Sample records for oligonucleotide-based array comparative

  1. Systematic validation and atomic force microscopy of non-covalent short oligonucleotide barcode microarrays.

    PubMed

    Cook, Michael A; Chan, Chi-Kin; Jorgensen, Paul; Ketela, Troy; So, Daniel; Tyers, Mike; Ho, Chi-Yip

    2008-02-06

    Molecular barcode arrays provide a powerful means to analyze cellular phenotypes in parallel through detection of short (20-60 base) unique sequence tags, or "barcodes", associated with each strain or clone in a collection. However, costs of current methods for microarray construction, whether by in situ oligonucleotide synthesis or ex situ coupling of modified oligonucleotides to the slide surface are often prohibitive to large-scale analyses. Here we demonstrate that unmodified 20mer oligonucleotide probes printed on conventional surfaces show comparable hybridization signals to covalently linked 5'-amino-modified probes. As a test case, we undertook systematic cell size analysis of the budding yeast Saccharomyces cerevisiae genome-wide deletion collection by size separation of the deletion pool followed by determination of strain abundance in size fractions by barcode arrays. We demonstrate that the properties of a 13K unique feature spotted 20 mer oligonucleotide barcode microarray compare favorably with an analogous covalently-linked oligonucleotide array. Further, cell size profiles obtained with the size selection/barcode array approach recapitulate previous cell size measurements of individual deletion strains. Finally, through atomic force microscopy (AFM), we characterize the mechanism of hybridization to unmodified barcode probes on the slide surface. These studies push the lower limit of probe size in genome-scale unmodified oligonucleotide microarray construction and demonstrate a versatile, cost-effective and reliable method for molecular barcode analysis.

  2. Oligonucleotide arrays vs. metaphase-comparative genomic hybridisation and BAC arrays for single-cell analysis: first applications to preimplantation genetic diagnosis for Robertsonian translocation carriers.

    PubMed

    Ramos, Laia; del Rey, Javier; Daina, Gemma; García-Aragonés, Manel; Armengol, Lluís; Fernandez-Encinas, Alba; Parriego, Mònica; Boada, Montserrat; Martinez-Passarell, Olga; Martorell, Maria Rosa; Casagran, Oriol; Benet, Jordi; Navarro, Joaquima

    2014-01-01

    Comprehensive chromosome analysis techniques such as metaphase-Comparative Genomic Hybridisation (CGH) and array-CGH are available for single-cell analysis. However, while metaphase-CGH and BAC array-CGH have been widely used for Preimplantation Genetic Diagnosis, oligonucleotide array-CGH has not been used in an extensive way. A comparison between oligonucleotide array-CGH and metaphase-CGH has been performed analysing 15 single fibroblasts from aneuploid cell-lines and 18 single blastomeres from human cleavage-stage embryos. Afterwards, oligonucleotide array-CGH and BAC array-CGH were also compared analysing 16 single blastomeres from human cleavage-stage embryos. All three comprehensive analysis techniques provided broadly similar cytogenetic profiles; however, non-identical profiles appeared when extensive aneuploidies were present in a cell. Both array techniques provided an optimised analysis procedure and a higher resolution than metaphase-CGH. Moreover, oligonucleotide array-CGH was able to define extra segmental imbalances in 14.7% of the blastomeres and it better determined the specific unbalanced chromosome regions due to a higher resolution of the technique (≈ 20 kb). Applicability of oligonucleotide array-CGH for Preimplantation Genetic Diagnosis has been demonstrated in two cases of Robertsonian translocation carriers 45,XY,der(13;14)(q10;q10). Transfer of euploid embryos was performed in both cases and pregnancy was achieved by one of the couples. This is the first time that an oligonucleotide array-CGH approach has been successfully applied to Preimplantation Genetic Diagnosis for balanced chromosome rearrangement carriers.

  3. Oligonucleotide Arrays vs. Metaphase-Comparative Genomic Hybridisation and BAC Arrays for Single-Cell Analysis: First Applications to Preimplantation Genetic Diagnosis for Robertsonian Translocation Carriers

    PubMed Central

    Ramos, Laia; del Rey, Javier; Daina, Gemma; García-Aragonés, Manel; Armengol, Lluís; Fernandez-Encinas, Alba; Parriego, Mònica; Boada, Montserrat; Martinez-Passarell, Olga; Martorell, Maria Rosa; Casagran, Oriol; Benet, Jordi; Navarro, Joaquima

    2014-01-01

    Comprehensive chromosome analysis techniques such as metaphase-Comparative Genomic Hybridisation (CGH) and array-CGH are available for single-cell analysis. However, while metaphase-CGH and BAC array-CGH have been widely used for Preimplantation Genetic Diagnosis, oligonucleotide array-CGH has not been used in an extensive way. A comparison between oligonucleotide array-CGH and metaphase-CGH has been performed analysing 15 single fibroblasts from aneuploid cell-lines and 18 single blastomeres from human cleavage-stage embryos. Afterwards, oligonucleotide array-CGH and BAC array-CGH were also compared analysing 16 single blastomeres from human cleavage-stage embryos. All three comprehensive analysis techniques provided broadly similar cytogenetic profiles; however, non-identical profiles appeared when extensive aneuploidies were present in a cell. Both array techniques provided an optimised analysis procedure and a higher resolution than metaphase-CGH. Moreover, oligonucleotide array-CGH was able to define extra segmental imbalances in 14.7% of the blastomeres and it better determined the specific unbalanced chromosome regions due to a higher resolution of the technique (≈20 kb). Applicability of oligonucleotide array-CGH for Preimplantation Genetic Diagnosis has been demonstrated in two cases of Robertsonian translocation carriers 45,XY,der(13;14)(q10;q10). Transfer of euploid embryos was performed in both cases and pregnancy was achieved by one of the couples. This is the first time that an oligonucleotide array-CGH approach has been successfully applied to Preimplantation Genetic Diagnosis for balanced chromosome rearrangement carriers. PMID:25415307

  4. Systematic Validation and Atomic Force Microscopy of Non-Covalent Short Oligonucleotide Barcode Microarrays

    PubMed Central

    Cook, Michael A.; Chan, Chi-Kin; Jorgensen, Paul; Ketela, Troy; So, Daniel; Tyers, Mike; Ho, Chi-Yip

    2008-01-01

    Background Molecular barcode arrays provide a powerful means to analyze cellular phenotypes in parallel through detection of short (20–60 base) unique sequence tags, or “barcodes”, associated with each strain or clone in a collection. However, costs of current methods for microarray construction, whether by in situ oligonucleotide synthesis or ex situ coupling of modified oligonucleotides to the slide surface are often prohibitive to large-scale analyses. Methodology/Principal Findings Here we demonstrate that unmodified 20mer oligonucleotide probes printed on conventional surfaces show comparable hybridization signals to covalently linked 5′-amino-modified probes. As a test case, we undertook systematic cell size analysis of the budding yeast Saccharomyces cerevisiae genome-wide deletion collection by size separation of the deletion pool followed by determination of strain abundance in size fractions by barcode arrays. We demonstrate that the properties of a 13K unique feature spotted 20 mer oligonucleotide barcode microarray compare favorably with an analogous covalently-linked oligonucleotide array. Further, cell size profiles obtained with the size selection/barcode array approach recapitulate previous cell size measurements of individual deletion strains. Finally, through atomic force microscopy (AFM), we characterize the mechanism of hybridization to unmodified barcode probes on the slide surface. Conclusions/Significance These studies push the lower limit of probe size in genome-scale unmodified oligonucleotide microarray construction and demonstrate a versatile, cost-effective and reliable method for molecular barcode analysis. PMID:18253494

  5. Partition resampling and extrapolation averaging: approximation methods for quantifying gene expression in large numbers of short oligonucleotide arrays.

    PubMed

    Goldstein, Darlene R

    2006-10-01

    Studies of gene expression using high-density short oligonucleotide arrays have become a standard in a variety of biological contexts. Of the expression measures that have been proposed to quantify expression in these arrays, multi-chip-based measures have been shown to perform well. As gene expression studies increase in size, however, utilizing multi-chip expression measures is more challenging in terms of computing memory requirements and time. A strategic alternative to exact multi-chip quantification on a full large chip set is to approximate expression values based on subsets of chips. This paper introduces an extrapolation method, Extrapolation Averaging (EA), and a resampling method, Partition Resampling (PR), to approximate expression in large studies. An examination of properties indicates that subset-based methods can perform well compared with exact expression quantification. The focus is on short oligonucleotide chips, but the same ideas apply equally well to any array type for which expression is quantified using an entire set of arrays, rather than for only a single array at a time. Software implementing Partition Resampling and Extrapolation Averaging is under development as an R package for the BioConductor project.

  6. Genome-wide comparison of paired fresh frozen and formalin-fixed paraffin-embedded gliomas by custom BAC and oligonucleotide array comparative genomic hybridization: facilitating analysis of archival gliomas.

    PubMed

    Mohapatra, Gayatry; Engler, David A; Starbuck, Kristen D; Kim, James C; Bernay, Derek C; Scangas, George A; Rousseau, Audrey; Batchelor, Tracy T; Betensky, Rebecca A; Louis, David N

    2011-04-01

    Array comparative genomic hybridization (aCGH) is a powerful tool for detecting DNA copy number alterations (CNA). Because diffuse malignant gliomas are often sampled by small biopsies, formalin-fixed paraffin-embedded (FFPE) blocks are often the only tissue available for genetic analysis; FFPE tissues are also needed to study the intratumoral heterogeneity that characterizes these neoplasms. In this paper, we present a combination of evaluations and technical advances that provide strong support for the ready use of oligonucleotide aCGH on FFPE diffuse gliomas. We first compared aCGH using bacterial artificial chromosome (BAC) arrays in 45 paired frozen and FFPE gliomas, and demonstrate a high concordance rate between FFPE and frozen DNA in an individual clone-level analysis of sensitivity and specificity, assuring that under certain array conditions, frozen and FFPE DNA can perform nearly identically. However, because oligonucleotide arrays offer advantages to BAC arrays in genomic coverage and practical availability, we next developed a method of labeling DNA from FFPE tissue that allows efficient hybridization to oligonucleotide arrays. To demonstrate utility in FFPE tissues, we applied this approach to biphasic anaplastic oligoastrocytomas and demonstrate CNA differences between DNA obtained from the two components. Therefore, BAC and oligonucleotide aCGH can be sensitive and specific tools for detecting CNAs in FFPE DNA, and novel labeling techniques enable the routine use of oligonucleotide arrays for FFPE DNA. In combination, these advances should facilitate genome-wide analysis of rare, small and/or histologically heterogeneous gliomas from FFPE tissues.

  7. Oligonucleotide Array for Identification and Detection of Pythium Species†

    PubMed Central

    Tambong, J. T.; de Cock, A. W. A. M.; Tinker, N. A.; Lévesque, C. A.

    2006-01-01

    A DNA array containing 172 oligonucleotides complementary to specific diagnostic regions of internal transcribed spacers (ITS) of more than 100 species was developed for identification and detection of Pythium species. All of the species studied, with the exception of Pythium ostracodes, exhibited a positive hybridization reaction with at least one corresponding species-specific oligonucleotide. Hybridization patterns were distinct for each species. The array hybridization patterns included cluster-specific oligonucleotides that facilitated the recognition of species, including new ones, belonging to groups such as those producing filamentous or globose sporangia. BLAST analyses against 500 publicly available Pythium sequences in GenBank confirmed that species-specific oligonucleotides were unique to all of the available strains of each species, of which there were numerous economically important ones. GenBank entries of newly described species that are not putative synonyms showed no homology to sequences of the spotted species-specific oligonucleotides, but most new species did match some of the cluster-specific oligonucleotides. Further verification of the specificity of the DNA array was done with 50 additional Pythium isolates obtained by soil dilution plating. The hybridization patterns obtained were consistent with the identification of these isolates based on morphology and ITS sequence analyses. In another blind test, total DNA of the same soil samples was amplified and hybridized on the array, and the results were compared to those of 130 Pythium isolates obtained by soil dilution plating and root baiting. The 13 species detected by the DNA array corresponded to the isolates obtained by a combination of soil dilution plating and baiting, except for one new species that was not represented on the array. We conclude that the reported DNA array is a reliable tool for identification and detection of the majority of Pythium species in environmental samples. Simultaneous detection and identification of multiple species of soilborne pathogens such as Pythium species could be a major step forward for epidemiological and ecological studies. PMID:16597974

  8. Particle-Based Microarrays of Oligonucleotides and Oligopeptides.

    PubMed

    Nesterov-Mueller, Alexander; Maerkle, Frieder; Hahn, Lothar; Foertsch, Tobias; Schillo, Sebastian; Bykovskaya, Valentina; Sedlmayr, Martyna; Weber, Laura K; Ridder, Barbara; Soehindrijo, Miriam; Muenster, Bastian; Striffler, Jakob; Bischoff, F Ralf; Breitling, Frank; Loeffler, Felix F

    2014-10-28

    In this review, we describe different methods of microarray fabrication based on the use of micro-particles/-beads and point out future tendencies in the development of particle-based arrays. First, we consider oligonucleotide bead arrays, where each bead is a carrier of one specific sequence of oligonucleotides. This bead-based array approach, appearing in the late 1990s, enabled high-throughput oligonucleotide analysis and had a large impact on genome research. Furthermore, we consider particle-based peptide array fabrication using combinatorial chemistry. In this approach, particles can directly participate in both the synthesis and the transfer of synthesized combinatorial molecules to a substrate. Subsequently, we describe in more detail the synthesis of peptide arrays with amino acid polymer particles, which imbed the amino acids inside their polymer matrix. By heating these particles, the polymer matrix is transformed into a highly viscous gel, and thereby, imbedded monomers are allowed to participate in the coupling reaction. Finally, we focus on combinatorial laser fusing of particles for the synthesis of high-density peptide arrays. This method combines the advantages of particles and combinatorial lithographic approaches.

  9. Particle-Based Microarrays of Oligonucleotides and Oligopeptides

    PubMed Central

    Nesterov-Mueller, Alexander; Maerkle, Frieder; Hahn, Lothar; Foertsch, Tobias; Schillo, Sebastian; Bykovskaya, Valentina; Sedlmayr, Martyna; Weber, Laura K.; Ridder, Barbara; Soehindrijo, Miriam; Muenster, Bastian; Striffler, Jakob; Bischoff, F. Ralf; Breitling, Frank; Loeffler, Felix F.

    2014-01-01

    In this review, we describe different methods of microarray fabrication based on the use of micro-particles/-beads and point out future tendencies in the development of particle-based arrays. First, we consider oligonucleotide bead arrays, where each bead is a carrier of one specific sequence of oligonucleotides. This bead-based array approach, appearing in the late 1990s, enabled high-throughput oligonucleotide analysis and had a large impact on genome research. Furthermore, we consider particle-based peptide array fabrication using combinatorial chemistry. In this approach, particles can directly participate in both the synthesis and the transfer of synthesized combinatorial molecules to a substrate. Subsequently, we describe in more detail the synthesis of peptide arrays with amino acid polymer particles, which imbed the amino acids inside their polymer matrix. By heating these particles, the polymer matrix is transformed into a highly viscous gel, and thereby, imbedded monomers are allowed to participate in the coupling reaction. Finally, we focus on combinatorial laser fusing of particles for the synthesis of high-density peptide arrays. This method combines the advantages of particles and combinatorial lithographic approaches. PMID:27600347

  10. Methods of DNA sequencing by hybridization based on optimizing concentration of matrix-bound oligonucleotide and device for carrying out same

    DOEpatents

    Khrapko, Konstantin R [Moscow, RU; Khorlin, Alexandr A [Moscow, RU; Ivanov, Igor B [Moskovskaya, RU; Ershov, Gennady M [Moscow, RU; Lysov, Jury P [Moscow, RU; Florentiev, Vladimir L [Moscow, RU; Mirzabekov, Andrei D [Moscow, RU

    1996-09-03

    A method for sequencing DNA by hybridization that includes the following steps: forming an array of oligonucleotides at such concentrations that either ensure the same dissociation temperature for all fully complementary duplexes or allows hybridization and washing of such duplexes to be conducted at the same temperature; hybridizing said oligonucleotide array with labeled test DNA; washing in duplex dissociation conditions; identifying single-base substitutions in the test DNA by analyzing the distribution of the dissociation temperatures and reconstructing the DNA nucleotide sequence based on the above analysis. A device for carrying out the method comprises a solid substrate and a matrix rigidly bound to the substrate. The matrix contains the oligonucleotide array and consists of a multiplicity of gel portions. Each gel portion contains one oligonucleotide of desired length. The gel portions are separated from one another by interstices and have a thickness not exceeding 30 .mu.m.

  11. Analytical Devices Based on Direct Synthesis of DNA on Paper.

    PubMed

    Glavan, Ana C; Niu, Jia; Chen, Zhen; Güder, Firat; Cheng, Chao-Min; Liu, David; Whitesides, George M

    2016-01-05

    This paper addresses a growing need in clinical diagnostics for parallel, multiplex analysis of biomarkers from small biological samples. It describes a new procedure for assembling arrays of ssDNA and proteins on paper. This method starts with the synthesis of DNA oligonucleotides covalently linked to paper and proceeds to assemble microzones of DNA-conjugated paper into arrays capable of simultaneously capturing DNA, DNA-conjugated protein antigens, and DNA-conjugated antibodies. The synthesis of ssDNA oligonucleotides on paper is convenient and effective with 32% of the oligonucleotides cleaved and eluted from the paper substrate being full-length by HPLC for a 32-mer. These ssDNA arrays can be used to detect fluorophore-linked DNA oligonucleotides in solution, and as the basis for DNA-directed assembly of arrays of DNA-conjugated capture antibodies on paper, detect protein antigens by sandwich ELISAs. Paper-anchored ssDNA arrays with different sequences can be used to assemble paper-based devices capable of detecting DNA and antibodies in the same device and enable simple microfluidic paper-based devices.

  12. Mapping of transcription factor binding regions in mammalian cells by ChIP: Comparison of array- and sequencing-based technologies

    PubMed Central

    Euskirchen, Ghia M.; Rozowsky, Joel S.; Wei, Chia-Lin; Lee, Wah Heng; Zhang, Zhengdong D.; Hartman, Stephen; Emanuelsson, Olof; Stolc, Viktor; Weissman, Sherman; Gerstein, Mark B.; Ruan, Yijun; Snyder, Michael

    2007-01-01

    Recent progress in mapping transcription factor (TF) binding regions can largely be credited to chromatin immunoprecipitation (ChIP) technologies. We compared strategies for mapping TF binding regions in mammalian cells using two different ChIP schemes: ChIP with DNA microarray analysis (ChIP-chip) and ChIP with DNA sequencing (ChIP-PET). We first investigated parameters central to obtaining robust ChIP-chip data sets by analyzing STAT1 targets in the ENCODE regions of the human genome, and then compared ChIP-chip to ChIP-PET. We devised methods for scoring and comparing results among various tiling arrays and examined parameters such as DNA microarray format, oligonucleotide length, hybridization conditions, and the use of competitor Cot-1 DNA. The best performance was achieved with high-density oligonucleotide arrays, oligonucleotides ≥50 bases (b), the presence of competitor Cot-1 DNA and hybridizations conducted in microfluidics stations. When target identification was evaluated as a function of array number, 80%–86% of targets were identified with three or more arrays. Comparison of ChIP-chip with ChIP-PET revealed strong agreement for the highest ranked targets with less overlap for the low ranked targets. With advantages and disadvantages unique to each approach, we found that ChIP-chip and ChIP-PET are frequently complementary in their relative abilities to detect STAT1 targets for the lower ranked targets; each method detected validated targets that were missed by the other method. The most comprehensive list of STAT1 binding regions is obtained by merging results from ChIP-chip and ChIP-sequencing. Overall, this study provides information for robust identification, scoring, and validation of TF targets using ChIP-based technologies. PMID:17568005

  13. Custom oligonucleotide array-based CGH: a reliable diagnostic tool for detection of exonic copy-number changes in multiple targeted genes

    PubMed Central

    Vasson, Aurélie; Leroux, Céline; Orhant, Lucie; Boimard, Mathieu; Toussaint, Aurélie; Leroy, Chrystel; Commere, Virginie; Ghiotti, Tiffany; Deburgrave, Nathalie; Saillour, Yoann; Atlan, Isabelle; Fouveaut, Corinne; Beldjord, Cherif; Valleix, Sophie; Leturcq, France; Dodé, Catherine; Bienvenu, Thierry; Chelly, Jamel; Cossée, Mireille

    2013-01-01

    The frequency of disease-related large rearrangements (referred to as copy-number mutations, CNMs) varies among genes, and search for these mutations has an important place in diagnostic strategies. In recent years, CGH method using custom-designed high-density oligonucleotide-based arrays allowed the development of a powerful tool for detection of alterations at the level of exons and made it possible to provide flexibility through the possibility of modeling chips. The aim of our study was to test custom-designed oligonucleotide CGH array in a diagnostic laboratory setting that analyses several genes involved in various genetic diseases, and to compare it with conventional strategies. To this end, we designed a 12-plex CGH array (135k; 135 000 probes/subarray) (Roche Nimblegen) with exonic and intronic oligonucleotide probes covering 26 genes routinely analyzed in the laboratory. We tested control samples with known CNMs and patients for whom genetic causes underlying their disorders were unknown. The contribution of this technique is undeniable. Indeed, it appeared reproducible, reliable and sensitive enough to detect heterozygous single-exon deletions or duplications, complex rearrangements and somatic mosaicism. In addition, it improves reliability of CNM detection and allows determination of boundaries precisely enough to direct targeted sequencing of breakpoints. All of these points, associated with the possibility of a simultaneous analysis of several genes and scalability ‘homemade' make it a valuable tool as a new diagnostic approach of CNMs. PMID:23340513

  14. Efficiency, error and yield in light-directed maskless synthesis of DNA microarrays

    PubMed Central

    2011-01-01

    Background Light-directed in situ synthesis of DNA microarrays using computer-controlled projection from a digital micromirror device--maskless array synthesis (MAS)--has proved to be successful at both commercial and laboratory scales. The chemical synthetic cycle in MAS is quite similar to that of conventional solid-phase synthesis of oligonucleotides, but the complexity of microarrays and unique synthesis kinetics on the glass substrate require a careful tuning of parameters and unique modifications to the synthesis cycle to obtain optimal deprotection and phosphoramidite coupling. In addition, unintended deprotection due to scattering and diffraction introduce insertion errors that contribute significantly to the overall error rate. Results Stepwise phosphoramidite coupling yields have been greatly improved and are now comparable to those obtained in solid phase synthesis of oligonucleotides. Extended chemical exposure in the synthesis of complex, long oligonucleotide arrays result in lower--but still high--final average yields which approach 99%. The new synthesis chemistry includes elimination of the standard oxidation until the final step, and improved coupling and light deprotection. Coupling Insertions due to stray light are the limiting factor in sequence quality for oligonucleotide synthesis for gene assembly. Diffraction and local flare are by far the largest contributors to loss of optical contrast. Conclusions Maskless array synthesis is an efficient and versatile method for synthesizing high density arrays of long oligonucleotides for hybridization- and other molecular binding-based experiments. For applications requiring high sequence purity, such as gene assembly, diffraction and flare remain significant obstacles, but can be significantly reduced with straightforward experimental strategies. PMID:22152062

  15. Method for performing site-specific affinity fractionation for use in DNA sequencing

    DOEpatents

    Mirzabekov, Andrei Darievich; Lysov, Yuri Petrovich; Dubley, Svetlana A.

    1999-01-01

    A method for fractionating and sequencing DNA via affinity interaction is provided comprising contacting cleaved DNA to a first array of oligonucleotide molecules to facilitate hybridization between said cleaved DNA and the molecules; extracting the hybridized DNA from the molecules; contacting said extracted hybridized DNA with a second array of oligonucleotide molecules, wherein the oligonucleotide molecules in the second array have specified base sequences that are complementary to said extracted hybridized DNA; and attaching labeled DNA to the second array of oligonucleotide molecules, wherein the labeled re-hybridized DNA have sequences that are complementary to the oligomers. The invention further provides a method for performing multi-step conversions of the chemical structure of compounds comprising supplying an array of polyacrylamide vessels separated by hydrophobic surfaces; immobilizing a plurality of reactants, such as enzymes, in the vessels so that each vessel contains one reactant; contacting the compounds to each of the vessels in a predetermined sequence and for a sufficient time to convert the compounds to a desired state; and isolating the converted compounds from said array.

  16. Miniaturized reaction vessel system, method for performing site-specific biochemical reactions and affinity fractionation for use in DNA sequencing

    DOEpatents

    Mirzabekov, Andrei Darievich; Lysov, Yuri Petrovich; Dubley, Svetlana A.

    2000-01-01

    A method for fractionating and sequencing DNA via affinity interaction is provided comprising contacting cleaved DNA to a first array of oligonucleotide molecules to facilitate hybridization between said cleaved DNA and the molecules; extracting the hybridized DNA from the molecules; contacting said extracted hybridized DNA with a second array of oligonucleotide molecules, wherein the oligonucleotide molecules in the second array have specified base sequences that are complementary to said extracted hybridized DNA; and attaching labeled DNA to the second array of oligonucleotide molecules, wherein the labeled re-hybridized DNA have sequences that are complementary to the oligomers. The invention further provides a method for performing multi-step conversions of the chemical structure of compounds comprising supplying an array of polyacrylamide vessels separated by hydrophobic surfaces; immobilizing a plurality of reactants, such as enzymes, in the vessels so that each vessel contains one reactant; contacting the compounds to each of the vessels in a predetermined sequence and for a sufficient time to convert the compounds to a desired state; and isolating the converted compounds from said array.

  17. Method for performing site-specific affinity fractionation for use in DNA sequencing

    DOEpatents

    Mirzabekov, A.D.; Lysov, Y.P.; Dubley, S.A.

    1999-05-18

    A method for fractionating and sequencing DNA via affinity interaction is provided comprising contacting cleaved DNA to a first array of oligonucleotide molecules to facilitate hybridization between the cleaved DNA and the molecules; extracting the hybridized DNA from the molecules; contacting the extracted hybridized DNA with a second array of oligonucleotide molecules, wherein the oligonucleotide molecules in the second array have specified base sequences that are complementary to the extracted hybridized DNA; and attaching labeled DNA to the second array of oligonucleotide molecules, wherein the labeled re-hybridized DNA have sequences that are complementary to the oligomers. The invention further provides a method for performing multi-step conversions of the chemical structure of compounds comprising supplying an array of polyacrylamide vessels separated by hydrophobic surfaces; immobilizing a plurality of reactants, such as enzymes, in the vessels so that each vessel contains one reactant; contacting the compounds to each of the vessels in a predetermined sequence and for a sufficient time to convert the compounds to a desired state; and isolating the converted compounds from the array. 14 figs.

  18. An oligonucleotide array for the identification and differentiation of bacteria pathogenic on potato.

    PubMed

    Fessehaie, Anania; De Boer, Solke H; Lévesque, C André

    2003-03-01

    ABSTRACT Oligonucleotides, 16 to 24 bases long, were selected from the 3' end of the 16S gene and the 16S-23S intergenic spacer regions of bacteria pathogenic on potato, including Clavibacter michiganensis subsp. sepedonicus, Ralstonia solanacearum, and the pectolytic erwinias, including Erwinia carotovora subsp. atroseptica and carotovora and E. chrysanthemi. Oligonucleotides were designed and formatted into an array by pin spotting on nylon membranes. Genomic DNA from bacterial cultures was amplified by polymerase chain reaction using conserved ribosomal primers and labeled simultaneously with digoxigenin-dUTP. Hybridization of amplicons to the array and subsequent serological detection of digoxigenin label revealed different hybridization patterns that were distinct for each species and subspecies tested. Hybridization of amplicons generally was restricted to appropriate homologous oligonucleotides and cross-hybridization with heterologous oligonucleotides was rare. Hybridization patterns were recorded as separate gray values for each hybridized spot and revealed a consistent pattern for multiple strains of each species or subspecies isolated from diverse geographical regions. In preliminary tests, bacteria could be correctly identified and detected by hybridizing to the array amplicons from mixed cultures and inoculated potato tissue.

  19. Photolithographic Synthesis of High-Density DNA and RNA Arrays on Flexible, Transparent, and Easily Subdivided Plastic Substrates.

    PubMed

    Holden, Matthew T; Carter, Matthew C D; Wu, Cheng-Hsien; Wolfer, Jamison; Codner, Eric; Sussman, Michael R; Lynn, David M; Smith, Lloyd M

    2015-11-17

    The photolithographic fabrication of high-density DNA and RNA arrays on flexible and transparent plastic substrates is reported. The substrates are thin sheets of poly(ethylene terephthalate) (PET) coated with cross-linked polymer multilayers that present hydroxyl groups suitable for conventional phosphoramidite-based nucleic acid synthesis. We demonstrate that by modifying array synthesis procedures to accommodate the physical and chemical properties of these materials, it is possible to synthesize plastic-backed oligonucleotide arrays with feature sizes as small as 14 μm × 14 μm and feature densities in excess of 125 000/cm(2), similar to specifications attainable using rigid substrates such as glass or glassy carbon. These plastic-backed arrays are tolerant to a wide range of hybridization temperatures, and improved synthetic procedures are described that enable the fabrication of arrays with sequences up to 50 nucleotides in length. These arrays hybridize with S/N ratios comparable to those fabricated on otherwise identical arrays prepared on glass or glassy carbon. This platform supports the enzymatic synthesis of RNA arrays and proof-of-concept experiments are presented showing that the arrays can be readily subdivided into smaller arrays (or "millichips") using common laboratory-scale laser cutting tools. These results expand the utility of oligonucleotide arrays fabricated on plastic substrates and open the door to new applications for these important bioanalytical tools.

  20. Genome-wide comparison of paired fresh frozen and formalin-fixed paraffin-embedded gliomas by custom BAC and oligonucleotide array comparative genomic hybridization: facilitating analysis of archival gliomas

    PubMed Central

    Mohapatra, Gayatry; Engler, David A.; Starbuck, Kristen D.; Kim, James C.; Bernay, Derek C.; Scangas, George A.; Rousseau, Audrey; Batchelor, Tracy T.; Betensky, Rebecca A.; Louis, David N.

    2010-01-01

    Molecular genetic analysis of cancer is rapidly evolving as a result of improvement in genomic technologies and the growing applicability of such analyses to clinical oncology. Array based comparative genomic hybridization (aCGH) is a powerful tool for detecting DNA copy number alterations (CNA), particularly in solid tumors, and has been applied to the study of malignant gliomas. In the clinical setting, however, gliomas are often sampled by small biopsies and thus formalin-fixed paraffin-embedded (FFPE) blocks are often the only tissue available for genetic analysis, especially for rare types of gliomas. Moreover, the biological basis for the marked intratumoral heterogeneity in gliomas is most readily addressed in FFPE material. Therefore, for gliomas, the ability to use DNA from FFPE tissue is essential for both clinical and research applications. In this study, we have constructed a custom bacterial artificial chromosome (BAC) array and show excellent sensitivity and specificity for detecting CNAs in a panel of paired frozen and FFPE glioma samples. Our study demonstrates a high concordance rate between CNAs detected in FFPE compared to frozen DNA. We have also developed a method of labeling DNA from FFPE tissue that allows efficient hybridization to oligonucleotide arrays. This labeling technique was applied to a panel of biphasic anaplastic oligoastrocytomas (AOA) to identify genetic changes unique to each component. Together, results from these studies suggest that BAC and oligonucleotide aCGH are sensitive tools for detecting CNAs in FFPE DNA, and can enable genome-wide analysis of rare, small and/or histologically heterogeneous gliomas. PMID:21080181

  1. Identification of clinically relevant viridans streptococci by an oligonucleotide array.

    PubMed

    Chen, Chao Chien; Teng, Lee Jene; Kaiung, Seng; Chang, Tsung Chain

    2005-04-01

    Viridans streptococci (VS) are common etiologic agents of subacute infective endocarditis and are capable of causing a variety of pyogenic infections. Many species of VS are difficult to differentiate by phenotypic traits. An oligonucleotide array based on 16S-23S rRNA gene intergenic spacer (ITS) sequences was developed to identify 11 clinically relevant VS. These 11 species were Streptococcus anginosus, S. constellatus, S. gordonii, S. intermedius, S. mitis, S. mutans, S. oralis, S. parasanguinis, S. salivarius, S. sanguinis, and S. uberis. The method consisted of PCR amplification of the ITS regions by using a pair of universal primers, followed by hybridization of the digoxigenin-labeled PCR products to a panel of species-specific oligonucleotides immobilized on a nylon membrane. After 120 strains of the 11 species of VG and 91 strains of other bacteria were tested, the sensitivity and specificity of the oligonucleotide array were found to be 100% (120 of 120 strains) and 95.6% (87 of 91 strains), respectively. S. pneumoniae cross-hybridized to the probes used for the identification of S. mitis, and simple biochemical tests such as optochin susceptibility or bile solubility should be used to differentiate S. pneumoniae from S. mitis. In conclusion, identification of species of VS by use of the present oligonucleotide array is accurate and could be used as an alternative reliable method for species identification of strains of VS.

  2. Refinement of light-responsive transcript lists using rice oligonucleotide arrays: evaluation of gene-redundancy.

    PubMed

    Jung, Ki-Hong; Dardick, Christopher; Bartley, Laura E; Cao, Peijian; Phetsom, Jirapa; Canlas, Patrick; Seo, Young-Su; Shultz, Michael; Ouyang, Shu; Yuan, Qiaoping; Frank, Bryan C; Ly, Eugene; Zheng, Li; Jia, Yi; Hsia, An-Ping; An, Kyungsook; Chou, Hui-Hsien; Rocke, David; Lee, Geun Cheol; Schnable, Patrick S; An, Gynheung; Buell, C Robin; Ronald, Pamela C

    2008-10-06

    Studies of gene function are often hampered by gene-redundancy, especially in organisms with large genomes such as rice (Oryza sativa). We present an approach for using transcriptomics data to focus functional studies and address redundancy. To this end, we have constructed and validated an inexpensive and publicly available rice oligonucleotide near-whole genome array, called the rice NSF45K array. We generated expression profiles for light- vs. dark-grown rice leaf tissue and validated the biological significance of the data by analyzing sources of variation and confirming expression trends with reverse transcription polymerase chain reaction. We examined trends in the data by evaluating enrichment of gene ontology terms at multiple false discovery rate thresholds. To compare data generated with the NSF45K array with published results, we developed publicly available, web-based tools (www.ricearray.org). The Oligo and EST Anatomy Viewer enables visualization of EST-based expression profiling data for all genes on the array. The Rice Multi-platform Microarray Search Tool facilitates comparison of gene expression profiles across multiple rice microarray platforms. Finally, we incorporated gene expression and biochemical pathway data to reduce the number of candidate gene products putatively participating in the eight steps of the photorespiration pathway from 52 to 10, based on expression levels of putatively functionally redundant genes. We confirmed the efficacy of this method to cope with redundancy by correctly predicting participation in photorespiration of a gene with five paralogs. Applying these methods will accelerate rice functional genomics.

  3. Hetero-oligonucleotide Nanoscale Tiles Capable of Two-Dimensional Lattice Formation as Testbeds for a Rapid, Affordable Purification Methodology

    DTIC Science & Technology

    2013-01-01

    SUBJECT TERMS DNA nanotechnology, purification, origami , 2d arrays Philip S. Lukeman St. John’s University, New York 8000 Utopia Parkway Queens, NY... origami ; DNA double-crossover (“DX”) tile based arrays5 have been constructed using PNA6 and LNA7 oligonucleotides. RNA/ DNA duplexes have been used8 for...the assembly of multiply armed tiles9 and as a template10 to fold DNA origami ;11 all-RNA systems known as ‘tecto-RNA’ have been used to generate a wide

  4. Cross reactive arrays of three-way junction sensors for steroid determination

    NASA Technical Reports Server (NTRS)

    Stojanovic, Milan N. (Inventor); Nikic, Dragan B. (Inventor); Landry, Donald (Inventor)

    2008-01-01

    This invention provides analyte sensitive oligonucleotide compositions for detecting and analyzing analytes in solution, including complex solutions using cross reactive arrays of analyte sensitive oligonucleotide compositions.

  5. Detection and identification of intestinal pathogenic bacteria by hybridization to oligonucleotide microarrays

    PubMed Central

    Jin, Lian-Qun; Li, Jun-Wen; Wang, Sheng-Qi; Chao, Fu-Huan; Wang, Xin-Wei; Yuan, Zheng-Quan

    2005-01-01

    AIM: To detect the common intestinal pathogenic bacteria quickly and accurately. METHODS: A rapid (<3 h) experimental procedure was set up based upon the gene chip technology. Target genes were amplified and hybridized by oligonucleotide microarrays. RESULTS: One hundred and seventy strains of bacteria in pure culture belonging to 11 genera were successfully discriminated under comparatively same conditions, and a series of specific hybridization maps corresponding to each kind of bacteria were obtained. When this method was applied to 26 divided cultures, 25 (96.2%) were identified. CONCLUSION: Salmonella sp., Escherichia coli, Shigella sp., Listeria monocytogenes, Vibrio parahaemolyticus, Staphylococcus aureus, Proteus sp., Bacillus cereus, Vibrio cholerae, Enterococcus faecalis, Yersinia enterocolitica, and Campylobacter jejuni can be detected and identified by our microarrays. The accuracy, range, and discrimination power of this assay can be continually improved by adding further oligonucleotides to the arrays without any significant increase of complexity or cost. PMID:16437687

  6. GeneChip{sup {trademark}} screening assay for cystic fibrosis mutations

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cronn, M.T.; Miyada, C.G.; Fucini, R.V.

    1994-09-01

    GeneChip{sup {trademark}} assays are based on high density, carefully designed arrays of short oligonucleotide probes (13-16 bases) built directly on derivatized silica substrates. DNA target sequence analysis is achieved by hybridizing fluorescently labeled amplification products to these arrays. Fluorescent hybridization signals located within the probe array are translated into target sequence information using the known probe sequence at each array feature. The mutation screening assay for cystic fibrosis includes sets of oligonucleotide probes designed to detect numerous different mutations that have been described in 14 exons and one intron of the CFTR gene. Each mutation site is addressed by amore » sub-array of at least 40 probe sequences, half designed to detect the wild type gene sequence and half designed to detect the reported mutant sequence. Hybridization with homozygous mutant, homozygous wild type or heterozygous targets results in distinctive hybridization patterns within a sub-array, permitting specific discrimination of each mutation. The GeneChip probe arrays are very small (approximately 1 cm{sup 2}). There miniature size coupled with their high information content make GeneChip probe arrays a useful and practical means for providing CF mutation analysis in a clinical setting.« less

  7. Paper-based solid-phase multiplexed nucleic acid hybridization assay with tunable dynamic range using immobilized quantum dots as donors in fluorescence resonance energy transfer.

    PubMed

    Noor, M Omair; Krull, Ulrich J

    2013-08-06

    A multiplexed solid-phase nucleic acid hybridization assay on a paper-based platform is presented using multicolor immobilized quantum dots (QDs) as donors in fluorescence resonance energy transfer (FRET). The surface of paper was modified with imidazole groups to immobilize two types of QD-probe oligonucleotide conjugates that were assembled in solution. Green-emitting QDs (gQDs) and red-emitting QDs (rQDs) served as donors with Cy3 and Alexa Fluor 647 (A647) acceptors. The gQD/Cy3 FRET pair served as an internal standard, while the rQD/A647 FRET pair served as a detection channel, combining the control and analytical test zones in one physical location. Hybridization of dye-labeled oligonucleotide targets provided the proximity for FRET sensitized emission from the acceptor dyes, which served as an analytical signal. Hybridization assays in the multicolor format provided a limit of detection of 90 fmol and an upper limit of dynamic range of 3.5 pmol. The use of an array of detection zones was designed to provide improved analytical figures of merit compared to that which could be achieved on one type of array design in terms of relative concentration of multicolor QDs. The hybridization assays showed excellent resistance to nonspecific adsorption of oligonucleotides. Selectivity of the two-plex hybridization assay was demonstrated by single nucleotide polymorphism (SNP) detection at a contrast ratio of 50:1. Additionally, it is shown that the use of preformed QD-probe oligonucleotide conjugates and consideration of the relative number density of the two types of QD-probe conjugates in the two-color assay format is advantageous to maximize assay sensitivity and the upper limit of dynamic range.

  8. Arrays of nucleic acid probes on biological chips

    DOEpatents

    Chee, Mark; Cronin, Maureen T.; Fodor, Stephen P. A.; Huang, Xiaohua X.; Hubbell, Earl A.; Lipshutz, Robert J.; Lobban, Peter E.; Morris, MacDonald S.; Sheldon, Edward L.

    1998-11-17

    DNA chips containing arrays of oligonucleotide probes can be used to determine whether a target nucleic acid has a nucleotide sequence identical to or different from a specific reference sequence. The array of probes comprises probes exactly complementary to the reference sequence, as well as probes that differ by one or more bases from the exactly complementary probes.

  9. Customized Oligonucleotide Array-Based Comparative Genomic Hybridization as a Clinical Assay for Genomic Profiling of Chronic Lymphocytic Leukemia

    PubMed Central

    Sargent, Rachel; Jones, Dan; Abruzzo, Lynne V.; Yao, Hui; Bonderover, Jaime; Cisneros, Marissa; Wierda, William G.; Keating, Michael J.; Luthra, Rajyalakshmi

    2009-01-01

    Chromosome gains and losses used for risk stratification in chronic lymphocytic leukemia (CLL) are commonly assessed by multiprobe fluorescence in situ hybridization (FISH) studies. We designed and validated a customized array-comparative genomic hybridization (aCGH) platform as a clinical assay for CLL genomic profiling. A 60-mer, 44,000-probe oligonucleotide array with a 50-kb average spatial resolution was augmented with high-density probe tiling at loci that are frequently aberrant in CLL. Aberrations identified by aCGH were compared with those identified by a FISH panel, including locus-specific probes to ATM (11q22.3), the centromeric region of chromosome 12 (12p11.1–q11), D13S319 (13q14.3), LAMP1 (13q34), and TP53 (17p13.1). In 100 CLL samples, aCGH/FISH concordance was seen for 89% of FISH-called aberrations at the ATM (n = 18), D13S319 (n = 42), LAMP (n = 12), and TP53 (n = 22) loci and for chromosome 12 (n = 14). Eighty-four percentage of FISH/aCGH discordant calls were in samples either at or below the limit of aCGH sensitivity (10% to 25% FISH aberration-containing cells). Therefore, aCGH profiling is a feasible routine clinical test with comparable results to multiprobe FISH studies; however, it may be less sensitive than FISH in cases with low-level aberrations. Further, a customized array design can provide comprehensive genomic profiling with additional accuracy in both identifying and defining the extent of small aberrations at target loci. PMID:19074592

  10. Surface enhanced Raman gene probe and methods thereof

    DOEpatents

    Vo-Dinh, T.

    1998-09-29

    The subject invention disclosed herein is a new gene probe biosensor and methods based on surface enhanced Raman scattering (SERS) label detection. The SER gene probe biosensor comprises a support means, a SER gene probe having at least one oligonucleotide strand labeled with at least one SERS label, and a SERS active substrate disposed on the support means and having at least one of the SER gene probes adsorbed thereon. Biotargets such as bacterial and viral DNA, RNA and PNA are detected using a SER gene probe via hybridization to oligonucleotide strands complementary to the SER gene probe. The support means supporting the SERS active substrate includes a fiberoptic probe, an array of fiberoptic probes for performance of multiple assays and a waveguide microsensor array with charge-coupled devices or photodiode arrays. 18 figs.

  11. Surface enhanced Raman gene probe and methods thereof

    DOEpatents

    Vo-Dinh, Tuan

    1998-01-01

    The subject invention disclosed herein is a new gene probe biosensor and methods thereof based on surface enhanced Raman scattering (SERS) label detection. The SER gene probe biosensor comprises a support means, a SER gene probe having at least one oligonucleotide strand labeled with at least one SERS label, and a SERS active substrate disposed on the support means and having at least one of the SER gene probes adsorbed thereon. Biotargets such as bacterial and viral DNA, RNA and PNA are detected using a SER gene probe via hybridization to oligonucleotide strands complementary to the SER gene probe. The support means supporting the SERS active substrate includes a fiberoptic probe, an array of fiberoptic probes for performance of multiple assays and a waveguide microsensor array with charge-coupled devices or photodiode arrays.

  12. Surface enhanced Raman gene probe and methods thereof

    DOEpatents

    Vo-Dinh, T.

    1998-02-24

    The subject invention disclosed is a new gene probe biosensor and methods based on surface enhanced Raman scattering (SERS) label detection. The SER gene probe biosensor comprises a support means, a SER gene probe having at least one oligonucleotide strand labeled with at least one SERS label, and a SERS active substrate disposed on the support means and having at least one of the SER gene probes adsorbed thereon. Biotargets such as bacterial and viral DNA, RNA and PNA are detected using a SER gene probe via hybridization to oligonucleotide strands complementary to the SER gene probe. The support means includes a fiberoptic probe, an array of fiberoptic probes for performance of multiple assays and a waveguide microsensor array with charge-coupled devices or photodiode arrays. 18 figs.

  13. Surface enhanced Raman gene probe and methods thereof

    DOEpatents

    Vo-Dinh, T.

    1998-07-21

    The subject invention disclosed is a new gene probe biosensor and methods based on surface enhanced Raman scattering (SERS) label detection. The SER gene probe biosensor comprises a support means, a SER gene probe having at least one oligonucleotide strand labeled with at least one SERS label, and a SERS active substrate disposed on the support means and having at least one of the SER gene probes adsorbed. Biotargets such as bacterial and viral DNA, RNA and PNA are detected using a SER gene probe via hybridization to oligonucleotide strands complementary to the SER gene probe. The support means supporting the SERS active substrate includes a fiberoptic probe, an array of fiberoptic probes for performance of multiple assays and a waveguide microsensor array with charge-coupled devices or photodiode arrays. 18 figs.

  14. High-density fiber optic biosensor arrays

    NASA Astrophysics Data System (ADS)

    Epstein, Jason R.; Walt, David R.

    2002-02-01

    Novel approaches are required to coordinate the immense amounts of information derived from diverse genomes. This concept has influenced the expanded role of high-throughput DNA detection and analysis in the biological sciences. A high-density fiber optic DNA biosensor was developed consisting of oligonucleotide-functionalized, 3.1 mm diameter microspheres deposited into the etched wells on the distal face of a 500 micrometers imaging fiber bundle. Imaging fiber bundles containing thousands of optical fibers, each associated with a unique oligonucleotide probe sequence, were the foundation for an optically connected, individually addressable DNA detection platform. Different oligonucleotide-functionalized microspheres were combined in a stock solution, and randomly dispersed into the etched wells. Microsphere positions were registered from optical dyes incorporated onto the microspheres. The distribution process provided an inherent redundancy that increases the signal-to-noise ratio as the square root of the number of sensors examined. The representative amount of each probe-type in the array was dependent on their initial stock solution concentration, and as other sequences of interest arise, new microsphere elements can be added to arrays without altering the existing detection capabilities. The oligonucleotide probe sequences hybridize to fluorescently-labeled, complementary DNA target solutions. Fiber optic DNA microarray research has included DNA-protein interaction profiles, microbial strain differentiation, non-labeled target interrogation with molecular beacons, and single cell-based assays. This biosensor array is proficient in DNA detection linked to specific disease states, single nucleotide polymorphism (SNP's) discrimination, and gene expression analysis. This array platform permits multiple detection formats, provides smaller feature sizes, and enables sensor design flexibility. High-density fiber optic microarray biosensors provide a fast, reversible format with the detection limit of a few hundred molecules.

  15. Carbon Nanotube Nanoelectrode Array for Ultrasensitive DNA Detection

    NASA Technical Reports Server (NTRS)

    Li, Jun; Koehne, Jessica; Chen, Hua; Cassell, Alan; Ng, Hou Tee; Fan, Wendy; Ye, Qi; Han, Jie; Meyyappan, M.

    2003-01-01

    A reliable nanoelectrode array based on vertically aligned multi-walled carbon nanotubes (MWNTs) embedded in SiO2 is used for ultrasensitive DNA detection. Characteristic nanoelectrode behavior is observed using low-density MWNT arrays for measuring both bulk and surface immobilized redox species such as K4Fe(CN)6. The open-end of MWNTs present similar properties as graphite edge-plane electrodes with wide potential window, flexible chemical functionalities, and good biocompatibility. Oligonucleotide probes are selectively functionalized at the open ends cf the nanotube array and specifically hybridized with oligonucleotide targets. The guanine groups are employed as the signal moieties in the electrochemical measurements. Ru(bpy)3(2+) mediator is used to further amplify the guanine oxidation signal. The hybridization of subattomoles of PCR amplified DNA targets is detected electrochemically by combining the MWNT nanoelectrode array with the Ru(bpy)32' amplification mechanism. This system provides a general platform of molecular diagnostics for applications requiring ultrahigh sensitivity, high-degree of miniaturization, and simple sample preparations.

  16. arrayCGHbase: an analysis platform for comparative genomic hybridization microarrays

    PubMed Central

    Menten, Björn; Pattyn, Filip; De Preter, Katleen; Robbrecht, Piet; Michels, Evi; Buysse, Karen; Mortier, Geert; De Paepe, Anne; van Vooren, Steven; Vermeesch, Joris; Moreau, Yves; De Moor, Bart; Vermeulen, Stefan; Speleman, Frank; Vandesompele, Jo

    2005-01-01

    Background The availability of the human genome sequence as well as the large number of physically accessible oligonucleotides, cDNA, and BAC clones across the entire genome has triggered and accelerated the use of several platforms for analysis of DNA copy number changes, amongst others microarray comparative genomic hybridization (arrayCGH). One of the challenges inherent to this new technology is the management and analysis of large numbers of data points generated in each individual experiment. Results We have developed arrayCGHbase, a comprehensive analysis platform for arrayCGH experiments consisting of a MIAME (Minimal Information About a Microarray Experiment) supportive database using MySQL underlying a data mining web tool, to store, analyze, interpret, compare, and visualize arrayCGH results in a uniform and user-friendly format. Following its flexible design, arrayCGHbase is compatible with all existing and forthcoming arrayCGH platforms. Data can be exported in a multitude of formats, including BED files to map copy number information on the genome using the Ensembl or UCSC genome browser. Conclusion ArrayCGHbase is a web based and platform independent arrayCGH data analysis tool, that allows users to access the analysis suite through the internet or a local intranet after installation on a private server. ArrayCGHbase is available at . PMID:15910681

  17. Identification of characteristic oligonucleotides in the bacterial 16S ribosomal RNA sequence dataset

    NASA Technical Reports Server (NTRS)

    Zhang, Zhengdong; Willson, Richard C.; Fox, George E.

    2002-01-01

    MOTIVATION: The phylogenetic structure of the bacterial world has been intensively studied by comparing sequences of 16S ribosomal RNA (16S rRNA). This database of sequences is now widely used to design probes for the detection of specific bacteria or groups of bacteria one at a time. The success of such methods reflects the fact that there are local sequence segments that are highly characteristic of particular organisms or groups of organisms. It is not clear, however, the extent to which such signature sequences exist in the 16S rRNA dataset. A better understanding of the numbers and distribution of highly informative oligonucleotide sequences may facilitate the design of hybridization arrays that can characterize the phylogenetic position of an unknown organism or serve as the basis for the development of novel approaches for use in bacterial identification. RESULTS: A computer-based algorithm that characterizes the extent to which any individual oligonucleotide sequence in 16S rRNA is characteristic of any particular bacterial grouping was developed. A measure of signature quality, Q(s), was formulated and subsequently calculated for every individual oligonucleotide sequence in the size range of 5-11 nucleotides and for 15mers with reference to each cluster and subcluster in a 929 organism representative phylogenetic tree. Subsequently, the perfect signature sequences were compared to the full set of 7322 sequences to see how common false positives were. The work completed here establishes beyond any doubt that highly characteristic oligonucleotides exist in the bacterial 16S rRNA sequence dataset in large numbers. Over 16,000 15mers were identified that might be useful as signatures. Signature oligonucleotides are available for over 80% of the nodes in the representative tree.

  18. Soft Lithography for Oligonucleotide Arrays Fabrication

    DTIC Science & Technology

    2001-10-25

    adenosine; Abbreviated T, C, G, A respectively), the other synthesis reagents and solvents except oxidation agent (seen in Table 1) were purchased...dried by cold blowing before hybridization. Oligonucleotide arrays were hybridized in 200 nM 3’-TCC TCC GAT TCA GAG AGT CC- HEX (PE Biosystems... citrate buffer), 0.1% SDS in 0.1xSSC respectively. The probe array was scanned on the Scanarray Microarray Systems (Packard Biochip Technologies, USA

  19. Manipulation of oligonucleotides immobilized on solid supports - DNA computations on surfaces

    NASA Astrophysics Data System (ADS)

    Liu, Qinghua

    The manipulation of DNA oligonucleotides immobilized on various solid supports has been studied intensively, especially in the area of surface hybridization. Recently, surface-based biotechnology has been applied to the area of molecular computing. These surface-based methods have advantages with regard to ease of handling, facile purification, and less interference when compared to solution methodologies. This dissertation describes the investigation of molecular approaches to DNA computing. The feasibility of encoding a bit (0 or 1) of information for DNA-based computations at the single nucleotide level was studied, particularly with regard to the efficiency and specificity of hybridization discrimination. Both gold and glass surfaces, with addressed arrays of 32 oligonucleotides, were employed with similar hybridization results. Although single-base discrimination may be achieved in the system, it is at the cost of a severe decrease in the efficiency of hybridization to perfectly matched sequences. This compromises the utility of single nucleotide encoding for DNA computing applications in the absence of some additional mechanism for increasing specificity. Several methods are suggested including a multiple-base encoding strategy. The multiple-base encoding strategy was employed to develop a prototype DNA computer. The approach was demonstrated by solving a small example of the Satisfiability (SAT) problem, an NP-complete problem in Boolean logic. 16 distinct DNA oligonucleotides, encoding all candidate solutions to the 4-variable-4-clause-3-SAT problem, were immobilized on a gold surface in the non-addressed format. Four cycles of MARK (hybridization), DESTROY (enzymatic destruction) and UNMARK (denaturation) were performed, which identified and eliminated members of the set which were not solutions to the problem. Determination of the answer was accomplished in the READOUT (sequence identification) operation by PCR amplification of the remaining molecules and hybridization to an addressed array. Four answers were determined and the S/N ratio between correct and incorrect solutions ranged from 10 to 777, making discrimination between correct and incorrect solutions to the problem straightforward. Additionally, studies of enzymatic manipulations of DNA molecules on surfaces suggested the use of E. coli Exonuclease I (Exo I) and perhaps EarI in the DESTROY operation.

  20. Assessing differential gene expression with small sample sizes in oligonucleotide arrays using a mean-variance model.

    PubMed

    Hu, Jianhua; Wright, Fred A

    2007-03-01

    The identification of the genes that are differentially expressed in two-sample microarray experiments remains a difficult problem when the number of arrays is very small. We discuss the implications of using ordinary t-statistics and examine other commonly used variants. For oligonucleotide arrays with multiple probes per gene, we introduce a simple model relating the mean and variance of expression, possibly with gene-specific random effects. Parameter estimates from the model have natural shrinkage properties that guard against inappropriately small variance estimates, and the model is used to obtain a differential expression statistic. A limiting value to the positive false discovery rate (pFDR) for ordinary t-tests provides motivation for our use of the data structure to improve variance estimates. Our approach performs well compared to other proposed approaches in terms of the false discovery rate.

  1. Detection and validation of single feature polymorphisms using RNA expression data from a rice genome array

    USDA-ARS?s Scientific Manuscript database

    A large number of genetic variations have been identified in rice. Such variations must in many cases control phenotypic differences in abiotic stress tolerance and other traits. A single feature polymorphism (SFP) is an oligonucleotide array-based polymorphism which can be used for identification o...

  2. Combinatorial algorithms for design of DNA arrays.

    PubMed

    Hannenhalli, Sridhar; Hubell, Earl; Lipshutz, Robert; Pevzner, Pavel A

    2002-01-01

    Optimal design of DNA arrays requires the development of algorithms with two-fold goals: reducing the effects caused by unintended illumination (border length minimization problem) and reducing the complexity of masks (mask decomposition problem). We describe algorithms that reduce the number of rectangles in mask decomposition by 20-30% as compared to a standard array design under the assumption that the arrangement of oligonucleotides on the array is fixed. This algorithm produces provably optimal solution for all studied real instances of array design. We also address the difficult problem of finding an arrangement which minimizes the border length and come up with a new idea of threading that significantly reduces the border length as compared to standard designs.

  3. Oligonucleotide-arrayed TFT photosensor applicable for DNA chip technology.

    PubMed

    Tanaka, Tsuyoshi; Hatakeyama, Keiichi; Sawaguchi, Masahiro; Iwadate, Akihito; Mizutani, Yasushi; Sasaki, Kazuhiro; Tateishi, Naofumi; Takeyama, Haruko; Matsunaga, Tadashi

    2006-09-05

    A thin film transistor (TFT) photosensor fabricated by semiconductor integrated circuit (IC) technology was applied to DNA chip technology. The surface of the TFT photosensor was coated with TiO2 using a vapor deposition technique for the fabrication of optical filters. The immobilization of thiolated oligonucleotide probes onto a TiO2-coated TFT photosensor using gamma-aminopropyltriethoxysilane (APTES) and N-(gamma-maleimidobutyloxy) sulfosuccinimide ester (GMBS) was optimized. The coverage value of immobilized oligonucleotides reached a plateau at 33.7 pmol/cm2, which was similar to a previous analysis using radioisotope-labeled oligonucleotides. The lowest detection limits were 0.05 pmol/cm2 for quantum dot and 2.1 pmol/cm2 for Alexa Fluor 350. Furthermore, single nucleotide polymorphism (SNP) detection was examined using the oligonucleotide-arrayed TFT photosensor. A SNP present in the aldehyde dehydrogenase 2 (ALDH2) gene was used as a target. The SNPs in ALDH2*1 and ALDH2*2 target DNA were detected successfully using the TFT photosensor. DNA hybridization in the presence of both ALDH2*1 and ALDH2*2 target DNA was observed using both ALDH2*1 and ALDH2*2 detection oligonucleotides-arrayed TFT photosensor. Use of the TFT photosensor will allow the development of a disposable photodetecting device for DNA chip systems. (c) 2006 Wiley Periodicals, Inc.

  4. Rapid and accurate synthesis of TALE genes from synthetic oligonucleotides.

    PubMed

    Wang, Fenghua; Zhang, Hefei; Gao, Jingxia; Chen, Fengjiao; Chen, Sijie; Zhang, Cuizhen; Peng, Gang

    2016-01-01

    Custom synthesis of transcription activator-like effector (TALE) genes has relied upon plasmid libraries of pre-fabricated TALE-repeat monomers or oligomers. Here we describe a novel synthesis method that directly incorporates annealed synthetic oligonucleotides into the TALE-repeat units. Our approach utilizes iterative sets of oligonucleotides and a translational frame check strategy to ensure the high efficiency and accuracy of TALE-gene synthesis. TALE arrays of more than 20 repeats can be constructed, and the majority of the synthesized constructs have perfect sequences. In addition, this novel oligonucleotide-based method can readily accommodate design changes to the TALE repeats. We demonstrated an increased gene targeting efficiency against a genomic site containing a potentially methylated cytosine by incorporating non-conventional repeat variable di-residue (RVD) sequences.

  5. A Complex 6p25 Rearrangement in a Child With Multiple Epiphyseal Dysplasia

    PubMed Central

    Bedoyan, Jirair K.; Lesperance, Marci M.; Ackley, Todd; Iyer, Ramaswamy K.; Innis, Jeffrey W.; Misra, Vinod K.

    2015-01-01

    Genomic rearrangements are increasingly recognized as important contributors to human disease. Here we report on an 11½-year-old child with myopia, Duane retraction syndrome, bilateral mixed hearing loss, skeletal anomalies including multiple epiphyseal dysplasia, and global developmental delay, and a complex 6p25 genomic rearrangement. We have employed oligonucleotide-based comparative genomic hybridization arrays (aCGH) of different resolutions (44 and 244K) as well as a 1 M single nucleotide polymorphism (SNP) array to analyze this complex rearrangement. Our analyses reveal a complex rearrangement involving a ~2.21 Mb interstitial deletion, a ~240 kb terminal deletion, and a 70–80 kb region in between these two deletions that shows maintenance of genomic copy number. The interstitial deletion contains eight known genes, including three Forkhead box containing (FOX) transcription factors (FOXQ1, FOXF2, and FOXC1). The region maintaining genomic copy number partly overlaps the dual specificity protein phosphatase 22 (DUSP22) gene. Array analyses suggest a homozygous loss of genomic material at the 5′ end of DUSP22, which was corroborated using TaqMan® copy number analysis. It is possible that this homozygous genomic loss may render both copies of DUSP22 or its products non-functional. Our analysis suggests a rearrangement mechanism distinct from a previously reported replication-based error-prone mechanism without template switching for a specific 6p25 rearrangement with a 1.22 Mb interstitial deletion. Our study demonstrates the utility and limitations of using oligonucleotide-based aCGH and SNP array technologies of increasing resolutions in order to identify complex DNA rearrangements and gene disruptions. PMID:21204225

  6. Precise and selective sensing of DNA-DNA hybridization by graphene/Si-nanowires diode-type biosensors.

    PubMed

    Kim, Jungkil; Park, Shin-Young; Kim, Sung; Lee, Dae Hun; Kim, Ju Hwan; Kim, Jong Min; Kang, Hee; Han, Joong-Soo; Park, Jun Woo; Lee, Hosun; Choi, Suk-Ho

    2016-08-18

    Single-Si-nanowire (NW)-based DNA sensors have been recently developed, but their sensitivity is very limited because of high noise signals, originating from small source-drain current of the single Si NW. Here, we demonstrate that chemical-vapor-deposition-grown large-scale graphene/surface-modified vertical-Si-NW-arrays junctions can be utilized as diode-type biosensors for highly-sensitive and -selective detection of specific oligonucleotides. For this, a twenty-seven-base-long synthetic oligonucleotide, which is a fragment of human DENND2D promoter sequence, is first decorated as a probe on the surface of vertical Si-NW arrays, and then the complementary oligonucleotide is hybridized to the probe. This hybridization gives rise to a doping effect on the surface of Si NWs, resulting in the increase of the current in the biosensor. The current of the biosensor increases from 19 to 120% as the concentration of the target DNA varies from 0.1 to 500 nM. In contrast, such biosensing does not come into play by the use of the oligonucleotide with incompatible or mismatched sequences. Similar results are observed from photoluminescence microscopic images and spectra. The biosensors show very-uniform current changes with standard deviations ranging ~1 to ~10% by ten-times endurance tests. These results are very promising for their applications in accurate, selective, and stable biosensing.

  7. High-density, microsphere-based fiber optic DNA microarrays.

    PubMed

    Epstein, Jason R; Leung, Amy P K; Lee, Kyong Hoon; Walt, David R

    2003-05-01

    A high-density fiber optic DNA microarray has been developed consisting of oligonucleotide-functionalized, 3.1-microm-diameter microspheres randomly distributed on the etched face of an imaging fiber bundle. The fiber bundles are comprised of 6000-50000 fused optical fibers and each fiber terminates with an etched well. The microwell array is capable of housing complementary-sized microspheres, each containing thousands of copies of a unique oligonucleotide probe sequence. The array fabrication process results in random microsphere placement. Determining the position of microspheres in the random array requires an optical encoding scheme. This array platform provides many advantages over other array formats. The microsphere-stock suspension concentration added to the etched fiber can be controlled to provide inherent sensor redundancy. Examining identical microspheres has a beneficial effect on the signal-to-noise ratio. As other sequences of interest are discovered, new microsphere sensing elements can be added to existing microsphere pools and new arrays can be fabricated incorporating the new sequences without altering the existing detection capabilities. These microarrays contain the smallest feature sizes (3 microm) of any DNA array, allowing interrogation of extremely small sample volumes. Reducing the feature size results in higher local target molecule concentrations, creating rapid and highly sensitive assays. The microsphere array platform is also flexible in its applications; research has included DNA-protein interaction profiles, microbial strain differentiation, and non-labeled target interrogation with molecular beacons. Fiber optic microsphere-based DNA microarrays have a simple fabrication protocol enabling their expansion into other applications, such as single cell-based assays.

  8. Current progress on aptamer-targeted oligonucleotide therapeutics

    PubMed Central

    Dassie, Justin P; Giangrande, Paloma H

    2014-01-01

    Exploiting the power of the RNAi pathway through the use of therapeutic siRNA drugs has remarkable potential for treating a vast array of human disease conditions. However, difficulties in delivery of these and similar nucleic acid-based pharmacological agents to appropriate organs or tissues, remains a major impediment to their broad clinical application. Synthetic nucleic acid ligands (aptamers) have emerged as effective delivery vehicles for therapeutic oligonucleotides, including siRNAs. In this review, we summarize recent attractive developments in creatively employing cell-internalizing aptamers to deliver therapeutic oligonucleotides (e.g., siRNAs, miRNAs, anti-miRs and antisense oligos) to target cells. We also discuss advancements in aptamer-siRNA chimera technology, as well as, aptamer-functionalized nanoparticles for siRNA delivery. In addition, the challenges and future prospects of aptamer-targeted oligonucleotide drugs for clinical translation are further highlighted. PMID:24304250

  9. Application of HLA-DRB1 genotyping by oligonucleotide micro-array technology in forensic medicine.

    PubMed

    Jiang, Bin; Li, Yao; Wu, Hai; He, Xianmin; Li, Chengtao; Li, Li; Tang, Rong; Xie, Yi; Mao, Yumin

    2006-10-16

    The human leukocyte antigen (HLA) system is known to be the most complex polymorphic system in the human genome. Among all of the HLA loci, HLA-DRB1 has the second largest number of alleles. The purpose of this study is to develop an oligonucleotide micro-array based HLA-DRB1 typing system for use in forensic identification, anthropology, tissue transplantation, and other genetic research fields. The system was developed by analyzing the HLA-DRB1 (DRB1) genotypes in 1198 unrelated healthy Chinese Han individuals originating from various parts of China and residing in Shanghai, China. Polymerase chain reaction (PCR) coupled with the oligonucleotide micro-array technology was used to detect and type HLA-DRB1 alleles of the sample individuals. The reliability, sensitivity, consistency and specificity were evaluated for use in forensic identification. Furthermore, a meta-analysis was carried out by comparing the allele frequencies of the HLA-DRB1 locus with those of other Chinese Han groups, Chinese minorities and other ethnic populations. All the DNA samples yielded a 273 bp amplification product, with no other amplification products in this length range. The minimum quantity of DNA detected by this method is 15 ng in a PCR reaction system of 25 microl. The population studied appeared to be not in Hardy-Weinberg equilibrium. Observed heterozygosity (Ho), expected heterozygosity (He), expected probability of exclusion (PE), polymorphic information content (PIC), and discrimination power (DP) of the HLA-DRB1 locus from the Shanghai Han ethnic group were evaluated to be 0.8022, 0.8870, 0.7741, 0.8771, 0.9750, respectively. A total of 25 HLA-DRB1 alleles were identified. HLA-DRB1*09XX, *04XX, *12XX and *15XX were the most frequent DRB1 alleles, which were observed in 58.76% of the sample. One hundred and sixteen genotypes were found. The five most frequent genotypes were: *04XX/*04XX (0.0626), *09XX/*09XX (0.0593), *04XX/*09XX (0.0551), *09XX/*15XX (0.0384) and *08XX/*12XX (0.0351). The meta-analysis showed that there were uniquely distributed features of DRB1 alleles among various ethnic populations and among the studied population groups from various regions with the same ethnic origin. An HLA-DRB1 genotyping system has been developed and established based on the oligonucleotide micro-array technology. The HLA-DRB1 typing of the Han population in Shanghai has revealed a relatively high heterogeneity. Information obtained in this study will be useful for medical and forensic applications as well as in anthropology research. Large-scale micro-array detection is highly accurate and reliable for DNA-based HLA-DRB1 genotyping. These results suggest that HLA-DRB1 DNA polymorphisms and the database of the Shanghai Han group have useful applications in processing forensic casework (as personal identification, paternity test), tracing population migration and genetic diagnosis.

  10. Novel Multiplex Oligonucleotide-Conjugated Bead Suspension Array for Rapid Identification of Enterovirus 71 Subgenogroups▿ §

    PubMed Central

    Wu, Y.; Tan, E. L.; Yeo, A.; Chan, K. P.; Nishimura, H.; Cardosa, M. J.; Poh, C. L.; Quak, S. H.; Chow, Vincent T.

    2011-01-01

    A high-throughput multiplex bead suspension array was developed for the rapid subgenogrouping of EV71 strains, based on single nucleotide polymorphisms observed within the VP1 region with a high sensitivity as low as 1 PFU. Of 33 viral isolates and 55 clinical samples, all EV71 strains were successfully detected and correctly subgenogrouped. PMID:21084510

  11. Synthesis of high-quality libraries of long (150mer) oligonucleotides by a novel depurination controlled process

    PubMed Central

    LeProust, Emily M.; Peck, Bill J.; Spirin, Konstantin; McCuen, Heather Brummel; Moore, Bridget; Namsaraev, Eugeni; Caruthers, Marvin H.

    2010-01-01

    We have achieved the ability to synthesize thousands of unique, long oligonucleotides (150mers) in fmol amounts using parallel synthesis of DNA on microarrays. The sequence accuracy of the oligonucleotides in such large-scale syntheses has been limited by the yields and side reactions of the DNA synthesis process used. While there has been significant demand for libraries of long oligos (150mer and more), the yields in conventional DNA synthesis and the associated side reactions have previously limited the availability of oligonucleotide pools to lengths <100 nt. Using novel array based depurination assays, we show that the depurination side reaction is the limiting factor for the synthesis of libraries of long oligonucleotides on Agilent Technologies’ SurePrint® DNA microarray platform. We also demonstrate how depurination can be controlled and reduced by a novel detritylation process to enable the synthesis of high quality, long (150mer) oligonucleotide libraries and we report the characterization of synthesis efficiency for such libraries. Oligonucleotide libraries prepared with this method have changed the economics and availability of several existing applications (e.g. targeted resequencing, preparation of shRNA libraries, site-directed mutagenesis), and have the potential to enable even more novel applications (e.g. high-complexity synthetic biology). PMID:20308161

  12. Comparative performance of high-density oligonucleotide sequencing and dideoxynucleotide sequencing of HIV type 1 pol from clinical samples.

    PubMed

    Günthard, H F; Wong, J K; Ignacio, C C; Havlir, D V; Richman, D D

    1998-07-01

    The performance of the high-density oligonucleotide array methodology (GeneChip) in detecting drug resistance mutations in HIV-1 pol was compared with that of automated dideoxynucleotide sequencing (ABI) of clinical samples, viral stocks, and plasmid-derived NL4-3 clones. Sequences from 29 clinical samples (plasma RNA, n = 17; lymph node RNA, n = 5; lymph node DNA, n = 7) from 12 patients, from 6 viral stock RNA samples, and from 13 NL4-3 clones were generated by both methods. Editing was done independently by a different investigator for each method before comparing the sequences. In addition, NL4-3 wild type (WT) and mutants were mixed in varying concentrations and sequenced by both methods. Overall, a concordance of 99.1% was found for a total of 30,865 bases compared. The comparison of clinical samples (plasma RNA and lymph node RNA and DNA) showed a slightly lower match of base calls, 98.8% for 19,831 nucleotides compared (protease region, 99.5%, n = 8272; RT region, 98.3%, n = 11,316), than for viral stocks and NL4-3 clones (protease region, 99.8%; RT region, 99.5%). Artificial mixing experiments showed a bias toward calling wild-type bases by GeneChip. Discordant base calls are most likely due to differential detection of mixtures. The concordance between GeneChip and ABI was high and appeared dependent on the nature of the templates (directly amplified versus cloned) and the complexity of mixes.

  13. Molecular testing for familial hypercholesterolaemia-associated mutations in a UK-based cohort: development of an NGS-based method and comparison with multiplex polymerase chain reaction and oligonucleotide arrays.

    PubMed

    Reiman, Anne; Pandey, Sarojini; Lloyd, Kate L; Dyer, Nigel; Khan, Mike; Crockard, Martin; Latten, Mark J; Watson, Tracey L; Cree, Ian A; Grammatopoulos, Dimitris K

    2016-11-01

    Background Detection of disease-associated mutations in patients with familial hypercholesterolaemia is crucial for early interventions to reduce risk of cardiovascular disease. Screening for these mutations represents a methodological challenge since more than 1200 different causal mutations in the low-density lipoprotein receptor has been identified. A number of methodological approaches have been developed for screening by clinical diagnostic laboratories. Methods Using primers targeting, the low-density lipoprotein receptor, apolipoprotein B, and proprotein convertase subtilisin/kexin type 9, we developed a novel Ion Torrent-based targeted re-sequencing method. We validated this in a West Midlands-UK small cohort of 58 patients screened in parallel with other mutation-targeting methods, such as multiplex polymerase chain reaction (Elucigene FH20), oligonucleotide arrays (Randox familial hypercholesterolaemia array) or the Illumina next-generation sequencing platform. Results In this small cohort, the next-generation sequencing method achieved excellent analytical performance characteristics and showed 100% and 89% concordance with the Randox array and the Elucigene FH20 assay. Investigation of the discrepant results identified two cases of mutation misclassification of the Elucigene FH20 multiplex polymerase chain reaction assay. A number of novel mutations not previously reported were also identified by the next-generation sequencing method. Conclusions Ion Torrent-based next-generation sequencing can deliver a suitable alternative for the molecular investigation of familial hypercholesterolaemia patients, especially when comprehensive mutation screening for rare or unknown mutations is required.

  14. Arrays of carbon nanofibers as a platform for biosensing at the molecular level and for tissue engineering and implantation.

    PubMed

    Koehne, Jessica E; Chen, Hua; Cassell, Alan; Liu, Gang-yu; Li, Jun; Meyyappan, M

    2009-01-01

    Arrays of Carbon nanofibers (CNFs) harness the advantages of individual CNF as well the collective property of assemblies, which made them promising materials in biosensing and tissue engineering or implantation. Here, we report two studies to explore the applications of vertically aligned CNFs. First, a nanoelectrode array (NEA) based on vertically aligned CNFs embedded in SiO(2) is used for ultrasensitive DNA detection. Oligonucleotide probes are selectively functionalized at the open ends of the CNFs and specifically hybridized with oligonucleotide targets. The guanine groups are employed as the signal moieties in the electrochemical measurements. Ru(bpy)(3)(2+) mediator is used to further amplify the guanine oxidation signal. The hybridization of less than approximately 1000 molecules of PCR amplified DNA targets are detected electrochemically by combining the CNF nanoelectrode array with the Ru(bpy)(3)(2+) amplification mechanism. Second, the SiO(2) matrix was etched back to produce needle-like protruding nanoelectrode arrays to be used as cell interfacing fibers for investigating gene transfection, electrical stimulation and detection of cellular processes. Our goal is to take advantage of the nanostructure of CNFs for unconventional biomolecular studies requiring ultrahigh sensitivity, high-degree of miniaturization and selective biofunctionalization.

  15. Template-Directed Ligation of Peptides to Oligonucleotides

    NASA Technical Reports Server (NTRS)

    Bruick, Richard K.; Dawson, Philip E.; Kent, Stephen BH; Usman, Nassim; Joyce, Gerald F.

    1996-01-01

    Synthetic oligonucleotides and peptides have enjoyed a wide range of applications in both biology and chemistry. As a consequence, oligonucleotide-peptide conjugates have received considerable attention, most notably in the development of antisense constructs with improved pharmacological properties. In addition, oligonucleotide-peptide conjugates have been used as molecular tags, in the assembly of supramolecular arrays and in the construction of encoded combinatorial libraries. To make these chimeric molecules more accessible for a broad range of investigations, we sought to develop a facile method for joining fully deprotected oligonucleotides and peptides through a stable amide bond linkage. Furthermore, we wished to make this ligation reaction addressable, enabling one to direct the ligation of specific oligonucleotide and peptide components.To confer specificity and accelerate the rate of the reaction, the ligation process was designed to be dependent on the presence of a complementary oligonucleotide template.

  16. Carbon Nanotube Nanoelectrode Array as an Electronic Chip for Ultrasensitive Label-free DNA Detection

    NASA Technical Reports Server (NTRS)

    Li, Jun; Koehne, Jessica; Chen, Hua; Cassell, Alan; Ng, Hou Tee; Fan, Wendy; Ye, Qi; Han, Jie; Meyyappan, M.

    2003-01-01

    A reliable nanoelectrode array based on vertically aligned multi-walled carbon nanotubes (MWNTs) embedded in SiO2 is used for ultrasensitive DNA detection. Characteristic nanoelectrode behavior is observed using low-density MWNT arrays for measuring both bulk and surface immobilized redox species such as K4Fe(CN)6 and ferrocene derivatives. The open-end of MWNTs are found to present similar properties as graphite edge-plane electrodes with wide potential window, flexible chemical functionalities, and good biocompatibility. BRCA1 related oligonucleotide probes with 18 bp are selectively functionalized at the open ends of the nanotube array and specifically hybridized with oligonucleotide targets incorporated with a polyG tag. The guanine groups are employed as the signal moieties in the electrochemical measurements. R(bpy)(sup 2+, sub 3) mediator is used to further amplify the guanine oxidation signal. The hybridization of sub-attomoles of DNA targets is detected electrochemically by combining the MWNT nanoelectrode array with the R(bpy)(sup 2+, sub 3) amplification mechanism. This technique was employed for direct electrochemical detection of label-free PCR amplicon from a healthy donor through specific hybridization with the BRCA1 probe. The detection limit is estimated to be less than 1000 DNA molecules since abundant guanine bases in the PCR amplicon provides a large signal. This system provides a general platform for rapid molecular diagnostics in applications requiring ultrahigh sensitivity, high-degree of miniaturization, and simple sample preparation, and low-cost operation.

  17. Real-Time Continuous Identification of Greenhouse Plant Pathogens Based on Recyclable Microfluidic Bioassay System.

    PubMed

    Qu, Xiangmeng; Li, Min; Zhang, Hongbo; Lin, Chenglie; Wang, Fei; Xiao, Mingshu; Zhou, Yi; Shi, Jiye; Aldalbahi, Ali; Pei, Hao; Chen, Hong; Li, Li

    2017-09-20

    The development of a real-time continuous analytical platform for the pathogen detection is of great scientific importance for achieving better disease control and prevention. In this work, we report a rapid and recyclable microfluidic bioassay system constructed from oligonucleotide arrays for selective and sensitive continuous identification of DNA targets of fungal pathogens. We employ the thermal denaturation method to effectively regenerate the oligonucleotide arrays for multiple sample detection, which could considerably reduce the screening effort and costs. The combination of thermal denaturation and laser-induced fluorescence detection technique enables real-time continuous identification of multiple samples (<10 min per sample). As a proof of concept, we have demonstrated that two DNA targets of fungal pathogens (Botrytis cinerea and Didymella bryoniae) can be sequentially analyzed using our rapid microfluidic bioassay system, which provides a new paradigm in the design of microfluidic bioassay system and will be valuable for chemical and biomedical analysis.

  18. Characterization of Deletions of the HBA and HBB Loci by Array Comparative Genomic Hybridization

    PubMed Central

    Sabath, Daniel E.; Bender, Michael A.; Sankaran, Vijay G.; Vamos, Esther; Kentsis, Alex; Yi, Hye-Son; Greisman, Harvey A.

    2017-01-01

    Thalassemia is among the most common genetic diseases worldwide. α-Thalassemia is usually caused by deletion of one or more of the duplicated HBA genes on chromosome 16. In contrast, most β-thalassemia results from point mutations that decrease or eliminate expression of the HBB gene on chromosome 11. Deletions within the HBB locus result in thalassemia or hereditary persistence of fetal Hb. Although routine diagnostic testing cannot distinguish thalassemia deletions from point mutations, deletional hereditary persistence of fetal Hb is notable for having an elevated HbF level with a normal mean corpuscular volume. A small number of deletions accounts for most α-thalassemias; in contrast, there are no predominant HBB deletions causing β-thalassemia. To facilitate the identification and characterization of deletions of the HBA and HBB globin loci, we performed array-based comparative genomic hybridization using a custom oligonucleotide microarray. We accurately mapped the breakpoints of known and previously uncharacterized HBB deletions defining previously uncharacterized deletion breakpoints by PCR amplification and sequencing. The array also successfully identified the common HBA deletions --SEA and --FIL. In summary, comparative genomic hybridization can be used to characterize deletions of the HBA and HBB loci, allowing high-resolution characterization of novel deletions that are not readily detected by PCR-based methods. PMID:26612711

  19. DNA detection on ultrahigh-density optical fiber-based nanoarrays.

    PubMed

    Tam, Jenny M; Song, Linan; Walt, David R

    2009-04-15

    Nanoarrays for DNA detection were fabricated on etched nanofiber bundles based on recently developed techniques for microscale arrays. Two different-sized nanoarrays were created: one with 700 nm feature sizes and a 1 microm center-to-center pitch (approximately 1x10(6) array elements/mm(2)) and one with 300 nm feature sizes and a 500 nm center-to-center pitch (4.6x10(6) array elements/mm(2)). A random, multiplexed array composed of oligonucleotide-functionalized nanospheres was constructed and used for parallel detection and analysis of fluorescently labeled DNA targets. We have used these arrays to detect a variety of target sequences including Bacillus thuringiensis kurstaki and vaccina virus sequences, two potential biowarfare agents, as well as interleukin-2 sequences, an immune system modulator that has been used for the diagnosis of HIV.

  20. Microarray Technology for the Diagnosis of Fetal Chromosomal Aberrations: Which Platform Should We Use?

    PubMed Central

    Karampetsou, Evangelia; Morrogh, Deborah; Chitty, Lyn

    2014-01-01

    The advantage of microarray (array) over conventional karyotype for the diagnosis of fetal pathogenic chromosomal anomalies has prompted the use of microarrays in prenatal diagnostics. In this review we compare the performance of different array platforms (BAC, oligonucleotide CGH, SNP) and designs (targeted, whole genome, whole genome, and targeted, custom) and discuss their advantages and disadvantages in relation to prenatal testing. We also discuss the factors to consider when implementing a microarray testing service for the diagnosis of fetal chromosomal aberrations. PMID:26237396

  1. Design of oligonucleotides for microarrays and perspectives for design of multi-transcriptome arrays.

    PubMed

    Nielsen, Henrik Bjørn; Wernersson, Rasmus; Knudsen, Steen

    2003-07-01

    Optimal design of oligonucleotides for microarrays involves tedious and laborious work evaluating potential oligonucleotides relative to a series of parameters. The currently available tools for this purpose are limited in their flexibility and do not present the oligonucleotide designer with an overview of these parameters. We present here a flexible tool named OligoWiz for designing oligonucleotides for multiple purposes. OligoWiz presents a set of parameter scores in a graphical interface to facilitate an overview for the user. Additional custom parameter scores can easily be added to the program to extend the default parameters: homology, DeltaTm, low-complexity, position and GATC-only. Furthermore we present an analysis of the limitations in designing oligonucleotide sets that can detect transcripts from multiple organisms. OligoWiz is available at www.cbs.dtu.dk/services/OligoWiz/.

  2. Ultrasensitive Label-free Electronic Chip for DNA Analysis Using Carbon Nanotube Nanoelectrode Arrays

    NASA Technical Reports Server (NTRS)

    Li, Jun; Koehne, Jessica; Chen, Hua; Cassell, Alan; Ng, Hou Tee; Ye, Qi; Han, Jie; Meyyappan, M.

    2004-01-01

    There is a strong need for faster, cheaper, and simpler methods for nucleic acid analysis in today s clinical tests. Nanotechnologies can potentially provide solutions to these requirements by integrating nanomaterials with biofunctionalities. Dramatic improvement in the sensitivity and multiplexing can be achieved through the high-degree miniaturization. Here, we present our study in the development of an ultrasensitive label-free electronic chip for DNA/RNA analysis based on carbon nanotube nanoelectrode arrays. A reliable nanoelectrode array based on vertically aligned multi-walled carbon nanotubes (MWNTs) embedded in a SiO2 matrix is fabricated using a bottom-up approach. Characteristic nanoelectrode behavior is observed with a low-density MWNT nanoelectrode array in measuring both the bulk and surface immobilized redox species. The open-end of MWNTs are found to present similar properties as graphite edge-plane electrodes, with a wide potential window, flexible chemical functionalities, and good biocompatibility. A BRCA1 related oligonucleotide probe with 18 bases is covalently functionalized at the open ends of the MWNTs and specifically hybridized with an oligonucleotide target as well as a PCR amplicon. The guanine bases in the target molecules are employed as the signal moieties for the electrochemical measurements. Ru(bpy)3(2+) mediator is used to further amplify the guanine oxidation signal. This technique has been employed for direct electrochemical detection of label-free PCR amplicon through specific hybridization with the BRCAl probe. The detection limit is estimated to be less than approximately 1000 DNA molecules, approaching the limit of the sensitivity by laser-based fluorescence techniques in DNA microarray. This system provides a general electronic platform for rapid molecular diagnostics in applications requiring ultrahigh sensitivity, high-degree of miniaturization, simple sample preparation, and low- cost operation.

  3. Mapping of RNA accessible sites by extension of random oligonucleotide libraries with reverse transcriptase.

    PubMed Central

    Allawi, H T; Dong, F; Ip, H S; Neri, B P; Lyamichev, V I

    2001-01-01

    A rapid and simple method for determining accessible sites in RNA that is independent of the length of target RNA and does not require RNA labeling is described. In this method, target RNA is allowed to hybridize with sequence-randomized libraries of DNA oligonucleotides linked to a common tag sequence at their 5'-end. Annealed oligonucleotides are extended with reverse transcriptase and the extended products are then amplified by using PCR with a primer corresponding to the tag sequence and a second primer specific to the target RNA sequence. We used the combination of both the lengths of the RT-PCR products and the location of the binding site of the RNA-specific primer to determine which regions of the RNA molecules were RNA extendible sites, that is, sites available for oligonucleotide binding and extension. We then employed this reverse transcription with the random oligonucleotide libraries (RT-ROL) method to determine the accessible sites on four mRNA targets, human activated ras (ha-ras), human intercellular adhesion molecule-1 (ICAM-1), rabbit beta-globin, and human interferon-gamma (IFN-gamma). Our results were concordant with those of other researchers who had used RNase H cleavage or hybridization with arrays of oligonucleotides to identify accessible sites on some of these targets. Further, we found good correlation between sites when we compared the location of extendible sites identified by RT-ROL with hybridization sites of effective antisense oligonucleotides on ICAM-1 mRNA in antisense inhibition studies. Finally, we discuss the relationship between RNA extendible sites and RNA accessibility. PMID:11233988

  4. ASSESSMENT OF THE SWINE PROTEIN-ANNOTATED OLIGONUCLEOTIDE MICROARRAY AND UTILITY OF THE ARRAYS FOR EQTL AND TRANSCRIPTIONAL PROFILING STUDIES

    USDA-ARS?s Scientific Manuscript database

    We have evaluated the new Swine Protein-Annotated Oligonucleotide Microarray (http://www.pigoligoarray.org) by analyzing transcriptional profiles for longissimus dorsi muscle (LD), Bronchial lymph node (BLN) and Lung. Four LD samples were used to assess the stringency of hybridization conditions com...

  5. sigReannot: an oligo-set re-annotation pipeline based on similarities with the Ensembl transcripts and Unigene clusters.

    PubMed

    Casel, Pierrot; Moreews, François; Lagarrigue, Sandrine; Klopp, Christophe

    2009-07-16

    Microarray is a powerful technology enabling to monitor tens of thousands of genes in a single experiment. Most microarrays are now using oligo-sets. The design of the oligo-nucleotides is time consuming and error prone. Genome wide microarray oligo-sets are designed using as large a set of transcripts as possible in order to monitor as many genes as possible. Depending on the genome sequencing state and on the assembly state the knowledge of the existing transcripts can be very different. This knowledge evolves with the different genome builds and gene builds. Once the design is done the microarrays are often used for several years. The biologists working in EADGENE expressed the need of up-to-dated annotation files for the oligo-sets they share including information about the orthologous genes of model species, the Gene Ontology, the corresponding pathways and the chromosomal location. The results of SigReannot on a chicken micro-array used in the EADGENE project compared to the initial annotations show that 23% of the oligo-nucleotide gene annotations were not confirmed, 2% were modified and 1% were added. The interest of this up-to-date annotation procedure is demonstrated through the analysis of real data previously published. SigReannot uses the oligo-nucleotide design procedure criteria to validate the probe-gene link and the Ensembl transcripts as reference for annotation. It therefore produces a high quality annotation based on reference gene sets.

  6. Microarray-Based Comparative Genomic Hybridization Using Sex-Matched Reference DNA Provides Greater Sensitivity for Detection of Sex Chromosome Imbalances than Array-Comparative Genomic Hybridization with Sex-Mismatched Reference DNA

    PubMed Central

    Yatsenko, Svetlana A.; Shaw, Chad A.; Ou, Zhishuo; Pursley, Amber N.; Patel, Ankita; Bi, Weimin; Cheung, Sau Wai; Lupski, James R.; Chinault, A. Craig; Beaudet, Arthur L.

    2009-01-01

    In array-comparative genomic hybridization (array-CGH) experiments, the measurement of DNA copy number of sex chromosomal regions depends on the sex of the patient and the reference DNAs used. We evaluated the ability of bacterial artificial chromosomes/P1-derived artificial and oligonucleotide array-CGH analyses to detect constitutional sex chromosome imbalances using sex-mismatched reference DNAs. Twenty-two samples with imbalances involving either the X or Y chromosome, including deletions, duplications, triplications, derivative or isodicentric chromosomes, and aneuploidy, were analyzed. Although concordant results were obtained for approximately one-half of the samples when using sex-mismatched and sex-matched reference DNAs, array-CGH analyses with sex-mismatched reference DNAs did not detect genomic imbalances that were detected using sex-matched reference DNAs in 6 of 22 patients. Small duplications and deletions of the X chromosome were most difficult to detect in female and male patients, respectively, when sex-mismatched reference DNAs were used. Sex-matched reference DNAs in array-CGH analyses provides optimal sensitivity and enables an automated statistical evaluation for the detection of sex chromosome imbalances when compared with an experimental design using sex-mismatched reference DNAs. Using sex-mismatched reference DNAs in array-CGH analyses may generate false-negative, false-positive, and ambiguous results for sex chromosome-specific probes, thus masking potential pathogenic genomic imbalances. Therefore, to optimize both detection of clinically relevant sex chromosome imbalances and ensure proper experimental performance, we suggest that alternative internal controls be developed and used instead of using sex-mismatched reference DNAs. PMID:19324990

  7. A novel computational method to simulate non-enzymatic self-replication. [Abstract only

    NASA Technical Reports Server (NTRS)

    Navarro-Gonzalez, Rafael; Reggia, James A.; Wu, Jayoung; Chou, Hui-Hsien

    1994-01-01

    Non-enzymatic, template-directed synthesis of oligonucleotides has been extensively studied in the laboratory as a model to understand the kind of chemical processes that might have contributed to the origin of life on Earth. Several oligonucleotides have been shown to catalyze the synthesis of their complements from activated mononucleotides; however, a restricted number of them have been found to self-replicate. Recently we developed an efficient modified cellular automata method that supports the study of self-replicating oligonucleotides. With this method the oligonucleotide molecules are represented as active cells imbedded in a two-dimensional array of inactive cells symbolizing the environment. Random movements and probability-governed chemical reactions occurring in a cellular space can effectively simulate the experimental behavior observed in self-directed replication of oligonucleotides.

  8. A dynamic bead-based microarray for parallel DNA detection

    NASA Astrophysics Data System (ADS)

    Sochol, R. D.; Casavant, B. P.; Dueck, M. E.; Lee, L. P.; Lin, L.

    2011-05-01

    A microfluidic system has been designed and constructed by means of micromachining processes to integrate both microfluidic mixing of mobile microbeads and hydrodynamic microbead arraying capabilities on a single chip to simultaneously detect multiple bio-molecules. The prototype system has four parallel reaction chambers, which include microchannels of 18 × 50 µm2 cross-sectional area and a microfluidic mixing section of 22 cm length. Parallel detection of multiple DNA oligonucleotide sequences was achieved via molecular beacon probes immobilized on polystyrene microbeads of 16 µm diameter. Experimental results show quantitative detection of three distinct DNA oligonucleotide sequences from the Hepatitis C viral (HCV) genome with single base-pair mismatch specificity. Our dynamic bead-based microarray offers an effective microfluidic platform to increase parallelization of reactions and improve microbead handling for various biological applications, including bio-molecule detection, medical diagnostics and drug screening.

  9. Global gene expression profiles of Phytophthora ramorum strain pr102 in response to plant host and tissue differentiation

    Treesearch

    Caroline M. Press; Niklaus J. Grunwald

    2008-01-01

    The release of the draft genome sequence of P. ramorum strain Pr102, enabled the construction of an oligonucleotide microarray of the entire genome of Pr102. The array contains 344,680 features (oligos) that represent the transcriptome of Pr102. P. ramorum RNA was extracted from mycelium and sporangia and used to compare gene...

  10. Ultrasensitive Hybridization-Based ELISA Method for the Determination of Phosphorodiamidate Morpholino Oligonucleotides in Biological samples.

    PubMed

    Burki, Umar; Straub, Volker

    2017-01-01

    Determining the concentration of oligonucleotide in biological samples such as tissue lysate and serum is essential for determining the biodistribution and pharmacokinetic profile, respectively. ELISA-based assays have shown far greater sensitivities compared to other methods such as HPLC and LC/MS. Here, we describe a novel ultrasensitive hybridization-based ELISA method for quantitating morpholino oligonucleotides in mouse tissue lysate and serum samples. The assay has a linear detection range of 5-250 pM (R2 > 0.99).

  11. Biorecognition by DNA oligonucleotides after Exposure to Photoresists and Resist Removers

    PubMed Central

    Dean, Stacey L.; Morrow, Thomas J.; Patrick, Sue; Li, Mingwei; Clawson, Gary; Mayer, Theresa S.; Keating, Christine D.

    2013-01-01

    Combining biological molecules with integrated circuit technology is of considerable interest for next generation sensors and biomedical devices. Current lithographic microfabrication methods, however, were developed for compatibility with silicon technology rather than bioorganic molecules and consequently it cannot be assumed that biomolecules will remain attached and intact during on-chip processing. Here, we evaluate the effects of three common photoresists (Microposit S1800 series, PMGI SF6, and Megaposit SPR 3012) and two photoresist removers (acetone and 1165 remover) on the ability of surface-immobilized DNA oligonucleotides to selectively recognize their reverse-complementary sequence. Two common DNA immobilization methods were compared: adsorption of 5′-thiolated sequences directly to gold nanowires and covalent attachment of 5′-thiolated sequences to surface amines on silica coated nanowires. We found that acetone had deleterious effects on selective hybridization as compared to 1165 remover, presumably due to incomplete resist removal. Use of the PMGI photoresist, which involves a high temperature bake step, was detrimental to the later performance of nanowire-bound DNA in hybridization assays, especially for DNA attached via thiol adsorption. The other three photoresists did not substantially degrade DNA binding capacity or selectivity for complementary DNA sequences. To determine if the lithographic steps caused more subtle damage, we also tested oligonucleotides containing a single base mismatch. Finally, a two-step photolithographic process was developed and used in combination with dielectrophoretic nanowire assembly to produce an array of doubly-contacted, electrically isolated individual nanowire components on a chip. Post-fabrication fluorescence imaging indicated that nanowire-bound DNA was present and able to selectively bind complementary strands. PMID:23952639

  12. A statistical learning approach to the modeling of chromatographic retention of oligonucleotides incorporating sequence and secondary structure data

    PubMed Central

    Sturm, Marc; Quinten, Sascha; Huber, Christian G.; Kohlbacher, Oliver

    2007-01-01

    We propose a new model for predicting the retention time of oligonucleotides. The model is based on ν support vector regression using features derived from base sequence and predicted secondary structure of oligonucleotides. Because of the secondary structure information, the model is applicable even at relatively low temperatures where the secondary structure is not suppressed by thermal denaturing. This makes the prediction of oligonucleotide retention time for arbitrary temperatures possible, provided that the target temperature lies within the temperature range of the training data. We describe different possibilities of feature calculation from base sequence and secondary structure, present the results and compare our model to existing models. PMID:17567619

  13. eSensor®: A Microarray Technology Based on Electrochemical Detection of Nucleic Acids and Its Application to Cystic Fibrosis Carrier Screening

    NASA Astrophysics Data System (ADS)

    Reed, Michael R.; Coty, William A.

    We have developed a test for identification of carriers for cystic fibrosis using the eSensor® DNA detection technology. Oligonucleotide probes are deposited within self-assembled monolayers on gold electrodes arrayed upon printed circuit boards. These probes allow sequence-specific capture of amplicons containing a panel of mutation sites associated with cystic fibrosis. DNA targets are detected and mutations genotyped using a “sandwich” assay methodology employing electrochemical detection of ferrocene-labeled oligonucleotides for discrimination of carrier and non-carrier alleles. Performance of the cystic fibrosis application demonstrates sufficient accuracy and reliability for clinical diagnostic use, and the procedure can be performed by trained medical technologists available in the hospital laboratory.

  14. Flexible CRISPR library construction using parallel oligonucleotide retrieval

    PubMed Central

    Read, Abigail; Gao, Shaojian; Batchelor, Eric

    2017-01-01

    Abstract CRISPR/Cas9-based gene knockout libraries have emerged as a powerful tool for functional screens. We present here a set of pre-designed human and mouse sgRNA sequences that are optimized for both high on-target potency and low off-target effect. To maximize the chance of target gene inactivation, sgRNAs were curated to target both 5΄ constitutive exons and exons that encode conserved protein domains. We describe here a robust and cost-effective method to construct multiple small sized CRISPR library from a single oligo pool generated by array synthesis using parallel oligonucleotide retrieval. Together, these resources provide a convenient means for individual labs to generate customized CRISPR libraries of variable size and coverage depth for functional genomics application. PMID:28334828

  15. Analysis of mutations in oral poliovirus vaccine by hybridization with generic oligonucleotide microchips.

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Proudnikov, D.; Kirillov, E.; Chumakov, K.

    2000-01-01

    This paper describes use of a new technology of hybridization with a micro-array of immobilized oligonucleotides for detection and quantification of neurovirulent mutants in Oral Poliovirus Vaccine (OPV). We used a micro-array consisting of three-dimensional gel-elements containing all possible hexamers (total of 4096 probes). Hybridization of fluorescently labelled viral cDNA samples with such microchips resulted in a pattern of spots that was registered and quantified by a computer-linked CCD camera, so that the sequence of the original cDNA could be deduced. The method could reliably identify single point mutations, since each of them affected fluorescence intensity of 12 micro-array elements.more » Micro-array hybridization of DNA mixtures with varying contents of point mutants demonstrated that the method can detect as little as 10% of revertants in a population of vaccine virus. This new technology should be useful for quality control of live viral vaccines, as well as for other applications requiring identification and quantification of point mutations.« less

  16. Gene expression profiling of single cells on large-scale oligonucleotide arrays

    PubMed Central

    Hartmann, Claudia H.; Klein, Christoph A.

    2006-01-01

    Over the last decade, important insights into the regulation of cellular responses to various stimuli were gained by global gene expression analyses of cell populations. More recently, specific cell functions and underlying regulatory networks of rare cells isolated from their natural environment moved to the center of attention. However, low cell numbers still hinder gene expression profiling of rare ex vivo material in biomedical research. Therefore, we developed a robust method for gene expression profiling of single cells on high-density oligonucleotide arrays with excellent coverage of low abundance transcripts. The protocol was extensively tested with freshly isolated single cells of very low mRNA content including single epithelial, mature and immature dendritic cells and hematopoietic stem cells. Quantitative PCR confirmed that the PCR-based global amplification method did not change the relative ratios of transcript abundance and unsupervised hierarchical cluster analysis revealed that the histogenetic origin of an individual cell is correctly reflected by the gene expression profile. Moreover, the gene expression data from dendritic cells demonstrate that cellular differentiation and pathway activation can be monitored in individual cells. PMID:17071717

  17. Molecular Diagnostic Tools for Detection and Differentiation of Phytoplasmas Based on Chaperonin-60 Reveal Differences in Host Plant Infection Patterns

    PubMed Central

    Dumonceaux, Tim J.; Green, Margaret; Hammond, Christine; Perez, Edel; Olivier, Chrystel

    2014-01-01

    Phytoplasmas (‘Candidatus Phytoplasma’ spp.) are insect-vectored bacteria that infect a wide variety of plants, including many agriculturally important species. The infections can cause devastating yield losses by inducing morphological changes that dramatically alter inflorescence development. Detection of phytoplasma infection typically utilizes sequences located within the 16S–23S rRNA-encoding locus, and these sequences are necessary for strain identification by currently accepted standards for phytoplasma classification. However, these methods can generate PCR products >1400 bp that are less divergent in sequence than protein-encoding genes, limiting strain resolution in certain cases. We describe a method for accessing the chaperonin-60 (cpn60) gene sequence from a diverse array of ‘Ca.Phytoplasma’ spp. Two degenerate primer sets were designed based on the known sequence diversity of cpn60 from ‘Ca.Phytoplasma’ spp. and used to amplify cpn60 gene fragments from various reference samples and infected plant tissues. Forty three cpn60 sequences were thereby determined. The cpn60 PCR-gel electrophoresis method was highly sensitive compared to 16S-23S-targeted PCR-gel electrophoresis. The topology of a phylogenetic tree generated using cpn60 sequences was congruent with that reported for 16S rRNA-encoding genes. The cpn60 sequences were used to design a hybridization array using oligonucleotide-coupled fluorescent microspheres, providing rapid diagnosis and typing of phytoplasma infections. The oligonucleotide-coupled fluorescent microsphere assay revealed samples that were infected simultaneously with two subtypes of phytoplasma. These tools were applied to show that two host plants, Brassica napus and Camelina sativa, displayed different phytoplasma infection patterns. PMID:25551224

  18. A functional genomics tool for the Pacific bluefin tuna: Development of a 44K oligonucleotide microarray from whole-genome sequencing data for global transcriptome analysis.

    PubMed

    Yasuike, Motoshige; Fujiwara, Atushi; Nakamura, Yoji; Iwasaki, Yuki; Nishiki, Issei; Sugaya, Takuma; Shimizu, Akio; Sano, Motohiko; Kobayashi, Takanori; Ototake, Mitsuru

    2016-02-01

    Bluefin tunas are one of the most important fishery resources worldwide. Because of high market values, bluefin tuna farming has been rapidly growing during recent years. At present, the most common form of the tuna farming is based on the stocking of wild-caught fish. Therefore, concerns have been raised about the negative impact of the tuna farming on wild stocks. Recently, the Pacific bluefin tuna (PBT), Thunnus orientalis, has succeeded in completing the reproduction cycle under aquaculture conditions, but production bottlenecks remain to be solved because of very little biological information on bluefin tunas. Functional genomics approaches promise to rapidly increase our knowledge on biological processes in the bluefin tuna. Here, we describe the development of the first 44K PBT oligonucleotide microarray (oligo-array), based on whole-genome shotgun (WGS) sequencing and large-scale expressed sequence tags (ESTs) data. In addition, we also introduce an initial 44K PBT oligo-array experiment using in vitro grown peripheral blood leukocytes (PBLs) stimulated with immunostimulants such as lipopolysaccharide (LPS: a cell wall component of Gram-negative bacteria) or polyinosinic:polycytidylic acid (poly I:C: a synthetic mimic of viral infection). This pilot 44K PBT oligo-array analysis successfully addressed distinct immune processes between LPS- and poly I:C- stimulated PBLs. Thus, we expect that this oligo-array will provide an excellent opportunity to analyze global gene expression profiles for a better understanding of diseases and stress, as well as for reproduction, development and influence of nutrition on tuna aquaculture production. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.

  19. Methods Of Using Chemical Libraries To Search For New Kinase Inhibitors

    DOEpatents

    Gray, Nathanael S. , Schultz, Peter , Wodicka, Lisa , Meijer, Laurent , Lockhart, David J.

    2003-06-03

    The generation of selective inhibitors for specific protein kinases would provide new tools for analyzing signal transduction pathways and possibly new therapeutic agents. We have invented an approach to the development of selective protein kinase inhibitors based on the unexpected binding mode of 2,6,9-trisubstituted purines to the ATP binding site of human CDK2. The most potent inhibitor, purvalanol B (IC.sub.50 =6 nM), binds with a 30-fold greater affinity than the known CDK2 inhibitor, flavopiridol. The cellular effects of this class of compounds were examined and compared to those of flavopiridol by monitoring changes in mRNA expression levels for all genes in treated cells of Saccharomyces cerevisiae using high-density oligonucleotide probe arrays.

  20. A new normalizing algorithm for BAC CGH arrays with quality control metrics.

    PubMed

    Miecznikowski, Jeffrey C; Gaile, Daniel P; Liu, Song; Shepherd, Lori; Nowak, Norma

    2011-01-01

    The main focus in pin-tip (or print-tip) microarray analysis is determining which probes, genes, or oligonucleotides are differentially expressed. Specifically in array comparative genomic hybridization (aCGH) experiments, researchers search for chromosomal imbalances in the genome. To model this data, scientists apply statistical methods to the structure of the experiment and assume that the data consist of the signal plus random noise. In this paper we propose "SmoothArray", a new method to preprocess comparative genomic hybridization (CGH) bacterial artificial chromosome (BAC) arrays and we show the effects on a cancer dataset. As part of our R software package "aCGHplus," this freely available algorithm removes the variation due to the intensity effects, pin/print-tip, the spatial location on the microarray chip, and the relative location from the well plate. removal of this variation improves the downstream analysis and subsequent inferences made on the data. Further, we present measures to evaluate the quality of the dataset according to the arrayer pins, 384-well plates, plate rows, and plate columns. We compare our method against competing methods using several metrics to measure the biological signal. With this novel normalization algorithm and quality control measures, the user can improve their inferences on datasets and pinpoint problems that may arise in their BAC aCGH technology.

  1. Safety of antisense oligonucleotide and siRNA-based therapeutics.

    PubMed

    Chi, Xuan; Gatti, Philip; Papoian, Thomas

    2017-05-01

    Oligonucleotide-based therapy is an active area of drug development designed to treat a variety of gene-specific diseases. Two of the more promising platforms are the antisense oligonucleotides (ASOs) and short interfering RNAs (siRNAs), both of which are often directed against similar targets. In light of recent reports on clinical trials of severe thrombocytopenia with two different ASO drugs and increased peripheral neuropathy with an siRNA drug, we compared and contrasted the specific safety characteristics of these two classes of oligonucleotide therapeutic. The objectives were to assess factors that could contribute to the specific toxicities observed with these two classes of promising drugs, and get a better understanding of the potential mechanism(s) responsible for these rare, but serious, adverse events. Published by Elsevier Ltd.

  2. Enzymatic production of single-molecule FISH and RNA capture probes.

    PubMed

    Gaspar, Imre; Wippich, Frank; Ephrussi, Anne

    2017-10-01

    Arrays of singly labeled short oligonucleotides that hybridize to a specific target revolutionized RNA biology, enabling quantitative, single-molecule microscopy analysis and high-efficiency RNA/RNP capture. Here, we describe a simple and efficient method that allows flexible functionalization of inexpensive DNA oligonucleotides by different fluorescent dyes or biotin using terminal deoxynucleotidyl transferase and custom-made functional group conjugated dideoxy-UTP. We show that (i) all steps of the oligonucleotide labeling-including conjugation, enzymatic synthesis, and product purification-can be performed in a standard biology laboratory, (ii) the process yields >90%, often >95% labeled product with minimal carryover of impurities, and (iii) the oligonucleotides can be labeled with different dyes or biotin, allowing single-molecule FISH, RNA affinity purification, and Northern blot analysis to be performed. © 2017 Gaspar et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  3. Impact of point-mutations on the hybridization affinity of surface-bound DNA/DNA and RNA/DNA oligonucleotide-duplexes: Comparison of single base mismatches and base bulges

    PubMed Central

    Naiser, Thomas; Ehler, Oliver; Kayser, Jona; Mai, Timo; Michel, Wolfgang; Ott, Albrecht

    2008-01-01

    Background The high binding specificity of short 10 to 30 mer oligonucleotide probes enables single base mismatch (MM) discrimination and thus provides the basis for genotyping and resequencing microarray applications. Recent experiments indicate that the underlying principles governing DNA microarray hybridization – and in particular MM discrimination – are not completely understood. Microarrays usually address complex mixtures of DNA targets. In order to reduce the level of complexity and to study the problem of surface-based hybridization with point defects in more detail, we performed array based hybridization experiments in well controlled and simple situations. Results We performed microarray hybridization experiments with short 16 to 40 mer target and probe lengths (in situations without competitive hybridization) in order to systematically investigate the impact of point-mutations – varying defect type and position – on the oligonucleotide duplex binding affinity. The influence of single base bulges and single base MMs depends predominantly on position – it is largest in the middle of the strand. The position-dependent influence of base bulges is very similar to that of single base MMs, however certain bulges give rise to an unexpectedly high binding affinity. Besides the defect (MM or bulge) type, which is the second contribution in importance to hybridization affinity, there is also a sequence dependence, which extends beyond the defect next-neighbor and which is difficult to quantify. Direct comparison between binding affinities of DNA/DNA and RNA/DNA duplexes shows, that RNA/DNA purine-purine MMs are more discriminating than corresponding DNA/DNA MMs. In DNA/DNA MM discrimination the affected base pair (C·G vs. A·T) is the pertinent parameter. We attribute these differences to the different structures of the duplexes (A vs. B form). Conclusion We have shown that DNA microarrays can resolve even subtle changes in hybridization affinity for simple target mixtures. We have further shown that the impact of point defects on oligonucleotide stability can be broken down to a hierarchy of effects. In order to explain our observations we propose DNA molecular dynamics – in form of zipping of the oligonucleotide duplex – to play an important role. PMID:18477387

  4. Discovery of novel variants in genotyping arrays improves genotype retention and reduces ascertainment bias

    PubMed Central

    2012-01-01

    Background High-density genotyping arrays that measure hybridization of genomic DNA fragments to allele-specific oligonucleotide probes are widely used to genotype single nucleotide polymorphisms (SNPs) in genetic studies, including human genome-wide association studies. Hybridization intensities are converted to genotype calls by clustering algorithms that assign each sample to a genotype class at each SNP. Data for SNP probes that do not conform to the expected pattern of clustering are often discarded, contributing to ascertainment bias and resulting in lost information - as much as 50% in a recent genome-wide association study in dogs. Results We identified atypical patterns of hybridization intensities that were highly reproducible and demonstrated that these patterns represent genetic variants that were not accounted for in the design of the array platform. We characterized variable intensity oligonucleotide (VINO) probes that display such patterns and are found in all hybridization-based genotyping platforms, including those developed for human, dog, cattle, and mouse. When recognized and properly interpreted, VINOs recovered a substantial fraction of discarded probes and counteracted SNP ascertainment bias. We developed software (MouseDivGeno) that identifies VINOs and improves the accuracy of genotype calling. MouseDivGeno produced highly concordant genotype calls when compared with other methods but it uniquely identified more than 786000 VINOs in 351 mouse samples. We used whole-genome sequence from 14 mouse strains to confirm the presence of novel variants explaining 28000 VINOs in those strains. We also identified VINOs in human HapMap 3 samples, many of which were specific to an African population. Incorporating VINOs in phylogenetic analyses substantially improved the accuracy of a Mus species tree and local haplotype assignment in laboratory mouse strains. Conclusion The problems of ascertainment bias and missing information due to genotyping errors are widely recognized as limiting factors in genetic studies. We have conducted the first formal analysis of the effect of novel variants on genotyping arrays, and we have shown that these variants account for a large portion of miscalled and uncalled genotypes. Genetic studies will benefit from substantial improvements in the accuracy of their results by incorporating VINOs in their analyses. PMID:22260749

  5. Stable Gene Targeting in Human Cells Using Single-Strand Oligonucleotides with Modified Bases

    PubMed Central

    Rios, Xavier; Briggs, Adrian W.; Christodoulou, Danos; Gorham, Josh M.; Seidman, Jonathan G.; Church, George M.

    2012-01-01

    Recent advances allow multiplexed genome engineering in E. coli, employing easily designed oligonucleotides to edit multiple loci simultaneously. A similar technology in human cells would greatly expedite functional genomics, both by enhancing our ability to test how individual variants such as single nucleotide polymorphisms (SNPs) are related to specific phenotypes, and potentially allowing simultaneous mutation of multiple loci. However, oligo-mediated targeting of human cells is currently limited by low targeting efficiencies and low survival of modified cells. Using a HeLa-based EGFP-rescue reporter system we show that use of modified base analogs can increase targeting efficiency, in part by avoiding the mismatch repair machinery. We investigate the effects of oligonucleotide toxicity and find a strong correlation between the number of phosphorothioate bonds and toxicity. Stably EGFP-corrected cells were generated at a frequency of ~0.05% with an optimized oligonucleotide design combining modified bases and reduced number of phosphorothioate bonds. We provide evidence from comparative RNA-seq analysis suggesting cellular immunity induced by the oligonucleotides might contribute to the low viability of oligo-corrected cells. Further optimization of this method should allow rapid and scalable genome engineering in human cells. PMID:22615794

  6. Towards MRI microarrays.

    PubMed

    Hall, Andrew; Mundell, Victoria J; Blanco-Andujar, Cristina; Bencsik, Martin; McHale, Glen; Newton, Michael I; Cave, Gareth W V

    2010-04-14

    Superparamagnetic iron oxide nanometre scale particles have been utilised as contrast agents to image staked target binding oligonucleotide arrays using MRI to correlate the signal intensity and T(2)* relaxation times in different NMR fluids.

  7. Microwell Array Method for Rapid Generation of Uniform Agarose Droplets and Beads for Single Molecule Analysis.

    PubMed

    Li, Xingrui; Zhang, Dongfeng; Zhang, Huimin; Guan, Zhichao; Song, Yanling; Liu, Ruochen; Zhu, Zhi; Yang, Chaoyong

    2018-02-20

    Compartmentalization of aqueous samples in uniform emulsion droplets has proven to be a useful tool for many chemical, biological, and biomedical applications. Herein, we introduce an array-based emulsification method for rapid and easy generation of monodisperse agarose-in-oil droplets in a PDMS microwell array. The microwells are filled with agarose solution, and subsequent addition of hot oil results in immediate formation of agarose droplets due to the surface-tension of the liquid solution. Because droplet size is determined solely by the array unit dimensions, uniform droplets with preselectable diameters ranging from 20 to 100 μm can be produced with relative standard deviations less than 3.5%. The array-based droplet generation method was used to perform digital PCR for absolute DNA quantitation. The array-based droplet isolation and sol-gel switching property of agarose enable formation of stable beads by chilling the droplet array at -20 °C, thus, maintaining the monoclonality of each droplet and facilitating the selective retrieval of desired droplets. The monoclonality of droplets was demonstrated by DNA sequencing and FACS analysis, suggesting the robustness and flexibility of the approach for single molecule amplification and analysis. We believe our approach will lead to new possibilities for a great variety of applications, such as single-cell gene expression studies, aptamer selection, and oligonucleotide analysis.

  8. Multiplexed screening assay for mRNA combining nuclease protection with luminescent array detection.

    PubMed

    Martel, Ralph R; Botros, Ihab W; Rounseville, Matthew P; Hinton, James P; Staples, Robin R; Morales, David A; Farmer, John B; Seligmann, Bruce E

    2002-11-01

    The principles and performance are described for the ArrayPlate mRNA assay, a multiplexed mRNA assay for high-throughput and high-content screening and drug development. THP-1 monocytes grown and subjected to compound treatments in 96-well plates were subjected to a multiplexed nuclease protection assay in situ. The nuclease protection assay destroyed all cell-derived mRNA, but left intact stoichiometric amounts of 16 target-specific oligonucleotide probes. Upon transfer of processed cell lysates to a microplate that contained a 16-element oligonucleotide array at the bottom of each well, the various probe species were separated by immobilization at predefined elements of the array. Quantitative detection of array-bound probes was by enzyme-mediated chemiluminescence. A high-resolution charge-coupled device imager was used for the simultaneous readout of all 1536 array elements in a 96-well plate. For the measurement of 16 genes in samples of 25000 cells, the average standard deviation from well to well within a plate was 8.6% of signal intensity and was 10.8% from plate to plate. Assay response was linear and reproducibility was constant for all detected genes in samples ranging from 1000 to 50000 cells. When THP-1 monocytes were differentiated with phorbol ester and subsequently activated with bacterial lipopolysaccharide that contained different concentrations of dexamethasone, dose-dependent effects of dexamethasone on the mRNA levels of several genes were observed.

  9. Direct fluorescence in situ hybridization on human metaphase chromosomes using quantum dot-platinum labeled DNA probes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hwang, Gyoyeon; Biological Chemistry, Korea University of Science and Technology, 217, Gajeong-ro, Yuseong-gu, Deajeon; Lee, Hansol

    The telomere shortening in chromosomes implies the senescence, apoptosis, or oncogenic transformation of cells. Since detecting telomeres in aging and diseases like cancer, is important, the direct detection of telomeres has been a very useful biomarker. We propose a telomere detection method using a newly synthesized quantum dot (QD) based probe with oligonucleotide conjugation and direct fluorescence in situ hybridization (FISH). QD-oligonucleotides were prepared with metal coordination bonding based on platinum-guanine binding reported in our previous work. The QD-oligonucleotide conjugation method has an advantage where any sequence containing guanine at the end can be easily bound to the starting QD-Ptmore » conjugate. A synthesized telomeric oligonucleotide was bound to the QD-Pt conjugate successfully and this probe hybridized specifically on the telomere of fabricated MV-4-11 and MOLT-4 chromosomes. Additionally, the QD-telomeric oligonucleotide probe successfully detected the telomeres on the CGH metaphase slide. Due to the excellent photostability and high quantum yield of QDs, the QD-oligonucleotide probe has high fluorescence intensity when compared to the organic dye-oligonucleotide probe. Our QD-oligonucleotide probe, conjugation method of this QD probe, and hybridization protocol with the chromosomes can be a useful tool for chromosome painting and FISH. - Highlights: • We prepared a probe linked between QD and telomeric oligonucleotide with platinum-guanine bonding. • Telomeres were detected by our new telomere probes successfully in three different human metaphase chromosomes. • QDPt-DNA probe has high fluorescence intensity in comparison with organic dye-DNA probe.« less

  10. Genetics Home Reference: mycosis fungoides

    MedlinePlus

    ... Cigudosa JC, Barranco C, Serrano S, Dummer R, Tensen CP, Solé F, Pujol RM, Espinet B. Oligonucleotide array- ... K, Knijnenburg J, Boer JM, Willemze R, Tensen CP. Oncogenomic analysis of mycosis fungoides reveals major differences ...

  11. Cambridge Healthtech Institute's Third Annual Conference on Lab-on-a-Chip and Microarrays. 22-24 January 2001, Zurich, Switzerland.

    PubMed

    Jain, K K

    2001-02-01

    Cambridge Healthtech Institute's Third Annual Conference on Lab-on-a-Chip and Microarray technology covered the latest advances in this technology and applications in life sciences. Highlights of the meetings are reported briefly with emphasis on applications in genomics, drug discovery and molecular diagnostics. There was an emphasis on microfluidics because of the wide applications in laboratory and drug discovery. The lab-on-a-chip provides the facilities of a complete laboratory in a hand-held miniature device. Several microarray systems have been used for hybridisation and detection techniques. Oligonucleotide scanning arrays provide a versatile tool for the analysis of nucleic acid interactions and provide a platform for improving the array-based methods for investigation of antisense therapeutics. A method for analysing combinatorial DNA arrays using oligonucleotide-modified gold nanoparticle probes and a conventional scanner has considerable potential in molecular diagnostics. Various applications of microarray technology for high-throughput screening in drug discovery and single nucleotide polymorphisms (SNP) analysis were discussed. Protein chips have important applications in proteomics. With the considerable amount of data generated by the different technologies using microarrays, it is obvious that the reading of the information and its interpretation and management through the use of bioinformatics is essential. Various techniques for data analysis were presented. Biochip and microarray technology has an essential role to play in the evolving trends in healthcare, which integrate diagnosis with prevention/treatment and emphasise personalised medicines.

  12. Synthesis and hybridization of a series of biotinylated oligonucleotides.

    PubMed Central

    Cook, A F; Vuocolo, E; Brakel, C L

    1988-01-01

    A series of oligonucleotides containing biotin-11-dUMP at various positions were synthesized and compared in quantitative, colorimetric hybridization-detection studies. A deoxyuridine phosphoramidite containing a protected allylamino sidearm was synthesized and used in standard, automated synthesis cycles to prepare oligonucleotides with allylamino residues at various positions within a standard 17-base sequence. Biotin substituents were subsequently attached to the allylamino sidearms by reaction with N-biotinyl-6-aminocaproic acid N-hydroxysuccinimide ester. These oligomers were hybridized to target DNA immobilized on microtiter wells (ELISA plates), and were detected with a streptavidin-biotinylated horseradish peroxidase complex using hydrogen peroxide as substrate and o-phenylenediamine as chromogen. We found that the sensitivity of detection of target DNA by biotin-labeled oligonucleotide probes was strongly dependent upon the position of the biotin label. Oligonucleotides containing biotin labels near or off the ends of the hybridizing sequence were more effective probes than oligonucleotides containing internal biotin labels. An additive effect of increasing numbers of biotin-dUMP residues was found for some labeling configurations. PMID:3375076

  13. Use of continuous/contiguous stacking hybridization as a diagnostic tool

    DOEpatents

    Mirzabekov, Andrei Darievich; Yershov, Gennadiy Moseyevich; Kirillov, Eugene Vladislavovich; Parinov, Sergei Valeryevich; Barski, Victor Evgenievich; Lysov, Yuri Petrovich

    1999-01-01

    A method for detecting disease-associated alleles in patient genetic material is provided whereby a first group of oligonucleotide molecules, synthesized to compliment base sequences of the disease associated alleles is immobilized on a predetermined position on a substrate, and then contacted with patient genetic material to form duplexes. The duplexes are then contacted with a second group of oligonucleotide molecules which are synthesized to extend the predetermined length of the oligonucleotide molecules of the first group, and where each of the oligonucleotide molecules of the second group are tagged and either incorporate universal bases or a mixture of guanine, cytosine, thymine, and adenine, or complementary nucleotide strands that are tagged with a different fluorochrome which radiates light at a predetermined wavelength. The treated substrate is then washed and the light patterns radiating therefrom are compared with predetermined light patterns of various diseases that were prepared on identical substrates.

  14. Use of continuous/contiguous stacking hybridization as a diagnostic tool

    DOEpatents

    Mirzabekov, A.D.; Yershov, G.M.; Kirillov, E.V.; Parinov, S.V.; Barski, V.E.; Lysov, Y.P.

    1999-06-01

    A method for detecting disease-associated alleles in patient genetic material is provided whereby a first group of oligonucleotide molecules, synthesized to compliment base sequences of the disease associated alleles is immobilized on a predetermined position on a substrate, and then contacted with patient genetic material to form duplexes. The duplexes are then contacted with a second group of oligonucleotide molecules which are synthesized to extend the predetermined length of the oligonucleotide molecules of the first group, and where each of the oligonucleotide molecules of the second group are tagged and either incorporate universal bases or a mixture of guanine, cytosine, thymine, and adenine, or complementary nucleotide strands that are tagged with a different fluorochrome which radiates light at a predetermined wavelength. The treated substrate is then washed and the light patterns radiating therefrom are compared with predetermined light patterns of various diseases that were prepared on identical substrates. 5 figs.

  15. Integrated analysis of copy number alteration and RNA expression profiles of cancer using a high-resolution whole-genome oligonucleotide array.

    PubMed

    Jung, Seung-Hyun; Shin, Seung-Hun; Yim, Seon-Hee; Choi, Hye-Sun; Lee, Sug-Hyung; Chung, Yeun-Jun

    2009-07-31

    Recently, microarray-based comparative genomic hybridization (array-CGH) has emerged as a very efficient technology with higher resolution for the genome-wide identification of copy number alterations (CNA). Although CNAs are thought to affect gene expression, there is no platform currently available for the integrated CNA-expression analysis. To achieve high-resolution copy number analysis integrated with expression profiles, we established human 30k oligoarray-based genome-wide copy number analysis system and explored the applicability of this system for integrated genome and transcriptome analysis using MDA-MB-231 cell line. We compared the CNAs detected by the oligoarray with those detected by the 3k BAC array for validation. The oligoarray identified the single copy difference more accurately and sensitively than the BAC array. Seventeen CNAs detected by both platforms in MDA-MB-231 such as gains of 5p15.33-13.1, 8q11.22-8q21.13, 17p11.2, and losses of 1p32.3, 8p23.3-8p11.21, and 9p21 were consistently identified in previous studies on breast cancer. There were 122 other small CNAs (mean size 1.79 mb) that were detected by oligoarray only, not by BAC-array. We performed genomic qPCR targeting 7 CNA regions, detected by oligoarray only, and one non-CNA region to validate the oligoarray CNA detection. All qPCR results were consistent with the oligoarray-CGH results. When we explored the possibility of combined interpretation of both DNA copy number and RNA expression profiles, mean DNA copy number and RNA expression levels showed a significant correlation. In conclusion, this 30k oligoarray-CGH system can be a reasonable choice for analyzing whole genome CNAs and RNA expression profiles at a lower cost.

  16. A robust method to analyze copy number alterations of less than 100 kb in single cells using oligonucleotide array CGH.

    PubMed

    Möhlendick, Birte; Bartenhagen, Christoph; Behrens, Bianca; Honisch, Ellen; Raba, Katharina; Knoefel, Wolfram T; Stoecklein, Nikolas H

    2013-01-01

    Comprehensive genome wide analyses of single cells became increasingly important in cancer research, but remain to be a technically challenging task. Here, we provide a protocol for array comparative genomic hybridization (aCGH) of single cells. The protocol is based on an established adapter-linker PCR (WGAM) and allowed us to detect copy number alterations as small as 56 kb in single cells. In addition we report on factors influencing the success of single cell aCGH downstream of the amplification method, including the characteristics of the reference DNA, the labeling technique, the amount of input DNA, reamplification, the aCGH resolution, and data analysis. In comparison with two other commercially available non-linear single cell amplification methods, WGAM showed a very good performance in aCGH experiments. Finally, we demonstrate that cancer cells that were processed and identified by the CellSearch® System and that were subsequently isolated from the CellSearch® cartridge as single cells by fluorescence activated cell sorting (FACS) could be successfully analyzed using our WGAM-aCGH protocol. We believe that even in the era of next-generation sequencing, our single cell aCGH protocol will be a useful and (cost-) effective approach to study copy number alterations in single cells at resolution comparable to those reported currently for single cell digital karyotyping based on next generation sequencing data.

  17. EvOligo: A Novel Software to Design and Group Libraries of Oligonucleotides Applicable for Nucleic Acid-Based Experiments.

    PubMed

    Milewski, Marek C; Kamel, Karol; Kurzynska-Kokorniak, Anna; Chmielewski, Marcin K; Figlerowicz, Marek

    2017-10-01

    Experimental methods based on DNA and RNA hybridization, such as multiplex polymerase chain reaction, multiplex ligation-dependent probe amplification, or microarray analysis, require the use of mixtures of multiple oligonucleotides (primers or probes) in a single test tube. To provide an optimal reaction environment, minimal self- and cross-hybridization must be achieved among these oligonucleotides. To address this problem, we developed EvOligo, which is a software package that provides the means to design and group DNA and RNA molecules with defined lengths. EvOligo combines two modules. The first module performs oligonucleotide design, and the second module performs oligonucleotide grouping. The software applies a nearest-neighbor model of nucleic acid interactions coupled with a parallel evolutionary algorithm to construct individual oligonucleotides, and to group the molecules that are characterized by the weakest possible cross-interactions. To provide optimal solutions, the evolutionary algorithm sorts oligonucleotides into sets, preserves preselected parts of the oligonucleotides, and shapes their remaining parts. In addition, the oligonucleotide sets can be designed and grouped based on their melting temperatures. For the user's convenience, EvOligo is provided with a user-friendly graphical interface. EvOligo was used to design individual oligonucleotides, oligonucleotide pairs, and groups of oligonucleotide pairs that are characterized by the following parameters: (1) weaker cross-interactions between the non-complementary oligonucleotides and (2) more uniform ranges of the oligonucleotide pair melting temperatures than other available software products. In addition, in contrast to other grouping algorithms, EvOligo offers time-efficient sorting of paired and unpaired oligonucleotides based on various parameters defined by the user.

  18. Stability of non-Watson-Crick G-A/A-G base pair in synthetic DNA and RNA oligonucleotides.

    PubMed

    Ito, Yuko; Sone, Yumiko; Mizutani, Takaharu

    2004-03-01

    A non-Watson-Crick G-A/A-G base pair is found in SECIS (selenocysteine-insertion sequence) element in the 3'-untranslated region of Se-protein mRNAs and in the functional site of the hammerhead ribozyme. We studied the stability of G-A/A-G base pair (bold) in 17mer GT(U)GACGGAAACCGGAAC synthetic DNA and RNA oligonucleotides by thermal melting experiments and gel electrophoresis. The measured Tm value of DNA oligonucleotide having G-A/A-G pair showed an intermediate value (58 degrees C) between that of Watson-Crick G-C/C-G base pair (75 degrees C) and that of G-G/A-A of non-base-pair (40 degrees C). Similar thermal melting patterns were obtained with RNA oligonucleotides. This result indicates that the secondary structure of oligonucleotide having G-A/A-G base pair is looser than that of the G-C type Watson-Crick base pair. In the comparison between RNA and DNA having G-A/A-G base pair, the Tm value of the RNA oligonucleotide was 11 degrees C lower than that of DNA, indicating that DNA has a more rigid structure than RNA. The stained pattern of oligonucleotide on polyacrylamide gel clarified that the mobility of the DNA oligonucleotide G-A/A-G base pair changed according to the urea concentration from the rigid state (near the mobility of G-C/C-G oligonucleotide) in the absence of urea to the random state (near the mobility of G-G/A-A oligonucleotide) in 7 M urea. However, the RNA oligonucleotide with G-A/A-G pair moved at an intermediate mobility between that of oligonucleotide with G-C/C-G and of the oligonucleotide with G-G/A-A, and the mobility pattern did not depend on urea concentration. Thus, DNA and RNA oligonucleotides with the G-A/A-G base pair showed a pattern indicating an intermediate structure between the rigid Watson-Crick base pair and the random structure of non-base pair. RNA with G-A/A-G base pair has the intermediate structure not influenced by urea concentration. Finally, this study indicated that the intermediate rigidity imparted by Non-Watson-Crick base pair in SECIS element plays an important role in the selenocysteine expression by UGA codon.

  19. Use of continuous/contiguous stacking hybridization as a diagnostic tool

    DOEpatents

    Mirzabekov, Andrei Darievich; Kirillov, Eugene Vladislavovich; Parinov, Sergei Valeryevich; Barski, Victor Evgenievich; Dubiley, Svetlana Alekseevna

    2002-01-01

    A method for detecting disease-associated alleles in patient genetic material is provided whereby a first group of oligonucleotide molecules, synthesized to compliment base sequences of the disease associated alleles is immobilized on a predetermined position on a substrate, and then contacted with patient genetic material to form duplexes. The duplexes are then contacted with a second group of oligonucleotide molecules which are synthesized to extend the predetermined length of the oligonucleotide molecules of the first group, and where each of the oligonucleotide molecules of the second group are tagged and either incorporate universal bases or a mixture of guanine, cytosine, thymine, and adenine, or complementary nucleotide strands that are tagged with a different fluorochrome which radiates light at a predetermined wavelength. The treated substrate is then washed and the light patterns radiating therefrom are compared with predetermined light patterns of various diseases that were prepared on identical substrates. A method is also provided for determining the length of a repeat sequence in DNA or RNA, and also for determining the base sequence of unknown DNA or RNA.

  20. Use of continuous/contiguous stacking hybridization as a diagnostic tool

    DOEpatents

    Mirzabekov, Andrei Darievich; Kirillov, Eugene Vladislavovich; Parinov, Sergei Valeryevich; Barski, Victor Evgenievich; Dubiley, Svetlana Alekseevna

    2000-01-01

    A method for detecting disease-associated alleles in patient genetic material is provided whereby a first group of oligonucleotide molecules, synthesized to compliment base sequences of the disease associated alleles is immobilized on a predetermined position on a substrate, and then contacted with patient genetic material to form duplexes. The duplexes are then contacted with a second group of oligonucleotide molecules which are synthesized to extend the predetermined length of the oligonucleotide molecules of the first group, and where each of the oligonucleotide molecules of the second group are tagged and either incorporate universal bases or a mixture of guanine, cytosine, thymine, and adenine, or complementary nucleotide strands that are tagged with a different fluorochrome which radiates light at a predetermined wavelength. The treated substrate is then washed and the light patterns radiating therefrom are compared with predetermined light patterns of various diseases that were prepared on identical substrates. A method is also provided for determining the length of a repeat sequence in DNA or RNA, and also for determining the base sequence of unknown DNA or RNA.

  1. WebaCGH: an interactive online tool for the analysis and display of array comparative genomic hybridisation data.

    PubMed

    Frankenberger, Casey; Wu, Xiaolin; Harmon, Jerry; Church, Deanna; Gangi, Lisa M; Munroe, David J; Urzúa, Ulises

    2006-01-01

    Gene copy number variations occur both in normal cells and in numerous pathologies including cancer and developmental diseases. Array comparative genomic hybridisation (aCGH) is an emerging technology that allows detection of chromosomal gains and losses in a high-resolution format. When aCGH is performed on cDNA and oligonucleotide microarrays, the impact of DNA copy number on gene transcription profiles may be directly compared. We have created an online software tool, WebaCGH, that functions to (i) upload aCGH and gene transcription results from multiple experiments; (ii) identify significant aberrant regions using a local Z-score threshold in user-selected chromosomal segments subjected to smoothing with moving averages; and (iii) display results in a graphical format with full genome and individual chromosome views. In the individual chromosome display, data can be zoomed in/out in both dimensions (i.e. ratio and physical location) and plotted features can have 'mouse over' linking to outside databases to identify loci of interest. Uploaded data can be stored indefinitely for subsequent retrieval and analysis. WebaCGH was created as a Java-based web application using the open-source database MySQL. WebaCGH is freely accessible at http://129.43.22.27/WebaCGH/welcome.htm Xiaolin Wu (forestwu@mail.nih.gov) or Ulises Urzúa (uurzua@med.uchile.cl).

  2. Solid phase synthesis of phosphorothioate oligonucleotides utilizing diethyldithiocarbonate disulfide (DDD) as an efficient sulfur transfer reagent.

    PubMed

    Cheruvallath, Zacharia S; Kumar, R Krishna; Rentel, Claus; Cole, Douglas L; Ravikumar, Vasulinga T

    2003-04-01

    Diethyldithiodicarbonate (DDD), a cheap and easily prepared compound, is found to be a rapid and efficient sulfurizing reagent in solid phase synthesis of phosphorothioate oligodeoxyribonucleotides via the phosphoramidite approach. Product yield and quality based on IP-LC-MS compares well with high quality oligonucleotides synthesized using phenylacetyl disulfide (PADS) which is being used for manufacture of our antisense drugs.

  3. Receptor-Mediated Uptake of Phosphorothioate Antisense Oligonucleotides in Different Cell Types of the Liver.

    PubMed

    Miller, Colton M; Tanowitz, Michael; Donner, Aaron J; Prakash, Thazha P; Swayze, Eric E; Harris, Edward N; Seth, Punit P

    2018-06-01

    Oligonucleotide therapeutics have emerged as a third distinct platform for drug discovery within the pharmaceutical industry. Five oligonucleotide-based drugs have been approved by the US FDA and over 100 oligonucleotides drugs are currently at different stages of human trials. Several of these oligonucleotide drugs are modified using the phosphorothioate (PS) backbone modification where one of the nonbridging oxygen atoms of the phosphodiester linkage is replaced with sulfur. In this review, we summarize our knowledge on receptor-mediated uptake of PS antisense oligonucleotides (ASOs) within different cell types of the liver-a privileged organ for the discovery of oligonucleotide-based therapeutics.

  4. Salivary gland carcinosarcoma: oligonucleotide array CGH reveals similar genomic profiles in epithelial and mesenchymal components.

    PubMed

    Vékony, Hedy; Leemans, C René; Ylstra, Bauke; Meijer, Gerrit A; van der Waal, Isaäc; Bloemena, Elisabeth

    2009-03-01

    In this study, we present a case of parotid gland de novo carcinosarcoma. Salivary gland carcinosarcoma (or true malignant mixed tumor) is a rare biphasic neoplasm, composed of both malignant epithelial and malignant mesenchymal components. It is yet unclear whether these two phenotypes occur by collision of two independent tumors or if they are of clonal origin. To analyze the clonality of the different morphologic tumor components, oligonucleotide microarray-based comparative genomic hybridization (oaCGH) was performed on the carcinoma and the sarcoma entity separately. This technique enables a high-resolution, genome-wide overview of the chromosomal alterations in the distinct tumor elements. Analysis of both fractions showed a high number of DNA copy number changes. Losses were more prevalent than gains (82 and 49, respectively). The carcinomatous element displayed more chromosomal aberrations than the sarcomatous component. Specific amplifications of MUC20 (in mesenchymal element) and BMI-1 (in both elements) loci were observed. Overall homology between the two genomic profiles was 75%. DNA copy number profiles of the epithelial and mesenchymal components in this salivary gland carcinosarcoma displayed extensive overlap, indicating a monoclonal origin. Since losses are shared to a larger extent than gains, they seem to be more essential for initial oncogenic events. Furthermore, specific amplifications of a mucin and a Polycomb group gene imply these proteins in the tumorigenesis of carcinosarcomas.

  5. Array of nucleic acid probes on biological chips for diagnosis of HIV and methods of using the same

    DOEpatents

    Chee, Mark; Gingeras, Thomas R.; Fodor, Stephen P. A.; Hubble, Earl A.; Morris, MacDonald S.

    1999-01-19

    The invention provides an array of oligonucleotide probes immobilized on a solid support for analysis of a target sequence from a human immunodeficiency virus. The array comprises at least four sets of oligonucleotide probes 9 to 21 nucleotides in length. A first probe set has a probe corresponding to each nucleotide in a reference sequence from a human immunodeficiency virus. A probe is related to its corresponding nucleotide by being exactly complementary to a subsequence of the reference sequence that includes the corresponding nucleotide. Thus, each probe has a position, designated an interrogation position, that is occupied by a complementary nucleotide to the corresponding nucleotide. The three additional probe sets each have a corresponding probe for each probe in the first probe set. Thus, for each nucleotide in the reference sequence, there are four corresponding probes, one from each of the probe sets. The three corresponding probes in the three additional probe sets are identical to the corresponding probe from the first probe or a subsequence thereof that includes the interrogation position, except that the interrogation position is occupied by a different nucleotide in each of the four corresponding probes.

  6. Modulation of Stat3 Alternative Splicing in Breast Cancer

    DTIC Science & Technology

    2010-09-01

    using morpholino oligonucleotides covalently linked to an octaguanidine dendrimer (vivo- morpholinos) [54]. Since delivery of vivo-morpholino oligos...Li, and S. Jiang, Vivo-Morpholinos: a non-peptide transporter delivers Morpholinos into a wide array of mouse tissues. Biotechniques, 2008. 45(6

  7. Linear model for fast background subtraction in oligonucleotide microarrays.

    PubMed

    Kroll, K Myriam; Barkema, Gerard T; Carlon, Enrico

    2009-11-16

    One important preprocessing step in the analysis of microarray data is background subtraction. In high-density oligonucleotide arrays this is recognized as a crucial step for the global performance of the data analysis from raw intensities to expression values. We propose here an algorithm for background estimation based on a model in which the cost function is quadratic in a set of fitting parameters such that minimization can be performed through linear algebra. The model incorporates two effects: 1) Correlated intensities between neighboring features in the chip and 2) sequence-dependent affinities for non-specific hybridization fitted by an extended nearest-neighbor model. The algorithm has been tested on 360 GeneChips from publicly available data of recent expression experiments. The algorithm is fast and accurate. Strong correlations between the fitted values for different experiments as well as between the free-energy parameters and their counterparts in aqueous solution indicate that the model captures a significant part of the underlying physical chemistry.

  8. Oligonucleotide-based pharmaceuticals: Non-clinical and clinical safety signals and non-clinical testing strategies.

    PubMed

    Mustonen, Enni-Kaisa; Palomäki, Tiina; Pasanen, Markku

    2017-11-01

    Antisense oligonucleotides, short interfering RNAs (siRNAs) and aptamers are oligonucleotide-based pharmaceuticals with a promising role in targeted therapies. Currently, five oligonucleotide-based pharmaceuticals have achieved marketing authorization in Europe or USA and many more are undergoing clinical testing. However, several safety concerns have been raised in non-clinical and clinical studies. Oligonucleotides share properties with both chemical and biological pharmaceuticals and therefore they pose challenges also from the regulatory point of view. We have analyzed the safety data of oligonucleotides and evaluated the applicability of current non-clinical toxicological guidelines for assessing the safety of oligonucleotide-based pharmaceuticals. Oligonucleotide-based pharmaceuticals display a similar toxicological profile, exerting adverse effects on liver and kidney, evoking hematological alterations, as well as causing immunostimulation and prolonging the coagulation time. It is possible to extrapolate some of these effects from non-clinical studies to humans. However, evaluation strategies for genotoxicity testing of "non-natural" oligonucleotides should be revised. Additionally, the selective use of surrogates and prediction of clinical endpoints for non-clinically observed immunostimulation is complicated by its multiple potential manifestations, demanding improvements in the testing strategies. Utilizing more relevant and mechanistic-based approaches and taking better account of species differences, could possibly improve the prediction of relevant immunological/proinflammatory effects in humans. Copyright © 2017 Elsevier Inc. All rights reserved.

  9. Early-onset seizures due to mosaic exonic deletions of CDKL5 in a male and two females.

    PubMed

    Bartnik, Magdalena; Derwińska, Katarzyna; Gos, Monika; Obersztyn, Ewa; Kołodziejska, Katarzyna E; Erez, Ayelet; Szpecht-Potocka, Agnieszka; Fang, Ping; Terczyńska, Iwona; Mierzewska, Hanna; Lohr, Naomi J; Bellus, Gary A; Reimschisel, Tyler; Bocian, Ewa; Mazurczak, Tadeusz; Cheung, Sau Wai; Stankiewicz, Paweł

    2011-05-01

    Mutations in the CDKL5 gene have been associated with an X-linked dominant early infantile epileptic encephalopathy-2. The clinical presentation is usually of severe encephalopathy with refractory seizures and Rett syndrome (RTT)-like phenotype. We attempted to assess the role of mosaic intragenic copy number variation in CDKL5. We have used comparative genomic hybridization with a custom-designed clinical oligonucleotide array targeting exons of selected disease and candidate genes, including CDKL5. We have identified mosaic exonic deletions of CDKL5 in one male and two females with developmental delay and medically intractable seizures. These three mosaic changes represent 60% of all deletions detected in 12,000 patients analyzed by array comparative genomic hybridization and involving the exonic portion of CDKL5. We report the first case of an exonic deletion of CDKL5 in a male and emphasize the importance of underappreciated mosaic exonic copy number variation in patients with early-onset seizures and RTT-like features of both genders.

  10. Identification of transcribed sequences in Arabidopsis thaliana by using high-resolution genome tiling arrays

    PubMed Central

    Stolc, Viktor; Samanta, Manoj Pratim; Tongprasit, Waraporn; Sethi, Himanshu; Liang, Shoudan; Nelson, David C.; Hegeman, Adrian; Nelson, Clark; Rancour, David; Bednarek, Sebastian; Ulrich, Eldon L.; Zhao, Qin; Wrobel, Russell L.; Newman, Craig S.; Fox, Brian G.; Phillips, George N.; Markley, John L.; Sussman, Michael R.

    2005-01-01

    Using a maskless photolithography method, we produced DNA oligonucleotide microarrays with probe sequences tiled throughout the genome of the plant Arabidopsis thaliana. RNA expression was determined for the complete nuclear, mitochondrial, and chloroplast genomes by tiling 5 million 36-mer probes. These probes were hybridized to labeled mRNA isolated from liquid grown T87 cells, an undifferentiated Arabidopsis cell culture line. Transcripts were detected from at least 60% of the nearly 26,330 annotated genes, which included 151 predicted genes that were not identified previously by a similar genome-wide hybridization study on four different cell lines. In comparison with previously published results with 25-mer tiling arrays produced by chromium masking-based photolithography technique, 36-mer oligonucleotide probes were found to be more useful in identifying intron–exon boundaries. Using two-dimensional HPLC tandem mass spectrometry, a small-scale proteomic analysis was performed with the same cells. A large amount of strongly hybridizing RNA was found in regions “antisense” to known genes. Similarity of antisense activities between the 25-mer and 36-mer data sets suggests that it is a reproducible and inherent property of the experiments. Transcription activities were also detected for many of the intergenic regions and the small RNAs, including tRNA, small nuclear RNA, small nucleolar RNA, and microRNA. Expression of tRNAs correlates with genome-wide amino acid usage. PMID:15755812

  11. Identification of transcribed sequences in Arabidopsis thaliana by using high-resolution genome tiling arrays

    NASA Technical Reports Server (NTRS)

    Stolc, Viktor; Samanta, Manoj Pratim; Tongprasit, Waraporn; Sethi, Himanshu; Liang, Shoudan; Nelson, David C.; Hegeman, Adrian; Nelson, Clark; Rancour, David; Bednarek, Sebastian; hide

    2005-01-01

    Using a maskless photolithography method, we produced DNA oligonucleotide microarrays with probe sequences tiled throughout the genome of the plant Arabidopsis thaliana. RNA expression was determined for the complete nuclear, mitochondrial, and chloroplast genomes by tiling 5 million 36-mer probes. These probes were hybridized to labeled mRNA isolated from liquid grown T87 cells, an undifferentiated Arabidopsis cell culture line. Transcripts were detected from at least 60% of the nearly 26,330 annotated genes, which included 151 predicted genes that were not identified previously by a similar genome-wide hybridization study on four different cell lines. In comparison with previously published results with 25-mer tiling arrays produced by chromium masking-based photolithography technique, 36-mer oligonucleotide probes were found to be more useful in identifying intron-exon boundaries. Using two-dimensional HPLC tandem mass spectrometry, a small-scale proteomic analysis was performed with the same cells. A large amount of strongly hybridizing RNA was found in regions "antisense" to known genes. Similarity of antisense activities between the 25-mer and 36-mer data sets suggests that it is a reproducible and inherent property of the experiments. Transcription activities were also detected for many of the intergenic regions and the small RNAs, including tRNA, small nuclear RNA, small nucleolar RNA, and microRNA. Expression of tRNAs correlates with genome-wide amino acid usage.

  12. SigReannot-mart: a query environment for expression microarray probe re-annotations.

    PubMed

    Moreews, François; Rauffet, Gaelle; Dehais, Patrice; Klopp, Christophe

    2011-01-01

    Expression microarrays are commonly used to study transcriptomes. Most of the arrays are now based on oligo-nucleotide probes. Probe design being a tedious task, it often takes place once at the beginning of the project. The oligo set is then used for several years. During this time period, the knowledge gathered by the community on the genome and the transcriptome increases and gets more precise. Therefore re-annotating the set is essential to supply the biologists with up-to-date annotations. SigReannot-mart is a query environment populated with regularly updated annotations for different oligo sets. It stores the results of the SigReannot pipeline that has mainly been used on farm and aquaculture species. It permits easy extraction in different formats using filters. It is used to compare probe sets on different criteria, to choose the set for a given experiment to mix probe sets in order to create a new one.

  13. Single scan parameterization of space-variant point spread functions in image space via a printed array: the impact for two PET/CT scanners.

    PubMed

    Kotasidis, F A; Matthews, J C; Angelis, G I; Noonan, P J; Jackson, A; Price, P; Lionheart, W R; Reader, A J

    2011-05-21

    Incorporation of a resolution model during statistical image reconstruction often produces images of improved resolution and signal-to-noise ratio. A novel and practical methodology to rapidly and accurately determine the overall emission and detection blurring component of the system matrix using a printed point source array within a custom-made Perspex phantom is presented. The array was scanned at different positions and orientations within the field of view (FOV) to examine the feasibility of extrapolating the measured point source blurring to other locations in the FOV and the robustness of measurements from a single point source array scan. We measured the spatially-variant image-based blurring on two PET/CT scanners, the B-Hi-Rez and the TruePoint TrueV. These measured spatially-variant kernels and the spatially-invariant kernel at the FOV centre were then incorporated within an ordinary Poisson ordered subset expectation maximization (OP-OSEM) algorithm and compared to the manufacturer's implementation using projection space resolution modelling (RM). Comparisons were based on a point source array, the NEMA IEC image quality phantom, the Cologne resolution phantom and two clinical studies (carbon-11 labelled anti-sense oligonucleotide [(11)C]-ASO and fluorine-18 labelled fluoro-l-thymidine [(18)F]-FLT). Robust and accurate measurements of spatially-variant image blurring were successfully obtained from a single scan. Spatially-variant resolution modelling resulted in notable resolution improvements away from the centre of the FOV. Comparison between spatially-variant image-space methods and the projection-space approach (the first such report, using a range of studies) demonstrated very similar performance with our image-based implementation producing slightly better contrast recovery (CR) for the same level of image roughness (IR). These results demonstrate that image-based resolution modelling within reconstruction is a valid alternative to projection-based modelling, and that, when using the proposed practical methodology, the necessary resolution measurements can be obtained from a single scan. This approach avoids the relatively time-consuming and involved procedures previously proposed in the literature.

  14. ASSESSING THE USE OF OLIGONUCLEOTIDE MICROARRAYS FOR FATHEAD MINNOW (PIMEPHALES PROMELAS) TO EXAMINE EXPOSURE VARIABLES

    EPA Science Inventory

    Microarray technology has proven to be a useful tool for analyzing the transcriptome of various organisms representing conditions such as disease states, developmental stages, and responses to chemical exposure. Although most commercially available arrays are limited to organism...

  15. Development and characterization of a microheater array device for real-time DNA mutation detection

    NASA Astrophysics Data System (ADS)

    Williams, Layne; Okandan, Murat; Chagovetz, Alex; Blair, Steve

    2008-04-01

    DNA analysis, specifically single nucleotide polymorphism (SNP) detection, is becoming increasingly important in rapid diagnostics and disease detection. Temperature is often controlled to help speed reaction rates and perform melting of hybridized oligonucleotides. The difference in melting temperatures, Tm, between wild-type and SNP sequences, respectively, to a given probe oligonucleotide, is indicative of the specificity of the reaction. We have characterized Tm's in solution and on a solid substrate of three sequences from known mutations associated with Cystic Fibrosis. Taking advantage of Tm differences, a microheater array device was designed to enable individual temperature control of up to 18 specific hybridization events. The device was fabricated at Sandia National Laboratories using surface micromachining techniques. The microheaters have been characterized using an IR camera at Sandia and show individual temperature control with minimal thermal cross talk. Development of the device as a real-time DNA detection platform, including surface chemistry and associated microfluidics, is described.

  16. Development and characterization of a microheater array device for real-time DNA mutation detection

    NASA Astrophysics Data System (ADS)

    Williams, Layne; Okandan, Murat; Chagovetz, Alex; Blair, Steve

    2008-02-01

    DNA analysis, specifically single nucleotide polymorphism (SNP) detection, is becoming increasingly important in rapid diagnostics and disease detection. Temperature is often controlled to help speed reaction rates and perform melting of hybridized oligonucleotides. The difference in melting temperatures, Tm, between wild-type and SNP sequences, respectively, to a given probe oligonucleotide, is indicative of the specificity of the reaction. We have characterized Tm's in solution and on a solid substrate of three sequences from known mutations associated with Cystic Fibrosis. Taking advantage of Tm differences, a microheater array device was designed to enable individual temperature control of up to 18 specific hybridization events. The device was fabricated at Sandia National Laboratories using surface micromachining techniques. The microheaters have been characterized using an IR camera at Sandia and show individual temperature control with minimal thermal cross talk. Development of the device as a real-time DNA detection platform, including surface chemistry and associated microfluidics, is described.

  17. Recommendations of the Oligonucleotide Safety Working Group's Formulated Oligonucleotide Subcommittee for the Safety Assessment of Formulated Oligonucleotide-Based Therapeutics.

    PubMed

    Marlowe, Jennifer L; Akopian, Violetta; Karmali, Priya; Kornbrust, Douglas; Lockridge, Jennifer; Semple, Sean

    2017-08-01

    The use of lipid formulations has greatly improved the ability to effectively deliver oligonucleotides and has been instrumental in the rapid expansion of therapeutic development programs using oligonucleotide drugs. However, the development of such complex multicomponent therapeutics requires the implementation of unique, scientifically sound approaches to the nonclinical development of these drugs, based upon a hybrid of knowledge and experiences drawn from small molecule, protein, and oligonucleotide therapeutic drug development. The relative paucity of directly applicable regulatory guidance documents for oligonucleotide therapeutics in general has resulted in the generation of multiple white papers from oligonucleotide drug development experts and members of the Oligonucleotide Safety Working Group (OSWG). The members of the Formulated Oligonucleotide Subcommittee of the OSWG have utilized their collective experience working with a variety of formulations and their associated oligonucleotide payloads, as well as their insights into regulatory considerations and expectations, to generate a series of consensus recommendations for the pharmacokinetic characterization and nonclinical safety assessment of this unique class of therapeutics. It should be noted that the focus of Subcommittee discussions was on lipid nanoparticle and other types of particulate formulations of therapeutic oligonucleotides and not on conjugates or other types of modifications of oligonucleotide structure intended to facilitate delivery.

  18. An oral oligonucleotide delivery system based on a thiolated polymer: Development and in vitro evaluation.

    PubMed

    Martien, Ronny; Hoyer, Herbert; Perera, Glen; Schnürch, Andreas Bernkop

    2011-08-01

    The purpose of this study was to develop and evaluate an oral oligonucleotide delivery system based on a thiolated polymer/reduced glutathione (GSH) system providing a protective effect toward nucleases and permeation enhancement. A polycarbophil-cysteine conjugate (PCP-Cys) was synthesized. Enzymatic degradation of a model oligonucleotide by DNase I and within freshly collected intestinal fluid was investigated in the absence and presence of PCP-Cys. Permeation studies with PCP-Cys/GSH versus control were performed in vitro on Caco-2 cell monolayers and ex vivo on rat intestinal mucosa. PCP-Cys displayed 223 ± 13.8 μmol thiol groups per gram polymer. After 4h, 61% of the free oligonucleotides were degraded by DNase I and 80% within intestinal fluid. In contrast, less than 41% (DNase I) and 60% (intestinal fluid) were degraded in the presence of 0.02% (m/v) PCP-Cys. Permeation studies revealed an 8-fold (Caco-2) and 10-fold (intestinal mucosa) increase in apparent permeability compared to buffer control. Hence, this PCP-Cys/GSH system might be a promising tool for the oral administration of oligonucleotides as it allows a significant protection toward degrading enzymes and facilitates their transport across intestinal membranes. Copyright © 2011 Elsevier B.V. All rights reserved.

  19. Multienzyme-nanoparticles amplification for sensitive virus genotyping in microfluidic microbeads array using Au nanoparticle probes and quantum dots as labels.

    PubMed

    Zhang, He; Liu, Lian; Li, Cheuk-Wing; Fu, Huayang; Chen, Yao; Yang, Mengsu

    2011-11-15

    A novel microfluidic device with microbeads array was developed and sensitive genotyping of human papillomavirus was demonstrated using a multiple-enzyme labeled oligonucleotide-Au nanoparticle bioconjugate as the detection tool. This method utilizes microbeads as sensing platform that was functionalized with the capture probes and modified electron rich proteins, and uses the horseradish peroxidase (HRP)-functionalized gold nanoparticles as label with a secondary DNA probe. The functionalized microbeads were independently introduced into the arrayed chambers using the loading chip slab. A single channel was used to generate weir structures to confine the microbeads and make the beads array accessible by microfluidics. Through "sandwich" hybridization, the enzyme-functionalized Au nanoparticles labels were brought close to the surface of microbeads. The oxidation of biotin-tyramine by hydrogen peroxide resulted in the deposition of multiple biotin moieties onto the surface of beads. This deposition is markedly increased in the presence of immobilized electron rich proteins. Streptavidin-labeled quantum dots were then allowed to bind to the deposited biotin moieties and displayed the signal. Enhanced detection sensitivity was achieved where the large surface area of Au nanoparticle carriers increased the amount HRP bound per sandwiched hybridization. The on-chip genotyping method could discriminate as low as 1fmol/L (10zmol/chip, SNR>3) synthesized HPV oligonucleotides DNA. The chip-based signal enhancement of the amplified assay resulted in 1000 times higher sensitivity than that of off-chip test. In addition, this on-chip format could discriminate and genotype 10copies/μL HPV genomic DNA using the PCR products. These results demonstrated that this on-chip approach can achieve highly sensitive detection and genotyping of target DNA and can be further developed for detection of disease-related biomolecules at the lowest level at their earliest incidence. Copyright © 2011 Elsevier B.V. All rights reserved.

  20. Gene chips and arrays revealed: a primer on their power and their uses.

    PubMed

    Watson, S J; Akil, H

    1999-03-01

    This article provides an overview and general explanation of the rapidly developing area of gene chips and expression array technology. These are methods targeted at allowing the simultaneous study of thousands of genes or messenger RNAs under various physiological and pathological states. Their technical basis grows from the Human Genome Project. Both methods place DNA strands on glass computer chips (or microscope slides). Expression arrays start with complementary DNA (cDNA) clones derived from the EST data base, whereas Gene Chips synthesize oligonucleotides directly on the chip itself. Both are analyzed using image analysis systems, are capable of reading values from two different individuals at any one site, and can yield quantitative data for thousands of genes or mRNAs per slide. These methods promise to revolutionize molecular biology, cell biology, neuroscience and psychiatry. It is likely that this technology will radically open up our ability to study the actions and structure of the multiple genes involved in the complex genetics of brain disorders.

  1. Combined array CGH plus SNP genome analyses in a single assay for optimized clinical testing

    PubMed Central

    Wiszniewska, Joanna; Bi, Weimin; Shaw, Chad; Stankiewicz, Pawel; Kang, Sung-Hae L; Pursley, Amber N; Lalani, Seema; Hixson, Patricia; Gambin, Tomasz; Tsai, Chun-hui; Bock, Hans-Georg; Descartes, Maria; Probst, Frank J; Scaglia, Fernando; Beaudet, Arthur L; Lupski, James R; Eng, Christine; Wai Cheung, Sau; Bacino, Carlos; Patel, Ankita

    2014-01-01

    In clinical diagnostics, both array comparative genomic hybridization (array CGH) and single nucleotide polymorphism (SNP) genotyping have proven to be powerful genomic technologies utilized for the evaluation of developmental delay, multiple congenital anomalies, and neuropsychiatric disorders. Differences in the ability to resolve genomic changes between these arrays may constitute an implementation challenge for clinicians: which platform (SNP vs array CGH) might best detect the underlying genetic cause for the disease in the patient? While only SNP arrays enable the detection of copy number neutral regions of absence of heterozygosity (AOH), they have limited ability to detect single-exon copy number variants (CNVs) due to the distribution of SNPs across the genome. To provide comprehensive clinical testing for both CNVs and copy-neutral AOH, we enhanced our custom-designed high-resolution oligonucleotide array that has exon-targeted coverage of 1860 genes with 60 000 SNP probes, referred to as Chromosomal Microarray Analysis – Comprehensive (CMA-COMP). Of the 3240 cases evaluated by this array, clinically significant CNVs were detected in 445 cases including 21 cases with exonic events. In addition, 162 cases (5.0%) showed at least one AOH region >10 Mb. We demonstrate that even though this array has a lower density of SNP probes than other commercially available SNP arrays, it reliably detected AOH events >10 Mb as well as exonic CNVs beyond the detection limitations of SNP genotyping. Thus, combining SNP probes and exon-targeted array CGH into one platform provides clinically useful genetic screening in an efficient manner. PMID:23695279

  2. Optimised laser microdissection of the human ocular surface epithelial regions for microarray studies

    PubMed Central

    2013-01-01

    Background The most important challenge of performing insitu transcriptional profiling of the human ocular surface epithelial regions is obtaining samples in sufficient amounts, without contamination from adjacent tissue, as the region of interest is microscopic and closely apposed to other tissues regions. We have effectively collected ocular surface (OS) epithelial tissue samples from the Limbal Epithelial Crypt (LEC), limbus, cornea and conjunctiva of post-mortem cadaver eyes with laser microdissection (LMD) technique for gene expression studies with spotted oligonucleotide microarrays and Gene 1.0 ST arrays. Methods Human donor eyes (4 pairs for spotted oligonucleotide microarrays, 3 pairs for Gene 1.0 ST arrays) consented for research were included in this study with due ethical approval of the Nottingham Research Ethics Committee. Eye retrieval was performed within 36 hours of post-mortem period. The dissected corneoscleral buttons were immersed in OCT media and frozen in liquid nitrogen and stored at −80°C till further use. Microscopic tissue sections of interest were taken on PALM slides and stained with Toluidine Blue for laser microdissection with PALM microbeam systems. Optimisation of the laser microdissection technique was crucial for efficient and cost effective sample collection. Results The starting concentration of RNA as stipulated by the protocol of microarray platforms was taken as the cut-off concentration of RNA samples in our studies. The area of LMD tissue processed for spotted oligonucleotide microarray study ranged from 86,253 μm2 in LEC to 392,887 μm2 in LEC stroma. The RNA concentration of the LMD samples ranged from 22 to 92 pg/μl. The recommended starting concentration of the RNA samples used for Gene 1.0 ST arrays was 6 ng/5 μl. To achieve the desired RNA concentration the area of ocular surface epithelial tissue sample processed for the Gene 1.0 ST array experiments was approximately 100,0000 μm2 to 130,0000 μm2. RNA concentration of these samples ranged from 10.88 ng/12 μl to 25.8 ng/12 μl, with the RNA integrity numbers (RIN) for these samples from 3.3 to 7.9. RNA samples with RIN values below 2, that had failed to amplify satisfactorily were discarded. Conclusions The optimised protocol for sample collection and laser microdissection improved the RNA yield of the insitu ocular surface epithelial regions for effective microarray studies on spotted oligonucleotide and affymetrix platforms. PMID:24160452

  3. Pentopyranosyl Oligonucleotide Systems. Part 11: Systems with Shortened Backbones: D)-beta-Ribopyranosyl-(4 yields 3 )- and (L)-alpha - Lyxopyranosyl-(4 yields 3 )-oligonucleotides

    NASA Technical Reports Server (NTRS)

    Wippo, Harald; Reck, Folkert; Kudick, Rene; Ramaseshan, Mahesh; Ceulemans, Griet; Bolli, Martin; Krishnamurthy, Ramanarayanan; Eschenmoser, Albert

    2001-01-01

    The (L)-a-lyxopyranosyl-(4'yields 3')-oligonucleotide system-a member of a pentopyranosyl oligonucleotide family containing a shortened backbone-is capable of cooperative base-pairing and of cross-pairing with DNA and RNA. In contrast, corresponding (D)-beta-ribopyransoyl-(4' yields 3')-oligonucleotides do not show base-pairing under similar conditions. We conclude that oligonucleotide systems can violate the six-bonds-per-backbone-unit rule by having five bonds instead, if their vicinally bound phosphodiester bridges can assume an antiperiplanar conformation. An additional structural feature that seems relevant to the cross-pairing capability of the (L)-a-lyxopyranosyl-(4' yields 3')-oligonucleotide system is its (small) backbone/basepair axes inclination. An inclination which is similar to that in B-DNA seems to be a prerequisite for an oligonucleotide system s capability to cross-pair with DNA.

  4. DETECTING LOW-LEVEL SYNTHESIS IMPURITIES IN MODIFIED PHOSPHOROTHIOATE OLIGONUCLEOTIDES USING LIQUID CHROMATOGRAPHY – HIGH RESOLUTION MASS SPECTROMETRY

    PubMed Central

    Nikcevic, Irena; Wyrzykiewicz, Tadeusz K.; Limbach, Patrick A.

    2010-01-01

    Summary An LC-MS method based on the use of high resolution Fourier transform ion cyclotron resonance mass spectrometry (FTIRCMS) for profiling oligonucleotides synthesis impurities is described. Oligonucleotide phosphorothioatediesters (phosphorothioate oligonucleotides), in which one of the non-bridging oxygen atoms at each phosphorus center is replaced by a sulfur atom, are now one of the most popular oligonucleotide modifications due to their ease of chemical synthesis and advantageous pharmacokinetic properties. Despite significant progress in the solid-phase oligomerization chemistry used in the manufacturing of these oligonucleotides, multiple classes of low-level impurities always accompany synthetic oligonucleotides. Liquid chromatography-mass spectrometry has emerged as a powerful technique for the identification of these synthesis impurities. However, impurity profiling, where the entire complement of low-level synthetic impurities is identified in a single analysis, is more challenging. Here we present an LC-MS method based the use of high resolution-mass spectrometry, specifically Fourier transform ion cyclotron resonance mass spectrometry (FTIRCMS or FTMS). The optimal LC-FTMS conditions, including the stationary phase and mobile phases for the separation and identification of phosphorothioate oligonucleotides, were found. The characteristics of FTMS enable charge state determination from single m/z values of low-level impurities. Charge state information then enables more accurate modeling of the detected isotopic distribution for identification of the chemical composition of the detected impurity. Using this approach, a number of phosphorothioate impurities can be detected by LC-FTMS including failure sequences carrying 3′-terminal phosphate monoester and 3′-terminal phosphorothioate monoester, incomplete backbone sulfurization and desulfurization products, high molecular weight impurities, and chloral, isobutyryl, and N3 (2-cyanoethyl) adducts of the full length product. When compared with low resolution LC-MS, ~60% more impurities can be identified when charge state and isotopic distribution information is available and used for impurity profiling. PMID:21811394

  5. Oligonucleotide-based biosensors for in vitro diagnostics and environmental hazard detection.

    PubMed

    Jung, Il Young; Lee, Eun Hee; Suh, Ah Young; Lee, Seung Jin; Lee, Hyukjin

    2016-04-01

    Oligonucleotide-based biosensors have drawn much attention because of their broad applications in in vitro diagnostics and environmental hazard detection. They are particularly of interest to many researchers because of their high specificity as well as excellent sensitivity. Recently, oligonucleotide-based biosensors have been used to achieve not only genetic detection of targets but also the detection of small molecules, peptides, and proteins. This has further broadened the applications of these sensors in the medical and health care industry. In this review, we highlight various examples of oligonucleotide-based biosensors for the detection of diseases, drugs, and environmentally hazardous chemicals. Each example is provided with detailed schematics of the detection mechanism in addition to the supporting experimental results. Furthermore, future perspectives and new challenges in oligonucleotide-based biosensors are discussed.

  6. Heterologous oligonucleotide microarrays for transcriptomics in a non-model species; a proof-of-concept study of drought stress in Musa

    PubMed Central

    Davey, Mark W; Graham, Neil S; Vanholme, Bartel; Swennen, Rony; May, Sean T; Keulemans, Johan

    2009-01-01

    Background 'Systems-wide' approaches such as microarray RNA-profiling are ideally suited to the study of the complex overlapping responses of plants to biotic and abiotic stresses. However, commercial microarrays are only available for a limited number of plant species and development costs are so substantial as to be prohibitive for most research groups. Here we evaluate the use of cross-hybridisation to Affymetrix oligonucleotide GeneChip® microarrays to profile the response of the banana (Musa spp.) leaf transcriptome to drought stress using a genomic DNA (gDNA)-based probe-selection strategy to improve the efficiency of detection of differentially expressed Musa transcripts. Results Following cross-hybridisation of Musa gDNA to the Rice GeneChip® Genome Array, ~33,700 gene-specific probe-sets had a sufficiently high degree of homology to be retained for transcriptomic analyses. In a proof-of-concept approach, pooled RNA representing a single biological replicate of control and drought stressed leaves of the Musa cultivar 'Cachaco' were hybridised to the Affymetrix Rice Genome Array. A total of 2,910 Musa gene homologues with a >2-fold difference in expression levels were subsequently identified. These drought-responsive transcripts included many functional classes associated with plant biotic and abiotic stress responses, as well as a range of regulatory genes known to be involved in coordinating abiotic stress responses. This latter group included members of the ERF, DREB, MYB, bZIP and bHLH transcription factor families. Fifty-two of these drought-sensitive Musa transcripts were homologous to genes underlying QTLs for drought and cold tolerance in rice, including in 2 instances QTLs associated with a single underlying gene. The list of drought-responsive transcripts also included genes identified in publicly-available comparative transcriptomics experiments. Conclusion Our results demonstrate that despite the general paucity of nucleotide sequence data in Musa and only distant phylogenetic relations to rice, gDNA probe-based cross-hybridisation to the Rice GeneChip® is a highly promising strategy to study complex biological responses and illustrates the potential of such strategies for gene discovery in non-model species. PMID:19758430

  7. Correction of Spatial Bias in Oligonucleotide Array Data

    PubMed Central

    Lemieux, Sébastien

    2013-01-01

    Background. Oligonucleotide microarrays allow for high-throughput gene expression profiling assays. The technology relies on the fundamental assumption that observed hybridization signal intensities (HSIs) for each intended target, on average, correlate with their target's true concentration in the sample. However, systematic, nonbiological variation from several sources undermines this hypothesis. Background hybridization signal has been previously identified as one such important source, one manifestation of which appears in the form of spatial autocorrelation. Results. We propose an algorithm, pyn, for the elimination of spatial autocorrelation in HSIs, exploiting the duality of desirable mutual information shared by probes in a common probe set and undesirable mutual information shared by spatially proximate probes. We show that this correction procedure reduces spatial autocorrelation in HSIs; increases HSI reproducibility across replicate arrays; increases differentially expressed gene detection power; and performs better than previously published methods. Conclusions. The proposed algorithm increases both precision and accuracy, while requiring virtually no changes to users' current analysis pipelines: the correction consists merely of a transformation of raw HSIs (e.g., CEL files for Affymetrix arrays). A free, open-source implementation is provided as an R package, compatible with standard Bioconductor tools. The approach may also be tailored to other platform types and other sources of bias. PMID:23573083

  8. Improved DNA hybridization parameters by Twisted Intercalating Nucleic Acid (TINA).

    PubMed

    Schneider, Uffe Vest

    2012-01-01

    This thesis establishes oligonucleotide design rules and applications of a novel group of DNA stabilizing molecules collectively called Twisted Intercalating Nucleic Acid - TINA. Three peer-reviewed publications form the basis for the thesis. One publication describes an improved and rapid method for determination of DNA melting points and two publications describe the effects of positioning TINA molecules in parallel triplex helix and antiparallel duplex helix forming DNA structures. The third publication establishes that TINA molecules containing oligonucleotides improve an antiparallel duplex hybridization based capture assay's analytical sensitivity compared to conventionel DNA oligonucleotides. Clinical microbiology is traditionally based on pathogenic microorganisms' culture and serological tests. The introduction of DNA target amplification methods like PCR has improved the analytical sensitivity and total turn around time involved in clinical diagnostics of infections. Due to the relatively weak hybridization between the two strands of double stranded DNA, a number of nucleic acid stabilizing molecules have been developed to improve the sensitivity of DNA based diagnostics through superior binding properties. A short introduction is given to Watson-Crick and Hoogsteen based DNA binding and the derived DNA structures. A number of other nucleic acid stabilizing molecules are described. The stabilizing effect of TINA molecules on different DNA structures is discussed and considered in relation to other nucleic acid stabilizing molecules and in relation to future use of TINA containing oligonucleotides in clinical diagnostics and therapy. In conclusion, design of TINA modified oligonucleotides for antiparallel duplex helixes and parallel triplex helixes follows simple purpose dependent rules. TINA molecules are well suited for improving multiplex PCR assays and can be used as part of novel technologies. Future research should test whether combinations of TINA molecules and other nucleic acid stabilizing molecules can increase analytical sensitivity whilst maintaining nucleobase mismatch discrimination in triplex helix based diagnostic assays.

  9. Genomic analysis using high density SNP based oligonucleotide arrays and MLPA provides a comprehensive analysis of INI1/SMARCB1 in malignant rhabdoid tumors

    PubMed Central

    Jackson, Eric M.; Sievert, Angela J.; Gai, Xiaowu; Hakonarson, Hakon; Judkins, Alexander R; Tooke, Laura; Perin, Juan Carlos; Xie, Hongbo; Shaikh, Tamim H.; Biegel, Jaclyn A.

    2009-01-01

    Translational Relevance Previous reports suggested that abnormalities of INI1 could be detected in 70–75% of malignant rhabdoid tumors. The mechanism of inactivation in the other 25% remained unclear. The goal of this study was to perform a high-resolution genomic analysis of a large series of rhabdoid tumors with the expectation of identifying additional loci related to the initiation or progression of these malignancies. We also developed a comprehensive set of assays, including a new MLPA assay, to interrogate the INI1 locus in 22q11.2. Intragenic deletions could be detected using the Illumina 550K Beadchip, whereas single exon deletions could be detected using MLPA. The current study demonstrates that with a multi-platform approach, alterations at the INI1 locus can be detected in almost all cases. Thus, appropriate molecular genetic testing can be used as an aid in the diagnosis and for treatment planning for most patients. Purpose A high-resolution genomic profiling and comprehensive targeted analysis of INI1/SMARCB1 of a large series of pediatric rhabdoid tumors was performed. The aim was to identify regions of copy number change and loss of heterozygosity that might pinpoint additional loci involved in the development or progression of rhabdoid tumors, and define the spectrum of genomic alterations of INI1 in this malignancy. Experimental Design A multi-platform approach, utilizing Illumina single nucleotide polymorphism (SNP) based oligonucleotide arrays, multiplex ligation dependent probe amplification (MLPA), fluorescence in situ hybridization (FISH), and coding sequence analysis was used to characterize genome wide copy number changes, loss of heterozygosity, and genomic alterations of INI1/SMARCB1 in a series of pediatric rhabdoid tumors. Results The bi-allelic alterations of INI1 that led to inactivation were elucidated in 50 of 51 tumors. INI1 inactivation was demonstrated by a variety of mechanisms, including deletions, mutations, and loss of heterozygosity. The results from the array studies highlighted the complexity of rearrangements of chromosome 22, compared to the low frequency of alterations involving the other chromosomes. Conclusions The results from the genome wide SNP-array analysis suggest that INI1 is the primary tumor suppressor gene involved in the development of rhabdoid tumors with no second locus identified. In addition, we did not identify hot spots for the breakpoints in sporadic tumors with deletions of chromosome 22q11.2. By employing a multimodality approach, the wide spectrum of alterations of INI1 can be identified in the majority of patients, which increases the clinical utility of molecular diagnostic testing. PMID:19276269

  10. MicroRNA profiling of the murine hematopoietic system

    PubMed Central

    Monticelli, Silvia; Ansel, K Mark; Xiao, Changchun; Socci, Nicholas D; Krichevsky, Anna M; Thai, To-Ha; Rajewsky, Nikolaus; Marks, Debora S; Sander, Chris; Rajewsky, Klaus; Rao, Anjana; Kosik, Kenneth S

    2005-01-01

    Background MicroRNAs (miRNAs) are a class of recently discovered noncoding RNA genes that post-transcriptionally regulate gene expression. It is becoming clear that miRNAs play an important role in the regulation of gene expression during development. However, in mammals, expression data are principally based on whole tissue analysis and are still very incomplete. Results We used oligonucleotide arrays to analyze miRNA expression in the murine hematopoietic system. Complementary oligonucleotides capable of hybridizing to 181 miRNAs were immobilized on a membrane and probed with radiolabeled RNA derived from low molecular weight fractions of total RNA from several different hematopoietic and neuronal cells. This method allowed us to analyze cell type-specific patterns of miRNA expression and to identify miRNAs that might be important for cell lineage specification and/or cell effector functions. Conclusion This is the first report of systematic miRNA gene profiling in cells of the hematopoietic system. As expected, miRNA expression patterns were very different between hematopoietic and non-hematopoietic cells, with further subtle differences observed within the hematopoietic group. Interestingly, the most pronounced similarities were observed among fully differentiated effector cells (Th1 and Th2 lymphocytes and mast cells) and precursors at comparable stages of differentiation (double negative thymocytes and pro-B cells), suggesting that in addition to regulating the process of commitment to particular cellular lineages, miRNAs might have an important general role in the mechanism of cell differentiation and maintenance of cell identity. PMID:16086853

  11. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Farahani, Poupak; Chiu, Sally; Bowlus, Christopher L.

    Obesity is a complex disease. To date, over 100 chromosomal loci for body weight, body fat, regional white adipose tissue weight, and other obesity-related traits have been identified in humans and in animal models. For most loci, the underlying genes are not yet identified; some of these chromosomal loci will be alleles of known obesity genes, whereas many will represent alleles of unknown genes. Microarray analysis allows simultaneous multiple gene and pathway discovery. cDNA and oligonucleotide arrays are commonly used to identify differentially expressed genes by surveys of large numbers of known and unnamed genes. Two papers previously identified genesmore » differentially expressed in adipose tissue of mouse models of obesity and diabetes by analysis of hybridization to Affymetrix oligonucleotide chips.« less

  12. Direct detection of a BRAF mutation in total RNA from melanoma cells using cantilever arrays

    NASA Astrophysics Data System (ADS)

    Huber, F.; Lang, H. P.; Backmann, N.; Rimoldi, D.; Gerber, Ch.

    2013-02-01

    Malignant melanoma, the deadliest form of skin cancer, is characterized by a predominant mutation in the BRAF gene. Drugs that target tumours carrying this mutation have recently entered the clinic. Accordingly, patients are routinely screened for mutations in this gene to determine whether they can benefit from this type of treatment. The current gold standard for mutation screening uses real-time polymerase chain reaction and sequencing methods. Here we show that an assay based on microcantilever arrays can detect the mutation nanomechanically without amplification in total RNA samples isolated from melanoma cells. The assay is based on a BRAF-specific oligonucleotide probe. We detected mutant BRAF at a concentration of 500 pM in a 50-fold excess of the wild-type sequence. The method was able to distinguish melanoma cells carrying the mutation from wild-type cells using as little as 20 ng µl-1 of RNA material, without prior PCR amplification and use of labels.

  13. Optical properties and electronic transitions of DNA oligonucleotides as a function of composition and stacking sequence.

    PubMed

    Schimelman, Jacob B; Dryden, Daniel M; Poudel, Lokendra; Krawiec, Katherine E; Ma, Yingfang; Podgornik, Rudolf; Parsegian, V Adrian; Denoyer, Linda K; Ching, Wai-Yim; Steinmetz, Nicole F; French, Roger H

    2015-02-14

    The role of base pair composition and stacking sequence in the optical properties and electronic transitions of DNA is of fundamental interest. We present and compare the optical properties of DNA oligonucleotides (AT)10, (AT)5(GC)5, and (AT-GC)5 using both ab initio methods and UV-vis molar absorbance measurements. Our data indicate a strong dependence of both the position and intensity of UV absorbance features on oligonucleotide composition and stacking sequence. The partial densities of states for each oligonucleotide indicate that the valence band edge arises from a feature associated with the PO4(3-) complex anion, and the conduction band edge arises from anti-bonding states in DNA base pairs. The results show a strong correspondence between the ab initio and experimentally determined optical properties. These results highlight the benefit of full spectral analysis of DNA, as opposed to reductive methods that consider only the 260 nm absorbance (A260) or simple purity ratios, such as A260/A230 or A260/A280, and suggest that the slope of the absorption edge onset may provide a useful metric for the degree of base pair stacking in DNA. These insights may prove useful for applications in biology, bioelectronics, and mesoscale self-assembly.

  14. Oligonucleotide assisted light-emitting Alq3 microrods: energy transfer effect with fluorescent dyes.

    PubMed

    Cui, Chunzhi; Park, Dong Hyuk; Kim, Jeongyong; Joo, Jinsoo; Ahn, Dong June

    2013-06-14

    Oligonucleotide assisted tri(8-hydroxyquinoline) aluminium (Alq3) microrods were prepared for the first time. When hybridized with oligonucleotide labeled by Cy3 fluorescent dye, a significant photoluminescence variation of the Alq3 microrods was observed due to Förster resonance energy transfer, unlike when Cy5-oligonucleotide was used. Versatile nucleotide manipulation would open up wider applications of Alq3-based materials, based on this fundamental observation.

  15. Functionalized bioengineered spider silk spheres improve nuclease resistance and activity of oligonucleotide therapeutics providing a strategy for cancer treatment.

    PubMed

    Kozlowska, Anna Karolina; Florczak, Anna; Smialek, Maciej; Dondajewska, Ewelina; Mackiewicz, Andrzej; Kortylewski, Marcin; Dams-Kozlowska, Hanna

    2017-09-01

    Cell-selective delivery and sensitivity to serum nucleases remain major hurdles to the clinical application of RNA-based oligonucleotide therapeutics, such as siRNA. Spider silk shows great potential as a biomaterial due to its biocompatibility and biodegradability. Self-assembling properties of silk proteins allow for processing into several different morphologies such as fibers, scaffolds, films, hydrogels, capsules and spheres. Moreover, bioengineering of spider silk protein sequences can functionalize silk by adding peptide moieties with specific features including binding or cell recognition domains. We demonstrated that modification of silk protein by adding the nucleic acid binding domain enabled the development of a novel oligonucleotide delivery system that can be utilized to improve pharmacokinetics of RNA-based therapeutics, such as CpG-siRNA. The MS2 bioengineered silk was functionalized with poly-lysine domain (KN) to generate hybrid silk MS2KN. CpG-siRNA efficiently bound to MS2KN in contrary to control MS2. Both MS2KN complexes and spheres protected CpG-siRNA from degradation by serum nucleases. CpG-siRNA molecules encapsulated into MS2KN spheres were efficiently internalized and processed by TLR9-positive macrophages. Importantly, CpG-STAT3siRNA loaded in silk spheres showed delayed and extended target gene silencing compared to naked oligonucleotides. The prolonged Stat3 silencing resulted in the more pronounced downregulation of interleukin 6 (IL-6), a proinflammatory cytokine and upstream activator of STAT3, which limits the efficacy of TLR9 immunostimulation. Our results demonstrate the feasibility of using spider silk spheres as a carrier of therapeutic nucleic acids. Moreover, the modified kinetic and activity of the CpG-STAT3siRNA embedded into silk spheres is likely to improve immunotherapeutic effects in vivo. We demonstrated that modification of silk protein by adding the nucleic acid binding domain enabled the development of a novel oligonucleotide delivery system that can be utilized to improve pharmacokinetics of RNA-based therapeutics. Although, the siRNA constructs have already given very promising results in the cancer therapy, the in vivo application of RNA-based oligonucleotide therapeutics still is limited due to their sensitivity to serum nucleases and some toxicity. We propose a carrier for RNA-based therapeutics that is made of bioengineered spider silk. We showed that functionalized bioengineered spider silk spheres not only protected RNA-based therapeutics from degradation by serum nucleases, but what is more important the embedding of siRNA into silk spheres delayed and extended target gene silencing compared with naked oligonucleotides. Moreover, we showed that plain silk spheres did not have unspecific effect on target gene levels proving not only to be non-cytotoxic but also very neutral vehicles in terms of TLR9/STAT3 activation in macrophages. We demonstrated advantages of novel delivery technology in safety and efficacy comparing with delivery of naked CpG-STAT3siRNA therapeutics. Copyright © 2017 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.

  16. The delivery of therapeutic oligonucleotides

    PubMed Central

    Juliano, Rudolph L.

    2016-01-01

    The oligonucleotide therapeutics field has seen remarkable progress over the last few years with the approval of the first antisense drug and with promising developments in late stage clinical trials using siRNA or splice switching oligonucleotides. However, effective delivery of oligonucleotides to their intracellular sites of action remains a major issue. This review will describe the biological basis of oligonucleotide delivery including the nature of various tissue barriers and the mechanisms of cellular uptake and intracellular trafficking of oligonucleotides. It will then examine a variety of current approaches for enhancing the delivery of oligonucleotides. This includes molecular scale targeted ligand-oligonucleotide conjugates, lipid- and polymer-based nanoparticles, antibody conjugates and small molecules that improve oligonucleotide delivery. The merits and liabilities of these approaches will be discussed in the context of the underlying basic biology. PMID:27084936

  17. Comparison of small molecules and oligonucleotides that target a toxic, non-coding RNA.

    PubMed

    Costales, Matthew G; Rzuczek, Suzanne G; Disney, Matthew D

    2016-06-01

    Potential RNA targets for chemical probes and therapeutic modalities are pervasive in the transcriptome. Oligonucleotide-based therapeutics are commonly used to target RNA sequence. Small molecules are emerging as a modality to target RNA structures selectively, but their development is still in its infancy. In this work, we compare the activity of oligonucleotides and several classes of small molecules that target the non-coding r(CCUG) repeat expansion (r(CCUG)(exp)) that causes myotonic dystrophy type 2 (DM2), an incurable disease that is the second-most common cause of adult onset muscular dystrophy. Small molecule types investigated include monomers, dimers, and multivalent compounds synthesized on-site by using RNA-templated click chemistry. Oligonucleotides investigated include phosphorothioates that cleave their target and vivo-morpholinos that modulate target RNA activity via binding. We show that compounds assembled on-site that recognize structure have the highest potencies amongst small molecules and are similar in potency to a vivo-morpholino modified oligonucleotide that targets sequence. These studies are likely to impact the design of therapeutic modalities targeting other repeats expansions that cause fragile X syndrome and amyotrophic lateral sclerosis, for example. Copyright © 2016. Published by Elsevier Ltd.

  18. ChIP-chip.

    PubMed

    Kim, Tae Hoon; Dekker, Job

    2018-05-01

    ChIP-chip can be used to analyze protein-DNA interactions in a region-wide and genome-wide manner. DNA microarrays contain PCR products or oligonucleotide probes that are designed to represent genomic sequences. Identification of genomic sites that interact with a specific protein is based on competitive hybridization of the ChIP-enriched DNA and the input DNA to DNA microarrays. The ChIP-chip protocol can be divided into two main sections: Amplification of ChIP DNA and hybridization of ChIP DNA to arrays. A large amount of DNA is required to hybridize to DNA arrays, and hybridization to a set of multiple commercial arrays that represent the entire human genome requires two rounds of PCR amplifications. The relative hybridization intensity of ChIP DNA and that of the input DNA is used to determine whether the probe sequence is a potential site of protein-DNA interaction. Resolution of actual genomic sites bound by the protein is dependent on the size of the chromatin and on the genomic distance between the probes on the array. As with expression profiling using gene chips, ChIP-chip experiments require multiple replicates for reliable statistical measure of protein-DNA interactions. © 2018 Cold Spring Harbor Laboratory Press.

  19. Integrated high-resolution array CGH and SKY analysis of homozygous deletions and other genomic alterations present in malignant mesothelioma cell lines.

    PubMed

    Klorin, Geula; Rozenblum, Ester; Glebov, Oleg; Walker, Robert L; Park, Yoonsoo; Meltzer, Paul S; Kirsch, Ilan R; Kaye, Frederic J; Roschke, Anna V

    2013-05-01

    High-resolution oligonucleotide array comparative genomic hybridization (aCGH) and spectral karyotyping (SKY) were applied to a panel of malignant mesothelioma (MMt) cell lines. SKY has not been applied to MMt before, and complete karyotypes are reported based on the integration of SKY and aCGH results. A whole genome search for homozygous deletions (HDs) produced the largest set of recurrent and non-recurrent HDs for MMt (52 recurrent HDs in 10 genomic regions; 36 non-recurrent HDs). For the first time, LINGO2, RBFOX1/A2BP1, RPL29, DUSP7, and CCSER1/FAM190A were found to be homozygously deleted in MMt, and some of these genes could be new tumor suppressor genes for MMt. Integration of SKY and aCGH data allowed reconstruction of chromosomal rearrangements that led to the formation of HDs. Our data imply that only with acquisition of structural and/or numerical karyotypic instability can MMt cells attain a complete loss of tumor suppressor genes located in 9p21.3, which is the most frequently homozygously deleted region. Tetraploidization is a late event in the karyotypic progression of MMt cells, after HDs in the 9p21.3 region have already been acquired. Published by Elsevier Inc.

  20. Synthesis and fluorescence studies of multiple labeled oligonucleotides containing dansyl fluorophore covalently attached at 2'-terminus of cytidine via carbamate linkage.

    PubMed

    Misra, Arvind; Mishra, Satyendra; Misra, Krishna

    2004-01-01

    Synthesis of modified oligonucleotides in which the specific cytidine nucleoside analogues linked at 2'-OH position via a carbamate bond with an amino ethyl derivative of dansyl fluorophore is reported. For the multiple labeling of oligonucleotides, a strategy involving prelabeling at the monomeric level followed by solid phase assembly of oligonucleotides to obtain regiospecifically labeled probes has been described. The labeled monomer was phosphitylated using 2-cyanoethyl-N,N,N',N'-tetraisopropyl-phosphoramidite (Bis-reagent) and pyridiniumtrifluoro acetate (Py.TFA) as an activator. To ascertain the minimal number of labeled monomers required for a specific length of oligonucleotide for detection and also to assess the effect of carbamate linkage on hybridization, hexamer and 20-mer sequences were selected. Both were labeled with 1, 2, and 3 monomers at the 5'-end and hybridized with normal (unmodified) complementary sequences. As compared to midsequence or 3'-terminal labeling reported earlier, the 5'-terminal labeling has been found to have minimal contact-mediated quenching on duplex formation. This may be due to complementary deoxyguanosine (dG) rich oligonucleotide sequences or CG base pairs at a terminus that is known to yield stronger binding. This is one reason for selecting cytidine for labeling. The results may aid rational design of multiple fluorescent DNA probes for nonradioactive detection of nucleic acids.

  1. [Study toward practical use of oligonucleotide therapeutics].

    PubMed

    Inoue, Takao; Yoshida, Tokuyuki

    2014-01-01

    Over the past decade, oligonucleotide-based therapeutics such as antisense oligonucleotides and small interfering RNAs (siRNAs) have been developed extensively. For example, mipomersen (Kynamro; ISIS Pharmaceuticals), which is a second-generation antisense oligonucleotide administered by subcutaneous injection, has recently been approved by the FDA for the treatment of homozygous familial hypercholesterolemia. On the other hands, methods for the evaluation of quality, efficacy and safety of oligonucleotide therapeutics have not been fully discussed. Furthermore, the regulatory guidance specific for oligonucleotide therapeutics has not been established yet. Under these circumstances, we started to collaborate with Osaka University and PMDA to discuss regulatory science focused on oligonucleotide therapeutics. Through the collaboration, we would like to propose the possible design of quality evaluation and preclinical safety-evaluation of oligonucleotide therapeutics.

  2. Exploring optimization parameters to increase ssDNA recombineering in Lactococcus lactis and Lactobacillus reuteri

    PubMed Central

    van Pijkeren, Jan-Peter; Neoh, Kar Mun; Sirias, Denise; Findley, Anthony S.; Britton, Robert A.

    2012-01-01

    Single-stranded DNA (ssDNA) recombineering is a technology which is used to make subtle changes in the chromosome of several bacterial genera. Cells which express a single-stranded DNA binding protein (RecT or Bet) are transformed with an oligonucleotide which is incorporated via an annealing and replication-dependent mechanism. By in silico analysis we identified ssDNA binding protein homologs in the genus Lactobacillus and Lactococcus lactis. To assess whether we could further improve the recombineering efficiency in Lactobacillus reuteri ATCC PTA 6475 we expressed several RecT homologs in this strain. RecT derived from Enterococcus faecalis CRMEN 19 yielded comparable efficiencies compared with a native RecT protein, but none of the other proteins further increased the recombineering efficiency. We successfully improved recombineering efficiency 10-fold in L. lactis by increasing oligonucleotide concentration combined with the use of oligonucleotides containing phosphorothioate-linkages (PTOs). Surprisingly, neither increased oligonucleotide concentration nor PTO linkages enhanced recombineering in L. reuteri 6475. To emphasize the utility of this technology in improving probiotic features we modified six bases in a transcriptional regulatory element region of the pdu-operon of L. reuteri 6475, yielding a 3-fold increase in the production of the antimicrobial compound reuterin. Directed genetic modification of lactic acid bacteria through ssDNA recombineering will simplify strain improvement in a way that, when mutating a single base, is genetically indistinguishable from strains obtained through directed evolution. PMID:22750793

  3. Molecular identification of common Salmonella serovars using multiplex DNA sensor-based suspension array.

    PubMed

    Aydin, Muhsin; Carter-Conger, Jacqueline; Gao, Ning; Gilmore, David F; Ricke, Steven C; Ahn, Soohyoun

    2018-04-01

    Salmonella is one of major foodborne pathogens and the leading cause of foodborne illness-related hospitalizations and deaths. It is critical to develop a sensitive and rapid detection assay that can identify Salmonella to ensure food safety. In this study, a DNA sensor-based suspension array system of high multiplexing ability was developed to identify eight Salmonella serovars commonly associated with foodborne outbreaks to the serotype level. Each DNA sensor was prepared by activating pre-encoded microspheres with oligonucleotide probes that are targeting virulence genes and serovar-specific regions. The mixture of 12 different types of DNA sensors were loaded into a 96-well microplate and used as a 12-plex DNA sensor array platform. DNA isolated from Salmonella was amplified by multiplex polymerase chain reaction (mPCR), and the presence of Salmonella was determined by reading fluorescent signals from hybridization between probes on DNA sensors and fluorescently labeled target DNA using the Bio-Plex® system. The developed multiplex array was able to detect synthetic DNA at the concentration as low as 100 fM and various Salmonella serovars as low as 100 CFU/mL within 1 h post-PCR. Sensitivity of this assay was further improved to 1 CFU/mL with 6-h enrichment. The array system also correctly and specifically identified serotype of tested Salmonella strains without any cross-reactivity with other common foodborne pathogens. Our results indicate the developed DNA sensor suspension array can be a rapid and reliable high-throughput method for simultaneous detection and molecular identification of common Salmonella serotypes.

  4. miRNA-based therapies: Strategies and delivery platforms for oligonucleotide and non-oligonucleotide agents

    PubMed Central

    Baumann, V; Winkler, J

    2015-01-01

    The discovery of microRNAs as important regulatory agents for gene expression has expanded the therapeutic opportunities for oligonucleotides. In contrast to siRNA, miRNA-targeted therapy is able to influence not only a single gene, but entire cellular pathways or processes. It is possible to supplement down regulated or non-functional miRNAs by synthetic oligonucleotides, as well as alleviating effects caused by overexpression of malignant miRNAs through artificial antagonists, either oligonucleotides or small molecules. Chemical oligonucleotide modifications together with an efficient delivery system seem to be mandatory for successful therapeutic application. While miRNA-based therapy benefits from the decades of research spent on other therapeutic oligonucleotides, there are some specific challenges associated with miRNA therapy, mainly caused by the short target sequence. The current status and recent progress of miRNA-targeted therapeutics is described and future challenges and potential applications in treatment of cancer and viral infections are discussed. PMID:25495987

  5. Homogeneous versus heterogeneous probes for microbial ecological microarrays.

    PubMed

    Bae, Jin-Woo; Park, Yong-Ha

    2006-07-01

    Microbial ecological microarrays have been developed for investigating the composition and functions of microorganism communities in environmental niches. These arrays include microbial identification microarrays, which use oligonucleotides, gene fragments or microbial genomes as probes. In this article, the advantages and disadvantages of each type of probe are reviewed. Oligonucleotide probes are currently useful for probing uncultivated bacteria that are not amenable to gene fragment probing, whereas the functional gene fragments amplified randomly from microbial genomes require phylogenetic and hierarchical categorization before use as microbial identification probes, despite their high resolution for both specificity and sensitivity. Until more bacteria are sequenced and gene fragment probes are thoroughly validated, heterogeneous bacterial genome probes will provide a simple, sensitive and quantitative tool for exploring the ecosystem structure.

  6. Modification of antisense phosphodiester oligodeoxynucleotides by a 5' cholesteryl moiety increases cellular association and improves efficacy.

    PubMed

    Krieg, A M; Tonkinson, J; Matson, S; Zhao, Q; Saxon, M; Zhang, L M; Bhanja, U; Yakubov, L; Stein, C A

    1993-02-01

    Phosphodiester oligodeoxynucleotides bearing a 5' cholesteryl (chol) modification bind to low density lipoprotein (LDL), apparently by partitioning the chol-modified oligonucleotides into the lipid layer. Both HL60 cells and primary mouse spleen T and B cells incubated with fluorescently labeled chol-modified oligonucleotide showed substantially increased cellular association by flow cytometry and increased internalization by confocal microscopy compared to an identical molecule not bearing the chol group. Cellular internalization of chol-modified oligonucleotide occurred at least partially through the LDL receptor; it was increased in mouse spleen cells by cell culture in lipoprotein-deficient medium and/or lovastatin, and it was decreased by culture in high serum medium. To determine whether chol-modified oligonucleotides are more potent antisense agents, we titered antisense unmodified phosphodiester and chol-modified oligonucleotides targeted against a mouse immunosuppressive protein. Murine spleen cells cultured with 20 microM phosphodiester antisense oligonucleotides had a 2-fold increase in RNA synthesis, indicating the expected lymphocyte activation. Antisense chol-modified oligonucleotides showed an 8-fold increase in relative potency: they caused a 2-fold increase in RNA synthesis at just 2.5 microM. The increased efficacy was blocked by heparin and was further increased by cell culture in 1% (vs. 10%) fetal bovine serum, suggesting that the effect may, at least in part, be mediated via the LDL receptor. Antisense chol-modified oligonucleotides are sequence specific and have increased potency as compared to unmodified oligonucleotides.

  7. Current Status and Future Prospects for Aptamer-Based Mycotoxin Detection.

    PubMed

    Ruscito, Annamaria; Smith, McKenzie; Goudreau, Daniel N; DeRosa, Maria C

    2016-07-01

    Aptamers are single-stranded oligonucleotides with the ability to bind tightly and selectively to a target analyte. High-affinity and specific aptamers for a variety of mycotoxins have been reported over the past decade. Increasingly, these molecular recognition elements are finding applications in biosensors and assays for the detection of mycotoxins in a variety of complex matrixes. This review article highlights the mycotoxin aptamers that are available for mycotoxin detection and the array of biosensing platforms into which they have been incorporated. Key advantages that aptamers have over analogous technology, and areas in which these advantages may be applied for the benefit of practical mycotoxin detection, are also discussed.

  8. On-chip multiplexed solid-phase nucleic acid hybridization assay using spatial profiles of immobilized quantum dots and fluorescence resonance energy transfer.

    PubMed

    Noor, M Omair; Tavares, Anthony J; Krull, Ulrich J

    2013-07-25

    A microfluidic based solid-phase assay for the multiplexed detection of nucleic acid hybridization using quantum dot (QD) mediated fluorescence resonance energy transfer (FRET) is described herein. The glass surface of hybrid glass-polydimethylsiloxane (PDMS) microfluidic channels was chemically modified to assemble the biorecognition interface. Multiplexing was demonstrated using a detection system that was comprised of two colors of immobilized semi-conductor QDs and two different oligonucleotide probe sequences. Green-emitting and red-emitting QDs were paired with Cy3 and Alexa Fluor 647 (A647) labeled oligonucleotides, respectively. The QDs served as energy donors for the transduction of dye labeled oligonucleotide targets. The in-channel assembly of the biorecognition interface and the subsequent introduction of oligonucleotide targets was accomplished within minutes using a combination of electroosmotic flow and electrophoretic force. The concurrent quantification of femtomole quantities of two target sequences was possible by measuring the spatial coverage of FRET sensitized emission along the length of the channel. In previous reports, multiplexed QD-FRET hybridization assays that employed a ratiometric method for quantification had challenges associated with lower analytical sensitivity arising from both donor and acceptor dilution that resulted in reduced energy transfer pathways as compared to single-color hybridization assays. Herein, a spatial method for quantification that is based on in-channel QD-FRET profiles provided higher analytical sensitivity in the multiplexed assay format as compared to single-color hybridization assays. The selectivity of the multiplexed hybridization assays was demonstrated by discrimination between a fully-complementary sequence and a 3 base pair sequence at a contrast ratio of 8 to 1. Copyright © 2013 Elsevier B.V. All rights reserved.

  9. Oligonucleotide-based theranostic nanoparticles in cancer therapy

    PubMed Central

    Shahbazi, Reza; Ozpolat, Bulent; Ulubayram, Kezban

    2016-01-01

    Theranostic approaches, combining the functionality of both therapy and imaging, have shown potential in cancer nanomedicine. Oligonucleotides such as small interfering RNA and microRNA, which are powerful therapeutic agents, have been effectively employed in theranostic systems against various cancers. Nanoparticles are used to deliver oligonucleotides into tumors by passive or active targeting while protecting the oligonucleotides from nucleases in the extracellular environment. The use of quantum dots, iron oxide nanoparticles and gold nanoparticles and tagging with contrast agents, like fluorescent dyes, optical or magnetic agents and various radioisotopes, has facilitated early detection of tumors and evaluation of therapeutic efficacy. In this article, we review the advantages of theranostic applications in cancer therapy and imaging, with special attention to oligonucleotide-based therapeutics. PMID:27102380

  10. A method for high-throughput production of sequence-verified DNA libraries and strain collections.

    PubMed

    Smith, Justin D; Schlecht, Ulrich; Xu, Weihong; Suresh, Sundari; Horecka, Joe; Proctor, Michael J; Aiyar, Raeka S; Bennett, Richard A O; Chu, Angela; Li, Yong Fuga; Roy, Kevin; Davis, Ronald W; Steinmetz, Lars M; Hyman, Richard W; Levy, Sasha F; St Onge, Robert P

    2017-02-13

    The low costs of array-synthesized oligonucleotide libraries are empowering rapid advances in quantitative and synthetic biology. However, high synthesis error rates, uneven representation, and lack of access to individual oligonucleotides limit the true potential of these libraries. We have developed a cost-effective method called Recombinase Directed Indexing (REDI), which involves integration of a complex library into yeast, site-specific recombination to index library DNA, and next-generation sequencing to identify desired clones. We used REDI to generate a library of ~3,300 DNA probes that exhibited > 96% purity and remarkable uniformity (> 95% of probes within twofold of the median abundance). Additionally, we created a collection of ~9,000 individually accessible CRISPR interference yeast strains for > 99% of genes required for either fermentative or respiratory growth, demonstrating the utility of REDI for rapid and cost-effective creation of strain collections from oligonucleotide pools. Our approach is adaptable to any complex DNA library, and fundamentally changes how these libraries can be parsed, maintained, propagated, and characterized. © 2017 The Authors. Published under the terms of the CC BY 4.0 license.

  11. Tuning the Cavity Size and Chirality of Self-Assembling 3D DNA Crystals

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Simmons, Chad R.; Zhang, Fei; MacCulloch, Tara

    The foundational goal of structural DNA nanotechnology—the field that uses oligonucleotides as a molecular building block for the programmable self-assembly of nanostructured systems—was to use DNA to construct three-dimensional (3D) lattices for solving macromolecular structures. The programmable nature of DNA makes it an ideal system for rationally constructing self-assembled crystals and immobilizing guest molecules in a repeating 3D array through their specific stereospatial interactions with the scaffold. In this work, we have extended a previously described motif (4 × 5) by expanding the structure to a system that links four double-helical layers; we use a central weaving oligonucleotide containing amore » sequence of four six-base repeats (4 × 6), forming a matrix of layers that are organized and dictated by a series of Holliday junctions. In addition, we have assembled mirror image crystals (l-DNA) with the identical sequence that are completely resistant to nucleases. Bromine and selenium derivatives were obtained for the l- and d-DNA forms, respectively, allowing phase determination for both forms and solution of the resulting structures to 3.0 and 3.05 Å resolution. Both right- and left-handed forms crystallized in the trigonal space groups with mirror image 3-fold helical screw axes P32 and P31 for each motif, respectively. The structures reveal a highly organized array of discrete and well-defined cavities that are suitable for hosting guest molecules and allow us to dictate a priori the assembly of guest–DNA conjugates with a specified crystalline hand.« less

  12. DNA impedance biosensor for detection of cancer, TP53 gene mutation, based on gold nanoparticles/aligned carbon nanotubes modified electrode.

    PubMed

    Fayazfar, H; Afshar, A; Dolati, M; Dolati, A

    2014-07-11

    For the first time, a new platform based on electrochemical growth of Au nanoparticles on aligned multi-walled carbon nanotubes (A-MWCNT) was developed for sensitive lable-free DNA detection of the TP53 gene mutation, one of the most popular genes in cancer research. Electrochemical impedance spectroscopy (EIS) was used to monitor the sequence-specific DNA hybridization events related to TP53 gene. Compared to the bare Ta or MWCNT/Ta electrodes, the synergistic interactions of vertically aligned MWCNT array and gold nanoparticles at modified electrode could improve the density of the probe DNA attachment and resulting the sensitivity of the DNA sensor greatly. Using EIS, over the extended DNA concentration range, the change of charge transfer resistance was found to have a linear relationship in respect to the logarithm of the complementary oligonucleotides sequence concentrations in the wide range of 1.0×10(-15)-1.0×10(-7)M, with a detection limit of 1.0×10(-17)M (S/N=3). The prepared sensor also showed good stability (14 days), reproducibility (RSD=2.1%) and could be conveniently regenerated via dehybridization in hot water. The significant improvement in sensitivity illustrates that combining gold nanoparticles with the on-site fabricated aligned MWCNT array represents a promising platform for achieving sensitive biosensor for fast mutation screening related to most human cancer types. Copyright © 2014. Published by Elsevier B.V.

  13. Identification of a deep intronic mutation in the COL6A2 gene by a novel custom oligonucleotide CGH array designed to explore allelic and genetic heterogeneity in collagen VI-related myopathies

    PubMed Central

    2010-01-01

    Background Molecular characterization of collagen-VI related myopathies currently relies on standard sequencing, which yields a detection rate approximating 75-79% in Ullrich congenital muscular dystrophy (UCMD) and 60-65% in Bethlem myopathy (BM) patients as PCR-based techniques tend to miss gross genomic rearrangements as well as copy number variations (CNVs) in both the coding sequence and intronic regions. Methods We have designed a custom oligonucleotide CGH array in order to investigate the presence of CNVs in the coding and non-coding regions of COL6A1, A2, A3, A5 and A6 genes and a group of genes functionally related to collagen VI. A cohort of 12 patients with UCMD/BM negative at sequencing analysis and 2 subjects carrying a single COL6 mutation whose clinical phenotype was not explicable by inheritance were selected and the occurrence of allelic and genetic heterogeneity explored. Results A deletion within intron 1A of the COL6A2 gene, occurring in compound heterozygosity with a small deletion in exon 28, previously detected by routine sequencing, was identified in a BM patient. RNA studies showed monoallelic transcription of the COL6A2 gene, thus elucidating the functional effect of the intronic deletion. No pathogenic mutations were identified in the remaining analyzed patients, either within COL6A genes, or in genes functionally related to collagen VI. Conclusions Our custom CGH array may represent a useful complementary diagnostic tool, especially in recessive forms of the disease, when only one mutant allele is detected by standard sequencing. The intronic deletion we identified represents the first example of a pure intronic mutation in COL6A genes. PMID:20302629

  14. Functionalization of silicon oxide using supercritical fluid deposition of 3,4-epoxybutyltrimethoxysilane for the immobilization of amino-modified oligonucleotide

    NASA Astrophysics Data System (ADS)

    Rull, Jordi; Nonglaton, Guillaume; Costa, Guillaume; Fontelaye, Caroline; Marchi-Delapierre, Caroline; Ménage, Stéphane; Marchand, Gilles

    2015-11-01

    The functionalization of silicon oxide based substrates using silanes is generally performed through liquid phase methodologies. These processes involve a huge quantity of potentially toxic solvents and present some important disadvantages for the functionalization of microdevices or porous materials, for example the low diffusion. To overcome this drawback, solvent-free methodologies like molecular vapor deposition (MVD) or supercritical fluid deposition (SFD) have been developed. In this paper, the deposition process of 3,4-epoxybutyltrimethoxysilane (EBTMOS) on silicon oxide using supercritical carbon dioxide (scCO2) as a solvent is studied for the first time. The oxirane ring of epoxy silanes readily reacts with amine group and is of particular interest for the grafting of amino-modified oligonucleotides or antibodies for diagnostic application. Then the ability of this specific EBTMOS layer to react with amine functions has been evaluated using the immobilization of amino-modified oligonucleotide probes. The presence of the probes is revealed by fluorescence using hybridization with a fluorescent target oligonucleotide. The performances of SFD of EBTMOS have been optimized and then compared with the dip coating and molecular vapor deposition methods, evidencing a better grafting efficiency and homogeneity, a lower reaction time in addition to the eco-friendly properties of the supercritical carbon dioxide. The epoxysilane layers have been characterized by surface enhanced ellipsometric contrast optical technique, atomic force microscopy, multiple internal reflection infrared spectroscopy and X-ray photoelectron spectroscopy. The shelf life of the 3,4-epoxybutyltrimethoxysilane coating layer has also been studied. Finally, two different strategies of NH2-oligonucleotide grafting on EBTMOS coating layer have been compared, i.e. reductive amination and nucleophilic substitution, SN2. This EBTMOS based coating layer can be used for a wide range of applications such as the preparation of new supported and recoverable catalysts and new integrated silicon microdevices for healthcare purposes.

  15. Multichannel microchip electrophoresis device fabricated in polycarbonate with an integrated contact conductivity sensor array.

    PubMed

    Shadpour, Hamed; Hupert, Mateusz L; Patterson, Donald; Liu, Changgeng; Galloway, Michelle; Stryjewski, Wieslaw; Goettert, Jost; Soper, Steven A

    2007-02-01

    A 16-channel microfluidic chip with an integrated contact conductivity sensor array is presented. The microfluidic network consisted of 16 separation channels that were hot-embossed into polycarbonate (PC) using a high-precision micromilled metal master. All channels were 40 microm deep and 60 microm wide with an effective separation length of 40 mm. A gold (Au) sensor array was lithographically patterned onto a PC cover plate and assembled to the fluidic chip via thermal bonding in such a way that a pair of Au microelectrodes (60 microm wide with a 5 microm spacing) was incorporated into each of the 16 channels and served as independent contact conductivity detectors. The spacing between the corresponding fluidic reservoirs for each separation channel was set to 9 mm, which allowed for loading samples and buffers to all 40 reservoirs situated on the microchip in only five pipetting steps using an 8-channel pipettor. A printed circuit board (PCB) with platinum (Pt) wires was used to distribute the electrophoresis high-voltage to all reservoirs situated on the fluidic chip. Another PCB was used for collecting the conductivity signals from the patterned Au microelectrodes. The device performance was evaluated using microchip capillary zone electrophoresis (mu-CZE) of amino acid, peptide, and protein mixtures as well as oligonucleotides that were separated via microchip capillary electrochromatography (mu-CEC). The separations were performed with an electric field (E) of 90 V/cm and were completed in less than 4 min in all cases. The conductivity detection was carried out using a bipolar pulse voltage waveform with a pulse amplitude of +/-0.6 V and a frequency of 6.0 kHz. The conductivity sensor array concentration limit of detection (SNR = 3) was determined to be 7.1 microM for alanine. The separation efficiency was found to be 6.4 x 10(4), 2.0 x 10(3), 4.8 x 10(3), and 3.4 x 10(2) plates for the mu-CEC of the oligonucleotides and mu-CZE of the amino acids, peptides, and proteins, respectively, with an average channel-to-channel migration time reproducibility of 2.8%. The average resolution obtained for mu-CEC of the oligonucleotides and mu-CZE of the amino acids, peptides, and proteins was 4.6, 1.0, 0.9, and 1.0, respectively. To the best of our knowledge, this report is the first to describe a multichannel microchip electrophoresis device with integrated contact conductivity sensor array.

  16. A limited innate immune response is induced by a replication-defective herpes simplex virus vector following delivery to the murine central nervous system

    PubMed Central

    Zeier, Zane; Aguilar, J Santiago; Lopez, Cecilia M; Devi-Rao, G B; Watson, Zachary L; Baker, Henry V; Wagner, Edward K; Bloom, David C

    2010-01-01

    Herpes simplex virus type 1 (HSV-1)–based vectors readily transduce neurons and have a large payload capacity, making them particularly amenable to gene therapy applications within the central nervous system (CNS). Because aspects of the host responses to HSV-1 vectors in the CNS are largely unknown, we compared the host response of a nonreplicating HSV-1 vector to that of a replication-competent HSV-1 virus using microarray analysis. In parallel, HSV-1 gene expression was tracked using HSV-specific oligonucleotide-based arrays in order to correlate viral gene expression with observed changes in host response. Microarray analysis was performed following stereotactic injection into the right hippocampal formation of mice with either a replication-competent HSV-1 or a nonreplicating recombinant of HSV-1, lacking the ICP4 gene (ICP4−). Genes that demonstrated a significant change (P < .001) in expression in response to the replicating HSV-1 outnumbered those that changed in response to mock or nonreplicating vector by approximately 3-fold. Pathway analysis revealed that both the replicating and nonreplicating vectors induced robust antigen presentation but only mild interferon, chemokine, and cytokine signaling responses. The ICP4− vector was restricted in several of the Toll-like receptor-signaling pathways, indicating reduced stimulation of the innate immune response. These array analyses suggest that although the nonreplicating vector induces detectable activation of immune response pathways, the number and magnitude of the induced response is dramatically restricted compared to the replicating vector, and with the exception of antigen presentation, host gene expression induced by the non-replicating vector largely resembles mock infection. PMID:20095947

  17. Pharmacokinetic Profiling of Conjugated Therapeutic Oligonucleotides: A High-Throughput Method Based Upon Serial Blood Microsampling Coupled to Peptide Nucleic Acid Hybridization Assay.

    PubMed

    Godinho, Bruno M D C; Gilbert, James W; Haraszti, Reka A; Coles, Andrew H; Biscans, Annabelle; Roux, Loic; Nikan, Mehran; Echeverria, Dimas; Hassler, Matthew; Khvorova, Anastasia

    2017-12-01

    Therapeutic oligonucleotides, such as small interfering RNAs (siRNAs), hold great promise for the treatment of incurable genetically defined disorders by targeting cognate toxic gene products for degradation. To achieve meaningful tissue distribution and efficacy in vivo, siRNAs must be conjugated or formulated. Clear understanding of the pharmacokinetic (PK)/pharmacodynamic behavior of these compounds is necessary to optimize and characterize the performance of therapeutic oligonucleotides in vivo. In this study, we describe a simple and reproducible methodology for the evaluation of in vivo blood/plasma PK profiles and tissue distribution of oligonucleotides. The method is based on serial blood microsampling from the saphenous vein, coupled to peptide nucleic acid hybridization assay for quantification of guide strands. Performed with minimal number of animals, this method allowed unequivocal detection and sensitive quantification without the need for amplification, or further modification of the oligonucleotides. Using this methodology, we compared plasma clearances and tissue distribution profiles of two different hydrophobically modified siRNAs (hsiRNAs). Notably, cholesterol-hsiRNA presented slow plasma clearances and mainly accumulated in the liver, whereas, phosphocholine-docosahexaenoic acid-hsiRNA was rapidly cleared from the plasma and preferably accumulated in the kidney. These data suggest that the PK/biodistribution profiles of modified hsiRNAs are determined by the chemical nature of the conjugate. Importantly, the method described in this study constitutes a simple platform to conduct pilot assessments of the basic clearance and tissue distribution profiles, which can be broadly applied for evaluation of new chemical variants of siRNAs and micro-RNAs.

  18. Monovalent Streptavidin that Senses Oligonucleotides**

    PubMed Central

    Wang, Jingxian; Kostic, Natasa; Stojanovic, Milan N.

    2013-01-01

    We report a straightforward chemical route to monovalent streptavidin, a valuable reagent for imaging. The one-step process is based on a (tris)biotinylated-oligonucleotide blocking three of streptavidin’s four biotin binding sites. Further, the complex is highly sensitive to single-base differences - whereby perfectly matched oligonucleotides trigger dissociation of the biotin-streptavidin interaction at higher rates than single-base mismatches. Unique properties and ease of synthesis open wide opportunities for practical applications in imaging and biosensing. PMID:23606329

  19. An Undergraduate Laboratory Exercise to Study the Effect of Darkness on Plant Gene Expression Using DNA Microarray

    ERIC Educational Resources Information Center

    Chang, Ming-Mei; Briggs, George M.

    2007-01-01

    DNA microarrays are microscopic arrays on a solid surface, typically a glass slide, on which DNA oligonucleotides are deposited or synthesized in a high-density matrix with a predetermined spatial order. Several types of DNA microarrays have been developed and used for various biological studies. Here, we developed an undergraduate laboratory…

  20. [Impact of Delivery Method on Antiviral Activity of Phosphodiester, Phosphorothioate, and Phosphoryl Guanidine Oligonucleotides in MDCK Cells Infected with H5N1 Bird Flu Virus].

    PubMed

    Levina, A S; Repkova, M N; Chelobanov, B P; Bessudnova, E V; Mazurkova, N A; Stetsenko, D A; Zarytova, V F

    2017-01-01

    We have previously described nanocomposites containing conjugates or complexes of native oligodeoxyribonucleotides with poly-L-lysine and TiO2 nanoparticles. We have shown that these nanocomposites efficiently suppressed influenza A virus reproduction in MDCK cells. Here, we have synthesized previously undescribed nanocomposites that consist of TiO2 nanoparticles and polylysine conjugates with oligonucleotides that contain phosphoryl guanidine or phosphorothioate internucleotide groups. These nanocomposites have been shown to exhibit antiviral activity in MDCK cells infected with H5N1 influenza A virus. The nanocomposites containing phosphorothioate oligonucleotides inhibited virus replication ~130-fold. More potent inhibition, i.e., ~5000-fold or ~4600-fold, has been demonstrated by nanocomposites that contain phosphoryl guanidine or phosphodiester oligonucleotides, respectively. Free oligonucleotides have been nearly inactive. The antiviral activity of oligonucleotides of all three types, when delivered by Lipofectamine, has been significantly lower compared to the oligonucleotides delivered in the nanocomposites. In the former case, the phosphoryl guanidine oligonucleotide has appeared to be the most efficient; it has inhibited the virus replication by a factor of 400. The results make it possible to consider phosphoryl guanidine oligonucleotides, along with other oligonucleotide derivatives, as potential antiviral agents against H5N1 avian flu virus.

  1. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sun, Zhen; Department of Biochemistry and Molecular Biology, Program in Molecular Cell Biology, Zhejiang University School of Medicine, Hangzhou, Zhejiang 310058; Xiang, Wenqing

    Highlights: {yields} LNA-modified oligonucleotides can pass through the plasma membrane of cultured cells even without using transfection machinery. {yields} LNA-modified oligonucleotides passed efficiently across the cell membrane, and lipid-coating facilitated translocation from the cytoplasm to the nucleus. {yields} LNA-oligonucleotide designed to target nuclear HBV DNA efficiently suppresses HBV replication and transcription in cultured hepatic cells. -- Abstract: Silencing target genes with small regulatory RNAs is widely used to investigate gene function and therapeutic drug development. Recently, triplex-based approaches have provided another attractive means to achieve targeted gene regulation and gene manipulation at the molecular and cellular levels. Nuclear entry ofmore » oligonucleotides and enhancement of their affinity to the DNA targets are key points of such approaches. In this study, we developed lipid-based transport of a locked-nucleic-acid (LNA)-modified oligonucleotide for hepatitis B virus (HBV) DNA interference in human hepatocytes expressing HBV genomic DNA. In these cells, the LNA-modified oligonucleotides passed efficiently across the cell membrane, and lipid-coating facilitated translocation from the cytoplasm to the nucleus. The oligonucleotide specifically targeting HBV DNA clearly interfered with HBV DNA transcription as shown by a block in pregenomic RNA (pgRNA) production. The HBV DNA-targeted oligonucleotide suppressed HBV DNA replication and HBV protein production more efficiently than small interfering RNAs directed to the pgRNA. These results demonstrate that fusion with lipid can carry LNA-modified oligonucleotides to the nucleus where they regulate gene expression. Interfering with HBV DNA transcription by LNA-modified oligonucleotides has strong potential as a new strategy for HBV inhibition.« less

  2. A novel 4p16.3 microduplication distal to WHSC1 and WHSC2 characterized by oligonucleotide array with new phenotypic features.

    PubMed

    Cyr, Andrew B; Nimmakayalu, Manjunath; Longmuir, Susannah Q; Patil, Shivanand R; Keppler-Noreuil, Kim M; Shchelochkov, Oleg A

    2011-09-01

    Larger imbalances on chromosome 4p in the form of deletions associated with Wolf-Hirschhorn syndrome (WHS) and duplications of chromosome 4p have a defined clinical phenotype. The critical region for both these clinical disorders has been narrowed based on the genotype-phenotype correlations. However, cryptic rearrangements in this region have been reported infrequently. We report on a male patient with a microduplication of chromosome 4p, who presents with findings of macrocephaly, irregular iris pigmentation-heterochromia, and preserved linear growth in addition to overlapping features of trisomy 4p such as seizures, delayed psychomotor development, and dysmorphic features including prominent glabella, low-set ears, and short neck. Using a high-density oligonucleotide microarray, we have identified a novel submicroscopic duplication involving dosage sensitive genes TACC3, FGFR3, and LETM1. The microduplication did not involve WHSC1 and WHSC2 which are considered in the critical region for WHS and trisomy 4p. This patient's presentation and genomic findings help further delineate clinical significance of re-arrangements in the 4p16 region without the involvement of WHS critical region. Copyright © 2011 Wiley-Liss, Inc.

  3. Simple and rapid enzymatic method for the synthesis of single-strand oligonucleotides containing trifluorothymidine.

    PubMed

    Suzuki, Norihiko; Fukushima, Masakazu

    2010-11-01

    To investigate the mechanism of trifluorothymidine (TFT)-induced DNA damage, we developed an enzymatic method for the synthesis of single-strand oligonucleotides containing TFT-monophosphate residues. Sixteen-mer oligonucleotides and 14-mer 5'-phosphorylated oligonucleotides were annealed to the template of 25-mer, so as to empty one nucleotide site. TFT-triphosphate was incorporated into the site by DNA polymerase and then ligated to 5'-phosphorylated oligonucleotides by DNA ligase. The synthesized 31-mer oligonucleotides containing TFT residues were isolated from the 25-mer complementary template by denaturing polyacrylamide electrophoresis. Using these single-strand oligonucleotides containing TFT residues, the cleavage of TFT residues from DNA, using mismatch uracil-DNA glycosylase (MUG) of E.coli origin, was compared with that of 5-fluorouracil (5FU) and 5-bromodeoxyuridine (BrdU). The TFT/A pair was not cleaved by MUG, while the other pairs, namely, 5FU/A, 5FU/G, BrdU/A, BrdU/G, and TFT/G, were easily cleaved from each synthesized DNA. Thus, this method is useful for obtaining some site-specifically modified oligonucleotides.

  4. Incorporation of an aldehyde function in oligonucleotides.

    PubMed

    Tilquin, J M; Dechamps, M; Sonveaux, E

    2001-01-01

    A nucleotide-like phosphoramidite building block that has the nucleic base replaced by the tert-butyldimethylsilyl-protected styrene glycol was synthesized. After the automatic synthesis of an oligonucleotide incorporating this synthon, the benzaldehyde function was generated by fluoride deprotection and oxidation by sodium periodate. In a similar manner, an oligonucleotide where a nucleic base was replaced by the (CH2)8CH=O chain was synthesized and conjugated with biotin derivatives.

  5. Automated detection and quantitation of bacterial RNA by using electrical microarrays.

    PubMed

    Elsholz, B; Wörl, R; Blohm, L; Albers, J; Feucht, H; Grunwald, T; Jürgen, B; Schweder, T; Hintsche, Rainer

    2006-07-15

    Low-density electrical 16S rRNA specific oligonucleotide microarrays and an automated analysis system have been developed for the identification and quantitation of pathogens. The pathogens are Escherichia coli, Pseudomonas aeruginosa, Enterococcus faecalis, Staphylococcus aureus, and Staphylococcus epidermidis, which are typically involved in urinary tract infections. Interdigitated gold array electrodes (IDA-electrodes), which have structures in the nanometer range, have been used for very sensitive analysis. Thiol-modified oligonucleotides are immobilized on the gold IDA as capture probes. They mediate the specific recognition of the target 16S rRNA by hybridization. Additionally three unlabeled oligonucleotides are hybridized in close proximity to the capturing site. They are supporting molecules, because they improve the RNA hybridization at the capturing site. A biotin labeled detector oligonucleotide is also allowed to hybridize to the captured RNA sequence. The biotin labels enable the binding of avidin alkaline phophatase conjugates. The phosphatase liberates the electrochemical mediator p-aminophenol from its electrically inactive phosphate derivative. The electrical signals were generated by amperometric redox cycling and detected by a unique multipotentiostat. The read out signals of the microarray are position specific current and change over time in proportion to the analyte concentration. If two additional biotins are introduced into the affinity binding complex via the supporting oligonucleotides, the sensitivity of the assays increase more than 60%. The limit of detection of Escherichia coli total RNA has been determined to be 0.5 ng/microL. The control of fluidics for variable assay formats as well as the multichannel electrical read out and data handling have all been fully automated. The fast and easy procedure does not require any amplification of the targeted nucleic acids by PCR.

  6. Rapid method to detect duplex formation in sequencing by hybridization methods

    DOEpatents

    Mirzabekov, A.D.; Timofeev, E.N.; Florentiev, V.L.; Kirillov, E.V.

    1999-01-19

    A method for determining the existence of duplexes of oligonucleotide complementary molecules is provided. A plurality of immobilized oligonucleotide molecules, each of a specific length and each having a specific base sequence, is contacted with complementary, single stranded oligonucleotide molecules to form a duplex. Each duplex facilitates intercalation of a fluorescent dye between the base planes of the duplex. The invention also provides for a method for constructing oligonucleotide matrices comprising confining light sensitive fluid to a surface and exposing the light-sensitive fluid to a light pattern. This causes the fluid exposed to the light to coalesce into discrete units and adhere to the surface. This places each of the units in contact with a set of different oligonucleotide molecules so as to allow the molecules to disperse into the units. 13 figs.

  7. Rapid method to detect duplex formation in sequencing by hybridization methods

    DOEpatents

    Mirzabekov, Andrei Darievich; Timofeev, Edward Nikolaevich; Florentiev, Vladimer Leonidovich; Kirillov, Eugene Vladislavovich

    1999-01-01

    A method for determining the existence of duplexes of oligonucleotide complementary molecules is provided whereby a plurality of immobilized oligonucleotide molecules, each of a specific length and each having a specific base sequence, is contacted with complementary, single stranded oligonucleotide molecules to form a duplex so as to facilitate intercalation of a fluorescent dye between the base planes of the duplex. The invention also provides for a method for constructing oligonucleotide matrices comprising confining light sensitive fluid to a surface, exposing said light-sensitive fluid to a light pattern so as to cause the fluid exposed to the light to coalesce into discrete units and adhere to the surface; and contacting each of the units with a set of different oligonucleotide molecules so as to allow the molecules to disperse into the units.

  8. Pyrophosphorolytic dismutation of oligodeoxy-nucleotides by terminal deoxynucleotidyltransferase.

    PubMed Central

    Anderson, R S; Bollum, F J; Beattie, K L

    1999-01-01

    Terminal transferase (TdT), when incubated with a purified(32)P-5"-end-labeled oligonucleotide of defined length in the presence of Co(2+), Mn(2+)or Mg(2+)and 2-mercaptoethanol in cacodylate or HEPES buffer, pH 7.2, exhibits the ability to remove a 3"-nucleotide from one oligonucleotide and add it to the 3"-end of another. When analyzed by urea-PAGE, this activity is observed as a disproportionation of the starting oligonucleotide into a ladder of shorter and longer oligonucleotides distributed around the starting material. Optimal metal ion concentration is 1-2 mM. All three metal ions support this activity with Co(2+)> Mn(2+) congruent with Mg(2+). Oligonucleotides p(dT) and p(dA) are more efficient substrates than p(dG) and p(dC) because the latter may form secondary structures. The dismutase activity is significant even in the presence of dNTP concentrations comparable to those that exist in the nucleus during the G(1)phase of the cell cycle. Using BetaScope image analysis the rate of pyrophosphorolytic dismutase activity was found to be only moderately slower than the poly-merization activity. These results may help explain the GC-richness of immunoglobulin gene segment joins (N regions) and the loss of bases that occur during gene rearrangements in pre-B and pre-T cells. PMID:10454617

  9. A facile inhibitor screening of SARS coronavirus N protein using nanoparticle-based RNA oligonucleotide.

    PubMed

    Roh, Changhyun

    2012-01-01

    Hundreds of million people worldwide have been infected with severe acute respiratory syndrome (SARS), and the rate of global death from SARS has remarkably increased. Hence, the development of efficient drug treatments for the biological effects of SARS is highly needed. We have previously shown that quantum dots (QDs)-conjugated RNA oligonucleotide is sensitive to the specific recognition of the SARS-associated coronavirus (SARS-CoV) nucleocapsid (N) protein. In this study, we found that a designed biochip could analyze inhibitors of the SARS-CoV N protein using nanoparticle-based RNA oligonucleotide. Among the polyphenolic compounds examined, (-)-catechin gallate and (-)-gallocatechin gallate demonstrated a remarkable inhibition activity on SARS-CoV N protein. (-)-catechin gallate and (-)-gallocatechin gallate attenuated the binding affinity in a concentrated manner as evidenced by QDs-conjugated RNA oligonucleotide on a designed biochip. At a concentration of 0.05 μg mL(-1), (-)-catechin gallate and (-)-gallocatechin gallate showed more than 40% inhibition activity on a nanoparticle-based RNA oligonucleotide biochip system.

  10. Oligonucleotide-based strategies to combat polyglutamine diseases

    PubMed Central

    Fiszer, Agnieszka; Krzyzosiak, Wlodzimierz J.

    2014-01-01

    Considerable advances have been recently made in understanding the molecular aspects of pathogenesis and in developing therapeutic approaches for polyglutamine (polyQ) diseases. Studies on pathogenic mechanisms have extended our knowledge of mutant protein toxicity, confirmed the toxicity of mutant transcript and identified other toxic RNA and protein entities. One very promising therapeutic strategy is targeting the causative gene expression with oligonucleotide (ON) based tools. This straightforward approach aimed at halting the early steps in the cascade of pathogenic events has been widely tested for Huntington's disease and spinocerebellar ataxia type 3. In this review, we gather information on the use of antisense oligonucleotides and RNA interference triggers for the experimental treatment of polyQ diseases in cellular and animal models. We present studies testing non-allele-selective and allele-selective gene silencing strategies. The latter include targeting SNP variants associated with mutations or targeting the pathologically expanded CAG repeat directly. We compare gene silencing effectors of various types in a number of aspects, including their design, efficiency in cell culture experiments and pre-clinical testing. We discuss advantages, current limitations and perspectives of various ON-based strategies used to treat polyQ diseases. PMID:24848018

  11. Detection of Sub-fM DNA with Target Recycling and Self-Assembly Amplification on Graphene Field-Effect Biosensors

    PubMed Central

    2018-01-01

    All-electronic DNA biosensors based on graphene field-effect transistors (GFETs) offer the prospect of simple and cost-effective diagnostics. For GFET sensors based on complementary probe DNA, the sensitivity is limited by the binding affinity of the target oligonucleotide, in the nM range for 20 mer targets. We report a ∼20 000× improvement in sensitivity through the use of engineered hairpin probe DNA that allows for target recycling and hybridization chain reaction. This enables detection of 21 mer target DNA at sub-fM concentration and provides superior specificity against single-base mismatched oligomers. The work is based on a scalable fabrication process for biosensor arrays that is suitable for multiplexed detection. This approach overcomes the binding-affinity-dependent sensitivity of nucleic acid biosensors and offers a pathway toward multiplexed and label-free nucleic acid testing with high accuracy and selectivity. PMID:29768011

  12. Detection of Sub-fM DNA with Target Recycling and Self-Assembly Amplification on Graphene Field-Effect Biosensors.

    PubMed

    Gao, Zhaoli; Xia, Han; Zauberman, Jonathan; Tomaiuolo, Maurizio; Ping, Jinglei; Zhang, Qicheng; Ducos, Pedro; Ye, Huacheng; Wang, Sheng; Yang, Xinping; Lubna, Fahmida; Luo, Zhengtang; Ren, Li; Johnson, Alan T Charlie

    2018-06-13

    All-electronic DNA biosensors based on graphene field-effect transistors (GFETs) offer the prospect of simple and cost-effective diagnostics. For GFET sensors based on complementary probe DNA, the sensitivity is limited by the binding affinity of the target oligonucleotide, in the nM range for 20 mer targets. We report a ∼20 000× improvement in sensitivity through the use of engineered hairpin probe DNA that allows for target recycling and hybridization chain reaction. This enables detection of 21 mer target DNA at sub-fM concentration and provides superior specificity against single-base mismatched oligomers. The work is based on a scalable fabrication process for biosensor arrays that is suitable for multiplexed detection. This approach overcomes the binding-affinity-dependent sensitivity of nucleic acid biosensors and offers a pathway toward multiplexed and label-free nucleic acid testing with high accuracy and selectivity.

  13. Versatile Method for the Site-Specific Modification of DNA with Boron Clusters: Anti-Epidermal Growth Factor Receptor (EGFR) Antisense Oligonucleotide Case.

    PubMed

    Ebenryter-Olbińska, Katarzyna; Kaniowski, Damian; Sobczak, Milena; Wojtczak, Błażej A; Janczak, Sławomir; Wielgus, Ewelina; Nawrot, Barbara; Leśnikowski, Zbigniew J

    2017-11-21

    A general and convenient approach for the incorporation of different types of boron clusters into specific locations of the DNA-oligonucleotide chain based on the automated phosphoramidite method of oligonucleotide synthesis and post-synthetic "click chemistry" modification has been developed. Pronounced effects of boron-cluster modification on the physico- and biochemical properties of the antisense oligonucleotides were observed. The silencing activity of antisense oligonucleotides bearing a single boron cluster modification in the middle of the oligonucleotide chain was substantially higher than that of unmodified oligonucleotides. This finding may be of importance for the design of therapeutic nucleic acids with improved properties. The proposed synthetic methodology broadens the availability of nucleic acid-boron cluster conjugates and opens up new avenues for their potential practical use. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. Scalable amplification of strand subsets from chip-synthesized oligonucleotide libraries

    PubMed Central

    Schmidt, Thorsten L.; Beliveau, Brian J.; Uca, Yavuz O.; Theilmann, Mark; Da Cruz, Felipe; Wu, Chao-Ting; Shih, William M.

    2015-01-01

    Synthetic oligonucleotides are the main cost factor for studies in DNA nanotechnology, genetics and synthetic biology, which all require thousands of these at high quality. Inexpensive chip-synthesized oligonucleotide libraries can contain hundreds of thousands of distinct sequences, however only at sub-femtomole quantities per strand. Here we present a selective oligonucleotide amplification method, based on three rounds of rolling-circle amplification, that produces nanomole amounts of single-stranded oligonucleotides per millilitre reaction. In a multistep one-pot procedure, subsets of hundreds or thousands of single-stranded DNAs with different lengths can selectively be amplified and purified together. These oligonucleotides are used to fold several DNA nanostructures and as primary fluorescence in situ hybridization probes. The amplification cost is lower than other reported methods (typically around US$ 20 per nanomole total oligonucleotides produced) and is dominated by the use of commercial enzymes. PMID:26567534

  15. Plasmodium Genus Assay Transition to the Joint Biological Agent Identification and Diagnostic System (JBAIDS)

    DTIC Science & Technology

    2012-07-12

    readily transferable to diverse real-time PCR instrumentation. These assays are used regularly for vector surveillance and are the primary...instrumentation ( FilmArray ) is under assessment. Assay oligonucleotide sequences and formulations are available for use in future joint projects...Plasmodium real-time PCR detection capability has been challenging. During 2006, the Division of Entomology, WRAIR designed and developed a

  16. A facile one-step fluorescence method for the quantitation of low-content single base deamination impurity in synthetic oligonucleotides.

    PubMed

    Su, Xiaoye; Liang, Ruiting; Stolee, Jessica A

    2018-06-05

    Oligonucleotides are being researched and developed as potential drug candidates for the treatment of a broad spectrum of diseases. The characterization of antisense oligonucleotide (ASO) impurities caused by base mutations (e.g. deamination) which are closely related to the target ASO is a significant analytical challenge. Herein, we describe a novel one-step method, utilizing a strategy that combines fluorescence-ON detection with competitive hybridization, to achieve single base mutation quantitation in extensively modified synthetic ASOs. Given that this method is highly specific and sensitive (LoQ = 4 nM), we envision that it will find utility for screening other impurities as well as sequencing modified oligonucleotides. Copyright © 2018 Elsevier B.V. All rights reserved.

  17. Metallo-Phthalocyanine Near-IR Fluorophores: Oligonucleotide Conjugates and Their Applications in PCR Assays

    PubMed Central

    Nesterova, Irina V.; Verdree, Vera T.; Pakhomov, Serhii; Strickler, Karen L.; Allen, Michael W.; Hammer, Robert P.; Soper, Steven A.

    2011-01-01

    Water soluble, metallo-pthalocyanine (MPc) near-IR fluorophores were designed, synthesized, and evaluated as highly stable and sensitive reporters for fluorescence assays. Their conjugation to oligonucleotides was achieved via succinimidyl ester-amino coupling chemistry with the conditions for conjugation extensively examined and optimized. In addition, various conjugate purification and isolation techniques were evaluated as well. Results showed that under proper conditions and following purification using reverse-phase ion-pair chromatography, labeling efficiencies near 80% could be achieved using ZnPc (Zn phthalocyanine) as the labeling fluorophore. Absorption and fluorescence spectra accumulated for the conjugates indicated that the intrinsic fluorescence properties of the MPc’s were not significantly altered by covalent attachment to oligonucleotides. As an example of the utility of MPc reporters, we used the MPc–oligonucleotide conjugates as primers for PCR (polymerase chain reaction) amplifications with the products sorted via electrophoresis and detected using near-IR fluorescence (λex = 680 nm). The MPc dyes were found to be more chemically stable under typical thermal cycling conditions used for PCR compared to the carbocyanine-based near-IR reporter systems typically used and produced single and narrow bands in the electrophoretic traces, indicative of producing a single PCR product during amplification. PMID:18030995

  18. Multiplex Detection of Bacteria Associated with Normal Microbiota and with Bacterial Vaginosis in Vaginal Swabs by Use of Oligonucleotide-Coupled Fluorescent Microspheres▿ †

    PubMed Central

    Dumonceaux, Tim J.; Schellenberg, John; Goleski, Vanessa; Hill, Janet E.; Jaoko, Walter; Kimani, Joshua; Money, Deborah; Ball, T. Blake; Plummer, Francis A.; Severini, Alberto

    2009-01-01

    Bacterial vaginosis (BV) is a recurrent condition that is associated with a range of negative outcomes, including the acquisition of human immunodeficiency virus and other sexually transmitted diseases, preterm births, and pelvic inflammatory disease. In contrast to the Lactobacillus-dominated normal vaginal microbiota, BV is characterized by a lack of lactobacilli and an abundance of anaerobic and gram-negative organisms, including Gardnerella vaginalis and Atopobium vaginae. To date, the laboratory diagnosis of BV has relied upon the fulfillment of criteria determined by microscopic observation of Gram-stained vaginal swabs. We describe a molecular-based method for the easy determination of the species profile within the vaginal microbiota based on the amplification of the chaperonin-60 genes of all bacteria present in the swab and hybridization of the amplicon to species-specific oligonucleotide-coupled fluorescent beads that are identified by flow cytometry with a Luminex instrument. We designed a nineplex Luminex array for characterization of the vaginal microbiota and applied it to the analysis of vaginal swabs from individuals from Africa and North America. Using the presence of A. vaginae or G. vaginalis, or both, as the defining criterion for BV, we found that the method was highly specific and sensitive for the diagnosis of BV using microscopy as a gold standard. PMID:19794034

  19. Method and apparatus for combinatorial chemistry

    DOEpatents

    Foote, Robert S.

    2007-02-20

    A method and apparatus are provided for performing light-directed reactions in spatially addressable channels within a plurality of channels. One aspect of the invention employs photoactivatable reagents in solutions disposed into spatially addressable flow streams to control the parallel synthesis of molecules immobilized within the channels. The reagents may be photoactivated within a subset of channels at the site of immobilized substrate molecules or at a light-addressable site upstream from the substrate molecules. The method and apparatus of the invention find particularly utility in the synthesis of biopolymer arrays, e.g., oligonucleotides, peptides and carbohydrates, and in the combinatorial synthesis of small molecule arrays for drug discovery.

  20. Method and apparatus for combinatorial chemistry

    DOEpatents

    Foote, Robert S [Oak Ridge, TN

    2012-06-05

    A method and apparatus are provided for performing light-directed reactions in spatially addressable channels within a plurality of channels. One aspect of the invention employs photoactivatable reagents in solutions disposed into spatially addressable flow streams to control the parallel synthesis of molecules immobilized within the channels. The reagents may be photoactivated within a subset of channels at the site of immobilized substrate molecules or at a light-addressable site upstream from the substrate molecules. The method and apparatus of the invention find particularly utility in the synthesis of biopolymer arrays, e.g., oligonucleotides, peptides and carbohydrates, and in the combinatorial synthesis of small molecule arrays for drug discovery.

  1. DNA hybridization detection on electrical microarrays using coulostatic pulse technique.

    PubMed

    Dharuman, V; Nebling, E; Grunwald, T; Albers, J; Blohm, L; Elsholz, B; Wörl, R; Hintsche, R

    2006-12-15

    We demonstrated a novel application of transient coulostatic pulse technique for the detection of label free DNA hybridization on nm-sized gold interdigitated ultramicroelectrode arrays (Au-IDA) made in silicon technology. The array consists of eight different positions with an Au-IDA pair at each position arranged on the Si-based Biochip. Immobilization of capture probes onto the Au-IDA was accomplished by self-assembling of thiol-modified oligonucleotides. Target hybridization was indicated by a change in the magnitude of the time dependant potential relaxation curve in presence of electroactive Fe(CN)(6)(3-) in the phosphate buffer solution. While complementary DNA hybridization showed 50% increase in the relaxation potential, the non-complementary DNA showed a negligible change. A constant behaviour was noted for all positions. The dsDNA specific intercalating molecule, methylene blue, was found to be enhancing the discrimination effect. The changes in the relaxation potential curves were further corroborated following the ELISA like experiments using ExtraAvidine alkaline phosphatase labelling and redox recycling of para-aminophenol phosphate at IDAs. The coulostatic pulse technique was shown to be useful for identifying DNA sequences from brain tumour gene CK20, human herpes simplex virus, cytomegalovirus, Epstein-Barr virus and M13 phage. Compared to the hybridization of short chain ONTs (27 mers), the hybridization of long chain M13 phage DNA showed three times higher increase in the relaxation curves. The method is fast enough to monitor hybridization interactions in milli or microsecond time scales and is well suitable for miniaturization and integration compared to the common impedance techniques for developing capacitative DNA sensors.

  2. Rapid method to detect duplex formation in sequencing by hybridization methods, a method for constructing containment structures for reagent interaction

    DOEpatents

    Mirzabekov, Andrei Darievich; Yershov, Gennadiy Moiseyevich; Guschin, Dmitry Yuryevich; Gemmell, Margaret Anne; Shick, Valentine V.; Proudnikov, Dmitri Y.; Timofeev, Edward N.

    2002-01-01

    A method for determining the existence of duplexes of oligonucleotide complementary molecules is provided whereby a plurality of immobilized oligonucleotide molecules, each of a specific length and each having a specific base sequence, is contacted with complementary, single stranded oligonucleotide molecules to form a duplex so as to facilitate intercalation of a fluorescent dye between the base planes of the duplex. The invention also provides for a method for constructing oligonucleotide matrices comprising confining light sensitive fluid to a surface, exposing said light-sensitive fluid to a light pattern so as to cause the fluid exposed to the light to polymerize into discrete units and adhere to the surface; and contacting each of the units with a set of different oligonucleotide molecules so as to allow the molecules to disperse into the units.

  3. Charge separation and charge delocalization identified in long-living states of photoexcited DNA

    PubMed Central

    Bucher, Dominik B.; Pilles, Bert M.; Carell, Thomas; Zinth, Wolfgang

    2014-01-01

    Base stacking in DNA is related to long-living excited states whose molecular nature is still under debate. To elucidate the molecular background we study well-defined oligonucleotides with natural bases, which allow selective UV excitation of one single base in the strand. IR probing in the picosecond regime enables us to dissect the contribution of different single bases to the excited state. All investigated oligonucleotides show long-living states on the 100-ps time scale, which are not observable in a mixture of single bases. The fraction of these states is well correlated with the stacking probabilities and reaches values up to 0.4. The long-living states show characteristic absorbance bands that can be assigned to charge-transfer states by comparing them to marker bands of radical cation and anion spectra. The charge separation is directed by the redox potential of the involved bases and thus controlled by the sequence. The spatial dimension of this charge separation was investigated in longer oligonucleotides, where bridging sequences separate the excited base from a sensor base with a characteristic marker band. After excitation we observe a bleach of all involved bases. The contribution of the sensor base is observable even if the bridge is composed of several bases. This result can be explained by a charge delocalization along a well-stacked domain in the strand. The presence of charged radicals in DNA strands after light absorption may cause reactions—oxidative or reductive damage—currently not considered in DNA photochemistry. PMID:24616517

  4. Oligonucleotide fingerprinting of rRNA genes for analysis of fungal community composition.

    PubMed

    Valinsky, Lea; Della Vedova, Gianluca; Jiang, Tao; Borneman, James

    2002-12-01

    Thorough assessments of fungal diversity are currently hindered by technological limitations. Here we describe a new method for identifying fungi, oligonucleotide fingerprinting of rRNA genes (OFRG). ORFG sorts arrayed rRNA gene (ribosomal DNA [rDNA]) clones into taxonomic clusters through a series of hybridization experiments, each using a single oligonucleotide probe. A simulated annealing algorithm was used to design an OFRG probe set for fungal rDNA. Analysis of 1,536 fungal rDNA clones derived from soil generated 455 clusters. A pairwise sequence analysis showed that clones with average sequence identities of 99.2% were grouped into the same cluster. To examine the accuracy of the taxonomic identities produced by this OFRG experiment, we determined the nucleotide sequences for 117 clones distributed throughout the tree. For all but two of these clones, the taxonomic identities generated by this OFRG experiment were consistent with those generated by a nucleotide sequence analysis. Eighty-eight percent of the clones were affiliated with Ascomycota, while 12% belonged to BASIDIOMYCOTA: A large fraction of the clones were affiliated with the genera Fusarium (404 clones) and Raciborskiomyces (176 clones). Smaller assemblages of clones had high sequence identities to the Alternaria, Ascobolus, Chaetomium, Cryptococcus, and Rhizoctonia clades.

  5. Ferrocene conjugated oligonucleotide for electrochemical detection of DNA base mismatch.

    PubMed

    Hasegawa, Yusuke; Takada, Tadao; Nakamura, Mitsunobu; Yamana, Kazushige

    2017-08-01

    We describe the synthesis, binding, and electrochemical properties of ferrocene-conjugated oligonucleotides (Fc-oligos). The key step for the preparation of Fc-oligos contains the coupling of vinylferrocene to 5-iododeoxyuridine via Heck reaction. The Fc-conjugated deoxyuridine phosphoramidite was used in the Fc-oligonucleotide synthesis. We show that thiol-modified Fc-oligos deposited onto gold electrodes possess potential ability in electrochemical detection of DNA base mismatch. Copyright © 2017 Elsevier Ltd. All rights reserved.

  6. Retention of nucleic acids in ion-pair reversed-phase high-performance liquid chromatography depends not only on base composition but also on base sequence.

    PubMed

    Qiao, Jun-Qin; Liang, Chao; Wei, Lan-Chun; Cao, Zhao-Ming; Lian, Hong-Zhen

    2016-12-01

    The study on nucleic acid retention in ion-pair reversed-phase high-performance liquid chromatography mainly focuses on size-dependence, however, other factors influencing retention behaviors have not been comprehensively clarified up to date. In this present work, the retention behaviors of oligonucleotides and double-stranded DNAs were investigated on silica-based C 18 stationary phase by ion-pair reversed-phase high-performance liquid chromatography. It is found that the retention of oligonucleotides was influenced by base composition and base sequence as well as size, and oligonucleotides prone to self-dimerization have weaker retention than those not prone to self-dimerization but with the same base composition. However, homo-oligonucleotides are suitable for the size-dependent separation as a special case of oligonucleotides. For double-stranded DNAs, the retention is also influenced by base composition and base sequence, as well as size. This may be attributed to the interaction of exposed bases in major or minor grooves with the hydrophobic alky chains of stationary phase. In addition, no specific influence of guanine and cytosine content was confirmed on retention of double-stranded DNAs. Notably, the space effect resulted from the stereostructure of nucleic acids also influences the retention behavior in ion-pair reversed-phase high-performance liquid chromatography. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. The chemical evolution of oligonucleotide therapies of clinical utility

    PubMed Central

    Khvorova, Anastasia; Watts, Jonathan K.

    2017-01-01

    After nearly 40 years of development, oligonucleotide therapeutics are nearing meaningful clinical productivity. One of the key advantages of oligonucleotide drugs is that their delivery and potency properties are derived primarily from the chemical structure of the oligonucleotide, while their target is defined by the base sequence. Thus, as oligonucleotides with a particular chemical design demonstrate appropriate distribution and safety profiles for clinical gene silencing in a particular tissue, this will open the door to the rapid development of additional drugs targeting other disease-associated genes in the same tissue. To achieve clinical productivity, the chemical architecture of the oligonucleotide needs to be optimized as a whole, using a combination of sugar, backbone, nucleobase and 3′/5′-terminal modifications. A portfolio of chemistries can be used to confer drug like properties onto the oligonucleotide as a whole, with minor chemical changes often translating into major improvements in clinical efficacy. Outstanding challenges in oligonucleotide chemical development include optimization of chemical architectures to ensure long-term safety and to enable robust clinical activity beyond the liver. PMID:28244990

  8. Quantitative surface-enhanced resonance Raman scattering of phthalocyanine-labelled oligonucleotides

    PubMed Central

    Macaskill, A.; Chernonosov, A. A.; Koval, V. V.; Lukyanets, E. A.; Fedorova, O. S.; Smith, W. E.; Faulds, K.; Graham, D.

    2007-01-01

    The evaluation of phthalocyanine labels for the surface-enhanced resonance Raman scattering (SERRS) detection of oligonucleotides is reported. Three phthalocyanine-labelled oligonucleotides were assessed, each containing a different metal centre. Detection limits for each labelled oligonucleotide were determined using two excitation frequencies where possible. Limits of detection as low as 2.8 × 10−11 mol. dm−3 were obtained which are comparable to standard fluorescently labelled probes used in previous SERRS studies. The identification of two phthalocyanine-labelled oligonucleotides without separation was also demonstrated indicating their suitability for multiplexing. This study extends the range of labels suitable for quantitative surface-enhanced resonance Raman scattering with silver nanoparticles and offers more flexibility and choice when considering SERRS for quantitative DNA detection. PMID:17289751

  9. Voltammetric behaviour of free DNA bases, methylcytosine and oligonucleotides at disposable screen printed graphite electrode platforms.

    PubMed

    Brotons, Ariadna; Mas, Luis Alcaraz; Metters, Jonathan P; Banks, Craig E; Iniesta, Jesús

    2013-09-21

    Improvements in analytical methods for the determination and quantification of methylcytosine in DNA are vital since it has the potential to be used as a biomarker to detect different diseases in the first stage such as in the case of carcinomas and sterility. In this work we utilized screen printed graphite electrodes (SPGE) for studying the electrochemical response of all free DNA bases, methylcytosine and short oligonucleotides by cyclic voltammetry (CV) and square wave voltammetry (SWV). CV and SWV responses of free DNA bases and methylcytosine have been investigated by using SPGE platforms and the feasibility of detecting and quantifying cytosine and methylcytosine as free DNA moieties has been evaluated as a function of pH, concentration and the presence of the other free DNA bases in solution simultaneously. Repeatability of using SWV has been performed for the electrochemical behavior of both 250 μM cytosine and 250 μM methylcytosine in the presence of 25 μM guanine, with coefficient of variations of 6.9% and 2.6% respectively based upon peak current (N = 5). Six-mer oligonucleotides with a sequence 5'-XXXCGC-3', where the XXX motif corresponds to TTT, TTA, TAA and AAA have been performed using SWV in 0.1 M acetate buffer pH 5.0 to explore how the DNA base position effects the electrooxidation of guanine and cytosine into the oligonucleotide. Furthermore SWV comparisons of the electrooxidation of the oligonucleotides 5'-CGCGCG-3' and its methylated 5'-mCGmCGmCG-3' have been performed with concentrations in acetate buffer solutions, and the interaction of both oligonucleotides with the graphitic surface of the SPGE has been demonstrated by fitting well-known adsorption models such as Freundlich and Langmuir kinetics according to the SWV current response of guanine, cytosine and methylcytosine into the oligonucleotide.

  10. RNA therapeutics: Beyond RNA interference and antisense oligonucleotides

    PubMed Central

    Kole, Ryszard; Krainer, Adrian R.; Altman, Sidney

    2016-01-01

    Here we discuss three RNA therapeutic technologies exploiting various oligonucleotides that bind RNA by base-pairing in a sequence-specific manner yet have different mechanisms of action and effects. RNA interference and antisense oligonucleotides downregulate gene expression by enzyme-dependent degradation of targeted mRNA. Steric blocking oligonucleotides block access of cellular machinery to pre-mRNA and mRNA without degrading the RNA. Through this mechanism, blocking oligonucleotides can redirect alternative splicing, repair defective RNA, restore protein production or also downregulate gene expression. Moreover, they can be extensively chemically modified, resulting in more drug-like properties. The ability of RNA blocking oligonucleotides to restore gene function makes them suited for treatment of genetic disorders. Positive results from clinical trials for the treatment of Duchenne muscular dystrophy show that this technology is close to realizing its clinical potential. PMID:22262036

  11. Development of a rapid microarray-based DNA subtyping assay for the alleles of Shiga toxins 1 and 2 of Escherichia coli.

    PubMed

    Geue, Lutz; Stieber, Bettina; Monecke, Stefan; Engelmann, Ines; Gunzer, Florian; Slickers, Peter; Braun, Sascha D; Ehricht, Ralf

    2014-08-01

    In this study, we developed a new rapid, economic, and automated microarray-based genotyping test for the standardized subtyping of Shiga toxins 1 and 2 of Escherichia coli. The microarrays from Alere Technologies can be used in two different formats, the ArrayTube and the ArrayStrip (which enables high-throughput testing in a 96-well format). One microarray chip harbors all the gene sequences necessary to distinguish between all Stx subtypes, facilitating the identification of single and multiple subtypes within a single isolate in one experiment. Specific software was developed to automatically analyze all data obtained from the microarray. The assay was validated with 21 Shiga toxin-producing E. coli (STEC) reference strains that were previously tested by the complete set of conventional subtyping PCRs. The microarray results showed 100% concordance with the PCR results. Essentially identical results were detected when the standard DNA extraction method was replaced by a time-saving heat lysis protocol. For further validation of the microarray, we identified the Stx subtypes or combinations of the subtypes in 446 STEC field isolates of human and animal origin. In summary, this oligonucleotide array represents an excellent diagnostic tool that provides some advantages over standard PCR-based subtyping. The number of the spotted probes on the microarrays can be increased by additional probes, such as for novel alleles, species markers, or resistance genes, should the need arise. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  12. Intelligent nanomedicine integrating diagnosis and therapy

    NASA Technical Reports Server (NTRS)

    Li, Na (Inventor); Tan, Winny (Inventor)

    2012-01-01

    A method of controlling the activity of a biologically active compound. The method concerns an oligonucleotide-based compound, comprising a hairpin-forming oligonucleotide, an effector moiety physically associated with the oligonucleotide, where the effector moiety possesses a biological activity, and a regulating moiety physically associated with the oligonucleotide, where the regulating moiety controls the biological activity of the effector moiety by interacting with the effector moiety. The oligonucleotide can assume a hairpin configuration, where the effector and regulating moieties interact, or an open configuration, where the effector and regulating moieties fail to interact. Depending on the nature of the effector and regulating moieties, either configuration can result in the expression of the biological activity of the effector moiety.

  13. Time-series oligonucleotide count to assign antiviral siRNAs with long utility fit in the big data era.

    PubMed

    Wada, K; Wada, Y; Iwasaki, Y; Ikemura, T

    2017-10-01

    Oligonucleotides are key elements of nucleic acid therapeutics such as small interfering RNAs (siRNAs). Influenza and Ebolaviruses are zoonotic RNA viruses mutating very rapidly, and their sequence changes must be characterized intensively to design therapeutic oligonucleotides with long utility. Focusing on a total of 182 experimentally validated siRNAs for influenza A, B and Ebolaviruses compiled by the siRNA database, we conducted time-series analyses of occurrences of siRNA targets in these viral genomes. Reflecting their high mutation rates, occurrences of target oligonucleotides evidently fluctuate in viral populations and often disappear. Time-series analysis of the one-base changed sequences derived from each original target identified the oligonucleotide that shows a compensatory increase and will potentially become the 'awaiting-type oligonucleotide'; the combined use of this oligonucleotide with the original can provide therapeutics with long utility. This strategy is also useful for assigning diagnostic reverse transcription-PCR primers with long utility.

  14. Experimental analysis of oligonucleotide microarray design criteria to detect deletions by comparative genomic hybridization.

    PubMed

    Flibotte, Stephane; Moerman, Donald G

    2008-10-21

    Microarray comparative genomic hybridization (CGH) is currently one of the most powerful techniques to measure DNA copy number in large genomes. In humans, microarray CGH is widely used to assess copy number variants in healthy individuals and copy number aberrations associated with various diseases, syndromes and disease susceptibility. In model organisms such as Caenorhabditis elegans (C. elegans) the technique has been applied to detect mutations, primarily deletions, in strains of interest. Although various constraints on oligonucleotide properties have been suggested to minimize non-specific hybridization and improve the data quality, there have been few experimental validations for CGH experiments. For genomic regions where strict design filters would limit the coverage it would also be useful to quantify the expected loss in data quality associated with relaxed design criteria. We have quantified the effects of filtering various oligonucleotide properties by measuring the resolving power for detecting deletions in the human and C. elegans genomes using NimbleGen microarrays. Approximately twice as many oligonucleotides are typically required to be affected by a deletion in human DNA samples in order to achieve the same statistical confidence as one would observe for a deletion in C. elegans. Surprisingly, the ability to detect deletions strongly depends on the oligonucleotide 15-mer count, which is defined as the sum of the genomic frequency of all the constituent 15-mers within the oligonucleotide. A similarity level above 80% to non-target sequences over the length of the probe produces significant cross-hybridization. We recommend the use of a fairly large melting temperature window of up to 10 degrees C, the elimination of repeat sequences, the elimination of homopolymers longer than 5 nucleotides, and a threshold of -1 kcal/mol on the oligonucleotide self-folding energy. We observed very little difference in data quality when varying the oligonucleotide length between 50 and 70, and even when using an isothermal design strategy. We have determined experimentally the effects of varying several key oligonucleotide microarray design criteria for detection of deletions in C. elegans and humans with NimbleGen's CGH technology. Our oligonucleotide design recommendations should be applicable for CGH analysis in most species.

  15. Base-Pairing Systems Related to TNA: alpha-Threofuranosyl Oligonucleotides Containing Phosphoramidate Linkages

    NASA Technical Reports Server (NTRS)

    Meyer, Michael (Technical Monitor); Wu, Xiaolin; Guntha, Sreenivasulu; Ferenclc, Mathias; Krishnamurthy, Ramanarayanan; Eschenmoser, Albert

    2002-01-01

    (3'NH)- and (2'NH)-TNA, two isomeric phosphoramidate analogues of TNA (alpha-threofuranosyl-(3'-2') oligonucleotides), are shown to be efficient Watson-Crick base-pairing systems and to undergo intersystem crosspairing with TNA, RNA, and DNA.

  16. A New Oligonucleotide Microarray for Detection of Pathogenic and Non-Pathogenic Legionella spp.

    PubMed Central

    Cao, Boyang; Liu, Xiangqian; Yu, Xiang; Chen, Min; Feng, Lu; Wang, Lei

    2014-01-01

    Legionella pneumophila has been recognized as the major cause of legionellosis since the discovery of the deadly disease. Legionella spp. other than L. pneumophila were later found to be responsible to many non-pneumophila infections. The non-L. pneumophila infections are likely under-detected because of a lack of effective diagnosis. In this report, we have sequenced the 16S-23S rRNA gene internal transcribed spacer (ITS) of 10 Legionella species and subspecies, including L. anisa, L. bozemanii, L. dumoffii, L. fairfieldensis, L. gormanii, L. jordanis, L. maceachernii, L. micdadei, L. pneumophila subspp. fraseri and L. pneumophila subspp. pasculleii, and developed a rapid oligonucleotide microarray detection technique accordingly to identify 12 most common Legionella spp., which consist of 11 pathogenic species of L. anisa, L. bozemanii, L. dumoffii, L. gormanii, L. jordanis, L. longbeachae, L. maceachernii, L. micdadei, and L. pneumophila (including subspp. pneumophila, subspp. fraseri, and subspp. pasculleii) and one non-pathogenic species, L. fairfieldensis. Twenty-nine probes that reproducibly detected multiple Legionella species with high specificity were included in the array. A total of 52 strains, including 30 target pathogens and 22 non-target bacteria, were used to verify the oligonucleotide microarray assay. The sensitivity of the detection was at 1.0 ng with genomic DNA or 13 CFU/100 mL with Legionella cultures. The microarray detected seven samples of air conditioner-condensed water with 100% accuracy, validating the technique as a promising method for applications in basic microbiology, clinical diagnosis, food safety, and epidemiological surveillance. The phylogenetic study based on the ITS has also revealed that the non-pathogenic L. fairfieldensis is the closest to L. pneumophila than the nine other pathogenic Legionella spp. PMID:25469776

  17. A new oligonucleotide microarray for detection of pathogenic and non-pathogenic Legionella spp.

    PubMed

    Cao, Boyang; Liu, Xiangqian; Yu, Xiang; Chen, Min; Feng, Lu; Wang, Lei

    2014-01-01

    Legionella pneumophila has been recognized as the major cause of legionellosis since the discovery of the deadly disease. Legionella spp. other than L. pneumophila were later found to be responsible to many non-pneumophila infections. The non-L. pneumophila infections are likely under-detected because of a lack of effective diagnosis. In this report, we have sequenced the 16S-23S rRNA gene internal transcribed spacer (ITS) of 10 Legionella species and subspecies, including L. anisa, L. bozemanii, L. dumoffii, L. fairfieldensis, L. gormanii, L. jordanis, L. maceachernii, L. micdadei, L. pneumophila subspp. fraseri and L. pneumophila subspp. pasculleii, and developed a rapid oligonucleotide microarray detection technique accordingly to identify 12 most common Legionella spp., which consist of 11 pathogenic species of L. anisa, L. bozemanii, L. dumoffii, L. gormanii, L. jordanis, L. longbeachae, L. maceachernii, L. micdadei, and L. pneumophila (including subspp. pneumophila, subspp. fraseri, and subspp. pasculleii) and one non-pathogenic species, L. fairfieldensis. Twenty-nine probes that reproducibly detected multiple Legionella species with high specificity were included in the array. A total of 52 strains, including 30 target pathogens and 22 non-target bacteria, were used to verify the oligonucleotide microarray assay. The sensitivity of the detection was at 1.0 ng with genomic DNA or 13 CFU/100 mL with Legionella cultures. The microarray detected seven samples of air conditioner-condensed water with 100% accuracy, validating the technique as a promising method for applications in basic microbiology, clinical diagnosis, food safety, and epidemiological surveillance. The phylogenetic study based on the ITS has also revealed that the non-pathogenic L. fairfieldensis is the closest to L. pneumophila than the nine other pathogenic Legionella spp.

  18. Detecting and Genotyping Escherichia coli O157:H7 using multiplexed PCR and nucleic acid microarrays

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Call, Douglas R.; Brockman, Fred J.; Chandler, Darrell P.

    2000-12-01

    Rapid detection and characterization of food borne pathogens such as Escherichia coli O157:H7 is crucial for epidemiological investigations and food safety surveillance. As an alternative to conventional technologies, we examined the sensitivity and specificity of nucleic acid microarrays for detecting and genotyping E. coli O157:H7. The array was composed of oligonucleotide probes (25-30 mer) complementary to four virulence loci (intimin, Shiga-like toxins I and II, and hemolysin A). Target DNA was amplified from whole cells or from purified DNA via single or multiplexed polymerase chain reaction (PCR), and PCR products were hybridized to the array without further modification or purification.more » The array was 32-fold more sensitive than gel electrophoresis and capable of detecting amplification products from < 1 cell equivalent of genomic DNA (1 fg). Immunomagnetic capture, PCR and a microarray were subsequently used to detect 55 CFU ml-1 (E. coli O157:H7) from chicken rinsate without the aid of pre-enrichment. Four isolates of E. coli O157:H7 and one isolate of O91:H2, for which genotypic data were available, were unambiguously genotyped with this array. Glass based microarrays are relatively simple to construct and provide a rapid and sensitive means to detect multiplexed PCR products and the system is amenable to automation.« less

  19. Detecting and genotyping Escherichia coli O157:H7 using multiplexed PCR and nucleic acid microarrays

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Call, Douglas R.; Brockman, Fred J.; Chandler, Darrell P.

    2001-07-05

    Rapid detection and characterization of food borne pathogens such as Escherichia coli O157:H7 is crucial for epidemiological investigations and food safety surveillance. As an alternative to conventional technologies, we examined the sensitivity and specificity of nucleic acid microarrays for detecting and genotyping E. coli O157:H7. The array was composed of oligonucleotide probes (25-30 mer) complementary to four virulence loci (intimin, Shiga-like toxins I and II, and hemolysin A). Target DNA was amplified from whole cells or from purified DNA via single or multiplexed polymerase chain reaction (PCR), and PCR products were hybridized to the array without further modification or purification.more » The array was 32-fold more sensitive than gel electrophoresis and capable of detecting amplification products from < 1 cell equivalent of genomic DNA (1 fg). Immunomagnetic capture, PCR and a microarray were subsequently used to detect 55 CFUs ml-1 (E. coli O157:H7) from chicken rinsate without the aid of pre-enrichment. Four isolates of E. coli O157:H7 and one isolate of O91:H2, for which genotypic data were available, were unambiguously genotyped with this array. Glass based microarrays are relatively simple to construct and provide a rapid and sensitive means to detect multiplexed PCR products and the system is amenable to automation.« less

  20. Synthesis, properties, and NMR studies of a C8-phenylguanine modified oligonucleotide that preferentially adopts the Z DNA conformation.

    PubMed

    Gannett, Peter M; Heavner, Sue; Daft, Jonathan R; Shaughnessy, Kevin H; Epperson, Jon D; Greenbaum, Nancy L

    2003-10-01

    Carcinogenic aryl hydrazines produce C8-arylated purine adducts. The effect of these adducts on DNA conformation and their role in hydrazine carcinogenesis are unknown. Here, we describe a new synthetic route to produce these adducts that is also compatible with the synthesis of the corresponding phosphoramidites needed for oligonucleotide synthesis. Two oligonucleotides were prepared, an unmodified oligonucleotide, d((5)(')CGCGCGCGCG(3)(')), and a C8-phenylguanine modified oligonucleotide, d((5)(')CGCGCGCGCG(3)(')) (G = 8-phenylguanine). These oligonucleotides were compared using thermal denaturation, circular dichroism, NMR, and molecular modeling. The phenyl modification destabilizes the B DNA form and stabilizes the Z DNA form such that the B:Z ratio is near one under physiological conditions. In light of recent studies that show a role for Z DNA in gene expression and cell transformation, Z DNA stabilization by C8-arylguanine formation from aryl hydrazines may be relevant to their role in carcinogenesis.

  1. In situ oligonucleotide synthesis on poly(dimethylsiloxane): a flexible substrate for microarray fabrication

    PubMed Central

    Moorcroft, Matthew J.; Meuleman, Wouter R. A.; Latham, Steven G.; Nicholls, Thomas J.; Egeland, Ryan D.; Southern, Edwin M.

    2005-01-01

    In this paper, we demonstrate in situ synthesis of oligonucleotide probes on poly(dimethylsiloxane) (PDMS) microchannels through use of conventional phosphoramidite chemistry. PDMS polymer was moulded into a series of microchannels using standard soft lithography (micro-moulding), with dimensions <100 μm. The surface of the PDMS was derivatized by exposure to ultraviolet/ozone followed by vapour phase deposition of glycidoxypropyltrimethoxysilane and reaction with poly(ethylene glycol) spacer, resulting in a reactive surface for oligonucleotide coupling. High, reproducible yields were achieved for both 6mer and 21mer probes as assessed by hybridization to fluorescent oligonucleotides. Oligonucleotide surface density was comparable with that obtained on glass substrates. These results suggest PDMS as a stable and flexible alternative to glass as a suitable substrate in the fabrication and synthesis of DNA microarrays. PMID:15870385

  2. Sensitive detection of unlabeled oligonucleotides using a paired surface plasma waves biosensor.

    PubMed

    Li, Ying-Chang; Chiou, Chiuan-Chian; Luo, Ji-Dung; Chen, Wei-Ju; Su, Li-Chen; Chang, Ying-Feng; Chang, Yu-Sun; Lai, Chao-Sung; Lee, Cheng-Chung; Chou, Chien

    2012-05-15

    Detection of unlabeled oligonucleotides using surface plasmon resonance (SPR) is difficult because of the oligonucleotides' relatively lower molecular weight compared with proteins. In this paper, we describe a method for detecting unlabeled oligonucleotides at low concentration using a paired surface plasma waves biosensor (PSPWB). The biosensor uses a sensor chip with an immobilized probe to detect a target oligonucleotide via sequence-specific hybridization. PSPWB measures the demodulated amplitude of the heterodyne signal in real time. In the meantime, the ratio of the amplitudes between the detected output signal and reference can reduce the excess noise from the laser intensity fluctuation. Also, the common-path propagation of p and s waves cancels the common phase noise induced by temperature variation. Thus, a high signal-to-noise ratio (SNR) of the heterodyne signal is detected. The sequence specificity of oligonucleotide hybridization ensures that the platform is precisely discriminating between target and non-target oligonucleotides. Under optimized experimental conditions, the detected heterodyne signal increases linearly with the logarithm of the concentration of target oligonucleotide over the range 0.5-500 pM. The detection limit is 0.5 pM in this experiment. In addition, the non-target oligonucleotide at concentrations of 10 pM and 10nM generated signals only slightly higher than background, indicating the high selectivity and specificity of this method. Different length of perfectly matched oligonucleotide targets at 10-mer, 15-mer and 20-mer were identified at the concentration of 150 pM. Copyright © 2012 Elsevier B.V. All rights reserved.

  3. Next generation 1536-well oligonucleotide synthesizer with on-the-fly dispense.

    PubMed

    Jensen, Michael; Roberts, Lester; Johnson, Andrew; Fukushima, Marilyn; Davis, Ronald

    2014-02-10

    Here we report the development of our Next Generation Automated Multiplexed Oligonucleotide Synthesizer (NG-1536-AMOS), capable of producing 1536 samples in a single run using a multi-well filtered titer plate. With the potential to synthesize up to 3456 samples per plate, we converted the BioRAPTR Flying Reagent Dispenser into an open-well system where spent reagents are drained to waste under vacuum. During synthesis, reagents are delivered on-the-fly to each micro-titer well at volumes ≤5 μl with plate speeds up to 150 mm/s. Using gas-phase cleavage and deprotection, a full plate of 1536 60 mers may be processed with same-day turnaround with an average yield per well at 3.5 nmol. Final product at only $0.00277/base is eluted into a low-volume collection plate for immediate use in downstream application (e.g. Biomek FX for versatile sample handling). Also, crude oligonucleotide quality is comparable to that of commercial synthesis instrumentation, with an error rate on the NG-1536-AMOS platform of 1.53/717 bases. Furthermore, mass spectral analysis on strands synthesized up to 80 bases showed high purity with an average coupling efficiency of 99.5%. Copyright © 2013 Elsevier B.V. All rights reserved.

  4. Cy3 and Cy5 dyes attached to oligonucleotide terminus stabilize DNA duplexes: predictive thermodynamic model.

    PubMed

    Moreira, Bernardo G; You, Yong; Owczarzy, Richard

    2015-03-01

    Cyanine dyes are important chemical modifications of oligonucleotides exhibiting intensive and stable fluorescence at visible light wavelengths. When Cy3 or Cy5 dye is attached to 5' end of a DNA duplex, the dye stacks on the terminal base pair and stabilizes the duplex. Using optical melting experiments, we have determined thermodynamic parameters that can predict the effects of the dyes on duplex stability quantitatively (ΔG°, Tm). Both Cy dyes enhance duplex formation by 1.2 kcal/mol on average, however, this Gibbs energy contribution is sequence-dependent. If the Cy5 is attached to a pyrimidine nucleotide of pyrimidine-purine base pair, the stabilization is larger compared to the attachment to a purine nucleotide. This is likely due to increased stacking interactions of the dye to the purine of the complementary strand. Dangling (unpaired) nucleotides at duplex terminus are also known to enhance duplex stability. Stabilization originated from the Cy dyes is significantly larger than the stabilization due to the presence of dangling nucleotides. If both the dangling base and Cy3 are present, their thermodynamic contributions are approximately additive. New thermodynamic parameters improve predictions of duplex folding, which will help design oligonucleotide sequences for biophysical, biological, engineering, and nanotechnology applications. Copyright © 2015. Published by Elsevier B.V.

  5. Validation of the high-throughput marker technology DArT using the model plant Arabidopsis thaliana.

    PubMed

    Wittenberg, Alexander H J; van der Lee, Theo; Cayla, Cyril; Kilian, Andrzej; Visser, Richard G F; Schouten, Henk J

    2005-08-01

    Diversity Arrays Technology (DArT) is a microarray-based DNA marker technique for genome-wide discovery and genotyping of genetic variation. DArT allows simultaneous scoring of hundreds of restriction site based polymorphisms between genotypes and does not require DNA sequence information or site-specific oligonucleotides. This paper demonstrates the potential of DArT for genetic mapping by validating the quality and molecular basis of the markers, using the model plant Arabidopsis thaliana. Restriction fragments from a genomic representation of the ecotype Landsberg erecta (Ler) were amplified by PCR, individualized by cloning and spotted onto glass slides. The arrays were then hybridized with labeled genomic representations of the ecotypes Columbia (Col) and Ler and of individuals from an F(2) population obtained from a Col x Ler cross. The scoring of markers with specialized software was highly reproducible and 107 markers could unambiguously be ordered on a genetic linkage map. The marker order on the genetic linkage map coincided with the order on the DNA sequence map. Sequencing of the Ler markers and alignment with the available Col genome sequence confirmed that the polymorphism in DArT markers is largely a result of restriction site polymorphisms.

  6. Angubindin-1 opens the blood-brain barrier in vivo for delivery of antisense oligonucleotide to the central nervous system.

    PubMed

    Zeniya, Satoshi; Kuwahara, Hiroya; Daizo, Kaiichi; Watari, Akihiro; Kondoh, Masuo; Yoshida-Tanaka, Kie; Kaburagi, Hidetoshi; Asada, Ken; Nagata, Tetsuya; Nagahama, Masahiro; Yagi, Kiyohito; Yokota, Takanori

    2018-05-17

    Within the field of RNA therapeutics, antisense oligonucleotide-based therapeutics are a potentially powerful means of treating intractable diseases. However, if these therapeutics are used for the treatment of neurological disorders, safe yet efficient methods of delivering antisense oligonucleotides across the blood-brain barrier to the central nervous system must be developed. Here, we examined the use of angubindin-1, a binder to the tricellular tight junction, to modulate paracellular transport between brain microvascular endothelial cells in the blood-brain barrier for the delivery of antisense oligonucleotides to the central nervous system. This proof-of-concept study demonstrated that intravenously injected angubindin-1 increased the permeability of the blood-brain barrier and enabled transient delivery of subsequently administered antisense oligonucleotides into the mouse brain and spinal cord, leading to silencing of a target RNA without any overt adverse effects. We also found that two bicellular tight junction modulators did not produce such a silencing effect, suggesting that the tricellular tight junction is likely a better target for the delivery of antisense oligonucleotides than the bicellular tight junction. Our delivery strategy of modulating the tricellular tight junction in the blood-brain barrier via angubindin-1 provides a novel avenue of research for the development of antisense oligonucleotide-based therapeutics for the treatment of neurological disorders. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

  7. Identification of FVIII gene mutations in patients with hemophilia A using new combinatorial sequencing by hybridization

    PubMed Central

    Chetta, M.; Drmanac, A.; Santacroce, R.; Grandone, E.; Surrey, S.; Fortina, P.; Margaglione, M.

    2008-01-01

    BACKGROUND: Standard methods of mutation detection are time consuming in Hemophilia A (HA) rendering their application unavailable in some analysis such as prenatal diagnosis. OBJECTIVES: To evaluate the feasibility of combinatorial sequencing-by-hybridization (cSBH) as an alternative and reliable tool for mutation detection in FVIII gene. PATIENTS/METHODS: We have applied a new method of cSBH that uses two different colors for detection of multiple point mutations in the FVIII gene. The 26 exons encompassing the HA gene were analyzed in 7 newly diagnosed Italian patients and in 19 previously characterized individuals with FVIII deficiency. RESULTS: Data show that, when solution-phase TAMRA and QUASAR labeled 5-mer oligonucleotide sets mixed with unlabeled target PCR templates are co-hybridized in the presence of DNA ligase to universal 6-mer oligonucleotide probe-based arrays, a number of mutations can be successfully detected. The technique was reliable also in identifying a mutant FVIII allele in an obligate heterozygote. A novel missense mutation (Leu1843Thr) in exon 16 and three novel neutral polymorphisms are presented with an updated protocol for 2-color cSBH. CONCLUSIONS: cSBH is a reliable tool for mutation detection in FVIII gene and may represent a complementary method for the genetic screening of HA patients. PMID:20300295

  8. A sense oligonucleotide to inducible nitric oxide synthase mRNA increases the survival rate of rats in septic shock.

    PubMed

    Okuyama, Tetsuya; Nakatake, Richi; Kaibori, Masaki; Okumura, Tadayoshi; Kon, Masanori; Nishizawa, Mikio

    2018-01-30

    Natural antisense transcripts (asRNAs) that do not encode proteins are transcribed from rat, mouse, and human genes, encoding inducible nitric oxide synthase (iNOS), which catalyzes the production of the inflammatory mediator nitric oxide (NO). In septic shock, NO is excessively produced in hepatocytes and macrophages. The iNOS asRNA interacts with and stabilizes iNOS mRNA. We found that single-stranded 'sense' oligonucleotides corresponding to the iNOS mRNA sequence reduced iNOS mRNA levels by interfering with the mRNA-asRNA interactions in rat hepatocytes. The iNOS sense oligonucleotides that were substituted with phosphorothioate bonds and locked nucleic acids efficiently decreased the levels of iNOS mRNA and iNOS protein. In this study, the gene expression patterns in the livers of two endotoxemia model rats with acute liver failure were compared. Next, we optimized the sequence and modification of the iNOS sense oligonucleotides in interleukin 1β-treated rat hepatocytes. When a sense oligonucleotide was simultaneously administered with d-galactosamine and bacterial lipopolysaccharide (LPS) to rats, their survival rate significantly increased compared to the rats administered d-galactosamine and LPS alone. In the livers of the sense oligonucleotide-administered rats, apoptosis in the hepatocytes markedly decreased. These results suggest that natural antisense transcript-targeted regulation technology using iNOS sense oligonucleotides may be used to treat human inflammatory diseases, such as sepsis and septic shock. Copyright © 2017 Elsevier Inc. All rights reserved.

  9. The chemical evolution of oligonucleotide therapies of clinical utility.

    PubMed

    Khvorova, Anastasia; Watts, Jonathan K

    2017-03-01

    After nearly 40 years of development, oligonucleotide therapeutics are nearing meaningful clinical productivity. One of the key advantages of oligonucleotide drugs is that their delivery and potency are derived primarily from the chemical structure of the oligonucleotide whereas their target is defined by the base sequence. Thus, as oligonucleotides with a particular chemical design show appropriate distribution and safety profiles for clinical gene silencing in a particular tissue, this will open the door to the rapid development of additional drugs targeting other disease-associated genes in the same tissue. To achieve clinical productivity, the chemical architecture of the oligonucleotide needs to be optimized with a combination of sugar, backbone, nucleobase, and 3'- and 5'-terminal modifications. A portfolio of chemistries can be used to confer drug-like properties onto the oligonucleotide as a whole, with minor chemical changes often translating into major improvements in clinical efficacy. One outstanding challenge in oligonucleotide chemical development is the optimization of chemical architectures to ensure long-term safety. There are multiple designs that enable effective targeting of the liver, but a second challenge is to develop architectures that enable robust clinical efficacy in additional tissues.

  10. Development of an oligonucleotide probe for Aureobasidium pullulans based on the small-subunit rRNA gene.

    PubMed Central

    Li, S; Cullen, D; Hjort, M; Spear, R; Andrews, J H

    1996-01-01

    Aureobasidium pullulans, a cosmopolitan yeast-like fungus, colonizes leaf surfaces and has potential as a biocontrol agent of pathogens. To assess the feasibility of rRNA as a target for A. pullulans-specific oligonucleotide probes, we compared the nucleotide sequences of the small-subunit rRNA (18S) genes of 12 geographically diverse A. pullulans strains. Extreme sequence conservation was observed. The consensus A. pullulans sequence was compared with other fungal sequences to identify potential probes. A 21-mer probe which hybridized to the 12 A. pullulans strains but not to 98 other fungi, including 82 isolates from the phylloplane, was identified. A 17-mer highly specific for Cladosporium herbarum was also identified. These probes have potential in monitoring and quantifying fungi in leaf surface and other microbial communities. PMID:8633850

  11. A nonviral transfection approach in vitro: the design of a gold nanoparticle vector joint with microelectromechanical systems.

    PubMed

    Jen, Chun-Ping; Chen, Yu-Hung; Fan, Chun-sheng; Yeh, Chen-Sheng; Lin, Yu-Cheng; Shieh, Dar-Bin; Wu, Chao-Ling; Chen, Dong-Hwang; Chou, Chen-Hsi

    2004-02-17

    Au nanoparticles modified with 21-base thiolated-oligonucleotides have been evaluated as delivery vehicles for the development of a nonviral transfection platform. The electromigration combined with electroporation for DNA delivery in an osteoblast like cell was employed to test on microchips. Electroporation introduces foreign materials into cells by applying impulses of electric field to induce multiple transient pores on the cell membrane through dielectric breakdown of the cell membrane. On the basis of the characteristic surface plasmon of the Au particles, UV-vis absorption was utilized to qualitatively judge the efficiency of delivery. Transmission electron microscopy images and atomic absorption measurements (quantitative analysis) provided evidence of the bare Au and Au/oligonucleotide nanoparticles before and after electroporation and electromigration function. The experiments demonstrated that electrophoretic migration followed by electroporation significantly enhanced the transportation efficiency of the nanoparticle-oligonucleotide complexes as compared with electroporation alone. Most interestingly, Au capped with oligonucleotides led to optimal performance. On the other hand, the bare Au colloidal suspensions resulted in aggregation, which might be an obstacle to the internalization process. In addition, analytical results demonstrated an increase in the local particle concentrations on the cell surface that provided additional support for the mechanism underlying the improved Au nanoparticle transportation into cells in the presence of electromigration function.

  12. Validation of the Swine Protein-Annotated Oligonucleotide Microarray

    USDA-ARS?s Scientific Manuscript database

    The specificity and utility of the Swine Protein-Annotated Oligonucleotide Microarray, or Pigoligoarray (www.pigoligoarray.org), has been evaluated by profiling the expression of transcripts from four porcine tissues. Tools for comparative analyses of expression on the Pigoligoarray were developed i...

  13. DNA Microarray Profiling Highlights Nrf2-Mediated Chemoprevention Targeted by Wasabi-Derived Isothiocyanates in HepG2 Cells.

    PubMed

    Trio, Phoebe Zapanta; Kawahara, Atsuyoshi; Tanigawa, Shunsuke; Sakao, Kozue; Hou, De-Xing

    2017-01-01

    6-MSITC and 6-MTITC are sulforaphane (SFN) analogs found in Japanese Wasabi. As we reported previously, Wasabi isothiocyanates (ITCs) are activators of Nrf2-antioxidant response element pathway, and also inhibitors of pro-inflammatory cyclooxygenase-2. This study is the first to assess the global changes in transcript levels by Wasabi ITCs, comparing with SFN, in HepG2 cells. We performed comparative gene expression profiling by treating HepG2 cells with ITCs, followed by DNA microarray analyses using HG-U133 plus 2.0 oligonucleotide array. Partial array data on selected gene products were confirmed by RT-PCR and Western blotting. Ingenuity Pathway Analysis (IPA) was used to identify functional subsets of genes and biologically significant network pathways. 6-MTITC showed the highest number of differentially altered (≥2 folds) gene expression, of which 114 genes were upregulated and 75 were downregulated. IPA revealed that Nrf2-mediated pathway, together with glutamate metabolism, is the common significantly modulated pathway across treatments. Interestingly, 6-MSITC exhibited the most potent effect toward Nrf2-mediated pathway. Our data suggest that 6-MSITC could exert chemopreventive role against cancer through its underlying antioxidant activity via the activation of Nrf2-mediated subsequent induction of cytoprotective genes.

  14. Circular DNA by "Bis-Click" Ligation: Template-Independent Intramolecular Circularization of Oligonucleotides with Terminal Alkynyl Groups Utilizing Bifunctional Azides.

    PubMed

    Yang, Haozhe; Seela, Frank

    2016-01-22

    A highly effective and convenient "bis-click" strategy was developed for the template-independent circularization of single-stranded oligonucleotides by employing copper(I)-assisted azide-alkyne cycloaddition. Terminal triple bonds were incorporated at both ends of linear oligonucleotides. Alkynylated 7-deaza-2'-deoxyadenosine and 2'-deoxyuridine residues with different side chains were used in solid-phase synthesis with phosphoramidite chemistry. The bis-click ligation of linear 9- to 36-mer oligonucleotides with 1,4-bis(azidomethyl)benzene afforded circular DNA in a simple and selective way; azido modification of the oligonucleotide was not necessary. Short ethynyl side chains were compatible with the circularization of longer oligonucleotides, whereas octadiynyl residues were used for short 9-mers. Compared with linear duplexes, circular bis-click constructs exhibit a significantly increased duplex stability over their linear counterparts. The intramolecular bis-click ligation protocol is not limited to DNA, but may also be suitable for the construction of other macrocycles, such as circular RNAs, peptides, or polysaccharides. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. High Boron-loaded DNA-Oligomers as Potential Boron Neutron Capture Therapy and Antisense Oligonucleotide Dual-Action Anticancer Agents.

    PubMed

    Kaniowski, Damian; Ebenryter-Olbińska, Katarzyna; Sobczak, Milena; Wojtczak, Błażej; Janczak, Sławomir; Leśnikowski, Zbigniew J; Nawrot, Barbara

    2017-08-23

    Boron cluster-modified therapeutic nucleic acids with improved properties are of interest in gene therapy and in cancer boron neutron capture therapy (BNCT). High metallacarborane-loaded antisense oligonucleotides (ASOs) targeting epidermal growth factor receptor (EGFR) were synthesized through post-synthetic Cu (I)-assisted "click" conjugation of alkyne-modified DNA-oligonucleotides with a boron cluster alkyl azide component. The obtained oligomers exhibited increased lipophilicity compared to their non-modified precursors, while their binding affinity to complementary DNA and RNA strands was slightly decreased. Multiple metallacarborane residues present in the oligonucleotide chain, each containing 18 B-H groups, enabled the use of IR spectroscopy as a convenient analytical method for these oligomers based on the diagnostic B-H signal at 2400-2650 cm -1 . The silencing activity of boron cluster-modified ASOs used at higher concentrations was similar to that of unmodified oligonucleotides. The screened ASOs, when used in low concentrations (up to 50 μM), exhibited pro-oxidative properties by inducing ROS production and an increase in mitochondrial activities in HeLa cells. In contrast, when used at higher concentrations, the ASOs exhibited anti-oxidative properties by lowering ROS species levels. In the HeLa cells (tested in the MTT assay) treated (without lipofectamine) or transfected with the screened compounds, the mitochondrial activity remained equal to the control level or only slightly changed (±30%). These findings may be useful in the design of dual-action boron cluster-modified therapeutic nucleic acids with combined antisense and anti-oxidant properties.

  16. Mucin-mediated nanocarrier disassembly for triggered uptake of oligonucleotides as a delivery strategy for the potential treatment of mucosal tumours

    NASA Astrophysics Data System (ADS)

    Martirosyan, A.; Olesen, M. J.; Fenton, R. A.; Kjems, J.; Howard, K. A.

    2016-06-01

    This work demonstrates gastric mucin-triggered nanocarrier disassembly for release of antisense oligonucleotides and consequent unassisted cellular entry as a novel oral delivery strategy. A fluorescence activation-based reporter system was used to investigate the interaction and mucin-mediated disassembly of chitosan-based nanocarriers containing a 13-mer DNA oligonucleotide with a flanked locked RNA nucleic acid gapmer design. Gastric mucins were shown to trigger gapmer release from nanocarriers that was dependent on the interaction time, mucin concentration and N : P ratio with a maximal release at N : P 10. In contrast to siRNA, naked gapmers exhibited uptake into mucus producing HT-MTX mono-cultures and HT-MTX co-cultured with the carcinoma epithelial cell line Caco-2. Importantly, in vivo gapmer uptake was observed in epithelial tissue 30 min post-injection in murine intestinal loops. The findings present a mucosal design-based system tailored for local delivery of oligonucleotides that may maximize the effectiveness of gene silencing therapeutics within tumours at mucosal sites.This work demonstrates gastric mucin-triggered nanocarrier disassembly for release of antisense oligonucleotides and consequent unassisted cellular entry as a novel oral delivery strategy. A fluorescence activation-based reporter system was used to investigate the interaction and mucin-mediated disassembly of chitosan-based nanocarriers containing a 13-mer DNA oligonucleotide with a flanked locked RNA nucleic acid gapmer design. Gastric mucins were shown to trigger gapmer release from nanocarriers that was dependent on the interaction time, mucin concentration and N : P ratio with a maximal release at N : P 10. In contrast to siRNA, naked gapmers exhibited uptake into mucus producing HT-MTX mono-cultures and HT-MTX co-cultured with the carcinoma epithelial cell line Caco-2. Importantly, in vivo gapmer uptake was observed in epithelial tissue 30 min post-injection in murine intestinal loops. The findings present a mucosal design-based system tailored for local delivery of oligonucleotides that may maximize the effectiveness of gene silencing therapeutics within tumours at mucosal sites. Electronic supplementary information (ESI) available. See DOI: 10.1039/c5nr07206a

  17. Characterization and electrochemical response of DNA functionalized 2nm gold nanoparticles confined in a nanochannel array.

    PubMed

    Peinetti, Ana S; Ceretti, Helena; Mizrahi, Martín; González, Graciela A; Ramírez, Silvana A; Requejo, Félix G; Montserrat, Javier M; Battaglini, Fernando

    2018-06-01

    Polyvalent gold nanoparticle oligonucleotide conjugates are subject of intense research. Even though 2nm diameter AuNPs have been previously modified with DNA, little is known about their structure and electrochemical behavior. In this work, we examine the influence of different surface modification strategies on the interplay between the meso-organization and the molecular recognition properties of a 27-mer DNA strand. This DNA strand is functionalized with different sulfur-containing moieties and immobilized on 2nm gold nanoparticles confined on a nanoporous alumina, working the whole system as an electrode array. Surface coverages were determined by EXAFS and the performance as recognition elements for impedance-based sensors is evaluated. Our results prove that low DNA coverages on the confined nanoparticles prompt to a more sensitive response, showing the relevance in avoiding the DNA strand overcrowding. The system was able to determine a concentration as low as 100pM of the complementary strand, thus introducing the foundations for the construction of label-free genosensors at the nanometer scale. Copyright © 2018 Elsevier B.V. All rights reserved.

  18. In Silico Screening Based on Predictive Algorithms as a Design Tool for Exon Skipping Oligonucleotides in Duchenne Muscular Dystrophy

    PubMed Central

    Echigoya, Yusuke; Mouly, Vincent; Garcia, Luis; Yokota, Toshifumi; Duddy, William

    2015-01-01

    The use of antisense ‘splice-switching’ oligonucleotides to induce exon skipping represents a potential therapeutic approach to various human genetic diseases. It has achieved greatest maturity in exon skipping of the dystrophin transcript in Duchenne muscular dystrophy (DMD), for which several clinical trials are completed or ongoing, and a large body of data exists describing tested oligonucleotides and their efficacy. The rational design of an exon skipping oligonucleotide involves the choice of an antisense sequence, usually between 15 and 32 nucleotides, targeting the exon that is to be skipped. Although parameters describing the target site can be computationally estimated and several have been identified to correlate with efficacy, methods to predict efficacy are limited. Here, an in silico pre-screening approach is proposed, based on predictive statistical modelling. Previous DMD data were compiled together and, for each oligonucleotide, some 60 descriptors were considered. Statistical modelling approaches were applied to derive algorithms that predict exon skipping for a given target site. We confirmed (1) the binding energetics of the oligonucleotide to the RNA, and (2) the distance in bases of the target site from the splice acceptor site, as the two most predictive parameters, and we included these and several other parameters (while discounting many) into an in silico screening process, based on their capacity to predict high or low efficacy in either phosphorodiamidate morpholino oligomers (89% correctly predicted) and/or 2’O Methyl RNA oligonucleotides (76% correctly predicted). Predictions correlated strongly with in vitro testing for sixteen de novo PMO sequences targeting various positions on DMD exons 44 (R2 0.89) and 53 (R2 0.89), one of which represents a potential novel candidate for clinical trials. We provide these algorithms together with a computational tool that facilitates screening to predict exon skipping efficacy at each position of a target exon. PMID:25816009

  19. Microfabricated Fountain Pens for High-Density DNA Arrays

    PubMed Central

    Reese, Matthew O.; van Dam, R. Michae; Scherer, Axel; Quake, Stephen R.

    2003-01-01

    We used photolithographic microfabrication techniques to create very small stainless steel fountain pens that were installed in place of conventional pens on a microarray spotter. Because of the small feature size produced by the microfabricated pens, we were able to print arrays with up to 25,000 spots/cm2, significantly higher than can be achieved by other deposition methods. This feature density is sufficiently large that a standard microscope slide can contain multiple replicates of every gene in a complex organism such as a mouse or human. We tested carryover during array printing with dye solution, labeled DNA, and hybridized DNA, and we found it to be indistinguishable from background. Hybridization also showed good sequence specificity to printed oligonucleotides. In addition to improved slide capacity, the microfabrication process offers the possibility of low-cost mass-produced pens and the flexibility to include novel pen features that cannot be machined with conventional techniques. PMID:12975313

  20. High-resolution array comparative genomic hybridization analysis of human bronchial and salivary adenoid cystic carcinoma.

    PubMed

    Bernheim, Alain; Toujani, Saloua; Saulnier, Patrick; Robert, Thomas; Casiraghi, Odile; Validire, Pierre; Temam, Stéphane; Menard, Philippe; Dessen, Philippe; Fouret, Pierre

    2008-05-01

    Adenoid cystic carcinoma (ACC) is a rare but distinctive tumor. Oligonucleotide array comparative genomic hybridization has been applied for cataloging genomic copy number alterations (CNAs) in 17 frozen salivary or bronchial tumors. Only four whole chromosome CNAs were found, and most cases had 2-4 segmental CNAs. No high level amplification was observed. There were recurrent gains at 7p15.2, 17q21-25, and 22q11-13, and recurrent losses at 1p35, 6q22-25, 8q12-13, 9p21, 12q12-13, and 17p11-13. The minimal region of gain at 7p15.2 contained the HOXA cluster. The minimal common regions of deletions contained the CDKN2A/CDKN2B, TP53, and LIMA1 tumor suppressor genes. The recurrent deletion at 8q12.3-13.1 contained no straightforward tumor suppressor gene, but the MIRN124A2 microRNA gene, whose product regulates MMP2 and CDK6. Among unique CNAs, gains harbored CCND1, KIT/PDGFRA/KDR, MDM2, and JAK2. The CNAs involving CCND1, MDM2, KIT, CDKN2A/2B, and TP53 were validated by FISH and/or multiplex ligation-dependent probe amplification. Although most tumors overexpressed cyclin D1 compared with surrounding glands, the only case to overexpress MDM2 had the corresponding CNA. In conclusion, our report suggests that ACC is characterized by a relatively low level of structural complexity. Array CGH and immunohistochemical data implicate MDM2 as the oncogene targeted at 12q15. The gain at 4q12 warrants further exploration as it contains a cluster of receptor kinase genes (KIT/PDGFRA/KDR), whose products can be responsive to specific therapies.

  1. Time-series oligonucleotide count to assign antiviral siRNAs with long utility fit in the big data era

    PubMed Central

    Wada, K; Wada, Y; Iwasaki, Y; Ikemura, T

    2017-01-01

    Oligonucleotides are key elements of nucleic acid therapeutics such as small interfering RNAs (siRNAs). Influenza and Ebolaviruses are zoonotic RNA viruses mutating very rapidly, and their sequence changes must be characterized intensively to design therapeutic oligonucleotides with long utility. Focusing on a total of 182 experimentally validated siRNAs for influenza A, B and Ebolaviruses compiled by the siRNA database, we conducted time-series analyses of occurrences of siRNA targets in these viral genomes. Reflecting their high mutation rates, occurrences of target oligonucleotides evidently fluctuate in viral populations and often disappear. Time-series analysis of the one-base changed sequences derived from each original target identified the oligonucleotide that shows a compensatory increase and will potentially become the ‘awaiting-type oligonucleotide’ the combined use of this oligonucleotide with the original can provide therapeutics with long utility. This strategy is also useful for assigning diagnostic reverse transcription-PCR primers with long utility. PMID:28905886

  2. Synthesis and biophysical properties of 5'-thio-2',4'-BNA/LNA oligonucleotide.

    PubMed

    Islam, Md Ariful; Fujisaka, Aki; Mori, Shohei; Ito, Kosuke Ramon; Yamaguchi, Takao; Obika, Satoshi

    2018-07-23

    Phosphorothioate modification of oligonucleotides is one of the most promising chemical modifications in nucleic acid therapeutics. Structurally similar 5'-thio or phosphorothiolate-modified nucleotides, in which the 5'-bridging oxygen atom is replaced with a sulfur atom, are attracting attention and gaining importance in oligonucleotide-based research. In our present study, we synthesized 5'-thio-2',4'-BNA/LNA monomers bearing thymine or 5-methylcytosine nucleobase. The 5'-thio-2',4'-BNA/LNA monomers were successfully incorporated into target oligonucleotides, and their nuclease stability and binding affinity with complementary strands were evaluated. Copyright © 2018 Elsevier Ltd. All rights reserved.

  3. Engineering Improvements in a Bacterial Therapeutic Delivery System for Breast Cancer

    DTIC Science & Technology

    2009-09-01

    curve is observed on the other platform (Supplementary Figure 2H). Although it is not the object of this article to explore a physical explanation for...light-directed oligonucleotide microarrays using a digital micromirror array.. Nat Biotechnol, 17(10), 974–978. [12] Matveeva, O. V., Shabalina, S. A...Rouillard, J. M., Whittam, T. S., Gulari, E., Tiedje, J. M., and Hashsham, S. A. (2006) On- chip non-equilibrium dissociation curves and dissociation

  4. Partial trisomy 16p (16p12.2→pter) and partial monosomy 22q (22q13.31 →qter) presenting with fetal ascites and ventriculomegaly: prenatal diagnosis and array comparative genomic hybridization characterization.

    PubMed

    Chen, Chih-Ping; Su, Yi-Ning; Young, Richard Shih-Hung; Tsai, Fuu-Jen; Wu, Pei-Chen; Chern, Schu-Rern; Town, Dai-Dyi; Pan, Chen-Wen; Wang, Wayseen

    2010-12-01

    To present prenatal diagnosis and array comparative genomic hybridization (aCGH) characterization of partial trisomy 16p (16p12.2→pter) and partial monosomy 22q (22q13.31→qter) presenting with fetal ascites and ventriculomegaly in the second trimester. A 31-year-old woman, gravida 2, para 1, was referred to the hospital at 20 weeks of gestation because of fetal ascites. Amniocentesis revealed a derivative chromosome 22. Subsequent parental karyotyping revealed that the father carried a balanced reciprocal translocation between 16p12 and 22q13. Bacterial artificial chromosome-based aCGH using amniocyte DNA demonstrated partial trisomy 16p and partial monosomy 22q [arr cgh 16p13.3p12.2 (CTD-3077J14→RP11-650D5)x3, 22q13.31q13.33 (RP1-111J24→CTD-3035C16)x1]. Oligonucleotide-based aCGH showed a 20.9-Mb duplication of distal 16p and an approximate 3.7-Mb deletion of distal 22q. Level II ultrasound revealed fetal ascites and ventriculomegaly. The pregnancy was terminated and a malformed male fetus was delivered with craniofacial dysmorphism and abnormalities of the digits. The fetal karyotype was 46,XY,der(22)t(16;22)(p12.2;q13.31)pat. The paternal karyotype was 46,XY,t(16;22)(p12.2;q13.31). Partial trisomy 16p can be associated with fetal ascites and ventriculomegaly in the second trimester. Prenatal sonographic detection of fetal ascites in association with ventriculomegaly should alert chromosomal abnormalities and prompt cytogenetic investigation, which may lead to the identification of an unexpected parental translocation involving chromosomal segments associated with cerebral and vascular abnormalities. Copyright © 2010 Taiwan Association of Obstetric & Gynecology. Published by Elsevier B.V. All rights reserved.

  5. Partial monosomy 13q (13q21.32--->qter) and partial trisomy 8p (8p1--->pter) presenting with anencephaly and increased nuchal translucency: array comparative genomic hybridization characterization.

    PubMed

    Chen, Chih-Ping; Su, Yi-Ning; Tsai, Fuu-Jen; Lin, Ming-Huei; Wu, Pei-Chen; Chern, Schu-Rern; Lee, Chen-Chi; Pan, Chen-Wen; Wang, Wayseen

    2011-06-01

    To present array comparative genomic hybridization (aCGH) characterization of partial monosomy 13q (13q21.32→qter) and partial trisomy 8p (8p12→pter) presenting with anencephaly and increased nuchal translucency (NT). A 34-year-old primigravid woman was referred to the hospital at 12 weeks of gestation for termination of the pregnancy because of major structural abnormalities of the fetus. Prenatal ultrasound revealed a malformed fetus with anencephaly and an increased NT thickness of 5mm at 12 weeks of gestation. Cytogenetic analysis of the fetus revealed a derivative chromosome 13. The mother was subsequently found to carry a balanced reciprocal translocation between 8p12 and 13q21. Bacterial artificial chromosome-based aCGH using fetal DNA demonstrated partial trisomy 8p and partial monosomy 13q [arr cgh 8p23.3p12 (RP11-1150M5→RP11-1145H12)×3, 13q21.32q34 (RP11-326B4→RP11-450H16)×1]. Oligonucleotide-based aCGH showed a 36.7-Mb duplication of distal 8p and a 48.4-Mb deletion of distal 13q. The fetal karyotype was 46,XY,der(13) t(8;13)(p12;q21.32)mat. The maternal karyotype was 46,XX,t(8;13)(p12;q21.32). The 13q deletion syndrome can be associated with neural tube defects and increased NT in the first trimester. Prenatal sonographic detection of neural tube defects should alert chromosomal abnormalities and prompt cytogenetic investigation, which may lead to the identification of an unexpected parental translocation involving chromosomal segments associated with neural tube development. Copyright © 2011. Published by Elsevier B.V.

  6. The Highly Robust Electrical Interconnects and Ultrasensitive Biosensors Based on Embedded Carbon Nanotube Arrays

    NASA Technical Reports Server (NTRS)

    Li, Jun; Cassell, Alan; Koehne, Jessica; Chen, Hua; Ng, Hou Tee; Ye, Qi; Stevens, Ramsey; Han, Jie; Meyyappan, M.

    2003-01-01

    We report on our recent breakthroughs in two different applications using well-aligned carbon nanotube (CNT) arrays on Si chips, including (1) a novel processing solution for highly robust electrical interconnects in integrated circuit manufacturing, and (2) the development of ultrasensitive electrochemical DNA sensors. Both of them rely on the invention of a bottom-up fabrication scheme which includes six steps, including: (a) lithographic patterning, (b) depositing bottom conducting contacts, (c) depositing metal catalysts, (d) CNT growth by plasma enhanced chemical vapor deposition (PECVD), (e) dielectric gap-filling, and (f) chemical mechanical polishing (CMP). Such processes produce a stable planarized surface with only the open end of CNTs exposed, whch can be further processed or modified for different applications. By depositing patterned top contacts, the CNT can serve as vertical interconnects between the two conducting layers. This method is fundamentally different fiom current damascene processes and avoids problems associated with etching and filling of high aspect ratio holes at nanoscales. In addition, multiwalled CNTs (MWCNTs) are highly robust and can carry a current density of 10(exp 9) A/square centimeters without degradation. It has great potential to help extending the current Si technology. The embedded MWCNT array without the top contact layer can be also used as a nanoelectrode array in electrochemical biosensors. The cell time-constant and sensitivity can be dramatically improved. By functionalizing the tube ends with specific oligonucleotide probes, specific DNA targets can be detected with electrochemical methods down to subattomoles.

  7. Functional regulation of RNA-induced silencing complex by photoreactive oligonucleotides.

    PubMed

    Matsuyama, Yohei; Yamayoshi, Asako; Kobori, Akio; Murakami, Akira

    2014-02-01

    We developed a novel method for regulation of RISC function by photoreactive oligonucleotides (Ps-Oligo) containing 2'-O-psoralenylmethoxyethyl adenosine (Aps). We observed that inhibitory effects of Ps-Oligos on RISC function were enhanced by UV-irradiation compared with 2'-O-methyl-oligonucleotide without Aps. These results suggest Ps-Oligo inhibited RISC function by cross-linking effect, and we propose that the concept described in this report may be promising and applicable one to regulate the small RNA-mediated post-transcriptional regulation. Crown Copyright © 2013. Published by Elsevier Ltd. All rights reserved.

  8. Silver Nanoparticle Oligonucleotide Conjugates Based on DNA with Triple Cyclic Disulfide Moieties

    PubMed Central

    Lee, Jae-Seung; Lytton-Jean, Abigail K. R.; Hurst, Sarah J.; Mirkin, Chad A.

    2011-01-01

    We report a new strategy for preparing silver nanoparticle oligonucleotide conjugates that are based upon DNA with cyclic disulfide-anchoring groups. These particles are extremely stable and can withstand NaCl concentrations up to 1.0 M. When silver nanoparticles functionalized with complementary sequences are combined, they assemble to form DNA-linked nanoparticle networks. This assembly process is reversible with heating and is associated with a red-shifting of the particle surface plasmon resonance and a concomitant color change from yellow to pale red. Analogous to the oligonucleotide-functionalized gold nanoparticles, these particles also exhibit highly cooperative binding properties with extremely sharp melting transitions. This work is an important step towards being able to use silver nanoparticle oligonucleotide conjugates for a variety of purposes, including molecular diagnostic labels, synthons in programmable materials synthesis approaches, and functional components for nanoelectronic and plasmonic devices. PMID:17571909

  9. 5-Fluoro pyrimidines: labels to probe DNA and RNA secondary structures by 1D 19F NMR spectroscopy

    PubMed Central

    Puffer, Barbara; Kreutz, Christoph; Rieder, Ulrike; Ebert, Marc-Olivier; Konrat, Robert; Micura, Ronald

    2009-01-01

    19F NMR spectroscopy has proved to be a valuable tool to monitor functionally important conformational transitions of nucleic acids. Here, we present a systematic investigation on the application of 5-fluoro pyrimidines to probe DNA and RNA secondary structures. Oligonucleotides with the propensity to adapt secondary structure equilibria were chosen as model systems and analyzed by 1D 19F and 1H NMR spectroscopy. A comparison with the unmodified analogs revealed that the equilibrium characteristics of the bistable DNA and RNA oligonucleotides were hardly affected upon fluorine substitution at C5 of pyrimidines. This observation was in accordance with UV spectroscopic melting experiments which demonstrated that single 5-fluoro substitutions in double helices lead to comparable thermodynamic stabilities. Thus, 5-fluoro pyrimidine labeling of DNA and RNA can be reliably applied for NMR based nucleic acid secondary structure evaluation. Furthermore, we developed a facile synthetic route towards 5-fluoro cytidine phosphoramidites that enables their convenient site-specific incorporation into oligonucleotides by solid-phase synthesis. PMID:19843610

  10. 5-Fluoro pyrimidines: labels to probe DNA and RNA secondary structures by 1D 19F NMR spectroscopy.

    PubMed

    Puffer, Barbara; Kreutz, Christoph; Rieder, Ulrike; Ebert, Marc-Olivier; Konrat, Robert; Micura, Ronald

    2009-12-01

    (19)F NMR spectroscopy has proved to be a valuable tool to monitor functionally important conformational transitions of nucleic acids. Here, we present a systematic investigation on the application of 5-fluoro pyrimidines to probe DNA and RNA secondary structures. Oligonucleotides with the propensity to adapt secondary structure equilibria were chosen as model systems and analyzed by 1D (19)F and (1)H NMR spectroscopy. A comparison with the unmodified analogs revealed that the equilibrium characteristics of the bistable DNA and RNA oligonucleotides were hardly affected upon fluorine substitution at C5 of pyrimidines. This observation was in accordance with UV spectroscopic melting experiments which demonstrated that single 5-fluoro substitutions in double helices lead to comparable thermodynamic stabilities. Thus, 5-fluoro pyrimidine labeling of DNA and RNA can be reliably applied for NMR based nucleic acid secondary structure evaluation. Furthermore, we developed a facile synthetic route towards 5-fluoro cytidine phosphoramidites that enables their convenient site-specific incorporation into oligonucleotides by solid-phase synthesis.

  11. Intracellular ROS mediates gas plasma-facilitated cellular transfection in 2D and 3D cultures

    PubMed Central

    Xu, Dehui; Wang, Biqing; Xu, Yujing; Chen, Zeyu; Cui, Qinjie; Yang, Yanjie; Chen, Hailan; Kong, Michael G.

    2016-01-01

    This study reports the potential of cold atmospheric plasma (CAP) as a versatile tool for delivering oligonucleotides into mammalian cells. Compared to lipofection and electroporation methods, plasma transfection showed a better uptake efficiency and less cell death in the transfection of oligonucleotides. We demonstrated that the level of extracellular aqueous reactive oxygen species (ROS) produced by gas plasma is correlated with the uptake efficiency and that this is achieved through an increase of intracellular ROS levels and the resulting increase in cell membrane permeability. This finding was supported by the use of ROS scavengers, which reduced CAP-based uptake efficiency. In addition, we found that cold atmospheric plasma could transfer oligonucleotides such as siRNA and miRNA into cells even in 3D cultures, thus suggesting the potential for unique applications of CAP beyond those provided by standard transfection techniques. Together, our results suggest that cold plasma might provide an efficient technique for the delivery of siRNA and miRNA in 2D and 3D culture models. PMID:27296089

  12. Nanomechanics for specific biological detection

    NASA Astrophysics Data System (ADS)

    Alvarez, Mar; Carrascosa, Laura G.; Tamayo, Javier; Calle, Ana; Lechuga, Laura M.

    2003-04-01

    Nanomechanical biosensors have emerged as a promising platform for specific biological. Among the advantages are direct detection without need of labelling with fluorescent or radioactive molecules, very high sensitivity, reduced sensor area, and suitability for integration using silicon technology. Here we have studied the immobilization of oligonucleotide monolayers by monitoring the microcantilever bending. Oligonucleotides were derivatized with thiol molecules for self-assembly on the gold-coated side of a microcantilever. The geometry of the binding and the surface density were studied by mixing derivatized oligonucleotides with spacer self-assembled monolayers and by controlling the oligonucleotide functional group form. These results are compared with fluoresencent and chemiluminescence techniques. Furthermore, we present the first results of direct pesticide detection with microcantilever-based biosensors. Herbicide DDT was detected by performing competitive assays, in which the cantilever was coated with a synthetic DDT hapten, and it was exposured to different rations between the monoclonal antibody and the DDT. A new technique is presented for the detection of the nanomechanical response for biosensing applications, in which the resonant frequency is measured with about two orders of magnitude higher sensitivity. The low quality factor of the microcantilever in liquid is increased up by using an active feedback control, in which the cantilever oscillation is amplified and delayed and it is used as a driving force. The technique has been applied for the detection of ethanol, proteins, and pathogens.

  13. Improved bioactivity of G-rich triplex-forming oligonucleotides containing modified guanine bases

    PubMed Central

    Rogers, Faye A; Lloyd, Janice A; Tiwari, Meetu Kaushik

    2014-01-01

    Triplex structures generated by sequence-specific triplex-forming oligonucleotides (TFOs) have proven to be promising tools for gene targeting strategies. In addition, triplex technology has been highly utilized to study the molecular mechanisms of DNA repair, recombination and mutagenesis. However, triplex formation utilizing guanine-rich oligonucleotides as third strands can be inhibited by potassium-induced self-association resulting in G-quadruplex formation. We report here that guanine-rich TFOs partially substituted with 8-aza-7-deaza-guanine (PPG) have improved target site binding in potassium compared with TFOs containing the natural guanine base. We designed PPG-substituted TFOs to bind to a polypurine sequence in the supFG1 reporter gene. The binding efficiency of PPG-substituted TFOs to the target sequence was analyzed using electrophoresis mobility gel shift assays. We have determined that in the presence of potassium, the non-substituted TFO, AG30 did not bind to its target sequence, however binding was observed with the PPG-substituted AG30 under conditions with up to 140 mM KCl. The PPG-TFOs were able to maintain their ability to induce genomic modifications as measured by an assay for gene-targeted mutagenesis. In addition, these compounds were capable of triplex-induced DNA double strand breaks, which resulted in activation of apoptosis. PMID:25483840

  14. Spherical Nucleic Acids: A New Form of DNA

    NASA Astrophysics Data System (ADS)

    Cutler, Joshua Isaac

    Spherical Nucleic Acids (SNAs) are a new class of nucleic acid-based nanomaterials that exhibit unique properties currently being explored in the contexts of gene-based cancer therapies and in the design of programmable nanoparticle-based materials. The properties of SNAs differ from canonical, linear nucleic acids by virtue of their dense packing into an oriented 3-dimensional array. SNAs can be synthesized from a number of useful nanoparticle templates, such as plasmonic gold and silver, magnetic oxides, luminescent semi-conductor quantum dots, and silica. In addition, by crosslinking the oligonucleotides and dissolving the core, they can be made in a hollow form as well. This dissertation describes the evolution of SNAs from initial studies of inorganic nanoparticle-based materials densely functionalized with oligonucleotides to the proving of a hypothesis that their unique properties can be observed in a core-less structure if the nucleic acids are densely packed and highly oriented. Chapter two describes the synthesis of densely functionalized polyvalent oligonucleotide superparamagnetic iron oxide nanoparticles using the copper-catalyzed azide-alkyne cycloaddition reaction. These particles are shown to exhibit cooperative binding in a density- and salt concentration-dependent fashion, with nearly identical behaviors to those of SNA-functionalized gold nanoparticles. Importantly, these particles are the first non-gold particles shown to be capable of entering cells in high numbers via the SNA-mediated cellular uptake pathway, and provided the first evidence that SNA-mediated cellular uptake is core-independent. In the third chapter, a gold nanoparticle catalyzed alkyne cross-linking reaction is described that is capable of forming hollow organic nanoparticles using polymers with alkyne-functionalized backbones. With this method, the alkyne-modified polymers adsorb to the particle surfaces, cross-link on the surface, allowing the gold nanoparticle to be subsequently dissolved oxidatively with KCN or Iodine. The reaction pathway is analyzed through characterization of the reaction progression and resulting products, and a mechanistic pathway is proposed. This is the first report of a gold nanoparticle catalyzed reaction involving the conversion of propargyl ethers to terminal alcohols, which can subsequently cross-link if densely arranged on a gold nanoparticle surface. Importantly, these structures can be synthesized using gold nanoparticles of a range of sizes, thereby providing control over the size and properties of the resulting crosslinked particle. Chapter four returns to the topic of SNAs and builds upon the chemistry of chapter three culminating in the synthesis of cross-linked hollow SNA nanoparticles. These structures are formed by the cross-linking of synthetically modified alkyne-bearing oligonucleotides through the pathway described in chapter three. When the gold core is dissolved, the resulting hollow SNAs exhibit nearly identical binding, nuclease resistance, cellular uptake, and gene regulation properties of SNA-gold nanoparticle conjugates. Indeed, this chapter demonstrates that the unique properties of SNA-nanoparticle conjugates are core-independent and stem solely from the dense ensemble of oligonucleotides arranged on their surfaces. The fifth chapter further asserts the synthetic achievements made in chapter four by showing how hollow SNAs can be substituted for SNA-gold nanoparticles in the context of DNA-programmable assembly. In this case, they can be used as building blocks within binary synthetic schemes to synthesize unique nanoparticle superlattices. It bolsters the design rules of DNA-programmable assembly by showing that the predicted structures form based on the behavior of SNA hybridization, and are universal for any SNA-functionalized nanoparticle.

  15. Measuring the binding stoichiometry of HIV-1 Gag to very-low-density oligonucleotide surfaces using surface plasmon resonance spectroscopy.

    PubMed

    Stephen, Andrew G; Datta, Siddhartha A K; Worthy, Karen M; Bindu, Lakshman; Fivash, Matthew J; Turner, Kevin B; Fabris, Daniele; Rein, Alan; Fisher, Robert J

    2007-09-01

    The interaction of the HIV Gag polyprotein with nucleic acid is a critical step in the assembly of viral particles. The Gag polyprotein is composed of the matrix (MA), capsid (CA), and nucleocapsid (NC) domains. The NC domain is required for nucleic acid interactions, and the CA domain is required for Gag-Gag interactions. Previously, we have investigated the binding of the NC protein to d(TG)(n) oligonucleotides using surface plasmon resonance (SPR) spectroscopy. We found a single NC protein is able to bind to more than one immobilized oligonucleotide, provided that the oligonucleotides are close enough together. As NC is believed to be the nucleic acid binding domain of Gag, we might expect Gag to show the same complex behavior. We wished to analyze the stoichiometry of Gag binding to oligonucleotides without this complication due to tertiary complex formation. We have therefore analyzed Gag binding to extremely low oligonucleotide density on SPR chips. Such low densities of oligonucleotides are difficult to accurately quantitate. We have determined by Fourier transform ion cyclotron (FTICR) mass spectrometry that four molecules of NC bind to d(TG)(10) (a 20-base oligonucleotide). We developed a method of calibrating low-density surfaces using NC calibration injections. Knowing the maximal response and the stoichiometry of binding, we can precisely determine the amount of oligonucleotide immobilized at these very-low-density surfaces (<1 Response Unit). Using this approach, we have measured the binding of Gag to d(TG)(10). Gag binds to a 20-mer with a stoichiometry of greater than 4. This suggests that once Gag is bound to the immobilized oligonucleotide, additional Gag molecules can bind to this complex.

  16. Copy number analysis of NIPBL in a cohort of 510 patients reveals rare copy number variants and a mosaic deletion.

    PubMed

    Cheng, Yu-Wei; Tan, Christopher A; Minor, Agata; Arndt, Kelly; Wysinger, Latrice; Grange, Dorothy K; Kozel, Beth A; Robin, Nathaniel H; Waggoner, Darrel; Fitzpatrick, Carrie; Das, Soma; Del Gaudio, Daniela

    2014-03-01

    Cornelia de Lange syndrome (CdLS) is a genetically heterogeneous disorder characterized by growth retardation, intellectual disability, upper limb abnormalities, hirsutism, and characteristic facial features. In this study we explored the occurrence of intragenic NIPBL copy number variations (CNVs) in a cohort of 510 NIPBL sequence-negative patients with suspected CdLS. Copy number analysis was performed by custom exon-targeted oligonucleotide array-comparative genomic hybridization and/or MLPA. Whole-genome SNP array was used to further characterize rearrangements extending beyond the NIPBL gene. We identified NIPBL CNVs in 13 patients (2.5%) including one intragenic duplication and a deletion in mosaic state. Breakpoint sequences in two patients provided further evidence of a microhomology-mediated replicative mechanism as a potential predominant contributor to CNVs in NIPBL. Patients for whom clinical information was available share classical CdLS features including craniofacial and limb defects. Our experience in studying the frequency of NIBPL CNVs in the largest series of patients to date widens the mutational spectrum of NIPBL and emphasizes the clinical utility of performing NIPBL deletion/duplication analysis in patients with CdLS.

  17. MEF2C haploinsufficiency caused by either microdeletion of the 5q14.3 region or mutation is responsible for severe mental retardation with stereotypic movements, epilepsy and/or cerebral malformations.

    PubMed

    Le Meur, N; Holder-Espinasse, M; Jaillard, S; Goldenberg, A; Joriot, S; Amati-Bonneau, P; Guichet, A; Barth, M; Charollais, A; Journel, H; Auvin, S; Boucher, C; Kerckaert, J-P; David, V; Manouvrier-Hanu, S; Saugier-Veber, P; Frébourg, T; Dubourg, C; Andrieux, J; Bonneau, D

    2010-01-01

    Over the last few years, array-comparative genomic hybridisation (CGH) has considerably improved our ability to detect cryptic unbalanced rearrangements in patients with syndromic mental retardation. Molecular karyotyping of six patients with syndromic mental retardation was carried out using whole-genome oligonucleotide array-CGH. 5q14.3 microdeletions ranging from 216 kb to 8.8 Mb were detected in five unrelated patients with the following phenotypic similarities: severe mental retardation with absent speech, hypotonia and stereotypic movements. Facial dysmorphic features, epilepsy and/or cerebral malformations were also present in most of these patients. The minimal common deleted region of these 5q14 microdeletions encompassed only MEF2C, the gene for a protein known to act in brain as a neurogenesis effector, which regulates excitatory synapse number. In a patient with a similar phenotype, an MEF2C nonsense mutation was subsequently identified. Taken together, these results strongly suggest that haploinsufficiency of MEF2C is responsible for severe mental retardation with stereotypic movements, seizures and/or cerebral malformations.

  18. Oligonucleotide-based therapy for neurodegenerative diseases.

    PubMed

    Magen, Iddo; Hornstein, Eran

    2014-10-10

    Molecular genetics insight into the pathogenesis of several neurodegenerative diseases, such as Alzheimer׳s disease, Parkinson׳s disease, Huntington׳s disease and amyotrophic lateral sclerosis, encourages direct interference with the activity of neurotoxic genes or the molecular activation of neuroprotective pathways. Oligonucleotide-based therapies are recently emerging as an efficient strategy for drug development and these can be employed as new treatments of neurodegenerative states. Here we review advances in this field in recent years which suggest an encouraging assessment that oligonucleotide technologies for targeting of RNAs will enable the development of new therapies and will contribute to preservation of brain integrity. Copyright © 2014 Elsevier B.V. All rights reserved.

  19. Biocompatible artificial DNA linker that is read through by DNA polymerases and is functional in Escherichia coli

    PubMed Central

    El-Sagheer, Afaf H.; Sanzone, A. Pia; Gao, Rachel; Tavassoli, Ali; Brown, Tom

    2011-01-01

    A triazole mimic of a DNA phosphodiester linkage has been produced by templated chemical ligation of oligonucleotides functionalized with 5′-azide and 3′-alkyne. The individual azide and alkyne oligonucleotides were synthesized by standard phosphoramidite methods and assembled using a straightforward ligation procedure. This highly efficient chemical equivalent of enzymatic DNA ligation has been used to assemble a 300-mer from three 100-mer oligonucleotides, demonstrating the total chemical synthesis of very long oligonucleotides. The base sequences of the DNA strands containing this artificial linkage were copied during PCR with high fidelity and a gene containing the triazole linker was functional in Escherichia coli. PMID:21709264

  20. Chemistry, mechanism and clinical status of antisense oligonucleotides and duplex RNAs

    PubMed Central

    Shen, Xiulong; Corey, David R

    2018-01-01

    Abstract RNA plays a central role in the expression of all genes. Because any sequence within RNA can be recognized by complementary base pairing, synthetic oligonucleotides and oligonucleotide mimics offer a general strategy for controlling processes that affect disease. The two primary antisense approaches for regulating expression through recognition of cellular RNAs are single-stranded antisense oligonucleotides and duplex RNAs. This review will discuss the chemical modifications and molecular mechanisms that make synthetic nucleic acid drugs possible. Lessons learned from recent clinical trials will be summarized. Ongoing clinical trials are likely to decisively test the adequacy of our current generation of antisense nucleic acid technologies and highlight areas where more basic research is needed. PMID:29240946

  1. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Andersen, G.L.; He, Z.; DeSantis, T.Z.

    Microarrays have proven to be a useful and high-throughput method to provide targeted DNA sequence information for up to many thousands of specific genetic regions in a single test. A microarray consists of multiple DNA oligonucleotide probes that, under high stringency conditions, hybridize only to specific complementary nucleic acid sequences (targets). A fluorescent signal indicates the presence and, in many cases, the abundance of genetic regions of interest. In this chapter we will look at how microarrays are used in microbial ecology, especially with the recent increase in microbial community DNA sequence data. Of particular interest to microbial ecologists, phylogeneticmore » microarrays are used for the analysis of phylotypes in a community and functional gene arrays are used for the analysis of functional genes, and, by inference, phylotypes in environmental samples. A phylogenetic microarray that has been developed by the Andersen laboratory, the PhyloChip, will be discussed as an example of a microarray that targets the known diversity within the 16S rRNA gene to determine microbial community composition. Using multiple, confirmatory probes to increase the confidence of detection and a mismatch probe for every perfect match probe to minimize the effect of cross-hybridization by non-target regions, the PhyloChip is able to simultaneously identify any of thousands of taxa present in an environmental sample. The PhyloChip is shown to reveal greater diversity within a community than rRNA gene sequencing due to the placement of the entire gene product on the microarray compared with the analysis of up to thousands of individual molecules by traditional sequencing methods. A functional gene array that has been developed by the Zhou laboratory, the GeoChip, will be discussed as an example of a microarray that dynamically identifies functional activities of multiple members within a community. The recent version of GeoChip contains more than 24,000 50mer oligonucleotide probes and covers more than 10,000 gene sequences in 150 gene categories involved in carbon, nitrogen, sulfur, and phosphorus cycling, metal resistance and reduction, and organic contaminant degradation. GeoChip can be used as a generic tool for microbial community analysis, and also link microbial community structure to ecosystem functioning. Examples of the application of both arrays in different environmental samples will be described in the two subsequent sections.« less

  2. Large-Scale Interaction Profiling of Protein Domains Through Proteomic Peptide-Phage Display Using Custom Peptidomes.

    PubMed

    Seo, Moon-Hyeong; Nim, Satra; Jeon, Jouhyun; Kim, Philip M

    2017-01-01

    Protein-protein interactions are essential to cellular functions and signaling pathways. We recently combined bioinformatics and custom oligonucleotide arrays to construct custom-made peptide-phage libraries for screening peptide-protein interactions, an approach we call proteomic peptide-phage display (ProP-PD). In this chapter, we describe protocols for phage display for the identification of natural peptide binders for a given protein. We finally describe deep sequencing for the analysis of the proteomic peptide-phage display.

  3. Horseradish peroxidase-labeled oligonucleotides and fluorescent tyramides for rapid detection of chromosome-specific repeat sequences.

    PubMed

    van Gijlswijk, R P; Wiegant, J; Vervenne, R; Lasan, R; Tanke, H J; Raap, A K

    1996-01-01

    We present a sensitive and rapid fluorescence in situ hybridization (FISH) strategy for detecting chromosome-specific repeat sequences. It uses horseradish peroxidase (HRP)-labeled oligonucleotide sequences in combination with fluorescent tyramide-based detection. After in situ hybridization, the HRP conjugated to the oligonucleotide probe is used to deposit fluorescently labeled tyramide molecules at the site of hybridization. The method features full chemical synthesis of probes, strong FISH signals, and short processing periods, as well as multicolor capabilities.

  4. VRP09 Reduction of Corneal Scarring Following Blast and Burn Injuries to Cornea Using siRNAs Targeting TGFb and CTGF

    DTIC Science & Technology

    2013-03-01

    oligonucleotide-based drug approaches (better than ribozymes, antisense oligonucleotides ( ASO ), or microRNAs). (4) To accomplish these objectives, we...negative control scrambled ASO (designated NC). The combination of siRNAs T1 and R1 produced a knockdown of ~80% of TGFb1 protein in the conditioned...sequences (antisense oligonucleotides, ASOs ) into rabbit corneal cells and found that technique was very effective in delivering ASOs into the stroma and

  5. VRP09 Reduction of Corneal Scarring Following Blast and Burn Injuries to Cornea Using siRNAs Targeting TGFb and CTGF

    DTIC Science & Technology

    2012-10-01

    selective of all gene-targeted, oligonucleotide-based drug approaches (better than ribozymes, antisense oligonucleotides ( ASO ), or microRNAs).(4) We will...respect to a scrambled siRNA control. For the migration assay, a circular region in the middle of the well was removed using a gel removal solution...oligonucleotides, ASOs ) into rabbit corneal cells and found that technique was very effective in delivering ASOs into the stroma and even into the endothelial cell

  6. G-Quadruplex Forming Oligonucleotides as Anti-HIV Agents.

    PubMed

    Musumeci, Domenica; Riccardi, Claudia; Montesarchio, Daniela

    2015-09-22

    Though a variety of different non-canonical nucleic acids conformations have been recognized, G-quadruplex structures are probably the structural motifs most commonly found within known oligonucleotide-based aptamers. This could be ascribed to several factors, as their large conformational diversity, marked responsiveness of their folding/unfolding processes to external stimuli, high structural compactness and chemo-enzymatic and thermodynamic stability. A number of G-quadruplex-forming oligonucleotides having relevant in vitro anti-HIV activity have been discovered in the last two decades through either SELEX or rational design approaches. Improved aptamers have been obtained by chemical modifications of natural oligonucleotides, as terminal conjugations with large hydrophobic groups, replacement of phosphodiester linkages with phosphorothioate bonds or other surrogates, insertion of base-modified monomers, etc. In turn, detailed structural studies have elucidated the peculiar architectures adopted by many G-quadruplex-based aptamers and provided insight into their mechanism of action. An overview of the state-of-the-art knowledge of the relevance of putative G-quadruplex forming sequences within the viral genome and of the most studied G-quadruplex-forming aptamers, selectively targeting HIV proteins, is here presented.

  7. probeBase—an online resource for rRNA-targeted oligonucleotide probes and primers: new features 2016

    PubMed Central

    Greuter, Daniel; Loy, Alexander; Horn, Matthias; Rattei, Thomas

    2016-01-01

    probeBase http://www.probebase.net is a manually maintained and curated database of rRNA-targeted oligonucleotide probes and primers. Contextual information and multiple options for evaluating in silico hybridization performance against the most recent rRNA sequence databases are provided for each oligonucleotide entry, which makes probeBase an important and frequently used resource for microbiology research and diagnostics. Here we present a major update of probeBase, which was last featured in the NAR Database Issue 2007. This update describes a complete remodeling of the database architecture and environment to accommodate computationally efficient access. Improved search functions, sequence match tools and data output now extend the opportunities for finding suitable hierarchical probe sets that target an organism or taxon at different taxonomic levels. To facilitate the identification of complementary probe sets for organisms represented by short rRNA sequence reads generated by amplicon sequencing or metagenomic analysis with next generation sequencing technologies such as Illumina and IonTorrent, we introduce a novel tool that recovers surrogate near full-length rRNA sequences for short query sequences and finds matching oligonucleotides in probeBase. PMID:26586809

  8. 2′-O-[2-[(N,N-dimethylamino)oxy]ethyl]-modified oligonucleotides inhibit expression of mRNA in vitro and in vivo

    PubMed Central

    Prakash, Thazha P.; Johnston, Joseph F.; Graham, Mark J.; Condon, Thomas P.; Manoharan, Muthiah

    2004-01-01

    Synthesis and antisense activity of oligonucleotides modified with 2′-O-[2-[(N,N-dimethylamino)oxy] ethyl] (2′-O-DMAOE) are described. The 2′-O-DMAOE-modified oligonucleotides showed superior metabolic stability in mice. The phosphorothioate oligonucleotide ‘gapmers’, with 2′-O-DMAOE- modified nucleoside residues at the ends and 2′-deoxy nucleosides residues in the central region, showed dose-dependent inhibition of mRNA expression in cell culture for two targets. ‘Gapmer’ oligonucleotides have one or two 2′-O-modified regions and a 2′-deoxyoligonucleotide phosphorothioate region that allows RNase H digestion of target mRNA. To determine the in vivo potency and efficacy, BalbC mice were treated with 2′-O-DMAOE gapmers and a dose-dependent reduction in the targeted C-raf mRNA expression was observed. Oligonucleotides with 2′-O-DMAOE modifications throughout the sequences reduced the intercellular adhesion molecule-1 (ICAM-1) protein expression very efficiently in HUVEC cells with an IC50 of 1.8 nM. The inhibition of ICAM-1 protein expression by these uniformly modified 2′-O-DMAOE oligonucleotides may be due to selective interference with the formation of the translational initiation complex. These results demonstrate that 2′-O-DMAOE- modified oligonucleotides are useful for antisense-based therapeutics when either RNase H-dependent or RNase H-independent target reduction mechanisms are employed. PMID:14762210

  9. Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3;-terminus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yeo, Hyun Koo; Lee, Jae Young

    2012-04-18

    The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapor diffusion and diffracted to 2.8 {angstrom} resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 {angstrom}, {alpha} = 91.37, {beta} = 93.21, {gamma} = 92.35{sup o}.

  10. Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus.

    PubMed

    Yeo, Hyun Koo; Lee, Jae Young

    2010-05-01

    The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapour diffusion and diffracted to 2.8 A resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 A, alpha = 91.37, beta = 93.21, gamma = 92.35 degrees .

  11. Oligo/Polynucleotide-Based Gene Modification: Strategies and Therapeutic Potential

    PubMed Central

    Sargent, R. Geoffrey; Kim, Soya

    2011-01-01

    Oligonucleotide- and polynucleotide-based gene modification strategies were developed as an alternative to transgene-based and classical gene targeting-based gene therapy approaches for treatment of genetic disorders. Unlike the transgene-based strategies, oligo/polynucleotide gene targeting approaches maintain gene integrity and the relationship between the protein coding and gene-specific regulatory sequences. Oligo/polynucleotide-based gene modification also has several advantages over classical vector-based homologous recombination approaches. These include essentially complete homology to the target sequence and the potential to rapidly engineer patient-specific oligo/polynucleotide gene modification reagents. Several oligo/polynucleotide-based approaches have been shown to successfully mediate sequence-specific modification of genomic DNA in mammalian cells. The strategies involve the use of polynucleotide small DNA fragments, triplex-forming oligonucleotides, and single-stranded oligodeoxynucleotides to mediate homologous exchange. The primary focus of this review will be on the mechanistic aspects of the small fragment homologous replacement, triplex-forming oligonucleotide-mediated, and single-stranded oligodeoxynucleotide-mediated gene modification strategies as it relates to their therapeutic potential. PMID:21417933

  12. PNA-COMBO-FISH: From combinatorial probe design in silico to vitality compatible, specific labelling of gene targets in cell nuclei

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Müller, Patrick; Rößler, Jens; Schwarz-Finsterle, Jutta

    Recently, advantages concerning targeting specificity of PCR constructed oligonucleotide FISH probes in contrast to established FISH probes, e.g. BAC clones, have been demonstrated. These techniques, however, are still using labelling protocols with DNA denaturing steps applying harsh heat treatment with or without further denaturing chemical agents. COMBO-FISH (COMBinatorial Oligonucleotide FISH) allows the design of specific oligonucleotide probe combinations in silico. Thus, being independent from primer libraries or PCR laboratory conditions, the probe sequences extracted by computer sequence data base search can also be synthesized as single stranded PNA-probes (Peptide Nucleic Acid probes). Gene targets can be specifically labelled with atmore » least about 20 PNA-probes obtaining visibly background free specimens. By using appropriately designed triplex forming oligonucleotides, the denaturing procedures can completely be omitted. These results reveal a significant step towards oligonucleotide-FISH maintaining the 3D-nanostructure and even the viability of the cell target. The method is demonstrated with the detection of Her2/neu and GRB7 genes, which are indicators in breast cancer diagnosis and therapy. - Highlights: • Denaturation free protocols preserve 3D architecture of chromosomes and nuclei. • Labelling sets are determined in silico for duplex and triplex binding. • Probes are produced chemically with freely chosen backbones and base variants. • Peptide nucleic acid backbones reduce hindering charge interactions. • Intercalating side chains stabilize binding of short oligonucleotides.« less

  13. Calibration and assessment of channel-specific biases in microarray data with extended dynamical range.

    PubMed

    Bengtsson, Henrik; Jönsson, Göran; Vallon-Christersson, Johan

    2004-11-12

    Non-linearities in observed log-ratios of gene expressions, also known as intensity dependent log-ratios, can often be accounted for by global biases in the two channels being compared. Any step in a microarray process may introduce such offsets and in this article we study the biases introduced by the microarray scanner and the image analysis software. By scanning the same spotted oligonucleotide microarray at different photomultiplier tube (PMT) gains, we have identified a channel-specific bias present in two-channel microarray data. For the scanners analyzed it was in the range of 15-25 (out of 65,535). The observed bias was very stable between subsequent scans of the same array although the PMT gain was greatly adjusted. This indicates that the bias does not originate from a step preceding the scanner detector parts. The bias varies slightly between arrays. When comparing estimates based on data from the same array, but from different scanners, we have found that different scanners introduce different amounts of bias. So do various image analysis methods. We propose a scanning protocol and a constrained affine model that allows us to identify and estimate the bias in each channel. Backward transformation removes the bias and brings the channels to the same scale. The result is that systematic effects such as intensity dependent log-ratios are removed, but also that signal densities become much more similar. The average scan, which has a larger dynamical range and greater signal-to-noise ratio than individual scans, can then be obtained. The study shows that microarray scanners may introduce a significant bias in each channel. Such biases have to be calibrated for, otherwise systematic effects such as intensity dependent log-ratios will be observed. The proposed scanning protocol and calibration method is simple to use and is useful for evaluating scanner biases or for obtaining calibrated measurements with extended dynamical range and better precision. The cross-platform R package aroma, which implements all described methods, is available for free from http://www.maths.lth.se/bioinformatics/.

  14. A regenerated electrochemical biosensor for label-free detection of glucose and urea based on conformational switch of i-motif oligonucleotide probe.

    PubMed

    Gao, Zhong Feng; Chen, Dong Mei; Lei, Jing Lei; Luo, Hong Qun; Li, Nian Bing

    2015-10-15

    Improving the reproducibility of electrochemical signal remains a great challenge over the past decades. In this work, i-motif oligonucleotide probe-based electrochemical DNA (E-DNA) sensor is introduced for the first time as a regenerated sensing platform, which enhances the reproducibility of electrochemical signal, for label-free detection of glucose and urea. The addition of glucose or urea is able to activate glucose oxidase-catalyzed or urease-catalyzed reaction, inducing or destroying the formation of i-motif oligonucleotide probe. The conformational switch of oligonucleotide probe can be recorded by electrochemical impedance spectroscopy. Thus, the difference of electron transfer resistance is utilized for the quantitative determination of glucose and urea. We further demonstrate that the E-DNA sensor exhibits high selectivity, excellent stability, and remarkable regenerated ability. The human serum analysis indicates that this simple and regenerated strategy holds promising potential in future biosensing applications. Copyright © 2015 Elsevier B.V. All rights reserved.

  15. Selective Detection of Peptide-Oligonucleotide Heteroconjugates Utilizing Capillary HPLC-ICPMS

    NASA Astrophysics Data System (ADS)

    Catron, Brittany; Caruso, Joseph A.; Limbach, Patrick A.

    2012-06-01

    A method for the selective detection and quantification of peptide:oligonucleotide heteroconjugates, such as those generated by protein:nucleic acid cross-links, using capillary reversed-phase high performance liquid chromatography (cap-RPHPLC) coupled with inductively coupled plasma mass spectrometry detection (ICPMS) is described. The selective detection of phosphorus as 31P+, the only natural isotope, in peptide-oligonucleotide heteroconjugates is enabled by the elemental detection capabilities of the ICPMS. Mobile phase conditions that allow separation of heteroconjugates while maintaining ICPMS compatibility were investigated. We found that trifluoroacetic acid (TFA) mobile phases, used in conventional peptide separations, and hexafluoroisopropanol/triethylamine (HFIP/TEA) mobile phases, used in conventional oligonucleotide separations, both are compatible with ICPMS and enable heteroconjugate separation. The TFA-based separations yielded limits of detection (LOD) of ~40 ppb phosphorus, which is nearly seven times lower than the LOD for HFIP/TEA-based separations. Using the TFA mobile phase, 1-2 pmol of a model heteroconjugate were routinely separated and detected by this optimized capLC-ICPMS method.

  16. In Situ Identification of Cyanobacteria with Horseradish Peroxidase-Labeled, rRNA-Targeted Oligonucleotide Probes

    PubMed Central

    Schönhuber, Wilhelm; Zarda, Boris; Eix, Stella; Rippka, Rosmarie; Herdman, Michael; Ludwig, Wolfgang; Amann, Rudolf

    1999-01-01

    Individual cyanobacterial cells are normally identified in environmental samples only on the basis of their pigmentation and morphology. However, these criteria are often insufficient for the differentiation of species. Here, a whole-cell hybridization technique is presented that uses horseradish peroxidase (HRP)-labeled, rRNA-targeted oligonucleotides for in situ identification of cyanobacteria. This indirect method, in which the probe-conferred enzyme has to be visualized in an additional step, was necessary since fluorescently monolabeled oligonucleotides were insufficient to overstain the autofluorescence of the target cells. Initially, a nonfluorescent detection assay was developed and successfully applied to cyanobacterial mats. Later, it was demonstrated that tyramide signal amplification (TSA) resulted in fluorescent signals far above the level of autofluorescence. Furthermore, TSA-based detection of HRP was more sensitive than that based on nonfluorescent substrates. Critical points of the assay, such as cell fixation and permeabilization, specificity, and sensitivity, were systematically investigated by using four oligonucleotides newly designed to target groups of cyanobacteria. PMID:10049892

  17. Design and evaluation of Actichip, a thematic microarray for the study of the actin cytoskeleton

    PubMed Central

    Muller, Jean; Mehlen, André; Vetter, Guillaume; Yatskou, Mikalai; Muller, Arnaud; Chalmel, Frédéric; Poch, Olivier; Friederich, Evelyne; Vallar, Laurent

    2007-01-01

    Background The actin cytoskeleton plays a crucial role in supporting and regulating numerous cellular processes. Mutations or alterations in the expression levels affecting the actin cytoskeleton system or related regulatory mechanisms are often associated with complex diseases such as cancer. Understanding how qualitative or quantitative changes in expression of the set of actin cytoskeleton genes are integrated to control actin dynamics and organisation is currently a challenge and should provide insights in identifying potential targets for drug discovery. Here we report the development of a dedicated microarray, the Actichip, containing 60-mer oligonucleotide probes for 327 genes selected for transcriptome analysis of the human actin cytoskeleton. Results Genomic data and sequence analysis features were retrieved from GenBank and stored in an integrative database called Actinome. From these data, probes were designed using a home-made program (CADO4MI) allowing sequence refinement and improved probe specificity by combining the complementary information recovered from the UniGene and RefSeq databases. Actichip performance was analysed by hybridisation with RNAs extracted from epithelial MCF-7 cells and human skeletal muscle. Using thoroughly standardised procedures, we obtained microarray images with excellent quality resulting in high data reproducibility. Actichip displayed a large dynamic range extending over three logs with a limit of sensitivity between one and ten copies of transcript per cell. The array allowed accurate detection of small changes in gene expression and reliable classification of samples based on the expression profiles of tissue-specific genes. When compared to two other oligonucleotide microarray platforms, Actichip showed similar sensitivity and concordant expression ratios. Moreover, Actichip was able to discriminate the highly similar actin isoforms whereas the two other platforms did not. Conclusion Our data demonstrate that Actichip is a powerful alternative to commercial high density microarrays for cytoskeleton gene profiling in normal or pathological samples. Actichip is available upon request. PMID:17727702

  18. Cellular Interactions and Immune Response of Spherical Nucleic Acid (SNA) Nanoconjugates

    NASA Astrophysics Data System (ADS)

    Massich, Matthew David

    Spherical nucleic acid (SNA) nanoconjugates consist of a densely packed monolayer shell of highly-oriented oligonucleotides covalently bound to a gold nanoparticle core. The nanoconjugates exhibit several important qualities, which make them useful for various biological applications, such as antisense gene regulation strategies and the intracellular detection of biomolecules. The focus of this thesis was to characterize the nanoconjugates interaction with cultured cells and specifically the immune response to their intracellular presence. The immune response of macrophage cells to internalized nanoconjugates was studied, and due to the dense functionalization of oligonucleotides on the surface of the nanoparticle and the resulting high localized salt concentration the innate immune response to the nanoconjugates is ˜25-fold less when compared to a lipoplex carrying the same sequence. Additionally, genome-wide expression profiling was used to study the biological response of cultured cells to the nanoconjugates. The biological response of HeLa cells to gold nanoparticles stabilized by weakly bound ligands was significant, yet when these same nanoparticles were stably functionalized with covalently attached oligonucleotides the cells showed no measurable response. In human keratinocytes, the oligonucleotide sequences caused 427 genes to be differentially expressed when complexed with Dharmafect, but when the oligonucleotides were conjugated to nanoparticles only 7 genes were differentially expressed. Beyond characterizing the cellular interactions and immune response of the nanoconjugates, the optimal length of siRNA (from 19--34 base pairs) that induces the most gene knockdown while maintaining limited immune activation was determined to be 24 base pairs. Further, the SNAs were shown to be useful as a potential antiviral gene therapy by demonstrating approximately 50% knockdown of the Ebola VP35 gene. Lastly, a scanning probe-enabled method was used to rapidly create nanoscale fibronectin patterns over large areas with a range of feature sizes, thereby opening the field of nanocombinatorics. This allowed the investigation of the relationship between fibronectin feature size and stem cell fate. MSCs cultured on nanoscale fibronectin features directed differentiation toward osteogenesis to a greater extent than cells grown on both microscale features and cells grown on non-patterned fibronectin substrates with osteogenic inducing media, demonstrating a new method for controlling stem cell fate.

  19. Oil-encapsulated nanodroplet array for bio-molecular detection.

    PubMed

    Qiao, Wen; Zhang, Tiantian; Yen, Tony; Ku, Ti-Hsuan; Song, Junlan; Lian, Ian; Lo, Yu-Hwa

    2014-09-01

    Detection of low abundance biomolecules is challenging for biosensors that rely on surface chemical reactions. For surface reaction based biosensors, it require to take hours or even days for biomolecules of diffusivities in the order of 10(-10-11) m2/s to reach the surface of the sensors by Brownian motion. In addition, often times the repelling Coulomb interactions between the molecules and the probes further defer the binding process, leading to undesirably long detection time for applications such as point-of-care in vitro diagnosis. In this work, we designed an oil encapsulated nanodroplet array microchip utilizing evaporation for pre-concentration of the targets to greatly shorten the reaction time and enhance the detection sensitivity. The evaporation process of the droplets is facilitated by the superhydrophilic surface and resulting nanodroplets are encapsulated by oil drops to form stable reaction chamber. Using this method, desirable droplet volumes, concentrations of target molecules, and reaction conditions (salt concentrations, reaction temperature, etc.) in favour of fast and sensitive detection are obtained. A linear response over 2 orders of magnitude in target concentration was achieved at 10 fM for protein targets and 100 fM for miRNA mimic oligonucleotides.

  20. Java web tools for PCR, in silico PCR, and oligonucleotide assembly and analysis.

    PubMed

    Kalendar, Ruslan; Lee, David; Schulman, Alan H

    2011-08-01

    The polymerase chain reaction is fundamental to molecular biology and is the most important practical molecular technique for the research laboratory. We have developed and tested efficient tools for PCR primer and probe design, which also predict oligonucleotide properties based on experimental studies of PCR efficiency. The tools provide comprehensive facilities for designing primers for most PCR applications and their combinations, including standard, multiplex, long-distance, inverse, real-time, unique, group-specific, bisulphite modification assays, Overlap-Extension PCR Multi-Fragment Assembly, as well as a programme to design oligonucleotide sets for long sequence assembly by ligase chain reaction. The in silico PCR primer or probe search includes comprehensive analyses of individual primers and primer pairs. It calculates the melting temperature for standard and degenerate oligonucleotides including LNA and other modifications, provides analyses for a set of primers with prediction of oligonucleotide properties, dimer and G-quadruplex detection, linguistic complexity, and provides a dilution and resuspension calculator. Copyright © 2011 Elsevier Inc. All rights reserved.

  1. Sequence-specific sepsis-related DNA capture and fluorescent labeling in monoliths prepared by single-step photopolymerization in microfluidic devices.

    PubMed

    Knob, Radim; Hanson, Robert L; Tateoka, Olivia B; Wood, Ryan L; Guerrero-Arguero, Israel; Robison, Richard A; Pitt, William G; Woolley, Adam T

    2018-05-21

    Fast determination of antibiotic resistance is crucial in selecting appropriate treatment for sepsis patients, but current methods based on culture are time consuming. We are developing a microfluidic platform with a monolithic column modified with oligonucleotides designed for sequence-specific capture of target DNA related to the Klebsiella pneumoniae carbapenemase (KPC) gene. We developed a novel single-step monolith fabrication method with an acrydite-modified capture oligonucleotide in the polymerization mixture, enabling fast monolith preparation in a microfluidic channel using UV photopolymerization. These prepared columns had a threefold higher capacity compared to monoliths prepared in a multistep process involving Schiff-base DNA attachment. Conditions for denaturing, capture and fluorescence labeling using hybridization probes were optimized with synthetic 90-mer oligonucleotides. These procedures were applied for extraction of a PCR amplicon from the KPC antibiotic resistance gene in bacterial lysate obtained from a blood sample spiked with E. coli. The results showed similar eluted peak areas for KPC amplicon extracted from either hybridization buffer or bacterial lysate. Selective extraction of the KPC DNA was verified by real time PCR on eluted fractions. These results show great promise for application in an integrated microfluidic diagnostic system that combines upstream blood sample preparation and downstream single-molecule counting detection. Copyright © 2018 Elsevier B.V. All rights reserved.

  2. Comparing Charge Transport in Oligonucleotides: RNA:DNA Hybrids and DNA Duplexes.

    PubMed

    Li, Yuanhui; Artés, Juan M; Qi, Jianqing; Morelan, Ian A; Feldstein, Paul; Anantram, M P; Hihath, Joshua

    2016-05-19

    Understanding the electronic properties of oligonucleotide systems is important for applications in nanotechnology, biology, and sensing systems. Here the charge-transport properties of guanine-rich RNA:DNA hybrids are compared to double-stranded DNA (dsDNA) duplexes with identical sequences. The conductance of the RNA:DNA hybrids is ∼10 times higher than the equivalent dsDNA, and conformational differences are determined to be the primary reason for this difference. The conductance of the RNA:DNA hybrids is also found to decrease more rapidly than dsDNA when the length is increased. Ab initio electronic structure and Green's function-based density of states calculations demonstrate that these differences arise because the energy levels are more spatially distributed in the RNA:DNA hybrid but that the number of accessible hopping sites is smaller. These combination results indicate that a simple hopping model that treats each individual guanine as a hopping site is insufficient to explain both a higher conductance and β value for RNA:DNA hybrids, and larger delocalization lengths must be considered.

  3. Predictive dose-based estimation of systemic exposure multiples in mouse and monkey relative to human for antisense oligonucleotides with 2'-o-(2-methoxyethyl) modifications.

    PubMed

    Yu, Rosie Z; Grundy, John S; Henry, Scott P; Kim, Tae-Won; Norris, Daniel A; Burkey, Jennifer; Wang, Yanfeng; Vick, Andrew; Geary, Richard S

    2015-01-20

    Evaluation of species differences and systemic exposure multiples (or ratios) in toxicological animal species versus human is an ongoing exercise during the course of drug development. The systemic exposure ratios are best estimated by directly comparing area under the plasma concentration-time curves (AUCs), and sometimes by comparing the dose administered, with the dose being adjusted either by body surface area (BSA) or body weight (BW). In this study, the association between AUC ratio and the administered dose ratio from animals to human were studied using a retrospective data-driven approach. The dataset included nine antisense oligonucleotides (ASOs) with 2'-O-(2-methoxyethyl) modifications, evaluated in two animal species (mouse and monkey) following single and repeated parenteral administrations. We found that plasma AUCs were similar between ASOs within the same species, and are predictable to human exposure using a single animal species, either mouse or monkey. Between monkey and human, the plasma exposure ratio can be predicted directly based on BW-adjusted dose ratios, whereas between mouse and human, the exposure ratio would be nearly fivefold lower in mouse compared to human based on BW-adjusted dose values. Thus, multiplying a factor of 5 for the mouse BW-adjusted dose would likely provide a reasonable AUC exposure estimate in human at steady-state.

  4. Optimized synthesis of phosphorothioate oligodeoxyribonucleotides substituted with a 5′-protected thiol function and a 3′-amino group

    PubMed Central

    Aubert, Yves; Bourgerie, Sylvain; Meunier, Laurent; Mayer, Roger; Roche, Annie-Claude; Monsigny, Michel; Thuong, Nguyen T.; Asseline, Ulysse

    2000-01-01

    A new deprotection procedure enables a medium scale preparation of phosphodiester and phosphorothioate oligonucleotides substituted with a protected thiol function at their 5′-ends and an amino group at their 3′-ends in good yield (up to 72 OD units/µmol for a 19mer phosphorothioate). Syntheses of 3′-amino-substituted oligonucleotides were carried out on a modified support. A linker containing the thioacetyl moiety was manually coupled in two steps by first adding its phosphoramidite derivative in the presence of tetrazole followed by either oxidation or sulfurization to afford the bis-derivatized oligonucleotide bound to the support. Deprotection was achieved by treating the fully protected oligonucleotide with a mixture of 2,2′-dithiodipyridine and concentrated aqueous ammonia in the presence of phenol and methanol. This procedure enables (i) cleavage of the oligonucleotide from the support, releasing the oligonucleotide with a free amino group at its 3′-end, (ii) deprotection of the phosphate groups and the amino functions of the nucleic bases, as well as (iii) transformation of the 5′-terminal S-acetyl function into a dithiopyridyl group. The bis-derivatized phosphorothioate oligomer was further substituted through a two-step procedure: first, the 3′-amino group was reacted with fluorescein isothiocyanate to yield a fluoresceinylated oligonucleotide; the 5′-dithiopyridyl group was then quantitatively reduced to give a free thiol group which was then substituted by reaction with an Nα-bromoacetyl derivative of a signal peptide containing a KDEL sequence to afford a fluoresceinylated peptide–oligonucleotide conjugate. PMID:10637335

  5. Incorporation of terminal phosphorothioates into oligonucleotides.

    PubMed Central

    Alefelder, S; Patel, B K; Eckstein, F

    1998-01-01

    Considerable effort has been directed towards studying the structure and function of oligonucleotides and several approaches rely on the attachment of reporter groups to oligonucleotides. We report here the introduction of 3'- and 5'-terminal phosphorothioates into heptameric oligonucleotides and their post-synthetic modification with several reporter groups. The synthesis of terminal phosphorothioates is based on the coupling of a ribonucleoside phosphoramidite at the first or last nucleotide, respectively, which, after sulphurization, is removed by sequential oxidation of the vicinal hydroxyl groups and then beta-elimination. Product formation is of the order of 95%. The ratio of phosphorothioate- versus phosphate-terminated oligodeoxynucleotides as analysed by electrophoresis on a Hg2+gel is in general 85/15. Examples for the reactivity of the terminal phosphorothioates for conjugation with cholesterol, bimane and for sulphydryl exchange are described. PMID:9776763

  6. Recognition of T·G mismatched base pairs in DNA by stacked imidazole-containing polyamides: surface plasmon resonance and circular dichroism studies

    PubMed Central

    Lacy, Eilyn R.; Cox, Kari K.; Wilson, W. David; Lee, Moses

    2002-01-01

    An imidazole-containing polyamide trimer, f-ImImIm, where f is a formamido group, was recently found using NMR methods to recognize T·G mismatched base pairs. In order to characterize in detail the T·G recognition affinity and specificity of imidazole-containing polyamides, f-ImIm, f-ImImIm and f-PyImIm were synthesized. The kinetics and thermodynamics for the polyamides binding to Watson–Crick and mismatched (containing one or two T·G, A·G or G·G mismatched base pairs) hairpin oligonucleotides were determined by surface plasmon resonance and circular dichroism (CD) methods. f-ImImIm binds significantly more strongly to the T·G mismatch-containing oligonucleotides than to the sequences with other mismatched or with Watson–Crick base pairs. Compared with the Watson–Crick CCGG sequence, f-ImImIm associates more slowly with DNAs containing T·G mismatches in place of one or two C·G base pairs and, more importantly, the dissociation rate from the T·G oligonucleotides is very slow (small kd). These results clearly demonstrate the binding selectivity and enhanced affinity of side-by-side imidazole/imidazole pairings for T·G mismatches and show that the affinity and specificity increase arise from much lower kd values with the T·G mismatched duplexes. CD titration studies of f-ImImIm complexes with T·G mismatched sequences produce strong induced bands at ∼330 nm with clear isodichroic points, in support of a single minor groove complex. CD DNA bands suggest that the complexes remain in the B conformation. PMID:11937638

  7. DNA with Parallel Strand Orientation: A Nanometer Distance Study with Spin Labels in the Watson-Crick and the Reverse Watson-Crick Double Helix.

    PubMed

    Wunnicke, Dorith; Ding, Ping; Yang, Haozhe; Seela, Frank; Steinhoff, Heinz-Jürgen

    2015-10-29

    Parallel-stranded (ps) DNA characterized by its sugar-phosphate backbones pointing in the same direction represents an alternative pairing system to antiparallel-stranded (aps) DNA with the potential to inhibit transcription and translation. 25-mer oligonucleotides were selected containing only dA·dT base pairs to compare spin-labeled nucleobase distances over a range of 10 or 15 base pairs in ps DNA with those in aps DNA. By means of the copper(I)-catalyzed Huisgen-Meldal-Sharpless alkyne-azide cycloaddition, the spin label 4-azido-2,2,6,6-tetramethylpiperidine-1-oxyl was clicked to 7-ethynyl-7-deaza-2'-deoxyadenosine or 5-ethynyl-2'-deoxyuridine to yield 25-mer oligonucleotides incorporating two spin labels. The interspin distances between spin labeled residues were determined by pulse EPR spectroscopy. The results reveal that in ps DNA these distances are between 5 and 10% longer than in aps DNA when the labeled DNA segment is located near the center of the double helix. The interspin distance in ps DNA becomes shorter compared with aps DNA when one of the spin labels occupies a position near the end of the double helix.

  8. UV-VIS extinction spectra of gold particle coated by oligonucleotide shell

    NASA Astrophysics Data System (ADS)

    Bogatyrev, Vladimir A.; Vrublevsky, Stanislav A.; Trachuk, Lyubov A.; Khlebtsov, Nikolai G.

    2005-06-01

    We describe synthesis process of an oligonucleotide-functionalized colloidal gold marker CG-l5-T28, its optical properties and interaction with poly(A) in solution and on a solid-phase substrate. The marker is a complex of 15 nm diameter colloidal gold nanoparticles with covalently attached 5'-thiolated 28-base oligothymidine macromolecules. A positive hybridization reaction of the marker with poly(A) is observed by solid-phase analysis on hanging a spot color (from red to blue ) or on appearance of a red dye in dot-blot test as compared to control experiments with poly(U) target. The principles of spectrophotometric monitoring all stages of the marker preparation and application of spectrophotometry to detection of the polynucleotide hybridization in vitro are described. Experimental data were compared with theoretical calculations based on Mie theory for 2-layer model of gold core in polymeric shell with imaginary part of refractive index that typical for the real absorption spectra of NA. To explain the aggregation of CG-15-T28 caused by interaction with poly(A) in solution, we suggest a new model differing from a standard model of cross-linker binding.

  9. Evaluation of chronic lymphocytic leukemia by oligonucleotide-based microarray analysis uncovers novel aberrations not detected by FISH or cytogenetic analysis

    PubMed Central

    2011-01-01

    Background Cytogenetic evaluation is a key component of the diagnosis and prognosis of chronic lymphocytic leukemia (CLL). We performed oligonucleotide-based comparative genomic hybridization microarray analysis on 34 samples with CLL and known abnormal karyotypes previously determined by cytogenetics and/or fluorescence in situ hybridization (FISH). Results Using a custom designed microarray that targets >1800 genes involved in hematologic disease and other malignancies, we identified additional cryptic aberrations and novel findings in 59% of cases. These included gains and losses of genes associated with cell cycle regulation, apoptosis and susceptibility loci on 3p21.31, 5q35.2q35.3, 10q23.31q23.33, 11q22.3, and 22q11.23. Conclusions Our results show that microarray analysis will detect known aberrations, including microscopic and cryptic alterations. In addition, novel genomic changes will be uncovered that may become important prognostic predictors or treatment targets for CLL in the future. PMID:22087757

  10. Charge-induced geometrical reorganization of DNA oligonucleotides studied by tandem mass spectrometry and ion mobility.

    PubMed

    Ickert, Stefanie; Hofmann, Johanna; Riedel, Jens; Beck, Sebastian; Pagel, Kevin; Linscheid, Michael W

    2018-04-01

    Mass spectrometry is applied as a tool for the elucidation of molecular structures. This premises that gas-phase structures reflect the original geometry of the analytes, while it requires a thorough understanding and investigation of the forces controlling and affecting the gas-phase structures. However, only little is known about conformational changes of oligonucleotides in the gas phase. In this study, a series of multiply charged DNA oligonucleotides (n = 15-40) has been subjected to a comprehensive tandem mass spectrometric study to unravel transitions between different ionic gas-phase structures. The nucleobase sequence and the chain length were varied to gain insights into their influence on the geometrical oligonucleotide organization. Altogether, 23 oligonucleotides were analyzed using collision-induced fragmentation. All sequences showed comparable correlation regarding the characteristic collision energy. This value that is also a measure for stability, strongly correlates with the net charge density of the precursor ions. With decreasing charge of the oligonucleotides, an increase in the fragmentation energy was observed. At a distinct charge density, a deviation from linearity was observed for all studied species, indicating a structural reorganization. To corroborate the proposed geometrical change, collisional cross-sections of the oligonucleotides at different charge states were determined using ion mobility-mass spectrometry. The results clearly indicate that an increase in charge density and thus Coulomb repulsion results in the transition from a folded, compact form to elongated structures of the precursor ions. Our data show this structural transition to depend mainly on the charge density, whereas sequence and size do not have an influence.

  11. Desulfurization of phosphorothioate oligonucleotides via the sulfur-by-oxygen replacement induced by the hydroxyl radical during negative electrospray ionization mass spectrometry.

    PubMed

    Wu, Lianming; White, David E; Ye, Connie; Vogt, Frederick G; Terfloth, Gerald J; Matsuhashi, Hayao

    2012-07-01

    While the occurrence of desulfurization of phosphorothioate oligonucleotides in solution is well established, this study represents the first attempt to investigate the basis of the unexpected desulfurization via the net sulfur-by-oxygen (S-O) replacement during negative electrospray ionization (ESI). The current work, facilitated by quantitative mass deconvolution, demonstrates that considerable desulfurization can take place even under common negative ESI operating conditions. The extent of desulfurization is dependent on the molar phosphorothioate oligonucleotide-to-hydroxyl radical ratio, which is consistent with the corona discharge-induced origin of the hydroxyl radical leading to the S-O replacement. This hypothesis is supported by the fact that an increase of the high-performance liquid chromatography (HPLC) flow rate and the on-column concentration of a phosphorothioate oligonucleotide, as well as a decrease of the electrospray voltage reduce the degree of desulfurization. Comparative LC-tandem mass spectrometry (MS/MS) sequencing of a phosphorothioate oligonucleotide and its corresponding desulfurization product revealed evidence that the S-O replacement occurs at multiple phosphorothioate internucleotide linkage sites. In practice, the most convenient and effective strategy for minimizing this P = O artifact is to increase the LC flow rate and the on-column concentration of phosphorothioate oligonucleotides. Another approach to mitigate possible detrimental effects of the undesired desulfurization is to operate the ESI source at a very low electrospray voltage to diminish the corona discharge; however this will significantly compromise sensitivity when analyzing the low-level P = O impurities in phosphorothioate oligonucleotides. Copyright © 2012 John Wiley & Sons, Ltd.

  12. Human Leukocyte Antigen Typing Using a Knowledge Base Coupled with a High-Throughput Oligonucleotide Probe Array Analysis

    PubMed Central

    Zhang, Guang Lan; Keskin, Derin B.; Lin, Hsin-Nan; Lin, Hong Huang; DeLuca, David S.; Leppanen, Scott; Milford, Edgar L.; Reinherz, Ellis L.; Brusic, Vladimir

    2014-01-01

    Human leukocyte antigens (HLA) are important biomarkers because multiple diseases, drug toxicity, and vaccine responses reveal strong HLA associations. Current clinical HLA typing is an elimination process requiring serial testing. We present an alternative in situ synthesized DNA-based microarray method that contains hundreds of thousands of probes representing a complete overlapping set covering 1,610 clinically relevant HLA class I alleles accompanied by computational tools for assigning HLA type to 4-digit resolution. Our proof-of-concept experiment included 21 blood samples, 18 cell lines, and multiple controls. The method is accurate, robust, and amenable to automation. Typing errors were restricted to homozygous samples or those with very closely related alleles from the same locus, but readily resolved by targeted DNA sequencing validation of flagged samples. High-throughput HLA typing technologies that are effective, yet inexpensive, can be used to analyze the world’s populations, benefiting both global public health and personalized health care. PMID:25505899

  13. DNA microarray-based detection and identification of Burkholderia mallei, Burkholderia pseudomallei and Burkholderia spp.

    PubMed

    Schmoock, Gernot; Ehricht, Ralf; Melzer, Falk; Rassbach, Astrid; Scholz, Holger C; Neubauer, Heinrich; Sachse, Konrad; Mota, Rinaldo Aparecido; Saqib, Muhammad; Elschner, Mandy

    2009-01-01

    We developed a rapid oligonucleotide microarray assay based on genetic markers for the accurate identification and differentiation of Burkholderia (B.) mallei and Burkholderia pseudomallei, the agents of glanders and melioidosis, respectively. These two agents were clearly identified using at least 4 independent genetic markers including 16S rRNA gene, fliC, motB and also by novel species-specific target genes, identified by in silico sequence analysis. Specific hybridization signal profiles allowed the detection and differentiation of up to 10 further Burkholderia spp., including the closely related species Burkholderia thailandensis and Burkholderia-like agents, such as Burkholderia cepacia, Burkholderia cenocepacia, Burkholderia vietnamiensis, Burkholderia ambifaria, and Burkholderia gladioli, which are often associated with cystic fibrosis (CF) lung disease. The assay was developed using the easy-to-handle and economical ArrayTube (AT) platform. A representative strain panel comprising 44 B. mallei, 32 B. pseudomallei isolates, and various Burkholderia type strains were examined to validate the test. Assay specificity was determined by examination of 40 non-Burkholderia strains.

  14. Direct on-chip DNA synthesis using electrochemically modified gold electrodes as solid support

    NASA Astrophysics Data System (ADS)

    Levrie, Karen; Jans, Karolien; Schepers, Guy; Vos, Rita; Van Dorpe, Pol; Lagae, Liesbet; Van Hoof, Chris; Van Aerschot, Arthur; Stakenborg, Tim

    2018-04-01

    DNA microarrays have propelled important advancements in the field of genomic research by enabling the monitoring of thousands of genes in parallel. The throughput can be increased even further by scaling down the microarray feature size. In this respect, microelectronics-based DNA arrays are promising as they can leverage semiconductor processing techniques with lithographic resolutions. We propose a method that enables the use of metal electrodes for de novo DNA synthesis without the need for an insulating support. By electrochemically functionalizing gold electrodes, these electrodes can act as solid support for phosphoramidite-based synthesis. The proposed method relies on the electrochemical reduction of diazonium salts, enabling site-specific incorporation of hydroxyl groups onto the metal electrodes. An automated DNA synthesizer was used to couple phosphoramidite moieties directly onto the OH-modified electrodes to obtain the desired oligonucleotide sequence. Characterization was done via cyclic voltammetry and fluorescence microscopy. Our results present a valuable proof-of-concept for the integration of solid-phase DNA synthesis with microelectronics.

  15. Optimization of oligonucleotide arrays and RNA amplification protocols for analysis of transcript structure and alternative splicing.

    PubMed

    Castle, John; Garrett-Engele, Phil; Armour, Christopher D; Duenwald, Sven J; Loerch, Patrick M; Meyer, Michael R; Schadt, Eric E; Stoughton, Roland; Parrish, Mark L; Shoemaker, Daniel D; Johnson, Jason M

    2003-01-01

    Microarrays offer a high-resolution means for monitoring pre-mRNA splicing on a genomic scale. We have developed a novel, unbiased amplification protocol that permits labeling of entire transcripts. Also, hybridization conditions, probe characteristics, and analysis algorithms were optimized for detection of exons, exon-intron edges, and exon junctions. These optimized protocols can be used to detect small variations and isoform mixtures, map the tissue specificity of known human alternative isoforms, and provide a robust, scalable platform for high-throughput discovery of alternative splicing.

  16. 3D DNA Crystals and Nanotechnology

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Paukstelis, Paul; Seeman, Nadrian

    DNA's molecular recognition properties have made it one of the most widely used biomacromolecular construction materials. The programmed assembly of DNA oligonucleotides has been used to create complex 2D and 3D self-assembled architectures and to guide the assembly of other molecules. The origins of DNA nanotechnology are rooted in the goal of assembling DNA molecules into designed periodic arrays, i.e., crystals. Here, we highlight several DNA crystal structures, the progress made in designing DNA crystals, and look at the current prospects and future directions of DNA crystals in nanotechnology.

  17. Blocks of limited haplotype diversity revealed by high-resolution scanning of human chromosome 21.

    PubMed

    Patil, N; Berno, A J; Hinds, D A; Barrett, W A; Doshi, J M; Hacker, C R; Kautzer, C R; Lee, D H; Marjoribanks, C; McDonough, D P; Nguyen, B T; Norris, M C; Sheehan, J B; Shen, N; Stern, D; Stokowski, R P; Thomas, D J; Trulson, M O; Vyas, K R; Frazer, K A; Fodor, S P; Cox, D R

    2001-11-23

    Global patterns of human DNA sequence variation (haplotypes) defined by common single nucleotide polymorphisms (SNPs) have important implications for identifying disease associations and human traits. We have used high-density oligonucleotide arrays, in combination with somatic cell genetics, to identify a large fraction of all common human chromosome 21 SNPs and to directly observe the haplotype structure defined by these SNPs. This structure reveals blocks of limited haplotype diversity in which more than 80% of a global human sample can typically be characterized by only three common haplotypes.

  18. 3D DNA Crystals and Nanotechnology

    DOE PAGES

    Paukstelis, Paul; Seeman, Nadrian

    2016-08-18

    DNA's molecular recognition properties have made it one of the most widely used biomacromolecular construction materials. The programmed assembly of DNA oligonucleotides has been used to create complex 2D and 3D self-assembled architectures and to guide the assembly of other molecules. The origins of DNA nanotechnology are rooted in the goal of assembling DNA molecules into designed periodic arrays, i.e., crystals. Here, we highlight several DNA crystal structures, the progress made in designing DNA crystals, and look at the current prospects and future directions of DNA crystals in nanotechnology.

  19. Optimization of oligonucleotide arrays and RNA amplification protocols for analysis of transcript structure and alternative splicing

    PubMed Central

    Castle, John; Garrett-Engele, Phil; Armour, Christopher D; Duenwald, Sven J; Loerch, Patrick M; Meyer, Michael R; Schadt, Eric E; Stoughton, Roland; Parrish, Mark L; Shoemaker, Daniel D; Johnson, Jason M

    2003-01-01

    Microarrays offer a high-resolution means for monitoring pre-mRNA splicing on a genomic scale. We have developed a novel, unbiased amplification protocol that permits labeling of entire transcripts. Also, hybridization conditions, probe characteristics, and analysis algorithms were optimized for detection of exons, exon-intron edges, and exon junctions. These optimized protocols can be used to detect small variations and isoform mixtures, map the tissue specificity of known human alternative isoforms, and provide a robust, scalable platform for high-throughput discovery of alternative splicing. PMID:14519201

  20. Click nucleic acid ligation: applications in biology and nanotechnology.

    PubMed

    El-Sagheer, Afaf H; Brown, Tom

    2012-08-21

    Biochemical strategies that use a combination of synthetic oligonucleotides, thermostable DNA polymerases, and DNA ligases can produce large DNA constructs up to 1 megabase in length. Although these ambitious targets are feasible biochemically, comparable technologies for the chemical synthesis of long DNA strands lag far behind. The best available chemical approach is the solid-phase phosphoramidite method, which can be used to assemble DNA strands up to 150 bases in length. Beyond this point, deficiencies in the chemistry make it impossible to produce pure DNA. A possible alternative approach to the chemical synthesis of large DNA strands is to join together carefully purified synthetic oligonucleotides by chemical methods. Click ligation by the copper-catalyzed azide-alkyne (CuAAC) reaction could facilitate this process. In this Account, we describe the synthesis, characterization, and applications of oligonucleotides prepared by click ligation. The alkyne and azide oligonucleotide strands can be prepared by standard protocols, and the ligation reaction is compatible with a wide range of chemical modifications to DNA and RNA. We have employed click ligation to synthesize DNA constructs up to 300 bases in length and much longer sequences are feasible. When the resulting triazole linkage is placed in a PCR template, various DNA polymerases correctly copy the entire base sequence. We have also successfully demonstrated both in vitro transcription and rolling circle amplification through the modified linkage. This linkage has shown in vivo biocompatibility: an antibiotic resistance gene containing triazole linkages functions in E. coli . Using click ligation, we have synthesized hairpin ribozymes up to 100 nucleotides in length and a hammerhead ribozyme with the triazole linkage located at the substrate cleavage site. At the opposite end of the length scale, click-ligated, cyclic mini-DNA duplexes have been used as models to study base pairing. Cyclic duplexes have potential therapeutic applications. They have extremely high thermodynamic stability, have increased resistance to enzymatic degradation, and have been investigated as decoys for regulatory proteins. For potential nanotechnology applications, we have synthesized double stranded DNA catenanes by click ligation. Other researchers have studied covalently fixed multistranded DNA constructs including triplexes and quadruplexes.

  1. Immunomodulatory oligonucleotide IMT504: Effects on mesenchymal stem cells as a first-in-class immunoprotective/immunoregenerative therapy

    PubMed Central

    Zorzopulos, Jorge; Opal, Steven M; Hernando-Insúa, Andrés; Rodriguez, Juan M; Elías, Fernanda; Fló, Juan; López, Ricardo A; Chasseing, Norma A; Lux-Lantos, Victoria A; Coronel, Maria F; Franco, Raul; Montaner, Alejandro D; Horn, David L

    2017-01-01

    The immune responses of humans and animals to insults (i.e., infections, traumas, tumoral transformation and radiation) are based on an intricate network of cells and chemical messengers. Abnormally high inflammation immediately after insult or abnormally prolonged pro-inflammatory stimuli bringing about chronic inflammation can lead to life-threatening or severely debilitating diseases. Mesenchymal stem cell (MSC) transplant has proved to be an effective therapy in preclinical studies which evaluated a vast diversity of inflammatory conditions. MSCs lead to resolution of inflammation, preparation for regeneration and actual regeneration, and then ultimate return to normal baseline or homeostasis. However, in clinical trials of transplanted MSCs, the expectations of great medical benefit have not yet been fulfilled. As a practical alternative to MSC transplant, a synthetic drug with the capacity to boost endogenous MSC expansion and/or activation may also be effective. Regarding this, IMT504, the prototype of a major class of immunomodulatory oligonucleotides, induces in vivo expansion of MSCs, resulting in a marked improvement in preclinical models of neuropathic pain, osteoporosis, diabetes and sepsis. IMT504 is easily manufactured and has an excellent preclinical safety record. In the small number of patients studied thus far, IMT504 has been well-tolerated, even at very high dosage. Further clinical investigation is necessary to demonstrate the utility of IMT504 for resolution of inflammation and regeneration in a broad array of human diseases that would likely benefit from an immunoprotective/immunoregenerative therapy. PMID:28396715

  2. Exploring the Use of a Guanine-Rich Catalytic DNA for Sulfoxide Preparation

    PubMed Central

    Dellafiore, María A.; Montserrat, Javier M.; Iribarren, Adolfo M.

    2015-01-01

    A guanine-rich DNA oligonucleotide complexed with hemin was used to catalyze controlled oxygen transfer reactions to different sulfides for sulfoxide preparation in the presence of H2O2. Comparable activities were obtained when using fully modified L-DNA. In addition, oligonucleotide immobilization led to an active catalyst which could be successfully recovered and reused without loss of activity. PMID:26066510

  3. Analysis of LDLR mutations in familial hypercholesterolemia patients in Greece by use of the NanoChip microelectronic array technology.

    PubMed

    Laios, Eleftheria; Drogari, Euridiki

    2006-12-01

    Three mutations in the low density lipoprotein receptor (LDLR) gene account for 49% of familial hypercholesterolemia (FH) cases in Greece. We used the microelectronic array technology of the NanoChip Molecular Biology Workstation to develop a multiplex method to analyze these single-nucleotide polymorphisms (SNPs). Primer pairs amplified the region encompassing each SNP. The biotinylated PCR amplicon was electronically addressed to streptavidin-coated microarray sites. Allele-specific fluorescently labeled oligonucleotide reporters were designed and used for detection of wild-type and SNP sequences. Genotypes were compared to PCR-restriction fragment length polymorphism (PCR-RFLP). We developed three monoplex assays (1 SNP/site) and an optimized multiplex assay (3SNPs/site). We performed 92 Greece II, 100 Genoa, and 98 Afrikaner-2 NanoChip monoplex assays (addressed to duplicate sites and analyzed separately). Of the 580 monoplex genotypings (290 samples), 579 agreed with RFLP. Duplicate sites of one sample were not in agreement with each other. Of the 580 multiplex genotypings, 576 agreed with the monoplex results. Duplicate sites of three samples were not in agreement with each other, indicating requirement for repetition upon which discrepancies were resolved. The multiplex assay detects common LDLR mutations in Greek FH patients and can be extended to accommodate additional mutations.

  4. Array painting reveals a high frequency of balanced translocations in breast cancer cell lines that break in cancer-relevant genes

    PubMed Central

    Howarth, KD; Blood, KA; Ng, BL; Beavis, JC; Chua, Y; Cooke, SL; Raby, S; Ichimura, K; Collins, VP; Carter, NP; Edwards, PAW

    2008-01-01

    Chromosome translocations in the common epithelial cancers are abundant, yet little is known about them. They have been thought to be almost all unbalanced and therefore dismissed as mostly mediating tumour suppressor loss. We present a comprehensive analysis by array painting of the chromosome translocations of breast cancer cell lines HCC1806, HCC1187 and ZR-75-30. In array painting, chromosomes are isolated by flow cytometry, amplified and hybridized to DNA microarrays. A total of 200 breakpoints were identified and all were mapped to 1Mb resolution on BAC arrays, then 40 selected breakpoints, including all balanced breakpoints, were further mapped on tiling-path BAC arrays or to around 2kb resolution using oligonucleotide arrays. Many more of the translocations were balanced at 1Mb resolution than expected, either reciprocal (eight in total) or balanced for at least one participating chromosome (19 paired breakpoints). Secondly, many of the breakpoints were at genes that are plausible targets of oncogenic translocation, including balanced breaks at CTCF, EP300/p300, and FOXP4. Two gene fusions were demonstrated, TAX1BP1-AHCY and RIF1-PKD1L1. Our results support the idea that chromosome rearrangements may play an important role in common epithelial cancers such as breast cancer. PMID:18084325

  5. Assembly of a biocompatible triazole-linked gene by one-pot click-DNA ligation

    NASA Astrophysics Data System (ADS)

    Kukwikila, Mikiembo; Gale, Nittaya; El-Sagheer, Afaf H.; Brown, Tom; Tavassoli, Ali

    2017-11-01

    The chemical synthesis of oligonucleotides and their enzyme-mediated assembly into genes and genomes has significantly advanced multiple scientific disciplines. However, these approaches are not without their shortcomings; enzymatic amplification and ligation of oligonucleotides into genes and genomes makes automation challenging, and site-specific incorporation of epigenetic information and/or modified bases into large constructs is not feasible. Here we present a fully chemical one-pot method for the assembly of oligonucleotides into a gene by click-DNA ligation. We synthesize the 335 base-pair gene that encodes the green fluorescent protein iLOV from ten functionalized oligonucleotides that contain 5ʹ-azide and 3ʹ-alkyne units. The resulting click-linked iLOV gene contains eight triazoles at the sites of chemical ligation, and yet is fully biocompatible; it is replicated by DNA polymerases in vitro and encodes a functional iLOV protein in Escherichia coli. We demonstrate the power and potential of our one-pot gene-assembly method by preparing an epigenetically modified variant of the iLOV gene.

  6. Lipophilic oligonucleotides spontaneously insert into lipid membranes, bind complementary DNA strands, and sequester into lipid-disordered domains.

    PubMed

    Bunge, Andreas; Kurz, Anke; Windeck, Anne-Kathrin; Korte, Thomas; Flasche, Wolfgang; Liebscher, Jürgen; Herrmann, Andreas; Huster, Daniel

    2007-04-10

    For the development of surface functionalized bilayers, we have synthesized lipophilic oligonucleotides to combine the molecular recognition mechanism of nucleic acids and the self-assembly characteristics of lipids in planar membranes. A lipophilic oligonucleotide consisting of 21 thymidine units and two lipophilic nucleotides with an alpha-tocopherol moiety as a lipophilic anchor was synthesized using solid-phase methods with a phosphoramadite strategy. The interaction of the water soluble lipophilic oligonucleotide with vesicular lipid membranes and its capability to bind complementary DNA strands was studied using complementary methods such as NMR, EPR, DSC, fluorescence spectroscopy, and fluorescence microscopy. This oligonucleotide inserted stably into preformed membranes from the aqueous phase. Thereby, no significant perturbation of the lipid bilayer and its stability was observed. However, the non-lipidated end of the oligonucleotide is exposed to the aqueous environment, is relatively mobile, and is free to interact with complementary DNA strands. Binding of the complementary single-stranded DNA molecules is fast and accomplished by the formation of Watson-Crick base pairs, which was confirmed by 1H NMR chemical shift analysis and fluorescence resonance energy transfer. The molecular structure of the membrane bound DNA double helix is very similar to the free double-stranded DNA. Further, the membrane bound DNA double strands also undergo regular melting. Finally, in raft-like membrane mixtures, the lipophilic oligonucleotide was shown to preferentially sequester into liquid-disordered membrane domains.

  7. Gene Silencing by Gold Nanoshell-Mediated Delivery and Laser-Triggered Release of Antisense Oligonucleotide and siRNA

    PubMed Central

    Huschka, Ryan; Barhoumi, Aoune; Liu, Qing; Roth, Jack A.; Ji, Lin; Halas, Naomi J.

    2013-01-01

    The approach of RNA interference (RNAi)- using antisense DNA or RNA oligonucleotides to silence activity of a specific pathogenic gene transcript and reduce expression of the encoded protein- is very useful in dissecting genetic function and holds significant promise as a molecular therapeutic. A major obstacle in achieving gene silencing with RNAi technology is the systemic delivery of therapeutic oligonucleotides. Here we demonstrate an engineered gold nanoshell (NS)-based therapeutic oligonucleotide delivery vehicle, designed to release its cargo on demand upon illumination with a near-infrared (NIR) laser. A poly(L)lysine peptide (PLL) epilayer covalently attached to the NS surface (NS-PLL) is used to capture intact, single-stranded antisense DNA oligonucleotides, or alternatively, double-stranded short-interfering RNA (siRNA) molecules. Controlled release of the captured therapeutic oligonucleotides in each case is accomplished by continuous wave NIR laser irradiation at 800 nm, near the resonance wavelength of the nanoshell. Fluorescently tagged oligonucleotides were used to monitor the time-dependent release process and light-triggered endosomal release. A green fluorescent protein (GFP)-expressing human lung cancer H1299 cell line was used to determine cellular uptake and gene silencing mediated by the NS-PLL carrying GFP gene-specific single-stranded DNA antisense oligonucleotide (AON-GFP), or a double-stranded siRNA (siRNA-GFP), in vitro. Light-triggered delivery resulted in ∼ 47% and ∼49% downregulation of the targeted GFP expression by AON-GFP and siRNA-GFP, respectively. Cytotoxicity induced by both the NS-PLL delivery vector and by laser irradiation is minimal, as demonstrated by a XTT cell proliferation assay. PMID:22862291

  8. A multiplex protein-free lateral flow assay for detection of microRNAs based on unmodified molecular beacons.

    PubMed

    Javani, Atefeh; Javadi-Zarnaghi, Fatemeh; Rasaee, Mohammad Javad

    2017-11-15

    Lateral flow assays (LFAs) have promising potentials for point-of-care applications. Recently, many LFAs have been reported that are based on hybridization of oligonucleotide strands. Mostly, biotinylated capture DNAs are immobilized on the surface of a nitrocellulose membrane via streptavidin interactions. During the assay, stable colorful complexes get formed that are visible by naked eyes. Here, we present an inexpensive and unique design of LFA that applies unmodified oligonucleotides at capture lines. The presented LFA do not utilize streptavidin or any other affinity protein. We employ structural switch of molecular beacons (MB) in combination with base stacking hybridization (BSH) phenomenon. The unique design of the reported LFA provided high selectivity for target oligonucleotides. We validated potential applications of the system for detection of DNA mimics of two microRNAs in multiplex assays. Copyright © 2017 Elsevier Inc. All rights reserved.

  9. Efficient self-assembly of DNA-functionalized fluorophores and gold nanoparticles with DNA functionalized silicon surfaces: the effect of oligomer spacers

    PubMed Central

    Milton, James A.; Patole, Samson; Yin, Huabing; Xiao, Qiang; Brown, Tom; Melvin, Tracy

    2013-01-01

    Although strategies for the immobilization of DNA oligonucleotides onto surfaces for bioanalytical and top-down bio-inspired nanobiofabrication approaches are well developed, the effect of introducing spacer molecules between the surface and the DNA oligonucleotide for the hybridization of nanoparticle–DNA conjugates has not been previously assessed in a quantitative manner. The hybridization efficiency of DNA oligonucleotides end-labelled with gold nanoparticles (1.4 or 10 nm diameter) with DNA sequences conjugated to silicon surfaces via hexaethylene glycol phosphate diester oligomer spacers (0, 1, 2, 6 oligomers) was found to be independent of spacer length. To quantify both the density of DNA strands attached to the surfaces and hybridization with the surface-attached DNA, new methodologies have been developed. Firstly, a simple approach based on fluorescence has been developed for determination of the immobilization density of DNA oligonucleotides. Secondly, an approach using mass spectrometry has been created to establish (i) the mean number of DNA oligonucleotides attached to the gold nanoparticles and (ii) the hybridization density of nanoparticle–oligonucleotide conjugates with the silicon surface–attached complementary sequence. These methods and results will be useful for application with nanosensors, the self-assembly of nanoelectronic devices and the attachment of nanoparticles to biomolecules for single-molecule biophysical studies. PMID:23361467

  10. A Novel Bioinformatics Strategy to Analyze Microbial Big Sequence Data for Efficient Knowledge Discovery: Batch-Learning Self-Organizing Map (BLSOM).

    PubMed

    Iwasaki, Yuki; Abe, Takashi; Wada, Kennosuke; Wada, Yoshiko; Ikemura, Toshimichi

    2013-11-20

    With the remarkable increase of genomic sequence data of microorganisms, novel tools are needed for comprehensive analyses of the big sequence data available. The self-organizing map (SOM) is an effective tool for clustering and visualizing high-dimensional data, such as oligonucleotide composition on one map. By modifying the conventional SOM, we developed batch-learning SOM (BLSOM), which allowed classification of sequence fragments (e.g., 1 kb) according to phylotypes, solely depending on oligonucleotide composition. Metagenomics studies of uncultivable microorganisms in clinical and environmental samples should allow extensive surveys of genes important in life sciences. BLSOM is most suitable for phylogenetic assignment of metagenomic sequences, because fragmental sequences can be clustered according to phylotypes, solely depending on oligonucleotide composition. We first constructed oligonucleotide BLSOMs for all available sequences from genomes of known species, and by mapping metagenomic sequences on these large-scale BLSOMs, we can predict phylotypes of individual metagenomic sequences, revealing a microbial community structure of uncultured microorganisms, including viruses. BLSOM has shown that influenza viruses isolated from humans and birds clearly differ in oligonucleotide composition. Based on this host-dependent oligonucleotide composition, we have proposed strategies for predicting directional changes of virus sequences and for surveilling potentially hazardous strains when introduced into humans from non-human sources.

  11. Junctions between i-motif tetramers in supramolecular structures

    PubMed Central

    Guittet, Eric; Renciuk, Daniel; Leroy, Jean-Louis

    2012-01-01

    The symmetry of i-motif tetramers gives to cytidine-rich oligonucleotides the capacity to associate into supramolecular structures (sms). In order to determine how the tetramers are linked together in such structures, we have measured by gel filtration chromatography and NMR the formation and dissociation kinetics of sms built by oligonucleotides containing two short C stretches separated by a non-cytidine-base. We show that a stretch of only two cytidines either at the 3′- or 5′-end is long enough to link the tetramers into sms. The analysis of the properties of sms formed by oligonucleotides differing by the length of the oligo-C stretches, the sequence orientation and the nature of the non-C base provides a model of the junction connecting the tetramers in sms. PMID:22362739

  12. Discrimination of Bacillus anthracis from closely related microorganisms by analysis of 16S and 23S rRNA with oligonucleotide microchips

    DOEpatents

    Bavykin, Sergei G.; Mirzabekova, legal representative, Natalia V.; Mirzabekov, deceased, Andrei D.

    2007-12-04

    The present invention relates to methods and compositions for using nucleotide sequence variations of 16S and 23S rRNA within the B. cereus group to discriminate a highly infectious bacterium B. anthracis from closely related microorganisms. Sequence variations in the 16S and 23S rRNA of the B. cereus subgroup including B. anthracis are utilized to construct an array that can detect these sequence variations through selective hybridizations and discriminate B. cereus group that includes B. anthracis. Discrimination of single base differences in rRNA was achieved with a microchip during analysis of B. cereus group isolates from both single and in mixed samples, as well as identification of polymorphic sites. Successful use of a microchip to determine the appropriate subgroup classification using eight reference microorganisms from the B. cereus group as a study set, was demonstrated.

  13. Discrimination of Bacillus anthracis from closely related microorganisms by analysis of 16S and 23S rRNA with oligonucleotide microchips

    DOEpatents

    Bavykin, Sergei G.; Mirzabekov, Andrei D.

    2007-10-30

    The present invention is directed to a novel method of discriminating a highly infectious bacterium Bacillus anthracis from a group of closely related microorganisms. Sequence variations in the 16S and 23S rRNA of the B. cereus subgroup including B. anthracis are utilized to construct an array that can detect these sequence variations through selective hybridizations. The identification and analysis of these sequence variations enables positive discrimination of isolates of the B. cereus group that includes B. anthracis. Discrimination of single base differences in rRNA was achieved with a microchip during analysis of B. cereus group isolates from both single and in mixed probes, as well as identification of polymorphic sites. Successful use of a microchip to determine the appropriate subgroup classification using eight reference microorganisms from the B. cereus group as a study set, was demonstrated.

  14. A reliable confirmation of the chemical structure of synthetic oligonucleotides: Detection of active protons in DNA oligomers by low-temperature FT infrared spectroscopy

    NASA Astrophysics Data System (ADS)

    Rozenberg, M.; Shoham, G.

    2009-01-01

    Cooling the samples allowed us to characterize solid oligonucleotides such as dimers, trimers and pentamers of cytidine, for the first time, in the IR range of the out-of-plane bending molecular modes (1000-400 cm -1) at 20 K. Especially interesting are the narrow IR bands of the out-of-plane bending ν4 NH 2 proton mode, which are apparently invisible at room temperature. This unequivocally defined and well-resolved NH 2 bending band should provide important information on the exact chemical form and hydrogen bonding interactions of cytidine amine groups. As such, this unique IR spectroscopy is suggested as a practical analytical tool to validate and characterize synthetic DNA bases and oligonucleotides. Using an approach of this type it was found that desalted oligonucleotide samples of the same nominal composition, but which had been produced by three different manufacturers, differ significantly in their IR spectra. These data suggest that the presumably identical oligonucleotides are in fact different, at least with respect to the content and nature of their NH protons.

  15. A reliable confirmation of the chemical structure of synthetic oligonucleotides: detection of active protons in DNA oligomers by low-temperature FT infrared spectroscopy.

    PubMed

    Rozenberg, M; Shoham, G

    2009-01-01

    Cooling the samples allowed us to characterize solid oligonucleotides such as dimers, trimers and pentamers of cytidine, for the first time, in the IR range of the out-of-plane bending molecular modes (1000-400 cm(-1)) at 20K. Especially interesting are the narrow IR bands of the out-of-plane bending nu(4) NH(2) proton mode, which are apparently invisible at room temperature. This unequivocally defined and well-resolved NH(2) bending band should provide important information on the exact chemical form and hydrogen bonding interactions of cytidine amine groups. As such, this unique IR spectroscopy is suggested as a practical analytical tool to validate and characterize synthetic DNA bases and oligonucleotides. Using an approach of this type it was found that desalted oligonucleotide samples of the same nominal composition, but which had been produced by three different manufacturers, differ significantly in their IR spectra. These data suggest that the presumably identical oligonucleotides are in fact different, at least with respect to the content and nature of their NH protons.

  16. Functional analysis of the stress response element and its role in the multistress response of Saccharomyces cerevisiae.

    PubMed

    Treger, J M; Magee, T R; McEntee, K

    1998-02-04

    The DDR2 gene of Saccharomyces cerevisiae is a multistress response gene whose transcription is rapidly and strongly induced by a diverse array of xenobiotic agents, and environmental and physiological conditions. The multistress response of this gene requires the pentanucleotide, 5' CCCCT, (C4T;STRE (STress Response Element)) and the zinc-finger transcription factors, Msn2p and Msn4p. A 51bp oligonucleotide (oligo 31/32) containing two STREs from the DDR2 promoter region was previously shown to direct heat shock activation of a lacZ reporter gene. In this work we demonstrate that the same element conferred a complete multistress response to an E. coli galK reporter gene introduced into yeast cells. A variant oligonucleotide in which both the STRE spacing and neighboring sequences were altered responded to the same spectrum of stresses, while substitution of nucleotides within the pentanucleotide completely abolished the multistress response. These results directly demonstrate that STREs are not only necessary but are sufficient for mediating a transcriptional response to a surprisingly diverse set of environmental and physiological conditions.

  17. High Quality Genomic Copy Number Data from Archival Formalin-Fixed Paraffin-Embedded Leiomyosarcoma: Optimisation of Universal Linkage System Labelling

    PubMed Central

    Salawu, Abdulazeez; Ul-Hassan, Aliya; Hammond, David; Fernando, Malee; Reed, Malcolm; Sisley, Karen

    2012-01-01

    Most soft tissue sarcomas are characterized by genetic instability and frequent genomic copy number aberrations that are not subtype-specific. Oligonucleotide microarray-based Comparative Genomic Hybridisation (array CGH) is an important technique used to map genome-wide copy number aberrations, but the traditional requirement for high-quality DNA typically obtained from fresh tissue has limited its use in sarcomas. Although large archives of Formalin-fixed Paraffin-embedded (FFPE) tumour samples are available for research, the degradative effects of formalin on DNA from these tissues has made labelling and analysis by array CGH technically challenging. The Universal Linkage System (ULS) may be used for a one-step chemical labelling of such degraded DNA. We have optimised the ULS labelling protocol to perform aCGH on archived FFPE leiomyosarcoma tissues using the 180k Agilent platform. Preservation age of samples ranged from a few months to seventeen years and the DNA showed a wide range of degradation (when visualised on agarose gels). Consistently high DNA labelling efficiency and low microarray probe-to-probe variation (as measured by the derivative log ratio spread) was seen. Comparison of paired fresh and FFPE samples from identical tumours showed good correlation of CNAs detected. Furthermore, the ability to macro-dissect FFPE samples permitted the detection of CNAs that were masked in fresh tissue. Aberrations were visually confirmed using Fluorescence in situ Hybridisation. These results suggest that archival FFPE tissue, with its relative abundance and attendant clinical data may be used for effective mapping for genomic copy number aberrations in such rare tumours as leiomyosarcoma and potentially unravel clues to tumour origins, progression and ultimately, targeted treatment. PMID:23209738

  18. Comparative Biochemistry and Metabolism

    DTIC Science & Technology

    1978-12-01

    pyrimidines). When interest includes labile pyrimidine derivatives, the DNA is hydrolyzed enzymatically; 5 mg DNA is dis- solved in water containing 20 j...Individual labeled pyrimidine nucleosides from animals so treated have been isolated but not yet identified. The DNA is hydrolyzed enzymatically to... hydrolyzed and chromatographically separated into pyrimidine oligonucleotides and free purine bases. At a dose of 60 mg hydrazine/kg body weight (LDO.0O

  19. Synthetic oligonucleotide separations by mixed-mode reversed-phase/weak anion-exchange liquid chromatography.

    PubMed

    Zimmermann, Aleksandra; Greco, Roberto; Walker, Isabel; Horak, Jeannie; Cavazzini, Alberto; Lämmerhofer, Michael

    2014-08-08

    Synthetic oligonucleotides gain increasing importance in new therapeutic concepts and as probes in biological sciences. If pharmaceutical-grade purities are required, chromatographic purification using ion-pair reversed-phase chromatography is commonly carried out. However, separation selectivity for structurally closely related impurities is often insufficient, especially at high sample loads. In this study, a "mixed-mode" reversed-phase/weak anion exchanger stationary phase has been investigated as an alternative tool for chromatographic separation of synthetic oligonucleotides with minor sequence variations. The employed mixed-mode phase shows great flexibility in method development. It has been run in various gradient elution modes, viz. one, two or three parameter (mixed) gradients (altering buffer pH, buffer concentration, and organic modifier) to find optimal elution conditions and gain further insight into retention mechanisms. Compared to ion-pair reversed-phase and mere anion-exchange separation, enhanced selectivities were observed with the mixed-mode phase for 20-23 nucleotide (nt) long oligonucleotides with similar sequences. Oligonucleotides differing by 1, 2 or 3 nucleotides in length could be readily resolved and separation factors for single nucleotide replacements declined in the order Cytosine (C)/Guanine (G)>Adenine (A)/Guanine∼Guanine/Thymine (T)>Adenine/Cytosine∼Cytosine/Thymine>Adenine/Thymine. Selectivities were larger when the modification was at the 3' terminal-end, declined when it was in the middle of the sequence and was smallest when it was located at the 5' terminus. Due to the lower surface area of the 200Å pore size mixed-mode stationary phase compared to the corresponding 100Å material, lower retention times with equal selectivities under milder elution conditions were achievable. Considering high sample loading capacities of the mixed-mode anion-exchanger phase, it should have great potential for chromatographic oligonucleotide separation and purification. Copyright © 2014 Elsevier B.V. All rights reserved.

  20. Detection of cystic fibrosis transmembrane conductance regulator ΔF508 gene mutation using a paper-based nucleic acid hybridization assay and a smartphone camera.

    PubMed

    Malhotra, Karan; Noor, M Omair; Krull, Ulrich J

    2018-05-29

    Diagnostic technology that makes use of paper platforms in conjunction with the ubiquitous availability of digital cameras in cellular telephones and personal assistive devices offers opportunities for development of bioassays that are cost effective and widely distributed. Assays that operate effectively in aqueous solution require further development for implementation in paper substrates, overcoming issues associated with surface interactions on a matrix that offers a large surface-to-volume ratio and constraints on convective mixing. This report presents and compares two related methods for determination of oligonucleotides that serve as indicators of cystic fibrosis, differentiating between the normal wild-type sequence, and a mutant-type sequence that has a 3-base replacement. The transduction strategy operates by selective hybridization of oligonucleotide probes that are conjugated to fluorescent quantum dots, where hybridization of target sequences causes a molecular fluorophore to approach the quantum dot and become emissive through fluorescence resonance energy transfer. Detection can rely on hybridization of a target that is labelled with Cy3 fluorophore, or in the presence of an unlabelled target when a sandwich assay format is implemented with a labelled reporter oligonucleotide. Selectivity to determine the presence of mismatched sequences involves appropriate selection of nucleotide sequences to set melt temperatures, in conjunction with control of stringency conditions using formamide as a chaotrope. It was determined that both direct and sandwich assays on paper substrates are able to distinguish between wild-type and mutant-type samples.

  1. DNA/RNA heteroduplex oligonucleotide for highly efficient gene silencing

    PubMed Central

    Nishina, Kazutaka; Piao, Wenying; Yoshida-Tanaka, Kie; Sujino, Yumiko; Nishina, Tomoko; Yamamoto, Tsuyoshi; Nitta, Keiko; Yoshioka, Kotaro; Kuwahara, Hiroya; Yasuhara, Hidenori; Baba, Takeshi; Ono, Fumiko; Miyata, Kanjiro; Miyake, Koichi; Seth, Punit P.; Low, Audrey; Yoshida, Masayuki; Bennett, C. Frank; Kataoka, Kazunori; Mizusawa, Hidehiro; Obika, Satoshi; Yokota, Takanori

    2015-01-01

    Antisense oligonucleotides (ASOs) are recognized therapeutic agents for the modulation of specific genes at the post-transcriptional level. Similar to any medical drugs, there are opportunities to improve their efficacy and safety. Here we develop a short DNA/RNA heteroduplex oligonucleotide (HDO) with a structure different from double-stranded RNA used for short interfering RNA and single-stranded DNA used for ASO. A DNA/locked nucleotide acid gapmer duplex with an α-tocopherol-conjugated complementary RNA (Toc-HDO) is significantly more potent at reducing the expression of the targeted mRNA in liver compared with the parent single-stranded gapmer ASO. Toc-HDO also improves the phenotype in disease models more effectively. In addition, the high potency of Toc-HDO results in a reduction of liver dysfunction observed in the parent ASO at a similar silencing effect. HDO technology offers a novel concept of therapeutic oligonucleotides, and the development of this molecular design opens a new therapeutic field. PMID:26258894

  2. Surface-enhanced Raman scattering detection of DNA derived from the West Nile virus genome using magnetic capture of Raman-active gold nanoparticles

    USDA-ARS?s Scientific Manuscript database

    A model paramagnetic nanoparticle (MNP) assay is demonstrated for surface-enhanced Raman scattering (SERS) detection of DNA oligonucleotides derived from the West Nile virus (WNV) genome. Detection is based on the capture of WNV target sequences by hybridization with complementary oligonucleotide pr...

  3. Non-Enzymatic Detection of Bacterial Genomic DNA Using the Bio-Barcode Assay

    PubMed Central

    Hill, Haley D.; Vega, Rafael A.; Mirkin, Chad A.

    2011-01-01

    The detection of bacterial genomic DNA through a non-enzymatic nanomaterials based amplification method, the bio-barcode assay, is reported. The assay utilizes oligonucleotide functionalized magnetic microparticles to capture the target of interest from the sample. A critical step in the new assay involves the use of blocking oligonucleotides during heat denaturation of the double stranded DNA. These blockers bind to specific regions of the target DNA upon cooling, and prevent the duplex DNA from re-hybridizing, which allows the particle probes to bind. Following target isolation using the magnetic particles, oligonucleotide functionalized gold nanoparticles act as target recognition agents. The oligonucleotides on the nanoparticle (barcodes) act as amplification surrogates. The barcodes are then detected using the Scanometric method. The limit of detection for this assay was determined to be 2.5 femtomolar, and this is the first demonstration of a barcode type assay for the detection of double stranded, genomic DNA. PMID:17927207

  4. Secondary binding sites for heavily modified triplex forming oligonucleotides

    PubMed Central

    Cardew, Antonia S.; Brown, Tom; Fox, Keith R.

    2012-01-01

    In order to enhance DNA triple helix stability synthetic oligonucleotides have been developed that bear amino groups on the sugar or base. One of the most effective of these is bis-amino-U (B), which possesses 5-propargylamino and 2′-aminoethoxy modifications. Inclusion of this modified nucleotide not only greatly enhances triplex stability, but also increases the affinity for related sequences. We have used a restriction enzyme protection, selection and amplification assay (REPSA) to isolate sequences that are bound by the heavily modified 9-mer triplex-forming oligonucleotide B6CBT. The isolated sequences contain An tracts (n = 6), suggesting that the 5′-end of this TFO was responsible for successful triplex formation. DNase I footprinting with these sequences confirmed triple helix formation at these secondary targets and demonstrated no interaction with similar oligonucleotides containing T or 5-propargylamino-dU. PMID:22180535

  5. Mismatch and G-Stack Modulated Probe Signals on SNP Microarrays

    PubMed Central

    Binder, Hans; Fasold, Mario; Glomb, Torsten

    2009-01-01

    Background Single nucleotide polymorphism (SNP) arrays are important tools widely used for genotyping and copy number estimation. This technology utilizes the specific affinity of fragmented DNA for binding to surface-attached oligonucleotide DNA probes. We analyze the variability of the probe signals of Affymetrix GeneChip SNP arrays as a function of the probe sequence to identify relevant sequence motifs which potentially cause systematic biases of genotyping and copy number estimates. Methodology/Principal Findings The probe design of GeneChip SNP arrays enables us to disentangle different sources of intensity modulations such as the number of mismatches per duplex, matched and mismatched base pairings including nearest and next-nearest neighbors and their position along the probe sequence. The effect of probe sequence was estimated in terms of triple-motifs with central matches and mismatches which include all 256 combinations of possible base pairings. The probe/target interactions on the chip can be decomposed into nearest neighbor contributions which correlate well with free energy terms of DNA/DNA-interactions in solution. The effect of mismatches is about twice as large as that of canonical pairings. Runs of guanines (G) and the particular type of mismatched pairings formed in cross-allelic probe/target duplexes constitute sources of systematic biases of the probe signals with consequences for genotyping and copy number estimates. The poly-G effect seems to be related to the crowded arrangement of probes which facilitates complex formation of neighboring probes with at minimum three adjacent G's in their sequence. Conclusions The applied method of “triple-averaging” represents a model-free approach to estimate the mean intensity contributions of different sequence motifs which can be applied in calibration algorithms to correct signal values for sequence effects. Rules for appropriate sequence corrections are suggested. PMID:19924253

  6. Resolving prokaryotic taxonomy without rRNA: longer oligonucleotide word lengths improve genome and metagenome taxonomic classification.

    PubMed

    Alsop, Eric B; Raymond, Jason

    2013-01-01

    Oligonucleotide signatures, especially tetranucleotide signatures, have been used as method for homology binning by exploiting an organism's inherent biases towards the use of specific oligonucleotide words. Tetranucleotide signatures have been especially useful in environmental metagenomics samples as many of these samples contain organisms from poorly classified phyla which cannot be easily identified using traditional homology methods, including NCBI BLAST. This study examines oligonucleotide signatures across 1,424 completed genomes from across the tree of life, substantially expanding upon previous work. A comprehensive analysis of mononucleotide through nonanucleotide word lengths suggests that longer word lengths substantially improve the classification of DNA fragments across a range of sizes of relevance to high throughput sequencing. We find that, at present, heptanucleotide signatures represent an optimal balance between prediction accuracy and computational time for resolving taxonomy using both genomic and metagenomic fragments. We directly compare the ability of tetranucleotide and heptanucleotide world lengths (tetranucleotide signatures are the current standard for oligonucleotide word usage analyses) for taxonomic binning of metagenome reads. We present evidence that heptanucleotide word lengths consistently provide more taxonomic resolving power, particularly in distinguishing between closely related organisms that are often present in metagenomic samples. This implies that longer oligonucleotide word lengths should replace tetranucleotide signatures for most analyses. Finally, we show that the application of longer word lengths to metagenomic datasets leads to more accurate taxonomic binning of DNA scaffolds and have the potential to substantially improve taxonomic assignment and assembly of metagenomic data.

  7. Spherically-clustered porous Au-Ag alloy nanoparticle prepared by partial inhibition of galvanic replacement and its application for efficient multimodal therapy.

    PubMed

    Jang, Hongje; Min, Dal-Hee

    2015-03-24

    The polyvinylpyrrolidone (PVP)-coated spherically clustered porous gold-silver alloy nanoparticle (PVP-SPAN) was prepared by low temperature mediated, partially inhibited galvanic replacement reaction followed by silver etching process. The prepared porous nanostructures exhibited excellent photothermal conversion efficiency under irradiation of near-infrared light (NIR) and allowed a high payload of both doxorubicin (Dox) and thiolated dye-labeled oligonucleotide, DNAzyme (FDz). Especially, PVP-SPAN provided 10 times higher loading capacity for oligonucleotide than conventional hollow nanoshells due to increased pore diameter and surface-to-volume ratio. We demonstrated highly efficient chemo-thermo-gene multitherapy based on codelivery of Dox and FDz with NIR-mediated photothermal therapeutic effect using a model system of hepatitis C virus infected human liver cells (Huh7 human hepatocarcinoma cell line containing hepatitis C virus NS3 gene replicon) compared to conventional hollow nanoshells.

  8. Hit-Validation Methodologies for Ligands Isolated from DNA-Encoded Chemical Libraries.

    PubMed

    Zimmermann, Gunther; Li, Yizhou; Rieder, Ulrike; Mattarella, Martin; Neri, Dario; Scheuermann, Jörg

    2017-05-04

    DNA-encoded chemical libraries (DECLs) are large collections of compounds linked to DNA fragments, serving as amplifiable barcodes, which can be screened on target proteins of interest. In typical DECL selections, preferential binders are identified by high-throughput DNA sequencing, by comparing their frequency before and after the affinity capture step. Hits identified in this procedure need to be confirmed, by resynthesis and by performing affinity measurements. In this article we present new methods based on hybridization of oligonucleotide conjugates with fluorescently labeled complementary oligonucleotides; these facilitate the determination of affinity constants and kinetic dissociation constants. The experimental procedures were demonstrated with acetazolamide, a binder to carbonic anhydrase IX with a dissociation constant in the nanomolar range. The detection of binding events was compatible not only with fluorescence polarization methodologies, but also with Alphascreen technology and with microscale thermophoresis. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Merlin: Computer-Aided Oligonucleotide Design for Large Scale Genome Engineering with MAGE.

    PubMed

    Quintin, Michael; Ma, Natalie J; Ahmed, Samir; Bhatia, Swapnil; Lewis, Aaron; Isaacs, Farren J; Densmore, Douglas

    2016-06-17

    Genome engineering technologies now enable precise manipulation of organism genotype, but can be limited in scalability by their design requirements. Here we describe Merlin ( http://merlincad.org ), an open-source web-based tool to assist biologists in designing experiments using multiplex automated genome engineering (MAGE). Merlin provides methods to generate pools of single-stranded DNA oligonucleotides (oligos) for MAGE experiments by performing free energy calculation and BLAST scoring on a sliding window spanning the targeted site. These oligos are designed not only to improve recombination efficiency, but also to minimize off-target interactions. The application further assists experiment planning by reporting predicted allelic replacement rates after multiple MAGE cycles, and enables rapid result validation by generating primer sequences for multiplexed allele-specific colony PCR. Here we describe the Merlin oligo and primer design procedures and validate their functionality compared to OptMAGE by eliminating seven AvrII restriction sites from the Escherichia coli genome.

  10. Self-replication of chemical systems based on recognition within a double or a triple helix - A realistic hypothesis

    NASA Technical Reports Server (NTRS)

    Kanavarioti, Anastassia

    1992-01-01

    A scenario is proposed for the non-enzymatic self-replication of short RNA molecules. The self-replication of an oligopyrimidine strand is considered and the process of template-directed synthesis based on recognition within a double helix is discussed. Replication mechanisms are suggested for selected oligonucleotides. The mechanisms are based on Watson-Crick base pairing between complementary nucleotides as well as Hoogsteen base pairing between a duplex and the complementary third strand. It is suggested that self-replication based on these mechanisms may be accomplished but may result in a substantial amount of misinformation transfer when mixed oligonucleotides are used.

  11. [Ru(phen)2DPPZ]2+ is in contact with DNA bases when it forms a luminescent complex with single-stranded oligonucleotides.

    PubMed

    Moon, Seok Joon; Kim, Jong Moon; Choi, Ji Youn; Kim, Seog K; Lee, Je Seung; Jang, Ho G

    2005-05-01

    The luminescence intensity of the Delta- and Lambda-enantiomer of [Ru(phen)2DPPZ]2+ ([Ru(phenanthroline)2 dipyrido[3,2-a:2',3'-c]phenazine]2+) complex enhanced upon binding to double stranded DNA, which has been known as "light switch effect". The enhancement of the luminescence required the intercalation of the large ligand between DNA base pairs. In this study, we report the enhancement in the luminescence intensity when the metal complexes bind to single stranded oligonucleotides, indicating that the "light switch effect" does not require intercalation of the large DPPZ ligand. Oligonucleotides may provide a hydrophobic cavity for the [Ru(phen)2DPPZ]2+ complex to prevent the quenching by the water molecule. In the cavity, the metal complex is in contact with DNA bases as is evidenced by the observation that the excited energy of the DNA bases transfer to the bound metal complex. However, the contact of the metal complex with DNA bases is different from the stacking of DPPZ in the intercalation pocket. In addition to the normal two luminescence lifetimes, a short lifetime in the range of 1-2 ns was found for both the delta- and lambda-enantiomer of [Ru(phen)2DPPZ]2+ when complexed with single stranded oligonucleotides, which may be assigned to the metal complex that is outside of the cavity, interacting with phosphate groups of DNA.

  12. Real-time single-molecule electronic DNA sequencing by synthesis using polymer-tagged nucleotides on a nanopore array

    PubMed Central

    Fuller, Carl W.; Kumar, Shiv; Porel, Mintu; Chien, Minchen; Bibillo, Arek; Stranges, P. Benjamin; Dorwart, Michael; Tao, Chuanjuan; Li, Zengmin; Guo, Wenjing; Shi, Shundi; Korenblum, Daniel; Trans, Andrew; Aguirre, Anne; Liu, Edward; Harada, Eric T.; Pollard, James; Bhat, Ashwini; Cech, Cynthia; Yang, Alexander; Arnold, Cleoma; Palla, Mirkó; Hovis, Jennifer; Chen, Roger; Morozova, Irina; Kalachikov, Sergey; Russo, James J.; Kasianowicz, John J.; Davis, Randy; Roever, Stefan; Church, George M.; Ju, Jingyue

    2016-01-01

    DNA sequencing by synthesis (SBS) offers a robust platform to decipher nucleic acid sequences. Recently, we reported a single-molecule nanopore-based SBS strategy that accurately distinguishes four bases by electronically detecting and differentiating four different polymer tags attached to the 5′-phosphate of the nucleotides during their incorporation into a growing DNA strand catalyzed by DNA polymerase. Further developing this approach, we report here the use of nucleotides tagged at the terminal phosphate with oligonucleotide-based polymers to perform nanopore SBS on an α-hemolysin nanopore array platform. We designed and synthesized several polymer-tagged nucleotides using tags that produce different electrical current blockade levels and verified they are active substrates for DNA polymerase. A highly processive DNA polymerase was conjugated to the nanopore, and the conjugates were complexed with primer/template DNA and inserted into lipid bilayers over individually addressable electrodes of the nanopore chip. When an incoming complementary-tagged nucleotide forms a tight ternary complex with the primer/template and polymerase, the tag enters the pore, and the current blockade level is measured. The levels displayed by the four nucleotides tagged with four different polymers captured in the nanopore in such ternary complexes were clearly distinguishable and sequence-specific, enabling continuous sequence determination during the polymerase reaction. Thus, real-time single-molecule electronic DNA sequencing data with single-base resolution were obtained. The use of these polymer-tagged nucleotides, combined with polymerase tethering to nanopores and multiplexed nanopore sensors, should lead to new high-throughput sequencing methods. PMID:27091962

  13. Spherical Nucleic Acids as Intracellular Agents for Nucleic Acid Based Therapeutics

    NASA Astrophysics Data System (ADS)

    Hao, Liangliang

    Recent functional discoveries on the noncoding sequences of human genome and transcriptome could lead to revolutionary treatment modalities because the noncoding RNAs (ncRNAs) can be applied as therapeutic agents to manipulate disease-causing genes. To date few nucleic acid-based therapeutics have been translated into the clinic due to challenges in the delivery of the oligonucleotide agents in an effective, cell specific, and non-toxic fashion. Unmodified oligonucleotide agents are destroyed rapidly in biological fluids by enzymatic degradation and have difficulty crossing the plasma membrane without the aid of transfection reagents, which often cause inflammatory, cytotoxic, or immunogenic side effects. Spherical nucleic acids (SNAs), nanoparticles consisting of densely organized and highly oriented oligonucleotides, pose one possible solution to circumventing these problems in both the antisense and RNA interference (RNAi) pathways. The unique three dimensional architecture of SNAs protects the bioactive oligonucleotides from unspecific degradation during delivery and supports their targeting of class A scavenger receptors and endocytosis via a lipid-raft-dependent, caveolae-mediated pathway. Owing to their unique structure, SNAs are able to cross cell membranes and regulate target genes expression as a single entity, without triggering the cellular innate immune response. Herein, my thesis has focused on understanding the interactions between SNAs and cellular components and developing SNA-based nanostructures to improve therapeutic capabilities. Specifically, I developed a novel SNA-based, nanoscale agent for delivery of therapeutic oligonucleotides to manipulate microRNAs (miRNAs), the endogenous post-transcriptional gene regulators. I investigated the role of SNAs involving miRNAs in anti-cancer or anti-inflammation responses in cells and in in vivo murine disease models via systemic injection. Furthermore, I explored using different strategies to construct novel SNA-based nanomaterials with desired properties and applying targeting moieties to the SNA platform to achieve cell type specific gene regulation effects. Due to the flexibility of the SNA approach, the SNA platform can potentially be applied to many genetic disorders through tailored target specificities.

  14. Preparation of genosensor for detection of specific DNA sequence of the hepatitis B virus

    NASA Astrophysics Data System (ADS)

    Honorato Castro, Ana C.; França, Erick G.; de Paula, Lucas F.; Soares, Marcia M. C. N.; Goulart, Luiz R.; Madurro, João M.; Brito-Madurro, Ana G.

    2014-09-01

    An electrochemical genosensor was constructed for detection of specific DNA sequence of the hepatitis B virus, based on graphite electrodes modified with poly(4-aminophenol) and incorporating a specific oligonucleotide probe. The modified electrode containing the probe was evaluated by differential pulse voltammetry, before and after incubation with the complementary oligonucleotide target. Detection was performed by monitoring oxidizable DNA bases (direct detection) or using ethidium bromide as indicator of the hybridization process (indirect detection). The device showed a detection limit for the oligonucleotide target of 2.61 nmol L-1. Indirect detection using ethidium bromide was promising in discriminating mismatches, which is a very desirable attribute for detection of disease-related point mutations. In addition, it was possible to observe differences between hybridized and non-hybridized surfaces by atomic force microscopy.

  15. Microelectroporation device for genomic screening

    DOEpatents

    Perroud, Thomas D.; Renzi, Ronald F.; Negrete, Oscar; Claudnic, Mark R.

    2014-09-09

    We have developed an microelectroporation device that combines microarrays of oligonucleotides, microfluidic channels, and electroporation for cell transfection and high-throughput screening applications (e.g. RNA interference screens). Microarrays allow the deposition of thousands of different oligonucleotides in microscopic spots. Microfluidic channels and microwells enable efficient loading of cells into the device and prevent cross-contamination between different oligonucleotides spots. Electroporation allows optimal transfection of nucleic acids into cells (especially hard-to-transfect cells such as primary cells) by minimizing cell death while maximizing transfection efficiency. This invention has the advantage of a higher throughput and lower cost, while preventing cross-contamination compared to conventional screening technologies. Moreover, this device does not require bulky robotic liquid handling equipment and is inherently safer given that it is a closed system.

  16. Detection of Hepatitis A Virus by the Nucleic Acid Sequence-Based Amplification Technique and Comparison with Reverse Transcription-PCR

    PubMed Central

    Jean, Julie; Blais, Burton; Darveau, André; Fliss, Ismaïl

    2001-01-01

    A nucleic acid sequence-based amplification (NASBA) technique for the detection of hepatitis A virus (HAV) in foods was developed and compared to the traditional reverse transcription (RT)-PCR technique. Oligonucleotide primers targeting the VP1 and VP2 genes encoding the major HAV capsid proteins were used for the amplification of viral RNA in an isothermal process resulting in the accumulation of RNA amplicons. Amplicons were detected by hybridization with a digoxigenin-labeled oligonucleotide probe in a dot blot assay format. Using the NASBA, as little as 0.4 ng of target RNA/ml was detected per comparison to 4 ng/ml for RT-PCR. When crude HAV viral lysate was used, a detection limit of 2 PFU (4 × 102 PFU/ml) was obtained with NASBA, compared to 50 PFU (1 × 104 PFU/ml) obtained with RT-PCR. No interference was encountered in the amplification of HAV RNA in the presence of excess nontarget RNA or DNA. The NASBA system successfully detected HAV recovered from experimentally inoculated samples of waste water, lettuce, and blueberries. Compared to RT-PCR and other amplification techniques, the NASBA system offers several advantages in terms of sensitivity, rapidity, and simplicity. This technique should be readily adaptable for detection of other RNA viruses in both foods and clinical samples. PMID:11722911

  17. Detection of hepatitis A virus by the nucleic acid sequence-based amplification technique and comparison with reverse transcription-PCR.

    PubMed

    Jean, J; Blais, B; Darveau, A; Fliss, I

    2001-12-01

    A nucleic acid sequence-based amplification (NASBA) technique for the detection of hepatitis A virus (HAV) in foods was developed and compared to the traditional reverse transcription (RT)-PCR technique. Oligonucleotide primers targeting the VP1 and VP2 genes encoding the major HAV capsid proteins were used for the amplification of viral RNA in an isothermal process resulting in the accumulation of RNA amplicons. Amplicons were detected by hybridization with a digoxigenin-labeled oligonucleotide probe in a dot blot assay format. Using the NASBA, as little as 0.4 ng of target RNA/ml was detected per comparison to 4 ng/ml for RT-PCR. When crude HAV viral lysate was used, a detection limit of 2 PFU (4 x 10(2) PFU/ml) was obtained with NASBA, compared to 50 PFU (1 x 10(4) PFU/ml) obtained with RT-PCR. No interference was encountered in the amplification of HAV RNA in the presence of excess nontarget RNA or DNA. The NASBA system successfully detected HAV recovered from experimentally inoculated samples of waste water, lettuce, and blueberries. Compared to RT-PCR and other amplification techniques, the NASBA system offers several advantages in terms of sensitivity, rapidity, and simplicity. This technique should be readily adaptable for detection of other RNA viruses in both foods and clinical samples.

  18. A High-throughput Assay for mRNA Silencing in Primary Cortical Neurons in vitro with Oligonucleotide Therapeutics.

    PubMed

    Alterman, Julia F; Coles, Andrew H; Hall, Lauren M; Aronin, Neil; Khvorova, Anastasia; Didiot, Marie-Cécile

    2017-08-20

    Primary neurons represent an ideal cellular system for the identification of therapeutic oligonucleotides for the treatment of neurodegenerative diseases. However, due to the sensitive nature of primary cells, the transfection of small interfering RNAs (siRNA) using classical methods is laborious and often shows low efficiency. Recent progress in oligonucleotide chemistry has enabled the development of stabilized and hydrophobically modified small interfering RNAs (hsiRNAs). This new class of oligonucleotide therapeutics shows extremely efficient self-delivery properties and supports potent and durable effects in vitro and in vivo . We have developed a high-throughput in vitro assay to identify and test hsiRNAs in primary neuronal cultures. To simply, rapidly, and accurately quantify the mRNA silencing of hundreds of hsiRNAs, we use the QuantiGene 2.0 quantitative gene expression assay. This high-throughput, 96-well plate-based assay can quantify mRNA levels directly from sample lysate. Here, we describe a method to prepare short-term cultures of mouse primary cortical neurons in a 96-well plate format for high-throughput testing of oligonucleotide therapeutics. This method supports the testing of hsiRNA libraries and the identification of potential therapeutics within just two weeks. We detail methodologies of our high throughput assay workflow from primary neuron preparation to data analysis. This method can help identify oligonucleotide therapeutics for treatment of various neurological diseases.

  19. Rapid, sensitive and label-free detection of Shiga-toxin producing Escherichia coli O157 using carbon nanotube biosensors.

    PubMed

    Subramanian, Sowmya; Aschenbach, Konrad H; Evangelista, Jennifer P; Najjar, Mohamed Badaoui; Song, Wenxia; Gomez, Romel D

    2012-02-15

    An electronic platform to detect very small amounts of genomic DNA from bacteria without the need for PCR amplification and molecular labeling is described. The system uses carbon nanotube field-effect transistor (FET) arrays whose electrical properties are affected by minute electrical charges localized on their active regions. Two pathogenic strains of E. coli are used to evaluate the detection properties of the transistor arrays. Described herein are the results for detection of synthetic oligomers, unpurified and highly purified genomic DNA at various concentrations and their comparison against non-specific binding. In particular, the capture of genomic DNA of E. coli O157:H7 by a specific oligonucleotide probe coated onto the transistor array results in a significant shift in the threshold (gate-source) voltage (V(th)). By contrast the signal under the same procedure using a different strain, E. coli O45 that is non-complementary to the probe remained nearly constant. This work highlights the detection sensitivity and efficacy of this biosensor without stringent requirement for DNA sample preparation. Copyright © 2011 Elsevier B.V. All rights reserved.

  20. A dual-colored ratiometric-fluorescent oligonucleotide probe for the detection of human telomerase RNA in cell extracts.

    PubMed

    Ning, Dianhua; He, Changtian; Liu, Zhengjie; Liu, Cui; Wu, Qilong; Zhao, TingTing; Liu, Renyong

    2017-05-21

    Human telomerase RNA (hTR), which is one component of telomerase, was deemed to be a biomarker to monitor tumor cells due to its different expression levels in tumor cells and normal somatic cells. Thus far, plentiful fluorescent probes have been designed to investigate nucleic acids. However, most of them are limited since they are time-consuming, require professional operators and even result in false positive signals in the cellular environment. Herein, we report a dual-colored ratiometric-fluorescent oligonucleotide probe to achieve the reliable detection of human telomerase RNA in cell extracts. The probe is constructed using a dual-labeled fluorescent oligonucleotide hybridized with target-complemented Dabcyl-labeled oligonucleotide. In the presence of the target, the dual-labeled fluorescent oligonucleotide translates into a hairpin structure, which leads to the generation of the fluorescence resonance energy transfer (FRET) phenomenon under UV excitation. Compared to conventional methods, this strategy could effectively avoid false positive signals, and it not only possesses the advantages of simplicity and high specificity but also has the merits of signal stability and distinguishable color variation. Moreover, the quantitative assay of hTR would have a far-reaching impact on the telomerase mechanism and even tumor diagnosis research.

  1. Structures of bacterial polynucleotide kinase in a Michaelis complex with GTP•Mg2+ and 5'-OH oligonucleotide and a product complex with GDP•Mg2+ and 5'-PO4 oligonucleotide reveal a mechanism of general acid-base catalysis and the determinants of phosphoacceptor recognition.

    PubMed

    Das, Ushati; Wang, Li Kai; Smith, Paul; Jacewicz, Agata; Shuman, Stewart

    2014-01-01

    Clostridium thermocellum polynucleotide kinase (CthPnk), the 5' end-healing module of a bacterial RNA repair system, catalyzes reversible phosphoryl transfer from an NTP donor to a 5'-OH polynucleotide acceptor. Here we report the crystal structures of CthPnk-D38N in a Michaelis complex with GTP•Mg(2+) and a 5'-OH oligonucleotide and a product complex with GDP•Mg(2+) and a 5'-PO4 oligonucleotide. The O5' nucleophile is situated 3.0 Å from the GTP γ phosphorus in the Michaelis complex, where it is coordinated by Asn38 and is apical to the bridging β phosphate oxygen of the GDP leaving group. In the product complex, the transferred phosphate has undergone stereochemical inversion and Asn38 coordinates the 5'-bridging phosphate oxygen of the oligonucleotide. The D38N enzyme is poised for catalysis, but cannot execute because it lacks Asp38-hereby implicated as the essential general base catalyst that abstracts a proton from the 5'-OH during the kinase reaction. Asp38 serves as a general acid catalyst during the 'reverse kinase' reaction by donating a proton to the O5' leaving group of the 5'-PO4 strand. The acceptor strand binding mode of CthPnk is distinct from that of bacteriophage T4 Pnk.

  2. Line scanning system for direct digital chemiluminescence imaging of DNA sequencing blots

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Karger, A.E.; Weiss, R.; Gesteland, R.F.

    A cryogenically cooled charge-coupled device (CCD) camera equipped with an area CCD array is used in a line scanning system for low-light-level imaging of chemiluminescent DNA sequencing blots. Operating the CCD camera in time-delayed integration (TDI) mode results in continuous data acquisition independent of the length of the CCD array. Scanning is possible with a resolution of 1.4 line pairs/mm at the 50% level of the modulation transfer function. High-sensitivity, low-light-level scanning of chemiluminescent direct-transfer electrophoresis (DTE) DNA sequencing blots is shown. The detection of DNA fragments on the blot involves DNA-DNA hybridization with oligonucleotide-alkaline phosphatase conjugate and 1,2-dioxetane-based chemiluminescence.more » The width of the scan allows the recording of up to four sequencing reactions (16 lanes) on one scan. The scan speed of 52 cm/h used for the sequencing blots corresponds to a data acquisition rate of 384 pixels/s. The chemiluminescence detection limit on the scanned images is 3.9 [times] 10[sup [minus]18] mol of plasmid DNA. A conditional median filter is described to remove spikes caused by cosmic ray events from the CCD images. 39 refs., 9 refs.« less

  3. Chemical synthesis of oligonucleotides containing a free sulphydryl group and subsequent attachment of thiol specific probes.

    PubMed Central

    Connolly, B A; Rider, P

    1985-01-01

    Oligonucleotides containing a free sulphydryl group at their 5'-termini have been synthesised and further derivatised with thiol specific probes. The nucleotide sequence required is prepared using standard solid phase phosphoramidite techniques and an extra round of synthesis is then performed using the S-triphenylmethyl O-methoxymorpholinophosphite derivatives of 2-mercaptoethanol, 3-mercaptopropan (1) ol or 6-mercaptohexan (1) ol. After cleavage from the resin and removal of the phosphate and base protecting groups, this yields an oligonucleotide containing an S-triphenylmethyl group attached to the 5'-phosphate group via a two, three or six carbon chain. The triphenylmethyl group can be readily removed with silver nitrate to give the free thiol. With the three and six carbon chain oligonucleotides, this thiol can be used, at pH 8, for the attachment of thiol specific probes as illustrated by the reaction with fluorescent conjugates of iodoacetates and maleiimides. However, oligonucleotides containing a thiol attached to the 5'-phosphate group via a two carbon chain are unstable at pH 8 decomposing to the free 5'-phosphate and so are unsuitable for further derivatisation. PMID:4011448

  4. PNA-COMBO-FISH: From combinatorial probe design in silico to vitality compatible, specific labelling of gene targets in cell nuclei.

    PubMed

    Müller, Patrick; Rößler, Jens; Schwarz-Finsterle, Jutta; Schmitt, Eberhard; Hausmann, Michael

    2016-07-01

    Recently, advantages concerning targeting specificity of PCR constructed oligonucleotide FISH probes in contrast to established FISH probes, e.g. BAC clones, have been demonstrated. These techniques, however, are still using labelling protocols with DNA denaturing steps applying harsh heat treatment with or without further denaturing chemical agents. COMBO-FISH (COMBinatorial Oligonucleotide FISH) allows the design of specific oligonucleotide probe combinations in silico. Thus, being independent from primer libraries or PCR laboratory conditions, the probe sequences extracted by computer sequence data base search can also be synthesized as single stranded PNA-probes (Peptide Nucleic Acid probes) or TINA-DNA (Twisted Intercalating Nucleic Acids). Gene targets can be specifically labelled with at least about 20 probes obtaining visibly background free specimens. By using appropriately designed triplex forming oligonucleotides, the denaturing procedures can completely be omitted. These results reveal a significant step towards oligonucleotide-FISH maintaining the 3d-nanostructure and even the viability of the cell target. The method is demonstrated with the detection of Her2/neu and GRB7 genes, which are indicators in breast cancer diagnosis and therapy. Copyright © 2016. Published by Elsevier Inc.

  5. Correlating In Vitro Splice Switching Activity With Systemic In Vivo Delivery Using Novel ZEN-modified Oligonucleotides.

    PubMed

    Hammond, Suzan M; McClorey, Graham; Nordin, Joel Z; Godfrey, Caroline; Stenler, Sofia; Lennox, Kim A; Smith, C I Edvard; Jacobi, Ashley M; Varela, Miguel A; Lee, Yi; Behlke, Mark A; Wood, Matthew J A; Andaloussi, Samir E L

    2014-11-25

    Splice switching oligonucleotides (SSOs) induce alternative splicing of pre-mRNA and typically employ chemical modifications to increase nuclease resistance and binding affinity to target pre-mRNA. Here we describe a new SSO non-base modifier (a naphthyl-azo group, "ZEN™") to direct exon exclusion in mutant dystrophin pre-mRNA to generate functional dystrophin protein. The ZEN modifier is placed near the ends of a 2'-O-methyl (2'OMe) oligonucleotide, increasing melting temperature and potency over unmodified 2'OMe oligonucleotides. In cultured H2K cells, a ZEN-modified 2'OMe phosphorothioate (PS) oligonucleotide delivered by lipid transfection greatly enhanced dystrophin exon skipping over the same 2'OMePS SSO lacking ZEN. However, when tested using free gymnotic uptake in vitro and following systemic delivery in vivo in dystrophin deficient mdx mice, the same ZEN-modified SSO failed to enhance potency. Importantly, we show for the first time that in vivo activity of anionic SSOs is modelled in vitro only when using gymnotic delivery. ZEN is thus a novel modifier that enhances activity of SSOs in vitro but will require improved delivery methods before its in vivo clinical potential can be realized.

  6. Biominetic High Density Lipoproteins for the Delivery of Therapeutic Oligonucleotides

    NASA Astrophysics Data System (ADS)

    Tripathy, Sushant

    Advances in nanotechnology have brought about novel inorganic and hybrid nanoparticles with unique physico-chemical properties that make them suitable for a broad range of applications---from nano-circuitry to drug delivery. A significant part of those advancements have led to ground-breaking discoveries that have changed the approaches to formulation of therapeutics against diseases, such as cancer. Now-a-days the focus does not lie solely on finding a candidate small-molecule therapeutic with minimal adverse effects, but researchers are looking up to nanoparticles to improve biodistribution and biocompatibility profile of clinically proven therapeutics. The plethora of conjugation chemistries offered by currently extant inorganic nanoparticles have, in recent years, led to great leaps in the field of biomimicry---a modality that promises high biocompatibility. Further, in the pursuit of highly specific therapeutic molecules, researchers have turned to silencing oligonucleotides and some have already brought together the strengths of nanoparticles and silencing oligonucleotides in search of an efficacious therapy for cancer with minimal adverse effects. This dissertation work focuses on such a biomimetic platform---a gold nanoparticle based high density lipoprotein biomimetic (HDL NP), for the delivery of therapeutic oligonucleotides. The first chapter of this body of work introduces the molecular target of the silencing oligonucleotides---VEGFR2, and its role in the progression of solid tumor cancers. The background information also covers important aspects of natural high density lipoproteins (HDL), especially their innate capacity to bind and deliver exogenous and endogenous silencing oligonucleotides to tissues that express their high affinity receptor SRB1. We subsequently describe the synthesis of the biomimetic HDL NP and its oligonucleotide conjugates, and establish their biocompatibility. Further on, experimental data demonstrate the efficacy of silencing oligonucleotides conjugated HDL NPs in regulating the expression and function of VEGFR2 in cultured endothelial cells. Finally, the efficacy of the conjugates in two animal models of angiogenesis is presented.

  7. Global analysis of gene expression in pulmonary fibrosis reveals distinct programs regulating lung inflammation and fibrosis

    NASA Astrophysics Data System (ADS)

    Kaminski, Naftali; Allard, John D.; Pittet, Jean F.; Zuo, Fengrong; Griffiths, Mark J. D.; Morris, David; Huang, Xiaozhu; Sheppard, Dean; Heller, Renu A.

    2000-02-01

    The molecular mechanisms of pulmonary fibrosis are poorly understood. We have used oligonucleotide arrays to analyze the gene expression programs that underlie pulmonary fibrosis in response to bleomycin, a drug that causes lung inflammation and fibrosis, in two strains of susceptible mice (129 and C57BL/6). We then compared the gene expression patterns in these mice with 129 mice carrying a null mutation in the epithelial-restricted integrin 6 subunit (6/-), which develop inflammation but are protected from pulmonary fibrosis. Cluster analysis identified two distinct groups of genes involved in the inflammatory and fibrotic responses. Analysis of gene expression at multiple time points after bleomycin administration revealed sequential induction of subsets of genes that characterize each response. The availability of this comprehensive data set should accelerate the development of more effective strategies for intervention at the various stages in the development of fibrotic diseases of the lungs and other organs.

  8. Advanced surface-enhanced Raman gene probe systems and methods thereof

    DOEpatents

    Vo-Dinh, Tuan

    2001-01-01

    The subject invention is a series of methods and systems for using the Surface-Enhanced Raman (SER)-labeled Gene Probe for hybridization, detection and identification of SER-labeled hybridized target oligonucleotide material comprising the steps of immobilizing SER-labeled hybridized target oligonucleotide material on a support means, wherein the SER-labeled hybridized target oligonucleotide material comprise a SER label attached either to a target oligonucleotide of unknown sequence or to a gene probe of known sequence complementary to the target oligonucleotide sequence, the SER label is unique for the target oligonucleotide strands of a particular sequence wherein the SER-labeled oligonucleotide is hybridized to its complementary oligonucleotide strand, then the support means having the SER-labeled hybridized target oligonucleotide material adsorbed thereon is SERS activated with a SERS activating means, then the support means is analyzed.

  9. Clinical potential of oligonucleotide-based therapeutics in the respiratory system.

    PubMed

    Moschos, Sterghios A; Usher, Louise; Lindsay, Mark A

    2017-01-01

    The discovery of an ever-expanding plethora of coding and non-coding RNAs with nodal and causal roles in the regulation of lung physiology and disease is reinvigorating interest in the clinical utility of the oligonucleotide therapeutic class. This is strongly supported through recent advances in nucleic acids chemistry, synthetic oligonucleotide delivery and viral gene therapy that have succeeded in bringing to market at least three nucleic acid-based drugs. As a consequence, multiple new candidates such as RNA interference modulators, antisense, and splice switching compounds are now progressing through clinical evaluation. Here, manipulation of RNA for the treatment of lung disease is explored, with emphasis on robust pharmacological evidence aligned to the five pillars of drug development: exposure to the appropriate tissue, binding to the desired molecular target, evidence of the expected mode of action, activity in the relevant patient population and commercially viable value proposition. Copyright © 2016 Elsevier Inc. All rights reserved.

  10. Electron transfer of plurimodified DNA SAMs.

    PubMed

    Rospigliosi, Alessandro; Ehlich, Rudolf; Hoerber, Heinrich; Middelberg, Anton; Moggridge, Geoff

    2007-07-17

    An STM-based current-voltage (I/V) investigation of deoxyribonucleic acid (DNA) 18 base pair (bp) oligonucleotide monolayers on gold is presented. Three bases of each of the immobilized and complementary strands were modified with either iodine or phenylethylene moieties. The oligonucleotides were immobilized on template stripped gold (tsg) surfaces and characterized by atomic force microscopy (AFM) and scanning tunneling microscopy (STM). AFM imaging showed that monolayers of the expected height were formed. A comparative study of normal, halogenated, and phenyl-modified DNA was made with the STM in tunneling spectroscopy (TS) mode. I/V spectroscopic measurements in the range +/-250 mV on both single- and double-stranded (ds) DNA monolayers (modified and unmodified) showed that for negative substrate bias (U(sub)) electron transfer is more efficient through a phenyl-modified monolayer than through normal or halogenated DNA. This effect was particularly clear below a threshold bias of -100 mV. For positive U(sub), unmodified ds DNA was found to conduct slightly better than the modified strands. This is presumably caused by greater order in the unmodified versus modified DNA monolayers. Modifications on the immobilized (thiolated) strand seem to improve electron transport through the DNA monolayer more than modifications on the complementary (not surface-bound) strand.

  11. Bi-specific splice-switching PMO oligonucleotides conjugated via a single peptide active in a mouse model of Duchenne muscular dystrophy

    PubMed Central

    Shabanpoor, Fazel; McClorey, Graham; Saleh, Amer F.; Järver, Peter; Wood, Matthew J.A.; Gait, Michael J.

    2015-01-01

    The potential for therapeutic application of splice-switching oligonucleotides (SSOs) to modulate pre-mRNA splicing is increasingly evident in a number of diseases. However, the primary drawback of this approach is poor cell and in vivo oligonucleotide uptake efficacy. Biological activities can be significantly enhanced through the use of synthetically conjugated cationic cell penetrating peptides (CPPs). Studies to date have focused on the delivery of a single SSO conjugated to a CPP, but here we describe the conjugation of two phosphorodiamidate morpholino oligonucleotide (PMO) SSOs to a single CPP for simultaneous delivery and pre-mRNA targeting of two separate genes, exon 23 of the Dmd gene and exon 5 of the Acvr2b gene, in a mouse model of Duchenne muscular dystrophy. Conjugations of PMOs to a single CPP were carried out through an amide bond in one case and through a triazole linkage (‘click chemistry’) in the other. The most active bi-specific CPP–PMOs demonstrated comparable exon skipping levels for both pre-mRNA targets when compared to individual CPP–PMO conjugates both in cell culture and in vivo in the mdx mouse model. Thus, two SSOs with different target sequences conjugated to a single CPP are biologically effective and potentially suitable for future therapeutic exploitation. PMID:25468897

  12. Pulsatile release of biomolecules from polydimethylsiloxane (PDMS) chips with hydrolytically degradable seals.

    PubMed

    Intra, Janjira; Glasgow, Justin M; Mai, Hoang Q; Salem, Aliasger K

    2008-05-08

    We demonstrate, for the first time, a robust novel polydimethylsiloxane (PDMS) chip that can provide controlled pulsatile release of DNA based molecules, proteins and oligonucleotides without external stimuli or triggers. The PDMS chip with arrays of wells was constructed by replica molding. Poly(lactic acid-co-glycolic acid) (PLGA) polymer films of varying composition and thickness were used as seals to the wells. The composition, molecular weight and thickness of the PLGA films were all parameters used to control the degradation rate of the seals and therefore the release profiles. Degradation of the films followed the PLGA composition order of 50:50 PLGA>75:25 PLGA>85:15 PLGA at all time-points beyond week 1. Scanning electron microscopy images showed that films were initially smooth, became porous and ruptured as the osmotic pressure pushed the degrading PLGA film outwards. Pulsatile release of DNA was controlled by the composition and thickness of the PLGA used to seal the well. Transfection experiments in a model Human Embryonic Kidney 293 (HEK293) cell line showed that plasmid DNA loaded in the wells was functional after pulsatile release in comparison to control plasmid DNA at all time-points. Thicker films degraded faster than thinner films and could be used to fine-tune the release of DNA over day length periods. Finally the PDMS chip was shown to provide repeated sequential release of CpG oligonucleotides and a model antigen, Ovalbumin (OVA), indicating significant potential for this device for vaccinations or applications that require defined complex release patterns of a variety of chemicals, drugs and biomolecules.

  13. Phosphorothioate backbone modifications of nucleotide-based drugs are potent platelet activators

    PubMed Central

    Flierl, Ulrike; Nero, Tracy L.; Lim, Bock; Arthur, Jane F.; Yao, Yu; Jung, Stephanie M.; Gitz, Eelo; Pollitt, Alice Y.; Zaldivia, Maria T.K.; Jandrot-Perrus, Martine; Schäfer, Andreas; Nieswandt, Bernhard; Andrews, Robert K.; Parker, Michael W.; Gardiner, Elizabeth E.

    2015-01-01

    Nucleotide-based drug candidates such as antisense oligonucleotides, aptamers, immunoreceptor-activating nucleotides, or (anti)microRNAs hold great therapeutic promise for many human diseases. Phosphorothioate (PS) backbone modification of nucleotide-based drugs is common practice to protect these promising drug candidates from rapid degradation by plasma and intracellular nucleases. Effects of the changes in physicochemical properties associated with PS modification on platelets have not been elucidated so far. Here we report the unexpected binding of PS-modified oligonucleotides to platelets eliciting strong platelet activation, signaling, reactive oxygen species generation, adhesion, spreading, aggregation, and thrombus formation in vitro and in vivo. Mechanistically, the platelet-specific receptor glycoprotein VI (GPVI) mediates these platelet-activating effects. Notably, platelets from GPVI function–deficient patients do not exhibit binding of PS-modified oligonucleotides, and platelet activation is fully abolished. Our data demonstrate a novel, unexpected, PS backbone–dependent, platelet-activating effect of nucleotide-based drug candidates mediated by GPVI. This unforeseen effect should be considered in the ongoing development programs for the broad range of upcoming and promising DNA/RNA therapeutics. PMID:25646267

  14. A 7T Spine Array Based on Electric Dipole Transmitters

    PubMed Central

    Duan, Qi; Nair, Govind; Gudino, Natalia; de Zwart, Jacco A.; van Gelderen, Peter; Murphy-Boesch, Joe; Reich, Daniel S.; Duyn, Jeff H.; Merkle, Hellmut

    2015-01-01

    Purpose In this work the feasibility of using an array of electric dipole antennas for RF transmission in spine MRI at high field is explored. Method A 2-channel transmit array based on an electric dipole design was quantitatively optimized for 7T spine imaging and integrated with a receive array combining 8 loop coils. Using B1+ mapping, the transmit efficiency of the dipole array was compared to a design using quadrature loop pairs. The radio-frequency (RF) energy deposition for each array was measured using a home-built dielectric phantom and MR thermometry. The performance of the proposed array was qualitatively demonstrated in human studies. Results The results indicate dramatically improved transmit efficiency for the dipole design as compared to the loop excitation. Up to 76% gain was achieved within the spinal region. Conclusion For imaging of the spine, electric-dipole based transmitters provided an attractive alternative to the traditional loop-based design. Easy integration with existing receive array technology facilitates practical use at high field. PMID:26190585

  15. Insertional Mutagenesis by CRISPR/Cas9 Ribonucleoprotein Gene Editing in Cells Targeted for Point Mutation Repair Directed by Short Single-Stranded DNA Oligonucleotides.

    PubMed

    Rivera-Torres, Natalia; Banas, Kelly; Bialk, Pawel; Bloh, Kevin M; Kmiec, Eric B

    2017-01-01

    CRISPR/Cas9 and single-stranded DNA oligonucleotides (ssODNs) have been used to direct the repair of a single base mutation in human genes. Here, we examine a method designed to increase the precision of RNA guided genome editing in human cells by utilizing a CRISPR/Cas9 ribonucleoprotein (RNP) complex to initiate DNA cleavage. The RNP is assembled in vitro and induces a double stranded break at a specific site surrounding the mutant base designated for correction by the ssODN. We use an integrated mutant eGFP gene, bearing a single base change rendering the expressed protein nonfunctional, as a single copy target in HCT 116 cells. We observe significant gene correction activity of the mutant base, promoted by the RNP and single-stranded DNA oligonucleotide with validation through genotypic and phenotypic readout. We demonstrate that all individual components must be present to obtain successful gene editing. Importantly, we examine the genotype of individually sorted corrected and uncorrected clonally expanded cell populations for the mutagenic footprint left by the action of these gene editing tools. While the DNA sequence of the corrected population is exact with no adjacent sequence modification, the uncorrected population exhibits heterogeneous mutagenicity with a wide variety of deletions and insertions surrounding the target site. We designate this type of DNA aberration as on-site mutagenicity. Analyses of two clonal populations bearing specific DNA insertions surrounding the target site, indicate that point mutation repair has occurred at the level of the gene. The phenotype, however, is not rescued because a section of the single-stranded oligonucleotide has been inserted altering the reading frame and generating truncated proteins. These data illustrate the importance of analysing mutagenicity in uncorrected cells. Our results also form the basis of a simple model for point mutation repair directed by a short single-stranded DNA oligonucleotides and CRISPR/Cas9 ribonucleoprotein complex.

  16. Insertional Mutagenesis by CRISPR/Cas9 Ribonucleoprotein Gene Editing in Cells Targeted for Point Mutation Repair Directed by Short Single-Stranded DNA Oligonucleotides

    PubMed Central

    Rivera-Torres, Natalia; Bialk, Pawel; Bloh, Kevin M.; Kmiec, Eric B.

    2017-01-01

    CRISPR/Cas9 and single-stranded DNA oligonucleotides (ssODNs) have been used to direct the repair of a single base mutation in human genes. Here, we examine a method designed to increase the precision of RNA guided genome editing in human cells by utilizing a CRISPR/Cas9 ribonucleoprotein (RNP) complex to initiate DNA cleavage. The RNP is assembled in vitro and induces a double stranded break at a specific site surrounding the mutant base designated for correction by the ssODN. We use an integrated mutant eGFP gene, bearing a single base change rendering the expressed protein nonfunctional, as a single copy target in HCT 116 cells. We observe significant gene correction activity of the mutant base, promoted by the RNP and single-stranded DNA oligonucleotide with validation through genotypic and phenotypic readout. We demonstrate that all individual components must be present to obtain successful gene editing. Importantly, we examine the genotype of individually sorted corrected and uncorrected clonally expanded cell populations for the mutagenic footprint left by the action of these gene editing tools. While the DNA sequence of the corrected population is exact with no adjacent sequence modification, the uncorrected population exhibits heterogeneous mutagenicity with a wide variety of deletions and insertions surrounding the target site. We designate this type of DNA aberration as on-site mutagenicity. Analyses of two clonal populations bearing specific DNA insertions surrounding the target site, indicate that point mutation repair has occurred at the level of the gene. The phenotype, however, is not rescued because a section of the single-stranded oligonucleotide has been inserted altering the reading frame and generating truncated proteins. These data illustrate the importance of analysing mutagenicity in uncorrected cells. Our results also form the basis of a simple model for point mutation repair directed by a short single-stranded DNA oligonucleotides and CRISPR/Cas9 ribonucleoprotein complex. PMID:28052104

  17. Synthesis, physicochemical and biochemical studies of 1',2'-oxetane constrained adenosine and guanosine modified oligonucleotides, and their comparison with those of the corresponding cytidine and thymidine analogues.

    PubMed

    Pradeepkumar, Pushpangadan I; Cheruku, Pradeep; Plashkevych, Oleksandr; Acharya, Parag; Gohil, Suresh; Chattopadhyaya, Jyoti

    2004-09-22

    We have earlier reported the synthesis and antisense properties of the conformationally constrained oxetane-C and -T containing oligonucleotides, which have shown effective down-regulation of the proto-oncogene c-myb mRNA in the K562 human leukemia cells. Here we report on the straightforward syntheses of the oxetane-A and oxetane-G nucleosides as well as their incorporations into antisense oligonucleotides (AONs), and compare their structural and antisense properties with those of the T and C modified AONs (including the thermostability and RNase H recruitment capability of the AON/RNA hybrid duplex by Michaelis-Menten kinetic analyses, their resistance in the human serum, as well as in the presence of exo and endonucleases).

  18. Enzymatic production of 'monoclonal stoichiometric' single-stranded DNA oligonucleotides.

    PubMed

    Ducani, Cosimo; Kaul, Corinna; Moche, Martin; Shih, William M; Högberg, Björn

    2013-07-01

    Single-stranded oligonucleotides are important as research tools, as diagnostic probes, in gene therapy and in DNA nanotechnology. Oligonucleotides are typically produced via solid-phase synthesis, using polymer chemistries that are limited relative to what biological systems produce. The number of errors in synthetic DNA increases with oligonucleotide length, and the resulting diversity of sequences can be a problem. Here we present the 'monoclonal stoichiometric' (MOSIC) method for enzyme-mediated production of DNA oligonucleotides. We amplified oligonucleotides from clonal templates derived from single bacterial colonies and then digested cutter hairpins in the products, which released pools of oligonucleotides with precisely controlled relative stoichiometric ratios. We prepared 14-378-nucleotide MOSIC oligonucleotides either by in vitro rolling-circle amplification or by amplification of phagemid DNA in Escherichia coli. Analyses of the formation of a DNA crystal and folding of DNA nanostructures confirmed the scalability, purity and stoichiometry of the produced oligonucleotides.

  19. Enzymatic Production of Monoclonal Stoichiometric Single-Stranded DNA Oligonucleotides

    PubMed Central

    Ducani, Cosimo; Kaul, Corinna; Moche, Martin; Shih, William M.; Högberg, Björn

    2013-01-01

    Single-stranded oligonucleotides are important as research tools as probes for diagnostics and gene therapy. Today, production of oligonucleotides is done via solid-phase synthesis. However, the capabilities of current polymer chemistry are limited in comparison to what can be produced in biological systems. The errors in synthetic DNA increases with oligonucleotide length, and sequence diversity can often be a problem. Here, we present the Monoclonal Stoichiometric (MOSIC) method for enzymatic DNA oligonucleotide production. Using this method, we amplify oligonucleotides from clonal templates followed by digestion of a cutter-hairpin, resulting in pools of monoclonal oligonucleotides with precisely controlled relative stoichiometric ratios. We present data where MOSIC oligonucleotides, 14–378 nt long, were prepared either by in vitro rolling-circle amplification, or by amplification in Escherichia coli in the form of phagemid DNA. The formation of a DNA crystal and folding of DNA nanostructures confirmed the scalability, purity and stoichiometry of the produced oligonucleotides. PMID:23727986

  20. Proof of concept: preimplantation genetic screening without embryo biopsy through analysis of cell-free DNA in spent embryo culture media.

    PubMed

    Shamonki, Mousa I; Jin, Helen; Haimowitz, Zachary; Liu, Lian

    2016-11-01

    To assess whether preimplantation genetic screening (PGS) is possible by testing for free embryonic DNA in spent IVF media from embryos undergoing trophectoderm biopsy. Prospective cohort analysis. Academic fertility center. Seven patients undergoing IVF and 57 embryos undergoing trophectoderm biopsy for PGS. On day 3 of development, each embryo was placed in a separate media droplet. All biopsied embryos received a PGS result by array comparative genomic hybridization. Preimplantation genetic screening was performed on amplified DNA extracted from media and results were compared with PGS results for the corresponding biopsy. [1] Presence of DNA in spent IVF culture media. [2] Correlation between genetic screening result from spent media and corresponding biopsy. Fifty-five samples had detectable DNA ranging from 2-642 ng/μL after a 2-hour amplification. Six samples with the highest DNA levels underwent PGS, rendering one result with a derivative log ratio SD (DLRSD) of <0.85 (a quality control metric of oligonucleotide array comparative genomic hybridization). The fluid sample and trophectoderm results were identical demonstrating (45XY, -13). Three samples were reamplified 1 hour later and tested showing improving DLRSD. One of the three samples with a DLRSD of 0.85 demonstrated (46XY), consistent with the biopsy. Overnight DNA amplification showed DNA in all samples. We demonstrate two novel findings: the presence of free embryonic DNA in spent media and a result that is consistent with trophectoderm biopsy. Improvements in DNA collection, amplification, and testing may allow for PGS without biopsy in the future. Copyright © 2016 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

  1. Targeting the r(CGG) repeats that cause FXTAS with modularly assembled small molecules and oligonucleotides.

    PubMed

    Tran, Tuan; Childs-Disney, Jessica L; Liu, Biao; Guan, Lirui; Rzuczek, Suzanne; Disney, Matthew D

    2014-04-18

    We designed small molecules that bind the structure of the RNA that causes fragile X-associated tremor ataxia syndrome (FXTAS), an incurable neuromuscular disease. FXTAS is caused by an expanded r(CGG) repeat (r(CGG)(exp)) that inactivates a protein regulator of alternative pre-mRNA splicing. Our designed compounds modulate r(CGG)(exp) toxicity in cellular models of FXTAS, and pull-down experiments confirm that they bind r(CGG)(exp) in vivo. Importantly, compound binding does not affect translation of the downstream open reading frame (ORF). We compared molecular recognition properties of our optimal compound to oligonucleotides. Studies show that r(CGG)(exp)'s self-structure is a significant energetic barrier for oligonucleotide binding. A fully modified 2'-OMethyl phosphorothioate is incapable of completely reversing an FXTAS-associated splicing defect and inhibits translation of the downstream ORF, which could have deleterious effects. Taken together, these studies suggest that a small molecule that recognizes structure may be more well suited for targeting highly structured RNAs that require strand invasion by a complementary oligonucleotide.

  2. Targeting the r(CGG) Repeats That Cause FXTAS with Modularly Assembled Small Molecules and Oligonucleotides

    PubMed Central

    2015-01-01

    We designed small molecules that bind the structure of the RNA that causes fragile X-associated tremor ataxia syndrome (FXTAS), an incurable neuromuscular disease. FXTAS is caused by an expanded r(CGG) repeat (r(CGG)exp) that inactivates a protein regulator of alternative pre-mRNA splicing. Our designed compounds modulate r(CGG)exp toxicity in cellular models of FXTAS, and pull-down experiments confirm that they bind r(CGG)expin vivo. Importantly, compound binding does not affect translation of the downstream open reading frame (ORF). We compared molecular recognition properties of our optimal compound to oligonucleotides. Studies show that r(CGG)exp’s self-structure is a significant energetic barrier for oligonucleotide binding. A fully modified 2′-OMethyl phosphorothioate is incapable of completely reversing an FXTAS-associated splicing defect and inhibits translation of the downstream ORF, which could have deleterious effects. Taken together, these studies suggest that a small molecule that recognizes structure may be more well suited for targeting highly structured RNAs that require strand invasion by a complementary oligonucleotide. PMID:24506227

  3. Diamond cubic phase of monoolein and water as an amphiphilic matrix for electrophoresis of oligonucleotides.

    PubMed

    Carlsson, Nils; Winge, Ann-Sofie; Engström, Sven; Akerman, Björn

    2005-10-06

    We used a cubic liquid crystal formed by the nonionic monoglyceride monoolein and water as a porous matrix for the electrophoresis of oligonucleotides. The diamond cubic phase is thermodynamically stable when in contact with a water-rich phase, which we exploit to run the electrophoresis in the useful submarine mode. Oligonucleotides are separated according to size and secondary structure by migration through the space-filling aqueous nanometer pores of the regular liquid crystal, but the comparatively slow migration means the cubic phase will not be a replacement for the conventional DNA gels. However, our demonstration that the cubic phase can be used in submarine electrophoresis opens up the possibility for a new matrix for electrophoresis of amphiphilic molecules. From this perspective, the results on the oligonucleotides show that water-soluble particles of nanometer size, typical for the hydrophilic parts of membrane-bound proteins, may be a useful separation motif. A charged contamination in the commercial sample of monoolein, most likely oleic acid that arises from its hydrolysis, restricts useful buffer conditions to a pH below 5.6.

  4. TGF-beta antisense oligonucleotides reduce mRNA expression of matrix metalloproteinases in cultured wound-healing-related cells.

    PubMed

    Philipp, Katrin; Riedel, Frank; Germann, Günter; Hörmann, Karl; Sauerbier, Michael

    2005-02-01

    The pathology of chronic dermal ulcers is characterized by excessive proteolytic activity which degrades extracellular matrix. The transforming growth factor-beta (TGF-beta) has been identified as an important component of wound healing. Recent developments in molecular therapy offer exciting prospects for the modulation of wound healing, specifically those targeting TGF-beta. We investigated the effect of TGF-beta antisense oligonucleotides on the mRNA expression of matrix metalloproteinases in cultured human keratinocytes, fibroblasts and endothelial cells using multiplex RT-PCR. The treatment of keratinocytes and fibroblasts with TGF-beta antisense oligonucleotides resulted in a significant decrease of expression of mRNA of MMP-1 and MMP-9 compared to controls. Accordingly, a decreased expression of MMP-1 mRNA in endothelial cells was detectable. Other MMPs were not affected. Affecting all dermal wound-healing-related cell types, TGF-beta antisense oligonucleotide technology may be a potential therapeutic option for the inhibition of proteolytic tissue destruction in chronic wounds. Pharmaceutical intervention in this area ultimately may help clinicians to proactively intervene in an effort to prevent normal wounds from becoming chronic.

  5. Combined in vitro transcription and reverse transcription to amplify and label complex synthetic oligonucleotide probe libraries.

    PubMed

    Murgha, Yusuf; Beliveau, Brian; Semrau, Kassandra; Schwartz, Donald; Wu, Chao-Ting; Gulari, Erdogan; Rouillard, Jean-Marie

    2015-06-01

    Oligonucleotide microarrays allow the production of complex custom oligonucleotide libraries for nucleic acid detection-based applications such as fluorescence in situ hybridization (FISH). We have developed a PCR-free method to make single-stranded DNA (ssDNA) fluorescent probes through an intermediate RNA library. A double-stranded oligonucleotide library is amplified by transcription to create an RNA library. Next, dye- or hapten-conjugate primers are used to reverse transcribe the RNA to produce a dye-labeled cDNA library. Finally the RNA is hydrolyzed under alkaline conditions to obtain the single-stranded fluorescent probes library. Starting from unique oligonucleotide library constructs, we present two methods to produce single-stranded probe libraries. The two methods differ in the type of reverse transcription (RT) primer, the incorporation of fluorescent dye, and the purification of fluorescent probes. The first method employs dye-labeled reverse transcription primers to produce multiple differentially single-labeled probe subsets from one microarray library. The fluorescent probes are purified from excess primers by oligonucleotide-bead capture. The second method uses an RNA:DNA chimeric primer and amino-modified nucleotides to produce amino-allyl probes. The excess primers and RNA are hydrolyzed under alkaline conditions, followed by probe purification and labeling with amino-reactive dyes. The fluorescent probes created by the combination of transcription and reverse transcription can be used for FISH and to detect any RNA and DNA targets via hybridization.

  6. Miniaturized multiplex label-free electronic chip for rapid nucleic acid analysis based on carbon nanotube nanoelectrode arrays

    NASA Technical Reports Server (NTRS)

    Koehne, Jessica E.; Chen, Hua; Cassell, Alan M.; Ye, Qi; Han, Jie; Meyyappan, Meyya; Li, Jun

    2004-01-01

    BACKGROUND: Reducing cost and time is the major concern in clinical diagnostics, particularly in molecular diagnostics. Miniaturization technologies have been recognized as promising solutions to provide low-cost microchips for diagnostics. With the recent advancement in nanotechnologies, it is possible to further improve detection sensitivity and simplify sample preparation by incorporating nanoscale elements in diagnostics devices. A fusion of micro- and nanotechnologies with biology has great potential for the development of low-cost disposable chips for rapid molecular analysis that can be carried out with simple handheld devices. APPROACH: Vertically aligned multiwalled carbon nanotubes (MWNTs) are fabricated on predeposited microelectrode pads and encapsulated in SiO2 dielectrics with only the very end exposed at the surface to form an inlaid nanoelectrode array (NEA). The NEA is used to collect the electrochemical signal associated with the target molecules binding to the probe molecules, which are covalently attached to the end of the MWNTs. CONTENT: A 3 x 3 microelectrode array is presented to demonstrate the miniaturization and multiplexing capability. A randomly distributed MWNT NEA is fabricated on each microelectrode pad. Selective functionalization of the MWNT end with a specific oligonucleotide probe and passivation of the SiO2 surface with ethylene glycol moieties are discussed. Ru(bpy)2+ -mediator-amplified guanine oxidation is used to directly measure the electrochemical signal associated with target molecules. SUMMARY: The discussed MWNT NEAs have ultrahigh sensitivity in direct electrochemical detection of guanine bases in the nucleic acid target. Fewer than approximately 1000 target nucleic acid molecules can be measured with a single microelectrode pad of approximately 20 x 20 microm2, which approaches the detection limit of laser scanners in fluorescence-based DNA microarray techniques. MWNT NEAs can be easily integrated with microelectronic circuitry and microfluidics for development of a fully automated system for rapid molecular analysis with minimum cost.

  7. Regulation of Gene Editing Activity Directed by Single-Stranded Oligonucleotides and CRISPR/Cas9 Systems

    PubMed Central

    Bialk, Pawel; Rivera-Torres, Natalia; Strouse, Bryan; Kmiec, Eric B.

    2015-01-01

    Single-stranded DNA oligonucleotides (ssODNs) can direct the repair of a single base mutation in human genes. While the regulation of this gene editing reaction has been partially elucidated, the low frequency with which repair occurs has hampered development toward clinical application. In this work a CRISPR/Cas9 complex is employed to induce double strand DNA breakage at specific sites surrounding the nucleotide designated for exchange. The result is a significant elevation in ssODN-directed gene repair, validated by a phenotypic readout. By analysing reaction parameters, we have uncovered restrictions on gene editing activity involving CRISPR/Cas9 complexes. First, ssODNs that hybridize to the non-transcribed strand direct a higher level of gene repair than those that hybridize to the transcribed strand. Second, cleavage must be proximal to the targeted mutant base to enable higher levels of gene editing. Third, DNA cleavage enables a higher level of gene editing activity as compared to single-stranded DNA nicks, created by modified Cas9 (Nickases). Fourth, we calculated the hybridization potential and free energy levels of ssODNs that are complementary to the guide RNA sequences of CRISPRs used in this study. We find a correlation between free energy potential and the capacity of single-stranded oligonucleotides to inhibit specific DNA cleavage activity, thereby indirectly reducing gene editing activity. Our data provide novel information that might be taken into consideration in the design and usage of CRISPR/Cas9 systems with ssODNs for gene editing. PMID:26053390

  8. Regulation of Gene Editing Activity Directed by Single-Stranded Oligonucleotides and CRISPR/Cas9 Systems.

    PubMed

    Bialk, Pawel; Rivera-Torres, Natalia; Strouse, Bryan; Kmiec, Eric B

    2015-01-01

    Single-stranded DNA oligonucleotides (ssODNs) can direct the repair of a single base mutation in human genes. While the regulation of this gene editing reaction has been partially elucidated, the low frequency with which repair occurs has hampered development toward clinical application. In this work a CRISPR/Cas9 complex is employed to induce double strand DNA breakage at specific sites surrounding the nucleotide designated for exchange. The result is a significant elevation in ssODN-directed gene repair, validated by a phenotypic readout. By analysing reaction parameters, we have uncovered restrictions on gene editing activity involving CRISPR/Cas9 complexes. First, ssODNs that hybridize to the non-transcribed strand direct a higher level of gene repair than those that hybridize to the transcribed strand. Second, cleavage must be proximal to the targeted mutant base to enable higher levels of gene editing. Third, DNA cleavage enables a higher level of gene editing activity as compared to single-stranded DNA nicks, created by modified Cas9 (Nickases). Fourth, we calculated the hybridization potential and free energy levels of ssODNs that are complementary to the guide RNA sequences of CRISPRs used in this study. We find a correlation between free energy potential and the capacity of single-stranded oligonucleotides to inhibit specific DNA cleavage activity, thereby indirectly reducing gene editing activity. Our data provide novel information that might be taken into consideration in the design and usage of CRISPR/Cas9 systems with ssODNs for gene editing.

  9. Specific DNA duplex formation at an artificial lipid bilayer: towards a new DNA biosensor technology.

    PubMed

    Werz, Emma; Korneev, Sergei; Montilla-Martinez, Malayko; Wagner, Richard; Hemmler, Roland; Walter, Claudius; Eisfeld, Jörg; Gall, Karsten; Rosemeyer, Helmut

    2012-02-01

    A novel technique is described which comprises a base-specific DNA duplex formation at a lipid bilayer-H(2) O-phase boundary layer. Two different probes of oligonucleotides both carrying a double-tailed lipid at the 5'-terminus were incorporated into stable artificial lipid bilayers separating two compartments (cis/trans-channel) of an optically transparent microfluidic sample carrier with perfusion capabilities. Both the cis- and trans-channels are filled with saline buffer. Injection of a cyanine-5-labeled target DNA sequence, which is complementary to only one of the oligonucleotide probes, into the cis-channel, followed by a thorough perfusion, leads to an immobilization of the labeled complementary oligonucleotide on the membrane as detected by single-molecule fluorescence spectroscopy and microscopy. In the case of fluorescent but non-complementary DNA sequences, no immobilized fluorescent oligonucleotide duplex could be detected on the membrane. This clearly verifies a specific duplex formation at the membrane interface. Copyright © 2012 Verlag Helvetica Chimica Acta AG, Zürich.

  10. Therapeutic Antisense Oligonucleotides against Cancer: Hurdling to the Clinic

    NASA Astrophysics Data System (ADS)

    Moreno, Pedro; Pêgo, Ana

    2014-10-01

    Under clinical development since the early 90’s and with two successfully approved drugs (Fomivirsen and Mipomersen), oligonucleotide-based therapeutics have not yet delivered a clinical drug to the market in the cancer field. Whilst many pre-clinical data has been generated, a lack of understanding still exists on how to efficiently tackle all the different challenges presented for cancer targeting in a clinical setting. Namely, effective drug vectorization, careful choice of target gene or synergistic multi-gene targeting are surely decisive, while caution must be exerted to avoid potential toxic, often misleading off-target-effects. Here a brief overview will be given on the nucleic acid chemistry advances that established oligonucleotide technologies as a promising therapeutic alternative and ongoing cancer related clinical trials. Special attention will be given towards a perspective on the hurdles encountered specifically in the cancer field by this class of therapeutic oligonucleotides and a view on possible avenues for success is presented, with particular focus on the contribution from nanotechnology to the field.

  11. Therapeutic antisense oligonucleotides against cancer: hurdling to the clinic

    PubMed Central

    Moreno, Pedro M. D.; Pêgo, Ana P.

    2014-01-01

    Under clinical development since the early 90's and with two successfully approved drugs (Fomivirsen and Mipomersen), oligonucleotide-based therapeutics has not yet delivered a clinical drug to the market in the cancer field. Whilst many pre-clinical data has been generated, a lack of understanding still exists on how to efficiently tackle all the different challenges presented for cancer targeting in a clinical setting. Namely, effective drug vectorization, careful choice of target gene or synergistic multi-gene targeting are surely decisive, while caution must be exerted to avoid potential toxic, often misleading off-target-effects. Here a brief overview will be given on the nucleic acid chemistry advances that established oligonucleotide technologies as a promising therapeutic alternative and ongoing cancer related clinical trials. Special attention will be given toward a perspective on the hurdles encountered specifically in the cancer field by this class of therapeutic oligonucleotides and a view on possible avenues for success is presented, with particular focus on the contribution from nanotechnology to the field. PMID:25353019

  12. Syntheses of prodrug-type phosphotriester oligonucleotides responsive to intracellular reducing environment for improvement of cell membrane permeability and nuclease resistance.

    PubMed

    Hayashi, Junsuke; Samezawa, Yusuke; Ochi, Yosuke; Wada, Shun-Ichi; Urata, Hidehito

    2017-07-15

    We synthesized prodrug-type phosphotriester (PTE) oligonucleotides containing the six-membered cyclic disulfide moiety by using phosphoramidite chemistry. Prodrug-type oligonucleotides named "Reducing-Environment-Dependent Uncatalyzed Chemical Transforming (REDUCT) PTE oligonucleotides" were converted into natural oligonucleotides under cytosol-mimetic reductive condition. Furthermore, the REDUCT PTE oligonucleotides were robust to nuclease digestion and exhibited good cell membrane permeability. Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. Ultrasensitive sliver nanorods array SERS sensor for mercury ions.

    PubMed

    Song, Chunyuan; Yang, Boyue; Zhu, Yu; Yang, Yanjun; Wang, Lianhui

    2017-01-15

    With years of outrageous mercury emissions, there is an urgent need to develop convenient and sensitive methods for detecting mercury ions in response to increasingly serious mercury pollution in water. In the present work, a portable, ultrasensitive SERS sensor is proposed and utilized for detecting trace mercury ions in water. The SERS sensor is prepared on an excellent sliver nanorods array SERS substrate by immobilizing T-component oligonucleotide probes labeled with dye on the 3'-end and -SH on the 5'-end. The SERS sensor responses to the specific chemical bonding between thymine and mercury ions, which causes the previous flexible single strand of oligonucleotide probe changing into rigid and upright double chain structure. Such change in the structure drives the dyes far away from the excellent SERS substrate and results in a SERS signal attenuation of the dye. Therefore, by monitoring the decay of SERS signal of the dye, mercury ions in water can be detected qualitatively and quantitatively. The experimental results indicate that the proposed optimal SERS sensor owns a linear response with wide detecting range from 1pM to 1μM, and a detection limit of 0.16pM is obtained. In addition, the SERS sensor demonstrates good specificity for Hg 2+ , which can accurately identify trace mercury ions from a mixture of ten kinds of other ions. The SERS sensor has been further executed to analyze the trace mercury ions in tap water and lake water respectively, and good recovery rates are obtained for sensing both kinds of water. With its high selectivity and good portability, the ultrasensitive SERS sensor is expected to be a promising candidate for discriminating mercury ions in the fields of environmental monitoring and food safety. Copyright © 2016 Elsevier B.V. All rights reserved.

  14. What controls the hybridization thermodynamics of spherical nucleic acids?

    PubMed

    Randeria, Pratik S; Jones, Matthew R; Kohlstedt, Kevin L; Banga, Resham J; Olvera de la Cruz, Monica; Schatz, George C; Mirkin, Chad A

    2015-03-18

    The hybridization of free oligonucleotides to densely packed, oriented arrays of DNA modifying the surfaces of spherical nucleic acid (SNA)-gold nanoparticle conjugates occurs with negative cooperativity; i.e., each binding event destabilizes subsequent binding events. DNA hybridization is thus an ever-changing function of the number of strands already hybridized to the particle. Thermodynamic quantification of this behavior reveals a 3 orders of magnitude decrease in the binding constant for the capture of a free oligonucleotide by an SNA conjugate as the fraction of pre-hybridized strands increases from 0 to ∼30%. Increasing the number of pre-hybridized strands imparts an increasing enthalpic penalty to hybridization that makes binding more difficult, while simultaneously decreasing the entropic penalty to hybridization, which makes binding more favorable. Hybridization of free DNA to an SNA is thus governed by both an electrostatic barrier as the SNA accumulates charge with additional binding events and an effect consistent with allostery, where hybridization at certain sites on an SNA modify the binding affinity at a distal site through conformational changes to the remaining single strands. Leveraging these insights allows for the design of conjugates that hybridize free strands with significantly higher efficiencies, some of which approach 100%.

  15. Identification of differentially regulated transcripts in mouse striatum following methamphetamine treatment--an oligonucleotide microarray approach.

    PubMed

    Thomas, David M; Francescutti-Verbeem, Dina M; Liu, Xiuli; Kuhn, Donald M

    2004-01-01

    Methamphetamine is an addictive drug of abuse that can produce neurotoxic effects in dopamine nerve endings of the striatum. The purpose of this study was to identify new genes that may play a role in the highly complex cascade of events associated with methamphetamine intoxication. Using Affymetrix oligonucleotide arrays, 12 488 genes were simultaneously interrogated and there were 152 whose expression levels were changed following methamphetamine treatment. The genes are grouped into broad functional categories with inflammatory/immune response elements, receptor/signal transduction components and ion channel/transport proteins among the most populated. Many genes within these categories can be linked to ion regulation and apoptosis, both of which have been implicated in methamphetamine toxicity, and numerous factors associated with microglial activation emerged with significant changes in expression. For example, brain-derived neurotrophic factor (BDNF), chemokine (C-C) receptor 6 (CCr6) and numerous chemokine transcripts were increased or decreased in expression more than 2.8-fold. These results point to activated microglia as a potential source of the reactive oxygen/nitrogen species and cytokines that have been previously associated with methamphetamine toxicity and other neurotoxic conditions.

  16. Static magnetic field reduced exogenous oligonucleotide uptake by spermatozoa using magnetic nanoparticle gene delivery system

    NASA Astrophysics Data System (ADS)

    Katebi, Samira; Esmaeili, Abolghasem; Ghaedi, Kamran

    2016-03-01

    Spermatozoa could introduce exogenous oligonucleotides of interest to the oocyte. The most important reason of low efficiency of sperm mediated gene transfer (SMGT) is low uptake of exogenous DNA by spermatozoa. The aim of this study was to evaluate the effects of static magnetic field on exogenous oligonucleotide uptake of spermatozoa using magnetofection method. Magnetic nanoparticles (MNPs) associated with the labeled oligonucleotides were used to increase the efficiency of exogenous oligonucleotide uptake by rooster spermatozoa. We used high-field/high-gradient magnet (NdFeB) to enhance and accelerate exogenous DNA sedimentation at the spermatozoa surface. Flow cytometry analysis was performed to measure viability and percentage of exogenous oligonucleotide uptake by sperm. Flow cytometry analysis showed a significant increase in exogenous oligonucleotide uptake by rooster spermatozoa (P<0.001) when spermatozoa were incubated in exogenous oligonucleotide solution and MNPs. However, by applying static magnetic field during magnetofection method, a significant decrease in exogenous oligonucleotide uptake was observed (P<0.05). Findings of this study showed that MNPs were effective to increase exogenous oligonucleotide uptake by rooster spermatozoa; however unlike others studies, static magnetic field, was not only ineffective to enhance exogenous oligonucleotide uptake by rooster spermatozoa but also led to reduction in efficiency of magnetic nanoparticles in gene transfer.

  17. "Spoligoriftyping," a dual-priming-oligonucleotide-based direct-hybridization assay for tuberculosis control with a multianalyte microbead-based hybridization system.

    PubMed

    Gomgnimbou, Michel Kiréopori; Abadia, Edgar; Zhang, Jian; Refrégier, Guislaine; Panaiotov, Stefan; Bachiyska, Elizabeta; Sola, Christophe

    2012-10-01

    We developed "spoligoriftyping," a 53-plex assay based on two preexisting methods, the spoligotyping and "rifoligotyping" assays, by combining them into a single assay. Spoligoriftyping allows simultaneous spoligotyping (i.e., clustered regularly interspaced short palindromic repeat [CRISPR]-based genotyping) and characterization of the main rifampin drug resistance mutations on the rpoB hot spot region in a few hours. This test partly uses the dual-priming-oligonucleotide (DPO) principle, which allows simultaneous efficient amplifications of rpoB and the CRISPR locus in the same sample. We tested this method on a set of 114 previously phenotypically and genotypically characterized multidrug-resistant (MDR) Mycobacterium tuberculosis or drug-susceptible M. tuberculosis DNA extracted from clinical isolates obtained from patients from Bulgaria, Nigeria, and Germany. We showed that our method is 100% concordant with rpoB sequencing results and 99.95% (3,911/3,913 spoligotype data points) correlated with classical spoligotyping results. The sensitivity and specificity of our assay were 99 and 100%, respectively, compared to those of phenotypic drug susceptibility testing. Such assays pave the way to the implementation of locally and specifically adapted methods of performing in a single tube both drug resistance mutation detection and genotyping in a few hours.

  18. Detection of Non-Nucleic Acid Targets with an Unmodified Aptamer and a Fluorogenic Competitor

    PubMed Central

    Li, Na

    2010-01-01

    Aptamers are oligonucleotides that can bind to various non-nucleic acid targets, ranging from proteins to small molecules, with a specificity and affinity comparable to that of antibodies. Most aptamer-based detection strategies require modification on the aptamer, which could lead to a significant loss in its affinity and specificity to the target. Here we reported a generic strategy to design aptamer-based optical probes. An unmodified aptamer specific to the target and a fluorogenic competitor complementary to the aptamer are utilized for target recognition and signal generation, respectively. The competitor is a hairpin oligonucleotide with a fluorophore attached on one end and a quencher attached on the other. When no target is present, the competitor binds to the aptamer. However, when the target is introduced, the competitor will be displaced from the aptamer by the target, thus resulting in a target-specific decrease in fluorescence signal. Successful application of this strategy to different types of targets (small molecules and proteins) as well as different types of aptamers (DNA and RNA) has been demonstrated. Furthermore, a thermodynamics-based prediction model was established to further rationalize the optimization process. Due to its rapidness and simplicity, this aptamer-based detection strategy holds great promise in high throughput applications. PMID:20563298

  19. Liver as a target for oligonucleotide therapeutics.

    PubMed

    Sehgal, Alfica; Vaishnaw, Akshay; Fitzgerald, Kevin

    2013-12-01

    Oligonucleotide-based therapeutics are an emerging class of drugs that hold the promise for silencing "un-druggable" targets,thus creating unique opportunities for innovative medicines. As opposed to gene therapy, oligonucleotides are considered to be more akin to small molecule therapeutics because they are small,completely synthetic in origin, do not integrate into the host genome,and have a defined duration of therapeutic activity after which effects recover to baseline. They offer a high degree of specificity at the genetic level, thereby reducing off-target effects.At the same time, they provide a strategy for targeting any gene in the genome, including transcripts that produce mutated proteins.Oligonucleotide-based therapeutics include short interfering RNA (siRNA), that degrade target mRNA through RISC mediated RNAi; anti-miRs, that target miRNAs; miRNA mimics, that regulate target mRNA; antisense oligonucleotides, that may be working through RNAseH mediated mRNA decay; mRNA upregulation,by targeting long non-coding RNAs; and oligonucleotides induced alternative splicing [1]. All these approaches require some minimal degree of homology at the nucleic acid sequence level for them to be functional. The different mechanisms of action and their relevant activity are outlined in Fig. 1. Besides homology,RNA secondary structure has also been exploited in the case of ribozymes and aptamers, which act by binding to nucleic acids or proteins, respectively. While there have been many reports of gene knockdown and gene modulation in cell lines and mice with all these methods, very few have advanced to clinical stages.The main obstacle to date has been the safe and effective intracellular delivery of these compounds in higher species, including humans. Indeed, their action requires direct interaction with DNA/RNA within the target cell so even when one solves the issues of tissue and cellular access, intracellular/intranuclear location represents yet another barrier to overcome. To date,hepatic delivery of oligonucleotides has been the area with greatest progress, and thus we have focused on liver-targeted therapeutics that have shown promise at the preclinical and/or clinical level.The liver is the largest internal organ in the body, playing a central role in metabolism, detoxification, synthesis, and secretion of major plasma proteins (carrier proteins, coagulation factors,complement components, hormones, and apolipoproteins),and iron homeostasis. It is therefore not surprising that a large number of disease targets reside in the liver where they are susceptible to modulation by oligonucleotide therapies.

  20. Selection of optimal oligonucleotide probes for microarrays usingmultiple criteria, global alignment and parameter estimation.

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Li, Xingyuan; He, Zhili; Zhou, Jizhong

    2005-10-30

    The oligonucleotide specificity for microarray hybridizationcan be predicted by its sequence identity to non-targets, continuousstretch to non-targets, and/or binding free energy to non-targets. Mostcurrently available programs only use one or two of these criteria, whichmay choose 'false' specific oligonucleotides or miss 'true' optimalprobes in a considerable proportion. We have developed a software tool,called CommOligo using new algorithms and all three criteria forselection of optimal oligonucleotide probes. A series of filters,including sequence identity, free energy, continuous stretch, GC content,self-annealing, distance to the 3'-untranslated region (3'-UTR) andmelting temperature (Tm), are used to check each possibleoligonucleotide. A sequence identity is calculated based onmore » gapped globalalignments. A traversal algorithm is used to generate alignments for freeenergy calculation. The optimal Tm interval is determined based on probecandidates that have passed all other filters. Final probes are pickedusing a combination of user-configurable piece-wise linear functions andan iterative process. The thresholds for identity, stretch and freeenergy filters are automatically determined from experimental data by anaccessory software tool, CommOligo_PE (CommOligo Parameter Estimator).The program was used to design probes for both whole-genome and highlyhomologous sequence data. CommOligo and CommOligo_PE are freely availableto academic users upon request.« less

  1. Size-uniform 200 nm particles: fabrication and application to magnetofection.

    PubMed

    Mair, Lamar; Ford, Kris; Alam, M d Rowshon; Kole, Ryszard; Fisher, Michael; Superfine, Richard

    2009-04-01

    We report on the fabrication of arrays of mono- and multimetallic particles via metal evaporation onto lithographically patterned posts, as well as the magnetic force calibration and successful magnetofection of iron particles grown via this method. This work represents the first instance in which metal evaporation onto post structures was used for the formation of released, shape-defined metal particles. Also, our work represents the first use of lithographically defined particles as agents of magnetofection. Using these techniques it is possible to create particles with complex shapes and lateral dimensions as small as 40 nm. Our demonstrated compositionally flexible particles are highly size-uniform due to their photolithographically defined growth substrates, with particle dimensions along two axes fixed at 200 nm; the third axis dimension can be varied from 20 nm to 300 nm during the deposition procedure. Atomic percent of metals incorporated into the particle volume is highly tunable and particles have been synthesized with as many as four different metals. We performed magnetic force calibrations on a single particle size for iron particles using an axially magnetized NeFeB permanent magnet and comparisons are made with commercially available magnetic beads. In order to evalutate their usefulness as magnetofection agents, an antisense oligonucleotide (ODN) designed to correct the aberrant splicing of enhanced green fluorescent protein mRNA, was successfully transfected into a modified HeLa cell line. Magnetically enhanced gene delivery was accomplished in vitro using antisense ODN-laden iron particles followed by application of a field gradient. Magnetically enhanced transfection resulted in a 76% and 139% increase in fluorescence intensity when compared to Lipofectamine and antisense ODN-loaded particles delivered without magnetic treatment, respectively. To our knowledge, these experiments constitute the first use of lithographically defined particles as successful agents for magnetically enhanced transfection of an antisense oligonucleotide.

  2. Fast and automated DNA assays on a compact disc (CD)-based microfluidic platform

    NASA Astrophysics Data System (ADS)

    Jia, Guangyao

    Nucleic acid-based molecular diagnostics offers enormous potential for the rapid and accurate diagnosis of infectious diseases. However, most of the existing commercial tests are time-consuming and technically complicated, and are thus incompatible with the need for rapid identification of infectious agents. We have successfully developed a CD-based microfluidic platform for fast and automated DNA array hybridization and a low cost, disposable plastic microfluidic platform for polymerase chain reaction (PCR). These platforms have proved to be a promising approach to meet the requirements in terms of detection speed and operational convenience in diagnosis of infectious diseases. In the CD-based microfluidic platform for DNA hybridization, convection is introduced to the system to enhance mass transport so as to accelerate the hybridization rate since DNA hybridization is a diffusion limited reaction. Centrifugal force is utilized for sample propulsion and surface force is used for liquid gating. Standard microscope glass slides are used as the substrates for capture probes owing to their compatibility with commercially available instrumentation (e.g. laser scanners) for detection. Microfabricated polydimethylsiloxane (PDMS) structures are used to accomplish the fluidic functions required by the protocols for DNA hybridization. The assembly of the PDMS structure and the glass slide forms a flow-through hybridization unit that can be accommodated onto the CD platform for reagent manipulation. The above scheme has been validated with oligonucleotides as the targets using commercially available enzyme-labeled fluorescence (ELF 97) for detection of the hybridization events, and tested with amplicons of genomic staphylococcus DNA labeled with Cy dye. In both experiments, significantly higher fluorescence intensities were observed in the flow-through hybridization unit compared to the passive assays. The CD fluidic scheme was also adapted to the immobilization of thiolated oligonucleotides on gold surfaces and up to a 2.5 fold increase was observed for the rate of adsorption compared to passive immobilization. In order to reduce the reaction time for DNA amplification, a miniaturized fluidic platform was developed for rapid polymerase chain reaction (PCR). Commercially available, adhesive-coated aluminum foils and polypropylene films were laminated to structured polycarbonate films forming micro reactors in a card format. Ice valves were employed to seal the reaction chambers during thermal cycling and a Peltier-based thermal cycler was configured for rapid thermal cycling and ice valve actuation. Numerical modeling was conducted to optimize the design of the PCR reactor and explore the thermal gradient in the reaction chamber in the direction of sample depth. The PCR reactor was experimentally characterized by using thin foil thermocouples and validated by a successful amplification of 10 genome copies of E. coli ATCC 35401 tuf gene in 27 minutes. In the future, we will integrate sample preparation, PCR amplification and DNA detection into a single, centrifugal microfluidic disc that is practically affordable for molecular diagnostics.

  3. Blackbody infrared radiative dissociation of oligonucleotide anions.

    PubMed

    Klassen, J S; Schnier, P D; Williams, E R

    1998-11-01

    The dissociation kinetics of a series of doubly deprotonated oligonucleotide 7-mers [d(A)7(2-), d(AATTAAT)2-, d(TTAATTA)2-, and d(CCGGCCG)2-] were measured using blackbody infrared radiative dissociation in a Fourier-transform mass spectrometer. The oligonucleotides dissociate first by cleavage at the glycosidic bond leading to the loss of a neutral nucleobase, followed by cleavage at the adjacent (5') phosphodiester bond to produce structurally informative a-base and w type ions. From the temperature dependence of the unimolecular dissociation rate constants, Arrhenius activation parameters in the zero-pressure limit are obtained for the loss of base. The measured Arrhenius parameters are dependent on the identity of the nucleobase. The process involving the loss of an adenine base from the dianions, d(A)7(2-), d(AATTAAT)2-, and d(TTAATTA)2- has an average activation energy (Ea) of approximately 1.0 eV and a preexponential factor (A) of 10(10) s-1. Both guanine and cytosine base loss occurs for d(CCGGCCG)2-. The average Arrhenius parameters for the loss of cytosine and guanine are Ea = 1.32 +/- 0.03 eV and A = 10(13.3 +/- 0.3) s-1. No loss of thymine was observed for mixed adenine-thymine oligonucleotides. Neither base loss nor any other fragmentation reactions occur for d(T)7(2-) over a 600 s reaction delay at 207 degrees C, a temperature close to the upper limit accessible with our instrument. The Arrhenius parameters indicate that the preferred cleavage sites for mixed oligonucleotides of similar mass-to-charge ratio will be strongly dependent on the internal energy of the precursor ions. At low internal energies (effective temperatures below 475 K), loss of adenine and subsequent cleavage of the adjacent phosphoester bonds will dominate, whereas at higher energies, preferential cleavage at C and G residues will occur. The magnitude of the A factors < or = 10(13) s-1 measured for the loss of the three nucleobases (A, G, and C) is indicative of an entropically neutral or disfavored process as the rate limiting step for this reaction.

  4. Blackbody Infrared Radiative Dissociation of Oligonucleotide Anions

    PubMed Central

    Klassen, John S.; Schnier, Paul D.; Williams, Evan R.

    2005-01-01

    The dissociation kinetics of a series of doubly deprotonated oligonucleotide 7-mers [ d(A)72-, d(AATTAAT)2−, d(TTAATTA)2−, and d(CCGGCCG)2−] were measured using blackbody infrared radiative dissociation in a Fourier-transform mass spectrometer. The oligonucleotides dissociate first by cleavage at the glycosidic bond leading to the loss of a neutral nucleobase, followed by cleavage at the adjacent (5′) phosphodiester bond to produce structurally informative a-base and w type ions. From the temperature dependence of the unimolecular dissociation rate constants, Arrhenius activation parameters in the zero-pressure limit are obtained for the loss of base. The measured Arrhenius parameters are dependent on the identity of the nucleobase. The process involving the loss of an adenine base from the dianions, d(A)72-, d(AATTAAT)2−, and d(TTAATTA)2− has an average activation energy (Ea) of ~1.0 eV and a preexponential factor (A) of 1010 s−1. Both guanine and cytosine base loss occurs for d(CCGGCCG)2−. The average Arrhenius parameters for the loss of cytosine and guanine are Ea = 1.32 ± 0.03 eV and A = 1013.3±0.3 s−1. No loss of thymine was observed for mixed adenine–thymine oligonucleotides. Neither base loss nor any other fragmentation reactions occur for d(T)72- over a 600 s reaction delay at 207 °C, a temperature close to the upper limit accessible with our instrument. The Arrhenius parameters indicate that the preferred cleavage sites for mixed oligonucleotides of similar mass-to-charge ratio will be strongly dependent on the internal energy of the precursor ions. At low internal energies (effective temperatures below 475 K), loss of adenine and subsequent cleavage of the adjacent phosphoester bonds will dominate, whereas at higher energies, preferential cleavage at C and G residues will occur. The magnitude of the A factors ≤1013 s−1 measured for the loss of the three nucleobases (A, G, and C) is indicative of an entropically neutral or disfavored process as the rate limiting step for this reaction. PMID:9794082

  5. A 7T spine array based on electric dipole transmitters.

    PubMed

    Duan, Qi; Nair, Govind; Gudino, Natalia; de Zwart, Jacco A; van Gelderen, Peter; Murphy-Boesch, Joe; Reich, Daniel S; Duyn, Jeff H; Merkle, Hellmut

    2015-10-01

    The goal of this study was to explore the feasibility of using an array of electric dipole antennas for RF transmission in spine MRI at high fields. A two-channel transmit array based on an electric dipole design was quantitatively optimized for 7T spine imaging and integrated with a receive array combining eight loop coils. Using B1+ mapping, the transmit efficiency of the dipole array was compared with a design using quadrature loop pairs. The radiofrequency energy deposition for each array was measured using a home-built dielectric phantom and MR thermometry. The performance of the proposed array was qualitatively demonstrated in human studies. The results indicate dramatically improved transmit efficiency for the dipole design compared with the loop excitation. A gain of up to 76% was achieved within the spinal region. For imaging of the spine, electric dipole-based transmitters provide an attractive alternative to the traditional loop-based design. Easy integration with existing receive array technology facilitates practical use at high fields. Published 2015. This article is a U.S. Government work and is in the public domain in the USA.

  6. [Oligonucleotide microarray for subtyping avian influenza virus].

    PubMed

    Xueqing, Han; Xiangmei, Lin; Yihong, Hou; Shaoqiang, Wu; Jian, Liu; Lin, Mei; Guangle, Jia; Zexiao, Yang

    2008-09-01

    Avian influenza viruses are important human and animal respiratory pathogens and rapid diagnosis of novel emerging avian influenza viruses is vital for effective global influenza surveillance. We developed an oligonucleotide microarray-based method for subtyping all avian influenza virus (16 HA and 9 NA subtypes). In total 25 pairs of primers specific for different subtypes and 1 pair of universal primers were carefully designed based on the genomic sequences of influenza A viruses retrieved from GenBank database. Several multiplex RT-PCR methods were then developed, and the target cDNAs of 25 subtype viruses were amplified by RT-PCR or overlapping PCR for evaluating the microarray. Further 52 oligonucleotide probes specific for all 25 subtype viruses were designed according to published gene sequences of avian influenza viruses in amplified target cDNAs domains, and a microarray for subtyping influenza A virus was developed. Then its specificity and sensitivity were validated by using different subtype strains and 2653 samples from 49 different areas. The results showed that all the subtypes of influenza virus could be identified simultaneously on this microarray with high sensitivity, which could reach to 2.47 pfu/mL virus or 2.5 ng target DNA. Furthermore, there was no cross reaction with other avian respiratory virus. An oligonucleotide microarray-based strategy for detection of avian influenza viruses has been developed. Such a diagnostic microarray will be useful in discovering and identifying all subtypes of avian influenza virus.

  7. Specific interaction of mutant p53 with regions of matrix attachment region DNA elements (MARs) with a high potential for base-unpairing

    PubMed Central

    Will, Katrin; Warnecke, Gabriele; Wiesmüller, Lisa; Deppert, Wolfgang

    1998-01-01

    Mutant, but not wild-type p53 binds with high affinity to a variety of MAR-DNA elements (MARs), suggesting that MAR-binding of mutant p53 relates to the dominant-oncogenic activities proposed for mutant p53. MARs recognized by mutant p53 share AT richness and contain variations of an AATATATTT “DNA-unwinding motif,” which enhances the structural dynamics of chromatin and promotes regional DNA base-unpairing. Mutant p53 specifically interacted with MAR-derived oligonucleotides carrying such unwinding motifs, catalyzing DNA strand separation when this motif was located within a structurally labile sequence environment. Addition of GC-clamps to the respective MAR-oligonucleotides or introducing mutations into the unwinding motif strongly reduced DNA strand separation, but supported the formation of tight complexes between mutant p53 and such oligonucleotides. We conclude that the specific interaction of mutant p53 with regions of MAR-DNA with a high potential for base-unpairing provides the basis for the high-affinity binding of mutant p53 to MAR-DNA. PMID:9811860

  8. Specific Discrimination of Three Pathogenic Salmonella enterica subsp. enterica Serotypes by carB-Based Oligonucleotide Microarray

    PubMed Central

    Shin, Hwa Hui; Hwang, Byeong Hee; Seo, Jeong Hyun

    2014-01-01

    It is important to rapidly and selectively detect and analyze pathogenic Salmonella enterica subsp. enterica in contaminated food to reduce the morbidity and mortality of Salmonella infection and to guarantee food safety. In the present work, we developed an oligonucleotide microarray containing duplicate specific capture probes based on the carB gene, which encodes the carbamoyl phosphate synthetase large subunit, as a competent biomarker evaluated by genetic analysis to selectively and efficiently detect and discriminate three S. enterica subsp. enterica serotypes: Choleraesuis, Enteritidis, and Typhimurium. Using the developed microarray system, three serotype targets were successfully analyzed in a range as low as 1.6 to 3.1 nM and were specifically discriminated from each other without nonspecific signals. In addition, the constructed microarray did not have cross-reactivity with other common pathogenic bacteria and even enabled the clear discrimination of the target Salmonella serotype from a bacterial mixture. Therefore, these results demonstrated that our novel carB-based oligonucleotide microarray can be used as an effective and specific detection system for S. enterica subsp. enterica serotypes. PMID:24185846

  9. Specific discrimination of three pathogenic Salmonella enterica subsp. enterica serotypes by carB-based oligonucleotide microarray.

    PubMed

    Shin, Hwa Hui; Hwang, Byeong Hee; Seo, Jeong Hyun; Cha, Hyung Joon

    2014-01-01

    It is important to rapidly and selectively detect and analyze pathogenic Salmonella enterica subsp. enterica in contaminated food to reduce the morbidity and mortality of Salmonella infection and to guarantee food safety. In the present work, we developed an oligonucleotide microarray containing duplicate specific capture probes based on the carB gene, which encodes the carbamoyl phosphate synthetase large subunit, as a competent biomarker evaluated by genetic analysis to selectively and efficiently detect and discriminate three S. enterica subsp. enterica serotypes: Choleraesuis, Enteritidis, and Typhimurium. Using the developed microarray system, three serotype targets were successfully analyzed in a range as low as 1.6 to 3.1 nM and were specifically discriminated from each other without nonspecific signals. In addition, the constructed microarray did not have cross-reactivity with other common pathogenic bacteria and even enabled the clear discrimination of the target Salmonella serotype from a bacterial mixture. Therefore, these results demonstrated that our novel carB-based oligonucleotide microarray can be used as an effective and specific detection system for S. enterica subsp. enterica serotypes.

  10. Creation of a bovine herpes virus 1 (BoHV-1) quantitative particle standard by transmission electron microscopy and comparison with established standards for use in real-time PCR.

    PubMed

    Hoferer, Marc; Braun, Anne; Sting, Reinhard

    2017-07-01

    Standards are pivotal for pathogen quantification by real-time PCR (qPCR); however, the creation of a complete and universally applicable virus particle standard is challenging. In the present study a procedure based on purification of bovine herpes virus type 1 (BoHV-1) and subsequent quantification by transmission electron microscopy (TEM) is described. Accompanying quantitative quality controls of the TEM preparation procedure using qPCR yielded recovery rates of more than 95% of the BoHV-1 virus particles on the grid used for virus counting, which was attributed to pre-treatment of the grid with 5% bovine albumin. To compare the value of the new virus particle standard for use in qPCR, virus counter based quantification and established pure DNA standards represented by a plasmid and an oligonucleotide were included. It could be shown that the numbers of virus particles, plasmid and oligonucleotide equivalents were within one log10 range determined on the basis of standard curves indicating that different approaches provide comparable quantitative values. However, only virus particles represent a complete, universally applicable quantitative virus standard that meets the high requirements of an RNA and DNA virus gold standard. In contrast, standards based on pure DNA have to be considered as sub-standard due to limited applications. Copyright © 2017 International Alliance for Biological Standardization. Published by Elsevier Ltd. All rights reserved.

  11. Degenerative encephalopathy in a coastal mountain kingsnake (Lampropeltis zonata multifasciata) due to adenoviral-like infection.

    PubMed

    Raymond, James T; Lamm, Marnie; Nordhausen, Robert; Latimer, Ken; Garner, Michael M

    2003-04-01

    In March 2000, an approximately 30-yr-old, male coastal mountain kingsnake (Lampropeltis zonata multifasciata) presented with disequilibrium and unresponsiveness to stimuli that ultimately lead to euthanasia. Histologically, there were foci of gliosis primarily within the caudal cerebrum, brainstem, and cervical spinal cord. Several glial cells and endothelial cells contained magenta, intranuclear inclusion bodies. Electron microscopy of the inclusions revealed paracrystalline arrays of 79-82 nm, viral-like particles. DNA in situ hybridization of sections of formalin-fixed brain using a mixture of two digoxigenin-end-labeled, adenovirus specific, oligonucleotide probes at low and high stringency was positive for adenovirus.

  12. Multiplex Identification of Microbes ▿ †

    PubMed Central

    Hyman, Richard W.; St.Onge, Robert P.; Allen, Edward A.; Miranda, Molly; Aparicio, Ana Maria; Fukushima, Marilyn; Davis, Ronald W.

    2010-01-01

    We have adapted molecular inversion probe technology to identify microbes in a highly multiplexed procedure. This procedure does not require growth of the microbes. Rather, the technology employs DNA homology twice: once for the molecular probe to hybridize to its homologous DNA and again for the 20-mer oligonucleotide barcode on the molecular probe to hybridize to a commercially available molecular barcode array. As proof of concept, we have designed, tested, and employed 192 molecular probes for 40 microbes. While these particular molecular probes are aimed at our interest in the microbes in the human vagina, this molecular probe method could be employed to identify the microbes in any ecological niche. PMID:20418427

  13. Comprehensive Study On The Metastable Negative Ion Fragmentation Of Individual Dna Components And Larger Oligonucleotides

    NASA Astrophysics Data System (ADS)

    Ingolfsson, O.; Flosadottir, H. D.; Omarsson, B.; Ilko, B.

    2010-07-01

    Here we present a systematic study on the unimolecular decay pathways of the deprotonated building blocks of DNA and RNA to address the following questions: 1. Are the negative ion fragmentation patterns observed in the metastable decay of individual DNA components still evident when these are combined to larger oligonucleotides? 2. What is the significance of the charge location in determining the fragmentation pathways in the metastable decay process? 3. Are those metastable decay channels relevant in dissociative electron attachment to DNA components? To address these questions we have studied the fragmentation patterns of the deprotonated ribose and ribose 5'-monophosphate, the fragmentation patterns of the individual bases, all nucleosides and all 2'-deoxynucleosides as well as the individual nucleotides and several combinations of hexameric oligonucleotides. Furthermore, to understand the significance of the charge location in determining the fragmentation path in the metastable decay process of these deprotonated ions we have also studied modified uridine and guanosine. These have been modified to block different deprotonation sites and thus to control the initial step in the in the fragmentation process i.e. the site of deprotonation. In addition to our experimental approach we have also simulated the metastable fragmentation of the deprotonated uridine and 2'-deoxyguanosine to clarify the mechanisms and fragmentation patterns observed. Where data is available, the results are compared to dissociative electron attachment to DNA components and discussed in context to the underlying mechanism. Experiments on modified nucleosides where selected deprotonation sites have been blocked are used to verify the predicted reaction paths and imulations on uridine and 2'-deoxyguanosine are compared to the experimental results and used to shed light on the mechanisms involved.

  14. Electrochemical DNA biosensor for detection of porcine oligonucleotides using ruthenium(II) complex as intercalator label redox

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Halid, Nurul Izni Abdullah; Hasbullah, Siti Aishah; Heng, Lee Yook

    2014-09-03

    A DNA biosensor detection of oligonucleotides via the interactions of porcine DNA with redox active complex based on the electrochemical transduction is described. A ruthenium(II) complex, [Ru(bpy){sub 2}(PIP)]{sup 2+}, (bpy = 2,2′bipyridine, PIP = 2-phenylimidazo[4,5-f[[1,10-phenanthroline]) as DNA label has been synthesized and characterized by 1H NMR and mass spectra. The study was carried out by covalent bonding immobilization of porcine aminated DNA probes sequences on screen printed electrode (SPE) modified with succinimide-acrylic microspheres and [Ru(bpy){sub 2}(PIP)]{sup 2+} was used as electrochemical redox intercalator label to detect DNA hybridization event. Electrochemical detection was performed by cyclic voltammetry (CV) and differential pulsemore » voltammetry (DPV) over the potential range where the ruthenium (II) complex was active. The results indicate that the interaction of [Ru(bpy){sub 2}(PIP)]{sup 2+} with hybridization complementary DNA has higher response compared to single-stranded and mismatch complementary DNA.« less

  15. The detection of HBV DNA with gold-coated iron oxide nanoparticle gene probes

    NASA Astrophysics Data System (ADS)

    Xi, Dong; Luo, XiaoPing; Lu, QiangHua; Yao, KaiLun; Liu, ZuLi; Ning, Qin

    2008-03-01

    Gold-coated iron oxide nanoparticle Hepatitis B virus (HBV) DNA probes were prepared, and their application for HBV DNA measurement was studied. Gold-coated iron oxide nanoparticles were prepared by the citrate reduction of tetra-chloroauric acid in the presence of iron oxide nanoparticles which were added as seeds. With a fluorescence-based method, the maximal surface coverage of hexaethiol 30-mer oligonucleotides and the maximal percentage of hybridization strands on gold-coated iron oxide nanoparticles were (120 ± 8) oligonucleotides per nanoparticle, and (14 ± 2%), respectively, which were comparable with those of (132 ± 10) and (22 ± 3%) in Au nanoparticle groups. Large network aggregates were formed when gold-coated iron oxide nanoparticle HBV DNA gene probe was applied to detect HBV DNA molecules as evidenced by transmission electron microscopy and the high specificity was verified by blot hybridization. Our results further suggested that detecting DNA with iron oxide nanoparticles and magnetic separator was feasible and might be an alternative effective method.

  16. Induced pluripotent stem cell generation from a man carrying a complex chromosomal rearrangement as a genetic model for infertility studies

    PubMed Central

    Mouka, Aurélie; Izard, Vincent; Tachdjian, Gérard; Brisset, Sophie; Yates, Frank; Mayeur, Anne; Drévillon, Loïc; Jarray, Rafika; Leboulch, Philippe; Maouche-Chrétien, Leila; Tosca, Lucie

    2017-01-01

    Despite progress in human reproductive biology, the cause of male infertility often remains unknown, due to the lack of appropriate and convenient in vitro models of meiosis. Induced pluripotent stem cells (iPSCs) derived from the cells of infertile patients could provide a gold standard model for generating primordial germ cells and studying their development and the process of spermatogenesis. We report the characterization of a complex chromosomal rearrangement (CCR) in an azoospermic patient, and the successful generation of specific-iPSCs from PBMC-derived erythroblasts. The CCR was characterized by karyotype, fluorescence in situ hybridization and oligonucleotide-based array-comparative genomic hybridization. The CCR included five breakpoints and was caused by the inverted insertion of a chromosome 12 segment into the short arm of one chromosome 7 and a pericentric inversion of the structurally rearranged chromosome 12. Gene mapping of the breakpoints led to the identification of a candidate gene, SYCP3. Erythroblasts from the patient were reprogrammed with Sendai virus vectors to generate iPSCs. We assessed iPSC pluripotency by RT-PCR, immunofluorescence staining and teratoma induction. The generation of specific-iPSCs from patients with a CCR provides a valuable in vitro genetic model for studying the mechanisms by which chromosomal abnormalities alter meiosis and germ cell development. PMID:28045072

  17. Partial trisomy 3p and partial monosomy 11q associated with atrial septal defect, cleft palate, and developmental delay: a case report.

    PubMed

    Tan, E-C; Lim, E; Cham, B; Knight, L; Ng, I

    2011-01-01

    Unbalanced translocation involving both chromosome 3p duplication and 11q deletion in the same patient is extremely rare; only 1 live-born case was reported previously. This karyotype was also detected during prenatal diagnosis of 2 different pregnancies in a Taiwanese family which were both terminated. In all 3 cases, only standard karyotyping was done to detect the abnormal karyotypes. Here, we report a 4-year-old boy with cleft palate, atrial septal defect, and hypotonia with gross and fine motor delay. Oligonucleotide-based array comparative genomic hybridization showed copy number gain from 3pter to 3p24.2 (approximately 24.5 Mb) and copy number loss from 11q25 to 11qter (approximately 5.8 Mb). This de novo unbalanced translocation event involving a terminal 3p duplication and a terminal 11q deletion provides candidate genes for further investigation of dosage effect leading to the patient's multiple phenotypic abnormalities. Genotype-phenotype correlation is difficult to make in this case due to the large number of genes involved. However, the description of such cases together with precise gene-level mapping of chromosomal breakpoints will add to further refinement of candidate genes to be investigated for terminal imbalances in 3p and 11q when more similar cases are reported. Copyright © 2011 S. Karger AG, Basel.

  18. New candidate loci identified by array-CGH in a cohort of 100 children presenting with syndromic obesity.

    PubMed

    Vuillaume, Marie-Laure; Naudion, Sophie; Banneau, Guillaume; Diene, Gwenaelle; Cartault, Audrey; Cailley, Dorothée; Bouron, Julie; Toutain, Jérôme; Bourrouillou, Georges; Vigouroux, Adeline; Bouneau, Laurence; Nacka, Fabienne; Kieffer, Isabelle; Arveiler, Benoit; Knoll-Gellida, Anja; Babin, Patrick J; Bieth, Eric; Jouret, Béatrice; Julia, Sophie; Sarda, Pierre; Geneviève, David; Faivre, Laurence; Lacombe, Didier; Barat, Pascal; Tauber, Maithé; Delrue, Marie-Ange; Rooryck, Caroline

    2014-08-01

    Syndromic obesity is defined by the association of obesity with one or more feature(s) including developmental delay, dysmorphic traits, and/or congenital malformations. Over 25 syndromic forms of obesity have been identified. However, most cases remain of unknown etiology. The aim of this study was to identify new candidate loci associated with syndromic obesity to find new candidate genes and to better understand molecular mechanisms involved in this pathology. We performed oligonucleotide microarray-based comparative genomic hybridization in a cohort of 100 children presenting with syndromic obesity of unknown etiology, after exhaustive clinical, biological, and molecular studies. Chromosomal copy number variations were detected in 42% of the children in our cohort, with 23% of patients with potentially pathogenic copy number variants. Our results support that chromosomal rearrangements are frequently associated with syndromic obesity with a variety of contributory genes having relevance to either obesity or developmental delay. A list of inherited or apparently de novo duplications and deletions including their enclosed genes and not previously linked to syndromic obesity was established. Proteins encoded by several of these genes are involved in lipid metabolism (ACOXL, MSMO1, MVD, and PDZK1) linked with nervous system function (BDH1 and LINGO2), neutral lipid storage (PLIN2), energy homeostasis and metabolic processes (CDH13, CNTNAP2, CPPED1, NDUFA4, PTGS2, and SOCS6). © 2014 Wiley Periodicals, Inc.

  19. DNA recognition by peptide nucleic acid-modified PCFs: from models to real samples

    NASA Astrophysics Data System (ADS)

    Selleri, S.; Coscelli, E.; Poli, F.; Passaro, D.; Cucinotta, A.; Lantano, C.; Corradini, R.; Marchelli, R.

    2010-04-01

    The increased concern, emerged in the last few years, on food products safety has stimulated the research on new techniques for traceability of raw food materials. DNA analysis is one of the most powerful tools for the certification of food quality, and it is presently performed through the polymerase chain reaction technique. Photonic crystal fibers, due to the presence of an array of air holes running along their length, can be exploited for performing DNA recognition by derivatizing hole surfaces and checking hybridization of complementary nucledotide chains in the sample. In this paper the application of a suspended core photonic crystal fiber in the recognition of DNA sequences is discussed. The fiber is characterized in terms of electromagnetic properties by means of a full-vector modal solver based on the finite element method. Then, the performances of the fiber in the recognition of mall synthetic oligonucleotides are discussed, together with a test of the possibility to extend this recognition to samples of DNA of applicative interest, such as olive leaves.

  20. Identification of ecotype-specific marker genes for categorization of beer-spoiling Lactobacillus brevis.

    PubMed

    Behr, Jürgen; Geissler, Andreas J; Preissler, Patrick; Ehrenreich, Armin; Angelov, Angel; Vogel, Rudi F

    2015-10-01

    The tolerance to hop compounds, which is mainly associated with inhibition of bacterial growth in beer, is a multi-factorial trait. Any approaches to predict the physiological differences between beer-spoiling and non-spoiling strains on the basis of a single marker gene are limited. We identified ecotype-specific genes related to the ability to grow in Pilsner beer via comparative genome sequencing. The genome sequences of four different strains of Lactobacillus brevis were compared, including newly established genomes of two highly hop tolerant beer isolates, one strain isolated from faeces and one published genome of a silage isolate. Gene fragments exclusively occurring in beer-spoiling strains as well as sequences only occurring in non-spoiling strains were identified. Comparative genomic arrays were established and hybridized with a set of L. brevis strains, which are characterized by their ability to spoil beer. As result, a set of 33 and 4 oligonucleotide probes could be established specifically detecting beer-spoilers and non-spoilers, respectively. The detection of more than one of these marker sequences according to a genetic barcode enables scoring of L. brevis for their beer-spoiling potential and can thus assist in risk evaluation in brewing industry. Copyright © 2015 Elsevier Ltd. All rights reserved.

  1. Toward a solid-phase nucleic acid hybridization assay within microfluidic channels using immobilized quantum dots as donors in fluorescence resonance energy transfer.

    PubMed

    Chen, Lu; Algar, W Russ; Tavares, Anthony J; Krull, Ulrich J

    2011-01-01

    The optical properties and surface area of quantum dots (QDs) have made them an attractive platform for the development of nucleic acid biosensors based on fluorescence resonance energy transfer (FRET). Solid-phase assays based on FRET using mixtures of immobilized QD-oligonucleotide conjugates (QD biosensors) have been developed. The typical challenges associated with solid-phase detection strategies include non-specific adsorption, slow kinetics of hybridization, and sample manipulation. The new work herein has considered the immobilization of QD biosensors onto the surfaces of microfluidic channels in order to address these challenges. Microfluidic flow can be used to dynamically control stringency by adjustment of the potential in an electrokinetic-based microfluidics environment. The shearing force, Joule heating, and the competition between electroosmotic and electrophoretic mobilities allow the optimization of hybridization conditions, convective delivery of target to the channel surface to speed hybridization, amelioration of adsorption, and regeneration of the sensing surface. Microfluidic flow can also be used to deliver (for immobilization) and remove QD biosensors. QDs that were conjugated with two different oligonucleotide sequences were used to demonstrate feasibility. One oligonucleotide sequence on the QD was available as a linker for immobilization via hybridization with complementary oligonucleotides located on a glass surface within a microfluidic channel. A second oligonucleotide sequence on the QD served as a probe to transduce hybridization with target nucleic acid in a sample solution. A Cy3 label on the target was excited by FRET using green-emitting CdSe/ZnS QD donors and provided an analytical signal to explore this detection strategy. The immobilized QDs could be removed under denaturing conditions by disrupting the duplex that was used as the surface linker and thus allowed a new layer of QD biosensors to be re-coated within the channel for re-use of the microfluidic chip.

  2. Fabrication of 3D Reconstituted Organoid Arrays by DNA-programmed Assembly of Cells (DPAC)

    PubMed Central

    Todhunter, Michael E; Weber, Robert J; Farlow, Justin; Jee, Noel Y; Cerchiari, Alec E; Gartner, Zev J

    2016-01-01

    Tissues are the organizational units of function in metazoan organisms. Tissues comprise an assortment of cellular building blocks, soluble factors, and extracellular matrix (ECM) that are composed into specific three dimensional (3D) structures. The capacity to reconstitute tissues in vitro with the structural complexity observed in vivo is key to understanding processes such as morphogenesis, homeostasis, and disease. In this unit, we describe DNA-programmed Assembly of Cells (DPAC), a method to fabricate viable, functional arrays of organoid-like tissues within 3D ECM gels. In DPAC, dissociated cells are chemically functionalized with degradable oligonucleotide “velcro,” allowing rapid, specific, and reversible cell adhesion to a two-dimensional (2D) template patterned with complementary DNA. An iterative assembly process builds up organoids, layer-by-layer, from this initial 2D template and into the third dimension. Cleavage of the DNA releases the completed array of tissues that are captured and fully embedded in ECM gels for culture and observation. DPAC controls the size, shape, composition, and spatial heterogeneity of organoids, and permits positioning constituent cells with single-cell resolution even within cultures several centimeters long. PMID:27622567

  3. alpha-DNA II. Synthesis of unnatural alpha-anomeric oligodeoxyribonucleotides containing the four usual bases and study of their substrate activities for nucleases.

    PubMed Central

    Morvan, F; Rayner, B; Imbach, J L; Thenet, S; Bertrand, J R; Paoletti, J; Malvy, C; Paoletti, C

    1987-01-01

    This paper describes for the first time the synthesis of alpha-oligonucleotides containing the four usual bases. Two unnatural hexadeoxyribonucleotides: alpha-[d(CpApTpGpCpG)] and alpha-[d(CpGpCpApTpG)], consisting only of alpha-anomeric nucleotide units, were obtained by an improved phosphotriester method, in solution. Starting material was the four base-protected alpha-deoxyribonucleosides 3a-d. Pyrimidine alpha-deoxynucleosides 3a and 3b were prepared by self-anomerization reactions followed by selective deprotection of sugar hydroxyles, while the two purine alpha-deoxynucleosides 3c and 3d were prepared by glycosylation reactions. In the case of guanine alpha-nucleoside derivative a supplementary base-protecting group: N,N-diphenylcarbamoyl was introduced on O6-position in order to avoid side-reactions during oligonucleotide assembling. The hexadeoxynucleotide alpha-[d(CpApTpGpCpG)] was tested as substrate of selected endo- and exonucleases. In conditions where the natural corresponding beta-hexamer was completely degradated by nuclease S1 and calf spleen phosphodiesterase, the alpha-oligonucleotide remained almost intact. PMID:3575096

  4. Assessment of new biocompatible poly(N-(morpholino)ethyl methacrylate)-based copolymers by transfection of immortalized keratinocytes.

    PubMed

    Van Overstraeten-Schlögel, Nancy; Shim, Yong-Ho; Tevel, Virginie; Piel, Géraldine; Piette, Jacques; Dubois, Philippe; Raes, Martine

    2012-02-01

    Skin carcinomas are among the most commonly diagnosed tumors in the world. In this study, we investigated the transfection of immortalized keratinocytes, used as an in vitro model for skin carcinoma, using the antisense technology and poly(2-(dimethylamino)ethyl methacrylate) (PDMAEMA)-based copolymers. In order to improve the transfection efficiency of the classic PDMAEMA polymers, copolymers were synthesized including a poly(N-morpholino)ethylmethacrylate) (PMEMA) moiety for an improved proton-sponge effect, intended to favour the release of the oligonucleotide from the acidic endosome. These copolymers were synthesized either statistically (with alternating PDMAEMA and PMEMA fragments) or in blocks (one PDMAEMA block followed by one PMEMA block). MTT assays were performed using the PDMAEMA-PMEMA copolymers and revealed no significant cytotoxicity of these polymers at an N/P ratio of 7.3. Using fluorescent oligonucleotides and analyzing transfection efficiency by flow cytometry, we noticed no significant differences between the two kinds of copolymers. However copolymers with a higher DMAEMA content and a higher Mn were also those displaying the highest vectorization efficiency. Confocal microscopy showed that these copolymers induced a fine granular distribution of the transfected antisense oligonucleotides inside the cells. We also assessed the functionality of the transfected antisense oligonucleotide by transfecting immortalized GFP expressing keratinocytes with a GFP antisense oligonucleotide using these copolymers. A significant silencing was achieved with a PDMAEMA-PMEMA in block copolymer (Mn=41,000, 89 % PDMAEMA). Together, these results suggest that PDMAEMA-PMEMA copolymers combining low toxicity, vectorization and proton sponge properties, can be efficiently used to transfect immortalized keratinocytes and so open new perspectives in the therapy of skin carcinomas as well as of other skin diseases of genetic or immunological origin. © 2012 Informa Healthcare USA, Inc.

  5. MALDI MS analysis of oligonucleotides: desalting by functional magnetite beads using microwave-assisted extraction.

    PubMed

    Chen, Wei-Yu; Chen, Yu-Chie

    2007-11-01

    The presence of alkali cation adductions of oligonucleotides commonly deteriorates matrix-assisted laser desorption/ionization (MALDI) mass spectra. Thus, desalting is required for oligonucleotide samples prior to MALDI MS analysis in order to prevent the mass spectra from developing poor quality. In this paper, we demonstrate a new approach to extract traces of oligonucleotides from aqueous solutions containing high concentrations of salts using microwave-assisted extraction. The C18-presenting magnetite beads, capable of absorbing microwave irradiation, are used as affinity probes for oligonucleotides with the addition of triethylammonium acetate as the counterions. This new microwave-assisted extraction approach using magnetite beads as the trapping agents and as microwave-absorbers has been demonstrated to be very effective in the selective binding of oligonucleotides from aqueous solutions. The extraction of oligonucleotides from solutions onto the C18-presenting magnetite beads takes only 30 s to enrich oligonucleotides in sufficient quantities for MALDI MS analysis. After using this desalting approach, alkali cation adductions of oligonucleotides are dramatically reduced in the MALDI mass spectra. The presence of saturated NaCl (approximately 6 M) in the oligonucleotide sample is tolerated without degrading the mass spectra. The detection limit for d(A)6 is approximately 2.8 fmol.

  6. Peptide-oligonucleotide conjugates as nanoscale building blocks for assembly of an artificial three-helix protein mimic

    NASA Astrophysics Data System (ADS)

    Lou, Chenguang; Martos-Maldonado, Manuel C.; Madsen, Charlotte S.; Thomsen, Rasmus P.; Midtgaard, Søren Roi; Christensen, Niels Johan; Kjems, Jørgen; Thulstrup, Peter W.; Wengel, Jesper; Jensen, Knud J.

    2016-07-01

    Peptide-based structures can be designed to yield artificial proteins with specific folding patterns and functions. Template-based assembly of peptide units is one design option, but the use of two orthogonal self-assembly principles, oligonucleotide triple helix and a coiled coil protein domain formation have never been realized for de novo protein design. Here, we show the applicability of peptide-oligonucleotide conjugates for self-assembly of higher-ordered protein-like structures. The resulting nano-assemblies were characterized by ultraviolet-melting, gel electrophoresis, circular dichroism (CD) spectroscopy, small-angle X-ray scattering and transmission electron microscopy. These studies revealed the formation of the desired triple helix and coiled coil domains at low concentrations, while a dimer of trimers was dominating at high concentration. CD spectroscopy showed an extraordinarily high degree of α-helicity for the peptide moieties in the assemblies. The results validate the use of orthogonal self-assembly principles as a paradigm for de novo protein design.

  7. Solid-phase synthesis of a nucleopeptide from the linking site of adenovirus-2 nucleoprotein, -Ser(p5'CATCAT)-Gly-Asp-. Convergent versus stepwise strategy.

    PubMed Central

    Robles, J; Pedroso, E; Grandas, A

    1995-01-01

    The synthesis of a nucleopeptide with the sequence -Ser(p5'CATCAT)-Gly-Asp- has been undertaken by either convergent or stepwise solid-phase strategies, both of which use base-labile permanent protecting groups. The coupling of phosphitylated protected peptides onto oligonucleotide-resins did not afford the desired nucleopeptide, which was nevertheless obtained after oligonucleotide elongation at the hydroxyl group of the resin-bound peptide and deprotection under mild basic conditions. A preliminary study on the stability of different nucleopeptides to bases is also reported. PMID:7479079

  8. Identifying of meat species using polymerase chain reaction (PCR)

    NASA Astrophysics Data System (ADS)

    Foong, Chow Ming; Sani, Norrakiah Abdullah

    2013-11-01

    Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one's diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing.

  9. Identifying of meat species using polymerase chain reaction (PCR)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Foong, Chow Ming; Sani, Norrakiah Abdullah

    Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one’s diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reactionmore » (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing.« less

  10. The pitfalls of platform comparison: DNA copy number array technologies assessed

    PubMed Central

    2009-01-01

    Background The accurate and high resolution mapping of DNA copy number aberrations has become an important tool by which to gain insight into the mechanisms of tumourigenesis. There are various commercially available platforms for such studies, but there remains no general consensus as to the optimal platform. There have been several previous platform comparison studies, but they have either described older technologies, used less-complex samples, or have not addressed the issue of the inherent biases in such comparisons. Here we describe a systematic comparison of data from four leading microarray technologies (the Affymetrix Genome-wide SNP 5.0 array, Agilent High-Density CGH Human 244A array, Illumina HumanCNV370-Duo DNA Analysis BeadChip, and the Nimblegen 385 K oligonucleotide array). We compare samples derived from primary breast tumours and their corresponding matched normals, well-established cancer cell lines, and HapMap individuals. By careful consideration and avoidance of potential sources of bias, we aim to provide a fair assessment of platform performance. Results By performing a theoretical assessment of the reproducibility, noise, and sensitivity of each platform, notable differences were revealed. Nimblegen exhibited between-replicate array variances an order of magnitude greater than the other three platforms, with Agilent slightly outperforming the others, and a comparison of self-self hybridizations revealed similar patterns. An assessment of the single probe power revealed that Agilent exhibits the highest sensitivity. Additionally, we performed an in-depth visual assessment of the ability of each platform to detect aberrations of varying sizes. As expected, all platforms were able to identify large aberrations in a robust manner. However, some focal amplifications and deletions were only detected in a subset of the platforms. Conclusion Although there are substantial differences in the design, density, and number of replicate probes, the comparison indicates a generally high level of concordance between platforms, despite differences in the reproducibility, noise, and sensitivity. In general, Agilent tended to be the best aCGH platform and Affymetrix, the superior SNP-CGH platform, but for specific decisions the results described herein provide a guide for platform selection and study design, and the dataset a resource for more tailored comparisons. PMID:19995423

  11. Modification of the 5' terminus of oligodeoxyribonucleotides for conjugation with ligands.

    PubMed

    Asseline, U; Thuong, N T

    2001-08-01

    Ligands can be introduced at the 5' terminus of an oligonucleotide by adding a linker to the ligand and modifying the 5' terminus of the oligonucleotide. These are then reacted to give the ligand-oligonucleotide conjugate. This unit describes the addition of carboxylated and aminoalkylated linkers, and phosphorothioate, phosphate, and masked thiol groups to the 5' terminus of an oligonucleotide. The addition of linkers to ligands and the final reaction that produces the ligand-conjugated oligonucleotide are described elsewhere in the series. This approach is particularly useful when there is a limited amount of ligand available, when the ligand is sensitive to chemical conditions required for oligonucleotide deprotection, or when the ligand is weakly soluble in solvents required for phosphoramidite- or H-phosphonate-mediated oligonucleotide synthesis.

  12. Within and between Whorls: Comparative Transcriptional Profiling of Aquilegia and Arabidopsis

    PubMed Central

    Voelckel, Claudia; Borevitz, Justin O.; Kramer, Elena M.; Hodges, Scott A.

    2010-01-01

    Background The genus Aquilegia is an emerging model system in plant evolutionary biology predominantly because of its wide variation in floral traits and associated floral ecology. The anatomy of the Aquilegia flower is also very distinct. There are two whorls of petaloid organs, the outer whorl of sepals and the second whorl of petals that form nectar spurs, as well as a recently evolved fifth whorl of staminodia inserted between stamens and carpels. Methodology/Principal Findings We designed an oligonucleotide microarray based on EST sequences from a mixed tissue, normalized cDNA library of an A. formosa x A. pubescens F2 population representing 17,246 unigenes. We then used this array to analyze floral gene expression in late pre-anthesis stage floral organs from a natural A. formosa population. In particular, we tested for gene expression patterns specific to each floral whorl and to combinations of whorls that correspond to traditional and modified ABC model groupings. Similar analyses were performed on gene expression data of Arabidopsis thaliana whorls previously obtained using the Ath1 gene chips (data available through The Arabidopsis Information Resource). Conclusions/Significance Our comparative gene expression analyses suggest that 1) petaloid sepals and petals of A. formosa share gene expression patterns more than either have organ-specific patterns, 2) petals of A. formosa and A. thaliana may be independently derived, 3) staminodia express B and C genes similar to stamens but the staminodium genetic program has also converged on aspects of the carpel program and 4) staminodia have unique up-regulation of regulatory genes and genes that have been implicated with defense against microbial infection and herbivory. Our study also highlights the value of comparative gene expression profiling and the Aquilegia microarray in particular for the study of floral evolution and ecology. PMID:20352114

  13. Roles of the amino group of purine bases in the thermodynamic stability of DNA base pairing.

    PubMed

    Nakano, Shu-ichi; Sugimoto, Naoki

    2014-08-05

    The energetic aspects of hydrogen-bonded base-pair interactions are important for the design of functional nucleotide analogs and for practical applications of oligonucleotides. The present study investigated the contribution of the 2-amino group of DNA purine bases to the thermodynamic stability of oligonucleotide duplexes under different salt and solvent conditions, using 2'-deoxyriboinosine (I) and 2'-deoxyribo-2,6-diaminopurine (D) as non-canonical nucleotides. The stability of DNA duplexes was changed by substitution of a single base pair in the following order: G • C > D • T ≈ I • C > A • T > G • T > I • T. The apparent stabilization energy due to the presence of the 2-amino group of G and D varied depending on the salt concentration, and decreased in the water-ethanol mixed solvent. The effects of salt concentration on the thermodynamics of DNA duplexes were found to be partially sequence-dependent, and the 2-amino group of the purine bases might have an influence on the binding of ions to DNA through the formation of a stable base-paired structure. Our results also showed that physiological salt conditions were energetically favorable for complementary base recognition, and conversely, low salt concentration media and ethanol-containing solvents were effective for low stringency oligonucleotide hybridization, in the context of conditions employed in this study.

  14. Comparative study of the interaction of meso-tetrakis (N-para-trimethyl-anilium) porphyrin (TMAP) in its free base and Fe derivative form with oligo(dA.dT)15 and oligo(dG.dC)15.

    PubMed

    Bathaie, S Zahra; Ajloo, Davood; Daraie, Marzieh; Ghadamgahi, Maryam

    2015-01-01

    Interaction between a cationic porphyrin and its ferric derivative with oligo(dA.dT)15 and oligo(dG.dC)15 was studied by UV-vis spectroscopy, resonance light scattering (RLS), and circular dichroism (CD) at different ionic strengths; molecular docking and molecular dynamics simulation were also used for completion. Followings are the observed changes in the spectral properties of meso-tetrakis (N-para-trimethyl-anilium) porphyrin (TMAP), as a free-base porphyrin with no axial ligand, and its Fe derivative (FeTMAP) upon interaction with oligo(dA.dT)15 and oligo(dG.dC)15: (1) the substantial red shift and hypochromicity at the Soret maximum in the UV-vis spectra; (2) the increased RLS intensity by increasing the ionic strength; and (3) an intense bisignate excitonic CD signal. All of them are the reasons for TMAP and FeTMAP binding to oligo(dA.dT)15 and oligo(dG.dC)15 with the outside binding mode, accompanied by the self-stacking of the ligands along the oligonucleotide helix. The CD results demonstrated a drastic change from excitonic in monomeric behavior at higher ionic strengths, which indicates the groove binding of the ligands with oligonucleotides. Molecular docking also confirmed the groove binding mode of the ligands and estimated the binding constants and energies of the interactions. Their interaction trend was further confirmed by molecular dynamics technique and structure parameters obtained from simulation. It showed that TMAP reduced the number of intermolecular hydrogen bonds and increased the solvent accessible surface area in the oligonucleotide. The self-aggregation of ligands at lower concentrations was also confirmed.

  15. Nucleic acid sequence detection using multiplexed oligonucleotide PCR

    DOEpatents

    Nolan, John P [Santa Fe, NM; White, P Scott [Los Alamos, NM

    2006-12-26

    Methods for rapidly detecting single or multiple sequence alleles in a sample nucleic acid are described. Provided are all of the oligonucleotide pairs capable of annealing specifically to a target allele and discriminating among possible sequences thereof, and ligating to each other to form an oligonucleotide complex when a particular sequence feature is present (or, alternatively, absent) in the sample nucleic acid. The design of each oligonucleotide pair permits the subsequent high-level PCR amplification of a specific amplicon when the oligonucleotide complex is formed, but not when the oligonucleotide complex is not formed. The presence or absence of the specific amplicon is used to detect the allele. Detection of the specific amplicon may be achieved using a variety of methods well known in the art, including without limitation, oligonucleotide capture onto DNA chips or microarrays, oligonucleotide capture onto beads or microspheres, electrophoresis, and mass spectrometry. Various labels and address-capture tags may be employed in the amplicon detection step of multiplexed assays, as further described herein.

  16. A simple and robust vector-based shRNA expression system used for RNA interference.

    PubMed

    Wang, Xue-jun; Li, Ying; Huang, Hai; Zhang, Xiu-juan; Xie, Pei-wen; Hu, Wei; Li, Dan-dan; Wang, Sheng-qi

    2013-01-01

    RNA interference (RNAi) mediated by small interfering RNAs (siRNAs) or short hairpin RNAs (shRNAs) has become a powerful genetic tool for conducting functional studies. Previously, vector-based shRNA-expression strategies capable of inducing RNAi in viable cells have been developed, however, these vector systems have some disadvantages, either because they were error-prone or cost prohibitive. In this report we described the development of a simple, robust shRNA expression system utilizing 1 long oligonucleotide or 2 short oligonucleotides for half the cost of conventional shRNA construction methods and with a >95% cloning success rate. The shRNA loop sequence and stem structure were also compared and carefully selected for better RNAi efficiency. Furthermore, an easier strategy was developed based on isocaudomers which permit rapid combination of the most efficient promoter-shRNA cassettes. Finally, using this method, the conservative target sites for hepatitis B virus (HBV) knockdown were systemically screened and HBV antigen expression shown to be successfully suppressed in the presence of connected multiple shRNAs both in vitro and in vivo. This novel design describes an inexpensive and effective way to clone and express single or multiple shRNAs from the same vector with the capacity for potent and effective silencing of target genes.

  17. A paper-based resonance energy transfer nucleic acid hybridization assay using upconversion nanoparticles as donors and quantum dots as acceptors.

    PubMed

    Doughan, Samer; Uddayasankar, Uvaraj; Krull, Ulrich J

    2015-06-09

    Monodisperse aqueous upconverting nanoparticles (UCNPs) were covalently immobilized on aldehyde modified cellulose paper via reduction amination to develop a luminescence resonance energy transfer (LRET)-based nucleic acid hybridization assay. This first account of covalent immobilization of UCNPs on paper for a bioassay reports an optically responsive method that is sensitive, reproducible and robust. The immobilized UCNPs were decorated with oligonucleotide probes to capture HPRT1 housekeeping gene fragments, which in turn brought reporter conjugated quantum dots (QDs) in close proximity to the UCNPs for LRET. This sandwich assay could detect unlabeled oligonucleotide target, and had a limit of detection of 13 fmol and a dynamic range spanning nearly 3 orders of magnitude. The use of QDs, which are excellent LRET acceptors, demonstrated improved sensitivity, limit of detection, dynamic range and selectivity compared to similar assays that have used molecular fluorophores as acceptors. The selectivity of the assay was attributed to the decoration of the QDs with polyethylene glycol to eliminate non-specific adsorption. The kinetics of hybridization were determined to be diffusion limited and full signal development occurred within 3 min. Copyright © 2015 Elsevier B.V. All rights reserved.

  18. Graphene Oxide Based Nanocarrier Combined with a pH-Sensitive Tracer: A Vehicle for Concurrent pH Sensing and pH-Responsive Oligonucleotide Delivery.

    PubMed

    Hsieh, Chia-Jung; Chen, Yu-Cheng; Hsieh, Pei-Ying; Liu, Shi-Rong; Wu, Shu-Pao; Hsieh, You-Zung; Hsu, Hsin-Yun

    2015-06-03

    We chemically tuned the oxidation status of graphene oxide (GO) and constructed a GO-based nanoplatform combined with a pH-sensitive fluorescence tracer that is designed for both pH sensing and pH-responsive drug delivery. A series of GOs oxidized to distinct degrees were examined to optimize the adsorption of the model drug, poly dT30. We determined that highly oxidized GO was a superior drug-carrier candidate in vitro when compared to GOs oxidized to lesser degrees. In the cell experiment, the synthesized pH-sensitive rhodamine dye was first applied to monitor cellular pH; under acidic conditions, protonated rhodamine fluoresces at 588 nm (λex=561 nm). When the dT30-GO nanocarrier was introduced into cells, a rhodamine-triggered competition reaction occurred, and this led to the release of the oligonucleotides and the quenching of rhodamine fluorescence by GO. Our results indicate high drug loading (FAM-dT30/GO=25/50 μg/mL) and rapid cellular uptake (<0.5 h) of the nanocarrier which can potentially be used for targeted RNAi delivery to the acidic milieu of tumors.

  19. Hybridization assay of insect antifreezing protein gene by novel multilayered porous silicon nucleic acid biosensor.

    PubMed

    Lv, Xiaoyi; Chen, Liangliang; Zhang, Hongyan; Mo, Jiaqing; Zhong, Furu; Lv, Changwu; Ma, Ji; Jia, Zhenhong

    2013-01-15

    A fabrication of a novel simple porous silicon polybasic photonic crystal with symmetrical structure has been reported as a nucleic acid biosensor for detecting antifreeze protein gene in insects (Microdera puntipennis dzhungarica), which would be helpful in the development of some new transgenic plants with tolerance of freezing stress. Compared to various porous silicon-based photonic configurations, porous silicon polytype layered structure is quite easy to prepare and shows more stability; moreover, polybasic photonic crystals with symmetrical structure exhibit interesting optical properties with a sharp resonance in the reflectance spectrum, giving a higher Q factor which causes higher sensitivity for sensing performance. In this experiment, DNA oligonucleotides were immobilized into the porous silicon pores using a standard crosslink chemistry method. The porous silicon polybasic symmetrical structure sensor possesses high specificity in performing controlled experiments with non-complementary DNA. The detection limit was found to be 21.3nM for DNA oligonucleotides. The fabricated multilayered porous silicon-based DNA biosensor has potential commercial applications in clinical chemistry for determination of an antifreeze protein gene or other genes. Copyright © 2012 Elsevier B.V. All rights reserved.

  20. The illusion of specific capture: surface and solution studies of suboptimal oligonucleotide hybridization

    PubMed Central

    2013-01-01

    Background Hybridization based assays and capture systems depend on the specificity of hybridization between a probe and its intended target. A common guideline in the construction of DNA microarrays, for instance, is that avoiding complementary stretches of more than 15 nucleic acids in a 50 or 60-mer probe will eliminate sequence specific cross-hybridization reactions. Here we present a study of the behavior of partially matched oligonucleotide pairs with complementary stretches starting well below this threshold complementarity length – in silico, in solution, and at the microarray surface. The modeled behavior of pairs of oligonucleotide probes and their targets suggests that even a complementary stretch of sequence 12 nt in length would give rise to specific cross-hybridization. We designed a set of binding partners to a 50-mer oligonucleotide containing complementary stretches from 6 nt to 21 nt in length. Results Solution melting experiments demonstrate that stable partial duplexes can form when only 12 bp of complementary sequence are present; surface hybridization experiments confirm that a signal close in magnitude to full-strength signal can be obtained from hybridization of a 12 bp duplex within a 50mer oligonucleotide. Conclusions Microarray and other molecular capture strategies that rely on a 15 nt lower complementarity bound for eliminating specific cross-hybridization may not be sufficiently conservative. PMID:23445545

  1. Fabrication of Micropatterned Dipeptide Hydrogels by Acoustic Trapping of Stimulus-Responsive Coacervate Droplets.

    PubMed

    Nichols, Madeleine K; Kumar, Ravinash Krishna; Bassindale, Philip G; Tian, Liangfei; Barnes, Adrian C; Drinkwater, Bruce W; Patil, Avinash J; Mann, Stephen

    2018-06-01

    Acoustic standing waves offer an excellent opportunity to trap and spatially manipulate colloidal objects. This noncontact technique is used for the in situ formation and patterning in aqueous solution of 1D or 2D arrays of pH-responsive coacervate microdroplets comprising poly(diallyldimethylammonium) chloride and the dipeptide N-fluorenyl-9-methoxy-carbonyl-D-alanine-D-alanine. Decreasing the pH of the preformed droplet arrays results in dipeptide nanofilament self-assembly and subsequent formation of a micropatterned supramolecular hydrogel that can be removed as a self-supporting monolith. Guest molecules such as molecular dyes, proteins, and oligonucleotides are sequestered specifically within the coacervate droplets during acoustic processing to produce micropatterned hydrogels containing spatially organized functional components. Using this strategy, the site-specific isolation of multiple enzymes to drive a catalytic cascade within the micropatterned hydrogel films is exploited. © 2018 The Authors. Published by WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Data-adaptive test statistics for microarray data.

    PubMed

    Mukherjee, Sach; Roberts, Stephen J; van der Laan, Mark J

    2005-09-01

    An important task in microarray data analysis is the selection of genes that are differentially expressed between different tissue samples, such as healthy and diseased. However, microarray data contain an enormous number of dimensions (genes) and very few samples (arrays), a mismatch which poses fundamental statistical problems for the selection process that have defied easy resolution. In this paper, we present a novel approach to the selection of differentially expressed genes in which test statistics are learned from data using a simple notion of reproducibility in selection results as the learning criterion. Reproducibility, as we define it, can be computed without any knowledge of the 'ground-truth', but takes advantage of certain properties of microarray data to provide an asymptotically valid guide to expected loss under the true data-generating distribution. We are therefore able to indirectly minimize expected loss, and obtain results substantially more robust than conventional methods. We apply our method to simulated and oligonucleotide array data. By request to the corresponding author.

  3. MEF2C haploinsufficiency caused by either microdeletion of the 5q14.3 region or mutation is responsible for severe mental retardation with stereotypic movements, epilepsy and/or cerebral malformations

    PubMed Central

    Le Meur, Nathalie; Holder-Espinasse, Muriel; Jaillard, Sylvie; Goldenberg, Alice; Joriot, Sylvie; Amati-Bonneau, Patrizia; Guichet, Agnès; Barth, Magalie; Charollais, Aude; Journel, Hubert; Auvin, Stéphane; Boucher, Cécile; Kerckaert, Jean-Pierre; David, Véronique; Manouvrier-Hanu, Sylvie; Saugier-Veber, Pascale; Frébourg, Thierry; Dubourg, Christèle; Andrieux, Joris; Bonneau, Dominique

    2010-01-01

    Over the last few years, array-CGH has remarkably improved the ability to detect cryptic unbalanced rearrangements in patients presenting with syndromic mental retardation. Using whole genome oligonucleotide array-CGH, we detected 5q14.3 microdeletions ranging from 216 kb to 8.8 Mb in 5 unrelated patients showing phenotypic similarities, namely severe mental retardation with absent speech, hypotonia and stereotypic movements. Most of the patients presented also with facial dysmorphic features, epilepsy and/or cerebral malformations. The minimal common deleted region of these 5q14 microdeletions encompassed only MEF2C, known to act in brain as a neurogenesis effector which regulates excitatory synapse number. In a patient presenting a similar phenotype, we subsequently identified a MEF2C nonsense mutation. Taken together, these results strongly suggest that haploinsufficiency of MEF2C is responsible for severe mental retardation with stereotypic movements, seizures and/or cerebral malformations. PMID:19592390

  4. Programmable display of DNA-protein chimeras for controlling cell-hydrogel interactions via reversible intermolecular hybridization.

    PubMed

    Zhang, Zhaoyang; Li, Shihui; Chen, Niancao; Yang, Cheng; Wang, Yong

    2013-04-08

    Extensive studies have been recently carried out to achieve dynamic control of cell-material interactions primarily through physicochemical stimulation. The purpose of this study was to apply reversible intermolecular hybridization to program cell-hydrogel interactions in physiological conditions based on DNA-antibody chimeras and complementary oligonucleotides. The results showed that DNA oligonucleotides could be captured to and released from the immobilizing DNA-functionalized hydrogels with high specificity via DNA hybridization. Accordingly, DNA-antibody chimeras were captured to the hydrogels, successfully inducing specific cell attachment. The cell attachment to the hydrogels reached the plateau at approximately half an hour after the functionalized hydrogels and the cells were incubated together. The attached cells were rapidly released from the bound hydrogels when triggering complementary oligonucleotides were introduced to the system. However, the capability of the triggering complementary oligonucleotides in releasing cells was affected by the length of intermolecular hybridization. The length needed to be at least more than 20 base pairs in the current experimental setting. Notably, because the procedure of intermolecular hybridization did not involve any harsh condition, the released cells maintained the same viability as that of the cultured cells. The functionalized hydrogels also exhibited the potential to catch and release cells repeatedly. Therefore, this study demonstrates that it is promising to regulate cell-material interactions dynamically through the DNA-programmed display of DNA-protein chimeras.

  5. Predicting oligonucleotide affinity to nucleic acid targets.

    PubMed Central

    Mathews, D H; Burkard, M E; Freier, S M; Wyatt, J R; Turner, D H

    1999-01-01

    A computer program, OligoWalk, is reported that predicts the equilibrium affinity of complementary DNA or RNA oligonucleotides to an RNA target. This program considers the predicted stability of the oligonucleotide-target helix and the competition with predicted secondary structure of both the target and the oligonucleotide. Both unimolecular and bimolecular oligonucleotide self structure are considered with a user-defined concentration. The application of OligoWalk is illustrated with three comparisons to experimental results drawn from the literature. PMID:10580474

  6. Gas-phase Reactivity of meta-Benzyne Analogs Toward Small Oligonucleotides of Differing Lengths

    NASA Astrophysics Data System (ADS)

    Widjaja, Fanny; Max, Joann P.; Jin, Zhicheng; Nash, John J.; Kenttämaa, Hilkka I.

    2017-07-01

    The gas-phase reactivity of two aromatic carbon-centered σ,σ-biradicals ( meta-benzyne analogs) and a related monoradical towards small oligonucleotides of differing lengths was investigated in a Fourier-transform ion cyclotron resonance (FT-ICR) mass spectrometer coupled with laser-induced acoustic desorption (LIAD). The mono- and biradicals were positively charged to allow for manipulation in the mass spectrometer. The oligonucleotides were evaporated into the gas phase as intact neutral molecules by using LIAD. One of the biradicals was found to be unreactive. The reactive biradical reacts with dinucleoside phosphates and trinucleoside diphosphates mainly by addition to a nucleobase moiety followed by cleavage of the glycosidic bond, leading to a nucleobase radical (e.g., base-H) abstraction. In some instances, after the initial cleavage, the unquenched radical site of the biradical abstracts a hydrogen atom from the neutral fragment, which results in a net nucleobase abstraction. In sharp contrast, the related monoradical mainly undergoes facile hydrogen atom abstraction from the sugar moiety. As the size of the oligonucleotides increases, the rate of hydrogen atom abstraction from the sugar moiety by the monoradical was found to increase due to the presence of more hydrogen atom donor sites, and it is the only reaction observed for tetranucleoside triphosphates. Hence, the monoradical only attacks sugar moieties in these substrates. The biradical also shows significant attack at the sugar moiety for tetranucleoside triphosphates. This drastic change in reactivity indicates that the size of the oligonucleotides plays a key role in the outcome of these reactions. This finding is attributed to more compact conformations in the gas phase for the tetranucleoside triphosphates than for the smaller oligonucleotides, which result from stronger stabilizing interactions between the nucleobases.

  7. Iontophoretic transport of oligonucleotides across human epidermal membrane: a study of the Nernst-Planck model.

    PubMed

    Li, S K; Ghanem, A H; Teng, C L; Hardee, G E; Higuchi, W I

    2001-07-01

    The objective of this study was to investigate the transport behavior of a series of oligonucleotides with human epidermal membrane (HEM) and to examine the applicability of the modified NERNST-PLANCK model to transdermal iontophoresis of these macromolecules. Iontophoretic transport experiments were first carried out in a synthetic model membrane system (Nuclepore membranes) with a four-electrode potentiostat to examine the baseline modified NERNST-PLANCK model. The modified NERNST-PLANCK model derived from the Einstein relation and the Stokes-Einstein equation taken from previous work did not hold for the oligonucleotides. Results obtained in the Nuclepore studies were, however, consistent with predictions of the modified NERNST-PLANCK model using the experimentally determined electromobilities and diffusion coefficients. The electromobilities of the oligonucleotides (determined by capillary electrophoresis) were found to be more than a factor of two smaller than expected from the Einstein relation between electromobilities and diffusion coefficients (the latter determined in diffusion cell experiments). A correlation between these electromobilities and the theoretical electromobilities estimated by considering the effects of counterion binding and the effects of mobility reduction according to colloid theory was also observed. These results suggest that the modified NERNST-PLANCK model predictions are satisfactory only when the electromobilities and the effective molecular size of the oligonucleotides are known and are used directly to predict the iontophoretically enhanced transport. Results with the HEM experiments generally agreed with model predictions based on the experimental electromobilities. The oligonucleotide HEM flux data also suggest the existence of pores with effective pore radii greater than the effective radii estimated in previous studies with small molecular weight model permeants.

  8. A Flexible Base Electrode Array for Intraspinal Microstimulation

    PubMed Central

    Khaled, I.; Elmallah, S.; Cheng, C.; Moussa, W.A.; Mushahwar, V.K.; Elias, A.L.

    2013-01-01

    In this paper, we report the development of a flexible base array of penetrating electrodes which can be used to interface with the spinal cord. A customizable and feasible fabrication protocol is described. The flexible base arrays were fabricated and implanted into surrogate cords which were elongated by 12%. The resulting strains were optically measured across the cord and compared to those associated with two types of electrodes arrays (one without a base and one with a rigid base connecting the electrodes). The deformation behavior of cords implanted with the flexible base arrays resembled the behavior of cords implanted with individual microwires that were not connected through a base. The results of the strain test were used to validate a 2D finite element model. The validated model was used to assess the stresses induced by the electrodes of the 3 types of arrays on the cord, and to examine how various design parameters (thickness, base modulus, etc.) impact the mechanical behavior of the electrode array. Rigid base arrays induced higher stresses on the cord than the flexible base arrays which in turn imposed higher stresses than the individual microwire implants. The developed flexible base array showed improvement over the rigid base array; however, its stiffness needs to be further reduced to emulate the mechanical behavior of individual microwire arrays without a base. PMID:23744656

  9. Serum protein profiling using an aptamer array predicts clinical outcomes of stage IIA colon cancer: A leave-one-out crossvalidation

    PubMed Central

    Huh, Jung Wook; Kim, Sung Chun; Sohn, Insuk; Jung, Sin-Ho; Kim, Hee Cheol

    2016-01-01

    Background In this study, we established and validated a model for predicting prognosis of stage IIA colon cancer patients based on expression profiles of aptamers in serum. Methods Bloods samples were collected from 227 consecutive patients with pathologic T3N0M0 (stage IIA) colon cancer. We incubated 1,149 serum molecule-binding aptamer pools of clinical significance with serum from patients to obtain aptamers bound to serum molecules, which were then amplified and marked. Oligonucleotide arrays were constructed with the base sequences of the 1,149 aptamers, and the marked products identified above were reacted with one another to produce profiles of the aptamers bound to serum molecules. These profiles were organized into low- and high-risk groups of colon cancer patients based on clinical information for the serum samples. Cox proportional hazards model and leave-one-out cross-validation (LOOCV) were used to evaluate predictive performance. Results During a median follow-up period of 5 years, 29 of the 227 patients (11.9%) experienced recurrence. There were 212 patients (93.4%) in the low-risk group and 15 patients (6.6%) in the high-risk group in our aptamer prognosis model. Postoperative recurrence significantly correlated with age and aptamer risk stratification (p = 0.046 and p = 0.001, respectively). In multivariate analysis, aptamer risk stratification (p < 0.001) was an independent predictor of recurrence. Disease-free survival curves calculated according to aptamer risk level predicted through a LOOCV procedure and age showed significant differences (p < 0.001 from permutations). Conclusion Aptamer risk stratification can be a valuable prognostic factor in stage II colon cancer patients. PMID:26908450

  10. Detection and discrimination of orthopoxviruses using microarrays of immobilized oligonucleotides.

    PubMed

    Laassri, Majid; Chizhikov, Vladimir; Mikheev, Maxim; Shchelkunov, Sergei; Chumakov, Konstantin

    2003-09-01

    Variola virus (VARV), causing smallpox, is a potential biological weapon. Methods to detect VARV rapidly and to differentiate it from other viruses causing similar clinical syndromes are needed urgently. We have developed a new microarray-based method that detects simultaneously and discriminates four orthopoxvirus (OPV) species pathogenic for humans (variola, monkeypox, cowpox, and vaccinia viruses) and distinguishes them from chickenpox virus (varicella-zoster virus or VZV). The OPV gene C23L/B29R, encoding the CC-chemokine binding protein, was sequenced for 41 strains of seven species of orthopox viruses obtained from different geographical regions. Those C23L/B29R sequences and the ORF 62 sequences from 13 strains of VZV (selected from GenBank) were used to design oligonucleotide probes that were immobilized on an aldehyde-coated glass surface (a total of 57 probes). The microchip contained several unique 13-21 bases long oligonucleotide probes specific to each virus species to ensure redundancy and robustness of the assay. A region approximately 1100 bases long was amplified from samples of viral DNA and fluorescently labeled with Cy5-modified dNTPs, and single-stranded DNA was prepared by strand separation. Hybridization was carried out under plastic coverslips, resulting in a fluorescent pattern that was quantified using a confocal laser scanner. 49 known and blinded samples of OPV DNA, representing different OPV species, and two VZV strains were tested. The oligonucleotide microarray hybridization technique identified reliably and correctly all samples. This new procedure takes only 3 h, and it can be used for parallel testing of multiple samples.

  11. DNA-binding and oxidative properties of cationic phthalocyanines and their dimeric complexes with anionic phthalocyanines covalently linked to oligonucleotides.

    PubMed

    Kuznetsova, A A; Lukyanets, E A; Solovyeva, L I; Knorre, D G; Fedorova, O S

    2008-12-01

    Design of chemically modified oligonucleotides for regulation of gene expression has attracted considerable attention over the past decades. One actively pursued approach involves antisense or antigene oligonucleotide constructs carrying reactive groups, many of these based on transition metal complexes. The complexes of Fe(II) and Co(II) with phthalocyanines are extremely good catalysts of oxidation of organic compounds with molecular oxygen and hydrogen peroxide. The binding of positively charged Fe(II) and Co(II) phthalocyanines with single- and double-stranded DNA was investigated. It was shown that these phthalocyanines interact with nucleic acids through an outside binding mode. The site-directed modification of single-stranded DNA by O2 and H2O2 in the presence of dimeric complexes of negatively and positively charged Fe(II) and Co(II) phthalocyanines was investigated. These complexes were formed directly on single-stranded DNA through interaction between negatively charged phthalocyanine in conjugate and positively charged phthalocyanine in solution. The resulting oppositely charged phthalocyanine complexes showed significant increase of catalytic activity compared with monomeric forms of phthalocyanines Fe(II) and Co(II). These complexes catalyzed the DNA oxidation with high efficacy and led to direct DNA strand cleavage. It was determined that oxidation of DNA by molecular oxygen catalyzed by complex of Fe(II)-phthalocyanines proceeds with higher rate than in the case of Co(II)-phthalocyanines but the latter led to a greater extent of target DNA modification.

  12. Solid-state probe based electrochemical aptasensor for cocaine: a potentially convenient, sensitive, repeatable, and integrated sensing platform for drugs.

    PubMed

    Du, Yan; Chen, Chaogui; Yin, Jianyuan; Li, Bingling; Zhou, Ming; Dong, Shaojun; Wang, Erkang

    2010-02-15

    Aptamers, which are artificial oligonucleotides selected in vitro, have been employed to design novel biosensors (i.e., aptasensors). In this work, we first constructed a label-free electrochemical aptasensor introducing a probe immobilization technique by the use of a layer-by-layer (LBL) self-assembled multilayer with ferrocene-appended poly(ethyleneimine) (Fc-PEI) on an indium tin oxide (ITO) array electrode for detection of cocaine. The Fc-PEI and gold nanoparticles (AuNPs) were LBL assembled on the electrode surface via electrostatic interaction. Then, cocaine aptamer fragments, SH-C2, were covalently labeled onto the outermost AuNP layer. When the target cocaine and cocaine aptamer C1 were present simultaneously, the SH-C2 layer hybridized partly with C1 to bind the cocaine, which led to a decreased differential pulse voltammetry (DPV) signal of Fc-PEI. This DPV signal change could be used to sensitively detect cocaine with the lowest detectable concentration down to 0.1 microM and the detection range up to 38.8 microM, which falls in the the expected range for medical use of detecting drug abuse involving cocaine. Meanwhile, the sensor was specific to cocaine in complex biologic fluids such as human plasma, human saliva, etc. The sensing strategy had general applicability, and the detection of thrombin could also be realized, displayed a low detection limit, and exhibited worthiness to other analytes. The aptasensor based on the array electrode held promising potential for integration of the sensing ability in multianalysis for simultaneous detection.

  13. Development of a genotyping microarray for Usher syndrome.

    PubMed

    Cremers, Frans P M; Kimberling, William J; Külm, Maigi; de Brouwer, Arjan P; van Wijk, Erwin; te Brinke, Heleen; Cremers, Cor W R J; Hoefsloot, Lies H; Banfi, Sandro; Simonelli, Francesca; Fleischhauer, Johannes C; Berger, Wolfgang; Kelley, Phil M; Haralambous, Elene; Bitner-Glindzicz, Maria; Webster, Andrew R; Saihan, Zubin; De Baere, Elfride; Leroy, Bart P; Silvestri, Giuliana; McKay, Gareth J; Koenekoop, Robert K; Millan, Jose M; Rosenberg, Thomas; Joensuu, Tarja; Sankila, Eeva-Marja; Weil, Dominique; Weston, Mike D; Wissinger, Bernd; Kremer, Hannie

    2007-02-01

    Usher syndrome, a combination of retinitis pigmentosa (RP) and sensorineural hearing loss with or without vestibular dysfunction, displays a high degree of clinical and genetic heterogeneity. Three clinical subtypes can be distinguished, based on the age of onset and severity of the hearing impairment, and the presence or absence of vestibular abnormalities. Thus far, eight genes have been implicated in the syndrome, together comprising 347 protein-coding exons. To improve DNA diagnostics for patients with Usher syndrome, we developed a genotyping microarray based on the arrayed primer extension (APEX) method. Allele-specific oligonucleotides corresponding to all 298 Usher syndrome-associated sequence variants known to date, 76 of which are novel, were arrayed. Approximately half of these variants were validated using original patient DNAs, which yielded an accuracy of >98%. The efficiency of the Usher genotyping microarray was tested using DNAs from 370 unrelated European and American patients with Usher syndrome. Sequence variants were identified in 64/140 (46%) patients with Usher syndrome type I, 45/189 (24%) patients with Usher syndrome type II, 6/21 (29%) patients with Usher syndrome type III and 6/20 (30%) patients with atypical Usher syndrome. The chip also identified two novel sequence variants, c.400C>T (p.R134X) in PCDH15 and c.1606T>C (p.C536S) in USH2A. The Usher genotyping microarray is a versatile and affordable screening tool for Usher syndrome. Its efficiency will improve with the addition of novel sequence variants with minimal extra costs, making it a very useful first-pass screening tool.

  14. Development of a genotyping microarray for Usher syndrome

    PubMed Central

    Cremers, Frans P M; Kimberling, William J; Külm, Maigi; de Brouwer, Arjan P; van Wijk, Erwin; te Brinke, Heleen; Cremers, Cor W R J; Hoefsloot, Lies H; Banfi, Sandro; Simonelli, Francesca; Fleischhauer, Johannes C; Berger, Wolfgang; Kelley, Phil M; Haralambous, Elene; Bitner‐Glindzicz, Maria; Webster, Andrew R; Saihan, Zubin; De Baere, Elfride; Leroy, Bart P; Silvestri, Giuliana; McKay, Gareth J; Koenekoop, Robert K; Millan, Jose M; Rosenberg, Thomas; Joensuu, Tarja; Sankila, Eeva‐Marja; Weil, Dominique; Weston, Mike D; Wissinger, Bernd; Kremer, Hannie

    2007-01-01

    Background Usher syndrome, a combination of retinitis pigmentosa (RP) and sensorineural hearing loss with or without vestibular dysfunction, displays a high degree of clinical and genetic heterogeneity. Three clinical subtypes can be distinguished, based on the age of onset and severity of the hearing impairment, and the presence or absence of vestibular abnormalities. Thus far, eight genes have been implicated in the syndrome, together comprising 347 protein‐coding exons. Methods: To improve DNA diagnostics for patients with Usher syndrome, we developed a genotyping microarray based on the arrayed primer extension (APEX) method. Allele‐specific oligonucleotides corresponding to all 298 Usher syndrome‐associated sequence variants known to date, 76 of which are novel, were arrayed. Results Approximately half of these variants were validated using original patient DNAs, which yielded an accuracy of >98%. The efficiency of the Usher genotyping microarray was tested using DNAs from 370 unrelated European and American patients with Usher syndrome. Sequence variants were identified in 64/140 (46%) patients with Usher syndrome type I, 45/189 (24%) patients with Usher syndrome type II, 6/21 (29%) patients with Usher syndrome type III and 6/20 (30%) patients with atypical Usher syndrome. The chip also identified two novel sequence variants, c.400C>T (p.R134X) in PCDH15 and c.1606T>C (p.C536S) in USH2A. Conclusion The Usher genotyping microarray is a versatile and affordable screening tool for Usher syndrome. Its efficiency will improve with the addition of novel sequence variants with minimal extra costs, making it a very useful first‐pass screening tool. PMID:16963483

  15. 1H NMR studies of the 5-(hydroxymethyl)-2'-deoxyuridine containing TF1 binding site.

    PubMed

    Pasternack, L B; Bramham, J; Mayol, L; Galeone, A; Jia, X; Kearns, D R

    1996-07-15

    The pyrimidine base 5-(hydroxymethyl)-2'-deoxyuridine (HmU) is a common nucleotide in SPO1 phage DNA. Numerous transcriptional proteins bind HmU-containing DNA preferentially implicating a regulatory function of HmU. We have investigated the conformation and dynamics of d-(5'-CHmUCHmUACACGHmUGHmUAGAG-OH-3')2 (HmU-DNA). This oligonucleotide mimics the consensus sequence of Transcription Factor 1 (TF1). The HmU-DNA was compared to the thymine-containing oligonucleotide. NOESY and DQF COSY spectroscopy provided resonance assignments of nonexchangeable and exchangeable protons, intranucleotide, internucleotide and intrastrand proton-proton distances, and dihedral angle constraints. Methylene protons of the hydroxymethyl group are nonequivalent protons and the hydroxymethyl group is not freely rotating. The hydroxymethyl group adopts a specific orientation with the OH group oriented on the 3' side of the plane of the base. Analysis of imino proton resonances and NOEs indicates additional end base pair fraying and a temperature-induced transition to a conformation in which the internal HmU-A base pairs are disrupted or have reduced lifetimes. Orientation of the hydroxymethyl group indicates the presence of internucleotide intrastrand hydrogen bonding between the HmU12C5 hydroxyl group and A13. All sugars in both DNAs show a C2'endo conformation (typical of B-DNA).

  16. Intravenous administration of stabilized antisense lipid particles (SALP) leads to activation and expansion of liver natural killer cells.

    PubMed

    Bramson, J L; Bodner, C A; Johnson, J; Semple, S; Hope, M J

    2000-06-01

    Stabilized antisense lipid particles (SALP) have been developed for the systemic delivery of oligonucleotides. The impact of intravenous SALP administration was measured with respect to activation of natural killer (NK) and NK1.1+ T (NKT) cells in the livers of immunocompetent mice. Treatment with a SALP containing a highly mitogenic oligonucleotide (INX-6295) generated an increase in NK cytolytic activity and cell number within the liver but did not appear to affect the number of hepatic NKT cells or their cytolytic activity. The same results were observed after intravenous administration of the mitogenic oligonucleotide alone. Interestingly, treatment with a SALP containing a weakly mitogenic oligonucleotide (INX-6300) also activated the liver NK cells, whereas the oligonucleotide alone was unable to elicit these effects. The NK stimulatory activity of a SALP containing INX-6300 required both lipid and oligonucleotide components. These results demonstrate that in addition to modifying the pharmacokinetics and biodistribution of intravenously administered oligonucleotides, SALP possess immunostimulatory activity independent of oligonucleotide mitogenicity, which can serve as an adjuvant to antisense therapies for cancer.

  17. Genotyping microarray (gene chip) for the ABCR (ABCA4) gene.

    PubMed

    Jaakson, K; Zernant, J; Külm, M; Hutchinson, A; Tonisson, N; Glavac, D; Ravnik-Glavac, M; Hawlina, M; Meltzer, M R; Caruso, R C; Testa, F; Maugeri, A; Hoyng, C B; Gouras, P; Simonelli, F; Lewis, R A; Lupski, J R; Cremers, F P M; Allikmets, R

    2003-11-01

    Genetic variation in the ABCR (ABCA4) gene has been associated with five distinct retinal phenotypes, including Stargardt disease/fundus flavimaculatus (STGD/FFM), cone-rod dystrophy (CRD), and age-related macular degeneration (AMD). Comparative genetic analyses of ABCR variation and diagnostics have been complicated by substantial allelic heterogeneity and by differences in screening methods. To overcome these limitations, we designed a genotyping microarray (gene chip) for ABCR that includes all approximately 400 disease-associated and other variants currently described, enabling simultaneous detection of all known ABCR variants. The ABCR genotyping microarray (the ABCR400 chip) was constructed by the arrayed primer extension (APEX) technology. Each sequence change in ABCR was included on the chip by synthesis and application of sequence-specific oligonucleotides. We validated the chip by screening 136 confirmed STGD patients and 96 healthy controls, each of whom we had analyzed previously by single strand conformation polymorphism (SSCP) technology and/or heteroduplex analysis. The microarray was >98% effective in determining the existing genetic variation and was comparable to direct sequencing in that it yielded many sequence changes undetected by SSCP. In STGD patient cohorts, the efficiency of the array to detect disease-associated alleles was between 54% and 78%, depending on the ethnic composition and degree of clinical and molecular characterization of a cohort. In addition, chip analysis suggested a high carrier frequency (up to 1:10) of ABCR variants in the general population. The ABCR genotyping microarray is a robust, cost-effective, and comprehensive screening tool for variation in one gene in which mutations are responsible for a substantial fraction of retinal disease. The ABCR chip is a prototype for the next generation of screening and diagnostic tools in ophthalmic genetics, bridging clinical and scientific research. Copyright 2003 Wiley-Liss, Inc.

  18. Hydrated electrons react with high specificity with cisplatin bound to single-stranded DNA.

    PubMed

    Behmand, B; Cloutier, P; Girouard, S; Wagner, J R; Sanche, L; Hunting, D J

    2013-12-19

    Short oligonucleotides TTTTTGTGTTT and TTTTTTTGTTT in solution with and without cisplatin (cisPt) bound to the guanine bases were irradiated with γ-rays at doses varying from 0 to 2500 Gy. To determine the effect of hydrated electrons from water radiolysis on the oligonucleotides, we quenched (•)OH radicals with ethylenediaminetetraacetic acid (EDTA) and displaced oxygen, which reacts with hydrated electrons, by bubbling the solution with wet nitrogen. DNA strand breaks and platinum detachment were quantified by gel electrophoresis. Our results demonstrate that hydrated electrons react almost exclusively at the position of the cisPt adduct, where they induce cisPt detachment from one or both guanines in the oligonucleotide. Given the high yield of hydrated electrons in irradiated tissues, this reaction may be an important step in the mechanism of radiosensitization of DNA by cisPt.

  19. Sieve-based device for MALDI sample preparation. I. Influence of sample deposition conditions in oligonucleotide analysis to achieve significant increases in both sensitivity and resolution.

    PubMed

    Molin, Laura; Cristoni, Simone; Crotti, Sara; Bernardi, Luigi Rossi; Seraglia, Roberta; Traldi, Pietro

    2008-11-01

    Spraying of oligonucleotide-matrix solutions through a stainless steel (ss) sieve (38 microm, 450 mesh) leads to the formation, on the matrix-assisted laser desorption/ionization (MALDI) sample holder, of uniformly distributed microcrystals, well separated from each other. When the resulting sample holder surface is irradiated by laser, abundant molecular species form, with a clear increase in both intensity and resolution with respect to values obtained by 'Dried Droplet', 'Double Layer', and 'Sandwich' deposition methods. In addition, unlike the usual situation, the sample is perfectly homogeneous, and identical spectra are obtained by irradiating different areas. On one hand, the data indicate that this method is highly effective for oligonucleotide MALDI analysis, and on the other, that it can be validly employed for fully automated MALDI procedures.

  20. Estrogen effects on cognition and hippocampal transcription in middle-aged mice.

    PubMed

    Aenlle, Kristina K; Kumar, Ashok; Cui, Li; Jackson, Travis C; Foster, Thomas C

    2009-06-01

    Young and middle-aged female mice were ovariectomized and given cyclic injections of either estradiol or vehicle treatments. During the fifth week after surgery the Morris water maze was used to assess cognitive function. Age and treatment effects emerged over the course of spatial training such that middle-aged vehicle treated mice exhibited deficits in acquiring a spatial search strategy compared to younger vehicle treated mice and middle-age estradiol treated mice. Following behavioral characterization, mice were maintained on their injection schedule until week seven and hippocampi were collected 24h after the last injection. Hippocampal RNA was extracted and genes responsive to age and estrogen were identified using cDNA microarrays. Estradiol treatment in middle-aged mice altered the expression of genes related to transcriptional regulation, biosynthesis, growth, neuroprotection, and elements of cell signaling pathways. Expression profiles for representative genes were confirmed in a separate set of animals using oligonucleotide arrays and RT-PCR. Our results indicate that estrogen treatment in middle-aged animals may promote hippocampal health during the aging process.

  1. Prebiotic chemistry and nucleic acid replication

    NASA Technical Reports Server (NTRS)

    Orgel, L. E.; Lohrmann, R.

    1974-01-01

    Recent work is reviewed on some reactions that could have occurred on the primitive earth and that could have played a part in the evolution of a self-replicating system. The transition from the primitive atmosphere to the simplest replicating molecules is considered in four stages: (1) the formation of a 'prebiotic soup' of organic precursors, including the purine and pyrimidine bases and the pentose sugars; (2) the condensation of these precursors and inorganic phosphate to form monomeric nucleotides and activated nucleotide derivatives; (3) the polymerization of nucleotide derivatives to oligonucleotides; and (4) the complementary replication of oligonucleotides in a template-directed process that depends on Watson-Crick base pairing.

  2. Proposed Array-based Deep Space Network for NASA

    NASA Technical Reports Server (NTRS)

    Bagri, Durgadas S.; Statman, Joseph I.; Gatti, Mark S.

    2007-01-01

    The current assets of the Deep Space Network (DSN) of the National Aeronautics and Space Administration (NASA), especially the 70-m antennas, are aging and becoming less reliable. Furthermore, they are expensive to operate and difficult to upgrade for operation at Ka-band (321 GHz). Replacing them with comparable monolithic large antennas would be expensive. On the other hand, implementation of similar high-sensitivity assets can be achieved economically using an array-based architecture, where sensitivity is measured by G/T, the ratio of antenna gain to system temperature. An array-based architecture would also provide flexibility in operations and allow for easy addition of more G/T whenever required. Therefore, an array-based plan of the next-generation DSN for NASA has been proposed. The DSN array would provide more flexible downlink capability compared to the current DSN for robust telemetry, tracking and command services to the space missions of NASA and its international partners in a cost effective way. Instead of using the array as an element of the DSN and relying on the existing concept of operation, we explore a broader departure in establishing a more modern concept of operations to reduce the operations costs. This paper presents the array-based architecture for the next generation DSN. It includes system block diagram, operations philosophy, user's view of operations, operations management, and logistics like maintenance philosophy and anomaly analysis and reporting. To develop the various required technologies and understand the logistics of building the array-based lowcost system, a breadboard array of three antennas has been built. This paper briefly describes the breadboard array system and its performance.

  3. Comparable stability of Hoogsteen and Watson-Crick base pairs in ionic liquid choline dihydrogen phosphate.

    PubMed

    Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki

    2014-01-08

    The instability of Hoogsteen base pairs relative to Watson-Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson-Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson-Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo.

  4. Comparable Stability of Hoogsteen and Watson–Crick Base Pairs in Ionic Liquid Choline Dihydrogen Phosphate

    PubMed Central

    Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki

    2014-01-01

    The instability of Hoogsteen base pairs relative to Watson–Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson–Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson–Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo. PMID:24399194

  5. A high-resolution, nucleosome position map of C. elegans reveals a lack of universal sequence-dictated positioning

    PubMed Central

    Valouev, Anton; Ichikawa, Jeffrey; Tonthat, Thaisan; Stuart, Jeremy; Ranade, Swati; Peckham, Heather; Zeng, Kathy; Malek, Joel A.; Costa, Gina; McKernan, Kevin; Sidow, Arend; Fire, Andrew; Johnson, Steven M.

    2008-01-01

    Using the massively parallel technique of sequencing by oligonucleotide ligation and detection (SOLiD; Applied Biosystems), we have assessed the in vivo positions of more than 44 million putative nucleosome cores in the multicellular genetic model organism Caenorhabditis elegans. These analyses provide a global view of the chromatin architecture of a multicellular animal at extremely high density and resolution. While we observe some degree of reproducible positioning throughout the genome in our mixed stage population of animals, we note that the major chromatin feature in the worm is a diversity of allowed nucleosome positions at the vast majority of individual loci. While absolute positioning of nucleosomes can vary substantially, relative positioning of nucleosomes (in a repeated array structure likely to be maintained at least in part by steric constraints) appears to be a significant property of chromatin structure. The high density of nucleosomal reads enabled a substantial extension of previous analysis describing the usage of individual oligonucleotide sequences along the span of the nucleosome core and linker. We release this data set, via the UCSC Genome Browser, as a resource for the high-resolution analysis of chromatin conformation and DNA accessibility at individual loci within the C. elegans genome. PMID:18477713

  6. Discovery and mapping of single feature polymorphisms in wheat using Affymetrix arrays

    PubMed Central

    Bernardo, Amy N; Bradbury, Peter J; Ma, Hongxiang; Hu, Shengwa; Bowden, Robert L; Buckler, Edward S; Bai, Guihua

    2009-01-01

    Background Wheat (Triticum aestivum L.) is a staple food crop worldwide. The wheat genome has not yet been sequenced due to its huge genome size (~17,000 Mb) and high levels of repetitive sequences; the whole genome sequence may not be expected in the near future. Available linkage maps have low marker density due to limitation in available markers; therefore new technologies that detect genome-wide polymorphisms are still needed to discover a large number of new markers for construction of high-resolution maps. A high-resolution map is a critical tool for gene isolation, molecular breeding and genomic research. Single feature polymorphism (SFP) is a new microarray-based type of marker that is detected by hybridization of DNA or cRNA to oligonucleotide probes. This study was conducted to explore the feasibility of using the Affymetrix GeneChip to discover and map SFPs in the large hexaploid wheat genome. Results Six wheat varieties of diverse origins (Ning 7840, Clark, Jagger, Encruzilhada, Chinese Spring, and Opata 85) were analyzed for significant probe by variety interactions and 396 probe sets with SFPs were identified. A subset of 164 unigenes was sequenced and 54% showed polymorphism within probes. Microarray analysis of 71 recombinant inbred lines from the cross Ning 7840/Clark identified 955 SFPs and 877 of them were mapped together with 269 simple sequence repeat markers. The SFPs were randomly distributed within a chromosome but were unevenly distributed among different genomes. The B genome had the most SFPs, and the D genome had the least. Map positions of a selected set of SFPs were validated by mapping single nucleotide polymorphism using SNaPshot and comparing with expressed sequence tags mapping data. Conclusion The Affymetrix array is a cost-effective platform for SFP discovery and SFP mapping in wheat. The new high-density map constructed in this study will be a useful tool for genetic and genomic research in wheat. PMID:19480702

  7. 5' modification of duplex DNA with a ruthenium electron donor-acceptor pair using solid-phase DNA synthesis

    NASA Technical Reports Server (NTRS)

    Frank, Natia L.; Meade, Thomas J.

    2003-01-01

    Incorporation of metalated nucleosides into DNA through covalent modification is crucial to measurement of thermal electron-transfer rates and the dependence of these rates with structure, distance, and position. Here, we report the first synthesis of an electron donor-acceptor pair of 5' metallonucleosides and their subsequent incorporation into oligonucleotides using solid-phase DNA synthesis techniques. Large-scale syntheses of metal-containing oligonucleotides are achieved using 5' modified phosporamidites containing [Ru(acac)(2)(IMPy)](2+) (acac is acetylacetonato; IMPy is 2'-iminomethylpyridyl-2'-deoxyuridine) (3) and [Ru(bpy)(2)(IMPy)](2+) (bpy is 2,2'-bipyridine; IMPy is 2'-iminomethylpyridyl-2'-deoxyuridine) (4). Duplexes formed with the metal-containing oligonucleotides exhibit thermal stability comparable to the corresponding unmetalated duplexes (T(m) of modified duplex = 49 degrees C vs T(m) of unmodified duplex = 47 degrees C). Electrochemical (3, E(1/2) = -0.04 V vs NHE; 4, E(1/2) = 1.12 V vs NHE), absorption (3, lambda(max) = 568, 369 nm; 4, lambda(max) = 480 nm), and emission (4, lambda(max) = 720 nm, tau = 55 ns, Phi = 1.2 x 10(-)(4)) data for the ruthenium-modified nucleosides and oligonucleotides indicate that incorporation into an oligonucleotide does not perturb the electronic properties of the ruthenium complex or the DNA significantly. In addition, the absence of any change in the emission properties upon metalated duplex formation suggests that the [Ru(bpy)(2)(IMPy)](2+)[Ru(acac)(2)(IMPy)](2+) pair will provide a valuable probe for DNA-mediated electron-transfer studies.

  8. Colloidal silica films for high-capacity DNA arrays

    NASA Astrophysics Data System (ADS)

    Glazer, Marc Irving

    The human genome project has greatly expanded the amount of genetic information available to researchers, but before this vast new source of data can be fully utilized, techniques for rapid, large-scale analysis of DNA and RNA must continue to develop. DNA arrays have emerged as a powerful new technology for analyzing genomic samples in a highly parallel format. The detection sensitivity of these arrays is dependent on the quantity and density of immobilized probe molecules. We have investigated substrates with a porous, "three-dimensional" surface layer as a means of increasing the surface area available for the synthesis of oligonucleotide probes, thereby increasing the number of available probes and the amount of detectable bound target. Porous colloidal silica films were created by two techniques. In the first approach, films were deposited by spin-coating silica colloid suspensions onto flat glass substrates, with the pores being formed by the natural voids between the solid particles (typically 23nm pores, 35% porosity). In the second approach, latex particles were co-deposited with the silica and then pyrolyzed, creating films with larger pores (36 nm), higher porosity (65%), and higher surface area. For 0.3 mum films, enhancements of eight to ten-fold and 12- to 14-fold were achieved with the pure silica films and the films "templated" with polymer latex, respectively. In gene expression assays for up to 7,000 genes using complex biological samples, the high-capacity films provided enhanced signals and performed equivalently or better than planar glass on all other functional measures, confirming that colloidal silica films are a promising platform for high-capacity DNA arrays. We have also investigated the kinetics of hybridization on planar glass and high-capacity substrates. Adsorption on planar arrays is similar to ideal Langmuir-type adsorption, although with an "overshoot" at high solution concentration. Hybridization on high-capacity films is controlled by traditional adsorption (ka) and desorption (kd) coefficients, as well as morphology factors and transient binding interactions between the target and probes. The strength of the transient probe/target binding interactions are on the order of 5--7 DNA base pairs, which suggests the formation of nucleation or other metastable complexes, rather than fully-zippered duplexes.

  9. Drop drying on surfaces determines chemical reactivity - the specific case of immobilization of oligonucleotides on microarrays

    PubMed Central

    2013-01-01

    Background Drop drying is a key factor in a wide range of technical applications, including spotted microarrays. The applied nL liquid volume provides specific reaction conditions for the immobilization of probe molecules to a chemically modified surface. Results We investigated the influence of nL and μL liquid drop volumes on the process of probe immobilization and compare the results obtained to the situation in liquid solution. In our data, we observe a strong relationship between drop drying effects on immobilization and surface chemistry. In this work, we present results on the immobilization of dye labeled 20mer oligonucleotides with and without an activating 5′-aminoheptyl linker onto a 2D epoxysilane and a 3D NHS activated hydrogel surface. Conclusions Our experiments identified two basic processes determining immobilization. First, the rate of drop drying that depends on the drop volume and the ambient relative humidity. Oligonucleotides in a dried spot react unspecifically with the surface and long reaction times are needed. 3D hydrogel surfaces allow for immobilization in a liquid environment under diffusive conditions. Here, oligonucleotide immobilization is much faster and a specific reaction with the reactive linker group is observed. Second, the effect of increasing probe concentration as a result of drop drying. On a 3D hydrogel, the increasing concentration of probe molecules in nL spotting volumes accelerates immobilization dramatically. In case of μL volumes, immobilization depends on whether the drop is allowed to dry completely. At non-drying conditions, very limited immobilization is observed due to the low oligonucleotide concentration used in microarray spotting solutions. The results of our study provide a general guideline for microarray assay development. They allow for the initial definition and further optimization of reaction conditions for the immobilization of oligonucleotides and other probe molecule classes to different surfaces in dependence of the applied spotting and reaction volume. PMID:23758982

  10. Giant magnetoresistive biosensors for molecular diagnosis: surface chemistry and assay development

    NASA Astrophysics Data System (ADS)

    Yu, Heng; Osterfeld, Sebastian J.; Xu, Liang; White, Robert L.; Pourmand, Nader; Wang, Shan X.

    2008-08-01

    Giant magnetoresistive (GMR) biochips using magnetic nanoparticle as labels were developed for molecular diagnosis. The sensor arrays consist of GMR sensing strips of 1.5 μm or 0.75 μm in width. GMR sensors are exquisitely sensitive yet very delicate, requiring ultrathin corrosion-resistive passivation and efficient surface chemistry for oligonucleotide probe immobilization. A mild and stable surface chemistry was first developed that is especially suitable for modifying delicate electronic device surfaces, and a practical application of our GMR biosensors was then demonstrated for detecting four most common human papillomavirus (HPV) subtypes in plasmids. We also showed that the DNA hybridization time could potentially be reduced from overnight to about ten minutes using microfluidics.

  11. Photo-Induced Click Chemistry for DNA Surface Structuring by Direct Laser Writing.

    PubMed

    Kerbs, Antonina; Mueller, Patrick; Kaupp, Michael; Ahmed, Ishtiaq; Quick, Alexander S; Abt, Doris; Wegener, Martin; Niemeyer, Christof M; Barner-Kowollik, Christopher; Fruk, Ljiljana

    2017-04-11

    Oligonucleotides containing photo-caged dienes were prepared and shown to react quantitatively in a light-induced Diels-Alder cycloaddition with functional maleimides in aqueous solution within minutes. Due to its high yield and fast rate, the reaction was exploited for DNA surface patterning with sub-micrometer resolution employing direct laser writing (DLW). Functional DNA arrays were written by direct laser writing (DLW) in variable patterns, which were further encoded with fluorophores and proteins through DNA directed immobilization. This mild and efficient light-driven platform technology holds promise for the fabrication of complex bioarrays with sub-micron resolution. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Parallel gene analysis with allele-specific padlock probes and tag microarrays

    PubMed Central

    Banér, Johan; Isaksson, Anders; Waldenström, Erik; Jarvius, Jonas; Landegren, Ulf; Nilsson, Mats

    2003-01-01

    Parallel, highly specific analysis methods are required to take advantage of the extensive information about DNA sequence variation and of expressed sequences. We present a scalable laboratory technique suitable to analyze numerous target sequences in multiplexed assays. Sets of padlock probes were applied to analyze single nucleotide variation directly in total genomic DNA or cDNA for parallel genotyping or gene expression analysis. All reacted probes were then co-amplified and identified by hybridization to a standard tag oligonucleotide array. The technique was illustrated by analyzing normal and pathogenic variation within the Wilson disease-related ATP7B gene, both at the level of DNA and RNA, using allele-specific padlock probes. PMID:12930977

  13. Beam wander of coherent and partially coherent Airy beam arrays in a turbulent atmosphere

    NASA Astrophysics Data System (ADS)

    Wen, Wei; Jin, Ying; Hu, Mingjun; Liu, Xianlong; Cai, Yangjian; Zou, Chenjuan; Luo, Mi; Zhou, Liwang; Chu, Xiuxiang

    2018-05-01

    The beam wander properties of coherent and partially coherent Airy beam arrays in a turbulent atmosphere are investigated. Based on the analytical results, we find that the beam wander of partially coherent Airy beam arrays is significantly reduced compared with the wander of a partially coherent Airy beam by numerical simulation. Moreover, the beam wander of a 2 × 2 partially coherent Airy beam arrays is significantly reduced compared with the wander of a 2 × 2 partially coherent Gaussian beam arrays. By using the definition of beam wander arrays factor which is used to characterize the capability of beam arrays for reducing the beam wander effect compared with a single beam, we find that the arrays factor of partially coherent Airy beam arrays is significantly less than that of partially coherent Gaussian beam arrays with the same arrays order. We also find that an artificial reduction of the initial coherence of laser arrays can be used to decrease the beam wander effect. These results indicate that the partially coherent Airy beam arrays have potential applications in long-distance free-space optical communications.

  14. Insights to primitive replication derived from structures of small oligonucleotides

    NASA Technical Reports Server (NTRS)

    Smith, G. K.; Fox, G. E.

    1995-01-01

    Available information on the structure of small oligonucleotides is surveyed. It is observed that even small oligomers typically exhibit defined structures over a wide range of pH and temperature. These structures rely on a plethora of non-standard base-base interactions in addition to the traditional Watson-Crick pairings. Stable duplexes, though typically antiparallel, can be parallel or staggered and perfect complementarity is not essential. These results imply that primitive template directed reactions do not require high fidelity. Hence, the extensive use of Watson-Crick complementarity in genes rather than being a direct consequence of the primitive condensation process, may instead reflect subsequent selection based on the advantage of accuracy in maintaining the primitive genetic machinery once it arose.

  15. High-Throughput Identification of Combinatorial Ligands for DNA Delivery in Cell Culture

    NASA Astrophysics Data System (ADS)

    Svahn, Mathias G.; Rabe, Kersten S.; Barger, Geoffrey; EL-Andaloussi, Samir; Simonson, Oscar E.; Didier, Boturyn; Olivier, Renaudet; Dumy, Pascal; Brandén, Lars J.; Niemeyer, Christof M.; Smith, C. I. Edvard

    2008-10-01

    Finding the optimal combinations of ligands for tissue-specific delivery is tedious even if only a few well-established compounds are tested. The cargo affects the receptor-ligand interaction, especially when it is charged like DNA. The ligand should therefore be evaluated together with its cargo. Several viruses have been shown to interact with more than one receptor, for efficient internalization. We here present a DNA oligonucleotide-based method for inexpensive and rapid screening of biotin labeled ligands for combinatorial effects on cellular binding and uptake. The oligonucleotide complex was designed as a 44 bp double-stranded DNA oligonucleotide with one central streptavidin molecule and a second streptavidin at the terminus. The use of a highly advanced robotic platform ensured stringent processing and execution of the experiments. The oligonucleotides were fluorescently labeled and used for detection and analysis of cell-bound, internalized and intra-cellular compartmentalized constructs by an automated line-scanning confocal microscope, IN Cell Analyzer 3000. All possible combinations of 22 ligands were explored in sets of 2 and tested on 6 different human cell lines in triplicates. In total, 10 000 transfections were performed on the automation platform. Cell-specific combinations of ligands were identified and their relative position on the scaffold oligonucleotide was found to be of importance. The ligands were found to be cargo dependent, carbohydrates were more potent for DNA delivery whereas cell penetrating peptides were more potent for delivery of less charged particles.

  16. The hormone response element mimic sequence of GAS5 lncRNA is sufficient to induce apoptosis in breast cancer cells

    PubMed Central

    Pickard, Mark R.; Williams, Gwyn T.

    2016-01-01

    Growth arrest-specific 5 (GAS5) lncRNA promotes apoptosis, and its expression is down-regulated in breast cancer. GAS5 lncRNA is a decoy of glucocorticoid/related receptors; a stem-loop sequence constitutes the GAS5 hormone response element mimic (HREM), which is essential for the regulation of breast cancer cell apoptosis. This preclinical study aimed to determine if the GAS5 HREM sequence alone promotes the apoptosis of breast cancer cells. Nucleofection of hormone-sensitive and –insensitive breast cancer cell lines with a GAS5 HREM DNA oligonucleotide increased both basal and ultraviolet-C-induced apoptosis, and decreased culture viability and clonogenic growth, similar to GAS5 lncRNA. The HREM oligonucleotide demonstrated similar sequence specificity to the native HREM for its functional activity and had no effect on endogenous GAS5 lncRNA levels. Certain chemically modified HREM oligonucleotides, notably DNA and RNA phosphorothioates, retained pro-apoptotic. activity. Crucially the HREM oligonucleotide could overcome apoptosis resistance secondary to deficient endogenous GAS5 lncRNA levels. Thus, the GAS5 lncRNA HREM sequence alone is sufficient to induce apoptosis in breast cancer cells, including triple-negative breast cancer cells. These findings further suggest that emerging knowledge of structure/function relationships in the field of lncRNA biology can be exploited for the development of entirely novel, oligonucleotide mimic-based, cancer therapies. PMID:26862727

  17. Cisplatin intrastrand adducts sensitize DNA to base damage by hydrated electrons.

    PubMed

    Behmand, B; Wagner, J R; Sanche, L; Hunting, D J

    2014-05-08

    The oligonucleotide TTTTTGTGTTT with or without a cisplatin adduct was reacted with hydrated electrons generated by ionizing radiation. Hydroxyl radicals were quenched with ethylenediaminetetraacetic acid (EDTA), and the solutions were bubbled with wet nitrogen to eliminate oxygen, a scavenger of hydrated electrons. Prior to irradiation, the structure of the initial cisplatin adduct was identified by mass spectrometry as G-cisplatin-G. Radiation damage to DNA bases was quantified by high-performance liquid chromatography (HPLC), after enzymatic digestion of the TTTTTGTGTTT-cisplatin complex to deoxyribonucleosides. The masses of the platinum adducts following digestion and separation by HPLC were measured by mass spectrometry. Our results demonstrate that hydrated electrons induce damage to thymines as well as detachment of the cisplatin moiety from both guanines in the oligonucleotide. This detachment regenerates both unmodified guanine and damaged guanine, in equimolar amounts. At 1000 Gy, a net average of 2.5 thymines and 1 guanine are damaged for each platinum lost from the oligonucleotide. Given the extensive base damage that occurs for each cisplatin adduct lost, it is clear that, prior to undergoing detachment, these adducts must catalyze several cycles of reactions of hydrated electrons with DNA bases. It is likely that a single reaction leads to the loss of the cisplatin adduct and the damage observed on the guanine base; however, the damage to the thymine bases must require the continued presence of the cisplatin adduct, acting as a catalyst. To our knowledge, this is the first time that platinum-DNA adducts have been shown to have catalytic activity. We propose two pathways for the interaction of hydrated electrons with TTTTTGTGTTT-cisplatin: (1) the hydrated electron is initially captured by a thymine base and transferred by base to base electron hopping to the guanine site, where the cisplatin moiety detaches from the oligonucleotide via dissociative electron attachment, and (2) the hydrated electron interacts directly with the platinum-guanine adduct and induces detachment of the cisplatin moiety via dissociative electron attachment. Although the precise mechanism remains to be elucidated, our results provide important insights into the radiosensitization of DNA by cisplatin.

  18. Cisplatin Intrastrand Adducts Sensitize DNA to Base Damage by Hydrated Electrons

    PubMed Central

    Behmand, B.; Wagner, J. R.; Sanche, L.; Hunting, D. J.

    2015-01-01

    The oligonucleotide TTTTTGTGTTT with or without a cisplatin adduct was reacted with hydrated electrons generated by ionizing radiation. Hydroxyl radicals were quenched with ethylenediaminetetraacetic acid (EDTA), and the solutions were bubbled with wet nitrogen to eliminate oxygen, a scavenger of hydrated electrons. Prior to irradiation, the structure of the initial cisplatin adduct was identified by mass spectrometry as G-cisplatin-G. Radiation damage to DNA bases was quantified by high-performance liquid chromatography (HPLC), after enzymatic digestion of the TTTTTGTGTTT-cisplatin complex to deoxyribonucleosides. The masses of the platinum adducts following digestion and separation by HPLC were measured by mass spectrometry. Our results demonstrate that hydrated electrons induce damage to thymines as well as detachment of the cisplatin moiety from both guanines in the oligonucleotide. This detachment regenerates both unmodified guanine and damaged guanine, in equimolar amounts. At 1000 Gy, a net average of 2.5 thymines and 1 guanine are damaged for each platinum lost from the oligonucleotide. Given the extensive base damage that occurs for each cisplatin adduct lost, it is clear that, prior to undergoing detachment, these adducts must catalyze several cycles of reactions of hydrated electrons with DNA bases. It is likely that a single reaction leads to the loss of the cisplatin adduct and the damage observed on the guanine base; however, the damage to the thymine bases must require the continued presence of the cisplatin adduct, acting as a catalyst. To our knowledge, this is the first time that platinum-DNA adducts have been shown to have catalytic activity. We propose two pathways for the interaction of hydrated electrons with TTTTTGTGTTT-cisplatin: (1) the hydrated electron is initially captured by a thymine base and transferred by base to base electron hopping to the guanine site, where the cisplatin moiety detaches from the oligonucleotide via dissociative electron attachment, and (2) the hydrated electron interacts directly with the platinum-guanine adduct and induces detachment of the cisplatin moiety via dissociative electron attachment. Although the precise mechanism remains to be elucidated, our results provide important insights into the radiosensitization of DNA by cisplatin. PMID:24779712

  19. Antisense Oligonucleotides Modulating Activation of a Nonsense-Mediated RNA Decay Switch Exon in the ATM Gene.

    PubMed

    Kralovicova, Jana; Moreno, Pedro M D; Cross, Nicholas C P; Pêgo, Ana Paula; Vorechovsky, Igor

    2016-12-01

    ATM (ataxia-telangiectasia, mutated) is an important cancer susceptibility gene that encodes a key apical kinase in the DNA damage response pathway. ATM mutations in the germ line result in ataxia-telangiectasia (A-T), a rare genetic syndrome associated with hypersensitivity to double-strand DNA breaks and predisposition to lymphoid malignancies. ATM expression is limited by a tightly regulated nonsense-mediated RNA decay (NMD) switch exon (termed NSE) located in intron 28. In this study, we identify antisense oligonucleotides that modulate NSE inclusion in mature transcripts by systematically targeting the entire 3.1-kb-long intron. Their identification was assisted by a segmental deletion analysis of transposed elements, revealing NSE repression upon removal of a distant antisense Alu and NSE activation upon elimination of a long terminal repeat transposon MER51A. Efficient NSE repression was achieved by delivering optimized splice-switching oligonucleotides to embryonic and lymphoblastoid cells using chitosan-based nanoparticles. Together, these results provide a basis for possible sequence-specific radiosensitization of cancer cells, highlight the power of intronic antisense oligonucleotides to modify gene expression, and demonstrate transposon-mediated regulation of NSEs.

  20. Typing of artiodactyl MHC-DRB genes with the help of intronic simple repeated DNA sequences.

    PubMed

    Schwaiger, F W; Buitkamp, J; Weyers, E; Epplen, J T

    1993-02-01

    An efficient oligonucleotide typing method for the highly polymorphic MHC-DRB genes is described for artiodactyls like cattle, sheep and goat. By means of the polymerase chain reaction, the second exon of MHC-DRB is amplified as well as part of the adjacent intron containing a mixed simple repeat sequence. Using this primer combination we were able to amplify the MHC-DRB exons 2 and adjacent introns from all of the investigated 10 species of the family of Bovidae and giraffes. Therefore, the DRB genes of novel artiodactyl species can also be readily studied. Oligonucleotide probes specific for the polymorphisms of ungulate DRB genes are used with which sequences differing in at least one single base can be distinguished. Exonic polymorphism was found to be correlated with the allele lengths and the patterns of the repeat structures. Hence oligonucleotide probes specific for different simple repeats and polymorphic positions serve also for typing across species barriers. The strict correlation of sequence length and exonic polymorphism permits a preselection of specific oligonucleotides for hybridization. Thus more than 20 alleles can already be differentiated from each of the three species.

  1. Electron stimulated desorption of anions from native and brominated single stranded oligonucleotide trimers

    PubMed Central

    Polska, Katarzyna; Rak, Janusz; Bass, Andrew D.; Cloutier, Pierre; Sanche, Léon

    2013-01-01

    We measured the low energy electron stimulated desorption (ESD) of anions from thin films of native (TXT) and bromine monosubstituted (TBrXT) oligonucleotide trimers deposited on a gold surface (T = thymidine, X = T, deoxycytidine (C), deoxyadenosine (A) or deoxyguanosine (G), Br = bromine). The desorption of H−, CH3−/NH−, O−/NH2−, OH−, CN−, and Br− was induced by 0 to 20 eV electrons. Dissociative electron attachment, below 12 eV, and dipolar dissociation, above 12 eV, are responsible for the formation of these anions. The comparison of the results obtained for the native and brominated trimers suggests that the main pathways of TBrXT degradation correspond to the release of the hydride and bromide anions. Significantly, the presence of bromine in oligonucleotide trimers blocks the electron-induced degradation of nuclobases as evidenced by a dramatic decrease in CN− desorption. An increase in the yields of OH− is also observed. The debromination yield of particular oligonucleotides diminishes in the following order: BrdU > BrdA > BrdG > BrdC. Based on these results, 5-bromo-2′-deoxyuridine appears to be the best radiosensitizer among the studied bromonucleosides. PMID:22360262

  2. Electron stimulated desorption of anions from native and brominated single stranded oligonucleotide trimers.

    PubMed

    Polska, Katarzyna; Rak, Janusz; Bass, Andrew D; Cloutier, Pierre; Sanche, Léon

    2012-02-21

    We measured the low energy electron stimulated desorption (ESD) of anions from thin films of native (TXT) and bromine monosubstituted (TBrXT) oligonucleotide trimers deposited on a gold surface (T = thymidine, X = T, deoxycytidine (C), deoxyadenosine (A) or deoxyguanosine (G), Br = bromine). The desorption of H(-), CH(3)(-)/NH(-), O(-)/NH(2)(-), OH(-), CN(-), and Br(-) was induced by 0 to 20 eV electrons. Dissociative electron attachment, below 12 eV, and dipolar dissociation, above 12 eV, are responsible for the formation of these anions. The comparison of the results obtained for the native and brominated trimers suggests that the main pathways of TBrXT degradation correspond to the release of the hydride and bromide anions. Significantly, the presence of bromine in oligonucleotide trimers blocks the electron-induced degradation of nuclobases as evidenced by a dramatic decrease in CN(-) desorption. An increase in the yields of OH(-) is also observed. The debromination yield of particular oligonucleotides diminishes in the following order: BrdU > BrdA > BrdG > BrdC. Based on these results, 5-bromo-2(')-deoxyuridine appears to be the best radiosensitizer among the studied bromonucleosides. © 2012 American Institute of Physics

  3. Electron stimulated desorption of anions from native and brominated single stranded oligonucleotide trimers

    NASA Astrophysics Data System (ADS)

    Polska, Katarzyna; Rak, Janusz; Bass, Andrew D.; Cloutier, Pierre; Sanche, Léon

    2012-02-01

    We measured the low energy electron stimulated desorption (ESD) of anions from thin films of native (TXT) and bromine monosubstituted (TBrXT) oligonucleotide trimers deposited on a gold surface (T = thymidine, X = T, deoxycytidine (C), deoxyadenosine (A) or deoxyguanosine (G), Br = bromine). The desorption of H-, CH3-/NH-, O-/NH2-, OH-, CN-, and Br- was induced by 0 to 20 eV electrons. Dissociative electron attachment, below 12 eV, and dipolar dissociation, above 12 eV, are responsible for the formation of these anions. The comparison of the results obtained for the native and brominated trimers suggests that the main pathways of TBrXT degradation correspond to the release of the hydride and bromide anions. Significantly, the presence of bromine in oligonucleotide trimers blocks the electron-induced degradation of nuclobases as evidenced by a dramatic decrease in CN- desorption. An increase in the yields of OH- is also observed. The debromination yield of particular oligonucleotides diminishes in the following order: BrdU > BrdA > BrdG > BrdC. Based on these results, 5-bromo-2'-deoxyuridine appears to be the best radiosensitizer among the studied bromonucleosides.

  4. Detecting novel genes with sparse arrays

    PubMed Central

    Haiminen, Niina; Smit, Bart; Rautio, Jari; Vitikainen, Marika; Wiebe, Marilyn; Martinez, Diego; Chee, Christine; Kunkel, Joe; Sanchez, Charles; Nelson, Mary Anne; Pakula, Tiina; Saloheimo, Markku; Penttilä, Merja; Kivioja, Teemu

    2014-01-01

    Species-specific genes play an important role in defining the phenotype of an organism. However, current gene prediction methods can only efficiently find genes that share features such as sequence similarity or general sequence characteristics with previously known genes. Novel sequencing methods and tiling arrays can be used to find genes without prior information and they have demonstrated that novel genes can still be found from extensively studied model organisms. Unfortunately, these methods are expensive and thus are not easily applicable, e.g., to finding genes that are expressed only in very specific conditions. We demonstrate a method for finding novel genes with sparse arrays, applying it on the 33.9 Mb genome of the filamentous fungus Trichoderma reesei. Our computational method does not require normalisations between arrays and it takes into account the multiple-testing problem typical for analysis of microarray data. In contrast to tiling arrays, that use overlapping probes, only one 25mer microarray oligonucleotide probe was used for every 100 b. Thus, only relatively little space on a microarray slide was required to cover the intergenic regions of a genome. The analysis was done as a by-product of a conventional microarray experiment with no additional costs. We found at least 23 good candidates for novel transcripts that could code for proteins and all of which were expressed at high levels. Candidate genes were found to neighbour ire1 and cre1 and many other regulatory genes. Our simple, low-cost method can easily be applied to finding novel species-specific genes without prior knowledge of their sequence properties. PMID:20691772

  5. A Carbon Nanotube Reporter of miRNA Hybridization Events In Vivo

    PubMed Central

    Harvey, Jackson D.; Jena, Prakrit V.; Baker, Hanan A.; Zerze, Gül H.; Williams, Ryan M.; Galassi, Thomas V.; Roxbury, Daniel; Mittal, Jeetain

    2017-01-01

    MicroRNAs and other small oligonucleotides in biofluids are promising disease biomarkers, yet conventional assays require complex processing steps that are unsuitable for point-of-care testing or for implantable or wearable sensors. Single-walled carbon nanotubes are an ideal material for implantable sensors, owing to their emission in the near-infrared spectral region, photostability and exquisite sensitivity. Here, we report an engineered carbon-nanotube-based sensor capable of real-time optical quantification of hybridization events of microRNA and other oligonucleotides. The mechanism of the sensor arises from competitive effects between displacement of both oligonucleotide charge groups and water from the nanotube surface, which result in a solvatochromism-like response. The sensor, which allows for detection via single-molecule sensor elements and for multiplexing by using multiple nanotube chiralities, can monitor toehold-based strand-displacement events, which reverse the sensor response and regenerate the sensor complex. We also show that the sensor functions in whole urine and serum, and can non-invasively measure DNA and microRNA after implantation in live mice. PMID:28845337

  6. A Carbon Nanotube Reporter of miRNA Hybridization Events In Vivo.

    PubMed

    Harvey, Jackson D; Jena, Prakrit V; Baker, Hanan A; Zerze, Gül H; Williams, Ryan M; Galassi, Thomas V; Roxbury, Daniel; Mittal, Jeetain; Heller, Daniel A

    2017-01-01

    MicroRNAs and other small oligonucleotides in biofluids are promising disease biomarkers, yet conventional assays require complex processing steps that are unsuitable for point-of-care testing or for implantable or wearable sensors. Single-walled carbon nanotubes are an ideal material for implantable sensors, owing to their emission in the near-infrared spectral region, photostability and exquisite sensitivity. Here, we report an engineered carbon-nanotube-based sensor capable of real-time optical quantification of hybridization events of microRNA and other oligonucleotides. The mechanism of the sensor arises from competitive effects between displacement of both oligonucleotide charge groups and water from the nanotube surface, which result in a solvatochromism-like response. The sensor, which allows for detection via single-molecule sensor elements and for multiplexing by using multiple nanotube chiralities, can monitor toehold-based strand-displacement events, which reverse the sensor response and regenerate the sensor complex. We also show that the sensor functions in whole urine and serum, and can non-invasively measure DNA and microRNA after implantation in live mice.

  7. Training a molecular automaton to play a game

    NASA Astrophysics Data System (ADS)

    Pei, Renjun; Matamoros, Elizabeth; Liu, Manhong; Stefanovic, Darko; Stojanovic, Milan N.

    2010-11-01

    Research at the interface between chemistry and cybernetics has led to reports of `programmable molecules', but what does it mean to say `we programmed a set of solution-phase molecules to do X'? A survey of recently implemented solution-phase circuitry indicates that this statement could be replaced with `we pre-mixed a set of molecules to do X and functional subsets of X'. These hard-wired mixtures are then exposed to a set of molecular inputs, which can be interpreted as being keyed to human moves in a game, or as assertions of logical propositions. In nucleic acids-based systems, stemming from DNA computation, these inputs can be seen as generic oligonucleotides. Here, we report using reconfigurable nucleic acid catalyst-based units to build a multipurpose reprogrammable molecular automaton that goes beyond single-purpose `hard-wired' molecular automata. The automaton covers all possible responses to two consecutive sets of four inputs (such as four first and four second moves for a generic set of trivial two-player two-move games). This is a model system for more general molecular field programmable gate array (FPGA)-like devices that can be programmed by example, which means that the operator need not have any knowledge of molecular computing methods.

  8. Training a molecular automaton to play a game.

    PubMed

    Pei, Renjun; Matamoros, Elizabeth; Liu, Manhong; Stefanovic, Darko; Stojanovic, Milan N

    2010-11-01

    Research at the interface between chemistry and cybernetics has led to reports of 'programmable molecules', but what does it mean to say 'we programmed a set of solution-phase molecules to do X'? A survey of recently implemented solution-phase circuitry indicates that this statement could be replaced with 'we pre-mixed a set of molecules to do X and functional subsets of X'. These hard-wired mixtures are then exposed to a set of molecular inputs, which can be interpreted as being keyed to human moves in a game, or as assertions of logical propositions. In nucleic acids-based systems, stemming from DNA computation, these inputs can be seen as generic oligonucleotides. Here, we report using reconfigurable nucleic acid catalyst-based units to build a multipurpose reprogrammable molecular automaton that goes beyond single-purpose 'hard-wired' molecular automata. The automaton covers all possible responses to two consecutive sets of four inputs (such as four first and four second moves for a generic set of trivial two-player two-move games). This is a model system for more general molecular field programmable gate array (FPGA)-like devices that can be programmed by example, which means that the operator need not have any knowledge of molecular computing methods.

  9. New approach to the determination phosphorothioate oligonucleotides by ultra high performance liquid chromatography coupled with inductively coupled plasma mass spectrometry.

    PubMed

    Studzińska, Sylwia; Mounicou, Sandra; Szpunar, Joanna; Łobiński, Ryszard; Buszewski, Bogusław

    2015-01-15

    This text presents a novel method for the separation and detection of phosphorothioate oligonucleotides with the use of ion pair ultra high performance liquid chromatography coupled with inductively coupled plasma mass spectrometry The research showed that hexafluoroisopropanol/triethylamine based mobile phases may be successfully used when liquid chromatography is coupled with such elemental detection. However, the concentration of both HFIP and TEA influences the final result. The lower concentration of HFIP, the lower the background in ICP-MS and the greater the sensitivity. The method applied for the analysis of serum samples was based on high resolution inductively coupled plasma mass spectrometry. Utilization of this method allows determination of fifty times lower quantity of phosphorothioate oligonucleotides than in the case of quadrupole mass analyzer. Monitoring of (31)P may be used to quantify these compounds at the level of 80 μg L(-1), while simultaneous determination of sulfur is very useful for qualitative analysis. Moreover, the results presented in this paper demonstrate the practical applicability of coupling LC with ICP-MS in determining phosphorothioate oligonucleotides and their metabolites in serum within 7 min with a very good sensitivity. The method was linear in the concentration range between 0.2 and 3 mg L(-1). The limit of detection was in the range of 0.07 and 0.13 mg L(-1). Accuracy varied with concentration, but was in the range of 3%. Copyright © 2014 Elsevier B.V. All rights reserved.

  10. Prediction of the optimum hybridization conditions of dot-blot-SNP analysis using estimated melting temperature of oligonucleotide probes.

    PubMed

    Shiokai, Sachiko; Kitashiba, Hiroyasu; Nishio, Takeshi

    2010-08-01

    Although the dot-blot-SNP technique is a simple cost-saving technique suitable for genotyping of many plant individuals, optimization of hybridization and washing conditions for each SNP marker requires much time and labor. For prediction of the optimum hybridization conditions for each probe, we compared T (m) values estimated from nucleotide sequences using the DINAMelt web server, measured T (m) values, and hybridization conditions yielding allele-specific signals. The estimated T (m) values were comparable to the measured T (m) values with small differences of less than 3 degrees C for most of the probes. There were differences of approximately 14 degrees C between the specific signal detection conditions and estimated T (m) values. Change of one level of SSC concentrations of 0.1, 0.2, 0.5, and 1.0x SSC corresponded to a difference of approximately 5 degrees C in optimum signal detection temperature. Increasing the sensitivity of signal detection by shortening the exposure time to X-ray film changed the optimum hybridization condition for specific signal detection. Addition of competitive oligonucleotides to the hybridization mixture increased the suitable hybridization conditions by 1.8. Based on these results, optimum hybridization conditions for newly produced dot-blot-SNP markers will become predictable.

  11. Pharmacology of a Central Nervous System Delivered 2′-O-Methoxyethyl–Modified Survival of Motor Neuron Splicing Oligonucleotide in Mice and Nonhuman Primates

    PubMed Central

    Chun, Seung J.; Norris, Daniel A.; Hung, Gene; Lee, Sam; Matson, John; Fey, Robert A.; Gaus, Hans; Hua, Yimin; Grundy, John S.; Krainer, Adrian R.; Henry, Scott P.; Bennett, C. Frank

    2014-01-01

    Spinal muscular atrophy (SMA) is a debilitating neuromuscular disease caused by the loss of survival of motor neuron (SMN) protein. Previously, we demonstrated that ISIS 396443, an antisense oligonucleotide (ASO) targeted to the SMN2 pre-mRNA, is a potent inducer of SMN2 exon 7 inclusion and SMN protein expression, and improves function and survival of mild and severe SMA mouse models. Here, we demonstrate that ISIS 396443 is the most potent ASO in central nervous system (CNS) tissues of adult mice, compared with several other chemically modified ASOs. We evaluated methods of ISIS 396443 delivery to the CNS and characterized its pharmacokinetics and pharmacodynamics in rodents and nonhuman primates (NHPs). Intracerebroventricular bolus injection is a more efficient method of delivering ISIS 396443 to the CNS of rodents, compared with i.c.v. infusion. For both methods of delivery, the duration of ISIS 396443–mediated SMN2 splicing correction is long lasting, with maximal effects still observed 6 months after treatment discontinuation. Administration of ISIS 396443 to the CNS of NHPs by a single intrathecal bolus injection results in widespread distribution throughout the spinal cord. Based upon these preclinical studies, we have advanced ISIS 396443 into clinical development. PMID:24784568

  12. 2'-modified nucleosides for site-specific labeling of oligonucleotides

    NASA Technical Reports Server (NTRS)

    Krider, Elizabeth S.; Miller, Jeremiah E.; Meade, Thomas J.

    2002-01-01

    We report the synthesis of 2'-modified nucleosides designed specifically for incorporating labels into oligonucleotides. Conversion of these nucleosides to phosphoramidite and solid support-bound derivatives proceeds in good yield. Large-scale synthesis of 11-mer oligonucleotides possessing the 2'-modified nucleosides is achieved using these derivatives. Thermal denaturation studies indicate that the presence of 2'-modified nucleosides in 11-mer duplexes has minimal destabilizing effects on the duplex structure when the nucleosides are placed at the duplex termini. The powerful combination of phosphoramidite and support-bound derivatives of 2'-modified nucleosides affords the large-scale preparation of an entirely new class of oligonucleotides. The ability to synthesize oligonucleotides containing label attachment sites at 3', intervening, and 5' locations of a duplex is a significant advance in the development of oligonucleotide conjugates.

  13. SWPhylo - A Novel Tool for Phylogenomic Inferences by Comparison of Oligonucleotide Patterns and Integration of Genome-Based and Gene-Based Phylogenetic Trees.

    PubMed

    Yu, Xiaoyu; Reva, Oleg N

    2018-01-01

    Modern phylogenetic studies may benefit from the analysis of complete genome sequences of various microorganisms. Evolutionary inferences based on genome-scale analysis are believed to be more accurate than the gene-based alternative. However, the computational complexity of current phylogenomic procedures, inappropriateness of standard phylogenetic tools to process genome-wide data, and lack of reliable substitution models which correlates with alignment-free phylogenomic approaches deter microbiologists from using these opportunities. For example, the super-matrix and super-tree approaches of phylogenomics use multiple integrated genomic loci or individual gene-based trees to infer an overall consensus tree. However, these approaches potentially multiply errors of gene annotation and sequence alignment not mentioning the computational complexity and laboriousness of the methods. In this article, we demonstrate that the annotation- and alignment-free comparison of genome-wide tetranucleotide frequencies, termed oligonucleotide usage patterns (OUPs), allowed a fast and reliable inference of phylogenetic trees. These were congruent to the corresponding whole genome super-matrix trees in terms of tree topology when compared with other known approaches including 16S ribosomal RNA and GyrA protein sequence comparison, complete genome-based MAUVE, and CVTree methods. A Web-based program to perform the alignment-free OUP-based phylogenomic inferences was implemented at http://swphylo.bi.up.ac.za/. Applicability of the tool was tested on different taxa from subspecies to intergeneric levels. Distinguishing between closely related taxonomic units may be enforced by providing the program with alignments of marker protein sequences, eg, GyrA.

  14. SWPhylo – A Novel Tool for Phylogenomic Inferences by Comparison of Oligonucleotide Patterns and Integration of Genome-Based and Gene-Based Phylogenetic Trees

    PubMed Central

    Yu, Xiaoyu; Reva, Oleg N

    2018-01-01

    Modern phylogenetic studies may benefit from the analysis of complete genome sequences of various microorganisms. Evolutionary inferences based on genome-scale analysis are believed to be more accurate than the gene-based alternative. However, the computational complexity of current phylogenomic procedures, inappropriateness of standard phylogenetic tools to process genome-wide data, and lack of reliable substitution models which correlates with alignment-free phylogenomic approaches deter microbiologists from using these opportunities. For example, the super-matrix and super-tree approaches of phylogenomics use multiple integrated genomic loci or individual gene-based trees to infer an overall consensus tree. However, these approaches potentially multiply errors of gene annotation and sequence alignment not mentioning the computational complexity and laboriousness of the methods. In this article, we demonstrate that the annotation- and alignment-free comparison of genome-wide tetranucleotide frequencies, termed oligonucleotide usage patterns (OUPs), allowed a fast and reliable inference of phylogenetic trees. These were congruent to the corresponding whole genome super-matrix trees in terms of tree topology when compared with other known approaches including 16S ribosomal RNA and GyrA protein sequence comparison, complete genome-based MAUVE, and CVTree methods. A Web-based program to perform the alignment-free OUP-based phylogenomic inferences was implemented at http://swphylo.bi.up.ac.za/. Applicability of the tool was tested on different taxa from subspecies to intergeneric levels. Distinguishing between closely related taxonomic units may be enforced by providing the program with alignments of marker protein sequences, eg, GyrA. PMID:29511354

  15. Hydrated Electrons React with High Specificity with Cisplatin Bound to Single-Stranded DNA

    PubMed Central

    Behmand, B.; Cloutier, P.; Girouard, S.; Wagner, J. R.; Sanche, L.; Hunting, D. J.

    2015-01-01

    Short oligonucleotides TTTTTGTGTTT and TTTTTTTGTTT in solution with and without cisplatin (cisPt) bound to the guanine bases were irradiated with γ-rays at doses varying from 0 to 2500 Gy. To determine the effect of hydrated electrons from water radiolysis on the oligonucleotides, we quenched •OH radicals with ethylenediaminetetraacetic acid (EDTA) and displaced oxygen, which reacts with hydrated electrons, by bubbling the solution with wet nitrogen. DNA strand breaks and platinum detachment were quantified by gel electrophoresis. Our results demonstrate that hydrated electrons react almost exclusively at the position of the cisPt adduct, where they induce cisPt detachment from one or both guanines in the oligonucleotide. Given the high yield of hydrated electrons in irradiated tissues, this reaction may be an important step in the mechanism of radiosensitization of DNA by cisPt. PMID:24205952

  16. Ultra-high-throughput microarray generation and liquid dispensing using multiple disposable piezoelectric ejectors.

    PubMed

    Hsieh, Huangpin Ben; Fitch, John; White, Dave; Torres, Frank; Roy, Joy; Matusiak, Robert; Krivacic, Bob; Kowalski, Bob; Bruce, Richard; Elrod, Scott

    2004-03-01

    The authors have constructed an array of 12 piezoelectric ejectors for printing biological materials. A single-ejector footprint is 8 mm in diameter, standing 4 mm high with 2 reservoirs totaling 76 micro L. These ejectors have been tested by dispensing various fluids in several environmental conditions. Reliable drop ejection can be expected in both humidity-controlled and ambient environments over extended periods of time and in hot and cold room temperatures. In a prototype system, 12 ejectors are arranged in a rack, together with an X - Y stage, to allow printing any pattern desired. Printed arrays of features are created with a biological solution containing bovine serum albumin conjugated oligonucleotides, dye, and salty buffer. This ejector system is designed for the ultra-high-throughput generation of arrays on a variety of surfaces. These single or racked ejectors could be used as long-term storage vessels for materials such as small molecules, nucleic acids, proteins, or cell libraries, which would allow for efficient preprogrammed selection of individual clones and greatly reduce the chance of cross-contamination and loss due to transfer. A new generation of design ideas includes plastic injection molded ejectors that are inexpensive and disposable and handheld personal pipettes for liquid transfer in the nanoliter regime.

  17. Assessing the Interplay between the Physicochemical Parameters of Ion-Pairing Reagents and the Analyte Sequence on the Electrospray Desorption Process for Oligonucleotides

    NASA Astrophysics Data System (ADS)

    Basiri, Babak; Murph, Mandi M.; Bartlett, Michael G.

    2017-08-01

    Alkylamines are widely used as ion-pairing agents during LC-MS of oligonucleotides. In addition to a better chromatographic separation, they also assist with the desorption of oligonucleotide ions into the gas phase, cause charge state reduction, and decrease cation adduction. However, the choice of such ion-pairing agents has considerable influence on the MS signal intensity of oligonucleotides as they can also cause significant ion suppression. Interestingly, optimal ion-pairing agents should be selected on a case by case basis as their choice is strongly influenced by the sequence of the oligonucleotide under investigation. Despite imposing major practical difficulties to analytical method development, such a highly variable system that responds very strongly to the nuances of the electrospray composition provides an excellent opportunity for a fundamental study of the electrospray ionization process. Our investigations using this system quantitatively revealed the major factors that influenced the ESI ionization efficiency of oligonucleotides. Parameters such as boiling point, proton affinity, partition coefficient, water solubility, and Henry's law constants for the ion-pairing reagents and the hydrophobic thymine content of the oligonucleotides were found to be the most significant contributors. Identification of these parameters also allowed for the development of a statistical predictive algorithm that can assist with the choice of an optimum IP agent for each particular oligonucleotide sequence. We believe that research in the field of oligonucleotide bioanalysis will significantly benefit from this algorithm (included in Supplementary Material) as it advocates for the use of lesser-known but more suitable ion-pair alternatives to TEA for many oligonucleotide sequences.

  18. Programmable DNA scaffolds for spatially-ordered protein assembly

    NASA Astrophysics Data System (ADS)

    Chandrasekaran, Arun Richard

    2016-02-01

    Ever since the notion of using DNA as a material was realized, it has been employed in the construction of complex structures that facilitate the assembly of nanoparticles or macromolecules with nanometer-scale precision. Specifically, tiles fashioned from DNA strands and DNA origami sheets have been shown to be suitable as scaffolds for immobilizing proteins with excellent control over their spatial positioning. Supramolecular assembly of proteins into periodic arrays in one or more dimensions is one of the most challenging aspects in the design of scaffolds for biomolecular investigations and macromolecular crystallization. This review provides a brief overview of how various biomolecular interactions with high degree of specificity such as streptavidin-biotin, antigen-antibody, and aptamer-protein interactions have been used to fabricate linear and multidimensional assemblies of structurally intact and functional proteins. The use of DNA-binding proteins as adaptors, polyamide recognition on DNA scaffolds and oligonucleotide linkers for protein assembly are also discussed.Ever since the notion of using DNA as a material was realized, it has been employed in the construction of complex structures that facilitate the assembly of nanoparticles or macromolecules with nanometer-scale precision. Specifically, tiles fashioned from DNA strands and DNA origami sheets have been shown to be suitable as scaffolds for immobilizing proteins with excellent control over their spatial positioning. Supramolecular assembly of proteins into periodic arrays in one or more dimensions is one of the most challenging aspects in the design of scaffolds for biomolecular investigations and macromolecular crystallization. This review provides a brief overview of how various biomolecular interactions with high degree of specificity such as streptavidin-biotin, antigen-antibody, and aptamer-protein interactions have been used to fabricate linear and multidimensional assemblies of structurally intact and functional proteins. The use of DNA-binding proteins as adaptors, polyamide recognition on DNA scaffolds and oligonucleotide linkers for protein assembly are also discussed. Dedicated to my advisor Ned Seeman on the occasion of his 70th birthday.

  19. Species-Level Identification of Orthopoxviruses with an Oligonucleotide Microchip

    PubMed Central

    Lapa, Sergey; Mikheev, Maxim; Shchelkunov, Sergei; Mikhailovich, Vladimir; Sobolev, Alexander; Blinov, Vladimir; Babkin, Igor; Guskov, Alexander; Sokunova, Elena; Zasedatelev, Alexander; Sandakhchiev, Lev; Mirzabekov, Andrei

    2002-01-01

    A method for species-specific detection of orthopoxviruses pathogenic for humans and animals is described. The method is based on hybridization of a fluorescently labeled amplified DNA specimen with the oligonucleotide DNA probes immobilized on a microchip (MAGIChip). The probes identify species-specific sites within the crmB gene encoding the viral analogue of tumor necrosis factor receptor, one of the most important determinants of pathogenicity in this genus of viruses. The diagnostic procedure takes 6 h and does not require any sophisticated equipment (a portable fluorescence reader can be used). PMID:11880388

  20. A zebrafish model of PINK1 deficiency reveals key pathway dysfunction including HIF signaling.

    PubMed

    Priyadarshini, M; Tuimala, J; Chen, Y C; Panula, P

    2013-06-01

    The PTEN induced putative kinase 1 (PINK1) gene is mutated in patients with hereditary early onset Parkinson's disease (PD). The targets of PINK1 and the mechanisms in PD are still not fully understood. Here, we carried out a high-throughput and unbiased microarray study to identify novel functions and pathways for PINK1. In larval zebrafish, the function of pink1 was inhibited using splice-site morpholino oligonucleotides and the samples were hybridized on a two-color gene expression array. We found 177 significantly altered genes in pink1 morphants compared with the uninjected wildtype controls (log fold change values from -1.6 to +0.9). The five most prominent pathways based on critical biological processes and key toxicological responses were hypoxia-inducible factor (HIF) signaling, TGF-β signaling, mitochondrial dysfunction, RAR activation, and biogenesis of mitochondria. Furthermore, we verified that potentially important genes such as hif1α, catalase, SOD3, and atp1a2a were downregulated in pink1 morphants, whereas genes such as fech, pax2a, and notch1a were upregulated. Some of these genes have been found to play important roles in HIF signaling pathways. The pink1 morphants were found to have heart dysfunction, increased erythropoiesis, increased expression of vascular endothelial growth factors, and increased ROS. Our findings suggest that a lack of pink1 in zebrafish alters many vital and critical pathways in addition to the HIF signaling pathway. Copyright © 2013 Elsevier Inc. All rights reserved.

  1. Rare genomic rearrangement in a boy with Williams-Beuren syndrome associated to XYY syndrome and intriguing behavior.

    PubMed

    Dutra, Roberta L; Piazzon, Flavia B; Zanardo, Évelin A; Costa, Thais Virginia Moura Machado; Montenegro, Marília M; Novo-Filho, Gil M; Dias, Alexandre T; Nascimento, Amom M; Kim, Chong Ae; Kulikowski, Leslie D

    2015-12-01

    Williams-Beuren syndrome (WBS) is caused by a hemizygous contiguous gene microdeletion of 1.55-1.84 Mb at 7q11.23 region. Approximately, 28 genes have been shown to contribute to classical phenotype of SWB with presence of dysmorphic facial features, supravalvular aortic stenosis (SVAS), intellectual disability, and overfriendliness. With the use of Microarray-based comparative genomic hybridization and other molecular cytogenetic techniques, is possible define with more accuracy partial or atypical deletion and refine the genotype-phenotype correlation. Here, we report on a rare genomic structural rearrangement in a boy with atypical deletion in 7q11.23 and XYY syndrome with characteristic clinical signs, but not sufficient for the diagnosis of WBS. Cytogenetic analysis of G-banding showed a karyotype 47,XYY. Analysis of DNA with the technique of MLPA (Multiplex Ligation-dependent Probe Amplification) using kits a combination of kits (P064, P036, P070, and P029) identified an atypical deletion on 7q11.23. In addition, high resolution SNP Oligonucleotide Microarray Analysis (SNP-array) confirmed the alterations found by MLPA and revealed others pathogenic CNVs, in the chromosomes 7 and X. The present report demonstrates an association not yet described in literature, between Williams-Beuren syndrome and 47,XYY. The identification of atypical deletion in 7q11.23 concomitant to additional pathogenic CNVs in others genomic regions allows a better comprehension of clinical consequences of atypical genomic rearrangements. © 2015 Wiley Periodicals, Inc.

  2. Current Challenges in Delivery and Cytosolic Translocation of Therapeutic RNAs

    PubMed Central

    Lucchino, Marco

    2018-01-01

    RNA interference (RNAi) is a fundamental cellular process for the posttranscriptional regulation of gene expression. RNAi can exogenously be modulated by small RNA oligonucleotides, such as microRNAs (miRNAs) and small interfering RNAs (siRNAs), or by antisense oligonucleotides. These small oligonucleotides provided the scientific community with powerful and versatile tools to turn off the expression of genes of interest, and hold out the promise of new therapeutic solutions against a wide range of gene-associated pathologies. However, unmodified nucleic acids are highly instable in biological systems, and their weak interaction with plasma proteins confers an unfavorable pharmacokinetics. In this review, we first provide an overview of the most efficient chemical strategies that, over the past 30 years, have been used to significantly improve the therapeutic potential of oligonucleotides. Oligonucleotides targeting and delivery technologies are then presented, including covalent conjugates between oligonucleotides and targeting ligand, and noncovalent association with lipid or polymer nanoparticles. Finally, we specifically focus on the endosomal escape step, which represents a major stumbling block for the effective use of oligonucleotides as therapeutic agents. The need for approaches to quantitatively measure endosomal escape and cytosolic arrival of biomolecules is discussed in the context of the development of efficient oligonucleotide targeting and delivery vectors. PMID:29883296

  3. Practical guidelines for interpreting copy number gains detected by high-resolution array in routine diagnostics

    PubMed Central

    Hanemaaijer, Nicolien M; Sikkema-Raddatz, Birgit; van der Vries, Gerben; Dijkhuizen, Trijnie; Hordijk, Roel; van Essen, Anthonie J; Veenstra-Knol, Hermine E; Kerstjens-Frederikse, Wilhelmina S; Herkert, Johanna C; Gerkes, Erica H; Leegte, Lamberta K; Kok, Klaas; Sinke, Richard J; van Ravenswaaij-Arts, Conny M A

    2012-01-01

    The correct interpretation of copy number gains in patients with developmental delay and multiple congenital anomalies is hampered by the large number of copy number variations (CNVs) encountered in healthy individuals. The variable phenotype associated with copy number gains makes interpretation even more difficult. Literature shows that inheritence, size and presence in healthy individuals are commonly used to decide whether a certain copy number gain is pathogenic, but no general consensus has been established. We aimed to develop guidelines for interpreting gains detected by array analysis using array CGH data of 300 patients analysed with the 105K Agilent oligo array in a diagnostic setting. We evaluated the guidelines in a second, independent, cohort of 300 patients. In the first 300 patients 797 gains of four or more adjacent oligonucleotides were observed. Of these, 45.4% were de novo and 54.6% were familial. In total, 94.8% of all de novo gains and 87.1% of all familial gains were concluded to be benign CNVs. Clinically relevant gains ranged from 288 to 7912 kb in size, and were significantly larger than benign gains and gains of unknown clinical relevance (P<0.001). Our study showed that a threshold of 200 kb is acceptable in a clinical setting, whereas heritability does not exclude a pathogenic nature of a gain. Evaluation of the guidelines in the second cohort of 300 patients revealed that the interpretation guidelines were clear, easy to follow and efficient. PMID:21934709

  4. Development and evaluation of a sensitive enzyme-linked oligonucleotide-sorbent assay for detection of polymerase chain reaction-amplified hepatitis C virus of genotypes 1-6.

    PubMed

    Huang, Rong-Yuan; Chang, Hao-Teng; Lan, Chung-Yu; Pai, Tun-Wen; Wu, Chao-Nan; Ling, Chung-Mei; Chang, Margaret Dah-Tsyr

    2008-08-01

    A high-throughput polymerase chain reaction (PCR)-based enzyme-linked oligonucleotide-sorbent assay (ELOSA) was developed for use in the diagnostic testing of serum from patients who may be infected with different hepatitis C virus (HCV) genotypes. Twelve genotype-specific 5'-aminated DNA-coated probes were designed based on the variable 5'-untranslated region sequences of the HCV genotypes 1-6. Using 100 clinical serum samples, the performance of the PCR-ELOSA method was compared with Roche's COBAS Amplicor HCV Monitor V2.0 assay and the VERSANT HCV genotype assay (LiPA), and the overall agreement was 99% at the level of HCV genotypes with a detection range of 2.0 x 10(2) to 1.0 x 10(7)IU/ml for PCR-ELOSA. The PCR-ELOSA was more comprehensive as demonstrated by the fact that approximately 20% of the samples with different subtypes could be discriminated by this method but not by LiPA. In addition, the PCR-ELOSA system showed high accuracy (CV

  5. Universal detection of phytoplasmas and Xylella spp. by TaqMan singleplex and multiplex real-time PCR with dual priming oligonucleotides.

    PubMed

    Ito, Takao; Suzaki, Koichi

    2017-01-01

    Phytoplasmas and Xylella spp. are bacteria that cause many economically important plant diseases worldwide. TaqMan probe-based quantitative real-time polymerase chain reaction (qPCR) assays have been utilized to universally detect phytoplasmas or Xylella fastidiosa. To develop a superior universal qPCR method, we used a dual priming oligonucleotide (DPO) with two annealing sites as a reverse primer to target the well-conserved bacterial 16S rDNA. The new qPCR assays universally detected various species of phytoplasmas and subspecies of X. fastidiosa as well as Xylella taiwanensis, and generally showed superior threshold cycle values when amplifying specific or non-specific products compared to current universal qPCR assays. The proposed qPCR assays were integrated to develop a multiplex qPCR assay that simultaneously detected phytoplasmas, Xylella spp., and an internal plant DNA positive control within 1 hour. This assay could detect a minimum of ten bacterial cells and was compatible with crude extractions used in the rapid screening of various plants. The amplicons were of sufficient lengths to be directly sequenced for preliminary identification, and the primers could be used in universal conventional PCR assays. Additionally, reverse DPO primers can be utilized to improve other probe-based qPCR assays.

  6. Universal detection of phytoplasmas and Xylella spp. by TaqMan singleplex and multiplex real-time PCR with dual priming oligonucleotides

    PubMed Central

    Suzaki, Koichi

    2017-01-01

    Phytoplasmas and Xylella spp. are bacteria that cause many economically important plant diseases worldwide. TaqMan probe-based quantitative real-time polymerase chain reaction (qPCR) assays have been utilized to universally detect phytoplasmas or Xylella fastidiosa. To develop a superior universal qPCR method, we used a dual priming oligonucleotide (DPO) with two annealing sites as a reverse primer to target the well-conserved bacterial 16S rDNA. The new qPCR assays universally detected various species of phytoplasmas and subspecies of X. fastidiosa as well as Xylella taiwanensis, and generally showed superior threshold cycle values when amplifying specific or non-specific products compared to current universal qPCR assays. The proposed qPCR assays were integrated to develop a multiplex qPCR assay that simultaneously detected phytoplasmas, Xylella spp., and an internal plant DNA positive control within 1 hour. This assay could detect a minimum of ten bacterial cells and was compatible with crude extractions used in the rapid screening of various plants. The amplicons were of sufficient lengths to be directly sequenced for preliminary identification, and the primers could be used in universal conventional PCR assays. Additionally, reverse DPO primers can be utilized to improve other probe-based qPCR assays. PMID:28957362

  7. Identification of sequence motifs in oligonucleotides whose presence is correlated with antisense activity

    PubMed Central

    Matveeva, O. V.; Tsodikov, A. D.; Giddings, M.; Freier, S. M.; Wyatt, J. R.; Spiridonov, A. N.; Shabalina, S. A.; Gesteland, R. F.; Atkins, J. F.

    2000-01-01

    Design of antisense oligonucleotides targeting any mRNA can be much more efficient when several activity-enhancing motifs are included and activity-decreasing motifs are avoided. This conclusion was made after statistical analysis of data collected from >1000 experiments with phosphorothioate-modified oligonucleotides. Highly significant positive correlation between the presence of motifs CCAC, TCCC, ACTC, GCCA and CTCT in the oligonucleotide and its antisense efficiency was demonstrated. In addition, negative correlation was revealed for the motifs GGGG, ACTG, AAA and TAA. It was found that the likelihood of activity of an oligonucleotide against a desired mRNA target is sequence motif content dependent. PMID:10908347

  8. DNA assembly with error correction on a droplet digital microfluidics platform.

    PubMed

    Khilko, Yuliya; Weyman, Philip D; Glass, John I; Adams, Mark D; McNeil, Melanie A; Griffin, Peter B

    2018-06-01

    Custom synthesized DNA is in high demand for synthetic biology applications. However, current technologies to produce these sequences using assembly from DNA oligonucleotides are costly and labor-intensive. The automation and reduced sample volumes afforded by microfluidic technologies could significantly decrease materials and labor costs associated with DNA synthesis. The purpose of this study was to develop a gene assembly protocol utilizing a digital microfluidic device. Toward this goal, we adapted bench-scale oligonucleotide assembly methods followed by enzymatic error correction to the Mondrian™ digital microfluidic platform. We optimized Gibson assembly, polymerase chain reaction (PCR), and enzymatic error correction reactions in a single protocol to assemble 12 oligonucleotides into a 339-bp double- stranded DNA sequence encoding part of the human influenza virus hemagglutinin (HA) gene. The reactions were scaled down to 0.6-1.2 μL. Initial microfluidic assembly methods were successful and had an error frequency of approximately 4 errors/kb with errors originating from the original oligonucleotide synthesis. Relative to conventional benchtop procedures, PCR optimization required additional amounts of MgCl 2 , Phusion polymerase, and PEG 8000 to achieve amplification of the assembly and error correction products. After one round of error correction, error frequency was reduced to an average of 1.8 errors kb - 1 . We demonstrated that DNA assembly from oligonucleotides and error correction could be completely automated on a digital microfluidic (DMF) platform. The results demonstrate that enzymatic reactions in droplets show a strong dependence on surface interactions, and successful on-chip implementation required supplementation with surfactants, molecular crowding agents, and an excess of enzyme. Enzymatic error correction of assembled fragments improved sequence fidelity by 2-fold, which was a significant improvement but somewhat lower than expected compared to bench-top assays, suggesting an additional capacity for optimization.

  9. Selective Inhibition of the Human tie-1 Promoter with Triplex-Forming Oligonucleotides Targeted to Ets Binding Sites

    PubMed Central

    Hewett, Peter W; Daft, Emma L; Laughton, Charles A; Ahmad, Shakil; Ahmed, Asif; Murray, J Clifford

    2006-01-01

    The Tie receptors (Tie-1 and Tie-2/Tek) are essential for angiogenesis and vascular remodeling/integrity. Tie receptors are up-regulated in tumor-associated endothelium, and their inhibition disrupts angiogenesis and can prevent tumor growth as a consequence. To investigate the potential of anti-gene approaches to inhibit tie gene expression for anti-angiogenic therapy, we have examined triple-helical (triplex) DNA formation at 2 tandem Ets transcription factor binding motifs (designated E-1 and E-2) in the human tie-1 promoter. Various tie-1 promoter deletion/mutation luciferase reporter constructs were generated and transfected into endothelial cells to examine the relative activities of E-1 and E-2. The binding of antiparallel and parallel (control) purine motif oligonucleotides (21–22 bp) targeted to E-1 and E-2 was assessed by plasmid DNA fragment binding and electrophoretic mobility shift assays. Triplex-forming oligonucleotides were incubated with tie-1 reporter constructs and transfected into endothelial cells to determine their activity. The Ets binding motifs in the E-1 sequence were essential for human tie-1 promoter activity in endothelial cells, whereas the deletion of E-2 had no effect. Antiparallel purine motif oligonucleotides targeted at E-1 or E-2 selectively formed strong triplex DNA (Kd ~10−7 M) at 37 °C. Transfection of tie-1 reporter constructs with triplex DNA at E-1, but not E-2, specifically inhibited tie-1 promoter activity by up to 75% compared with control oligonucleotides in endothelial cells. As similar multiple Ets binding sites are important for the regulation of several endothelial-restricted genes, this approach may have broad therapeutic potential for cancer and other pathologies involving endothelial proliferation/dysfunction. PMID:16838069

  10. Selective inhibition of the human tie-1 promoter with triplex-forming oligonucleotides targeted to Ets binding sites.

    PubMed

    Hewett, Peter W; Daft, Emma L; Laughton, Charles A; Ahmad, Shakil; Ahmed, Asif; Murray, J Clifford

    2006-01-01

    The Tie receptors (Tie-1 and Tie-2/Tek) are essential for angiogenesis and vascular remodeling/integrity. Tie receptors are up-regulated in tumor-associated endothelium, and their inhibition disrupts angiogenesis and can prevent tumor growth as a consequence. To investigate the potential of anti-gene approaches to inhibit tie gene expression for anti-angiogenic therapy, we have examined triple-helical (triplex) DNA formation at 2 tandem Ets transcription factor binding motifs (designated E-1 and E-2) in the human tie-1 promoter. Various tie-1 promoter deletion/mutation luciferase reporter constructs were generated and transfected into endothelial cells to examine the relative activities of E-1 and E-2. The binding of antiparallel and parallel (control) purine motif oligonucleotides (21-22 bp) targeted to E-1 and E-2 was assessed by plasmid DNA fragment binding and electrophoretic mobility shift assays. Triplex-forming oligonucleotides were incubated with tie-1 reporter constructs and transfected into endothelial cells to determine their activity. The Ets binding motifs in the E-1 sequence were essential for human tie-1 promoter activity in endothelial cells, whereas the deletion of E-2 had no effect. Antiparallel purine motif oligonucleotides targeted at E-1 or E-2 selectively formed strong triplex DNA (K(d) approximately 10(-7) M) at 37 degrees C. Transfection of tie-1 reporter constructs with triplex DNA at E-1, but not E-2, specifically inhibited tie-1 promoter activity by up to 75% compared with control oligonucleotides in endothelial cells. As similar multiple Ets binding sites are important for the regulation of several endothelial-restricted genes, this approach may have broad therapeutic potential for cancer and other pathologies involving endothelial proliferation/dysfunction.

  11. Micro-array versus nano-array platforms: a comparative study for ODN detection based on SPR enhanced ellipsometry

    NASA Astrophysics Data System (ADS)

    Celen, Burcu; Demirel, Gökhan; Piskin, Erhan

    2011-04-01

    The rapid and sensitive detection of DNA has recently attracted worldwide attention for a variety of disease diagnoses and detection of harmful bacteria in food and drink. In this paper, we carried out a comparative study based on surface plasmon resonance enhanced ellipsometry (SPREE) for the detection of oligodeoxynucleotides (ODNs) using micro- and nano-array platforms. The micro-arrayed surfaces were fabricated by a photolithography approach using different types of mask having varying size and shape. Well-ordered arrays of high aspect ratio polymeric nanotubes were also obtained using high molecular weight polystyrene (PS) and anodic aluminum oxide (AAO) membranes having 200 nm pore diameters. The SPREE sensors were then prepared by direct coupling of thiolated probe-ODNs, which contain suitable spacer arms, on gold-coated micro- and nano-arrayed surfaces. We experimentally demonstrated that, for the first time, gold-coated free standing polymeric nano-arrayed platforms can easily be produced and lead to a significant sensor sensitivity gain compared to that of the conventional SPREE surfaces of about four times. We believe that such an enhancement in sensor response could be useful for next generation sensor systems.

  12. [Comparative results of preimplantation genetic screening by array comparative genomic hybridization and new-generation sequencing].

    PubMed

    Aleksandrova, N V; Shubina, E S; Ekimov, A N; Kodyleva, T A; Mukosey, I S; Makarova, N P; Kulakova, E V; Levkov, L A; Barkov, I Yu; Trofimov, D Yu; Sukhikh, G T

    2017-01-01

    Aneuploidies as quantitative chromosome abnormalities are a main cause of failed development of morphologically normal embryos, implantation failures, and early reproductive losses. Preimplantation genetic screening (PGS) allows a preselection of embryos with a normal karyotype, thus increasing the implantation rate and reducing the frequency of early pregnancy loss after IVF. Modern PGS technologies are based on a genome-wide analysis of the embryo. The first pilot study in Russia was performed to assess the possibility of using semiconductor new-generation sequencing (NGS) as a PGS method. NGS data were collected for 38 biopsied embryos and compared with the data from array comparative genomic hybridization (array-CGH). The concordance between the NGS and array-CGH data was 94.8%. Two samples showed the karyotype 47,XXY by array-CGH and a normal karyotype by NGS. The discrepancies may be explained by loss of efficiency of array-CGH amplicon labeling.

  13. Oligonucleotide and Parylene Surface Coating of Polystyrene and ePTFE for Improved Endothelial Cell Attachment and Hemocompatibility

    PubMed Central

    Schleicher, Martina; Hansmann, Jan; Elkin, Bentsian; Kluger, Petra J.; Liebscher, Simone; Huber, Agnes J. T.; Fritze, Olaf; Schille, Christine; Müller, Michaela; Schenke-Layland, Katja; Seifert, Martina; Walles, Heike; Wendel, Hans-Peter; Stock, Ulrich A.

    2012-01-01

    In vivo self-endothelialization by endothelial cell adhesion on cardiovascular implants is highly desirable. DNA-oligonucleotides are an intriguing coating material with nonimmunogenic characteristics and the feasibility of easy and rapid chemical fabrication. The objective of this study was the creation of cell adhesive DNA-oligonucleotide coatings on vascular implant surfaces. DNA-oligonucleotides immobilized by adsorption on parylene (poly(monoaminomethyl-para-xylene)) coated polystyrene and ePTFE were resistant to high shear stress (9.5 N/m2) and human blood serum for up to 96 h. Adhesion of murine endothelial progenitor cells, HUVECs and endothelial cells from human adult saphenous veins as well as viability over a period of 14 days of HUVECs on oligonucleotide coated samples under dynamic culture conditions was significantly enhanced (P < 0.05). Oligonucleotide-coated surfaces revealed low thrombogenicity and excellent hemocompatibility after incubation with human blood. These properties suggest the suitability of immobilization of DNA-oligonucleotides for biofunctionalization of blood vessel substitutes for improved in vivo endothelialization. PMID:22481939

  14. Nutrition metabolism plays an important role in the alternate bearing of the olive tree (Olea europaea L.).

    PubMed

    Turktas, Mine; Inal, Behcet; Okay, Sezer; Erkilic, Emine Gulden; Dundar, Ekrem; Hernandez, Pilar; Dorado, Gabriel; Unver, Turgay

    2013-01-01

    The olive tree (Olea europaea L.) is widely known for its strong tendency for alternate bearing, which severely affects the fruit yield from year to year. Microarray based gene expression analysis using RNA from olive samples (on-off years leaves and ripe-unripe fruits) are particularly useful to understand the molecular mechanisms influencing the periodicity in the olive tree. Thus, we carried out genome wide transcriptome analyses involving different organs and temporal stages of the olive tree using the NimbleGen Array containing 136,628 oligonucleotide probe sets. Cluster analyses of the genes showed that cDNAs originated from different organs could be sorted into separate groups. The nutritional control had a particularly remarkable impact on the alternate bearing of olive, as shown by the differential expression of transcripts under different temporal phases and organs. Additionally, hormonal control and flowering processes also played important roles in this phenomenon. Our analyses provide further insights into the transcript changes between "on year" and "off year" leaves along with the changes from unrpipe to ripe fruits, which shed light on the molecular mechanisms underlying the olive tree alternate bearing. These findings have important implications for the breeding and agriculture of the olive tree and other crops showing periodicity. To our knowledge, this is the first study reporting the development and use of an olive array to document the gene expression profiling associated with the alternate bearing in olive tree.

  15. Nutrition Metabolism Plays an Important Role in the Alternate Bearing of the Olive Tree (Olea europaea L.)

    PubMed Central

    Turktas, Mine; Inal, Behcet; Okay, Sezer; Erkilic, Emine Gulden; Dundar, Ekrem; Hernandez, Pilar; Dorado, Gabriel; Unver, Turgay

    2013-01-01

    The olive tree (Olea europaea L.) is widely known for its strong tendency for alternate bearing, which severely affects the fruit yield from year to year. Microarray based gene expression analysis using RNA from olive samples (on-off years leaves and ripe-unripe fruits) are particularly useful to understand the molecular mechanisms influencing the periodicity in the olive tree. Thus, we carried out genome wide transcriptome analyses involving different organs and temporal stages of the olive tree using the NimbleGen Array containing 136,628 oligonucleotide probe sets. Cluster analyses of the genes showed that cDNAs originated from different organs could be sorted into separate groups. The nutritional control had a particularly remarkable impact on the alternate bearing of olive, as shown by the differential expression of transcripts under different temporal phases and organs. Additionally, hormonal control and flowering processes also played important roles in this phenomenon. Our analyses provide further insights into the transcript changes between ”on year” and “off year” leaves along with the changes from unrpipe to ripe fruits, which shed light on the molecular mechanisms underlying the olive tree alternate bearing. These findings have important implications for the breeding and agriculture of the olive tree and other crops showing periodicity. To our knowledge, this is the first study reporting the development and use of an olive array to document the gene expression profiling associated with the alternate bearing in olive tree. PMID:23555820

  16. Genome-Wide Mapping of Copy Number Variation in Humans: Comparative Analysis of High Resolution Array Platforms

    PubMed Central

    Haraksingh, Rajini R.; Abyzov, Alexej; Gerstein, Mark; Urban, Alexander E.; Snyder, Michael

    2011-01-01

    Accurate and efficient genome-wide detection of copy number variants (CNVs) is essential for understanding human genomic variation, genome-wide CNV association type studies, cytogenetics research and diagnostics, and independent validation of CNVs identified from sequencing based technologies. Numerous, array-based platforms for CNV detection exist utilizing array Comparative Genome Hybridization (aCGH), Single Nucleotide Polymorphism (SNP) genotyping or both. We have quantitatively assessed the abilities of twelve leading genome-wide CNV detection platforms to accurately detect Gold Standard sets of CNVs in the genome of HapMap CEU sample NA12878, and found significant differences in performance. The technologies analyzed were the NimbleGen 4.2 M, 2.1 M and 3×720 K Whole Genome and CNV focused arrays, the Agilent 1×1 M CGH and High Resolution and 2×400 K CNV and SNP+CGH arrays, the Illumina Human Omni1Quad array and the Affymetrix SNP 6.0 array. The Gold Standards used were a 1000 Genomes Project sequencing-based set of 3997 validated CNVs and an ultra high-resolution aCGH-based set of 756 validated CNVs. We found that sensitivity, total number, size range and breakpoint resolution of CNV calls were highest for CNV focused arrays. Our results are important for cost effective CNV detection and validation for both basic and clinical applications. PMID:22140474

  17. Microenvironmental Effect of 2'-O-(1-Pyrenylmethyl)uridine Modified Fluorescent Oligonucleotide Probes on Sensitive and Selective Detection of Target RNA.

    PubMed

    Imincan, Gülnur; Pei, Fen; Yu, Lijia; Jin, Hongwei; Zhang, Liangren; Yang, Xiaoda; Zhang, Lihe; Tang, XinJing

    2016-04-19

    2'-O-(1-Pyrenylmethyl)uridine modified oligoribonucleotides provide highly sensitive pyrene fluorescent probes for detecting specific nucleotide mutation of RNA targets. To develop more stable and cost-effective oligonucleotide probes, we investigated the local microenvironmental effects of nearby nucleobases on pyrene fluorescence in duplexes of RNAs and 2'-O-(1-pyrenylmethyl)uridine modified oligonucleotides. By incorporation of deoxyribonucleotides, ribonucleotides, 2'-MeO-nucleotides and 2'-F-nucleotides at both sides of 2'-O-(1-pyrenylmethyl)uridine (U(p)) in oligodeoxynucleotide probes, we synthesized a series of pyrene modified oligonucleotide probes. Their pyrene fluorescence emission spectra indicated that only two proximal nucleotides have a substantial effect on the pyrene fluorescence properties of these oligonucleotide probes hybridized with target RNA with an order of fluorescence sensitivity of 2'-F-nucleotides > 2'-MeO-nucleotides > ribonucleotides ≫ deoxyribonucleotides. While based on circular dichroism spectra, overall helix conformations (either A- or B-form) of the duplexes have marginal effects on the sensitivity of the probes. Instead, the local substitution reflected the propensity of the nucleotide sugar ring to adopt North type conformation and, accordingly, shifted their helix geometry toward a more A-type like conformation in local microenvironments. Thus, higher enhancement of pyrene fluorescence emission favored local A-type helix structures and more polar and hydrophobic environments (F > MeO > OH at 2' substitution) of duplex minor grooves of probes with the target RNA. Further dynamic simulation revealed that local microenvironmental effect of 2'-F-nucleotides or ribonucleotides was enough for pyrene moiety to move out of nucleobases to the minor groove of duplexes; in addition, 2'-F-nucleotide had less effect on π-stack of pyrene-modified uridine with upstream and downstream nucleobases. The present oligonucleotide probes successfully distinguished target RNA from single-mutated RNA analyte during an in vitro assay of RNA synthesis.

  18. Description of three new species of Hepatozoon (Apicomplexa, Hepatozoidae) from Rattlesnakes (Crotalus durissus terrificus) based on molecular, morphometric and morphologic characters.

    PubMed

    O'Dwyer, Lucia Helena; Moço, Tatiana Cristina; Paduan, Karina dos Santos; Spenassatto, Carine; da Silva, Reinaldo José; Ribolla, Paulo Eduardo Martins

    2013-10-01

    Hepatozoon spp. are commonly found infecting snakes. Since the latter are parasitized by diverse forms and data in the literature show divergence, we studied Hepatozoon spp. diversity on Crotalus durissus terrificus snakes using both molecular and morphological approaches. Naturally infected animals were employed. Blood was collected, blood smears were prepared and an aliquot was stored at -20°C for DNA extraction. Five specimens of C. durissus terrificus were selected, each of them infected with one gamont type. Morphological and morphometric analyses of the found gamonts led to their grouping into three populations. For molecular characterization, seven oligonucleotide pairs that amplify distinct regions of rDNA gene were tested by adopting the PCR technique. Only the oligonucleotide pairs HepF300/Hep900 and HEMO1/HEMO2 were efficient in amplifying and distinguishing different isolates of Hepatozoon spp. from snakes. The better results were obtained when both oligonucleotide pairs were used in association. Based on the molecular and morphologic differences, three new species were proposed: Hepatozoon cuestensis sp. nov.; Hepatozoon cevapii sp. nov. and Hepatozoon massardii sp. nov. This is the first description of new Hepatozoon species from snakes, based on molecular characterization and morphological data, in South America. Copyright © 2013 Elsevier Inc. All rights reserved.

  19. Highly Stable Double-Stranded DNA Containing Sequential Silver(I)-Mediated 7-Deazaadenine/Thymine Watson-Crick Base Pairs.

    PubMed

    Santamaría-Díaz, Noelia; Méndez-Arriaga, José M; Salas, Juan M; Galindo, Miguel A

    2016-05-17

    The oligonucleotide d(TX)9 , which consists of an octadecamer sequence with alternating non-canonical 7-deazaadenine (X) and canonical thymine (T) as the nucleobases, was synthesized and shown to hybridize into double-stranded DNA through the formation of hydrogen-bonded Watson-Crick base pairs. dsDNA with metal-mediated base pairs was then obtained by selectively replacing W-C hydrogen bonds by coordination bonds to central silver(I) ions. The oligonucleotide I adopts a duplex structure in the absence of Ag(+) ions, and its stability is significantly enhanced in the presence of Ag(+) ions while its double-helix structure is retained. Temperature-dependent UV spectroscopy, circular dichroism spectroscopy, and ESI mass spectrometry were used to confirm the selective formation of the silver(I)-mediated base pairs. This strategy could become useful for preparing stable metallo-DNA-based nanostructures. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. DNA cross-linking by dehydromonocrotaline lacks apparent base sequence preference.

    PubMed

    Rieben, W Kurt; Coulombe, Roger A

    2004-12-01

    Pyrrolizidine alkaloids (PAs) are ubiquitous plant toxins, many of which, upon oxidation by hepatic mixed-function oxidases, become reactive bifunctional pyrrolic electrophiles that form DNA-DNA and DNA-protein cross-links. The anti-mitotic, toxic, and carcinogenic action of PAs is thought to be caused, at least in part, by these cross-links. We wished to determine whether the activated PA pyrrole dehydromonocrotaline (DHMO) exhibits base sequence preferences when cross-linked to a set of model duplex poly A-T 14-mer oligonucleotides with varying internal and/or end 5'-d(CG), 5'-d(GC), 5'-d(TA), 5'-d(CGCG), or 5'-d(GCGC) sequences. DHMO-DNA cross-links were assessed by electrophoretic mobility shift assay (EMSA) of 32P endlabeled oligonucleotides and by HPLC analysis of cross-linked DNAs enzymatically digested to their constituent deoxynucleosides. The degree of DNA cross-links depended upon the concentration of the pyrrole, but not on the base sequence of the oligonucleotide target. Likewise, HPLC chromatograms of cross-linked and digested DNAs showed no discernible sequence preference for any nucleotide. Added glutathione, tyrosine, cysteine, and aspartic acid, but not phenylalanine, threonine, serine, lysine, or methionine competed with DNA as alternate nucleophiles for cross-linking by DHMO. From these data it appears that DHMO exhibits no strong base preference when forming cross-links with DNA, and that some cellular nucleophiles can inhibit DNA cross-link formation.

  1. An Ultra-High-Density, Transcript-Based, Genetic Map of Lettuce

    PubMed Central

    Truco, Maria José; Ashrafi, Hamid; Kozik, Alexander; van Leeuwen, Hans; Bowers, John; Wo, Sebastian Reyes Chin; Stoffel, Kevin; Xu, Huaqin; Hill, Theresa; Van Deynze, Allen; Michelmore, Richard W.

    2013-01-01

    We have generated an ultra-high-density genetic map for lettuce, an economically important member of the Compositae, consisting of 12,842 unigenes (13,943 markers) mapped in 3696 genetic bins distributed over nine chromosomal linkage groups. Genomic DNA was hybridized to a custom Affymetrix oligonucleotide array containing 6.4 million features representing 35,628 unigenes of Lactuca spp. Segregation of single-position polymorphisms was analyzed using 213 F7:8 recombinant inbred lines that had been generated by crossing cultivated Lactuca sativa cv. Salinas and L. serriola acc. US96UC23, the wild progenitor species of L. sativa. The high level of replication of each allele in the recombinant inbred lines was exploited to identify single-position polymorphisms that were assigned to parental haplotypes. Marker information has been made available using GBrowse to facilitate access to the map. This map has been anchored to the previously published integrated map of lettuce providing candidate genes for multiple phenotypes. The high density of markers achieved in this ultradense map allowed syntenic studies between lettuce and Vitis vinifera as well as other plant species. PMID:23550116

  2. An Ultra-High-Density, Transcript-Based, Genetic Map of Lettuce.

    PubMed

    Truco, Maria José; Ashrafi, Hamid; Kozik, Alexander; van Leeuwen, Hans; Bowers, John; Wo, Sebastian Reyes Chin; Stoffel, Kevin; Xu, Huaqin; Hill, Theresa; Van Deynze, Allen; Michelmore, Richard W

    2013-04-09

    We have generated an ultra-high-density genetic map for lettuce, an economically important member of the Compositae, consisting of 12,842 unigenes (13,943 markers) mapped in 3696 genetic bins distributed over nine chromosomal linkage groups. Genomic DNA was hybridized to a custom Affymetrix oligonucleotide array containing 6.4 million features representing 35,628 unigenes of Lactuca spp. Segregation of single-position polymorphisms was analyzed using 213 F 7:8 recombinant inbred lines that had been generated by crossing cultivated Lactuca sativa cv. Salinas and L. serriola acc. US96UC23, the wild progenitor species of L. sativa The high level of replication of each allele in the recombinant inbred lines was exploited to identify single-position polymorphisms that were assigned to parental haplotypes. Marker information has been made available using GBrowse to facilitate access to the map. This map has been anchored to the previously published integrated map of lettuce providing candidate genes for multiple phenotypes. The high density of markers achieved in this ultradense map allowed syntenic studies between lettuce and Vitis vinifera as well as other plant species. Copyright © 2013 Truco et al.

  3. A DNA microarray for identification of selected Korean birds based on mitochondrial cytochrome c oxidase I gene sequences.

    PubMed

    Chung, In-Hyuk; Yoo, Hye Sook; Eah, Jae-Yong; Yoon, Hyun-Kyu; Jung, Jin-Wook; Hwang, Seung Yong; Kim, Chang-Bae

    2010-10-01

    DNA barcoding with the gene encoding cytochrome c oxidase I (COI) in the mitochondrial genome has been proposed as a standard marker to identify and discover animal species. Some migratory wild birds are suspected of transmitting avian influenza and pose a threat to aircraft safety because of bird strikes. We have previously reported the COI gene sequences of 92 Korean bird species. In the present study, we developed a DNA microarray to identify 17 selected bird species on the basis of nucleotide diversity. We designed and synthesized 19 specific oligonucleotide probes; these probes were arrayed on a silylated glass slide. The length of the probes was 19-24 bps. The COI sequences amplified from the tissues of the selected birds were labeled with a fluorescent probe for microarray hybridization, and unique hybridization patterns were detected for each selected species. These patterns may be considered diagnostic patterns for species identification. This microarray system will provide a sensitive and a high-throughput method for identification of Korean birds.

  4. Functional Genomics Using the Saccharomyces cerevisiae Yeast Deletion Collections.

    PubMed

    Nislow, Corey; Wong, Lai Hong; Lee, Amy Huei-Yi; Giaever, Guri

    2016-09-01

    Constructed by a consortium of 16 laboratories, the Saccharomyces genome-wide deletion collections have, for the past decade, provided a powerful, rapid, and inexpensive approach for functional profiling of the yeast genome. Loss-of-function deletion mutants were systematically created using a polymerase chain reaction (PCR)-based gene deletion strategy to generate a start-to-stop codon replacement of each open reading frame by homologous recombination. Each strain carries two molecular barcodes that serve as unique strain identifiers, enabling their growth to be analyzed in parallel and the fitness contribution of each gene to be quantitatively assessed by hybridization to high-density oligonucleotide arrays or through the use of next-generation sequencing technologies. Functional profiling of the deletion collections, using either strain-by-strain or parallel assays, provides an unbiased approach to systematically survey the yeast genome. The Saccharomyces yeast deletion collections have proved immensely powerful in contributing to the understanding of gene function, including functional relationships between genes and genetic pathways in response to diverse genetic and environmental perturbations. © 2016 Cold Spring Harbor Laboratory Press.

  5. Tissue Gene Expression Analysis Using Arrayed Normalized cDNA Libraries

    PubMed Central

    Eickhoff, Holger; Schuchhardt, Johannes; Ivanov, Igor; Meier-Ewert, Sebastian; O'Brien, John; Malik, Arif; Tandon, Neeraj; Wolski, Eryk-Witold; Rohlfs, Elke; Nyarsik, Lajos; Reinhardt, Richard; Nietfeld, Wilfried; Lehrach, Hans

    2000-01-01

    We have used oligonucleotide-fingerprinting data on 60,000 cDNA clones from two different mouse embryonic stages to establish a normalized cDNA clone set. The normalized set of 5,376 clones represents different clusters and therefore, in almost all cases, different genes. The inserts of the cDNA clones were amplified by PCR and spotted on glass slides. The resulting arrays were hybridized with mRNA probes prepared from six different adult mouse tissues. Expression profiles were analyzed by hierarchical clustering techniques. We have chosen radioactive detection because it combines robustness with sensitivity and allows the comparison of multiple normalized experiments. Sensitive detection combined with highly effective clustering algorithms allowed the identification of tissue-specific expression profiles and the detection of genes specifically expressed in the tissues investigated. The obtained results are publicly available (http://www.rzpd.de) and can be used by other researchers as a digital expression reference. [The sequence data described in this paper have been submitted to the EMBL data library under accession nos. AL360374–AL36537.] PMID:10958641

  6. DNA-based species detection capabilities using laser transmission spectroscopy

    PubMed Central

    Mahon, A. R.; Barnes, M. A.; Li, F.; Egan, S. P.; Tanner, C. E.; Ruggiero, S. T.; Feder, J. L.; Lodge, D. M.

    2013-01-01

    Early detection of invasive species is critical for effective biocontrol to mitigate potential ecological and economic damage. Laser transmission spectroscopy (LTS) is a powerful solution offering real-time, DNA-based species detection in the field. LTS can measure the size, shape and number of nanoparticles in a solution and was used here to detect size shifts resulting from hybridization of the polymerase chain reaction product to nanoparticles functionalized with species-specific oligonucleotide probes or with the species-specific oligonucleotide probes alone. We carried out a series of DNA detection experiments using the invasive freshwater quagga mussel (Dreissena bugensis) to evaluate the capability of the LTS platform for invasive species detection. Specifically, we tested LTS sensitivity to (i) DNA concentrations of a single target species, (ii) the presence of a target species within a mixed sample of other closely related species, (iii) species-specific functionalized nanoparticles versus species-specific oligonucleotide probes alone, and (iv) amplified DNA fragments versus unamplified genomic DNA. We demonstrate that LTS is a highly sensitive technique for rapid target species detection, with detection limits in the picomolar range, capable of successful identification in multispecies samples containing target and non-target species DNA. These results indicate that the LTS DNA detection platform will be useful for field application of target species. Additionally, we find that LTS detection is effective with species-specific oligonucleotide tags alone or when they are attached to polystyrene nanobeads and with both amplified and unamplified DNA, indicating that the technique may also have versatility for broader applications. PMID:23015524

  7. Oligonucleotide labeling methods. 3. Direct labeling of oligonucleotides employing a novel, non-nucleosidic, 2-aminobutyl-1,3-propanediol backbone.

    PubMed Central

    Nelson, P S; Kent, M; Muthini, S

    1992-01-01

    Novel CE-phosphoramidite (7a-e) and CPG (8a, c, d, e) reagents have been prepared from a unique 2-aminobutyl-1,3-propanediol backbone. The reagents have been used to directly label oligonucleotides with fluorescein, acridine, and biotin via automated DNA synthesis. The versatile 2-aminobutyl-1,3-propanediol backbone allows for labeling at any position (5', internal, and 3') during solid phase oligonucleotide synthesis. Multiple labels can be achieved by repetitive coupling cycles. Furthermore, the 3-carbon atom internucleotide phosphate distance is retained when inserted internally. Using this method, individual oligonucleotides possessing two and three different reporter molecules have been prepared. PMID:1475185

  8. Real-Time and Accurate Identification of Single Oligonucleotide Photoisomers via an Aerolysin Nanopore.

    PubMed

    Hu, Zheng-Li; Li, Zi-Yuan; Ying, Yi-Lun; Zhang, Junji; Cao, Chan; Long, Yi-Tao; Tian, He

    2018-04-03

    Identification of the configuration for the photoresponsive oligonucleotide plays an important role in the ingenious design of DNA nanomolecules and nanodevices. Due to the limited resolution and sensitivity of present methods, it remains a challenge to determine the accurate configuration of photoresponsive oligonucleotides, much less a precise description of their photoconversion process. Here, we used an aerolysin (AeL) nanopore-based confined space for real-time determination and quantification of the absolute cis/ trans configuration of each azobenzene-modified oligonucleotide (Azo-ODN) with a single molecule resolution. The two completely separated current distributions with narrow peak widths at half height (<0.62 pA) are assigned to cis/ trans-Azo-ODN isomers, respectively. Due to the high current sensitivity, each isomer of Azo-ODN could be undoubtedly identified, which gives the accurate photostationary conversion values of 82.7% for trans-to- cis under UV irradiation and 82.5% for cis-to- trans under vis irradiation. Further real-time kinetic evaluation reveals that the photoresponsive rate constants of Azo-ODN from trans-to- cis and cis-to -trans are 0.43 and 0.20 min -1 , respectively. This study will promote the sophisticated design of photoresponsive ODN to achieve an efficient and applicable photocontrollable process.

  9. Electron stimulated desorption of anions from native and brominated single stranded oligonucleotide trimers

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Polska, Katarzyna; Rak, Janusz; Bass, Andrew D.

    2012-02-21

    We measured the low energy electron stimulated desorption (ESD) of anions from thin films of native (TXT) and bromine monosubstituted (TBrXT) oligonucleotide trimers deposited on a gold surface (T = thymidine, X = T, deoxycytidine (C), deoxyadenosine (A) or deoxyguanosine (G), Br = bromine). The desorption of H{sup -}, CH{sub 3}{sup -}/NH{sup -}, O{sup -}/NH{sub 2}{sup -}, OH{sup -}, CN{sup -}, and Br{sup -} was induced by 0 to 20 eV electrons. Dissociative electron attachment, below 12 eV, and dipolar dissociation, above 12 eV, are responsible for the formation of these anions. The comparison of the results obtained for themore » native and brominated trimers suggests that the main pathways of TBrXT degradation correspond to the release of the hydride and bromide anions. Significantly, the presence of bromine in oligonucleotide trimers blocks the electron-induced degradation of nuclobases as evidenced by a dramatic decrease in CN{sup -} desorption. An increase in the yields of OH{sup -} is also observed. The debromination yield of particular oligonucleotides diminishes in the following order: BrdU > BrdA > BrdG > BrdC. Based on these results, 5-bromo-2{sup '}-deoxyuridine appears to be the best radiosensitizer among the studied bromonucleosides.« less

  10. Integrated Safety Assessment of 2′-O-Methoxyethyl Chimeric Antisense Oligonucleotides in NonHuman Primates and Healthy Human Volunteers

    PubMed Central

    Crooke, Stanley T; Baker, Brenda F; Kwoh, T Jesse; Cheng, Wei; Schulz, Dan J; Xia, Shuting; Salgado, Nelson; Bui, Huynh-Hoa; Hart, Christopher E; Burel, Sebastien A; Younis, Husam S; Geary, Richard S; Henry, Scott P; Bhanot, Sanjay

    2016-01-01

    The common chemical and biological properties of antisense oligonucleotides provide the opportunity to identify and characterize chemical class effects across species. The chemical class that has proven to be the most versatile and best characterized is the 2′-O-methoxyethyl chimeric antisense oligonucleotides. In this report we present an integrated safety assessment of data obtained from controlled dose-ranging studies in nonhuman primates (macaques) and healthy human volunteers for 12 unique 2′-O-methoxyethyl chimeric antisense oligonucleotides. Safety was assessed by the incidence of safety signals in standardized laboratory tests for kidney and liver function, hematology, and complement activation; as well as by the mean test results as a function of dose level over time. At high doses a number of toxicities were observed in nonhuman primates. However, no class safety effects were identified in healthy human volunteers from this integrated data analysis. Effects on complement in nonhuman primates were not observed in humans. Nonhuman primates predicted safe doses in humans, but over predicted risk of complement activation and effects on platelets. Although limited to a single chemical class, comparisons from this analysis are considered valid and accurate based on the carefully controlled setting for the specified study populations and within the total exposures studied. PMID:27357629

  11. Size-Uniform 200 nm Particles: Fabrication and Application to Magnetofection

    PubMed Central

    Mair, Lamar; Ford, Kris; Alam, Rowshon; Kole, Ryszard; Fisher, Michael; Superfine, Richard

    2009-01-01

    We report on the fabrication of arrays of mono- and multimetallic particles via metal evaporation onto lithographically patterned posts, as well as the magnetic force calibration and successful magnetofection of iron particles grown via this method. This work represents the first instance in which metal evaporation onto post structures was used for the formation of released, shape-defined metal particles. Also, our work represents the first use of lithographically defined particles as agents of magnetofection. Using these techniques it is possible to create particles with complex shapes and lateral dimensions as small as 40 nm. Our demonstrated compositionally flexible particles are highly size-uniform due to their photolithographically defined growth substrates, with particle dimensions along two axes fixed at 200 nm; the third axis dimension can be varied from 20 nm to 300 nm during the deposition procedure. Atomic percent of metals incorporated into the particle volume is highly tunable and particles have been synthesized with as many as four different metals. We performed magnetic force calibrations on a single particle size for iron particles using an axially magnetized NeFeB permanent magnet and comparisons are made with commercially available magnetic beads. In order to evalutate their usefulness as magnetofection agents, an antisense oligonucleotide (ODN) designed to correct the aberrant splicing of enhanced green fluorescent protein mRNA, was successfully transfected into a modified HeLa cell line. Magnetically enhanced gene delivery was accomplished in vitro using antisense ODN-laden iron particles followed by application of a field gradient. Magnetically enhanced transfection resulted in a 76% and 139% increase in fluorescence intensity when compared to Lipofectamine and antisense ODN-loaded particles delivered without magnetic treatment, respectively. To our knowledge, these experiments constitute the first use of lithographically defined particles as successful agents for magnetically enhanced transfection of an antisense oligonucleotide. PMID:20055096

  12. Oligoribonucleotide map and protein of CMII: detection of conserved and nonconserved genetic elements in avian acute leukemia viruses CMII, MC29, and MH2.

    PubMed Central

    Bister, K; Löliger, H C; Duesberg, P H

    1979-01-01

    RNA and protein of the defective avian acute leukemia virus CMII, which causes myelocytomas in chickens, and of CMII-associated helper virus (CMIIAV) were investigated. The RNA of CMII measured 6 kilobases (kb) and that of CMIIAV measured 8.5 kb. By comparing more than 20 mapped oligonucleotides of CMII RNA with mapped and nonmapped oligonucleotides of acute leukemia viruses MC29 and MH2 and with mapped oligonucleotides of CMIIAV and other nondefective avian tumor viruses, three segments were distinguished in the oligonucleotide map of CMII RNA: (i) a 5' group-specific segment of 1.5 kb which was conserved among CMII, MC29, and MH2 and also homologous with gag-related oligonucleotides of CMIIAV and other helper viruses (hence, group specific); (ii) an internal segment of 2 kb which was conserved specifically among CMII, MC29, and MH2 and whose presence in CMII lends new support to the view that this class of genetic elements is essential for oncogenicity, because it was absent from an otherwise isogenic, nontransforming helper, CMIIAV; and (iii) a 3' group-specific segment of 2.5 kb which shared 13 of 14 oligonucleotides with CMIIAV and included env oligonucleotides of other nondefective viruses of the avian tumor virus group (hence, group specific). This segment and analogous map segments of MC29 and MH2 were not conserved at the level of shared oligonucleotides. CMII-transformed cells contained a nonstructural, gag gene-related protein of 90,000 daltons, distinguished by its size from 110,000-daltom MC29 and 100,000-dalton MH2 counterparts. The gag relatedness and similarity to the 110,000-dalton MC29 counterpart indicated that the 90,000-dalton CMII protein is translated from the 5' and internal segments of CMII RNA. The existence of conserved 5' and internal RNA segments and conserved nonstructural protein products in CMII, MC29, and MH2 indicates that these viruses belong to a related group, termed here the MC29 group. Viruses of the MC29 group differ from one another mainly in their 3' RNA segments and in minor variations of their conserved RNA segments as well as by strain-specific size markers of their gag-related proteins. Because (i) the conserved 5' gag-related and internal RNA segments and their gag-related, nonvirion protein products correlate with the conserved oncogenic spectra of the MC29 group of viruses and because (ii) the internal RNA sequences and nonvirion proteins are not found in nondefective viruses, we propose that the conserved RNA and protein elements are necessary for oncogenicity and probably are the onc gene products of the MC29 group of viruses. Images PMID:232172

  13. Numerical study of the properties of optical vortex array laser tweezers.

    PubMed

    Kuo, Chun-Fu; Chu, Shu-Chun

    2013-11-04

    Chu et al. constructed a kind of Ince-Gaussian modes (IGM)-based vortex array laser beams consisting of p x p embedded optical vortexes from Ince-Gaussian modes, IG(e)(p,p) modes [Opt. Express 16, 19934 (2008)]. Such an IGM-based vortex array laser beams maintains its vortex array profile during both propagation and focusing, and is applicable to optical tweezers. This study uses the discrete dipole approximation (DDA) method to study the properties of the IGM-based vortex array laser tweezers while it traps dielectric particles. This study calculates the resultant force exerted on the spherical dielectric particles of different sizes situated at the IGM-based vortex array laser beam waist. Numerical results show that the number of trapping spots of a structure light (i.e. IGM-based vortex laser beam), is depended on the relation between the trapped particle size and the structure light beam size. While the trapped particle is small comparing to the beam size of the IGM-based vortex array laser beams, the IGM-based vortex array laser beams tweezers are suitable for multiple traps. Conversely, the tweezers is suitable for single traps. The results of this study is useful to the future development of the vortex array laser tweezers applications.

  14. Importance of length and sequence order on magnesium binding to surface-bound oligonucleotides studied by second harmonic generation and atomic force microscopy.

    PubMed

    Holland, Joseph G; Geiger, Franz M

    2012-06-07

    The binding of magnesium ions to surface-bound single-stranded oligonucleotides was studied under aqueous conditions using second harmonic generation (SHG) and atomic force microscopy (AFM). The effect of strand length on the number of Mg(II) ions bound and their free binding energy was examined for 5-, 10-, 15-, and 20-mers of adenine and guanine at pH 7, 298 K, and 10 mM NaCl. The binding free energies for adenine and guanine sequences were calculated to be -32.1(4) and -35.6(2) kJ/mol, respectively, and invariant with strand length. Furthermore, the ion density for adenine oligonucleotides did not change as strand length increased, with an average value of 2(1) ions/strand. In sharp contrast, guanine oligonucleotides displayed a linear relationship between strand length and ion density, suggesting that cooperativity is important. This data gives predictive capabilities for mixed strands of various lengths, which we exploit for 20-mers of adenines and guanines. In addition, the role sequence order plays in strands of hetero-oligonucleotides was examined for 5'-A(10)G(10)-3', 5'-(AG)(10)-3', and 5'-G(10)A(10)-3' (here the -3' end is chemically modified to bind to the surface). Although the free energy of binding is the same for these three strands (averaged to be -33.3(4) kJ/mol), the total ion density increases when several guanine residues are close to the 3' end (and thus close to the solid support substrate). To further understand these results, we analyzed the height profiles of the functionalized surfaces with tapping-mode atomic force microscopy (AFM). When comparing the average surface height profiles of the oligonucleotide surfaces pre- and post- Mg(II) binding, a positive correlation was found between ion density and the subsequent height decrease following Mg(II) binding, which we attribute to reductions in Coulomb repulsion and strand collapse once a critical number of Mg(II) ions are bound to the strand.

  15. Alteration in oligonucleotide fingerprint patterns of the viral genome in poliovirus type 2 isolated from paralytic patients.

    PubMed Central

    Yoneyama, T; Hagiwara, A; Hara, M; Shimojo, H

    1982-01-01

    A close relationship was demonstrated by oligonucleotide fingerprinting between genomes of the poliovirus type 2 Sabin vaccine strain and recent isolates from paralytic cases associated with vaccination in Japan. The oligonucleotide maps of isolates from an agammaglobulinemic patient, who continued to excrete poliovirus type 2 for 3.5 years after the administration of oral vaccine, showed that the genomic alteration proceeded gradually, retaining the majority of the oligonucleotides characteristic of the vaccine strain for a long period, indicating vaccine origin for the isolates. The final isolate at month 41, however, lost the majority of these oligonucleotides. The heterologous antigenic relationship between the final isolate and the previous isolates was also observed. The serial alteration in electrophoretic mobility of the major structural proteins (VP1, VP2, and VP3) was observed throughout the excreting period. These results indicate that the population of the virus in this individual changed markedly during the last short period (about 3 months), in which the treatment with secretory immunoglobulin A was carried out. Genome comparisons in oligonucleotide maps show that some oligonucleotides in the genome of the vaccine strain are highly mutable after passage in humans. Images PMID:6179881

  16. Multiple primer extension by DNA polymerase on a novel plastic DNA array coated with a biocompatible polymer

    PubMed Central

    Kinoshita, Kenji; Fujimoto, Kentaro; Yakabe, Toru; Saito, Shin; Hamaguchi, Yuzo; Kikuchi, Takayuki; Nonaka, Ken; Murata, Shigenori; Masuda, Daisuke; Takada, Wataru; Funaoka, Sohei; Arai, Susumu; Nakanishi, Hisao; Yokoyama, Kanehisa; Fujiwara, Kazuhiko; Matsubara, Kenichi

    2007-01-01

    DNA microarrays are routinely used to monitor gene expression profiling and single nucleotide polymorphisms (SNPs). However, for practically useful high performance, the detection sensitivity is still not adequate, leaving low expression genes undetected. To resolve this issue, we have developed a new plastic S-BIO® PrimeSurface® with a biocompatible polymer; its surface chemistry offers an extraordinarily stable thermal property for a lack of pre-activated glass slide surface. The oligonucleotides immobilized on this substrate are robust in boiling water and show no significant loss of hybridization activity during dissociation treatment. This allowed us to hybridize the templates, extend the 3′ end of the immobilized DNA primers on the S-Bio® by DNA polymerase using deoxynucleotidyl triphosphates (dNTP) as extender units, release the templates by denaturalization and use the same templates for a second round of reactions similar to that of the PCR method. By repeating this cycle, the picomolar concentration range of the template oligonucleotide can be detected as stable signals via the incorporation of labeled dUTP into primers. This method of Multiple Primer EXtension (MPEX) could be further extended as an alternative route for producing DNA microarrays for SNP analyses via simple template preparation such as reverse transcript cDNA or restriction enzyme treatment of genome DNA. PMID:17135189

  17. Method of identifying hairpin DNA probes by partial fold analysis

    DOEpatents

    Miller, Benjamin L [Penfield, NY; Strohsahl, Christopher M [Saugerties, NY

    2009-10-06

    Method of identifying molecular beacons in which a secondary structure prediction algorithm is employed to identify oligonucleotide sequences within a target gene having the requisite hairpin structure. Isolated oligonucleotides, molecular beacons prepared from those oligonucleotides, and their use are also disclosed.

  18. Method of identifying hairpin DNA probes by partial fold analysis

    DOEpatents

    Miller, Benjamin L.; Strohsahl, Christopher M.

    2008-10-28

    Methods of identifying molecular beacons in which a secondary structure prediction algorithm is employed to identify oligonucleotide sequences within a target gene having the requisite hairpin structure. Isolated oligonucleotides, molecular beacons prepared from those oligonucleotides, and their use are also disclosed.

  19. Synthesis of 3'-, or 5'-, or internal methacrylamido-modified oligonucleotides

    DOEpatents

    Golova, Julia B.; Chernov, Boris K.

    2010-04-27

    New modifiers were synthesized for incorporation of a methacrylic function in 3'-, 5'- and internal positions of oligonucleotides during solid phase synthesis. A modifier was used for synthesis of 5'-methacrylated oligonucleotides for preparation of microarrays by a co-polymerization method.

  20. Recurrent reciprocal deletions and duplications of 16p13.11: the deletion is a risk factor for MR/MCA while the duplication may be a rare benign variant

    PubMed Central

    Hannes, F D; Sharp, A J; Mefford, H C; de Ravel, T; Ruivenkamp, C A; Breuning, M H; Fryns, J-P; Devriendt, K; Van Buggenhout, G; Vogels, A; Stewart, H; Hennekam, R C; Cooper, G M; Regan, R; Knight, S J L; Eichler, E E; Vermeesch, J R

    2009-01-01

    Background: Genomic disorders are often caused by non-allelic homologous recombination between segmental duplications. Chromosome 16 is especially rich in a chromosome-specific low copy repeat, termed LCR16. Methods and Results: A bacterial artificial chromosome (BAC) array comparative genome hybridisation (CGH) screen of 1027 patients with mental retardation and/or multiple congenital anomalies (MR/MCA) was performed. The BAC array CGH screen identified five patients with deletions and five with apparently reciprocal duplications of 16p13 covering 1.65 Mb, including 15 RefSeq genes. In addition, three atypical rearrangements overlapping or flanking this region were found. Fine mapping by high-resolution oligonucleotide arrays suggests that these deletions and duplications result from non-allelic homologous recombination (NAHR) between distinct LCR16 subunits with >99% sequence identity. Deletions and duplications were either de novo or inherited from unaffected parents. To determine whether these imbalances are associated with the MR/MCA phenotype or whether they might be benign variants, a population of 2014 normal controls was screened. The absence of deletions in the control population showed that 16p13.11 deletions are significantly associated with MR/MCA (p = 0.0048). Despite phenotypic variability, common features were identified: three patients with deletions presented with MR, microcephaly and epilepsy (two of these had also short stature), and two other deletion carriers ascertained prenatally presented with cleft lip and midline defects. In contrast to its previous association with autism, the duplication seems to be a common variant in the population (5/1682, 0.29%). Conclusion: These findings indicate that deletions inherited from clinically normal parents are likely to be causal for the patients’ phenotype whereas the role of duplications (de novo or inherited) in the phenotype remains uncertain. This difference in knowledge regarding the clinical relevance of the deletion and the duplication causes a paradigm shift in (cyto)genetic counselling. PMID:18550696

Top