Describing Speech Usage in Daily Activities in Typical Adults.

PubMed

Anderson, Laine; Baylor, Carolyn R; Eadie, Tanya L; Yorkston, Kathryn M

2016-01-01

"Speech usage" refers to what people want or need to do with their speech to meet communication demands in life roles. The purpose of this study was to contribute to validation of the Levels of Speech Usage scale by providing descriptive data from a sample of adults without communication disorders, comparing this scale to a published Occupational Voice Demands scale and examining predictors of speech usage levels. This is a survey design. Adults aged ≥25 years without reported communication disorders were recruited nationally to complete an online questionnaire. The questionnaire included the Levels of Speech Usage scale, questions about relevant occupational and nonoccupational activities (eg, socializing, hobbies, childcare, and so forth), and demographic information. Participants were also categorized according to Koufman and Isaacson occupational voice demands scale. A total of 276 participants completed the questionnaires. People who worked for pay tended to report higher levels of speech usage than those who do not work for pay. Regression analyses showed employment to be the major contributor to speech usage; however, considerable variance left unaccounted for suggests that determinants of speech usage and the relationship between speech usage, employment, and other life activities are not yet fully defined. The Levels of Speech Usage may be a viable instrument to systematically rate speech usage because it captures both occupational and nonoccupational speech demands. These data from a sample of typical adults may provide a reference to help in interpreting the impact of communication disorders on speech usage patterns. Copyright © 2016 The Voice Foundation. Published by Elsevier Inc. All rights reserved.

Twenty-Five Years of Applications of the Modified Allan Variance in Telecommunications.

PubMed

Bregni, Stefano

2016-04-01

The Modified Allan Variance (MAVAR) was originally defined in 1981 for measuring frequency stability in precision oscillators. Due to its outstanding accuracy in discriminating power-law noise, it attracted significant interest among telecommunications engineers since the early 1990s, when it was approved as a standard measure in international standards, redressed as Time Variance (TVAR), for specifying the time stability of network synchronization signals and of equipment clocks. A dozen years later, the usage of MAVAR was also introduced for Internet traffic analysis to estimate self-similarity and long-range dependence. Further, in this field, it demonstrated superior accuracy and sensitivity, better than most popular tools already in use. This paper surveys the last 25 years of progress in extending the field of application of the MAVAR in telecommunications. First, the rationale and principles of the MAVAR are briefly summarized. Its adaptation as TVAR for specification of timing stability is presented. The usage of MAVAR/TVAR in telecommunications standards is reviewed. Examples of measurements on real telecommunications equipment clocks are presented, providing an overview on their actual performance in terms of MAVAR. Moreover, applications of MAVAR to network traffic analysis are surveyed. The superior accuracy of MAVAR in estimating long-range dependence is emphasized by highlighting some remarkable practical examples of real network traffic analysis.

A high-resolution, nucleosome position map of C. elegans reveals a lack of universal sequence-dictated positioning

PubMed Central

Valouev, Anton; Ichikawa, Jeffrey; Tonthat, Thaisan; Stuart, Jeremy; Ranade, Swati; Peckham, Heather; Zeng, Kathy; Malek, Joel A.; Costa, Gina; McKernan, Kevin; Sidow, Arend; Fire, Andrew; Johnson, Steven M.

2008-01-01

Using the massively parallel technique of sequencing by oligonucleotide ligation and detection (SOLiD; Applied Biosystems), we have assessed the in vivo positions of more than 44 million putative nucleosome cores in the multicellular genetic model organism Caenorhabditis elegans. These analyses provide a global view of the chromatin architecture of a multicellular animal at extremely high density and resolution. While we observe some degree of reproducible positioning throughout the genome in our mixed stage population of animals, we note that the major chromatin feature in the worm is a diversity of allowed nucleosome positions at the vast majority of individual loci. While absolute positioning of nucleosomes can vary substantially, relative positioning of nucleosomes (in a repeated array structure likely to be maintained at least in part by steric constraints) appears to be a significant property of chromatin structure. The high density of nucleosomal reads enabled a substantial extension of previous analysis describing the usage of individual oligonucleotide sequences along the span of the nucleosome core and linker. We release this data set, via the UCSC Genome Browser, as a resource for the high-resolution analysis of chromatin conformation and DNA accessibility at individual loci within the C. elegans genome. PMID:18477713

Comparing the Self-Report and Measured Smartphone Usage of College Students: A Pilot Study

PubMed Central

Lee, Heyoung; Nguyen, Trung Giang; Choi, Sam-Wook; Kim, Dae Jin

2017-01-01

Objective Nowadays smartphone overuse has become a social and medical concern. For the diagnosis and treatment, clinicians use the self-report information, but the report data often does not match actual usage pattern. The paper examines the similarity and variance in smartphone usage patterns between the measured data and self-reported data. Methods Together with the self-reported data, the real usage log data is collected from 35 college students in a metropolitan region of Northeast Asia, using Android smartphone monitoring application developed by the authors. Results The unconscious users underestimate their usage time by 40%, in spite of 15% more use in the actual usage. Messengers are most-used application regardless of their self-report, and significant preference to SNS applications was observed in addict group. The actual hourly pattern is consistent with the reported one. College students use more in the afternoon, when they have more free time and cannot use PCs. No significant difference in hourly pattern is observed between the measured and self-report. Conclusion The result shows there are significant cognitive bias in actual usage patterns exists in self report of smartphone addictions. Clinicians are recommended to utilize measurement tools in diagnosis and treatment of smartphone overusing subjects. PMID:28326119

Recommendations of the Oligonucleotide Safety Working Group's Formulated Oligonucleotide Subcommittee for the Safety Assessment of Formulated Oligonucleotide-Based Therapeutics.

PubMed

Marlowe, Jennifer L; Akopian, Violetta; Karmali, Priya; Kornbrust, Douglas; Lockridge, Jennifer; Semple, Sean

2017-08-01

The use of lipid formulations has greatly improved the ability to effectively deliver oligonucleotides and has been instrumental in the rapid expansion of therapeutic development programs using oligonucleotide drugs. However, the development of such complex multicomponent therapeutics requires the implementation of unique, scientifically sound approaches to the nonclinical development of these drugs, based upon a hybrid of knowledge and experiences drawn from small molecule, protein, and oligonucleotide therapeutic drug development. The relative paucity of directly applicable regulatory guidance documents for oligonucleotide therapeutics in general has resulted in the generation of multiple white papers from oligonucleotide drug development experts and members of the Oligonucleotide Safety Working Group (OSWG). The members of the Formulated Oligonucleotide Subcommittee of the OSWG have utilized their collective experience working with a variety of formulations and their associated oligonucleotide payloads, as well as their insights into regulatory considerations and expectations, to generate a series of consensus recommendations for the pharmacokinetic characterization and nonclinical safety assessment of this unique class of therapeutics. It should be noted that the focus of Subcommittee discussions was on lipid nanoparticle and other types of particulate formulations of therapeutic oligonucleotides and not on conjugates or other types of modifications of oligonucleotide structure intended to facilitate delivery.

EvOligo: A Novel Software to Design and Group Libraries of Oligonucleotides Applicable for Nucleic Acid-Based Experiments.

PubMed

Milewski, Marek C; Kamel, Karol; Kurzynska-Kokorniak, Anna; Chmielewski, Marcin K; Figlerowicz, Marek

2017-10-01

Experimental methods based on DNA and RNA hybridization, such as multiplex polymerase chain reaction, multiplex ligation-dependent probe amplification, or microarray analysis, require the use of mixtures of multiple oligonucleotides (primers or probes) in a single test tube. To provide an optimal reaction environment, minimal self- and cross-hybridization must be achieved among these oligonucleotides. To address this problem, we developed EvOligo, which is a software package that provides the means to design and group DNA and RNA molecules with defined lengths. EvOligo combines two modules. The first module performs oligonucleotide design, and the second module performs oligonucleotide grouping. The software applies a nearest-neighbor model of nucleic acid interactions coupled with a parallel evolutionary algorithm to construct individual oligonucleotides, and to group the molecules that are characterized by the weakest possible cross-interactions. To provide optimal solutions, the evolutionary algorithm sorts oligonucleotides into sets, preserves preselected parts of the oligonucleotides, and shapes their remaining parts. In addition, the oligonucleotide sets can be designed and grouped based on their melting temperatures. For the user's convenience, EvOligo is provided with a user-friendly graphical interface. EvOligo was used to design individual oligonucleotides, oligonucleotide pairs, and groups of oligonucleotide pairs that are characterized by the following parameters: (1) weaker cross-interactions between the non-complementary oligonucleotides and (2) more uniform ranges of the oligonucleotide pair melting temperatures than other available software products. In addition, in contrast to other grouping algorithms, EvOligo offers time-efficient sorting of paired and unpaired oligonucleotides based on various parameters defined by the user.

The delivery of therapeutic oligonucleotides

PubMed Central

Juliano, Rudolph L.

2016-01-01

The oligonucleotide therapeutics field has seen remarkable progress over the last few years with the approval of the first antisense drug and with promising developments in late stage clinical trials using siRNA or splice switching oligonucleotides. However, effective delivery of oligonucleotides to their intracellular sites of action remains a major issue. This review will describe the biological basis of oligonucleotide delivery including the nature of various tissue barriers and the mechanisms of cellular uptake and intracellular trafficking of oligonucleotides. It will then examine a variety of current approaches for enhancing the delivery of oligonucleotides. This includes molecular scale targeted ligand-oligonucleotide conjugates, lipid- and polymer-based nanoparticles, antibody conjugates and small molecules that improve oligonucleotide delivery. The merits and liabilities of these approaches will be discussed in the context of the underlying basic biology. PMID:27084936

Paper-based tuberculosis diagnostic devices with colorimetric gold nanoparticles

NASA Astrophysics Data System (ADS)

Tsai, Tsung-Ting; Shen, Shu-Wei; Cheng, Chao-Min; Chen, Chien-Fu

2013-08-01

A colorimetric sensing strategy employing gold nanoparticles and a paper assay platform has been developed for tuberculosis diagnosis. Unmodified gold nanoparticles and single-stranded detection oligonucleotides are used to achieve rapid diagnosis without complicated and time-consuming thiolated or other surface-modified probe preparation processes. To eliminate the use of sophisticated equipment for data analysis, the color variance for multiple detection results was simultaneously collected and concentrated on cellulose paper with the data readout transmitted for cloud computing via a smartphone. The results show that the 2.6 nM tuberculosis mycobacterium target sequences extracted from patients can easily be detected, and the turnaround time after the human DNA is extracted from clinical samples was approximately 1 h.

A clinical economics workstation for risk-adjusted health care cost management.

PubMed Central

Eisenstein, E. L.; Hales, J. W.

1995-01-01

This paper describes a healthcare cost accounting system which is under development at Duke University Medical Center. Our approach differs from current practice in that this system will dynamically adjust its resource usage estimates to compensate for variations in patient risk levels. This adjustment is made possible by introducing a new cost accounting concept, Risk-Adjusted Quantity (RQ). RQ divides case-level resource usage variances into their risk-based component (resource consumption differences attributable to differences in patient risk levels) and their non-risk-based component (resource consumption differences which cannot be attributed to differences in patient risk levels). Because patient risk level is a factor in estimating resource usage, this system is able to simultaneously address the financial and quality dimensions of case cost management. In effect, cost-effectiveness analysis is incorporated into health care cost management. PMID:8563361

Advanced surface-enhanced Raman gene probe systems and methods thereof

DOEpatents

Vo-Dinh, Tuan

2001-01-01

The subject invention is a series of methods and systems for using the Surface-Enhanced Raman (SER)-labeled Gene Probe for hybridization, detection and identification of SER-labeled hybridized target oligonucleotide material comprising the steps of immobilizing SER-labeled hybridized target oligonucleotide material on a support means, wherein the SER-labeled hybridized target oligonucleotide material comprise a SER label attached either to a target oligonucleotide of unknown sequence or to a gene probe of known sequence complementary to the target oligonucleotide sequence, the SER label is unique for the target oligonucleotide strands of a particular sequence wherein the SER-labeled oligonucleotide is hybridized to its complementary oligonucleotide strand, then the support means having the SER-labeled hybridized target oligonucleotide material adsorbed thereon is SERS activated with a SERS activating means, then the support means is analyzed.

The Effect of Flow Frequency on Internet Addiction to Different Internet Usage Activities

ERIC Educational Resources Information Center

Yang, Hui-Ling; Wu, Wei-Pang

2017-01-01

This study investigated the online flow frequency among college students in regard to different internet activities, and analyzed the effect of flow frequency on internet addiction. This study surveyed 525 undergraduate internet users in Taiwan by using convenience sampling to question participants. In this paper, analysis of variance (ANOVA) was…

A 12-week pilot study of acceptance of a computer-based chronic disease self-monitoring system among patients with type 2 diabetes mellitus and/or hypertension.

PubMed

Yan, Mian; Or, Calvin

2017-08-01

This study tested a structural model examining the effects of perceived usefulness, perceived ease of use, attitude, subjective norm, perceived behavioral control, health consciousness, and application-specific self-efficacy on the acceptance (i.e. behavioral intention and actual usage) of a computer-based chronic disease self-monitoring system among patients with type 2 diabetes mellitus and/or hypertension. The model was tested using partial least squares structural equation modeling, with 119 observations that were obtained by pooling data across three time points over a 12-week period. The results indicate that all of the seven constructs examined had a significant total effect on behavioral intention and explained 74 percent of the variance. Also, application-specific self-efficacy and behavioral intention had a significant total effect on actual usage and explained 17 percent of the variance. This study demonstrates that technology acceptance is determined by patient characteristics, technology attributes, and social influences. Applying the findings may increase the likelihood of acceptance.

[Study toward practical use of oligonucleotide therapeutics].

PubMed

Inoue, Takao; Yoshida, Tokuyuki

2014-01-01

Over the past decade, oligonucleotide-based therapeutics such as antisense oligonucleotides and small interfering RNAs (siRNAs) have been developed extensively. For example, mipomersen (Kynamro; ISIS Pharmaceuticals), which is a second-generation antisense oligonucleotide administered by subcutaneous injection, has recently been approved by the FDA for the treatment of homozygous familial hypercholesterolemia. On the other hands, methods for the evaluation of quality, efficacy and safety of oligonucleotide therapeutics have not been fully discussed. Furthermore, the regulatory guidance specific for oligonucleotide therapeutics has not been established yet. Under these circumstances, we started to collaborate with Osaka University and PMDA to discuss regulatory science focused on oligonucleotide therapeutics. Through the collaboration, we would like to propose the possible design of quality evaluation and preclinical safety-evaluation of oligonucleotide therapeutics.

Enzymatic production of 'monoclonal stoichiometric' single-stranded DNA oligonucleotides.

PubMed

Ducani, Cosimo; Kaul, Corinna; Moche, Martin; Shih, William M; Högberg, Björn

2013-07-01

Single-stranded oligonucleotides are important as research tools, as diagnostic probes, in gene therapy and in DNA nanotechnology. Oligonucleotides are typically produced via solid-phase synthesis, using polymer chemistries that are limited relative to what biological systems produce. The number of errors in synthetic DNA increases with oligonucleotide length, and the resulting diversity of sequences can be a problem. Here we present the 'monoclonal stoichiometric' (MOSIC) method for enzyme-mediated production of DNA oligonucleotides. We amplified oligonucleotides from clonal templates derived from single bacterial colonies and then digested cutter hairpins in the products, which released pools of oligonucleotides with precisely controlled relative stoichiometric ratios. We prepared 14-378-nucleotide MOSIC oligonucleotides either by in vitro rolling-circle amplification or by amplification of phagemid DNA in Escherichia coli. Analyses of the formation of a DNA crystal and folding of DNA nanostructures confirmed the scalability, purity and stoichiometry of the produced oligonucleotides.

Enzymatic Production of Monoclonal Stoichiometric Single-Stranded DNA Oligonucleotides

PubMed Central

Ducani, Cosimo; Kaul, Corinna; Moche, Martin; Shih, William M.; Högberg, Björn

2013-01-01

Single-stranded oligonucleotides are important as research tools as probes for diagnostics and gene therapy. Today, production of oligonucleotides is done via solid-phase synthesis. However, the capabilities of current polymer chemistry are limited in comparison to what can be produced in biological systems. The errors in synthetic DNA increases with oligonucleotide length, and sequence diversity can often be a problem. Here, we present the Monoclonal Stoichiometric (MOSIC) method for enzymatic DNA oligonucleotide production. Using this method, we amplify oligonucleotides from clonal templates followed by digestion of a cutter-hairpin, resulting in pools of monoclonal oligonucleotides with precisely controlled relative stoichiometric ratios. We present data where MOSIC oligonucleotides, 14–378 nt long, were prepared either by in vitro rolling-circle amplification, or by amplification in Escherichia coli in the form of phagemid DNA. The formation of a DNA crystal and folding of DNA nanostructures confirmed the scalability, purity and stoichiometry of the produced oligonucleotides. PMID:23727986

Identification of transcribed sequences in Arabidopsis thaliana by using high-resolution genome tiling arrays

PubMed Central

Stolc, Viktor; Samanta, Manoj Pratim; Tongprasit, Waraporn; Sethi, Himanshu; Liang, Shoudan; Nelson, David C.; Hegeman, Adrian; Nelson, Clark; Rancour, David; Bednarek, Sebastian; Ulrich, Eldon L.; Zhao, Qin; Wrobel, Russell L.; Newman, Craig S.; Fox, Brian G.; Phillips, George N.; Markley, John L.; Sussman, Michael R.

2005-01-01

Using a maskless photolithography method, we produced DNA oligonucleotide microarrays with probe sequences tiled throughout the genome of the plant Arabidopsis thaliana. RNA expression was determined for the complete nuclear, mitochondrial, and chloroplast genomes by tiling 5 million 36-mer probes. These probes were hybridized to labeled mRNA isolated from liquid grown T87 cells, an undifferentiated Arabidopsis cell culture line. Transcripts were detected from at least 60% of the nearly 26,330 annotated genes, which included 151 predicted genes that were not identified previously by a similar genome-wide hybridization study on four different cell lines. In comparison with previously published results with 25-mer tiling arrays produced by chromium masking-based photolithography technique, 36-mer oligonucleotide probes were found to be more useful in identifying intron–exon boundaries. Using two-dimensional HPLC tandem mass spectrometry, a small-scale proteomic analysis was performed with the same cells. A large amount of strongly hybridizing RNA was found in regions “antisense” to known genes. Similarity of antisense activities between the 25-mer and 36-mer data sets suggests that it is a reproducible and inherent property of the experiments. Transcription activities were also detected for many of the intergenic regions and the small RNAs, including tRNA, small nuclear RNA, small nucleolar RNA, and microRNA. Expression of tRNAs correlates with genome-wide amino acid usage. PMID:15755812

Identification of transcribed sequences in Arabidopsis thaliana by using high-resolution genome tiling arrays

NASA Technical Reports Server (NTRS)

Stolc, Viktor; Samanta, Manoj Pratim; Tongprasit, Waraporn; Sethi, Himanshu; Liang, Shoudan; Nelson, David C.; Hegeman, Adrian; Nelson, Clark; Rancour, David; Bednarek, Sebastian;

Syntheses of prodrug-type phosphotriester oligonucleotides responsive to intracellular reducing environment for improvement of cell membrane permeability and nuclease resistance.

PubMed

Hayashi, Junsuke; Samezawa, Yusuke; Ochi, Yosuke; Wada, Shun-Ichi; Urata, Hidehito

2017-07-15

We synthesized prodrug-type phosphotriester (PTE) oligonucleotides containing the six-membered cyclic disulfide moiety by using phosphoramidite chemistry. Prodrug-type oligonucleotides named "Reducing-Environment-Dependent Uncatalyzed Chemical Transforming (REDUCT) PTE oligonucleotides" were converted into natural oligonucleotides under cytosol-mimetic reductive condition. Furthermore, the REDUCT PTE oligonucleotides were robust to nuclease digestion and exhibited good cell membrane permeability. Copyright © 2017 Elsevier Ltd. All rights reserved.

Receptor-Mediated Uptake of Phosphorothioate Antisense Oligonucleotides in Different Cell Types of the Liver.

PubMed

Miller, Colton M; Tanowitz, Michael; Donner, Aaron J; Prakash, Thazha P; Swayze, Eric E; Harris, Edward N; Seth, Punit P

2018-06-01

Oligonucleotide therapeutics have emerged as a third distinct platform for drug discovery within the pharmaceutical industry. Five oligonucleotide-based drugs have been approved by the US FDA and over 100 oligonucleotides drugs are currently at different stages of human trials. Several of these oligonucleotide drugs are modified using the phosphorothioate (PS) backbone modification where one of the nonbridging oxygen atoms of the phosphodiester linkage is replaced with sulfur. In this review, we summarize our knowledge on receptor-mediated uptake of PS antisense oligonucleotides (ASOs) within different cell types of the liver-a privileged organ for the discovery of oligonucleotide-based therapeutics.

Static magnetic field reduced exogenous oligonucleotide uptake by spermatozoa using magnetic nanoparticle gene delivery system

NASA Astrophysics Data System (ADS)

Katebi, Samira; Esmaeili, Abolghasem; Ghaedi, Kamran

2016-03-01

Spermatozoa could introduce exogenous oligonucleotides of interest to the oocyte. The most important reason of low efficiency of sperm mediated gene transfer (SMGT) is low uptake of exogenous DNA by spermatozoa. The aim of this study was to evaluate the effects of static magnetic field on exogenous oligonucleotide uptake of spermatozoa using magnetofection method. Magnetic nanoparticles (MNPs) associated with the labeled oligonucleotides were used to increase the efficiency of exogenous oligonucleotide uptake by rooster spermatozoa. We used high-field/high-gradient magnet (NdFeB) to enhance and accelerate exogenous DNA sedimentation at the spermatozoa surface. Flow cytometry analysis was performed to measure viability and percentage of exogenous oligonucleotide uptake by sperm. Flow cytometry analysis showed a significant increase in exogenous oligonucleotide uptake by rooster spermatozoa (P<0.001) when spermatozoa were incubated in exogenous oligonucleotide solution and MNPs. However, by applying static magnetic field during magnetofection method, a significant decrease in exogenous oligonucleotide uptake was observed (P<0.05). Findings of this study showed that MNPs were effective to increase exogenous oligonucleotide uptake by rooster spermatozoa; however unlike others studies, static magnetic field, was not only ineffective to enhance exogenous oligonucleotide uptake by rooster spermatozoa but also led to reduction in efficiency of magnetic nanoparticles in gene transfer.

Are Career Centers Worthwhile?: Predicting Unique Variance in Career Outcomes through Career Center Usage

ERIC Educational Resources Information Center

Brotheridge, Celeste M.; Power, Jacqueline L.

2008-01-01

Purpose: This study seeks to examine the extent to which the use of career center services results in the significant incremental prediction of career outcomes beyond its established predictors. Design/methodology/approach: The authors survey the clients of a public agency's career center and use hierarchical multiple regressions in order to…

Quantitative analysis of antibiotic usage in British sheep flocks.

PubMed

Davies, Peers; Remnant, John G; Green, Martin J; Gascoigne, Emily; Gibbon, Nick; Hyde, Robert; Porteous, Jack R; Schubert, Kiera; Lovatt, Fiona; Corbishley, Alexander

2017-11-11

The aim of this study was to examine the variation in antibiotic usage between 207 commercial sheep flocks using their veterinary practice prescribing records. Mean and median prescribed mass per population corrected unit (mg/PCU) was 11.38 and 5.95, respectively and closely correlated with animal defined daily dose (ADDD) 1.47 (mean), 0.74 (median) (R 2 =0.84, P<0.001). This is low in comparison with the suggested target (an average across all the UK livestock sectors) of 50 mg/PCU. In total, 80 per cent of all antibiotic usage occurred in the 39 per cent of flocks where per animal usage was greater than 9.0 mg/PCU. Parenteral antibiotics, principally oxytetracycline, represented 82 per cent of the total prescribed mass, 65.5 per cent of antibiotics (mg/PCU) were prescribed for the treatment of lameness. Oral antibiotics were prescribed to 49 per cent of flocks, 64 per cent of predicted lamb crop/farm. Lowland flocks were prescribed significantly more antibiotics than hill flocks. Variance partitioning apportioned 79 per cent of variation in total antibiotic usage (mg/PCU) to the farm level and 21 per cent to the veterinary practice indicating that veterinary practices have a substantial impact on overall antimicrobial usage. Reducing antibiotic usage in the sheep sector should be possible with better understanding of the drivers of high usage in individual flocks and of veterinary prescribing practices. © British Veterinary Association (unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

Pentopyranosyl Oligonucleotide Systems. Part 11: Systems with Shortened Backbones: D)-beta-Ribopyranosyl-(4 yields 3 )- and (L)-alpha - Lyxopyranosyl-(4 yields 3 )-oligonucleotides

NASA Technical Reports Server (NTRS)

Wippo, Harald; Reck, Folkert; Kudick, Rene; Ramaseshan, Mahesh; Ceulemans, Griet; Bolli, Martin; Krishnamurthy, Ramanarayanan; Eschenmoser, Albert

2001-01-01

The (L)-a-lyxopyranosyl-(4'yields 3')-oligonucleotide system-a member of a pentopyranosyl oligonucleotide family containing a shortened backbone-is capable of cooperative base-pairing and of cross-pairing with DNA and RNA. In contrast, corresponding (D)-beta-ribopyransoyl-(4' yields 3')-oligonucleotides do not show base-pairing under similar conditions. We conclude that oligonucleotide systems can violate the six-bonds-per-backbone-unit rule by having five bonds instead, if their vicinally bound phosphodiester bridges can assume an antiperiplanar conformation. An additional structural feature that seems relevant to the cross-pairing capability of the (L)-a-lyxopyranosyl-(4' yields 3')-oligonucleotide system is its (small) backbone/basepair axes inclination. An inclination which is similar to that in B-DNA seems to be a prerequisite for an oligonucleotide system s capability to cross-pair with DNA.

MALDI MS analysis of oligonucleotides: desalting by functional magnetite beads using microwave-assisted extraction.

PubMed

Chen, Wei-Yu; Chen, Yu-Chie

2007-11-01

The presence of alkali cation adductions of oligonucleotides commonly deteriorates matrix-assisted laser desorption/ionization (MALDI) mass spectra. Thus, desalting is required for oligonucleotide samples prior to MALDI MS analysis in order to prevent the mass spectra from developing poor quality. In this paper, we demonstrate a new approach to extract traces of oligonucleotides from aqueous solutions containing high concentrations of salts using microwave-assisted extraction. The C18-presenting magnetite beads, capable of absorbing microwave irradiation, are used as affinity probes for oligonucleotides with the addition of triethylammonium acetate as the counterions. This new microwave-assisted extraction approach using magnetite beads as the trapping agents and as microwave-absorbers has been demonstrated to be very effective in the selective binding of oligonucleotides from aqueous solutions. The extraction of oligonucleotides from solutions onto the C18-presenting magnetite beads takes only 30 s to enrich oligonucleotides in sufficient quantities for MALDI MS analysis. After using this desalting approach, alkali cation adductions of oligonucleotides are dramatically reduced in the MALDI mass spectra. The presence of saturated NaCl (approximately 6 M) in the oligonucleotide sample is tolerated without degrading the mass spectra. The detection limit for d(A)6 is approximately 2.8 fmol.

[Impact of Delivery Method on Antiviral Activity of Phosphodiester, Phosphorothioate, and Phosphoryl Guanidine Oligonucleotides in MDCK Cells Infected with H5N1 Bird Flu Virus].

PubMed

Levina, A S; Repkova, M N; Chelobanov, B P; Bessudnova, E V; Mazurkova, N A; Stetsenko, D A; Zarytova, V F

2017-01-01

We have previously described nanocomposites containing conjugates or complexes of native oligodeoxyribonucleotides with poly-L-lysine and TiO2 nanoparticles. We have shown that these nanocomposites efficiently suppressed influenza A virus reproduction in MDCK cells. Here, we have synthesized previously undescribed nanocomposites that consist of TiO2 nanoparticles and polylysine conjugates with oligonucleotides that contain phosphoryl guanidine or phosphorothioate internucleotide groups. These nanocomposites have been shown to exhibit antiviral activity in MDCK cells infected with H5N1 influenza A virus. The nanocomposites containing phosphorothioate oligonucleotides inhibited virus replication ~130-fold. More potent inhibition, i.e., ~5000-fold or ~4600-fold, has been demonstrated by nanocomposites that contain phosphoryl guanidine or phosphodiester oligonucleotides, respectively. Free oligonucleotides have been nearly inactive. The antiviral activity of oligonucleotides of all three types, when delivered by Lipofectamine, has been significantly lower compared to the oligonucleotides delivered in the nanocomposites. In the former case, the phosphoryl guanidine oligonucleotide has appeared to be the most efficient; it has inhibited the virus replication by a factor of 400. The results make it possible to consider phosphoryl guanidine oligonucleotides, along with other oligonucleotide derivatives, as potential antiviral agents against H5N1 avian flu virus.

Modification of the 5' terminus of oligodeoxyribonucleotides for conjugation with ligands.

PubMed

Asseline, U; Thuong, N T

2001-08-01

Ligands can be introduced at the 5' terminus of an oligonucleotide by adding a linker to the ligand and modifying the 5' terminus of the oligonucleotide. These are then reacted to give the ligand-oligonucleotide conjugate. This unit describes the addition of carboxylated and aminoalkylated linkers, and phosphorothioate, phosphate, and masked thiol groups to the 5' terminus of an oligonucleotide. The addition of linkers to ligands and the final reaction that produces the ligand-conjugated oligonucleotide are described elsewhere in the series. This approach is particularly useful when there is a limited amount of ligand available, when the ligand is sensitive to chemical conditions required for oligonucleotide deprotection, or when the ligand is weakly soluble in solvents required for phosphoramidite- or H-phosphonate-mediated oligonucleotide synthesis.

Nucleic acid sequence detection using multiplexed oligonucleotide PCR

DOEpatents

Nolan, John P [Santa Fe, NM; White, P Scott [Los Alamos, NM

2006-12-26

Methods for rapidly detecting single or multiple sequence alleles in a sample nucleic acid are described. Provided are all of the oligonucleotide pairs capable of annealing specifically to a target allele and discriminating among possible sequences thereof, and ligating to each other to form an oligonucleotide complex when a particular sequence feature is present (or, alternatively, absent) in the sample nucleic acid. The design of each oligonucleotide pair permits the subsequent high-level PCR amplification of a specific amplicon when the oligonucleotide complex is formed, but not when the oligonucleotide complex is not formed. The presence or absence of the specific amplicon is used to detect the allele. Detection of the specific amplicon may be achieved using a variety of methods well known in the art, including without limitation, oligonucleotide capture onto DNA chips or microarrays, oligonucleotide capture onto beads or microspheres, electrophoresis, and mass spectrometry. Various labels and address-capture tags may be employed in the amplicon detection step of multiplexed assays, as further described herein.

Eta- and Partial Eta-Squared in L2 Research: A Cautionary Review and Guide to More Appropriate Usage

ERIC Educational Resources Information Center

Norouzian, Reza; Plonsky, Luke

2018-01-01

Eta-squared (?[superscript 2]) and partial eta-squared (?[subscript p][superscript 2]) are effect sizes that express the amount of variance accounted for by one or more independent variables. These indices are generally used in conjunction with ANOVA, the most commonly used statistical test in second language (L2) research (Plonsky, 2013).…

MULTIVARIATE ANALYSES (CONONICAL CORRELATION AND PARTIAL LEAST SQUARE, PLS) TO MODEL AND ASSESS THE ASSOCIATION OF LANDSCAPE METRICS TO SURFACE WATER CHEMICAL AND BIOLOGICAL PROPERTIES USING SAVANNAH RIVER BASIN DATA.

EPA Science Inventory

Many multivariate methods are used in describing and predicting relation; each has its unique usage of categorical and non-categorical data. In multivariate analysis of variance (MANOVA), many response variables (y's) are related to many independent variables that are categorical...

Predicting oligonucleotide affinity to nucleic acid targets.

PubMed Central

Mathews, D H; Burkard, M E; Freier, S M; Wyatt, J R; Turner, D H

1999-01-01

A computer program, OligoWalk, is reported that predicts the equilibrium affinity of complementary DNA or RNA oligonucleotides to an RNA target. This program considers the predicted stability of the oligonucleotide-target helix and the competition with predicted secondary structure of both the target and the oligonucleotide. Both unimolecular and bimolecular oligonucleotide self structure are considered with a user-defined concentration. The application of OligoWalk is illustrated with three comparisons to experimental results drawn from the literature. PMID:10580474

Template-Directed Ligation of Peptides to Oligonucleotides

NASA Technical Reports Server (NTRS)

Bruick, Richard K.; Dawson, Philip E.; Kent, Stephen BH; Usman, Nassim; Joyce, Gerald F.

1996-01-01

Synthetic oligonucleotides and peptides have enjoyed a wide range of applications in both biology and chemistry. As a consequence, oligonucleotide-peptide conjugates have received considerable attention, most notably in the development of antisense constructs with improved pharmacological properties. In addition, oligonucleotide-peptide conjugates have been used as molecular tags, in the assembly of supramolecular arrays and in the construction of encoded combinatorial libraries. To make these chimeric molecules more accessible for a broad range of investigations, we sought to develop a facile method for joining fully deprotected oligonucleotides and peptides through a stable amide bond linkage. Furthermore, we wished to make this ligation reaction addressable, enabling one to direct the ligation of specific oligonucleotide and peptide components.To confer specificity and accelerate the rate of the reaction, the ligation process was designed to be dependent on the presence of a complementary oligonucleotide template.

Versatile Method for the Site-Specific Modification of DNA with Boron Clusters: Anti-Epidermal Growth Factor Receptor (EGFR) Antisense Oligonucleotide Case.

PubMed

Ebenryter-Olbińska, Katarzyna; Kaniowski, Damian; Sobczak, Milena; Wojtczak, Błażej A; Janczak, Sławomir; Wielgus, Ewelina; Nawrot, Barbara; Leśnikowski, Zbigniew J

2017-11-21

A general and convenient approach for the incorporation of different types of boron clusters into specific locations of the DNA-oligonucleotide chain based on the automated phosphoramidite method of oligonucleotide synthesis and post-synthetic "click chemistry" modification has been developed. Pronounced effects of boron-cluster modification on the physico- and biochemical properties of the antisense oligonucleotides were observed. The silencing activity of antisense oligonucleotides bearing a single boron cluster modification in the middle of the oligonucleotide chain was substantially higher than that of unmodified oligonucleotides. This finding may be of importance for the design of therapeutic nucleic acids with improved properties. The proposed synthetic methodology broadens the availability of nucleic acid-boron cluster conjugates and opens up new avenues for their potential practical use. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Scalable amplification of strand subsets from chip-synthesized oligonucleotide libraries

PubMed Central

Schmidt, Thorsten L.; Beliveau, Brian J.; Uca, Yavuz O.; Theilmann, Mark; Da Cruz, Felipe; Wu, Chao-Ting; Shih, William M.

2015-01-01

Synthetic oligonucleotides are the main cost factor for studies in DNA nanotechnology, genetics and synthetic biology, which all require thousands of these at high quality. Inexpensive chip-synthesized oligonucleotide libraries can contain hundreds of thousands of distinct sequences, however only at sub-femtomole quantities per strand. Here we present a selective oligonucleotide amplification method, based on three rounds of rolling-circle amplification, that produces nanomole amounts of single-stranded oligonucleotides per millilitre reaction. In a multistep one-pot procedure, subsets of hundreds or thousands of single-stranded DNAs with different lengths can selectively be amplified and purified together. These oligonucleotides are used to fold several DNA nanostructures and as primary fluorescence in situ hybridization probes. The amplification cost is lower than other reported methods (typically around US$ 20 per nanomole total oligonucleotides produced) and is dominated by the use of commercial enzymes. PMID:26567534

Simple and rapid enzymatic method for the synthesis of single-strand oligonucleotides containing trifluorothymidine.

PubMed

Suzuki, Norihiko; Fukushima, Masakazu

2010-11-01

To investigate the mechanism of trifluorothymidine (TFT)-induced DNA damage, we developed an enzymatic method for the synthesis of single-strand oligonucleotides containing TFT-monophosphate residues. Sixteen-mer oligonucleotides and 14-mer 5'-phosphorylated oligonucleotides were annealed to the template of 25-mer, so as to empty one nucleotide site. TFT-triphosphate was incorporated into the site by DNA polymerase and then ligated to 5'-phosphorylated oligonucleotides by DNA ligase. The synthesized 31-mer oligonucleotides containing TFT residues were isolated from the 25-mer complementary template by denaturing polyacrylamide electrophoresis. Using these single-strand oligonucleotides containing TFT residues, the cleavage of TFT residues from DNA, using mismatch uracil-DNA glycosylase (MUG) of E.coli origin, was compared with that of 5-fluorouracil (5FU) and 5-bromodeoxyuridine (BrdU). The TFT/A pair was not cleaved by MUG, while the other pairs, namely, 5FU/A, 5FU/G, BrdU/A, BrdU/G, and TFT/G, were easily cleaved from each synthesized DNA. Thus, this method is useful for obtaining some site-specifically modified oligonucleotides.

Intravenous administration of stabilized antisense lipid particles (SALP) leads to activation and expansion of liver natural killer cells.

PubMed

Bramson, J L; Bodner, C A; Johnson, J; Semple, S; Hope, M J

2000-06-01

Stabilized antisense lipid particles (SALP) have been developed for the systemic delivery of oligonucleotides. The impact of intravenous SALP administration was measured with respect to activation of natural killer (NK) and NK1.1+ T (NKT) cells in the livers of immunocompetent mice. Treatment with a SALP containing a highly mitogenic oligonucleotide (INX-6295) generated an increase in NK cytolytic activity and cell number within the liver but did not appear to affect the number of hepatic NKT cells or their cytolytic activity. The same results were observed after intravenous administration of the mitogenic oligonucleotide alone. Interestingly, treatment with a SALP containing a weakly mitogenic oligonucleotide (INX-6300) also activated the liver NK cells, whereas the oligonucleotide alone was unable to elicit these effects. The NK stimulatory activity of a SALP containing INX-6300 required both lipid and oligonucleotide components. These results demonstrate that in addition to modifying the pharmacokinetics and biodistribution of intravenously administered oligonucleotides, SALP possess immunostimulatory activity independent of oligonucleotide mitogenicity, which can serve as an adjuvant to antisense therapies for cancer.

The chemical evolution of oligonucleotide therapies of clinical utility

PubMed Central

Khvorova, Anastasia; Watts, Jonathan K.

2017-01-01

After nearly 40 years of development, oligonucleotide therapeutics are nearing meaningful clinical productivity. One of the key advantages of oligonucleotide drugs is that their delivery and potency properties are derived primarily from the chemical structure of the oligonucleotide, while their target is defined by the base sequence. Thus, as oligonucleotides with a particular chemical design demonstrate appropriate distribution and safety profiles for clinical gene silencing in a particular tissue, this will open the door to the rapid development of additional drugs targeting other disease-associated genes in the same tissue. To achieve clinical productivity, the chemical architecture of the oligonucleotide needs to be optimized as a whole, using a combination of sugar, backbone, nucleobase and 3′/5′-terminal modifications. A portfolio of chemistries can be used to confer drug like properties onto the oligonucleotide as a whole, with minor chemical changes often translating into major improvements in clinical efficacy. Outstanding challenges in oligonucleotide chemical development include optimization of chemical architectures to ensure long-term safety and to enable robust clinical activity beyond the liver. PMID:28244990

Stability of non-Watson-Crick G-A/A-G base pair in synthetic DNA and RNA oligonucleotides.

PubMed

Ito, Yuko; Sone, Yumiko; Mizutani, Takaharu

2004-03-01

A non-Watson-Crick G-A/A-G base pair is found in SECIS (selenocysteine-insertion sequence) element in the 3'-untranslated region of Se-protein mRNAs and in the functional site of the hammerhead ribozyme. We studied the stability of G-A/A-G base pair (bold) in 17mer GT(U)GACGGAAACCGGAAC synthetic DNA and RNA oligonucleotides by thermal melting experiments and gel electrophoresis. The measured Tm value of DNA oligonucleotide having G-A/A-G pair showed an intermediate value (58 degrees C) between that of Watson-Crick G-C/C-G base pair (75 degrees C) and that of G-G/A-A of non-base-pair (40 degrees C). Similar thermal melting patterns were obtained with RNA oligonucleotides. This result indicates that the secondary structure of oligonucleotide having G-A/A-G base pair is looser than that of the G-C type Watson-Crick base pair. In the comparison between RNA and DNA having G-A/A-G base pair, the Tm value of the RNA oligonucleotide was 11 degrees C lower than that of DNA, indicating that DNA has a more rigid structure than RNA. The stained pattern of oligonucleotide on polyacrylamide gel clarified that the mobility of the DNA oligonucleotide G-A/A-G base pair changed according to the urea concentration from the rigid state (near the mobility of G-C/C-G oligonucleotide) in the absence of urea to the random state (near the mobility of G-G/A-A oligonucleotide) in 7 M urea. However, the RNA oligonucleotide with G-A/A-G pair moved at an intermediate mobility between that of oligonucleotide with G-C/C-G and of the oligonucleotide with G-G/A-A, and the mobility pattern did not depend on urea concentration. Thus, DNA and RNA oligonucleotides with the G-A/A-G base pair showed a pattern indicating an intermediate structure between the rigid Watson-Crick base pair and the random structure of non-base pair. RNA with G-A/A-G base pair has the intermediate structure not influenced by urea concentration. Finally, this study indicated that the intermediate rigidity imparted by Non-Watson-Crick base pair in SECIS element plays an important role in the selenocysteine expression by UGA codon.

Is rapid growth in Internet usage environmentally sustainable for Australia? An empirical investigation.

PubMed

Salahuddin, Mohammad; Alam, Khorshed; Ozturk, Ilhan

2016-03-01

This study estimates the short- and long-run effects of Internet usage and economic growth on carbon dioxide (CO2) emissions using annual time series macro data for Australia for the period 1985-2012. Autoregressive distributive lag (ARDL) bounds and Gregory-Hansen structural break cointegration tests are applied. ARDL estimates indicate no significant long-run relationship between Internet usage and CO2 emissions, which implies that the rapid growth in Internet usage is still not an environmental threat for Australia. The study further indicates that higher level of economic growth is associated with lower level of CO2 emissions; however, Internet usage and economic growth have no significant short-run relationship with CO2 emissions. Financial development has both short-run and long-run significant positive association with CO2 emissions. The findings offer support in favor of energy efficiency gains and a reduction in energy intensity in Australia. However, impulse response and variance decomposition analysis suggest that Internet usage, economic growth and financial development will continue to impact CO2 emissions in the future, and as such, this study recommends that in addition to the existing measures to combat CO2 emissions, Australia needs to exploit the potential of the Internet not only to reduce its own carbon footprint but also to utilize information and communication technology (ICT)-enabled emissions abatement potential to reduce emissions in various other sectors across the economy, such as, power, renewable energy especially in solar and wind energy, agriculture, transport and service.

Sensitive detection of unlabeled oligonucleotides using a paired surface plasma waves biosensor.

PubMed

Li, Ying-Chang; Chiou, Chiuan-Chian; Luo, Ji-Dung; Chen, Wei-Ju; Su, Li-Chen; Chang, Ying-Feng; Chang, Yu-Sun; Lai, Chao-Sung; Lee, Cheng-Chung; Chou, Chien

2012-05-15

Detection of unlabeled oligonucleotides using surface plasmon resonance (SPR) is difficult because of the oligonucleotides' relatively lower molecular weight compared with proteins. In this paper, we describe a method for detecting unlabeled oligonucleotides at low concentration using a paired surface plasma waves biosensor (PSPWB). The biosensor uses a sensor chip with an immobilized probe to detect a target oligonucleotide via sequence-specific hybridization. PSPWB measures the demodulated amplitude of the heterodyne signal in real time. In the meantime, the ratio of the amplitudes between the detected output signal and reference can reduce the excess noise from the laser intensity fluctuation. Also, the common-path propagation of p and s waves cancels the common phase noise induced by temperature variation. Thus, a high signal-to-noise ratio (SNR) of the heterodyne signal is detected. The sequence specificity of oligonucleotide hybridization ensures that the platform is precisely discriminating between target and non-target oligonucleotides. Under optimized experimental conditions, the detected heterodyne signal increases linearly with the logarithm of the concentration of target oligonucleotide over the range 0.5-500 pM. The detection limit is 0.5 pM in this experiment. In addition, the non-target oligonucleotide at concentrations of 10 pM and 10nM generated signals only slightly higher than background, indicating the high selectivity and specificity of this method. Different length of perfectly matched oligonucleotide targets at 10-mer, 15-mer and 20-mer were identified at the concentration of 150 pM. Copyright © 2012 Elsevier B.V. All rights reserved.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sun, Zhen; Department of Biochemistry and Molecular Biology, Program in Molecular Cell Biology, Zhejiang University School of Medicine, Hangzhou, Zhejiang 310058; Xiang, Wenqing

Highlights: {yields} LNA-modified oligonucleotides can pass through the plasma membrane of cultured cells even without using transfection machinery. {yields} LNA-modified oligonucleotides passed efficiently across the cell membrane, and lipid-coating facilitated translocation from the cytoplasm to the nucleus. {yields} LNA-oligonucleotide designed to target nuclear HBV DNA efficiently suppresses HBV replication and transcription in cultured hepatic cells. -- Abstract: Silencing target genes with small regulatory RNAs is widely used to investigate gene function and therapeutic drug development. Recently, triplex-based approaches have provided another attractive means to achieve targeted gene regulation and gene manipulation at the molecular and cellular levels. Nuclear entry ofmore » oligonucleotides and enhancement of their affinity to the DNA targets are key points of such approaches. In this study, we developed lipid-based transport of a locked-nucleic-acid (LNA)-modified oligonucleotide for hepatitis B virus (HBV) DNA interference in human hepatocytes expressing HBV genomic DNA. In these cells, the LNA-modified oligonucleotides passed efficiently across the cell membrane, and lipid-coating facilitated translocation from the cytoplasm to the nucleus. The oligonucleotide specifically targeting HBV DNA clearly interfered with HBV DNA transcription as shown by a block in pregenomic RNA (pgRNA) production. The HBV DNA-targeted oligonucleotide suppressed HBV DNA replication and HBV protein production more efficiently than small interfering RNAs directed to the pgRNA. These results demonstrate that fusion with lipid can carry LNA-modified oligonucleotides to the nucleus where they regulate gene expression. Interfering with HBV DNA transcription by LNA-modified oligonucleotides has strong potential as a new strategy for HBV inhibition.« less

Oligonucleotide-based pharmaceuticals: Non-clinical and clinical safety signals and non-clinical testing strategies.

PubMed

Mustonen, Enni-Kaisa; Palomäki, Tiina; Pasanen, Markku

2017-11-01

Antisense oligonucleotides, short interfering RNAs (siRNAs) and aptamers are oligonucleotide-based pharmaceuticals with a promising role in targeted therapies. Currently, five oligonucleotide-based pharmaceuticals have achieved marketing authorization in Europe or USA and many more are undergoing clinical testing. However, several safety concerns have been raised in non-clinical and clinical studies. Oligonucleotides share properties with both chemical and biological pharmaceuticals and therefore they pose challenges also from the regulatory point of view. We have analyzed the safety data of oligonucleotides and evaluated the applicability of current non-clinical toxicological guidelines for assessing the safety of oligonucleotide-based pharmaceuticals. Oligonucleotide-based pharmaceuticals display a similar toxicological profile, exerting adverse effects on liver and kidney, evoking hematological alterations, as well as causing immunostimulation and prolonging the coagulation time. It is possible to extrapolate some of these effects from non-clinical studies to humans. However, evaluation strategies for genotoxicity testing of "non-natural" oligonucleotides should be revised. Additionally, the selective use of surrogates and prediction of clinical endpoints for non-clinically observed immunostimulation is complicated by its multiple potential manifestations, demanding improvements in the testing strategies. Utilizing more relevant and mechanistic-based approaches and taking better account of species differences, could possibly improve the prediction of relevant immunological/proinflammatory effects in humans. Copyright © 2017 Elsevier Inc. All rights reserved.

The chemical evolution of oligonucleotide therapies of clinical utility.

PubMed

Khvorova, Anastasia; Watts, Jonathan K

2017-03-01

After nearly 40 years of development, oligonucleotide therapeutics are nearing meaningful clinical productivity. One of the key advantages of oligonucleotide drugs is that their delivery and potency are derived primarily from the chemical structure of the oligonucleotide whereas their target is defined by the base sequence. Thus, as oligonucleotides with a particular chemical design show appropriate distribution and safety profiles for clinical gene silencing in a particular tissue, this will open the door to the rapid development of additional drugs targeting other disease-associated genes in the same tissue. To achieve clinical productivity, the chemical architecture of the oligonucleotide needs to be optimized with a combination of sugar, backbone, nucleobase, and 3'- and 5'-terminal modifications. A portfolio of chemistries can be used to confer drug-like properties onto the oligonucleotide as a whole, with minor chemical changes often translating into major improvements in clinical efficacy. One outstanding challenge in oligonucleotide chemical development is the optimization of chemical architectures to ensure long-term safety. There are multiple designs that enable effective targeting of the liver, but a second challenge is to develop architectures that enable robust clinical efficacy in additional tissues.

Time-series oligonucleotide count to assign antiviral siRNAs with long utility fit in the big data era.

PubMed

Wada, K; Wada, Y; Iwasaki, Y; Ikemura, T

2017-10-01

Oligonucleotides are key elements of nucleic acid therapeutics such as small interfering RNAs (siRNAs). Influenza and Ebolaviruses are zoonotic RNA viruses mutating very rapidly, and their sequence changes must be characterized intensively to design therapeutic oligonucleotides with long utility. Focusing on a total of 182 experimentally validated siRNAs for influenza A, B and Ebolaviruses compiled by the siRNA database, we conducted time-series analyses of occurrences of siRNA targets in these viral genomes. Reflecting their high mutation rates, occurrences of target oligonucleotides evidently fluctuate in viral populations and often disappear. Time-series analysis of the one-base changed sequences derived from each original target identified the oligonucleotide that shows a compensatory increase and will potentially become the 'awaiting-type oligonucleotide'; the combined use of this oligonucleotide with the original can provide therapeutics with long utility. This strategy is also useful for assigning diagnostic reverse transcription-PCR primers with long utility.

miRNA-based therapies: Strategies and delivery platforms for oligonucleotide and non-oligonucleotide agents

PubMed Central

Baumann, V; Winkler, J

2015-01-01

The discovery of microRNAs as important regulatory agents for gene expression has expanded the therapeutic opportunities for oligonucleotides. In contrast to siRNA, miRNA-targeted therapy is able to influence not only a single gene, but entire cellular pathways or processes. It is possible to supplement down regulated or non-functional miRNAs by synthetic oligonucleotides, as well as alleviating effects caused by overexpression of malignant miRNAs through artificial antagonists, either oligonucleotides or small molecules. Chemical oligonucleotide modifications together with an efficient delivery system seem to be mandatory for successful therapeutic application. While miRNA-based therapy benefits from the decades of research spent on other therapeutic oligonucleotides, there are some specific challenges associated with miRNA therapy, mainly caused by the short target sequence. The current status and recent progress of miRNA-targeted therapeutics is described and future challenges and potential applications in treatment of cancer and viral infections are discussed. PMID:25495987

2'-modified nucleosides for site-specific labeling of oligonucleotides

NASA Technical Reports Server (NTRS)

Krider, Elizabeth S.; Miller, Jeremiah E.; Meade, Thomas J.

2002-01-01

We report the synthesis of 2'-modified nucleosides designed specifically for incorporating labels into oligonucleotides. Conversion of these nucleosides to phosphoramidite and solid support-bound derivatives proceeds in good yield. Large-scale synthesis of 11-mer oligonucleotides possessing the 2'-modified nucleosides is achieved using these derivatives. Thermal denaturation studies indicate that the presence of 2'-modified nucleosides in 11-mer duplexes has minimal destabilizing effects on the duplex structure when the nucleosides are placed at the duplex termini. The powerful combination of phosphoramidite and support-bound derivatives of 2'-modified nucleosides affords the large-scale preparation of an entirely new class of oligonucleotides. The ability to synthesize oligonucleotides containing label attachment sites at 3', intervening, and 5' locations of a duplex is a significant advance in the development of oligonucleotide conjugates.

Assessing the Interplay between the Physicochemical Parameters of Ion-Pairing Reagents and the Analyte Sequence on the Electrospray Desorption Process for Oligonucleotides

NASA Astrophysics Data System (ADS)

Basiri, Babak; Murph, Mandi M.; Bartlett, Michael G.

2017-08-01

Alkylamines are widely used as ion-pairing agents during LC-MS of oligonucleotides. In addition to a better chromatographic separation, they also assist with the desorption of oligonucleotide ions into the gas phase, cause charge state reduction, and decrease cation adduction. However, the choice of such ion-pairing agents has considerable influence on the MS signal intensity of oligonucleotides as they can also cause significant ion suppression. Interestingly, optimal ion-pairing agents should be selected on a case by case basis as their choice is strongly influenced by the sequence of the oligonucleotide under investigation. Despite imposing major practical difficulties to analytical method development, such a highly variable system that responds very strongly to the nuances of the electrospray composition provides an excellent opportunity for a fundamental study of the electrospray ionization process. Our investigations using this system quantitatively revealed the major factors that influenced the ESI ionization efficiency of oligonucleotides. Parameters such as boiling point, proton affinity, partition coefficient, water solubility, and Henry's law constants for the ion-pairing reagents and the hydrophobic thymine content of the oligonucleotides were found to be the most significant contributors. Identification of these parameters also allowed for the development of a statistical predictive algorithm that can assist with the choice of an optimum IP agent for each particular oligonucleotide sequence. We believe that research in the field of oligonucleotide bioanalysis will significantly benefit from this algorithm (included in Supplementary Material) as it advocates for the use of lesser-known but more suitable ion-pair alternatives to TEA for many oligonucleotide sequences.

Measuring the binding stoichiometry of HIV-1 Gag to very-low-density oligonucleotide surfaces using surface plasmon resonance spectroscopy.

PubMed

Stephen, Andrew G; Datta, Siddhartha A K; Worthy, Karen M; Bindu, Lakshman; Fivash, Matthew J; Turner, Kevin B; Fabris, Daniele; Rein, Alan; Fisher, Robert J

2007-09-01

The interaction of the HIV Gag polyprotein with nucleic acid is a critical step in the assembly of viral particles. The Gag polyprotein is composed of the matrix (MA), capsid (CA), and nucleocapsid (NC) domains. The NC domain is required for nucleic acid interactions, and the CA domain is required for Gag-Gag interactions. Previously, we have investigated the binding of the NC protein to d(TG)(n) oligonucleotides using surface plasmon resonance (SPR) spectroscopy. We found a single NC protein is able to bind to more than one immobilized oligonucleotide, provided that the oligonucleotides are close enough together. As NC is believed to be the nucleic acid binding domain of Gag, we might expect Gag to show the same complex behavior. We wished to analyze the stoichiometry of Gag binding to oligonucleotides without this complication due to tertiary complex formation. We have therefore analyzed Gag binding to extremely low oligonucleotide density on SPR chips. Such low densities of oligonucleotides are difficult to accurately quantitate. We have determined by Fourier transform ion cyclotron (FTICR) mass spectrometry that four molecules of NC bind to d(TG)(10) (a 20-base oligonucleotide). We developed a method of calibrating low-density surfaces using NC calibration injections. Knowing the maximal response and the stoichiometry of binding, we can precisely determine the amount of oligonucleotide immobilized at these very-low-density surfaces (<1 Response Unit). Using this approach, we have measured the binding of Gag to d(TG)(10). Gag binds to a 20-mer with a stoichiometry of greater than 4. This suggests that once Gag is bound to the immobilized oligonucleotide, additional Gag molecules can bind to this complex.

RNA therapeutics: Beyond RNA interference and antisense oligonucleotides

PubMed Central

Kole, Ryszard; Krainer, Adrian R.; Altman, Sidney

2016-01-01

Here we discuss three RNA therapeutic technologies exploiting various oligonucleotides that bind RNA by base-pairing in a sequence-specific manner yet have different mechanisms of action and effects. RNA interference and antisense oligonucleotides downregulate gene expression by enzyme-dependent degradation of targeted mRNA. Steric blocking oligonucleotides block access of cellular machinery to pre-mRNA and mRNA without degrading the RNA. Through this mechanism, blocking oligonucleotides can redirect alternative splicing, repair defective RNA, restore protein production or also downregulate gene expression. Moreover, they can be extensively chemically modified, resulting in more drug-like properties. The ability of RNA blocking oligonucleotides to restore gene function makes them suited for treatment of genetic disorders. Positive results from clinical trials for the treatment of Duchenne muscular dystrophy show that this technology is close to realizing its clinical potential. PMID:22262036

Design of oligonucleotides for microarrays and perspectives for design of multi-transcriptome arrays.

PubMed

Nielsen, Henrik Bjørn; Wernersson, Rasmus; Knudsen, Steen

2003-07-01

Optimal design of oligonucleotides for microarrays involves tedious and laborious work evaluating potential oligonucleotides relative to a series of parameters. The currently available tools for this purpose are limited in their flexibility and do not present the oligonucleotide designer with an overview of these parameters. We present here a flexible tool named OligoWiz for designing oligonucleotides for multiple purposes. OligoWiz presents a set of parameter scores in a graphical interface to facilitate an overview for the user. Additional custom parameter scores can easily be added to the program to extend the default parameters: homology, DeltaTm, low-complexity, position and GATC-only. Furthermore we present an analysis of the limitations in designing oligonucleotide sets that can detect transcripts from multiple organisms. OligoWiz is available at www.cbs.dtu.dk/services/OligoWiz/.

Modification of antisense phosphodiester oligodeoxynucleotides by a 5' cholesteryl moiety increases cellular association and improves efficacy.

PubMed

Krieg, A M; Tonkinson, J; Matson, S; Zhao, Q; Saxon, M; Zhang, L M; Bhanja, U; Yakubov, L; Stein, C A

1993-02-01

Phosphodiester oligodeoxynucleotides bearing a 5' cholesteryl (chol) modification bind to low density lipoprotein (LDL), apparently by partitioning the chol-modified oligonucleotides into the lipid layer. Both HL60 cells and primary mouse spleen T and B cells incubated with fluorescently labeled chol-modified oligonucleotide showed substantially increased cellular association by flow cytometry and increased internalization by confocal microscopy compared to an identical molecule not bearing the chol group. Cellular internalization of chol-modified oligonucleotide occurred at least partially through the LDL receptor; it was increased in mouse spleen cells by cell culture in lipoprotein-deficient medium and/or lovastatin, and it was decreased by culture in high serum medium. To determine whether chol-modified oligonucleotides are more potent antisense agents, we titered antisense unmodified phosphodiester and chol-modified oligonucleotides targeted against a mouse immunosuppressive protein. Murine spleen cells cultured with 20 microM phosphodiester antisense oligonucleotides had a 2-fold increase in RNA synthesis, indicating the expected lymphocyte activation. Antisense chol-modified oligonucleotides showed an 8-fold increase in relative potency: they caused a 2-fold increase in RNA synthesis at just 2.5 microM. The increased efficacy was blocked by heparin and was further increased by cell culture in 1% (vs. 10%) fetal bovine serum, suggesting that the effect may, at least in part, be mediated via the LDL receptor. Antisense chol-modified oligonucleotides are sequence specific and have increased potency as compared to unmodified oligonucleotides.

Current Challenges in Delivery and Cytosolic Translocation of Therapeutic RNAs

PubMed Central

Lucchino, Marco

2018-01-01

RNA interference (RNAi) is a fundamental cellular process for the posttranscriptional regulation of gene expression. RNAi can exogenously be modulated by small RNA oligonucleotides, such as microRNAs (miRNAs) and small interfering RNAs (siRNAs), or by antisense oligonucleotides. These small oligonucleotides provided the scientific community with powerful and versatile tools to turn off the expression of genes of interest, and hold out the promise of new therapeutic solutions against a wide range of gene-associated pathologies. However, unmodified nucleic acids are highly instable in biological systems, and their weak interaction with plasma proteins confers an unfavorable pharmacokinetics. In this review, we first provide an overview of the most efficient chemical strategies that, over the past 30 years, have been used to significantly improve the therapeutic potential of oligonucleotides. Oligonucleotides targeting and delivery technologies are then presented, including covalent conjugates between oligonucleotides and targeting ligand, and noncovalent association with lipid or polymer nanoparticles. Finally, we specifically focus on the endosomal escape step, which represents a major stumbling block for the effective use of oligonucleotides as therapeutic agents. The need for approaches to quantitatively measure endosomal escape and cytosolic arrival of biomolecules is discussed in the context of the development of efficient oligonucleotide targeting and delivery vectors. PMID:29883296

Comparing online opportunities and risks among Israeli children and youth Hebrew and Arabic speakers

NASA Astrophysics Data System (ADS)

Blau, Ina

2014-10-01

This study explores the relationships between application usage, online communication patterns, problematic Internet use (PIU) of online applications, and online self-disclosure among children from culturally different groups. An online survey was administered in Hebrew and Arabic among 3867 Israeli 7-17 year old, including Jews, Arabs, and Bedouins. The level of PIU was relatively low-only 9.5% scored "very high" in the PIU index. For all the groups the highest level of communication was reported for safe interactions with family and friends, lower level for purely virtual communication with online acquaintances, and the lowest level for meeting online acquaintances face-to-face. However, various forms of the online communication patterns and use of applications differed across the groups, suggesting cultural diversity in Internet usage among children in the same country. PIU and self-disclosure explained 47.3% of variance in risky e-communication activities (e.g. sending ones' photos to online acquaintances, providing them with a school or home address, and meeting them face-to-face), as well as 34.4% of variance in exposure to unpleasant online experiences (e.g. receiving messages, pictures, or videos that make the children feel uncomfortable). However, both PIU and self-disclosure were unrelated to educational activities and to the use of educational applications.

Life-space mobility of middle-aged and older adults at various stages of usage of power mobility devices.

PubMed

Auger, Claudine; Demers, Louise; Gélinas, Isabelle; Miller, William C; Jutai, Jeffrey W; Noreau, Luc

2010-05-01

To examine whether the impact of power mobility devices (PMDs) varies as a function of stage of usage and to explore key factors associated with greater life-space mobility for middle-aged and older adults. Multicohort study with respondents grouped as a function of stage of PMD usage (reference group with mobility impairments, n=42; initial users, 1-6mo, n=35; long-term users, 12-18mo, n=39). Cohorts were compared with respect to life-space mobility in a continuum of environments ranging from home to outside town, using analysis of variance and chi-square tests. Baseline personal, assistive device, intervention, and environmental factors associated with life-space mobility were explored with age-adjusted linear regression models. Four Canadian rehabilitation centers. Random sample of middle-aged and older adults (N=116; 50-89y) living in the community or residential care. Procurement of a powered wheelchair or scooter. Life-Space Assessment composite score. Cohort comparisons showed higher frequency of outings for PMD users in the neighborhood (P<.001) and around home (P<.05) and significantly greater Life-Space Assessment composite scores for initial and long-term users than for the reference group (P<.05). Factors such as sex, the nature of activities, and device type explained variances in Life-Space Assessment composite score ranging from 15.9% to 18.0% (P<.006). Life-space mobility increases after PMD use and remains stable across the stages of initial and long-term use. To appreciate the impact of PMDs, clinicians should consider the environment and a combination of personal and device factors that are associated with the range of life-space mobility in the first 18 months after procurement.

Identification of sequence motifs in oligonucleotides whose presence is correlated with antisense activity

PubMed Central

Matveeva, O. V.; Tsodikov, A. D.; Giddings, M.; Freier, S. M.; Wyatt, J. R.; Spiridonov, A. N.; Shabalina, S. A.; Gesteland, R. F.; Atkins, J. F.

2000-01-01

Design of antisense oligonucleotides targeting any mRNA can be much more efficient when several activity-enhancing motifs are included and activity-decreasing motifs are avoided. This conclusion was made after statistical analysis of data collected from >1000 experiments with phosphorothioate-modified oligonucleotides. Highly significant positive correlation between the presence of motifs CCAC, TCCC, ACTC, GCCA and CTCT in the oligonucleotide and its antisense efficiency was demonstrated. In addition, negative correlation was revealed for the motifs GGGG, ACTG, AAA and TAA. It was found that the likelihood of activity of an oligonucleotide against a desired mRNA target is sequence motif content dependent. PMID:10908347

Oligonucleotide and Parylene Surface Coating of Polystyrene and ePTFE for Improved Endothelial Cell Attachment and Hemocompatibility

PubMed Central

Schleicher, Martina; Hansmann, Jan; Elkin, Bentsian; Kluger, Petra J.; Liebscher, Simone; Huber, Agnes J. T.; Fritze, Olaf; Schille, Christine; Müller, Michaela; Schenke-Layland, Katja; Seifert, Martina; Walles, Heike; Wendel, Hans-Peter; Stock, Ulrich A.

2012-01-01

In vivo self-endothelialization by endothelial cell adhesion on cardiovascular implants is highly desirable. DNA-oligonucleotides are an intriguing coating material with nonimmunogenic characteristics and the feasibility of easy and rapid chemical fabrication. The objective of this study was the creation of cell adhesive DNA-oligonucleotide coatings on vascular implant surfaces. DNA-oligonucleotides immobilized by adsorption on parylene (poly(monoaminomethyl-para-xylene)) coated polystyrene and ePTFE were resistant to high shear stress (9.5 N/m2) and human blood serum for up to 96 h. Adhesion of murine endothelial progenitor cells, HUVECs and endothelial cells from human adult saphenous veins as well as viability over a period of 14 days of HUVECs on oligonucleotide coated samples under dynamic culture conditions was significantly enhanced (P < 0.05). Oligonucleotide-coated surfaces revealed low thrombogenicity and excellent hemocompatibility after incubation with human blood. These properties suggest the suitability of immobilization of DNA-oligonucleotides for biofunctionalization of blood vessel substitutes for improved in vivo endothelialization. PMID:22481939

Oligonucleotide assisted light-emitting Alq3 microrods: energy transfer effect with fluorescent dyes.

PubMed

Cui, Chunzhi; Park, Dong Hyuk; Kim, Jeongyong; Joo, Jinsoo; Ahn, Dong June

2013-06-14

Oligonucleotide assisted tri(8-hydroxyquinoline) aluminium (Alq3) microrods were prepared for the first time. When hybridized with oligonucleotide labeled by Cy3 fluorescent dye, a significant photoluminescence variation of the Alq3 microrods was observed due to Förster resonance energy transfer, unlike when Cy5-oligonucleotide was used. Versatile nucleotide manipulation would open up wider applications of Alq3-based materials, based on this fundamental observation.

SWPhylo - A Novel Tool for Phylogenomic Inferences by Comparison of Oligonucleotide Patterns and Integration of Genome-Based and Gene-Based Phylogenetic Trees.

PubMed

Yu, Xiaoyu; Reva, Oleg N

2018-01-01

Modern phylogenetic studies may benefit from the analysis of complete genome sequences of various microorganisms. Evolutionary inferences based on genome-scale analysis are believed to be more accurate than the gene-based alternative. However, the computational complexity of current phylogenomic procedures, inappropriateness of standard phylogenetic tools to process genome-wide data, and lack of reliable substitution models which correlates with alignment-free phylogenomic approaches deter microbiologists from using these opportunities. For example, the super-matrix and super-tree approaches of phylogenomics use multiple integrated genomic loci or individual gene-based trees to infer an overall consensus tree. However, these approaches potentially multiply errors of gene annotation and sequence alignment not mentioning the computational complexity and laboriousness of the methods. In this article, we demonstrate that the annotation- and alignment-free comparison of genome-wide tetranucleotide frequencies, termed oligonucleotide usage patterns (OUPs), allowed a fast and reliable inference of phylogenetic trees. These were congruent to the corresponding whole genome super-matrix trees in terms of tree topology when compared with other known approaches including 16S ribosomal RNA and GyrA protein sequence comparison, complete genome-based MAUVE, and CVTree methods. A Web-based program to perform the alignment-free OUP-based phylogenomic inferences was implemented at http://swphylo.bi.up.ac.za/. Applicability of the tool was tested on different taxa from subspecies to intergeneric levels. Distinguishing between closely related taxonomic units may be enforced by providing the program with alignments of marker protein sequences, eg, GyrA.

SWPhylo – A Novel Tool for Phylogenomic Inferences by Comparison of Oligonucleotide Patterns and Integration of Genome-Based and Gene-Based Phylogenetic Trees

PubMed Central

Yu, Xiaoyu; Reva, Oleg N

2018-01-01

Modern phylogenetic studies may benefit from the analysis of complete genome sequences of various microorganisms. Evolutionary inferences based on genome-scale analysis are believed to be more accurate than the gene-based alternative. However, the computational complexity of current phylogenomic procedures, inappropriateness of standard phylogenetic tools to process genome-wide data, and lack of reliable substitution models which correlates with alignment-free phylogenomic approaches deter microbiologists from using these opportunities. For example, the super-matrix and super-tree approaches of phylogenomics use multiple integrated genomic loci or individual gene-based trees to infer an overall consensus tree. However, these approaches potentially multiply errors of gene annotation and sequence alignment not mentioning the computational complexity and laboriousness of the methods. In this article, we demonstrate that the annotation- and alignment-free comparison of genome-wide tetranucleotide frequencies, termed oligonucleotide usage patterns (OUPs), allowed a fast and reliable inference of phylogenetic trees. These were congruent to the corresponding whole genome super-matrix trees in terms of tree topology when compared with other known approaches including 16S ribosomal RNA and GyrA protein sequence comparison, complete genome-based MAUVE, and CVTree methods. A Web-based program to perform the alignment-free OUP-based phylogenomic inferences was implemented at http://swphylo.bi.up.ac.za/. Applicability of the tool was tested on different taxa from subspecies to intergeneric levels. Distinguishing between closely related taxonomic units may be enforced by providing the program with alignments of marker protein sequences, eg, GyrA. PMID:29511354

Direct fluorescence in situ hybridization on human metaphase chromosomes using quantum dot-platinum labeled DNA probes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hwang, Gyoyeon; Biological Chemistry, Korea University of Science and Technology, 217, Gajeong-ro, Yuseong-gu, Deajeon; Lee, Hansol

The telomere shortening in chromosomes implies the senescence, apoptosis, or oncogenic transformation of cells. Since detecting telomeres in aging and diseases like cancer, is important, the direct detection of telomeres has been a very useful biomarker. We propose a telomere detection method using a newly synthesized quantum dot (QD) based probe with oligonucleotide conjugation and direct fluorescence in situ hybridization (FISH). QD-oligonucleotides were prepared with metal coordination bonding based on platinum-guanine binding reported in our previous work. The QD-oligonucleotide conjugation method has an advantage where any sequence containing guanine at the end can be easily bound to the starting QD-Ptmore » conjugate. A synthesized telomeric oligonucleotide was bound to the QD-Pt conjugate successfully and this probe hybridized specifically on the telomere of fabricated MV-4-11 and MOLT-4 chromosomes. Additionally, the QD-telomeric oligonucleotide probe successfully detected the telomeres on the CGH metaphase slide. Due to the excellent photostability and high quantum yield of QDs, the QD-oligonucleotide probe has high fluorescence intensity when compared to the organic dye-oligonucleotide probe. Our QD-oligonucleotide probe, conjugation method of this QD probe, and hybridization protocol with the chromosomes can be a useful tool for chromosome painting and FISH. - Highlights: • We prepared a probe linked between QD and telomeric oligonucleotide with platinum-guanine bonding. • Telomeres were detected by our new telomere probes successfully in three different human metaphase chromosomes. • QDPt-DNA probe has high fluorescence intensity in comparison with organic dye-DNA probe.« less

Simultaneous analysis of large INTEGRAL/SPI1 datasets: Optimizing the computation of the solution and its variance using sparse matrix algorithms

NASA Astrophysics Data System (ADS)

Bouchet, L.; Amestoy, P.; Buttari, A.; Rouet, F.-H.; Chauvin, M.

2013-02-01

Nowadays, analyzing and reducing the ever larger astronomical datasets is becoming a crucial challenge, especially for long cumulated observation times. The INTEGRAL/SPI X/γ-ray spectrometer is an instrument for which it is essential to process many exposures at the same time in order to increase the low signal-to-noise ratio of the weakest sources. In this context, the conventional methods for data reduction are inefficient and sometimes not feasible at all. Processing several years of data simultaneously requires computing not only the solution of a large system of equations, but also the associated uncertainties. We aim at reducing the computation time and the memory usage. Since the SPI transfer function is sparse, we have used some popular methods for the solution of large sparse linear systems; we briefly review these methods. We use the Multifrontal Massively Parallel Solver (MUMPS) to compute the solution of the system of equations. We also need to compute the variance of the solution, which amounts to computing selected entries of the inverse of the sparse matrix corresponding to our linear system. This can be achieved through one of the latest features of the MUMPS software that has been partly motivated by this work. In this paper we provide a brief presentation of this feature and evaluate its effectiveness on astrophysical problems requiring the processing of large datasets simultaneously, such as the study of the entire emission of the Galaxy. We used these algorithms to solve the large sparse systems arising from SPI data processing and to obtain both their solutions and the associated variances. In conclusion, thanks to these newly developed tools, processing large datasets arising from SPI is now feasible with both a reasonable execution time and a low memory usage.

Intelligent nanomedicine integrating diagnosis and therapy

NASA Technical Reports Server (NTRS)

Li, Na (Inventor); Tan, Winny (Inventor)

2012-01-01

A method of controlling the activity of a biologically active compound. The method concerns an oligonucleotide-based compound, comprising a hairpin-forming oligonucleotide, an effector moiety physically associated with the oligonucleotide, where the effector moiety possesses a biological activity, and a regulating moiety physically associated with the oligonucleotide, where the regulating moiety controls the biological activity of the effector moiety by interacting with the effector moiety. The oligonucleotide can assume a hairpin configuration, where the effector and regulating moieties interact, or an open configuration, where the effector and regulating moieties fail to interact. Depending on the nature of the effector and regulating moieties, either configuration can result in the expression of the biological activity of the effector moiety.

Oligonucleotide labeling methods. 3. Direct labeling of oligonucleotides employing a novel, non-nucleosidic, 2-aminobutyl-1,3-propanediol backbone.

PubMed Central

Nelson, P S; Kent, M; Muthini, S

1992-01-01

Novel CE-phosphoramidite (7a-e) and CPG (8a, c, d, e) reagents have been prepared from a unique 2-aminobutyl-1,3-propanediol backbone. The reagents have been used to directly label oligonucleotides with fluorescein, acridine, and biotin via automated DNA synthesis. The versatile 2-aminobutyl-1,3-propanediol backbone allows for labeling at any position (5', internal, and 3') during solid phase oligonucleotide synthesis. Multiple labels can be achieved by repetitive coupling cycles. Furthermore, the 3-carbon atom internucleotide phosphate distance is retained when inserted internally. Using this method, individual oligonucleotides possessing two and three different reporter molecules have been prepared. PMID:1475185

Alteration in oligonucleotide fingerprint patterns of the viral genome in poliovirus type 2 isolated from paralytic patients.

PubMed Central

Yoneyama, T; Hagiwara, A; Hara, M; Shimojo, H

1982-01-01

A close relationship was demonstrated by oligonucleotide fingerprinting between genomes of the poliovirus type 2 Sabin vaccine strain and recent isolates from paralytic cases associated with vaccination in Japan. The oligonucleotide maps of isolates from an agammaglobulinemic patient, who continued to excrete poliovirus type 2 for 3.5 years after the administration of oral vaccine, showed that the genomic alteration proceeded gradually, retaining the majority of the oligonucleotides characteristic of the vaccine strain for a long period, indicating vaccine origin for the isolates. The final isolate at month 41, however, lost the majority of these oligonucleotides. The heterologous antigenic relationship between the final isolate and the previous isolates was also observed. The serial alteration in electrophoretic mobility of the major structural proteins (VP1, VP2, and VP3) was observed throughout the excreting period. These results indicate that the population of the virus in this individual changed markedly during the last short period (about 3 months), in which the treatment with secretory immunoglobulin A was carried out. Genome comparisons in oligonucleotide maps show that some oligonucleotides in the genome of the vaccine strain are highly mutable after passage in humans. Images PMID:6179881

Method of identifying hairpin DNA probes by partial fold analysis

DOEpatents

Miller, Benjamin L [Penfield, NY; Strohsahl, Christopher M [Saugerties, NY

2009-10-06

Method of identifying molecular beacons in which a secondary structure prediction algorithm is employed to identify oligonucleotide sequences within a target gene having the requisite hairpin structure. Isolated oligonucleotides, molecular beacons prepared from those oligonucleotides, and their use are also disclosed.

Method of identifying hairpin DNA probes by partial fold analysis

DOEpatents

Miller, Benjamin L.; Strohsahl, Christopher M.

2008-10-28

Methods of identifying molecular beacons in which a secondary structure prediction algorithm is employed to identify oligonucleotide sequences within a target gene having the requisite hairpin structure. Isolated oligonucleotides, molecular beacons prepared from those oligonucleotides, and their use are also disclosed.

Synthesis of 3'-, or 5'-, or internal methacrylamido-modified oligonucleotides

DOEpatents

Golova, Julia B.; Chernov, Boris K.

2010-04-27

New modifiers were synthesized for incorporation of a methacrylic function in 3'-, 5'- and internal positions of oligonucleotides during solid phase synthesis. A modifier was used for synthesis of 5'-methacrylated oligonucleotides for preparation of microarrays by a co-polymerization method.

Validity of questionnaire self‐reports on computer, mouse and keyboard usage during a four‐week period

PubMed Central

Mikkelsen, Sigurd; Vilstrup, Imogen; Lassen, Christina Funch; Kryger, Ann Isabel; Thomsen, Jane Frølund; Andersen, Johan Hviid

2007-01-01

Objective To examine the validity and potential biases in self‐reports of computer, mouse and keyboard usage times, compared with objective recordings. Methods A study population of 1211 people was asked in a questionnaire to estimate the average time they had worked with computer, mouse and keyboard during the past four working weeks. During the same period, a software program recorded these activities objectively. The study was part of a one‐year follow‐up study from 2000–1 of musculoskeletal outcomes among Danish computer workers. Results Self‐reports on computer, mouse and keyboard usage times were positively associated with objectively measured activity, but the validity was low. Self‐reports explained only between a quarter and a third of the variance of objectively measured activity, and were even lower for one measure (keyboard time). Self‐reports overestimated usage times. Overestimation was large at low levels and declined with increasing levels of objectively measured activity. Mouse usage time proportion was an exception with a near 1:1 relation. Variability in objectively measured activity, arm pain, gender and age influenced self‐reports in a systematic way, but the effects were modest and sometimes in different directions. Conclusion Self‐reported durations of computer activities are positively associated with objective measures but they are quite inaccurate. Studies using self‐reports to establish relations between computer work times and musculoskeletal pain could be biased and lead to falsely increased or decreased risk estimates. PMID:17387136

Validity of questionnaire self-reports on computer, mouse and keyboard usage during a four-week period.

PubMed

Mikkelsen, Sigurd; Vilstrup, Imogen; Lassen, Christina Funch; Kryger, Ann Isabel; Thomsen, Jane Frølund; Andersen, Johan Hviid

2007-08-01

To examine the validity and potential biases in self-reports of computer, mouse and keyboard usage times, compared with objective recordings. A study population of 1211 people was asked in a questionnaire to estimate the average time they had worked with computer, mouse and keyboard during the past four working weeks. During the same period, a software program recorded these activities objectively. The study was part of a one-year follow-up study from 2000-1 of musculoskeletal outcomes among Danish computer workers. Self-reports on computer, mouse and keyboard usage times were positively associated with objectively measured activity, but the validity was low. Self-reports explained only between a quarter and a third of the variance of objectively measured activity, and were even lower for one measure (keyboard time). Self-reports overestimated usage times. Overestimation was large at low levels and declined with increasing levels of objectively measured activity. Mouse usage time proportion was an exception with a near 1:1 relation. Variability in objectively measured activity, arm pain, gender and age influenced self-reports in a systematic way, but the effects were modest and sometimes in different directions. Self-reported durations of computer activities are positively associated with objective measures but they are quite inaccurate. Studies using self-reports to establish relations between computer work times and musculoskeletal pain could be biased and lead to falsely increased or decreased risk estimates.

Targeted delivery of an antisense oligonucleotide in the retina: uptake, distribution, stability, and effect.

PubMed

Rakoczy, P E; Lai, M C; Watson, M; Seydel, U; Constable, I

1996-01-01

In this article, we describe the preliminary results of the development of an animal model that will enable us to study the effect of photoreceptor-derived debris accumulation on the normal function of the retina in vivo. An antisense oligonucleotide (Cat 5), saline, and two control oligonucleotides were injected into the vitreous of 7-week-old RCS-rdy+ rats. The uptake, distribution, and persistence of the antisense oligonucleotide in the retina was demonstrated by fluorescent confocal microscopy, and the stability of the oligonucleotide was shown by GeneScan analysis using a fluorescein-labeled derivative of Cat 5 (Cat 5F). The accumulation of photoreceptor-derived debris was monitored by the number of undigested phagosomes in the RPE layer by light microscopy. Following intravitreal injection of Cat 5F, penetration of the oligonucleotide was observed in the ganglion cell layer in 2 hours and in the photoreceptor and pigment epithelial layers 3 days later. However, at 7, 28, and 56 days postinjection, only the RPE layer had significant amounts of Cat 5F present. Using GeneScan analysis, it was demonstrated that the fluorescein-labeled oligonucleotide present in the RPE layer was not degraded and it retained its original 19-mer length. There was no statistically significant difference in the number of phagosomes found in the RPE layer of control uninjected, saline-injected, and two sense and two antisense oligonucleotides-injected animals at 7 and 28 days postinjection. In contrast, the number of phagosomes was significantly higher (p < 0.001) in the RPE layer of Cat 5 antisense oligonucleotide-injected animals at 7 and 28 days postinjection. This difference, however, disappeared by 56 days postinjection. The inner nuclear layers of the retina of control and experimental animals were not affected by the injections.

Rural development and family planning behavior in Bangladesh Villages.

PubMed

Alauddin, M

1979-01-01

Variarion in knowledge and usage of contraceptive methods was examined across Bangladesh villages. It was hypothesized that the variation can be explained by 3 sets of factors measured at the village level: development programs, family planning program efforts, and given environmental and socioeconomic conditions. The data were drawn from the Bangladesh Fertility Survey and the 1974 Bangladesh Population Census. The 3 sets of factors taken together explained a greater proportion of the variance in knowledge and contraceptive usage than each of the sets taken either singly or in paired combination. Knowledge of clinical contraceptive methods was found to be affected more by development programs than by either family planning or environmental and socioeconomic conditions. Despite the fact that both development and family planning variables have independent and about equal effects on ever use of contraception, each of them separately is not likely to produce as much contraceptive usage as would both of them jointly. In terms of policy, if both development and family planning programs are provided to the villages, the effect on fertility may be maximized.

Oligonucleotide-based theranostic nanoparticles in cancer therapy

PubMed Central

Shahbazi, Reza; Ozpolat, Bulent; Ulubayram, Kezban

2016-01-01

Theranostic approaches, combining the functionality of both therapy and imaging, have shown potential in cancer nanomedicine. Oligonucleotides such as small interfering RNA and microRNA, which are powerful therapeutic agents, have been effectively employed in theranostic systems against various cancers. Nanoparticles are used to deliver oligonucleotides into tumors by passive or active targeting while protecting the oligonucleotides from nucleases in the extracellular environment. The use of quantum dots, iron oxide nanoparticles and gold nanoparticles and tagging with contrast agents, like fluorescent dyes, optical or magnetic agents and various radioisotopes, has facilitated early detection of tumors and evaluation of therapeutic efficacy. In this article, we review the advantages of theranostic applications in cancer therapy and imaging, with special attention to oligonucleotide-based therapeutics. PMID:27102380

Derivatized versions of ligase enzymes for constructing DNA sequences

DOEpatents

Mariella, Jr., Raymond P.; Christian, Allen T [Tracy, CA; Tucker, James D [Novi, MN; Dzenitis, John M [Livermore, CA; Papavasiliou, Alexandros P [Oakland, CA

2006-08-15

A method of making very long, double-stranded synthetic poly-nucleotides. A multiplicity of short oligonucleotides is provided. The short oligonucleotides are sequentially hybridized to each other. Enzymatic ligation of the oligonucleotides provides a contiguous piece of PCR-ready DNA of predetermined sequence.

Voltage-gated calcium channel and antisense oligonucleotides thereto

NASA Technical Reports Server (NTRS)

Friedman, Peter A. (Inventor); Duncan, Randall L. (Inventor); Hruska, Keith A. (Inventor); Barry, Elizabeth L. R. (Inventor)

1998-01-01

An antisense oligonucleotide of 10 to 35 nucleotides in length that can hybridize with a region of the .alpha..sub.1 subunit of the SA-Cat channel gene DNA or mRNA is provided, together with pharmaceutical compositions containing and methods utilizing such antisense oligonucleotide.

NAA-modified DNA oligonucleotides with zwitterionic backbones: stereoselective synthesis of A-T phosphoramidite building blocks.

PubMed

Schmidtgall, Boris; Höbartner, Claudia; Ducho, Christian

2015-01-01

Modifications of the nucleic acid backbone are essential for the development of oligonucleotide-derived bioactive agents. The NAA-modification represents a novel artificial internucleotide linkage which enables the site-specific introduction of positive charges into the otherwise polyanionic backbone of DNA oligonucleotides. Following initial studies with the introduction of the NAA-linkage at T-T sites, it is now envisioned to prepare NAA-modified oligonucleotides bearing the modification at X-T motifs (X = A, C, G). We have therefore developed the efficient and stereoselective synthesis of NAA-linked 'dimeric' A-T phosphoramidite building blocks for automated DNA synthesis. Both the (S)- and the (R)-configured NAA-motifs were constructed with high diastereoselectivities to furnish two different phosphoramidite reagents, which were employed for the solid phase-supported automated synthesis of two NAA-modified DNA oligonucleotides. This represents a significant step to further establish the NAA-linkage as a useful addition to the existing 'toolbox' of backbone modifications for the design of bioactive oligonucleotide analogues.

Synthesis and hybridization of a series of biotinylated oligonucleotides.

PubMed Central

Cook, A F; Vuocolo, E; Brakel, C L

1988-01-01

A series of oligonucleotides containing biotin-11-dUMP at various positions were synthesized and compared in quantitative, colorimetric hybridization-detection studies. A deoxyuridine phosphoramidite containing a protected allylamino sidearm was synthesized and used in standard, automated synthesis cycles to prepare oligonucleotides with allylamino residues at various positions within a standard 17-base sequence. Biotin substituents were subsequently attached to the allylamino sidearms by reaction with N-biotinyl-6-aminocaproic acid N-hydroxysuccinimide ester. These oligomers were hybridized to target DNA immobilized on microtiter wells (ELISA plates), and were detected with a streptavidin-biotinylated horseradish peroxidase complex using hydrogen peroxide as substrate and o-phenylenediamine as chromogen. We found that the sensitivity of detection of target DNA by biotin-labeled oligonucleotide probes was strongly dependent upon the position of the biotin label. Oligonucleotides containing biotin labels near or off the ends of the hybridizing sequence were more effective probes than oligonucleotides containing internal biotin labels. An additive effect of increasing numbers of biotin-dUMP residues was found for some labeling configurations. PMID:3375076

Synthesis, properties, and NMR studies of a C8-phenylguanine modified oligonucleotide that preferentially adopts the Z DNA conformation.

PubMed

Gannett, Peter M; Heavner, Sue; Daft, Jonathan R; Shaughnessy, Kevin H; Epperson, Jon D; Greenbaum, Nancy L

2003-10-01

Carcinogenic aryl hydrazines produce C8-arylated purine adducts. The effect of these adducts on DNA conformation and their role in hydrazine carcinogenesis are unknown. Here, we describe a new synthetic route to produce these adducts that is also compatible with the synthesis of the corresponding phosphoramidites needed for oligonucleotide synthesis. Two oligonucleotides were prepared, an unmodified oligonucleotide, d((5)(')CGCGCGCGCG(3)(')), and a C8-phenylguanine modified oligonucleotide, d((5)(')CGCGCGCGCG(3)(')) (G = 8-phenylguanine). These oligonucleotides were compared using thermal denaturation, circular dichroism, NMR, and molecular modeling. The phenyl modification destabilizes the B DNA form and stabilizes the Z DNA form such that the B:Z ratio is near one under physiological conditions. In light of recent studies that show a role for Z DNA in gene expression and cell transformation, Z DNA stabilization by C8-arylguanine formation from aryl hydrazines may be relevant to their role in carcinogenesis.

Time-series oligonucleotide count to assign antiviral siRNAs with long utility fit in the big data era

PubMed Central

Wada, K; Wada, Y; Iwasaki, Y; Ikemura, T

2017-01-01

Oligonucleotides are key elements of nucleic acid therapeutics such as small interfering RNAs (siRNAs). Influenza and Ebolaviruses are zoonotic RNA viruses mutating very rapidly, and their sequence changes must be characterized intensively to design therapeutic oligonucleotides with long utility. Focusing on a total of 182 experimentally validated siRNAs for influenza A, B and Ebolaviruses compiled by the siRNA database, we conducted time-series analyses of occurrences of siRNA targets in these viral genomes. Reflecting their high mutation rates, occurrences of target oligonucleotides evidently fluctuate in viral populations and often disappear. Time-series analysis of the one-base changed sequences derived from each original target identified the oligonucleotide that shows a compensatory increase and will potentially become the ‘awaiting-type oligonucleotide’ the combined use of this oligonucleotide with the original can provide therapeutics with long utility. This strategy is also useful for assigning diagnostic reverse transcription-PCR primers with long utility. PMID:28905886

Oligonucleotide recombination in corynebacteria without the expression of exogenous recombinases.

PubMed

Krylov, Alexander A; Kolontaevsky, Egor E; Mashko, Sergey V

2014-10-01

Brevibacterium lactofermentum and Corynebacterium glutamicum are important biotechnology species of the genus Corynebacterium. The single-strand DNA annealing protein (SSAP)-independent oligonucleotide-mediated recombination procedure was successfully applied to the commonly used wild-type strains B. lactofermentum AJ1511 and C. glutamicum ATCC13032. When the rpsL gene was used as a target, the optimized protocol yielded up to (1.4±0.3)×10(3) and (6.7±1.3)×10(3) streptomycin-resistant colonies per 10(8) viable cells for the corresponding strains. We tested the influence of several parameters that are known to enhance the efficiency of oligonucleotide-mediated recombination in other bacterial species. Among them, increasing the concentration of oligonucleotides and targeting the lagging strand of the chromosome have proven to have positive effects on both of the tested species. No difference in the efficiency of recombination was observed between the oligonucleotides phosphorothiorated at the 5' ends and the unmodified oligonucleotides or between the oligonucleotides with four mutated nucleotides and those with one mutated nucleotide. The described approach demonstrates that during the adaptation of the recombineering technique, testing SSAP-independent oligonucleotide-mediated recombination could be a good starting point. Such testing could decrease the probability of an incorrect interpretation of the effect of exogenous protein factors (such as SSAP and/or corresponding exonucleases) due to non-optimal experimental conditions. In addition, SSAP-independent recombination itself could be useful in combination with suitable selection/enrichment methods. Copyright © 2014 Elsevier B.V. All rights reserved.

Degradation product characterization of therapeutic oligonucleotides using liquid chromatography mass spectrometry.

PubMed

Elzahar, N M; Magdy, N; El-Kosasy, Amira M; Bartlett, Michael G

2018-05-01

Synthetic antisense phosphorothioate oligonucleotides (PS) have undergone rapid development as novel therapeutic agents. The increasing significance of this class of drugs requires significant investment in the development of quality control methods. The determination of the many degradation pathways of such complex molecules presents a significant challenge. However, an understanding of the potential impurities that may arise is necessary to continue to advance these powerful new therapeutics. In this study, four different antisense oligonucleotides representing several generations of oligonucleotide therapeutic agents were evaluated under various stress conditions (pH, thermal, and oxidative stress) using ion-pairing reversed-phase liquid chromatography tandem mass spectrometry (IP-RPLC-MS/MS) to provide in-depth characterization and identification of the degradation products. The oligonucleotide samples were stressed under different pH values at 45 and 90 °C. The main degradation products were observed to be losses of nucleotide moieties from the 3'- and 5'-terminus, depurination, formation of terminal phosphorothioates, and production of ribose, ribophosphorothioates (Rp), and phosphoribophosphorothioates (pRp). Moreover, the effects of different concentrations of hydrogen peroxide were studied resulting in primarily extensive desulfurization and subsequent oxidation of the phosphorothioate linkage to produce the corresponding phosphodiester. The reaction kinetics for the degradation of the oligonucleotides under the different stress conditions were studied and were found to follow pseudo-first-order kinetics. Differences in rates exist even for oligonucleotides of similar length but consisting of different sequences. Graphical abstract Identification of degradation products across several generations of oligonucleotide therapeutics using LC-MS.

2′-O-[2-[(N,N-dimethylamino)oxy]ethyl]-modified oligonucleotides inhibit expression of mRNA in vitro and in vivo

PubMed Central

Prakash, Thazha P.; Johnston, Joseph F.; Graham, Mark J.; Condon, Thomas P.; Manoharan, Muthiah

2004-01-01

Synthesis and antisense activity of oligonucleotides modified with 2′-O-[2-[(N,N-dimethylamino)oxy] ethyl] (2′-O-DMAOE) are described. The 2′-O-DMAOE-modified oligonucleotides showed superior metabolic stability in mice. The phosphorothioate oligonucleotide ‘gapmers’, with 2′-O-DMAOE- modified nucleoside residues at the ends and 2′-deoxy nucleosides residues in the central region, showed dose-dependent inhibition of mRNA expression in cell culture for two targets. ‘Gapmer’ oligonucleotides have one or two 2′-O-modified regions and a 2′-deoxyoligonucleotide phosphorothioate region that allows RNase H digestion of target mRNA. To determine the in vivo potency and efficacy, BalbC mice were treated with 2′-O-DMAOE gapmers and a dose-dependent reduction in the targeted C-raf mRNA expression was observed. Oligonucleotides with 2′-O-DMAOE modifications throughout the sequences reduced the intercellular adhesion molecule-1 (ICAM-1) protein expression very efficiently in HUVEC cells with an IC50 of 1.8 nM. The inhibition of ICAM-1 protein expression by these uniformly modified 2′-O-DMAOE oligonucleotides may be due to selective interference with the formation of the translational initiation complex. These results demonstrate that 2′-O-DMAOE- modified oligonucleotides are useful for antisense-based therapeutics when either RNase H-dependent or RNase H-independent target reduction mechanisms are employed. PMID:14762210

A fluorescent radioiodinated oligonucleotidic photoaffinity probe for protein labeling: synthesis and photolabeling of thrombin.

PubMed

Berens, C; Courtoy, P J; Sonveaux, E

1999-01-01

To study the interactions between oligonucleotides and proteins, an original photoaffinity radiolabeling probe has been synthesized. Starting with a 5'-pyridyldithio-3'-amino-oligonucleotide, the photophore benzophenone was first coupled to the 3' end, through acylation by an activated ester of benzoylbenzoic acid. A fluorescein molecule was grafted by alkylation of the free 5'-SH. This compound was finally radiolabeled with 125I using IodoBeads. The selective photolabeling of thrombin in a complex protein mixture by the radioiodinated probe validates this strategy to identify oligonucleotide-binding proteins.

Synthesis of high quality phosphorothioate oligonucleotides as antisense drugs. Use of I-linker in the elimination of 3'-terminal phosphorothioate monoesters.

PubMed

Ravikumar, Vasulinga T; Kumar, R Krishna; Capaldi, Daniel C; Cole, Douglas L

2003-01-01

Detritylation of a 5'-O-DMT-2'-deoxyadenosine moiety attached to solid support under acidic condition leads to depurination during oligonucleotide synthesis. Deprotection followed by reversed phase HPLC purification leads to desired oligonucleotide contaminated with significant levels of 3'-terminal phosphorothiaote (3'-TPT) monoester (n-1)-mer. However, it is demonstrated that attachment of dA nucleoside through its exocyclic amino group to solid support leads to substantial reduction of 3'-TPT formation thereby improving the quality of oligonucleotide synthesized.

The Use of Gel Electrophoresis to Study the Reactions of Activated Amino Acids with Oligonucleotides

NASA Technical Reports Server (NTRS)

Zieboll, Gerhard; Orgel, Leslie E.

1994-01-01

We have used gel electrophoresis to study the primary covalent addition of amino acids to oligonu-cleotides or their analogs and the subsequent addition of further molecules of the amino acids to generate peptides covalently linked to the oligonucleotides. We have surveyed the reactions of a variety of amino acids with the phosphoramidates derived from oligonucleotide 5 inches phosphates and ethylenediamine. We find that arginine and amino acids can interact with oligonucleotidesl through stacking interactions react most efficiently. D- and L-amino acids give indistinguishable families of products.

Methods for immobilizing nucleic acids on a gel substrate

DOEpatents

Mirzabekov, Andrei Darievich; Proudnikov, Dimitri Y.; Timofeev, Edward N.; Kochetkova, Svetlana V.; Florentiev, Vladimir L.; Shick, Valentine V.

1999-01-01

A method for labeling oligonucleotide molecules, and for immobilizing oligonucleotide and DNA molecules is provided comprising modifying the molecules to create a chemically active group, and contacting activated fluorescent dyes to the region. A method for preparing an immobilization substrate is also provided comprising modifying a gel to contain desired functional groups which covalently interact with certain moieties of the oligonucleotide molecules. A method for immobilizing biomolecules and other molecules within a gel by copolymerization of allyl-substituted oligonucleotides, DNA and proteins with acrylamide is also provided.

Method for promoting specific alignment of short oligonucleotides on nucleic acids

DOEpatents

Studier, F. William; Kieleczawa, Jan; Dunn, John J.

1996-01-01

Disclosed is a method for promoting specific alignment of short oligonucleotides on a nucleic acid polymer. The nucleic acid polymer is incubated in a solution containing a single-stranded DNA-binding protein and a plurality of oligonucleotides which are perfectly complementary to distinct but adjacent regions of a predetermined contiguous nucleotide sequence in the nucleic acid polymer. The plurality of oligonucleotides anneal to the nucleic acid polymer to form a contiguous region of double stranded nucleic acid. Specific application of the methods disclosed include priming DNA synthesis and template-directed ligation.

Synthetic Method for Oligonucleotide Block by Using Alkyl-Chain-Soluble Support.

PubMed

Matsuno, Yuki; Shoji, Takao; Kim, Shokaku; Chiba, Kazuhiro

2016-02-19

A straightforward method for the synthesis of oligonucleotide blocks using a Cbz-type alkyl-chain-soluble support (Z-ACSS) attached to the 3'-OH group of 3'-terminal nucleosides was developed. The Z-ACSS allowed for the preparation of fully protected deoxyribo- and ribo-oligonucleotides without chromatographic purification and released dimer- to tetramer-size oligonucleotide blocks via hydrogenation using a Pd/C catalyst without significant loss or migration of protective groups such as 5'-end 4,4'-dimethoxtrityl, 2-cyanoethyl on internucleotide bonds, or 2'-TBS.

A novel computational method to simulate non-enzymatic self-replication. [Abstract only

NASA Technical Reports Server (NTRS)

Navarro-Gonzalez, Rafael; Reggia, James A.; Wu, Jayoung; Chou, Hui-Hsien

1994-01-01

Non-enzymatic, template-directed synthesis of oligonucleotides has been extensively studied in the laboratory as a model to understand the kind of chemical processes that might have contributed to the origin of life on Earth. Several oligonucleotides have been shown to catalyze the synthesis of their complements from activated mononucleotides; however, a restricted number of them have been found to self-replicate. Recently we developed an efficient modified cellular automata method that supports the study of self-replicating oligonucleotides. With this method the oligonucleotide molecules are represented as active cells imbedded in a two-dimensional array of inactive cells symbolizing the environment. Random movements and probability-governed chemical reactions occurring in a cellular space can effectively simulate the experimental behavior observed in self-directed replication of oligonucleotides.

Quantitative surface-enhanced resonance Raman scattering of phthalocyanine-labelled oligonucleotides

PubMed Central

Macaskill, A.; Chernonosov, A. A.; Koval, V. V.; Lukyanets, E. A.; Fedorova, O. S.; Smith, W. E.; Faulds, K.; Graham, D.

2007-01-01

The evaluation of phthalocyanine labels for the surface-enhanced resonance Raman scattering (SERRS) detection of oligonucleotides is reported. Three phthalocyanine-labelled oligonucleotides were assessed, each containing a different metal centre. Detection limits for each labelled oligonucleotide were determined using two excitation frequencies where possible. Limits of detection as low as 2.8 × 10−11 mol. dm−3 were obtained which are comparable to standard fluorescently labelled probes used in previous SERRS studies. The identification of two phthalocyanine-labelled oligonucleotides without separation was also demonstrated indicating their suitability for multiplexing. This study extends the range of labels suitable for quantitative surface-enhanced resonance Raman scattering with silver nanoparticles and offers more flexibility and choice when considering SERRS for quantitative DNA detection. PMID:17289751

Oligonucleotide-based biosensors for in vitro diagnostics and environmental hazard detection.

PubMed

Jung, Il Young; Lee, Eun Hee; Suh, Ah Young; Lee, Seung Jin; Lee, Hyukjin

2016-04-01

Oligonucleotide-based biosensors have drawn much attention because of their broad applications in in vitro diagnostics and environmental hazard detection. They are particularly of interest to many researchers because of their high specificity as well as excellent sensitivity. Recently, oligonucleotide-based biosensors have been used to achieve not only genetic detection of targets but also the detection of small molecules, peptides, and proteins. This has further broadened the applications of these sensors in the medical and health care industry. In this review, we highlight various examples of oligonucleotide-based biosensors for the detection of diseases, drugs, and environmentally hazardous chemicals. Each example is provided with detailed schematics of the detection mechanism in addition to the supporting experimental results. Furthermore, future perspectives and new challenges in oligonucleotide-based biosensors are discussed.

As Technologies for Nucleotide Therapeutics Mature, Products Emerge.

PubMed

Beierlein, Jennifer M; McNamee, Laura M; Ledley, Fred D

2017-12-15

The long path from initial research on oligonucleotide therapies to approval of antisense products is not unfamiliar. This lag resembles those encountered with monoclonal antibodies, gene therapies, and many biological targets and is consistent with studies of innovation showing that technology maturation is a critical determinant of product success. We previously described an analytical model for the maturation of biomedical research, demonstrating that the efficiency of targeted and biological development is connected to metrics of technology growth. The present work applies this model to characterize the advance of oligonucleotide therapeutics. We show that recent oligonucleotide product approvals incorporate technologies and targets that are past the established point of technology growth, as do most of the oligonucleotide products currently in phase 3. Less mature oligonucleotide technologies, such as miRNAs and some novel gene targets, have not passed the established point and have not yielded products. This analysis shows that oligonucleotide product development has followed largely predictable patterns of innovation. While technology maturation alone does not ensure success, these data show that many oligonucleotide technologies are sufficiently mature to be considered part of the arsenal for therapeutic development. These results demonstrate the importance of technology assessment in strategic management of biomedical technologies. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

Synthesis of high-quality libraries of long (150mer) oligonucleotides by a novel depurination controlled process

PubMed Central

LeProust, Emily M.; Peck, Bill J.; Spirin, Konstantin; McCuen, Heather Brummel; Moore, Bridget; Namsaraev, Eugeni; Caruthers, Marvin H.

2010-01-01

We have achieved the ability to synthesize thousands of unique, long oligonucleotides (150mers) in fmol amounts using parallel synthesis of DNA on microarrays. The sequence accuracy of the oligonucleotides in such large-scale syntheses has been limited by the yields and side reactions of the DNA synthesis process used. While there has been significant demand for libraries of long oligos (150mer and more), the yields in conventional DNA synthesis and the associated side reactions have previously limited the availability of oligonucleotide pools to lengths <100 nt. Using novel array based depurination assays, we show that the depurination side reaction is the limiting factor for the synthesis of libraries of long oligonucleotides on Agilent Technologies’ SurePrint® DNA microarray platform. We also demonstrate how depurination can be controlled and reduced by a novel detritylation process to enable the synthesis of high quality, long (150mer) oligonucleotide libraries and we report the characterization of synthesis efficiency for such libraries. Oligonucleotide libraries prepared with this method have changed the economics and availability of several existing applications (e.g. targeted resequencing, preparation of shRNA libraries, site-directed mutagenesis), and have the potential to enable even more novel applications (e.g. high-complexity synthetic biology). PMID:20308161

Experimental analysis of oligonucleotide microarray design criteria to detect deletions by comparative genomic hybridization.

PubMed

Flibotte, Stephane; Moerman, Donald G

2008-10-21

Microarray comparative genomic hybridization (CGH) is currently one of the most powerful techniques to measure DNA copy number in large genomes. In humans, microarray CGH is widely used to assess copy number variants in healthy individuals and copy number aberrations associated with various diseases, syndromes and disease susceptibility. In model organisms such as Caenorhabditis elegans (C. elegans) the technique has been applied to detect mutations, primarily deletions, in strains of interest. Although various constraints on oligonucleotide properties have been suggested to minimize non-specific hybridization and improve the data quality, there have been few experimental validations for CGH experiments. For genomic regions where strict design filters would limit the coverage it would also be useful to quantify the expected loss in data quality associated with relaxed design criteria. We have quantified the effects of filtering various oligonucleotide properties by measuring the resolving power for detecting deletions in the human and C. elegans genomes using NimbleGen microarrays. Approximately twice as many oligonucleotides are typically required to be affected by a deletion in human DNA samples in order to achieve the same statistical confidence as one would observe for a deletion in C. elegans. Surprisingly, the ability to detect deletions strongly depends on the oligonucleotide 15-mer count, which is defined as the sum of the genomic frequency of all the constituent 15-mers within the oligonucleotide. A similarity level above 80% to non-target sequences over the length of the probe produces significant cross-hybridization. We recommend the use of a fairly large melting temperature window of up to 10 degrees C, the elimination of repeat sequences, the elimination of homopolymers longer than 5 nucleotides, and a threshold of -1 kcal/mol on the oligonucleotide self-folding energy. We observed very little difference in data quality when varying the oligonucleotide length between 50 and 70, and even when using an isothermal design strategy. We have determined experimentally the effects of varying several key oligonucleotide microarray design criteria for detection of deletions in C. elegans and humans with NimbleGen's CGH technology. Our oligonucleotide design recommendations should be applicable for CGH analysis in most species.

Optimized synthesis of phosphorothioate oligodeoxyribonucleotides substituted with a 5′-protected thiol function and a 3′-amino group

PubMed Central

Aubert, Yves; Bourgerie, Sylvain; Meunier, Laurent; Mayer, Roger; Roche, Annie-Claude; Monsigny, Michel; Thuong, Nguyen T.; Asseline, Ulysse

2000-01-01

A new deprotection procedure enables a medium scale preparation of phosphodiester and phosphorothioate oligonucleotides substituted with a protected thiol function at their 5′-ends and an amino group at their 3′-ends in good yield (up to 72 OD units/µmol for a 19mer phosphorothioate). Syntheses of 3′-amino-substituted oligonucleotides were carried out on a modified support. A linker containing the thioacetyl moiety was manually coupled in two steps by first adding its phosphoramidite derivative in the presence of tetrazole followed by either oxidation or sulfurization to afford the bis-derivatized oligonucleotide bound to the support. Deprotection was achieved by treating the fully protected oligonucleotide with a mixture of 2,2′-dithiodipyridine and concentrated aqueous ammonia in the presence of phenol and methanol. This procedure enables (i) cleavage of the oligonucleotide from the support, releasing the oligonucleotide with a free amino group at its 3′-end, (ii) deprotection of the phosphate groups and the amino functions of the nucleic bases, as well as (iii) transformation of the 5′-terminal S-acetyl function into a dithiopyridyl group. The bis-derivatized phosphorothioate oligomer was further substituted through a two-step procedure: first, the 3′-amino group was reacted with fluorescein isothiocyanate to yield a fluoresceinylated oligonucleotide; the 5′-dithiopyridyl group was then quantitatively reduced to give a free thiol group which was then substituted by reaction with an Nα-bromoacetyl derivative of a signal peptide containing a KDEL sequence to afford a fluoresceinylated peptide–oligonucleotide conjugate. PMID:10637335

STAT3 Oligonucleotide Inhibits Tumor Angiogenesis in Preclinical Models of Squamous Cell Carcinoma

PubMed Central

Klein, Jonah D.; Sano, Daisuke; Sen, Malabika; Myers, Jeffrey N.; Grandis, Jennifer R.; Kim, Seungwon

2014-01-01

Purpose Signal transducer and activator of transcription 3 (STAT3) has shown to play a critical role in head and neck squamous cell carcinoma (HNSCC) and we have recently completed clinical trials of STAT3 decoy oligonucleotide in patients with recurrent or metastatic HNSCC. However, there is limited understanding of the role of STAT3 in modulating other aspects of tumorigenesis such as angiogenesis. In this study, we aimed to examine the effects of STAT3 decoy oligonucleotide on tumor angiogenesis. Experimental Design A STAT3 decoy oligonucleotide and small interfering RNA (siRNA) were used to inhibit STAT3 in endothelial cells in vitro and in vivo. The biochemical effects of STAT3 inhibition were examined in conjunction with the consequences on proliferation, migration, apoptotic staining, and tubule formation. Additionally, we assessed the effects of STAT3 inhibition on tumor angiogenesis using murine xenograft models. Results STAT3 decoy oligonucleotide decreased proliferation, induces apoptosis, decreased migration, and decreased tubule formation of endothelial cells in vitro. The STAT3 decoy oligonucleotide also inhibited tumor angiogenesis in murine tumor xenografts. Lastly, our data suggest that the antiangiogenic effects of STAT3 decoy oligonucleotide were mediatedthrough the inhibition of both STAT3 and STAT1. Conclusions The STAT3 decoy oligonucleotidewas found to be an effective antiangiogenic agent, which is likely to contribute to the overall antitumor effects of this agent in solid tumors.Taken together with the previously demonstrated antitumor activity of this agent, STAT3 decoy oligonucleotide represents a promising single agent approach to targeting both the tumor and vascular compartments in various malignancies. PMID:24404126

Improved strategies for postoligomerization synthesis of oligodeoxynucleotides bearing structurally defined adducts at the N2 position of deoxyguanosine.

PubMed

DeCorte, B L; Tsarouhtsis, D; Kuchimanchi, S; Cooper, M D; Horton, P; Harris, C M; Harris, T M

1996-01-01

Improved methodology has been developed for preparation of oligodeoxynucleotides bearing adducts on the N2 position of guanine in which the adduction reaction is carried out in homogeneous solution rather than while the oligonucleotide is immobilized on a solid matrix. The methodology utilizes a new synthon, 2-fluoro-O6-(trimethylsilylethyl)-2'-deoxyinosine (3). Nucleoside 3 is stable to the conditions of oligonucleotide synthesis, but the O6 protection is eliminated under very mild conditions following displacement of the 2-fluoro group by amine nucleophiles. Oligonucleotides containing 3 could be removed from the solid support by treatment with 0.1 M NaOH (8 h, rt) without disruption of 3. Reaction of the crude, partially deprotected oligonucleotide with (R)-2-amino-2-phenylethanol in homogeneous solution, followed by removal of the remaining protective groups with NH4OH (60 degrees C, 8 h) and then 0.1% acetic acid, gave the adducted oligonucleotide in good purity and yield. Alternatively, fully deprotected oligonucleotide containing 3 could be prepared by use of labile phenoxyacetyl-type protecting groups on the exocyclic amino groups.

Detection with synthetic oligonucleotide probes of nucleotide sequence variations in the genes encoding enterotoxins of Escherichia coli.

PubMed Central

Nishibuchi, M; Murakami, A; Arita, M; Jikuya, H; Takano, J; Honda, T; Miwatani, T

1989-01-01

We examined variations in the genes encoding heat-stable enterotoxin (ST) and heat-labile enterotoxin (LT) in 88 strains of Escherichia coli isolated from individuals with traveler's diarrhea to find suitable sequences for use as oligonucleotide probes. Four oligonucleotide probes of the gene encoding ST of human origin (STIb or STh), one oligonucleotide probe of the gene encoding ST of porcine origin (STIa or STp), and three oligonucleotide probes of the gene encoding LT of human origin (LTIh) were used in DNA colony hybridization tests. In 15 of 22 strains possessing the STh gene and 28 of 42 strains producing LT, the sequences of all regions tested were identical to the published sequences. One region in the STh gene examined with a 18-mer probe was relatively well conserved and was shown to be closely associated with the enterotoxicity of the E. coli strains in suckling mice. This oligonucleotide, however, hybridized with strains of Vibrio cholerae O1, V. parahaemolyticus, and Yersinia enterocolitica that gave negative results in the suckling mouse assay. PMID:2685027

Circular DNA by "Bis-Click" Ligation: Template-Independent Intramolecular Circularization of Oligonucleotides with Terminal Alkynyl Groups Utilizing Bifunctional Azides.

PubMed

Yang, Haozhe; Seela, Frank

2016-01-22

A highly effective and convenient "bis-click" strategy was developed for the template-independent circularization of single-stranded oligonucleotides by employing copper(I)-assisted azide-alkyne cycloaddition. Terminal triple bonds were incorporated at both ends of linear oligonucleotides. Alkynylated 7-deaza-2'-deoxyadenosine and 2'-deoxyuridine residues with different side chains were used in solid-phase synthesis with phosphoramidite chemistry. The bis-click ligation of linear 9- to 36-mer oligonucleotides with 1,4-bis(azidomethyl)benzene afforded circular DNA in a simple and selective way; azido modification of the oligonucleotide was not necessary. Short ethynyl side chains were compatible with the circularization of longer oligonucleotides, whereas octadiynyl residues were used for short 9-mers. Compared with linear duplexes, circular bis-click constructs exhibit a significantly increased duplex stability over their linear counterparts. The intramolecular bis-click ligation protocol is not limited to DNA, but may also be suitable for the construction of other macrocycles, such as circular RNAs, peptides, or polysaccharides. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

DNA - peptide polyelectrolyte complexes: Phase control by hybridization

NASA Astrophysics Data System (ADS)

Vieregg, Jeffrey; Lueckheide, Michael; Marciel, Amanda; Leon, Lorraine; Tirrell, Matthew

DNA is one of the most highly-charged molecules known, and interacts strongly with charged molecules in the cell. Condensation of long double-stranded DNA is one of the classic problems of biophysics, but the polyelectrolyte behavior of short and/or single-stranded nucleic acids has attracted far less study despite its importance for both biological and engineered systems. We report here studies of DNA oligonucleotides complexed with cationic peptides and polyamines. As seen previously for longer sequences, double-stranded oligonucleotides form solid precipitates, but single-stranded oligonucleotides instead undergo liquid-liquid phase separation to form coacervate droplets. Complexed oligonucleotides remain competent for hybridization, and display sequence-dependent environmental response. We observe similar behavior for RNA oligonucleotides, and methylphosphonate substitution of the DNA backbone indicates that nucleic acid charge density controls whether liquid or solid complexes are formed. Liquid-liquid phase separations of this type have been implicated in formation of membraneless organelles in vivo, and have been suggested as protocells in early life scenarios; oligonucleotides offer an excellent method to probe the physics controlling these phenomena.

Rapid method to detect duplex formation in sequencing by hybridization methods

DOEpatents

Mirzabekov, A.D.; Timofeev, E.N.; Florentiev, V.L.; Kirillov, E.V.

1999-01-19

A method for determining the existence of duplexes of oligonucleotide complementary molecules is provided. A plurality of immobilized oligonucleotide molecules, each of a specific length and each having a specific base sequence, is contacted with complementary, single stranded oligonucleotide molecules to form a duplex. Each duplex facilitates intercalation of a fluorescent dye between the base planes of the duplex. The invention also provides for a method for constructing oligonucleotide matrices comprising confining light sensitive fluid to a surface and exposing the light-sensitive fluid to a light pattern. This causes the fluid exposed to the light to coalesce into discrete units and adhere to the surface. This places each of the units in contact with a set of different oligonucleotide molecules so as to allow the molecules to disperse into the units. 13 figs.

In situ oligonucleotide synthesis on poly(dimethylsiloxane): a flexible substrate for microarray fabrication

PubMed Central

Moorcroft, Matthew J.; Meuleman, Wouter R. A.; Latham, Steven G.; Nicholls, Thomas J.; Egeland, Ryan D.; Southern, Edwin M.

2005-01-01

In this paper, we demonstrate in situ synthesis of oligonucleotide probes on poly(dimethylsiloxane) (PDMS) microchannels through use of conventional phosphoramidite chemistry. PDMS polymer was moulded into a series of microchannels using standard soft lithography (micro-moulding), with dimensions <100 μm. The surface of the PDMS was derivatized by exposure to ultraviolet/ozone followed by vapour phase deposition of glycidoxypropyltrimethoxysilane and reaction with poly(ethylene glycol) spacer, resulting in a reactive surface for oligonucleotide coupling. High, reproducible yields were achieved for both 6mer and 21mer probes as assessed by hybridization to fluorescent oligonucleotides. Oligonucleotide surface density was comparable with that obtained on glass substrates. These results suggest PDMS as a stable and flexible alternative to glass as a suitable substrate in the fabrication and synthesis of DNA microarrays. PMID:15870385

NMR of enzymatically synthesized uniformly 13C15N-labeled DNA oligonucleotides.

PubMed Central

Zimmer, D P; Crothers, D M

1995-01-01

A procedure for the enzymatic synthesis of uniformly 13C15N-labeled DNA oligonucleotides in milligram quantities for NMR studies is described. Deoxynucleotides obtained from microorganisms grown on 13C and 15N nutrient sources are enzymatically phosphorylated to dNTPs, and the dNTPs are incorporated into oligonucleotides using a 3'-5' exonuclease-deficient mutant of Klenow fragment of DNA polymerase I and an oligonucleotide template primer designed for efficient separation of labeled product DNA from unlabeled template. The labeling strategy has been used to uniformly label one or the other oligonucleotide strand in the DNA duplex dGGCAAAACGG.dCCGTTTTGCC in order to facilitate assignment and structure determination by NMR. Application of 15N and 13C heteronuclear NMR experiments to isotopically labeled DNA is presented. Images Fig. 2 Fig. 3 Fig. 4 PMID:7724521

Rapid method to detect duplex formation in sequencing by hybridization methods

DOEpatents

Mirzabekov, Andrei Darievich; Timofeev, Edward Nikolaevich; Florentiev, Vladimer Leonidovich; Kirillov, Eugene Vladislavovich

1999-01-01

A method for determining the existence of duplexes of oligonucleotide complementary molecules is provided whereby a plurality of immobilized oligonucleotide molecules, each of a specific length and each having a specific base sequence, is contacted with complementary, single stranded oligonucleotide molecules to form a duplex so as to facilitate intercalation of a fluorescent dye between the base planes of the duplex. The invention also provides for a method for constructing oligonucleotide matrices comprising confining light sensitive fluid to a surface, exposing said light-sensitive fluid to a light pattern so as to cause the fluid exposed to the light to coalesce into discrete units and adhere to the surface; and contacting each of the units with a set of different oligonucleotide molecules so as to allow the molecules to disperse into the units.

Tritium labeling of antisense oligonucleotides by exchange with tritiated water.

PubMed Central

Graham, M J; Freier, S M; Crooke, R M; Ecker, D J; Maslova, R N; Lesnik, E A

1993-01-01

We describe a simple, efficient, procedure for labeling oligonucleotides to high specific activity (< 1 x 10(8) cpm/mumol) by hydrogen exchange with tritiated water at the C8 positions of purines in the presence of beta-mercaptoethanol, an effective radical scavenger. Approximately 90% of the starting material is recovered as intact, labeled oligonucleotide. The radiolabeled compounds are stable in biological systems; greater than 90% of the specific activity is retained after 72 hr incubation at 37 degrees C in serum-containing media. Data obtained from in vitro cellular uptake experiments using oligonucleotides labeled by this method are similar to those obtained using 35S or 14C-labeled compounds. Because this protocol is solely dependent upon the existence of purine residues, it should be useful for radiolabeling modified as well as unmodified phosphodiester oligonucleotides. Images PMID:8367289

Systematic validation and atomic force microscopy of non-covalent short oligonucleotide barcode microarrays.

PubMed

Cook, Michael A; Chan, Chi-Kin; Jorgensen, Paul; Ketela, Troy; So, Daniel; Tyers, Mike; Ho, Chi-Yip

2008-02-06

Molecular barcode arrays provide a powerful means to analyze cellular phenotypes in parallel through detection of short (20-60 base) unique sequence tags, or "barcodes", associated with each strain or clone in a collection. However, costs of current methods for microarray construction, whether by in situ oligonucleotide synthesis or ex situ coupling of modified oligonucleotides to the slide surface are often prohibitive to large-scale analyses. Here we demonstrate that unmodified 20mer oligonucleotide probes printed on conventional surfaces show comparable hybridization signals to covalently linked 5'-amino-modified probes. As a test case, we undertook systematic cell size analysis of the budding yeast Saccharomyces cerevisiae genome-wide deletion collection by size separation of the deletion pool followed by determination of strain abundance in size fractions by barcode arrays. We demonstrate that the properties of a 13K unique feature spotted 20 mer oligonucleotide barcode microarray compare favorably with an analogous covalently-linked oligonucleotide array. Further, cell size profiles obtained with the size selection/barcode array approach recapitulate previous cell size measurements of individual deletion strains. Finally, through atomic force microscopy (AFM), we characterize the mechanism of hybridization to unmodified barcode probes on the slide surface. These studies push the lower limit of probe size in genome-scale unmodified oligonucleotide microarray construction and demonstrate a versatile, cost-effective and reliable method for molecular barcode analysis.

Gallium-68-labelled NOTA-oligonucleotides: an optimized method for their preparation.

PubMed

Gijs, Marlies; Dammicco, Sylvestre; Warnier, Corentin; Aerts, An; Impens, Nathalie R E N; D'Huyvetter, Matthias; Léonard, Marc; Baatout, Sarah; Luxen, André

2016-02-01

One of the most essential aspects to the success of radiopharmaceuticals is an easy and reliable radiolabelling protocol to obtain pure and stable products. In this study, we optimized the bioconjugation and gallium-68 ((68) Ga) radiolabelling conditions for a single-stranded 40-mer DNA oligonucleotide, in order to obtain highly pure and stable radiolabelled oligonucleotides. Quantitative bioconjugation was obtained for a disulfide-functionalized oligonucleotide conjugated to the macrocylic bifunctional chelator MMA-NOTA (maleimido-mono-amide (1,4,7-triazanonane-1,4,7-triyl)triacetic acid). Next, this NOTA-oligonucleotide bioconjugate was radiolabelled at room temperature with purified and pre-concentrated (68) Ga with quantitative levels of radioactive incorporation and high radiochemical and chemical purity. In addition, high chelate stability was observed in physiological-like conditions (37 °C, PBS and serum), in the presence of a transchelator (EDTA) and transferrin. A specific activity of 51.1 MBq/nmol was reached using a 1470-fold molar excess bioconjugate over (68) Ga. This study presents a fast, straightforward and reliable protocol for the preparation of (68) Ga-radiolabelled DNA oligonucleotides under mild reaction conditions and without the use of organic solvents. The methodology herein developed will be applied to the preparation of oligonucleotidic sequences (aptamers) targeting the human epidermal growth factor receptor 2 (HER2) for cancer imaging. Copyright © 2015 John Wiley & Sons, Ltd.

In vitro transcription in the presence of DNA oligonucleotides can generate strong anomalous initiation sites.

PubMed

Chow, C W; Clark, M P; Rinaldo, J E; Chalkley, R

1996-03-01

In the present study, we have explored an unexpected observation in transcription initiation that is mediated by single-stranded oligonucleotides. Initially, our goal was to understand the function of different upstream regulatory elements/initiation sites in the rat xanthine dehydrogenase/oxidase (XDH/XO) promoter. We performed in vitro transcription with HeLa nuclear extracts in the presence of different double-stranded oligonucleotides against upstream elements as competitors. A new and unusual transcription initiation site was detected by primer extension. This new initiation site maps to the downstream region of the corresponding competitor. Subsequent analyses have indicated that the induction of a new transcription initiation site is anomalous which is due to the presence of a small amount of single-stranded oligonucleotide in the competitor. We found that this anomalous initiation site is insensitive to the orientation of the promoter and requires only a small amount of single-stranded oligonucleotide (< 2-fold molar excess relative to template). We surmise that a complementary interaction between the single-stranded oligonucleotide and transiently denatured promoter template may be responsible for this sequence-specific transcription initiation artifact. To study the regulation of transcription initiation by in vitro transcription approaches, we propose that one should probe the effect of removing transacting factors by adding an excess of a cognate oligonucleotide which does not bear exact sequence identity to the template.

Angubindin-1 opens the blood-brain barrier in vivo for delivery of antisense oligonucleotide to the central nervous system.

PubMed

Zeniya, Satoshi; Kuwahara, Hiroya; Daizo, Kaiichi; Watari, Akihiro; Kondoh, Masuo; Yoshida-Tanaka, Kie; Kaburagi, Hidetoshi; Asada, Ken; Nagata, Tetsuya; Nagahama, Masahiro; Yagi, Kiyohito; Yokota, Takanori

2018-05-17

Within the field of RNA therapeutics, antisense oligonucleotide-based therapeutics are a potentially powerful means of treating intractable diseases. However, if these therapeutics are used for the treatment of neurological disorders, safe yet efficient methods of delivering antisense oligonucleotides across the blood-brain barrier to the central nervous system must be developed. Here, we examined the use of angubindin-1, a binder to the tricellular tight junction, to modulate paracellular transport between brain microvascular endothelial cells in the blood-brain barrier for the delivery of antisense oligonucleotides to the central nervous system. This proof-of-concept study demonstrated that intravenously injected angubindin-1 increased the permeability of the blood-brain barrier and enabled transient delivery of subsequently administered antisense oligonucleotides into the mouse brain and spinal cord, leading to silencing of a target RNA without any overt adverse effects. We also found that two bicellular tight junction modulators did not produce such a silencing effect, suggesting that the tricellular tight junction is likely a better target for the delivery of antisense oligonucleotides than the bicellular tight junction. Our delivery strategy of modulating the tricellular tight junction in the blood-brain barrier via angubindin-1 provides a novel avenue of research for the development of antisense oligonucleotide-based therapeutics for the treatment of neurological disorders. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

Accurate and rapid modeling of iron-bleomycin-induced DNA damage using tethered duplex oligonucleotides and electrospray ionization ion trap mass spectrometric analysis.

PubMed

Harsch, A; Marzilli, L A; Bunt, R C; Stubbe, J; Vouros, P

2000-05-01

Bleomycin B(2)(BLM) in the presence of iron [Fe(II)] and O(2)catalyzes single-stranded (ss) and double-stranded (ds) cleavage of DNA. Electrospray ionization ion trap mass spectrometry was used to monitor these cleavage processes. Two duplex oligonucleotides containing an ethylene oxide tether between both strands were used in this investigation, allowing facile monitoring of all ss and ds cleavage events. A sequence for site-specific binding and cleavage by Fe-BLM was incorporated into each analyte. One of these core sequences, GTAC, is a known hot-spot for ds cleavage, while the other sequence, GGCC, is a hot-spot for ss cleavage. Incubation of each oligo-nucleotide under anaerobic conditions with Fe(II)-BLM allowed detection of the non-covalent ternary Fe-BLM/oligonucleotide complex in the gas phase. Cleavage studies were then performed utilizing O(2)-activated Fe(II)-BLM. No work-up or separation steps were required and direct MS and MS/MS analyses of the crude reaction mixtures confirmed sequence-specific Fe-BLM-induced cleavage. Comparison of the cleavage patterns for both oligonucleotides revealed sequence-dependent preferences for ss and ds cleavages in accordance with previously established gel electrophoresis analysis of hairpin oligonucleotides. This novel methodology allowed direct, rapid and accurate determination of cleavage profiles of model duplex oligonucleotides after exposure to activated Fe-BLM.

Gene Silencing by Gold Nanoshell-Mediated Delivery and Laser-Triggered Release of Antisense Oligonucleotide and siRNA

PubMed Central

Huschka, Ryan; Barhoumi, Aoune; Liu, Qing; Roth, Jack A.; Ji, Lin; Halas, Naomi J.

2013-01-01

The approach of RNA interference (RNAi)- using antisense DNA or RNA oligonucleotides to silence activity of a specific pathogenic gene transcript and reduce expression of the encoded protein- is very useful in dissecting genetic function and holds significant promise as a molecular therapeutic. A major obstacle in achieving gene silencing with RNAi technology is the systemic delivery of therapeutic oligonucleotides. Here we demonstrate an engineered gold nanoshell (NS)-based therapeutic oligonucleotide delivery vehicle, designed to release its cargo on demand upon illumination with a near-infrared (NIR) laser. A poly(L)lysine peptide (PLL) epilayer covalently attached to the NS surface (NS-PLL) is used to capture intact, single-stranded antisense DNA oligonucleotides, or alternatively, double-stranded short-interfering RNA (siRNA) molecules. Controlled release of the captured therapeutic oligonucleotides in each case is accomplished by continuous wave NIR laser irradiation at 800 nm, near the resonance wavelength of the nanoshell. Fluorescently tagged oligonucleotides were used to monitor the time-dependent release process and light-triggered endosomal release. A green fluorescent protein (GFP)-expressing human lung cancer H1299 cell line was used to determine cellular uptake and gene silencing mediated by the NS-PLL carrying GFP gene-specific single-stranded DNA antisense oligonucleotide (AON-GFP), or a double-stranded siRNA (siRNA-GFP), in vitro. Light-triggered delivery resulted in ∼ 47% and ∼49% downregulation of the targeted GFP expression by AON-GFP and siRNA-GFP, respectively. Cytotoxicity induced by both the NS-PLL delivery vector and by laser irradiation is minimal, as demonstrated by a XTT cell proliferation assay. PMID:22862291

Rapid method to detect duplex formation in sequencing by hybridization methods, a method for constructing containment structures for reagent interaction

DOEpatents

Mirzabekov, Andrei Darievich; Yershov, Gennadiy Moiseyevich; Guschin, Dmitry Yuryevich; Gemmell, Margaret Anne; Shick, Valentine V.; Proudnikov, Dmitri Y.; Timofeev, Edward N.

2002-01-01

A method for determining the existence of duplexes of oligonucleotide complementary molecules is provided whereby a plurality of immobilized oligonucleotide molecules, each of a specific length and each having a specific base sequence, is contacted with complementary, single stranded oligonucleotide molecules to form a duplex so as to facilitate intercalation of a fluorescent dye between the base planes of the duplex. The invention also provides for a method for constructing oligonucleotide matrices comprising confining light sensitive fluid to a surface, exposing said light-sensitive fluid to a light pattern so as to cause the fluid exposed to the light to polymerize into discrete units and adhere to the surface; and contacting each of the units with a set of different oligonucleotide molecules so as to allow the molecules to disperse into the units.

Oligonucleotides complementary to a promoter over the region -8...+2 as transcription primers for E. coli RNA polymerase.

PubMed Central

Grachev, M A; Zaychikov, E F; Ivanova, E M; Komarova, N I; Kutyavin, I V; Sidelnikova, N P; Frolova, I P

1984-01-01

Primer-dependent transcription by E. coli RNA polymerase on T7 promoter A2 has been studied. Synthetic deoxyribonucleotides complementary to the promoter over the region -8...+2 were taken as primers. A ribonucleoside residue was present at the 3'-end of some of these oligonucleotides. The octanucleotide complementary to the region -8...-1 appeared to be an active primer. Oligonucleotides having lengths from 3 to 6 nucleotide residues complementary to the promoter over the region -4...+2 also exhibited primer activity. The latter was some 5-10 times greater in the case of oligonucleotides having a ribonucleoside residue at the 3'-end. Oligonucleotides which on complementary binding do not reach the center of phosphodiester bond synthesis, as well as the decanucleotides (-8...+2) and octanucleotides (-6...+2) of both the ribo- and deoxyribo-series were inactive as primers. Images PMID:6390344

Characterization of Satellite DNA Sequences from the Commercially Important Marine Rotifers Brachionus rotundiformis and Brachionus plicatilis.

PubMed

Boehm; Gibson; Lubzens

2000-01-01

This study was initiated to search for species-specific and strain-specific satellite DNA sequences for which oligonucleotide primers could be designed to differentiate between various commercially important strains of the marine monogonont rotifers Brachionus rotundiformis and Brachionus plicatilis. Two unrelated, highly reiterated satellite sequences were cloned and characterized. The eight sequenced monomers from B. rotundiformis and six from B. plicatilis had low intrarepeat variability and were similar in their overall lengths, A + T compositions, and high degrees of repeated motif substructure. However, hybridizations to 19 representative strains, sequence characterizations, and GenBank searches indicated that these two satellites are morphotype-specific and population-specific, respectively, and share little homology to each other or to other characterized sequences in the database. Primer pairs designed for the B. rotundiformis satellite confirmed hybridization specificities on polymerase chain reaction and could serve as a useful molecular diagnostic tool to identify strains belonging to the SS morphotype, which are gaining widespread usage as first feeds for marine fish in commercial production.

Microbial Lifestyle and Genome Signatures

PubMed Central

Dutta, Chitra; Paul, Sandip

2012-01-01

Microbes are known for their unique ability to adapt to varying lifestyle and environment, even to the extreme or adverse ones. The genomic architecture of a microbe may bear the signatures not only of its phylogenetic position, but also of the kind of lifestyle to which it is adapted. The present review aims to provide an account of the specific genome signatures observed in microbes acclimatized to distinct lifestyles or ecological niches. Niche-specific signatures identified at different levels of microbial genome organization like base composition, GC-skew, purine-pyrimidine ratio, dinucleotide abundance, codon bias, oligonucleotide composition etc. have been discussed. Among the specific cases highlighted in the review are the phenomena of genome shrinkage in obligatory host-restricted microbes, genome expansion in strictly intra-amoebal pathogens, strand-specific codon usage in intracellular species, acquisition of genome islands in pathogenic or symbiotic organisms, discriminatory genomic traits of marine microbes with distinct trophic strategies, and conspicuous sequence features of certain extremophiles like those adapted to high temperature or high salinity. PMID:23024607

Energy reduction for the spot welding process in the automotive industry

NASA Astrophysics Data System (ADS)

Cullen, J. D.; Athi, N.; Al-Jader, M. A.; Shaw, A.; Al-Shamma'a, A. I.

2007-07-01

When performing spot welding on galvanised metals, higher welding force and current are required than on uncoated steels. This has implications for the energy usage when creating each spot weld, of which there are approximately 4300 in each passenger car. The paper presented is an overview of electrode current selection and its variance over the lifetime of the electrode tip. This also describes the proposed analysis system for the selection of welding parameters for the spot welding process, as the electrode tip wears.

Non-nucleoside building blocks for copper-assisted and copper-free click chemistry for the efficient synthesis of RNA conjugates.

PubMed

Jayaprakash, K N; Peng, Chang Geng; Butler, David; Varghese, Jos P; Maier, Martin A; Rajeev, Kallanthottathil G; Manoharan, Muthiah

2010-12-03

Novel non-nucleoside alkyne monomers compatible with oligonucleotide synthesis were designed, synthesized, and efficiently incorporated into RNA and RNA analogues during solid-phase synthesis. These modifications allowed site-specific conjugation of ligands to the RNA oligonucleotides through copper-assisted (CuAAC) and copper-free strain-promoted azide-alkyne cycloaddition (SPAAC) reactions. The SPAAC click reactions of cyclooctyne-oligonucleotides with various classes of azido-functionalized ligands in solution phase and on solid phase were efficient and quantitative and occurred under mild reaction conditions. The SPAAC reaction provides a method for the synthesis of oligonucleotide-ligand conjugates uncontaminated with copper ions.

Synthesis and biophysical properties of 5'-thio-2',4'-BNA/LNA oligonucleotide.

PubMed

Islam, Md Ariful; Fujisaka, Aki; Mori, Shohei; Ito, Kosuke Ramon; Yamaguchi, Takao; Obika, Satoshi

2018-07-23

Phosphorothioate modification of oligonucleotides is one of the most promising chemical modifications in nucleic acid therapeutics. Structurally similar 5'-thio or phosphorothiolate-modified nucleotides, in which the 5'-bridging oxygen atom is replaced with a sulfur atom, are attracting attention and gaining importance in oligonucleotide-based research. In our present study, we synthesized 5'-thio-2',4'-BNA/LNA monomers bearing thymine or 5-methylcytosine nucleobase. The 5'-thio-2',4'-BNA/LNA monomers were successfully incorporated into target oligonucleotides, and their nuclease stability and binding affinity with complementary strands were evaluated. Copyright © 2018 Elsevier Ltd. All rights reserved.

2'-O-[2-[2-(N,N-Dimethylamino)ethoxy]ethyl] Modified Antisense Oligonucleotides: Symbiosis of Charge Interaction Factors and Stereoelectronic Effects

DOE Office of Scientific and Technical Information (OSTI.GOV)

Prhavc, M.; Prakash, T.P.; Minasov, G.

Oligonucleotides with a novel, 2'-O-[2-[2-(N,N-dimethylamino)ethoxy]ethyl] (2'-O-DMAEOE) modification have been synthesized. This modification, a cationic analogue of the 2'-O-(2-methoxyethyl) (2'-O-MOE) modification, exhibits high binding affinity to target RNA (but not to DNA) and exceptional resistance to nuclease degradation. Analysis of the crystal structure of a self-complementary oligonucleotide containing a single 2'-O-DMAEOE modification explains the importance of charge factors and gauche effects on the observed antisense properties. 2'-O-DMAEOE modified oligonucleotides are ideal candidates for antisense drugs.

Systematic Validation and Atomic Force Microscopy of Non-Covalent Short Oligonucleotide Barcode Microarrays

PubMed Central

Cook, Michael A.; Chan, Chi-Kin; Jorgensen, Paul; Ketela, Troy; So, Daniel; Tyers, Mike; Ho, Chi-Yip

2008-01-01

Background Molecular barcode arrays provide a powerful means to analyze cellular phenotypes in parallel through detection of short (20–60 base) unique sequence tags, or “barcodes”, associated with each strain or clone in a collection. However, costs of current methods for microarray construction, whether by in situ oligonucleotide synthesis or ex situ coupling of modified oligonucleotides to the slide surface are often prohibitive to large-scale analyses. Methodology/Principal Findings Here we demonstrate that unmodified 20mer oligonucleotide probes printed on conventional surfaces show comparable hybridization signals to covalently linked 5′-amino-modified probes. As a test case, we undertook systematic cell size analysis of the budding yeast Saccharomyces cerevisiae genome-wide deletion collection by size separation of the deletion pool followed by determination of strain abundance in size fractions by barcode arrays. We demonstrate that the properties of a 13K unique feature spotted 20 mer oligonucleotide barcode microarray compare favorably with an analogous covalently-linked oligonucleotide array. Further, cell size profiles obtained with the size selection/barcode array approach recapitulate previous cell size measurements of individual deletion strains. Finally, through atomic force microscopy (AFM), we characterize the mechanism of hybridization to unmodified barcode probes on the slide surface. Conclusions/Significance These studies push the lower limit of probe size in genome-scale unmodified oligonucleotide microarray construction and demonstrate a versatile, cost-effective and reliable method for molecular barcode analysis. PMID:18253494

Effect of competing self-structure on triplex formation with purine-rich oligodeoxynucleotides containing GA repeats.

PubMed Central

Noonberg, S B; François, J C; Garestier, T; Hélène, C

1995-01-01

Competition between triplex formation with double-stranded DNA and oligonucleotide self-association was investigated in 23mer GA and GT oligonucleotides containing d(GA)5 or d(GT)5 repeats. Whereas triplex formation with GT oligonucleotides was diminished when temperature increased from 4 to 37 degrees C, triplex formation with GA oligonucleotides was enhanced when temperature increased within the same range due to the presence of competing intermolecular GA oligonucleotide self-structure. This self-structure was determined to be a homoduplex stabilized by the internal GA repeats. UV spectroscopy of these homoduplexes demonstrated a single sharp transition with rapid kinetics (Tm = 38.5-43.5 degrees C over strand concentrations of 0.5-4 microM, respectively, with transition enthalpy, delta H = -89 +/- 7 kcal/mol) in 10 mM MgCl2, 100 mM NaCl, pH 7.0. Homoduplex formation was strongly stabilized by multivalent cations (spermine > Mg2+ = Ca2+) and destabilized by low concentrations of monovalent cations (K+ = Li+ = Na+) in the presence of divalent cations. However, unlike GA or GT oligonucleotide-containing triplexes, the homoduplex formed even in the absence of multivalent cations, stabilized by only moderate concentrations of monovalent cations (Li+ > Na+ > K+). Through the development of multiple equilibrium states and the resulting depletion of free oligonucleotide, it was found that the presence of competing self-structure could decrease triplex formation under a variety of experimental conditions. Images PMID:7596824

Lipophilic oligonucleotides spontaneously insert into lipid membranes, bind complementary DNA strands, and sequester into lipid-disordered domains.

PubMed

Bunge, Andreas; Kurz, Anke; Windeck, Anne-Kathrin; Korte, Thomas; Flasche, Wolfgang; Liebscher, Jürgen; Herrmann, Andreas; Huster, Daniel

2007-04-10

For the development of surface functionalized bilayers, we have synthesized lipophilic oligonucleotides to combine the molecular recognition mechanism of nucleic acids and the self-assembly characteristics of lipids in planar membranes. A lipophilic oligonucleotide consisting of 21 thymidine units and two lipophilic nucleotides with an alpha-tocopherol moiety as a lipophilic anchor was synthesized using solid-phase methods with a phosphoramadite strategy. The interaction of the water soluble lipophilic oligonucleotide with vesicular lipid membranes and its capability to bind complementary DNA strands was studied using complementary methods such as NMR, EPR, DSC, fluorescence spectroscopy, and fluorescence microscopy. This oligonucleotide inserted stably into preformed membranes from the aqueous phase. Thereby, no significant perturbation of the lipid bilayer and its stability was observed. However, the non-lipidated end of the oligonucleotide is exposed to the aqueous environment, is relatively mobile, and is free to interact with complementary DNA strands. Binding of the complementary single-stranded DNA molecules is fast and accomplished by the formation of Watson-Crick base pairs, which was confirmed by 1H NMR chemical shift analysis and fluorescence resonance energy transfer. The molecular structure of the membrane bound DNA double helix is very similar to the free double-stranded DNA. Further, the membrane bound DNA double strands also undergo regular melting. Finally, in raft-like membrane mixtures, the lipophilic oligonucleotide was shown to preferentially sequester into liquid-disordered membrane domains.

Effect on embryos of injection of phosphorothioate-modified oligonucleotides into pregnant mice.

PubMed

Gaudette, M F; Hampikian, G; Metelev, V; Agrawal, S; Crain, W R

1993-01-01

Phosphorothioate-modified oligonucleotides were injected into pregnant female mice to assess the effect on developing embryos. Injections were carried out during two different time periods, one when embryos were in preimplantation stages of development (about 3.5 days of development) and the other after implantation, when both a fetus and placenta are present (from days 9.5 to 11.5 of development). Three different phosphorothioate-modified oligonucleotides were injected. One, which had a sequence not present in the mouse genome, was used to ask whether nonspecific toxic or teratogenic effects on embryos result from treatment of the mother. A second was complementary to the mRNA of the testis-determining factor gene Sry and was used to ask whether a specific developmental pathway (i.e., sex determination) could be disrupted in embryos in vivo. The third was the complement of the anti-Sry sequence. None of these oligonucleotides reduced the frequency of successful pregnancy after mating or the average litter size from that observed in controls animals. Furthermore, examination of 291 pups or fetuses from all oligonucleotide-injected pregnant females revealed no developmental defects regardless of which sequence was used. It is concluded that injection of phosphorothioate-modified oligonucleotides into pregnant females according to the protocols described here is not toxic or teratogenic to embryos in a nonspecific way. Also, anti-Sry oligonucleotides did not influence sex determination in embryos, although there are several possible explanations for this.

Oligonucleotides Containing Aminated 2'-Amino-LNA Nucleotides: Synthesis and Strong Binding to Complementary DNA and RNA.

PubMed

Lou, Chenguang; Samuelsen, Simone V; Christensen, Niels Johan; Vester, Birte; Wengel, Jesper

2017-04-19

Mono- and diaminated 2'-amino-LNA monomers were synthesized and introduced into oligonucleotides. Each modification imparts significant stabilization of nucleic acid duplexes and triplexes, excellent sequence selectivity, and significant nuclease resistance. Molecular modeling suggested that structural stabilization occurs via intrastrand electrostatic attraction between the protonated amino groups of the aminated 2'-amino-LNA monomers and the host oligonucleotide backbone.

Phosphorothioate oligonucleotides inhibit the intrinsic tenase complex.

PubMed

Sheehan, J P; Lan, H C

1998-09-01

Systemic administration of ISIS 2302, a 20-mer antisense phosphorothioate oligonucleotide targeting human intercellular adhesion molecule-1 mRNA, causes prolongation of plasma clotting times in both monkey and human studies. The anticoagulant effects of ISIS 2302 were investigated with both in vitro coagulation assays in human plasma and purified enzyme systems. At high oligonucleotide plasma concentrations (>100 microgram/mL), prolongation of the prothrombin and thrombin times was observed. In a thrombin time assay using purified components, high concentrations of ISIS 2302 inhibited thrombin clotting activity both by stimulating inhibition by heparin cofactor II and directly competing with fibrinogen for binding to anion binding exosite I. In contrast, low concentrations of ISIS 2302 (<100 microgram/mL) showed a selective, linear prolongation of the activated partial thromboplastin time (PTT). The rate limiting effect of 50 microgram/mL ISIS 2302, which prolonged the PTT to 1.5 times control, was identified by sequential modification of the clotting assay. Delaying addition of oligonucleotide until after contact activation failed to correct prolongation of the PTT. The calcium-dependent steps of the intrinsic pathway were individually assessed by adding sufficient activated coagulation factor to correct the PTT in plasma deficient in that specific factor. Addition of factor XIa, IXa, VIIIa, or Va failed to correct the PTT in the presence of ISIS 2302. In contrast, 0.2 nmol/L factor Xa corrected prolongation of the PTT in factor X-deficient plasma with or without oligonucleotide present. ISIS 2302 (50 microgram/mL) did not prolong a modified Russel viper venom time, suggesting no significant inhibition of prothrombinase. Thus, 50 microgram/mL ISIS 2302 prolonged the PTT by selectively inhibiting intrinsic tenase activity. ISIS 2302 showed partial inhibition of intrinsic tenase activity (to approximately 35% of control) at clinically relevant oligonucleotide concentrations in a chromogenic assay. This activity was oligonucleotide sequence-independent but required the phosphorothioate backbone, suggesting that inhibition of intrinsic tenase is a general property of this class of oligonucleotides. These results are relevant to both the therapeutic use of phosphorothioate oligonucleotides and the potential design of inhibitors of the intrinsic tenase complex, a novel target for anticoagulation. Copyright 1998 by The American Society of Hematology.

Glycotoxin and Autoantibodies Are Additive Environmentally Determined Predictors of Type 1 Diabetes

PubMed Central

Beyan, Huriya; Riese, Harriette; Hawa, Mohammed I.; Beretta, Guisi; Davidson, Howard W.; Hutton, John C.; Burger, Huibert; Schlosser, Michael; Snieder, Harold; Boehm, Bernhard O.; Leslie, R. David

2012-01-01

In type 1 diabetes, diabetes-associated autoantibodies, including islet cell antibodies (ICAs), reflect adaptive immunity, while increased serum Nε-carboxymethyl-lysine (CML), an advanced glycation end product, is associated with proinflammation. We assessed whether serum CML and autoantibodies predicted type 1 diabetes and to what extent they were determined by genetic or environmental factors. Of 7,287 unselected schoolchildren screened, 115 were ICA+ and were tested for baseline CML and diabetes autoantibodies and followed (for median 7 years), whereas a random selection (n = 2,102) had CML tested. CML and diabetes autoantibodies were determined in a classic twin study of twin pairs discordant for type 1 diabetes (32 monozygotic, 32 dizygotic pairs). CML was determined by enzyme-linked immunosorbent assay, autoantibodies were determined by radioimmunoprecipitation, ICA was determined by indirect immunofluorescence, and HLA class II genotyping was determined by sequence-specific oligonucleotides. CML was increased in ICA+ and prediabetic schoolchildren and in diabetic and nondiabetic twins (all P < 0.001). Elevated levels of CML in ICA+ children were a persistent, independent predictor of diabetes progression, in addition to autoantibodies and HLA risk. In twins model fitting, familial environment explained 75% of CML variance, and nonshared environment explained all autoantibody variance. Serum CML, a glycotoxin, emerged as an environmentally determined diabetes risk factor, in addition to autoimmunity and HLA genetic risk, and a potential therapeutic target. PMID:22396204

Understanding the usage of content in a mental health intervention for depression: an analysis of log data.

PubMed

Van Gemert-Pijnen, Julia Ewc; Kelders, Saskia M; Bohlmeijer, Ernst T

2014-01-31

Web-based interventions for the early treatment of depressive symptoms can be considered effective in reducing mental complaints. However, there is a limited understanding of which elements in an intervention contribute to effectiveness. For efficiency and effectiveness of interventions, insight is needed into the use of content and persuasive features. The aims of this study were (1) to illustrate how log data can be used to understand the uptake of the content of a Web-based intervention that is based on the acceptance and commitment therapy (ACT) and (2) to discover how log data can be of value for improving the incorporation of content in Web-based interventions. Data from 206 participants (out of the 239) who started the first nine lessons of the Web-based intervention, Living to the Full, were used for a secondary analysis of a subset of the log data of the parent study about adherence to the intervention. The log files used in this study were per lesson: login, start mindfulness, download mindfulness, view success story, view feedback message, start multimedia, turn on text-message coach, turn off text-message coach, and view text message. Differences in usage between lessons were explored with repeated measures ANOVAs (analysis of variance). Differences between groups were explored with one-way ANOVAs. To explore the possible predictive value of the login per lesson quartiles on the outcome measures, four linear regressions were used with login quartiles as predictor and with the outcome measures (Center for Epidemiologic Studies-Depression [CES-D] and the Hospital Anxiety and Depression Scale-Anxiety [HADS-A] on post-intervention and follow-up) as dependent variables. A significant decrease in logins and in the use of content and persuasive features over time was observed. The usage of features varied significantly during the treatment process. The usage of persuasive features increased during the third part of the ACT (commitment to value-based living), which might indicate that at that stage motivational support was relevant. Higher logins over time (9 weeks) corresponded with a higher usage of features (in most cases significant); when predicting depressive symptoms at post-intervention, the linear regression yielded a significant model with login quartile as a significant predictor (explained variance is 2.7%). A better integration of content and persuasive features in the design of the intervention and a better intra-usability of features within the system are needed to identify which combination of features works best for whom. Pattern recognition can be used to tailor the intervention based on usage patterns from the earlier lessons and to support the uptake of content essential for therapy. An adaptable interface for a modular composition of therapy features supposes a dynamic approach for Web-based treatment; not a predefined path for all, but a flexible way to go through all features that have to be used.

Understanding the Usage of Content in a Mental Health Intervention for Depression: An Analysis of Log Data

PubMed Central

2014-01-01

Background Web-based interventions for the early treatment of depressive symptoms can be considered effective in reducing mental complaints. However, there is a limited understanding of which elements in an intervention contribute to effectiveness. For efficiency and effectiveness of interventions, insight is needed into the use of content and persuasive features. Objective The aims of this study were (1) to illustrate how log data can be used to understand the uptake of the content of a Web-based intervention that is based on the acceptance and commitment therapy (ACT) and (2) to discover how log data can be of value for improving the incorporation of content in Web-based interventions. Methods Data from 206 participants (out of the 239) who started the first nine lessons of the Web-based intervention, Living to the Full, were used for a secondary analysis of a subset of the log data of the parent study about adherence to the intervention. The log files used in this study were per lesson: login, start mindfulness, download mindfulness, view success story, view feedback message, start multimedia, turn on text-message coach, turn off text-message coach, and view text message. Differences in usage between lessons were explored with repeated measures ANOVAs (analysis of variance). Differences between groups were explored with one-way ANOVAs. To explore the possible predictive value of the login per lesson quartiles on the outcome measures, four linear regressions were used with login quartiles as predictor and with the outcome measures (Center for Epidemiologic Studies—Depression [CES-D] and the Hospital Anxiety and Depression Scale—Anxiety [HADS-A] on post-intervention and follow-up) as dependent variables. Results A significant decrease in logins and in the use of content and persuasive features over time was observed. The usage of features varied significantly during the treatment process. The usage of persuasive features increased during the third part of the ACT (commitment to value-based living), which might indicate that at that stage motivational support was relevant. Higher logins over time (9 weeks) corresponded with a higher usage of features (in most cases significant); when predicting depressive symptoms at post-intervention, the linear regression yielded a significant model with login quartile as a significant predictor (explained variance is 2.7%). Conclusions A better integration of content and persuasive features in the design of the intervention and a better intra-usability of features within the system are needed to identify which combination of features works best for whom. Pattern recognition can be used to tailor the intervention based on usage patterns from the earlier lessons and to support the uptake of content essential for therapy. An adaptable interface for a modular composition of therapy features supposes a dynamic approach for Web-based treatment; not a predefined path for all, but a flexible way to go through all features that have to be used. PMID:24486914

Biocompatible artificial DNA linker that is read through by DNA polymerases and is functional in Escherichia coli

PubMed Central

El-Sagheer, Afaf H.; Sanzone, A. Pia; Gao, Rachel; Tavassoli, Ali; Brown, Tom

2011-01-01

A triazole mimic of a DNA phosphodiester linkage has been produced by templated chemical ligation of oligonucleotides functionalized with 5′-azide and 3′-alkyne. The individual azide and alkyne oligonucleotides were synthesized by standard phosphoramidite methods and assembled using a straightforward ligation procedure. This highly efficient chemical equivalent of enzymatic DNA ligation has been used to assemble a 300-mer from three 100-mer oligonucleotides, demonstrating the total chemical synthesis of very long oligonucleotides. The base sequences of the DNA strands containing this artificial linkage were copied during PCR with high fidelity and a gene containing the triazole linker was functional in Escherichia coli. PMID:21709264

Chemoselective covalent coupling of oligonucleotide probes to self-assembled monolayers.

PubMed

Devaraj, Neal K; Miller, Gregory P; Ebina, Wataru; Kakaradov, Boyko; Collman, James P; Kool, Eric T; Chidsey, Christopher E D

2005-06-22

A chemoselective route to routinely and rapidly attach oligonucleotide probes to well-defined surfaces is presented. Cu(I) tris(benzyltriazolylmethyl)amine-catalyzed coupling of terminal acetylenes to azides on a self-assembled monolayer is used instead of traditional nucleophilic-electrophilic coupling reactions. The reaction proceeds well even in the presence of purposely introduced nucleophilic and electrophilic impurities. The density of oligonucleotide probes can be controlled by controlling the amount of azide functionality. Although most of our work was done on gold surfaces, this technique should be readily applicable to any surface on which an azide-containing monolayer can be assembled as we have preliminarily demonstrated by derivatizing azidotrimethoxysilane-modified glass slides with fluorescein-containing oligonucleotides.

A statistical learning approach to the modeling of chromatographic retention of oligonucleotides incorporating sequence and secondary structure data

PubMed Central

Sturm, Marc; Quinten, Sascha; Huber, Christian G.; Kohlbacher, Oliver

2007-01-01

We propose a new model for predicting the retention time of oligonucleotides. The model is based on ν support vector regression using features derived from base sequence and predicted secondary structure of oligonucleotides. Because of the secondary structure information, the model is applicable even at relatively low temperatures where the secondary structure is not suppressed by thermal denaturing. This makes the prediction of oligonucleotide retention time for arbitrary temperatures possible, provided that the target temperature lies within the temperature range of the training data. We describe different possibilities of feature calculation from base sequence and secondary structure, present the results and compare our model to existing models. PMID:17567619

Chemistry, mechanism and clinical status of antisense oligonucleotides and duplex RNAs

PubMed Central

Shen, Xiulong; Corey, David R

2018-01-01

Abstract RNA plays a central role in the expression of all genes. Because any sequence within RNA can be recognized by complementary base pairing, synthetic oligonucleotides and oligonucleotide mimics offer a general strategy for controlling processes that affect disease. The two primary antisense approaches for regulating expression through recognition of cellular RNAs are single-stranded antisense oligonucleotides and duplex RNAs. This review will discuss the chemical modifications and molecular mechanisms that make synthetic nucleic acid drugs possible. Lessons learned from recent clinical trials will be summarized. Ongoing clinical trials are likely to decisively test the adequacy of our current generation of antisense nucleic acid technologies and highlight areas where more basic research is needed. PMID:29240946

Cellular Internalization of Therapeutic Oligonucleotides by Peptide Amphiphile Nanofibers and Nanospheres.

PubMed

Mumcuoglu, Didem; Sardan Ekiz, Melis; Gunay, Gokhan; Tekinay, Turgay; Tekinay, Ayse B; Guler, Mustafa O

2016-05-11

Oligonucleotides are promising drug candidates due to the exceptionally high specificity they exhibit toward their target DNA and RNA sequences. However, their poor pharmacokinetic and pharmacodynamic properties, in conjunction with problems associated with their internalization by cells, necessitates their delivery through specialized carrier systems for efficient therapy. Here, we investigate the effects of carrier morphology on the cellular internalization mechanisms of oligonucleotides by using self-assembled fibrous or spherical peptide nanostructures. Size and geometry were both found to be important parameters for the oligonucleotide internalization process; direct penetration was determined to be the major mechanism for the internalization of nanosphere carriers, whereas nanofibers were internalized by clathrin- and dynamin-dependent endocytosis pathways. We further showed that glucose conjugation to carrier nanosystems improved cellular internalization in cancer cells due to the enhanced glucose metabolism associated with oncogenesis, and the internalization of the glucose-conjugated peptide/oligonucleotide complexes was found to be dependent on glucose transporters present on the surface of the cell membrane.

A facile inhibitor screening of SARS coronavirus N protein using nanoparticle-based RNA oligonucleotide.

PubMed

Roh, Changhyun

2012-01-01

Hundreds of million people worldwide have been infected with severe acute respiratory syndrome (SARS), and the rate of global death from SARS has remarkably increased. Hence, the development of efficient drug treatments for the biological effects of SARS is highly needed. We have previously shown that quantum dots (QDs)-conjugated RNA oligonucleotide is sensitive to the specific recognition of the SARS-associated coronavirus (SARS-CoV) nucleocapsid (N) protein. In this study, we found that a designed biochip could analyze inhibitors of the SARS-CoV N protein using nanoparticle-based RNA oligonucleotide. Among the polyphenolic compounds examined, (-)-catechin gallate and (-)-gallocatechin gallate demonstrated a remarkable inhibition activity on SARS-CoV N protein. (-)-catechin gallate and (-)-gallocatechin gallate attenuated the binding affinity in a concentrated manner as evidenced by QDs-conjugated RNA oligonucleotide on a designed biochip. At a concentration of 0.05 μg mL(-1), (-)-catechin gallate and (-)-gallocatechin gallate showed more than 40% inhibition activity on a nanoparticle-based RNA oligonucleotide biochip system.

Methods of DNA sequencing by hybridization based on optimizing concentration of matrix-bound oligonucleotide and device for carrying out same

DOEpatents

Khrapko, Konstantin R [Moscow, RU; Khorlin, Alexandr A [Moscow, RU; Ivanov, Igor B [Moskovskaya, RU; Ershov, Gennady M [Moscow, RU; Lysov, Jury P [Moscow, RU; Florentiev, Vladimir L [Moscow, RU; Mirzabekov, Andrei D [Moscow, RU

1996-09-03

A method for sequencing DNA by hybridization that includes the following steps: forming an array of oligonucleotides at such concentrations that either ensure the same dissociation temperature for all fully complementary duplexes or allows hybridization and washing of such duplexes to be conducted at the same temperature; hybridizing said oligonucleotide array with labeled test DNA; washing in duplex dissociation conditions; identifying single-base substitutions in the test DNA by analyzing the distribution of the dissociation temperatures and reconstructing the DNA nucleotide sequence based on the above analysis. A device for carrying out the method comprises a solid substrate and a matrix rigidly bound to the substrate. The matrix contains the oligonucleotide array and consists of a multiplicity of gel portions. Each gel portion contains one oligonucleotide of desired length. The gel portions are separated from one another by interstices and have a thickness not exceeding 30 .mu.m.

Java web tools for PCR, in silico PCR, and oligonucleotide assembly and analysis.

PubMed

Kalendar, Ruslan; Lee, David; Schulman, Alan H

2011-08-01

The polymerase chain reaction is fundamental to molecular biology and is the most important practical molecular technique for the research laboratory. We have developed and tested efficient tools for PCR primer and probe design, which also predict oligonucleotide properties based on experimental studies of PCR efficiency. The tools provide comprehensive facilities for designing primers for most PCR applications and their combinations, including standard, multiplex, long-distance, inverse, real-time, unique, group-specific, bisulphite modification assays, Overlap-Extension PCR Multi-Fragment Assembly, as well as a programme to design oligonucleotide sets for long sequence assembly by ligase chain reaction. The in silico PCR primer or probe search includes comprehensive analyses of individual primers and primer pairs. It calculates the melting temperature for standard and degenerate oligonucleotides including LNA and other modifications, provides analyses for a set of primers with prediction of oligonucleotide properties, dimer and G-quadruplex detection, linguistic complexity, and provides a dilution and resuspension calculator. Copyright © 2011 Elsevier Inc. All rights reserved.

Antisense phosphorothioate oligonucleotides: selective killing of the intracellular parasite Leishmania amazonensis.

PubMed

Ramazeilles, C; Mishra, R K; Moreau, S; Pascolo, E; Toulmé, J J

1994-08-16

We targeted the mini-exon sequence, present at the 5' end of every mRNA of the protozoan parasite Leishmania amazonensis, by phosphorothioate oligonucleotides. A complementary 16-mer (16PS) was able to kill amastigotes--the intracellular stage of the parasite--in murine macrophages in culture. After 24 hr of incubation with 10 microM 16PS, about 30% infected macrophages were cured. The oligomer 16PS acted through antisense hybridization in a sequence-dependent way; no effect on parasites was observed with noncomplementary phosphorothioate oligonucleotides. The antisense oligonucleotide 16PS was a selective killer of the protozoans without any detrimental effect to the host macrophage. Using 16PS linked to a palmitate chain, which enabled it to complex with low density lipoproteins, improved the leishmanicidal efficiency on intracellular amastigotes, probably due to increased endocytosis. Phosphorothioate oligonucleotides complementary to the intron part of the mini-exon pre-RNA were also effective, suggesting that antisense oligomers could prevent trans-splicing in these parasites.

Incorporation of an aldehyde function in oligonucleotides.

PubMed

Tilquin, J M; Dechamps, M; Sonveaux, E

2001-01-01

A nucleotide-like phosphoramidite building block that has the nucleic base replaced by the tert-butyldimethylsilyl-protected styrene glycol was synthesized. After the automatic synthesis of an oligonucleotide incorporating this synthon, the benzaldehyde function was generated by fluoride deprotection and oxidation by sodium periodate. In a similar manner, an oligonucleotide where a nucleic base was replaced by the (CH2)8CH=O chain was synthesized and conjugated with biotin derivatives.

Efficient self-assembly of DNA-functionalized fluorophores and gold nanoparticles with DNA functionalized silicon surfaces: the effect of oligomer spacers

PubMed Central

Milton, James A.; Patole, Samson; Yin, Huabing; Xiao, Qiang; Brown, Tom; Melvin, Tracy

2013-01-01

Although strategies for the immobilization of DNA oligonucleotides onto surfaces for bioanalytical and top-down bio-inspired nanobiofabrication approaches are well developed, the effect of introducing spacer molecules between the surface and the DNA oligonucleotide for the hybridization of nanoparticle–DNA conjugates has not been previously assessed in a quantitative manner. The hybridization efficiency of DNA oligonucleotides end-labelled with gold nanoparticles (1.4 or 10 nm diameter) with DNA sequences conjugated to silicon surfaces via hexaethylene glycol phosphate diester oligomer spacers (0, 1, 2, 6 oligomers) was found to be independent of spacer length. To quantify both the density of DNA strands attached to the surfaces and hybridization with the surface-attached DNA, new methodologies have been developed. Firstly, a simple approach based on fluorescence has been developed for determination of the immobilization density of DNA oligonucleotides. Secondly, an approach using mass spectrometry has been created to establish (i) the mean number of DNA oligonucleotides attached to the gold nanoparticles and (ii) the hybridization density of nanoparticle–oligonucleotide conjugates with the silicon surface–attached complementary sequence. These methods and results will be useful for application with nanosensors, the self-assembly of nanoelectronic devices and the attachment of nanoparticles to biomolecules for single-molecule biophysical studies. PMID:23361467

A Novel Bioinformatics Strategy to Analyze Microbial Big Sequence Data for Efficient Knowledge Discovery: Batch-Learning Self-Organizing Map (BLSOM).

PubMed

Iwasaki, Yuki; Abe, Takashi; Wada, Kennosuke; Wada, Yoshiko; Ikemura, Toshimichi

2013-11-20

With the remarkable increase of genomic sequence data of microorganisms, novel tools are needed for comprehensive analyses of the big sequence data available. The self-organizing map (SOM) is an effective tool for clustering and visualizing high-dimensional data, such as oligonucleotide composition on one map. By modifying the conventional SOM, we developed batch-learning SOM (BLSOM), which allowed classification of sequence fragments (e.g., 1 kb) according to phylotypes, solely depending on oligonucleotide composition. Metagenomics studies of uncultivable microorganisms in clinical and environmental samples should allow extensive surveys of genes important in life sciences. BLSOM is most suitable for phylogenetic assignment of metagenomic sequences, because fragmental sequences can be clustered according to phylotypes, solely depending on oligonucleotide composition. We first constructed oligonucleotide BLSOMs for all available sequences from genomes of known species, and by mapping metagenomic sequences on these large-scale BLSOMs, we can predict phylotypes of individual metagenomic sequences, revealing a microbial community structure of uncultured microorganisms, including viruses. BLSOM has shown that influenza viruses isolated from humans and birds clearly differ in oligonucleotide composition. Based on this host-dependent oligonucleotide composition, we have proposed strategies for predicting directional changes of virus sequences and for surveilling potentially hazardous strains when introduced into humans from non-human sources.

Oligonucleotide-arrayed TFT photosensor applicable for DNA chip technology.

PubMed

Tanaka, Tsuyoshi; Hatakeyama, Keiichi; Sawaguchi, Masahiro; Iwadate, Akihito; Mizutani, Yasushi; Sasaki, Kazuhiro; Tateishi, Naofumi; Takeyama, Haruko; Matsunaga, Tadashi

2006-09-05

A thin film transistor (TFT) photosensor fabricated by semiconductor integrated circuit (IC) technology was applied to DNA chip technology. The surface of the TFT photosensor was coated with TiO2 using a vapor deposition technique for the fabrication of optical filters. The immobilization of thiolated oligonucleotide probes onto a TiO2-coated TFT photosensor using gamma-aminopropyltriethoxysilane (APTES) and N-(gamma-maleimidobutyloxy) sulfosuccinimide ester (GMBS) was optimized. The coverage value of immobilized oligonucleotides reached a plateau at 33.7 pmol/cm2, which was similar to a previous analysis using radioisotope-labeled oligonucleotides. The lowest detection limits were 0.05 pmol/cm2 for quantum dot and 2.1 pmol/cm2 for Alexa Fluor 350. Furthermore, single nucleotide polymorphism (SNP) detection was examined using the oligonucleotide-arrayed TFT photosensor. A SNP present in the aldehyde dehydrogenase 2 (ALDH2) gene was used as a target. The SNPs in ALDH2*1 and ALDH2*2 target DNA were detected successfully using the TFT photosensor. DNA hybridization in the presence of both ALDH2*1 and ALDH2*2 target DNA was observed using both ALDH2*1 and ALDH2*2 detection oligonucleotides-arrayed TFT photosensor. Use of the TFT photosensor will allow the development of a disposable photodetecting device for DNA chip systems. (c) 2006 Wiley Periodicals, Inc.

Charge-induced geometrical reorganization of DNA oligonucleotides studied by tandem mass spectrometry and ion mobility.

PubMed

Ickert, Stefanie; Hofmann, Johanna; Riedel, Jens; Beck, Sebastian; Pagel, Kevin; Linscheid, Michael W

2018-04-01

Mass spectrometry is applied as a tool for the elucidation of molecular structures. This premises that gas-phase structures reflect the original geometry of the analytes, while it requires a thorough understanding and investigation of the forces controlling and affecting the gas-phase structures. However, only little is known about conformational changes of oligonucleotides in the gas phase. In this study, a series of multiply charged DNA oligonucleotides (n = 15-40) has been subjected to a comprehensive tandem mass spectrometric study to unravel transitions between different ionic gas-phase structures. The nucleobase sequence and the chain length were varied to gain insights into their influence on the geometrical oligonucleotide organization. Altogether, 23 oligonucleotides were analyzed using collision-induced fragmentation. All sequences showed comparable correlation regarding the characteristic collision energy. This value that is also a measure for stability, strongly correlates with the net charge density of the precursor ions. With decreasing charge of the oligonucleotides, an increase in the fragmentation energy was observed. At a distinct charge density, a deviation from linearity was observed for all studied species, indicating a structural reorganization. To corroborate the proposed geometrical change, collisional cross-sections of the oligonucleotides at different charge states were determined using ion mobility-mass spectrometry. The results clearly indicate that an increase in charge density and thus Coulomb repulsion results in the transition from a folded, compact form to elongated structures of the precursor ions. Our data show this structural transition to depend mainly on the charge density, whereas sequence and size do not have an influence.

Oligonucleotide arrays vs. metaphase-comparative genomic hybridisation and BAC arrays for single-cell analysis: first applications to preimplantation genetic diagnosis for Robertsonian translocation carriers.

PubMed

Ramos, Laia; del Rey, Javier; Daina, Gemma; García-Aragonés, Manel; Armengol, Lluís; Fernandez-Encinas, Alba; Parriego, Mònica; Boada, Montserrat; Martinez-Passarell, Olga; Martorell, Maria Rosa; Casagran, Oriol; Benet, Jordi; Navarro, Joaquima

2014-01-01

Comprehensive chromosome analysis techniques such as metaphase-Comparative Genomic Hybridisation (CGH) and array-CGH are available for single-cell analysis. However, while metaphase-CGH and BAC array-CGH have been widely used for Preimplantation Genetic Diagnosis, oligonucleotide array-CGH has not been used in an extensive way. A comparison between oligonucleotide array-CGH and metaphase-CGH has been performed analysing 15 single fibroblasts from aneuploid cell-lines and 18 single blastomeres from human cleavage-stage embryos. Afterwards, oligonucleotide array-CGH and BAC array-CGH were also compared analysing 16 single blastomeres from human cleavage-stage embryos. All three comprehensive analysis techniques provided broadly similar cytogenetic profiles; however, non-identical profiles appeared when extensive aneuploidies were present in a cell. Both array techniques provided an optimised analysis procedure and a higher resolution than metaphase-CGH. Moreover, oligonucleotide array-CGH was able to define extra segmental imbalances in 14.7% of the blastomeres and it better determined the specific unbalanced chromosome regions due to a higher resolution of the technique (≈ 20 kb). Applicability of oligonucleotide array-CGH for Preimplantation Genetic Diagnosis has been demonstrated in two cases of Robertsonian translocation carriers 45,XY,der(13;14)(q10;q10). Transfer of euploid embryos was performed in both cases and pregnancy was achieved by one of the couples. This is the first time that an oligonucleotide array-CGH approach has been successfully applied to Preimplantation Genetic Diagnosis for balanced chromosome rearrangement carriers.

Oligonucleotide Arrays vs. Metaphase-Comparative Genomic Hybridisation and BAC Arrays for Single-Cell Analysis: First Applications to Preimplantation Genetic Diagnosis for Robertsonian Translocation Carriers

PubMed Central

Ramos, Laia; del Rey, Javier; Daina, Gemma; García-Aragonés, Manel; Armengol, Lluís; Fernandez-Encinas, Alba; Parriego, Mònica; Boada, Montserrat; Martinez-Passarell, Olga; Martorell, Maria Rosa; Casagran, Oriol; Benet, Jordi; Navarro, Joaquima

2014-01-01

Comprehensive chromosome analysis techniques such as metaphase-Comparative Genomic Hybridisation (CGH) and array-CGH are available for single-cell analysis. However, while metaphase-CGH and BAC array-CGH have been widely used for Preimplantation Genetic Diagnosis, oligonucleotide array-CGH has not been used in an extensive way. A comparison between oligonucleotide array-CGH and metaphase-CGH has been performed analysing 15 single fibroblasts from aneuploid cell-lines and 18 single blastomeres from human cleavage-stage embryos. Afterwards, oligonucleotide array-CGH and BAC array-CGH were also compared analysing 16 single blastomeres from human cleavage-stage embryos. All three comprehensive analysis techniques provided broadly similar cytogenetic profiles; however, non-identical profiles appeared when extensive aneuploidies were present in a cell. Both array techniques provided an optimised analysis procedure and a higher resolution than metaphase-CGH. Moreover, oligonucleotide array-CGH was able to define extra segmental imbalances in 14.7% of the blastomeres and it better determined the specific unbalanced chromosome regions due to a higher resolution of the technique (≈20 kb). Applicability of oligonucleotide array-CGH for Preimplantation Genetic Diagnosis has been demonstrated in two cases of Robertsonian translocation carriers 45,XY,der(13;14)(q10;q10). Transfer of euploid embryos was performed in both cases and pregnancy was achieved by one of the couples. This is the first time that an oligonucleotide array-CGH approach has been successfully applied to Preimplantation Genetic Diagnosis for balanced chromosome rearrangement carriers. PMID:25415307

Desulfurization of phosphorothioate oligonucleotides via the sulfur-by-oxygen replacement induced by the hydroxyl radical during negative electrospray ionization mass spectrometry.

PubMed

Wu, Lianming; White, David E; Ye, Connie; Vogt, Frederick G; Terfloth, Gerald J; Matsuhashi, Hayao

2012-07-01

While the occurrence of desulfurization of phosphorothioate oligonucleotides in solution is well established, this study represents the first attempt to investigate the basis of the unexpected desulfurization via the net sulfur-by-oxygen (S-O) replacement during negative electrospray ionization (ESI). The current work, facilitated by quantitative mass deconvolution, demonstrates that considerable desulfurization can take place even under common negative ESI operating conditions. The extent of desulfurization is dependent on the molar phosphorothioate oligonucleotide-to-hydroxyl radical ratio, which is consistent with the corona discharge-induced origin of the hydroxyl radical leading to the S-O replacement. This hypothesis is supported by the fact that an increase of the high-performance liquid chromatography (HPLC) flow rate and the on-column concentration of a phosphorothioate oligonucleotide, as well as a decrease of the electrospray voltage reduce the degree of desulfurization. Comparative LC-tandem mass spectrometry (MS/MS) sequencing of a phosphorothioate oligonucleotide and its corresponding desulfurization product revealed evidence that the S-O replacement occurs at multiple phosphorothioate internucleotide linkage sites. In practice, the most convenient and effective strategy for minimizing this P = O artifact is to increase the LC flow rate and the on-column concentration of phosphorothioate oligonucleotides. Another approach to mitigate possible detrimental effects of the undesired desulfurization is to operate the ESI source at a very low electrospray voltage to diminish the corona discharge; however this will significantly compromise sensitivity when analyzing the low-level P = O impurities in phosphorothioate oligonucleotides. Copyright © 2012 John Wiley & Sons, Ltd.

Mapping of RNA accessible sites by extension of random oligonucleotide libraries with reverse transcriptase.

PubMed Central

Allawi, H T; Dong, F; Ip, H S; Neri, B P; Lyamichev, V I

2001-01-01

A rapid and simple method for determining accessible sites in RNA that is independent of the length of target RNA and does not require RNA labeling is described. In this method, target RNA is allowed to hybridize with sequence-randomized libraries of DNA oligonucleotides linked to a common tag sequence at their 5'-end. Annealed oligonucleotides are extended with reverse transcriptase and the extended products are then amplified by using PCR with a primer corresponding to the tag sequence and a second primer specific to the target RNA sequence. We used the combination of both the lengths of the RT-PCR products and the location of the binding site of the RNA-specific primer to determine which regions of the RNA molecules were RNA extendible sites, that is, sites available for oligonucleotide binding and extension. We then employed this reverse transcription with the random oligonucleotide libraries (RT-ROL) method to determine the accessible sites on four mRNA targets, human activated ras (ha-ras), human intercellular adhesion molecule-1 (ICAM-1), rabbit beta-globin, and human interferon-gamma (IFN-gamma). Our results were concordant with those of other researchers who had used RNase H cleavage or hybridization with arrays of oligonucleotides to identify accessible sites on some of these targets. Further, we found good correlation between sites when we compared the location of extendible sites identified by RT-ROL with hybridization sites of effective antisense oligonucleotides on ICAM-1 mRNA in antisense inhibition studies. Finally, we discuss the relationship between RNA extendible sites and RNA accessibility. PMID:11233988

A sense oligonucleotide to inducible nitric oxide synthase mRNA increases the survival rate of rats in septic shock.

PubMed

Okuyama, Tetsuya; Nakatake, Richi; Kaibori, Masaki; Okumura, Tadayoshi; Kon, Masanori; Nishizawa, Mikio

2018-01-30

Natural antisense transcripts (asRNAs) that do not encode proteins are transcribed from rat, mouse, and human genes, encoding inducible nitric oxide synthase (iNOS), which catalyzes the production of the inflammatory mediator nitric oxide (NO). In septic shock, NO is excessively produced in hepatocytes and macrophages. The iNOS asRNA interacts with and stabilizes iNOS mRNA. We found that single-stranded 'sense' oligonucleotides corresponding to the iNOS mRNA sequence reduced iNOS mRNA levels by interfering with the mRNA-asRNA interactions in rat hepatocytes. The iNOS sense oligonucleotides that were substituted with phosphorothioate bonds and locked nucleic acids efficiently decreased the levels of iNOS mRNA and iNOS protein. In this study, the gene expression patterns in the livers of two endotoxemia model rats with acute liver failure were compared. Next, we optimized the sequence and modification of the iNOS sense oligonucleotides in interleukin 1β-treated rat hepatocytes. When a sense oligonucleotide was simultaneously administered with d-galactosamine and bacterial lipopolysaccharide (LPS) to rats, their survival rate significantly increased compared to the rats administered d-galactosamine and LPS alone. In the livers of the sense oligonucleotide-administered rats, apoptosis in the hepatocytes markedly decreased. These results suggest that natural antisense transcript-targeted regulation technology using iNOS sense oligonucleotides may be used to treat human inflammatory diseases, such as sepsis and septic shock. Copyright © 2017 Elsevier Inc. All rights reserved.

DETECTING LOW-LEVEL SYNTHESIS IMPURITIES IN MODIFIED PHOSPHOROTHIOATE OLIGONUCLEOTIDES USING LIQUID CHROMATOGRAPHY – HIGH RESOLUTION MASS SPECTROMETRY

PubMed Central

Nikcevic, Irena; Wyrzykiewicz, Tadeusz K.; Limbach, Patrick A.

2010-01-01

Summary An LC-MS method based on the use of high resolution Fourier transform ion cyclotron resonance mass spectrometry (FTIRCMS) for profiling oligonucleotides synthesis impurities is described. Oligonucleotide phosphorothioatediesters (phosphorothioate oligonucleotides), in which one of the non-bridging oxygen atoms at each phosphorus center is replaced by a sulfur atom, are now one of the most popular oligonucleotide modifications due to their ease of chemical synthesis and advantageous pharmacokinetic properties. Despite significant progress in the solid-phase oligomerization chemistry used in the manufacturing of these oligonucleotides, multiple classes of low-level impurities always accompany synthetic oligonucleotides. Liquid chromatography-mass spectrometry has emerged as a powerful technique for the identification of these synthesis impurities. However, impurity profiling, where the entire complement of low-level synthetic impurities is identified in a single analysis, is more challenging. Here we present an LC-MS method based the use of high resolution-mass spectrometry, specifically Fourier transform ion cyclotron resonance mass spectrometry (FTIRCMS or FTMS). The optimal LC-FTMS conditions, including the stationary phase and mobile phases for the separation and identification of phosphorothioate oligonucleotides, were found. The characteristics of FTMS enable charge state determination from single m/z values of low-level impurities. Charge state information then enables more accurate modeling of the detected isotopic distribution for identification of the chemical composition of the detected impurity. Using this approach, a number of phosphorothioate impurities can be detected by LC-FTMS including failure sequences carrying 3′-terminal phosphate monoester and 3′-terminal phosphorothioate monoester, incomplete backbone sulfurization and desulfurization products, high molecular weight impurities, and chloral, isobutyryl, and N3 (2-cyanoethyl) adducts of the full length product. When compared with low resolution LC-MS, ~60% more impurities can be identified when charge state and isotopic distribution information is available and used for impurity profiling. PMID:21811394

Biominetic High Density Lipoproteins for the Delivery of Therapeutic Oligonucleotides

NASA Astrophysics Data System (ADS)

Tripathy, Sushant

Advances in nanotechnology have brought about novel inorganic and hybrid nanoparticles with unique physico-chemical properties that make them suitable for a broad range of applications---from nano-circuitry to drug delivery. A significant part of those advancements have led to ground-breaking discoveries that have changed the approaches to formulation of therapeutics against diseases, such as cancer. Now-a-days the focus does not lie solely on finding a candidate small-molecule therapeutic with minimal adverse effects, but researchers are looking up to nanoparticles to improve biodistribution and biocompatibility profile of clinically proven therapeutics. The plethora of conjugation chemistries offered by currently extant inorganic nanoparticles have, in recent years, led to great leaps in the field of biomimicry---a modality that promises high biocompatibility. Further, in the pursuit of highly specific therapeutic molecules, researchers have turned to silencing oligonucleotides and some have already brought together the strengths of nanoparticles and silencing oligonucleotides in search of an efficacious therapy for cancer with minimal adverse effects. This dissertation work focuses on such a biomimetic platform---a gold nanoparticle based high density lipoprotein biomimetic (HDL NP), for the delivery of therapeutic oligonucleotides. The first chapter of this body of work introduces the molecular target of the silencing oligonucleotides---VEGFR2, and its role in the progression of solid tumor cancers. The background information also covers important aspects of natural high density lipoproteins (HDL), especially their innate capacity to bind and deliver exogenous and endogenous silencing oligonucleotides to tissues that express their high affinity receptor SRB1. We subsequently describe the synthesis of the biomimetic HDL NP and its oligonucleotide conjugates, and establish their biocompatibility. Further on, experimental data demonstrate the efficacy of silencing oligonucleotides conjugated HDL NPs in regulating the expression and function of VEGFR2 in cultured endothelial cells. Finally, the efficacy of the conjugates in two animal models of angiogenesis is presented.

Demographic and health related data of users of a mobile application to support drug adherence is associated with usage duration and intensity.

PubMed

Becker, Stefan; Brandl, Christopher; Meister, Sven; Nagel, Eckhard; Miron-Shatz, Talya; Mitchell, Anna; Kribben, Andreas; Albrecht, Urs-Vito; Mertens, Alexander

2015-01-01

A wealth of mobile applications are designed to support users in their drug intake. When developing software for patients, it is important to understand the differences between individuals who have, who will or who might never adopt mobile interventions. This study analyzes demographic and health-related factors associated with real-life "longer usage" and the "usage-intensity per day" of the mobile application "Medication Plan". Between 2010-2012, the mobile application "Medication Plan" could be downloaded free of charge from the Apple-App-Store. It was aimed at supporting the regular and correct intake of medication. Demographic and health-related data were collected via an online questionnaire. This study analyzed captured data. App-related activities of 1799 users (1708 complete data sets) were recorded. 69% (1183/1708) applied "Medication Plan" for more than a day. 74% were male (872/1183), the median age 45 years. Variance analysis showed a significant effect of the users' age with respect to duration of usage (p = 0.025). While the mean duration of use was only 23.3 days for users younger than 21 years, for older users, there was a substantial increase over all age cohorts up to users of 60 years and above (103.9 days). Sex and educational status had no effect. "Daily usage intensity" was directly associated with an increasing number of prescribed medications and increased from an average of 1.87 uses per day and 1 drug per day to on average 3.71 uses per day for users stating to be taking more than 7 different drugs a day (p<0.001). Demographic predictors (sex, age and educational attainment) did not affect usage intensity. Users aged 60+ as well as those with complicated therapeutic drug regimens relied on the service we provided for more than three months on average. Mobile applications may be a promising approach to support the treatment of patients with chronic conditions.

An evaluation of an educational intervention in psychology of injury for athletic training students.

PubMed

Stiller-Ostrowski, Jennifer L; Gould, Daniel R; Covassin, Tracey

2009-01-01

"Psychosocial Intervention and Referral" is 1 of the 12 content areas in athletic training education programs, but knowledge gained and skill usage after an educational intervention in this area have never been evaluated. To evaluate the effectiveness of an educational intervention in increasing psychology-of-injury knowledge and skill usage in athletic training students (ATSs). Observational study. An accredited athletic training education program at a large Midwestern university. Participants included 26 ATSs divided into 2 groups: intervention group (4 men, 7 women; age = 21.4 +/- 0.67 years, grade point average = 3.37) and control group (7 men, 8 women; age = 21.5 +/- 3.8 years, grade point average = 3.27). All participants completed the Applied Sport Psychology for Athletic Trainers educational intervention. Psychology-of-injury knowledge tests and skill usage surveys were administered to all participants at the following intervals: baseline, intervention week 3, and intervention week 6. Retention tests were administered to intervention-group participants at 7 and 14 weeks after intervention. Analysis techniques included mixed-model analysis of variance (ANOVA) and repeated-measures ANOVA. The Applied Sport Psychology for Athletic Trainers educational intervention effectively increased psychology-of-injury knowledge (29-point increase from baseline to intervention week 6; F(2,23) = 29.358, P < .001, eta(p) (2) = 0.719) and skill usage (50-point increase from baseline to intervention week 6; F(2,23) = 5.999, P = .008, eta(p) (2) = 0.343) in undergraduate ATSs. These increases were maintained at the 7-week and 14-week retention testing (P < .001 for both). This first attempt at evaluating an educational intervention designed to improve ATSs' knowledge and skill usage revealed that the intervention was effective. Although both knowledge and skill usage scores decreased by the end of the retention period, the scores were still higher than baseline scores, indicating that the intervention was effective.

A CpG Oligonucleotide Can Protect Mice From a Low Aerosol Challenge Dose of Burkholderia mallei

DTIC Science & Technology

2006-03-01

may protect victims of a biological attack from glanders . Burkholderia mallei , the causative agent of glanders , natu- rally infects equines, but it can...attack from glanders . 15. SUBJECT TERMS Burkholderia mallei , glanders , oligonucleotides, CpG motif, efficacy, laboratory animals, mice 16...Society for Microbiology. All Rights Reserved. A CpG Oligonucleotide Can Protect Mice from a Low Aerosol Challenge Dose of Burkholderia mallei David M

Fluorescence energy transfer as a probe for nucleic acid structures and sequences.

PubMed Central

Mergny, J L; Boutorine, A S; Garestier, T; Belloc, F; Rougée, M; Bulychev, N V; Koshkin, A A; Bourson, J; Lebedev, A V; Valeur, B

1994-01-01

The primary or secondary structure of single-stranded nucleic acids has been investigated with fluorescent oligonucleotides, i.e., oligonucleotides covalently linked to a fluorescent dye. Five different chromophores were used: 2-methoxy-6-chloro-9-amino-acridine, coumarin 500, fluorescein, rhodamine and ethidium. The chemical synthesis of derivatized oligonucleotides is described. Hybridization of two fluorescent oligonucleotides to adjacent nucleic acid sequences led to fluorescence excitation energy transfer between the donor and the acceptor dyes. This phenomenon was used to probe primary and secondary structures of DNA fragments and the orientation of oligodeoxynucleotides synthesized with the alpha-anomers of nucleoside units. Fluorescence energy transfer can be used to reveal the formation of hairpin structures and the translocation of genes between two chromosomes. PMID:8152922

[Oligonucleotide derivatives in the nucleic acid hybridization analysis. III. Synthesis and investigation of properties of oligonucleotides, bearing bifunctional non-nucleotide insert].

PubMed

Kupriushkin, M S; Pyshnyĭ, D V

2012-01-01

Non-nucleotide phosporamidites were synthetized, having branched backbone with different position of functional groups. Obtained phosphoramidite monomers contain intercalator moiety--6-chloro-2-methoxyacridine, and additional hydroxyl residue protected with dimethoxytrityl group or with tert-butyldimethylsilyl group for post-synthetic modification. Synthesized oligothymidilates contain one or more modified units in different positions of sequence. Melting temperature and thermodynamic parameters of formation of complementary duplexes formed by modified oligonucleotides was defined (change in enthalpy and entropy). The introduction of intercalating residue causes a significant stabilization of DNA duplexes. It is shown that the efficiency of the fluorescence of acridine residue in the oligonucleotide conjugate significantly changes upon hybridization with DNA.

Preparation of a DNA matrix via an electrochemically directed copolymerization of pyrrole and oligonucleotides bearing a pyrrole group.

PubMed Central

Livache, T; Roget, A; Dejean, E; Barthet, C; Bidan, G; Téoule, R

1994-01-01

A new methodology for the preparation of addressed DNA matrices is described. The process includes an electrochemically directed copolymerization of pyrrole and oligonucleotides bearing on their 5' end a pyrrole moiety introduced by phosphoramidite chemistry. The electro-controlled synthesis of the copolymer (poly-pyrrole) gives, in one step, a solid conducting film deposited on the surface of an electrode. The resulting polymer consists of pyrrole chains bearing covalently linked oligonucleotide. The polymer growth is limited to the electrode surface, so that it is possible to prepare a DNA matrix on a multiple electrode device by successive copolymerizations. A support bearing four oligonucleotides was used to detect three ras mutations on a synthetic DNA fragment. PMID:8065902

Single-base-pair discrimination of terminal mismatches by using oligonucleotide microarrays and neural network analyses

NASA Technical Reports Server (NTRS)

Urakawa, Hidetoshi; Noble, Peter A.; El Fantroussi, Said; Kelly, John J.; Stahl, David A.

2002-01-01

The effects of single-base-pair near-terminal and terminal mismatches on the dissociation temperature (T(d)) and signal intensity of short DNA duplexes were determined by using oligonucleotide microarrays and neural network (NN) analyses. Two perfect-match probes and 29 probes having a single-base-pair mismatch at positions 1 to 5 from the 5' terminus of the probe were designed to target one of two short sequences representing 16S rRNA. Nonequilibrium dissociation rates (i.e., melting profiles) of all probe-target duplexes were determined simultaneously. Analysis of variance revealed that position of the mismatch, type of mismatch, and formamide concentration significantly affected the T(d) and signal intensity. Increasing the concentration of formamide in the washing buffer decreased the T(d) and signal intensity, and it decreased the variability of the signal. Although T(d)s of probe-target duplexes with mismatches in the first or second position were not significantly different from one another, duplexes with mismatches in the third to fifth positions had significantly lower T(d)s than those with mismatches in the first or second position. The trained NNs predicted the T(d) with high accuracies (R(2) = 0.93). However, the NNs predicted the signal intensity only moderately accurately (R(2) = 0.67), presumably due to increased noise in the signal intensity at low formamide concentrations. Sensitivity analysis revealed that the concentration of formamide explained most (75%) of the variability in T(d)s, followed by position of the mismatch (19%) and type of mismatch (6%). The results suggest that position of the mismatch at or near the 5' terminus plays a greater role in determining the T(d) and signal intensity of duplexes than the type of mismatch.

The butterfly effect of the "butterfly effect".

PubMed

Dooley, Kevin J

2009-07-01

The "Butterfly Effect" metaphor states with variance that the flap of a butterfly's wings in Brazil can cause a tornado in Texas. This metaphor has become part of the common vernacular of Western culture. In this paper I discuss the origins of the metaphor, examine its current usage within popular culture, and present an argument as to why it is popular. I propose that the metaphor is a type of semantic attractor, a narrative device with invariant meaning but audience-specific contextualization. Finally I address whether the Butterfly Effect metaphor is a good example of itself.

Monovalent Streptavidin that Senses Oligonucleotides**

PubMed Central

Wang, Jingxian; Kostic, Natasa; Stojanovic, Milan N.

2013-01-01

We report a straightforward chemical route to monovalent streptavidin, a valuable reagent for imaging. The one-step process is based on a (tris)biotinylated-oligonucleotide blocking three of streptavidin’s four biotin binding sites. Further, the complex is highly sensitive to single-base differences - whereby perfectly matched oligonucleotides trigger dissociation of the biotin-streptavidin interaction at higher rates than single-base mismatches. Unique properties and ease of synthesis open wide opportunities for practical applications in imaging and biosensing. PMID:23606329

Ferrocene conjugated oligonucleotide for electrochemical detection of DNA base mismatch.

PubMed

Hasegawa, Yusuke; Takada, Tadao; Nakamura, Mitsunobu; Yamana, Kazushige

2017-08-01

We describe the synthesis, binding, and electrochemical properties of ferrocene-conjugated oligonucleotides (Fc-oligos). The key step for the preparation of Fc-oligos contains the coupling of vinylferrocene to 5-iododeoxyuridine via Heck reaction. The Fc-conjugated deoxyuridine phosphoramidite was used in the Fc-oligonucleotide synthesis. We show that thiol-modified Fc-oligos deposited onto gold electrodes possess potential ability in electrochemical detection of DNA base mismatch. Copyright © 2017 Elsevier Ltd. All rights reserved.

Systemic peptide-mediated oligonucleotide therapy improves long-term survival in spinal muscular atrophy

PubMed Central

Hazell, Gareth; Shabanpoor, Fazel; Saleh, Amer F.; Bowerman, Melissa; Meijboom, Katharina E.; Zhou, Haiyan; Muntoni, Francesco; Talbot, Kevin; Gait, Michael J.; Wood, Matthew J. A.

2016-01-01

The development of antisense oligonucleotide therapy is an important advance in the identification of corrective therapy for neuromuscular diseases, such as spinal muscular atrophy (SMA). Because of difficulties of delivering single-stranded oligonucleotides to the CNS, current approaches have been restricted to using invasive intrathecal single-stranded oligonucleotide delivery. Here, we report an advanced peptide-oligonucleotide, Pip6a-morpholino phosphorodiamidate oligomer (PMO), which demonstrates potent efficacy in both the CNS and peripheral tissues in severe SMA mice following systemic administration. SMA results from reduced levels of the ubiquitously expressed survival motor neuron (SMN) protein because of loss-of-function mutations in the SMN1 gene. Therapeutic splice-switching oligonucleotides (SSOs) modulate exon 7 splicing of the nearly identical SMN2 gene to generate functional SMN protein. Pip6a-PMO yields SMN expression at high efficiency in peripheral and CNS tissues, resulting in profound phenotypic correction at doses an order-of-magnitude lower than required by standard naked SSOs. Survival is dramatically extended from 12 d to a mean of 456 d, with improvement in neuromuscular junction morphology, down-regulation of transcripts related to programmed cell death in the spinal cord, and normalization of circulating insulin-like growth factor 1. The potent systemic efficacy of Pip6a-PMO, targeting both peripheral as well as CNS tissues, demonstrates the high clinical potential of peptide-PMO therapy for SMA. PMID:27621445

Synthesis and fluorescence studies of multiple labeled oligonucleotides containing dansyl fluorophore covalently attached at 2'-terminus of cytidine via carbamate linkage.

PubMed

Misra, Arvind; Mishra, Satyendra; Misra, Krishna

2004-01-01

Synthesis of modified oligonucleotides in which the specific cytidine nucleoside analogues linked at 2'-OH position via a carbamate bond with an amino ethyl derivative of dansyl fluorophore is reported. For the multiple labeling of oligonucleotides, a strategy involving prelabeling at the monomeric level followed by solid phase assembly of oligonucleotides to obtain regiospecifically labeled probes has been described. The labeled monomer was phosphitylated using 2-cyanoethyl-N,N,N',N'-tetraisopropyl-phosphoramidite (Bis-reagent) and pyridiniumtrifluoro acetate (Py.TFA) as an activator. To ascertain the minimal number of labeled monomers required for a specific length of oligonucleotide for detection and also to assess the effect of carbamate linkage on hybridization, hexamer and 20-mer sequences were selected. Both were labeled with 1, 2, and 3 monomers at the 5'-end and hybridized with normal (unmodified) complementary sequences. As compared to midsequence or 3'-terminal labeling reported earlier, the 5'-terminal labeling has been found to have minimal contact-mediated quenching on duplex formation. This may be due to complementary deoxyguanosine (dG) rich oligonucleotide sequences or CG base pairs at a terminus that is known to yield stronger binding. This is one reason for selecting cytidine for labeling. The results may aid rational design of multiple fluorescent DNA probes for nonradioactive detection of nucleic acids.

A High-throughput Assay for mRNA Silencing in Primary Cortical Neurons in vitro with Oligonucleotide Therapeutics.

PubMed

Alterman, Julia F; Coles, Andrew H; Hall, Lauren M; Aronin, Neil; Khvorova, Anastasia; Didiot, Marie-Cécile

2017-08-20

Primary neurons represent an ideal cellular system for the identification of therapeutic oligonucleotides for the treatment of neurodegenerative diseases. However, due to the sensitive nature of primary cells, the transfection of small interfering RNAs (siRNA) using classical methods is laborious and often shows low efficiency. Recent progress in oligonucleotide chemistry has enabled the development of stabilized and hydrophobically modified small interfering RNAs (hsiRNAs). This new class of oligonucleotide therapeutics shows extremely efficient self-delivery properties and supports potent and durable effects in vitro and in vivo . We have developed a high-throughput in vitro assay to identify and test hsiRNAs in primary neuronal cultures. To simply, rapidly, and accurately quantify the mRNA silencing of hundreds of hsiRNAs, we use the QuantiGene 2.0 quantitative gene expression assay. This high-throughput, 96-well plate-based assay can quantify mRNA levels directly from sample lysate. Here, we describe a method to prepare short-term cultures of mouse primary cortical neurons in a 96-well plate format for high-throughput testing of oligonucleotide therapeutics. This method supports the testing of hsiRNA libraries and the identification of potential therapeutics within just two weeks. We detail methodologies of our high throughput assay workflow from primary neuron preparation to data analysis. This method can help identify oligonucleotide therapeutics for treatment of various neurological diseases.

Review on investigations of antisense oligonucleotides with the use of mass spectrometry.

PubMed

Studzińska, Sylwia

2018-01-01

Antisense oligonucleotides have been investigated as potential drugs for years. They inhibit target gene or protein expression. The present review summarizes their modifications, modes of action, and applications of liquid chromatography coupled with mass spectrometry for qualitative and quantitative analysis of these compounds. The most recent reports on a given topic were given prominence, while some early studies were reviewed in order to provide a theoretical background. The present review covers the issues of using ion-exchange chromatography, ion-pair reversed-phase high performance liquid chromatography and hydrophilic interaction chromatography for the separation of antisense oligonucleotides. The application of mass spectrometry was described with regard to the ionization type used for the determination of these potential therapeutics. Moreover, the current approaches and applications of mass spectrometry for quantitative analysis of antisense oligonucleotides and their metabolites as well as their impurities during in vitro and in vivo studies were discussed. Finally, certain conclusions and perspectives on the determination of therapeutic oligonucleotides in various samples were briefly described. Copyright © 2017 Elsevier B.V. All rights reserved.

Evolution of thermophilic DNA polymerases for the recognition and amplification of C2ʹ-modified DNA

NASA Astrophysics Data System (ADS)

Chen, Tingjian; Hongdilokkul, Narupat; Liu, Zhixia; Adhikary, Ramkrishna; Tsuen, Shujian S.; Romesberg, Floyd E.

2016-06-01

The PCR amplification of oligonucleotides enables the evolution of sequences called aptamers that bind specific targets with antibody-like affinity. However, in many applications the use of these aptamers is limited by nuclease-mediated degradation. In contrast, oligonucleotides that are modified at their sugar C2ʹ positions with methoxy or fluorine substituents are stable to nucleases, but they cannot be synthesized by natural polymerases. Here we report the development of a polymerase-evolution system and its use to evolve thermostable polymerases that efficiently interconvert C2ʹ-OMe-modified oligonucleotides and their DNA counterparts via ‘transcription’ and ‘reverse transcription’ or, more importantly, that PCR-amplify partially C2ʹ-OMe- or C2ʹ-F-modified oligonucleotides. A mechanistic analysis demonstrates that the ability to amplify the modified oligonucleotides evolved by optimizing interdomain interactions that stabilize the catalytically competent closed conformation of the polymerase. The evolved polymerases should find practical applications and the developed evolution system should be a powerful tool for tailoring polymerases to have other types of novel function.

An oligonucleotide array for the identification and differentiation of bacteria pathogenic on potato.

PubMed

Fessehaie, Anania; De Boer, Solke H; Lévesque, C André

2003-03-01

ABSTRACT Oligonucleotides, 16 to 24 bases long, were selected from the 3' end of the 16S gene and the 16S-23S intergenic spacer regions of bacteria pathogenic on potato, including Clavibacter michiganensis subsp. sepedonicus, Ralstonia solanacearum, and the pectolytic erwinias, including Erwinia carotovora subsp. atroseptica and carotovora and E. chrysanthemi. Oligonucleotides were designed and formatted into an array by pin spotting on nylon membranes. Genomic DNA from bacterial cultures was amplified by polymerase chain reaction using conserved ribosomal primers and labeled simultaneously with digoxigenin-dUTP. Hybridization of amplicons to the array and subsequent serological detection of digoxigenin label revealed different hybridization patterns that were distinct for each species and subspecies tested. Hybridization of amplicons generally was restricted to appropriate homologous oligonucleotides and cross-hybridization with heterologous oligonucleotides was rare. Hybridization patterns were recorded as separate gray values for each hybridized spot and revealed a consistent pattern for multiple strains of each species or subspecies isolated from diverse geographical regions. In preliminary tests, bacteria could be correctly identified and detected by hybridizing to the array amplicons from mixed cultures and inoculated potato tissue.

A reliable confirmation of the chemical structure of synthetic oligonucleotides: Detection of active protons in DNA oligomers by low-temperature FT infrared spectroscopy

NASA Astrophysics Data System (ADS)

Rozenberg, M.; Shoham, G.

2009-01-01

Cooling the samples allowed us to characterize solid oligonucleotides such as dimers, trimers and pentamers of cytidine, for the first time, in the IR range of the out-of-plane bending molecular modes (1000-400 cm -1) at 20 K. Especially interesting are the narrow IR bands of the out-of-plane bending ν4 NH 2 proton mode, which are apparently invisible at room temperature. This unequivocally defined and well-resolved NH 2 bending band should provide important information on the exact chemical form and hydrogen bonding interactions of cytidine amine groups. As such, this unique IR spectroscopy is suggested as a practical analytical tool to validate and characterize synthetic DNA bases and oligonucleotides. Using an approach of this type it was found that desalted oligonucleotide samples of the same nominal composition, but which had been produced by three different manufacturers, differ significantly in their IR spectra. These data suggest that the presumably identical oligonucleotides are in fact different, at least with respect to the content and nature of their NH protons.

A reliable confirmation of the chemical structure of synthetic oligonucleotides: detection of active protons in DNA oligomers by low-temperature FT infrared spectroscopy.

PubMed

Rozenberg, M; Shoham, G

2009-01-01

Cooling the samples allowed us to characterize solid oligonucleotides such as dimers, trimers and pentamers of cytidine, for the first time, in the IR range of the out-of-plane bending molecular modes (1000-400 cm(-1)) at 20K. Especially interesting are the narrow IR bands of the out-of-plane bending nu(4) NH(2) proton mode, which are apparently invisible at room temperature. This unequivocally defined and well-resolved NH(2) bending band should provide important information on the exact chemical form and hydrogen bonding interactions of cytidine amine groups. As such, this unique IR spectroscopy is suggested as a practical analytical tool to validate and characterize synthetic DNA bases and oligonucleotides. Using an approach of this type it was found that desalted oligonucleotide samples of the same nominal composition, but which had been produced by three different manufacturers, differ significantly in their IR spectra. These data suggest that the presumably identical oligonucleotides are in fact different, at least with respect to the content and nature of their NH protons.

Chimeric RNase H–Competent Oligonucleotides Directed to the HIV-1 Rev Response Element

PubMed Central

Prater, Chrissy E.; Saleh, Anthony D.; Wear, Maggie P.; Miller, Paul S.

2007-01-01

Chimeric oligo-2′-O-methylribonucleotides containing centrally located patches of contiguous 2′-deoxyribonucleotides and terminating in a nuclease resistant 3′-methylphosphonate internucleotide linkage were prepared. The oligonucleotides were targeted to the 3′-side of HIV Rev response element (RRE) stem-loop IIB RNA, which is adjacent to the high affinity Rev protein binding site and is critical to virus function. Thermal denaturation experiments showed that chimeric oligonucleotides form very stable duplexes with a complementary single-stranded RNA, and gel electrophoretic mobility shift assays (EMSA) showed that they bind with high affinity and specificity to RRE stem-loop II RNA (KD approximately 200 nM). The chimeric oligonucleotides promote RNase H-mediated hydrolysis of RRE stem-loop II RNA and have half lives exceeding 24 h when incubated in cell culture medium containing 10% fetal calf serum. One of the chimeric oligonucleotides inhibited RRE mediated expression of chloramphenicol acetyl transferase (CAT) approximately 60% at a concentration of 300 nM in HEK 293T cells co-transfected with p-RRE/CAT and p-Rev mammalian expression vectors. PMID:17566743

Oligonucleotide-Gold Nanoparticle Networks for Detection of Cryptosporidium parvum Heat Shock Protein 70 mRNA ▿

PubMed Central

Javier, David J.; Castellanos-Gonzalez, Alejandro; Weigum, Shannon E.; White, A. Clinton; Richards-Kortum, Rebecca

2009-01-01

We report on a novel strategy for the detection of mRNA targets derived from Cryptosporidium parvum oocysts by the use of oligonucleotide-gold nanoparticles. Gold nanoparticles are functionalized with oligonucleotides which are complementary to unique sequences present on the heat shock protein 70 (HSP70) DNA/RNA target. The results indicate that the presence of HPS70 targets of increasing complexity causes the formation of oligonucleotide-gold nanoparticle networks which can be visually monitored via a simple colorimetric readout measured by a total internal reflection imaging setup. Furthermore, the induced expression of HSP70 mRNA in Cryptosporidium parvum oocysts via a simple heat shock process provides nonenzymatic amplification such that the HSP70 mRNA derived from as few as 5 × 103 purified C. parvum oocysts was successfully detected. Taken together, these results support the use of oligonucleotide-gold nanoparticles for the molecular diagnosis of cryptosporidiosis, offering new opportunities for the further development of point-of-care diagnostic assays with low-cost, robust reagents and simple colorimetric detection. PMID:19828740

[Evaluation of transfection effectiveness using fluorescein-labelled oligonucleotides and entraster-R siRNA transfection into Plasmodium falciparum].

PubMed

Zhou, Hong-Chang; Gao, Yu-Hui; Shao, Sheng-Wen; Zhang, Hui; Zhang, Ting

2013-12-01

The cultured Plasmodium falciparum parasites were synchronized twice by 5% sorbitol treatment twice (8-hour window), and then incubated at 37 degrees C for 16 h. Parasites were transfected with fluorescein-labelled oligonucleotides (group A) or fluorescein-labelled oligonucleotides+Entranster-R siRNA transfection reagent (group B). After 5 h a part of parasites was evaluated by fluorescence microscopy and flow cytometry. The rest of parasites were washed with RPMI 1640 medium, and then incubated with 500 microl new medium containing 2% fresh erythrocytes for another 12 h, and detected by flow cytometry. The fluorescein-labelled oligonucleotides were localized in erythrocytes in group B, but nearly no fluorescence was observed for group A. Flow cytometry analysis indicated that the transfection efficiency of group B [(47.40 +/- 3.39)%] was higher than that of group A [(0.60 +/- 0.27)%]. In the second cell cycle, the transfection efficiency in group B was (26.85 +/- 2.90)%, while that of group A was nearly zero. The results indicated that Entranster-R siRNA transfection reagent may increase the oligonucleotides transfection efficiency.

Safety of antisense oligonucleotide and siRNA-based therapeutics.

PubMed

Chi, Xuan; Gatti, Philip; Papoian, Thomas

2017-05-01

Oligonucleotide-based therapy is an active area of drug development designed to treat a variety of gene-specific diseases. Two of the more promising platforms are the antisense oligonucleotides (ASOs) and short interfering RNAs (siRNAs), both of which are often directed against similar targets. In light of recent reports on clinical trials of severe thrombocytopenia with two different ASO drugs and increased peripheral neuropathy with an siRNA drug, we compared and contrasted the specific safety characteristics of these two classes of oligonucleotide therapeutic. The objectives were to assess factors that could contribute to the specific toxicities observed with these two classes of promising drugs, and get a better understanding of the potential mechanism(s) responsible for these rare, but serious, adverse events. Published by Elsevier Ltd.

Incorporation of terminal phosphorothioates into oligonucleotides.

PubMed Central

Alefelder, S; Patel, B K; Eckstein, F

1998-01-01

Considerable effort has been directed towards studying the structure and function of oligonucleotides and several approaches rely on the attachment of reporter groups to oligonucleotides. We report here the introduction of 3'- and 5'-terminal phosphorothioates into heptameric oligonucleotides and their post-synthetic modification with several reporter groups. The synthesis of terminal phosphorothioates is based on the coupling of a ribonucleoside phosphoramidite at the first or last nucleotide, respectively, which, after sulphurization, is removed by sequential oxidation of the vicinal hydroxyl groups and then beta-elimination. Product formation is of the order of 95%. The ratio of phosphorothioate- versus phosphate-terminated oligodeoxynucleotides as analysed by electrophoresis on a Hg2+gel is in general 85/15. Examples for the reactivity of the terminal phosphorothioates for conjugation with cholesterol, bimane and for sulphydryl exchange are described. PMID:9776763

Targeted self-assembly of functionalized carbon nanotubes on tumors

DOEpatents

Scheinberg, David A.; McDevitt, Michael R.; Villa, Carlos H.; Mulvey, J. Justin

2018-05-22

Provided herein are methods for delivering a molecule in situ to a cell and for treating a cancer via the in situ delivery. The methods comprise contacting or administering to the cell, as two separate components, a morpholino oligonucleotide comprising a targeting moiety followed by a single wall nanotube construct comprising second morpholino oligonucleotides complementary to the first morpholino oligonucleotides and one or both of a therapeutic or diagnostic payload molecule linked to the single wall nanotube construct. Upon self-assembly of a single wall nanotube complex via hybridization of the first morpholino and second complementary morpholino oligonucleotides at the cell, the payload molecule is delivered. Also provided is the two component self-assembly single wall nanotube system and the single wall nanotube construct comprising the second component.

A facile one-step fluorescence method for the quantitation of low-content single base deamination impurity in synthetic oligonucleotides.

PubMed

Su, Xiaoye; Liang, Ruiting; Stolee, Jessica A

2018-06-05

Oligonucleotides are being researched and developed as potential drug candidates for the treatment of a broad spectrum of diseases. The characterization of antisense oligonucleotide (ASO) impurities caused by base mutations (e.g. deamination) which are closely related to the target ASO is a significant analytical challenge. Herein, we describe a novel one-step method, utilizing a strategy that combines fluorescence-ON detection with competitive hybridization, to achieve single base mutation quantitation in extensively modified synthetic ASOs. Given that this method is highly specific and sensitive (LoQ = 4 nM), we envision that it will find utility for screening other impurities as well as sequencing modified oligonucleotides. Copyright © 2018 Elsevier B.V. All rights reserved.

Rapid and accurate synthesis of TALE genes from synthetic oligonucleotides.

PubMed

Wang, Fenghua; Zhang, Hefei; Gao, Jingxia; Chen, Fengjiao; Chen, Sijie; Zhang, Cuizhen; Peng, Gang

2016-01-01

Custom synthesis of transcription activator-like effector (TALE) genes has relied upon plasmid libraries of pre-fabricated TALE-repeat monomers or oligomers. Here we describe a novel synthesis method that directly incorporates annealed synthetic oligonucleotides into the TALE-repeat units. Our approach utilizes iterative sets of oligonucleotides and a translational frame check strategy to ensure the high efficiency and accuracy of TALE-gene synthesis. TALE arrays of more than 20 repeats can be constructed, and the majority of the synthesized constructs have perfect sequences. In addition, this novel oligonucleotide-based method can readily accommodate design changes to the TALE repeats. We demonstrated an increased gene targeting efficiency against a genomic site containing a potentially methylated cytosine by incorporating non-conventional repeat variable di-residue (RVD) sequences.

Influences of population density on polyandry and patterns of sperm usage in the marine gastropod Rapana venosa.

PubMed

Xue, Dong-Xiu; Zhang, Tao; Liu, Jin-Xian

2016-03-21

Polyandry is a common mating strategy in animals, with potential for sexual selection to continue post-copulation through sperm competition and/or cryptic female choice. Few studies have investigated the influences of population density on polyandry and sperm usage, and paternity distribution in successive broods of marine invertebrates. The marine gastropod Rapana venosa is ideal for investigating how population density influences the frequency of polyandry and elucidating patterns of sperm usage. Two different population density (12 ind/m(3) and 36 ind/m(3)) treatments with two replications were set to observe reproductive behaviors. Five microsatellite markers were used to identify the frequency of multiple paternity and determine paternal contributions to progeny arrays in 120 egg masses. All of the mean mating frequency, mean number of sires and mean egg-laying frequency were higher at high population density treatment relative to low population density treatment, indicating population density is an important factor affecting polyandry. The last sperm donors achieved high proportions of paternity in 74.77% of egg masses, which supported the "last male sperm precedence" hypothesis. In addition, high variance in reproductive success among R. venosa males were detected, which might have an important influence on effective population size.

Effect of mobile phone use on metal ion release from fixed orthodontic appliances.

PubMed

Saghiri, Mohammad Ali; Orangi, Jafar; Asatourian, Armen; Mehriar, Peiman; Sheibani, Nader

2015-06-01

The aim of this study was to evaluate the effect of exposure to radiofrequency electromagnetic fields emitted by mobile phones on the level of nickel in saliva. Fifty healthy patients with fixed orthodontic appliances were asked not to use their cell phones for a week, and their saliva samples were taken at the end of the week (control group). The patients recorded their time of mobile phone usage during the next week and returned for a second saliva collection (experimental group). Samples at both times were taken between 8:00 and 10:00 pm, and the nickel levels were measured. Two-tailed paired-samples t test, linear regression, independent t test, and 1-way analysis of variance were used for data analysis. The 2-tailed paired-samples t test showed significant differences between the levels of nickel in the control and experimental groups (t [49] = 9.967; P <0.001). The linear regression test showed a significant relationship between mobile phone usage time and the nickel release (F [1, 48] = 60.263; P <0.001; R(2) = 0.577). Mobile phone usage has a time-dependent influence on the concentration of nickel in the saliva of patients with orthodontic appliances. Copyright © 2015 American Association of Orthodontists. Published by Elsevier Inc. All rights reserved.

Influences of population density on polyandry and patterns of sperm usage in the marine gastropod Rapana venosa

PubMed Central

Xue, Dong-Xiu; Zhang, Tao; Liu, Jin-Xian

2016-01-01

Polyandry is a common mating strategy in animals, with potential for sexual selection to continue post-copulation through sperm competition and/or cryptic female choice. Few studies have investigated the influences of population density on polyandry and sperm usage, and paternity distribution in successive broods of marine invertebrates. The marine gastropod Rapana venosa is ideal for investigating how population density influences the frequency of polyandry and elucidating patterns of sperm usage. Two different population density (12 ind/m3 and 36 ind/m3) treatments with two replications were set to observe reproductive behaviors. Five microsatellite markers were used to identify the frequency of multiple paternity and determine paternal contributions to progeny arrays in 120 egg masses. All of the mean mating frequency, mean number of sires and mean egg-laying frequency were higher at high population density treatment relative to low population density treatment, indicating population density is an important factor affecting polyandry. The last sperm donors achieved high proportions of paternity in 74.77% of egg masses, which supported the “last male sperm precedence” hypothesis. In addition, high variance in reproductive success among R. venosa males were detected, which might have an important influence on effective population size. PMID:26996441

Cross reactive arrays of three-way junction sensors for steroid determination

NASA Technical Reports Server (NTRS)

Stojanovic, Milan N. (Inventor); Nikic, Dragan B. (Inventor); Landry, Donald (Inventor)

2008-01-01

This invention provides analyte sensitive oligonucleotide compositions for detecting and analyzing analytes in solution, including complex solutions using cross reactive arrays of analyte sensitive oligonucleotide compositions.

Ultrasensitive Hybridization-Based ELISA Method for the Determination of Phosphorodiamidate Morpholino Oligonucleotides in Biological samples.

PubMed

Burki, Umar; Straub, Volker

2017-01-01

Determining the concentration of oligonucleotide in biological samples such as tissue lysate and serum is essential for determining the biodistribution and pharmacokinetic profile, respectively. ELISA-based assays have shown far greater sensitivities compared to other methods such as HPLC and LC/MS. Here, we describe a novel ultrasensitive hybridization-based ELISA method for quantitating morpholino oligonucleotides in mouse tissue lysate and serum samples. The assay has a linear detection range of 5-250 pM (R2 > 0.99).

Horseradish peroxidase-labeled oligonucleotides and fluorescent tyramides for rapid detection of chromosome-specific repeat sequences.

PubMed

van Gijlswijk, R P; Wiegant, J; Vervenne, R; Lasan, R; Tanke, H J; Raap, A K

1996-01-01

We present a sensitive and rapid fluorescence in situ hybridization (FISH) strategy for detecting chromosome-specific repeat sequences. It uses horseradish peroxidase (HRP)-labeled oligonucleotide sequences in combination with fluorescent tyramide-based detection. After in situ hybridization, the HRP conjugated to the oligonucleotide probe is used to deposit fluorescently labeled tyramide molecules at the site of hybridization. The method features full chemical synthesis of probes, strong FISH signals, and short processing periods, as well as multicolor capabilities.

VRP09 Reduction of Corneal Scarring Following Blast and Burn Injuries to Cornea Using siRNAs Targeting TGFb and CTGF

DTIC Science & Technology

2013-03-01

oligonucleotide-based drug approaches (better than ribozymes, antisense oligonucleotides ( ASO ), or microRNAs). (4) To accomplish these objectives, we...negative control scrambled ASO (designated NC). The combination of siRNAs T1 and R1 produced a knockdown of ~80% of TGFb1 protein in the conditioned...sequences (antisense oligonucleotides, ASOs ) into rabbit corneal cells and found that technique was very effective in delivering ASOs into the stroma and

VRP09 Reduction of Corneal Scarring Following Blast and Burn Injuries to Cornea Using siRNAs Targeting TGFb and CTGF

DTIC Science & Technology

2012-10-01

selective of all gene-targeted, oligonucleotide-based drug approaches (better than ribozymes, antisense oligonucleotides ( ASO ), or microRNAs).(4) We will...respect to a scrambled siRNA control. For the migration assay, a circular region in the middle of the well was removed using a gel removal solution...oligonucleotides, ASOs ) into rabbit corneal cells and found that technique was very effective in delivering ASOs into the stroma and even into the endothelial cell

Why Do Drivers Use Mobile Phones While Driving? The Contribution of Compensatory Beliefs.

PubMed

Zhou, Ronggang; Yu, Mengli; Wang, Xinyi

2016-01-01

The current study is the first to investigate the contribution of compensatory beliefs (i.e., the belief that the negative effects of an unsafe behavior can be "neutralized" by engaging in another safe behavior; e.g., "I can use a mobile phone now because I will slow down ") on drivers' mobile phone use while driving. The effects of drivers' personal characteristics on compensatory beliefs, mobile phone use and self-regulatory behaviors were also examined. A series of questions were administered to drivers, which included (1) personal measures, (2) scales that measured compensatory beliefs generally in substance use and with regard to driving safety, and (3) questions to measure drivers' previous primary mobile phone usage and corresponding self-regulatory actions. Overall, drivers reported a low likelihood of compensatory beliefs, prior mobile phone use, and a strong frequency of self-regulatory behaviors. Respondents who had a higher tendency toward compensatory beliefs reported more incidents or crash involvement caused by making or answering calls and sending or reading messages. The findings provide strong support for the contribution of compensatory beliefs in predicting mobile phone usage in the context of driving. Compensatory beliefs can explain 41% and 43% of the variance in the active activities of making calls and texting/sending messages compared with 18% and 31% of the variance in the passive activities of answering calls and reading messages. Among the regression models for predicting self-regulatory behaviors at the tactical or operational level, compensatory beliefs emerge as significant predictors only in predicting shorter conversations while on a call. The findings and limitations of the current study are discussed.

Therapeutic Oligonucleotides Targeting Liver Disease: TTR Amyloidosis.

PubMed

Niemietz, Christoph; Chandhok, Gursimran; Schmidt, Hartmut

2015-09-30

The liver has become an increasingly interesting target for oligonucleotide therapy. Mutations of the gene encoding transthyretin (TTR), expressed in vast amounts by the liver, result in a complex degenerative disease, termed familial amyloid polyneuropathy (FAP). Misfolded variants of TTR are linked to the establishment of extracellular protein deposition in various tissues, including the heart and the peripheral nervous system. Recent progress in the chemistry and formulation of antisense (ASO) and small interfering RNA (siRNA) designed for a knockdown of TTR mRNA in the liver has allowed to address the issue of gene-specific molecular therapy in a clinical setting of FAP. The two therapeutic oligonucleotides bind to RNA in a sequence specific manner but exploit different mechanisms. Here we describe major developments that have led to the advent of therapeutic oligonucleotides for treatment of TTR-related disease.

Current progress on aptamer-targeted oligonucleotide therapeutics

PubMed Central

Dassie, Justin P; Giangrande, Paloma H

2014-01-01

Exploiting the power of the RNAi pathway through the use of therapeutic siRNA drugs has remarkable potential for treating a vast array of human disease conditions. However, difficulties in delivery of these and similar nucleic acid-based pharmacological agents to appropriate organs or tissues, remains a major impediment to their broad clinical application. Synthetic nucleic acid ligands (aptamers) have emerged as effective delivery vehicles for therapeutic oligonucleotides, including siRNAs. In this review, we summarize recent attractive developments in creatively employing cell-internalizing aptamers to deliver therapeutic oligonucleotides (e.g., siRNAs, miRNAs, anti-miRs and antisense oligos) to target cells. We also discuss advancements in aptamer-siRNA chimera technology, as well as, aptamer-functionalized nanoparticles for siRNA delivery. In addition, the challenges and future prospects of aptamer-targeted oligonucleotide drugs for clinical translation are further highlighted. PMID:24304250

Combined in vitro transcription and reverse transcription to amplify and label complex synthetic oligonucleotide probe libraries.

PubMed

Murgha, Yusuf; Beliveau, Brian; Semrau, Kassandra; Schwartz, Donald; Wu, Chao-Ting; Gulari, Erdogan; Rouillard, Jean-Marie

2015-06-01

Oligonucleotide microarrays allow the production of complex custom oligonucleotide libraries for nucleic acid detection-based applications such as fluorescence in situ hybridization (FISH). We have developed a PCR-free method to make single-stranded DNA (ssDNA) fluorescent probes through an intermediate RNA library. A double-stranded oligonucleotide library is amplified by transcription to create an RNA library. Next, dye- or hapten-conjugate primers are used to reverse transcribe the RNA to produce a dye-labeled cDNA library. Finally the RNA is hydrolyzed under alkaline conditions to obtain the single-stranded fluorescent probes library. Starting from unique oligonucleotide library constructs, we present two methods to produce single-stranded probe libraries. The two methods differ in the type of reverse transcription (RT) primer, the incorporation of fluorescent dye, and the purification of fluorescent probes. The first method employs dye-labeled reverse transcription primers to produce multiple differentially single-labeled probe subsets from one microarray library. The fluorescent probes are purified from excess primers by oligonucleotide-bead capture. The second method uses an RNA:DNA chimeric primer and amino-modified nucleotides to produce amino-allyl probes. The excess primers and RNA are hydrolyzed under alkaline conditions, followed by probe purification and labeling with amino-reactive dyes. The fluorescent probes created by the combination of transcription and reverse transcription can be used for FISH and to detect any RNA and DNA targets via hybridization.

PNA-COMBO-FISH: From combinatorial probe design in silico to vitality compatible, specific labelling of gene targets in cell nuclei

DOE Office of Scientific and Technical Information (OSTI.GOV)

Müller, Patrick; Rößler, Jens; Schwarz-Finsterle, Jutta

Recently, advantages concerning targeting specificity of PCR constructed oligonucleotide FISH probes in contrast to established FISH probes, e.g. BAC clones, have been demonstrated. These techniques, however, are still using labelling protocols with DNA denaturing steps applying harsh heat treatment with or without further denaturing chemical agents. COMBO-FISH (COMBinatorial Oligonucleotide FISH) allows the design of specific oligonucleotide probe combinations in silico. Thus, being independent from primer libraries or PCR laboratory conditions, the probe sequences extracted by computer sequence data base search can also be synthesized as single stranded PNA-probes (Peptide Nucleic Acid probes). Gene targets can be specifically labelled with atmore » least about 20 PNA-probes obtaining visibly background free specimens. By using appropriately designed triplex forming oligonucleotides, the denaturing procedures can completely be omitted. These results reveal a significant step towards oligonucleotide-FISH maintaining the 3D-nanostructure and even the viability of the cell target. The method is demonstrated with the detection of Her2/neu and GRB7 genes, which are indicators in breast cancer diagnosis and therapy. - Highlights: • Denaturation free protocols preserve 3D architecture of chromosomes and nuclei. • Labelling sets are determined in silico for duplex and triplex binding. • Probes are produced chemically with freely chosen backbones and base variants. • Peptide nucleic acid backbones reduce hindering charge interactions. • Intercalating side chains stabilize binding of short oligonucleotides.« less

Comparison of small molecules and oligonucleotides that target a toxic, non-coding RNA.

PubMed

Costales, Matthew G; Rzuczek, Suzanne G; Disney, Matthew D

2016-06-01

Potential RNA targets for chemical probes and therapeutic modalities are pervasive in the transcriptome. Oligonucleotide-based therapeutics are commonly used to target RNA sequence. Small molecules are emerging as a modality to target RNA structures selectively, but their development is still in its infancy. In this work, we compare the activity of oligonucleotides and several classes of small molecules that target the non-coding r(CCUG) repeat expansion (r(CCUG)(exp)) that causes myotonic dystrophy type 2 (DM2), an incurable disease that is the second-most common cause of adult onset muscular dystrophy. Small molecule types investigated include monomers, dimers, and multivalent compounds synthesized on-site by using RNA-templated click chemistry. Oligonucleotides investigated include phosphorothioates that cleave their target and vivo-morpholinos that modulate target RNA activity via binding. We show that compounds assembled on-site that recognize structure have the highest potencies amongst small molecules and are similar in potency to a vivo-morpholino modified oligonucleotide that targets sequence. These studies are likely to impact the design of therapeutic modalities targeting other repeats expansions that cause fragile X syndrome and amyotrophic lateral sclerosis, for example. Copyright © 2016. Published by Elsevier Ltd.

Chemical synthesis of oligonucleotides containing a free sulphydryl group and subsequent attachment of thiol specific probes.

PubMed Central

Connolly, B A; Rider, P

1985-01-01

Oligonucleotides containing a free sulphydryl group at their 5'-termini have been synthesised and further derivatised with thiol specific probes. The nucleotide sequence required is prepared using standard solid phase phosphoramidite techniques and an extra round of synthesis is then performed using the S-triphenylmethyl O-methoxymorpholinophosphite derivatives of 2-mercaptoethanol, 3-mercaptopropan (1) ol or 6-mercaptohexan (1) ol. After cleavage from the resin and removal of the phosphate and base protecting groups, this yields an oligonucleotide containing an S-triphenylmethyl group attached to the 5'-phosphate group via a two, three or six carbon chain. The triphenylmethyl group can be readily removed with silver nitrate to give the free thiol. With the three and six carbon chain oligonucleotides, this thiol can be used, at pH 8, for the attachment of thiol specific probes as illustrated by the reaction with fluorescent conjugates of iodoacetates and maleiimides. However, oligonucleotides containing a thiol attached to the 5'-phosphate group via a two carbon chain are unstable at pH 8 decomposing to the free 5'-phosphate and so are unsuitable for further derivatisation. PMID:4011448

PNA-COMBO-FISH: From combinatorial probe design in silico to vitality compatible, specific labelling of gene targets in cell nuclei.

PubMed

Müller, Patrick; Rößler, Jens; Schwarz-Finsterle, Jutta; Schmitt, Eberhard; Hausmann, Michael

2016-07-01

Recently, advantages concerning targeting specificity of PCR constructed oligonucleotide FISH probes in contrast to established FISH probes, e.g. BAC clones, have been demonstrated. These techniques, however, are still using labelling protocols with DNA denaturing steps applying harsh heat treatment with or without further denaturing chemical agents. COMBO-FISH (COMBinatorial Oligonucleotide FISH) allows the design of specific oligonucleotide probe combinations in silico. Thus, being independent from primer libraries or PCR laboratory conditions, the probe sequences extracted by computer sequence data base search can also be synthesized as single stranded PNA-probes (Peptide Nucleic Acid probes) or TINA-DNA (Twisted Intercalating Nucleic Acids). Gene targets can be specifically labelled with at least about 20 probes obtaining visibly background free specimens. By using appropriately designed triplex forming oligonucleotides, the denaturing procedures can completely be omitted. These results reveal a significant step towards oligonucleotide-FISH maintaining the 3d-nanostructure and even the viability of the cell target. The method is demonstrated with the detection of Her2/neu and GRB7 genes, which are indicators in breast cancer diagnosis and therapy. Copyright © 2016. Published by Elsevier Inc.

Biological and molecular characterization of cellular differentiation in Tetrahymena vorax: a potential biocontrol protozoan.

PubMed

Green, M M; LeBoeuf, R D; Churchill, P F

2000-01-01

Tetrahymena vorax (T. vorax) is an indigenous fresh water protozoan with the natural biological potential to maintain a specific aquatic microbial flora by ingesting and eliminating specific microorganism. To investigate the molecular mechanisms controlling Tetrahymena vorax (T. vorax) cellular differentiation from a small-mouth vegetative cell to a voracious large-mouth carnivore capable of ingesting prey ciliates and bacteria from aquatic environments, we use DNA subtraction and gene discovery techniques to identify and isolate T. vorax differentiation-specific genes. The physiological necessity for one newly discovered gene, SUBII-TG, was determined in vivo using an antisense oligonucleotide directed against the 5' SUBII-TG DNA sequence. The barriers to delivering antisense oligonucleotides to the cytoplasm of T. vorax were circumvented by employing a new but simple procedure of processing the oligonucleotide with the differentiation stimulus, stomatin. In these studies, the antisense oligonucleotide down-regulated SUBII-TG mRNA expression, and blocked differentiation and ingestion of prey ciliates. The ability to down-regulate SUBII-TG expression with the antisense oligonucleotide suggests that the molecular mechanisms controlling the natural biological activities of T. vorax can be manipulated to further study its cellular differentiation and potential as a biocontrol microorganism.

Stable Gene Targeting in Human Cells Using Single-Strand Oligonucleotides with Modified Bases

PubMed Central

Rios, Xavier; Briggs, Adrian W.; Christodoulou, Danos; Gorham, Josh M.; Seidman, Jonathan G.; Church, George M.

2012-01-01

Recent advances allow multiplexed genome engineering in E. coli, employing easily designed oligonucleotides to edit multiple loci simultaneously. A similar technology in human cells would greatly expedite functional genomics, both by enhancing our ability to test how individual variants such as single nucleotide polymorphisms (SNPs) are related to specific phenotypes, and potentially allowing simultaneous mutation of multiple loci. However, oligo-mediated targeting of human cells is currently limited by low targeting efficiencies and low survival of modified cells. Using a HeLa-based EGFP-rescue reporter system we show that use of modified base analogs can increase targeting efficiency, in part by avoiding the mismatch repair machinery. We investigate the effects of oligonucleotide toxicity and find a strong correlation between the number of phosphorothioate bonds and toxicity. Stably EGFP-corrected cells were generated at a frequency of ~0.05% with an optimized oligonucleotide design combining modified bases and reduced number of phosphorothioate bonds. We provide evidence from comparative RNA-seq analysis suggesting cellular immunity induced by the oligonucleotides might contribute to the low viability of oligo-corrected cells. Further optimization of this method should allow rapid and scalable genome engineering in human cells. PMID:22615794

Correlating In Vitro Splice Switching Activity With Systemic In Vivo Delivery Using Novel ZEN-modified Oligonucleotides.

PubMed

Hammond, Suzan M; McClorey, Graham; Nordin, Joel Z; Godfrey, Caroline; Stenler, Sofia; Lennox, Kim A; Smith, C I Edvard; Jacobi, Ashley M; Varela, Miguel A; Lee, Yi; Behlke, Mark A; Wood, Matthew J A; Andaloussi, Samir E L

2014-11-25

Splice switching oligonucleotides (SSOs) induce alternative splicing of pre-mRNA and typically employ chemical modifications to increase nuclease resistance and binding affinity to target pre-mRNA. Here we describe a new SSO non-base modifier (a naphthyl-azo group, "ZEN™") to direct exon exclusion in mutant dystrophin pre-mRNA to generate functional dystrophin protein. The ZEN modifier is placed near the ends of a 2'-O-methyl (2'OMe) oligonucleotide, increasing melting temperature and potency over unmodified 2'OMe oligonucleotides. In cultured H2K cells, a ZEN-modified 2'OMe phosphorothioate (PS) oligonucleotide delivered by lipid transfection greatly enhanced dystrophin exon skipping over the same 2'OMePS SSO lacking ZEN. However, when tested using free gymnotic uptake in vitro and following systemic delivery in vivo in dystrophin deficient mdx mice, the same ZEN-modified SSO failed to enhance potency. Importantly, we show for the first time that in vivo activity of anionic SSOs is modelled in vitro only when using gymnotic delivery. ZEN is thus a novel modifier that enhances activity of SSOs in vitro but will require improved delivery methods before its in vivo clinical potential can be realized.

Oligonucleotides as antivirals: dream or realistic perspective?

PubMed

Van Aerschot, Arthur

2006-09-01

Many reports have been published on antiviral activity of synthetic oligonucleotides, targeted to act either by a true antisense effect or via non-sequence specific interactions. This short review will try to evaluate the current status of the field by focusing on the effects as reported for inhibition of either HSV-1, HCMV or HIV-1. Following an introduction with a historical background and a brief discussion on the different types of constructs and mechanisms of action, the therapeutic potential of antisense oligonucleotides as antivirals, as well as possible pitfalls upon their evaluation will be discussed.

CD studies on ribonuclease A - oligonucleotides interactions.

PubMed Central

White, M D; Keren-Zur, M; Lapidot, Y

1977-01-01

The interaction of ApU, Aps4U, Aps4Up, ApAps4Up and Gps4U with RNase A was studied by CD difference spectroscopy. The use of 4-thiouridine (s4U) containing oligonucleotides enables to distinguish between the interaction of the different components of the ligand with the enzyme. The mode of binding of the oligonucleotides to the enzyme is described. From this mode of binding it is explained why Aps4U, for example, inhibits RNase A, while s4UpA serves as a substrate. PMID:866194

Rapid purification of circular DNA by triplex-mediated affinity capture

DOEpatents

Ji, Huamin; Smith, Lloyd M.

1997-01-01

A single-step capture of a target supercoiled double-stranded DNA molecule is accomplished by forming a local triple-helix among two strands of the supercoiled circular DNA and an oligonucleotide probe. The oligonucleotide is bound to an immobilizing support which facilitates the immobilization and purification of target DNA molecules. Non-target DNA molecules and other contaminating cellular material are easily removed by washing. The triple-helical structure is destabilized by raising the pH, leaving purified target DNA in the supernatant and reusable affinity capture oligonucleotide secured to the immobilizing support.

Customized oligonucleotide microchips that convert multiple genetic information to simple patterns, are portable and reusable

DOEpatents

Mirzabekov, Andrei; Guschin, Dmitry Y.; Chik, Valentine; Drobyshev, Aleksei; Fotin, Alexander; Yershov, Gennadiy; Lysov, Yuri

2002-01-01

This invention relates to using customized oligonucleotide microchips as biosensors for the detection and identification of nucleic acids specific for different genes, organisms and/or individuals in the environment, in food and in biological samples. The microchips are designed to convert multiple bits of genetic information into simpler patterns of signals that are interpreted as a unit. Because of an improved method of hybridizing oligonucleotides from samples to microchips, microchips are reusable and transportable. For field study, portable laser or bar code scanners are suitable.

Functional regulation of RNA-induced silencing complex by photoreactive oligonucleotides.

PubMed

Matsuyama, Yohei; Yamayoshi, Asako; Kobori, Akio; Murakami, Akira

2014-02-01

We developed a novel method for regulation of RISC function by photoreactive oligonucleotides (Ps-Oligo) containing 2'-O-psoralenylmethoxyethyl adenosine (Aps). We observed that inhibitory effects of Ps-Oligos on RISC function were enhanced by UV-irradiation compared with 2'-O-methyl-oligonucleotide without Aps. These results suggest Ps-Oligo inhibited RISC function by cross-linking effect, and we propose that the concept described in this report may be promising and applicable one to regulate the small RNA-mediated post-transcriptional regulation. Crown Copyright © 2013. Published by Elsevier Ltd. All rights reserved.

Oligonucleotide Array for Identification and Detection of Pythium Species†

PubMed Central

Tambong, J. T.; de Cock, A. W. A. M.; Tinker, N. A.; Lévesque, C. A.

2006-01-01

A DNA array containing 172 oligonucleotides complementary to specific diagnostic regions of internal transcribed spacers (ITS) of more than 100 species was developed for identification and detection of Pythium species. All of the species studied, with the exception of Pythium ostracodes, exhibited a positive hybridization reaction with at least one corresponding species-specific oligonucleotide. Hybridization patterns were distinct for each species. The array hybridization patterns included cluster-specific oligonucleotides that facilitated the recognition of species, including new ones, belonging to groups such as those producing filamentous or globose sporangia. BLAST analyses against 500 publicly available Pythium sequences in GenBank confirmed that species-specific oligonucleotides were unique to all of the available strains of each species, of which there were numerous economically important ones. GenBank entries of newly described species that are not putative synonyms showed no homology to sequences of the spotted species-specific oligonucleotides, but most new species did match some of the cluster-specific oligonucleotides. Further verification of the specificity of the DNA array was done with 50 additional Pythium isolates obtained by soil dilution plating. The hybridization patterns obtained were consistent with the identification of these isolates based on morphology and ITS sequence analyses. In another blind test, total DNA of the same soil samples was amplified and hybridized on the array, and the results were compared to those of 130 Pythium isolates obtained by soil dilution plating and root baiting. The 13 species detected by the DNA array corresponded to the isolates obtained by a combination of soil dilution plating and baiting, except for one new species that was not represented on the array. We conclude that the reported DNA array is a reliable tool for identification and detection of the majority of Pythium species in environmental samples. Simultaneous detection and identification of multiple species of soilborne pathogens such as Pythium species could be a major step forward for epidemiological and ecological studies. PMID:16597974

In Silico Screening Based on Predictive Algorithms as a Design Tool for Exon Skipping Oligonucleotides in Duchenne Muscular Dystrophy

PubMed Central

Echigoya, Yusuke; Mouly, Vincent; Garcia, Luis; Yokota, Toshifumi; Duddy, William

2015-01-01

The use of antisense ‘splice-switching’ oligonucleotides to induce exon skipping represents a potential therapeutic approach to various human genetic diseases. It has achieved greatest maturity in exon skipping of the dystrophin transcript in Duchenne muscular dystrophy (DMD), for which several clinical trials are completed or ongoing, and a large body of data exists describing tested oligonucleotides and their efficacy. The rational design of an exon skipping oligonucleotide involves the choice of an antisense sequence, usually between 15 and 32 nucleotides, targeting the exon that is to be skipped. Although parameters describing the target site can be computationally estimated and several have been identified to correlate with efficacy, methods to predict efficacy are limited. Here, an in silico pre-screening approach is proposed, based on predictive statistical modelling. Previous DMD data were compiled together and, for each oligonucleotide, some 60 descriptors were considered. Statistical modelling approaches were applied to derive algorithms that predict exon skipping for a given target site. We confirmed (1) the binding energetics of the oligonucleotide to the RNA, and (2) the distance in bases of the target site from the splice acceptor site, as the two most predictive parameters, and we included these and several other parameters (while discounting many) into an in silico screening process, based on their capacity to predict high or low efficacy in either phosphorodiamidate morpholino oligomers (89% correctly predicted) and/or 2’O Methyl RNA oligonucleotides (76% correctly predicted). Predictions correlated strongly with in vitro testing for sixteen de novo PMO sequences targeting various positions on DMD exons 44 (R2 0.89) and 53 (R2 0.89), one of which represents a potential novel candidate for clinical trials. We provide these algorithms together with a computational tool that facilitates screening to predict exon skipping efficacy at each position of a target exon. PMID:25816009

Voltammetric behaviour of free DNA bases, methylcytosine and oligonucleotides at disposable screen printed graphite electrode platforms.

PubMed

Brotons, Ariadna; Mas, Luis Alcaraz; Metters, Jonathan P; Banks, Craig E; Iniesta, Jesús

2013-09-21

Improvements in analytical methods for the determination and quantification of methylcytosine in DNA are vital since it has the potential to be used as a biomarker to detect different diseases in the first stage such as in the case of carcinomas and sterility. In this work we utilized screen printed graphite electrodes (SPGE) for studying the electrochemical response of all free DNA bases, methylcytosine and short oligonucleotides by cyclic voltammetry (CV) and square wave voltammetry (SWV). CV and SWV responses of free DNA bases and methylcytosine have been investigated by using SPGE platforms and the feasibility of detecting and quantifying cytosine and methylcytosine as free DNA moieties has been evaluated as a function of pH, concentration and the presence of the other free DNA bases in solution simultaneously. Repeatability of using SWV has been performed for the electrochemical behavior of both 250 μM cytosine and 250 μM methylcytosine in the presence of 25 μM guanine, with coefficient of variations of 6.9% and 2.6% respectively based upon peak current (N = 5). Six-mer oligonucleotides with a sequence 5'-XXXCGC-3', where the XXX motif corresponds to TTT, TTA, TAA and AAA have been performed using SWV in 0.1 M acetate buffer pH 5.0 to explore how the DNA base position effects the electrooxidation of guanine and cytosine into the oligonucleotide. Furthermore SWV comparisons of the electrooxidation of the oligonucleotides 5'-CGCGCG-3' and its methylated 5'-mCGmCGmCG-3' have been performed with concentrations in acetate buffer solutions, and the interaction of both oligonucleotides with the graphitic surface of the SPGE has been demonstrated by fitting well-known adsorption models such as Freundlich and Langmuir kinetics according to the SWV current response of guanine, cytosine and methylcytosine into the oligonucleotide.

Non-Enzymatic Detection of Bacterial Genomic DNA Using the Bio-Barcode Assay

PubMed Central

Hill, Haley D.; Vega, Rafael A.; Mirkin, Chad A.

2011-01-01

The detection of bacterial genomic DNA through a non-enzymatic nanomaterials based amplification method, the bio-barcode assay, is reported. The assay utilizes oligonucleotide functionalized magnetic microparticles to capture the target of interest from the sample. A critical step in the new assay involves the use of blocking oligonucleotides during heat denaturation of the double stranded DNA. These blockers bind to specific regions of the target DNA upon cooling, and prevent the duplex DNA from re-hybridizing, which allows the particle probes to bind. Following target isolation using the magnetic particles, oligonucleotide functionalized gold nanoparticles act as target recognition agents. The oligonucleotides on the nanoparticle (barcodes) act as amplification surrogates. The barcodes are then detected using the Scanometric method. The limit of detection for this assay was determined to be 2.5 femtomolar, and this is the first demonstration of a barcode type assay for the detection of double stranded, genomic DNA. PMID:17927207

Persistence and breakdown of strand symmetry in the human genome.

PubMed

Zhang, Shang-Hong

2015-04-07

Afreixo, V., Bastos, C.A.C., Garcia, S.P., Rodrigues, J.M.O.S., Pinho, A.J., Ferreira, P.J.S.G., 2013. The breakdown of the word symmetry in the human genome. J. Theor. Biol. 335, 153-159 analyzed the word symmetry (strand symmetry or the second parity rule) in the human genome. They concluded that strand symmetry holds for oligonucleotides up to 6 nt and is no longer statistically significant for oligonucleotides of higher orders. However, although they provided some new results for the issue, their interpretation would not be fully justified. Also, their conclusion needs to be further evaluated. Further analysis of their results, especially those of equivalence tests and word symmetry distance, shows that strand symmetry would persist for higher-order oligonucleotides up to 9 nt in the human genome, at least for its overall frequency framework (oligonucleotide frequency pattern). Copyright © 2015 Elsevier Ltd. All rights reserved.

Use of continuous/contiguous stacking hybridization as a diagnostic tool

DOEpatents

Mirzabekov, Andrei Darievich; Yershov, Gennadiy Moseyevich; Kirillov, Eugene Vladislavovich; Parinov, Sergei Valeryevich; Barski, Victor Evgenievich; Lysov, Yuri Petrovich

1999-01-01

A method for detecting disease-associated alleles in patient genetic material is provided whereby a first group of oligonucleotide molecules, synthesized to compliment base sequences of the disease associated alleles is immobilized on a predetermined position on a substrate, and then contacted with patient genetic material to form duplexes. The duplexes are then contacted with a second group of oligonucleotide molecules which are synthesized to extend the predetermined length of the oligonucleotide molecules of the first group, and where each of the oligonucleotide molecules of the second group are tagged and either incorporate universal bases or a mixture of guanine, cytosine, thymine, and adenine, or complementary nucleotide strands that are tagged with a different fluorochrome which radiates light at a predetermined wavelength. The treated substrate is then washed and the light patterns radiating therefrom are compared with predetermined light patterns of various diseases that were prepared on identical substrates.

Use of continuous/contiguous stacking hybridization as a diagnostic tool

DOEpatents

Mirzabekov, A.D.; Yershov, G.M.; Kirillov, E.V.; Parinov, S.V.; Barski, V.E.; Lysov, Y.P.

1999-06-01

A method for detecting disease-associated alleles in patient genetic material is provided whereby a first group of oligonucleotide molecules, synthesized to compliment base sequences of the disease associated alleles is immobilized on a predetermined position on a substrate, and then contacted with patient genetic material to form duplexes. The duplexes are then contacted with a second group of oligonucleotide molecules which are synthesized to extend the predetermined length of the oligonucleotide molecules of the first group, and where each of the oligonucleotide molecules of the second group are tagged and either incorporate universal bases or a mixture of guanine, cytosine, thymine, and adenine, or complementary nucleotide strands that are tagged with a different fluorochrome which radiates light at a predetermined wavelength. The treated substrate is then washed and the light patterns radiating therefrom are compared with predetermined light patterns of various diseases that were prepared on identical substrates. 5 figs.

Oligonucleotide primers, probes and molecular methods for the environmental monitoring of methanogenic archaea

PubMed Central

Narihiro, Takashi; Sekiguchi, Yuji

2011-01-01

Summary For the identification and quantification of methanogenic archaea (methanogens) in environmental samples, various oligonucleotide probes/primers targeting phylogenetic markers of methanogens, such as 16S rRNA, 16S rRNA gene and the gene for the α‐subunit of methyl coenzyme M reductase (mcrA), have been extensively developed and characterized experimentally. These oligonucleotides were designed to resolve different groups of methanogens at different taxonomic levels, and have been widely used as hybridization probes or polymerase chain reaction primers for membrane hybridization, fluorescence in situ hybridization, rRNA cleavage method, gene cloning, DNA microarray and quantitative polymerase chain reaction for studies in environmental and determinative microbiology. In this review, we present a comprehensive list of such oligonucleotide probes/primers, which enable us to determine methanogen populations in an environment quantitatively and hierarchically, with examples of the practical applications of the probes and primers. PMID:21375721

Toward a new paradigm of DNA writing using a massively parallel sequencing platform and degenerate oligonucleotide

PubMed Central

Hwang, Byungjin; Bang, Duhee

2016-01-01

All synthetic DNA materials require prior programming of the building blocks of the oligonucleotide sequences. The development of a programmable microarray platform provides cost-effective and time-efficient solutions in the field of data storage using DNA. However, the scalability of the synthesis is not on par with the accelerating sequencing capacity. Here, we report on a new paradigm of generating genetic material (writing) using a degenerate oligonucleotide and optomechanical retrieval method that leverages sequencing (reading) throughput to generate the desired number of oligonucleotides. As a proof of concept, we demonstrate the feasibility of our concept in digital information storage in DNA. In simulation, the ability to store data is expected to exponentially increase with increase in degenerate space. The present study highlights the major framework change in conventional DNA writing paradigm as a sequencer itself can become a potential source of making genetic materials. PMID:27876825

Preparation and Analysis of Oligonucleotides Containing the C4′-Oxidized Abasic Site and Related Mechanistic Probes

PubMed Central

Kim, Jaeseung; Kreller, Cortney R.; Greenberg, Marc M.

2005-01-01

The C4′-oxidized abasic site (C4-AP) is produced by a variety of DNA damaging agents. This alkali labile lesion can exist in up to four diastereomeric cyclic forms, in addition to the acyclic keto-aldehyde. Synthetic oligonucleotides containing the lesion were prepared from a stable photochemical precursor. Chemical integrity of the lesion containing oligonucleotides was probed using phosphodiesterase lability. Analysis of the 3′,5′-phosphate diester of the monomeric lesion released from single diastereomers of photolabile precursors by 1H NMR indicates that isomerization of the hemiacetal and/or hemiketal is rapid. The syntheses and characterization of oligonucleotides containing configurationally stable analogues of C4-AP, which serve as mechanistic probes for deciphering the structural basis of the biochemical and biological effects of the C4′-oxidized abasic lesion, are also described. PMID:16277338

Toward a new paradigm of DNA writing using a massively parallel sequencing platform and degenerate oligonucleotide.

PubMed

Hwang, Byungjin; Bang, Duhee

2016-11-23

All synthetic DNA materials require prior programming of the building blocks of the oligonucleotide sequences. The development of a programmable microarray platform provides cost-effective and time-efficient solutions in the field of data storage using DNA. However, the scalability of the synthesis is not on par with the accelerating sequencing capacity. Here, we report on a new paradigm of generating genetic material (writing) using a degenerate oligonucleotide and optomechanical retrieval method that leverages sequencing (reading) throughput to generate the desired number of oligonucleotides. As a proof of concept, we demonstrate the feasibility of our concept in digital information storage in DNA. In simulation, the ability to store data is expected to exponentially increase with increase in degenerate space. The present study highlights the major framework change in conventional DNA writing paradigm as a sequencer itself can become a potential source of making genetic materials.

Silver Nanoparticle Oligonucleotide Conjugates Based on DNA with Triple Cyclic Disulfide Moieties

PubMed Central

Lee, Jae-Seung; Lytton-Jean, Abigail K. R.; Hurst, Sarah J.; Mirkin, Chad A.

2011-01-01

We report a new strategy for preparing silver nanoparticle oligonucleotide conjugates that are based upon DNA with cyclic disulfide-anchoring groups. These particles are extremely stable and can withstand NaCl concentrations up to 1.0 M. When silver nanoparticles functionalized with complementary sequences are combined, they assemble to form DNA-linked nanoparticle networks. This assembly process is reversible with heating and is associated with a red-shifting of the particle surface plasmon resonance and a concomitant color change from yellow to pale red. Analogous to the oligonucleotide-functionalized gold nanoparticles, these particles also exhibit highly cooperative binding properties with extremely sharp melting transitions. This work is an important step towards being able to use silver nanoparticle oligonucleotide conjugates for a variety of purposes, including molecular diagnostic labels, synthons in programmable materials synthesis approaches, and functional components for nanoelectronic and plasmonic devices. PMID:17571909

Secondary binding sites for heavily modified triplex forming oligonucleotides

PubMed Central

Cardew, Antonia S.; Brown, Tom; Fox, Keith R.

2012-01-01

In order to enhance DNA triple helix stability synthetic oligonucleotides have been developed that bear amino groups on the sugar or base. One of the most effective of these is bis-amino-U (B), which possesses 5-propargylamino and 2′-aminoethoxy modifications. Inclusion of this modified nucleotide not only greatly enhances triplex stability, but also increases the affinity for related sequences. We have used a restriction enzyme protection, selection and amplification assay (REPSA) to isolate sequences that are bound by the heavily modified 9-mer triplex-forming oligonucleotide B6CBT. The isolated sequences contain An tracts (n = 6), suggesting that the 5′-end of this TFO was responsible for successful triplex formation. DNase I footprinting with these sequences confirmed triple helix formation at these secondary targets and demonstrated no interaction with similar oligonucleotides containing T or 5-propargylamino-dU. PMID:22180535

Gene silencing by siRNAs and antisense oligonucleotides in the laboratory and the clinic

PubMed Central

Watts, Jonathan K.; Corey, David R.

2014-01-01

Synthetic nucleic acids are commonly used laboratory tools for modulating gene expression and have the potential to be widely used in the clinic. Progress towards nucleic acid drugs, however, has been slow and many challenges remain to be overcome before their full impact on patient care can be understood. Antisense oligonucleotides (ASOs) and small interfering RNAs (siRNAs) are the two most widely used strategies for silencing gene expression. We first describe these two approaches and contrast their relative strengths and weaknesses for laboratory applications. We then review the choices faced during development of clinical candidates and the current state of clinical trials. Attitudes towards clinical development of nucleic acid silencing strategies have repeatedly swung from optimism to depression during the past twenty years. Our goal is to provide the information needed to design robust studies with oligonucleotides, making use of the strengths of each oligonucleotide technology. PMID:22069063

Repair of Thalassemic Human β -globin mRNA in Mammalian Cells by Antisense Oligonucleotides

NASA Astrophysics Data System (ADS)

Sierakowska, Halina; Sambade, Maria J.; Agrawal, Sudhir; Kole, Ryszard

1996-11-01

In one form of β -thalassemia, a genetic blood disorder, a mutation in intron 2 of the β -globin gene (IVS2-654) causes aberrant splicing of β -globin pre-mRNA and, consequently, β -globin deficiency. Treatment of mammalian cells stably expressing the IVS2-654 human β -globin gene with antisense oligonucleotides targeted at the aberrant splice sites restored correct splicing in a dose-dependent fashion, generating correct human β -globin mRNA and polypeptide. Both products persisted for up to 72 hr posttreatment. The oligonucleotides modified splicing by a true antisense mechanism without overt unspecific effects on cell growth and splicing of other pre-mRNAs. This novel approach in which antisense oligonucleotides are used to restore rather than to down-regulate the activity of the target gene is applicable to other splicing mutants and is of potential clinical interest.

Enzymatic production of single-molecule FISH and RNA capture probes.

PubMed

Gaspar, Imre; Wippich, Frank; Ephrussi, Anne

2017-10-01

Arrays of singly labeled short oligonucleotides that hybridize to a specific target revolutionized RNA biology, enabling quantitative, single-molecule microscopy analysis and high-efficiency RNA/RNP capture. Here, we describe a simple and efficient method that allows flexible functionalization of inexpensive DNA oligonucleotides by different fluorescent dyes or biotin using terminal deoxynucleotidyl transferase and custom-made functional group conjugated dideoxy-UTP. We show that (i) all steps of the oligonucleotide labeling-including conjugation, enzymatic synthesis, and product purification-can be performed in a standard biology laboratory, (ii) the process yields >90%, often >95% labeled product with minimal carryover of impurities, and (iii) the oligonucleotides can be labeled with different dyes or biotin, allowing single-molecule FISH, RNA affinity purification, and Northern blot analysis to be performed. © 2017 Gaspar et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

Universal Oligonucleotide Microarray for Sub-Typing of Influenza A Virus

PubMed Central

Ryabinin, Vladimir A.; Kostina, Elena V.; Maksakova, Galiya A.; Neverov, Alexander A.; Chumakov, Konstantin M.; Sinyakov, Alexander N.

2011-01-01

A universal microchip was developed for genotyping Influenza A viruses. It contains two sets of oligonucleotide probes allowing viruses to be classified by the subtypes of hemagglutinin (H1–H13, H15, H16) and neuraminidase (N1–N9). Additional sets of probes are used to detect H1N1 swine influenza viruses. Selection of probes was done in two steps. Initially, amino acid sequences specific to each subtype were identified, and then the most specific and representative oligonucleotide probes were selected. Overall, between 19 and 24 probes were used to identify each subtype of hemagglutinin (HA) and neuraminidase (NA). Genotyping included preparation of fluorescently labeled PCR amplicons of influenza virus cDNA and their hybridization to microarrays of specific oligonucleotide probes. Out of 40 samples tested, 36 unambiguously identified HA and NA subtypes of Influenza A virus. PMID:21559081

Synthesis of nucleosides and oligonucleotides containing adducts of acrolein and vinyl chloride.

PubMed

Nechev, L V; Harris, C M; Harris, T M

2000-05-01

Vinyl chloride and acrolein are important industrial chemicals. Both form DNA adducts, vinyl chloride after enzymatic oxidation to chlorooxirane and acrolein by direct reaction. Reaction at the N(2) position of guanine is a major pathway. The resulting 2-oxoethyl and 3-oxopropyl adducts cyclize spontaneously to hydroxyethano and hydroxypropano derivatives, respectively. The two cyclic adducts have been detected in DNA exposed to these mutagens. A new method has been developed for the synthesis of deoxyguanosine adducts of chlorooxirane and acrolein, as well as oligonucleotides containing these adducts. Reaction of O(6)-[(trimethylsilyl)ethyl]-2-fluoro-2'-deoxyinosine with the appropriate aminodiol followed by oxidative cleavage of the diol with NaIO(4) gave the adducts in excellent yields. Reaction of oligonucleotides containing the halonucleoside with the aminodiols followed by NaIO(4) efficiently created the nucleosides in the oligonucleotides. Deoxyadenosine adducts were created similarly using 6-chloropurine 9-(2'-deoxyriboside).

Marketing and reputation aspects of neonatal safeguards and hospital-security systems.

PubMed

Smith, Alan D

2009-01-01

Technological advancements have migrated from personal-use electronics into the healthcare setting for security enhancements. Within maternity wards and nurseries, technology was seen as one of best way to protect newborns from abduction. The present study is a focus on what systems and methods are used in neonatal security, the security arrangements, staff training, and impacts outside the control of the hospital, customer satisfaction and customer relations management. Through hypothesis-testing and exploratory analysis, gender biases and extremely high levels of security were found within a web-enabled and professional sample of 200 respondents. The factor-based constructs were found to be, in order of the greatest explained variance: security concerns, personal technology usage, work technology applications, and demographic maturity concerns, resulting in four factor-based scores with significant combined variance of 61.5%. It was found that through a better understanding on the importance and vital need for hospitals to continue to improve on their technology-based security policies significantly enhanced their reputation in the highly competitive local healthcare industry.

Genome-wide comparison of paired fresh frozen and formalin-fixed paraffin-embedded gliomas by custom BAC and oligonucleotide array comparative genomic hybridization: facilitating analysis of archival gliomas.

PubMed

Mohapatra, Gayatry; Engler, David A; Starbuck, Kristen D; Kim, James C; Bernay, Derek C; Scangas, George A; Rousseau, Audrey; Batchelor, Tracy T; Betensky, Rebecca A; Louis, David N

2011-04-01

Array comparative genomic hybridization (aCGH) is a powerful tool for detecting DNA copy number alterations (CNA). Because diffuse malignant gliomas are often sampled by small biopsies, formalin-fixed paraffin-embedded (FFPE) blocks are often the only tissue available for genetic analysis; FFPE tissues are also needed to study the intratumoral heterogeneity that characterizes these neoplasms. In this paper, we present a combination of evaluations and technical advances that provide strong support for the ready use of oligonucleotide aCGH on FFPE diffuse gliomas. We first compared aCGH using bacterial artificial chromosome (BAC) arrays in 45 paired frozen and FFPE gliomas, and demonstrate a high concordance rate between FFPE and frozen DNA in an individual clone-level analysis of sensitivity and specificity, assuring that under certain array conditions, frozen and FFPE DNA can perform nearly identically. However, because oligonucleotide arrays offer advantages to BAC arrays in genomic coverage and practical availability, we next developed a method of labeling DNA from FFPE tissue that allows efficient hybridization to oligonucleotide arrays. To demonstrate utility in FFPE tissues, we applied this approach to biphasic anaplastic oligoastrocytomas and demonstrate CNA differences between DNA obtained from the two components. Therefore, BAC and oligonucleotide aCGH can be sensitive and specific tools for detecting CNAs in FFPE DNA, and novel labeling techniques enable the routine use of oligonucleotide arrays for FFPE DNA. In combination, these advances should facilitate genome-wide analysis of rare, small and/or histologically heterogeneous gliomas from FFPE tissues.

[Again review of research design and statistical methods of Chinese Journal of Cardiology].

PubMed

Kong, Qun-yu; Yu, Jin-ming; Jia, Gong-xian; Lin, Fan-li

2012-11-01

To re-evaluate and compare the research design and the use of statistical methods in Chinese Journal of Cardiology. Summary the research design and statistical methods in all of the original papers in Chinese Journal of Cardiology all over the year of 2011, and compared the result with the evaluation of 2008. (1) There is no difference in the distribution of the design of researches of between the two volumes. Compared with the early volume, the use of survival regression and non-parameter test are increased, while decreased in the proportion of articles with no statistical analysis. (2) The proportions of articles in the later volume are significant lower than the former, such as 6(4%) with flaws in designs, 5(3%) with flaws in the expressions, 9(5%) with the incomplete of analysis. (3) The rate of correction of variance analysis has been increased, so as the multi-group comparisons and the test of normality. The error rate of usage has been decreased form 17% to 25% without significance in statistics due to the ignorance of the test of homogeneity of variance. Many improvements showed in Chinese Journal of Cardiology such as the regulation of the design and statistics. The homogeneity of variance should be paid more attention in the further application.

PRACTICAL STRATEGIES FOR PROCESSING AND ANALYZING SPOTTED OLIGONUCLEOTIDE MICROARRAY DATA

EPA Science Inventory

Thoughtful data analysis is as important as experimental design, biological sample quality, and appropriate experimental procedures for making microarrays a useful supplement to traditional toxicology. In the present study, spotted oligonucleotide microarrays were used to profile...

Mobile Phone Sensor Correlates of Depressive Symptom Severity in Daily-Life Behavior: An Exploratory Study.

PubMed

Saeb, Sohrab; Zhang, Mi; Karr, Christopher J; Schueller, Stephen M; Corden, Marya E; Kording, Konrad P; Mohr, David C

2015-07-15

Depression is a common, burdensome, often recurring mental health disorder that frequently goes undetected and untreated. Mobile phones are ubiquitous and have an increasingly large complement of sensors that can potentially be useful in monitoring behavioral patterns that might be indicative of depressive symptoms. The objective of this study was to explore the detection of daily-life behavioral markers using mobile phone global positioning systems (GPS) and usage sensors, and their use in identifying depressive symptom severity. A total of 40 adult participants were recruited from the general community to carry a mobile phone with a sensor data acquisition app (Purple Robot) for 2 weeks. Of these participants, 28 had sufficient sensor data received to conduct analysis. At the beginning of the 2-week period, participants completed a self-reported depression survey (PHQ-9). Behavioral features were developed and extracted from GPS location and phone usage data. A number of features from GPS data were related to depressive symptom severity, including circadian movement (regularity in 24-hour rhythm; r=-.63, P=.005), normalized entropy (mobility between favorite locations; r=-.58, P=.012), and location variance (GPS mobility independent of location; r=-.58, P=.012). Phone usage features, usage duration, and usage frequency were also correlated (r=.54, P=.011, and r=.52, P=.015, respectively). Using the normalized entropy feature and a classifier that distinguished participants with depressive symptoms (PHQ-9 score ≥5) from those without (PHQ-9 score <5), we achieved an accuracy of 86.5%. Furthermore, a regression model that used the same feature to estimate the participants' PHQ-9 scores obtained an average error of 23.5%. Features extracted from mobile phone sensor data, including GPS and phone usage, provided behavioral markers that were strongly related to depressive symptom severity. While these findings must be replicated in a larger study among participants with confirmed clinical symptoms, they suggest that phone sensors offer numerous clinical opportunities, including continuous monitoring of at-risk populations with little patient burden and interventions that can provide just-in-time outreach.

Impact of Healthcare Information Technology on Nursing Practice.

PubMed

Piscotty, Ronald J; Kalisch, Beatrice; Gracey-Thomas, Angel

2015-07-01

To report additional mediation findings from a descriptive cross sectional study to examine if nurses' perceptions of the impact of healthcare information technology on their practice mediates the relationship between electronic nursing care reminder use and missed nursing care. The study used a descriptive design. The sample (N = 165) was composed of registered nurses working on acute care hospital units. The sample was obtained from a large teaching hospital in Southeast Michigan in the fall of 2012. All eligible nursing units (n = 19) were included. The MISSCARE Survey, Nursing Care Reminders Usage Survey, and the Impact of Healthcare Information Technology Scale were used to collect data to test for mediation. Mediation was tested using the method described by Baron and Kenny. Multiple regression equations were used to analyze the data to determine if mediation occurred between the variables. Missed nursing care, the outcome variable, was regressed on the predictor variable, reminder usage, and the mediator variable impact of technology on nursing practice. The impact of healthcare information technology (IHIT) on nursing practice negatively affected missed nursing care (t = -4.12, p < .001), explaining 9.8% of variance in missed nursing care. With IHIT present, the predictor (reminder usage) was no longer significant (t = -.70, p = .48). Thus, the reduced direct association between reminder usage and missed nursing care when IHIT was in the model supported the hypothesis that IHIT was at least one of the mediators in the relationship between reminder usage and missed nursing care. The perceptions of the impact of healthcare information technology mediates the relationship between nursing care reminder use and missed nursing care. The findings are beneficial to the advancement of healthcare technology in that designers of healthcare information technology systems need to keep in mind that perceptions regarding impacts of the technology will influence usage. Many times, information technology systems are not designed to match the workflow of nurses. Systems built with redundant or impertinent reminders may be ignored. System designers must study which reminders nurses find most useful and which reminders result in the best quality outcomes. © 2015 Sigma Theta Tau International.

Mobile Phone Sensor Correlates of Depressive Symptom Severity in Daily-Life Behavior: An Exploratory Study

PubMed Central

Saeb, Sohrab; Zhang, Mi; Karr, Christopher J; Schueller, Stephen M; Corden, Marya E; Kording, Konrad P

2015-01-01

Background Depression is a common, burdensome, often recurring mental health disorder that frequently goes undetected and untreated. Mobile phones are ubiquitous and have an increasingly large complement of sensors that can potentially be useful in monitoring behavioral patterns that might be indicative of depressive symptoms. Objective The objective of this study was to explore the detection of daily-life behavioral markers using mobile phone global positioning systems (GPS) and usage sensors, and their use in identifying depressive symptom severity. Methods A total of 40 adult participants were recruited from the general community to carry a mobile phone with a sensor data acquisition app (Purple Robot) for 2 weeks. Of these participants, 28 had sufficient sensor data received to conduct analysis. At the beginning of the 2-week period, participants completed a self-reported depression survey (PHQ-9). Behavioral features were developed and extracted from GPS location and phone usage data. Results A number of features from GPS data were related to depressive symptom severity, including circadian movement (regularity in 24-hour rhythm; r=-.63, P=.005), normalized entropy (mobility between favorite locations; r=-.58, P=.012), and location variance (GPS mobility independent of location; r=-.58, P=.012). Phone usage features, usage duration, and usage frequency were also correlated (r=.54, P=.011, and r=.52, P=.015, respectively). Using the normalized entropy feature and a classifier that distinguished participants with depressive symptoms (PHQ-9 score ≥5) from those without (PHQ-9 score <5), we achieved an accuracy of 86.5%. Furthermore, a regression model that used the same feature to estimate the participants’ PHQ-9 scores obtained an average error of 23.5%. Conclusions Features extracted from mobile phone sensor data, including GPS and phone usage, provided behavioral markers that were strongly related to depressive symptom severity. While these findings must be replicated in a larger study among participants with confirmed clinical symptoms, they suggest that phone sensors offer numerous clinical opportunities, including continuous monitoring of at-risk populations with little patient burden and interventions that can provide just-in-time outreach. PMID:26180009

Base-Pairing Systems Related to TNA: alpha-Threofuranosyl Oligonucleotides Containing Phosphoramidate Linkages

NASA Technical Reports Server (NTRS)

Meyer, Michael (Technical Monitor); Wu, Xiaolin; Guntha, Sreenivasulu; Ferenclc, Mathias; Krishnamurthy, Ramanarayanan; Eschenmoser, Albert

2002-01-01

(3'NH)- and (2'NH)-TNA, two isomeric phosphoramidate analogues of TNA (alpha-threofuranosyl-(3'-2') oligonucleotides), are shown to be efficient Watson-Crick base-pairing systems and to undergo intersystem crosspairing with TNA, RNA, and DNA.

Validation of the Swine Protein-Annotated Oligonucleotide Microarray

USDA-ARS?s Scientific Manuscript database

The specificity and utility of the Swine Protein-Annotated Oligonucleotide Microarray, or Pigoligoarray (www.pigoligoarray.org), has been evaluated by profiling the expression of transcripts from four porcine tissues. Tools for comparative analyses of expression on the Pigoligoarray were developed i...

Identifying members of the domain Archaea with rRNA-targeted oligonucleotide probes.

PubMed

Burggraf, S; Mayer, T; Amann, R; Schadhauser, S; Woese, C R; Stetter, K O

1994-09-01

Two 16S rRNA-targeted oligonucleotide probes were designed for the archaeal kingdoms Euryachaeota and Crenarchaeota. Probe specificities were evaluated by nonradioactive dot blot hybridization against selected reference organisms. The successful application of fluorescent-probe derivatives for whole-cell hybridization required organism-specific optimizations of fixation and hybridization conditions to assure probe penetration and morphological integrity of the cells. The probes allowed preliminary grouping of three new hyperthermophilic isolates. Together with other group-specific rRNA-targeted oligonucleotide probes, these probes will facilitate rapid in situ monitoring of the populations present in hydrothermal systems and support cultivation attempts.

Nucleic acid amplification using modular branched primers

DOEpatents

Ulanovsky, Levy; Raja, Mugasimangalam C.

2001-01-01

Methods and compositions expand the options for making primers for use in amplifying nucleic acid segments. The invention eliminates the step of custom synthesis of primers for Polymerase Chain Reactions (PCR). Instead of being custom-synthesized, a primer is replaced by a combination of several oligonucleotide modules selected from a pre-synthesized library. A modular combination of just a few oligonucleotides essentially mimics the performance of a conventional, custom-made primer by matching the sequence of the priming site in the template. Each oligonucleotide module has a segment that matches one of the stretches within the priming site.

Rapid purification of circular DNA by triplex-mediated affinity capture

DOEpatents

Ji, H.; Smith, L.M.

1997-01-07

A single-step capture of a target supercoiled double-stranded DNA molecule is accomplished by forming a local triple-helix among two strands of the supercoiled circular DNA and an oligonucleotide probe. The oligonucleotide is bound to an immobilizing support which facilitates the immobilization and purification of target DNA molecules. Non-target DNA molecules and other contaminating cellular material are easily removed by washing. The triple-helical structure is destabilized by raising the pH, leaving purified target DNA in the supernatant and reusable affinity capture oligonucleotide secured to the immobilizing support. 3 figs.

Fluorescent triplex-forming DNA oligonucleotides labeled with a thiazole orange dimer unit

PubMed Central

Ikeda, Shuji; Yanagisawa, Hiroyuki; Yuki, Mizue; Okamoto, Akimitsu

2013-01-01

Fluorescent probes for the detection of a double-stranded DNA were prepared by labeling a triplex-forming DNA oligonucleotide with a thiazole orange (TO) dimer unit. They belong to ECHO (exciton-controlled hybridization-sensitive fluorescent oligonucleotide) probes which we have previously reported. The excitonic interaction between the two TO molecules was expected to effectively suppress the background fluorescence of the probes. The applicability of the ECHO probes for the detection of double-stranded DNA was confirmed by examining the thermal stability and photophysical and kinetic properties of the DNA triplexes formed by the ECHO probes. PMID:23445822

Polynucleotides. XXXII. Further studies on the synthesis of oligonucleotides containing 8,2'-S-cycloadenosine.

PubMed Central

Ikehara, M; Tezuka, T

1975-01-01

A dinucleoside monophosphate, 8,2'-anhydro-8-mercapto-9-beta-D-arabinofuranosyladenine phosphoryl-(3'-5')-inosine (AspI) was synthesized by the condensation of protected 8-mercapto-adenosine 2',3'-cyclic phosphate and 2',3'-isopropylideneinosine with diphenylphosphorochloridate. 8-Mercaptoadenosine 2',3'-cyclic phosphate was polymerized by using tetraphenyl pyrophosphate as the condensing reagent. As oligonucleotides, thus obtained, contained some uncyclized 8-mercaptoadenosine residues and were cleaved at these sites with 0.3N KOH. As 5'-phosphate was synthesized and polymerized with DCC to give oligonucleotides with chain lengths 2 to 9. PMID:170595

Nucleoside-O-Methyl-(H)-Phosphinates: Novel Monomers for the Synthesis of Methylphosphonate Oligonucleotides Using H-Phosphonate Chemistry.

PubMed

Kostov, Ondřej; Páv, Ondřej; Rosenberg, Ivan

2017-09-18

This unit comprises the straightforward synthesis of protected 2'-deoxyribonucleoside-O-methyl-(H)-phosphinates in both 3'- and 5'-series. These compounds represent a new class of monomers compatible with the solid-phase synthesis of oligonucleotides using H-phosphonate chemistry and are suitable for the preparation of both 3'- and 5'-O-methylphosphonate oligonucleotides. The synthesis of 4-toluenesulfonyloxymethyl-(H)-phosphinic acid as a new reagent for the preparation of O-methyl-(H)-phosphinic acid derivatives is described. © 2017 by John Wiley & Sons, Inc. Copyright © 2017 John Wiley & Sons, Inc.

FDA-Approved Oligonucleotide Therapies in 2017.

PubMed

Stein, Cy A; Castanotto, Daniela

2017-05-03

Oligonucleotides (oligos) have been under clinical development for approximately the past 30 years, beginning with antisense oligonucleotides (ASOs) and apatmers and followed about 15 years ago by siRNAs. During that lengthy period of time, numerous clinical trials have been performed and thousands of trial participants accrued onto studies. Of all the molecules evaluated as of January 2017, the regulatory authorities assessed that six provided clear clinical benefit in rigorously controlled trials. The story of these six is given in this review. Copyright © 2017 The American Society of Gene and Cell Therapy. Published by Elsevier Inc. All rights reserved.

An oral oligonucleotide delivery system based on a thiolated polymer: Development and in vitro evaluation.

PubMed

Martien, Ronny; Hoyer, Herbert; Perera, Glen; Schnürch, Andreas Bernkop

2011-08-01

The purpose of this study was to develop and evaluate an oral oligonucleotide delivery system based on a thiolated polymer/reduced glutathione (GSH) system providing a protective effect toward nucleases and permeation enhancement. A polycarbophil-cysteine conjugate (PCP-Cys) was synthesized. Enzymatic degradation of a model oligonucleotide by DNase I and within freshly collected intestinal fluid was investigated in the absence and presence of PCP-Cys. Permeation studies with PCP-Cys/GSH versus control were performed in vitro on Caco-2 cell monolayers and ex vivo on rat intestinal mucosa. PCP-Cys displayed 223 ± 13.8 μmol thiol groups per gram polymer. After 4h, 61% of the free oligonucleotides were degraded by DNase I and 80% within intestinal fluid. In contrast, less than 41% (DNase I) and 60% (intestinal fluid) were degraded in the presence of 0.02% (m/v) PCP-Cys. Permeation studies revealed an 8-fold (Caco-2) and 10-fold (intestinal mucosa) increase in apparent permeability compared to buffer control. Hence, this PCP-Cys/GSH system might be a promising tool for the oral administration of oligonucleotides as it allows a significant protection toward degrading enzymes and facilitates their transport across intestinal membranes. Copyright © 2011 Elsevier B.V. All rights reserved.

Development of species-specific rDNA probes for Giardia by multiple fluorescent in situ hybridization combined with immunocytochemical identification of cyst wall antigens.

PubMed

Erlandsen, Stanley L; Jarroll, Edward; Wallis, Peter; van Keulen, Harry

2005-08-01

In this study, we describe the development of fluorescent oligonucleotide probes to variable regions in the small subunit of 16S rRNA in three distinct Giardia species. Sense and antisense probes (17-22 mer) to variable regions 1, 3, and 8 were labeled with digoxygenin or selected fluorochomes (FluorX, Cy3, or Cy5). Optimal results were obtained with fluorochome-labeled oligonucleotides for detection of rRNA in Giardia cysts. Specificity of fluorescent in situ hybridization (FISH) was shown using RNase digestion and high stringency to diminish the hybridization signal, and oligonucleotide probes for rRNA in Giardia lamblia, Giardia muris, and Giardia ardeae were shown to specifically stain rRNA only within cysts or trophozoites of those species. The fluorescent oligonucleotide specific for rRNA in human isolates of Giardia was positive for ten different strains. A method for simultaneous FISH detection of cysts using fluorescent antibody (genotype marker) and two oligonucleotide probes (species marker) permitted visualization of G. lamblia and G. muris cysts in the same preparation. Testing of an environmental water sample revealed the presence of FISH-positive G. lamblia cysts with a specific rDNA probe for rRNA, while negative cysts were presumed to be of animal or bird origin.

A dual-colored ratiometric-fluorescent oligonucleotide probe for the detection of human telomerase RNA in cell extracts.

PubMed

Ning, Dianhua; He, Changtian; Liu, Zhengjie; Liu, Cui; Wu, Qilong; Zhao, TingTing; Liu, Renyong

2017-05-21

Human telomerase RNA (hTR), which is one component of telomerase, was deemed to be a biomarker to monitor tumor cells due to its different expression levels in tumor cells and normal somatic cells. Thus far, plentiful fluorescent probes have been designed to investigate nucleic acids. However, most of them are limited since they are time-consuming, require professional operators and even result in false positive signals in the cellular environment. Herein, we report a dual-colored ratiometric-fluorescent oligonucleotide probe to achieve the reliable detection of human telomerase RNA in cell extracts. The probe is constructed using a dual-labeled fluorescent oligonucleotide hybridized with target-complemented Dabcyl-labeled oligonucleotide. In the presence of the target, the dual-labeled fluorescent oligonucleotide translates into a hairpin structure, which leads to the generation of the fluorescence resonance energy transfer (FRET) phenomenon under UV excitation. Compared to conventional methods, this strategy could effectively avoid false positive signals, and it not only possesses the advantages of simplicity and high specificity but also has the merits of signal stability and distinguishable color variation. Moreover, the quantitative assay of hTR would have a far-reaching impact on the telomerase mechanism and even tumor diagnosis research.

Single-Cell in Situ RNA Analysis With Switchable Fluorescent Oligonucleotides.

PubMed

Xiao, Lu; Guo, Jia

2018-01-01

Comprehensive RNA analyses in individual cells in their native spatial contexts promise to transform our understanding of normal physiology and disease pathogenesis. Here we report a single-cell in situ RNA analysis approach using switchable fluorescent oligonucleotides (SFO). In this method, transcripts are first hybridized by pre-decoding oligonucleotides. These oligonucleotides subsequently recruit SFO to stain their corresponding RNA targets. After fluorescence imaging, all the SFO in the whole specimen are simultaneously removed by DNA strand displacement reactions. Through continuous cycles of target staining, fluorescence imaging, and SFO removal, a large number of different transcripts can be identified by unique fluorophore sequences and visualized at the optical resolution. To demonstrate the feasibility of this approach, we show that the hybridized SFO can be efficiently stripped by strand displacement reactions within 30 min. We also demonstrate that this SFO removal process maintains the integrity of the RNA targets and the pre-decoding oligonucleotides, and keeps them hybridized. Applying this approach, we show that transcripts can be restained in at least eight hybridization cycles with high analysis accuracy, which theoretically would enable the whole transcriptome to be quantified at the single molecule sensitivity in individual cells. This in situ RNA analysis technology will have wide applications in systems biology, molecular diagnosis, and targeted therapies.

Selective amplification of T-cell receptor variable region species is demonstrable but not essential in early lesions of psoriasis vulgaris: analysis by anchored polymerase chain reaction and hypervariable region size spectratyping.

PubMed

Vekony, M A; Holder, J E; Lee, A J; Horrocks, C; Eperon, I C; Camp, R D

1997-07-01

Several groups have investigated the role of T cells in the pathogenesis of psoriasis by determination of T-cell receptor (TCR) B-chain variable (V) region usage, both in chronic plaque (psoriasis vulgaris) and guttate forms, with various results. Because there are no data on TCR expression in early psoriasis vulgaris, when specific cellular immune events may be expected to be most pronounced, we have analyzed early lesions (less than 3 wk old) of ten patients, with highly reproducible results. We have developed a highly controlled anchored polymerase chain reaction (PCR) method in which TCR beta chain species are all amplified with the same primer pair and products are quantified by dot blot hybridization with BV family-specific oligonucleotide probes. Overexpression of certain TCR BV genes was observed in the majority of lesional biopsies, but in samples in which the expanded BV family formed more than 10% of total lesional BV (half of the samples analyzed), BV2 and BV6 predominated. The consistency of overexpression of these BV species between patients was much less than in previous studies of TCRBV usage in established chronic plaque psoriasis lesions. Complementarity-determining region 3 (CDR3) size spectratyping demonstrated evidence for selective clonal T cell accumulation in less than half of the lesional samples showing BV expansion. These results indicate that selective amplification of TCRBV species occurs in early psoriasis vulgaris but is not essential to the pathogenic process and may be more important in the maintenance or expansion of chronic lesions.

Thermodynamics of Oligonucleotide Duplex Melting

ERIC Educational Resources Information Center

Schreiber-Gosche, Sherrie; Edwards, Robert A.

2009-01-01

Melting temperatures of oligonucleotides are useful for a number of molecular biology applications, such as the polymerase chain reaction (PCR). Although melting temperatures are often calculated with simplistic empirical equations, application of thermodynamics provides more accurate melting temperatures and an opportunity for students to apply…

Gas-phase Reactivity of meta-Benzyne Analogs Toward Small Oligonucleotides of Differing Lengths

NASA Astrophysics Data System (ADS)

Widjaja, Fanny; Max, Joann P.; Jin, Zhicheng; Nash, John J.; Kenttämaa, Hilkka I.

2017-07-01

The gas-phase reactivity of two aromatic carbon-centered σ,σ-biradicals ( meta-benzyne analogs) and a related monoradical towards small oligonucleotides of differing lengths was investigated in a Fourier-transform ion cyclotron resonance (FT-ICR) mass spectrometer coupled with laser-induced acoustic desorption (LIAD). The mono- and biradicals were positively charged to allow for manipulation in the mass spectrometer. The oligonucleotides were evaporated into the gas phase as intact neutral molecules by using LIAD. One of the biradicals was found to be unreactive. The reactive biradical reacts with dinucleoside phosphates and trinucleoside diphosphates mainly by addition to a nucleobase moiety followed by cleavage of the glycosidic bond, leading to a nucleobase radical (e.g., base-H) abstraction. In some instances, after the initial cleavage, the unquenched radical site of the biradical abstracts a hydrogen atom from the neutral fragment, which results in a net nucleobase abstraction. In sharp contrast, the related monoradical mainly undergoes facile hydrogen atom abstraction from the sugar moiety. As the size of the oligonucleotides increases, the rate of hydrogen atom abstraction from the sugar moiety by the monoradical was found to increase due to the presence of more hydrogen atom donor sites, and it is the only reaction observed for tetranucleoside triphosphates. Hence, the monoradical only attacks sugar moieties in these substrates. The biradical also shows significant attack at the sugar moiety for tetranucleoside triphosphates. This drastic change in reactivity indicates that the size of the oligonucleotides plays a key role in the outcome of these reactions. This finding is attributed to more compact conformations in the gas phase for the tetranucleoside triphosphates than for the smaller oligonucleotides, which result from stronger stabilizing interactions between the nucleobases.

Identification of characteristic oligonucleotides in the bacterial 16S ribosomal RNA sequence dataset

NASA Technical Reports Server (NTRS)

Zhang, Zhengdong; Willson, Richard C.; Fox, George E.

2002-01-01

MOTIVATION: The phylogenetic structure of the bacterial world has been intensively studied by comparing sequences of 16S ribosomal RNA (16S rRNA). This database of sequences is now widely used to design probes for the detection of specific bacteria or groups of bacteria one at a time. The success of such methods reflects the fact that there are local sequence segments that are highly characteristic of particular organisms or groups of organisms. It is not clear, however, the extent to which such signature sequences exist in the 16S rRNA dataset. A better understanding of the numbers and distribution of highly informative oligonucleotide sequences may facilitate the design of hybridization arrays that can characterize the phylogenetic position of an unknown organism or serve as the basis for the development of novel approaches for use in bacterial identification. RESULTS: A computer-based algorithm that characterizes the extent to which any individual oligonucleotide sequence in 16S rRNA is characteristic of any particular bacterial grouping was developed. A measure of signature quality, Q(s), was formulated and subsequently calculated for every individual oligonucleotide sequence in the size range of 5-11 nucleotides and for 15mers with reference to each cluster and subcluster in a 929 organism representative phylogenetic tree. Subsequently, the perfect signature sequences were compared to the full set of 7322 sequences to see how common false positives were. The work completed here establishes beyond any doubt that highly characteristic oligonucleotides exist in the bacterial 16S rRNA sequence dataset in large numbers. Over 16,000 15mers were identified that might be useful as signatures. Signature oligonucleotides are available for over 80% of the nodes in the representative tree.

Iontophoretic transport of oligonucleotides across human epidermal membrane: a study of the Nernst-Planck model.

PubMed

Li, S K; Ghanem, A H; Teng, C L; Hardee, G E; Higuchi, W I

2001-07-01

The objective of this study was to investigate the transport behavior of a series of oligonucleotides with human epidermal membrane (HEM) and to examine the applicability of the modified NERNST-PLANCK model to transdermal iontophoresis of these macromolecules. Iontophoretic transport experiments were first carried out in a synthetic model membrane system (Nuclepore membranes) with a four-electrode potentiostat to examine the baseline modified NERNST-PLANCK model. The modified NERNST-PLANCK model derived from the Einstein relation and the Stokes-Einstein equation taken from previous work did not hold for the oligonucleotides. Results obtained in the Nuclepore studies were, however, consistent with predictions of the modified NERNST-PLANCK model using the experimentally determined electromobilities and diffusion coefficients. The electromobilities of the oligonucleotides (determined by capillary electrophoresis) were found to be more than a factor of two smaller than expected from the Einstein relation between electromobilities and diffusion coefficients (the latter determined in diffusion cell experiments). A correlation between these electromobilities and the theoretical electromobilities estimated by considering the effects of counterion binding and the effects of mobility reduction according to colloid theory was also observed. These results suggest that the modified NERNST-PLANCK model predictions are satisfactory only when the electromobilities and the effective molecular size of the oligonucleotides are known and are used directly to predict the iontophoretically enhanced transport. Results with the HEM experiments generally agreed with model predictions based on the experimental electromobilities. The oligonucleotide HEM flux data also suggest the existence of pores with effective pore radii greater than the effective radii estimated in previous studies with small molecular weight model permeants.

In vitro evaluation of phosphorothioate oligonucleotides targeted to the E2 mRNA of papillomavirus: potential treatment for genital warts.

PubMed Central

Cowsert, L M; Fox, M C; Zon, G; Mirabelli, C K

1993-01-01

Papillomaviruses induce benign proliferative lesions, such as genital warts, in humans. The E2 gene product is thought to play a major role in the regulation of viral transcription and DNA replication and may represent a rational target for an antisense oligonucleotide drug action. Phosphorothioate oligonucleotides complementary to E2 mRNAs were synthesized and tested in a series of in vitro bovine papillomavirus (BPV) and human papillomavirus (HPV) models for the ability to inhibit E2 transactivation and virus-induced focus formation. The most active BPV-specific compounds were complementary to the mRNA cap region (ISIS 1751), the translation initiation region for the full-length E2 transactivator (ISIS 1753), and the translation initiation region for the E2 transrepressor mRNA (ISIS 1755). ISIS 1751 and ISIS 1753 were found to reduce E2-dependent transactivation and viral focus formation in a sequence-specific and concentration-dependent manner. ISIS 1755 increased E2 transactivation in a dose-dependent manner but had no effect on focus formation. Oligonucleotides with a chain length of 20 residues had optimal activity in the E2 transactivation assay. On the basis of the above observations, ISIS 2105, a 20-residue phosphorothioate oligonucleotide targeted to the translation initiation of both HPV type 6 (HPV-6) and HPV-11 E2 mRNA, was designed and shown to inhibit E2-dependent transactivation by HPV-11 E2 expressed from a surrogate promoter. These observations support the rationale of E2 as a target for antiviral therapy against papillomavirus infections and specifically identify ISIS 2105 as a candidate antisense oligonucleotide for the treatment of genital warts induced by HPV-6 and HPV-11. Images PMID:8383937

Why Do Drivers Use Mobile Phones While Driving? The Contribution of Compensatory Beliefs

PubMed Central

Zhou, Ronggang; Yu, Mengli; Wang, Xinyi

2016-01-01

The current study is the first to investigate the contribution of compensatory beliefs (i.e., the belief that the negative effects of an unsafe behavior can be "neutralized" by engaging in another safe behavior; e.g., "I can use a mobile phone now because I will slow down ") on drivers’ mobile phone use while driving. The effects of drivers’ personal characteristics on compensatory beliefs, mobile phone use and self-regulatory behaviors were also examined. A series of questions were administered to drivers, which included (1) personal measures, (2) scales that measured compensatory beliefs generally in substance use and with regard to driving safety, and (3) questions to measure drivers’ previous primary mobile phone usage and corresponding self-regulatory actions. Overall, drivers reported a low likelihood of compensatory beliefs, prior mobile phone use, and a strong frequency of self-regulatory behaviors. Respondents who had a higher tendency toward compensatory beliefs reported more incidents or crash involvement caused by making or answering calls and sending or reading messages. The findings provide strong support for the contribution of compensatory beliefs in predicting mobile phone usage in the context of driving. Compensatory beliefs can explain 41% and 43% of the variance in the active activities of making calls and texting/sending messages compared with 18% and 31% of the variance in the passive activities of answering calls and reading messages. Among the regression models for predicting self-regulatory behaviors at the tactical or operational level, compensatory beliefs emerge as significant predictors only in predicting shorter conversations while on a call. The findings and limitations of the current study are discussed. PMID:27494524

Educational attainment has a limited impact on disease management outcomes in heart failure.

PubMed

Smith, Brad; Forkner, Emma; Krasuski, Richard A; Galbreath, Autumn Dawn; Freeman, Gregory L

2006-06-01

The objective of this study was to assess whether educational attainment moderates outcomes in the intervention group in a trial of disease management in heart failure (HF). Data were collected from a sample of 654 patients enrolled in the disease management arm of a community- based study of HF patients. The full sample was used to analyze two primary outcomes- all-cause mortality and cardiac event-free survival. Two other primary outcomes- rates of HF-related emergency department (ED) visits and inpatient admissions-and secondary outcomes (patient self-confidence in managing HF symptoms and daily dietary sodium intake in milligrams) were analyzed in a smaller sample of 602 patients who completed at least 6 months of disease management. One-way analysis of variance and chi (2) tests were used to assess differences in baseline demographic and clinical characteristics. Survival analyses were conducted with proportional hazards regression, while negative binomial regression was used to assess educational differences in ED usage and inpatient admissions. Repeated measures analysis of variance models were used to assess whether secondary outcomes differed across educational strata and/or over time. All outcome analyses were adjusted for confounders. Patients with the least education fared the poorest for all-cause mortality, but education- related differences failed to achieve statistical significance. No education-related differences were observed for cardiac event-free survival, or for the rates of inpatient admission and ED usage. For secondary outcomes, sodium intake differed significantly by education (p = 0.04), with the largest drop (-838 mg/day) observed in the least well-educated group. Confidence increased an approximately equal amount (2.1-3.0 points on a 100-point scale) across all educational strata (p = ns). Low educational attainment may not be a barrier to effective disease management.

Who uses NHS Direct? Investigating the impact of ethnicity on the uptake of telephone based healthcare.

PubMed

Cook, Erica J; Randhawa, Gurch; Large, Shirley; Guppy, Andy; Chater, Angel M; Pang, Dong

2014-11-07

NHS Direct, a leading telephone healthcare provider worldwide, provided 24/7 health care advice and information to the public in England and Wales (1998-2014). The fundamental aim of this service was to increase accessibility, however, research has suggested a disparity in the utilisation of this service related to ethnicity. This research presents the first national study to determine how the diverse population in England have engaged with this service. NHS Direct call data from the combined months of July, 2010 October, 2010, January 2011 and April, 2011 was analysed (N = 1,342, 245) for all 0845 4647 NHS Direct core service calls in England. Expected usage of NHS Direct was determined for each ethnic group of the population by age and gender and compared by actual usage using Chi-square analysis. A one-way analysis of variance (ANOVA) was used to determine variations of uptake by ethnic group and Index for Multiple Deprivation (IMD) 2010 rank. Results confirmed that all mixed ethnic groups (White and Black Caribbean, White and Black African, White and Asian) had a higher than expected uptake of NHS Direct which held consistent across all age groups. Lower than expected uptake was found for Black (African/Caribbean) and Asian (Bangladeshi/Indian/Chinese) ethnic group which held consistent by age and gender. For the Pakistani ethnic group usage was higher than expected in adults aged 40 years and older although was lower than expected in younger age groups (0-39). Findings support previous research suggesting a variation in usage of NHS Direct influenced by ethnicity, which is evidenced on a national level. Further research is now required to examine the underlying barriers that contribute to the ethnic variation in uptake of this service.

Analysis of phylogeny and codon usage bias and relationship of GC content, amino acid composition with expression of the structural nif genes.

PubMed

Mondal, Sunil Kanti; Kundu, Sudip; Das, Rabindranath; Roy, Sujit

2016-08-01

Bacteria and archaea have evolved with the ability to fix atmospheric dinitrogen in the form of ammonia, catalyzed by the nitrogenase enzyme complex which comprises three structural genes nifK, nifD and nifH. The nifK and nifD encodes for the beta and alpha subunits, respectively, of component 1, while nifH encodes for component 2 of nitrogenase. Phylogeny based on nifDHK have indicated that Cyanobacteria is closer to Proteobacteria alpha and gamma but not supported by the tree based on 16SrRNA. The evolutionary ancestor for the different trees was also different. The GC1 and GC2% analysis showed more consistency than GC3% which appeared to below for Firmicutes, Cyanobacteria and Euarchaeota while highest in Proteobacteria beta and clearly showed the proportional effect on the codon usage with a few exceptions. Few genes from Firmicutes, Euryarchaeota, Proteobacteria alpha and delta were found under mutational pressure. These nif genes with low and high GC3% from different classes of organisms showed similar expected number of codons. Distribution of the genes and codons, based on codon usage demonstrated opposite pattern for different orientation of mirror plane when compared with each other. Overall our results provide a comprehensive analysis on the evolutionary relationship of the three structural nif genes, nifK, nifD and nifH, respectively, in the context of codon usage bias, GC content relationship and amino acid composition of the encoded proteins and exploration of crucial statistical method for the analysis of positive data with non-constant variance to identify the shape factors of codon adaptation index.

Delivery of gene biotechnologies to plants: Pathogen and pest control

USDA-ARS?s Scientific Manuscript database

Treatment of oligonucleotides to plants for host delivered suppression of microbes and insect pests of citrus was successful. FANA_ASO, (2'-deoxy-2'-fluoro-D- arabinonucleic acid)_( antisense oligonucleotides- AUM LifeTech) designed to: Asian citrus psyllid; Citrus plant bacterial pathogen of citru...

A regenerated electrochemical biosensor for label-free detection of glucose and urea based on conformational switch of i-motif oligonucleotide probe.

PubMed

Gao, Zhong Feng; Chen, Dong Mei; Lei, Jing Lei; Luo, Hong Qun; Li, Nian Bing

2015-10-15

Improving the reproducibility of electrochemical signal remains a great challenge over the past decades. In this work, i-motif oligonucleotide probe-based electrochemical DNA (E-DNA) sensor is introduced for the first time as a regenerated sensing platform, which enhances the reproducibility of electrochemical signal, for label-free detection of glucose and urea. The addition of glucose or urea is able to activate glucose oxidase-catalyzed or urease-catalyzed reaction, inducing or destroying the formation of i-motif oligonucleotide probe. The conformational switch of oligonucleotide probe can be recorded by electrochemical impedance spectroscopy. Thus, the difference of electron transfer resistance is utilized for the quantitative determination of glucose and urea. We further demonstrate that the E-DNA sensor exhibits high selectivity, excellent stability, and remarkable regenerated ability. The human serum analysis indicates that this simple and regenerated strategy holds promising potential in future biosensing applications. Copyright © 2015 Elsevier B.V. All rights reserved.

The estimation of quantitative parameters of oligonucleotides immobilization on mica surface

NASA Astrophysics Data System (ADS)

Sharipov, T. I.; Bakhtizin, R. Z.

2017-05-01

Immobilization of nucleic acids on the surface of various materials is increasingly being used in research and some practical applications. Currently, the DNA chip technology is rapidly developing. The basis of the immobilization process can be both physical adsorption and chemisorption. A useful way to control the immobilization of nucleic acids on a surface is to use atomic force microscopy. It allows you to investigate the topography of the surface by its direct imaging with high resolution. Usually, to fix the DNA on the surface of mica are used cations which mediate the interaction between the mica surface and the DNA molecules. In our work we have developed a method for estimation of quantitative parameter of immobilization of oligonucleotides is their degree of aggregation depending on the fixation conditions on the surface of mica. The results on study of aggregation of oligonucleotides immobilized on mica surface will be presented. The single oligonucleotides molecules have been imaged clearly, whereas their surface areas have been calculated and calibration curve has been plotted.

Specific DNA duplex formation at an artificial lipid bilayer: towards a new DNA biosensor technology.

PubMed

Werz, Emma; Korneev, Sergei; Montilla-Martinez, Malayko; Wagner, Richard; Hemmler, Roland; Walter, Claudius; Eisfeld, Jörg; Gall, Karsten; Rosemeyer, Helmut

2012-02-01

A novel technique is described which comprises a base-specific DNA duplex formation at a lipid bilayer-H(2) O-phase boundary layer. Two different probes of oligonucleotides both carrying a double-tailed lipid at the 5'-terminus were incorporated into stable artificial lipid bilayers separating two compartments (cis/trans-channel) of an optically transparent microfluidic sample carrier with perfusion capabilities. Both the cis- and trans-channels are filled with saline buffer. Injection of a cyanine-5-labeled target DNA sequence, which is complementary to only one of the oligonucleotide probes, into the cis-channel, followed by a thorough perfusion, leads to an immobilization of the labeled complementary oligonucleotide on the membrane as detected by single-molecule fluorescence spectroscopy and microscopy. In the case of fluorescent but non-complementary DNA sequences, no immobilized fluorescent oligonucleotide duplex could be detected on the membrane. This clearly verifies a specific duplex formation at the membrane interface. Copyright © 2012 Verlag Helvetica Chimica Acta AG, Zürich.

OCaPPI-Db: an oligonucleotide probe database for pathogen identification through hybridization capture.

PubMed

Gasc, Cyrielle; Constantin, Antony; Jaziri, Faouzi; Peyret, Pierre

2017-01-01

The detection and identification of bacterial pathogens involved in acts of bio- and agroterrorism are essential to avoid pathogen dispersal in the environment and propagation within the population. Conventional molecular methods, such as PCR amplification, DNA microarrays or shotgun sequencing, are subject to various limitations when assessing environmental samples, which can lead to inaccurate findings. We developed a hybridization capture strategy that uses a set of oligonucleotide probes to target and enrich biomarkers of interest in environmental samples. Here, we present Oligonucleotide Capture Probes for Pathogen Identification Database (OCaPPI-Db), an online capture probe database containing a set of 1,685 oligonucleotide probes allowing for the detection and identification of 30 biothreat agents up to the species level. This probe set can be used in its entirety as a comprehensive diagnostic tool or can be restricted to a set of probes targeting a specific pathogen or virulence factor according to the user's needs. : http://ocappidb.uca.works. © The Author(s) 2017. Published by Oxford University Press.

Peroxide-mediated desulfurization of phosphorothioate oligonucleotides and its prevention.

PubMed

Krotz, Achim H; Mehta, Rahul C; Hardee, Gregory E

2005-02-01

Desulfurization at the internucleotide phosphorothioate linkage of antisense oligonucleotides (ASOs) in dermatological formulations has been investigated using strong ion exchange chromatography and mass spectroscopy. The formation of phosphate diester linkages appeared to arise from a reaction between the phosphorothioate oligonucleotide and a potent oxidizing agent. Screening of excipients used in the formulation indicated that the cause of desulfurization was related to the presence of polyethylene glycol-derived nonionic surfactants MYRJ 52 or BRIJ 58. Autoxidation of the polyethylene glycol chain is suggested as the probable origin for the observed incompatibility. The ability of various antioxidants to prevent oxidative degradation of ASO-1 in simple test systems and in oil-in-water emulsions is described. It is found that in test systems both lipophilic and hydrophilic antioxidants are effective. However, in cream formulation (oil-in-water emulsions) of ASO-1 the addition of hydrophilic antioxidants L-cysteine or DL-alpha-lipoic acid has been shown to be superior in protecting the oligonucleotide from desulfurization upon storage. Copyright 2004 Wiley-Liss, Inc.

Modulating nanoparticle superlattice structure using proteins with tunable bond distributions

DOE PAGES

McMillan, Janet R.; Brodin, Jeffrey D.; Millan, Jaime A.; ...

2017-01-25

Here, we investigate the use of proteins with tunable DNA modification distributions to modulate nanoparticle superlattice structure. Using Beta-galactosidase (βgal) as a model system, we have employed the orthogonal chemical reactivities of surface amines and thiols to synthesize protein-DNA conjugates with 36 evenly distributed or 8 specifically positioned oligonucleotides. When assembled into crystalline superlattices with AuNPs, we find that the distribution of DNA modifications modulates the favored structure: βgal with uniformly distributed DNA bonding elements results in body-centered cubic crystals, whereas DNA functionalization of cysteines results in AB 2 packing. We probe the role of protein oligonucleotide number and conjugatemore » size on this observation, which revealed the importance of oligonucleotide distribution and number in this observed assembly behavior. These results indicate that proteins with defined DNA-modification patterns are powerful tools to control the nanoparticle superlattices architecture, and establish the importance of oligonucleotide distribution in the assembly behavior of protein-DNA conjugates.« less

DNA/RNA heteroduplex oligonucleotide for highly efficient gene silencing

PubMed Central

Nishina, Kazutaka; Piao, Wenying; Yoshida-Tanaka, Kie; Sujino, Yumiko; Nishina, Tomoko; Yamamoto, Tsuyoshi; Nitta, Keiko; Yoshioka, Kotaro; Kuwahara, Hiroya; Yasuhara, Hidenori; Baba, Takeshi; Ono, Fumiko; Miyata, Kanjiro; Miyake, Koichi; Seth, Punit P.; Low, Audrey; Yoshida, Masayuki; Bennett, C. Frank; Kataoka, Kazunori; Mizusawa, Hidehiro; Obika, Satoshi; Yokota, Takanori

2015-01-01

Antisense oligonucleotides (ASOs) are recognized therapeutic agents for the modulation of specific genes at the post-transcriptional level. Similar to any medical drugs, there are opportunities to improve their efficacy and safety. Here we develop a short DNA/RNA heteroduplex oligonucleotide (HDO) with a structure different from double-stranded RNA used for short interfering RNA and single-stranded DNA used for ASO. A DNA/locked nucleotide acid gapmer duplex with an α-tocopherol-conjugated complementary RNA (Toc-HDO) is significantly more potent at reducing the expression of the targeted mRNA in liver compared with the parent single-stranded gapmer ASO. Toc-HDO also improves the phenotype in disease models more effectively. In addition, the high potency of Toc-HDO results in a reduction of liver dysfunction observed in the parent ASO at a similar silencing effect. HDO technology offers a novel concept of therapeutic oligonucleotides, and the development of this molecular design opens a new therapeutic field. PMID:26258894

Selective Detection of Peptide-Oligonucleotide Heteroconjugates Utilizing Capillary HPLC-ICPMS

NASA Astrophysics Data System (ADS)

Catron, Brittany; Caruso, Joseph A.; Limbach, Patrick A.

2012-06-01

A method for the selective detection and quantification of peptide:oligonucleotide heteroconjugates, such as those generated by protein:nucleic acid cross-links, using capillary reversed-phase high performance liquid chromatography (cap-RPHPLC) coupled with inductively coupled plasma mass spectrometry detection (ICPMS) is described. The selective detection of phosphorus as 31P+, the only natural isotope, in peptide-oligonucleotide heteroconjugates is enabled by the elemental detection capabilities of the ICPMS. Mobile phase conditions that allow separation of heteroconjugates while maintaining ICPMS compatibility were investigated. We found that trifluoroacetic acid (TFA) mobile phases, used in conventional peptide separations, and hexafluoroisopropanol/triethylamine (HFIP/TEA) mobile phases, used in conventional oligonucleotide separations, both are compatible with ICPMS and enable heteroconjugate separation. The TFA-based separations yielded limits of detection (LOD) of ~40 ppb phosphorus, which is nearly seven times lower than the LOD for HFIP/TEA-based separations. Using the TFA mobile phase, 1-2 pmol of a model heteroconjugate were routinely separated and detected by this optimized capLC-ICPMS method.

In Situ Identification of Cyanobacteria with Horseradish Peroxidase-Labeled, rRNA-Targeted Oligonucleotide Probes

PubMed Central

Schönhuber, Wilhelm; Zarda, Boris; Eix, Stella; Rippka, Rosmarie; Herdman, Michael; Ludwig, Wolfgang; Amann, Rudolf

1999-01-01

Individual cyanobacterial cells are normally identified in environmental samples only on the basis of their pigmentation and morphology. However, these criteria are often insufficient for the differentiation of species. Here, a whole-cell hybridization technique is presented that uses horseradish peroxidase (HRP)-labeled, rRNA-targeted oligonucleotides for in situ identification of cyanobacteria. This indirect method, in which the probe-conferred enzyme has to be visualized in an additional step, was necessary since fluorescently monolabeled oligonucleotides were insufficient to overstain the autofluorescence of the target cells. Initially, a nonfluorescent detection assay was developed and successfully applied to cyanobacterial mats. Later, it was demonstrated that tyramide signal amplification (TSA) resulted in fluorescent signals far above the level of autofluorescence. Furthermore, TSA-based detection of HRP was more sensitive than that based on nonfluorescent substrates. Critical points of the assay, such as cell fixation and permeabilization, specificity, and sensitivity, were systematically investigated by using four oligonucleotides newly designed to target groups of cyanobacteria. PMID:10049892

Effect of Molecular Crowding and Ionic Strength on the Isothermal Hybridization of Oligonucleotides

PubMed Central

Markarian, Marie Z.; Schlenoff, Joseph B.

2010-01-01

The isothermal hybridization of complimentary oligonucleotides, 15-mer, 25-mer, 35-mer, and a molecular beacon, was investigated under varying conditions of molecular crowding and ionic strength, using hypochromicity to follow strand pairing and polyethylene glycol as a crowding agent. Thermodynamic analysis of the results revealed the addition of counterions to the oligonucleotide backbones, Δψ, to be dependent on the strand G-C content and the molecular crowding. A decrease in Δψ was observed with both increasing GC% and solution PEG content. In contrast, the number of bound water molecules depended on the activity of Na+, where two regimes were observed. At aNa+⟨0.05 and increasing molecular crowding, water molecules were released into the DNA solutions and oligonucleotide pairing was favored with both increasing hydrophobic forces, while at aNa+≥0.05, water molecules were bound to the strands and the extent of double strand formation decreased with increasing PEG wt%. PMID:20701389

Therapeutic Antisense Oligonucleotides against Cancer: Hurdling to the Clinic

NASA Astrophysics Data System (ADS)

Moreno, Pedro; Pêgo, Ana

2014-10-01

Under clinical development since the early 90’s and with two successfully approved drugs (Fomivirsen and Mipomersen), oligonucleotide-based therapeutics have not yet delivered a clinical drug to the market in the cancer field. Whilst many pre-clinical data has been generated, a lack of understanding still exists on how to efficiently tackle all the different challenges presented for cancer targeting in a clinical setting. Namely, effective drug vectorization, careful choice of target gene or synergistic multi-gene targeting are surely decisive, while caution must be exerted to avoid potential toxic, often misleading off-target-effects. Here a brief overview will be given on the nucleic acid chemistry advances that established oligonucleotide technologies as a promising therapeutic alternative and ongoing cancer related clinical trials. Special attention will be given towards a perspective on the hurdles encountered specifically in the cancer field by this class of therapeutic oligonucleotides and a view on possible avenues for success is presented, with particular focus on the contribution from nanotechnology to the field.

Therapeutic antisense oligonucleotides against cancer: hurdling to the clinic

PubMed Central

Moreno, Pedro M. D.; Pêgo, Ana P.

2014-01-01

Under clinical development since the early 90's and with two successfully approved drugs (Fomivirsen and Mipomersen), oligonucleotide-based therapeutics has not yet delivered a clinical drug to the market in the cancer field. Whilst many pre-clinical data has been generated, a lack of understanding still exists on how to efficiently tackle all the different challenges presented for cancer targeting in a clinical setting. Namely, effective drug vectorization, careful choice of target gene or synergistic multi-gene targeting are surely decisive, while caution must be exerted to avoid potential toxic, often misleading off-target-effects. Here a brief overview will be given on the nucleic acid chemistry advances that established oligonucleotide technologies as a promising therapeutic alternative and ongoing cancer related clinical trials. Special attention will be given toward a perspective on the hurdles encountered specifically in the cancer field by this class of therapeutic oligonucleotides and a view on possible avenues for success is presented, with particular focus on the contribution from nanotechnology to the field. PMID:25353019

Mucin-mediated nanocarrier disassembly for triggered uptake of oligonucleotides as a delivery strategy for the potential treatment of mucosal tumours

NASA Astrophysics Data System (ADS)

Martirosyan, A.; Olesen, M. J.; Fenton, R. A.; Kjems, J.; Howard, K. A.

2016-06-01

This work demonstrates gastric mucin-triggered nanocarrier disassembly for release of antisense oligonucleotides and consequent unassisted cellular entry as a novel oral delivery strategy. A fluorescence activation-based reporter system was used to investigate the interaction and mucin-mediated disassembly of chitosan-based nanocarriers containing a 13-mer DNA oligonucleotide with a flanked locked RNA nucleic acid gapmer design. Gastric mucins were shown to trigger gapmer release from nanocarriers that was dependent on the interaction time, mucin concentration and N : P ratio with a maximal release at N : P 10. In contrast to siRNA, naked gapmers exhibited uptake into mucus producing HT-MTX mono-cultures and HT-MTX co-cultured with the carcinoma epithelial cell line Caco-2. Importantly, in vivo gapmer uptake was observed in epithelial tissue 30 min post-injection in murine intestinal loops. The findings present a mucosal design-based system tailored for local delivery of oligonucleotides that may maximize the effectiveness of gene silencing therapeutics within tumours at mucosal sites.This work demonstrates gastric mucin-triggered nanocarrier disassembly for release of antisense oligonucleotides and consequent unassisted cellular entry as a novel oral delivery strategy. A fluorescence activation-based reporter system was used to investigate the interaction and mucin-mediated disassembly of chitosan-based nanocarriers containing a 13-mer DNA oligonucleotide with a flanked locked RNA nucleic acid gapmer design. Gastric mucins were shown to trigger gapmer release from nanocarriers that was dependent on the interaction time, mucin concentration and N : P ratio with a maximal release at N : P 10. In contrast to siRNA, naked gapmers exhibited uptake into mucus producing HT-MTX mono-cultures and HT-MTX co-cultured with the carcinoma epithelial cell line Caco-2. Importantly, in vivo gapmer uptake was observed in epithelial tissue 30 min post-injection in murine intestinal loops. The findings present a mucosal design-based system tailored for local delivery of oligonucleotides that may maximize the effectiveness of gene silencing therapeutics within tumours at mucosal sites. Electronic supplementary information (ESI) available. See DOI: 10.1039/c5nr07206a

Kinetic and mechanistic analysis of dinucleotide and oligonucleotide formation from the 5'-phosphorimidazolide of adenosine on Na(+)-montmorillonite

NASA Technical Reports Server (NTRS)

Kawamura, K.; Ferris, J. P.

1994-01-01

The rate constants for the condensation reaction of the 5'-phosphorimidazolide of adenosine (ImpA) to form dinucleotides and oligonucleotides have been measured in the presence of Na(+)-volclay (a Na(+)-montmorillonite) in pH 8 aqueous solution at 25 degrees C. The rates of the reaction of ImpA with an excess of adenosine 5'-monophosphoramidate (NH2pA), P1,P2-diadenosine 5',5'-pyrophosphate (A5'ppA), or adenosine 5'-monophosphate (5'-AMP or pA) in the presence of the montmorillonite to form NH2pA3'pA, A5'ppA3'pA, and pA3'pA, respectively, were measured. Only 3',5'-linked products were observed. The magnitude of the rate constants decrease in the order NH2pA3'pA > A5'-ppA3'pA > pA3'pA. The binding of ImpA to montmorillonite was measured, and the adsorption isotherm was determined. The binding of ImpA to montmorillonite and the formation of higher oligonucleotides is not observed in the absence of salts. Mg2+ enhances binding and oligonucleotide formation more than Ca2+ and Na+. The rate constants for the oligonucleotide formation were determined from the reaction products formed from 10 to 40 mM ImpA in the presence of Na(+)-montmorillonite using the computer program SIMFIT. The magnitudes of the rate constants for the formation of oligonucleotides increased in the order 2-mer < 3-mer < 4-mer ... 7-mer. The rate constants for dinucleotide and trinucleotide formation are more than 1000 times larger than those measured in the absence of montmorillonite. The rate constants for the formation of dinucleotide, trinucleotide, and tetranucleotide are 41,2.6, and 3.7 times larger than those for the formation of oligo(G)s with a poly(C) template. The hydrolysis of ImpA was accelerated 35 times in the presence of the montmorillonite. The catalytic ability of montmorillonite to form dinucleotides and oligonucleotides is quantitatively evaluated and possible pathways for oligo(A) formation are proposed.

Oligonucleotide-based therapy for neurodegenerative diseases.

PubMed

Magen, Iddo; Hornstein, Eran

2014-10-10

Molecular genetics insight into the pathogenesis of several neurodegenerative diseases, such as Alzheimer׳s disease, Parkinson׳s disease, Huntington׳s disease and amyotrophic lateral sclerosis, encourages direct interference with the activity of neurotoxic genes or the molecular activation of neuroprotective pathways. Oligonucleotide-based therapies are recently emerging as an efficient strategy for drug development and these can be employed as new treatments of neurodegenerative states. Here we review advances in this field in recent years which suggest an encouraging assessment that oligonucleotide technologies for targeting of RNAs will enable the development of new therapies and will contribute to preservation of brain integrity. Copyright © 2014 Elsevier B.V. All rights reserved.

Inhibition of B cell proliferation by antisense DNA to both alpha and beta forms of Fc epsilon R II.

PubMed

Bhatti, L; Behle, K; Stevens, R H

1992-10-01

Epstein-Barr Virus (EBV) infection activates B lymphocyte proliferation through partially understood mechanisms, resulting in phenotypic changes, including the appearance of new antigens. One such antigen is Fc epsilon R II/CD-23 which may be relevant for B cell proliferation. We have used anti-sense oligonucleotides to study the importance of the two forms of this molecule for proliferation in the EBV-transformed, Fc epsilon R II +ve lymphoblastoid B cell line, RPMI 8866. Anti-sense oligodeoxynucleotides were generated to the two forms of Fc epsilon R II; Fc epsilon R IIa (alpha) and IIb (beta) which differ only in their intracytoplasmic domains. Addition of increasing concentrations of anti-sense oligonucleotides, ranging from 1 to 30 microM, significantly decreased cellular proliferation as measured by the incorporation of [3H]thymidine (inhibition range 8-88%). Optimum inhibition of cellular proliferation was apparent at 15 microM concentration of both anti-sense Fc epsilon R IIa and IIb (Fc epsilon R IIa, mean +/- SE = 75 +/- 7% inhibition, p less than 0.001; Fc epsilon R IIb, mean +/- SE = 71 +/- 7% inhibition, p less than 0.001). Anti-sense oligonucleotides complementary to the common part of Fc epsilon R II resulted in a similar inhibition of proliferation. Sense oligonucleotides did not induce significant inhibition. Preincubation of sense and anti-sense oligonucleotides resulted in an abrogation of proliferation inhibition. Moreover, none of these oligonucleotides had any effect on a Fc epsilon R II -ve cell line. Incubation with both anti-sense IIa and IIb resulted in additive, but not synergistic inhibition of proliferation. Addition of soluble Fc epsilon R II did not reverse inhibition of proliferation, suggesting that membrane-bound or intracellular rather than soluble Fc epsilon R II was important for the induced proliferation. Analysis of cell surface expression for Fc epsilon II indicated that while there was a pronounced effect on cell number following incubation with anti-sense oligonucleotides, surface expression of Fc epsilon R II was consistent as measured over different time points. PCR analysis revealed that while most cells expressed either the alpha or the beta form of Fc epsilon R II, EBV-transformed cell lines, particularly RPMI 8866, were found to express both alpha and beta forms simultaneously. This may constitute a mechanism whereby EBV infection confers an immortal state to the cell, resulting in its uncontrolled proliferation. Cell lines expressing only one receptor form, either alpha or beta, were unaffected after incubation with anti-sense oligonucleotides.(ABSTRACT TRUNCATED AT 400 WORDS)

Liver as a target for oligonucleotide therapeutics.

PubMed

Sehgal, Alfica; Vaishnaw, Akshay; Fitzgerald, Kevin

2013-12-01

Oligonucleotide-based therapeutics are an emerging class of drugs that hold the promise for silencing "un-druggable" targets,thus creating unique opportunities for innovative medicines. As opposed to gene therapy, oligonucleotides are considered to be more akin to small molecule therapeutics because they are small,completely synthetic in origin, do not integrate into the host genome,and have a defined duration of therapeutic activity after which effects recover to baseline. They offer a high degree of specificity at the genetic level, thereby reducing off-target effects.At the same time, they provide a strategy for targeting any gene in the genome, including transcripts that produce mutated proteins.Oligonucleotide-based therapeutics include short interfering RNA (siRNA), that degrade target mRNA through RISC mediated RNAi; anti-miRs, that target miRNAs; miRNA mimics, that regulate target mRNA; antisense oligonucleotides, that may be working through RNAseH mediated mRNA decay; mRNA upregulation,by targeting long non-coding RNAs; and oligonucleotides induced alternative splicing [1]. All these approaches require some minimal degree of homology at the nucleic acid sequence level for them to be functional. The different mechanisms of action and their relevant activity are outlined in Fig. 1. Besides homology,RNA secondary structure has also been exploited in the case of ribozymes and aptamers, which act by binding to nucleic acids or proteins, respectively. While there have been many reports of gene knockdown and gene modulation in cell lines and mice with all these methods, very few have advanced to clinical stages.The main obstacle to date has been the safe and effective intracellular delivery of these compounds in higher species, including humans. Indeed, their action requires direct interaction with DNA/RNA within the target cell so even when one solves the issues of tissue and cellular access, intracellular/intranuclear location represents yet another barrier to overcome. To date,hepatic delivery of oligonucleotides has been the area with greatest progress, and thus we have focused on liver-targeted therapeutics that have shown promise at the preclinical and/or clinical level.The liver is the largest internal organ in the body, playing a central role in metabolism, detoxification, synthesis, and secretion of major plasma proteins (carrier proteins, coagulation factors,complement components, hormones, and apolipoproteins),and iron homeostasis. It is therefore not surprising that a large number of disease targets reside in the liver where they are susceptible to modulation by oligonucleotide therapies.

The high stability of the triple helices formed between short purine oligonucleotides and SIV/HIV-2 vpx genes is determined by the targeted DNA structure.

PubMed Central

Svinarchuk, F; Monnot, M; Merle, A; Malvy, C; Fermandjian, S

1995-01-01

In our previous works we have shown that the oligonucleotides 5'-GGGGAGGGGGAGG-3' and 5'-GGAGGGGGAGGGG-3' give very stable and specific triplexes with their target double stranded DNAs [Svinarchuk, F., Bertrand, J.-R. and Malvy, C. (1994) Nucleic Acids Res., 22, 3742-3747; Svinarchuk, F., Paoletti, J. and Malvy, C. (1995) J. Biol. Chem., 270, 14 068-14,071]. The target for the invariable part of these oligonucleotides, 5'-GGAGGGGGAGG-3', is found in a highly conserved 20 bp long purine/pyrimidine tract of the vpx gene of the SIV and HIV-2 viruses and could be a target for oligonucleotide directed antivirus therapy. Here were report on the ability of four purine oligonucleotides with different lengths (11-, 14-, 17- and 20-mer) to form triplexes with the purine/pyrimidine stretch of the vpx gene. Triplex formation was tested by joint dimethyl sulfate (DMS) footprint, gel-retardation assay, circular dichroism (CD) and UV-melting studies. Dimethyl sulfate footprint studies revealed the antiparallel orientation of the third strand to the purine strand of the Watson-Crick duplex. However, the protection of the guanines at the ends of the target sequence decreased as the length of the third strand oligonucleotide increased. Melting temperature studies provided profiles with only one transition for all of the triplexes. The melting temperatures of the triplexes were found to be the same as for the targeted duplex in the case of the 11- and 14-mer third strands while for the 17- and 20-mer third strands the melting temperature of the triplexes were correspondingly 4 and 8 degrees C higher than for the duplex. Heating and cooling melting curves were reversible for all of the tested triplexes except one with the 20-mer third strand oligonucleotide. Circular dichroism spectra showed the ability of the target DNA to adopt an A-like DNA conformation. Upon triplex formation the A-DNA form becomes even more pronounced. This effect depends on the length of the third strand oligonucleotide: the CD spectrum shows a 'classical' A-DNA shape with the 20-mer. This is not observed with the purine/pyrimidine stretch of the HIV-1 DNA which keeps a B-like spectrum even after triplex formation. We suggest, that an A-like duplex DNA is required for the formation of a stable DNA purine(purine-pyrimidine) triplex. Images PMID:7479024

Self-regulatory skills usage strengthens the relations of self-efficacy for improved eating, exercise, and weight in the severely obese: toward an explanatory model.

PubMed

Annesi, James J

2011-07-01

Lack of success with behavioral weight-management treatments indicates a need for a better understanding of modifiable psychological correlates. Adults with class 2 and 3 obesity (N = 183; Mean(BMI) = 42.0 kg/m(2)) volunteered for a 26-week nutrition and exercise treatment, based on social cognitive theory, that focused on self-efficacy and self-regulation applied to increasing cardiovascular exercise and fruit and vegetable consumption. Improved self-efficacy for controlled eating significantly predicted increased fruit and vegetable consumption (R(2) = .15). Improved self-efficacy for exercise significantly predicted increased exercise (R(2) = .46). When changes in self-regulatory skill usage were stepped into the 2 previous equations, the variances accounted for significantly increased. Increases in fruit and vegetable consumption and exercise significantly predicted weight loss (R(2) = .38). Findings suggest that behavioral theory should guide research on weight-loss treatment, and a focus on self-efficacy and self-regulatory skills applied to specific nutrition and exercise behaviors is warranted.

Theoretical and practical investigation into sustainable metal joining process for the automotive industry

NASA Astrophysics Data System (ADS)

Al-Jader, M. A.; Cullen, J. D.; Shaw, Andy; Al-Shamma'a, A. I.

2011-08-01

Currently there are about 4300 weld points on the average steel vehicle. Errors and problems due to tip damage and wear can cause great losses due to production line downtime. Current industrial monitoring systems check the quality of the nugget after processing 15 cars average once every two weeks. The nuggets are examined off line using a destructive process, which takes approximately 10 days to complete causing a long delay in the production process. In this paper a simulation results using software package, SORPAS, will be presented to determined the sustainability factors in spot welding process including Voltage, Current, Force, Water cooling rates, Material thicknesses and usage. The experimental results of various spot welding processes will be investigated and reported. The correlation of experimental results shows that SORPAS simulations can be used as an off line measurement to reduce factory energy usage. This paper also provides an overview of electrode current selection and its variance over the lifetime of the electrode tip, and describes the proposed analysis system for the selection of welding parameters for the spot welding process, as the electrode tip wears.

Pyrophosphorolytic dismutation of oligodeoxy-nucleotides by terminal deoxynucleotidyltransferase.

PubMed Central

Anderson, R S; Bollum, F J; Beattie, K L

1999-01-01

Terminal transferase (TdT), when incubated with a purified(32)P-5"-end-labeled oligonucleotide of defined length in the presence of Co(2+), Mn(2+)or Mg(2+)and 2-mercaptoethanol in cacodylate or HEPES buffer, pH 7.2, exhibits the ability to remove a 3"-nucleotide from one oligonucleotide and add it to the 3"-end of another. When analyzed by urea-PAGE, this activity is observed as a disproportionation of the starting oligonucleotide into a ladder of shorter and longer oligonucleotides distributed around the starting material. Optimal metal ion concentration is 1-2 mM. All three metal ions support this activity with Co(2+)> Mn(2+) congruent with Mg(2+). Oligonucleotides p(dT) and p(dA) are more efficient substrates than p(dG) and p(dC) because the latter may form secondary structures. The dismutase activity is significant even in the presence of dNTP concentrations comparable to those that exist in the nucleus during the G(1)phase of the cell cycle. Using BetaScope image analysis the rate of pyrophosphorolytic dismutase activity was found to be only moderately slower than the poly-merization activity. These results may help explain the GC-richness of immunoglobulin gene segment joins (N regions) and the loss of bases that occur during gene rearrangements in pre-B and pre-T cells. PMID:10454617

The illusion of specific capture: surface and solution studies of suboptimal oligonucleotide hybridization

PubMed Central

2013-01-01

Background Hybridization based assays and capture systems depend on the specificity of hybridization between a probe and its intended target. A common guideline in the construction of DNA microarrays, for instance, is that avoiding complementary stretches of more than 15 nucleic acids in a 50 or 60-mer probe will eliminate sequence specific cross-hybridization reactions. Here we present a study of the behavior of partially matched oligonucleotide pairs with complementary stretches starting well below this threshold complementarity length – in silico, in solution, and at the microarray surface. The modeled behavior of pairs of oligonucleotide probes and their targets suggests that even a complementary stretch of sequence 12 nt in length would give rise to specific cross-hybridization. We designed a set of binding partners to a 50-mer oligonucleotide containing complementary stretches from 6 nt to 21 nt in length. Results Solution melting experiments demonstrate that stable partial duplexes can form when only 12 bp of complementary sequence are present; surface hybridization experiments confirm that a signal close in magnitude to full-strength signal can be obtained from hybridization of a 12 bp duplex within a 50mer oligonucleotide. Conclusions Microarray and other molecular capture strategies that rely on a 15 nt lower complementarity bound for eliminating specific cross-hybridization may not be sufficiently conservative. PMID:23445545

Retention of nucleic acids in ion-pair reversed-phase high-performance liquid chromatography depends not only on base composition but also on base sequence.

PubMed

Qiao, Jun-Qin; Liang, Chao; Wei, Lan-Chun; Cao, Zhao-Ming; Lian, Hong-Zhen

2016-12-01

The study on nucleic acid retention in ion-pair reversed-phase high-performance liquid chromatography mainly focuses on size-dependence, however, other factors influencing retention behaviors have not been comprehensively clarified up to date. In this present work, the retention behaviors of oligonucleotides and double-stranded DNAs were investigated on silica-based C 18 stationary phase by ion-pair reversed-phase high-performance liquid chromatography. It is found that the retention of oligonucleotides was influenced by base composition and base sequence as well as size, and oligonucleotides prone to self-dimerization have weaker retention than those not prone to self-dimerization but with the same base composition. However, homo-oligonucleotides are suitable for the size-dependent separation as a special case of oligonucleotides. For double-stranded DNAs, the retention is also influenced by base composition and base sequence, as well as size. This may be attributed to the interaction of exposed bases in major or minor grooves with the hydrophobic alky chains of stationary phase. In addition, no specific influence of guanine and cytosine content was confirmed on retention of double-stranded DNAs. Notably, the space effect resulted from the stereostructure of nucleic acids also influences the retention behavior in ion-pair reversed-phase high-performance liquid chromatography. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Stabilizing effect of propionic acid derivative of anthraquinone--polyamine conjugate incorporated into α-β chimeric oligonucleotides on the alternate-stranded triple helix.

PubMed

Moriguchi, Tomohisa; Azam, A T M Zafrul; Shinozuka, Kazuo

2011-06-15

Two types of anthraquinone conjugates were synthesized as non-nucleosidic oligonucleotide components. These include an anthraquinone derivative conjugated with 2,2-bis(hydroxymethyl)propionic acid and an anthraquinone--polyamine derivative conjugated with 2,2-bis(hydroxymethyl)propionic acid. The conjugates were successfully incorporated into the "linking-region" of the α-β chimeric oligonucleotides via phosphoramidite method as non-nucleosidic backbone units. The resultant novel α-β chimeric oligonucleotides possessed two diastereomers that were generated by the introduction of the anthraquinone conjugate with a stereogenic carbon atom. The isomers were successfully separated by a reversed-phase HPLC. UV-melting experiments revealed that both stereoisomers formed a substantially stable alternate-strand triple helix, irrespective of the stereochemistry of the incorporated non-nucleosidic backbone unit. However, the enhancing effect on thermal stability depended on the length of the alkyl linker connecting anthraquinone moiety and the propionic acid moiety. The sequence discrimination ability of the chimeric oligonucleotides toward mismatch target duplex was also examined. The T(m) values of the triplexes containing the mismatch target were substantially lower than the T(m) values of those containing the full-match target. The thermodynamic parameters (ΔH°, ΔS°, and ΔG°) required for the dissociation of the triplexes into the third strand and target duplex were also measured.

Identification of clinically relevant viridans streptococci by an oligonucleotide array.

PubMed

Chen, Chao Chien; Teng, Lee Jene; Kaiung, Seng; Chang, Tsung Chain

2005-04-01

Viridans streptococci (VS) are common etiologic agents of subacute infective endocarditis and are capable of causing a variety of pyogenic infections. Many species of VS are difficult to differentiate by phenotypic traits. An oligonucleotide array based on 16S-23S rRNA gene intergenic spacer (ITS) sequences was developed to identify 11 clinically relevant VS. These 11 species were Streptococcus anginosus, S. constellatus, S. gordonii, S. intermedius, S. mitis, S. mutans, S. oralis, S. parasanguinis, S. salivarius, S. sanguinis, and S. uberis. The method consisted of PCR amplification of the ITS regions by using a pair of universal primers, followed by hybridization of the digoxigenin-labeled PCR products to a panel of species-specific oligonucleotides immobilized on a nylon membrane. After 120 strains of the 11 species of VG and 91 strains of other bacteria were tested, the sensitivity and specificity of the oligonucleotide array were found to be 100% (120 of 120 strains) and 95.6% (87 of 91 strains), respectively. S. pneumoniae cross-hybridized to the probes used for the identification of S. mitis, and simple biochemical tests such as optochin susceptibility or bile solubility should be used to differentiate S. pneumoniae from S. mitis. In conclusion, identification of species of VS by use of the present oligonucleotide array is accurate and could be used as an alternative reliable method for species identification of strains of VS.

PCSK9 LNA antisense oligonucleotides induce sustained reduction of LDL cholesterol in nonhuman primates.

PubMed

Lindholm, Marie W; Elmén, Joacim; Fisker, Niels; Hansen, Henrik F; Persson, Robert; Møller, Marianne R; Rosenbohm, Christoph; Ørum, Henrik; Straarup, Ellen M; Koch, Troels

2012-02-01

Proprotein convertase subtilisin/kexin type 9 (PCSK9) has emerged as a therapeutic target for the reduction of low-density lipoprotein cholesterol (LDL-C). PCSK9 increases the degradation of the LDL receptor, resulting in high LDL-C in individuals with high PCSK9 activity. Here, we show that two locked nucleic acid (LNA) antisense oligonucleotides targeting PCSK9 produce sustained reduction of LDL-C in nonhuman primates after a loading dose (20 mg/kg) and four weekly maintenance doses (5 mg/kg). PCSK9 messenger RNA (mRNA) and serum PCSK9 protein were reduced by 85% which resulted in a 50% reduction in circulating LDL-C. Serum total cholesterol (TC) levels were reduced to the same extent as LDL-C with no reduction in high-density lipoprotein levels, demonstrating a specific pharmacological effect on LDL-C. The reduction in hepatic PCSK9 mRNA correlated with liver LNA oligonucleotide content. This verified that anti-PCSK9 LNA oligonucleotides regulated LDL-C through an antisense mechanism. The compounds were well tolerated with no observed effects on toxicological parameters (liver and kidney histology, alanine aminotransferase, aspartate aminotransferase, urea, and creatinine). The pharmacologic evidence and initial safety profile of the compounds used in this study indicate that LNA antisense oligonucleotides targeting PCSK9 provide a viable therapeutic strategy and are potential complements to statins in managing high LDL-C.

Mechanistic Studies of Oligonucleotide Aptamers With Potent Antiproliferative and Pro-Apoptotic Activity Against Prostate Cancer Cells

DTIC Science & Technology

2007-05-01

AD_________________ Award Number: W81XWH-04-1-0183 TITLE: Mechanistic Studies of Oligonucleotide...Ph.D. CONTRACTING ORGANIZATION: University of Louisville...Louisville, KY 40292-0001 REPORT DATE: May 2007 TYPE OF REPORT: Final PREPARED FOR: U.S. Army Medical Research and Materiel Command

Gene expression profiling of anti-GBM glomerulonephritis model: the role of NF-kappaB in immune complex kidney disease.

PubMed

Kim, Ju Han; Ha, Il Soo; Hwang, Chang-Il; Lee, Young-Ju; Kim, Jihoon; Yang, Seung-Hee; Kim, Yon Su; Cao, Yun Anna; Choi, Sangdun; Park, Woong-Yang

2004-11-01

Immune complexes may cause an irreversible onset of chronic renal disease. Most patients with chronic renal disease undergo a final common pathway, marked by glomerulosclerosis and interstitial fibrosis. We attempted to draw a molecular map of anti-glomerular basement membrane (GBM) glomerulonephritis in mice using oligonucleotide microarray technology. Kidneys were harvested at days 1, 3, 7, 11, and 16 after inducing glomerulonephritis by using anti-GBM antibody. In parallel with examining the biochemical and histologic changes, gene expression profiles were acquired against five pooled control kidneys. Gene expression levels were cross-validated by either reverse transcription-polymerase chain reaction (RT-PCR), real-time PCR, or immunohistochemistry. Pathologic changes in anti-GBM glomerulonephritis were confirmed in both BALB/c and C57BL/6 strains. Among the 13,680 spotted 65mer oligonucleotides, 1112 genes showing significant temporal patterns by permutation analysis of variance (ANOVA) with multiple testing correction [false discovery ratio (FDR) < 0.05] were chosen for cluster analysis. From the expression profile, acute inflammatory reactions characterized by the elevation of various cytokines, including interleukin (IL)-1 and IL-6, were identified within 3 days of disease onset. After 7 days, tissue remodeling response was prominent with highly induced extracellular-matrix (ECM) genes. Although cytokines related to lymphocyte activation were not detected, monocyte or mesangial cell proliferation-related genes were increased. Tumor necrosis factor-alpha (TNF-alpha) and nuclear factor-kappaB (NF-kappaB) pathway were consistently activated along the entire disease progression, inducing various target genes like complement 3, IL-1b, IL-6, Traf1, and Saa1. We made a large-scale gene expression time table for mouse anti-GBM glomerulonephritis model, providing a comprehensive overview on the mechanism governing the initiation and the progression of inflammatory renal disease.

The Dimensions of Facebook Addiction as Measured by Facebook Addiction Italian Questionnaire and Their Relationships with Individual Differences.

PubMed

Caci, Barbara; Cardaci, Maurizio; Scrima, Fabrizio; Tabacchi, Marco Elio

2017-04-01

The studies reported analyze the factorial structure of Facebook Addiction Italian Questionnaire (FAIQ), a variant of 20-item Young's Internet Addiction Test (IAT). In Study 1, we tested FAIQ psychometric properties using exploratory factor analysis (EFA). In Study 2, we performed a confirmatory factor analysis (CFA) to verify the FAIQ factorial structure identified through EFA. Results from CFA confirm the presence of a four-factor model accounting for 58 percent of total variance, plus a general higher order factor that best fits the data. Further relationships between FAIQ factor scores, personality, and Facebook usage have been explored.

Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3;-terminus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yeo, Hyun Koo; Lee, Jae Young

2012-04-18

The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapor diffusion and diffracted to 2.8 {angstrom} resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 {angstrom}, {alpha} = 91.37, {beta} = 93.21, {gamma} = 92.35{sup o}.

Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus.

PubMed

Yeo, Hyun Koo; Lee, Jae Young

2010-05-01

The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapour diffusion and diffracted to 2.8 A resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 A, alpha = 91.37, beta = 93.21, gamma = 92.35 degrees .

ASSESSMENT OF THE SWINE PROTEIN-ANNOTATED OLIGONUCLEOTIDE MICROARRAY AND UTILITY OF THE ARRAYS FOR EQTL AND TRANSCRIPTIONAL PROFILING STUDIES

USDA-ARS?s Scientific Manuscript database

We have evaluated the new Swine Protein-Annotated Oligonucleotide Microarray (http://www.pigoligoarray.org) by analyzing transcriptional profiles for longissimus dorsi muscle (LD), Bronchial lymph node (BLN) and Lung. Four LD samples were used to assess the stringency of hybridization conditions com...

Protein-RNA crosslinking in Escherichia coli 30S ribosomal subunits. Identification of a 16S rRNA fragment crosslinked to protein S12 by the use of the chemical crosslinking reagent 1-ethyl-3-dimethyl-aminopropylcarbodiimide.

PubMed Central

Chiaruttini, C; Expert-Bezançon, A; Hayes, D; Ehresmann, B

1982-01-01

1-ethyl-3-dimethyl aminopropylcarbodiimide (EDC) was used to cross-link 30S ribosomal proteins to 16S rRNA within the E. coli 3OS ribosomal subunit. Covalently linked complexes containing 30S proteins and 16S rRNA, isolated by sedimentation of dissociated crosslinked 30S subunits through SDS containing sucrose gradients, were digested with RNase T1, and the resulting oligonucleotide-protein complexes were fractionated on SDS containing polyacrylamide gels. Eluted complexes containing 30S proteins S9 and S12 linked to oligonucleotides were obtained in pure form. Oligonucleotide 5'terminal labelling was successful in the case of S12 containing but not of the S9 containing complex and led to identification of the S12 bound oligonucleotide as CAACUCG which is located at positions 1316-1322 in the 16S rRNA sequence. Protein S12 is crosslinked to the terminal G of this heptanucleotide. Images PMID:6760129

Structural properties of oligonucleotide monolayers on gold surfaces probed by fluorescence investigations.

PubMed

Rant, Ulrich; Arinaga, Kenji; Fujita, Shozo; Yokoyama, Naoki; Abstreiter, Gerhard; Tornow, Marc

2004-11-09

We present optical investigations on the conformation of oligonucleotide layers on Au surfaces. Our studies concentrate on the effect of varying surface coverage densities on the structural properties of layers of 12- and 24mer single-stranded DNA, tethered to the Au surface at one end while being labeled with a fluorescent marker at the opposing end. The distance-dependent energy transfer from the marker dye to the metal surface, which causes quenching of the observed fluorescence, is used to provide information on the orientation of the DNA strands relative to the surface. Variations in the oligonucleotide coverage density, as determined from electrochemical quantification, over 2 orders of magnitude are achieved by employing different preparation conditions. The observed enhancement in fluorescence intensity with increasing DNA coverage can be related to a model involving mutual steric interactions of oligonucleotides on the surface, as well as fluorescence quenching theory. Finally, the applicability of the presented concepts for investigations of heterogeneous monolayers is demonstrated by means of studying the coadsorption of mercaptohexanol onto DNA-modified Au surfaces.

Discrimination of heterogenous mRNAs encoding strychnine-sensitive glycine receptors in Xenopus oocytes by antisense oligonucleotides.

PubMed Central

Akagi, H; Patton, D E; Miledi, R

1989-01-01

Three synthetic oligodeoxynucleotides complementary to different parts of an RNA encoding a glycine receptor subunit were used to discriminate heterogenous mRNAs coding for glycine receptors in adult and neonatal rat spinal cord. Injection of the three antisense oligonucleotides into Xenopus oocytes specifically inhibited the expression of glycine receptors by adult spinal cord mRNA. In contrast, the antisense oligonucleotides were much less potent in inhibiting the expression of glycine receptors encoded by neonatal spinal cord mRNA. Northern blot analysis revealed that the oligonucleotides hybridized mostly to an adult cord transcript of approximately 10 kilobases in size. This band was also present in neonatal spinal cord mRNA but its density was about one-fourth of the adult cord message. There was no intense band in the low molecular weight position (approximately 2 kilobases), the existence of which was expected from electrophysiological studies with size-fractionated mRNA of neonatal spinal cord. Our results suggest that in the rat spinal cord there are at least three different types of mRNAs encoding functional strychnine-sensitive glycine receptors. Images PMID:2479016

Use of continuous/contiguous stacking hybridization as a diagnostic tool

DOEpatents

Mirzabekov, Andrei Darievich; Kirillov, Eugene Vladislavovich; Parinov, Sergei Valeryevich; Barski, Victor Evgenievich; Dubiley, Svetlana Alekseevna

2002-01-01

A method for detecting disease-associated alleles in patient genetic material is provided whereby a first group of oligonucleotide molecules, synthesized to compliment base sequences of the disease associated alleles is immobilized on a predetermined position on a substrate, and then contacted with patient genetic material to form duplexes. The duplexes are then contacted with a second group of oligonucleotide molecules which are synthesized to extend the predetermined length of the oligonucleotide molecules of the first group, and where each of the oligonucleotide molecules of the second group are tagged and either incorporate universal bases or a mixture of guanine, cytosine, thymine, and adenine, or complementary nucleotide strands that are tagged with a different fluorochrome which radiates light at a predetermined wavelength. The treated substrate is then washed and the light patterns radiating therefrom are compared with predetermined light patterns of various diseases that were prepared on identical substrates. A method is also provided for determining the length of a repeat sequence in DNA or RNA, and also for determining the base sequence of unknown DNA or RNA.

Use of continuous/contiguous stacking hybridization as a diagnostic tool

DOEpatents

Mirzabekov, Andrei Darievich; Kirillov, Eugene Vladislavovich; Parinov, Sergei Valeryevich; Barski, Victor Evgenievich; Dubiley, Svetlana Alekseevna

2000-01-01

A method for detecting disease-associated alleles in patient genetic material is provided whereby a first group of oligonucleotide molecules, synthesized to compliment base sequences of the disease associated alleles is immobilized on a predetermined position on a substrate, and then contacted with patient genetic material to form duplexes. The duplexes are then contacted with a second group of oligonucleotide molecules which are synthesized to extend the predetermined length of the oligonucleotide molecules of the first group, and where each of the oligonucleotide molecules of the second group are tagged and either incorporate universal bases or a mixture of guanine, cytosine, thymine, and adenine, or complementary nucleotide strands that are tagged with a different fluorochrome which radiates light at a predetermined wavelength. The treated substrate is then washed and the light patterns radiating therefrom are compared with predetermined light patterns of various diseases that were prepared on identical substrates. A method is also provided for determining the length of a repeat sequence in DNA or RNA, and also for determining the base sequence of unknown DNA or RNA.

Targeting the r(CGG) repeats that cause FXTAS with modularly assembled small molecules and oligonucleotides.

PubMed

Tran, Tuan; Childs-Disney, Jessica L; Liu, Biao; Guan, Lirui; Rzuczek, Suzanne; Disney, Matthew D

2014-04-18

We designed small molecules that bind the structure of the RNA that causes fragile X-associated tremor ataxia syndrome (FXTAS), an incurable neuromuscular disease. FXTAS is caused by an expanded r(CGG) repeat (r(CGG)(exp)) that inactivates a protein regulator of alternative pre-mRNA splicing. Our designed compounds modulate r(CGG)(exp) toxicity in cellular models of FXTAS, and pull-down experiments confirm that they bind r(CGG)(exp) in vivo. Importantly, compound binding does not affect translation of the downstream open reading frame (ORF). We compared molecular recognition properties of our optimal compound to oligonucleotides. Studies show that r(CGG)(exp)'s self-structure is a significant energetic barrier for oligonucleotide binding. A fully modified 2'-OMethyl phosphorothioate is incapable of completely reversing an FXTAS-associated splicing defect and inhibits translation of the downstream ORF, which could have deleterious effects. Taken together, these studies suggest that a small molecule that recognizes structure may be more well suited for targeting highly structured RNAs that require strand invasion by a complementary oligonucleotide.

Targeting the r(CGG) Repeats That Cause FXTAS with Modularly Assembled Small Molecules and Oligonucleotides

PubMed Central

2015-01-01

We designed small molecules that bind the structure of the RNA that causes fragile X-associated tremor ataxia syndrome (FXTAS), an incurable neuromuscular disease. FXTAS is caused by an expanded r(CGG) repeat (r(CGG)exp) that inactivates a protein regulator of alternative pre-mRNA splicing. Our designed compounds modulate r(CGG)exp toxicity in cellular models of FXTAS, and pull-down experiments confirm that they bind r(CGG)expin vivo. Importantly, compound binding does not affect translation of the downstream open reading frame (ORF). We compared molecular recognition properties of our optimal compound to oligonucleotides. Studies show that r(CGG)exp’s self-structure is a significant energetic barrier for oligonucleotide binding. A fully modified 2′-OMethyl phosphorothioate is incapable of completely reversing an FXTAS-associated splicing defect and inhibits translation of the downstream ORF, which could have deleterious effects. Taken together, these studies suggest that a small molecule that recognizes structure may be more well suited for targeting highly structured RNAs that require strand invasion by a complementary oligonucleotide. PMID:24506227

Analytical Devices Based on Direct Synthesis of DNA on Paper.

PubMed

Glavan, Ana C; Niu, Jia; Chen, Zhen; Güder, Firat; Cheng, Chao-Min; Liu, David; Whitesides, George M

2016-01-05

This paper addresses a growing need in clinical diagnostics for parallel, multiplex analysis of biomarkers from small biological samples. It describes a new procedure for assembling arrays of ssDNA and proteins on paper. This method starts with the synthesis of DNA oligonucleotides covalently linked to paper and proceeds to assemble microzones of DNA-conjugated paper into arrays capable of simultaneously capturing DNA, DNA-conjugated protein antigens, and DNA-conjugated antibodies. The synthesis of ssDNA oligonucleotides on paper is convenient and effective with 32% of the oligonucleotides cleaved and eluted from the paper substrate being full-length by HPLC for a 32-mer. These ssDNA arrays can be used to detect fluorophore-linked DNA oligonucleotides in solution, and as the basis for DNA-directed assembly of arrays of DNA-conjugated capture antibodies on paper, detect protein antigens by sandwich ELISAs. Paper-anchored ssDNA arrays with different sequences can be used to assemble paper-based devices capable of detecting DNA and antibodies in the same device and enable simple microfluidic paper-based devices.

Method for performing site-specific affinity fractionation for use in DNA sequencing

DOEpatents

Mirzabekov, Andrei Darievich; Lysov, Yuri Petrovich; Dubley, Svetlana A.

1999-01-01

A method for fractionating and sequencing DNA via affinity interaction is provided comprising contacting cleaved DNA to a first array of oligonucleotide molecules to facilitate hybridization between said cleaved DNA and the molecules; extracting the hybridized DNA from the molecules; contacting said extracted hybridized DNA with a second array of oligonucleotide molecules, wherein the oligonucleotide molecules in the second array have specified base sequences that are complementary to said extracted hybridized DNA; and attaching labeled DNA to the second array of oligonucleotide molecules, wherein the labeled re-hybridized DNA have sequences that are complementary to the oligomers. The invention further provides a method for performing multi-step conversions of the chemical structure of compounds comprising supplying an array of polyacrylamide vessels separated by hydrophobic surfaces; immobilizing a plurality of reactants, such as enzymes, in the vessels so that each vessel contains one reactant; contacting the compounds to each of the vessels in a predetermined sequence and for a sufficient time to convert the compounds to a desired state; and isolating the converted compounds from said array.

Miniaturized reaction vessel system, method for performing site-specific biochemical reactions and affinity fractionation for use in DNA sequencing

DOEpatents

Mirzabekov, Andrei Darievich; Lysov, Yuri Petrovich; Dubley, Svetlana A.

2000-01-01

A method for fractionating and sequencing DNA via affinity interaction is provided comprising contacting cleaved DNA to a first array of oligonucleotide molecules to facilitate hybridization between said cleaved DNA and the molecules; extracting the hybridized DNA from the molecules; contacting said extracted hybridized DNA with a second array of oligonucleotide molecules, wherein the oligonucleotide molecules in the second array have specified base sequences that are complementary to said extracted hybridized DNA; and attaching labeled DNA to the second array of oligonucleotide molecules, wherein the labeled re-hybridized DNA have sequences that are complementary to the oligomers. The invention further provides a method for performing multi-step conversions of the chemical structure of compounds comprising supplying an array of polyacrylamide vessels separated by hydrophobic surfaces; immobilizing a plurality of reactants, such as enzymes, in the vessels so that each vessel contains one reactant; contacting the compounds to each of the vessels in a predetermined sequence and for a sufficient time to convert the compounds to a desired state; and isolating the converted compounds from said array.

G-Quadruplex Forming Oligonucleotides as Anti-HIV Agents.

PubMed

Musumeci, Domenica; Riccardi, Claudia; Montesarchio, Daniela

2015-09-22

Though a variety of different non-canonical nucleic acids conformations have been recognized, G-quadruplex structures are probably the structural motifs most commonly found within known oligonucleotide-based aptamers. This could be ascribed to several factors, as their large conformational diversity, marked responsiveness of their folding/unfolding processes to external stimuli, high structural compactness and chemo-enzymatic and thermodynamic stability. A number of G-quadruplex-forming oligonucleotides having relevant in vitro anti-HIV activity have been discovered in the last two decades through either SELEX or rational design approaches. Improved aptamers have been obtained by chemical modifications of natural oligonucleotides, as terminal conjugations with large hydrophobic groups, replacement of phosphodiester linkages with phosphorothioate bonds or other surrogates, insertion of base-modified monomers, etc. In turn, detailed structural studies have elucidated the peculiar architectures adopted by many G-quadruplex-based aptamers and provided insight into their mechanism of action. An overview of the state-of-the-art knowledge of the relevance of putative G-quadruplex forming sequences within the viral genome and of the most studied G-quadruplex-forming aptamers, selectively targeting HIV proteins, is here presented.

Formation of oligonucleotide adducts in pharmaceutical formulations.

PubMed

Krotz, Achim H; Gaus, Hans; Hardee, Gregory E

2005-01-01

During preformulation studies, we observed that oligonucleotide extracted from topical formulations contained considerable amounts of covalently modified oligonucleotide adducts. In this report, we describe the identification and characterization of reaction products that form when PS-oligodeoxyribonucleotide ISIS 2302 (1) is brought into contact with aqueous solutions of glycerol-derived excipients. Compatibility tests showed that the presence of certain glycerides in the formulation lead to adduct formation (1+58x amu, 1+72x amu, 1+58x+72y amu, x, and y are the number of modifications on one oligonucleotide strand). No adduct formation was observed in the presence of triglycerides or propylene glycol-derived excipients used in the study. Using nucleosides as model compounds, two modifications of deoxyguanosine were isolated by preparative reversed phase (RP)-high pressure liquid chromatography (HPLC) and characterized by nuclear magnetic resonance (NMR) and HPLC-mass spectrometry (MS). Modifications were identified as N2-(1-carboxymethyl)- and N2-(1-carboxyethyl) derivatives of 2'-deoxyguanosine. The mechanism of formation of these adducts may involve advanced glycation reactions possibly caused by excipient impurities or degradation products such as glyceraldehyde or glyceraldehyde derivatives.

Regulation of the activity of the promoter of RNA-induced silencing, C3PO.

PubMed

Sahu, Shriya; Williams, Leo; Perez, Alberto; Philip, Finly; Caso, Giuseppe; Zurawsky, Walter; Scarlata, Suzanne

2017-09-01

RNA-induced silencing is a process which allows cells to regulate the synthesis of specific proteins. RNA silencing is promoted by the protein C3PO (component 3 of RISC). We have previously found that phospholipase Cβ, which increases intracellular calcium levels in response to specific G protein signals, inhibits C3PO activity towards certain genes. Understanding the parameters that control C3PO activity and which genes are impacted by G protein activation would help predict which genes are more vulnerable to downregulation. Here, using a library of 10 18 oligonucleotides, we show that C3PO binds oligonucleotides with structural specificity but little sequence specificity. Alternately, C3PO hydrolyzes oligonucleotides with a rate that is sensitive to substrate stability. Importantly, we find that oligonucleotides with higher Tm values are inhibited by bound PLCβ. This finding is supported by microarray analysis in cells over-expressing PLCβ1. Taken together, this study allows predictions of the genes whose post-transcriptional regulation is responsive to the G protein/phospholipase Cβ/calcium signaling pathway. © 2017 The Protein Society.

Assembly of a biocompatible triazole-linked gene by one-pot click-DNA ligation

NASA Astrophysics Data System (ADS)

Kukwikila, Mikiembo; Gale, Nittaya; El-Sagheer, Afaf H.; Brown, Tom; Tavassoli, Ali

2017-11-01

The chemical synthesis of oligonucleotides and their enzyme-mediated assembly into genes and genomes has significantly advanced multiple scientific disciplines. However, these approaches are not without their shortcomings; enzymatic amplification and ligation of oligonucleotides into genes and genomes makes automation challenging, and site-specific incorporation of epigenetic information and/or modified bases into large constructs is not feasible. Here we present a fully chemical one-pot method for the assembly of oligonucleotides into a gene by click-DNA ligation. We synthesize the 335 base-pair gene that encodes the green fluorescent protein iLOV from ten functionalized oligonucleotides that contain 5ʹ-azide and 3ʹ-alkyne units. The resulting click-linked iLOV gene contains eight triazoles at the sites of chemical ligation, and yet is fully biocompatible; it is replicated by DNA polymerases in vitro and encodes a functional iLOV protein in Escherichia coli. We demonstrate the power and potential of our one-pot gene-assembly method by preparing an epigenetically modified variant of the iLOV gene.

A Targeted Oligonucleotide Enhancer of SMN2 Exon 7 Splicing Forms Competing Quadruplex and Protein Complexes in Functional Conditions

PubMed Central

Smith, Lindsay D.; Dickinson, Rachel L.; Lucas, Christian M.; Cousins, Alex; Malygin, Alexey A.; Weldon, Carika; Perrett, Andrew J.; Bottrill, Andrew R.; Searle, Mark S.; Burley, Glenn A.; Eperon, Ian C.

2014-01-01

Summary The use of oligonucleotides to activate the splicing of selected exons is limited by a poor understanding of the mechanisms affected. A targeted bifunctional oligonucleotide enhancer of splicing (TOES) anneals to SMN2 exon 7 and carries an exonic splicing enhancer (ESE) sequence. We show that it stimulates splicing specifically of intron 6 in the presence of repressing sequences in intron 7. Complementarity to the 5′ end of exon 7 increases U2AF65 binding, but the ESE sequence is required for efficient recruitment of U2 snRNP. The ESE forms at least three coexisting discrete states: a quadruplex, a complex containing only hnRNP F/H, and a complex enriched in the activator SRSF1. Neither hnRNP H nor quadruplex formation contributes to ESE activity. The results suggest that splicing limited by weak signals can be rescued by rapid exchange of TOES oligonucleotides in various complexes and raise the possibility that SR proteins associate transiently with ESEs. PMID:25263560

Diamond cubic phase of monoolein and water as an amphiphilic matrix for electrophoresis of oligonucleotides.

PubMed

Carlsson, Nils; Winge, Ann-Sofie; Engström, Sven; Akerman, Björn

2005-10-06

We used a cubic liquid crystal formed by the nonionic monoglyceride monoolein and water as a porous matrix for the electrophoresis of oligonucleotides. The diamond cubic phase is thermodynamically stable when in contact with a water-rich phase, which we exploit to run the electrophoresis in the useful submarine mode. Oligonucleotides are separated according to size and secondary structure by migration through the space-filling aqueous nanometer pores of the regular liquid crystal, but the comparatively slow migration means the cubic phase will not be a replacement for the conventional DNA gels. However, our demonstration that the cubic phase can be used in submarine electrophoresis opens up the possibility for a new matrix for electrophoresis of amphiphilic molecules. From this perspective, the results on the oligonucleotides show that water-soluble particles of nanometer size, typical for the hydrophilic parts of membrane-bound proteins, may be a useful separation motif. A charged contamination in the commercial sample of monoolein, most likely oleic acid that arises from its hydrolysis, restricts useful buffer conditions to a pH below 5.6.

Method for performing site-specific affinity fractionation for use in DNA sequencing

DOEpatents

Mirzabekov, A.D.; Lysov, Y.P.; Dubley, S.A.

1999-05-18

A method for fractionating and sequencing DNA via affinity interaction is provided comprising contacting cleaved DNA to a first array of oligonucleotide molecules to facilitate hybridization between the cleaved DNA and the molecules; extracting the hybridized DNA from the molecules; contacting the extracted hybridized DNA with a second array of oligonucleotide molecules, wherein the oligonucleotide molecules in the second array have specified base sequences that are complementary to the extracted hybridized DNA; and attaching labeled DNA to the second array of oligonucleotide molecules, wherein the labeled re-hybridized DNA have sequences that are complementary to the oligomers. The invention further provides a method for performing multi-step conversions of the chemical structure of compounds comprising supplying an array of polyacrylamide vessels separated by hydrophobic surfaces; immobilizing a plurality of reactants, such as enzymes, in the vessels so that each vessel contains one reactant; contacting the compounds to each of the vessels in a predetermined sequence and for a sufficient time to convert the compounds to a desired state; and isolating the converted compounds from the array. 14 figs.

[Inheritable phenotypic normalization of rodent cells transformed by simian adenovirus SA7 E1 oncogenes by singled-stranded oligonucleotides complementary to a long region of integrated oncogenes].

PubMed

Grineva, N I; Borovkova, T V; Sats, N V; Kurabekova, R M; Rozhitskaia, O S; Solov'ev, G Ia; Pantin, V I

1995-08-01

G11 mouse cells and SH2 rat cells transformed with simian adenovirus SA7 DNA showed inheritable oncogen-specific phenotypic normalization when treated with sense and antisense oligonucleotides complementary to long RNA sequences, plus or minus strands of the integrated adenovirus oncogenes E1A and E1B. Transitory treatment of the cells with the oligonucleotides in the absence of serum was shown to cause the appearance of normalized cell lines with fibroblastlike morphology, slower cell proliferation, and lack of ability to form colonies in soft agar. Proliferative activity and adhesion of the normalized cells that established cell lines were found to depend on the concentration of growth factors in the cultural medium. In some of the cell lines, an inhibition of transcription of the E1 oncogenes was observed. The normalization also produced cells that divided 2 - 5 times and died and cells that reverted to a transformed phenotype in 2 - 10 days. The latter appeared predominantly upon the action of the antisense oligonucleotides.

Particle-Based Microarrays of Oligonucleotides and Oligopeptides.

PubMed

Nesterov-Mueller, Alexander; Maerkle, Frieder; Hahn, Lothar; Foertsch, Tobias; Schillo, Sebastian; Bykovskaya, Valentina; Sedlmayr, Martyna; Weber, Laura K; Ridder, Barbara; Soehindrijo, Miriam; Muenster, Bastian; Striffler, Jakob; Bischoff, F Ralf; Breitling, Frank; Loeffler, Felix F

2014-10-28

In this review, we describe different methods of microarray fabrication based on the use of micro-particles/-beads and point out future tendencies in the development of particle-based arrays. First, we consider oligonucleotide bead arrays, where each bead is a carrier of one specific sequence of oligonucleotides. This bead-based array approach, appearing in the late 1990s, enabled high-throughput oligonucleotide analysis and had a large impact on genome research. Furthermore, we consider particle-based peptide array fabrication using combinatorial chemistry. In this approach, particles can directly participate in both the synthesis and the transfer of synthesized combinatorial molecules to a substrate. Subsequently, we describe in more detail the synthesis of peptide arrays with amino acid polymer particles, which imbed the amino acids inside their polymer matrix. By heating these particles, the polymer matrix is transformed into a highly viscous gel, and thereby, imbedded monomers are allowed to participate in the coupling reaction. Finally, we focus on combinatorial laser fusing of particles for the synthesis of high-density peptide arrays. This method combines the advantages of particles and combinatorial lithographic approaches.

Particle-Based Microarrays of Oligonucleotides and Oligopeptides

PubMed Central

Nesterov-Mueller, Alexander; Maerkle, Frieder; Hahn, Lothar; Foertsch, Tobias; Schillo, Sebastian; Bykovskaya, Valentina; Sedlmayr, Martyna; Weber, Laura K.; Ridder, Barbara; Soehindrijo, Miriam; Muenster, Bastian; Striffler, Jakob; Bischoff, F. Ralf; Breitling, Frank; Loeffler, Felix F.

2014-01-01

In this review, we describe different methods of microarray fabrication based on the use of micro-particles/-beads and point out future tendencies in the development of particle-based arrays. First, we consider oligonucleotide bead arrays, where each bead is a carrier of one specific sequence of oligonucleotides. This bead-based array approach, appearing in the late 1990s, enabled high-throughput oligonucleotide analysis and had a large impact on genome research. Furthermore, we consider particle-based peptide array fabrication using combinatorial chemistry. In this approach, particles can directly participate in both the synthesis and the transfer of synthesized combinatorial molecules to a substrate. Subsequently, we describe in more detail the synthesis of peptide arrays with amino acid polymer particles, which imbed the amino acids inside their polymer matrix. By heating these particles, the polymer matrix is transformed into a highly viscous gel, and thereby, imbedded monomers are allowed to participate in the coupling reaction. Finally, we focus on combinatorial laser fusing of particles for the synthesis of high-density peptide arrays. This method combines the advantages of particles and combinatorial lithographic approaches. PMID:27600347

TGF-beta antisense oligonucleotides reduce mRNA expression of matrix metalloproteinases in cultured wound-healing-related cells.

PubMed

Philipp, Katrin; Riedel, Frank; Germann, Günter; Hörmann, Karl; Sauerbier, Michael

2005-02-01

The pathology of chronic dermal ulcers is characterized by excessive proteolytic activity which degrades extracellular matrix. The transforming growth factor-beta (TGF-beta) has been identified as an important component of wound healing. Recent developments in molecular therapy offer exciting prospects for the modulation of wound healing, specifically those targeting TGF-beta. We investigated the effect of TGF-beta antisense oligonucleotides on the mRNA expression of matrix metalloproteinases in cultured human keratinocytes, fibroblasts and endothelial cells using multiplex RT-PCR. The treatment of keratinocytes and fibroblasts with TGF-beta antisense oligonucleotides resulted in a significant decrease of expression of mRNA of MMP-1 and MMP-9 compared to controls. Accordingly, a decreased expression of MMP-1 mRNA in endothelial cells was detectable. Other MMPs were not affected. Affecting all dermal wound-healing-related cell types, TGF-beta antisense oligonucleotide technology may be a potential therapeutic option for the inhibition of proteolytic tissue destruction in chronic wounds. Pharmaceutical intervention in this area ultimately may help clinicians to proactively intervene in an effort to prevent normal wounds from becoming chronic.

The relationship between victimization and substance use among homeless and runaway female adolescents.

PubMed

Tyler, Kimberly A; Gervais, Sarah J; Davidson, M Meghan

2013-02-01

Each year, thousands of female adolescents run away from home due to sexual abuse, yet they continue to be victims of sexual assault once on the street. To date, few studies have examined how various forms of victimization are related to different types of substance use. The purpose of this article is to investigate the relationship between street exposure, childhood abuse, and different forms of street victimization with alcohol and marijuana use among 137 homeless and runaway female adolescents. Results from path analysis revealed that child sexual abuse was positively linked to trading sex and sexual and physical victimization. In addition, those who have traded sex experienced greater physical victimization, and who have spent more time away from home, used alcohol more frequently. Moreover, trading sex and experiencing more types of sexual victimization were positively linked to more frequent marijuana usage. Age, age at first run, longest time away from home, sexual abuse, and trading sex had significant indirect effects on alcohol and/or marijuana use. Together, these factors accounted for 27% of the variance in alcohol use and 37% of the variance in marijuana use.

Structures of bacterial polynucleotide kinase in a Michaelis complex with GTP•Mg2+ and 5'-OH oligonucleotide and a product complex with GDP•Mg2+ and 5'-PO4 oligonucleotide reveal a mechanism of general acid-base catalysis and the determinants of phosphoacceptor recognition.

PubMed

Das, Ushati; Wang, Li Kai; Smith, Paul; Jacewicz, Agata; Shuman, Stewart

2014-01-01

Clostridium thermocellum polynucleotide kinase (CthPnk), the 5' end-healing module of a bacterial RNA repair system, catalyzes reversible phosphoryl transfer from an NTP donor to a 5'-OH polynucleotide acceptor. Here we report the crystal structures of CthPnk-D38N in a Michaelis complex with GTP•Mg(2+) and a 5'-OH oligonucleotide and a product complex with GDP•Mg(2+) and a 5'-PO4 oligonucleotide. The O5' nucleophile is situated 3.0 Å from the GTP γ phosphorus in the Michaelis complex, where it is coordinated by Asn38 and is apical to the bridging β phosphate oxygen of the GDP leaving group. In the product complex, the transferred phosphate has undergone stereochemical inversion and Asn38 coordinates the 5'-bridging phosphate oxygen of the oligonucleotide. The D38N enzyme is poised for catalysis, but cannot execute because it lacks Asp38-hereby implicated as the essential general base catalyst that abstracts a proton from the 5'-OH during the kinase reaction. Asp38 serves as a general acid catalyst during the 'reverse kinase' reaction by donating a proton to the O5' leaving group of the 5'-PO4 strand. The acceptor strand binding mode of CthPnk is distinct from that of bacteriophage T4 Pnk.

High-Throughput Identification of Combinatorial Ligands for DNA Delivery in Cell Culture

NASA Astrophysics Data System (ADS)

Svahn, Mathias G.; Rabe, Kersten S.; Barger, Geoffrey; EL-Andaloussi, Samir; Simonson, Oscar E.; Didier, Boturyn; Olivier, Renaudet; Dumy, Pascal; Brandén, Lars J.; Niemeyer, Christof M.; Smith, C. I. Edvard

2008-10-01

Finding the optimal combinations of ligands for tissue-specific delivery is tedious even if only a few well-established compounds are tested. The cargo affects the receptor-ligand interaction, especially when it is charged like DNA. The ligand should therefore be evaluated together with its cargo. Several viruses have been shown to interact with more than one receptor, for efficient internalization. We here present a DNA oligonucleotide-based method for inexpensive and rapid screening of biotin labeled ligands for combinatorial effects on cellular binding and uptake. The oligonucleotide complex was designed as a 44 bp double-stranded DNA oligonucleotide with one central streptavidin molecule and a second streptavidin at the terminus. The use of a highly advanced robotic platform ensured stringent processing and execution of the experiments. The oligonucleotides were fluorescently labeled and used for detection and analysis of cell-bound, internalized and intra-cellular compartmentalized constructs by an automated line-scanning confocal microscope, IN Cell Analyzer 3000. All possible combinations of 22 ligands were explored in sets of 2 and tested on 6 different human cell lines in triplicates. In total, 10 000 transfections were performed on the automation platform. Cell-specific combinations of ligands were identified and their relative position on the scaffold oligonucleotide was found to be of importance. The ligands were found to be cargo dependent, carbohydrates were more potent for DNA delivery whereas cell penetrating peptides were more potent for delivery of less charged particles.

Contribution of the first K-homology domain of poly(C)-binding protein 1 to its affinity and specificity for C-rich oligonucleotides

PubMed Central

Yoga, Yano M. K.; Traore, Daouda A. K.; Sidiqi, Mahjooba; Szeto, Chris; Pendini, Nicole R.; Barker, Andrew; Leedman, Peter J.; Wilce, Jacqueline A.; Wilce, Matthew C. J.

2012-01-01

Poly-C-binding proteins are triple KH (hnRNP K homology) domain proteins with specificity for single stranded C-rich RNA and DNA. They play diverse roles in the regulation of protein expression at both transcriptional and translational levels. Here, we analyse the contributions of individual αCP1 KH domains to binding C-rich oligonucleotides using biophysical and structural methods. Using surface plasmon resonance (SPR), we demonstrate that KH1 makes the most stable interactions with both RNA and DNA, KH3 binds with intermediate affinity and KH2 only interacts detectibly with DNA. The crystal structure of KH1 bound to a 5′-CCCTCCCT-3′ DNA sequence shows a 2:1 protein:DNA stoichiometry and demonstrates a molecular arrangement of KH domains bound to immediately adjacent oligonucleotide target sites. SPR experiments, with a series of poly-C-sequences reveals that cytosine is preferred at all four positions in the oligonucleotide binding cleft and that a C-tetrad binds KH1 with 10 times higher affinity than a C-triplet. The basis for this high affinity interaction is finally detailed with the structure determination of a KH1.W.C54S mutant bound to 5′-ACCCCA-3′ DNA sequence. Together, these data establish the lead role of KH1 in oligonucleotide binding by αCP1 and reveal the molecular basis of its specificity for a C-rich tetrad. PMID:22344691

Contribution of the first K-homology domain of poly(C)-binding protein 1 to its affinity and specificity for C-rich oligonucleotides.

PubMed

Yoga, Yano M K; Traore, Daouda A K; Sidiqi, Mahjooba; Szeto, Chris; Pendini, Nicole R; Barker, Andrew; Leedman, Peter J; Wilce, Jacqueline A; Wilce, Matthew C J

2012-06-01

Poly-C-binding proteins are triple KH (hnRNP K homology) domain proteins with specificity for single stranded C-rich RNA and DNA. They play diverse roles in the regulation of protein expression at both transcriptional and translational levels. Here, we analyse the contributions of individual αCP1 KH domains to binding C-rich oligonucleotides using biophysical and structural methods. Using surface plasmon resonance (SPR), we demonstrate that KH1 makes the most stable interactions with both RNA and DNA, KH3 binds with intermediate affinity and KH2 only interacts detectibly with DNA. The crystal structure of KH1 bound to a 5'-CCCTCCCT-3' DNA sequence shows a 2:1 protein:DNA stoichiometry and demonstrates a molecular arrangement of KH domains bound to immediately adjacent oligonucleotide target sites. SPR experiments, with a series of poly-C-sequences reveals that cytosine is preferred at all four positions in the oligonucleotide binding cleft and that a C-tetrad binds KH1 with 10 times higher affinity than a C-triplet. The basis for this high affinity interaction is finally detailed with the structure determination of a KH1.W.C54S mutant bound to 5'-ACCCCA-3' DNA sequence. Together, these data establish the lead role of KH1 in oligonucleotide binding by αCP1 and reveal the molecular basis of its specificity for a C-rich tetrad.

nuID: a universal naming scheme of oligonucleotides for Illumina, Affymetrix, and other microarrays

PubMed Central

Du, Pan; Kibbe, Warren A; Lin, Simon M

2007-01-01

Background Oligonucleotide probes that are sequence identical may have different identifiers between manufacturers and even between different versions of the same company's microarray; and sometimes the same identifier is reused and represents a completely different oligonucleotide, resulting in ambiguity and potentially mis-identification of the genes hybridizing to that probe. Results We have devised a unique, non-degenerate encoding scheme that can be used as a universal representation to identify an oligonucleotide across manufacturers. We have named the encoded representation 'nuID', for nucleotide universal identifier. Inspired by the fact that the raw sequence of the oligonucleotide is the true definition of identity for a probe, the encoding algorithm uniquely and non-degenerately transforms the sequence itself into a compact identifier (a lossless compression). In addition, we added a redundancy check (checksum) to validate the integrity of the identifier. These two steps, encoding plus checksum, result in an nuID, which is a unique, non-degenerate, permanent, robust and efficient representation of the probe sequence. For commercial applications that require the sequence identity to be confidential, we have an encryption schema for nuID. We demonstrate the utility of nuIDs for the annotation of Illumina microarrays, and we believe it has universal applicability as a source-independent naming convention for oligomers. Reviewers This article was reviewed by Itai Yanai, Rong Chen (nominated by Mark Gerstein), and Gregory Schuler (nominated by David Lipman). PMID:17540033

The hormone response element mimic sequence of GAS5 lncRNA is sufficient to induce apoptosis in breast cancer cells

PubMed Central

Pickard, Mark R.; Williams, Gwyn T.

2016-01-01

Growth arrest-specific 5 (GAS5) lncRNA promotes apoptosis, and its expression is down-regulated in breast cancer. GAS5 lncRNA is a decoy of glucocorticoid/related receptors; a stem-loop sequence constitutes the GAS5 hormone response element mimic (HREM), which is essential for the regulation of breast cancer cell apoptosis. This preclinical study aimed to determine if the GAS5 HREM sequence alone promotes the apoptosis of breast cancer cells. Nucleofection of hormone-sensitive and –insensitive breast cancer cell lines with a GAS5 HREM DNA oligonucleotide increased both basal and ultraviolet-C-induced apoptosis, and decreased culture viability and clonogenic growth, similar to GAS5 lncRNA. The HREM oligonucleotide demonstrated similar sequence specificity to the native HREM for its functional activity and had no effect on endogenous GAS5 lncRNA levels. Certain chemically modified HREM oligonucleotides, notably DNA and RNA phosphorothioates, retained pro-apoptotic. activity. Crucially the HREM oligonucleotide could overcome apoptosis resistance secondary to deficient endogenous GAS5 lncRNA levels. Thus, the GAS5 lncRNA HREM sequence alone is sufficient to induce apoptosis in breast cancer cells, including triple-negative breast cancer cells. These findings further suggest that emerging knowledge of structure/function relationships in the field of lncRNA biology can be exploited for the development of entirely novel, oligonucleotide mimic-based, cancer therapies. PMID:26862727

Telomeric repeat-containing RNA/G-quadruplex-forming sequences cause genome-wide alteration of gene expression in human cancer cells in vivo.

PubMed

Hirashima, Kyotaro; Seimiya, Hiroyuki

2015-02-27

Telomere erosion causes cell mortality, suggesting that longer telomeres enable more cell divisions. In telomerase-positive human cancer cells, however, telomeres are often kept shorter than those of surrounding normal tissues. Recently, we showed that cancer cell telomere elongation represses innate immune genes and promotes their differentiation in vivo. This implies that short telomeres contribute to cancer malignancy, but it is unclear how such genetic repression is caused by elongated telomeres. Here, we report that telomeric repeat-containing RNA (TERRA) induces a genome-wide alteration of gene expression in telomere-elongated cancer cells. Using three different cell lines, we found that telomere elongation up-regulates TERRA signal and down-regulates innate immune genes such as STAT1, ISG15 and OAS3 in vivo. Ectopic TERRA oligonucleotides repressed these genes even in cells with short telomeres under three-dimensional culture conditions. This appeared to occur from the action of G-quadruplexes (G4) in TERRA, because control oligonucleotides had no effect and a nontelomeric G4-forming oligonucleotide phenocopied the TERRA oligonucleotide. Telomere elongation and G4-forming oligonucleotides showed similar gene expression signatures. Most of the commonly suppressed genes were involved in the innate immune system and were up-regulated in various cancers. We propose that TERRA G4 counteracts cancer malignancy by suppressing innate immune genes. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Synthetic oligonucleotide separations by mixed-mode reversed-phase/weak anion-exchange liquid chromatography.

PubMed

Zimmermann, Aleksandra; Greco, Roberto; Walker, Isabel; Horak, Jeannie; Cavazzini, Alberto; Lämmerhofer, Michael

2014-08-08

Synthetic oligonucleotides gain increasing importance in new therapeutic concepts and as probes in biological sciences. If pharmaceutical-grade purities are required, chromatographic purification using ion-pair reversed-phase chromatography is commonly carried out. However, separation selectivity for structurally closely related impurities is often insufficient, especially at high sample loads. In this study, a "mixed-mode" reversed-phase/weak anion exchanger stationary phase has been investigated as an alternative tool for chromatographic separation of synthetic oligonucleotides with minor sequence variations. The employed mixed-mode phase shows great flexibility in method development. It has been run in various gradient elution modes, viz. one, two or three parameter (mixed) gradients (altering buffer pH, buffer concentration, and organic modifier) to find optimal elution conditions and gain further insight into retention mechanisms. Compared to ion-pair reversed-phase and mere anion-exchange separation, enhanced selectivities were observed with the mixed-mode phase for 20-23 nucleotide (nt) long oligonucleotides with similar sequences. Oligonucleotides differing by 1, 2 or 3 nucleotides in length could be readily resolved and separation factors for single nucleotide replacements declined in the order Cytosine (C)/Guanine (G)>Adenine (A)/Guanine∼Guanine/Thymine (T)>Adenine/Cytosine∼Cytosine/Thymine>Adenine/Thymine. Selectivities were larger when the modification was at the 3' terminal-end, declined when it was in the middle of the sequence and was smallest when it was located at the 5' terminus. Due to the lower surface area of the 200Å pore size mixed-mode stationary phase compared to the corresponding 100Å material, lower retention times with equal selectivities under milder elution conditions were achievable. Considering high sample loading capacities of the mixed-mode anion-exchanger phase, it should have great potential for chromatographic oligonucleotide separation and purification. Copyright © 2014 Elsevier B.V. All rights reserved.

Microenvironmental Effect of 2'-O-(1-Pyrenylmethyl)uridine Modified Fluorescent Oligonucleotide Probes on Sensitive and Selective Detection of Target RNA.

PubMed

Imincan, Gülnur; Pei, Fen; Yu, Lijia; Jin, Hongwei; Zhang, Liangren; Yang, Xiaoda; Zhang, Lihe; Tang, XinJing

2016-04-19

2'-O-(1-Pyrenylmethyl)uridine modified oligoribonucleotides provide highly sensitive pyrene fluorescent probes for detecting specific nucleotide mutation of RNA targets. To develop more stable and cost-effective oligonucleotide probes, we investigated the local microenvironmental effects of nearby nucleobases on pyrene fluorescence in duplexes of RNAs and 2'-O-(1-pyrenylmethyl)uridine modified oligonucleotides. By incorporation of deoxyribonucleotides, ribonucleotides, 2'-MeO-nucleotides and 2'-F-nucleotides at both sides of 2'-O-(1-pyrenylmethyl)uridine (U(p)) in oligodeoxynucleotide probes, we synthesized a series of pyrene modified oligonucleotide probes. Their pyrene fluorescence emission spectra indicated that only two proximal nucleotides have a substantial effect on the pyrene fluorescence properties of these oligonucleotide probes hybridized with target RNA with an order of fluorescence sensitivity of 2'-F-nucleotides > 2'-MeO-nucleotides > ribonucleotides ≫ deoxyribonucleotides. While based on circular dichroism spectra, overall helix conformations (either A- or B-form) of the duplexes have marginal effects on the sensitivity of the probes. Instead, the local substitution reflected the propensity of the nucleotide sugar ring to adopt North type conformation and, accordingly, shifted their helix geometry toward a more A-type like conformation in local microenvironments. Thus, higher enhancement of pyrene fluorescence emission favored local A-type helix structures and more polar and hydrophobic environments (F > MeO > OH at 2' substitution) of duplex minor grooves of probes with the target RNA. Further dynamic simulation revealed that local microenvironmental effect of 2'-F-nucleotides or ribonucleotides was enough for pyrene moiety to move out of nucleobases to the minor groove of duplexes; in addition, 2'-F-nucleotide had less effect on π-stack of pyrene-modified uridine with upstream and downstream nucleobases. The present oligonucleotide probes successfully distinguished target RNA from single-mutated RNA analyte during an in vitro assay of RNA synthesis.

Drop drying on surfaces determines chemical reactivity - the specific case of immobilization of oligonucleotides on microarrays

PubMed Central

2013-01-01

Background Drop drying is a key factor in a wide range of technical applications, including spotted microarrays. The applied nL liquid volume provides specific reaction conditions for the immobilization of probe molecules to a chemically modified surface. Results We investigated the influence of nL and μL liquid drop volumes on the process of probe immobilization and compare the results obtained to the situation in liquid solution. In our data, we observe a strong relationship between drop drying effects on immobilization and surface chemistry. In this work, we present results on the immobilization of dye labeled 20mer oligonucleotides with and without an activating 5′-aminoheptyl linker onto a 2D epoxysilane and a 3D NHS activated hydrogel surface. Conclusions Our experiments identified two basic processes determining immobilization. First, the rate of drop drying that depends on the drop volume and the ambient relative humidity. Oligonucleotides in a dried spot react unspecifically with the surface and long reaction times are needed. 3D hydrogel surfaces allow for immobilization in a liquid environment under diffusive conditions. Here, oligonucleotide immobilization is much faster and a specific reaction with the reactive linker group is observed. Second, the effect of increasing probe concentration as a result of drop drying. On a 3D hydrogel, the increasing concentration of probe molecules in nL spotting volumes accelerates immobilization dramatically. In case of μL volumes, immobilization depends on whether the drop is allowed to dry completely. At non-drying conditions, very limited immobilization is observed due to the low oligonucleotide concentration used in microarray spotting solutions. The results of our study provide a general guideline for microarray assay development. They allow for the initial definition and further optimization of reaction conditions for the immobilization of oligonucleotides and other probe molecule classes to different surfaces in dependence of the applied spotting and reaction volume. PMID:23758982

Understanding Determinants of Consumer Mobile Health Usage Intentions, Assimilation, and Channel Preferences

PubMed Central

Chen, Liwei; Pye, Jessica; Baird, Aaron

2013-01-01

Background Consumer use of mobile devices as health service delivery aids (mHealth) is growing, especially as smartphones become ubiquitous. However, questions remain as to how consumer traits, health perceptions, situational characteristics, and demographics may affect consumer mHealth usage intentions, assimilation, and channel preferences. Objective We examine how consumers’ personal innovativeness toward mobile services (PIMS), perceived health conditions, health care availability, health care utilization, demographics, and socioeconomic status affect their (1) mHealth usage intentions and extent of mHealth assimilation, and (2) preference for mHealth as a complement or substitute for in-person doctor visits. Methods Leveraging constructs from research in technology acceptance, technology assimilation, consumer behavior, and health informatics, we developed a cross-sectional online survey to study determinants of consumers’ mHealth usage intentions, assimilation, and channel preferences. Data were collected from 1132 nationally representative US consumers and analyzed by using moderated multivariate regressions and ANOVA. Results The results indicate that (1) 430 of 1132 consumers in our sample (37.99%) have started using mHealth, (2) a larger quantity of consumers are favorable to using mHealth as a complement to in-person doctor visits (758/1132, 66.96%) than as a substitute (532/1132, 47.00%), and (3) consumers’ PIMS and perceived health conditions have significant positive direct influences on mHealth usage intentions, assimilation, and channel preferences, and significant positive interactive influences on assimilation and channel preferences. The independent variables within the moderated regressions collectively explained 59.70% variance in mHealth usage intentions, 60.41% in mHealth assimilation, 34.29% in preference for complementary use of mHealth, and 45.30% in preference for substitutive use of mHealth. In a follow-up ANOVA examination, we found that those who were more favorable toward using mHealth as a substitute for in-person doctor visits than as a complement indicated stronger intentions to use mHealth (F 1,702=20.14, P<.001) and stronger assimilation of mHealth (F 1,702=41.866, P<.001). Conclusions Multiple predictors are shown to have significant associations with mHealth usage intentions, assimilation, and channel preferences. We suggest that future initiatives to promote mHealth should shift targeting of consumers from coarse demographics to nuanced considerations of individual dispositions toward mobile service innovations, complementary or substitutive channel use preferences, perceived health conditions, health services availability and utilization, demographics, and socioeconomic characteristics. PMID:23912839

Understanding determinants of consumer mobile health usage intentions, assimilation, and channel preferences.

PubMed

Rai, Arun; Chen, Liwei; Pye, Jessica; Baird, Aaron

2013-08-02

Consumer use of mobile devices as health service delivery aids (mHealth) is growing, especially as smartphones become ubiquitous. However, questions remain as to how consumer traits, health perceptions, situational characteristics, and demographics may affect consumer mHealth usage intentions, assimilation, and channel preferences. We examine how consumers' personal innovativeness toward mobile services (PIMS), perceived health conditions, health care availability, health care utilization, demographics, and socioeconomic status affect their (1) mHealth usage intentions and extent of mHealth assimilation, and (2) preference for mHealth as a complement or substitute for in-person doctor visits. Leveraging constructs from research in technology acceptance, technology assimilation, consumer behavior, and health informatics, we developed a cross-sectional online survey to study determinants of consumers' mHealth usage intentions, assimilation, and channel preferences. Data were collected from 1132 nationally representative US consumers and analyzed by using moderated multivariate regressions and ANOVA. The results indicate that (1) 430 of 1132 consumers in our sample (37.99%) have started using mHealth, (2) a larger quantity of consumers are favorable to using mHealth as a complement to in-person doctor visits (758/1132, 66.96%) than as a substitute (532/1132, 47.00%), and (3) consumers' PIMS and perceived health conditions have significant positive direct influences on mHealth usage intentions, assimilation, and channel preferences, and significant positive interactive influences on assimilation and channel preferences. The independent variables within the moderated regressions collectively explained 59.70% variance in mHealth usage intentions, 60.41% in mHealth assimilation, 34.29% in preference for complementary use of mHealth, and 45.30% in preference for substitutive use of mHealth. In a follow-up ANOVA examination, we found that those who were more favorable toward using mHealth as a substitute for in-person doctor visits than as a complement indicated stronger intentions to use mHealth (F₁,₇₀₂=20.14, P<.001) and stronger assimilation of mHealth (F₁,₇₀₂=41.866, P<.001). Multiple predictors are shown to have significant associations with mHealth usage intentions, assimilation, and channel preferences. We suggest that future initiatives to promote mHealth should shift targeting of consumers from coarse demographics to nuanced considerations of individual dispositions toward mobile service innovations, complementary or substitutive channel use preferences, perceived health conditions, health services availability and utilization, demographics, and socioeconomic characteristics.

Oligoribonucleotide map and protein of CMII: detection of conserved and nonconserved genetic elements in avian acute leukemia viruses CMII, MC29, and MH2.

PubMed Central

Bister, K; Löliger, H C; Duesberg, P H

1979-01-01

RNA and protein of the defective avian acute leukemia virus CMII, which causes myelocytomas in chickens, and of CMII-associated helper virus (CMIIAV) were investigated. The RNA of CMII measured 6 kilobases (kb) and that of CMIIAV measured 8.5 kb. By comparing more than 20 mapped oligonucleotides of CMII RNA with mapped and nonmapped oligonucleotides of acute leukemia viruses MC29 and MH2 and with mapped oligonucleotides of CMIIAV and other nondefective avian tumor viruses, three segments were distinguished in the oligonucleotide map of CMII RNA: (i) a 5' group-specific segment of 1.5 kb which was conserved among CMII, MC29, and MH2 and also homologous with gag-related oligonucleotides of CMIIAV and other helper viruses (hence, group specific); (ii) an internal segment of 2 kb which was conserved specifically among CMII, MC29, and MH2 and whose presence in CMII lends new support to the view that this class of genetic elements is essential for oncogenicity, because it was absent from an otherwise isogenic, nontransforming helper, CMIIAV; and (iii) a 3' group-specific segment of 2.5 kb which shared 13 of 14 oligonucleotides with CMIIAV and included env oligonucleotides of other nondefective viruses of the avian tumor virus group (hence, group specific). This segment and analogous map segments of MC29 and MH2 were not conserved at the level of shared oligonucleotides. CMII-transformed cells contained a nonstructural, gag gene-related protein of 90,000 daltons, distinguished by its size from 110,000-daltom MC29 and 100,000-dalton MH2 counterparts. The gag relatedness and similarity to the 110,000-dalton MC29 counterpart indicated that the 90,000-dalton CMII protein is translated from the 5' and internal segments of CMII RNA. The existence of conserved 5' and internal RNA segments and conserved nonstructural protein products in CMII, MC29, and MH2 indicates that these viruses belong to a related group, termed here the MC29 group. Viruses of the MC29 group differ from one another mainly in their 3' RNA segments and in minor variations of their conserved RNA segments as well as by strain-specific size markers of their gag-related proteins. Because (i) the conserved 5' gag-related and internal RNA segments and their gag-related, nonvirion protein products correlate with the conserved oncogenic spectra of the MC29 group of viruses and because (ii) the internal RNA sequences and nonvirion proteins are not found in nondefective viruses, we propose that the conserved RNA and protein elements are necessary for oncogenicity and probably are the onc gene products of the MC29 group of viruses. Images PMID:232172

Identification of Brucella spp. by using the polymerase chain reaction.

PubMed Central

Herman, L; De Ridder, H

1992-01-01

The application of two synthetic oligonucleotides as probes and as primers in the polymerase chain reaction is presented for a specific, sensitive, and quick identification of Brucella spp. The specific oligonucleotide sequences were chosen on the basis of a 16S rRNA sequence alignment between Brucella abortus and Agrobacterium tumefaciens. Images PMID:1377903

Surface-enhanced Raman scattering detection of DNA derived from the West Nile virus genome using magnetic capture of Raman-active gold nanoparticles

USDA-ARS?s Scientific Manuscript database

A model paramagnetic nanoparticle (MNP) assay is demonstrated for surface-enhanced Raman scattering (SERS) detection of DNA oligonucleotides derived from the West Nile virus (WNV) genome. Detection is based on the capture of WNV target sequences by hybridization with complementary oligonucleotide pr...

Microelectroporation device for genomic screening

DOEpatents

Perroud, Thomas D.; Renzi, Ronald F.; Negrete, Oscar; Claudnic, Mark R.

2014-09-09

We have developed an microelectroporation device that combines microarrays of oligonucleotides, microfluidic channels, and electroporation for cell transfection and high-throughput screening applications (e.g. RNA interference screens). Microarrays allow the deposition of thousands of different oligonucleotides in microscopic spots. Microfluidic channels and microwells enable efficient loading of cells into the device and prevent cross-contamination between different oligonucleotides spots. Electroporation allows optimal transfection of nucleic acids into cells (especially hard-to-transfect cells such as primary cells) by minimizing cell death while maximizing transfection efficiency. This invention has the advantage of a higher throughput and lower cost, while preventing cross-contamination compared to conventional screening technologies. Moreover, this device does not require bulky robotic liquid handling equipment and is inherently safer given that it is a closed system.

Analysis of new charge-neutral DNA/RNA analogues phosphoryl guanidine oligonucleotides (PGO) by gel electrophoresis.

PubMed

Fokina, Alesya; Wang, Meiling; Ilyina, Anna; Klabenkova, Kristina; Burakova, Ekaterina; Chelobanov, Boris; Stetsenko, Dmitry

2018-06-02

Analysis and isolation of new charge-neutral phosphoryl guanidine oligonucleotides (PGO) by vertical slab electrophoresis were tested at different pH values (3-11) or in the presence of SDS as a micelle-forming agent. The most convenient way to analyze and purify phosphoryl guanidine oligonucleotides was by denaturing PAGE (8 M urea) at pH 3. The mobility of PGO is dependent on their A + C content. To analyze PGO containing only G, T or U, denaturing PAGE at pH 11 can be used, although the conditions need to be optimized. Bands were visualized by UV shadowing or Coomassie Brilliant Blue staining. Copyright © 2018. Published by Elsevier Inc.

Demographic and Health Related Data of Users of a Mobile Application to Support Drug Adherence is Associated with Usage Duration and Intensity

PubMed Central

Becker, Stefan; Brandl, Christopher; Meister, Sven; Nagel, Eckhard; Miron-Shatz, Talya; Mitchell, Anna; Kribben, Andreas; Albrecht, Urs-Vito; Mertens, Alexander

2015-01-01

Purpose A wealth of mobile applications are designed to support users in their drug intake. When developing software for patients, it is important to understand the differences between individuals who have, who will or who might never adopt mobile interventions. This study analyzes demographic and health-related factors associated with real-life “longer usage” and the “usage-intensity per day” of the mobile application “Medication Plan”. Methods Between 2010-2012, the mobile application “Medication Plan” could be downloaded free of charge from the Apple-App-Store. It was aimed at supporting the regular and correct intake of medication. Demographic and health-related data were collected via an online questionnaire. This study analyzed captured data. Results App-related activities of 1799 users (1708 complete data sets) were recorded. 69% (1183/1708) applied “Medication Plan” for more than a day. 74% were male (872/1183), the median age 45 years. Variance analysis showed a significant effect of the users´ age with respect to duration of usage (p = 0.025). While the mean duration of use was only 23.3 days for users younger than 21 years, for older users, there was a substantial increase over all age cohorts up to users of 60 years and above (103.9 days). Sex and educational status had no effect. “Daily usage intensity” was directly associated with an increasing number of prescribed medications and increased from an average of 1.87 uses per day and 1 drug per day to on average 3.71 uses per day for users stating to be taking more than 7 different drugs a day (p<0.001). Demographic predictors (sex, age and educational attainment) did not affect usage intensity. Conclusion Users aged 60+ as well as those with complicated therapeutic drug regimens relied on the service we provided for more than three months on average. Mobile applications may be a promising approach to support the treatment of patients with chronic conditions. PMID:25629939

Efficiency, error and yield in light-directed maskless synthesis of DNA microarrays

PubMed Central

2011-01-01

Background Light-directed in situ synthesis of DNA microarrays using computer-controlled projection from a digital micromirror device--maskless array synthesis (MAS)--has proved to be successful at both commercial and laboratory scales. The chemical synthetic cycle in MAS is quite similar to that of conventional solid-phase synthesis of oligonucleotides, but the complexity of microarrays and unique synthesis kinetics on the glass substrate require a careful tuning of parameters and unique modifications to the synthesis cycle to obtain optimal deprotection and phosphoramidite coupling. In addition, unintended deprotection due to scattering and diffraction introduce insertion errors that contribute significantly to the overall error rate. Results Stepwise phosphoramidite coupling yields have been greatly improved and are now comparable to those obtained in solid phase synthesis of oligonucleotides. Extended chemical exposure in the synthesis of complex, long oligonucleotide arrays result in lower--but still high--final average yields which approach 99%. The new synthesis chemistry includes elimination of the standard oxidation until the final step, and improved coupling and light deprotection. Coupling Insertions due to stray light are the limiting factor in sequence quality for oligonucleotide synthesis for gene assembly. Diffraction and local flare are by far the largest contributors to loss of optical contrast. Conclusions Maskless array synthesis is an efficient and versatile method for synthesizing high density arrays of long oligonucleotides for hybridization- and other molecular binding-based experiments. For applications requiring high sequence purity, such as gene assembly, diffraction and flare remain significant obstacles, but can be significantly reduced with straightforward experimental strategies. PMID:22152062

Pharmacokinetic Profiling of Conjugated Therapeutic Oligonucleotides: A High-Throughput Method Based Upon Serial Blood Microsampling Coupled to Peptide Nucleic Acid Hybridization Assay.

PubMed

Godinho, Bruno M D C; Gilbert, James W; Haraszti, Reka A; Coles, Andrew H; Biscans, Annabelle; Roux, Loic; Nikan, Mehran; Echeverria, Dimas; Hassler, Matthew; Khvorova, Anastasia

2017-12-01

Therapeutic oligonucleotides, such as small interfering RNAs (siRNAs), hold great promise for the treatment of incurable genetically defined disorders by targeting cognate toxic gene products for degradation. To achieve meaningful tissue distribution and efficacy in vivo, siRNAs must be conjugated or formulated. Clear understanding of the pharmacokinetic (PK)/pharmacodynamic behavior of these compounds is necessary to optimize and characterize the performance of therapeutic oligonucleotides in vivo. In this study, we describe a simple and reproducible methodology for the evaluation of in vivo blood/plasma PK profiles and tissue distribution of oligonucleotides. The method is based on serial blood microsampling from the saphenous vein, coupled to peptide nucleic acid hybridization assay for quantification of guide strands. Performed with minimal number of animals, this method allowed unequivocal detection and sensitive quantification without the need for amplification, or further modification of the oligonucleotides. Using this methodology, we compared plasma clearances and tissue distribution profiles of two different hydrophobically modified siRNAs (hsiRNAs). Notably, cholesterol-hsiRNA presented slow plasma clearances and mainly accumulated in the liver, whereas, phosphocholine-docosahexaenoic acid-hsiRNA was rapidly cleared from the plasma and preferably accumulated in the kidney. These data suggest that the PK/biodistribution profiles of modified hsiRNAs are determined by the chemical nature of the conjugate. Importantly, the method described in this study constitutes a simple platform to conduct pilot assessments of the basic clearance and tissue distribution profiles, which can be broadly applied for evaluation of new chemical variants of siRNAs and micro-RNAs.

5' modification of duplex DNA with a ruthenium electron donor-acceptor pair using solid-phase DNA synthesis

NASA Technical Reports Server (NTRS)

Frank, Natia L.; Meade, Thomas J.

2003-01-01

Incorporation of metalated nucleosides into DNA through covalent modification is crucial to measurement of thermal electron-transfer rates and the dependence of these rates with structure, distance, and position. Here, we report the first synthesis of an electron donor-acceptor pair of 5' metallonucleosides and their subsequent incorporation into oligonucleotides using solid-phase DNA synthesis techniques. Large-scale syntheses of metal-containing oligonucleotides are achieved using 5' modified phosporamidites containing [Ru(acac)(2)(IMPy)](2+) (acac is acetylacetonato; IMPy is 2'-iminomethylpyridyl-2'-deoxyuridine) (3) and [Ru(bpy)(2)(IMPy)](2+) (bpy is 2,2'-bipyridine; IMPy is 2'-iminomethylpyridyl-2'-deoxyuridine) (4). Duplexes formed with the metal-containing oligonucleotides exhibit thermal stability comparable to the corresponding unmetalated duplexes (T(m) of modified duplex = 49 degrees C vs T(m) of unmodified duplex = 47 degrees C). Electrochemical (3, E(1/2) = -0.04 V vs NHE; 4, E(1/2) = 1.12 V vs NHE), absorption (3, lambda(max) = 568, 369 nm; 4, lambda(max) = 480 nm), and emission (4, lambda(max) = 720 nm, tau = 55 ns, Phi = 1.2 x 10(-)(4)) data for the ruthenium-modified nucleosides and oligonucleotides indicate that incorporation into an oligonucleotide does not perturb the electronic properties of the ruthenium complex or the DNA significantly. In addition, the absence of any change in the emission properties upon metalated duplex formation suggests that the [Ru(bpy)(2)(IMPy)](2+)[Ru(acac)(2)(IMPy)](2+) pair will provide a valuable probe for DNA-mediated electron-transfer studies.

High Boron-loaded DNA-Oligomers as Potential Boron Neutron Capture Therapy and Antisense Oligonucleotide Dual-Action Anticancer Agents.

PubMed

Kaniowski, Damian; Ebenryter-Olbińska, Katarzyna; Sobczak, Milena; Wojtczak, Błażej; Janczak, Sławomir; Leśnikowski, Zbigniew J; Nawrot, Barbara

2017-08-23

Boron cluster-modified therapeutic nucleic acids with improved properties are of interest in gene therapy and in cancer boron neutron capture therapy (BNCT). High metallacarborane-loaded antisense oligonucleotides (ASOs) targeting epidermal growth factor receptor (EGFR) were synthesized through post-synthetic Cu (I)-assisted "click" conjugation of alkyne-modified DNA-oligonucleotides with a boron cluster alkyl azide component. The obtained oligomers exhibited increased lipophilicity compared to their non-modified precursors, while their binding affinity to complementary DNA and RNA strands was slightly decreased. Multiple metallacarborane residues present in the oligonucleotide chain, each containing 18 B-H groups, enabled the use of IR spectroscopy as a convenient analytical method for these oligomers based on the diagnostic B-H signal at 2400-2650 cm -1 . The silencing activity of boron cluster-modified ASOs used at higher concentrations was similar to that of unmodified oligonucleotides. The screened ASOs, when used in low concentrations (up to 50 μM), exhibited pro-oxidative properties by inducing ROS production and an increase in mitochondrial activities in HeLa cells. In contrast, when used at higher concentrations, the ASOs exhibited anti-oxidative properties by lowering ROS species levels. In the HeLa cells (tested in the MTT assay) treated (without lipofectamine) or transfected with the screened compounds, the mitochondrial activity remained equal to the control level or only slightly changed (±30%). These findings may be useful in the design of dual-action boron cluster-modified therapeutic nucleic acids with combined antisense and anti-oxidant properties.

Antisense Oligonucleotide Therapy for Patients with Advanced Cancer | Center for Cancer Research

Cancer.gov

Colorectal cancer (CRC) is the second leading cause of cancer-related death in the U.S. Improvements in therapy have increased the survival of patients with CRC from 10 months to two years, but for patients who stop responding to treatments, such as irinotecan, options for additional therapy are limited. Antisense oligonucleotides (ASOs) may offer advantages over traditional

Development of a general methodology for labelling peptide-morpholino oligonucleotide conjugates using alkyne-azide click chemistry.

PubMed

Shabanpoor, Fazel; Gait, Michael J

2013-11-11

We describe a general methodology for fluorescent labelling of peptide conjugates of phosphorodiamidate morpholino oligonucleotides (PMOs) by alkyne functionalization of peptides, subsequent conjugation to PMOs and labelling with a fluorescent compound (Cy5-azide). Two peptide-PMO (PPMO) examples are shown. No detrimental effect of such labelled PMOs was seen in a biological assay.

Antisense Oligonucleotides Modulating Activation of a Nonsense-Mediated RNA Decay Switch Exon in the ATM Gene.

PubMed

Kralovicova, Jana; Moreno, Pedro M D; Cross, Nicholas C P; Pêgo, Ana Paula; Vorechovsky, Igor

2016-12-01

ATM (ataxia-telangiectasia, mutated) is an important cancer susceptibility gene that encodes a key apical kinase in the DNA damage response pathway. ATM mutations in the germ line result in ataxia-telangiectasia (A-T), a rare genetic syndrome associated with hypersensitivity to double-strand DNA breaks and predisposition to lymphoid malignancies. ATM expression is limited by a tightly regulated nonsense-mediated RNA decay (NMD) switch exon (termed NSE) located in intron 28. In this study, we identify antisense oligonucleotides that modulate NSE inclusion in mature transcripts by systematically targeting the entire 3.1-kb-long intron. Their identification was assisted by a segmental deletion analysis of transposed elements, revealing NSE repression upon removal of a distant antisense Alu and NSE activation upon elimination of a long terminal repeat transposon MER51A. Efficient NSE repression was achieved by delivering optimized splice-switching oligonucleotides to embryonic and lymphoblastoid cells using chitosan-based nanoparticles. Together, these results provide a basis for possible sequence-specific radiosensitization of cancer cells, highlight the power of intronic antisense oligonucleotides to modify gene expression, and demonstrate transposon-mediated regulation of NSEs.

Identifying of meat species using polymerase chain reaction (PCR)

NASA Astrophysics Data System (ADS)

Foong, Chow Ming; Sani, Norrakiah Abdullah

2013-11-01

Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one's diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing.

A novel bioinformatics method for efficient knowledge discovery by BLSOM from big genomic sequence data.

PubMed

Bai, Yu; Iwasaki, Yuki; Kanaya, Shigehiko; Zhao, Yue; Ikemura, Toshimichi

2014-01-01

With remarkable increase of genomic sequence data of a wide range of species, novel tools are needed for comprehensive analyses of the big sequence data. Self-Organizing Map (SOM) is an effective tool for clustering and visualizing high-dimensional data such as oligonucleotide composition on one map. By modifying the conventional SOM, we have previously developed Batch-Learning SOM (BLSOM), which allows classification of sequence fragments according to species, solely depending on the oligonucleotide composition. In the present study, we introduce the oligonucleotide BLSOM used for characterization of vertebrate genome sequences. We first analyzed pentanucleotide compositions in 100 kb sequences derived from a wide range of vertebrate genomes and then the compositions in the human and mouse genomes in order to investigate an efficient method for detecting differences between the closely related genomes. BLSOM can recognize the species-specific key combination of oligonucleotide frequencies in each genome, which is called a "genome signature," and the specific regions specifically enriched in transcription-factor-binding sequences. Because the classification and visualization power is very high, BLSOM is an efficient powerful tool for extracting a wide range of information from massive amounts of genomic sequences (i.e., big sequence data).

Oligonucleotide-genotyping as a method of detecting the HLA-DR2 (DRw15)-Dw2, -DR2 (DRw15)-Dw12, -DR4-Dw15, and -DR4-D"KT2" haplotypes in the Japanese population.

PubMed

Obata, F; Ito, I; Kaneko, T; Ohkubo, M; Ishimoto, A L; Abe, A; Kashiwagi, N

1989-05-01

We synthesized pairs of four different oligonucleotides, F22, F29, F42, and F158, to analyse the HLA-DR2 (DRw15) and -DR4 haplotypes in the Japanese population. After enzymatically amplifying the HLA-DRB1 gene, we hybridized the oligonucleotide probes with DNA extracted from 42 donors. Hybridization was completed between F22 and the DNA of haplotype DR2 (DRw15)-Dw2, between F29 and the DNA of DR2 (DRw15)-Dw12, between F42 and the DNA of DR4-D"KT2", and between F158 and the DNA of DR4-Dw15. In keeping with the nucleotide sequences of the probes, F29 hybridized also with DNA from the DR9-Dw23 haplotype and F158 with that from some of the DRw8 haplotypes (DRw8-Dw8.3) in the Japanese population. Results of this study demonstrate that the four oligonucleotides make useful probes for detecting the haplotypes above.

Metallo-Phthalocyanine Near-IR Fluorophores: Oligonucleotide Conjugates and Their Applications in PCR Assays

PubMed Central

Nesterova, Irina V.; Verdree, Vera T.; Pakhomov, Serhii; Strickler, Karen L.; Allen, Michael W.; Hammer, Robert P.; Soper, Steven A.

2011-01-01

Water soluble, metallo-pthalocyanine (MPc) near-IR fluorophores were designed, synthesized, and evaluated as highly stable and sensitive reporters for fluorescence assays. Their conjugation to oligonucleotides was achieved via succinimidyl ester-amino coupling chemistry with the conditions for conjugation extensively examined and optimized. In addition, various conjugate purification and isolation techniques were evaluated as well. Results showed that under proper conditions and following purification using reverse-phase ion-pair chromatography, labeling efficiencies near 80% could be achieved using ZnPc (Zn phthalocyanine) as the labeling fluorophore. Absorption and fluorescence spectra accumulated for the conjugates indicated that the intrinsic fluorescence properties of the MPc’s were not significantly altered by covalent attachment to oligonucleotides. As an example of the utility of MPc reporters, we used the MPc–oligonucleotide conjugates as primers for PCR (polymerase chain reaction) amplifications with the products sorted via electrophoresis and detected using near-IR fluorescence (λex = 680 nm). The MPc dyes were found to be more chemically stable under typical thermal cycling conditions used for PCR compared to the carbocyanine-based near-IR reporter systems typically used and produced single and narrow bands in the electrophoretic traces, indicative of producing a single PCR product during amplification. PMID:18030995

Identifying of meat species using polymerase chain reaction (PCR)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Foong, Chow Ming; Sani, Norrakiah Abdullah

Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one’s diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reactionmore » (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing.« less

Typing of artiodactyl MHC-DRB genes with the help of intronic simple repeated DNA sequences.

PubMed

Schwaiger, F W; Buitkamp, J; Weyers, E; Epplen, J T

1993-02-01

An efficient oligonucleotide typing method for the highly polymorphic MHC-DRB genes is described for artiodactyls like cattle, sheep and goat. By means of the polymerase chain reaction, the second exon of MHC-DRB is amplified as well as part of the adjacent intron containing a mixed simple repeat sequence. Using this primer combination we were able to amplify the MHC-DRB exons 2 and adjacent introns from all of the investigated 10 species of the family of Bovidae and giraffes. Therefore, the DRB genes of novel artiodactyl species can also be readily studied. Oligonucleotide probes specific for the polymorphisms of ungulate DRB genes are used with which sequences differing in at least one single base can be distinguished. Exonic polymorphism was found to be correlated with the allele lengths and the patterns of the repeat structures. Hence oligonucleotide probes specific for different simple repeats and polymorphic positions serve also for typing across species barriers. The strict correlation of sequence length and exonic polymorphism permits a preselection of specific oligonucleotides for hybridization. Thus more than 20 alleles can already be differentiated from each of the three species.

Electron stimulated desorption of anions from native and brominated single stranded oligonucleotide trimers

PubMed Central

Polska, Katarzyna; Rak, Janusz; Bass, Andrew D.; Cloutier, Pierre; Sanche, Léon

2013-01-01

We measured the low energy electron stimulated desorption (ESD) of anions from thin films of native (TXT) and bromine monosubstituted (TBrXT) oligonucleotide trimers deposited on a gold surface (T = thymidine, X = T, deoxycytidine (C), deoxyadenosine (A) or deoxyguanosine (G), Br = bromine). The desorption of H−, CH3−/NH−, O−/NH2−, OH−, CN−, and Br− was induced by 0 to 20 eV electrons. Dissociative electron attachment, below 12 eV, and dipolar dissociation, above 12 eV, are responsible for the formation of these anions. The comparison of the results obtained for the native and brominated trimers suggests that the main pathways of TBrXT degradation correspond to the release of the hydride and bromide anions. Significantly, the presence of bromine in oligonucleotide trimers blocks the electron-induced degradation of nuclobases as evidenced by a dramatic decrease in CN− desorption. An increase in the yields of OH− is also observed. The debromination yield of particular oligonucleotides diminishes in the following order: BrdU > BrdA > BrdG > BrdC. Based on these results, 5-bromo-2′-deoxyuridine appears to be the best radiosensitizer among the studied bromonucleosides. PMID:22360262

Electron stimulated desorption of anions from native and brominated single stranded oligonucleotide trimers.

PubMed

Polska, Katarzyna; Rak, Janusz; Bass, Andrew D; Cloutier, Pierre; Sanche, Léon

2012-02-21

We measured the low energy electron stimulated desorption (ESD) of anions from thin films of native (TXT) and bromine monosubstituted (TBrXT) oligonucleotide trimers deposited on a gold surface (T = thymidine, X = T, deoxycytidine (C), deoxyadenosine (A) or deoxyguanosine (G), Br = bromine). The desorption of H(-), CH(3)(-)/NH(-), O(-)/NH(2)(-), OH(-), CN(-), and Br(-) was induced by 0 to 20 eV electrons. Dissociative electron attachment, below 12 eV, and dipolar dissociation, above 12 eV, are responsible for the formation of these anions. The comparison of the results obtained for the native and brominated trimers suggests that the main pathways of TBrXT degradation correspond to the release of the hydride and bromide anions. Significantly, the presence of bromine in oligonucleotide trimers blocks the electron-induced degradation of nuclobases as evidenced by a dramatic decrease in CN(-) desorption. An increase in the yields of OH(-) is also observed. The debromination yield of particular oligonucleotides diminishes in the following order: BrdU > BrdA > BrdG > BrdC. Based on these results, 5-bromo-2(')-deoxyuridine appears to be the best radiosensitizer among the studied bromonucleosides. © 2012 American Institute of Physics

Electron stimulated desorption of anions from native and brominated single stranded oligonucleotide trimers

NASA Astrophysics Data System (ADS)

Polska, Katarzyna; Rak, Janusz; Bass, Andrew D.; Cloutier, Pierre; Sanche, Léon

2012-02-01

We measured the low energy electron stimulated desorption (ESD) of anions from thin films of native (TXT) and bromine monosubstituted (TBrXT) oligonucleotide trimers deposited on a gold surface (T = thymidine, X = T, deoxycytidine (C), deoxyadenosine (A) or deoxyguanosine (G), Br = bromine). The desorption of H-, CH3-/NH-, O-/NH2-, OH-, CN-, and Br- was induced by 0 to 20 eV electrons. Dissociative electron attachment, below 12 eV, and dipolar dissociation, above 12 eV, are responsible for the formation of these anions. The comparison of the results obtained for the native and brominated trimers suggests that the main pathways of TBrXT degradation correspond to the release of the hydride and bromide anions. Significantly, the presence of bromine in oligonucleotide trimers blocks the electron-induced degradation of nuclobases as evidenced by a dramatic decrease in CN- desorption. An increase in the yields of OH- is also observed. The debromination yield of particular oligonucleotides diminishes in the following order: BrdU > BrdA > BrdG > BrdC. Based on these results, 5-bromo-2'-deoxyuridine appears to be the best radiosensitizer among the studied bromonucleosides.

probeBase—an online resource for rRNA-targeted oligonucleotide probes and primers: new features 2016

PubMed Central

Greuter, Daniel; Loy, Alexander; Horn, Matthias; Rattei, Thomas

2016-01-01

probeBase http://www.probebase.net is a manually maintained and curated database of rRNA-targeted oligonucleotide probes and primers. Contextual information and multiple options for evaluating in silico hybridization performance against the most recent rRNA sequence databases are provided for each oligonucleotide entry, which makes probeBase an important and frequently used resource for microbiology research and diagnostics. Here we present a major update of probeBase, which was last featured in the NAR Database Issue 2007. This update describes a complete remodeling of the database architecture and environment to accommodate computationally efficient access. Improved search functions, sequence match tools and data output now extend the opportunities for finding suitable hierarchical probe sets that target an organism or taxon at different taxonomic levels. To facilitate the identification of complementary probe sets for organisms represented by short rRNA sequence reads generated by amplicon sequencing or metagenomic analysis with next generation sequencing technologies such as Illumina and IonTorrent, we introduce a novel tool that recovers surrogate near full-length rRNA sequences for short query sequences and finds matching oligonucleotides in probeBase. PMID:26586809

Cellular uptake of modified oligonucleotides: fluorescence approach

NASA Astrophysics Data System (ADS)

Kočišová, Eva; Praus, Petr; Rosenberg, Ivan; Seksek, Olivier; Sureau, Franck; Štěpánek, Josef; Turpin, Pierre-Yves

2005-06-01

Cellular uptake and intracellular distribution of the synthetic antisense analogue of dT 15 oligonucleotide (homogenously containing 3'-O-P-CH 2-O-5' internucleotide linkages and labeled with tetramethylrhodamine dye) was studied on B16 melanoma cell line by fluorescence micro-imaging and time-resolved microspectrofluorimetry. By using amphotericin B 3-dimethylaminopropyl amide as an enhancer molecule for the uptake process, homogenous staining of the cells with rather distinct nucleoli staining was achieved after 4 h of incubation. Two spectral components of 2.7 and 1.3 ns lifetime, respectively, were resolved in the emission collected from the cell nucleus. The way of staining and the long-lived component differed from our previous experiments demonstrating complexity of the intracellular oligonucleotide distribution and in particular of the binding inside the nucleus.

Morpholino-mediated Knockdown of DUX4 Toward Facioscapulohumeral Muscular Dystrophy Therapeutics.

PubMed

Chen, Jennifer Cj; King, Oliver D; Zhang, Yuanfan; Clayton, Nicholas P; Spencer, Carrie; Wentworth, Bruce M; Emerson, Charles P; Wagner, Kathryn R

2016-08-01

Derepression of DUX4 in skeletal muscle has emerged as a likely cause of pathology in facioscapulohumeral muscular dystrophy (FSHD). Here we report on the use of antisense phosphorodiamidate morpholino oligonucleotides to suppress DUX4 expression and function in FSHD myotubes and xenografts. The most effective was phosphorodiamidate morpholino oligonucleotide FM10, which targets the polyadenylation signal of DUX4. FM10 had no significant cell toxicity, and RNA-seq analyses of FSHD and control myotubes revealed that FM10 down-regulated many transcriptional targets of DUX4, without overt off-target effects. Electroporation of FM10 into FSHD patient muscle xenografts in mice also down-regulated DUX4 and DUX4 targets. These findings demonstrate the potential of antisense phosphorodiamidate morpholino oligonucleotides as an FSHD therapeutic option.

Synthesis of the Tellurium-Derivatized Phosphoramidites and their Incorporation into DNA Oligonucleotides

PubMed Central

Jiang, Sibo; Sheng, Jia

2015-01-01

Introduction In this unit, an efficient method for the synthesis of 2’-tellerium modified phosphoramidite and its incorporation into oligonucleotide are presented. We choose 5’-O-DMTr-2,2’-anhydro-uridine and -thymidine nucleosides (S.1, S.2) as starting materials due to their easy preparation. The 5’-O-DMTr-2,2’-anhydro-uridine and -thymidine can be converted to corresponding the 2’-tellerium-derivatized nucleosides by treating with the telluride nucleophiles. Subsequently, the 2’-Te-nucleosides can be transformed into 3’-phosphoramidites, which are the building blocks for DNA/RNA synthesis. The DNA synthesis, purification and applications of oligonucleotides containing 2’-Te-U or 2’-Te-T are described in this protocol. PMID:22147418

Junctions between i-motif tetramers in supramolecular structures

PubMed Central

Guittet, Eric; Renciuk, Daniel; Leroy, Jean-Louis

2012-01-01

The symmetry of i-motif tetramers gives to cytidine-rich oligonucleotides the capacity to associate into supramolecular structures (sms). In order to determine how the tetramers are linked together in such structures, we have measured by gel filtration chromatography and NMR the formation and dissociation kinetics of sms built by oligonucleotides containing two short C stretches separated by a non-cytidine-base. We show that a stretch of only two cytidines either at the 3′- or 5′-end is long enough to link the tetramers into sms. The analysis of the properties of sms formed by oligonucleotides differing by the length of the oligo-C stretches, the sequence orientation and the nature of the non-C base provides a model of the junction connecting the tetramers in sms. PMID:22362739

Synthesis, physicochemical and biochemical studies of 1',2'-oxetane constrained adenosine and guanosine modified oligonucleotides, and their comparison with those of the corresponding cytidine and thymidine analogues.

PubMed

Pradeepkumar, Pushpangadan I; Cheruku, Pradeep; Plashkevych, Oleksandr; Acharya, Parag; Gohil, Suresh; Chattopadhyaya, Jyoti

2004-09-22

We have earlier reported the synthesis and antisense properties of the conformationally constrained oxetane-C and -T containing oligonucleotides, which have shown effective down-regulation of the proto-oncogene c-myb mRNA in the K562 human leukemia cells. Here we report on the straightforward syntheses of the oxetane-A and oxetane-G nucleosides as well as their incorporations into antisense oligonucleotides (AONs), and compare their structural and antisense properties with those of the T and C modified AONs (including the thermostability and RNase H recruitment capability of the AON/RNA hybrid duplex by Michaelis-Menten kinetic analyses, their resistance in the human serum, as well as in the presence of exo and endonucleases).

The role of antisense oligonucleotide therapy in patients with familial hypercholesterolemia: risks, benefits, and management recommendations.

PubMed

Agarwala, Anandita; Jones, Peter; Nambi, Vijay

2015-01-01

Antisense oligonucleotide therapy is a promising approach for the treatment of a broad variety of medical conditions. It functions at the cellular level by interfering with RNA function, often leading to degradation of specifically targeted abnormal gene products implicated in the disease process. Mipomersen is a novel antisense oligonucleotide directed at apolipoprotein (apoB)-100, the primary apolipoprotein associated with low-density lipoprotein cholesterol (LDL-C), which has recently been approved for the treatment of familial hypercholesterolemia. A number of clinical studies have demonstrated its efficacy in lowering LDL-C and apoB levels in patients with elevated LDL-C despite maximal medical therapy using conventional lipid-lowering agents. This review outlines the risks and benefits of therapy and provides recommendations on the use of mipomersen.

A mobile asset sharing policy for hospitals with real time locating systems.

PubMed

Demircan-Yıldız, Ece Arzu; Fescioglu-Unver, Nilgun

2016-01-01

Each year, hospitals lose a considerable amount of time and money due to misplaced mobile assets. In addition the assets which remain in departments that frequently use them depreciate early, while other assets of the same type in different departments are rarely used. A real time locating system can prevent these losses when used with appropriate asset sharing policies. This research quantifies the amount of time a medium size hospital saves by using real time locating system and proposes an asset selection rule to eliminate the asset usage imbalance problem. The asset selection rule proposed is based on multi objective optimization techniques. The effectiveness of this rule on asset to patient time and asset utilization rate variance performance measures were tested using discrete event simulation method. Results show that the proposed asset selection rule improved the usage balance significantly. Sensitivity analysis showed that the proposed rule is robust to changes in demand rates and user preferences. Real time locating systems enable saving considerable amount of time in hospitals, and they can still be improved by integrating decision support mechanisms. Combining tracking technology and asset selection rules helps improve healthcare services.

Endoplasmic Reticulum-Associated Degradation Factor ERLIN2: Oncogenic Roles and Molecular Targeting of Breast Cancer

DTIC Science & Technology

2013-06-01

Chemicals were purchased from Sigma unless indicated otherwise. Synthetic oligonucleotides were purchased from Integrated DNA Technologies. Human insulin was...otherwise. Synthetic oligonucleotides were purchased from Integrated DNA Technolo- gies, Inc. (Coralville, IA). Antibodies against XBP1, C/EBPα, and...component of marijuana , induces human glioma cancer cell death through stimulation of ER stress-associated autophagy [92]. δ- tetrahydrocannabinol can

Solid phase synthesis of phosphorothioate oligonucleotides utilizing diethyldithiocarbonate disulfide (DDD) as an efficient sulfur transfer reagent.

PubMed

Cheruvallath, Zacharia S; Kumar, R Krishna; Rentel, Claus; Cole, Douglas L; Ravikumar, Vasulinga T

2003-04-01

Diethyldithiodicarbonate (DDD), a cheap and easily prepared compound, is found to be a rapid and efficient sulfurizing reagent in solid phase synthesis of phosphorothioate oligodeoxyribonucleotides via the phosphoramidite approach. Product yield and quality based on IP-LC-MS compares well with high quality oligonucleotides synthesized using phenylacetyl disulfide (PADS) which is being used for manufacture of our antisense drugs.

Exploring the Use of a Guanine-Rich Catalytic DNA for Sulfoxide Preparation

PubMed Central

Dellafiore, María A.; Montserrat, Javier M.; Iribarren, Adolfo M.

2015-01-01

A guanine-rich DNA oligonucleotide complexed with hemin was used to catalyze controlled oxygen transfer reactions to different sulfides for sulfoxide preparation in the presence of H2O2. Comparable activities were obtained when using fully modified L-DNA. In addition, oligonucleotide immobilization led to an active catalyst which could be successfully recovered and reused without loss of activity. PMID:26066510

Importance of length and sequence order on magnesium binding to surface-bound oligonucleotides studied by second harmonic generation and atomic force microscopy.

PubMed

Holland, Joseph G; Geiger, Franz M

2012-06-07

The binding of magnesium ions to surface-bound single-stranded oligonucleotides was studied under aqueous conditions using second harmonic generation (SHG) and atomic force microscopy (AFM). The effect of strand length on the number of Mg(II) ions bound and their free binding energy was examined for 5-, 10-, 15-, and 20-mers of adenine and guanine at pH 7, 298 K, and 10 mM NaCl. The binding free energies for adenine and guanine sequences were calculated to be -32.1(4) and -35.6(2) kJ/mol, respectively, and invariant with strand length. Furthermore, the ion density for adenine oligonucleotides did not change as strand length increased, with an average value of 2(1) ions/strand. In sharp contrast, guanine oligonucleotides displayed a linear relationship between strand length and ion density, suggesting that cooperativity is important. This data gives predictive capabilities for mixed strands of various lengths, which we exploit for 20-mers of adenines and guanines. In addition, the role sequence order plays in strands of hetero-oligonucleotides was examined for 5'-A(10)G(10)-3', 5'-(AG)(10)-3', and 5'-G(10)A(10)-3' (here the -3' end is chemically modified to bind to the surface). Although the free energy of binding is the same for these three strands (averaged to be -33.3(4) kJ/mol), the total ion density increases when several guanine residues are close to the 3' end (and thus close to the solid support substrate). To further understand these results, we analyzed the height profiles of the functionalized surfaces with tapping-mode atomic force microscopy (AFM). When comparing the average surface height profiles of the oligonucleotide surfaces pre- and post- Mg(II) binding, a positive correlation was found between ion density and the subsequent height decrease following Mg(II) binding, which we attribute to reductions in Coulomb repulsion and strand collapse once a critical number of Mg(II) ions are bound to the strand.

Abnormal thymic maturation and lymphoproliferation in MRL-Fas lpr/lpr mice can be partially reversed by synthetic oligonucleotides: implications for systemic lupus erythematosus and autoimmune lymphoproliferative syndrome.

PubMed

Ashman, R F; Singh, N; Lenert, P S

2017-06-01

MRL-Fas lpr/lpr mice represent an excellent animal model for studying non-malignant lymphoproliferation, regeneration and systemic autoimmunity. Retro-transposon insertion into the second intron of the pro-apoptotic Fas gene appears to be responsible for both lymphoproliferation and autoimmunity, while other genes are more likely to contribute to the regenerative healing characteristic of this mouse strain. Previous studies have shown that neonatal thymectomy can halt the development of abnormal lymphoproliferation. Whereas at four weeks of age primary and secondary lymphoid organs appear to be grossly intact, vigorous lymphoproliferation and autoantibody production subsequently ensues. This is first noticeable at six weeks of age, at which time lymph nodes, spleens and thymuses, but not the bone marrow, become infiltrated with abnormal B220 + CD3 + CD4 - CD8 - T cells. Around the same time, thymuses show a significant drop in CD4 + CD8 + double-positive T cells generating an abnormal ratio between double-positive and single-positive thymocytes. The objective of current study was to evaluate the effect of synthetic oligonucleotides-toll-like receptor antagonists on early lymphoid development in this strain of mice. Herein, we demonstrate the ability of synthetic oligonucleotides made with the nuclease-resistant phosphorothioate backbone to partially reverse abnormal lymphoproliferation and thymic involution in pre-diseased MRL-Fas lpr/lpr mice when administered intraperitoneally starting from week four of age. This curative effect of oligonucleotides was primary sequence/secondary oligonucleotide structure-independent, suggesting an effect through the toll-like receptor 7. A similar approach may potentially benefit patients with autoimmune lymphoproliferative syndrome who, like MRL-Fas lpr/lpr mice, carry a mutation in the Fas gene.

DNA assembly with error correction on a droplet digital microfluidics platform.

PubMed

Khilko, Yuliya; Weyman, Philip D; Glass, John I; Adams, Mark D; McNeil, Melanie A; Griffin, Peter B

2018-06-01

Custom synthesized DNA is in high demand for synthetic biology applications. However, current technologies to produce these sequences using assembly from DNA oligonucleotides are costly and labor-intensive. The automation and reduced sample volumes afforded by microfluidic technologies could significantly decrease materials and labor costs associated with DNA synthesis. The purpose of this study was to develop a gene assembly protocol utilizing a digital microfluidic device. Toward this goal, we adapted bench-scale oligonucleotide assembly methods followed by enzymatic error correction to the Mondrian™ digital microfluidic platform. We optimized Gibson assembly, polymerase chain reaction (PCR), and enzymatic error correction reactions in a single protocol to assemble 12 oligonucleotides into a 339-bp double- stranded DNA sequence encoding part of the human influenza virus hemagglutinin (HA) gene. The reactions were scaled down to 0.6-1.2 μL. Initial microfluidic assembly methods were successful and had an error frequency of approximately 4 errors/kb with errors originating from the original oligonucleotide synthesis. Relative to conventional benchtop procedures, PCR optimization required additional amounts of MgCl 2 , Phusion polymerase, and PEG 8000 to achieve amplification of the assembly and error correction products. After one round of error correction, error frequency was reduced to an average of 1.8 errors kb - 1 . We demonstrated that DNA assembly from oligonucleotides and error correction could be completely automated on a digital microfluidic (DMF) platform. The results demonstrate that enzymatic reactions in droplets show a strong dependence on surface interactions, and successful on-chip implementation required supplementation with surfactants, molecular crowding agents, and an excess of enzyme. Enzymatic error correction of assembled fragments improved sequence fidelity by 2-fold, which was a significant improvement but somewhat lower than expected compared to bench-top assays, suggesting an additional capacity for optimization.

Introduction on Using the FastPCR Software and the Related Java Web Tools for PCR and Oligonucleotide Assembly and Analysis.

PubMed

Kalendar, Ruslan; Tselykh, Timofey V; Khassenov, Bekbolat; Ramanculov, Erlan M

2017-01-01

This chapter introduces the FastPCR software as an integrated tool environment for PCR primer and probe design, which predicts properties of oligonucleotides based on experimental studies of the PCR efficiency. The software provides comprehensive facilities for designing primers for most PCR applications and their combinations. These include the standard PCR as well as the multiplex, long-distance, inverse, real-time, group-specific, unique, overlap extension PCR for multi-fragments assembling cloning and loop-mediated isothermal amplification (LAMP). It also contains a built-in program to design oligonucleotide sets both for long sequence assembly by ligase chain reaction and for design of amplicons that tile across a region(s) of interest. The software calculates the melting temperature for the standard and degenerate oligonucleotides including locked nucleic acid (LNA) and other modifications. It also provides analyses for a set of primers with the prediction of oligonucleotide properties, dimer and G/C-quadruplex detection, linguistic complexity as well as a primer dilution and resuspension calculator. The program consists of various bioinformatical tools for analysis of sequences with the GC or AT skew, CG% and GA% content, and the purine-pyrimidine skew. It also analyzes the linguistic sequence complexity and performs generation of random DNA sequence as well as restriction endonucleases analysis. The program allows to find or create restriction enzyme recognition sites for coding sequences and supports the clustering of sequences. It performs efficient and complete detection of various repeat types with visual display. The FastPCR software allows the sequence file batch processing that is essential for automation. The program is available for download at http://primerdigital.com/fastpcr.html , and its online version is located at http://primerdigital.com/tools/pcr.html .

Improved DNA hybridization parameters by Twisted Intercalating Nucleic Acid (TINA).

PubMed

Schneider, Uffe Vest

2012-01-01

This thesis establishes oligonucleotide design rules and applications of a novel group of DNA stabilizing molecules collectively called Twisted Intercalating Nucleic Acid - TINA. Three peer-reviewed publications form the basis for the thesis. One publication describes an improved and rapid method for determination of DNA melting points and two publications describe the effects of positioning TINA molecules in parallel triplex helix and antiparallel duplex helix forming DNA structures. The third publication establishes that TINA molecules containing oligonucleotides improve an antiparallel duplex hybridization based capture assay's analytical sensitivity compared to conventionel DNA oligonucleotides. Clinical microbiology is traditionally based on pathogenic microorganisms' culture and serological tests. The introduction of DNA target amplification methods like PCR has improved the analytical sensitivity and total turn around time involved in clinical diagnostics of infections. Due to the relatively weak hybridization between the two strands of double stranded DNA, a number of nucleic acid stabilizing molecules have been developed to improve the sensitivity of DNA based diagnostics through superior binding properties. A short introduction is given to Watson-Crick and Hoogsteen based DNA binding and the derived DNA structures. A number of other nucleic acid stabilizing molecules are described. The stabilizing effect of TINA molecules on different DNA structures is discussed and considered in relation to other nucleic acid stabilizing molecules and in relation to future use of TINA containing oligonucleotides in clinical diagnostics and therapy. In conclusion, design of TINA modified oligonucleotides for antiparallel duplex helixes and parallel triplex helixes follows simple purpose dependent rules. TINA molecules are well suited for improving multiplex PCR assays and can be used as part of novel technologies. Future research should test whether combinations of TINA molecules and other nucleic acid stabilizing molecules can increase analytical sensitivity whilst maintaining nucleobase mismatch discrimination in triplex helix based diagnostic assays.

Assessment of new biocompatible poly(N-(morpholino)ethyl methacrylate)-based copolymers by transfection of immortalized keratinocytes.

PubMed

Van Overstraeten-Schlögel, Nancy; Shim, Yong-Ho; Tevel, Virginie; Piel, Géraldine; Piette, Jacques; Dubois, Philippe; Raes, Martine

2012-02-01

Skin carcinomas are among the most commonly diagnosed tumors in the world. In this study, we investigated the transfection of immortalized keratinocytes, used as an in vitro model for skin carcinoma, using the antisense technology and poly(2-(dimethylamino)ethyl methacrylate) (PDMAEMA)-based copolymers. In order to improve the transfection efficiency of the classic PDMAEMA polymers, copolymers were synthesized including a poly(N-morpholino)ethylmethacrylate) (PMEMA) moiety for an improved proton-sponge effect, intended to favour the release of the oligonucleotide from the acidic endosome. These copolymers were synthesized either statistically (with alternating PDMAEMA and PMEMA fragments) or in blocks (one PDMAEMA block followed by one PMEMA block). MTT assays were performed using the PDMAEMA-PMEMA copolymers and revealed no significant cytotoxicity of these polymers at an N/P ratio of 7.3. Using fluorescent oligonucleotides and analyzing transfection efficiency by flow cytometry, we noticed no significant differences between the two kinds of copolymers. However copolymers with a higher DMAEMA content and a higher Mn were also those displaying the highest vectorization efficiency. Confocal microscopy showed that these copolymers induced a fine granular distribution of the transfected antisense oligonucleotides inside the cells. We also assessed the functionality of the transfected antisense oligonucleotide by transfecting immortalized GFP expressing keratinocytes with a GFP antisense oligonucleotide using these copolymers. A significant silencing was achieved with a PDMAEMA-PMEMA in block copolymer (Mn=41,000, 89 % PDMAEMA). Together, these results suggest that PDMAEMA-PMEMA copolymers combining low toxicity, vectorization and proton sponge properties, can be efficiently used to transfect immortalized keratinocytes and so open new perspectives in the therapy of skin carcinomas as well as of other skin diseases of genetic or immunological origin. © 2012 Informa Healthcare USA, Inc.

Automated detection and quantitation of bacterial RNA by using electrical microarrays.

PubMed

Elsholz, B; Wörl, R; Blohm, L; Albers, J; Feucht, H; Grunwald, T; Jürgen, B; Schweder, T; Hintsche, Rainer

2006-07-15

Low-density electrical 16S rRNA specific oligonucleotide microarrays and an automated analysis system have been developed for the identification and quantitation of pathogens. The pathogens are Escherichia coli, Pseudomonas aeruginosa, Enterococcus faecalis, Staphylococcus aureus, and Staphylococcus epidermidis, which are typically involved in urinary tract infections. Interdigitated gold array electrodes (IDA-electrodes), which have structures in the nanometer range, have been used for very sensitive analysis. Thiol-modified oligonucleotides are immobilized on the gold IDA as capture probes. They mediate the specific recognition of the target 16S rRNA by hybridization. Additionally three unlabeled oligonucleotides are hybridized in close proximity to the capturing site. They are supporting molecules, because they improve the RNA hybridization at the capturing site. A biotin labeled detector oligonucleotide is also allowed to hybridize to the captured RNA sequence. The biotin labels enable the binding of avidin alkaline phophatase conjugates. The phosphatase liberates the electrochemical mediator p-aminophenol from its electrically inactive phosphate derivative. The electrical signals were generated by amperometric redox cycling and detected by a unique multipotentiostat. The read out signals of the microarray are position specific current and change over time in proportion to the analyte concentration. If two additional biotins are introduced into the affinity binding complex via the supporting oligonucleotides, the sensitivity of the assays increase more than 60%. The limit of detection of Escherichia coli total RNA has been determined to be 0.5 ng/microL. The control of fluidics for variable assay formats as well as the multichannel electrical read out and data handling have all been fully automated. The fast and easy procedure does not require any amplification of the targeted nucleic acids by PCR.

Selective Inhibition of the Human tie-1 Promoter with Triplex-Forming Oligonucleotides Targeted to Ets Binding Sites

PubMed Central

Hewett, Peter W; Daft, Emma L; Laughton, Charles A; Ahmad, Shakil; Ahmed, Asif; Murray, J Clifford

2006-01-01

The Tie receptors (Tie-1 and Tie-2/Tek) are essential for angiogenesis and vascular remodeling/integrity. Tie receptors are up-regulated in tumor-associated endothelium, and their inhibition disrupts angiogenesis and can prevent tumor growth as a consequence. To investigate the potential of anti-gene approaches to inhibit tie gene expression for anti-angiogenic therapy, we have examined triple-helical (triplex) DNA formation at 2 tandem Ets transcription factor binding motifs (designated E-1 and E-2) in the human tie-1 promoter. Various tie-1 promoter deletion/mutation luciferase reporter constructs were generated and transfected into endothelial cells to examine the relative activities of E-1 and E-2. The binding of antiparallel and parallel (control) purine motif oligonucleotides (21–22 bp) targeted to E-1 and E-2 was assessed by plasmid DNA fragment binding and electrophoretic mobility shift assays. Triplex-forming oligonucleotides were incubated with tie-1 reporter constructs and transfected into endothelial cells to determine their activity. The Ets binding motifs in the E-1 sequence were essential for human tie-1 promoter activity in endothelial cells, whereas the deletion of E-2 had no effect. Antiparallel purine motif oligonucleotides targeted at E-1 or E-2 selectively formed strong triplex DNA (Kd ~10−7 M) at 37 °C. Transfection of tie-1 reporter constructs with triplex DNA at E-1, but not E-2, specifically inhibited tie-1 promoter activity by up to 75% compared with control oligonucleotides in endothelial cells. As similar multiple Ets binding sites are important for the regulation of several endothelial-restricted genes, this approach may have broad therapeutic potential for cancer and other pathologies involving endothelial proliferation/dysfunction. PMID:16838069

Selective inhibition of the human tie-1 promoter with triplex-forming oligonucleotides targeted to Ets binding sites.

PubMed

Hewett, Peter W; Daft, Emma L; Laughton, Charles A; Ahmad, Shakil; Ahmed, Asif; Murray, J Clifford

2006-01-01

The Tie receptors (Tie-1 and Tie-2/Tek) are essential for angiogenesis and vascular remodeling/integrity. Tie receptors are up-regulated in tumor-associated endothelium, and their inhibition disrupts angiogenesis and can prevent tumor growth as a consequence. To investigate the potential of anti-gene approaches to inhibit tie gene expression for anti-angiogenic therapy, we have examined triple-helical (triplex) DNA formation at 2 tandem Ets transcription factor binding motifs (designated E-1 and E-2) in the human tie-1 promoter. Various tie-1 promoter deletion/mutation luciferase reporter constructs were generated and transfected into endothelial cells to examine the relative activities of E-1 and E-2. The binding of antiparallel and parallel (control) purine motif oligonucleotides (21-22 bp) targeted to E-1 and E-2 was assessed by plasmid DNA fragment binding and electrophoretic mobility shift assays. Triplex-forming oligonucleotides were incubated with tie-1 reporter constructs and transfected into endothelial cells to determine their activity. The Ets binding motifs in the E-1 sequence were essential for human tie-1 promoter activity in endothelial cells, whereas the deletion of E-2 had no effect. Antiparallel purine motif oligonucleotides targeted at E-1 or E-2 selectively formed strong triplex DNA (K(d) approximately 10(-7) M) at 37 degrees C. Transfection of tie-1 reporter constructs with triplex DNA at E-1, but not E-2, specifically inhibited tie-1 promoter activity by up to 75% compared with control oligonucleotides in endothelial cells. As similar multiple Ets binding sites are important for the regulation of several endothelial-restricted genes, this approach may have broad therapeutic potential for cancer and other pathologies involving endothelial proliferation/dysfunction.

Decoy Oligonucleotide Rescues IGF1R Expression from MicroRNA-223 Suppression

PubMed Central

Wang, Rong; He, Bao Mei; Qi, Bing; Xu, Chang Jun; Wu, Xing Zhong

2013-01-01

A mature miRNA generally suppresses hundreds of mRNA targets. To evaluate the selective effect of synthetic oligonucleotide decoys on hsa-miR-223 activity, reporters containing 3’ untranslated regions (UTR) of IGF1R, FOXO1, POLR3G, FOXO3, CDC27, FBXW7 and PAXIP1 mRNAs were constructed for the luciferase assay. The oligonucleotide decoys were designed and synthesized according to mature miR-223 sequence and its target mRNA sequence. Quantitative RT-PCR & western analysis were used to measure miR-223-targeted mRNA expression, Interestingly, apart from the antisense oligonucleotide, decoy nucleotides which were complementary to the 5’, central or 3’ region of mature miR-223 suppressed miR-223 targeting the 3’UTR of IGF1R, FOXO1, FOXO3, CDC27, POLR3G, and FBXW7 mRNAs and rescued the expression of these genes to varying degrees from miR-223 suppression at both mRNA and protein levels. All decoys had no effect on PAXIP1 which was not targeted by miR-223. The decoy 1 that was based on the sequence of IGF1R 3’UTR rescued the expression of IGF1R more significantly than other decoy nucleotides except the antisense decoy 4. Decoy 1 also rescued the expression of FOXO3 and POLR3G of which their 3’UTRs have similar binding sites for miR-223 with IGF1R 3’UTR. However decoy 1 failed to recover Sp1, CDC27 and FBXW7 expression. These data support that the sequence-specific decoy oligonucleotides might represent exogenous competing RNA which selectively inhibits microRNA targeting. PMID:24324762

Decoy oligonucleotide rescues IGF1R expression from MicroRNA-223 suppression.

PubMed

Wu, Li Hui; Cai, Qian Qian; Dong, Yi Wei; Wang, Rong; He, Bao Mei; Qi, Bing; Xu, Chang Jun; Wu, Xing Zhong

2013-01-01

A mature miRNA generally suppresses hundreds of mRNA targets. To evaluate the selective effect of synthetic oligonucleotide decoys on hsa-miR-223 activity, reporters containing 3' untranslated regions (UTR) of IGF1R, FOXO1, POLR3G, FOXO3, CDC27, FBXW7 and PAXIP1 mRNAs were constructed for the luciferase assay. The oligonucleotide decoys were designed and synthesized according to mature miR-223 sequence and its target mRNA sequence. Quantitative RT-PCR & western analysis were used to measure miR-223-targeted mRNA expression, Interestingly, apart from the antisense oligonucleotide, decoy nucleotides which were complementary to the 5', central or 3' region of mature miR-223 suppressed miR-223 targeting the 3'UTR of IGF1R, FOXO1, FOXO3, CDC27, POLR3G, and FBXW7 mRNAs and rescued the expression of these genes to varying degrees from miR-223 suppression at both mRNA and protein levels. All decoys had no effect on PAXIP1 which was not targeted by miR-223. The decoy 1 that was based on the sequence of IGF1R 3'UTR rescued the expression of IGF1R more significantly than other decoy nucleotides except the antisense decoy 4. Decoy 1 also rescued the expression of FOXO3 and POLR3G of which their 3'UTRs have similar binding sites for miR-223 with IGF1R 3'UTR. However decoy 1 failed to recover Sp1, CDC27 and FBXW7 expression. These data support that the sequence-specific decoy oligonucleotides might represent exogenous competing RNA which selectively inhibits microRNA targeting.

Oligonucleotide aptamers against tyrosine kinase receptors: Prospect for anticancer applications.

PubMed

Camorani, Simona; Crescenzi, Elvira; Fedele, Monica; Cerchia, Laura

2018-04-01

Transmembrane receptor tyrosine kinases (RTKs) play crucial roles in cancer cell proliferation, survival, migration and differentiation. Area of intense research is searching for effective anticancer therapies targeting these receptors and, to date, several monoclonal antibodies and small-molecule tyrosine kinase inhibitors have entered the clinic. However, some of these drugs show limited efficacy and give rise to acquired resistance. Emerging highly selective compounds for anticancer therapy are oligonucleotide aptamers that interact with their targets by recognizing a specific three-dimensional structure. Because of their nucleic acid nature, the rational design of advanced strategies to manipulate aptamers for both diagnostic and therapeutic applications is greatly simplified over antibodies. In this manuscript, we will provide a comprehensive overview of oligonucleotide aptamers as next generation strategies to efficiently target RTKs in human cancers. Copyright © 2018 Elsevier B.V. All rights reserved.

Efficient assessment of modified nucleoside stability under conditions of automated oligonucleotide synthesis: characterization of the oxidation and oxidative desulfurization of 2-thiouridine.

PubMed

Sochacka, E

2001-01-01

In order to efficiently assess the chemical stability of modified nucleosides to the reagents and conditions of automated oligonucleotide synthesis, we designed, developed and tested a scheme in which the modified nucleoside, directly attached to a solid support, is exposed to the cyclic chemistry of the instrument. Stability of 2-thiouridine against different oxidizers was investigated. Tertbutyl hydroperoxide (1 M) in anhydrous acetonitrile was a more effective oxidizer for the incorporation of 2-thiouridine into oligonucleotide chains than the same oxidizer in methylene chloride. Carbon tetrachloride/water in the presence of a basic catalyst was superior in maintaining the thiocarbonyl function, but its utility for RNA synthesis has yet to be fully tested, whereas 2-phenylsulfonyloxaziridine was a very efficient reagent for oxidative desulfurization of 2-thiouridine.

Heated oligonucleotide ligation assay (HOLA): an affordable single nucleotide polymorphism assay.

PubMed

Black, W C; Gorrochotegui-Escalante, N; Duteau, N M

2006-03-01

Most single nucleotide polymorphism (SNP) detection requires expensive equipment and reagents. The oligonucleotide ligation assay (OLA) is an inexpensive SNP assay that detects ligation between a biotinylated "allele-specific detector" and a 3' fluorescein-labeled "reporter" oligonucleotide. No ligation occurs unless the 3' detector nucleotide is complementary to the SNP nucleotide. The original OLA used chemical denaturation and neutralization. Heated OLA (HOLA) instead uses a thermal stable ligase and cycles of denaturing and hybridization for ligation and SNP detection. The cost per genotype is approximately US$1.25 with two-allele SNPs or approximately US$1.75 with three-allele SNPs. We illustrate the development of HOLA for SNP detection in the Early Trypsin and Abundant Trypsin loci in the mosquito Aedes aegypti (L.) and at the a-glycerophosphate dehydrogenase locus in the mosquito Anopheles gambiae s.s.

Hydrated electrons react with high specificity with cisplatin bound to single-stranded DNA.

PubMed

Behmand, B; Cloutier, P; Girouard, S; Wagner, J R; Sanche, L; Hunting, D J

2013-12-19

Short oligonucleotides TTTTTGTGTTT and TTTTTTTGTTT in solution with and without cisplatin (cisPt) bound to the guanine bases were irradiated with γ-rays at doses varying from 0 to 2500 Gy. To determine the effect of hydrated electrons from water radiolysis on the oligonucleotides, we quenched (•)OH radicals with ethylenediaminetetraacetic acid (EDTA) and displaced oxygen, which reacts with hydrated electrons, by bubbling the solution with wet nitrogen. DNA strand breaks and platinum detachment were quantified by gel electrophoresis. Our results demonstrate that hydrated electrons react almost exclusively at the position of the cisPt adduct, where they induce cisPt detachment from one or both guanines in the oligonucleotide. Given the high yield of hydrated electrons in irradiated tissues, this reaction may be an important step in the mechanism of radiosensitization of DNA by cisPt.

Preparation of genosensor for detection of specific DNA sequence of the hepatitis B virus

NASA Astrophysics Data System (ADS)

Honorato Castro, Ana C.; França, Erick G.; de Paula, Lucas F.; Soares, Marcia M. C. N.; Goulart, Luiz R.; Madurro, João M.; Brito-Madurro, Ana G.

2014-09-01

An electrochemical genosensor was constructed for detection of specific DNA sequence of the hepatitis B virus, based on graphite electrodes modified with poly(4-aminophenol) and incorporating a specific oligonucleotide probe. The modified electrode containing the probe was evaluated by differential pulse voltammetry, before and after incubation with the complementary oligonucleotide target. Detection was performed by monitoring oxidizable DNA bases (direct detection) or using ethidium bromide as indicator of the hybridization process (indirect detection). The device showed a detection limit for the oligonucleotide target of 2.61 nmol L-1. Indirect detection using ethidium bromide was promising in discriminating mismatches, which is a very desirable attribute for detection of disease-related point mutations. In addition, it was possible to observe differences between hybridized and non-hybridized surfaces by atomic force microscopy.

Sieve-based device for MALDI sample preparation. I. Influence of sample deposition conditions in oligonucleotide analysis to achieve significant increases in both sensitivity and resolution.

PubMed

Molin, Laura; Cristoni, Simone; Crotti, Sara; Bernardi, Luigi Rossi; Seraglia, Roberta; Traldi, Pietro

2008-11-01

Spraying of oligonucleotide-matrix solutions through a stainless steel (ss) sieve (38 microm, 450 mesh) leads to the formation, on the matrix-assisted laser desorption/ionization (MALDI) sample holder, of uniformly distributed microcrystals, well separated from each other. When the resulting sample holder surface is irradiated by laser, abundant molecular species form, with a clear increase in both intensity and resolution with respect to values obtained by 'Dried Droplet', 'Double Layer', and 'Sandwich' deposition methods. In addition, unlike the usual situation, the sample is perfectly homogeneous, and identical spectra are obtained by irradiating different areas. On one hand, the data indicate that this method is highly effective for oligonucleotide MALDI analysis, and on the other, that it can be validly employed for fully automated MALDI procedures.

Expression profiling of cassava storage roots reveals an active process of glycolysis/gluconeogenesis.

PubMed

Yang, Jun; An, Dong; Zhang, Peng

2011-03-01

Mechanisms related to the development of cassava storage roots and starch accumulation remain largely unknown. To evaluate genome-wide expression patterns during tuberization, a 60 mer oligonucleotide microarray representing 20 840 cassava genes was designed to identify differentially expressed transcripts in fibrous roots, developing storage roots and mature storage roots. Using a random variance model and the traditional twofold change method for statistical analysis, 912 and 3 386 upregulated and downregulated genes related to the three developmental phases were identified. Among 25 significantly changed pathways identified, glycolysis/gluconeogenesis was the most evident one. Rate-limiting enzymes were identified from each individual pathway, for example, enolase, L-lactate dehydrogenase and aldehyde dehydrogenase for glycolysis/gluconeogenesis, and ADP-glucose pyrophosphorylase, starch branching enzyme and glucan phosphorylase for sucrose and starch metabolism. This study revealed that dynamic changes in at least 16% of the total transcripts, including transcription factors, oxidoreductases/transferases/hydrolases, hormone-related genes, and effectors of homeostasis. The reliability of these differentially expressed genes was verified by quantitative real-time reverse transcription-polymerase chain reaction. These studies should facilitate our understanding of the storage root formation and cassava improvement. © 2011 Institute of Botany, Chinese Academy of Sciences.

Coordinated transcriptional regulation patterns associated with infertility phenotypes in men

PubMed Central

Ellis, Peter J I; Furlong, Robert A; Conner, Sarah J; Kirkman‐Brown, Jackson; Afnan, Masoud; Barratt, Christopher; Griffin, Darren K; Affara, Nabeel A

2007-01-01

Introduction Microarray gene‐expression profiling is a powerful tool for global analysis of the transcriptional consequences of disease phenotypes. Understanding the genetic correlates of particular pathological states is important for more accurate diagnosis and screening of patients, and thus for suggesting appropriate avenues of treatment. As yet, there has been little research describing gene‐expression profiling of infertile and subfertile men, and thus the underlying transcriptional events involved in loss of spermatogenesis remain unclear. Here we present the results of an initial screen of 33 patients with differing spermatogenic phenotypes. Methods Oligonucleotide array expression profiling was performed on testis biopsies for 33 patients presenting for testicular sperm extraction. Significantly regulated genes were selected using a mixed model analysis of variance. Principle components analysis and hierarchical clustering were used to interpret the resulting dataset with reference to the patient history, clinical findings and histological composition of the biopsies. Results Striking patterns of coordinated gene expression were found. The most significant contains multiple germ cell‐specific genes and corresponds to the degree of successful spermatogenesis in each patient, whereas a second pattern corresponds to inflammatory activity within the testis. Smaller‐scale patterns were also observed, relating to unique features of the individual biopsies. PMID:17496197

Targeted Delivery of Therapeutic Oligonucleotides for the Treatment of Prostate Cancer

DTIC Science & Technology

2004-05-01

AD Award Number: DAMD17-01-1-0090 TITLE: Targeted Delivery of Therapeutic Oligonucleotides for the Treatment of Prostate Cancer PRINCIPAL...independence and chemoresistance are the major obstacles in the treatment of patients with advanced prostate cancer (Denis & Murphy, 1993; Oh & Kantoff...independence and chemoresistance in prostate cancer (McDonnell et al., 1992; Colombel et al., 1993; Berchem et al., 1995; Raffo et al., 1995; Bauer et al

Soft Lithography for Oligonucleotide Arrays Fabrication

DTIC Science & Technology

2001-10-25

adenosine; Abbreviated T, C, G, A respectively), the other synthesis reagents and solvents except oxidation agent (seen in Table 1) were purchased...dried by cold blowing before hybridization. Oligonucleotide arrays were hybridized in 200 nM 3’-TCC TCC GAT TCA GAG AGT CC- HEX (PE Biosystems... citrate buffer), 0.1% SDS in 0.1xSSC respectively. The probe array was scanned on the Scanarray Microarray Systems (Packard Biochip Technologies, USA

DNA polymorphism identity determination using flow cytometry

DOEpatents

Nolan, John P.; White, P. Scott; Cai, Hong

2001-01-01

DNA polymorphism identity determination using flow cytometry. Primers designed to be immobilized on microspheres are allowed to anneal to the DNA strand under investigation, and are extended by either DNA polymerase using fluorescent dideoxynucleotides or ligated by DNA ligase to fluorescent reporter oligonucleotides. The fluorescence of either the dideoxynucleotide or the reporter oligonucleotide attached to the immobilized primer is measured by flow cytometry, thereby identifying the nucleotide polymorphism on the DNA strand.

Antisense Oligonucleotide Therapy for Patients with Advanced Cancer | Center for Cancer Research

Cancer.gov

Colorectal cancer (CRC) is the second leading cause of cancer-related death in the U.S. Improvements in therapy have increased the survival of patients with CRC from 10 months to two years, but for patients who stop responding to treatments, such as irinotecan, options for additional therapy are limited. Antisense oligonucleotides (ASOs) may offer advantages over traditional therapies if an appropriate target can be identified.

Co-Administration of an Excipient Oligonucleotide Helps Delineate Pathways of Productive and Nonproductive Uptake of Phosphorothioate Antisense Oligonucleotides in the Liver.

PubMed

Donner, Aaron J; Wancewicz, Edward V; Murray, Heather M; Greenlee, Sarah; Post, Noah; Bell, Melanie; Lima, Walt F; Swayze, Eric E; Seth, Punit P

2017-08-01

Phosphorothioate (PS) modified antisense oligonucleotides (ASOs) have progressed rapidly in the clinic for treating a variety of disease indications. We previously demonstrated that the activity of PS ASOs in the liver can be enhanced by co-infusion of an excipient oligonucleotide (EON). It was posited that the EON saturates a nonproductive uptake pathway(s) thereby permitting accumulation of the PS ASO in a productive tissue compartment. In this report, we measured PS ASO activity following administration by bolus, infusion or co-fusion with EON within hepatocytes and nonparenchymal cells (NPCs), of the liver. This revealed that while ASOs accumulate preferentially in NPCs, they are intrinsically more active in hepatocytes. Furthermore, we show that the EON enhances ASO potency when infused up to 72 h before or after administration of the active ASO suggesting that the EON can saturate and displace the ASO from nonproductive to productive compartments. Physical presence of the EON in tissues was required for optimal potentiation suggesting that there is a dynamic distribution of the ASO and EON between the compartments. Lastly, using a candidate approach, we confirmed Stabilin-2 as a molecular pathway for ASO uptake in sinusoidal endothelial cells and the ASGR as a pathway for ASO uptake into hepatocytes in the liver.

Selection of optimal oligonucleotide probes for microarrays usingmultiple criteria, global alignment and parameter estimation.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Xingyuan; He, Zhili; Zhou, Jizhong

2005-10-30

The oligonucleotide specificity for microarray hybridizationcan be predicted by its sequence identity to non-targets, continuousstretch to non-targets, and/or binding free energy to non-targets. Mostcurrently available programs only use one or two of these criteria, whichmay choose 'false' specific oligonucleotides or miss 'true' optimalprobes in a considerable proportion. We have developed a software tool,called CommOligo using new algorithms and all three criteria forselection of optimal oligonucleotide probes. A series of filters,including sequence identity, free energy, continuous stretch, GC content,self-annealing, distance to the 3'-untranslated region (3'-UTR) andmelting temperature (Tm), are used to check each possibleoligonucleotide. A sequence identity is calculated based onmore » gapped globalalignments. A traversal algorithm is used to generate alignments for freeenergy calculation. The optimal Tm interval is determined based on probecandidates that have passed all other filters. Final probes are pickedusing a combination of user-configurable piece-wise linear functions andan iterative process. The thresholds for identity, stretch and freeenergy filters are automatically determined from experimental data by anaccessory software tool, CommOligo_PE (CommOligo Parameter Estimator).The program was used to design probes for both whole-genome and highlyhomologous sequence data. CommOligo and CommOligo_PE are freely availableto academic users upon request.« less

Real-Time and Accurate Identification of Single Oligonucleotide Photoisomers via an Aerolysin Nanopore.

PubMed

Hu, Zheng-Li; Li, Zi-Yuan; Ying, Yi-Lun; Zhang, Junji; Cao, Chan; Long, Yi-Tao; Tian, He

2018-04-03

Identification of the configuration for the photoresponsive oligonucleotide plays an important role in the ingenious design of DNA nanomolecules and nanodevices. Due to the limited resolution and sensitivity of present methods, it remains a challenge to determine the accurate configuration of photoresponsive oligonucleotides, much less a precise description of their photoconversion process. Here, we used an aerolysin (AeL) nanopore-based confined space for real-time determination and quantification of the absolute cis/ trans configuration of each azobenzene-modified oligonucleotide (Azo-ODN) with a single molecule resolution. The two completely separated current distributions with narrow peak widths at half height (<0.62 pA) are assigned to cis/ trans-Azo-ODN isomers, respectively. Due to the high current sensitivity, each isomer of Azo-ODN could be undoubtedly identified, which gives the accurate photostationary conversion values of 82.7% for trans-to- cis under UV irradiation and 82.5% for cis-to- trans under vis irradiation. Further real-time kinetic evaluation reveals that the photoresponsive rate constants of Azo-ODN from trans-to- cis and cis-to -trans are 0.43 and 0.20 min -1 , respectively. This study will promote the sophisticated design of photoresponsive ODN to achieve an efficient and applicable photocontrollable process.

A nonviral transfection approach in vitro: the design of a gold nanoparticle vector joint with microelectromechanical systems.

PubMed

Jen, Chun-Ping; Chen, Yu-Hung; Fan, Chun-sheng; Yeh, Chen-Sheng; Lin, Yu-Cheng; Shieh, Dar-Bin; Wu, Chao-Ling; Chen, Dong-Hwang; Chou, Chen-Hsi

2004-02-17

Au nanoparticles modified with 21-base thiolated-oligonucleotides have been evaluated as delivery vehicles for the development of a nonviral transfection platform. The electromigration combined with electroporation for DNA delivery in an osteoblast like cell was employed to test on microchips. Electroporation introduces foreign materials into cells by applying impulses of electric field to induce multiple transient pores on the cell membrane through dielectric breakdown of the cell membrane. On the basis of the characteristic surface plasmon of the Au particles, UV-vis absorption was utilized to qualitatively judge the efficiency of delivery. Transmission electron microscopy images and atomic absorption measurements (quantitative analysis) provided evidence of the bare Au and Au/oligonucleotide nanoparticles before and after electroporation and electromigration function. The experiments demonstrated that electrophoretic migration followed by electroporation significantly enhanced the transportation efficiency of the nanoparticle-oligonucleotide complexes as compared with electroporation alone. Most interestingly, Au capped with oligonucleotides led to optimal performance. On the other hand, the bare Au colloidal suspensions resulted in aggregation, which might be an obstacle to the internalization process. In addition, analytical results demonstrated an increase in the local particle concentrations on the cell surface that provided additional support for the mechanism underlying the improved Au nanoparticle transportation into cells in the presence of electromigration function.

In vitro selection using a dual RNA library that allows primerless selection

PubMed Central

Jarosch, Florian; Buchner, Klaus; Klussmann, Sven

2006-01-01

High affinity target-binding aptamers are identified from random oligonucleotide libraries by an in vitro selection process called Systematic Evolution of Ligands by EXponential enrichment (SELEX). Since the SELEX process includes a PCR amplification step the randomized region of the oligonucleotide libraries need to be flanked by two fixed primer binding sequences. These primer binding sites are often difficult to truncate because they may be necessary to maintain the structure of the aptamer or may even be part of the target binding motif. We designed a novel type of RNA library that carries fixed sequences which constrain the oligonucleotides into a partly double-stranded structure, thereby minimizing the risk that the primer binding sequences become part of the target-binding motif. Moreover, the specific design of the library including the use of tandem RNA Polymerase promoters allows the selection of oligonucleotides without any primer binding sequences. The library was used to select aptamers to the mirror-image peptide of ghrelin. Ghrelin is a potent stimulator of growth-hormone release and food intake. After selection, the identified aptamer sequences were directly synthesized in their mirror-image configuration. The final 44 nt-Spiegelmer, named NOX-B11-3, blocks ghrelin action in a cell culture assay displaying an IC50 of 4.5 nM at 37°C. PMID:16855281

Electron stimulated desorption of anions from native and brominated single stranded oligonucleotide trimers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Polska, Katarzyna; Rak, Janusz; Bass, Andrew D.

2012-02-21

We measured the low energy electron stimulated desorption (ESD) of anions from thin films of native (TXT) and bromine monosubstituted (TBrXT) oligonucleotide trimers deposited on a gold surface (T = thymidine, X = T, deoxycytidine (C), deoxyadenosine (A) or deoxyguanosine (G), Br = bromine). The desorption of H{sup -}, CH{sub 3}{sup -}/NH{sup -}, O{sup -}/NH{sub 2}{sup -}, OH{sup -}, CN{sup -}, and Br{sup -} was induced by 0 to 20 eV electrons. Dissociative electron attachment, below 12 eV, and dipolar dissociation, above 12 eV, are responsible for the formation of these anions. The comparison of the results obtained for themore » native and brominated trimers suggests that the main pathways of TBrXT degradation correspond to the release of the hydride and bromide anions. Significantly, the presence of bromine in oligonucleotide trimers blocks the electron-induced degradation of nuclobases as evidenced by a dramatic decrease in CN{sup -} desorption. An increase in the yields of OH{sup -} is also observed. The debromination yield of particular oligonucleotides diminishes in the following order: BrdU > BrdA > BrdG > BrdC. Based on these results, 5-bromo-2{sup '}-deoxyuridine appears to be the best radiosensitizer among the studied bromonucleosides.« less

Optical properties and electronic transitions of DNA oligonucleotides as a function of composition and stacking sequence.

PubMed

Schimelman, Jacob B; Dryden, Daniel M; Poudel, Lokendra; Krawiec, Katherine E; Ma, Yingfang; Podgornik, Rudolf; Parsegian, V Adrian; Denoyer, Linda K; Ching, Wai-Yim; Steinmetz, Nicole F; French, Roger H

2015-02-14

The role of base pair composition and stacking sequence in the optical properties and electronic transitions of DNA is of fundamental interest. We present and compare the optical properties of DNA oligonucleotides (AT)10, (AT)5(GC)5, and (AT-GC)5 using both ab initio methods and UV-vis molar absorbance measurements. Our data indicate a strong dependence of both the position and intensity of UV absorbance features on oligonucleotide composition and stacking sequence. The partial densities of states for each oligonucleotide indicate that the valence band edge arises from a feature associated with the PO4(3-) complex anion, and the conduction band edge arises from anti-bonding states in DNA base pairs. The results show a strong correspondence between the ab initio and experimentally determined optical properties. These results highlight the benefit of full spectral analysis of DNA, as opposed to reductive methods that consider only the 260 nm absorbance (A260) or simple purity ratios, such as A260/A230 or A260/A280, and suggest that the slope of the absorption edge onset may provide a useful metric for the degree of base pair stacking in DNA. These insights may prove useful for applications in biology, bioelectronics, and mesoscale self-assembly.

Antisense oligonucleotides as innovative therapeutic strategy in the treatment of high-grade gliomas.

PubMed

Caruso, Gerardo; Caffo, Mariella; Raudino, Giuseppe; Alafaci, Concetta; Salpietro, Francesco M; Tomasello, Francesco

2010-01-01

Despite the intensive recent research in cancer therapy, the prognosis in patients affected by high-grade gliomas is still very unfavorable. The efficacy of classical anti-cancer strategies is seriously limited by lack of specific therapies against malignant cells. The extracellular matrix plays a pivotal role in processes such as differentiation, apoptosis, and migration in both the normal and the pathologic nervous system. Glial tumors seem to be able to create a favorable environment for the invasion of glioma cells in cerebral parenchyma when they combine with the extracellular matrix via cell surface receptors. Glioma cells synthesize matrix proteins, such as tenascin, laminin, fibronectin that facilitate the tumor cell's motility. New treatments have shown to hit the acting molecules in the tumor growth and to increase the efficacy and minimize the toxicity. Antisense oligonucleotides are synthetic stretches of DNA which hybridize with specific mRNA strands. The specificity of hybridization makes antisense method an interesting strategy to selectively modulate the expression of genes involved in tumorigenesis. In this review we will focus on the mechanisms of action of antisense oligonucleotides and report clinical and experimental studies on the treatment of high-grade gliomas. We will also report the patents of preclinical and/or clinical studies that adopt the antisense oligonucleotide therapy list in cerebral gliomas.

Integrated Safety Assessment of 2′-O-Methoxyethyl Chimeric Antisense Oligonucleotides in NonHuman Primates and Healthy Human Volunteers

PubMed Central

Crooke, Stanley T; Baker, Brenda F; Kwoh, T Jesse; Cheng, Wei; Schulz, Dan J; Xia, Shuting; Salgado, Nelson; Bui, Huynh-Hoa; Hart, Christopher E; Burel, Sebastien A; Younis, Husam S; Geary, Richard S; Henry, Scott P; Bhanot, Sanjay

2016-01-01

The common chemical and biological properties of antisense oligonucleotides provide the opportunity to identify and characterize chemical class effects across species. The chemical class that has proven to be the most versatile and best characterized is the 2′-O-methoxyethyl chimeric antisense oligonucleotides. In this report we present an integrated safety assessment of data obtained from controlled dose-ranging studies in nonhuman primates (macaques) and healthy human volunteers for 12 unique 2′-O-methoxyethyl chimeric antisense oligonucleotides. Safety was assessed by the incidence of safety signals in standardized laboratory tests for kidney and liver function, hematology, and complement activation; as well as by the mean test results as a function of dose level over time. At high doses a number of toxicities were observed in nonhuman primates. However, no class safety effects were identified in healthy human volunteers from this integrated data analysis. Effects on complement in nonhuman primates were not observed in humans. Nonhuman primates predicted safe doses in humans, but over predicted risk of complement activation and effects on platelets. Although limited to a single chemical class, comparisons from this analysis are considered valid and accurate based on the carefully controlled setting for the specified study populations and within the total exposures studied. PMID:27357629

Gene Composer: database software for protein construct design, codon engineering, and gene synthesis

PubMed Central

Lorimer, Don; Raymond, Amy; Walchli, John; Mixon, Mark; Barrow, Adrienne; Wallace, Ellen; Grice, Rena; Burgin, Alex; Stewart, Lance

2009-01-01

Background To improve efficiency in high throughput protein structure determination, we have developed a database software package, Gene Composer, which facilitates the information-rich design of protein constructs and their codon engineered synthetic gene sequences. With its modular workflow design and numerous graphical user interfaces, Gene Composer enables researchers to perform all common bio-informatics steps used in modern structure guided protein engineering and synthetic gene engineering. Results An interactive Alignment Viewer allows the researcher to simultaneously visualize sequence conservation in the context of known protein secondary structure, ligand contacts, water contacts, crystal contacts, B-factors, solvent accessible area, residue property type and several other useful property views. The Construct Design Module enables the facile design of novel protein constructs with altered N- and C-termini, internal insertions or deletions, point mutations, and desired affinity tags. The modifications can be combined and permuted into multiple protein constructs, and then virtually cloned in silico into defined expression vectors. The Gene Design Module uses a protein-to-gene algorithm that automates the back-translation of a protein amino acid sequence into a codon engineered nucleic acid gene sequence according to a selected codon usage table with minimal codon usage threshold, defined G:C% content, and desired sequence features achieved through synonymous codon selection that is optimized for the intended expression system. The gene-to-oligo algorithm of the Gene Design Module plans out all of the required overlapping oligonucleotides and mutagenic primers needed to synthesize the desired gene constructs by PCR, and for physically cloning them into selected vectors by the most popular subcloning strategies. Conclusion We present a complete description of Gene Composer functionality, and an efficient PCR-based synthetic gene assembly procedure with mis-match specific endonuclease error correction in combination with PIPE cloning. In a sister manuscript we present data on how Gene Composer designed genes and protein constructs can result in improved protein production for structural studies. PMID:19383142

Gene composer: database software for protein construct design, codon engineering, and gene synthesis.

PubMed

Lorimer, Don; Raymond, Amy; Walchli, John; Mixon, Mark; Barrow, Adrienne; Wallace, Ellen; Grice, Rena; Burgin, Alex; Stewart, Lance

2009-04-21

To improve efficiency in high throughput protein structure determination, we have developed a database software package, Gene Composer, which facilitates the information-rich design of protein constructs and their codon engineered synthetic gene sequences. With its modular workflow design and numerous graphical user interfaces, Gene Composer enables researchers to perform all common bio-informatics steps used in modern structure guided protein engineering and synthetic gene engineering. An interactive Alignment Viewer allows the researcher to simultaneously visualize sequence conservation in the context of known protein secondary structure, ligand contacts, water contacts, crystal contacts, B-factors, solvent accessible area, residue property type and several other useful property views. The Construct Design Module enables the facile design of novel protein constructs with altered N- and C-termini, internal insertions or deletions, point mutations, and desired affinity tags. The modifications can be combined and permuted into multiple protein constructs, and then virtually cloned in silico into defined expression vectors. The Gene Design Module uses a protein-to-gene algorithm that automates the back-translation of a protein amino acid sequence into a codon engineered nucleic acid gene sequence according to a selected codon usage table with minimal codon usage threshold, defined G:C% content, and desired sequence features achieved through synonymous codon selection that is optimized for the intended expression system. The gene-to-oligo algorithm of the Gene Design Module plans out all of the required overlapping oligonucleotides and mutagenic primers needed to synthesize the desired gene constructs by PCR, and for physically cloning them into selected vectors by the most popular subcloning strategies. We present a complete description of Gene Composer functionality, and an efficient PCR-based synthetic gene assembly procedure with mis-match specific endonuclease error correction in combination with PIPE cloning. In a sister manuscript we present data on how Gene Composer designed genes and protein constructs can result in improved protein production for structural studies.

Whole-transcriptome brain expression and exon-usage profiling in major depression and suicide: evidence for altered glial, endothelial and ATPase activity

PubMed Central

Pantazatos, Spiro P.; Huang, Yung-yu; Rosoklija, Gorazd B.; Dwork, Andrew J.; Arango, Victoria; Mann, J. John

2016-01-01

Brain gene expression profiling studies of suicide and depression using oligonucleotide microarrays have often failed to distinguish these two phenotypes. Moreover, next generation sequencing (NGS) approaches are more accurate in quantifying gene expression and can detect alternative splicing. Using RNA-seq, we examined whole-exome gene and exon expression in non-psychiatric controls (CON, N=29), DSM-IV major depressive disorder suicides (MDD-S, N=21) and MDD non-suicides (MDD, N=9) in dorsal lateral prefrontal cortex (Brodmann Area 9) of sudden-death medication-free individuals postmortem. Using small RNA-seq, we also examined miRNA expression (9 samples per group). DeSeq2 identified thirty-five genes differentially expressed between groups and surviving adjustment for false discovery rate (adjusted p<0.1). In depression, altered genes include humanin like-8 (MTRNRL8), interleukin-8 (IL8), and serpin peptidase inhibitor, clade H (SERPINH1) and chemokine ligand 4 (CCL4), while exploratory gene ontology (GO) analyses revealed lower expression of immune-related pathways such as chemokine receptor activity, chemotaxis and cytokine biosynthesis, and angiogenesis and vascular development in (adjusted p<0.1). Hypothesis-driven GO analysis suggests lower expression of genes involved in oligodendrocyte differentiation, regulation of glutamatergic neurotransmission, and oxytocin receptor expression in both suicide and depression, and provisional evidence for altered DNA-dependent ATPase expression in suicide only. DEXSEq analysis identified differential exon usage in ATPase, class II, type 9B (adjusted p<0.1) in depression. Differences in miRNA expression or structural gene variants were not detected. Results lend further support for models in which deficits in microglial, endothelial (blood-brain barrier), ATPase activity and astrocytic cell functions contribute to MDD and suicide, and identify putative pathways and mechanisms for further study in these disorders. PMID:27528462

Whole-transcriptome brain expression and exon-usage profiling in major depression and suicide: evidence for altered glial, endothelial and ATPase activity.

PubMed

Pantazatos, S P; Huang, Y-Y; Rosoklija, G B; Dwork, A J; Arango, V; Mann, J J

2017-05-01

Brain gene expression profiling studies of suicide and depression using oligonucleotide microarrays have often failed to distinguish these two phenotypes. Moreover, next generation sequencing approaches are more accurate in quantifying gene expression and can detect alternative splicing. Using RNA-seq, we examined whole-exome gene and exon expression in non-psychiatric controls (CON, N=29), DSM-IV major depressive disorder suicides (MDD-S, N=21) and MDD non-suicides (MDD, N=9) in the dorsal lateral prefrontal cortex (Brodmann Area 9) of sudden death medication-free individuals post mortem. Using small RNA-seq, we also examined miRNA expression (nine samples per group). DeSeq2 identified 35 genes differentially expressed between groups and surviving adjustment for false discovery rate (adjusted P<0.1). In depression, altered genes include humanin-like-8 (MTRNRL8), interleukin-8 (IL8), and serpin peptidase inhibitor, clade H (SERPINH1) and chemokine ligand 4 (CCL4), while exploratory gene ontology (GO) analyses revealed lower expression of immune-related pathways such as chemokine receptor activity, chemotaxis and cytokine biosynthesis, and angiogenesis and vascular development in (adjusted P<0.1). Hypothesis-driven GO analysis suggests lower expression of genes involved in oligodendrocyte differentiation, regulation of glutamatergic neurotransmission, and oxytocin receptor expression in both suicide and depression, and provisional evidence for altered DNA-dependent ATPase expression in suicide only. DEXSEq analysis identified differential exon usage in ATPase, class II, type 9B (adjusted P<0.1) in depression. Differences in miRNA expression or structural gene variants were not detected. Results lend further support for models in which deficits in microglial, endothelial (blood-brain barrier), ATPase activity and astrocytic cell functions contribute to MDD and suicide, and identify putative pathways and mechanisms for further study in these disorders.

Testing the Technology Acceptance Model: HIV case managers' intention to use a continuity of care record with context-specific links.

PubMed

Schnall, Rebecca; Bakken, Suzanne

2011-09-01

To assess the applicability of the Technology Acceptance Model (TAM) constructs in explaining HIV case managers' behavioural intention to use a continuity of care record (CCR) with context-specific links designed to meet their information needs. Data were collected from 94 case managers who provide care to persons living with HIV (PLWH) using an online survey comprising three components: (1) demographic information: age, gender, ethnicity, race, Internet usage and computer experience; (2) mock-up of CCR with context-specific links; and items related to TAM constructs. Data analysis included: principal components factor analysis (PCA), assessment of internal consistency reliability and univariate and multivariate analysis. PCA extracted three factors (Perceived Ease of Use, Perceived Usefulness and Perceived Barriers to Use), explained variance = 84.9%, Cronbach's ά = 0.69-0.91. In a linear regression model, Perceived Ease of Use, Perceived Usefulness and Perceived Barriers to Use explained 43.6% (p < 0.001) of the variance in Behavioural Intention to use a CCR with context-specific links. Our study contributes to the evidence base regarding TAM in health care through expanding the type of professional surveyed, study setting and Health Information Technology assessed.

Multi-clues image retrieval based on improved color invariants

NASA Astrophysics Data System (ADS)

Liu, Liu; Li, Jian-Xun

2012-05-01

At present, image retrieval has a great progress in indexing efficiency and memory usage, which mainly benefits from the utilization of the text retrieval technology, such as the bag-of-features (BOF) model and the inverted-file structure. Meanwhile, because the robust local feature invariants are selected to establish BOF, the retrieval precision of BOF is enhanced, especially when it is applied to a large-scale database. However, these local feature invariants mainly consider the geometric variance of the objects in the images, and thus the color information of the objects fails to be made use of. Because of the development of the information technology and Internet, the majority of our retrieval objects is color images. Therefore, retrieval performance can be further improved through proper utilization of the color information. We propose an improved method through analyzing the flaw of shadow-shading quasi-invariant. The response and performance of shadow-shading quasi-invariant for the object edge with the variance of lighting are enhanced. The color descriptors of the invariant regions are extracted and integrated into BOF based on the local feature. The robustness of the algorithm and the improvement of the performance are verified in the final experiments.

Structural polymorphism of a cytosine-rich DNA sequence forming i-motif structure: Exploring pH based biosensors.

PubMed

Ahmed, Saami; Kaushik, Mahima; Chaudhary, Swati; Kukreti, Shrikant

2018-05-01

Sequence recognition and conformational polymorphism enable DNA to emerge out as a substantial tool in fabricating the devices within nano-dimensions. These DNA associated nano devices work on the principle of conformational switches, which can be facilitated by many factors like sequence of DNA/RNA strand, change in pH or temperature, enzyme or ligand interactions etc. Thus, controlling these DNA conformational changes to acquire the desired function is significant for evolving DNA hybridization biosensor, used in genetic screening and molecular diagnosis. For exploring this conformational switching ability of cytosine-rich DNA oligonucleotides as a function of pH for their potential usage as biosensors, this study has been designed. A C-rich stretch of DNA sequence (5'-TCCCCCAATTAATTCCCCCA-3'; SG20c) has been investigated using UV-Thermal denaturation, poly-acrylamide gel electrophoresis and CD spectroscopy. The SG20c sequence is shown to adopt various topologies of i-motif structure at low pH. This pH dependent transition of SG20c from unstructured single strand to unimolecular and bimolecular i-motif structures can further be exploited for its utilization as switching on/off pH-based biosensors. Copyright © 2018. Published by Elsevier B.V.

Diversity of Glycosyl Hydrolases from Cellulose-Depleting Communities Enriched from Casts of Two Earthworm Species▿ †

PubMed Central

Beloqui, Ana; Nechitaylo, Taras Y.; López-Cortés, Nieves; Ghazi, Azam; Guazzaroni, María-Eugenia; Polaina, Julio; Strittmatter, Axel W.; Reva, Oleg; Waliczek, Agnes; Yakimov, Michail M.; Golyshina, Olga V.; Ferrer, Manuel; Golyshin, Peter N.

2010-01-01

The guts and casts of earthworms contain microbial assemblages that process large amounts of organic polymeric substrates from plant litter and soil; however, the enzymatic potential of these microbial communities remains largely unexplored. In the present work, we retrieved carbohydrate-modifying enzymes through the activity screening of metagenomic fosmid libraries from cellulose-depleting microbial communities established with the fresh casts of two earthworm species, Aporrectodea caliginosa and Lumbricus terrestris, as inocula. Eight glycosyl hydrolases (GHs) from the A. caliginosa-derived community were multidomain endo-β-glucanases, β-glucosidases, β-cellobiohydrolases, β-galactosidase, and β-xylosidases of known GH families. In contrast, two GHs derived from the L. terrestris microbiome had no similarity to any known GHs and represented two novel families of β-galactosidases/α-arabinopyranosidases. Members of these families were annotated in public databases as conserved hypothetical proteins, with one being structurally related to isomerases/dehydratases. This study provides insight into their biochemistry, domain structures, and active-site architecture. The two communities were similar in bacterial composition but significantly different with regard to their eukaryotic inhabitants. Further sequence analysis of fosmids and plasmids bearing the GH-encoding genes, along with oligonucleotide usage pattern analysis, suggested that those apparently originated from Gammaproteobacteria (pseudomonads and Cellvibrio-like organisms), Betaproteobacteria (Comamonadaceae), and Alphaproteobacteria (Rhizobiales). PMID:20622123

Singular over-representation of an octameric palindrome, HIP1, in DNA from many cyanobacteria.

PubMed

Robinson, N J; Robinson, P J; Gupta, A; Bleasby, A J; Whitton, B A; Morby, A P

1995-03-11

An octameric palindrome (5'-GCGATCGC-3') is abundant in cyanobacterial sequences within databases (GenBank/EMBL) and was designated HIP1 (highly iterated palindrome). The frequency of occurrence of all 256 octameric palindromes has now been determined in sub-databases revealing large and unique over-representation of HIP1 in cyanobacterial entries. DNA sequences from other bacteria were searched for any over-represented octameric palindromes analogous to HIP1. Only two sequences were identified, in the genomes of a thermophile and halophilic archaebacteria, although these were less abundant than HIP1 in cyanobacteria and relate to codon usage. To test the proposed widespread distribution of HIP1 in DNA from the cyanobacterium Synechococcus PCC 6301, randomly selected genomic clones were partly sequenced. HIP1 constituted 2.5% of the novel sequences, equivalent to a site on average once every 320 nucleotides. An oligonucleotide including HIP1 was also tested in PCR. Multiple products were obtained using template DNA from cyanobacterial strains in which HIP1 is abundant in known sequences, and some strains generated characteristic HIP-PCR banding patterns. However, analysis of DNA from one strain (not previously represented in databases) by random sequencing, HIP-PCR and Pvul digestion, confirms that not all cyanobacterial genomes are rich in HIP1.

Generation of Soluble Receptor Activator of NF-kappa B Ligand is Critical for Osteolytic Bone Metastasis

DTIC Science & Technology

2009-10-01

differentiation and activation of osteoclast precursors. Targeting RANKL expression with antisense oligonucleotides (RANKL- ASO ) decreased RANKL expression and...1,175 Ci/mmol at 10 mCi/mL). Two microliters of the reaction mixture were separated on a 12% SDS-polyacrylamide gel and subsequently visualized...OPG), a decoy receptor for RANKL, at the TB-interface was also increased. Targeting RANKL expression with antisense oligonucleotides (RANKL- ASO

Detection and identification of intestinal pathogenic bacteria by hybridization to oligonucleotide microarrays

PubMed Central

Jin, Lian-Qun; Li, Jun-Wen; Wang, Sheng-Qi; Chao, Fu-Huan; Wang, Xin-Wei; Yuan, Zheng-Quan

2005-01-01

AIM: To detect the common intestinal pathogenic bacteria quickly and accurately. METHODS: A rapid (<3 h) experimental procedure was set up based upon the gene chip technology. Target genes were amplified and hybridized by oligonucleotide microarrays. RESULTS: One hundred and seventy strains of bacteria in pure culture belonging to 11 genera were successfully discriminated under comparatively same conditions, and a series of specific hybridization maps corresponding to each kind of bacteria were obtained. When this method was applied to 26 divided cultures, 25 (96.2%) were identified. CONCLUSION: Salmonella sp., Escherichia coli, Shigella sp., Listeria monocytogenes, Vibrio parahaemolyticus, Staphylococcus aureus, Proteus sp., Bacillus cereus, Vibrio cholerae, Enterococcus faecalis, Yersinia enterocolitica, and Campylobacter jejuni can be detected and identified by our microarrays. The accuracy, range, and discrimination power of this assay can be continually improved by adding further oligonucleotides to the arrays without any significant increase of complexity or cost. PMID:16437687

A simple physical mechanism enables homeostasis in primitive cells

NASA Astrophysics Data System (ADS)

Engelhart, Aaron E.; Adamala, Katarzyna P.; Szostak, Jack W.

2016-05-01

The emergence of homeostatic mechanisms that enable maintenance of an intracellular steady state during growth was critical to the advent of cellular life. Here, we show that concentration-dependent reversible binding of short oligonucleotides, of both specific and random sequence, can modulate ribozyme activity. In both cases, catalysis is inhibited at high concentrations, and dilution activates the ribozyme via inhibitor dissociation, thus maintaining near-constant ribozyme specific activity throughout protocell growth. To mimic the result of RNA synthesis within non-growing protocells, we co-encapsulated high concentrations of ribozyme and oligonucleotides within fatty acid vesicles, and ribozyme activity was inhibited. Following vesicle growth, the resulting internal dilution produced ribozyme activation. This simple physical system enables a primitive homeostatic behaviour: the maintenance of constant ribozyme activity per unit volume during protocell volume changes. We suggest that such systems, wherein short oligonucleotides reversibly inhibit functional RNAs, could have preceded sophisticated modern RNA regulatory mechanisms, such as those involving miRNAs.

RNA-Catalyzed RNA Ligation on an External RNA Template

NASA Technical Reports Server (NTRS)

McGinness, Kathleen E.; Joyce, Gerald F.

2002-01-01

Variants of the hc ligase ribozyme, which catalyzes ligation of the 3' end of an RNA substrate to the 5' end of the ribozyme, were utilized to evolve a ribozyme that catalyzes ligation reactions on an external RNA template. The evolved ribozyme catalyzes the joining of an oligonucleotide 3'-hydroxyl to the 5'-triphosphate of an RNA hairpin molecule. The ribozyme can also utilize various substrate sequences, demonstrating a largely sequence-independent mechanism for substrate recognition. The ribozyme also carries out the ligation of two oligonucleotides that are bound at adjacent positions on a complementary template. Finally, it catalyzes addition of mononucleoside '5-triphosphates onto the '3 end of an oligonucleotide primer in a template-dependent manner. The development of ribozymes that catalyze polymerase-type reactions contributes to the notion that an RNA world could have existed during the early history of life on Earth.

Clinical potential of oligonucleotide-based therapeutics in the respiratory system.

PubMed

Moschos, Sterghios A; Usher, Louise; Lindsay, Mark A

2017-01-01

The discovery of an ever-expanding plethora of coding and non-coding RNAs with nodal and causal roles in the regulation of lung physiology and disease is reinvigorating interest in the clinical utility of the oligonucleotide therapeutic class. This is strongly supported through recent advances in nucleic acids chemistry, synthetic oligonucleotide delivery and viral gene therapy that have succeeded in bringing to market at least three nucleic acid-based drugs. As a consequence, multiple new candidates such as RNA interference modulators, antisense, and splice switching compounds are now progressing through clinical evaluation. Here, manipulation of RNA for the treatment of lung disease is explored, with emphasis on robust pharmacological evidence aligned to the five pillars of drug development: exposure to the appropriate tissue, binding to the desired molecular target, evidence of the expected mode of action, activity in the relevant patient population and commercially viable value proposition. Copyright © 2016 Elsevier Inc. All rights reserved.

A multiplex protein-free lateral flow assay for detection of microRNAs based on unmodified molecular beacons.

PubMed

Javani, Atefeh; Javadi-Zarnaghi, Fatemeh; Rasaee, Mohammad Javad

2017-11-15

Lateral flow assays (LFAs) have promising potentials for point-of-care applications. Recently, many LFAs have been reported that are based on hybridization of oligonucleotide strands. Mostly, biotinylated capture DNAs are immobilized on the surface of a nitrocellulose membrane via streptavidin interactions. During the assay, stable colorful complexes get formed that are visible by naked eyes. Here, we present an inexpensive and unique design of LFA that applies unmodified oligonucleotides at capture lines. The presented LFA do not utilize streptavidin or any other affinity protein. We employ structural switch of molecular beacons (MB) in combination with base stacking hybridization (BSH) phenomenon. The unique design of the reported LFA provided high selectivity for target oligonucleotides. We validated potential applications of the system for detection of DNA mimics of two microRNAs in multiplex assays. Copyright © 2017 Elsevier Inc. All rights reserved.

Dose-Dependent Lowering of Mutant Huntingtin Using Antisense Oligonucleotides in Huntington Disease Patients.

PubMed

van Roon-Mom, Willeke M C; Roos, Raymund A C; de Bot, Susanne T

2018-04-01

On December 11 of 2017, Ionis Pharmaceuticals published a press release announcing dose-dependent reductions of mutant huntingtin protein in their HTTRx Phase 1/2a study in Huntington disease (HD) patients. The results from this Ionis trial have gained much attention from the patient community and the oligonucleotide therapeutics field, since it is the first trial targeting the cause of HD, namely the mutant huntingtin protein, using antisense oligonucleotides (ASOs). The press release also states that the primary endpoints of the study (safety and tolerability) were met, but does not contain data. This news follows the approval of another therapeutic ASO nusinersen (trade name Spinraza) for a neurological disease, spinal muscular atrophy, by the U.S. Food and Drug Administration and European Medicines Agency, in 2016 and 2017, respectively. Combined, this offers hope for the development of the HTTRx therapy for HD patients.

Hydrated Electrons React with High Specificity with Cisplatin Bound to Single-Stranded DNA

PubMed Central

Behmand, B.; Cloutier, P.; Girouard, S.; Wagner, J. R.; Sanche, L.; Hunting, D. J.

2015-01-01

Short oligonucleotides TTTTTGTGTTT and TTTTTTTGTTT in solution with and without cisplatin (cisPt) bound to the guanine bases were irradiated with γ-rays at doses varying from 0 to 2500 Gy. To determine the effect of hydrated electrons from water radiolysis on the oligonucleotides, we quenched •OH radicals with ethylenediaminetetraacetic acid (EDTA) and displaced oxygen, which reacts with hydrated electrons, by bubbling the solution with wet nitrogen. DNA strand breaks and platinum detachment were quantified by gel electrophoresis. Our results demonstrate that hydrated electrons react almost exclusively at the position of the cisPt adduct, where they induce cisPt detachment from one or both guanines in the oligonucleotide. Given the high yield of hydrated electrons in irradiated tissues, this reaction may be an important step in the mechanism of radiosensitization of DNA by cisPt. PMID:24205952

Aptamer-Mediated Codelivery of Doxorubicin and NF-κB Decoy Enhances Chemosensitivity of Pancreatic Tumor Cells

PubMed Central

Porciani, David; Tedeschi, Lorena; Marchetti, Laura; Citti, Lorenzo; Piazza, Vincenzo; Beltram, Fabio; Signore, Giovanni

2015-01-01

Aptamers able to bind efficiently cell-surface receptors differentially expressed in tumor and in healthy cells are emerging as powerful tools to perform targeted anticancer therapy. Here, we present a novel oligonucleotide chimera, composed by an RNA aptamer and a DNA decoy. Our assembly is able to (i) target tumor cells via an antitransferrin receptor RNA aptamer and (ii) perform selective codelivery of a chemotherapeutic drug (Doxorubicin) and of an inhibitor of a cell-survival factor, the nuclear factor κB decoy oligonucleotide. Both payloads are released under conditions found in endolysosomal compartments (low pH and reductive environment). Targeting and cytotoxicity of the oligonucleotidic chimera were assessed by confocal microscopy, cell viability, and Western blot analysis. These data indicated that the nuclear factor κB decoy does inhibit nuclear factor κB activity and ultimately leads to an increased therapeutic efficacy of Doxorubicin selectively in tumor cells. PMID:25919089

An improved multilevel Monte Carlo method for estimating probability distribution functions in stochastic oil reservoir simulations

DOE PAGES

Lu, Dan; Zhang, Guannan; Webster, Clayton G.; ...

2016-12-30

In this paper, we develop an improved multilevel Monte Carlo (MLMC) method for estimating cumulative distribution functions (CDFs) of a quantity of interest, coming from numerical approximation of large-scale stochastic subsurface simulations. Compared with Monte Carlo (MC) methods, that require a significantly large number of high-fidelity model executions to achieve a prescribed accuracy when computing statistical expectations, MLMC methods were originally proposed to significantly reduce the computational cost with the use of multifidelity approximations. The improved performance of the MLMC methods depends strongly on the decay of the variance of the integrand as the level increases. However, the main challengemore » in estimating CDFs is that the integrand is a discontinuous indicator function whose variance decays slowly. To address this difficult task, we approximate the integrand using a smoothing function that accelerates the decay of the variance. In addition, we design a novel a posteriori optimization strategy to calibrate the smoothing function, so as to balance the computational gain and the approximation error. The combined proposed techniques are integrated into a very general and practical algorithm that can be applied to a wide range of subsurface problems for high-dimensional uncertainty quantification, such as a fine-grid oil reservoir model considered in this effort. The numerical results reveal that with the use of the calibrated smoothing function, the improved MLMC technique significantly reduces the computational complexity compared to the standard MC approach. Finally, we discuss several factors that affect the performance of the MLMC method and provide guidance for effective and efficient usage in practice.« less

Improvement of the quality of work in a biochemistry laboratory via measurement system analysis.

PubMed

Chen, Ming-Shu; Liao, Chen-Mao; Wu, Ming-Hsun; Lin, Chih-Ming

2016-10-31

An adequate and continuous monitoring of operational variations can effectively reduce the uncertainty and enhance the quality of laboratory reports. This study applied the evaluation rule of the measurement system analysis (MSA) method to estimate the quality of work conducted in a biochemistry laboratory. Using the gauge repeatability & reproducibility (GR&R) approach, variations in quality control (QC) data among medical technicians in conducting measurements of five biochemical items, namely, serum glucose (GLU), aspartate aminotransferase (AST), uric acid (UA), sodium (Na) and chloride (Cl), were evaluated. The measurements of the five biochemical items showed different levels of variance among the different technicians, with the variances in GLU measurements being higher than those for the other four items. The ratios of precision-to-tolerance (P/T) for Na, Cl and GLU were all above 0.5, implying inadequate gauge capability. The product variation contribution of Na was large (75.45% and 31.24% in normal and abnormal QC levels, respectively), which showed that the impact of insufficient usage of reagents could not be excluded. With regard to reproducibility, high contributions (of more than 30%) of variation for the selected items were found. These high operator variation levels implied that the possibility of inadequate gauge capacity could not be excluded. The analysis of variance (ANOVA) of GR&R showed that the operator variations in GLU measurements were significant (F=5.296, P=0.001 in the normal level and F=3.399, P=0.015 in the abnormal level, respectively). In addition to operator variations, product variations of Na were also significant for both QC levels. The heterogeneity of variance for the five technicians showed significant differences for the Na and Cl measurements in the normal QC level. The accuracy of QC for five technicians was identified for further operational improvement. This study revealed that MSA can be used to evaluate product and personnel errors and to improve the quality of work in a biochemical laboratory through proper corrective actions.

Detection and prevention of mycoplasma hominis infection

DOEpatents

DelVecchio, Vito G.; Gallia, Gary L.; McCleskey, Ferne K.

1997-01-21

The present invention is directed to a rapid and sensitive method for detecting Mycoplasma hominis using M. hominis-specific probes, oligonucleotides or antibodies. In particular a target sequence can be amplified by in vitro nucleic acid amplification techniques, detected by nucleic acid hybridization using the subject probes and oligonucleotides or detected by immunoassay using M. hominis-specific antibodies. M. hominis-specific nucleic acids which do not recognize or hybridize to genomic nucleic acid of other Mycoplasma species are also provided.

Pressure-Mediated Oligonucleotide Transfection of Rat and Human Cardiovascular Tissues

NASA Astrophysics Data System (ADS)

Mann, Michael J.; Gibbons, Gary H.; Hutchinson, Howard; Poston, Robert S.; Hoyt, E. Grant; Robbins, Robert C.; Dzau, Victor J.

1999-05-01

The application of gene therapy to human disease is currently restricted by the relatively low efficiency and potential hazards of methods of oligonucleotide or gene delivery. Antisense or transcription factor decoy oligonucleotides have been shown to be effective at altering gene expression in cell culture expreriments, but their in vivo application is limited by the efficiency of cellular delivery, the intracellular stability of the compounds, and their duration of activity. We report herein the development of a highly efficient method for naked oligodeoxynucleotide (ODN) transfection into cardiovascular tissues by using controlled, nondistending pressure without the use of viral vectors, lipid formulations, or exposure to other adjunctive, potentially hazardous substances. In this study, we have documented the ability of ex vivo, pressure-mediated transfection to achieve nuclear localization of fluorescent (FITC)-labeled ODN in approximately 90% and 50% of cells in intact human saphenous vein and rat myocardium, respectively. We have further documented that pressure-mediated delivery of antisense ODN can functionally inhibited target gene expression in both of these tissues in a sequence-specific manner at the mRNA and protein levels. This oligonucleotide transfection system may represent a safe means of achieving the intraoperative genetic engineering of failure-resistant human bypass grafts and may provide an avenue for the genetic manipulation of cardiac allograft rejection, allograft vasculopathy, or other transplant diseases.

Oligo Design: a computer program for development of probes for oligonucleotide microarrays.

PubMed

Herold, Keith E; Rasooly, Avraham

2003-12-01

Oligonucleotide microarrays have demonstrated potential for the analysis of gene expression, genotyping, and mutational analysis. Our work focuses primarily on the detection and identification of bacteria based on known short sequences of DNA. Oligo Design, the software described here, automates several design aspects that enable the improved selection of oligonucleotides for use with microarrays for these applications. Two major features of the program are: (i) a tiling algorithm for the design of short overlapping temperature-matched oligonucleotides of variable length, which are useful for the analysis of single nucleotide polymorphisms and (ii) a set of tools for the analysis of multiple alignments of gene families and related short DNA sequences, which allow for the identification of conserved DNA sequences for PCR primer selection and variable DNA sequences for the selection of unique probes for identification. Note that the program does not address the full genome perspective but, instead, is focused on the genetic analysis of short segments of DNA. The program is Internet-enabled and includes a built-in browser and the automated ability to download sequences from GenBank by specifying the GI number. The program also includes several utilities, including audio recital of a DNA sequence (useful for verifying sequences against a written document), a random sequence generator that provides insight into the relationship between melting temperature and GC content, and a PCR calculator.

Bi-specific splice-switching PMO oligonucleotides conjugated via a single peptide active in a mouse model of Duchenne muscular dystrophy

PubMed Central

Shabanpoor, Fazel; McClorey, Graham; Saleh, Amer F.; Järver, Peter; Wood, Matthew J.A.; Gait, Michael J.

2015-01-01

The potential for therapeutic application of splice-switching oligonucleotides (SSOs) to modulate pre-mRNA splicing is increasingly evident in a number of diseases. However, the primary drawback of this approach is poor cell and in vivo oligonucleotide uptake efficacy. Biological activities can be significantly enhanced through the use of synthetically conjugated cationic cell penetrating peptides (CPPs). Studies to date have focused on the delivery of a single SSO conjugated to a CPP, but here we describe the conjugation of two phosphorodiamidate morpholino oligonucleotide (PMO) SSOs to a single CPP for simultaneous delivery and pre-mRNA targeting of two separate genes, exon 23 of the Dmd gene and exon 5 of the Acvr2b gene, in a mouse model of Duchenne muscular dystrophy. Conjugations of PMOs to a single CPP were carried out through an amide bond in one case and through a triazole linkage (‘click chemistry’) in the other. The most active bi-specific CPP–PMOs demonstrated comparable exon skipping levels for both pre-mRNA targets when compared to individual CPP–PMO conjugates both in cell culture and in vivo in the mdx mouse model. Thus, two SSOs with different target sequences conjugated to a single CPP are biologically effective and potentially suitable for future therapeutic exploitation. PMID:25468897

[Oligonucleotide derivatives in the nucleic acid hybridization analysis. I. Covalent immobilization of oligonucleotide probes onto the nylon].

PubMed

Dmitrienko, E V; Pyshnaia, I A; Pyshnyĭ, D V

2010-01-01

The features of UV-induced immobilization of oligonucleotides on a nylon membranes and the effectiveness of enzymatic labeling of immobilized probes at heterophase detection of nucleic acids are studied. Short terminal oligothymidilate (up to 10 nt) sequences are suggested to attach to the probe via a flexible ethylene glycol based linker. The presence of such fragment enhances the intensity of immobilization and reduces UV-dependent degradation of the targeted (sequence-specific) part of the probe by reducing the dose needed for the immobilization of DNA. The optimum dose of UV-irradiation is determined to be ~0.4 J/cm(2) at the wavelength 254 nm. This dose provides high level of hybridization signal for immobilized probes with various nucleotide composition of the sequence specific moiety. The amide groups of the polyamide are shown to play the key role in the photoinduced immobilization of nucleic acids, whereas the primary amino groups in the structure of PA is not the center responsible for the covalent binding of DNA by UV-irradiation, as previously believed. Various additives in the soaking solution during the membrane of UV-dependent immobilization of probes are shown to influence its effectiveness. The use of alternative to UV-irradiation system of radical generation are shown to provide the immobilization of oligonucleotides onto the nylon membrane.

Induction of strand breaks by low-energy electrons (8-68 eV) in a self-assembled monolayer of oligonucleotides: Effective cross sections and attenuation lengths

NASA Astrophysics Data System (ADS)

Cai, Zhongli; Dextraze, Marie-Eve; Cloutier, Pierre; Hunting, Darel; Sanche, Léon

2006-01-01

Self-assembled monolayers of 5'-P32-labeled 3'-thiolated oligonucleotides chemisorbed on gold were bombarded by low-energy electrons (LEE) of 8-68eV. Shorter 5'-P32-oligonucleotides produced by LEE-induced strand breaks were separated with denaturing polyacrylamide gel electrophoresis and quantified by phosphor imaging. The yields of short oligonucleotides (y) decrease exponentially with their length (n), following the equation y =ae-bn, where a and b are constants, which are related to the average effective cross section per nucleotide for DNA strand break (σeff) and the attenuation length (AL=1/b) of LEE, respectively. The AL decreases with LEE energies from 2.5±0.6nm at 8eVto0.8±0.1nm at 68eV, whereas σeff increases from (3±1)×10-18to(5.1±1.6)×10-17cm2 within the same energy range. The energy dependence of σeff shows a resonance peak of (2.8±0.9)×10-17cm2 at 18eV superimposed on a monotonically rising curve. Transient electron attachment to a σ* anion state of the deoxyribose group, followed by dipolar dissociation into H- and the corresponding positive-ion radical, leading to C-O bond cleavage, is proposed to account for this maximum.

Programmable display of DNA-protein chimeras for controlling cell-hydrogel interactions via reversible intermolecular hybridization.

PubMed

Zhang, Zhaoyang; Li, Shihui; Chen, Niancao; Yang, Cheng; Wang, Yong

2013-04-08

Extensive studies have been recently carried out to achieve dynamic control of cell-material interactions primarily through physicochemical stimulation. The purpose of this study was to apply reversible intermolecular hybridization to program cell-hydrogel interactions in physiological conditions based on DNA-antibody chimeras and complementary oligonucleotides. The results showed that DNA oligonucleotides could be captured to and released from the immobilizing DNA-functionalized hydrogels with high specificity via DNA hybridization. Accordingly, DNA-antibody chimeras were captured to the hydrogels, successfully inducing specific cell attachment. The cell attachment to the hydrogels reached the plateau at approximately half an hour after the functionalized hydrogels and the cells were incubated together. The attached cells were rapidly released from the bound hydrogels when triggering complementary oligonucleotides were introduced to the system. However, the capability of the triggering complementary oligonucleotides in releasing cells was affected by the length of intermolecular hybridization. The length needed to be at least more than 20 base pairs in the current experimental setting. Notably, because the procedure of intermolecular hybridization did not involve any harsh condition, the released cells maintained the same viability as that of the cultured cells. The functionalized hydrogels also exhibited the potential to catch and release cells repeatedly. Therefore, this study demonstrates that it is promising to regulate cell-material interactions dynamically through the DNA-programmed display of DNA-protein chimeras.

Specificity tests of an oligonucleotide probe against food-outbreak salmonella for biosensor detection

NASA Astrophysics Data System (ADS)

Chen, I.-H.; Horikawa, S.; Xi, J.; Wikle, H. C.; Barbaree, J. M.; Chin, B. A.

2017-05-01

Phage based magneto-elastic (ME) biosensors have been shown to be able to rapidly detect Salmonella in various food systems to serve food pathogen monitoring purposes. In this ME biosensor platform, the free-standing strip-shaped magneto-elastic sensor is the transducer and the phage probe that recognizes Salmonella in food serves as the bio-recognition element. According to Sorokulova et al. at 2005, a developed oligonucleotide probe E2 was reported to have high specificity to Salmonella enterica Typhimurium. In the report, the specificity tests were focused in most of Enterobacterace groups outside of Salmonella family. Here, to understand the specificity of phage E2 to different Salmonella enterica serotypes within Salmonella Family, we further tested the specificity of the phage probe to thirty-two Salmonella serotypes that were present in the major foodborne outbreaks during the past ten years (according to Centers for Disease Control and Prevention). The tests were conducted through an Enzyme linked Immunosorbent Assay (ELISA) format. This assay can mimic probe immobilized conditions on the magnetoelastic biosensor platform and also enable to study the binding specificity of oligonucleotide probes toward different Salmonella while avoiding phage/ sensor lot variations. Test results confirmed that this oligonucleotide probe E2 was high specific to Salmonella Typhimurium cells but showed cross reactivity to Salmonella Tennessee and four other serotypes among the thirty-two tested Salmonella serotypes.

Lyophilisation and concentration of chitosan/siRNA polyplexes: Influence of buffer composition, oligonucleotide sequence, and hyaluronic acid coating.

PubMed

Veilleux, Daniel; Gopalakrishna Panicker, Rajesh Krishnan; Chevrier, Anik; Biniecki, Kristof; Lavertu, Marc; Buschmann, Michael D

2018-02-15

Chitosan (CS)/siRNA polyplexes have great therapeutic potential for treating multiple diseases by gene silencing. However, clinical application of this technology requires the development of concentrated, hemocompatible, pH neutral formulations for safe and efficient administration. In this study we evaluate physicochemical properties of chitosan polyplexes in various buffers at increasing ionic strengths, to identify conditions for freeze-drying and rehydration at higher doses of uncoated or hyaluronic acid (HA)-coated polyplexes while maintaining physiological compatibility. Optimized formulations are used to evaluate the impact of the siRNA/oligonucleotide sequence on polyplex physicochemical properties, and to measure their in vitro silencing efficiency, cytotoxicity, and hemocompatibility. Specific oligonucleotide sequences influence polyplex physical properties at low N:P ratios, as well as their stability during freeze-drying. Nanoparticles display greater stability for oligodeoxynucleotides ODN vs siRNA; AT-rich vs GC-rich; and overhangs vs blunt ends. Using this knowledge, various CS/siRNA polyplexes are prepared with and without HA coating, freeze-dried and rehydrated at increased concentrations using reduced rehydration volumes. These polyplexes are non-cytotoxic and preserve silencing activity even after rehydration to 20-fold their initial concentration, while HA-coated polyplexes at pH∼7 also displayed increased hemocompatibility. These concentrated formulations represent a critical step towards clinical development of chitosan-based oligonucleotide intravenous delivery systems. Copyright © 2017 Elsevier Inc. All rights reserved.

Precise and selective sensing of DNA-DNA hybridization by graphene/Si-nanowires diode-type biosensors.

PubMed

Kim, Jungkil; Park, Shin-Young; Kim, Sung; Lee, Dae Hun; Kim, Ju Hwan; Kim, Jong Min; Kang, Hee; Han, Joong-Soo; Park, Jun Woo; Lee, Hosun; Choi, Suk-Ho

2016-08-18

Single-Si-nanowire (NW)-based DNA sensors have been recently developed, but their sensitivity is very limited because of high noise signals, originating from small source-drain current of the single Si NW. Here, we demonstrate that chemical-vapor-deposition-grown large-scale graphene/surface-modified vertical-Si-NW-arrays junctions can be utilized as diode-type biosensors for highly-sensitive and -selective detection of specific oligonucleotides. For this, a twenty-seven-base-long synthetic oligonucleotide, which is a fragment of human DENND2D promoter sequence, is first decorated as a probe on the surface of vertical Si-NW arrays, and then the complementary oligonucleotide is hybridized to the probe. This hybridization gives rise to a doping effect on the surface of Si NWs, resulting in the increase of the current in the biosensor. The current of the biosensor increases from 19 to 120% as the concentration of the target DNA varies from 0.1 to 500 nM. In contrast, such biosensing does not come into play by the use of the oligonucleotide with incompatible or mismatched sequences. Similar results are observed from photoluminescence microscopic images and spectra. The biosensors show very-uniform current changes with standard deviations ranging ~1 to ~10% by ten-times endurance tests. These results are very promising for their applications in accurate, selective, and stable biosensing.

Application of a cholesterol stationary phase in the analysis of phosphorothioate oligonucleotides by means of ion pair chromatography coupled with tandem mass spectrometry.

PubMed

Studzińska, Sylwia; Krzemińska, Katarzyna; Szumski, Michał; Buszewski, Bogusław

2016-07-01

The main aim of this study was the investigation of the influence of several ion pair reagents towards both the retention and the mass spectrometry sensitivity of phosphorothioate oligonucleotides. A cholesterol stationary phase was applied for the first time in the analysis of this group of compounds. The mobile phase composition was modified by changing the concentration and the type of amines and acetates or 1,1,1,3,3,3-hexafluoroisopropanol. It has been shown that the increase of amines concentration results in the retention factor increase for each oligonucleotide, on each adsorbent. The only exception was the mobile phase composed of triethylamine and 1,1,1,3,3,3-hexafluoroisopropanol. This is a consequence of interactions taking place between a cholesterol molecule and an alcohol. This effect was convenient when the mass spectrometry detection was applied, since it allowed an increase in the sensitivity. Moreover, optimization of the mobile phase composition and its impact on the efficiency of ionization process and on the sensitivity in mass spectrometry were also presented. The optimization of this new method, based on cholesterol stationary phase coupled with mass spectrometry detection, was finally applied for the determination of phosphorothioate oligonucleotides impurity in a real sample. Copyright © 2016 Elsevier B.V. All rights reserved.

Nanomechanics for specific biological detection

NASA Astrophysics Data System (ADS)

Alvarez, Mar; Carrascosa, Laura G.; Tamayo, Javier; Calle, Ana; Lechuga, Laura M.

2003-04-01

Nanomechanical biosensors have emerged as a promising platform for specific biological. Among the advantages are direct detection without need of labelling with fluorescent or radioactive molecules, very high sensitivity, reduced sensor area, and suitability for integration using silicon technology. Here we have studied the immobilization of oligonucleotide monolayers by monitoring the microcantilever bending. Oligonucleotides were derivatized with thiol molecules for self-assembly on the gold-coated side of a microcantilever. The geometry of the binding and the surface density were studied by mixing derivatized oligonucleotides with spacer self-assembled monolayers and by controlling the oligonucleotide functional group form. These results are compared with fluoresencent and chemiluminescence techniques. Furthermore, we present the first results of direct pesticide detection with microcantilever-based biosensors. Herbicide DDT was detected by performing competitive assays, in which the cantilever was coated with a synthetic DDT hapten, and it was exposured to different rations between the monoclonal antibody and the DDT. A new technique is presented for the detection of the nanomechanical response for biosensing applications, in which the resonant frequency is measured with about two orders of magnitude higher sensitivity. The low quality factor of the microcantilever in liquid is increased up by using an active feedback control, in which the cantilever oscillation is amplified and delayed and it is used as a driving force. The technique has been applied for the detection of ethanol, proteins, and pathogens.

Monolithic poly[(trimethylsilyl-4-methylstyrene)-co- bis(4-vinylbenzyl)dimethylsilane] stationary phases for the fast separation of proteins and oligonucleotides.

PubMed

Jakschitz, Thomas A E; Huck, Christian W; Lubbad, Said; Bonn, Günther K

2007-04-13

In this paper the synthesis, optimisation and application of a silane based monolithic copolymer for the rapid separation of proteins and oligonucleotides is described. The monolith was prepared by thermal initiated in situ copolymerisation of trimethylsilyl-4-methylstyrene (TMSiMS) and bis(4-vinylbenzyl)dimethylsilane (BVBDMSi) in a silanised 200 microm I.D. fused silica column. Different ratios of monomer and crosslinker, as well as different ratios of micro- (toluene) and macro-porogen (2-propanol) were used for optimising the physical properties of the stationary phase regarding separation efficiency. The prepared monolithic stationary phases were characterised by measurement of permeability with different solvents, determination of pore size distribution by mercury intrusion porosimetry (MIP). Morphology was studied by scanning electron microscopy (SEM). Applying optimised conditions, a mixture comprised of five standard proteins ribunuclease A, cytochrome c, alpha-lactalbumine, myoglobine and ovalbumine was separated within 1 min by ion-pair reversed-phase liquid chromatography (IP-RPLC) obtaining half-height peak widths between 1.8 and 2.4 s. Baseline separation of oligonucleotides d(pT)(12-18) was achieved within 1.8 min obtaining half-height peak widths between 3.6 and 5.4 s. The results demonstrate the high potential of this stationary phase for fast separation of high-molecular weight biomolecules such as oligonucleotides and proteins.

New redox-active layer create via epoxy-amine reaction - The base of genosensor for the detection of specific DNA and RNA sequences of avian influenza virus H5N1.

PubMed

Malecka, Kamila; Stachyra, Anna; Góra-Sochacka, Anna; Sirko, Agnieszka; Zagórski-Ostoja, Włodzimierz; Dehaen, Wim; Radecka, Hanna; Radecki, Jerzy

2015-03-15

This paper concerns the development of a redox-active monolayer and its application for the construction of an electrochemical genosensor designed for the detection of specific DNA and RNA oligonucleotide sequences related to the avian influenza virus (AIV) type H5N1. This new redox layer was created on a gold electrode surface step by step. Cyclic Voltammetry, Osteryoung Square-Wave Voltammetry and Differential Pulse Voltammetry were used for its characterization. This new redox-active layer was applied for the construction of the DNA biosensor. The NH2-NC3 probe (20-mer) was covalently attached to the gold electrode surface via a "click" reaction between the amine and an epoxide group. The hybridization process was monitored using the Osteryoung Square-Wave Voltammetry. The 20-mer DNA and ca. 280-mer RNA oligonucleotides were used as the targets. The constructed genosensor was capable to determine complementary oligonucleotide sequences with a detection limit in the pM range. It is able to distinguish the different position of the part RNA complementary to the DNA probe. The genosensor was very selective. The 20-mer DNA as well as the 280-mer RNA oligonucleotides without a complementary sequence generated a weak signal. Copyright © 2014 Elsevier B.V. All rights reserved.

Ultrasensitive Detection of Ebola Virus Oligonucleotide Based on Upconversion Nanoprobe/Nanoporous Membrane System.

PubMed

Tsang, Ming-Kiu; Ye, WeiWei; Wang, Guojing; Li, Jingming; Yang, Mo; Hao, Jianhua

2016-01-26

Ebola outbreaks are currently of great concern, and therefore, development of effective diagnosis methods is urgently needed. The key for lethal virus detection is high sensitivity, since early-stage detection of virus may increase the probability of survival. Here, we propose a luminescence scheme of assay consisting of BaGdF5:Yb/Er upconversion nanoparticles (UCNPs) conjugated with oligonucleotide probe and gold nanoparticles (AuNPs) linked with target Ebola virus oligonucleotide. As a proof of concept, a homogeneous assay was fabricated and tested, yielding a detection limit at picomolar level. The luminescence resonance energy transfer is ascribed to the spectral overlapping of upconversion luminescence and the absorption characteristics of AuNPs. Moreover, we anchored the UCNPs and AuNPs on a nanoporous alumina (NAAO) membrane to form a heterogeneous assay. Importantly, the detection limit was greatly improved, exhibiting a remarkable value at the femtomolar level. The enhancement is attributed to the increased light-matter interaction throughout the nanopore walls of the NAAO membrane. The specificity test suggested that the nanoprobes were specific to Ebola virus oligonucleotides. The strategy combining UCNPs, AuNPs, and NAAO membrane provides new insight into low-cost, rapid, and ultrasensitive detection of different diseases. Furthermore, we explored the feasibility of clinical application by using inactivated Ebola virus samples. The detection results showed great potential of our heterogeneous design for practical application.

Label-Free Electrochemical Detection of the Specific Oligonucleotide Sequence of Dengue Virus Type 1 on Pencil Graphite Electrodes

PubMed Central

Souza, Elaine; Nascimento, Gustavo; Santana, Nataly; Ferreira, Danielly; Lima, Manoel; Natividade, Edna; Martins, Danyelly; Lima-Filho, José

2011-01-01

A biosensor that relies on the adsorption immobilization of the 18-mer single-stranded nucleic acid related to dengue virus gene 1 on activated pencil graphite was developed. Hybridization between the probe and its complementary oligonucleotides (the target) was investigated by monitoring guanine oxidation by differential pulse voltammetry (DPV). The pencil graphite electrode was made of ordinary pencil lead (type 4B). The polished surface of the working electrode was activated by applying a potential of 1.8 V for 5 min. Afterward, the dengue oligonucleotides probe was immobilized on the activated electrode by applying 0.5 V to the electrode in 0.5 M acetate buffer (pH 5.0) for 5 min. The hybridization process was carried out by incubating at the annealing temperature of the oligonucleotides. A time of five minutes and concentration of 1 μM were found to be the optimal conditions for probe immobilization. The electrochemical detection of annealing between the DNA probe (TS-1P) immobilized on the modified electrode, and the target (TS-1T) was achieved. The target could be quantified in a range from 1 to 40 nM with good linearity and a detection limit of 0.92 nM. The specificity of the electrochemical biosensor was tested using non-complementary sequences of dengue virus 2 and 3. PMID:22163916

Insertional Mutagenesis by CRISPR/Cas9 Ribonucleoprotein Gene Editing in Cells Targeted for Point Mutation Repair Directed by Short Single-Stranded DNA Oligonucleotides.

PubMed

Rivera-Torres, Natalia; Banas, Kelly; Bialk, Pawel; Bloh, Kevin M; Kmiec, Eric B

2017-01-01

CRISPR/Cas9 and single-stranded DNA oligonucleotides (ssODNs) have been used to direct the repair of a single base mutation in human genes. Here, we examine a method designed to increase the precision of RNA guided genome editing in human cells by utilizing a CRISPR/Cas9 ribonucleoprotein (RNP) complex to initiate DNA cleavage. The RNP is assembled in vitro and induces a double stranded break at a specific site surrounding the mutant base designated for correction by the ssODN. We use an integrated mutant eGFP gene, bearing a single base change rendering the expressed protein nonfunctional, as a single copy target in HCT 116 cells. We observe significant gene correction activity of the mutant base, promoted by the RNP and single-stranded DNA oligonucleotide with validation through genotypic and phenotypic readout. We demonstrate that all individual components must be present to obtain successful gene editing. Importantly, we examine the genotype of individually sorted corrected and uncorrected clonally expanded cell populations for the mutagenic footprint left by the action of these gene editing tools. While the DNA sequence of the corrected population is exact with no adjacent sequence modification, the uncorrected population exhibits heterogeneous mutagenicity with a wide variety of deletions and insertions surrounding the target site. We designate this type of DNA aberration as on-site mutagenicity. Analyses of two clonal populations bearing specific DNA insertions surrounding the target site, indicate that point mutation repair has occurred at the level of the gene. The phenotype, however, is not rescued because a section of the single-stranded oligonucleotide has been inserted altering the reading frame and generating truncated proteins. These data illustrate the importance of analysing mutagenicity in uncorrected cells. Our results also form the basis of a simple model for point mutation repair directed by a short single-stranded DNA oligonucleotides and CRISPR/Cas9 ribonucleoprotein complex.

Insertional Mutagenesis by CRISPR/Cas9 Ribonucleoprotein Gene Editing in Cells Targeted for Point Mutation Repair Directed by Short Single-Stranded DNA Oligonucleotides

PubMed Central

Rivera-Torres, Natalia; Bialk, Pawel; Bloh, Kevin M.; Kmiec, Eric B.

2017-01-01

CRISPR/Cas9 and single-stranded DNA oligonucleotides (ssODNs) have been used to direct the repair of a single base mutation in human genes. Here, we examine a method designed to increase the precision of RNA guided genome editing in human cells by utilizing a CRISPR/Cas9 ribonucleoprotein (RNP) complex to initiate DNA cleavage. The RNP is assembled in vitro and induces a double stranded break at a specific site surrounding the mutant base designated for correction by the ssODN. We use an integrated mutant eGFP gene, bearing a single base change rendering the expressed protein nonfunctional, as a single copy target in HCT 116 cells. We observe significant gene correction activity of the mutant base, promoted by the RNP and single-stranded DNA oligonucleotide with validation through genotypic and phenotypic readout. We demonstrate that all individual components must be present to obtain successful gene editing. Importantly, we examine the genotype of individually sorted corrected and uncorrected clonally expanded cell populations for the mutagenic footprint left by the action of these gene editing tools. While the DNA sequence of the corrected population is exact with no adjacent sequence modification, the uncorrected population exhibits heterogeneous mutagenicity with a wide variety of deletions and insertions surrounding the target site. We designate this type of DNA aberration as on-site mutagenicity. Analyses of two clonal populations bearing specific DNA insertions surrounding the target site, indicate that point mutation repair has occurred at the level of the gene. The phenotype, however, is not rescued because a section of the single-stranded oligonucleotide has been inserted altering the reading frame and generating truncated proteins. These data illustrate the importance of analysing mutagenicity in uncorrected cells. Our results also form the basis of a simple model for point mutation repair directed by a short single-stranded DNA oligonucleotides and CRISPR/Cas9 ribonucleoprotein complex. PMID:28052104

Intrinsically Labeled Fluorescent Oligonucleotide Probes on Quantum Dots for Transduction of Nucleic Acid Hybridization.

PubMed

Shahmuradyan, Anna; Krull, Ulrich J

2016-03-15

Quantum dots (QDs) have been widely used in chemical and biosensing due to their unique photoelectrical properties and are well suited as donors in fluorescence resonance energy transfer (FRET). Selective hybridization interactions of oligonucleotides on QDs have been determined by FRET. Typically, the QD-FRET constructs have made use of labeled targets or have implemented labeled sandwich format assays to introduce dyes in proximity to the QDs for the FRET process. The intention of this new work is to explore a method to incorporate the acceptor dye into the probe molecule. Thiazole orange (TO) derivatives are fluorescent intercalating dyes that have been used for detection of double-stranded nucleic acids. One such dye system has been reported in which single-stranded oligonucleotide probes were doubly labeled with adjacent thiazole orange derivatives. In the absence of the fully complementary (FC) oligonucleotide target, the dyes form an H-aggregate, which results in quenching of fluorescence emission due to excitonic interactions between the dyes. The hybridization of the FC target to the probe provides for dissociation of the aggregate as the dyes intercalate into the double stranded duplex, resulting in increased fluorescence. This work reports investigation of the dependence of the ratiometric signal on the type of linkage used to conjugate the dyes to the probe, the location of the dye along the length of the probe, and the distance between adjacent dye molecules. The limit of detection for 34mer and 90mer targets was found to be identical and was 10 nM (2 pmol), similar to analogous QD-FRET using labeled oligonucleotide target. The detection system could discriminate a one base pair mismatch (1BPM) target and was functional without substantial compromise of the signal in 75% serum. The 1BPM was found to reduce background signal, indicating that the structure of the mismatch affected the environment of the intercalating dyes.

Toward a solid-phase nucleic acid hybridization assay within microfluidic channels using immobilized quantum dots as donors in fluorescence resonance energy transfer.

PubMed

Chen, Lu; Algar, W Russ; Tavares, Anthony J; Krull, Ulrich J

2011-01-01

The optical properties and surface area of quantum dots (QDs) have made them an attractive platform for the development of nucleic acid biosensors based on fluorescence resonance energy transfer (FRET). Solid-phase assays based on FRET using mixtures of immobilized QD-oligonucleotide conjugates (QD biosensors) have been developed. The typical challenges associated with solid-phase detection strategies include non-specific adsorption, slow kinetics of hybridization, and sample manipulation. The new work herein has considered the immobilization of QD biosensors onto the surfaces of microfluidic channels in order to address these challenges. Microfluidic flow can be used to dynamically control stringency by adjustment of the potential in an electrokinetic-based microfluidics environment. The shearing force, Joule heating, and the competition between electroosmotic and electrophoretic mobilities allow the optimization of hybridization conditions, convective delivery of target to the channel surface to speed hybridization, amelioration of adsorption, and regeneration of the sensing surface. Microfluidic flow can also be used to deliver (for immobilization) and remove QD biosensors. QDs that were conjugated with two different oligonucleotide sequences were used to demonstrate feasibility. One oligonucleotide sequence on the QD was available as a linker for immobilization via hybridization with complementary oligonucleotides located on a glass surface within a microfluidic channel. A second oligonucleotide sequence on the QD served as a probe to transduce hybridization with target nucleic acid in a sample solution. A Cy3 label on the target was excited by FRET using green-emitting CdSe/ZnS QD donors and provided an analytical signal to explore this detection strategy. The immobilized QDs could be removed under denaturing conditions by disrupting the duplex that was used as the surface linker and thus allowed a new layer of QD biosensors to be re-coated within the channel for re-use of the microfluidic chip.

Spherical Nucleic Acids as Intracellular Agents for Nucleic Acid Based Therapeutics

NASA Astrophysics Data System (ADS)

Hao, Liangliang

Recent functional discoveries on the noncoding sequences of human genome and transcriptome could lead to revolutionary treatment modalities because the noncoding RNAs (ncRNAs) can be applied as therapeutic agents to manipulate disease-causing genes. To date few nucleic acid-based therapeutics have been translated into the clinic due to challenges in the delivery of the oligonucleotide agents in an effective, cell specific, and non-toxic fashion. Unmodified oligonucleotide agents are destroyed rapidly in biological fluids by enzymatic degradation and have difficulty crossing the plasma membrane without the aid of transfection reagents, which often cause inflammatory, cytotoxic, or immunogenic side effects. Spherical nucleic acids (SNAs), nanoparticles consisting of densely organized and highly oriented oligonucleotides, pose one possible solution to circumventing these problems in both the antisense and RNA interference (RNAi) pathways. The unique three dimensional architecture of SNAs protects the bioactive oligonucleotides from unspecific degradation during delivery and supports their targeting of class A scavenger receptors and endocytosis via a lipid-raft-dependent, caveolae-mediated pathway. Owing to their unique structure, SNAs are able to cross cell membranes and regulate target genes expression as a single entity, without triggering the cellular innate immune response. Herein, my thesis has focused on understanding the interactions between SNAs and cellular components and developing SNA-based nanostructures to improve therapeutic capabilities. Specifically, I developed a novel SNA-based, nanoscale agent for delivery of therapeutic oligonucleotides to manipulate microRNAs (miRNAs), the endogenous post-transcriptional gene regulators. I investigated the role of SNAs involving miRNAs in anti-cancer or anti-inflammation responses in cells and in in vivo murine disease models via systemic injection. Furthermore, I explored using different strategies to construct novel SNA-based nanomaterials with desired properties and applying targeting moieties to the SNA platform to achieve cell type specific gene regulation effects. Due to the flexibility of the SNA approach, the SNA platform can potentially be applied to many genetic disorders through tailored target specificities.

Functionalization of silicon oxide using supercritical fluid deposition of 3,4-epoxybutyltrimethoxysilane for the immobilization of amino-modified oligonucleotide

NASA Astrophysics Data System (ADS)

Rull, Jordi; Nonglaton, Guillaume; Costa, Guillaume; Fontelaye, Caroline; Marchi-Delapierre, Caroline; Ménage, Stéphane; Marchand, Gilles

2015-11-01

The functionalization of silicon oxide based substrates using silanes is generally performed through liquid phase methodologies. These processes involve a huge quantity of potentially toxic solvents and present some important disadvantages for the functionalization of microdevices or porous materials, for example the low diffusion. To overcome this drawback, solvent-free methodologies like molecular vapor deposition (MVD) or supercritical fluid deposition (SFD) have been developed. In this paper, the deposition process of 3,4-epoxybutyltrimethoxysilane (EBTMOS) on silicon oxide using supercritical carbon dioxide (scCO2) as a solvent is studied for the first time. The oxirane ring of epoxy silanes readily reacts with amine group and is of particular interest for the grafting of amino-modified oligonucleotides or antibodies for diagnostic application. Then the ability of this specific EBTMOS layer to react with amine functions has been evaluated using the immobilization of amino-modified oligonucleotide probes. The presence of the probes is revealed by fluorescence using hybridization with a fluorescent target oligonucleotide. The performances of SFD of EBTMOS have been optimized and then compared with the dip coating and molecular vapor deposition methods, evidencing a better grafting efficiency and homogeneity, a lower reaction time in addition to the eco-friendly properties of the supercritical carbon dioxide. The epoxysilane layers have been characterized by surface enhanced ellipsometric contrast optical technique, atomic force microscopy, multiple internal reflection infrared spectroscopy and X-ray photoelectron spectroscopy. The shelf life of the 3,4-epoxybutyltrimethoxysilane coating layer has also been studied. Finally, two different strategies of NH2-oligonucleotide grafting on EBTMOS coating layer have been compared, i.e. reductive amination and nucleophilic substitution, SN2. This EBTMOS based coating layer can be used for a wide range of applications such as the preparation of new supported and recoverable catalysts and new integrated silicon microdevices for healthcare purposes.

Direct profiling of environmental microbial populations by thermal dissociation analysis of native rRNAs hybridized to oligonucleotide microarrays

NASA Technical Reports Server (NTRS)

El Fantroussi, Said; Urakawa, Hidetoshi; Bernhard, Anne E.; Kelly, John J.; Noble, Peter A.; Smidt, H.; Yershov, G. M.; Stahl, David A.

2003-01-01

Oligonucleotide microarrays were used to profile directly extracted rRNA from environmental microbial populations without PCR amplification. In our initial inspection of two distinct estuarine study sites, the hybridization patterns were reproducible and varied between estuarine sediments of differing salinities. The determination of a thermal dissociation curve (i.e., melting profile) for each probe-target duplex provided information on hybridization specificity, which is essential for confirming adequate discrimination between target and nontarget sequences.

Molecular diagnostics using magnetic nanobeads

NASA Astrophysics Data System (ADS)

Zardán Gómez de la Torre, Teresa; Strömberg, Mattias; Göransson, Jenny; Gunnarsson, Klas; Nilsson, Mats; Svedlindh, Peter; Strømme, Maria

2010-01-01

In this paper, we investigate the volume-amplified magnetic nanobead detection assay with respect to bead size, bead concentration and bead oligonucleotide surface coverage in order to improve the understanding of the underlying microscopic mechanisms. It has been shown that: (i) the immobilization efficiency of the beads depends on the surface coverage of oligonucleotides, (ii) by using lower amounts of probe-tagged beads, detection sensitivity can be improved and (iii) using small enough beads enables both turn-off and turn-on detection. Finally, biplex detection was demonstrated.

Transcript copy number estimation using a mouse whole-genome oligonucleotide microarray

PubMed Central

Carter, Mark G; Sharov, Alexei A; VanBuren, Vincent; Dudekula, Dawood B; Carmack, Condie E; Nelson, Charlie; Ko, Minoru SH

2005-01-01

The ability to quantitatively measure the expression of all genes in a given tissue or cell with a single assay is an exciting promise of gene-expression profiling technology. An in situ-synthesized 60-mer oligonucleotide microarray designed to detect transcripts from all mouse genes was validated, as well as a set of exogenous RNA controls derived from the yeast genome (made freely available without restriction), which allow quantitative estimation of absolute endogenous transcript abundance. PMID:15998450

SIMULATION AND VISUALIZATION OF FLOW PATTERN IN MICROARRAYS FOR LIQUID PHASE OLIGONUCLEOTIDE AND PEPTIDE SYNTHESIS

PubMed Central

O-Charoen, Sirimon; Srivannavit, Onnop; Gulari, Erdogan

2008-01-01

Microfluidic microarrays have been developed for economical and rapid parallel synthesis of oligonucleotide and peptide libraries. For a synthesis system to be reproducible and uniform, it is crucial to have a uniform reagent delivery throughout the system. Computational fluid dynamics (CFD) is used to model and simulate the microfluidic microarrays to study geometrical effects on flow patterns. By proper design geometry, flow uniformity could be obtained in every microreactor in the microarrays. PMID:17480053

Sensible use of antisense: how to use oligonucleotides as research tools.

PubMed

Myers, K J; Dean, N M

2000-01-01

In the past decade, there has been a vast increase in the amount of gene sequence information that has the potential to revolutionize the way diseases are both categorized and treated. Old diagnoses, largely anatomical or descriptive in nature, are likely to be superceded by the molecular characterization of the disease. The recognition that certain genes drive key disease processes will also enable the rational design of gene-specific therapeutics. Antisense oligonucleotides represent a technology that should play multiple roles in this process.

Remote Optical Switch for Localized and Selective Control of Gene Interference

PubMed Central

Lee, Somin Eunice; Liu, Gang Logan; Kim, Franklin; Lee, Luke P.

2009-01-01

Near infrared-absorbing gold nanoplasmonic particles (GNPs) are used as optical switches of gene interference and are remotely controlled using light. We have tuned optical switches to a wavelength where cellular photodamage is minimized. Optical switches are functionalized with double-stranded oligonucleotides. At desired times and at specific intracellular locations, remote optical excitation is used to liberate gene-interfering oligonucleotides. We demonstrate a novel gene-interfering technique offering spatial and temporal control, which is otherwise impossible using conventional gene-interfering techniques. PMID:19128006

M1.3 - a small scaffold for DNA origami

NASA Astrophysics Data System (ADS)

Said, Hassan; Schüller, Verena J.; Eber, Fabian J.; Wege, Christina; Liedl, Tim; Richert, Clemens

2012-12-01

The DNA origami method produces programmable nanoscale objects that form when one long scaffold strand hybridizes to numerous oligonucleotide staple strands. One scaffold strand is dominating the field: M13mp18, a bacteriophage-derived vector 7249 nucleotides in length. The full-length M13 is typically folded by using over 200 staple oligonucleotides. Here we report the convenient preparation of a 704 nt fragment dubbed ``M1.3'' as a linear or cyclic scaffold and the assembly of small origami structures with just 15-24 staple strands. A typical M1.3 origami is large enough to be visualized by TEM, but small enough to show a cooperativity in its assembly and thermal denaturation that is reminiscent of oligonucleotide duplexes. Due to its medium size, M1.3 origami with globally modified staples is affordable. As a proof of principle, two origami structures with globally 5'-capped staples were prepared and were shown to give higher UV-melting points than the corresponding assembly with unmodified DNA. M1.3 has the size of a gene, not a genome, and may function as a model for gene-based nanostructures. Small origami with M1.3 as a scaffold may serve as a workbench for chemical, physical, and biological experiments.The DNA origami method produces programmable nanoscale objects that form when one long scaffold strand hybridizes to numerous oligonucleotide staple strands. One scaffold strand is dominating the field: M13mp18, a bacteriophage-derived vector 7249 nucleotides in length. The full-length M13 is typically folded by using over 200 staple oligonucleotides. Here we report the convenient preparation of a 704 nt fragment dubbed ``M1.3'' as a linear or cyclic scaffold and the assembly of small origami structures with just 15-24 staple strands. A typical M1.3 origami is large enough to be visualized by TEM, but small enough to show a cooperativity in its assembly and thermal denaturation that is reminiscent of oligonucleotide duplexes. Due to its medium size, M1.3 origami with globally modified staples is affordable. As a proof of principle, two origami structures with globally 5'-capped staples were prepared and were shown to give higher UV-melting points than the corresponding assembly with unmodified DNA. M1.3 has the size of a gene, not a genome, and may function as a model for gene-based nanostructures. Small origami with M1.3 as a scaffold may serve as a workbench for chemical, physical, and biological experiments. Electronic supplementary information (ESI) available: Materials, full sequence of M1.3, alternative restriction reactions, sequences and origami designs, ALEX data, estimated cost of producing M13, additional melting data for origami, and MALDI spectra of individual capped oligonucleotides. See DOI: 10.1039/c2nr32393a

High-throughput assays for DNA gyrase and other topoisomerases

PubMed Central

Maxwell, Anthony; Burton, Nicolas P.; O'Hagan, Natasha

2006-01-01

We have developed high-throughput microtitre plate-based assays for DNA gyrase and other DNA topoisomerases. These assays exploit the fact that negatively supercoiled plasmids form intermolecular triplexes more efficiently than when they are relaxed. Two assays are presented, one using capture of a plasmid containing a single triplex-forming sequence by an oligonucleotide tethered to the surface of a microtitre plate and subsequent detection by staining with a DNA-specific fluorescent dye. The other uses capture of a plasmid containing two triplex-forming sequences by an oligonucleotide tethered to the surface of a microtitre plate and subsequent detection by a second oligonucleotide that is radiolabelled. The assays are shown to be appropriate for assaying DNA supercoiling by Escherichia coli DNA gyrase and DNA relaxation by eukaryotic topoisomerases I and II, and E.coli topoisomerase IV. The assays are readily adaptable to other enzymes that change DNA supercoiling (e.g. restriction enzymes) and are suitable for use in a high-throughput format. PMID:16936317

High-throughput assays for DNA gyrase and other topoisomerases.

PubMed

Maxwell, Anthony; Burton, Nicolas P; O'Hagan, Natasha

2006-01-01

We have developed high-throughput microtitre plate-based assays for DNA gyrase and other DNA topoisomerases. These assays exploit the fact that negatively supercoiled plasmids form intermolecular triplexes more efficiently than when they are relaxed. Two assays are presented, one using capture of a plasmid containing a single triplex-forming sequence by an oligonucleotide tethered to the surface of a microtitre plate and subsequent detection by staining with a DNA-specific fluorescent dye. The other uses capture of a plasmid containing two triplex-forming sequences by an oligonucleotide tethered to the surface of a microtitre plate and subsequent detection by a second oligonucleotide that is radiolabelled. The assays are shown to be appropriate for assaying DNA supercoiling by Escherichia coli DNA gyrase and DNA relaxation by eukaryotic topoisomerases I and II, and E.coli topoisomerase IV. The assays are readily adaptable to other enzymes that change DNA supercoiling (e.g. restriction enzymes) and are suitable for use in a high-throughput format.

Template switching between PNA and RNA oligonucleotides

NASA Technical Reports Server (NTRS)

Bohler, C.; Nielsen, P. E.; Orgel, L. E.; Miller, S. L. (Principal Investigator)

1995-01-01

The origin of the RNA world is not easily understood, as effective prebiotic syntheses of the components of RNA, the beta-ribofuranoside-5'-phosphates, are hard to envisage. Recognition of this difficulty has led to the proposal that other genetic systems, the components of which are more easily formed, may have preceded RNA. This raises the question of how transitions between one genetic system and another could occur. Peptide nucleic acid (PNA) resembles RNA in its ability to form double-helical complexes stabilized by Watson-Crick hydrogen bonding between adenine and thymine and between cytosine and guanine, but has a backbone that is held together by amide rather than by phosphodiester bonds. Oligonucleotides bases on RNA are known to act as templates that catalyse the non-enzymatic synthesis of their complements from activated mononucleotides, we now show that RNA oligonucleotides facilitate the synthesis of complementary PNA strands and vice versa. This suggests that a transition between different genetic systems can occur without loss of information.

Oligo/Polynucleotide-Based Gene Modification: Strategies and Therapeutic Potential

PubMed Central

Sargent, R. Geoffrey; Kim, Soya

2011-01-01

Oligonucleotide- and polynucleotide-based gene modification strategies were developed as an alternative to transgene-based and classical gene targeting-based gene therapy approaches for treatment of genetic disorders. Unlike the transgene-based strategies, oligo/polynucleotide gene targeting approaches maintain gene integrity and the relationship between the protein coding and gene-specific regulatory sequences. Oligo/polynucleotide-based gene modification also has several advantages over classical vector-based homologous recombination approaches. These include essentially complete homology to the target sequence and the potential to rapidly engineer patient-specific oligo/polynucleotide gene modification reagents. Several oligo/polynucleotide-based approaches have been shown to successfully mediate sequence-specific modification of genomic DNA in mammalian cells. The strategies involve the use of polynucleotide small DNA fragments, triplex-forming oligonucleotides, and single-stranded oligodeoxynucleotides to mediate homologous exchange. The primary focus of this review will be on the mechanistic aspects of the small fragment homologous replacement, triplex-forming oligonucleotide-mediated, and single-stranded oligodeoxynucleotide-mediated gene modification strategies as it relates to their therapeutic potential. PMID:21417933

Comprehensive hydrophilic interaction and ion-pair reversed-phase liquid chromatography for analysis of di- to deca-oligonucleotides.

PubMed

Li, Qin; Lynen, Frédéric; Wang, Jian; Li, Hanlin; Xu, Guowang; Sandra, Pat

2012-09-14

A comprehensive two-dimensional HPLC approach with a high degree of orthogonality was developed for analysis of di- to deca-oligonucleotides (ONs). Hydrophilic interaction liquid chromatography (HILIC) was used in the first dimension, and ion-pair reversed-phase liquid chromatography (IP-RPLC) was employed in the second dimension. The two dimensions were connected via a ten-port valve interface equipped with octadecyl silica (ODS) traps to immobilize and focus the ONs eluting from the first dimension prior to IP-RPLC separation. An aqueous make-up flow was used for effective trapping. The comprehensive two-dimensional HPLC system was optimized with a mixture consisting of 27 oligonucleotide standards. An overall chromatographic peak capacity of 500 was obtained. The use of the volatile buffer triethylamine acetate in the second dimension allowed straightforward coupling to electrospray ionization mass spectrometry (ESI-MS) and detection of each ON in the negative ionization mode. Copyright © 2011 Elsevier B.V. All rights reserved.

Peptide-oligonucleotide conjugates as nanoscale building blocks for assembly of an artificial three-helix protein mimic

NASA Astrophysics Data System (ADS)

Lou, Chenguang; Martos-Maldonado, Manuel C.; Madsen, Charlotte S.; Thomsen, Rasmus P.; Midtgaard, Søren Roi; Christensen, Niels Johan; Kjems, Jørgen; Thulstrup, Peter W.; Wengel, Jesper; Jensen, Knud J.

2016-07-01

Peptide-based structures can be designed to yield artificial proteins with specific folding patterns and functions. Template-based assembly of peptide units is one design option, but the use of two orthogonal self-assembly principles, oligonucleotide triple helix and a coiled coil protein domain formation have never been realized for de novo protein design. Here, we show the applicability of peptide-oligonucleotide conjugates for self-assembly of higher-ordered protein-like structures. The resulting nano-assemblies were characterized by ultraviolet-melting, gel electrophoresis, circular dichroism (CD) spectroscopy, small-angle X-ray scattering and transmission electron microscopy. These studies revealed the formation of the desired triple helix and coiled coil domains at low concentrations, while a dimer of trimers was dominating at high concentration. CD spectroscopy showed an extraordinarily high degree of α-helicity for the peptide moieties in the assemblies. The results validate the use of orthogonal self-assembly principles as a paradigm for de novo protein design.

Mass spectrometric detection of siRNA in plasma samples for doping control purposes.

PubMed

Kohler, Maxie; Thomas, Andreas; Walpurgis, Katja; Schänzer, Wilhelm; Thevis, Mario

2010-10-01

Small interfering ribonucleic acid (siRNA) molecules can effect the expression of any gene by inducing the degradation of mRNA. Therefore, these molecules can be of interest for illicit performance enhancement in sports by affecting different metabolic pathways. An example of an efficient performance-enhancing gene knockdown is the myostatin gene that regulates muscle growth. This study was carried out to provide a tool for the mass spectrometric detection of modified and unmodified siRNA from plasma samples. The oligonucleotides are purified by centrifugal filtration and the use of an miRNA purification kit, followed by flow-injection analysis using an Exactive mass spectrometer to yield the accurate masses of the sense and antisense strands. Although chromatography and sensitive mass spectrometric analysis of oligonucleotides are still challenging, a method was developed and validated that has adequate sensitivity (limit of detection 0.25-1 nmol mL(-1)) and performance (precision 11-21%, recovery 23-67%) for typical antisense oligonucleotides currently used in clinical studies.

In vitro pharmacokinetics of phosphorothioate antisense oligonucleotides.

PubMed

Crooke, R M; Graham, M J; Cooke, M E; Crooke, S T

1995-10-01

ISIS 2105 (Afovirsen), a 20-mer phosphorothioate oligonucleotide that inhibits the production of a gene product essential to the growth of human papillomavirus, is in phase II clinical trials for the treatment of genital warts induced by human papillomavirus-6 and human papillomavirus-11. The uptake, subcellular distribution and metabolism of ISIS 2105 and three other similar length phosphorothioates have been studied in a variety of cell lines. Our experiments indicated that ISIS 2105 and other phosphorothioates are internalized and distributed in a time-, temperature-, concentration-, sequence- and cell line-dependent manner. Cell association was also influenced by the tissue culture medium. Several different analytical techniques revealed that phosphorothioates were more rapidly degraded in vitro than previously reported. These data suggest that phosphorothioate oligonucleotide uptake and stability observed in tissue culture can vary as a function of cellular assay conditions and analytical methods used. Comparison of these results with those obtained in vivo suggests that the pharmacokinetic behavior of this class of compounds cannot necessarily be predicted from in vitro studies.

Effective oligonucleotide-mediated gene disruption in ES cells lacking the mismatch repair protein MSH3.

PubMed

Dekker, M; Brouwers, C; Aarts, M; van der Torre, J; de Vries, S; van de Vrugt, H; te Riele, H

2006-04-01

We have previously demonstrated that site-specific insertion, deletion or substitution of one or two nucleotides in mouse embryonic stem cells (ES cells) by single-stranded deoxyribo-oligonucleotides is several hundred-fold suppressed by DNA mismatch repair (MMR) activity. Here, we have investigated whether compound mismatches and larger insertions escape detection by the MMR machinery and can be effectively introduced in MMR-proficient cells. We identified several compound mismatches that escaped detection by the MMR machinery to some extent, but could not define general rules predicting the efficacy of complex base-pair substitutions. In contrast, we found that four-nucleotide insertions were largely subject to suppression by the MSH2/MSH3 branch of MMR and could be effectively introduced in Msh3-deficient cells. As these cells have no overt mutator phenotype and Msh3-deficient mice do not develop cancer, Msh3-deficient ES cells can be used for oligonucleotide-mediated gene disruption. As an example, we present disruption of the Fanconi anemia gene Fancf.

Photouncaged Sequence-specific Interstrand DNA Cross-Linking with Photolabile 4-oxo-enal-modified Oligonucleotides

PubMed Central

Sun, Jingjing; Tang, Xinjing

2015-01-01

DNA cross-linking technology is an attractive tool for the detection, regulation, and manipulation of genes. In this study, a series of photolabile 4-oxo-enal-modified oligonucleotides functionalized with photosensitive ο-nitrobenzyl derivatives were rationally designed as a new kind of photocaged cross-linking agents. A comprehensive evaluation of cross-linking reactions for different nucleobases in complementary strands under different conditions suggested that the modified DNA oligonucleotides tended to form interstrand cross-linking to nucleobases with the potential of thymidine > guanosine » cytidine ~ adenosine. Different from previous literature reports that cytidine and adenosine were preferential cross-linked nucleobases with 4-oxo-enal moieties, our study represents the first example of DNA cross-linking for T and G selectivity using 4-oxo-enal moiety. The cross-linked adducts were identified and their cross-linking mechanism was also illustrated. This greatly expands the applications of 4-oxo-enal derivatives in the studies of DNA damage and RNA structure PMID:26020694

Metastasizing patent claims on BRCA1.

PubMed

Kepler, Thomas B; Crossman, Colin; Cook-Deegan, Robert

2010-05-01

Many patents make claims on DNA sequences; some include claims on oligonucleotides related to the primary patented gene. We used bioinformatics to quantify the reach of one such claim from patent 4,747,282 on BRCA1. We find that human chromosome 1 (which does not contain BRCA1) contains over 300,000 oligonucleotides covered by this claim, and that 80% of cDNA and mRNA sequences contributed to GenBank before the patent application was filed also contain at least one claimed oligonucleotide. Any "isolated" DNA molecules that include such 15 bp nucleotide sequences would fall under the claim as granted by the US Patent and Trademark Office. Anyone making, using, selling, or importing such a molecule for any purpose within the United States would thus be infringing the claim. This claim and others like it turn out, on examination, to be surprisingly broad, and if enforced would have substantial implications for medical practice and scientific research. Copyright 2010 Elsevier Inc. All rights reserved.

Fluorescence Characterization of Gold Modified Liposomes with Antisense N-myc DNA Bound to the Magnetisable Particles with Encapsulated Anticancer Drugs (Doxorubicin, Ellipticine and Etoposide).

PubMed

Skalickova, Sylvie; Nejdl, Lukas; Kudr, Jiri; Ruttkay-Nedecky, Branislav; Jimenez, Ana Maria Jimenez; Kopel, Pavel; Kremplova, Monika; Masarik, Michal; Stiborova, Marie; Eckschlager, Tomas; Adam, Vojtech; Kizek, Rene

2016-02-25

Liposome-based drug delivery systems hold great potential for cancer therapy. The aim of this study was to design a nanodevice for targeted anchoring of liposomes (with and without cholesterol) with encapsulated anticancer drugs and antisense N-myc gene oligonucleotide attached to its surface. To meet this main aim, liposomes with encapsulated doxorubicin, ellipticine and etoposide were prepared. They were further characterized by measuring their fluorescence intensity, whereas the encapsulation efficiency was estimated to be 16%. The hybridization process of individual oligonucleotides forming the nanoconstruct was investigated spectrophotometrically and electrochemically. The concentrations of ellipticine, doxorubicin and etoposide attached to the nanoconstruct in gold nanoparticle-modified liposomes were found to be 14, 5 and 2 µg·mL(-1), respectively. The study succeeded in demonstrating that liposomes are suitable for the transport of anticancer drugs and the antisense oligonucleotide, which can block the expression of the N-myc gene.

Photouncaged Sequence-specific Interstrand DNA Cross-Linking with Photolabile 4-oxo-enal-modified Oligonucleotides.

PubMed

Sun, Jingjing; Tang, Xinjing

2015-05-28

DNA cross-linking technology is an attractive tool for the detection, regulation, and manipulation of genes. In this study, a series of photolabile 4-oxo-enal-modified oligonucleotides functionalized with photosensitive ο-nitrobenzyl derivatives were rationally designed as a new kind of photocaged cross-linking agents. A comprehensive evaluation of cross-linking reactions for different nucleobases in complementary strands under different conditions suggested that the modified DNA oligonucleotides tended to form interstrand cross-linking to nucleobases with the potential of thymidine > guanosine » cytidine ~ adenosine. Different from previous literature reports that cytidine and adenosine were preferential cross-linked nucleobases with 4-oxo-enal moieties, our study represents the first example of DNA cross-linking for T and G selectivity using 4-oxo-enal moiety. The cross-linked adducts were identified and their cross-linking mechanism was also illustrated. This greatly expands the applications of 4-oxo-enal derivatives in the studies of DNA damage and RNA structure.

Oligonucleotide Aptamers: New Tools for Targeted Cancer Therapy

PubMed Central

Sun, Hongguang; Zhu, Xun; Lu, Patrick Y; Rosato, Roberto R; Tan, Wen; Zu, Youli

2014-01-01

Aptamers are a class of small nucleic acid ligands that are composed of RNA or single-stranded DNA oligonucleotides and have high specificity and affinity for their targets. Similar to antibodies, aptamers interact with their targets by recognizing a specific three-dimensional structure and are thus termed “chemical antibodies.” In contrast to protein antibodies, aptamers offer unique chemical and biological characteristics based on their oligonucleotide properties. Hence, they are more suitable for the development of novel clinical applications. Aptamer technology has been widely investigated in various biomedical fields for biomarker discovery, in vitro diagnosis, in vivo imaging, and targeted therapy. This review will discuss the potential applications of aptamer technology as a new tool for targeted cancer therapy with emphasis on the development of aptamers that are able to specifically target cell surface biomarkers. Additionally, we will describe several approaches for the use of aptamers in targeted therapeutics, including aptamer-drug conjugation, aptamer-nanoparticle conjugation, aptamer-mediated targeted gene therapy, aptamer-mediated immunotherapy, and aptamer-mediated biotherapy. PMID:25093706

Duplex and triplex formation of mixed pyrimidine oligonucleotides with stacking of phenyl-triazole moieties in the major groove.

PubMed

Andersen, Nicolai Krog; Døssing, Holger; Jensen, Frank; Vester, Birte; Nielsen, Poul

2011-08-05

5-(1-Phenyl-1,2,3-triazol-4-yl)-2'-deoxycytidine was synthesized from a modified CuAAC protocol and incorporated into mixed pyrimidine oligonucleotide sequences together with the corresponding 5-(1-phenyl-1,2,3-triazol-4-yl)-2'-deoxyuridine. With consecutive incorporations of the two modified nucleosides, improved duplex formation with a complementary RNA and improved triplex formation with a complementary DNA duplex were observed. The improvement is due to π-π stacking of the phenyl-triazole moieties in the major groove. The strongest stacking and most pronounced positive influence on thermal stability was found in between the uridine analogues or with the cytidine analogue placed in the 3' direction to the uridine analogue. Modeling indicated a different orientation of the phenyl-triazole moieties in the major groove to account for the difference between the two nucleotides. The modified oligonucleotides were all found to be significantly stabilized toward nucleolytic degration.

Optimized oligonucleotide probes for DNA fingerprinting.

PubMed

Schäfer, R; Zischler, H; Birsner, U; Becker, A; Epplen, J T

1988-08-01

The three different simple repetitive oligonucleotide probes (CT)8, (CAC)5 and (TCC)5 were hybridized to a panel of human DNAs which had been digested with the restriction endonucleases Alu I, Hinf I and Mbo I. The resulting DNA fingerprints were analyzed and different parameters calculated, such as the maximal mean allele frequency and the average number of polymorphic bands per individual. The highest number of bands was obtained after hybridization of Hinf I digested DNA with (CAC)5. The probability of finding the same band pattern as in individual A in individual B is 2 x 10(-8). The DNAs of monozygous twins show indistinguishable banding patterns and the bands are inherited according to the Mendelian laws. Thus this procedure reveals informative fingerprints that can be used for individual identification, e.g. in paternity testing and in forensic applications. In most of these experiments 32P-labelled probes were employed, yet the biotinylated oligonucleotide (GACA)4 produced results which were equivalent to those obtained by hybridization with the 32P-labelled probe (GACA)4.

Antagonists of the miRNA-Argonaute 2 Protein Complex: Anti-miR-AGOs.

PubMed

Schmidt, Marco F; Korb, Oliver; Abell, Chris

2017-01-01

microRNAs (miRNAs) have been identified as high-value drug targets. A widely applied strategy in miRNA inhibition is the use of antisense agents. However, it has been shown that oligonucleotides are poorly cell permeable because of their complex chemical structure and due to their negatively charged backbone. Consequently, the general application of oligonucleotides in therapy is limited. Since miRNAs' functions are executed exclusively by the Argonaute 2 protein, we therefore describe a protocol for the design of a novel miRNA inhibitor class: antagonists of the miRNA-Argonaute 2 protein complex, so-called anti-miR-AGOs, that not only block the crucial binding site of the target miRNA but also bind to the protein's active site. Due to their lower molecular weight and, thus, more drug-like chemical structure, the novel inhibitor class may show better pharmacokinetic properties than reported oligonucleotide inhibitors, enabling them for potential therapeutic use.

A Randomized Comparative Trial of the Knowledge Retention and Usage Conditions in Undergraduate Medical Students Using Podcasts and Blog Posts

PubMed Central

Chin, Alvin; Helman, Anton; Chan, Teresa M

2018-01-01

Introduction Podcasts and blog posts have gained popularity in Free Open Access Medical education (FOAM). Previous work suggests that podcasts may be useful for knowledge acquisition in undergraduate medical education. However, there remains a paucity of research comparing the two mediums. This study aims to investigate if there are differences in knowledge acquisition and usage conditions by medical students using podcasts and blog posts. Methods Medical students were randomized to either the podcast or blog post group. They completed an initial online assessment of their baseline knowledge on the subject matter. Participants then received access to learning materials and were given four weeks to complete the follow-up assessment on their own time. Independent t-test, paired samples t-test, and a mixed ANOVA (analysis of variance) were conducted to assess knowledge acquisition. An intention-to-teach analysis was used to impute missing data from students lost to follow-up. Simple descriptive statistical data was used to describe media usage conditions. Results Completion of at least one follow-up assessment was comparable (68% podcasts (n = 21/31), 73% blog posts (n = 22/30)). Both groups showed significant improvements in their test scores, with an average 22% improvement for the podcast group and 29% for the blog post group. There was no significant statistical difference in knowledge acquisition between educational modalities overall. Students in the blog post group that completed both post-intervention quizzes showed a larger improvement than the podcast group in the toxicology topic, with similar improvements in the asthma topic. The podcast group tended to engage in multiple activities while using the learning materials (e.g. at least two to three of the following: driving, eating, chores, taking notes, exercising/walking), while the blog readers tended to do fewer activities (e.g. only one of the following: note taking, eating). Conclusion This study suggests that podcasts and blog posts are useful for extracurricular knowledge acquisition by undergraduate medical students with no significant difference between the two modalities. The usage conditions for each type of media differ. PMID:29552428

Understanding the Psychosocial Correlates of the Intention to Use Condoms among Young Men in KwaZulu-Natal, South Africa

PubMed Central

Manyaapelo, Thabang; Nyembezi, Anam; Ruiter, Robert A. C.; van den Borne, Bart; Sifunda, Sibusiso; Reddy, Priscilla

2017-01-01

South Africa leads the world with the number of people infected with HIV. Even with all attempts that have been made to curb HIV, it is still evident that new infections are on the rise. Condom use remains one of the best tools against this challenge yet a small number of sexually active men use them. This study investigates the psychosocial correlates of the intention to use condoms among young men in KwaZulu-Natal province. Using the Theory of Planned Behaviour as a framework, hierarchical linear regression models were used to determine the unique contribution of the study measures in explaining the overall variance of intention to consistently use condoms. Subjective norms and perceived behavioural control towards consistent condom use explained 46% of the variance in the intention to use a condom, suggesting that health behaviour interventions should focus on targeting the normative beliefs as well as control beliefs of the target population. Furthermore, subjective norms and intentions towards reducing alcohol and marijuana use explained an additional 7% to the final model in intentions to condom use, implying that substance use and condom usage may influence each other. No significant contributions were found for beliefs underlying cultural aspects of responsible manhood. PMID:28333100

An automated tool for an analysis of compliance to evidence-based clinical guidelines.

PubMed

Metfessel, B A

2001-01-01

Evidence-based clinical guidelines have been developed in an attempt to decrease practice variation and improve patient outcomes. Although a number of studies and a few commercial products have attempted to measure guideline compliance, there still exists a strong need for an automated product that can take as input large amounts of data and create systematic and detailed profiles of compliance to evidence-based guidelines. The Guideline Compliance Assessment Tool is a product presently under development in our group that will accept as input medical and pharmacy claims data and create a guideline compliance profile that assesses provider practice patterns as compared to evidence-based standards. The system components include an episode of care grouper to standardize classifications of illnesses, an evidence-based guideline knowledge base that potentially contains information on several hundred distinct conditions, a guideline compliance scoring system that emphasizes systematic guideline variance rather than random variances, and an advanced data warehouse that would allow drilling into specific areas of interest. As provider profiling begins to shift away from a primary emphasis on cost to an emphasis on quality, automated methods for measuring guideline compliance will become important in measuring provider performance and increasing guideline usage, consequently improving the standard of care and the potential for better patient outcomes.

OligArch: A software tool to allow artificially expanded genetic information systems (AEGIS) to guide the autonomous self-assembly of long DNA constructs from multiple DNA single strands.

PubMed

Bradley, Kevin M; Benner, Steven A

2014-01-01

Synthetic biologists wishing to self-assemble large DNA (L-DNA) constructs from small DNA fragments made by automated synthesis need fragments that hybridize predictably. Such predictability is difficult to obtain with nucleotides built from just the four standard nucleotides. Natural DNA's peculiar combination of strong and weak G:C and A:T pairs, the context-dependence of the strengths of those pairs, unimolecular strand folding that competes with desired interstrand hybridization, and non-Watson-Crick interactions available to standard DNA, all contribute to this unpredictability. In principle, adding extra nucleotides to the genetic alphabet can improve the predictability and reliability of autonomous DNA self-assembly, simply by increasing the information density of oligonucleotide sequences. These extra nucleotides are now available as parts of artificially expanded genetic information systems (AEGIS), and tools are now available to generate entirely standard DNA from AEGIS DNA during PCR amplification. Here, we describe the OligArch (for "oligonucleotide architecting") software, an application that permits synthetic biologists to engineer optimally self-assembling DNA constructs from both six- and eight-letter AEGIS alphabets. This software has been used to design oligonucleotides that self-assemble to form complete genes from 20 or more single-stranded synthetic oligonucleotides. OligArch is therefore a key element of a scalable and integrated infrastructure for the rapid and designed engineering of biology.

Custom oligonucleotide array-based CGH: a reliable diagnostic tool for detection of exonic copy-number changes in multiple targeted genes

PubMed Central

Vasson, Aurélie; Leroux, Céline; Orhant, Lucie; Boimard, Mathieu; Toussaint, Aurélie; Leroy, Chrystel; Commere, Virginie; Ghiotti, Tiffany; Deburgrave, Nathalie; Saillour, Yoann; Atlan, Isabelle; Fouveaut, Corinne; Beldjord, Cherif; Valleix, Sophie; Leturcq, France; Dodé, Catherine; Bienvenu, Thierry; Chelly, Jamel; Cossée, Mireille

2013-01-01

The frequency of disease-related large rearrangements (referred to as copy-number mutations, CNMs) varies among genes, and search for these mutations has an important place in diagnostic strategies. In recent years, CGH method using custom-designed high-density oligonucleotide-based arrays allowed the development of a powerful tool for detection of alterations at the level of exons and made it possible to provide flexibility through the possibility of modeling chips. The aim of our study was to test custom-designed oligonucleotide CGH array in a diagnostic laboratory setting that analyses several genes involved in various genetic diseases, and to compare it with conventional strategies. To this end, we designed a 12-plex CGH array (135k; 135 000 probes/subarray) (Roche Nimblegen) with exonic and intronic oligonucleotide probes covering 26 genes routinely analyzed in the laboratory. We tested control samples with known CNMs and patients for whom genetic causes underlying their disorders were unknown. The contribution of this technique is undeniable. Indeed, it appeared reproducible, reliable and sensitive enough to detect heterozygous single-exon deletions or duplications, complex rearrangements and somatic mosaicism. In addition, it improves reliability of CNM detection and allows determination of boundaries precisely enough to direct targeted sequencing of breakpoints. All of these points, associated with the possibility of a simultaneous analysis of several genes and scalability ‘homemade' make it a valuable tool as a new diagnostic approach of CNMs. PMID:23340513

Exploring optimization parameters to increase ssDNA recombineering in Lactococcus lactis and Lactobacillus reuteri

PubMed Central

van Pijkeren, Jan-Peter; Neoh, Kar Mun; Sirias, Denise; Findley, Anthony S.; Britton, Robert A.

2012-01-01

Single-stranded DNA (ssDNA) recombineering is a technology which is used to make subtle changes in the chromosome of several bacterial genera. Cells which express a single-stranded DNA binding protein (RecT or Bet) are transformed with an oligonucleotide which is incorporated via an annealing and replication-dependent mechanism. By in silico analysis we identified ssDNA binding protein homologs in the genus Lactobacillus and Lactococcus lactis. To assess whether we could further improve the recombineering efficiency in Lactobacillus reuteri ATCC PTA 6475 we expressed several RecT homologs in this strain. RecT derived from Enterococcus faecalis CRMEN 19 yielded comparable efficiencies compared with a native RecT protein, but none of the other proteins further increased the recombineering efficiency. We successfully improved recombineering efficiency 10-fold in L. lactis by increasing oligonucleotide concentration combined with the use of oligonucleotides containing phosphorothioate-linkages (PTOs). Surprisingly, neither increased oligonucleotide concentration nor PTO linkages enhanced recombineering in L. reuteri 6475. To emphasize the utility of this technology in improving probiotic features we modified six bases in a transcriptional regulatory element region of the pdu-operon of L. reuteri 6475, yielding a 3-fold increase in the production of the antimicrobial compound reuterin. Directed genetic modification of lactic acid bacteria through ssDNA recombineering will simplify strain improvement in a way that, when mutating a single base, is genetically indistinguishable from strains obtained through directed evolution. PMID:22750793

[Ru(phen)2DPPZ]2+ is in contact with DNA bases when it forms a luminescent complex with single-stranded oligonucleotides.

PubMed

Moon, Seok Joon; Kim, Jong Moon; Choi, Ji Youn; Kim, Seog K; Lee, Je Seung; Jang, Ho G

2005-05-01

The luminescence intensity of the Delta- and Lambda-enantiomer of [Ru(phen)2DPPZ]2+ ([Ru(phenanthroline)2 dipyrido[3,2-a:2',3'-c]phenazine]2+) complex enhanced upon binding to double stranded DNA, which has been known as "light switch effect". The enhancement of the luminescence required the intercalation of the large ligand between DNA base pairs. In this study, we report the enhancement in the luminescence intensity when the metal complexes bind to single stranded oligonucleotides, indicating that the "light switch effect" does not require intercalation of the large DPPZ ligand. Oligonucleotides may provide a hydrophobic cavity for the [Ru(phen)2DPPZ]2+ complex to prevent the quenching by the water molecule. In the cavity, the metal complex is in contact with DNA bases as is evidenced by the observation that the excited energy of the DNA bases transfer to the bound metal complex. However, the contact of the metal complex with DNA bases is different from the stacking of DPPZ in the intercalation pocket. In addition to the normal two luminescence lifetimes, a short lifetime in the range of 1-2 ns was found for both the delta- and lambda-enantiomer of [Ru(phen)2DPPZ]2+ when complexed with single stranded oligonucleotides, which may be assigned to the metal complex that is outside of the cavity, interacting with phosphate groups of DNA.

[Oligonucleotide microarray for subtyping avian influenza virus].

PubMed

Xueqing, Han; Xiangmei, Lin; Yihong, Hou; Shaoqiang, Wu; Jian, Liu; Lin, Mei; Guangle, Jia; Zexiao, Yang

2008-09-01

Avian influenza viruses are important human and animal respiratory pathogens and rapid diagnosis of novel emerging avian influenza viruses is vital for effective global influenza surveillance. We developed an oligonucleotide microarray-based method for subtyping all avian influenza virus (16 HA and 9 NA subtypes). In total 25 pairs of primers specific for different subtypes and 1 pair of universal primers were carefully designed based on the genomic sequences of influenza A viruses retrieved from GenBank database. Several multiplex RT-PCR methods were then developed, and the target cDNAs of 25 subtype viruses were amplified by RT-PCR or overlapping PCR for evaluating the microarray. Further 52 oligonucleotide probes specific for all 25 subtype viruses were designed according to published gene sequences of avian influenza viruses in amplified target cDNAs domains, and a microarray for subtyping influenza A virus was developed. Then its specificity and sensitivity were validated by using different subtype strains and 2653 samples from 49 different areas. The results showed that all the subtypes of influenza virus could be identified simultaneously on this microarray with high sensitivity, which could reach to 2.47 pfu/mL virus or 2.5 ng target DNA. Furthermore, there was no cross reaction with other avian respiratory virus. An oligonucleotide microarray-based strategy for detection of avian influenza viruses has been developed. Such a diagnostic microarray will be useful in discovering and identifying all subtypes of avian influenza virus.

New approach to the determination phosphorothioate oligonucleotides by ultra high performance liquid chromatography coupled with inductively coupled plasma mass spectrometry.

PubMed

Studzińska, Sylwia; Mounicou, Sandra; Szpunar, Joanna; Łobiński, Ryszard; Buszewski, Bogusław

2015-01-15

This text presents a novel method for the separation and detection of phosphorothioate oligonucleotides with the use of ion pair ultra high performance liquid chromatography coupled with inductively coupled plasma mass spectrometry The research showed that hexafluoroisopropanol/triethylamine based mobile phases may be successfully used when liquid chromatography is coupled with such elemental detection. However, the concentration of both HFIP and TEA influences the final result. The lower concentration of HFIP, the lower the background in ICP-MS and the greater the sensitivity. The method applied for the analysis of serum samples was based on high resolution inductively coupled plasma mass spectrometry. Utilization of this method allows determination of fifty times lower quantity of phosphorothioate oligonucleotides than in the case of quadrupole mass analyzer. Monitoring of (31)P may be used to quantify these compounds at the level of 80 μg L(-1), while simultaneous determination of sulfur is very useful for qualitative analysis. Moreover, the results presented in this paper demonstrate the practical applicability of coupling LC with ICP-MS in determining phosphorothioate oligonucleotides and their metabolites in serum within 7 min with a very good sensitivity. The method was linear in the concentration range between 0.2 and 3 mg L(-1). The limit of detection was in the range of 0.07 and 0.13 mg L(-1). Accuracy varied with concentration, but was in the range of 3%. Copyright © 2014 Elsevier B.V. All rights reserved.

Fundamental mechanisms of DNA radiosensitization: damage induced by low-energy electrons in brominated oligonucleotide trimers.

PubMed

Park, Yeunsoo; Polska, Katarzyna; Rak, Janusz; Wagner, J Richard; Sanche, Léon

2012-08-16

The replacement of nucleobases with brominated analogs enhances DNA radiosensitivity. We examine the chemistry of low-energy electrons (LEEs) in this sensitization process by experiments with thin films of the oligonucleotide trimers TBrXT, where BrX = 5-BrU (5-bromouracil), 5-BrC (5-bromocytosine), 8-BrA (8-bromoadenine), or 8-BrG (8-bromoguanine). The products induced from irradiation of thin (∼ 2.5 nm) oligonucleotide films, with 10 eV electrons, under ultrahigh vacuum (UHV) are analyzed by HPLC-UV. The number of damaged brominated trimers ranges from about 12 to 15 × 10(-3) molecules per incident electron, whereas under the identical conditions, these numbers drop to 4-7 × 10(-3) for the same, but nonbrominated oligonucleotides. The results of HPLC analysis show that the main degradation pathway of trinucleotides containing brominated bases involve debromination (i.e., loss of the bromine atom and its replacement with a hydrogen atom). The electron-induced sum of products upon bromination increases by factors of 2.1 for the pyrimidines and 3.2 for the purines. Thus, substitution of any native nucleobase with a brominated one in simple models of DNA increases LEE-induced damage to DNA and hence its radiosensitivity. Furthermore, besides the brominated pyrimidines that have already been tested in clinical trials, brominated purines not only appear to be promising sensitizers for radiotherapy, but could provide a higher degree of radiosensitization.

Efficient delivery of RNA interference oligonucleotides to polarized airway epithelia in vitro

PubMed Central

Ramachandran, Shyam; Krishnamurthy, Sateesh; Jacobi, Ashley M.; Wohlford-Lenane, Christine; Behlke, Mark A.; Davidson, Beverly L.

2013-01-01

Polarized and pseudostratified primary airway epithelia present barriers that significantly reduce their transfection efficiency and the efficacy of RNA interference oligonucleotides. This creates an impediment in studies of the airway epithelium, diminishing the utility of loss-of-function as a research tool. Here we outline methods to introduce RNAi oligonucleotides into primary human and porcine airway epithelia grown at an air-liquid interface and difficult-to-transfect transformed epithelial cell lines grown on plastic. At the time of plating, we reverse transfect small-interfering RNA (siRNA), Dicer-substrate siRNA, or microRNA oligonucleotides into cells by use of lipid or peptide transfection reagents. Using this approach we achieve significant knockdown in vitro of hypoxanthine-guanine phosphoribosyltransferase, IL-8, and CFTR expression at the mRNA and protein levels in 1–3 days. We also attain significant reduction of secreted IL-8 in polarized primary pig airway epithelia 3 days posttransfection and inhibition of CFTR-mediated Cl− conductance in polarized air-liquid interface cultures of human airway epithelia 2 wk posttransfection. These results highlight an efficient means to deliver RNA interference reagents to airway epithelial cells and achieve significant knockdown of target gene expression and function. The ability to reliably conduct loss-of-function assays in polarized primary airway epithelia offers benefits to research in studies of epithelial cell homeostasis, candidate gene function, gene-based therapeutics, microRNA biology, and targeting the replication of respiratory viruses. PMID:23624792

Natural antisense transcript-targeted regulation of inducible nitric oxide synthase mRNA levels.

PubMed

Yoshigai, Emi; Hara, Takafumi; Araki, Yoshiro; Tanaka, Yoshito; Oishi, Masaharu; Tokuhara, Katsuji; Kaibori, Masaki; Okumura, Tadayoshi; Kwon, A-Hon; Nishizawa, Mikio

2013-04-01

Natural antisense transcripts (asRNAs) are frequently transcribed from mammalian genes. Recently, we found that non-coding asRNAs are transcribed from the 3' untranslated region (3'UTR) of the rat and mouse genes encoding inducible nitric oxide synthase (iNOS), which catalyzes the production of the inflammatory mediator nitric oxide. The iNOS asRNA stabilizes iNOS mRNA by interacting with the mRNA 3'UTR. Furthermore, single-stranded 'sense' oligonucleotides corresponding to the iNOS mRNA sequence were found to reduce iNOS mRNA levels by interfering with mRNA-asRNA interactions in rat hepatocytes. This method was named natural antisense transcript-targeted regulation (NATRE) technology. In this study, we detected human iNOS asRNA expressed in hepatocarcinoma and colon carcinoma tissues. The human iNOS asRNA harbored a sequence complementary to an evolutionarily conserved region of the iNOS mRNA 3'UTR. When introduced into hepatocytes, iNOS sense oligonucleotides that were modified by substitution with partial phosphorothioate bonds and locked nucleic acids or 2'-O-methyl nucleic acids greatly reduced levels of iNOS mRNA and iNOS protein. Moreover, sense oligonucleotides and short interfering RNAs decreased iNOS mRNA to comparable levels. These results suggest that NATRE technology using iNOS sense oligonucleotides could potentially be used to treat human inflammatory diseases and cancers by reducing iNOS mRNA levels. Copyright © 2013 Elsevier Inc. All rights reserved.

Use of synthetic oligonucleotide DNA probes for the identification of Bacteroides gingivalis.

PubMed Central

Moncla, B J; Braham, P; Dix, K; Watanabe, S; Schwartz, D

1990-01-01

Six different oligonucleotide probes complementary to the hypervariable regions of 16S rRNA of Bacteroides gingivalis were tested for specificity and sensitivity against 77 field strains of B. gingivalis and 105 strains of 12 other Bacteroides species. The data demonstrated that these probes were very specific (range, 0.85 to 1.00) and sensitive (1.00). Some limited cross-reactions with other Bacteroides species were observed. Four of these probes should be useful for rapid detection and identification of B. gingivalis. Images PMID:1690217

Species-Level Identification of Orthopoxviruses with an Oligonucleotide Microchip

PubMed Central

Lapa, Sergey; Mikheev, Maxim; Shchelkunov, Sergei; Mikhailovich, Vladimir; Sobolev, Alexander; Blinov, Vladimir; Babkin, Igor; Guskov, Alexander; Sokunova, Elena; Zasedatelev, Alexander; Sandakhchiev, Lev; Mirzabekov, Andrei

2002-01-01

A method for species-specific detection of orthopoxviruses pathogenic for humans and animals is described. The method is based on hybridization of a fluorescently labeled amplified DNA specimen with the oligonucleotide DNA probes immobilized on a microchip (MAGIChip). The probes identify species-specific sites within the crmB gene encoding the viral analogue of tumor necrosis factor receptor, one of the most important determinants of pathogenicity in this genus of viruses. The diagnostic procedure takes 6 h and does not require any sophisticated equipment (a portable fluorescence reader can be used). PMID:11880388

Oligonucleotides as probes for studying polymerization reactions in dilute aqueous solution: II. Polycondensations

NASA Technical Reports Server (NTRS)

Kolb, V.; Orgel, L. E.

1995-01-01

We have prepared a [32P]-labeled oligonucleotide probe carrying a ureido (-NH-CO-NH2) function at its 3'-terminus. This labeled oligomer was used to study polycondensations of urea and formaldehyde and of various phenols and formaldehyde in aqueous solution. The formation of formaldehyde copolymers attached to the amido-function of the probe was monitored by gel electrophoresis. Our results are generally in agreement with those obtained using conventional techniques. Our method is suitable for monitoring potentially prebiotic polycondensation reactions involving formaldehyde.

Methods and kits for nucleic acid analysis using fluorescence resonance energy transfer

DOEpatents

Kwok, Pui-Yan; Chen, Xiangning

1999-01-01

A method for detecting the presence of a target nucleotide or sequence of nucleotides in a nucleic acid is disclosed. The method is comprised of forming an oligonucleotide labeled with two fluorophores on the nucleic acid target site. The doubly labeled oligonucleotide is formed by addition of a singly labeled dideoxynucleoside triphosphate to a singly labeled polynucleotide or by ligation of two singly labeled polynucleotides. Detection of fluorescence resonance energy transfer upon denaturation indicates the presence of the target. Kits are also provided. The method is particularly applicable to genotyping.

Hetero-oligonucleotide Nanoscale Tiles Capable of Two-Dimensional Lattice Formation as Testbeds for a Rapid, Affordable Purification Methodology

DTIC Science & Technology

2013-01-01

SUBJECT TERMS DNA nanotechnology, purification, origami , 2d arrays Philip S. Lukeman St. John’s University, New York 8000 Utopia Parkway Queens, NY... origami ; DNA double-crossover (“DX”) tile based arrays5 have been constructed using PNA6 and LNA7 oligonucleotides. RNA/ DNA duplexes have been used8 for...the assembly of multiply armed tiles9 and as a template10 to fold DNA origami ;11 all-RNA systems known as ‘tecto-RNA’ have been used to generate a wide

Inhibition Of Molecular And Biological Processes Using Modified Oligonucleotides

DOEpatents

Kozyavkin, Sergei A.; Malykh, Andrei G.; Polouchine, Nikolai N.; Slesarev, Alexei I.

2003-04-15

A method of inhibiting at least one molecular process in a sample, comprising administering to the sample an oligonucleotide or polynucleotide containing at least one monomeric unit having formula (I): wherein A is an organic moiety, n is at least 1, and each X is independently selected from the group consisting of --NRCOCONu, --NHCOCR.sub.2 CR.sub.2 CONu, --NHCOCR.dbd.CRCONu, and --NHCOSSCONu, wherein each R independently represents H or a substituted or unsubstituted alkyl group, and Nu represents a nucleophile, or a salt of the compound.

Oligonucleotides as probes for studying polymerization reactions in dilute aqueous solution. 2: Polycondensations

NASA Technical Reports Server (NTRS)

Kolb, Vera; Orgel, Leslie E.

1995-01-01

We have prepared a (P-32)-labeled oligonucleotide probe carrying a ureido (-NH-CO-NH2) function at its 3'-terminus. This labeled oligomer was used to study polycondensations of urea and formaldehyde and of various phenols and formaldehyde in aqueous solution. The formation of formaldehyde copolymers attached to the amido-function of the probe was monitored by gel electrophoresis. Our results are generally in agreement with those obtained using conventional techniques. Our method is suitable for monitoring potentially prebiotic polycondensation reactions involving formaldehyde.

PCR amplification on microarrays of gel immobilized oligonucleotides

DOEpatents

Strizhkov, Boris; Tillib, Sergei; Mikhailovich, Vladimir; Mirzabekov, Andrei

2003-11-04

The invention relates two general methods for performing PCR amplification, combined with the detection and analysis of the PCR products on a microchip. In the first method, the amplification occurs both outside and within a plurality of gel pads on a microchip, with at least one oligonucleotide primer immobilized in a gel pad. In the second method, PCR amplification also takes place within gel pads on a microchip, but the pads are surrounded by a hydrophobic liquid such as that which separates the individual gel pads into environments which resemble micro-miniaturized test tubes.

Development of a gene synthesis platform for the efficient large scale production of small genes encoding animal toxins.

PubMed

Sequeira, Ana Filipa; Brás, Joana L A; Guerreiro, Catarina I P D; Vincentelli, Renaud; Fontes, Carlos M G A

2016-12-01

Gene synthesis is becoming an important tool in many fields of recombinant DNA technology, including recombinant protein production. De novo gene synthesis is quickly replacing the classical cloning and mutagenesis procedures and allows generating nucleic acids for which no template is available. In addition, when coupled with efficient gene design algorithms that optimize codon usage, it leads to high levels of recombinant protein expression. Here, we describe the development of an optimized gene synthesis platform that was applied to the large scale production of small genes encoding venom peptides. This improved gene synthesis method uses a PCR-based protocol to assemble synthetic DNA from pools of overlapping oligonucleotides and was developed to synthesise multiples genes simultaneously. This technology incorporates an accurate, automated and cost effective ligation independent cloning step to directly integrate the synthetic genes into an effective Escherichia coli expression vector. The robustness of this technology to generate large libraries of dozens to thousands of synthetic nucleic acids was demonstrated through the parallel and simultaneous synthesis of 96 genes encoding animal toxins. An automated platform was developed for the large-scale synthesis of small genes encoding eukaryotic toxins. Large scale recombinant expression of synthetic genes encoding eukaryotic toxins will allow exploring the extraordinary potency and pharmacological diversity of animal venoms, an increasingly valuable but unexplored source of lead molecules for drug discovery.

A Highly Sensitive Electrochemical DNA Biosensor from Acrylic-Gold Nano-composite for the Determination of Arowana Fish Gender

NASA Astrophysics Data System (ADS)

Rahman, Mahbubur; Heng, Lee Yook; Futra, Dedi; Chiang, Chew Poh; Rashid, Zulkafli A.; Ling, Tan Ling

2017-08-01

The present research describes a simple method for the identification of the gender of arowana fish ( Scleropages formosus). The DNA biosensor was able to detect specific DNA sequence at extremely low level down to atto M regimes. An electrochemical DNA biosensor based on acrylic microsphere-gold nanoparticle (AcMP-AuNP) hybrid composite was fabricated. Hydrophobic poly(n-butylacrylate-N-acryloxysuccinimide) microspheres were synthesised with a facile and well-established one-step photopolymerization procedure and physically adsorbed on the AuNPs at the surface of a carbon screen printed electrode (SPE). The DNA biosensor was constructed simply by grafting an aminated DNA probe on the succinimide functionalised AcMPs via a strong covalent attachment. DNA hybridisation response was determined by differential pulse voltammetry (DPV) technique using anthraquinone monosulphonic acid redox probe as an electroactive oligonucleotide label (Table 1). A low detection limit at 1.0 × 10-18 M with a wide linear calibration range of 1.0 × 10-18 to 1.0 × 10-8 M ( R 2 = 0.99) can be achieved by the proposed DNA biosensor under optimal conditions. Electrochemical detection of arowana DNA can be completed within 1 hour. Due to its small size and light weight, the developed DNA biosensor holds high promise for the development of functional kit for fish culture usage.

CAPRRESI: Chimera Assembly by Plasmid Recovery and Restriction Enzyme Site Insertion.

PubMed

Santillán, Orlando; Ramírez-Romero, Miguel A; Dávila, Guillermo

2017-06-25

Here, we present chimera assembly by plasmid recovery and restriction enzyme site insertion (CAPRRESI). CAPRRESI benefits from many strengths of the original plasmid recovery method and introduces restriction enzyme digestion to ease DNA ligation reactions (required for chimera assembly). For this protocol, users clone wildtype genes into the same plasmid (pUC18 or pUC19). After the in silico selection of amino acid sequence regions where chimeras should be assembled, users obtain all the synonym DNA sequences that encode them. Ad hoc Perl scripts enable users to determine all synonym DNA sequences. After this step, another Perl script searches for restriction enzyme sites on all synonym DNA sequences. This in silico analysis is also performed using the ampicillin resistance gene (ampR) found on pUC18/19 plasmids. Users design oligonucleotides inside synonym regions to disrupt wildtype and ampR genes by PCR. After obtaining and purifying complementary DNA fragments, restriction enzyme digestion is accomplished. Chimera assembly is achieved by ligating appropriate complementary DNA fragments. pUC18/19 vectors are selected for CAPRRESI because they offer technical advantages, such as small size (2,686 base pairs), high copy number, advantageous sequencing reaction features, and commercial availability. The usage of restriction enzymes for chimera assembly eliminates the need for DNA polymerases yielding blunt-ended products. CAPRRESI is a fast and low-cost method for fusing protein-coding genes.

Functionalized bioengineered spider silk spheres improve nuclease resistance and activity of oligonucleotide therapeutics providing a strategy for cancer treatment.

PubMed

Kozlowska, Anna Karolina; Florczak, Anna; Smialek, Maciej; Dondajewska, Ewelina; Mackiewicz, Andrzej; Kortylewski, Marcin; Dams-Kozlowska, Hanna

2017-09-01

Cell-selective delivery and sensitivity to serum nucleases remain major hurdles to the clinical application of RNA-based oligonucleotide therapeutics, such as siRNA. Spider silk shows great potential as a biomaterial due to its biocompatibility and biodegradability. Self-assembling properties of silk proteins allow for processing into several different morphologies such as fibers, scaffolds, films, hydrogels, capsules and spheres. Moreover, bioengineering of spider silk protein sequences can functionalize silk by adding peptide moieties with specific features including binding or cell recognition domains. We demonstrated that modification of silk protein by adding the nucleic acid binding domain enabled the development of a novel oligonucleotide delivery system that can be utilized to improve pharmacokinetics of RNA-based therapeutics, such as CpG-siRNA. The MS2 bioengineered silk was functionalized with poly-lysine domain (KN) to generate hybrid silk MS2KN. CpG-siRNA efficiently bound to MS2KN in contrary to control MS2. Both MS2KN complexes and spheres protected CpG-siRNA from degradation by serum nucleases. CpG-siRNA molecules encapsulated into MS2KN spheres were efficiently internalized and processed by TLR9-positive macrophages. Importantly, CpG-STAT3siRNA loaded in silk spheres showed delayed and extended target gene silencing compared to naked oligonucleotides. The prolonged Stat3 silencing resulted in the more pronounced downregulation of interleukin 6 (IL-6), a proinflammatory cytokine and upstream activator of STAT3, which limits the efficacy of TLR9 immunostimulation. Our results demonstrate the feasibility of using spider silk spheres as a carrier of therapeutic nucleic acids. Moreover, the modified kinetic and activity of the CpG-STAT3siRNA embedded into silk spheres is likely to improve immunotherapeutic effects in vivo. We demonstrated that modification of silk protein by adding the nucleic acid binding domain enabled the development of a novel oligonucleotide delivery system that can be utilized to improve pharmacokinetics of RNA-based therapeutics. Although, the siRNA constructs have already given very promising results in the cancer therapy, the in vivo application of RNA-based oligonucleotide therapeutics still is limited due to their sensitivity to serum nucleases and some toxicity. We propose a carrier for RNA-based therapeutics that is made of bioengineered spider silk. We showed that functionalized bioengineered spider silk spheres not only protected RNA-based therapeutics from degradation by serum nucleases, but what is more important the embedding of siRNA into silk spheres delayed and extended target gene silencing compared with naked oligonucleotides. Moreover, we showed that plain silk spheres did not have unspecific effect on target gene levels proving not only to be non-cytotoxic but also very neutral vehicles in terms of TLR9/STAT3 activation in macrophages. We demonstrated advantages of novel delivery technology in safety and efficacy comparing with delivery of naked CpG-STAT3siRNA therapeutics. Copyright © 2017 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.

Knockdown of synaptic scaffolding protein Homer 1b/c attenuates secondary hyperalgesia induced by complete Freund's adjuvant in rats.

PubMed

Yao, Yong-Xing; Jiang, Zhen; Zhao, Zhi-Qi

2011-12-01

Previous studies have demonstrated that Homer 1b/c, a postsynaptic molecular scaffolding protein that binds and clusters metabotropic glutamate receptors at neuronal synapses, has an important role in the metabotropic glutamate receptor signaling process. In the current study, we investigated the possible involvement of Homer 1b/c in secondary hyperalgesia induced by complete Freund's adjuvant (CFA). Chronic inflammation was induced by injecting CFA into the left hind ankle of Wistar rats. Homer 1b/c antisense or missense oligonucleotides were intrathecally administrated (antisense, 10 μg/10 μL, 5 μg/10 μL, or 2.5 μg/10 μL, once a day; missense, 10 μg/10 μL) from 5 to 8 days after the onset of inflammation. The withdrawal threshold and withdrawal latency to mechanical or thermal stimuli were determined before and after the intrathecal administration. The expression and distribution of Homer 1b/c were examined in the spinal cord using immunological techniques. Mechanical allodynia and thermal hyperalgesia were induced within 24 hours and maintained for >2 weeks after the CFA injection. The expression of Homer 1b/c reached the highest level 7 days after inflammation and returned to baseline at day 28. Intrathecal administration of Homer 1b/c antisense oligonucleotides markedly reduced the expression of Homer 1b/c protein in the spinal cord. Additionally, administration of Homer 1b/c antisense oligonucleotides attenuated secondary mechanical hypersensitization on days 2 to 5 and reduced thermal hypersensitization on days 3 to 4. There were no effects of missense oligonucleotides on hypersensitization and the expression of Homer 1b/c. In the naïve rats, Homer 1b/c antisense oligonucleotides did not affect the mechanical and thermal responses or locomotor activity. These novel results demonstrate that Homer 1b/c in the spinal cord contributes to the maintenance of secondary hyperalgesia induced by CFA and suggest that Homer 1b/c may be a novel target for pain therapy.

Blackbody infrared radiative dissociation of oligonucleotide anions.

PubMed

Klassen, J S; Schnier, P D; Williams, E R

1998-11-01

The dissociation kinetics of a series of doubly deprotonated oligonucleotide 7-mers [d(A)7(2-), d(AATTAAT)2-, d(TTAATTA)2-, and d(CCGGCCG)2-] were measured using blackbody infrared radiative dissociation in a Fourier-transform mass spectrometer. The oligonucleotides dissociate first by cleavage at the glycosidic bond leading to the loss of a neutral nucleobase, followed by cleavage at the adjacent (5') phosphodiester bond to produce structurally informative a-base and w type ions. From the temperature dependence of the unimolecular dissociation rate constants, Arrhenius activation parameters in the zero-pressure limit are obtained for the loss of base. The measured Arrhenius parameters are dependent on the identity of the nucleobase. The process involving the loss of an adenine base from the dianions, d(A)7(2-), d(AATTAAT)2-, and d(TTAATTA)2- has an average activation energy (Ea) of approximately 1.0 eV and a preexponential factor (A) of 10(10) s-1. Both guanine and cytosine base loss occurs for d(CCGGCCG)2-. The average Arrhenius parameters for the loss of cytosine and guanine are Ea = 1.32 +/- 0.03 eV and A = 10(13.3 +/- 0.3) s-1. No loss of thymine was observed for mixed adenine-thymine oligonucleotides. Neither base loss nor any other fragmentation reactions occur for d(T)7(2-) over a 600 s reaction delay at 207 degrees C, a temperature close to the upper limit accessible with our instrument. The Arrhenius parameters indicate that the preferred cleavage sites for mixed oligonucleotides of similar mass-to-charge ratio will be strongly dependent on the internal energy of the precursor ions. At low internal energies (effective temperatures below 475 K), loss of adenine and subsequent cleavage of the adjacent phosphoester bonds will dominate, whereas at higher energies, preferential cleavage at C and G residues will occur. The magnitude of the A factors < or = 10(13) s-1 measured for the loss of the three nucleobases (A, G, and C) is indicative of an entropically neutral or disfavored process as the rate limiting step for this reaction.

Blackbody Infrared Radiative Dissociation of Oligonucleotide Anions

PubMed Central

Klassen, John S.; Schnier, Paul D.; Williams, Evan R.

2005-01-01

The dissociation kinetics of a series of doubly deprotonated oligonucleotide 7-mers [ d(A)72-, d(AATTAAT)2−, d(TTAATTA)2−, and d(CCGGCCG)2−] were measured using blackbody infrared radiative dissociation in a Fourier-transform mass spectrometer. The oligonucleotides dissociate first by cleavage at the glycosidic bond leading to the loss of a neutral nucleobase, followed by cleavage at the adjacent (5′) phosphodiester bond to produce structurally informative a-base and w type ions. From the temperature dependence of the unimolecular dissociation rate constants, Arrhenius activation parameters in the zero-pressure limit are obtained for the loss of base. The measured Arrhenius parameters are dependent on the identity of the nucleobase. The process involving the loss of an adenine base from the dianions, d(A)72-, d(AATTAAT)2−, and d(TTAATTA)2− has an average activation energy (Ea) of ~1.0 eV and a preexponential factor (A) of 1010 s−1. Both guanine and cytosine base loss occurs for d(CCGGCCG)2−. The average Arrhenius parameters for the loss of cytosine and guanine are Ea = 1.32 ± 0.03 eV and A = 1013.3±0.3 s−1. No loss of thymine was observed for mixed adenine–thymine oligonucleotides. Neither base loss nor any other fragmentation reactions occur for d(T)72- over a 600 s reaction delay at 207 °C, a temperature close to the upper limit accessible with our instrument. The Arrhenius parameters indicate that the preferred cleavage sites for mixed oligonucleotides of similar mass-to-charge ratio will be strongly dependent on the internal energy of the precursor ions. At low internal energies (effective temperatures below 475 K), loss of adenine and subsequent cleavage of the adjacent phosphoester bonds will dominate, whereas at higher energies, preferential cleavage at C and G residues will occur. The magnitude of the A factors ≤1013 s−1 measured for the loss of the three nucleobases (A, G, and C) is indicative of an entropically neutral or disfavored process as the rate limiting step for this reaction. PMID:9794082

Cellular Interactions and Immune Response of Spherical Nucleic Acid (SNA) Nanoconjugates

NASA Astrophysics Data System (ADS)

Massich, Matthew David

Spherical nucleic acid (SNA) nanoconjugates consist of a densely packed monolayer shell of highly-oriented oligonucleotides covalently bound to a gold nanoparticle core. The nanoconjugates exhibit several important qualities, which make them useful for various biological applications, such as antisense gene regulation strategies and the intracellular detection of biomolecules. The focus of this thesis was to characterize the nanoconjugates interaction with cultured cells and specifically the immune response to their intracellular presence. The immune response of macrophage cells to internalized nanoconjugates was studied, and due to the dense functionalization of oligonucleotides on the surface of the nanoparticle and the resulting high localized salt concentration the innate immune response to the nanoconjugates is ˜25-fold less when compared to a lipoplex carrying the same sequence. Additionally, genome-wide expression profiling was used to study the biological response of cultured cells to the nanoconjugates. The biological response of HeLa cells to gold nanoparticles stabilized by weakly bound ligands was significant, yet when these same nanoparticles were stably functionalized with covalently attached oligonucleotides the cells showed no measurable response. In human keratinocytes, the oligonucleotide sequences caused 427 genes to be differentially expressed when complexed with Dharmafect, but when the oligonucleotides were conjugated to nanoparticles only 7 genes were differentially expressed. Beyond characterizing the cellular interactions and immune response of the nanoconjugates, the optimal length of siRNA (from 19--34 base pairs) that induces the most gene knockdown while maintaining limited immune activation was determined to be 24 base pairs. Further, the SNAs were shown to be useful as a potential antiviral gene therapy by demonstrating approximately 50% knockdown of the Ebola VP35 gene. Lastly, a scanning probe-enabled method was used to rapidly create nanoscale fibronectin patterns over large areas with a range of feature sizes, thereby opening the field of nanocombinatorics. This allowed the investigation of the relationship between fibronectin feature size and stem cell fate. MSCs cultured on nanoscale fibronectin features directed differentiation toward osteogenesis to a greater extent than cells grown on both microscale features and cells grown on non-patterned fibronectin substrates with osteogenic inducing media, demonstrating a new method for controlling stem cell fate.

Cardiovascular and Metabolic Effects of ANGPTL3 Antisense Oligonucleotides.

PubMed

Graham, Mark J; Lee, Richard G; Brandt, Teresa A; Tai, Li-Jung; Fu, Wuxia; Peralta, Raechel; Yu, Rosie; Hurh, Eunju; Paz, Erika; McEvoy, Bradley W; Baker, Brenda F; Pham, Nguyen C; Digenio, Andres; Hughes, Steven G; Geary, Richard S; Witztum, Joseph L; Crooke, Rosanne M; Tsimikas, Sotirios

2017-07-20

Epidemiologic and genomewide association studies have linked loss-of-function variants in ANGPTL3, encoding angiopoietin-like 3, with low levels of plasma lipoproteins. We evaluated antisense oligonucleotides (ASOs) targeting Angptl3 messenger RNA (mRNA) for effects on plasma lipid levels, triglyceride clearance, liver triglyceride content, insulin sensitivity, and atherosclerosis in mice. Subsequently, 44 human participants (with triglyceride levels of either 90 to 150 mg per deciliter [1.0 to 1.7 mmol per liter] or >150 mg per deciliter, depending on the dose group) were randomly assigned to receive subcutaneous injections of placebo or an antisense oligonucleotide targeting ANGPTL3 mRNA in a single dose (20, 40, or 80 mg) or multiple doses (10, 20, 40, or 60 mg per week for 6 weeks). The main end points were safety, side-effect profile, pharmacokinetic and pharmacodynamic measures, and changes in levels of lipids and lipoproteins. The treated mice had dose-dependent reductions in levels of hepatic Angptl3 mRNA, Angptl3 protein, triglycerides, and low-density lipoprotein (LDL) cholesterol, as well as reductions in liver triglyceride content and atherosclerosis progression and increases in insulin sensitivity. After 6 weeks of treatment, persons in the multiple-dose groups had reductions in levels of ANGPTL3 protein (reductions of 46.6 to 84.5% from baseline, P<0.01 for all doses vs. placebo) and in levels of triglycerides (reductions of 33.2 to 63.1%), LDL cholesterol (1.3 to 32.9%), very-low-density lipoprotein cholesterol (27.9 to 60.0%), non-high-density lipoprotein cholesterol (10.0 to 36.6%), apolipoprotein B (3.4 to 25.7%), and apolipoprotein C-III (18.9 to 58.8%). Three participants who received the antisense oligonucleotide and three who received placebo reported dizziness or headache. There were no serious adverse events. Oligonucleotides targeting mouse Angptl3 retarded the progression of atherosclerosis and reduced levels of atherogenic lipoproteins in mice. Use of the same strategy to target human ANGPTL3 reduced levels of atherogenic lipoproteins in humans. (Funded by Ionis Pharmaceuticals; ClinicalTrials.gov number, NCT02709850 .).

Post-traumatic anxiety associates with failure of the innate immune receptor TLR9 to evade the pro-inflammatory NFκB pathway.

PubMed

Zimmerman, G; Shaltiel, G; Barbash, S; Cohen, J; Gasho, C J; Shenhar-Tsarfaty, S; Shalev, H; Berliner, S A; Shelef, I; Shoham, S; Friedman, A; Cohen, H; Soreq, H

2012-02-21

Post-traumatic anxiety notably involves inflammation, but its causes and functional significance are yet unclear. Here, we report that failure of the innate immune system Toll-like receptor 9 (TLR9) to limit inflammation is causally involved with anxiety-associated inflammation and that peripheral administration of specific oligonucleotide activators of TLR9 may prevent post-traumatic consequences in stressed mice. Suggesting involvement of NFκB-mediated enhancement of inflammatory reactions in the post-traumatic phenotype, we found association of serum interleukin-1β increases with symptoms severity and volumetric brain changes in post-traumatic stress disorder patients. In predator scent-stressed mice, the moderate NFκB-activating oligonucleotides mEN101 and its human ortholog BL-7040, but not the canonic NFκB activator oligonucleotide ODN1826, induced anxiolytic effects. In stressed mice, peripherally administered mEN101 prevented delayed stress-inducible serum interleukin-1β increases while limiting stress-characteristic hippocampal transcript modifications and the anxiety-induced EGR1-mediated neuronal activation. Attesting to the TLR9 specificity of this response, BL-7040 suppressed NFκB-mediated luciferase in transfected cells co-expressing TLR9, but not other TLRs. Furthermore, TLR9-/- mice were mEN101 and BL-7040 resistant and presented unprovoked anxiety-like behavior and anxiety-characteristic hippocampal transcripts. Our findings demonstrate functional relevance of TLR9 in protecting stressed mammals from overreacting to traumatic experiences and suggest using oligonucleotide-mediated peripheral TLR9 activation to potentiate the innate immune system and prevent post-traumatic inflammation and anxiety.

Combination of ICP-MS, capillary electrophoresis, and their hyphenation for probing Ru(III) metallodrug-DNA interactions.

PubMed

Foteeva, Lidia S; Matczuk, Magdalena; Pawlak, Katarzyna; Aleksenko, Svetlana S; Nosenko, Sergey V; Karandashev, Vasily K; Jarosz, Maciej; Timerbaev, Andrei R

2017-03-01

Determination of the DNA-binding reactivity and affinity is an important part of a successful program for the selection of metallodrug candidates. For such assaying, a range of complementary analytical techniques was proposed and tested here using one of few anticancer metal-based drugs that are currently in clinical trials, indazolium trans-[tetrachloridobis(1H-indazole)ruthenate(III), and a DNA oligonucleotide. A high reactivity of the Ru drug was confirmed in affinity capillary electrophoresis (CE) mode, where adduct formation takes place in situ (i.e., in the capillary filled with an oligonucleotide-containing electrolyte). To further characterize the binding kinetics, a drug-oligonucleotide mixture was incubated for a different period of time, followed by ultrafiltration separation into two different in molecular weight fractions (>3 and <3 kDa). The time-dependent distribution profiles of the Ru drug were then assessed by CE-inductively coupled plasma mass spectrometry (ICP-MS), revealing that at least two DNA adducts exist at equilibrium conditions. Using standalone ICP-MS, dominant equilibrium amount of the bound ruthenium was found to occur in a fraction of 5-10 kDa, which includes the oligonucleotide (ca. 6 kDa). Importantly, in all three assays, the drug was used for the first time in in-vitro studies, not in the intact form but as its active species released from the transferrin adduct at simulated cancer cytosolic conditions. This circumstance makes the established analytical platform promising to provide a detailed view on metallodrug targeting, including other possible biomolecules and ex vivo samples.

DNA-based species detection capabilities using laser transmission spectroscopy

PubMed Central

Mahon, A. R.; Barnes, M. A.; Li, F.; Egan, S. P.; Tanner, C. E.; Ruggiero, S. T.; Feder, J. L.; Lodge, D. M.

2013-01-01

Early detection of invasive species is critical for effective biocontrol to mitigate potential ecological and economic damage. Laser transmission spectroscopy (LTS) is a powerful solution offering real-time, DNA-based species detection in the field. LTS can measure the size, shape and number of nanoparticles in a solution and was used here to detect size shifts resulting from hybridization of the polymerase chain reaction product to nanoparticles functionalized with species-specific oligonucleotide probes or with the species-specific oligonucleotide probes alone. We carried out a series of DNA detection experiments using the invasive freshwater quagga mussel (Dreissena bugensis) to evaluate the capability of the LTS platform for invasive species detection. Specifically, we tested LTS sensitivity to (i) DNA concentrations of a single target species, (ii) the presence of a target species within a mixed sample of other closely related species, (iii) species-specific functionalized nanoparticles versus species-specific oligonucleotide probes alone, and (iv) amplified DNA fragments versus unamplified genomic DNA. We demonstrate that LTS is a highly sensitive technique for rapid target species detection, with detection limits in the picomolar range, capable of successful identification in multispecies samples containing target and non-target species DNA. These results indicate that the LTS DNA detection platform will be useful for field application of target species. Additionally, we find that LTS detection is effective with species-specific oligonucleotide tags alone or when they are attached to polystyrene nanobeads and with both amplified and unamplified DNA, indicating that the technique may also have versatility for broader applications. PMID:23015524

Simplified Paper Format for Detecting HIV Drug Resistance in Clinical Specimens by Oligonucleotide Ligation

PubMed Central

Panpradist, Nuttada; Beck, Ingrid A.; Chung, Michael H.; Kiarie, James N.; Frenkel, Lisa M.; Lutz, Barry R.

2016-01-01

Human immunodeficiency virus (HIV) is a chronic infection that can be managed by antiretroviral treatment (ART). However, periods of suboptimal viral suppression during lifelong ART can select for HIV drug resistant (DR) variants. Transmission of drug resistant virus can lessen or abrogate ART efficacy. Therefore, testing of individuals for drug resistance prior to initiation of treatment is recommended to ensure effective ART. Sensitive and inexpensive HIV genotyping methods are needed in low-resource settings where most HIV infections occur. The oligonucleotide ligation assay (OLA) is a sensitive point mutation assay for detection of drug resistance mutations in HIV pol. The current OLA involves four main steps from sample to analysis: (1) lysis and/or nucleic acid extraction, (2) amplification of HIV RNA or DNA, (3) ligation of oligonucleotide probes designed to detect single nucleotide mutations that confer HIV drug resistance, and (4) analysis via oligonucleotide surface capture, denaturation, and detection (CDD). The relative complexity of these steps has limited its adoption in resource-limited laboratories. Here we describe a simplification of the 2.5-hour plate-format CDD to a 45-minute paper-format CDD that eliminates the need for a plate reader. Analysis of mutations at four HIV-1 DR codons (K103N, Y181C, M184V, and G190A) in 26 blood specimens showed a strong correlation of the ratios of mutant signal to total signal between the paper CDD and the plate CDD. The assay described makes the OLA easier to perform in low resource laboratories. PMID:26751207

Post-traumatic anxiety associates with failure of the innate immune receptor TLR9 to evade the pro-inflammatory NFκB pathway

PubMed Central

Zimmerman, G; Shaltiel, G; Barbash, S; Cohen, J; Gasho, C J; Shenhar-Tsarfaty, S; Shalev, H; Berliner, S A; Shelef, I; Shoham, S; Friedman, A; Cohen, H; Soreq, H

2012-01-01

Post-traumatic anxiety notably involves inflammation, but its causes and functional significance are yet unclear. Here, we report that failure of the innate immune system Toll-like receptor 9 (TLR9) to limit inflammation is causally involved with anxiety-associated inflammation and that peripheral administration of specific oligonucleotide activators of TLR9 may prevent post-traumatic consequences in stressed mice. Suggesting involvement of NFκB-mediated enhancement of inflammatory reactions in the post-traumatic phenotype, we found association of serum interleukin-1β increases with symptoms severity and volumetric brain changes in post-traumatic stress disorder patients. In predator scent-stressed mice, the moderate NFκB-activating oligonucleotides mEN101 and its human ortholog BL-7040, but not the canonic NFκB activator oligonucleotide ODN1826, induced anxiolytic effects. In stressed mice, peripherally administered mEN101 prevented delayed stress-inducible serum interleukin-1β increases while limiting stress-characteristic hippocampal transcript modifications and the anxiety-induced EGR1-mediated neuronal activation. Attesting to the TLR9 specificity of this response, BL-7040 suppressed NFκB-mediated luciferase in transfected cells co-expressing TLR9, but not other TLRs. Furthermore, TLR9−/− mice were mEN101 and BL-7040 resistant and presented unprovoked anxiety-like behavior and anxiety-characteristic hippocampal transcripts. Our findings demonstrate functional relevance of TLR9 in protecting stressed mammals from overreacting to traumatic experiences and suggest using oligonucleotide-mediated peripheral TLR9 activation to potentiate the innate immune system and prevent post-traumatic inflammation and anxiety. PMID:22832815

Oligonucleotide probes to the 16S ribosomal RNA: implications of sequence homology and secondary structure with particular reference to the oral species Prevotella intermedia and Prevotella nigrescens.

PubMed

Shah, H N; Gharbia, S E; Scully, C; Finegold, S M

1995-03-01

Eight oligonucleotides based upon regions of the small subunit 16S ribosomal RNA gene sequences were analysed against a background of their position within the molecule and their two-dimensional structure to rationalise their use in recognising Prevotella intermedia and Prevotella nigrescens. The 41 clinical isolates from both oral and respiratory sites and two reference strains were subjected to DNA-DNA hybridisation and multilocus enzyme electrophoresis to confirm their identity. Alignment of oligonucleotide probes designated I Bi-2 to I Bi-6 (for P. intermedia) and 2Bi-2 (for P. nigrescens) with the 16S rRNA suggested that these probes lacked specificity or were constructed from hypervariable regions. A 52-mer oligonucleotide (designated Bi) reliably detected both species. Because of the high degree of concordance between the 16S rRNAs of both species, it was necessary to vary the stringency of hybridisation conditions for detection of both species. Thus probe I Bi-I recognised P. intermedia while I Bi-I detected both P. intermedia and P. nigrescens at low stringency. However, under conditions of high stringency only P. nigrescens was recognised by probe 2Bi-I. These probes were highly specific and did not hybridise with DNA from the closely related P. corporis, nor other periodontal pathogens such as Fusobacterium nucleatum, Actinobacillus actinomycetemcomitans, Treponema denticola and several pigmented species such as Prevotella melaninogenica, P. denticola, P. loescheii, Porphyromonas asaccharolytica, Py. endodontalis, Py. gingivalis, Py. levii, and Py. macacae.

Bcl-2 inhibitors potentiate the cytotoxic effects of radiation in Bcl-2 overexpressing radioresistant tumor cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hara, Takamitsu; Omura-Minamisawa, Motoko; Chao Cheng

Purpose: Bcl-2, an inhibitor of apoptosis frequently shows elevated expression in human tumors, thus resulting in resistance to radiation therapy. Therefore, inhibiting Bcl-2 function may enhance the radiosensitivity of tumor cells. Tetrocarcin A (TC-A) and bcl-2 antisense oligonucleotides exhibit antitumor activity by inhibiting Bcl-2 function and transcription, respectively. We investigated whether these antitumor agents would enhance the cytotoxic effects of radiation in tumor cells overexpressing Bcl-2. Methods and materials: We used HeLa/bcl-2 cells, a stable Bcl-2-expressing cell line derived from wild-type HeLa (HeLa/wt) cells. Cells were incubated with TC-A and bcl-2 antisense oligonucleotides for 24 h after irradiation, and cellmore » viability was then determined. Apoptotic cells were quantified by flow cytometric assay. Results: The HeLa/bcl-2 cells were more resistant to radiation than HeLa/wt cells. At concentrations that are not inherently cytotoxic, both TC-A and bcl-2 antisense oligonucleotides increased the cytotoxic effects of radiation in HeLa/bcl-2 cells, but not in HeLa/wt cells. However, in HeLa/bcl-2 cells, additional treatment with TC-A in combination with radiation did not significantly increase apoptosis. Conclusions: The present results suggest that TC-A and bcl-2 antisense oligonucleotides reduce radioresistance of tumor cells overexpressing Bcl-2. Therefore, a combination of radiotherapy and Bcl-2 inhibitors may prove to be a useful therapeutic approach for treating tumors that overexpress Bcl-2.« less

Detection and discrimination of orthopoxviruses using microarrays of immobilized oligonucleotides.

PubMed

Laassri, Majid; Chizhikov, Vladimir; Mikheev, Maxim; Shchelkunov, Sergei; Chumakov, Konstantin

2003-09-01

Variola virus (VARV), causing smallpox, is a potential biological weapon. Methods to detect VARV rapidly and to differentiate it from other viruses causing similar clinical syndromes are needed urgently. We have developed a new microarray-based method that detects simultaneously and discriminates four orthopoxvirus (OPV) species pathogenic for humans (variola, monkeypox, cowpox, and vaccinia viruses) and distinguishes them from chickenpox virus (varicella-zoster virus or VZV). The OPV gene C23L/B29R, encoding the CC-chemokine binding protein, was sequenced for 41 strains of seven species of orthopox viruses obtained from different geographical regions. Those C23L/B29R sequences and the ORF 62 sequences from 13 strains of VZV (selected from GenBank) were used to design oligonucleotide probes that were immobilized on an aldehyde-coated glass surface (a total of 57 probes). The microchip contained several unique 13-21 bases long oligonucleotide probes specific to each virus species to ensure redundancy and robustness of the assay. A region approximately 1100 bases long was amplified from samples of viral DNA and fluorescently labeled with Cy5-modified dNTPs, and single-stranded DNA was prepared by strand separation. Hybridization was carried out under plastic coverslips, resulting in a fluorescent pattern that was quantified using a confocal laser scanner. 49 known and blinded samples of OPV DNA, representing different OPV species, and two VZV strains were tested. The oligonucleotide microarray hybridization technique identified reliably and correctly all samples. This new procedure takes only 3 h, and it can be used for parallel testing of multiple samples.