponding markers among products of inter-Alu-PCR. The use of LSOs converts alumorphs into a system of non-anonymous, often multiallelic codominant markes which can be simultaneously typed, thus achieving the goal of high multiplex ratio.« less

  8. Polymerase chain reaction (PCR) amplification of a nucleoprotein gene sequence of infectious hematopoietic necrosis virus

    USGS Publications Warehouse

    Arakawa, C.K.; Deering, R.E.; Higman, K.H.; Oshima, K.H.; O'Hara, P.J.; Winton, J.R.

    1990-01-01

    The polymerase chain reaction [PCR) was used to amplify a portion of the nucleoprotein [NI gene of infectious hematopoietic necrosis virus (IHNV). Using a published sequence for the Round Butte isolate of IHNV, a pair of PCR pnmers was synthesized that spanned a 252 nucleotide region of the N gene from residue 319 to residue 570 of the open reading frame. This region included a 30 nucleotide target sequence for a synthetic oligonucleotide probe developed for detection of IHNV N gene messenger RNA. After 25 cycles of amplification of either messenger or genomic RNA, the PCR product (DNA) of the expected size was easily visible on agarose gels stained with ethidium bromide. The specificity of the amplified DNA was confirmed by Southern and dot-blot analysis using the biotinylated oligonucleotide probe. The PCR was able to amplify the N gene sequence of purified genomic RNA from isolates of IHNV representing 5 different electropherotypes. Using the IHNV primer set, no PCR product was obtained from viral hemorrhagic septicemia virus RNA, but 2 higher molecular weight products were synthesized from hirame rhabdovirus RNA that did not hybridize with the biotinylated probe. The PCR could be efficiently performed with all IHNV genomic RNA template concentrations tested (1 ng to 1 pg). The lowest level of sensitivity was not determined. The PCR was used to amplify RNA extracted from infected cell cultures and selected tissues of Infected rainbow trout. The combination of PCR and nucleic acid probe promises to provide a detection method for IHNV that is rapid, h~ghly specific, and sensitive.

  9. SigReannot-mart: a query environment for expression microarray probe re-annotations.

    PubMed

    Moreews, François; Rauffet, Gaelle; Dehais, Patrice; Klopp, Christophe

    2011-01-01

    Expression microarrays are commonly used to study transcriptomes. Most of the arrays are now based on oligo-nucleotide probes. Probe design being a tedious task, it often takes place once at the beginning of the project. The oligo set is then used for several years. During this time period, the knowledge gathered by the community on the genome and the transcriptome increases and gets more precise. Therefore re-annotating the set is essential to supply the biologists with up-to-date annotations. SigReannot-mart is a query environment populated with regularly updated annotations for different oligo sets. It stores the results of the SigReannot pipeline that has mainly been used on farm and aquaculture species. It permits easy extraction in different formats using filters. It is used to compare probe sets on different criteria, to choose the set for a given experiment to mix probe sets in order to create a new one.

  10. Oligonucleotide Sensor Based on Selective Capture of Upconversion Nanoparticles Triggered by Target-Induced DNA Interstrand Ligand Reaction

    PubMed Central

    2017-01-01

    We present a sensor that exploits the phenomenon of upconversion luminescence to detect the presence of specific sequences of small oligonucleotides such as miRNAs among others. The sensor is based on NaYF4:Yb,Er@SiO2 nanoparticles functionalized with ssDNA that contain azide groups on the 3′ ends. In the presence of a target sequence, interstrand ligation is possible via the click-reaction between one azide of the upconversion probe and a DBCO-ssDNA-biotin probe present in the solution. As a result of this specific and selective process, biotin is covalently attached to the surface of the upconversion nanoparticles. The presence of biotin on the surface of the nanoparticles allows their selective capture on a streptavidin-coated support, giving a luminescent signal proportional to the amount of target strands present in the test samples. With the aim of studying the analytical properties of the sensor, total RNA samples were extracted from healthy mosquitoes and were spiked-in with a specific target sequence at different concentrations. The result of these experiments revealed that the sensor was able to detect 10–17 moles per well (100 fM) of the target sequence in mixtures containing 100 ng of total RNA per well. A similar limit of detection was found for spiked human serum samples, demonstrating the suitability of the sensor for detecting specific sequences of small oligonucleotides under real conditions. In contrast, in the presence of noncomplementary sequences or sequences having mismatches, the luminescent signal was negligible or conspicuously reduced. PMID:28332400

  11. 5' modification of duplex DNA with a ruthenium electron donor-acceptor pair using solid-phase DNA synthesis

    NASA Technical Reports Server (NTRS)

    Frank, Natia L.; Meade, Thomas J.

    2003-01-01

    Incorporation of metalated nucleosides into DNA through covalent modification is crucial to measurement of thermal electron-transfer rates and the dependence of these rates with structure, distance, and position. Here, we report the first synthesis of an electron donor-acceptor pair of 5' metallonucleosides and their subsequent incorporation into oligonucleotides using solid-phase DNA synthesis techniques. Large-scale syntheses of metal-containing oligonucleotides are achieved using 5' modified phosporamidites containing [Ru(acac)(2)(IMPy)](2+) (acac is acetylacetonato; IMPy is 2'-iminomethylpyridyl-2'-deoxyuridine) (3) and [Ru(bpy)(2)(IMPy)](2+) (bpy is 2,2'-bipyridine; IMPy is 2'-iminomethylpyridyl-2'-deoxyuridine) (4). Duplexes formed with the metal-containing oligonucleotides exhibit thermal stability comparable to the corresponding unmetalated duplexes (T(m) of modified duplex = 49 degrees C vs T(m) of unmodified duplex = 47 degrees C). Electrochemical (3, E(1/2) = -0.04 V vs NHE; 4, E(1/2) = 1.12 V vs NHE), absorption (3, lambda(max) = 568, 369 nm; 4, lambda(max) = 480 nm), and emission (4, lambda(max) = 720 nm, tau = 55 ns, Phi = 1.2 x 10(-)(4)) data for the ruthenium-modified nucleosides and oligonucleotides indicate that incorporation into an oligonucleotide does not perturb the electronic properties of the ruthenium complex or the DNA significantly. In addition, the absence of any change in the emission properties upon metalated duplex formation suggests that the [Ru(bpy)(2)(IMPy)](2+)[Ru(acac)(2)(IMPy)](2+) pair will provide a valuable probe for DNA-mediated electron-transfer studies.

  12. Electrochemical DNA biosensor for bovine papillomavirus detection using polymeric film on screen-printed electrode.

    PubMed

    Nascimento, Gustavo A; Souza, Elaine V M; Campos-Ferreira, Danielly S; Arruda, Mariana S; Castelletti, Carlos H M; Wanderley, Marcela S O; Ekert, Marek H F; Bruneska, Danyelly; Lima-Filho, José L

    2012-01-01

    A new electrochemical DNA biosensor for bovine papillomavirus (BPV) detection that was based on screen-printed electrodes was comprehensively studied by electrochemical methods of cyclic voltammetry (CV) and differential pulse voltammetry (DPV). A BPV probe was immobilised on a working electrode (gold) modified with a polymeric film of poly-L-lysine (PLL) and chitosan. The experimental design was carried out to evaluate the influence of polymers, probe concentration (BPV probe) and immobilisation time on the electrochemical reduction of methylene blue (MB). The polymer poly-L-lysine (PLL), a probe concentration of 1 μM and an immobilisation time of 60 min showed the best result for the BPV probe immobilisation. With the hybridisation of a complementary target sequence (BPV target), the electrochemical signal decreased compared to a BPV probe immobilised on the modified PLL-gold electrode. Viral DNA that was extracted from cattle with papillomatosis also showed a decrease in the MB electrochemical reduction, which suggested that the decreased electrochemical signal corresponded to a bovine papillomavirus infection. The hybridisation specificity experiments further indicated that the biosensor could discriminate the complementary sequence from the non-complementary sequence. Thus, the results showed that the development of analytical devices, such as a biosensor, could assist in the rapid and efficient detection of bovine papillomavirus DNA and help in the prevention and treatment of papillomatosis in cattle. Copyright © 2012 Elsevier B.V. All rights reserved.

  13. Cloning and expression of a cDNA coding for a human monocyte-derived plasminogen activator inhibitor.

    PubMed

    Antalis, T M; Clark, M A; Barnes, T; Lehrbach, P R; Devine, P L; Schevzov, G; Goss, N H; Stephens, R W; Tolstoshev, P

    1988-02-01

    Human monocyte-derived plasminogen activator inhibitor (mPAI-2) was purified to homogeneity from the U937 cell line and partially sequenced. Oligonucleotide probes derived from this sequence were used to screen a cDNA library prepared from U937 cells. One positive clone was sequenced and contained most of the coding sequence as well as a long incomplete 3' untranslated region (1112 base pairs). This cDNA sequence was shown to encode mPAI-2 by hybrid-select translation. A cDNA clone encoding the remainder of the mPAI-2 mRNA was obtained by primer extension of U937 poly(A)+ RNA using a probe complementary to the mPAI-2 coding region. The coding sequence for mPAI-2 was placed under the control of the lambda PL promoter, and the protein expressed in Escherichia coli formed a complex with urokinase that could be detected immunologically. By nucleotide sequence analysis, mPAI-2 cDNA encodes a protein containing 415 amino acids with a predicted unglycosylated Mr of 46,543. The predicted amino acid sequence of mPAI-2 is very similar to placental PAI-2 (3 amino acid differences) and shows extensive homology with members of the serine protease inhibitor (serpin) superfamily. mPAI-2 was found to be more homologous to ovalbumin (37%) than the endothelial plasminogen activator inhibitor, PAI-1 (26%). Like ovalbumin, mPAI-2 appears to have no typical amino-terminal signal sequence. The 3' untranslated region of the mPAI-2 cDNA contains a putative regulatory sequence that has been associated with the inflammatory mediators.

  14. Cloning and expression of a cDNA coding for a human monocyte-derived plasminogen activator inhibitor.

    PubMed Central

    Antalis, T M; Clark, M A; Barnes, T; Lehrbach, P R; Devine, P L; Schevzov, G; Goss, N H; Stephens, R W; Tolstoshev, P

    1988-01-01

    Human monocyte-derived plasminogen activator inhibitor (mPAI-2) was purified to homogeneity from the U937 cell line and partially sequenced. Oligonucleotide probes derived from this sequence were used to screen a cDNA library prepared from U937 cells. One positive clone was sequenced and contained most of the coding sequence as well as a long incomplete 3' untranslated region (1112 base pairs). This cDNA sequence was shown to encode mPAI-2 by hybrid-select translation. A cDNA clone encoding the remainder of the mPAI-2 mRNA was obtained by primer extension of U937 poly(A)+ RNA using a probe complementary to the mPAI-2 coding region. The coding sequence for mPAI-2 was placed under the control of the lambda PL promoter, and the protein expressed in Escherichia coli formed a complex with urokinase that could be detected immunologically. By nucleotide sequence analysis, mPAI-2 cDNA encodes a protein containing 415 amino acids with a predicted unglycosylated Mr of 46,543. The predicted amino acid sequence of mPAI-2 is very similar to placental PAI-2 (3 amino acid differences) and shows extensive homology with members of the serine protease inhibitor (serpin) superfamily. mPAI-2 was found to be more homologous to ovalbumin (37%) than the endothelial plasminogen activator inhibitor, PAI-1 (26%). Like ovalbumin, mPAI-2 appears to have no typical amino-terminal signal sequence. The 3' untranslated region of the mPAI-2 cDNA contains a putative regulatory sequence that has been associated with the inflammatory mediators. Images PMID:3257578

  15. Oligonucleotide Microarray for 16S rRNA Gene-Based Detection of All Recognized Lineages of Sulfate-Reducing Prokaryotes in the Environment

    PubMed Central

    Loy, Alexander; Lehner, Angelika; Lee, Natuschka; Adamczyk, Justyna; Meier, Harald; Ernst, Jens; Schleifer, Karl-Heinz; Wagner, Michael

    2002-01-01

    For cultivation-independent detection of sulfate-reducing prokaryotes (SRPs) an oligonucleotide microarray consisting of 132 16S rRNA gene-targeted oligonucleotide probes (18-mers) having hierarchical and parallel (identical) specificity for the detection of all known lineages of sulfate-reducing prokaryotes (SRP-PhyloChip) was designed and subsequently evaluated with 41 suitable pure cultures of SRPs. The applicability of SRP-PhyloChip for diversity screening of SRPs in environmental and clinical samples was tested by using samples from periodontal tooth pockets and from the chemocline of a hypersaline cyanobacterial mat from Solar Lake (Sinai, Egypt). Consistent with previous studies, SRP-PhyloChip indicated the occurrence of Desulfomicrobium spp. in the tooth pockets and the presence of Desulfonema- and Desulfomonile-like SRPs (together with other SRPs) in the chemocline of the mat. The SRP-PhyloChip results were confirmed by several DNA microarray-independent techniques, including specific PCR amplification, cloning, and sequencing of SRP 16S rRNA genes and the genes encoding the dissimilatory (bi)sulfite reductase (dsrAB). PMID:12324358

  16. Synthesis, hybridization characteristics, and fluorescence properties of oligonucleotides modified with nucleobase-functionalized locked nucleic acid adenosine and cytidine monomers.

    PubMed

    Kaura, Mamta; Kumar, Pawan; Hrdlicka, Patrick J

    2014-07-03

    Conformationally restricted nucleotides such as locked nucleic acid (LNA) are very popular as affinity-, specificity-, and stability-enhancing modifications in oligonucleotide chemistry to produce probes for nucleic acid targeting applications in molecular biology, biotechnology, and medicinal chemistry. Considerable efforts have been devoted in recent years to optimize the biophysical properties of LNA through additional modification of the sugar skeleton. We recently introduced C5-functionalization of LNA uridines as an alternative and synthetically more straightforward approach to improve the biophysical properties of LNA. In the present work, we set out to test the generality of this concept by studying the characteristics of oligonucleotides modified with four different C5-functionalized LNA cytidine and C8-functionalized LNA adenosine monomers. The results strongly suggest that C5-functionalization of LNA pyrimidines is indeed a viable approach for improving the binding affinity, target specificity, and/or enzymatic stability of LNA-modified ONs, whereas C8-functionalization of LNA adenosines is detrimental to binding affinity and specificity. These insights will impact the future design of conformationally restricted nucleotides for nucleic acid targeting applications.

  17. Specific Discrimination of Three Pathogenic Salmonella enterica subsp. enterica Serotypes by carB-Based Oligonucleotide Microarray

    PubMed Central

    Shin, Hwa Hui; Hwang, Byeong Hee; Seo, Jeong Hyun

    2014-01-01

    It is important to rapidly and selectively detect and analyze pathogenic Salmonella enterica subsp. enterica in contaminated food to reduce the morbidity and mortality of Salmonella infection and to guarantee food safety. In the present work, we developed an oligonucleotide microarray containing duplicate specific capture probes based on the carB gene, which encodes the carbamoyl phosphate synthetase large subunit, as a competent biomarker evaluated by genetic analysis to selectively and efficiently detect and discriminate three S. enterica subsp. enterica serotypes: Choleraesuis, Enteritidis, and Typhimurium. Using the developed microarray system, three serotype targets were successfully analyzed in a range as low as 1.6 to 3.1 nM and were specifically discriminated from each other without nonspecific signals. In addition, the constructed microarray did not have cross-reactivity with other common pathogenic bacteria and even enabled the clear discrimination of the target Salmonella serotype from a bacterial mixture. Therefore, these results demonstrated that our novel carB-based oligonucleotide microarray can be used as an effective and specific detection system for S. enterica subsp. enterica serotypes. PMID:24185846

  18. Specific discrimination of three pathogenic Salmonella enterica subsp. enterica serotypes by carB-based oligonucleotide microarray.

    PubMed

    Shin, Hwa Hui; Hwang, Byeong Hee; Seo, Jeong Hyun; Cha, Hyung Joon

    2014-01-01

    It is important to rapidly and selectively detect and analyze pathogenic Salmonella enterica subsp. enterica in contaminated food to reduce the morbidity and mortality of Salmonella infection and to guarantee food safety. In the present work, we developed an oligonucleotide microarray containing duplicate specific capture probes based on the carB gene, which encodes the carbamoyl phosphate synthetase large subunit, as a competent biomarker evaluated by genetic analysis to selectively and efficiently detect and discriminate three S. enterica subsp. enterica serotypes: Choleraesuis, Enteritidis, and Typhimurium. Using the developed microarray system, three serotype targets were successfully analyzed in a range as low as 1.6 to 3.1 nM and were specifically discriminated from each other without nonspecific signals. In addition, the constructed microarray did not have cross-reactivity with other common pathogenic bacteria and even enabled the clear discrimination of the target Salmonella serotype from a bacterial mixture. Therefore, these results demonstrated that our novel carB-based oligonucleotide microarray can be used as an effective and specific detection system for S. enterica subsp. enterica serotypes.

  19. Colorimetry and SERS dual-mode detection of telomerase activity: combining rapid screening with high sensitivity.

    PubMed

    Zong, Shenfei; Wang, Zhuyuan; Chen, Hui; Hu, Guohua; Liu, Min; Chen, Peng; Cui, Yiping

    2014-01-01

    As an important biomarker and therapeutic target, telomerase has attracted considerable attention concerning its detection and monitoring. Here, we present a colorimetry and surface enhanced Raman scattering (SERS) dual-mode telomerase activity detection method, which has several distinctive advantages. First, colorimetric functionality allows rapid preliminary discrimination of telomerase activity by the naked eye. Second, the employment of SERS technique results in greatly improved detection sensitivity. Third, the combination of colorimetry and SERS into one detection system can ensure highly efficacious and sensitive screening of numerous samples. Besides, the avoidance of polymerase chain reaction (PCR) procedures further guarantees fine reliability and simplicity. Generally, the presented method is realized by an "elongate and capture" procedure. To be specific, gold nanoparticles modified with Raman molecules and telomeric repeat complementary oligonucleotide are employed as the colorimetric-SERS bifunctional reporting nanotag, while magnetic nanoparticles functionalized with telomerase substrate oligonucleotide are used as the capturing substrate. Telomerase can synthesize and elongate telomeric repeats onto the capturing substrate. The elongated telomeric repeats subsequently facilitate capturing of the reporting nanotag via hybridization between telomeric repeat and its complementary strand. The captured nanotags can cause a significant difference in the color and SERS intensity of the magnetically separated sediments. Thus both the color and SERS can be used as indicators of the telomerase activity. With fast screening ability and outstanding sensitivity, we anticipate that this method would greatly promote practical application of telomerase-based early-stage cancer diagnosis.

  20. Adjuvanticity of a CTLA-4 3' UTR complementary oligonucleotide for emulsion formulated recombinant subunit and inactivated vaccines.

    PubMed

    Li, Xin; Yang, Lei; Zhao, Peiyan; Yao, Yun; Lu, Fangjie; Tu, Liqun; Liu, Jiwei; Li, Zhiqin; Yu, Yongli; Wang, Liying

    2017-04-25

    Cytotoxic T-lymphocyte antigen 4 (CTLA-4) is recognized as a critical inhibitory regulator of T-cell proliferation and activation, opposing the action of CD28-mediated co-stimulation. Interfering or blocking CTLA-4 can result in continuous T-cell activation required for the full immune response to pathogenic microbes and vaccines. To test if nucleic acid-based CTLA-4 inhibitors could be developed into a novel adjuvant, we designed two oligonucleotides, CMD-1 and CMD-2, with the sequences complementary to the conserve regions identical between human and mouse CTLA-4 mRNA 3' untranslated region (3' UTR), and tested their in vitro effects on CTLA-4 production and their adjuvanticity for vaccines in mice. We found that CMD-1 inhibited the antigen-induced CTLA-4 up-regulation on the CD4 + T cells by interfering its mRNA expression, maintained higher levels of CD80 and CD86 on the CD11c + cells and promoted the recalled proliferation of the CD4 + T cells and CD19 + B cells, and that the CMD-1 enhanced the antibody response against recombinant PCV2b capsid protein or inactivated foot-and-mouth disease virus in both ICR and BALB/c mice. These data suggest that the CMD-1 could be used as a novel vaccine adjuvant capable of inhibiting inhibitory signals rather than inducing stimulatory signals of immune cells. Copyright © 2017 Elsevier Ltd. All rights reserved.

  1. A new class of homogeneous nucleic acid probes based on specific displacement hybridization

    PubMed Central

    Li, Qingge; Luan, Guoyan; Guo, Qiuping; Liang, Jixuan

    2002-01-01

    We have developed a new class of probes for homogeneous nucleic acid detection based on the proposed displacement hybridization. Our probes consist of two complementary oligodeoxyribonucleotides of different length labeled with a fluorophore and a quencher in close proximity in the duplex. The probes on their own are quenched, but they become fluorescent upon displacement hybridization with the target. These probes display complete discrimination between a perfectly matched target and single nucleotide mismatch targets. A comparison of double-stranded probes with corresponding linear probes confirms that the presence of the complementary strand significantly enhances their specificity. Using four such probes labeled with different color fluorophores, each designed to recognize a different target, we have demonstrated that multiple targets can be distinguished in the same solution, even if they differ from one another by as little as a single nucleotide. Double-stranded probes were used in real-time nucleic acid amplifications as either probes or as primers. In addition to its extreme specificity and flexibility, the new class of probes is simple to design and synthesize, has low cost and high sensitivity and is accessible to a wide range of labels. This class of probes should find applications in a variety of areas wherever high specificity of nucleic acid hybridization is relevant. PMID:11788731

  2. Distribution of bacterial biomass and activity in the marginal ice zone of the central Barents Sea during summer

    NASA Astrophysics Data System (ADS)

    Howard-Jones, M. H.; Ballard, V. D.; Allen, A. E.; Frischer, M. E.; Verity, P. G.

    2002-12-01

    The purpose of this study was to determine bacterioplankton abundance and activity in the Barents Sea using the novel modified vital stain and probe (mVSP) method. The mVSP is a protocol that combines DAPI and propidium iodide staining with 16S rRNA eubacterial-specific oligonucleotide probes to determine the physiological status of individual microbial cells. Bacterial abundance and metabolic activity were measured in near-surface waters and with depth at stations in the central Barents Sea during a cruise in June/July 1999. Viral abundance was also determined for 19 transect stations and at depth (2-200 m) for five intensive 24-h stations. In general, bacterial and viral abundances varied across the transect, but showed peaks of abundance (6×10 9 cells l -1, 9×10 9 viruses l -1) in Polar Front water masses. Viruses were abundant in seawater and exceeded bacterial abundance. Metabolic activity was determined for individual cells using 16S rRNA eubacterial-specific oligonucleotide probes, and for the total community with 3H-leucine incorporation. Activity measured by oligonucleotide probes increased from south to north. The fraction of cells that were active was lowest in the southern Barents Sea (20%) and highest in the Polar Front (53%). The proportion of cells at the 24-h stations that were determined to be active decreased with depth, but not with distance from ice cover. Leucine incorporation rates varied significantly and did not always correlate with probe measurements. The proportion of total cells that had compromised membranes and were therefore considered dead remained relatively constant (<10%) across the transect. The percent of dead cells in the near surface waters and at depth were statistically similar. The percent dead cells made up only a small fraction of the total population at the 24-h stations. The largest and most variable fraction of cells were those classified as low activity (25-80%), which supports the hypothesis that a significant fraction of cells in aquatic ecosystems are inactive. Bacterioplankton production rates ranged from <0.05 to 2.8 mg C m -3 day -1. Growth rates ranged from <0.05 to 0.25 day -1, implying turnover rates of 2.5 to >200 days. Our results demonstrate that bacterioplankton and viruses are dynamic but ubiquitous features of Arctic microbial communities. The contribution of bacteria and viruses to Arctic food webs is discussed.

  3. Impedimetric DNA biosensor based on a nanoporous alumina membrane for the detection of the specific oligonucleotide sequence of dengue virus.

    PubMed

    Deng, Jiajia; Toh, Chee-Seng

    2013-06-17

    A novel and integrated membrane sensing platform for DNA detection is developed based on an anodic aluminum oxide (AAO) membrane. Platinum electrodes (~50-100 nm thick) are coated directly on both sides of the alumina membrane to eliminate the solution resistance outside the nanopores. The electrochemical impedance technique is employed to monitor the impedance changes within the nanopores upon DNA binding. Pore resistance (Rp) linearly increases in response towards the increasing concentration of the target DNA in the range of 1 × 10⁻¹² to 1 × 10⁻⁶ M. Moreover, the biosensor selectively differentiates the complementary sequence from single base mismatched (MM-1) strands and non-complementary strands. This study reveals a simple, selective and sensitive method to fabricate a label-free DNA biosensor.

  4. Protocol for chromosome-specific probe construction using PRINS, micromanipulation and DOP-PCR techniques.

    PubMed

    Passamani, Paulo Z; Carvalho, Carlos R; Soares, Fernanda A F

    2018-01-01

    Chromosome-specific probes have been widely used in molecular cytogenetics, being obtained with different methods. In this study, a reproducible protocol for construction of chromosome-specific probes is proposed which associates in situ amplification (PRINS), micromanipulation and degenerate oligonucleotide-primed PCR (DOP-PCR). Human lymphocyte cultures were used to obtain metaphases from male and female individuals. The chromosomes were amplified via PRINS, and subcentromeric fragments of the X chromosome were microdissected using microneedles coupled to a phase contrast microscope. The fragments were amplified by DOP-PCR and labeled with tetramethyl-rhodamine-5-dUTP. The probes were used in fluorescent in situ hybridization (FISH) procedure to highlight these specific regions in the metaphases. The results show one fluorescent red spot in male and two in female X chromosomes and interphase nuclei.

  5. [Identification of human pathogenic variola and monkeypox viruses by real-time polymerase chain reaction].

    PubMed

    Kostina, E V; Gavrilova, E V; Riabinin, V A; Shchelkunov, S N; Siniakov, A N

    2009-01-01

    A kit of specific oligonucleotide primers and hybridization probes has been proposed to detect orthopoxviruses (OPV) and to discriminate human pathogenic viruses, such as variola virus and monkey virus by real-time polymerase chain reaction (PCR). For real-time PCR, the following pairs of fluorophore and a fluorescence quencher were used: TAMRA-BHQ2 for genus-specific probes and FAM-BHQ1 for species-specific ones (variola virus, monkeypox virus, ectomelia virus). The specificity of this assay was tested on 38 strains of 6 OPV species and it was 100%.

  6. Targeted Capture and High-Throughput Sequencing Using Molecular Inversion Probes (MIPs).

    PubMed

    Cantsilieris, Stuart; Stessman, Holly A; Shendure, Jay; Eichler, Evan E

    2017-01-01

    Molecular inversion probes (MIPs) in combination with massively parallel DNA sequencing represent a versatile, yet economical tool for targeted sequencing of genomic DNA. Several thousand genomic targets can be selectively captured using long oligonucleotides containing unique targeting arms and universal linkers. The ability to append sequencing adaptors and sample-specific barcodes allows large-scale pooling and subsequent high-throughput sequencing at relatively low cost per sample. Here, we describe a "wet bench" protocol detailing the capture and subsequent sequencing of >2000 genomic targets from 192 samples, representative of a single lane on the Illumina HiSeq 2000 platform.

  7. Animal Viruses Probe dataset (AVPDS) for microarray-based diagnosis and identification of viruses.

    PubMed

    Yadav, Brijesh S; Pokhriyal, Mayank; Vasishtha, Dinesh P; Sharma, Bhaskar

    2014-03-01

    AVPDS (Animal Viruses Probe dataset) is a dataset of virus-specific and conserve oligonucleotides for identification and diagnosis of viruses infecting animals. The current dataset contain 20,619 virus specific probes for 833 viruses and their subtypes and 3,988 conserved probes for 146 viral genera. Dataset of virus specific probe has been divided into two fields namely virus name and probe sequence. Similarly conserved probes for virus genera table have genus, and subgroup within genus name and probe sequence. The subgroup within genus is artificially divided subgroups with no taxonomic significance and contains probes which identifies viruses in that specific subgroup of the genus. Using this dataset we have successfully diagnosed the first case of Newcastle disease virus in sheep and reported a mixed infection of Bovine viral diarrhea and Bovine herpesvirus in cattle. These dataset also contains probes which cross reacts across species experimentally though computationally they meet specifications. These probes have been marked. We hope that this dataset will be useful in microarray-based detection of viruses. The dataset can be accessed through the link https://dl.dropboxusercontent.com/u/94060831/avpds/HOME.html.

  8. Signal amplification of padlock probes by rolling circle replication.

    PubMed Central

    Banér, J; Nilsson, M; Mendel-Hartvig, M; Landegren, U

    1998-01-01

    Circularizing oligonucleotide probes (padlock probes) have the potential to detect sets of gene sequences with high specificity and excellent selectivity for sequence variants, but sensitivity of detection has been limiting. By using a rolling circle replication (RCR) mechanism, circularized but not unreacted probes can yield a powerful signal amplification. We demonstrate here that in order for the reaction to proceed efficiently, the probes must be released from the topological link that forms with target molecules upon hybridization and ligation. If the target strand has a nearby free 3' end, then the probe-target hybrids can be displaced by the polymerase used for replication. The displaced probe can then slip off the targetstrand and a rolling circle amplification is initiated. Alternatively, the target sequence itself can prime an RCR after its non-base paired 3' end has been removed by exonucleolytic activity. We found the Phi29 DNA polymerase to be superior to the Klenow fragment in displacing the target DNA strand, and it maintained the polymerization reaction for at least 12 h, yielding an extension product that represents several thousand-fold the length of the padlock probe. PMID:9801302

  9. Motor neuron cell-nonautonomous rescue of spinal muscular atrophy phenotypes in mild and severe transgenic mouse models

    PubMed Central

    Liu, Ying Hsiu; Sahashi, Kentaro; Rigo, Frank; Bennett, C. Frank

    2015-01-01

    Survival of motor neuron (SMN) deficiency causes spinal muscular atrophy (SMA), but the pathogenesis mechanisms remain elusive. Restoring SMN in motor neurons only partially rescues SMA in mouse models, although it is thought to be therapeutically essential. Here, we address the relative importance of SMN restoration in the central nervous system (CNS) versus peripheral tissues in mouse models using a therapeutic splice-switching antisense oligonucleotide to restore SMN and a complementary decoy oligonucleotide to neutralize its effects in the CNS. Increasing SMN exclusively in peripheral tissues completely rescued necrosis in mild SMA mice and robustly extended survival in severe SMA mice, with significant improvements in vulnerable tissues and motor function. Our data demonstrate a critical role of peripheral pathology in the mortality of SMA mice and indicate that peripheral SMN restoration compensates for its deficiency in the CNS and preserves motor neurons. Thus, SMA is not a cell-autonomous defect of motor neurons in SMA mice. PMID:25583329

  10. Aptamer-Targeted Gold Nanoparticles As Molecular-Specific Contrast Agents for Reflectance Imaging

    PubMed Central

    2008-01-01

    Targeted metallic nanoparticles have shown potential as a platform for development of molecular-specific contrast agents. Aptamers have recently been demonstrated as ideal candidates for molecular targeting applications. In this study, we investigated the development of aptamer-based gold nanoparticles as contrast agents, using aptamers as targeting agents and gold nanoparticles as imaging agents. We devised a novel conjugation approach using an extended aptamer design where the extension is complementary to an oligonucleotide sequence attached to the surface of the gold nanoparticles. The chemical and optical properties of the aptamer−gold conjugates were characterized using size measurements and oligonucleotide quantitation assays. We demonstrate this conjugation approach to create a contrast agent designed for detection of prostate-specific membrane antigen (PSMA), obtaining reflectance images of PSMA(+) and PSMA(−) cell lines treated with the anti-PSMA aptamer−gold conjugates. This design strategy can easily be modified to incorporate multifunctional agents as part of a multimodal platform for reflectance imaging applications. PMID:18512972

  11. Design and Evaluation of a Lactobacillus manihotivorans Species-Specific rRNA-Targeted Hybridization Probe and Its Application to the Study of Sour Cassava Fermentation

    PubMed Central

    Ampe, Frédéric

    2000-01-01

    Based on 16S rRNA sequence comparison, we have designed a 20-mer oligonucleotide that targets a region specific to the species Lactobacillus manihotivorans recently isolated from sour cassava fermentation. The probe recognized the rRNA obtained from all the L. manihotivorans strains tested but did not recognize 56 strains of microorganisms from culture collections or directly isolated from sour cassava, including 29 species of lactic acid bacteria. This probe was then successfully used in quantitative RNA blots and demonstrated the importance of L. manihotivorans in the fermentation of sour cassava starch, which could represent up to 20% of total lactic acid bacteria. PMID:10788405

  12. Ultrasensitive Detection of Ebola Virus Oligonucleotide Based on Upconversion Nanoprobe/Nanoporous Membrane System.

    PubMed

    Tsang, Ming-Kiu; Ye, WeiWei; Wang, Guojing; Li, Jingming; Yang, Mo; Hao, Jianhua

    2016-01-26

    Ebola outbreaks are currently of great concern, and therefore, development of effective diagnosis methods is urgently needed. The key for lethal virus detection is high sensitivity, since early-stage detection of virus may increase the probability of survival. Here, we propose a luminescence scheme of assay consisting of BaGdF5:Yb/Er upconversion nanoparticles (UCNPs) conjugated with oligonucleotide probe and gold nanoparticles (AuNPs) linked with target Ebola virus oligonucleotide. As a proof of concept, a homogeneous assay was fabricated and tested, yielding a detection limit at picomolar level. The luminescence resonance energy transfer is ascribed to the spectral overlapping of upconversion luminescence and the absorption characteristics of AuNPs. Moreover, we anchored the UCNPs and AuNPs on a nanoporous alumina (NAAO) membrane to form a heterogeneous assay. Importantly, the detection limit was greatly improved, exhibiting a remarkable value at the femtomolar level. The enhancement is attributed to the increased light-matter interaction throughout the nanopore walls of the NAAO membrane. The specificity test suggested that the nanoprobes were specific to Ebola virus oligonucleotides. The strategy combining UCNPs, AuNPs, and NAAO membrane provides new insight into low-cost, rapid, and ultrasensitive detection of different diseases. Furthermore, we explored the feasibility of clinical application by using inactivated Ebola virus samples. The detection results showed great potential of our heterogeneous design for practical application.

  13. 16S rRNA gene-based phylogenetic microarray for simultaneous identification of members of the genus Burkholderia.

    PubMed

    Schönmann, Susan; Loy, Alexander; Wimmersberger, Céline; Sobek, Jens; Aquino, Catharine; Vandamme, Peter; Frey, Beat; Rehrauer, Hubert; Eberl, Leo

    2009-04-01

    For cultivation-independent and highly parallel analysis of members of the genus Burkholderia, an oligonucleotide microarray (phylochip) consisting of 131 hierarchically nested 16S rRNA gene-targeted oligonucleotide probes was developed. A novel primer pair was designed for selective amplification of a 1.3 kb 16S rRNA gene fragment of Burkholderia species prior to microarray analysis. The diagnostic performance of the microarray for identification and differentiation of Burkholderia species was tested with 44 reference strains of the genera Burkholderia, Pandoraea, Ralstonia and Limnobacter. Hybridization patterns based on presence/absence of probe signals were interpreted semi-automatically using the novel likelihood-based strategy of the web-tool Phylo- Detect. Eighty-eight per cent of the reference strains were correctly identified at the species level. The evaluated microarray was applied to investigate shifts in the Burkholderia community structure in acidic forest soil upon addition of cadmium, a condition that selected for Burkholderia species. The microarray results were in agreement with those obtained from phylogenetic analysis of Burkholderia 16S rRNA gene sequences recovered from the same cadmiumcontaminated soil, demonstrating the value of the Burkholderia phylochip for determinative and environmental studies.

  14. Oligonucleotide-stabilized fluorescent silver nanoclusters for the specific and sensitive detection of biotin.

    PubMed

    Xiong, Xiaoli; Tang, Yan; Zhao, Jingjin; Zhao, Shulin

    2016-02-21

    A novel biotin fluorescent probe based on oligonucleotide-stabilized silver nanoclusters (DNA-AgNCs) was synthesized by employing a biotinylated cytosine-rich sequence as a synthesized template. The fluorescence properties of the DNA-AgNCs are related to the modified position of the DNA. When biotin is linked to the middle thymine base of the DNA sequence, the DNA-AgNCs emit the strongest fluorescence. Moreover, the stability of the DNA-AgNCs was affected by avidin through biotin-avidin binding, quenching the fluorescence of the DNA-AgNCs. In contrast, if free biotin is further introduced into this system, the quenching is apparently weakened by competition, leading to the restoration of fluorescence. This phenomenon can be utilized for the detection of biotin. Under the optimal conditions, the fluorescence recovery is linearly proportional to the concentration of biotin in the range of 10 nM-1.0 μM with a detection limit of 6.0 nM. This DNA-AgNCs probe with excellent fluorescent properties is sensitive and selective for the detection of biotin and has been applied for the determination of biotin in wheat flour.

  15. Non-radioactive TRF assay modifications to improve telomeric DNA detection efficiency in plants

    PubMed Central

    Nigmatullina, Liliia R.; Sharipova, Margarita R.; Shakirov, Eugene V.

    2016-01-01

    The length of telomeric DNA is often considered a cellular biomarker of aging and general health status. Several telomere length measuring assays have been developed, of which the most common is the Telomere Restriction Fragment (TRF) analysis, which typically involves the use of radioactively labeled oligonucleotide probes. While highly effective, this method potentially poses substantial health concerns and generates radioactive waste. Digoxigenin (DIG) alternatives to radioactive probes have been developed and used successfully in a number of assays. Here we optimize the DIG protocol to measure telomere length in the model plant Arabidopsis thaliana and present evidence that this approach can be used successfully to efficiently and accurately measure telomere length in plants. Specifically, hybridization temperature of 42 °C instead of the typical 55 °C appears to generate stronger signals. In addition, DIG incorporation at 5′-end instead of 3′-end of the labeled oligonucleotide greatly enhances signal. We conclude that non-radioactive TRF assays can be as efficient as radioactive methods in detecting and measuring telomere length in plants, making this assay suitable for medical and research laboratories unable to utilize radioactivity due to hazardous waste disposal and safety concerns. PMID:28133587

  16. Enrichment of individual KIR2DL4 sequences from genomic DNA using long-template PCR and allele-specific hybridization to magnetic bead-bound oligonucleotide probes.

    PubMed

    Roberts, C H; Turino, C; Madrigal, J A; Marsh, S G E

    2007-06-01

    DNA enrichment by allele-specific hybridization (DEASH) was used as a means to isolate individual alleles of the killer cell immunoglobulin-like receptor (KIR2DL4) gene from heterozygous genomic DNA. Using long-template polymerase chain reaction (LT-PCR), the complete KIR2DL4 gene was amplified from a cell line that had previously been characterized for its KIR gene content by PCR using sequence-specific primers (PCR-SSP). The whole gene amplicons were sequenced and we identified two heterozygous positions in accordance with the predictions of the PCR-SSP. The amplicons were then hybridized to allele-specific, biotinylated oligonucleotide probes and through binding to streptavidin-coated beads, the targeted alleles were enriched. A second PCR amplified only the exonic regions of the enriched allele, and these were then sequenced in full. We show DEASH to be capable of enriching single alleles from a heterozygous PCR product, and through sequencing the enriched DNA, we are able to produce complete coding sequences of the KIR2DL4 alleles in accordance with the typing predicted by PCR-SSP.

  17. Synthetic oligonucleotide separations by mixed-mode reversed-phase/weak anion-exchange liquid chromatography.

    PubMed

    Zimmermann, Aleksandra; Greco, Roberto; Walker, Isabel; Horak, Jeannie; Cavazzini, Alberto; Lämmerhofer, Michael

    2014-08-08

    Synthetic oligonucleotides gain increasing importance in new therapeutic concepts and as probes in biological sciences. If pharmaceutical-grade purities are required, chromatographic purification using ion-pair reversed-phase chromatography is commonly carried out. However, separation selectivity for structurally closely related impurities is often insufficient, especially at high sample loads. In this study, a "mixed-mode" reversed-phase/weak anion exchanger stationary phase has been investigated as an alternative tool for chromatographic separation of synthetic oligonucleotides with minor sequence variations. The employed mixed-mode phase shows great flexibility in method development. It has been run in various gradient elution modes, viz. one, two or three parameter (mixed) gradients (altering buffer pH, buffer concentration, and organic modifier) to find optimal elution conditions and gain further insight into retention mechanisms. Compared to ion-pair reversed-phase and mere anion-exchange separation, enhanced selectivities were observed with the mixed-mode phase for 20-23 nucleotide (nt) long oligonucleotides with similar sequences. Oligonucleotides differing by 1, 2 or 3 nucleotides in length could be readily resolved and separation factors for single nucleotide replacements declined in the order Cytosine (C)/Guanine (G)>Adenine (A)/Guanine∼Guanine/Thymine (T)>Adenine/Cytosine∼Cytosine/Thymine>Adenine/Thymine. Selectivities were larger when the modification was at the 3' terminal-end, declined when it was in the middle of the sequence and was smallest when it was located at the 5' terminus. Due to the lower surface area of the 200Å pore size mixed-mode stationary phase compared to the corresponding 100Å material, lower retention times with equal selectivities under milder elution conditions were achievable. Considering high sample loading capacities of the mixed-mode anion-exchanger phase, it should have great potential for chromatographic oligonucleotide separation and purification. Copyright © 2014 Elsevier B.V. All rights reserved.

  18. Avian acute leukemia viruses MC29 and MH2 share specific RNA sequences: Evidence for a second class of transforming genes

    PubMed Central

    Duesberg, Peter H.; Vogt, Peter K.

    1979-01-01

    The genome of the defective avian tumor virus MH2 was identified as a RNA of 5.7 kilobases by its presence in different MH2-helper virus complexes and its absence from pure helper virus, by its unique fingerprint pattern of RNase T1-resistant (T1) oligonucleotides that differed from those of two helper virus RNAs, and by its structural analogy to the RNA of MC29, another avian acute leukemia virus. Two sets of sequences were distinguished in MH2 RNA: 66% hybridized with DNA complementary to helper-independent avian tumor viruses, termed group-specific, and 34% were specific. The percentage of specific sequences is considered a minimal estimate because the MH2 RNA used was about 30% contaminated by helper virus RNA. No sequences related to the transforming src gene of avian sarcoma viruses were found in MH2. MH2 shared three large T1 oligonucleotides with MC29, two of which could also be isolated from a RNase A- and T1-resistant hybrid formed between MH2 RNA and MC29 specific cDNA. These oligonucleotides belong to a group of six that define the specific segment of MC29 RNA described previously. The group-specific sequences of MH2 and MC29 RNA shared only the two smallest out of about 20 T1 oligonucleotides associated with MH2 RNA. It is concluded that the specific sequences of MH2 and MC29 are related, and it is proposed that they are necessary for, or identical with, the onc genes of these viruses. These sequences would define a related class of transforming genes in avian tumor viruses that differs from the src genes of avian sarcoma viruses. Images PMID:221900

  19. Phosphoryl Guanidines: A New Type of Nucleic Acid Analogues

    PubMed Central

    Kupryushkin, M. S.; Pyshnyi, D. V.; Stetsenko, D. A.

    2014-01-01

    A new type of nucleic acid analogues with a phosphoryl guanidine group is described. Oxidation of polymer-supported dinucleoside 2-cyanoethyl phosphite by iodine in the presence of 1,1,3,3-tetramethyl guanidine yields a dinucleotide with an internucleoside tetramethyl phosphoryl guanidine (Tmg) group as the main product. The Tmg group is stable under conditions of solid-phase DNA synthesis and subsequent cleavage and deprotection with ammonia. Oligonucleotides with one or more Tmg groups bind their complementary DNA or RNA with affinity similar to that of natural oligodeoxyribonucleotides. PMID:25558402

  20. Quantitative fluorescent in-situ hybridization: a hypothesized competition mode between two dominant bacteria groups in hydrogen-producing anaerobic sludge processes.

    PubMed

    Huang, C-L; Chen, C-C; Lin, C-Y; Liu, W-T

    2009-01-01

    Two hydrogen-producing continuous flow stirred tank reactors (CSTRs) fed respectively with glucose and sucrose were investigated by polymerase chain reaction-denatured gradient gel electrophoresis (PCR-DGGE) and fluorescent in-situ hybridization (FISH). The substrate was fed in a continuous mode decreased from hydraulic retention time (HRT) 10 hours to 6, 5, 4, 3, and 2 hours. Quantitative fluorescent in-situ hybridization (FISH) observations further demonstrated that two morphotypes of bacteria dominated both microbial communities. One was long rod bacteria which can be targeted either by Chis150 probe designed to hybridize the gram positive low G + C bacteria or the specific oligonucleotide probe Lg10-6. The probe Lg10-6, affiliated with Clostridium pasteurianum, was designed and then checked with other reference organisms. The other type, unknown group, which cannot be detected by Chis150 was curved rod bacteria. Notably, the population ratios of the two predominant groups reflected the different operational performance of the two reactors, such as hydrogen producing rates, substrate turnover rates and metabolites compositions. Therefore, a competition mode of the two dominant bacteria groups was hypothesized. In the study, 16S rRNA-based gene library of hydrogen-producing microbial communities was established. The efficiency of hydrogen yields was correlated with substrates (glucose or sucrose), HRT, metabolites compositions (acetate, propionate, butyrate and ethanol), thermal pre-treatment (seed biomass was heated at 100 degrees C for 45 minutes), and microbial communities in the bioreactor, not sludge sources (municipal sewage sludge, alcohol-processing sludge, or bean-processing sludge). The designed specific oligonucleotide probe Lg10-6 also provides us a useful and fast molecular tool to screen hydrogen-producing microbial communities in the future research.

  1. BIOCONJUGATION OF OLIGONUCLEOTIDES FOR TREATING LIVER FIBROSIS

    PubMed Central

    Ye, Zhaoyang; Hajj Houssein, Houssam S.; Mahato, Ram I.

    2009-01-01

    Liver fibrosis results from chronic liver injury due to hepatitis B and C, excessive alcohol ingestion, and metal ion overload. Fibrosis culminates in cirrhosis and results in liver failure. Therefore, a potent antifibrotic therapy is in urgent need to reverse scarring and eliminate progression to cirrhosis. Although activated hepatic stellate cells (HSCs) remains the principle cell type responsible for liver fibrosis, perivascular fibroblasts of portal and central veins as well as periductular fibroblasts are other sources of fibrogenic cells. This review will critically discuss various treatment strategies for liver fibrosis, including prevention of liver injury, reduction of inflammation, inhibition of HSC activation, degradation of scar matrix, and inhibition of aberrant collagen synthesis. Oligonucleotides (ODNs) are short, single-stranded nucleic acids, which disrupt expression of target protein by binding to complementary mRNA or forming triplex with genomic DNA. Triplex forming oligonucleotides (TFOs) provide an attractive strategy for treating liver fibrosis. A series of TFOs have been developed for inhibiting the transcription of α1(I) collagen gene, which opens a new area for antifibrotic drugs. There will be in depth discussion on the use of TFOs and how different bioconjugation strategies can be utilized for their site-specific delivery to HSCs or hepatocytes for enhanced antifibrotic activities. Various insights developed in individual strategy and the need for multipronged approaches will also be discussed. PMID:18154454

  2. Roles of the amino group of purine bases in the thermodynamic stability of DNA base pairing.

    PubMed

    Nakano, Shu-ichi; Sugimoto, Naoki

    2014-08-05

    The energetic aspects of hydrogen-bonded base-pair interactions are important for the design of functional nucleotide analogs and for practical applications of oligonucleotides. The present study investigated the contribution of the 2-amino group of DNA purine bases to the thermodynamic stability of oligonucleotide duplexes under different salt and solvent conditions, using 2'-deoxyriboinosine (I) and 2'-deoxyribo-2,6-diaminopurine (D) as non-canonical nucleotides. The stability of DNA duplexes was changed by substitution of a single base pair in the following order: G • C > D • T ≈ I • C > A • T > G • T > I • T. The apparent stabilization energy due to the presence of the 2-amino group of G and D varied depending on the salt concentration, and decreased in the water-ethanol mixed solvent. The effects of salt concentration on the thermodynamics of DNA duplexes were found to be partially sequence-dependent, and the 2-amino group of the purine bases might have an influence on the binding of ions to DNA through the formation of a stable base-paired structure. Our results also showed that physiological salt conditions were energetically favorable for complementary base recognition, and conversely, low salt concentration media and ethanol-containing solvents were effective for low stringency oligonucleotide hybridization, in the context of conditions employed in this study.

  3. Quick Fluorescent In Situ Hybridization Protocol for Xist RNA Combined with Immunofluorescence of Histone Modification in X-chromosome Inactivation

    PubMed Central

    Yamada, Norishige; Ogawa, Akiyo; Ogawa, Yuya

    2014-01-01

    Combining RNA fluorescent in situ hybridization (FISH) with immunofluorescence (immuno-FISH) creates a technique that can be employed at the single cell level to detect the spatial dynamics of RNA localization with simultaneous insight into the localization of proteins, epigenetic modifications and other details which can be highlighted by immunofluorescence. X-chromosome inactivation is a paradigm for long non-coding RNA (lncRNA)-mediated gene silencing. X-inactive specific transcript (Xist) lncRNA accumulation (called an Xist cloud) on one of the two X-chromosomes in mammalian females is a critical step to initiate X-chromosome inactivation. Xist RNA directly or indirectly interacts with various chromatin-modifying enzymes and introduces distinct epigenetic landscapes to the inactive X-chromosome (Xi). One known epigenetic hallmark of the Xi is the Histone H3 trimethyl-lysine 27 (H3K27me3) modification. Here, we describe a simple and quick immuno-FISH protocol for detecting Xist RNA using RNA FISH with multiple oligonucleotide probes coupled with immunofluorescence of H3K27me3 to examine the localization of Xist RNA and associated epigenetic modifications. Using oligonucleotide probes results in a shorter incubation time and more sensitive detection of Xist RNA compared to in vitro transcribed RNA probes (riboprobes). This protocol provides a powerful tool for understanding the dynamics of lncRNAs and its associated epigenetic modification, chromatin structure, nuclear organization and transcriptional regulation. PMID:25489864

  4. Biobarcode assay for the oral anticoagulant acenocoumarol.

    PubMed

    Broto, Marta; Salvador, J Pablo; Galve, Roger; Marco, M Pilar

    2018-02-01

    A novel approach for therapeutic drug monitoring of oral anticoagulants (OA) in clinical samples is reported, based on a NP-based biobarcode assay. The proposed strategy uses specific antibodies for acenocumarol (ACL) covalently bound to magnetic particles (pAb236-MP) and a bioconjugate competitor (hACL-BSA) linked to encoded polystyrene probes (hACL-BSA-ePSP) on a classical competitive immunochemical format. By using this scheme ACL can be detected in low nM range (LOD, 0.96 ± 0.26, N = 3, in buffer) even in complex samples such as serum or plasma (LOD 4 ± 1). The assay shows a high reproducibility (%CV 1.1 day-to-day) and is robust, as it is demonstrated by the fact that ACL can be quantified in complex biological samples with a very good accuracy (slope = 0.97 and R 2 = 0.91, of the linear regression obtained when analyzing spiked vs measured values). Moreover, we have demonstrated that the biobarcode approach has the potential to overcome one of the main challenges of the multiplexed diagnostic, which is the possibility to measure in a single run biomarker targets present at different concentration ranges. Thus, it has been proven that the signal and the detectability can be modulated by just modifying the oligonucleotide load of the encoded probes. This fact opens the door for combining in the same assay encoded probes with the necessary oligonucleotide load to achieve the detectability required for each biomarker target. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. Introduction on Using the FastPCR Software and the Related Java Web Tools for PCR and Oligonucleotide Assembly and Analysis.

    PubMed

    Kalendar, Ruslan; Tselykh, Timofey V; Khassenov, Bekbolat; Ramanculov, Erlan M

    2017-01-01

    This chapter introduces the FastPCR software as an integrated tool environment for PCR primer and probe design, which predicts properties of oligonucleotides based on experimental studies of the PCR efficiency. The software provides comprehensive facilities for designing primers for most PCR applications and their combinations. These include the standard PCR as well as the multiplex, long-distance, inverse, real-time, group-specific, unique, overlap extension PCR for multi-fragments assembling cloning and loop-mediated isothermal amplification (LAMP). It also contains a built-in program to design oligonucleotide sets both for long sequence assembly by ligase chain reaction and for design of amplicons that tile across a region(s) of interest. The software calculates the melting temperature for the standard and degenerate oligonucleotides including locked nucleic acid (LNA) and other modifications. It also provides analyses for a set of primers with the prediction of oligonucleotide properties, dimer and G/C-quadruplex detection, linguistic complexity as well as a primer dilution and resuspension calculator. The program consists of various bioinformatical tools for analysis of sequences with the GC or AT skew, CG% and GA% content, and the purine-pyrimidine skew. It also analyzes the linguistic sequence complexity and performs generation of random DNA sequence as well as restriction endonucleases analysis. The program allows to find or create restriction enzyme recognition sites for coding sequences and supports the clustering of sequences. It performs efficient and complete detection of various repeat types with visual display. The FastPCR software allows the sequence file batch processing that is essential for automation. The program is available for download at http://primerdigital.com/fastpcr.html , and its online version is located at http://primerdigital.com/tools/pcr.html .

  6. Automated detection and quantitation of bacterial RNA by using electrical microarrays.

    PubMed

    Elsholz, B; Wörl, R; Blohm, L; Albers, J; Feucht, H; Grunwald, T; Jürgen, B; Schweder, T; Hintsche, Rainer

    2006-07-15

    Low-density electrical 16S rRNA specific oligonucleotide microarrays and an automated analysis system have been developed for the identification and quantitation of pathogens. The pathogens are Escherichia coli, Pseudomonas aeruginosa, Enterococcus faecalis, Staphylococcus aureus, and Staphylococcus epidermidis, which are typically involved in urinary tract infections. Interdigitated gold array electrodes (IDA-electrodes), which have structures in the nanometer range, have been used for very sensitive analysis. Thiol-modified oligonucleotides are immobilized on the gold IDA as capture probes. They mediate the specific recognition of the target 16S rRNA by hybridization. Additionally three unlabeled oligonucleotides are hybridized in close proximity to the capturing site. They are supporting molecules, because they improve the RNA hybridization at the capturing site. A biotin labeled detector oligonucleotide is also allowed to hybridize to the captured RNA sequence. The biotin labels enable the binding of avidin alkaline phophatase conjugates. The phosphatase liberates the electrochemical mediator p-aminophenol from its electrically inactive phosphate derivative. The electrical signals were generated by amperometric redox cycling and detected by a unique multipotentiostat. The read out signals of the microarray are position specific current and change over time in proportion to the analyte concentration. If two additional biotins are introduced into the affinity binding complex via the supporting oligonucleotides, the sensitivity of the assays increase more than 60%. The limit of detection of Escherichia coli total RNA has been determined to be 0.5 ng/microL. The control of fluidics for variable assay formats as well as the multichannel electrical read out and data handling have all been fully automated. The fast and easy procedure does not require any amplification of the targeted nucleic acids by PCR.

  7. Measuring DNA hybridization using fluorescent DNA-stabilized silver clusters to investigate mismatch effects on therapeutic oligonucleotides.

    PubMed

    de Bruin, Donny; Bossert, Nelli; Aartsma-Rus, Annemieke; Bouwmeester, Dirk

    2018-04-06

    Short nucleic acid oligomers have found a wide range of applications in experimental physics, biology and medicine, and show potential for the treatment of acquired and genetic diseases. These applications rely heavily on the predictability of hybridization through Watson-Crick base pairing to allow positioning on a nanometer scale, as well as binding to the target transcripts, but also off-target binding to transcripts with partial homology. These effects are of particular importance in the development of therapeutic oligonucleotides, where off-target effects caused by the binding of mismatched sequences need to be avoided. We employ a novel method of probing DNA hybridization using optically active DNA-stabilized silver clusters (Ag-DNA) to measure binding efficiencies through a change in fluorescence intensity. In this way we can determine their location-specific sensitivity to individual mismatches in the sequence. The results reveal a strong dependence of the hybridization on the location of the mismatch, whereby mismatches close to the edges and center show a relatively minor impact. In parallel, we propose a simple model for calculating the annealing ratios of mismatched DNA sequences, which supports our experimental results. The primary result shown in this work is a demonstration of a novel technique to measure DNA hybridization using fluorescent Ag-DNA. With this technique, we investigated the effect of mismatches on the hybridization efficiency, and found a significant dependence on the location of individual mismatches. These effects are strongly influenced by the length of the used oligonucleotides. The novel probe method based on fluorescent Ag-DNA functions as a reliable tool in measuring this behavior. As a secondary result, we formulated a simple model that is consistent with the experimental data.

  8. Identification of some ectomycorrhizal basidiomycetes by PCR amplification of their gpd (glyceraldehyde-3-phosphate dehydrogenase) genes.

    PubMed Central

    Kreuzinger, N; Podeu, R; Gruber, F; Göbl, F; Kubicek, C P

    1996-01-01

    Degenerated oligonucleotide primers designed to flank an approximately 1.2-kb fragment of the gene encoding glyceraldehyde-3-phosphate dehydrogenase (gpd) from ascomycetes and basidiomycetes were used to amplify the corresponding gpd fragments from several species of the ectomycorrhizal fungal taxa Boletus, Amanita, and Lactarius. Those from B. edulis, A. muscaria, and L. deterrimus were cloned and sequenced. The respective nucleotide sequences of these gene fragments showed a moderate degree of similarity (72 to 76%) in the protein-encoding regions and only a low degree of similarity in the introns (56 to 66%). Introns, where present, occurred at conserved positions, but the respective positions and numbers of introns in a given taxon varied. The amplified fragment from a given taxon could be distinguished from that of others by both restriction nuclease cleavage analysis and Southern hybridization. A procedure for labeling DNA probes with fluorescein-12-dUTP by PCR was developed. These probes were used in a nonradioactive hybridization assay, with which the gene could be detected in 2 ng of chromosomal DNA of L. deterrimus on slot blots. Taxon-specific amplification was achieved by the design of specific oligonucleotide primers. The application of the gpd gene for the identification of mycorrhizal fungi under field conditions was demonstrated, with Picea abies (spruce) mycorrhizal roots harvested from a northern alpine forest area as well as from a plant-breeding nursery. The interference by inhibitory substances, which sometimes occurred in the DNA extracted from the root-fungus mixture, could be overcome by using very diluted concentrations of template DNA for a first round of PCR amplification followed by a second round with nested oligonucleotide primers. We conclude that gpd can be used to detect ectomycorrhizal fungi during symbiotic interaction. PMID:8795234

  9. Selective amplification of an mRNA and related pseudogene for a human ADP-ribosylation factor, a guanine nucleotide-dependent protein activator of cholera toxin

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Monaco, L.; Murtagh, J.J.; Newman, K.B.

    1990-03-01

    ADP-ribosylation factors (ARFs) are {approx}20-kDa proteins that act as GTP-dependent allosteric activators of cholera toxin. With deoxyinosine-containing degenerate oligonucleotide primers corresponding to conserved GTP-binding domains in ARFs, the polymerase chain reaction (PCR) was used to amplify simultaneously from human DNA portions of three ARF genes that include codons for 102 amino acids, with intervening sequences. Amplification products that differed in size because of differences in intron sizes were separated by agarose gel electrophoresis. One amplified DNA contained no introns and had a sequence different from those of known AFRs. Based on this sequence, selective oligonucleotide probes were prepared and usedmore » to isolate clone {Psi}ARF 4, a putative ARF pseudogene, from a human genomic library in {lambda} phage EMBL3. Reverse transcription-PCR was then used to clone from human poly(A){sup +} RNA the cDNA corresponding to the expressed homolog of {Psi}ARF 4, referred to as human ARF 4. It appears that {Psi}ARF 4 arose during human evolution by integration of processed ARF 4 mRNA into the genome. Human ARF 4 differs from previously identified mammalian ARFs 1, 2, and 3. Hybridization of ARF 4-specific oligonucleotide probes with human, bovine, and rat RNA revealed a single 1.8-kilobase mRNA, which was clearly distinguished from the 1.9-kilobase mRNA for ARF 1 in these tissues. The PCR provides a powerful tool for investigating diversity in this and other multigene families, especially with primers targeted at domains believed to have functional significance.« less

  10. Synthesis of Bipartite Tetracysteine PNA Probes for DNA In Situ Fluorescent Labeling.

    PubMed

    Fang, Ge-Min; Seitz, Oliver

    2017-12-24

    "Label-free" fluorescent probes that avoid additional steps or building blocks for conjugation of fluorescent dyes with oligonucleotides can significantly reduce the time and cost of parallel bioanalysis of a large number of nucleic acid samples. A method for the synthesis of "label-free" bicysteine-modified PNA probes using solid-phase synthesis and procedures for sequence-specific DNA in situ fluorescent labeling is described here. The concept is based on the adjacent alignment of two bicysteine-modified peptide nucleic acids on a DNA target to form a structurally optimized bipartite tetracysteine motif, which induces a sequence-specific fluorogenic reaction with commercially available biarsenic dyes, even in complex media such as cell lysate. This unit will help researchers to quickly synthesize bipartite tetracysteine PNA probes and carry out low-cost DNA in situ fluorescent labeling experiments. © 2017 by John Wiley & Sons, Inc. Copyright © 2017 John Wiley & Sons, Inc.

  11. G quadruplex-based FRET probes with the thrombin-binding aptamer (TBA) sequence designed for the efficient fluorometric detection of the potassium ion.

    PubMed

    Nagatoishi, Satoru; Nojima, Takahiko; Galezowska, Elzbieta; Juskowiak, Bernard; Takenaka, Shigeori

    2006-11-01

    The dual-labeled oligonucleotide derivative, FAT-0, carrying 6- carboxyfluorescein (FAM) and 6-carboxytetramethylrhodamine (TAMRA) labels at the 5' and 3' termini of the thrombin-binding aptamer (TBA) sequence 5'-GGT TGG TGT GGT TGG-3', and its derivatives, FAT-n (n=3, 5, and 7) with a spacer at the 5'-end of a TBA sequence of T(m)A (m=2, 4, and 6) have been designed and synthesized. These fluorescent probes were developed for monitoring K(+) concentrations in living organisms. Circular dichroism, UV-visible absorption, and fluorescence studies revealed that all FAT-n probes could form intramolecular tetraplex structures after binding K(+). Fluorescence resonance energy transfer and quenching results are discussed taking into account dye-dye contact interactions. The relationship between the fluorescence behavior of the probes and the spacer length in FAT-n was studied in detail and is discussed.

  12. Synthetic oligonucleotide probes deduced from amino acid sequence data. Theoretical and practical considerations.

    PubMed

    Lathe, R

    1985-05-05

    Synthetic probes deduced from amino acid sequence data are widely used to detect cognate coding sequences in libraries of cloned DNA segments. The redundancy of the genetic code dictates that a choice must be made between (1) a mixture of probes reflecting all codon combinations, and (2) a single longer "optimal" probe. The second strategy is examined in detail. The frequency of sequences matching a given probe by chance alone can be determined and also the frequency of sequences closely resembling the probe and contributing to the hybridization background. Gene banks cannot be treated as random associations of the four nucleotides, and probe sequences deduced from amino acid sequence data occur more often than predicted by chance alone. Probe lengths must be increased to confer the necessary specificity. Examination of hybrids formed between unique homologous probes and their cognate targets reveals that short stretches of perfect homology occurring by chance make a significant contribution to the hybridization background. Statistical methods for improving homology are examined, taking human coding sequences as an example, and considerations of codon utilization and dinucleotide frequencies yield an overall homology of greater than 82%. Recommendations for probe design and hybridization are presented, and the choice between using multiple probes reflecting all codon possibilities and a unique optimal probe is discussed.

  13. Hairpin Bisulfite Sequencing: Synchronous Methylation Analysis on Complementary DNA Strands of Individual Chromosomes.

    PubMed

    Giehr, Pascal; Walter, Jörn

    2018-01-01

    The accurate and quantitative detection of 5-methylcytosine is of great importance in the field of epigenetics. The method of choice is usually bisulfite sequencing because of the high resolution and the possibility to combine it with next generation sequencing. Nevertheless, also this method has its limitations. Following the bisulfite treatment DNA strands are no longer complementary such that in a subsequent PCR amplification the DNA methylation patterns information of only one of the two DNA strand is preserved. Several years ago Hairpin Bisulfite sequencing was developed as a method to obtain the pattern information on complementary DNA strands. The method requires fragmentation (usually by enzymatic cleavage) of genomic DNA followed by a covalent linking of both DNA strands through ligation of a short DNA hairpin oligonucleotide to both strands. The ligated covalently linked dsDNA products are then subjected to a conventional bisulfite treatment during which all unmodified cytosines are converted to uracils. During the treatment the DNA is denatured forming noncomplementary ssDNA circles. These circles serve as a template for a locus specific PCR to amplify chromosomal patterns of the region of interest. As a result one ends up with a linearized product, which contains the methylation information of both complementary DNA strands.

  14. [A new class of exciplex-formed probe detect of specific sequence DNA].

    PubMed

    Li, Qing-Yong; Zu, Yuan-Gang; Lü, Hong-Yan; Wang, Li-Min

    2009-07-01

    The present research was to develop the exciplex-based fluorescence detection of DNA. A SNP-containing region of cytochrome P450 2C9 DNA systems was evaluated to define some of the structural and associated requirement of this new class of exciplex-formed probe, and a 24-base target was selected which contains single-nucleotide polymorphisms (SNP) in genes coding for cytochrome P450. The two probes were all 12-base to give coverage of a 24-base target region to ensure specificity within the human genome. Exciplex partners used in this study were prepared using analogous phosphoramide attachment to the 3'- or 5'-phosphate group of the appropriate oligonucleotide probes. The target effectively assembled its own detector by hybridization from components which were non-fluorescent at the detection wavelength, leading to the huge improvement in terms of decreased background. This research provides details of the effects of different partner, position of partners and different excitation wavelengths for the split-oligonucleotide probe system for exciplex-based fluorescence detection of DNA. This study demonstrates that the emission intensity of the excimer formed by new pyrene derivative is the highest in these excimer and exciplex, and the excimer is easy to be formed and not sensitive to the position of partners. However the exciplex formed by the new pyrene derivative and naphthalene emitted strongly at -505 nm with large Stokes shifts (120-130 nm), and the monomer emission at 390 and 410 nm is nearly zero. Excitation wavelength of 400 nm is the best for I(e505)/I(m410) (exciplex emission at 505 nm/monomer emission at 410 nm) of the exciplex. This method features lower background and high sensitivity. Moreover the exciplex is sensitive to the steric factor, different position of partners and microenvironment, so this exciplex system is promising and could be tried to identify the SNP genes.

  15. Nucleotide sequence of a complementary DNA encoding pea cytosolic copper/zinc superoxide dismutase. [Pisum sativum L

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    White, D.A.; Zilinskas, B.A.

    1991-08-01

    The authors now report the nucleotide sequence of the cytosolic Cu/Zn SOD cloned from a {lambda}gt11 cDNA library constructed from mRNA extracted from leaves of 7- to 10-d pea seedlings (Pisum sativum L.). The clone was isolated using a 22-base synthetic oligonucleotide complementary to the amino acid sequence CGIIGLQG. This sequence, found at the protein's carboxy terminus, is highly conserved among plant cytosolic Cu/Zn SODs but not chloroplastic Cu/Zn SODs. The 738-base pair sequence contains an open reading frame specifying 152 codons and a predicted M{sub r} of 18,024 D. The deduced amino acid sequence is highly homologous (79-82% identity)more » with the sequences of other known plant cytosolic Cu/Zn SODs but less highly conserved (63-65%) when compared with several chloroplastic Cu/Zn SODs including pea (10).« less

  16. Distributed biotin–streptavidin transcription roadblocks for mapping cotranscriptional RNA folding

    PubMed Central

    Strobel, Eric J.; Nedialkov, Yuri; Artsimovitch, Irina

    2017-01-01

    Abstract RNA folding during transcription directs an order of folding that can determine RNA structure and function. However, the experimental study of cotranscriptional RNA folding has been limited by the lack of easily approachable methods that can interrogate nascent RNA structure at nucleotide resolution. To address this, we previously developed cotranscriptional selective 2΄-hydroxyl acylation analyzed by primer extension sequencing (SHAPE-Seq) to simultaneously probe all intermediate RNA transcripts during transcription by stalling elongation complexes at catalytically dead EcoRIE111Q roadblocks. While effective, the distribution of elongation complexes using EcoRIE111Q requires laborious PCR using many different oligonucleotides for each sequence analyzed. Here, we improve the broad applicability of cotranscriptional SHAPE-Seq by developing a sequence-independent biotin–streptavidin (SAv) roadblocking strategy that simplifies the preparation of roadblocking DNA templates. We first determine the properties of biotin–SAv roadblocks. We then show that randomly distributed biotin–SAv roadblocks can be used in cotranscriptional SHAPE-Seq experiments to identify the same RNA structural transitions related to a riboswitch decision-making process that we previously identified using EcoRIE111Q. Lastly, we find that EcoRIE111Q maps nascent RNA structure to specific transcript lengths more precisely than biotin–SAv and propose guidelines to leverage the complementary strengths of each transcription roadblock in cotranscriptional SHAPE-Seq. PMID:28398514

  17. Distributed biotin-streptavidin transcription roadblocks for mapping cotranscriptional RNA folding.

    PubMed

    Strobel, Eric J; Watters, Kyle E; Nedialkov, Yuri; Artsimovitch, Irina; Lucks, Julius B

    2017-07-07

    RNA folding during transcription directs an order of folding that can determine RNA structure and function. However, the experimental study of cotranscriptional RNA folding has been limited by the lack of easily approachable methods that can interrogate nascent RNA structure at nucleotide resolution. To address this, we previously developed cotranscriptional selective 2΄-hydroxyl acylation analyzed by primer extension sequencing (SHAPE-Seq) to simultaneously probe all intermediate RNA transcripts during transcription by stalling elongation complexes at catalytically dead EcoRIE111Q roadblocks. While effective, the distribution of elongation complexes using EcoRIE111Q requires laborious PCR using many different oligonucleotides for each sequence analyzed. Here, we improve the broad applicability of cotranscriptional SHAPE-Seq by developing a sequence-independent biotin-streptavidin (SAv) roadblocking strategy that simplifies the preparation of roadblocking DNA templates. We first determine the properties of biotin-SAv roadblocks. We then show that randomly distributed biotin-SAv roadblocks can be used in cotranscriptional SHAPE-Seq experiments to identify the same RNA structural transitions related to a riboswitch decision-making process that we previously identified using EcoRIE111Q. Lastly, we find that EcoRIE111Q maps nascent RNA structure to specific transcript lengths more precisely than biotin-SAv and propose guidelines to leverage the complementary strengths of each transcription roadblock in cotranscriptional SHAPE-Seq. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  18. Genetic Relatedness among Environmental, Clinical, and Diseased-Eel Vibrio vulnificus Isolates from Different Geographic Regions by Ribotyping and Randomly Amplified Polymorphic DNA PCR

    PubMed Central

    Arias, Covadonga R.; Pujalte, María Jesús; Garay, Esperanza; Aznar, Rosa

    1998-01-01

    Genetic relationships among 132 strains of Vibrio vulnificus (clinical, environmental, and diseased-eel isolates from different geographic origins, as well as seawater and shellfish isolates from the western Mediterranean coast, including reference strains) were analyzed by random amplified polymorphic DNA (RAPD) PCR. Results were validated by ribotyping. For ribotyping, DNAs were digested with KpnI and hybridized with an oligonucleotide probe complementary to a highly conserved sequence in the 23S rRNA gene. Random amplification of DNA was performed with M13 and T3 universal primers. The comparison between ribotyping and RAPD PCR revealed an overall agreement regarding the high level of homogeneity of diseased-eel isolates in contrast to the genetic heterogeneity of Mediterranean isolates. The latter suggests the existence of autochthonous clones present in Mediterranean coastal waters. Both techniques have revealed a genetic proximity among Spanish fish farm isolates and a close relationship between four Spanish eel farm isolates and some Mediterranean isolates. Whereas the differentiation within diseased-eel isolates was only possible by ribotyping, RAPD PCR was able to differentiate phenotypically atypical isolates of V. vulnificus. On the basis of our results, RAPD PCR is proposed as a better technique than ribotyping for rapid typing in the routine analysis of new V. vulnificus isolates. PMID:9726889

  19. Biochemical and proteomic analysis of spliceosome factors interacting with intron-1 of human papillomavirus type-16.

    PubMed

    Martínez-Salazar, Martha; López-Urrutia, Eduardo; Arechaga-Ocampo, Elena; Bonilla-Moreno, Raul; Martínez-Castillo, Macario; Díaz-Hernández, Job; Del Moral-Hernández, Oscar; Cedillo-Barrón, Leticia; Martines-Juarez, Víctor; De Nova-Ocampo, Monica; Valdes, Jesús; Berumen, Jaime; Villegas-Sepúlveda, Nicolás

    2014-12-05

    The human papillomavirus type 16 (HPV-16) E6/E7 spliced transcripts are heterogeneously expressed in cervical carcinoma. The heterogeneity of the E6/E7 splicing profile might be in part due to the intrinsic variation of splicing factors in tumor cells. However, the splicing factors that bind the E6/E7 intron 1 (In-1) have not been defined. Therefore, we aimed to identify these factors; we used HeLa nuclear extracts (NE) for in vitro spliceosome assembly. The proteins were allowed to bind to an RNA/DNA hybrid formed by the In-1 transcript and a 5'-biotinylated DNA oligonucleotide complementary to the upstream exon sequence, which prevented interference in protein binding to the intron. The hybrid probes bound with the nuclear proteins were coupled to streptavidin magnetic beads for chromatography affinity purification. Proteins were eluted and identified by mass spectrometry (MS). Approximately 170 proteins were identified by MS, 80% of which were RNA binding proteins, including canonical spliceosome core components, helicases and regulatory splicing factors. The canonical factors were identified as components of the spliceosomal B-complex. Although 35-40 of the identified factors were cognate splicing factors or helicases, they have not been previously detected in spliceosome complexes that were assembled using in vivo or in vitro models. Copyright © 2014 Elsevier B.V. All rights reserved.

  20. Detecting and Genotyping Escherichia coli O157:H7 using multiplexed PCR and nucleic acid microarrays

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Call, Douglas R.; Brockman, Fred J.; Chandler, Darrell P.

    2000-12-01

    Rapid detection and characterization of food borne pathogens such as Escherichia coli O157:H7 is crucial for epidemiological investigations and food safety surveillance. As an alternative to conventional technologies, we examined the sensitivity and specificity of nucleic acid microarrays for detecting and genotyping E. coli O157:H7. The array was composed of oligonucleotide probes (25-30 mer) complementary to four virulence loci (intimin, Shiga-like toxins I and II, and hemolysin A). Target DNA was amplified from whole cells or from purified DNA via single or multiplexed polymerase chain reaction (PCR), and PCR products were hybridized to the array without further modification or purification.more » The array was 32-fold more sensitive than gel electrophoresis and capable of detecting amplification products from < 1 cell equivalent of genomic DNA (1 fg). Immunomagnetic capture, PCR and a microarray were subsequently used to detect 55 CFU ml-1 (E. coli O157:H7) from chicken rinsate without the aid of pre-enrichment. Four isolates of E. coli O157:H7 and one isolate of O91:H2, for which genotypic data were available, were unambiguously genotyped with this array. Glass based microarrays are relatively simple to construct and provide a rapid and sensitive means to detect multiplexed PCR products and the system is amenable to automation.« less

  1. Detecting and genotyping Escherichia coli O157:H7 using multiplexed PCR and nucleic acid microarrays

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Call, Douglas R.; Brockman, Fred J.; Chandler, Darrell P.

    2001-07-05

    Rapid detection and characterization of food borne pathogens such as Escherichia coli O157:H7 is crucial for epidemiological investigations and food safety surveillance. As an alternative to conventional technologies, we examined the sensitivity and specificity of nucleic acid microarrays for detecting and genotyping E. coli O157:H7. The array was composed of oligonucleotide probes (25-30 mer) complementary to four virulence loci (intimin, Shiga-like toxins I and II, and hemolysin A). Target DNA was amplified from whole cells or from purified DNA via single or multiplexed polymerase chain reaction (PCR), and PCR products were hybridized to the array without further modification or purification.more » The array was 32-fold more sensitive than gel electrophoresis and capable of detecting amplification products from < 1 cell equivalent of genomic DNA (1 fg). Immunomagnetic capture, PCR and a microarray were subsequently used to detect 55 CFUs ml-1 (E. coli O157:H7) from chicken rinsate without the aid of pre-enrichment. Four isolates of E. coli O157:H7 and one isolate of O91:H2, for which genotypic data were available, were unambiguously genotyped with this array. Glass based microarrays are relatively simple to construct and provide a rapid and sensitive means to detect multiplexed PCR products and the system is amenable to automation.« less

  2. Construction of a microfluidic chip, using dried-down reagents, for LATE-PCR amplification and detection of single-stranded DNA.

    PubMed

    Jia, Yanwei; Mak, Pui-In; Massey, Conner; Martins, Rui P; Wangh, Lawrence J

    2013-12-07

    LATE-PCR is an advanced form of non-symmetric PCR that efficiently generates single-stranded DNA which can readily be characterized at the end of amplification by hybridization to low-temperature fluorescent probes. We demonstrate here for the first time that monoplex and duplex LATE-PCR amplification and probe target hybridization can be carried out in double layered PDMS microfluidics chips containing dried reagents. Addition of a set of reagents during dry down overcomes the common problem of single-stranded oligonucleotide binding to PDMS. These proof-of-principle results open the way to construction of inexpensive point-of-care devices that take full advantage of the analytical power of assays built using LATE-PCR and low-temperature probes.

  3. In situ identification of the synthrophic protein fermentative Coprothermobacter spp. involved in the thermophilic anaerobic digestion process.

    PubMed

    Gagliano, Maria Cristina; Braguglia, Camilla Maria; Rossetti, Simona

    2014-09-01

    Thermophilic bacteria have recently attracted great attention because of their potential application in improving different biochemical processes such as anaerobic digestion of various substrates, wastewater treatment or hydrogen production. In this study we report on the design of a specific 16S rRNA-targeted oligonucleotide probe for detecting members of Coprothermobacter genus characterized by a strong protease activity to degrade proteins and peptides. The newly designed CTH485 probe and helper probes hCTH429 and hCTH439 were optimized for use in fluorescence in situ hybridization (FISH) on thermophilic anaerobic sludge samples. In situ probing revealed that thermo-adaptive mechanisms shaping the 16S rRNA gene may affect the identification of thermophilic microorganisms. The novel developed FISH probe extends the possibility to study the widespread thermophilic syntrophic interaction of Coprothermobacter spp. with hydrogenotrophic methanogenic archaea, whose establishment is a great benefit for the whole anaerobic system. © 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

  4. Rapid detection of IHNV by molecular padlock recognition and surface-associated isothermal amplification

    NASA Astrophysics Data System (ADS)

    McCarthy, Erik L.; Egeler, Teressa J.; Bickerstaff, Lee E.; Pereira da Cunha, Mauricio; Millard, Paul J.

    2005-11-01

    RNA sequences derived from infectious hematopoeitic necrosis virus (IHNV) could be detected using a combination of surface-associated molecular padlock DNA probes (MPP) and rolling circle amplification (RCA) in microcapillary tubes. DNA oligonucleotides with base sequences identical to RNA obtained from IHNV were recognized by MPP. Circularized MPP were then captured on the inner surface of glass microcapillary tubes by immobilized DNA oligonucleotide primers. Extension of the immobilized primers by isothermal RCA gave rise to DNA concatamers, which were in turn bound by the fluorescent reporter SYBR Green II nucleic acid stain, and measured by microfluorimetry. Surface-associated molecular padlock technology, combined with isothermal RCA, exhibited high selectivity and sensitivity without thermal cycling. This technology is applicable to direct RNA and DNA detection, permitting detection of a variety of viral or bacterial pathogens.

  5. Compaction of rolling circle amplification products increases signal integrity and signal-to-noise ratio

    PubMed Central

    Clausson, Carl-Magnus; Arngården, Linda; Ishaq, Omer; Klaesson, Axel; Kühnemund, Malte; Grannas, Karin; Koos, Björn; Qian, Xiaoyan; Ranefall, Petter; Krzywkowski, Tomasz; Brismar, Hjalmar; Nilsson, Mats; Wählby, Carolina; Söderberg, Ola

    2015-01-01

    Rolling circle amplification (RCA) for generation of distinct fluorescent signals in situ relies upon the self-collapsing properties of single-stranded DNA in commonly used RCA-based methods. By introducing a cross-hybridizing DNA oligonucleotide during rolling circle amplification, we demonstrate that the fluorophore-labeled RCA products (RCPs) become smaller. The reduced size of RCPs increases the local concentration of fluorophores and as a result, the signal intensity increases together with the signal-to-noise ratio. Furthermore, we have found that RCPs sometimes tend to disintegrate and may be recorded as several RCPs, a trait that is prevented with our cross-hybridizing DNA oligonucleotide. These effects generated by compaction of RCPs improve accuracy of visual as well as automated in situ analysis for RCA based methods, such as proximity ligation assays (PLA) and padlock probes. PMID:26202090

  6. A dynamic bead-based microarray for parallel DNA detection

    NASA Astrophysics Data System (ADS)

    Sochol, R. D.; Casavant, B. P.; Dueck, M. E.; Lee, L. P.; Lin, L.

    2011-05-01

    A microfluidic system has been designed and constructed by means of micromachining processes to integrate both microfluidic mixing of mobile microbeads and hydrodynamic microbead arraying capabilities on a single chip to simultaneously detect multiple bio-molecules. The prototype system has four parallel reaction chambers, which include microchannels of 18 × 50 µm2 cross-sectional area and a microfluidic mixing section of 22 cm length. Parallel detection of multiple DNA oligonucleotide sequences was achieved via molecular beacon probes immobilized on polystyrene microbeads of 16 µm diameter. Experimental results show quantitative detection of three distinct DNA oligonucleotide sequences from the Hepatitis C viral (HCV) genome with single base-pair mismatch specificity. Our dynamic bead-based microarray offers an effective microfluidic platform to increase parallelization of reactions and improve microbead handling for various biological applications, including bio-molecule detection, medical diagnostics and drug screening.

  7. Methylation oligonucleotide microarray: a novel tool to analyze methylation patterns

    NASA Astrophysics Data System (ADS)

    Hou, Peng; Ji, Meiju; He, Nongyao; Lu, Zuhong

    2003-04-01

    A new technique to analyze methylation patterns in several adjacent CpG sites was developed and reported here. We selected a 336bp segment of the 5"-untranslated region and the first exon of the p16Ink4a gene, which include the most densely packed CpG fragment of the islands containing 32 CpG dinucleotides, as the investigated target. The probes that include all types of methylation patterns were designed to fabricate a DNA microarray to determine the methylation patterns of seven adjacent CpG dinucleotides sites. High accuracy and reproducibility were observed in several parallel experiments. The results led us to the conclusion that the methylation oligonucleotide microarray can be applied as a novel and powerful tool to map methylation patterns and changes in multiple CpG island loci in a variety of tumors.

  8. Differentiation of the seven major lyssavirus species by oligonucleotide microarray.

    PubMed

    Xi, Jin; Guo, Huancheng; Feng, Ye; Xu, Yunbin; Shao, Mingfu; Su, Nan; Wan, Jiayu; Li, Jiping; Tu, Changchun

    2012-03-01

    An oligonucleotide microarray, LyssaChip, has been developed and verified as a highly specific diagnostic tool for differentiation of the 7 major lyssavirus species. As with conventional typing microarray methods, the LyssaChip relies on sequence differences in the 371-nucleotide region coding for the nucleoprotein. This region was amplified using nested reverse transcription-PCR primers that bind to the 7 major lyssaviruses. The LyssaChip includes 57 pairs of species typing and corresponding control oligonucleotide probes (oligoprobes) immobilized on glass slides, and it can analyze 12 samples on a single slide within 8 h. Analysis of 111 clinical brain specimens (65 from animals with suspected rabies submitted to the laboratory and 46 of butchered dog brain tissues collected from restaurants) showed that the chip method was 100% sensitive and highly consistent with the "gold standard," a fluorescent antibody test (FAT). The chip method could detect rabies virus in highly decayed brain tissues, whereas the FAT did not, and therefore the chip test may be more applicable to highly decayed brain tissues than the FAT. LyssaChip may provide a convenient and inexpensive alternative for diagnosis and differentiation of rabies and rabies-related diseases.

  9. Effects of non-CpG site methylation on DNA thermal stability: a fluorescence study

    PubMed Central

    Nardo, Luca; Lamperti, Marco; Salerno, Domenico; Cassina, Valeria; Missana, Natalia; Bondani, Maria; Tempestini, Alessia; Mantegazza, Francesco

    2015-01-01

    Cytosine methylation is a widespread epigenetic regulation mechanism. In healthy mature cells, methylation occurs at CpG dinucleotides within promoters, where it primarily silences gene expression by modifying the binding affinity of transcription factors to the promoters. Conversely, a recent study showed that in stem cells and cancer cell precursors, methylation also occurs at non-CpG pairs and involves introns and even gene bodies. The epigenetic role of such methylations and the molecular mechanisms by which they induce gene regulation remain elusive. The topology of both physiological and aberrant non-CpG methylation patterns still has to be detailed and could be revealed by using the differential stability of the duplexes formed between site-specific oligonucleotide probes and the corresponding methylated regions of genomic DNA. Here, we present a systematic study of the thermal stability of a DNA oligonucleotide sequence as a function of the number and position of non-CpG methylation sites. The melting temperatures were determined by monitoring the fluorescence of donor-acceptor dual-labelled oligonucleotides at various temperatures. An empirical model that estimates the methylation-induced variations in the standard values of hybridization entropy and enthalpy was developed. PMID:26354864

  10. 2'β-Fluoro-Tricyclo Nucleic Acids (2'F-tc-ANA): Thermal Duplex Stability, Structural Studies, and RNase H Activation.

    PubMed

    Istrate, Alena; Katolik, Adam; Istrate, Andrei; Leumann, Christian J

    2017-08-01

    We describe the synthesis, thermal stability, structural and RNase H activation properties of 2'β-fluoro-tricyclo nucleic acids (2'F-tc-ANA). Three 2'F-tc-ANA nucleosides (T, 5Me C and A) were synthesized starting from a previously described fluorinated tricyclo sugar intermediate. NMR analysis and quantum mechanical calculations indicate that 2'F-tc-ANA nucleosides prefer sugar conformations in the East and South regions of the pseudorotational cycle. UV-melting experiments revealed that non-consecutive insertions of 2'F-tc-ANA units in DNA reduce the affinity to DNA and RNA complements. However, an oligonucleotide with five contiguous 2'F-tc-ANA-T insertions exhibits increased affinity to complementary RNA. Moreover, a fully modified 10-mer 2'F-tc-ANA oligonucleotide paired to both DNA (+1.6 °C/mod) and RNA (+2.5 °C/mod) with significantly higher affinity compared to corresponding unmodified DNA, and similar affinity compared to corresponding tc-DNA. In addition, CD spectroscopy and molecular dynamics simulations indicate that the conformation of the 2'F-tc-ANA/RNA duplex is similar to that of a DNA/RNA duplex. Moreover, in some sequence contexts, 2'F-tc-ANA promotes RNase H-mediated cleavage of a complementary RNA strand. Taken together, 2'F-tc-ANA represents a nucleic acid analogue that offers the advantage of high RNA affinity while maintaining the ability to activate RNase H, and can be considered a prospective candidate for gene silencing applications. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. [Oligonucleotide microarray for subtyping avian influenza virus].

    PubMed

    Xueqing, Han; Xiangmei, Lin; Yihong, Hou; Shaoqiang, Wu; Jian, Liu; Lin, Mei; Guangle, Jia; Zexiao, Yang

    2008-09-01

    Avian influenza viruses are important human and animal respiratory pathogens and rapid diagnosis of novel emerging avian influenza viruses is vital for effective global influenza surveillance. We developed an oligonucleotide microarray-based method for subtyping all avian influenza virus (16 HA and 9 NA subtypes). In total 25 pairs of primers specific for different subtypes and 1 pair of universal primers were carefully designed based on the genomic sequences of influenza A viruses retrieved from GenBank database. Several multiplex RT-PCR methods were then developed, and the target cDNAs of 25 subtype viruses were amplified by RT-PCR or overlapping PCR for evaluating the microarray. Further 52 oligonucleotide probes specific for all 25 subtype viruses were designed according to published gene sequences of avian influenza viruses in amplified target cDNAs domains, and a microarray for subtyping influenza A virus was developed. Then its specificity and sensitivity were validated by using different subtype strains and 2653 samples from 49 different areas. The results showed that all the subtypes of influenza virus could be identified simultaneously on this microarray with high sensitivity, which could reach to 2.47 pfu/mL virus or 2.5 ng target DNA. Furthermore, there was no cross reaction with other avian respiratory virus. An oligonucleotide microarray-based strategy for detection of avian influenza viruses has been developed. Such a diagnostic microarray will be useful in discovering and identifying all subtypes of avian influenza virus.

  12. Development and use of fluorescent 16S rRNA-targeted probes for the specific detection of Methylophaga species by in situ hybridization in marine sediments.

    PubMed

    Janvier, Monique; Regnault, Béatrice; Grimont, Patrick

    2003-09-01

    Methylotrophic bacteria are widespread in nature. They may play an important role in the cycling of carbon and in the metabolism of dimethylsulfide in a marine environment. Bacteria belonging to the genus Methylophaga are a unique group of aerobic, halophilic, non-methane-utilizing methylotrophs. Two 16S rRNA-targeted oligonucleotide probes were developed for the specific detection of Methylophaga species, marine methylobacteria, by fluorescence in situ hybridization. Probe MPH-730 was highly specific for all members of the genus Methylophaga while probe MPHm-994 targeted exclusively M. marina. The application of these probes were demonstrated by the detection of Methylophaga species in enrichment cultures from various marine sediments. All isolates recovered were visualized by using the genus specific probe MPH-730. The results were confirmed by 16S rDNA sequencing which demonstrated that all selected isolates belong to Methylophaga. Five isolates could be detected by the M. marina-specific probe MPHm-994 and were confirmed by rRNA gene restriction pattern (ribotyping). With the development of these specific probes, fluorescence in situ hybridization shows that the genus Methylophaga is widespread in marine samples.

  13. Primary structure of prostaglandin G/H synthase from sheep vesicular gland determined from the complementary DNA sequence.

    PubMed Central

    DeWitt, D L; Smith, W L

    1988-01-01

    Prostaglandin G/H synthase (8,11,14-icosatrienoate, hydrogen-donor:oxygen oxidoreductase, EC 1.14.99.1) catalyzes the first step in the formation of prostaglandins and thromboxanes, the conversion of arachidonic acid to prostaglandin endoperoxides G and H. This enzyme is the site of action of nonsteroidal anti-inflammatory drugs. We have isolated a 2.7-kilobase complementary DNA (cDNA) encompassing the entire coding region of prostaglandin G/H synthase from sheep vesicular glands. This cDNA, cloned from a lambda gt 10 library prepared from poly(A)+ RNA of vesicular glands, hybridizes with a single 2.75-kilobase mRNA species. The cDNA clone was selected using oligonucleotide probes modeled from amino acid sequences of tryptic peptides prepared from the purified enzyme. The full-length cDNA encodes a protein of 600 amino acids, including a signal sequence of 24 amino acids. Identification of the cDNA as coding for prostaglandin G/H synthase is based on comparison of amino acid sequences of seven peptides comprising 103 amino acids with the amino acid sequence deduced from the nucleotide sequence of the cDNA. The molecular weight of the unglycosylated enzyme lacking the signal peptide is 65,621. The synthase is a glycoprotein, and there are three potential sites for N-glycosylation, two of them in the amino-terminal half of the molecule. The serine reported to be acetylated by aspirin is at position 530, near the carboxyl terminus. There is no significant similarity between the sequence of the synthase and that of any other protein in amino acid or nucleotide sequence libraries, and a heme binding site(s) is not apparent from the amino acid sequence. The availability of a full-length cDNA clone coding for prostaglandin G/H synthase should facilitate studies of the regulation of expression of this enzyme and the structural features important for catalysis and for interaction with anti-inflammatory drugs. Images PMID:3125548

  14. Coiled coil interactions for the targeting of liposomes for nucleic acid delivery

    NASA Astrophysics Data System (ADS)

    Oude Blenke, Erik E.; van den Dikkenberg, Joep; van Kolck, Bartjan; Kros, Alexander; Mastrobattista, Enrico

    2016-04-01

    Coiled coil interactions are strong protein-protein interactions that are involved in many biological processes, including intracellular trafficking and membrane fusion. A synthetic heterodimeric coiled-coil forming peptide pair, known as E3 (EIAALEK)3 and K3 (KIAALKE)3 was used to functionalize liposomes encapsulating a splice correcting oligonucleotide or siRNA. These peptide-functionalized vesicles are highly stable in solution but start to cluster when vesicles modified with complementary peptides are mixed together, demonstrating that the peptides quickly coil and crosslink the vesicles. When one of the peptides was anchored to the cell membrane using a hydrophobic cholesterol anchor, vesicles functionalized with the complementary peptide could be docked to these cells, whereas non-functionalized cells did not show any vesicle tethering. Although the anchored peptides do not have a downstream signaling pathway, microscopy pictures revealed that after four hours, the majority of the docked vesicles were internalized by endocytosis. Finally, for the first time, it was shown that the coiled coil assembly at the interface between the vesicles and the cell membrane induces active uptake and leads to cytosolic delivery of the nucleic acid cargo. Both the siRNA and the splice correcting oligonucleotide were functionally delivered, resulting respectively in the silencing or recovery of luciferase expression in the appropriate cell lines. These results demonstrate that the docking to the cell by coiled coil interaction can induce active uptake and achieve the successful intracellular delivery of otherwise membrane impermeable nucleic acids in a highly specific manner.Coiled coil interactions are strong protein-protein interactions that are involved in many biological processes, including intracellular trafficking and membrane fusion. A synthetic heterodimeric coiled-coil forming peptide pair, known as E3 (EIAALEK)3 and K3 (KIAALKE)3 was used to functionalize liposomes encapsulating a splice correcting oligonucleotide or siRNA. These peptide-functionalized vesicles are highly stable in solution but start to cluster when vesicles modified with complementary peptides are mixed together, demonstrating that the peptides quickly coil and crosslink the vesicles. When one of the peptides was anchored to the cell membrane using a hydrophobic cholesterol anchor, vesicles functionalized with the complementary peptide could be docked to these cells, whereas non-functionalized cells did not show any vesicle tethering. Although the anchored peptides do not have a downstream signaling pathway, microscopy pictures revealed that after four hours, the majority of the docked vesicles were internalized by endocytosis. Finally, for the first time, it was shown that the coiled coil assembly at the interface between the vesicles and the cell membrane induces active uptake and leads to cytosolic delivery of the nucleic acid cargo. Both the siRNA and the splice correcting oligonucleotide were functionally delivered, resulting respectively in the silencing or recovery of luciferase expression in the appropriate cell lines. These results demonstrate that the docking to the cell by coiled coil interaction can induce active uptake and achieve the successful intracellular delivery of otherwise membrane impermeable nucleic acids in a highly specific manner. Electronic supplementary information (ESI) available: Two videos of the experiment are shown in Fig. 5, demonstrating the distinctive characteristics of the peptide pair in a mixed population of cells are available in online. Video S1 shows the experiment in the bright field channel including the green channel (calcein-AM stained unfunctionalized cells) and orange channel (rhodamine labeled liposomes). Video S2 shows the exact same frames but combining the fluorescent channels only, including the blue channel for Hoechst nuclear staining. Both videos consist of 31 frames at a frame rate of 5 fps. The labeled liposomes are injected after frame 1. The videos span a total timeframe of 15 minutes. See DOI: 10.1039/c6nr00711b

  15. Combinatorial approaches to gene recognition.

    PubMed

    Roytberg, M A; Astakhova, T V; Gelfand, M S

    1997-01-01

    Recognition of genes via exon assembly approaches leads naturally to the use of dynamic programming. We consider the general graph-theoretical formulation of the exon assembly problem and analyze in detail some specific variants: multicriterial optimization in the case of non-linear gene-scoring functions; context-dependent schemes for scoring exons and related procedures for exon filtering; and highly specific recognition of arbitrary gene segments, oligonucleotide probes and polymerase chain reaction (PCR) primers.

  16. RNA splicing process analysis for identifying antisense oligonucleotide inhibitors with padlock probe-based isothermal amplification† †Electronic supplementary information (ESI) available: Additional experimental materials, methods, DNA sequences and supplementary figures and tables. See DOI: 10.1039/c7sc01336a Click here for additional data file.

    PubMed Central

    Ren, Xiaojun; Deng, Ruijie; Wang, Lida; Zhang, Kaixiang

    2017-01-01

    RNA splicing, which mainly involves two transesterification steps, is a fundamental process of gene expression and its abnormal regulation contributes to serious genetic diseases. Antisense oligonucleotides (ASOs) are genetic control tools that can be used to specifically control genes through alteration of the RNA splicing pathway. Despite intensive research, how ASOs or various other factors influence the multiple processes of RNA splicing still remains obscure. This is largely due to an inability to analyze the splicing efficiency of each step in the RNA splicing process with high sensitivity. We addressed this limitation by introducing a padlock probe-based isothermal amplification assay to achieve quantification of the specific products in different splicing steps. With this amplified assay, the roles that ASOs play in RNA splicing inhibition in the first and second steps could be distinguished. We identified that 5′-ASO could block RNA splicing by inhibiting the first step, while 3′-ASO could block RNA splicing by inhibiting the second step. This method provides a versatile tool for assisting efficient ASO design and discovering new splicing modulators and therapeutic drugs. PMID:28989608

  17. Nanoparticle based bio-bar code technology for trace analysis of aflatoxin B1 in Chinese herbs.

    PubMed

    Yu, Yu-Yan; Chen, Yuan-Yuan; Gao, Xuan; Liu, Yuan-Yuan; Zhang, Hong-Yan; Wang, Tong-Ying

    2018-04-01

    A novel and sensitive assay for aflatoxin B1 (AFB1) detection has been developed by using bio-bar code assay (BCA). The method that relies on polyclonal antibodies encoded with DNA modified gold nanoparticle (NP) and monoclonal antibodies modified magnetic microparticle (MMP), and subsequent detection of amplified target in the form of bio-bar code using a fluorescent quantitative polymerase chain reaction (FQ-PCR) detection method. First, NP probes encoded with DNA that was unique to AFB1, MMP probes with monoclonal antibodies that bind AFB1 specifically were prepared. Then, the MMP-AFB1-NP sandwich compounds were acquired, dehybridization of the oligonucleotides on the nanoparticle surface allows the determination of the presence of AFB1 by identifying the oligonucleotide sequence released from the NP through FQ-PCR detection. The bio-bar code techniques system for detecting AFB1 was established, and the sensitivity limit was about 10 -8  ng/mL, comparable ELISA assays for detecting the same target, it showed that we can detect AFB1 at low attomolar levels with the bio-bar-code amplification approach. This is also the first demonstration of a bio-bar code type assay for the detection of AFB1 in Chinese herbs. Copyright © 2017. Published by Elsevier B.V.

  18. A Paper-Based Sandwich Format Hybridization Assay for Unlabeled Nucleic Acid Detection Using Upconversion Nanoparticles as Energy Donors in Luminescence Resonance Energy Transfer.

    PubMed

    Zhou, Feng; Noor, M Omair; Krull, Ulrich J

    2015-09-24

    Bioassays based on cellulose paper substrates are gaining increasing popularity for the development of field portable and low-cost diagnostic applications. Herein, we report a paper-based nucleic acid hybridization assay using immobilized upconversion nanoparticles (UCNPs) as donors in luminescence resonance energy transfer (LRET). UCNPs with intense green emission served as donors with Cy3 dye as the acceptor. The avidin functionalized UCNPs were immobilized on cellulose paper and subsequently bioconjugated to biotinylated oligonucleotide probes. Introduction of unlabeled oligonucleotide targets resulted in a formation of probe-target duplexes. A subsequent hybridization of Cy3 labeled reporter with the remaining single stranded portion of target brought the Cy3 dye in close proximity to the UCNPs to trigger a LRET-sensitized emission from the acceptor dye. The hybridization assays provided a limit of detection (LOD) of 146.0 fmol and exhibited selectivity for one base pair mismatch discrimination. The assay was functional even in undiluted serum samples. This work embodies important progress in developing DNA hybridization assays on paper. Detection of unlabeled targets is achieved using UCNPs as LRET donors, with minimization of background signal from paper substrates owing to the implementation of low energy near-infrared (NIR) excitation.

  19. Universal detection of phytoplasmas and Xylella spp. by TaqMan singleplex and multiplex real-time PCR with dual priming oligonucleotides.

    PubMed

    Ito, Takao; Suzaki, Koichi

    2017-01-01

    Phytoplasmas and Xylella spp. are bacteria that cause many economically important plant diseases worldwide. TaqMan probe-based quantitative real-time polymerase chain reaction (qPCR) assays have been utilized to universally detect phytoplasmas or Xylella fastidiosa. To develop a superior universal qPCR method, we used a dual priming oligonucleotide (DPO) with two annealing sites as a reverse primer to target the well-conserved bacterial 16S rDNA. The new qPCR assays universally detected various species of phytoplasmas and subspecies of X. fastidiosa as well as Xylella taiwanensis, and generally showed superior threshold cycle values when amplifying specific or non-specific products compared to current universal qPCR assays. The proposed qPCR assays were integrated to develop a multiplex qPCR assay that simultaneously detected phytoplasmas, Xylella spp., and an internal plant DNA positive control within 1 hour. This assay could detect a minimum of ten bacterial cells and was compatible with crude extractions used in the rapid screening of various plants. The amplicons were of sufficient lengths to be directly sequenced for preliminary identification, and the primers could be used in universal conventional PCR assays. Additionally, reverse DPO primers can be utilized to improve other probe-based qPCR assays.

  20. Universal detection of phytoplasmas and Xylella spp. by TaqMan singleplex and multiplex real-time PCR with dual priming oligonucleotides

    PubMed Central

    Suzaki, Koichi

    2017-01-01

    Phytoplasmas and Xylella spp. are bacteria that cause many economically important plant diseases worldwide. TaqMan probe-based quantitative real-time polymerase chain reaction (qPCR) assays have been utilized to universally detect phytoplasmas or Xylella fastidiosa. To develop a superior universal qPCR method, we used a dual priming oligonucleotide (DPO) with two annealing sites as a reverse primer to target the well-conserved bacterial 16S rDNA. The new qPCR assays universally detected various species of phytoplasmas and subspecies of X. fastidiosa as well as Xylella taiwanensis, and generally showed superior threshold cycle values when amplifying specific or non-specific products compared to current universal qPCR assays. The proposed qPCR assays were integrated to develop a multiplex qPCR assay that simultaneously detected phytoplasmas, Xylella spp., and an internal plant DNA positive control within 1 hour. This assay could detect a minimum of ten bacterial cells and was compatible with crude extractions used in the rapid screening of various plants. The amplicons were of sufficient lengths to be directly sequenced for preliminary identification, and the primers could be used in universal conventional PCR assays. Additionally, reverse DPO primers can be utilized to improve other probe-based qPCR assays. PMID:28957362

Top