Marlowe, Jennifer L; Akopian, Violetta; Karmali, Priya; Kornbrust, Douglas; Lockridge, Jennifer; Semple, Sean
2017-08-01
The use of lipid formulations has greatly improved the ability to effectively deliver oligonucleotides and has been instrumental in the rapid expansion of therapeutic development programs using oligonucleotide drugs. However, the development of such complex multicomponent therapeutics requires the implementation of unique, scientifically sound approaches to the nonclinical development of these drugs, based upon a hybrid of knowledge and experiences drawn from small molecule, protein, and oligonucleotide therapeutic drug development. The relative paucity of directly applicable regulatory guidance documents for oligonucleotide therapeutics in general has resulted in the generation of multiple white papers from oligonucleotide drug development experts and members of the Oligonucleotide Safety Working Group (OSWG). The members of the Formulated Oligonucleotide Subcommittee of the OSWG have utilized their collective experience working with a variety of formulations and their associated oligonucleotide payloads, as well as their insights into regulatory considerations and expectations, to generate a series of consensus recommendations for the pharmacokinetic characterization and nonclinical safety assessment of this unique class of therapeutics. It should be noted that the focus of Subcommittee discussions was on lipid nanoparticle and other types of particulate formulations of therapeutic oligonucleotides and not on conjugates or other types of modifications of oligonucleotide structure intended to facilitate delivery.
Milewski, Marek C; Kamel, Karol; Kurzynska-Kokorniak, Anna; Chmielewski, Marcin K; Figlerowicz, Marek
2017-10-01
Experimental methods based on DNA and RNA hybridization, such as multiplex polymerase chain reaction, multiplex ligation-dependent probe amplification, or microarray analysis, require the use of mixtures of multiple oligonucleotides (primers or probes) in a single test tube. To provide an optimal reaction environment, minimal self- and cross-hybridization must be achieved among these oligonucleotides. To address this problem, we developed EvOligo, which is a software package that provides the means to design and group DNA and RNA molecules with defined lengths. EvOligo combines two modules. The first module performs oligonucleotide design, and the second module performs oligonucleotide grouping. The software applies a nearest-neighbor model of nucleic acid interactions coupled with a parallel evolutionary algorithm to construct individual oligonucleotides, and to group the molecules that are characterized by the weakest possible cross-interactions. To provide optimal solutions, the evolutionary algorithm sorts oligonucleotides into sets, preserves preselected parts of the oligonucleotides, and shapes their remaining parts. In addition, the oligonucleotide sets can be designed and grouped based on their melting temperatures. For the user's convenience, EvOligo is provided with a user-friendly graphical interface. EvOligo was used to design individual oligonucleotides, oligonucleotide pairs, and groups of oligonucleotide pairs that are characterized by the following parameters: (1) weaker cross-interactions between the non-complementary oligonucleotides and (2) more uniform ranges of the oligonucleotide pair melting temperatures than other available software products. In addition, in contrast to other grouping algorithms, EvOligo offers time-efficient sorting of paired and unpaired oligonucleotides based on various parameters defined by the user.
The delivery of therapeutic oligonucleotides
Juliano, Rudolph L.
2016-01-01
The oligonucleotide therapeutics field has seen remarkable progress over the last few years with the approval of the first antisense drug and with promising developments in late stage clinical trials using siRNA or splice switching oligonucleotides. However, effective delivery of oligonucleotides to their intracellular sites of action remains a major issue. This review will describe the biological basis of oligonucleotide delivery including the nature of various tissue barriers and the mechanisms of cellular uptake and intracellular trafficking of oligonucleotides. It will then examine a variety of current approaches for enhancing the delivery of oligonucleotides. This includes molecular scale targeted ligand-oligonucleotide conjugates, lipid- and polymer-based nanoparticles, antibody conjugates and small molecules that improve oligonucleotide delivery. The merits and liabilities of these approaches will be discussed in the context of the underlying basic biology. PMID:27084936
Advanced surface-enhanced Raman gene probe systems and methods thereof
Vo-Dinh, Tuan
2001-01-01
The subject invention is a series of methods and systems for using the Surface-Enhanced Raman (SER)-labeled Gene Probe for hybridization, detection and identification of SER-labeled hybridized target oligonucleotide material comprising the steps of immobilizing SER-labeled hybridized target oligonucleotide material on a support means, wherein the SER-labeled hybridized target oligonucleotide material comprise a SER label attached either to a target oligonucleotide of unknown sequence or to a gene probe of known sequence complementary to the target oligonucleotide sequence, the SER label is unique for the target oligonucleotide strands of a particular sequence wherein the SER-labeled oligonucleotide is hybridized to its complementary oligonucleotide strand, then the support means having the SER-labeled hybridized target oligonucleotide material adsorbed thereon is SERS activated with a SERS activating means, then the support means is analyzed.
[Study toward practical use of oligonucleotide therapeutics].
Inoue, Takao; Yoshida, Tokuyuki
2014-01-01
Over the past decade, oligonucleotide-based therapeutics such as antisense oligonucleotides and small interfering RNAs (siRNAs) have been developed extensively. For example, mipomersen (Kynamro; ISIS Pharmaceuticals), which is a second-generation antisense oligonucleotide administered by subcutaneous injection, has recently been approved by the FDA for the treatment of homozygous familial hypercholesterolemia. On the other hands, methods for the evaluation of quality, efficacy and safety of oligonucleotide therapeutics have not been fully discussed. Furthermore, the regulatory guidance specific for oligonucleotide therapeutics has not been established yet. Under these circumstances, we started to collaborate with Osaka University and PMDA to discuss regulatory science focused on oligonucleotide therapeutics. Through the collaboration, we would like to propose the possible design of quality evaluation and preclinical safety-evaluation of oligonucleotide therapeutics.
Enzymatic production of 'monoclonal stoichiometric' single-stranded DNA oligonucleotides.
Ducani, Cosimo; Kaul, Corinna; Moche, Martin; Shih, William M; Högberg, Björn
2013-07-01
Single-stranded oligonucleotides are important as research tools, as diagnostic probes, in gene therapy and in DNA nanotechnology. Oligonucleotides are typically produced via solid-phase synthesis, using polymer chemistries that are limited relative to what biological systems produce. The number of errors in synthetic DNA increases with oligonucleotide length, and the resulting diversity of sequences can be a problem. Here we present the 'monoclonal stoichiometric' (MOSIC) method for enzyme-mediated production of DNA oligonucleotides. We amplified oligonucleotides from clonal templates derived from single bacterial colonies and then digested cutter hairpins in the products, which released pools of oligonucleotides with precisely controlled relative stoichiometric ratios. We prepared 14-378-nucleotide MOSIC oligonucleotides either by in vitro rolling-circle amplification or by amplification of phagemid DNA in Escherichia coli. Analyses of the formation of a DNA crystal and folding of DNA nanostructures confirmed the scalability, purity and stoichiometry of the produced oligonucleotides.
Enzymatic Production of Monoclonal Stoichiometric Single-Stranded DNA Oligonucleotides
Ducani, Cosimo; Kaul, Corinna; Moche, Martin; Shih, William M.; Högberg, Björn
2013-01-01
Single-stranded oligonucleotides are important as research tools as probes for diagnostics and gene therapy. Today, production of oligonucleotides is done via solid-phase synthesis. However, the capabilities of current polymer chemistry are limited in comparison to what can be produced in biological systems. The errors in synthetic DNA increases with oligonucleotide length, and sequence diversity can often be a problem. Here, we present the Monoclonal Stoichiometric (MOSIC) method for enzymatic DNA oligonucleotide production. Using this method, we amplify oligonucleotides from clonal templates followed by digestion of a cutter-hairpin, resulting in pools of monoclonal oligonucleotides with precisely controlled relative stoichiometric ratios. We present data where MOSIC oligonucleotides, 14–378 nt long, were prepared either by in vitro rolling-circle amplification, or by amplification in Escherichia coli in the form of phagemid DNA. The formation of a DNA crystal and folding of DNA nanostructures confirmed the scalability, purity and stoichiometry of the produced oligonucleotides. PMID:23727986
Hayashi, Junsuke; Samezawa, Yusuke; Ochi, Yosuke; Wada, Shun-Ichi; Urata, Hidehito
2017-07-15
We synthesized prodrug-type phosphotriester (PTE) oligonucleotides containing the six-membered cyclic disulfide moiety by using phosphoramidite chemistry. Prodrug-type oligonucleotides named "Reducing-Environment-Dependent Uncatalyzed Chemical Transforming (REDUCT) PTE oligonucleotides" were converted into natural oligonucleotides under cytosol-mimetic reductive condition. Furthermore, the REDUCT PTE oligonucleotides were robust to nuclease digestion and exhibited good cell membrane permeability. Copyright © 2017 Elsevier Ltd. All rights reserved.
Miller, Colton M; Tanowitz, Michael; Donner, Aaron J; Prakash, Thazha P; Swayze, Eric E; Harris, Edward N; Seth, Punit P
2018-06-01
Oligonucleotide therapeutics have emerged as a third distinct platform for drug discovery within the pharmaceutical industry. Five oligonucleotide-based drugs have been approved by the US FDA and over 100 oligonucleotides drugs are currently at different stages of human trials. Several of these oligonucleotide drugs are modified using the phosphorothioate (PS) backbone modification where one of the nonbridging oxygen atoms of the phosphodiester linkage is replaced with sulfur. In this review, we summarize our knowledge on receptor-mediated uptake of PS antisense oligonucleotides (ASOs) within different cell types of the liver-a privileged organ for the discovery of oligonucleotide-based therapeutics.
NASA Astrophysics Data System (ADS)
Katebi, Samira; Esmaeili, Abolghasem; Ghaedi, Kamran
2016-03-01
Spermatozoa could introduce exogenous oligonucleotides of interest to the oocyte. The most important reason of low efficiency of sperm mediated gene transfer (SMGT) is low uptake of exogenous DNA by spermatozoa. The aim of this study was to evaluate the effects of static magnetic field on exogenous oligonucleotide uptake of spermatozoa using magnetofection method. Magnetic nanoparticles (MNPs) associated with the labeled oligonucleotides were used to increase the efficiency of exogenous oligonucleotide uptake by rooster spermatozoa. We used high-field/high-gradient magnet (NdFeB) to enhance and accelerate exogenous DNA sedimentation at the spermatozoa surface. Flow cytometry analysis was performed to measure viability and percentage of exogenous oligonucleotide uptake by sperm. Flow cytometry analysis showed a significant increase in exogenous oligonucleotide uptake by rooster spermatozoa (P<0.001) when spermatozoa were incubated in exogenous oligonucleotide solution and MNPs. However, by applying static magnetic field during magnetofection method, a significant decrease in exogenous oligonucleotide uptake was observed (P<0.05). Findings of this study showed that MNPs were effective to increase exogenous oligonucleotide uptake by rooster spermatozoa; however unlike others studies, static magnetic field, was not only ineffective to enhance exogenous oligonucleotide uptake by rooster spermatozoa but also led to reduction in efficiency of magnetic nanoparticles in gene transfer.
NASA Technical Reports Server (NTRS)
Wippo, Harald; Reck, Folkert; Kudick, Rene; Ramaseshan, Mahesh; Ceulemans, Griet; Bolli, Martin; Krishnamurthy, Ramanarayanan; Eschenmoser, Albert
2001-01-01
The (L)-a-lyxopyranosyl-(4'yields 3')-oligonucleotide system-a member of a pentopyranosyl oligonucleotide family containing a shortened backbone-is capable of cooperative base-pairing and of cross-pairing with DNA and RNA. In contrast, corresponding (D)-beta-ribopyransoyl-(4' yields 3')-oligonucleotides do not show base-pairing under similar conditions. We conclude that oligonucleotide systems can violate the six-bonds-per-backbone-unit rule by having five bonds instead, if their vicinally bound phosphodiester bridges can assume an antiperiplanar conformation. An additional structural feature that seems relevant to the cross-pairing capability of the (L)-a-lyxopyranosyl-(4' yields 3')-oligonucleotide system is its (small) backbone/basepair axes inclination. An inclination which is similar to that in B-DNA seems to be a prerequisite for an oligonucleotide system s capability to cross-pair with DNA.
Chen, Wei-Yu; Chen, Yu-Chie
2007-11-01
The presence of alkali cation adductions of oligonucleotides commonly deteriorates matrix-assisted laser desorption/ionization (MALDI) mass spectra. Thus, desalting is required for oligonucleotide samples prior to MALDI MS analysis in order to prevent the mass spectra from developing poor quality. In this paper, we demonstrate a new approach to extract traces of oligonucleotides from aqueous solutions containing high concentrations of salts using microwave-assisted extraction. The C18-presenting magnetite beads, capable of absorbing microwave irradiation, are used as affinity probes for oligonucleotides with the addition of triethylammonium acetate as the counterions. This new microwave-assisted extraction approach using magnetite beads as the trapping agents and as microwave-absorbers has been demonstrated to be very effective in the selective binding of oligonucleotides from aqueous solutions. The extraction of oligonucleotides from solutions onto the C18-presenting magnetite beads takes only 30 s to enrich oligonucleotides in sufficient quantities for MALDI MS analysis. After using this desalting approach, alkali cation adductions of oligonucleotides are dramatically reduced in the MALDI mass spectra. The presence of saturated NaCl (approximately 6 M) in the oligonucleotide sample is tolerated without degrading the mass spectra. The detection limit for d(A)6 is approximately 2.8 fmol.
Levina, A S; Repkova, M N; Chelobanov, B P; Bessudnova, E V; Mazurkova, N A; Stetsenko, D A; Zarytova, V F
2017-01-01
We have previously described nanocomposites containing conjugates or complexes of native oligodeoxyribonucleotides with poly-L-lysine and TiO2 nanoparticles. We have shown that these nanocomposites efficiently suppressed influenza A virus reproduction in MDCK cells. Here, we have synthesized previously undescribed nanocomposites that consist of TiO2 nanoparticles and polylysine conjugates with oligonucleotides that contain phosphoryl guanidine or phosphorothioate internucleotide groups. These nanocomposites have been shown to exhibit antiviral activity in MDCK cells infected with H5N1 influenza A virus. The nanocomposites containing phosphorothioate oligonucleotides inhibited virus replication ~130-fold. More potent inhibition, i.e., ~5000-fold or ~4600-fold, has been demonstrated by nanocomposites that contain phosphoryl guanidine or phosphodiester oligonucleotides, respectively. Free oligonucleotides have been nearly inactive. The antiviral activity of oligonucleotides of all three types, when delivered by Lipofectamine, has been significantly lower compared to the oligonucleotides delivered in the nanocomposites. In the former case, the phosphoryl guanidine oligonucleotide has appeared to be the most efficient; it has inhibited the virus replication by a factor of 400. The results make it possible to consider phosphoryl guanidine oligonucleotides, along with other oligonucleotide derivatives, as potential antiviral agents against H5N1 avian flu virus.
Modification of the 5' terminus of oligodeoxyribonucleotides for conjugation with ligands.
Asseline, U; Thuong, N T
2001-08-01
Ligands can be introduced at the 5' terminus of an oligonucleotide by adding a linker to the ligand and modifying the 5' terminus of the oligonucleotide. These are then reacted to give the ligand-oligonucleotide conjugate. This unit describes the addition of carboxylated and aminoalkylated linkers, and phosphorothioate, phosphate, and masked thiol groups to the 5' terminus of an oligonucleotide. The addition of linkers to ligands and the final reaction that produces the ligand-conjugated oligonucleotide are described elsewhere in the series. This approach is particularly useful when there is a limited amount of ligand available, when the ligand is sensitive to chemical conditions required for oligonucleotide deprotection, or when the ligand is weakly soluble in solvents required for phosphoramidite- or H-phosphonate-mediated oligonucleotide synthesis.
Nucleic acid sequence detection using multiplexed oligonucleotide PCR
Nolan, John P [Santa Fe, NM; White, P Scott [Los Alamos, NM
2006-12-26
Methods for rapidly detecting single or multiple sequence alleles in a sample nucleic acid are described. Provided are all of the oligonucleotide pairs capable of annealing specifically to a target allele and discriminating among possible sequences thereof, and ligating to each other to form an oligonucleotide complex when a particular sequence feature is present (or, alternatively, absent) in the sample nucleic acid. The design of each oligonucleotide pair permits the subsequent high-level PCR amplification of a specific amplicon when the oligonucleotide complex is formed, but not when the oligonucleotide complex is not formed. The presence or absence of the specific amplicon is used to detect the allele. Detection of the specific amplicon may be achieved using a variety of methods well known in the art, including without limitation, oligonucleotide capture onto DNA chips or microarrays, oligonucleotide capture onto beads or microspheres, electrophoresis, and mass spectrometry. Various labels and address-capture tags may be employed in the amplicon detection step of multiplexed assays, as further described herein.
Predicting oligonucleotide affinity to nucleic acid targets.
Mathews, D H; Burkard, M E; Freier, S M; Wyatt, J R; Turner, D H
1999-01-01
A computer program, OligoWalk, is reported that predicts the equilibrium affinity of complementary DNA or RNA oligonucleotides to an RNA target. This program considers the predicted stability of the oligonucleotide-target helix and the competition with predicted secondary structure of both the target and the oligonucleotide. Both unimolecular and bimolecular oligonucleotide self structure are considered with a user-defined concentration. The application of OligoWalk is illustrated with three comparisons to experimental results drawn from the literature. PMID:10580474
Template-Directed Ligation of Peptides to Oligonucleotides
NASA Technical Reports Server (NTRS)
Bruick, Richard K.; Dawson, Philip E.; Kent, Stephen BH; Usman, Nassim; Joyce, Gerald F.
1996-01-01
Synthetic oligonucleotides and peptides have enjoyed a wide range of applications in both biology and chemistry. As a consequence, oligonucleotide-peptide conjugates have received considerable attention, most notably in the development of antisense constructs with improved pharmacological properties. In addition, oligonucleotide-peptide conjugates have been used as molecular tags, in the assembly of supramolecular arrays and in the construction of encoded combinatorial libraries. To make these chimeric molecules more accessible for a broad range of investigations, we sought to develop a facile method for joining fully deprotected oligonucleotides and peptides through a stable amide bond linkage. Furthermore, we wished to make this ligation reaction addressable, enabling one to direct the ligation of specific oligonucleotide and peptide components.To confer specificity and accelerate the rate of the reaction, the ligation process was designed to be dependent on the presence of a complementary oligonucleotide template.
Ebenryter-Olbińska, Katarzyna; Kaniowski, Damian; Sobczak, Milena; Wojtczak, Błażej A; Janczak, Sławomir; Wielgus, Ewelina; Nawrot, Barbara; Leśnikowski, Zbigniew J
2017-11-21
A general and convenient approach for the incorporation of different types of boron clusters into specific locations of the DNA-oligonucleotide chain based on the automated phosphoramidite method of oligonucleotide synthesis and post-synthetic "click chemistry" modification has been developed. Pronounced effects of boron-cluster modification on the physico- and biochemical properties of the antisense oligonucleotides were observed. The silencing activity of antisense oligonucleotides bearing a single boron cluster modification in the middle of the oligonucleotide chain was substantially higher than that of unmodified oligonucleotides. This finding may be of importance for the design of therapeutic nucleic acids with improved properties. The proposed synthetic methodology broadens the availability of nucleic acid-boron cluster conjugates and opens up new avenues for their potential practical use. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Scalable amplification of strand subsets from chip-synthesized oligonucleotide libraries
Schmidt, Thorsten L.; Beliveau, Brian J.; Uca, Yavuz O.; Theilmann, Mark; Da Cruz, Felipe; Wu, Chao-Ting; Shih, William M.
2015-01-01
Synthetic oligonucleotides are the main cost factor for studies in DNA nanotechnology, genetics and synthetic biology, which all require thousands of these at high quality. Inexpensive chip-synthesized oligonucleotide libraries can contain hundreds of thousands of distinct sequences, however only at sub-femtomole quantities per strand. Here we present a selective oligonucleotide amplification method, based on three rounds of rolling-circle amplification, that produces nanomole amounts of single-stranded oligonucleotides per millilitre reaction. In a multistep one-pot procedure, subsets of hundreds or thousands of single-stranded DNAs with different lengths can selectively be amplified and purified together. These oligonucleotides are used to fold several DNA nanostructures and as primary fluorescence in situ hybridization probes. The amplification cost is lower than other reported methods (typically around US$ 20 per nanomole total oligonucleotides produced) and is dominated by the use of commercial enzymes. PMID:26567534
Suzuki, Norihiko; Fukushima, Masakazu
2010-11-01
To investigate the mechanism of trifluorothymidine (TFT)-induced DNA damage, we developed an enzymatic method for the synthesis of single-strand oligonucleotides containing TFT-monophosphate residues. Sixteen-mer oligonucleotides and 14-mer 5'-phosphorylated oligonucleotides were annealed to the template of 25-mer, so as to empty one nucleotide site. TFT-triphosphate was incorporated into the site by DNA polymerase and then ligated to 5'-phosphorylated oligonucleotides by DNA ligase. The synthesized 31-mer oligonucleotides containing TFT residues were isolated from the 25-mer complementary template by denaturing polyacrylamide electrophoresis. Using these single-strand oligonucleotides containing TFT residues, the cleavage of TFT residues from DNA, using mismatch uracil-DNA glycosylase (MUG) of E.coli origin, was compared with that of 5-fluorouracil (5FU) and 5-bromodeoxyuridine (BrdU). The TFT/A pair was not cleaved by MUG, while the other pairs, namely, 5FU/A, 5FU/G, BrdU/A, BrdU/G, and TFT/G, were easily cleaved from each synthesized DNA. Thus, this method is useful for obtaining some site-specifically modified oligonucleotides.
Bramson, J L; Bodner, C A; Johnson, J; Semple, S; Hope, M J
2000-06-01
Stabilized antisense lipid particles (SALP) have been developed for the systemic delivery of oligonucleotides. The impact of intravenous SALP administration was measured with respect to activation of natural killer (NK) and NK1.1+ T (NKT) cells in the livers of immunocompetent mice. Treatment with a SALP containing a highly mitogenic oligonucleotide (INX-6295) generated an increase in NK cytolytic activity and cell number within the liver but did not appear to affect the number of hepatic NKT cells or their cytolytic activity. The same results were observed after intravenous administration of the mitogenic oligonucleotide alone. Interestingly, treatment with a SALP containing a weakly mitogenic oligonucleotide (INX-6300) also activated the liver NK cells, whereas the oligonucleotide alone was unable to elicit these effects. The NK stimulatory activity of a SALP containing INX-6300 required both lipid and oligonucleotide components. These results demonstrate that in addition to modifying the pharmacokinetics and biodistribution of intravenously administered oligonucleotides, SALP possess immunostimulatory activity independent of oligonucleotide mitogenicity, which can serve as an adjuvant to antisense therapies for cancer.
The chemical evolution of oligonucleotide therapies of clinical utility
Khvorova, Anastasia; Watts, Jonathan K.
2017-01-01
After nearly 40 years of development, oligonucleotide therapeutics are nearing meaningful clinical productivity. One of the key advantages of oligonucleotide drugs is that their delivery and potency properties are derived primarily from the chemical structure of the oligonucleotide, while their target is defined by the base sequence. Thus, as oligonucleotides with a particular chemical design demonstrate appropriate distribution and safety profiles for clinical gene silencing in a particular tissue, this will open the door to the rapid development of additional drugs targeting other disease-associated genes in the same tissue. To achieve clinical productivity, the chemical architecture of the oligonucleotide needs to be optimized as a whole, using a combination of sugar, backbone, nucleobase and 3′/5′-terminal modifications. A portfolio of chemistries can be used to confer drug like properties onto the oligonucleotide as a whole, with minor chemical changes often translating into major improvements in clinical efficacy. Outstanding challenges in oligonucleotide chemical development include optimization of chemical architectures to ensure long-term safety and to enable robust clinical activity beyond the liver. PMID:28244990
Stability of non-Watson-Crick G-A/A-G base pair in synthetic DNA and RNA oligonucleotides.
Ito, Yuko; Sone, Yumiko; Mizutani, Takaharu
2004-03-01
A non-Watson-Crick G-A/A-G base pair is found in SECIS (selenocysteine-insertion sequence) element in the 3'-untranslated region of Se-protein mRNAs and in the functional site of the hammerhead ribozyme. We studied the stability of G-A/A-G base pair (bold) in 17mer GT(U)GACGGAAACCGGAAC synthetic DNA and RNA oligonucleotides by thermal melting experiments and gel electrophoresis. The measured Tm value of DNA oligonucleotide having G-A/A-G pair showed an intermediate value (58 degrees C) between that of Watson-Crick G-C/C-G base pair (75 degrees C) and that of G-G/A-A of non-base-pair (40 degrees C). Similar thermal melting patterns were obtained with RNA oligonucleotides. This result indicates that the secondary structure of oligonucleotide having G-A/A-G base pair is looser than that of the G-C type Watson-Crick base pair. In the comparison between RNA and DNA having G-A/A-G base pair, the Tm value of the RNA oligonucleotide was 11 degrees C lower than that of DNA, indicating that DNA has a more rigid structure than RNA. The stained pattern of oligonucleotide on polyacrylamide gel clarified that the mobility of the DNA oligonucleotide G-A/A-G base pair changed according to the urea concentration from the rigid state (near the mobility of G-C/C-G oligonucleotide) in the absence of urea to the random state (near the mobility of G-G/A-A oligonucleotide) in 7 M urea. However, the RNA oligonucleotide with G-A/A-G pair moved at an intermediate mobility between that of oligonucleotide with G-C/C-G and of the oligonucleotide with G-G/A-A, and the mobility pattern did not depend on urea concentration. Thus, DNA and RNA oligonucleotides with the G-A/A-G base pair showed a pattern indicating an intermediate structure between the rigid Watson-Crick base pair and the random structure of non-base pair. RNA with G-A/A-G base pair has the intermediate structure not influenced by urea concentration. Finally, this study indicated that the intermediate rigidity imparted by Non-Watson-Crick base pair in SECIS element plays an important role in the selenocysteine expression by UGA codon.
Sensitive detection of unlabeled oligonucleotides using a paired surface plasma waves biosensor.
Li, Ying-Chang; Chiou, Chiuan-Chian; Luo, Ji-Dung; Chen, Wei-Ju; Su, Li-Chen; Chang, Ying-Feng; Chang, Yu-Sun; Lai, Chao-Sung; Lee, Cheng-Chung; Chou, Chien
2012-05-15
Detection of unlabeled oligonucleotides using surface plasmon resonance (SPR) is difficult because of the oligonucleotides' relatively lower molecular weight compared with proteins. In this paper, we describe a method for detecting unlabeled oligonucleotides at low concentration using a paired surface plasma waves biosensor (PSPWB). The biosensor uses a sensor chip with an immobilized probe to detect a target oligonucleotide via sequence-specific hybridization. PSPWB measures the demodulated amplitude of the heterodyne signal in real time. In the meantime, the ratio of the amplitudes between the detected output signal and reference can reduce the excess noise from the laser intensity fluctuation. Also, the common-path propagation of p and s waves cancels the common phase noise induced by temperature variation. Thus, a high signal-to-noise ratio (SNR) of the heterodyne signal is detected. The sequence specificity of oligonucleotide hybridization ensures that the platform is precisely discriminating between target and non-target oligonucleotides. Under optimized experimental conditions, the detected heterodyne signal increases linearly with the logarithm of the concentration of target oligonucleotide over the range 0.5-500 pM. The detection limit is 0.5 pM in this experiment. In addition, the non-target oligonucleotide at concentrations of 10 pM and 10nM generated signals only slightly higher than background, indicating the high selectivity and specificity of this method. Different length of perfectly matched oligonucleotide targets at 10-mer, 15-mer and 20-mer were identified at the concentration of 150 pM. Copyright © 2012 Elsevier B.V. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sun, Zhen; Department of Biochemistry and Molecular Biology, Program in Molecular Cell Biology, Zhejiang University School of Medicine, Hangzhou, Zhejiang 310058; Xiang, Wenqing
Highlights: {yields} LNA-modified oligonucleotides can pass through the plasma membrane of cultured cells even without using transfection machinery. {yields} LNA-modified oligonucleotides passed efficiently across the cell membrane, and lipid-coating facilitated translocation from the cytoplasm to the nucleus. {yields} LNA-oligonucleotide designed to target nuclear HBV DNA efficiently suppresses HBV replication and transcription in cultured hepatic cells. -- Abstract: Silencing target genes with small regulatory RNAs is widely used to investigate gene function and therapeutic drug development. Recently, triplex-based approaches have provided another attractive means to achieve targeted gene regulation and gene manipulation at the molecular and cellular levels. Nuclear entry ofmore » oligonucleotides and enhancement of their affinity to the DNA targets are key points of such approaches. In this study, we developed lipid-based transport of a locked-nucleic-acid (LNA)-modified oligonucleotide for hepatitis B virus (HBV) DNA interference in human hepatocytes expressing HBV genomic DNA. In these cells, the LNA-modified oligonucleotides passed efficiently across the cell membrane, and lipid-coating facilitated translocation from the cytoplasm to the nucleus. The oligonucleotide specifically targeting HBV DNA clearly interfered with HBV DNA transcription as shown by a block in pregenomic RNA (pgRNA) production. The HBV DNA-targeted oligonucleotide suppressed HBV DNA replication and HBV protein production more efficiently than small interfering RNAs directed to the pgRNA. These results demonstrate that fusion with lipid can carry LNA-modified oligonucleotides to the nucleus where they regulate gene expression. Interfering with HBV DNA transcription by LNA-modified oligonucleotides has strong potential as a new strategy for HBV inhibition.« less
Mustonen, Enni-Kaisa; Palomäki, Tiina; Pasanen, Markku
2017-11-01
Antisense oligonucleotides, short interfering RNAs (siRNAs) and aptamers are oligonucleotide-based pharmaceuticals with a promising role in targeted therapies. Currently, five oligonucleotide-based pharmaceuticals have achieved marketing authorization in Europe or USA and many more are undergoing clinical testing. However, several safety concerns have been raised in non-clinical and clinical studies. Oligonucleotides share properties with both chemical and biological pharmaceuticals and therefore they pose challenges also from the regulatory point of view. We have analyzed the safety data of oligonucleotides and evaluated the applicability of current non-clinical toxicological guidelines for assessing the safety of oligonucleotide-based pharmaceuticals. Oligonucleotide-based pharmaceuticals display a similar toxicological profile, exerting adverse effects on liver and kidney, evoking hematological alterations, as well as causing immunostimulation and prolonging the coagulation time. It is possible to extrapolate some of these effects from non-clinical studies to humans. However, evaluation strategies for genotoxicity testing of "non-natural" oligonucleotides should be revised. Additionally, the selective use of surrogates and prediction of clinical endpoints for non-clinically observed immunostimulation is complicated by its multiple potential manifestations, demanding improvements in the testing strategies. Utilizing more relevant and mechanistic-based approaches and taking better account of species differences, could possibly improve the prediction of relevant immunological/proinflammatory effects in humans. Copyright © 2017 Elsevier Inc. All rights reserved.
The chemical evolution of oligonucleotide therapies of clinical utility.
Khvorova, Anastasia; Watts, Jonathan K
2017-03-01
After nearly 40 years of development, oligonucleotide therapeutics are nearing meaningful clinical productivity. One of the key advantages of oligonucleotide drugs is that their delivery and potency are derived primarily from the chemical structure of the oligonucleotide whereas their target is defined by the base sequence. Thus, as oligonucleotides with a particular chemical design show appropriate distribution and safety profiles for clinical gene silencing in a particular tissue, this will open the door to the rapid development of additional drugs targeting other disease-associated genes in the same tissue. To achieve clinical productivity, the chemical architecture of the oligonucleotide needs to be optimized with a combination of sugar, backbone, nucleobase, and 3'- and 5'-terminal modifications. A portfolio of chemistries can be used to confer drug-like properties onto the oligonucleotide as a whole, with minor chemical changes often translating into major improvements in clinical efficacy. One outstanding challenge in oligonucleotide chemical development is the optimization of chemical architectures to ensure long-term safety. There are multiple designs that enable effective targeting of the liver, but a second challenge is to develop architectures that enable robust clinical efficacy in additional tissues.
Wada, K; Wada, Y; Iwasaki, Y; Ikemura, T
2017-10-01
Oligonucleotides are key elements of nucleic acid therapeutics such as small interfering RNAs (siRNAs). Influenza and Ebolaviruses are zoonotic RNA viruses mutating very rapidly, and their sequence changes must be characterized intensively to design therapeutic oligonucleotides with long utility. Focusing on a total of 182 experimentally validated siRNAs for influenza A, B and Ebolaviruses compiled by the siRNA database, we conducted time-series analyses of occurrences of siRNA targets in these viral genomes. Reflecting their high mutation rates, occurrences of target oligonucleotides evidently fluctuate in viral populations and often disappear. Time-series analysis of the one-base changed sequences derived from each original target identified the oligonucleotide that shows a compensatory increase and will potentially become the 'awaiting-type oligonucleotide'; the combined use of this oligonucleotide with the original can provide therapeutics with long utility. This strategy is also useful for assigning diagnostic reverse transcription-PCR primers with long utility.
Baumann, V; Winkler, J
2015-01-01
The discovery of microRNAs as important regulatory agents for gene expression has expanded the therapeutic opportunities for oligonucleotides. In contrast to siRNA, miRNA-targeted therapy is able to influence not only a single gene, but entire cellular pathways or processes. It is possible to supplement down regulated or non-functional miRNAs by synthetic oligonucleotides, as well as alleviating effects caused by overexpression of malignant miRNAs through artificial antagonists, either oligonucleotides or small molecules. Chemical oligonucleotide modifications together with an efficient delivery system seem to be mandatory for successful therapeutic application. While miRNA-based therapy benefits from the decades of research spent on other therapeutic oligonucleotides, there are some specific challenges associated with miRNA therapy, mainly caused by the short target sequence. The current status and recent progress of miRNA-targeted therapeutics is described and future challenges and potential applications in treatment of cancer and viral infections are discussed. PMID:25495987
2'-modified nucleosides for site-specific labeling of oligonucleotides
NASA Technical Reports Server (NTRS)
Krider, Elizabeth S.; Miller, Jeremiah E.; Meade, Thomas J.
2002-01-01
We report the synthesis of 2'-modified nucleosides designed specifically for incorporating labels into oligonucleotides. Conversion of these nucleosides to phosphoramidite and solid support-bound derivatives proceeds in good yield. Large-scale synthesis of 11-mer oligonucleotides possessing the 2'-modified nucleosides is achieved using these derivatives. Thermal denaturation studies indicate that the presence of 2'-modified nucleosides in 11-mer duplexes has minimal destabilizing effects on the duplex structure when the nucleosides are placed at the duplex termini. The powerful combination of phosphoramidite and support-bound derivatives of 2'-modified nucleosides affords the large-scale preparation of an entirely new class of oligonucleotides. The ability to synthesize oligonucleotides containing label attachment sites at 3', intervening, and 5' locations of a duplex is a significant advance in the development of oligonucleotide conjugates.
NASA Astrophysics Data System (ADS)
Basiri, Babak; Murph, Mandi M.; Bartlett, Michael G.
2017-08-01
Alkylamines are widely used as ion-pairing agents during LC-MS of oligonucleotides. In addition to a better chromatographic separation, they also assist with the desorption of oligonucleotide ions into the gas phase, cause charge state reduction, and decrease cation adduction. However, the choice of such ion-pairing agents has considerable influence on the MS signal intensity of oligonucleotides as they can also cause significant ion suppression. Interestingly, optimal ion-pairing agents should be selected on a case by case basis as their choice is strongly influenced by the sequence of the oligonucleotide under investigation. Despite imposing major practical difficulties to analytical method development, such a highly variable system that responds very strongly to the nuances of the electrospray composition provides an excellent opportunity for a fundamental study of the electrospray ionization process. Our investigations using this system quantitatively revealed the major factors that influenced the ESI ionization efficiency of oligonucleotides. Parameters such as boiling point, proton affinity, partition coefficient, water solubility, and Henry's law constants for the ion-pairing reagents and the hydrophobic thymine content of the oligonucleotides were found to be the most significant contributors. Identification of these parameters also allowed for the development of a statistical predictive algorithm that can assist with the choice of an optimum IP agent for each particular oligonucleotide sequence. We believe that research in the field of oligonucleotide bioanalysis will significantly benefit from this algorithm (included in Supplementary Material) as it advocates for the use of lesser-known but more suitable ion-pair alternatives to TEA for many oligonucleotide sequences.
Stephen, Andrew G; Datta, Siddhartha A K; Worthy, Karen M; Bindu, Lakshman; Fivash, Matthew J; Turner, Kevin B; Fabris, Daniele; Rein, Alan; Fisher, Robert J
2007-09-01
The interaction of the HIV Gag polyprotein with nucleic acid is a critical step in the assembly of viral particles. The Gag polyprotein is composed of the matrix (MA), capsid (CA), and nucleocapsid (NC) domains. The NC domain is required for nucleic acid interactions, and the CA domain is required for Gag-Gag interactions. Previously, we have investigated the binding of the NC protein to d(TG)(n) oligonucleotides using surface plasmon resonance (SPR) spectroscopy. We found a single NC protein is able to bind to more than one immobilized oligonucleotide, provided that the oligonucleotides are close enough together. As NC is believed to be the nucleic acid binding domain of Gag, we might expect Gag to show the same complex behavior. We wished to analyze the stoichiometry of Gag binding to oligonucleotides without this complication due to tertiary complex formation. We have therefore analyzed Gag binding to extremely low oligonucleotide density on SPR chips. Such low densities of oligonucleotides are difficult to accurately quantitate. We have determined by Fourier transform ion cyclotron (FTICR) mass spectrometry that four molecules of NC bind to d(TG)(10) (a 20-base oligonucleotide). We developed a method of calibrating low-density surfaces using NC calibration injections. Knowing the maximal response and the stoichiometry of binding, we can precisely determine the amount of oligonucleotide immobilized at these very-low-density surfaces (<1 Response Unit). Using this approach, we have measured the binding of Gag to d(TG)(10). Gag binds to a 20-mer with a stoichiometry of greater than 4. This suggests that once Gag is bound to the immobilized oligonucleotide, additional Gag molecules can bind to this complex.
RNA therapeutics: Beyond RNA interference and antisense oligonucleotides
Kole, Ryszard; Krainer, Adrian R.; Altman, Sidney
2016-01-01
Here we discuss three RNA therapeutic technologies exploiting various oligonucleotides that bind RNA by base-pairing in a sequence-specific manner yet have different mechanisms of action and effects. RNA interference and antisense oligonucleotides downregulate gene expression by enzyme-dependent degradation of targeted mRNA. Steric blocking oligonucleotides block access of cellular machinery to pre-mRNA and mRNA without degrading the RNA. Through this mechanism, blocking oligonucleotides can redirect alternative splicing, repair defective RNA, restore protein production or also downregulate gene expression. Moreover, they can be extensively chemically modified, resulting in more drug-like properties. The ability of RNA blocking oligonucleotides to restore gene function makes them suited for treatment of genetic disorders. Positive results from clinical trials for the treatment of Duchenne muscular dystrophy show that this technology is close to realizing its clinical potential. PMID:22262036
Nielsen, Henrik Bjørn; Wernersson, Rasmus; Knudsen, Steen
2003-07-01
Optimal design of oligonucleotides for microarrays involves tedious and laborious work evaluating potential oligonucleotides relative to a series of parameters. The currently available tools for this purpose are limited in their flexibility and do not present the oligonucleotide designer with an overview of these parameters. We present here a flexible tool named OligoWiz for designing oligonucleotides for multiple purposes. OligoWiz presents a set of parameter scores in a graphical interface to facilitate an overview for the user. Additional custom parameter scores can easily be added to the program to extend the default parameters: homology, DeltaTm, low-complexity, position and GATC-only. Furthermore we present an analysis of the limitations in designing oligonucleotide sets that can detect transcripts from multiple organisms. OligoWiz is available at www.cbs.dtu.dk/services/OligoWiz/.
Krieg, A M; Tonkinson, J; Matson, S; Zhao, Q; Saxon, M; Zhang, L M; Bhanja, U; Yakubov, L; Stein, C A
1993-02-01
Phosphodiester oligodeoxynucleotides bearing a 5' cholesteryl (chol) modification bind to low density lipoprotein (LDL), apparently by partitioning the chol-modified oligonucleotides into the lipid layer. Both HL60 cells and primary mouse spleen T and B cells incubated with fluorescently labeled chol-modified oligonucleotide showed substantially increased cellular association by flow cytometry and increased internalization by confocal microscopy compared to an identical molecule not bearing the chol group. Cellular internalization of chol-modified oligonucleotide occurred at least partially through the LDL receptor; it was increased in mouse spleen cells by cell culture in lipoprotein-deficient medium and/or lovastatin, and it was decreased by culture in high serum medium. To determine whether chol-modified oligonucleotides are more potent antisense agents, we titered antisense unmodified phosphodiester and chol-modified oligonucleotides targeted against a mouse immunosuppressive protein. Murine spleen cells cultured with 20 microM phosphodiester antisense oligonucleotides had a 2-fold increase in RNA synthesis, indicating the expected lymphocyte activation. Antisense chol-modified oligonucleotides showed an 8-fold increase in relative potency: they caused a 2-fold increase in RNA synthesis at just 2.5 microM. The increased efficacy was blocked by heparin and was further increased by cell culture in 1% (vs. 10%) fetal bovine serum, suggesting that the effect may, at least in part, be mediated via the LDL receptor. Antisense chol-modified oligonucleotides are sequence specific and have increased potency as compared to unmodified oligonucleotides.
Current Challenges in Delivery and Cytosolic Translocation of Therapeutic RNAs
Lucchino, Marco
2018-01-01
RNA interference (RNAi) is a fundamental cellular process for the posttranscriptional regulation of gene expression. RNAi can exogenously be modulated by small RNA oligonucleotides, such as microRNAs (miRNAs) and small interfering RNAs (siRNAs), or by antisense oligonucleotides. These small oligonucleotides provided the scientific community with powerful and versatile tools to turn off the expression of genes of interest, and hold out the promise of new therapeutic solutions against a wide range of gene-associated pathologies. However, unmodified nucleic acids are highly instable in biological systems, and their weak interaction with plasma proteins confers an unfavorable pharmacokinetics. In this review, we first provide an overview of the most efficient chemical strategies that, over the past 30 years, have been used to significantly improve the therapeutic potential of oligonucleotides. Oligonucleotides targeting and delivery technologies are then presented, including covalent conjugates between oligonucleotides and targeting ligand, and noncovalent association with lipid or polymer nanoparticles. Finally, we specifically focus on the endosomal escape step, which represents a major stumbling block for the effective use of oligonucleotides as therapeutic agents. The need for approaches to quantitatively measure endosomal escape and cytosolic arrival of biomolecules is discussed in the context of the development of efficient oligonucleotide targeting and delivery vectors. PMID:29883296
Matveeva, O. V.; Tsodikov, A. D.; Giddings, M.; Freier, S. M.; Wyatt, J. R.; Spiridonov, A. N.; Shabalina, S. A.; Gesteland, R. F.; Atkins, J. F.
2000-01-01
Design of antisense oligonucleotides targeting any mRNA can be much more efficient when several activity-enhancing motifs are included and activity-decreasing motifs are avoided. This conclusion was made after statistical analysis of data collected from >1000 experiments with phosphorothioate-modified oligonucleotides. Highly significant positive correlation between the presence of motifs CCAC, TCCC, ACTC, GCCA and CTCT in the oligonucleotide and its antisense efficiency was demonstrated. In addition, negative correlation was revealed for the motifs GGGG, ACTG, AAA and TAA. It was found that the likelihood of activity of an oligonucleotide against a desired mRNA target is sequence motif content dependent. PMID:10908347
Schleicher, Martina; Hansmann, Jan; Elkin, Bentsian; Kluger, Petra J.; Liebscher, Simone; Huber, Agnes J. T.; Fritze, Olaf; Schille, Christine; Müller, Michaela; Schenke-Layland, Katja; Seifert, Martina; Walles, Heike; Wendel, Hans-Peter; Stock, Ulrich A.
2012-01-01
In vivo self-endothelialization by endothelial cell adhesion on cardiovascular implants is highly desirable. DNA-oligonucleotides are an intriguing coating material with nonimmunogenic characteristics and the feasibility of easy and rapid chemical fabrication. The objective of this study was the creation of cell adhesive DNA-oligonucleotide coatings on vascular implant surfaces. DNA-oligonucleotides immobilized by adsorption on parylene (poly(monoaminomethyl-para-xylene)) coated polystyrene and ePTFE were resistant to high shear stress (9.5 N/m2) and human blood serum for up to 96 h. Adhesion of murine endothelial progenitor cells, HUVECs and endothelial cells from human adult saphenous veins as well as viability over a period of 14 days of HUVECs on oligonucleotide coated samples under dynamic culture conditions was significantly enhanced (P < 0.05). Oligonucleotide-coated surfaces revealed low thrombogenicity and excellent hemocompatibility after incubation with human blood. These properties suggest the suitability of immobilization of DNA-oligonucleotides for biofunctionalization of blood vessel substitutes for improved in vivo endothelialization. PMID:22481939
Cui, Chunzhi; Park, Dong Hyuk; Kim, Jeongyong; Joo, Jinsoo; Ahn, Dong June
2013-06-14
Oligonucleotide assisted tri(8-hydroxyquinoline) aluminium (Alq3) microrods were prepared for the first time. When hybridized with oligonucleotide labeled by Cy3 fluorescent dye, a significant photoluminescence variation of the Alq3 microrods was observed due to Förster resonance energy transfer, unlike when Cy5-oligonucleotide was used. Versatile nucleotide manipulation would open up wider applications of Alq3-based materials, based on this fundamental observation.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hwang, Gyoyeon; Biological Chemistry, Korea University of Science and Technology, 217, Gajeong-ro, Yuseong-gu, Deajeon; Lee, Hansol
The telomere shortening in chromosomes implies the senescence, apoptosis, or oncogenic transformation of cells. Since detecting telomeres in aging and diseases like cancer, is important, the direct detection of telomeres has been a very useful biomarker. We propose a telomere detection method using a newly synthesized quantum dot (QD) based probe with oligonucleotide conjugation and direct fluorescence in situ hybridization (FISH). QD-oligonucleotides were prepared with metal coordination bonding based on platinum-guanine binding reported in our previous work. The QD-oligonucleotide conjugation method has an advantage where any sequence containing guanine at the end can be easily bound to the starting QD-Ptmore » conjugate. A synthesized telomeric oligonucleotide was bound to the QD-Pt conjugate successfully and this probe hybridized specifically on the telomere of fabricated MV-4-11 and MOLT-4 chromosomes. Additionally, the QD-telomeric oligonucleotide probe successfully detected the telomeres on the CGH metaphase slide. Due to the excellent photostability and high quantum yield of QDs, the QD-oligonucleotide probe has high fluorescence intensity when compared to the organic dye-oligonucleotide probe. Our QD-oligonucleotide probe, conjugation method of this QD probe, and hybridization protocol with the chromosomes can be a useful tool for chromosome painting and FISH. - Highlights: • We prepared a probe linked between QD and telomeric oligonucleotide with platinum-guanine bonding. • Telomeres were detected by our new telomere probes successfully in three different human metaphase chromosomes. • QDPt-DNA probe has high fluorescence intensity in comparison with organic dye-DNA probe.« less
Intelligent nanomedicine integrating diagnosis and therapy
NASA Technical Reports Server (NTRS)
Li, Na (Inventor); Tan, Winny (Inventor)
2012-01-01
A method of controlling the activity of a biologically active compound. The method concerns an oligonucleotide-based compound, comprising a hairpin-forming oligonucleotide, an effector moiety physically associated with the oligonucleotide, where the effector moiety possesses a biological activity, and a regulating moiety physically associated with the oligonucleotide, where the regulating moiety controls the biological activity of the effector moiety by interacting with the effector moiety. The oligonucleotide can assume a hairpin configuration, where the effector and regulating moieties interact, or an open configuration, where the effector and regulating moieties fail to interact. Depending on the nature of the effector and regulating moieties, either configuration can result in the expression of the biological activity of the effector moiety.
Nelson, P S; Kent, M; Muthini, S
1992-01-01
Novel CE-phosphoramidite (7a-e) and CPG (8a, c, d, e) reagents have been prepared from a unique 2-aminobutyl-1,3-propanediol backbone. The reagents have been used to directly label oligonucleotides with fluorescein, acridine, and biotin via automated DNA synthesis. The versatile 2-aminobutyl-1,3-propanediol backbone allows for labeling at any position (5', internal, and 3') during solid phase oligonucleotide synthesis. Multiple labels can be achieved by repetitive coupling cycles. Furthermore, the 3-carbon atom internucleotide phosphate distance is retained when inserted internally. Using this method, individual oligonucleotides possessing two and three different reporter molecules have been prepared. PMID:1475185
Yoneyama, T; Hagiwara, A; Hara, M; Shimojo, H
1982-01-01
A close relationship was demonstrated by oligonucleotide fingerprinting between genomes of the poliovirus type 2 Sabin vaccine strain and recent isolates from paralytic cases associated with vaccination in Japan. The oligonucleotide maps of isolates from an agammaglobulinemic patient, who continued to excrete poliovirus type 2 for 3.5 years after the administration of oral vaccine, showed that the genomic alteration proceeded gradually, retaining the majority of the oligonucleotides characteristic of the vaccine strain for a long period, indicating vaccine origin for the isolates. The final isolate at month 41, however, lost the majority of these oligonucleotides. The heterologous antigenic relationship between the final isolate and the previous isolates was also observed. The serial alteration in electrophoretic mobility of the major structural proteins (VP1, VP2, and VP3) was observed throughout the excreting period. These results indicate that the population of the virus in this individual changed markedly during the last short period (about 3 months), in which the treatment with secretory immunoglobulin A was carried out. Genome comparisons in oligonucleotide maps show that some oligonucleotides in the genome of the vaccine strain are highly mutable after passage in humans. Images PMID:6179881
Method of identifying hairpin DNA probes by partial fold analysis
Miller, Benjamin L [Penfield, NY; Strohsahl, Christopher M [Saugerties, NY
2009-10-06
Method of identifying molecular beacons in which a secondary structure prediction algorithm is employed to identify oligonucleotide sequences within a target gene having the requisite hairpin structure. Isolated oligonucleotides, molecular beacons prepared from those oligonucleotides, and their use are also disclosed.
Method of identifying hairpin DNA probes by partial fold analysis
Miller, Benjamin L.; Strohsahl, Christopher M.
2008-10-28
Methods of identifying molecular beacons in which a secondary structure prediction algorithm is employed to identify oligonucleotide sequences within a target gene having the requisite hairpin structure. Isolated oligonucleotides, molecular beacons prepared from those oligonucleotides, and their use are also disclosed.
Synthesis of 3'-, or 5'-, or internal methacrylamido-modified oligonucleotides
Golova, Julia B.; Chernov, Boris K.
2010-04-27
New modifiers were synthesized for incorporation of a methacrylic function in 3'-, 5'- and internal positions of oligonucleotides during solid phase synthesis. A modifier was used for synthesis of 5'-methacrylated oligonucleotides for preparation of microarrays by a co-polymerization method.
Rakoczy, P E; Lai, M C; Watson, M; Seydel, U; Constable, I
1996-01-01
In this article, we describe the preliminary results of the development of an animal model that will enable us to study the effect of photoreceptor-derived debris accumulation on the normal function of the retina in vivo. An antisense oligonucleotide (Cat 5), saline, and two control oligonucleotides were injected into the vitreous of 7-week-old RCS-rdy+ rats. The uptake, distribution, and persistence of the antisense oligonucleotide in the retina was demonstrated by fluorescent confocal microscopy, and the stability of the oligonucleotide was shown by GeneScan analysis using a fluorescein-labeled derivative of Cat 5 (Cat 5F). The accumulation of photoreceptor-derived debris was monitored by the number of undigested phagosomes in the RPE layer by light microscopy. Following intravitreal injection of Cat 5F, penetration of the oligonucleotide was observed in the ganglion cell layer in 2 hours and in the photoreceptor and pigment epithelial layers 3 days later. However, at 7, 28, and 56 days postinjection, only the RPE layer had significant amounts of Cat 5F present. Using GeneScan analysis, it was demonstrated that the fluorescein-labeled oligonucleotide present in the RPE layer was not degraded and it retained its original 19-mer length. There was no statistically significant difference in the number of phagosomes found in the RPE layer of control uninjected, saline-injected, and two sense and two antisense oligonucleotides-injected animals at 7 and 28 days postinjection. In contrast, the number of phagosomes was significantly higher (p < 0.001) in the RPE layer of Cat 5 antisense oligonucleotide-injected animals at 7 and 28 days postinjection. This difference, however, disappeared by 56 days postinjection. The inner nuclear layers of the retina of control and experimental animals were not affected by the injections.
Oligonucleotide-based theranostic nanoparticles in cancer therapy
Shahbazi, Reza; Ozpolat, Bulent; Ulubayram, Kezban
2016-01-01
Theranostic approaches, combining the functionality of both therapy and imaging, have shown potential in cancer nanomedicine. Oligonucleotides such as small interfering RNA and microRNA, which are powerful therapeutic agents, have been effectively employed in theranostic systems against various cancers. Nanoparticles are used to deliver oligonucleotides into tumors by passive or active targeting while protecting the oligonucleotides from nucleases in the extracellular environment. The use of quantum dots, iron oxide nanoparticles and gold nanoparticles and tagging with contrast agents, like fluorescent dyes, optical or magnetic agents and various radioisotopes, has facilitated early detection of tumors and evaluation of therapeutic efficacy. In this article, we review the advantages of theranostic applications in cancer therapy and imaging, with special attention to oligonucleotide-based therapeutics. PMID:27102380
Derivatized versions of ligase enzymes for constructing DNA sequences
Mariella, Jr., Raymond P.; Christian, Allen T [Tracy, CA; Tucker, James D [Novi, MN; Dzenitis, John M [Livermore, CA; Papavasiliou, Alexandros P [Oakland, CA
2006-08-15
A method of making very long, double-stranded synthetic poly-nucleotides. A multiplicity of short oligonucleotides is provided. The short oligonucleotides are sequentially hybridized to each other. Enzymatic ligation of the oligonucleotides provides a contiguous piece of PCR-ready DNA of predetermined sequence.
Voltage-gated calcium channel and antisense oligonucleotides thereto
NASA Technical Reports Server (NTRS)
Friedman, Peter A. (Inventor); Duncan, Randall L. (Inventor); Hruska, Keith A. (Inventor); Barry, Elizabeth L. R. (Inventor)
1998-01-01
An antisense oligonucleotide of 10 to 35 nucleotides in length that can hybridize with a region of the .alpha..sub.1 subunit of the SA-Cat channel gene DNA or mRNA is provided, together with pharmaceutical compositions containing and methods utilizing such antisense oligonucleotide.
Schmidtgall, Boris; Höbartner, Claudia; Ducho, Christian
2015-01-01
Modifications of the nucleic acid backbone are essential for the development of oligonucleotide-derived bioactive agents. The NAA-modification represents a novel artificial internucleotide linkage which enables the site-specific introduction of positive charges into the otherwise polyanionic backbone of DNA oligonucleotides. Following initial studies with the introduction of the NAA-linkage at T-T sites, it is now envisioned to prepare NAA-modified oligonucleotides bearing the modification at X-T motifs (X = A, C, G). We have therefore developed the efficient and stereoselective synthesis of NAA-linked 'dimeric' A-T phosphoramidite building blocks for automated DNA synthesis. Both the (S)- and the (R)-configured NAA-motifs were constructed with high diastereoselectivities to furnish two different phosphoramidite reagents, which were employed for the solid phase-supported automated synthesis of two NAA-modified DNA oligonucleotides. This represents a significant step to further establish the NAA-linkage as a useful addition to the existing 'toolbox' of backbone modifications for the design of bioactive oligonucleotide analogues.
Synthesis and hybridization of a series of biotinylated oligonucleotides.
Cook, A F; Vuocolo, E; Brakel, C L
1988-01-01
A series of oligonucleotides containing biotin-11-dUMP at various positions were synthesized and compared in quantitative, colorimetric hybridization-detection studies. A deoxyuridine phosphoramidite containing a protected allylamino sidearm was synthesized and used in standard, automated synthesis cycles to prepare oligonucleotides with allylamino residues at various positions within a standard 17-base sequence. Biotin substituents were subsequently attached to the allylamino sidearms by reaction with N-biotinyl-6-aminocaproic acid N-hydroxysuccinimide ester. These oligomers were hybridized to target DNA immobilized on microtiter wells (ELISA plates), and were detected with a streptavidin-biotinylated horseradish peroxidase complex using hydrogen peroxide as substrate and o-phenylenediamine as chromogen. We found that the sensitivity of detection of target DNA by biotin-labeled oligonucleotide probes was strongly dependent upon the position of the biotin label. Oligonucleotides containing biotin labels near or off the ends of the hybridizing sequence were more effective probes than oligonucleotides containing internal biotin labels. An additive effect of increasing numbers of biotin-dUMP residues was found for some labeling configurations. PMID:3375076
Gannett, Peter M; Heavner, Sue; Daft, Jonathan R; Shaughnessy, Kevin H; Epperson, Jon D; Greenbaum, Nancy L
2003-10-01
Carcinogenic aryl hydrazines produce C8-arylated purine adducts. The effect of these adducts on DNA conformation and their role in hydrazine carcinogenesis are unknown. Here, we describe a new synthetic route to produce these adducts that is also compatible with the synthesis of the corresponding phosphoramidites needed for oligonucleotide synthesis. Two oligonucleotides were prepared, an unmodified oligonucleotide, d((5)(')CGCGCGCGCG(3)(')), and a C8-phenylguanine modified oligonucleotide, d((5)(')CGCGCGCGCG(3)(')) (G = 8-phenylguanine). These oligonucleotides were compared using thermal denaturation, circular dichroism, NMR, and molecular modeling. The phenyl modification destabilizes the B DNA form and stabilizes the Z DNA form such that the B:Z ratio is near one under physiological conditions. In light of recent studies that show a role for Z DNA in gene expression and cell transformation, Z DNA stabilization by C8-arylguanine formation from aryl hydrazines may be relevant to their role in carcinogenesis.
Wada, K; Wada, Y; Iwasaki, Y; Ikemura, T
2017-01-01
Oligonucleotides are key elements of nucleic acid therapeutics such as small interfering RNAs (siRNAs). Influenza and Ebolaviruses are zoonotic RNA viruses mutating very rapidly, and their sequence changes must be characterized intensively to design therapeutic oligonucleotides with long utility. Focusing on a total of 182 experimentally validated siRNAs for influenza A, B and Ebolaviruses compiled by the siRNA database, we conducted time-series analyses of occurrences of siRNA targets in these viral genomes. Reflecting their high mutation rates, occurrences of target oligonucleotides evidently fluctuate in viral populations and often disappear. Time-series analysis of the one-base changed sequences derived from each original target identified the oligonucleotide that shows a compensatory increase and will potentially become the ‘awaiting-type oligonucleotide’ the combined use of this oligonucleotide with the original can provide therapeutics with long utility. This strategy is also useful for assigning diagnostic reverse transcription-PCR primers with long utility. PMID:28905886
Oligonucleotide recombination in corynebacteria without the expression of exogenous recombinases.
Krylov, Alexander A; Kolontaevsky, Egor E; Mashko, Sergey V
2014-10-01
Brevibacterium lactofermentum and Corynebacterium glutamicum are important biotechnology species of the genus Corynebacterium. The single-strand DNA annealing protein (SSAP)-independent oligonucleotide-mediated recombination procedure was successfully applied to the commonly used wild-type strains B. lactofermentum AJ1511 and C. glutamicum ATCC13032. When the rpsL gene was used as a target, the optimized protocol yielded up to (1.4±0.3)×10(3) and (6.7±1.3)×10(3) streptomycin-resistant colonies per 10(8) viable cells for the corresponding strains. We tested the influence of several parameters that are known to enhance the efficiency of oligonucleotide-mediated recombination in other bacterial species. Among them, increasing the concentration of oligonucleotides and targeting the lagging strand of the chromosome have proven to have positive effects on both of the tested species. No difference in the efficiency of recombination was observed between the oligonucleotides phosphorothiorated at the 5' ends and the unmodified oligonucleotides or between the oligonucleotides with four mutated nucleotides and those with one mutated nucleotide. The described approach demonstrates that during the adaptation of the recombineering technique, testing SSAP-independent oligonucleotide-mediated recombination could be a good starting point. Such testing could decrease the probability of an incorrect interpretation of the effect of exogenous protein factors (such as SSAP and/or corresponding exonucleases) due to non-optimal experimental conditions. In addition, SSAP-independent recombination itself could be useful in combination with suitable selection/enrichment methods. Copyright © 2014 Elsevier B.V. All rights reserved.
Elzahar, N M; Magdy, N; El-Kosasy, Amira M; Bartlett, Michael G
2018-05-01
Synthetic antisense phosphorothioate oligonucleotides (PS) have undergone rapid development as novel therapeutic agents. The increasing significance of this class of drugs requires significant investment in the development of quality control methods. The determination of the many degradation pathways of such complex molecules presents a significant challenge. However, an understanding of the potential impurities that may arise is necessary to continue to advance these powerful new therapeutics. In this study, four different antisense oligonucleotides representing several generations of oligonucleotide therapeutic agents were evaluated under various stress conditions (pH, thermal, and oxidative stress) using ion-pairing reversed-phase liquid chromatography tandem mass spectrometry (IP-RPLC-MS/MS) to provide in-depth characterization and identification of the degradation products. The oligonucleotide samples were stressed under different pH values at 45 and 90 °C. The main degradation products were observed to be losses of nucleotide moieties from the 3'- and 5'-terminus, depurination, formation of terminal phosphorothioates, and production of ribose, ribophosphorothioates (Rp), and phosphoribophosphorothioates (pRp). Moreover, the effects of different concentrations of hydrogen peroxide were studied resulting in primarily extensive desulfurization and subsequent oxidation of the phosphorothioate linkage to produce the corresponding phosphodiester. The reaction kinetics for the degradation of the oligonucleotides under the different stress conditions were studied and were found to follow pseudo-first-order kinetics. Differences in rates exist even for oligonucleotides of similar length but consisting of different sequences. Graphical abstract Identification of degradation products across several generations of oligonucleotide therapeutics using LC-MS.
Prakash, Thazha P.; Johnston, Joseph F.; Graham, Mark J.; Condon, Thomas P.; Manoharan, Muthiah
2004-01-01
Synthesis and antisense activity of oligonucleotides modified with 2′-O-[2-[(N,N-dimethylamino)oxy] ethyl] (2′-O-DMAOE) are described. The 2′-O-DMAOE-modified oligonucleotides showed superior metabolic stability in mice. The phosphorothioate oligonucleotide ‘gapmers’, with 2′-O-DMAOE- modified nucleoside residues at the ends and 2′-deoxy nucleosides residues in the central region, showed dose-dependent inhibition of mRNA expression in cell culture for two targets. ‘Gapmer’ oligonucleotides have one or two 2′-O-modified regions and a 2′-deoxyoligonucleotide phosphorothioate region that allows RNase H digestion of target mRNA. To determine the in vivo potency and efficacy, BalbC mice were treated with 2′-O-DMAOE gapmers and a dose-dependent reduction in the targeted C-raf mRNA expression was observed. Oligonucleotides with 2′-O-DMAOE modifications throughout the sequences reduced the intercellular adhesion molecule-1 (ICAM-1) protein expression very efficiently in HUVEC cells with an IC50 of 1.8 nM. The inhibition of ICAM-1 protein expression by these uniformly modified 2′-O-DMAOE oligonucleotides may be due to selective interference with the formation of the translational initiation complex. These results demonstrate that 2′-O-DMAOE- modified oligonucleotides are useful for antisense-based therapeutics when either RNase H-dependent or RNase H-independent target reduction mechanisms are employed. PMID:14762210
Berens, C; Courtoy, P J; Sonveaux, E
1999-01-01
To study the interactions between oligonucleotides and proteins, an original photoaffinity radiolabeling probe has been synthesized. Starting with a 5'-pyridyldithio-3'-amino-oligonucleotide, the photophore benzophenone was first coupled to the 3' end, through acylation by an activated ester of benzoylbenzoic acid. A fluorescein molecule was grafted by alkylation of the free 5'-SH. This compound was finally radiolabeled with 125I using IodoBeads. The selective photolabeling of thrombin in a complex protein mixture by the radioiodinated probe validates this strategy to identify oligonucleotide-binding proteins.
Ravikumar, Vasulinga T; Kumar, R Krishna; Capaldi, Daniel C; Cole, Douglas L
2003-01-01
Detritylation of a 5'-O-DMT-2'-deoxyadenosine moiety attached to solid support under acidic condition leads to depurination during oligonucleotide synthesis. Deprotection followed by reversed phase HPLC purification leads to desired oligonucleotide contaminated with significant levels of 3'-terminal phosphorothiaote (3'-TPT) monoester (n-1)-mer. However, it is demonstrated that attachment of dA nucleoside through its exocyclic amino group to solid support leads to substantial reduction of 3'-TPT formation thereby improving the quality of oligonucleotide synthesized.
The Use of Gel Electrophoresis to Study the Reactions of Activated Amino Acids with Oligonucleotides
NASA Technical Reports Server (NTRS)
Zieboll, Gerhard; Orgel, Leslie E.
1994-01-01
We have used gel electrophoresis to study the primary covalent addition of amino acids to oligonu-cleotides or their analogs and the subsequent addition of further molecules of the amino acids to generate peptides covalently linked to the oligonucleotides. We have surveyed the reactions of a variety of amino acids with the phosphoramidates derived from oligonucleotide 5 inches phosphates and ethylenediamine. We find that arginine and amino acids can interact with oligonucleotidesl through stacking interactions react most efficiently. D- and L-amino acids give indistinguishable families of products.
Methods for immobilizing nucleic acids on a gel substrate
Mirzabekov, Andrei Darievich; Proudnikov, Dimitri Y.; Timofeev, Edward N.; Kochetkova, Svetlana V.; Florentiev, Vladimir L.; Shick, Valentine V.
1999-01-01
A method for labeling oligonucleotide molecules, and for immobilizing oligonucleotide and DNA molecules is provided comprising modifying the molecules to create a chemically active group, and contacting activated fluorescent dyes to the region. A method for preparing an immobilization substrate is also provided comprising modifying a gel to contain desired functional groups which covalently interact with certain moieties of the oligonucleotide molecules. A method for immobilizing biomolecules and other molecules within a gel by copolymerization of allyl-substituted oligonucleotides, DNA and proteins with acrylamide is also provided.
Method for promoting specific alignment of short oligonucleotides on nucleic acids
Studier, F. William; Kieleczawa, Jan; Dunn, John J.
1996-01-01
Disclosed is a method for promoting specific alignment of short oligonucleotides on a nucleic acid polymer. The nucleic acid polymer is incubated in a solution containing a single-stranded DNA-binding protein and a plurality of oligonucleotides which are perfectly complementary to distinct but adjacent regions of a predetermined contiguous nucleotide sequence in the nucleic acid polymer. The plurality of oligonucleotides anneal to the nucleic acid polymer to form a contiguous region of double stranded nucleic acid. Specific application of the methods disclosed include priming DNA synthesis and template-directed ligation.
Synthetic Method for Oligonucleotide Block by Using Alkyl-Chain-Soluble Support.
Matsuno, Yuki; Shoji, Takao; Kim, Shokaku; Chiba, Kazuhiro
2016-02-19
A straightforward method for the synthesis of oligonucleotide blocks using a Cbz-type alkyl-chain-soluble support (Z-ACSS) attached to the 3'-OH group of 3'-terminal nucleosides was developed. The Z-ACSS allowed for the preparation of fully protected deoxyribo- and ribo-oligonucleotides without chromatographic purification and released dimer- to tetramer-size oligonucleotide blocks via hydrogenation using a Pd/C catalyst without significant loss or migration of protective groups such as 5'-end 4,4'-dimethoxtrityl, 2-cyanoethyl on internucleotide bonds, or 2'-TBS.
A novel computational method to simulate non-enzymatic self-replication. [Abstract only
NASA Technical Reports Server (NTRS)
Navarro-Gonzalez, Rafael; Reggia, James A.; Wu, Jayoung; Chou, Hui-Hsien
1994-01-01
Non-enzymatic, template-directed synthesis of oligonucleotides has been extensively studied in the laboratory as a model to understand the kind of chemical processes that might have contributed to the origin of life on Earth. Several oligonucleotides have been shown to catalyze the synthesis of their complements from activated mononucleotides; however, a restricted number of them have been found to self-replicate. Recently we developed an efficient modified cellular automata method that supports the study of self-replicating oligonucleotides. With this method the oligonucleotide molecules are represented as active cells imbedded in a two-dimensional array of inactive cells symbolizing the environment. Random movements and probability-governed chemical reactions occurring in a cellular space can effectively simulate the experimental behavior observed in self-directed replication of oligonucleotides.
Quantitative surface-enhanced resonance Raman scattering of phthalocyanine-labelled oligonucleotides
Macaskill, A.; Chernonosov, A. A.; Koval, V. V.; Lukyanets, E. A.; Fedorova, O. S.; Smith, W. E.; Faulds, K.; Graham, D.
2007-01-01
The evaluation of phthalocyanine labels for the surface-enhanced resonance Raman scattering (SERRS) detection of oligonucleotides is reported. Three phthalocyanine-labelled oligonucleotides were assessed, each containing a different metal centre. Detection limits for each labelled oligonucleotide were determined using two excitation frequencies where possible. Limits of detection as low as 2.8 × 10−11 mol. dm−3 were obtained which are comparable to standard fluorescently labelled probes used in previous SERRS studies. The identification of two phthalocyanine-labelled oligonucleotides without separation was also demonstrated indicating their suitability for multiplexing. This study extends the range of labels suitable for quantitative surface-enhanced resonance Raman scattering with silver nanoparticles and offers more flexibility and choice when considering SERRS for quantitative DNA detection. PMID:17289751
Oligonucleotide-based biosensors for in vitro diagnostics and environmental hazard detection.
Jung, Il Young; Lee, Eun Hee; Suh, Ah Young; Lee, Seung Jin; Lee, Hyukjin
2016-04-01
Oligonucleotide-based biosensors have drawn much attention because of their broad applications in in vitro diagnostics and environmental hazard detection. They are particularly of interest to many researchers because of their high specificity as well as excellent sensitivity. Recently, oligonucleotide-based biosensors have been used to achieve not only genetic detection of targets but also the detection of small molecules, peptides, and proteins. This has further broadened the applications of these sensors in the medical and health care industry. In this review, we highlight various examples of oligonucleotide-based biosensors for the detection of diseases, drugs, and environmentally hazardous chemicals. Each example is provided with detailed schematics of the detection mechanism in addition to the supporting experimental results. Furthermore, future perspectives and new challenges in oligonucleotide-based biosensors are discussed.
As Technologies for Nucleotide Therapeutics Mature, Products Emerge.
Beierlein, Jennifer M; McNamee, Laura M; Ledley, Fred D
2017-12-15
The long path from initial research on oligonucleotide therapies to approval of antisense products is not unfamiliar. This lag resembles those encountered with monoclonal antibodies, gene therapies, and many biological targets and is consistent with studies of innovation showing that technology maturation is a critical determinant of product success. We previously described an analytical model for the maturation of biomedical research, demonstrating that the efficiency of targeted and biological development is connected to metrics of technology growth. The present work applies this model to characterize the advance of oligonucleotide therapeutics. We show that recent oligonucleotide product approvals incorporate technologies and targets that are past the established point of technology growth, as do most of the oligonucleotide products currently in phase 3. Less mature oligonucleotide technologies, such as miRNAs and some novel gene targets, have not passed the established point and have not yielded products. This analysis shows that oligonucleotide product development has followed largely predictable patterns of innovation. While technology maturation alone does not ensure success, these data show that many oligonucleotide technologies are sufficiently mature to be considered part of the arsenal for therapeutic development. These results demonstrate the importance of technology assessment in strategic management of biomedical technologies. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.
LeProust, Emily M.; Peck, Bill J.; Spirin, Konstantin; McCuen, Heather Brummel; Moore, Bridget; Namsaraev, Eugeni; Caruthers, Marvin H.
2010-01-01
We have achieved the ability to synthesize thousands of unique, long oligonucleotides (150mers) in fmol amounts using parallel synthesis of DNA on microarrays. The sequence accuracy of the oligonucleotides in such large-scale syntheses has been limited by the yields and side reactions of the DNA synthesis process used. While there has been significant demand for libraries of long oligos (150mer and more), the yields in conventional DNA synthesis and the associated side reactions have previously limited the availability of oligonucleotide pools to lengths <100 nt. Using novel array based depurination assays, we show that the depurination side reaction is the limiting factor for the synthesis of libraries of long oligonucleotides on Agilent Technologies’ SurePrint® DNA microarray platform. We also demonstrate how depurination can be controlled and reduced by a novel detritylation process to enable the synthesis of high quality, long (150mer) oligonucleotide libraries and we report the characterization of synthesis efficiency for such libraries. Oligonucleotide libraries prepared with this method have changed the economics and availability of several existing applications (e.g. targeted resequencing, preparation of shRNA libraries, site-directed mutagenesis), and have the potential to enable even more novel applications (e.g. high-complexity synthetic biology). PMID:20308161
Flibotte, Stephane; Moerman, Donald G
2008-10-21
Microarray comparative genomic hybridization (CGH) is currently one of the most powerful techniques to measure DNA copy number in large genomes. In humans, microarray CGH is widely used to assess copy number variants in healthy individuals and copy number aberrations associated with various diseases, syndromes and disease susceptibility. In model organisms such as Caenorhabditis elegans (C. elegans) the technique has been applied to detect mutations, primarily deletions, in strains of interest. Although various constraints on oligonucleotide properties have been suggested to minimize non-specific hybridization and improve the data quality, there have been few experimental validations for CGH experiments. For genomic regions where strict design filters would limit the coverage it would also be useful to quantify the expected loss in data quality associated with relaxed design criteria. We have quantified the effects of filtering various oligonucleotide properties by measuring the resolving power for detecting deletions in the human and C. elegans genomes using NimbleGen microarrays. Approximately twice as many oligonucleotides are typically required to be affected by a deletion in human DNA samples in order to achieve the same statistical confidence as one would observe for a deletion in C. elegans. Surprisingly, the ability to detect deletions strongly depends on the oligonucleotide 15-mer count, which is defined as the sum of the genomic frequency of all the constituent 15-mers within the oligonucleotide. A similarity level above 80% to non-target sequences over the length of the probe produces significant cross-hybridization. We recommend the use of a fairly large melting temperature window of up to 10 degrees C, the elimination of repeat sequences, the elimination of homopolymers longer than 5 nucleotides, and a threshold of -1 kcal/mol on the oligonucleotide self-folding energy. We observed very little difference in data quality when varying the oligonucleotide length between 50 and 70, and even when using an isothermal design strategy. We have determined experimentally the effects of varying several key oligonucleotide microarray design criteria for detection of deletions in C. elegans and humans with NimbleGen's CGH technology. Our oligonucleotide design recommendations should be applicable for CGH analysis in most species.
Aubert, Yves; Bourgerie, Sylvain; Meunier, Laurent; Mayer, Roger; Roche, Annie-Claude; Monsigny, Michel; Thuong, Nguyen T.; Asseline, Ulysse
2000-01-01
A new deprotection procedure enables a medium scale preparation of phosphodiester and phosphorothioate oligonucleotides substituted with a protected thiol function at their 5′-ends and an amino group at their 3′-ends in good yield (up to 72 OD units/µmol for a 19mer phosphorothioate). Syntheses of 3′-amino-substituted oligonucleotides were carried out on a modified support. A linker containing the thioacetyl moiety was manually coupled in two steps by first adding its phosphoramidite derivative in the presence of tetrazole followed by either oxidation or sulfurization to afford the bis-derivatized oligonucleotide bound to the support. Deprotection was achieved by treating the fully protected oligonucleotide with a mixture of 2,2′-dithiodipyridine and concentrated aqueous ammonia in the presence of phenol and methanol. This procedure enables (i) cleavage of the oligonucleotide from the support, releasing the oligonucleotide with a free amino group at its 3′-end, (ii) deprotection of the phosphate groups and the amino functions of the nucleic bases, as well as (iii) transformation of the 5′-terminal S-acetyl function into a dithiopyridyl group. The bis-derivatized phosphorothioate oligomer was further substituted through a two-step procedure: first, the 3′-amino group was reacted with fluorescein isothiocyanate to yield a fluoresceinylated oligonucleotide; the 5′-dithiopyridyl group was then quantitatively reduced to give a free thiol group which was then substituted by reaction with an Nα-bromoacetyl derivative of a signal peptide containing a KDEL sequence to afford a fluoresceinylated peptide–oligonucleotide conjugate. PMID:10637335
STAT3 Oligonucleotide Inhibits Tumor Angiogenesis in Preclinical Models of Squamous Cell Carcinoma
Klein, Jonah D.; Sano, Daisuke; Sen, Malabika; Myers, Jeffrey N.; Grandis, Jennifer R.; Kim, Seungwon
2014-01-01
Purpose Signal transducer and activator of transcription 3 (STAT3) has shown to play a critical role in head and neck squamous cell carcinoma (HNSCC) and we have recently completed clinical trials of STAT3 decoy oligonucleotide in patients with recurrent or metastatic HNSCC. However, there is limited understanding of the role of STAT3 in modulating other aspects of tumorigenesis such as angiogenesis. In this study, we aimed to examine the effects of STAT3 decoy oligonucleotide on tumor angiogenesis. Experimental Design A STAT3 decoy oligonucleotide and small interfering RNA (siRNA) were used to inhibit STAT3 in endothelial cells in vitro and in vivo. The biochemical effects of STAT3 inhibition were examined in conjunction with the consequences on proliferation, migration, apoptotic staining, and tubule formation. Additionally, we assessed the effects of STAT3 inhibition on tumor angiogenesis using murine xenograft models. Results STAT3 decoy oligonucleotide decreased proliferation, induces apoptosis, decreased migration, and decreased tubule formation of endothelial cells in vitro. The STAT3 decoy oligonucleotide also inhibited tumor angiogenesis in murine tumor xenografts. Lastly, our data suggest that the antiangiogenic effects of STAT3 decoy oligonucleotide were mediatedthrough the inhibition of both STAT3 and STAT1. Conclusions The STAT3 decoy oligonucleotidewas found to be an effective antiangiogenic agent, which is likely to contribute to the overall antitumor effects of this agent in solid tumors.Taken together with the previously demonstrated antitumor activity of this agent, STAT3 decoy oligonucleotide represents a promising single agent approach to targeting both the tumor and vascular compartments in various malignancies. PMID:24404126
DeCorte, B L; Tsarouhtsis, D; Kuchimanchi, S; Cooper, M D; Horton, P; Harris, C M; Harris, T M
1996-01-01
Improved methodology has been developed for preparation of oligodeoxynucleotides bearing adducts on the N2 position of guanine in which the adduction reaction is carried out in homogeneous solution rather than while the oligonucleotide is immobilized on a solid matrix. The methodology utilizes a new synthon, 2-fluoro-O6-(trimethylsilylethyl)-2'-deoxyinosine (3). Nucleoside 3 is stable to the conditions of oligonucleotide synthesis, but the O6 protection is eliminated under very mild conditions following displacement of the 2-fluoro group by amine nucleophiles. Oligonucleotides containing 3 could be removed from the solid support by treatment with 0.1 M NaOH (8 h, rt) without disruption of 3. Reaction of the crude, partially deprotected oligonucleotide with (R)-2-amino-2-phenylethanol in homogeneous solution, followed by removal of the remaining protective groups with NH4OH (60 degrees C, 8 h) and then 0.1% acetic acid, gave the adducted oligonucleotide in good purity and yield. Alternatively, fully deprotected oligonucleotide containing 3 could be prepared by use of labile phenoxyacetyl-type protecting groups on the exocyclic amino groups.
Nishibuchi, M; Murakami, A; Arita, M; Jikuya, H; Takano, J; Honda, T; Miwatani, T
1989-01-01
We examined variations in the genes encoding heat-stable enterotoxin (ST) and heat-labile enterotoxin (LT) in 88 strains of Escherichia coli isolated from individuals with traveler's diarrhea to find suitable sequences for use as oligonucleotide probes. Four oligonucleotide probes of the gene encoding ST of human origin (STIb or STh), one oligonucleotide probe of the gene encoding ST of porcine origin (STIa or STp), and three oligonucleotide probes of the gene encoding LT of human origin (LTIh) were used in DNA colony hybridization tests. In 15 of 22 strains possessing the STh gene and 28 of 42 strains producing LT, the sequences of all regions tested were identical to the published sequences. One region in the STh gene examined with a 18-mer probe was relatively well conserved and was shown to be closely associated with the enterotoxicity of the E. coli strains in suckling mice. This oligonucleotide, however, hybridized with strains of Vibrio cholerae O1, V. parahaemolyticus, and Yersinia enterocolitica that gave negative results in the suckling mouse assay. PMID:2685027
Yang, Haozhe; Seela, Frank
2016-01-22
A highly effective and convenient "bis-click" strategy was developed for the template-independent circularization of single-stranded oligonucleotides by employing copper(I)-assisted azide-alkyne cycloaddition. Terminal triple bonds were incorporated at both ends of linear oligonucleotides. Alkynylated 7-deaza-2'-deoxyadenosine and 2'-deoxyuridine residues with different side chains were used in solid-phase synthesis with phosphoramidite chemistry. The bis-click ligation of linear 9- to 36-mer oligonucleotides with 1,4-bis(azidomethyl)benzene afforded circular DNA in a simple and selective way; azido modification of the oligonucleotide was not necessary. Short ethynyl side chains were compatible with the circularization of longer oligonucleotides, whereas octadiynyl residues were used for short 9-mers. Compared with linear duplexes, circular bis-click constructs exhibit a significantly increased duplex stability over their linear counterparts. The intramolecular bis-click ligation protocol is not limited to DNA, but may also be suitable for the construction of other macrocycles, such as circular RNAs, peptides, or polysaccharides. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
DNA - peptide polyelectrolyte complexes: Phase control by hybridization
NASA Astrophysics Data System (ADS)
Vieregg, Jeffrey; Lueckheide, Michael; Marciel, Amanda; Leon, Lorraine; Tirrell, Matthew
DNA is one of the most highly-charged molecules known, and interacts strongly with charged molecules in the cell. Condensation of long double-stranded DNA is one of the classic problems of biophysics, but the polyelectrolyte behavior of short and/or single-stranded nucleic acids has attracted far less study despite its importance for both biological and engineered systems. We report here studies of DNA oligonucleotides complexed with cationic peptides and polyamines. As seen previously for longer sequences, double-stranded oligonucleotides form solid precipitates, but single-stranded oligonucleotides instead undergo liquid-liquid phase separation to form coacervate droplets. Complexed oligonucleotides remain competent for hybridization, and display sequence-dependent environmental response. We observe similar behavior for RNA oligonucleotides, and methylphosphonate substitution of the DNA backbone indicates that nucleic acid charge density controls whether liquid or solid complexes are formed. Liquid-liquid phase separations of this type have been implicated in formation of membraneless organelles in vivo, and have been suggested as protocells in early life scenarios; oligonucleotides offer an excellent method to probe the physics controlling these phenomena.
Rapid method to detect duplex formation in sequencing by hybridization methods
Mirzabekov, A.D.; Timofeev, E.N.; Florentiev, V.L.; Kirillov, E.V.
1999-01-19
A method for determining the existence of duplexes of oligonucleotide complementary molecules is provided. A plurality of immobilized oligonucleotide molecules, each of a specific length and each having a specific base sequence, is contacted with complementary, single stranded oligonucleotide molecules to form a duplex. Each duplex facilitates intercalation of a fluorescent dye between the base planes of the duplex. The invention also provides for a method for constructing oligonucleotide matrices comprising confining light sensitive fluid to a surface and exposing the light-sensitive fluid to a light pattern. This causes the fluid exposed to the light to coalesce into discrete units and adhere to the surface. This places each of the units in contact with a set of different oligonucleotide molecules so as to allow the molecules to disperse into the units. 13 figs.
Moorcroft, Matthew J.; Meuleman, Wouter R. A.; Latham, Steven G.; Nicholls, Thomas J.; Egeland, Ryan D.; Southern, Edwin M.
2005-01-01
In this paper, we demonstrate in situ synthesis of oligonucleotide probes on poly(dimethylsiloxane) (PDMS) microchannels through use of conventional phosphoramidite chemistry. PDMS polymer was moulded into a series of microchannels using standard soft lithography (micro-moulding), with dimensions <100 μm. The surface of the PDMS was derivatized by exposure to ultraviolet/ozone followed by vapour phase deposition of glycidoxypropyltrimethoxysilane and reaction with poly(ethylene glycol) spacer, resulting in a reactive surface for oligonucleotide coupling. High, reproducible yields were achieved for both 6mer and 21mer probes as assessed by hybridization to fluorescent oligonucleotides. Oligonucleotide surface density was comparable with that obtained on glass substrates. These results suggest PDMS as a stable and flexible alternative to glass as a suitable substrate in the fabrication and synthesis of DNA microarrays. PMID:15870385
NMR of enzymatically synthesized uniformly 13C15N-labeled DNA oligonucleotides.
Zimmer, D P; Crothers, D M
1995-01-01
A procedure for the enzymatic synthesis of uniformly 13C15N-labeled DNA oligonucleotides in milligram quantities for NMR studies is described. Deoxynucleotides obtained from microorganisms grown on 13C and 15N nutrient sources are enzymatically phosphorylated to dNTPs, and the dNTPs are incorporated into oligonucleotides using a 3'-5' exonuclease-deficient mutant of Klenow fragment of DNA polymerase I and an oligonucleotide template primer designed for efficient separation of labeled product DNA from unlabeled template. The labeling strategy has been used to uniformly label one or the other oligonucleotide strand in the DNA duplex dGGCAAAACGG.dCCGTTTTGCC in order to facilitate assignment and structure determination by NMR. Application of 15N and 13C heteronuclear NMR experiments to isotopically labeled DNA is presented. Images Fig. 2 Fig. 3 Fig. 4 PMID:7724521
Rapid method to detect duplex formation in sequencing by hybridization methods
Mirzabekov, Andrei Darievich; Timofeev, Edward Nikolaevich; Florentiev, Vladimer Leonidovich; Kirillov, Eugene Vladislavovich
1999-01-01
A method for determining the existence of duplexes of oligonucleotide complementary molecules is provided whereby a plurality of immobilized oligonucleotide molecules, each of a specific length and each having a specific base sequence, is contacted with complementary, single stranded oligonucleotide molecules to form a duplex so as to facilitate intercalation of a fluorescent dye between the base planes of the duplex. The invention also provides for a method for constructing oligonucleotide matrices comprising confining light sensitive fluid to a surface, exposing said light-sensitive fluid to a light pattern so as to cause the fluid exposed to the light to coalesce into discrete units and adhere to the surface; and contacting each of the units with a set of different oligonucleotide molecules so as to allow the molecules to disperse into the units.
Tritium labeling of antisense oligonucleotides by exchange with tritiated water.
Graham, M J; Freier, S M; Crooke, R M; Ecker, D J; Maslova, R N; Lesnik, E A
1993-01-01
We describe a simple, efficient, procedure for labeling oligonucleotides to high specific activity (< 1 x 10(8) cpm/mumol) by hydrogen exchange with tritiated water at the C8 positions of purines in the presence of beta-mercaptoethanol, an effective radical scavenger. Approximately 90% of the starting material is recovered as intact, labeled oligonucleotide. The radiolabeled compounds are stable in biological systems; greater than 90% of the specific activity is retained after 72 hr incubation at 37 degrees C in serum-containing media. Data obtained from in vitro cellular uptake experiments using oligonucleotides labeled by this method are similar to those obtained using 35S or 14C-labeled compounds. Because this protocol is solely dependent upon the existence of purine residues, it should be useful for radiolabeling modified as well as unmodified phosphodiester oligonucleotides. Images PMID:8367289
Cook, Michael A; Chan, Chi-Kin; Jorgensen, Paul; Ketela, Troy; So, Daniel; Tyers, Mike; Ho, Chi-Yip
2008-02-06
Molecular barcode arrays provide a powerful means to analyze cellular phenotypes in parallel through detection of short (20-60 base) unique sequence tags, or "barcodes", associated with each strain or clone in a collection. However, costs of current methods for microarray construction, whether by in situ oligonucleotide synthesis or ex situ coupling of modified oligonucleotides to the slide surface are often prohibitive to large-scale analyses. Here we demonstrate that unmodified 20mer oligonucleotide probes printed on conventional surfaces show comparable hybridization signals to covalently linked 5'-amino-modified probes. As a test case, we undertook systematic cell size analysis of the budding yeast Saccharomyces cerevisiae genome-wide deletion collection by size separation of the deletion pool followed by determination of strain abundance in size fractions by barcode arrays. We demonstrate that the properties of a 13K unique feature spotted 20 mer oligonucleotide barcode microarray compare favorably with an analogous covalently-linked oligonucleotide array. Further, cell size profiles obtained with the size selection/barcode array approach recapitulate previous cell size measurements of individual deletion strains. Finally, through atomic force microscopy (AFM), we characterize the mechanism of hybridization to unmodified barcode probes on the slide surface. These studies push the lower limit of probe size in genome-scale unmodified oligonucleotide microarray construction and demonstrate a versatile, cost-effective and reliable method for molecular barcode analysis.
Gallium-68-labelled NOTA-oligonucleotides: an optimized method for their preparation.
Gijs, Marlies; Dammicco, Sylvestre; Warnier, Corentin; Aerts, An; Impens, Nathalie R E N; D'Huyvetter, Matthias; Léonard, Marc; Baatout, Sarah; Luxen, André
2016-02-01
One of the most essential aspects to the success of radiopharmaceuticals is an easy and reliable radiolabelling protocol to obtain pure and stable products. In this study, we optimized the bioconjugation and gallium-68 ((68) Ga) radiolabelling conditions for a single-stranded 40-mer DNA oligonucleotide, in order to obtain highly pure and stable radiolabelled oligonucleotides. Quantitative bioconjugation was obtained for a disulfide-functionalized oligonucleotide conjugated to the macrocylic bifunctional chelator MMA-NOTA (maleimido-mono-amide (1,4,7-triazanonane-1,4,7-triyl)triacetic acid). Next, this NOTA-oligonucleotide bioconjugate was radiolabelled at room temperature with purified and pre-concentrated (68) Ga with quantitative levels of radioactive incorporation and high radiochemical and chemical purity. In addition, high chelate stability was observed in physiological-like conditions (37 °C, PBS and serum), in the presence of a transchelator (EDTA) and transferrin. A specific activity of 51.1 MBq/nmol was reached using a 1470-fold molar excess bioconjugate over (68) Ga. This study presents a fast, straightforward and reliable protocol for the preparation of (68) Ga-radiolabelled DNA oligonucleotides under mild reaction conditions and without the use of organic solvents. The methodology herein developed will be applied to the preparation of oligonucleotidic sequences (aptamers) targeting the human epidermal growth factor receptor 2 (HER2) for cancer imaging. Copyright © 2015 John Wiley & Sons, Ltd.
Chow, C W; Clark, M P; Rinaldo, J E; Chalkley, R
1996-03-01
In the present study, we have explored an unexpected observation in transcription initiation that is mediated by single-stranded oligonucleotides. Initially, our goal was to understand the function of different upstream regulatory elements/initiation sites in the rat xanthine dehydrogenase/oxidase (XDH/XO) promoter. We performed in vitro transcription with HeLa nuclear extracts in the presence of different double-stranded oligonucleotides against upstream elements as competitors. A new and unusual transcription initiation site was detected by primer extension. This new initiation site maps to the downstream region of the corresponding competitor. Subsequent analyses have indicated that the induction of a new transcription initiation site is anomalous which is due to the presence of a small amount of single-stranded oligonucleotide in the competitor. We found that this anomalous initiation site is insensitive to the orientation of the promoter and requires only a small amount of single-stranded oligonucleotide (< 2-fold molar excess relative to template). We surmise that a complementary interaction between the single-stranded oligonucleotide and transiently denatured promoter template may be responsible for this sequence-specific transcription initiation artifact. To study the regulation of transcription initiation by in vitro transcription approaches, we propose that one should probe the effect of removing transacting factors by adding an excess of a cognate oligonucleotide which does not bear exact sequence identity to the template.
Zeniya, Satoshi; Kuwahara, Hiroya; Daizo, Kaiichi; Watari, Akihiro; Kondoh, Masuo; Yoshida-Tanaka, Kie; Kaburagi, Hidetoshi; Asada, Ken; Nagata, Tetsuya; Nagahama, Masahiro; Yagi, Kiyohito; Yokota, Takanori
2018-05-17
Within the field of RNA therapeutics, antisense oligonucleotide-based therapeutics are a potentially powerful means of treating intractable diseases. However, if these therapeutics are used for the treatment of neurological disorders, safe yet efficient methods of delivering antisense oligonucleotides across the blood-brain barrier to the central nervous system must be developed. Here, we examined the use of angubindin-1, a binder to the tricellular tight junction, to modulate paracellular transport between brain microvascular endothelial cells in the blood-brain barrier for the delivery of antisense oligonucleotides to the central nervous system. This proof-of-concept study demonstrated that intravenously injected angubindin-1 increased the permeability of the blood-brain barrier and enabled transient delivery of subsequently administered antisense oligonucleotides into the mouse brain and spinal cord, leading to silencing of a target RNA without any overt adverse effects. We also found that two bicellular tight junction modulators did not produce such a silencing effect, suggesting that the tricellular tight junction is likely a better target for the delivery of antisense oligonucleotides than the bicellular tight junction. Our delivery strategy of modulating the tricellular tight junction in the blood-brain barrier via angubindin-1 provides a novel avenue of research for the development of antisense oligonucleotide-based therapeutics for the treatment of neurological disorders. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.
Harsch, A; Marzilli, L A; Bunt, R C; Stubbe, J; Vouros, P
2000-05-01
Bleomycin B(2)(BLM) in the presence of iron [Fe(II)] and O(2)catalyzes single-stranded (ss) and double-stranded (ds) cleavage of DNA. Electrospray ionization ion trap mass spectrometry was used to monitor these cleavage processes. Two duplex oligonucleotides containing an ethylene oxide tether between both strands were used in this investigation, allowing facile monitoring of all ss and ds cleavage events. A sequence for site-specific binding and cleavage by Fe-BLM was incorporated into each analyte. One of these core sequences, GTAC, is a known hot-spot for ds cleavage, while the other sequence, GGCC, is a hot-spot for ss cleavage. Incubation of each oligo-nucleotide under anaerobic conditions with Fe(II)-BLM allowed detection of the non-covalent ternary Fe-BLM/oligonucleotide complex in the gas phase. Cleavage studies were then performed utilizing O(2)-activated Fe(II)-BLM. No work-up or separation steps were required and direct MS and MS/MS analyses of the crude reaction mixtures confirmed sequence-specific Fe-BLM-induced cleavage. Comparison of the cleavage patterns for both oligonucleotides revealed sequence-dependent preferences for ss and ds cleavages in accordance with previously established gel electrophoresis analysis of hairpin oligonucleotides. This novel methodology allowed direct, rapid and accurate determination of cleavage profiles of model duplex oligonucleotides after exposure to activated Fe-BLM.
Huschka, Ryan; Barhoumi, Aoune; Liu, Qing; Roth, Jack A.; Ji, Lin; Halas, Naomi J.
2013-01-01
The approach of RNA interference (RNAi)- using antisense DNA or RNA oligonucleotides to silence activity of a specific pathogenic gene transcript and reduce expression of the encoded protein- is very useful in dissecting genetic function and holds significant promise as a molecular therapeutic. A major obstacle in achieving gene silencing with RNAi technology is the systemic delivery of therapeutic oligonucleotides. Here we demonstrate an engineered gold nanoshell (NS)-based therapeutic oligonucleotide delivery vehicle, designed to release its cargo on demand upon illumination with a near-infrared (NIR) laser. A poly(L)lysine peptide (PLL) epilayer covalently attached to the NS surface (NS-PLL) is used to capture intact, single-stranded antisense DNA oligonucleotides, or alternatively, double-stranded short-interfering RNA (siRNA) molecules. Controlled release of the captured therapeutic oligonucleotides in each case is accomplished by continuous wave NIR laser irradiation at 800 nm, near the resonance wavelength of the nanoshell. Fluorescently tagged oligonucleotides were used to monitor the time-dependent release process and light-triggered endosomal release. A green fluorescent protein (GFP)-expressing human lung cancer H1299 cell line was used to determine cellular uptake and gene silencing mediated by the NS-PLL carrying GFP gene-specific single-stranded DNA antisense oligonucleotide (AON-GFP), or a double-stranded siRNA (siRNA-GFP), in vitro. Light-triggered delivery resulted in ∼ 47% and ∼49% downregulation of the targeted GFP expression by AON-GFP and siRNA-GFP, respectively. Cytotoxicity induced by both the NS-PLL delivery vector and by laser irradiation is minimal, as demonstrated by a XTT cell proliferation assay. PMID:22862291
Mirzabekov, Andrei Darievich; Yershov, Gennadiy Moiseyevich; Guschin, Dmitry Yuryevich; Gemmell, Margaret Anne; Shick, Valentine V.; Proudnikov, Dmitri Y.; Timofeev, Edward N.
2002-01-01
A method for determining the existence of duplexes of oligonucleotide complementary molecules is provided whereby a plurality of immobilized oligonucleotide molecules, each of a specific length and each having a specific base sequence, is contacted with complementary, single stranded oligonucleotide molecules to form a duplex so as to facilitate intercalation of a fluorescent dye between the base planes of the duplex. The invention also provides for a method for constructing oligonucleotide matrices comprising confining light sensitive fluid to a surface, exposing said light-sensitive fluid to a light pattern so as to cause the fluid exposed to the light to polymerize into discrete units and adhere to the surface; and contacting each of the units with a set of different oligonucleotide molecules so as to allow the molecules to disperse into the units.
Grachev, M A; Zaychikov, E F; Ivanova, E M; Komarova, N I; Kutyavin, I V; Sidelnikova, N P; Frolova, I P
1984-01-01
Primer-dependent transcription by E. coli RNA polymerase on T7 promoter A2 has been studied. Synthetic deoxyribonucleotides complementary to the promoter over the region -8...+2 were taken as primers. A ribonucleoside residue was present at the 3'-end of some of these oligonucleotides. The octanucleotide complementary to the region -8...-1 appeared to be an active primer. Oligonucleotides having lengths from 3 to 6 nucleotide residues complementary to the promoter over the region -4...+2 also exhibited primer activity. The latter was some 5-10 times greater in the case of oligonucleotides having a ribonucleoside residue at the 3'-end. Oligonucleotides which on complementary binding do not reach the center of phosphodiester bond synthesis, as well as the decanucleotides (-8...+2) and octanucleotides (-6...+2) of both the ribo- and deoxyribo-series were inactive as primers. Images PMID:6390344
Jayaprakash, K N; Peng, Chang Geng; Butler, David; Varghese, Jos P; Maier, Martin A; Rajeev, Kallanthottathil G; Manoharan, Muthiah
2010-12-03
Novel non-nucleoside alkyne monomers compatible with oligonucleotide synthesis were designed, synthesized, and efficiently incorporated into RNA and RNA analogues during solid-phase synthesis. These modifications allowed site-specific conjugation of ligands to the RNA oligonucleotides through copper-assisted (CuAAC) and copper-free strain-promoted azide-alkyne cycloaddition (SPAAC) reactions. The SPAAC click reactions of cyclooctyne-oligonucleotides with various classes of azido-functionalized ligands in solution phase and on solid phase were efficient and quantitative and occurred under mild reaction conditions. The SPAAC reaction provides a method for the synthesis of oligonucleotide-ligand conjugates uncontaminated with copper ions.
Synthesis and biophysical properties of 5'-thio-2',4'-BNA/LNA oligonucleotide.
Islam, Md Ariful; Fujisaka, Aki; Mori, Shohei; Ito, Kosuke Ramon; Yamaguchi, Takao; Obika, Satoshi
2018-07-23
Phosphorothioate modification of oligonucleotides is one of the most promising chemical modifications in nucleic acid therapeutics. Structurally similar 5'-thio or phosphorothiolate-modified nucleotides, in which the 5'-bridging oxygen atom is replaced with a sulfur atom, are attracting attention and gaining importance in oligonucleotide-based research. In our present study, we synthesized 5'-thio-2',4'-BNA/LNA monomers bearing thymine or 5-methylcytosine nucleobase. The 5'-thio-2',4'-BNA/LNA monomers were successfully incorporated into target oligonucleotides, and their nuclease stability and binding affinity with complementary strands were evaluated. Copyright © 2018 Elsevier Ltd. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Prhavc, M.; Prakash, T.P.; Minasov, G.
Oligonucleotides with a novel, 2'-O-[2-[2-(N,N-dimethylamino)ethoxy]ethyl] (2'-O-DMAEOE) modification have been synthesized. This modification, a cationic analogue of the 2'-O-(2-methoxyethyl) (2'-O-MOE) modification, exhibits high binding affinity to target RNA (but not to DNA) and exceptional resistance to nuclease degradation. Analysis of the crystal structure of a self-complementary oligonucleotide containing a single 2'-O-DMAEOE modification explains the importance of charge factors and gauche effects on the observed antisense properties. 2'-O-DMAEOE modified oligonucleotides are ideal candidates for antisense drugs.
Cook, Michael A.; Chan, Chi-Kin; Jorgensen, Paul; Ketela, Troy; So, Daniel; Tyers, Mike; Ho, Chi-Yip
2008-01-01
Background Molecular barcode arrays provide a powerful means to analyze cellular phenotypes in parallel through detection of short (20–60 base) unique sequence tags, or “barcodes”, associated with each strain or clone in a collection. However, costs of current methods for microarray construction, whether by in situ oligonucleotide synthesis or ex situ coupling of modified oligonucleotides to the slide surface are often prohibitive to large-scale analyses. Methodology/Principal Findings Here we demonstrate that unmodified 20mer oligonucleotide probes printed on conventional surfaces show comparable hybridization signals to covalently linked 5′-amino-modified probes. As a test case, we undertook systematic cell size analysis of the budding yeast Saccharomyces cerevisiae genome-wide deletion collection by size separation of the deletion pool followed by determination of strain abundance in size fractions by barcode arrays. We demonstrate that the properties of a 13K unique feature spotted 20 mer oligonucleotide barcode microarray compare favorably with an analogous covalently-linked oligonucleotide array. Further, cell size profiles obtained with the size selection/barcode array approach recapitulate previous cell size measurements of individual deletion strains. Finally, through atomic force microscopy (AFM), we characterize the mechanism of hybridization to unmodified barcode probes on the slide surface. Conclusions/Significance These studies push the lower limit of probe size in genome-scale unmodified oligonucleotide microarray construction and demonstrate a versatile, cost-effective and reliable method for molecular barcode analysis. PMID:18253494
Noonberg, S B; François, J C; Garestier, T; Hélène, C
1995-01-01
Competition between triplex formation with double-stranded DNA and oligonucleotide self-association was investigated in 23mer GA and GT oligonucleotides containing d(GA)5 or d(GT)5 repeats. Whereas triplex formation with GT oligonucleotides was diminished when temperature increased from 4 to 37 degrees C, triplex formation with GA oligonucleotides was enhanced when temperature increased within the same range due to the presence of competing intermolecular GA oligonucleotide self-structure. This self-structure was determined to be a homoduplex stabilized by the internal GA repeats. UV spectroscopy of these homoduplexes demonstrated a single sharp transition with rapid kinetics (Tm = 38.5-43.5 degrees C over strand concentrations of 0.5-4 microM, respectively, with transition enthalpy, delta H = -89 +/- 7 kcal/mol) in 10 mM MgCl2, 100 mM NaCl, pH 7.0. Homoduplex formation was strongly stabilized by multivalent cations (spermine > Mg2+ = Ca2+) and destabilized by low concentrations of monovalent cations (K+ = Li+ = Na+) in the presence of divalent cations. However, unlike GA or GT oligonucleotide-containing triplexes, the homoduplex formed even in the absence of multivalent cations, stabilized by only moderate concentrations of monovalent cations (Li+ > Na+ > K+). Through the development of multiple equilibrium states and the resulting depletion of free oligonucleotide, it was found that the presence of competing self-structure could decrease triplex formation under a variety of experimental conditions. Images PMID:7596824
NASA Astrophysics Data System (ADS)
Matsishin, M.; Rachkov, A.; Lopatynskyi, A.; Chegel, V.; Soldatkin, A.; El'skaya, A.
2017-04-01
An experimental approach for improving the sensitivity of the surface plasmon resonance (SPR) DNA hybridization sensor using gold nanoparticles (GNPs), modified by specific oligonucleotides, was elaborated. An influence of the ionic strength on the aggregation stability of unmodified GNPs and GNPs modified by the thiolated oligonucleotides was investigated by monitoring a value of light extinction at 520 nm that can be considered as a measure of a quantity of the non-aggregated GNPs. While the unmodified GNPs started to aggregate in 0.2 × saline-sodium citrate (SSC), GNPs modified by the negatively charged oligonucleotides were more stable at increasing ionic strength up to 0.5 × SSC. A bioselective element of the SPR DNA hybridization sensor was formed by immobilization on the gold sensor surface of the thiolated oligonucleotides P2, the sequence of which is a fragment of the rpoB gene of Mycobacterium tuberculosis. The injections into the measuring flow cell of the SPR spectrometer of various concentrations of GNPs modified by the complementary oligonucleotides T2-18m caused the pronounced concentration-dependent sequence-specific sensor responses. The magnitude of the sensor responses was much higher than in the case of the free standing complementary oligonucleotides. According to the obtained experimental data, the usage of GNPs modified by specific oligonucleotides can amplify the sensor response of the SPR DNA hybridization sensor in 1200 times.
Bunge, Andreas; Kurz, Anke; Windeck, Anne-Kathrin; Korte, Thomas; Flasche, Wolfgang; Liebscher, Jürgen; Herrmann, Andreas; Huster, Daniel
2007-04-10
For the development of surface functionalized bilayers, we have synthesized lipophilic oligonucleotides to combine the molecular recognition mechanism of nucleic acids and the self-assembly characteristics of lipids in planar membranes. A lipophilic oligonucleotide consisting of 21 thymidine units and two lipophilic nucleotides with an alpha-tocopherol moiety as a lipophilic anchor was synthesized using solid-phase methods with a phosphoramadite strategy. The interaction of the water soluble lipophilic oligonucleotide with vesicular lipid membranes and its capability to bind complementary DNA strands was studied using complementary methods such as NMR, EPR, DSC, fluorescence spectroscopy, and fluorescence microscopy. This oligonucleotide inserted stably into preformed membranes from the aqueous phase. Thereby, no significant perturbation of the lipid bilayer and its stability was observed. However, the non-lipidated end of the oligonucleotide is exposed to the aqueous environment, is relatively mobile, and is free to interact with complementary DNA strands. Binding of the complementary single-stranded DNA molecules is fast and accomplished by the formation of Watson-Crick base pairs, which was confirmed by 1H NMR chemical shift analysis and fluorescence resonance energy transfer. The molecular structure of the membrane bound DNA double helix is very similar to the free double-stranded DNA. Further, the membrane bound DNA double strands also undergo regular melting. Finally, in raft-like membrane mixtures, the lipophilic oligonucleotide was shown to preferentially sequester into liquid-disordered membrane domains.
Effect on embryos of injection of phosphorothioate-modified oligonucleotides into pregnant mice.
Gaudette, M F; Hampikian, G; Metelev, V; Agrawal, S; Crain, W R
1993-01-01
Phosphorothioate-modified oligonucleotides were injected into pregnant female mice to assess the effect on developing embryos. Injections were carried out during two different time periods, one when embryos were in preimplantation stages of development (about 3.5 days of development) and the other after implantation, when both a fetus and placenta are present (from days 9.5 to 11.5 of development). Three different phosphorothioate-modified oligonucleotides were injected. One, which had a sequence not present in the mouse genome, was used to ask whether nonspecific toxic or teratogenic effects on embryos result from treatment of the mother. A second was complementary to the mRNA of the testis-determining factor gene Sry and was used to ask whether a specific developmental pathway (i.e., sex determination) could be disrupted in embryos in vivo. The third was the complement of the anti-Sry sequence. None of these oligonucleotides reduced the frequency of successful pregnancy after mating or the average litter size from that observed in controls animals. Furthermore, examination of 291 pups or fetuses from all oligonucleotide-injected pregnant females revealed no developmental defects regardless of which sequence was used. It is concluded that injection of phosphorothioate-modified oligonucleotides into pregnant females according to the protocols described here is not toxic or teratogenic to embryos in a nonspecific way. Also, anti-Sry oligonucleotides did not influence sex determination in embryos, although there are several possible explanations for this.
Lou, Chenguang; Samuelsen, Simone V; Christensen, Niels Johan; Vester, Birte; Wengel, Jesper
2017-04-19
Mono- and diaminated 2'-amino-LNA monomers were synthesized and introduced into oligonucleotides. Each modification imparts significant stabilization of nucleic acid duplexes and triplexes, excellent sequence selectivity, and significant nuclease resistance. Molecular modeling suggested that structural stabilization occurs via intrastrand electrostatic attraction between the protonated amino groups of the aminated 2'-amino-LNA monomers and the host oligonucleotide backbone.
Phosphorothioate oligonucleotides inhibit the intrinsic tenase complex.
Sheehan, J P; Lan, H C
1998-09-01
Systemic administration of ISIS 2302, a 20-mer antisense phosphorothioate oligonucleotide targeting human intercellular adhesion molecule-1 mRNA, causes prolongation of plasma clotting times in both monkey and human studies. The anticoagulant effects of ISIS 2302 were investigated with both in vitro coagulation assays in human plasma and purified enzyme systems. At high oligonucleotide plasma concentrations (>100 microgram/mL), prolongation of the prothrombin and thrombin times was observed. In a thrombin time assay using purified components, high concentrations of ISIS 2302 inhibited thrombin clotting activity both by stimulating inhibition by heparin cofactor II and directly competing with fibrinogen for binding to anion binding exosite I. In contrast, low concentrations of ISIS 2302 (<100 microgram/mL) showed a selective, linear prolongation of the activated partial thromboplastin time (PTT). The rate limiting effect of 50 microgram/mL ISIS 2302, which prolonged the PTT to 1.5 times control, was identified by sequential modification of the clotting assay. Delaying addition of oligonucleotide until after contact activation failed to correct prolongation of the PTT. The calcium-dependent steps of the intrinsic pathway were individually assessed by adding sufficient activated coagulation factor to correct the PTT in plasma deficient in that specific factor. Addition of factor XIa, IXa, VIIIa, or Va failed to correct the PTT in the presence of ISIS 2302. In contrast, 0.2 nmol/L factor Xa corrected prolongation of the PTT in factor X-deficient plasma with or without oligonucleotide present. ISIS 2302 (50 microgram/mL) did not prolong a modified Russel viper venom time, suggesting no significant inhibition of prothrombinase. Thus, 50 microgram/mL ISIS 2302 prolonged the PTT by selectively inhibiting intrinsic tenase activity. ISIS 2302 showed partial inhibition of intrinsic tenase activity (to approximately 35% of control) at clinically relevant oligonucleotide concentrations in a chromogenic assay. This activity was oligonucleotide sequence-independent but required the phosphorothioate backbone, suggesting that inhibition of intrinsic tenase is a general property of this class of oligonucleotides. These results are relevant to both the therapeutic use of phosphorothioate oligonucleotides and the potential design of inhibitors of the intrinsic tenase complex, a novel target for anticoagulation. Copyright 1998 by The American Society of Hematology.
El-Sagheer, Afaf H.; Sanzone, A. Pia; Gao, Rachel; Tavassoli, Ali; Brown, Tom
2011-01-01
A triazole mimic of a DNA phosphodiester linkage has been produced by templated chemical ligation of oligonucleotides functionalized with 5′-azide and 3′-alkyne. The individual azide and alkyne oligonucleotides were synthesized by standard phosphoramidite methods and assembled using a straightforward ligation procedure. This highly efficient chemical equivalent of enzymatic DNA ligation has been used to assemble a 300-mer from three 100-mer oligonucleotides, demonstrating the total chemical synthesis of very long oligonucleotides. The base sequences of the DNA strands containing this artificial linkage were copied during PCR with high fidelity and a gene containing the triazole linker was functional in Escherichia coli. PMID:21709264
Chemoselective covalent coupling of oligonucleotide probes to self-assembled monolayers.
Devaraj, Neal K; Miller, Gregory P; Ebina, Wataru; Kakaradov, Boyko; Collman, James P; Kool, Eric T; Chidsey, Christopher E D
2005-06-22
A chemoselective route to routinely and rapidly attach oligonucleotide probes to well-defined surfaces is presented. Cu(I) tris(benzyltriazolylmethyl)amine-catalyzed coupling of terminal acetylenes to azides on a self-assembled monolayer is used instead of traditional nucleophilic-electrophilic coupling reactions. The reaction proceeds well even in the presence of purposely introduced nucleophilic and electrophilic impurities. The density of oligonucleotide probes can be controlled by controlling the amount of azide functionality. Although most of our work was done on gold surfaces, this technique should be readily applicable to any surface on which an azide-containing monolayer can be assembled as we have preliminarily demonstrated by derivatizing azidotrimethoxysilane-modified glass slides with fluorescein-containing oligonucleotides.
Sturm, Marc; Quinten, Sascha; Huber, Christian G.; Kohlbacher, Oliver
2007-01-01
We propose a new model for predicting the retention time of oligonucleotides. The model is based on ν support vector regression using features derived from base sequence and predicted secondary structure of oligonucleotides. Because of the secondary structure information, the model is applicable even at relatively low temperatures where the secondary structure is not suppressed by thermal denaturing. This makes the prediction of oligonucleotide retention time for arbitrary temperatures possible, provided that the target temperature lies within the temperature range of the training data. We describe different possibilities of feature calculation from base sequence and secondary structure, present the results and compare our model to existing models. PMID:17567619
Chemistry, mechanism and clinical status of antisense oligonucleotides and duplex RNAs
Shen, Xiulong; Corey, David R
2018-01-01
Abstract RNA plays a central role in the expression of all genes. Because any sequence within RNA can be recognized by complementary base pairing, synthetic oligonucleotides and oligonucleotide mimics offer a general strategy for controlling processes that affect disease. The two primary antisense approaches for regulating expression through recognition of cellular RNAs are single-stranded antisense oligonucleotides and duplex RNAs. This review will discuss the chemical modifications and molecular mechanisms that make synthetic nucleic acid drugs possible. Lessons learned from recent clinical trials will be summarized. Ongoing clinical trials are likely to decisively test the adequacy of our current generation of antisense nucleic acid technologies and highlight areas where more basic research is needed. PMID:29240946
Mumcuoglu, Didem; Sardan Ekiz, Melis; Gunay, Gokhan; Tekinay, Turgay; Tekinay, Ayse B; Guler, Mustafa O
2016-05-11
Oligonucleotides are promising drug candidates due to the exceptionally high specificity they exhibit toward their target DNA and RNA sequences. However, their poor pharmacokinetic and pharmacodynamic properties, in conjunction with problems associated with their internalization by cells, necessitates their delivery through specialized carrier systems for efficient therapy. Here, we investigate the effects of carrier morphology on the cellular internalization mechanisms of oligonucleotides by using self-assembled fibrous or spherical peptide nanostructures. Size and geometry were both found to be important parameters for the oligonucleotide internalization process; direct penetration was determined to be the major mechanism for the internalization of nanosphere carriers, whereas nanofibers were internalized by clathrin- and dynamin-dependent endocytosis pathways. We further showed that glucose conjugation to carrier nanosystems improved cellular internalization in cancer cells due to the enhanced glucose metabolism associated with oncogenesis, and the internalization of the glucose-conjugated peptide/oligonucleotide complexes was found to be dependent on glucose transporters present on the surface of the cell membrane.
Roh, Changhyun
2012-01-01
Hundreds of million people worldwide have been infected with severe acute respiratory syndrome (SARS), and the rate of global death from SARS has remarkably increased. Hence, the development of efficient drug treatments for the biological effects of SARS is highly needed. We have previously shown that quantum dots (QDs)-conjugated RNA oligonucleotide is sensitive to the specific recognition of the SARS-associated coronavirus (SARS-CoV) nucleocapsid (N) protein. In this study, we found that a designed biochip could analyze inhibitors of the SARS-CoV N protein using nanoparticle-based RNA oligonucleotide. Among the polyphenolic compounds examined, (-)-catechin gallate and (-)-gallocatechin gallate demonstrated a remarkable inhibition activity on SARS-CoV N protein. (-)-catechin gallate and (-)-gallocatechin gallate attenuated the binding affinity in a concentrated manner as evidenced by QDs-conjugated RNA oligonucleotide on a designed biochip. At a concentration of 0.05 μg mL(-1), (-)-catechin gallate and (-)-gallocatechin gallate showed more than 40% inhibition activity on a nanoparticle-based RNA oligonucleotide biochip system.
Khrapko, Konstantin R [Moscow, RU; Khorlin, Alexandr A [Moscow, RU; Ivanov, Igor B [Moskovskaya, RU; Ershov, Gennady M [Moscow, RU; Lysov, Jury P [Moscow, RU; Florentiev, Vladimir L [Moscow, RU; Mirzabekov, Andrei D [Moscow, RU
1996-09-03
A method for sequencing DNA by hybridization that includes the following steps: forming an array of oligonucleotides at such concentrations that either ensure the same dissociation temperature for all fully complementary duplexes or allows hybridization and washing of such duplexes to be conducted at the same temperature; hybridizing said oligonucleotide array with labeled test DNA; washing in duplex dissociation conditions; identifying single-base substitutions in the test DNA by analyzing the distribution of the dissociation temperatures and reconstructing the DNA nucleotide sequence based on the above analysis. A device for carrying out the method comprises a solid substrate and a matrix rigidly bound to the substrate. The matrix contains the oligonucleotide array and consists of a multiplicity of gel portions. Each gel portion contains one oligonucleotide of desired length. The gel portions are separated from one another by interstices and have a thickness not exceeding 30 .mu.m.
Java web tools for PCR, in silico PCR, and oligonucleotide assembly and analysis.
Kalendar, Ruslan; Lee, David; Schulman, Alan H
2011-08-01
The polymerase chain reaction is fundamental to molecular biology and is the most important practical molecular technique for the research laboratory. We have developed and tested efficient tools for PCR primer and probe design, which also predict oligonucleotide properties based on experimental studies of PCR efficiency. The tools provide comprehensive facilities for designing primers for most PCR applications and their combinations, including standard, multiplex, long-distance, inverse, real-time, unique, group-specific, bisulphite modification assays, Overlap-Extension PCR Multi-Fragment Assembly, as well as a programme to design oligonucleotide sets for long sequence assembly by ligase chain reaction. The in silico PCR primer or probe search includes comprehensive analyses of individual primers and primer pairs. It calculates the melting temperature for standard and degenerate oligonucleotides including LNA and other modifications, provides analyses for a set of primers with prediction of oligonucleotide properties, dimer and G-quadruplex detection, linguistic complexity, and provides a dilution and resuspension calculator. Copyright © 2011 Elsevier Inc. All rights reserved.
Ramazeilles, C; Mishra, R K; Moreau, S; Pascolo, E; Toulmé, J J
1994-08-16
We targeted the mini-exon sequence, present at the 5' end of every mRNA of the protozoan parasite Leishmania amazonensis, by phosphorothioate oligonucleotides. A complementary 16-mer (16PS) was able to kill amastigotes--the intracellular stage of the parasite--in murine macrophages in culture. After 24 hr of incubation with 10 microM 16PS, about 30% infected macrophages were cured. The oligomer 16PS acted through antisense hybridization in a sequence-dependent way; no effect on parasites was observed with noncomplementary phosphorothioate oligonucleotides. The antisense oligonucleotide 16PS was a selective killer of the protozoans without any detrimental effect to the host macrophage. Using 16PS linked to a palmitate chain, which enabled it to complex with low density lipoproteins, improved the leishmanicidal efficiency on intracellular amastigotes, probably due to increased endocytosis. Phosphorothioate oligonucleotides complementary to the intron part of the mini-exon pre-RNA were also effective, suggesting that antisense oligomers could prevent trans-splicing in these parasites.
Incorporation of an aldehyde function in oligonucleotides.
Tilquin, J M; Dechamps, M; Sonveaux, E
2001-01-01
A nucleotide-like phosphoramidite building block that has the nucleic base replaced by the tert-butyldimethylsilyl-protected styrene glycol was synthesized. After the automatic synthesis of an oligonucleotide incorporating this synthon, the benzaldehyde function was generated by fluoride deprotection and oxidation by sodium periodate. In a similar manner, an oligonucleotide where a nucleic base was replaced by the (CH2)8CH=O chain was synthesized and conjugated with biotin derivatives.
Milton, James A.; Patole, Samson; Yin, Huabing; Xiao, Qiang; Brown, Tom; Melvin, Tracy
2013-01-01
Although strategies for the immobilization of DNA oligonucleotides onto surfaces for bioanalytical and top-down bio-inspired nanobiofabrication approaches are well developed, the effect of introducing spacer molecules between the surface and the DNA oligonucleotide for the hybridization of nanoparticle–DNA conjugates has not been previously assessed in a quantitative manner. The hybridization efficiency of DNA oligonucleotides end-labelled with gold nanoparticles (1.4 or 10 nm diameter) with DNA sequences conjugated to silicon surfaces via hexaethylene glycol phosphate diester oligomer spacers (0, 1, 2, 6 oligomers) was found to be independent of spacer length. To quantify both the density of DNA strands attached to the surfaces and hybridization with the surface-attached DNA, new methodologies have been developed. Firstly, a simple approach based on fluorescence has been developed for determination of the immobilization density of DNA oligonucleotides. Secondly, an approach using mass spectrometry has been created to establish (i) the mean number of DNA oligonucleotides attached to the gold nanoparticles and (ii) the hybridization density of nanoparticle–oligonucleotide conjugates with the silicon surface–attached complementary sequence. These methods and results will be useful for application with nanosensors, the self-assembly of nanoelectronic devices and the attachment of nanoparticles to biomolecules for single-molecule biophysical studies. PMID:23361467
Iwasaki, Yuki; Abe, Takashi; Wada, Kennosuke; Wada, Yoshiko; Ikemura, Toshimichi
2013-11-20
With the remarkable increase of genomic sequence data of microorganisms, novel tools are needed for comprehensive analyses of the big sequence data available. The self-organizing map (SOM) is an effective tool for clustering and visualizing high-dimensional data, such as oligonucleotide composition on one map. By modifying the conventional SOM, we developed batch-learning SOM (BLSOM), which allowed classification of sequence fragments (e.g., 1 kb) according to phylotypes, solely depending on oligonucleotide composition. Metagenomics studies of uncultivable microorganisms in clinical and environmental samples should allow extensive surveys of genes important in life sciences. BLSOM is most suitable for phylogenetic assignment of metagenomic sequences, because fragmental sequences can be clustered according to phylotypes, solely depending on oligonucleotide composition. We first constructed oligonucleotide BLSOMs for all available sequences from genomes of known species, and by mapping metagenomic sequences on these large-scale BLSOMs, we can predict phylotypes of individual metagenomic sequences, revealing a microbial community structure of uncultured microorganisms, including viruses. BLSOM has shown that influenza viruses isolated from humans and birds clearly differ in oligonucleotide composition. Based on this host-dependent oligonucleotide composition, we have proposed strategies for predicting directional changes of virus sequences and for surveilling potentially hazardous strains when introduced into humans from non-human sources.
Oligonucleotide-arrayed TFT photosensor applicable for DNA chip technology.
Tanaka, Tsuyoshi; Hatakeyama, Keiichi; Sawaguchi, Masahiro; Iwadate, Akihito; Mizutani, Yasushi; Sasaki, Kazuhiro; Tateishi, Naofumi; Takeyama, Haruko; Matsunaga, Tadashi
2006-09-05
A thin film transistor (TFT) photosensor fabricated by semiconductor integrated circuit (IC) technology was applied to DNA chip technology. The surface of the TFT photosensor was coated with TiO2 using a vapor deposition technique for the fabrication of optical filters. The immobilization of thiolated oligonucleotide probes onto a TiO2-coated TFT photosensor using gamma-aminopropyltriethoxysilane (APTES) and N-(gamma-maleimidobutyloxy) sulfosuccinimide ester (GMBS) was optimized. The coverage value of immobilized oligonucleotides reached a plateau at 33.7 pmol/cm2, which was similar to a previous analysis using radioisotope-labeled oligonucleotides. The lowest detection limits were 0.05 pmol/cm2 for quantum dot and 2.1 pmol/cm2 for Alexa Fluor 350. Furthermore, single nucleotide polymorphism (SNP) detection was examined using the oligonucleotide-arrayed TFT photosensor. A SNP present in the aldehyde dehydrogenase 2 (ALDH2) gene was used as a target. The SNPs in ALDH2*1 and ALDH2*2 target DNA were detected successfully using the TFT photosensor. DNA hybridization in the presence of both ALDH2*1 and ALDH2*2 target DNA was observed using both ALDH2*1 and ALDH2*2 detection oligonucleotides-arrayed TFT photosensor. Use of the TFT photosensor will allow the development of a disposable photodetecting device for DNA chip systems. (c) 2006 Wiley Periodicals, Inc.
Ickert, Stefanie; Hofmann, Johanna; Riedel, Jens; Beck, Sebastian; Pagel, Kevin; Linscheid, Michael W
2018-04-01
Mass spectrometry is applied as a tool for the elucidation of molecular structures. This premises that gas-phase structures reflect the original geometry of the analytes, while it requires a thorough understanding and investigation of the forces controlling and affecting the gas-phase structures. However, only little is known about conformational changes of oligonucleotides in the gas phase. In this study, a series of multiply charged DNA oligonucleotides (n = 15-40) has been subjected to a comprehensive tandem mass spectrometric study to unravel transitions between different ionic gas-phase structures. The nucleobase sequence and the chain length were varied to gain insights into their influence on the geometrical oligonucleotide organization. Altogether, 23 oligonucleotides were analyzed using collision-induced fragmentation. All sequences showed comparable correlation regarding the characteristic collision energy. This value that is also a measure for stability, strongly correlates with the net charge density of the precursor ions. With decreasing charge of the oligonucleotides, an increase in the fragmentation energy was observed. At a distinct charge density, a deviation from linearity was observed for all studied species, indicating a structural reorganization. To corroborate the proposed geometrical change, collisional cross-sections of the oligonucleotides at different charge states were determined using ion mobility-mass spectrometry. The results clearly indicate that an increase in charge density and thus Coulomb repulsion results in the transition from a folded, compact form to elongated structures of the precursor ions. Our data show this structural transition to depend mainly on the charge density, whereas sequence and size do not have an influence.
Ramos, Laia; del Rey, Javier; Daina, Gemma; García-Aragonés, Manel; Armengol, Lluís; Fernandez-Encinas, Alba; Parriego, Mònica; Boada, Montserrat; Martinez-Passarell, Olga; Martorell, Maria Rosa; Casagran, Oriol; Benet, Jordi; Navarro, Joaquima
2014-01-01
Comprehensive chromosome analysis techniques such as metaphase-Comparative Genomic Hybridisation (CGH) and array-CGH are available for single-cell analysis. However, while metaphase-CGH and BAC array-CGH have been widely used for Preimplantation Genetic Diagnosis, oligonucleotide array-CGH has not been used in an extensive way. A comparison between oligonucleotide array-CGH and metaphase-CGH has been performed analysing 15 single fibroblasts from aneuploid cell-lines and 18 single blastomeres from human cleavage-stage embryos. Afterwards, oligonucleotide array-CGH and BAC array-CGH were also compared analysing 16 single blastomeres from human cleavage-stage embryos. All three comprehensive analysis techniques provided broadly similar cytogenetic profiles; however, non-identical profiles appeared when extensive aneuploidies were present in a cell. Both array techniques provided an optimised analysis procedure and a higher resolution than metaphase-CGH. Moreover, oligonucleotide array-CGH was able to define extra segmental imbalances in 14.7% of the blastomeres and it better determined the specific unbalanced chromosome regions due to a higher resolution of the technique (≈ 20 kb). Applicability of oligonucleotide array-CGH for Preimplantation Genetic Diagnosis has been demonstrated in two cases of Robertsonian translocation carriers 45,XY,der(13;14)(q10;q10). Transfer of euploid embryos was performed in both cases and pregnancy was achieved by one of the couples. This is the first time that an oligonucleotide array-CGH approach has been successfully applied to Preimplantation Genetic Diagnosis for balanced chromosome rearrangement carriers.
Ramos, Laia; del Rey, Javier; Daina, Gemma; García-Aragonés, Manel; Armengol, Lluís; Fernandez-Encinas, Alba; Parriego, Mònica; Boada, Montserrat; Martinez-Passarell, Olga; Martorell, Maria Rosa; Casagran, Oriol; Benet, Jordi; Navarro, Joaquima
2014-01-01
Comprehensive chromosome analysis techniques such as metaphase-Comparative Genomic Hybridisation (CGH) and array-CGH are available for single-cell analysis. However, while metaphase-CGH and BAC array-CGH have been widely used for Preimplantation Genetic Diagnosis, oligonucleotide array-CGH has not been used in an extensive way. A comparison between oligonucleotide array-CGH and metaphase-CGH has been performed analysing 15 single fibroblasts from aneuploid cell-lines and 18 single blastomeres from human cleavage-stage embryos. Afterwards, oligonucleotide array-CGH and BAC array-CGH were also compared analysing 16 single blastomeres from human cleavage-stage embryos. All three comprehensive analysis techniques provided broadly similar cytogenetic profiles; however, non-identical profiles appeared when extensive aneuploidies were present in a cell. Both array techniques provided an optimised analysis procedure and a higher resolution than metaphase-CGH. Moreover, oligonucleotide array-CGH was able to define extra segmental imbalances in 14.7% of the blastomeres and it better determined the specific unbalanced chromosome regions due to a higher resolution of the technique (≈20 kb). Applicability of oligonucleotide array-CGH for Preimplantation Genetic Diagnosis has been demonstrated in two cases of Robertsonian translocation carriers 45,XY,der(13;14)(q10;q10). Transfer of euploid embryos was performed in both cases and pregnancy was achieved by one of the couples. This is the first time that an oligonucleotide array-CGH approach has been successfully applied to Preimplantation Genetic Diagnosis for balanced chromosome rearrangement carriers. PMID:25415307
Wu, Lianming; White, David E; Ye, Connie; Vogt, Frederick G; Terfloth, Gerald J; Matsuhashi, Hayao
2012-07-01
While the occurrence of desulfurization of phosphorothioate oligonucleotides in solution is well established, this study represents the first attempt to investigate the basis of the unexpected desulfurization via the net sulfur-by-oxygen (S-O) replacement during negative electrospray ionization (ESI). The current work, facilitated by quantitative mass deconvolution, demonstrates that considerable desulfurization can take place even under common negative ESI operating conditions. The extent of desulfurization is dependent on the molar phosphorothioate oligonucleotide-to-hydroxyl radical ratio, which is consistent with the corona discharge-induced origin of the hydroxyl radical leading to the S-O replacement. This hypothesis is supported by the fact that an increase of the high-performance liquid chromatography (HPLC) flow rate and the on-column concentration of a phosphorothioate oligonucleotide, as well as a decrease of the electrospray voltage reduce the degree of desulfurization. Comparative LC-tandem mass spectrometry (MS/MS) sequencing of a phosphorothioate oligonucleotide and its corresponding desulfurization product revealed evidence that the S-O replacement occurs at multiple phosphorothioate internucleotide linkage sites. In practice, the most convenient and effective strategy for minimizing this P = O artifact is to increase the LC flow rate and the on-column concentration of phosphorothioate oligonucleotides. Another approach to mitigate possible detrimental effects of the undesired desulfurization is to operate the ESI source at a very low electrospray voltage to diminish the corona discharge; however this will significantly compromise sensitivity when analyzing the low-level P = O impurities in phosphorothioate oligonucleotides. Copyright © 2012 John Wiley & Sons, Ltd.
Allawi, H T; Dong, F; Ip, H S; Neri, B P; Lyamichev, V I
2001-01-01
A rapid and simple method for determining accessible sites in RNA that is independent of the length of target RNA and does not require RNA labeling is described. In this method, target RNA is allowed to hybridize with sequence-randomized libraries of DNA oligonucleotides linked to a common tag sequence at their 5'-end. Annealed oligonucleotides are extended with reverse transcriptase and the extended products are then amplified by using PCR with a primer corresponding to the tag sequence and a second primer specific to the target RNA sequence. We used the combination of both the lengths of the RT-PCR products and the location of the binding site of the RNA-specific primer to determine which regions of the RNA molecules were RNA extendible sites, that is, sites available for oligonucleotide binding and extension. We then employed this reverse transcription with the random oligonucleotide libraries (RT-ROL) method to determine the accessible sites on four mRNA targets, human activated ras (ha-ras), human intercellular adhesion molecule-1 (ICAM-1), rabbit beta-globin, and human interferon-gamma (IFN-gamma). Our results were concordant with those of other researchers who had used RNase H cleavage or hybridization with arrays of oligonucleotides to identify accessible sites on some of these targets. Further, we found good correlation between sites when we compared the location of extendible sites identified by RT-ROL with hybridization sites of effective antisense oligonucleotides on ICAM-1 mRNA in antisense inhibition studies. Finally, we discuss the relationship between RNA extendible sites and RNA accessibility. PMID:11233988
Okuyama, Tetsuya; Nakatake, Richi; Kaibori, Masaki; Okumura, Tadayoshi; Kon, Masanori; Nishizawa, Mikio
2018-01-30
Natural antisense transcripts (asRNAs) that do not encode proteins are transcribed from rat, mouse, and human genes, encoding inducible nitric oxide synthase (iNOS), which catalyzes the production of the inflammatory mediator nitric oxide (NO). In septic shock, NO is excessively produced in hepatocytes and macrophages. The iNOS asRNA interacts with and stabilizes iNOS mRNA. We found that single-stranded 'sense' oligonucleotides corresponding to the iNOS mRNA sequence reduced iNOS mRNA levels by interfering with the mRNA-asRNA interactions in rat hepatocytes. The iNOS sense oligonucleotides that were substituted with phosphorothioate bonds and locked nucleic acids efficiently decreased the levels of iNOS mRNA and iNOS protein. In this study, the gene expression patterns in the livers of two endotoxemia model rats with acute liver failure were compared. Next, we optimized the sequence and modification of the iNOS sense oligonucleotides in interleukin 1β-treated rat hepatocytes. When a sense oligonucleotide was simultaneously administered with d-galactosamine and bacterial lipopolysaccharide (LPS) to rats, their survival rate significantly increased compared to the rats administered d-galactosamine and LPS alone. In the livers of the sense oligonucleotide-administered rats, apoptosis in the hepatocytes markedly decreased. These results suggest that natural antisense transcript-targeted regulation technology using iNOS sense oligonucleotides may be used to treat human inflammatory diseases, such as sepsis and septic shock. Copyright © 2017 Elsevier Inc. All rights reserved.
Nikcevic, Irena; Wyrzykiewicz, Tadeusz K.; Limbach, Patrick A.
2010-01-01
Summary An LC-MS method based on the use of high resolution Fourier transform ion cyclotron resonance mass spectrometry (FTIRCMS) for profiling oligonucleotides synthesis impurities is described. Oligonucleotide phosphorothioatediesters (phosphorothioate oligonucleotides), in which one of the non-bridging oxygen atoms at each phosphorus center is replaced by a sulfur atom, are now one of the most popular oligonucleotide modifications due to their ease of chemical synthesis and advantageous pharmacokinetic properties. Despite significant progress in the solid-phase oligomerization chemistry used in the manufacturing of these oligonucleotides, multiple classes of low-level impurities always accompany synthetic oligonucleotides. Liquid chromatography-mass spectrometry has emerged as a powerful technique for the identification of these synthesis impurities. However, impurity profiling, where the entire complement of low-level synthetic impurities is identified in a single analysis, is more challenging. Here we present an LC-MS method based the use of high resolution-mass spectrometry, specifically Fourier transform ion cyclotron resonance mass spectrometry (FTIRCMS or FTMS). The optimal LC-FTMS conditions, including the stationary phase and mobile phases for the separation and identification of phosphorothioate oligonucleotides, were found. The characteristics of FTMS enable charge state determination from single m/z values of low-level impurities. Charge state information then enables more accurate modeling of the detected isotopic distribution for identification of the chemical composition of the detected impurity. Using this approach, a number of phosphorothioate impurities can be detected by LC-FTMS including failure sequences carrying 3′-terminal phosphate monoester and 3′-terminal phosphorothioate monoester, incomplete backbone sulfurization and desulfurization products, high molecular weight impurities, and chloral, isobutyryl, and N3 (2-cyanoethyl) adducts of the full length product. When compared with low resolution LC-MS, ~60% more impurities can be identified when charge state and isotopic distribution information is available and used for impurity profiling. PMID:21811394
Biominetic High Density Lipoproteins for the Delivery of Therapeutic Oligonucleotides
NASA Astrophysics Data System (ADS)
Tripathy, Sushant
Advances in nanotechnology have brought about novel inorganic and hybrid nanoparticles with unique physico-chemical properties that make them suitable for a broad range of applications---from nano-circuitry to drug delivery. A significant part of those advancements have led to ground-breaking discoveries that have changed the approaches to formulation of therapeutics against diseases, such as cancer. Now-a-days the focus does not lie solely on finding a candidate small-molecule therapeutic with minimal adverse effects, but researchers are looking up to nanoparticles to improve biodistribution and biocompatibility profile of clinically proven therapeutics. The plethora of conjugation chemistries offered by currently extant inorganic nanoparticles have, in recent years, led to great leaps in the field of biomimicry---a modality that promises high biocompatibility. Further, in the pursuit of highly specific therapeutic molecules, researchers have turned to silencing oligonucleotides and some have already brought together the strengths of nanoparticles and silencing oligonucleotides in search of an efficacious therapy for cancer with minimal adverse effects. This dissertation work focuses on such a biomimetic platform---a gold nanoparticle based high density lipoprotein biomimetic (HDL NP), for the delivery of therapeutic oligonucleotides. The first chapter of this body of work introduces the molecular target of the silencing oligonucleotides---VEGFR2, and its role in the progression of solid tumor cancers. The background information also covers important aspects of natural high density lipoproteins (HDL), especially their innate capacity to bind and deliver exogenous and endogenous silencing oligonucleotides to tissues that express their high affinity receptor SRB1. We subsequently describe the synthesis of the biomimetic HDL NP and its oligonucleotide conjugates, and establish their biocompatibility. Further on, experimental data demonstrate the efficacy of silencing oligonucleotides conjugated HDL NPs in regulating the expression and function of VEGFR2 in cultured endothelial cells. Finally, the efficacy of the conjugates in two animal models of angiogenesis is presented.
A CpG Oligonucleotide Can Protect Mice From a Low Aerosol Challenge Dose of Burkholderia mallei
2006-03-01
may protect victims of a biological attack from glanders . Burkholderia mallei , the causative agent of glanders , natu- rally infects equines, but it can...attack from glanders . 15. SUBJECT TERMS Burkholderia mallei , glanders , oligonucleotides, CpG motif, efficacy, laboratory animals, mice 16...Society for Microbiology. All Rights Reserved. A CpG Oligonucleotide Can Protect Mice from a Low Aerosol Challenge Dose of Burkholderia mallei David M
Fluorescence energy transfer as a probe for nucleic acid structures and sequences.
Mergny, J L; Boutorine, A S; Garestier, T; Belloc, F; Rougée, M; Bulychev, N V; Koshkin, A A; Bourson, J; Lebedev, A V; Valeur, B
1994-01-01
The primary or secondary structure of single-stranded nucleic acids has been investigated with fluorescent oligonucleotides, i.e., oligonucleotides covalently linked to a fluorescent dye. Five different chromophores were used: 2-methoxy-6-chloro-9-amino-acridine, coumarin 500, fluorescein, rhodamine and ethidium. The chemical synthesis of derivatized oligonucleotides is described. Hybridization of two fluorescent oligonucleotides to adjacent nucleic acid sequences led to fluorescence excitation energy transfer between the donor and the acceptor dyes. This phenomenon was used to probe primary and secondary structures of DNA fragments and the orientation of oligodeoxynucleotides synthesized with the alpha-anomers of nucleoside units. Fluorescence energy transfer can be used to reveal the formation of hairpin structures and the translocation of genes between two chromosomes. PMID:8152922
Kupriushkin, M S; Pyshnyĭ, D V
2012-01-01
Non-nucleotide phosporamidites were synthetized, having branched backbone with different position of functional groups. Obtained phosphoramidite monomers contain intercalator moiety--6-chloro-2-methoxyacridine, and additional hydroxyl residue protected with dimethoxytrityl group or with tert-butyldimethylsilyl group for post-synthetic modification. Synthesized oligothymidilates contain one or more modified units in different positions of sequence. Melting temperature and thermodynamic parameters of formation of complementary duplexes formed by modified oligonucleotides was defined (change in enthalpy and entropy). The introduction of intercalating residue causes a significant stabilization of DNA duplexes. It is shown that the efficiency of the fluorescence of acridine residue in the oligonucleotide conjugate significantly changes upon hybridization with DNA.
Livache, T; Roget, A; Dejean, E; Barthet, C; Bidan, G; Téoule, R
1994-01-01
A new methodology for the preparation of addressed DNA matrices is described. The process includes an electrochemically directed copolymerization of pyrrole and oligonucleotides bearing on their 5' end a pyrrole moiety introduced by phosphoramidite chemistry. The electro-controlled synthesis of the copolymer (poly-pyrrole) gives, in one step, a solid conducting film deposited on the surface of an electrode. The resulting polymer consists of pyrrole chains bearing covalently linked oligonucleotide. The polymer growth is limited to the electrode surface, so that it is possible to prepare a DNA matrix on a multiple electrode device by successive copolymerizations. A support bearing four oligonucleotides was used to detect three ras mutations on a synthetic DNA fragment. PMID:8065902
Monovalent Streptavidin that Senses Oligonucleotides**
Wang, Jingxian; Kostic, Natasa; Stojanovic, Milan N.
2013-01-01
We report a straightforward chemical route to monovalent streptavidin, a valuable reagent for imaging. The one-step process is based on a (tris)biotinylated-oligonucleotide blocking three of streptavidin’s four biotin binding sites. Further, the complex is highly sensitive to single-base differences - whereby perfectly matched oligonucleotides trigger dissociation of the biotin-streptavidin interaction at higher rates than single-base mismatches. Unique properties and ease of synthesis open wide opportunities for practical applications in imaging and biosensing. PMID:23606329
Ferrocene conjugated oligonucleotide for electrochemical detection of DNA base mismatch.
Hasegawa, Yusuke; Takada, Tadao; Nakamura, Mitsunobu; Yamana, Kazushige
2017-08-01
We describe the synthesis, binding, and electrochemical properties of ferrocene-conjugated oligonucleotides (Fc-oligos). The key step for the preparation of Fc-oligos contains the coupling of vinylferrocene to 5-iododeoxyuridine via Heck reaction. The Fc-conjugated deoxyuridine phosphoramidite was used in the Fc-oligonucleotide synthesis. We show that thiol-modified Fc-oligos deposited onto gold electrodes possess potential ability in electrochemical detection of DNA base mismatch. Copyright © 2017 Elsevier Ltd. All rights reserved.
Hazell, Gareth; Shabanpoor, Fazel; Saleh, Amer F.; Bowerman, Melissa; Meijboom, Katharina E.; Zhou, Haiyan; Muntoni, Francesco; Talbot, Kevin; Gait, Michael J.; Wood, Matthew J. A.
2016-01-01
The development of antisense oligonucleotide therapy is an important advance in the identification of corrective therapy for neuromuscular diseases, such as spinal muscular atrophy (SMA). Because of difficulties of delivering single-stranded oligonucleotides to the CNS, current approaches have been restricted to using invasive intrathecal single-stranded oligonucleotide delivery. Here, we report an advanced peptide-oligonucleotide, Pip6a-morpholino phosphorodiamidate oligomer (PMO), which demonstrates potent efficacy in both the CNS and peripheral tissues in severe SMA mice following systemic administration. SMA results from reduced levels of the ubiquitously expressed survival motor neuron (SMN) protein because of loss-of-function mutations in the SMN1 gene. Therapeutic splice-switching oligonucleotides (SSOs) modulate exon 7 splicing of the nearly identical SMN2 gene to generate functional SMN protein. Pip6a-PMO yields SMN expression at high efficiency in peripheral and CNS tissues, resulting in profound phenotypic correction at doses an order-of-magnitude lower than required by standard naked SSOs. Survival is dramatically extended from 12 d to a mean of 456 d, with improvement in neuromuscular junction morphology, down-regulation of transcripts related to programmed cell death in the spinal cord, and normalization of circulating insulin-like growth factor 1. The potent systemic efficacy of Pip6a-PMO, targeting both peripheral as well as CNS tissues, demonstrates the high clinical potential of peptide-PMO therapy for SMA. PMID:27621445
Misra, Arvind; Mishra, Satyendra; Misra, Krishna
2004-01-01
Synthesis of modified oligonucleotides in which the specific cytidine nucleoside analogues linked at 2'-OH position via a carbamate bond with an amino ethyl derivative of dansyl fluorophore is reported. For the multiple labeling of oligonucleotides, a strategy involving prelabeling at the monomeric level followed by solid phase assembly of oligonucleotides to obtain regiospecifically labeled probes has been described. The labeled monomer was phosphitylated using 2-cyanoethyl-N,N,N',N'-tetraisopropyl-phosphoramidite (Bis-reagent) and pyridiniumtrifluoro acetate (Py.TFA) as an activator. To ascertain the minimal number of labeled monomers required for a specific length of oligonucleotide for detection and also to assess the effect of carbamate linkage on hybridization, hexamer and 20-mer sequences were selected. Both were labeled with 1, 2, and 3 monomers at the 5'-end and hybridized with normal (unmodified) complementary sequences. As compared to midsequence or 3'-terminal labeling reported earlier, the 5'-terminal labeling has been found to have minimal contact-mediated quenching on duplex formation. This may be due to complementary deoxyguanosine (dG) rich oligonucleotide sequences or CG base pairs at a terminus that is known to yield stronger binding. This is one reason for selecting cytidine for labeling. The results may aid rational design of multiple fluorescent DNA probes for nonradioactive detection of nucleic acids.
Alterman, Julia F; Coles, Andrew H; Hall, Lauren M; Aronin, Neil; Khvorova, Anastasia; Didiot, Marie-Cécile
2017-08-20
Primary neurons represent an ideal cellular system for the identification of therapeutic oligonucleotides for the treatment of neurodegenerative diseases. However, due to the sensitive nature of primary cells, the transfection of small interfering RNAs (siRNA) using classical methods is laborious and often shows low efficiency. Recent progress in oligonucleotide chemistry has enabled the development of stabilized and hydrophobically modified small interfering RNAs (hsiRNAs). This new class of oligonucleotide therapeutics shows extremely efficient self-delivery properties and supports potent and durable effects in vitro and in vivo . We have developed a high-throughput in vitro assay to identify and test hsiRNAs in primary neuronal cultures. To simply, rapidly, and accurately quantify the mRNA silencing of hundreds of hsiRNAs, we use the QuantiGene 2.0 quantitative gene expression assay. This high-throughput, 96-well plate-based assay can quantify mRNA levels directly from sample lysate. Here, we describe a method to prepare short-term cultures of mouse primary cortical neurons in a 96-well plate format for high-throughput testing of oligonucleotide therapeutics. This method supports the testing of hsiRNA libraries and the identification of potential therapeutics within just two weeks. We detail methodologies of our high throughput assay workflow from primary neuron preparation to data analysis. This method can help identify oligonucleotide therapeutics for treatment of various neurological diseases.
Review on investigations of antisense oligonucleotides with the use of mass spectrometry.
Studzińska, Sylwia
2018-01-01
Antisense oligonucleotides have been investigated as potential drugs for years. They inhibit target gene or protein expression. The present review summarizes their modifications, modes of action, and applications of liquid chromatography coupled with mass spectrometry for qualitative and quantitative analysis of these compounds. The most recent reports on a given topic were given prominence, while some early studies were reviewed in order to provide a theoretical background. The present review covers the issues of using ion-exchange chromatography, ion-pair reversed-phase high performance liquid chromatography and hydrophilic interaction chromatography for the separation of antisense oligonucleotides. The application of mass spectrometry was described with regard to the ionization type used for the determination of these potential therapeutics. Moreover, the current approaches and applications of mass spectrometry for quantitative analysis of antisense oligonucleotides and their metabolites as well as their impurities during in vitro and in vivo studies were discussed. Finally, certain conclusions and perspectives on the determination of therapeutic oligonucleotides in various samples were briefly described. Copyright © 2017 Elsevier B.V. All rights reserved.
Evolution of thermophilic DNA polymerases for the recognition and amplification of C2ʹ-modified DNA
NASA Astrophysics Data System (ADS)
Chen, Tingjian; Hongdilokkul, Narupat; Liu, Zhixia; Adhikary, Ramkrishna; Tsuen, Shujian S.; Romesberg, Floyd E.
2016-06-01
The PCR amplification of oligonucleotides enables the evolution of sequences called aptamers that bind specific targets with antibody-like affinity. However, in many applications the use of these aptamers is limited by nuclease-mediated degradation. In contrast, oligonucleotides that are modified at their sugar C2ʹ positions with methoxy or fluorine substituents are stable to nucleases, but they cannot be synthesized by natural polymerases. Here we report the development of a polymerase-evolution system and its use to evolve thermostable polymerases that efficiently interconvert C2ʹ-OMe-modified oligonucleotides and their DNA counterparts via ‘transcription’ and ‘reverse transcription’ or, more importantly, that PCR-amplify partially C2ʹ-OMe- or C2ʹ-F-modified oligonucleotides. A mechanistic analysis demonstrates that the ability to amplify the modified oligonucleotides evolved by optimizing interdomain interactions that stabilize the catalytically competent closed conformation of the polymerase. The evolved polymerases should find practical applications and the developed evolution system should be a powerful tool for tailoring polymerases to have other types of novel function.
Fessehaie, Anania; De Boer, Solke H; Lévesque, C André
2003-03-01
ABSTRACT Oligonucleotides, 16 to 24 bases long, were selected from the 3' end of the 16S gene and the 16S-23S intergenic spacer regions of bacteria pathogenic on potato, including Clavibacter michiganensis subsp. sepedonicus, Ralstonia solanacearum, and the pectolytic erwinias, including Erwinia carotovora subsp. atroseptica and carotovora and E. chrysanthemi. Oligonucleotides were designed and formatted into an array by pin spotting on nylon membranes. Genomic DNA from bacterial cultures was amplified by polymerase chain reaction using conserved ribosomal primers and labeled simultaneously with digoxigenin-dUTP. Hybridization of amplicons to the array and subsequent serological detection of digoxigenin label revealed different hybridization patterns that were distinct for each species and subspecies tested. Hybridization of amplicons generally was restricted to appropriate homologous oligonucleotides and cross-hybridization with heterologous oligonucleotides was rare. Hybridization patterns were recorded as separate gray values for each hybridized spot and revealed a consistent pattern for multiple strains of each species or subspecies isolated from diverse geographical regions. In preliminary tests, bacteria could be correctly identified and detected by hybridizing to the array amplicons from mixed cultures and inoculated potato tissue.
NASA Astrophysics Data System (ADS)
Rozenberg, M.; Shoham, G.
2009-01-01
Cooling the samples allowed us to characterize solid oligonucleotides such as dimers, trimers and pentamers of cytidine, for the first time, in the IR range of the out-of-plane bending molecular modes (1000-400 cm -1) at 20 K. Especially interesting are the narrow IR bands of the out-of-plane bending ν4 NH 2 proton mode, which are apparently invisible at room temperature. This unequivocally defined and well-resolved NH 2 bending band should provide important information on the exact chemical form and hydrogen bonding interactions of cytidine amine groups. As such, this unique IR spectroscopy is suggested as a practical analytical tool to validate and characterize synthetic DNA bases and oligonucleotides. Using an approach of this type it was found that desalted oligonucleotide samples of the same nominal composition, but which had been produced by three different manufacturers, differ significantly in their IR spectra. These data suggest that the presumably identical oligonucleotides are in fact different, at least with respect to the content and nature of their NH protons.
Rozenberg, M; Shoham, G
2009-01-01
Cooling the samples allowed us to characterize solid oligonucleotides such as dimers, trimers and pentamers of cytidine, for the first time, in the IR range of the out-of-plane bending molecular modes (1000-400 cm(-1)) at 20K. Especially interesting are the narrow IR bands of the out-of-plane bending nu(4) NH(2) proton mode, which are apparently invisible at room temperature. This unequivocally defined and well-resolved NH(2) bending band should provide important information on the exact chemical form and hydrogen bonding interactions of cytidine amine groups. As such, this unique IR spectroscopy is suggested as a practical analytical tool to validate and characterize synthetic DNA bases and oligonucleotides. Using an approach of this type it was found that desalted oligonucleotide samples of the same nominal composition, but which had been produced by three different manufacturers, differ significantly in their IR spectra. These data suggest that the presumably identical oligonucleotides are in fact different, at least with respect to the content and nature of their NH protons.
Chimeric RNase H–Competent Oligonucleotides Directed to the HIV-1 Rev Response Element
Prater, Chrissy E.; Saleh, Anthony D.; Wear, Maggie P.; Miller, Paul S.
2007-01-01
Chimeric oligo-2′-O-methylribonucleotides containing centrally located patches of contiguous 2′-deoxyribonucleotides and terminating in a nuclease resistant 3′-methylphosphonate internucleotide linkage were prepared. The oligonucleotides were targeted to the 3′-side of HIV Rev response element (RRE) stem-loop IIB RNA, which is adjacent to the high affinity Rev protein binding site and is critical to virus function. Thermal denaturation experiments showed that chimeric oligonucleotides form very stable duplexes with a complementary single-stranded RNA, and gel electrophoretic mobility shift assays (EMSA) showed that they bind with high affinity and specificity to RRE stem-loop II RNA (KD approximately 200 nM). The chimeric oligonucleotides promote RNase H-mediated hydrolysis of RRE stem-loop II RNA and have half lives exceeding 24 h when incubated in cell culture medium containing 10% fetal calf serum. One of the chimeric oligonucleotides inhibited RRE mediated expression of chloramphenicol acetyl transferase (CAT) approximately 60% at a concentration of 300 nM in HEK 293T cells co-transfected with p-RRE/CAT and p-Rev mammalian expression vectors. PMID:17566743
Javier, David J.; Castellanos-Gonzalez, Alejandro; Weigum, Shannon E.; White, A. Clinton; Richards-Kortum, Rebecca
2009-01-01
We report on a novel strategy for the detection of mRNA targets derived from Cryptosporidium parvum oocysts by the use of oligonucleotide-gold nanoparticles. Gold nanoparticles are functionalized with oligonucleotides which are complementary to unique sequences present on the heat shock protein 70 (HSP70) DNA/RNA target. The results indicate that the presence of HPS70 targets of increasing complexity causes the formation of oligonucleotide-gold nanoparticle networks which can be visually monitored via a simple colorimetric readout measured by a total internal reflection imaging setup. Furthermore, the induced expression of HSP70 mRNA in Cryptosporidium parvum oocysts via a simple heat shock process provides nonenzymatic amplification such that the HSP70 mRNA derived from as few as 5 × 103 purified C. parvum oocysts was successfully detected. Taken together, these results support the use of oligonucleotide-gold nanoparticles for the molecular diagnosis of cryptosporidiosis, offering new opportunities for the further development of point-of-care diagnostic assays with low-cost, robust reagents and simple colorimetric detection. PMID:19828740
Zhou, Hong-Chang; Gao, Yu-Hui; Shao, Sheng-Wen; Zhang, Hui; Zhang, Ting
2013-12-01
The cultured Plasmodium falciparum parasites were synchronized twice by 5% sorbitol treatment twice (8-hour window), and then incubated at 37 degrees C for 16 h. Parasites were transfected with fluorescein-labelled oligonucleotides (group A) or fluorescein-labelled oligonucleotides+Entranster-R siRNA transfection reagent (group B). After 5 h a part of parasites was evaluated by fluorescence microscopy and flow cytometry. The rest of parasites were washed with RPMI 1640 medium, and then incubated with 500 microl new medium containing 2% fresh erythrocytes for another 12 h, and detected by flow cytometry. The fluorescein-labelled oligonucleotides were localized in erythrocytes in group B, but nearly no fluorescence was observed for group A. Flow cytometry analysis indicated that the transfection efficiency of group B [(47.40 +/- 3.39)%] was higher than that of group A [(0.60 +/- 0.27)%]. In the second cell cycle, the transfection efficiency in group B was (26.85 +/- 2.90)%, while that of group A was nearly zero. The results indicated that Entranster-R siRNA transfection reagent may increase the oligonucleotides transfection efficiency.
Safety of antisense oligonucleotide and siRNA-based therapeutics.
Chi, Xuan; Gatti, Philip; Papoian, Thomas
2017-05-01
Oligonucleotide-based therapy is an active area of drug development designed to treat a variety of gene-specific diseases. Two of the more promising platforms are the antisense oligonucleotides (ASOs) and short interfering RNAs (siRNAs), both of which are often directed against similar targets. In light of recent reports on clinical trials of severe thrombocytopenia with two different ASO drugs and increased peripheral neuropathy with an siRNA drug, we compared and contrasted the specific safety characteristics of these two classes of oligonucleotide therapeutic. The objectives were to assess factors that could contribute to the specific toxicities observed with these two classes of promising drugs, and get a better understanding of the potential mechanism(s) responsible for these rare, but serious, adverse events. Published by Elsevier Ltd.
Incorporation of terminal phosphorothioates into oligonucleotides.
Alefelder, S; Patel, B K; Eckstein, F
1998-01-01
Considerable effort has been directed towards studying the structure and function of oligonucleotides and several approaches rely on the attachment of reporter groups to oligonucleotides. We report here the introduction of 3'- and 5'-terminal phosphorothioates into heptameric oligonucleotides and their post-synthetic modification with several reporter groups. The synthesis of terminal phosphorothioates is based on the coupling of a ribonucleoside phosphoramidite at the first or last nucleotide, respectively, which, after sulphurization, is removed by sequential oxidation of the vicinal hydroxyl groups and then beta-elimination. Product formation is of the order of 95%. The ratio of phosphorothioate- versus phosphate-terminated oligodeoxynucleotides as analysed by electrophoresis on a Hg2+gel is in general 85/15. Examples for the reactivity of the terminal phosphorothioates for conjugation with cholesterol, bimane and for sulphydryl exchange are described. PMID:9776763
Targeted self-assembly of functionalized carbon nanotubes on tumors
Scheinberg, David A.; McDevitt, Michael R.; Villa, Carlos H.; Mulvey, J. Justin
2018-05-22
Provided herein are methods for delivering a molecule in situ to a cell and for treating a cancer via the in situ delivery. The methods comprise contacting or administering to the cell, as two separate components, a morpholino oligonucleotide comprising a targeting moiety followed by a single wall nanotube construct comprising second morpholino oligonucleotides complementary to the first morpholino oligonucleotides and one or both of a therapeutic or diagnostic payload molecule linked to the single wall nanotube construct. Upon self-assembly of a single wall nanotube complex via hybridization of the first morpholino and second complementary morpholino oligonucleotides at the cell, the payload molecule is delivered. Also provided is the two component self-assembly single wall nanotube system and the single wall nanotube construct comprising the second component.
Su, Xiaoye; Liang, Ruiting; Stolee, Jessica A
2018-06-05
Oligonucleotides are being researched and developed as potential drug candidates for the treatment of a broad spectrum of diseases. The characterization of antisense oligonucleotide (ASO) impurities caused by base mutations (e.g. deamination) which are closely related to the target ASO is a significant analytical challenge. Herein, we describe a novel one-step method, utilizing a strategy that combines fluorescence-ON detection with competitive hybridization, to achieve single base mutation quantitation in extensively modified synthetic ASOs. Given that this method is highly specific and sensitive (LoQ = 4 nM), we envision that it will find utility for screening other impurities as well as sequencing modified oligonucleotides. Copyright © 2018 Elsevier B.V. All rights reserved.
Rapid and accurate synthesis of TALE genes from synthetic oligonucleotides.
Wang, Fenghua; Zhang, Hefei; Gao, Jingxia; Chen, Fengjiao; Chen, Sijie; Zhang, Cuizhen; Peng, Gang
2016-01-01
Custom synthesis of transcription activator-like effector (TALE) genes has relied upon plasmid libraries of pre-fabricated TALE-repeat monomers or oligomers. Here we describe a novel synthesis method that directly incorporates annealed synthetic oligonucleotides into the TALE-repeat units. Our approach utilizes iterative sets of oligonucleotides and a translational frame check strategy to ensure the high efficiency and accuracy of TALE-gene synthesis. TALE arrays of more than 20 repeats can be constructed, and the majority of the synthesized constructs have perfect sequences. In addition, this novel oligonucleotide-based method can readily accommodate design changes to the TALE repeats. We demonstrated an increased gene targeting efficiency against a genomic site containing a potentially methylated cytosine by incorporating non-conventional repeat variable di-residue (RVD) sequences.
Cross reactive arrays of three-way junction sensors for steroid determination
NASA Technical Reports Server (NTRS)
Stojanovic, Milan N. (Inventor); Nikic, Dragan B. (Inventor); Landry, Donald (Inventor)
2008-01-01
This invention provides analyte sensitive oligonucleotide compositions for detecting and analyzing analytes in solution, including complex solutions using cross reactive arrays of analyte sensitive oligonucleotide compositions.
Burki, Umar; Straub, Volker
2017-01-01
Determining the concentration of oligonucleotide in biological samples such as tissue lysate and serum is essential for determining the biodistribution and pharmacokinetic profile, respectively. ELISA-based assays have shown far greater sensitivities compared to other methods such as HPLC and LC/MS. Here, we describe a novel ultrasensitive hybridization-based ELISA method for quantitating morpholino oligonucleotides in mouse tissue lysate and serum samples. The assay has a linear detection range of 5-250 pM (R2 > 0.99).
van Gijlswijk, R P; Wiegant, J; Vervenne, R; Lasan, R; Tanke, H J; Raap, A K
1996-01-01
We present a sensitive and rapid fluorescence in situ hybridization (FISH) strategy for detecting chromosome-specific repeat sequences. It uses horseradish peroxidase (HRP)-labeled oligonucleotide sequences in combination with fluorescent tyramide-based detection. After in situ hybridization, the HRP conjugated to the oligonucleotide probe is used to deposit fluorescently labeled tyramide molecules at the site of hybridization. The method features full chemical synthesis of probes, strong FISH signals, and short processing periods, as well as multicolor capabilities.
2013-03-01
oligonucleotide-based drug approaches (better than ribozymes, antisense oligonucleotides ( ASO ), or microRNAs). (4) To accomplish these objectives, we...negative control scrambled ASO (designated NC). The combination of siRNAs T1 and R1 produced a knockdown of ~80% of TGFb1 protein in the conditioned...sequences (antisense oligonucleotides, ASOs ) into rabbit corneal cells and found that technique was very effective in delivering ASOs into the stroma and
2012-10-01
selective of all gene-targeted, oligonucleotide-based drug approaches (better than ribozymes, antisense oligonucleotides ( ASO ), or microRNAs).(4) We will...respect to a scrambled siRNA control. For the migration assay, a circular region in the middle of the well was removed using a gel removal solution...oligonucleotides, ASOs ) into rabbit corneal cells and found that technique was very effective in delivering ASOs into the stroma and even into the endothelial cell
Therapeutic Oligonucleotides Targeting Liver Disease: TTR Amyloidosis.
Niemietz, Christoph; Chandhok, Gursimran; Schmidt, Hartmut
2015-09-30
The liver has become an increasingly interesting target for oligonucleotide therapy. Mutations of the gene encoding transthyretin (TTR), expressed in vast amounts by the liver, result in a complex degenerative disease, termed familial amyloid polyneuropathy (FAP). Misfolded variants of TTR are linked to the establishment of extracellular protein deposition in various tissues, including the heart and the peripheral nervous system. Recent progress in the chemistry and formulation of antisense (ASO) and small interfering RNA (siRNA) designed for a knockdown of TTR mRNA in the liver has allowed to address the issue of gene-specific molecular therapy in a clinical setting of FAP. The two therapeutic oligonucleotides bind to RNA in a sequence specific manner but exploit different mechanisms. Here we describe major developments that have led to the advent of therapeutic oligonucleotides for treatment of TTR-related disease.
Current progress on aptamer-targeted oligonucleotide therapeutics
Dassie, Justin P; Giangrande, Paloma H
2014-01-01
Exploiting the power of the RNAi pathway through the use of therapeutic siRNA drugs has remarkable potential for treating a vast array of human disease conditions. However, difficulties in delivery of these and similar nucleic acid-based pharmacological agents to appropriate organs or tissues, remains a major impediment to their broad clinical application. Synthetic nucleic acid ligands (aptamers) have emerged as effective delivery vehicles for therapeutic oligonucleotides, including siRNAs. In this review, we summarize recent attractive developments in creatively employing cell-internalizing aptamers to deliver therapeutic oligonucleotides (e.g., siRNAs, miRNAs, anti-miRs and antisense oligos) to target cells. We also discuss advancements in aptamer-siRNA chimera technology, as well as, aptamer-functionalized nanoparticles for siRNA delivery. In addition, the challenges and future prospects of aptamer-targeted oligonucleotide drugs for clinical translation are further highlighted. PMID:24304250
Alsop, Eric B; Raymond, Jason
2013-01-01
Oligonucleotide signatures, especially tetranucleotide signatures, have been used as method for homology binning by exploiting an organism's inherent biases towards the use of specific oligonucleotide words. Tetranucleotide signatures have been especially useful in environmental metagenomics samples as many of these samples contain organisms from poorly classified phyla which cannot be easily identified using traditional homology methods, including NCBI BLAST. This study examines oligonucleotide signatures across 1,424 completed genomes from across the tree of life, substantially expanding upon previous work. A comprehensive analysis of mononucleotide through nonanucleotide word lengths suggests that longer word lengths substantially improve the classification of DNA fragments across a range of sizes of relevance to high throughput sequencing. We find that, at present, heptanucleotide signatures represent an optimal balance between prediction accuracy and computational time for resolving taxonomy using both genomic and metagenomic fragments. We directly compare the ability of tetranucleotide and heptanucleotide world lengths (tetranucleotide signatures are the current standard for oligonucleotide word usage analyses) for taxonomic binning of metagenome reads. We present evidence that heptanucleotide word lengths consistently provide more taxonomic resolving power, particularly in distinguishing between closely related organisms that are often present in metagenomic samples. This implies that longer oligonucleotide word lengths should replace tetranucleotide signatures for most analyses. Finally, we show that the application of longer word lengths to metagenomic datasets leads to more accurate taxonomic binning of DNA scaffolds and have the potential to substantially improve taxonomic assignment and assembly of metagenomic data.
Murgha, Yusuf; Beliveau, Brian; Semrau, Kassandra; Schwartz, Donald; Wu, Chao-Ting; Gulari, Erdogan; Rouillard, Jean-Marie
2015-06-01
Oligonucleotide microarrays allow the production of complex custom oligonucleotide libraries for nucleic acid detection-based applications such as fluorescence in situ hybridization (FISH). We have developed a PCR-free method to make single-stranded DNA (ssDNA) fluorescent probes through an intermediate RNA library. A double-stranded oligonucleotide library is amplified by transcription to create an RNA library. Next, dye- or hapten-conjugate primers are used to reverse transcribe the RNA to produce a dye-labeled cDNA library. Finally the RNA is hydrolyzed under alkaline conditions to obtain the single-stranded fluorescent probes library. Starting from unique oligonucleotide library constructs, we present two methods to produce single-stranded probe libraries. The two methods differ in the type of reverse transcription (RT) primer, the incorporation of fluorescent dye, and the purification of fluorescent probes. The first method employs dye-labeled reverse transcription primers to produce multiple differentially single-labeled probe subsets from one microarray library. The fluorescent probes are purified from excess primers by oligonucleotide-bead capture. The second method uses an RNA:DNA chimeric primer and amino-modified nucleotides to produce amino-allyl probes. The excess primers and RNA are hydrolyzed under alkaline conditions, followed by probe purification and labeling with amino-reactive dyes. The fluorescent probes created by the combination of transcription and reverse transcription can be used for FISH and to detect any RNA and DNA targets via hybridization.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Müller, Patrick; Rößler, Jens; Schwarz-Finsterle, Jutta
Recently, advantages concerning targeting specificity of PCR constructed oligonucleotide FISH probes in contrast to established FISH probes, e.g. BAC clones, have been demonstrated. These techniques, however, are still using labelling protocols with DNA denaturing steps applying harsh heat treatment with or without further denaturing chemical agents. COMBO-FISH (COMBinatorial Oligonucleotide FISH) allows the design of specific oligonucleotide probe combinations in silico. Thus, being independent from primer libraries or PCR laboratory conditions, the probe sequences extracted by computer sequence data base search can also be synthesized as single stranded PNA-probes (Peptide Nucleic Acid probes). Gene targets can be specifically labelled with atmore » least about 20 PNA-probes obtaining visibly background free specimens. By using appropriately designed triplex forming oligonucleotides, the denaturing procedures can completely be omitted. These results reveal a significant step towards oligonucleotide-FISH maintaining the 3D-nanostructure and even the viability of the cell target. The method is demonstrated with the detection of Her2/neu and GRB7 genes, which are indicators in breast cancer diagnosis and therapy. - Highlights: • Denaturation free protocols preserve 3D architecture of chromosomes and nuclei. • Labelling sets are determined in silico for duplex and triplex binding. • Probes are produced chemically with freely chosen backbones and base variants. • Peptide nucleic acid backbones reduce hindering charge interactions. • Intercalating side chains stabilize binding of short oligonucleotides.« less
Comparison of small molecules and oligonucleotides that target a toxic, non-coding RNA.
Costales, Matthew G; Rzuczek, Suzanne G; Disney, Matthew D
2016-06-01
Potential RNA targets for chemical probes and therapeutic modalities are pervasive in the transcriptome. Oligonucleotide-based therapeutics are commonly used to target RNA sequence. Small molecules are emerging as a modality to target RNA structures selectively, but their development is still in its infancy. In this work, we compare the activity of oligonucleotides and several classes of small molecules that target the non-coding r(CCUG) repeat expansion (r(CCUG)(exp)) that causes myotonic dystrophy type 2 (DM2), an incurable disease that is the second-most common cause of adult onset muscular dystrophy. Small molecule types investigated include monomers, dimers, and multivalent compounds synthesized on-site by using RNA-templated click chemistry. Oligonucleotides investigated include phosphorothioates that cleave their target and vivo-morpholinos that modulate target RNA activity via binding. We show that compounds assembled on-site that recognize structure have the highest potencies amongst small molecules and are similar in potency to a vivo-morpholino modified oligonucleotide that targets sequence. These studies are likely to impact the design of therapeutic modalities targeting other repeats expansions that cause fragile X syndrome and amyotrophic lateral sclerosis, for example. Copyright © 2016. Published by Elsevier Ltd.
Connolly, B A; Rider, P
1985-01-01
Oligonucleotides containing a free sulphydryl group at their 5'-termini have been synthesised and further derivatised with thiol specific probes. The nucleotide sequence required is prepared using standard solid phase phosphoramidite techniques and an extra round of synthesis is then performed using the S-triphenylmethyl O-methoxymorpholinophosphite derivatives of 2-mercaptoethanol, 3-mercaptopropan (1) ol or 6-mercaptohexan (1) ol. After cleavage from the resin and removal of the phosphate and base protecting groups, this yields an oligonucleotide containing an S-triphenylmethyl group attached to the 5'-phosphate group via a two, three or six carbon chain. The triphenylmethyl group can be readily removed with silver nitrate to give the free thiol. With the three and six carbon chain oligonucleotides, this thiol can be used, at pH 8, for the attachment of thiol specific probes as illustrated by the reaction with fluorescent conjugates of iodoacetates and maleiimides. However, oligonucleotides containing a thiol attached to the 5'-phosphate group via a two carbon chain are unstable at pH 8 decomposing to the free 5'-phosphate and so are unsuitable for further derivatisation. PMID:4011448
Müller, Patrick; Rößler, Jens; Schwarz-Finsterle, Jutta; Schmitt, Eberhard; Hausmann, Michael
2016-07-01
Recently, advantages concerning targeting specificity of PCR constructed oligonucleotide FISH probes in contrast to established FISH probes, e.g. BAC clones, have been demonstrated. These techniques, however, are still using labelling protocols with DNA denaturing steps applying harsh heat treatment with or without further denaturing chemical agents. COMBO-FISH (COMBinatorial Oligonucleotide FISH) allows the design of specific oligonucleotide probe combinations in silico. Thus, being independent from primer libraries or PCR laboratory conditions, the probe sequences extracted by computer sequence data base search can also be synthesized as single stranded PNA-probes (Peptide Nucleic Acid probes) or TINA-DNA (Twisted Intercalating Nucleic Acids). Gene targets can be specifically labelled with at least about 20 probes obtaining visibly background free specimens. By using appropriately designed triplex forming oligonucleotides, the denaturing procedures can completely be omitted. These results reveal a significant step towards oligonucleotide-FISH maintaining the 3d-nanostructure and even the viability of the cell target. The method is demonstrated with the detection of Her2/neu and GRB7 genes, which are indicators in breast cancer diagnosis and therapy. Copyright © 2016. Published by Elsevier Inc.
Green, M M; LeBoeuf, R D; Churchill, P F
2000-01-01
Tetrahymena vorax (T. vorax) is an indigenous fresh water protozoan with the natural biological potential to maintain a specific aquatic microbial flora by ingesting and eliminating specific microorganism. To investigate the molecular mechanisms controlling Tetrahymena vorax (T. vorax) cellular differentiation from a small-mouth vegetative cell to a voracious large-mouth carnivore capable of ingesting prey ciliates and bacteria from aquatic environments, we use DNA subtraction and gene discovery techniques to identify and isolate T. vorax differentiation-specific genes. The physiological necessity for one newly discovered gene, SUBII-TG, was determined in vivo using an antisense oligonucleotide directed against the 5' SUBII-TG DNA sequence. The barriers to delivering antisense oligonucleotides to the cytoplasm of T. vorax were circumvented by employing a new but simple procedure of processing the oligonucleotide with the differentiation stimulus, stomatin. In these studies, the antisense oligonucleotide down-regulated SUBII-TG mRNA expression, and blocked differentiation and ingestion of prey ciliates. The ability to down-regulate SUBII-TG expression with the antisense oligonucleotide suggests that the molecular mechanisms controlling the natural biological activities of T. vorax can be manipulated to further study its cellular differentiation and potential as a biocontrol microorganism.
Stable Gene Targeting in Human Cells Using Single-Strand Oligonucleotides with Modified Bases
Rios, Xavier; Briggs, Adrian W.; Christodoulou, Danos; Gorham, Josh M.; Seidman, Jonathan G.; Church, George M.
2012-01-01
Recent advances allow multiplexed genome engineering in E. coli, employing easily designed oligonucleotides to edit multiple loci simultaneously. A similar technology in human cells would greatly expedite functional genomics, both by enhancing our ability to test how individual variants such as single nucleotide polymorphisms (SNPs) are related to specific phenotypes, and potentially allowing simultaneous mutation of multiple loci. However, oligo-mediated targeting of human cells is currently limited by low targeting efficiencies and low survival of modified cells. Using a HeLa-based EGFP-rescue reporter system we show that use of modified base analogs can increase targeting efficiency, in part by avoiding the mismatch repair machinery. We investigate the effects of oligonucleotide toxicity and find a strong correlation between the number of phosphorothioate bonds and toxicity. Stably EGFP-corrected cells were generated at a frequency of ~0.05% with an optimized oligonucleotide design combining modified bases and reduced number of phosphorothioate bonds. We provide evidence from comparative RNA-seq analysis suggesting cellular immunity induced by the oligonucleotides might contribute to the low viability of oligo-corrected cells. Further optimization of this method should allow rapid and scalable genome engineering in human cells. PMID:22615794
Hammond, Suzan M; McClorey, Graham; Nordin, Joel Z; Godfrey, Caroline; Stenler, Sofia; Lennox, Kim A; Smith, C I Edvard; Jacobi, Ashley M; Varela, Miguel A; Lee, Yi; Behlke, Mark A; Wood, Matthew J A; Andaloussi, Samir E L
2014-11-25
Splice switching oligonucleotides (SSOs) induce alternative splicing of pre-mRNA and typically employ chemical modifications to increase nuclease resistance and binding affinity to target pre-mRNA. Here we describe a new SSO non-base modifier (a naphthyl-azo group, "ZEN™") to direct exon exclusion in mutant dystrophin pre-mRNA to generate functional dystrophin protein. The ZEN modifier is placed near the ends of a 2'-O-methyl (2'OMe) oligonucleotide, increasing melting temperature and potency over unmodified 2'OMe oligonucleotides. In cultured H2K cells, a ZEN-modified 2'OMe phosphorothioate (PS) oligonucleotide delivered by lipid transfection greatly enhanced dystrophin exon skipping over the same 2'OMePS SSO lacking ZEN. However, when tested using free gymnotic uptake in vitro and following systemic delivery in vivo in dystrophin deficient mdx mice, the same ZEN-modified SSO failed to enhance potency. Importantly, we show for the first time that in vivo activity of anionic SSOs is modelled in vitro only when using gymnotic delivery. ZEN is thus a novel modifier that enhances activity of SSOs in vitro but will require improved delivery methods before its in vivo clinical potential can be realized.
Oligonucleotides as antivirals: dream or realistic perspective?
Van Aerschot, Arthur
2006-09-01
Many reports have been published on antiviral activity of synthetic oligonucleotides, targeted to act either by a true antisense effect or via non-sequence specific interactions. This short review will try to evaluate the current status of the field by focusing on the effects as reported for inhibition of either HSV-1, HCMV or HIV-1. Following an introduction with a historical background and a brief discussion on the different types of constructs and mechanisms of action, the therapeutic potential of antisense oligonucleotides as antivirals, as well as possible pitfalls upon their evaluation will be discussed.
CD studies on ribonuclease A - oligonucleotides interactions.
White, M D; Keren-Zur, M; Lapidot, Y
1977-01-01
The interaction of ApU, Aps4U, Aps4Up, ApAps4Up and Gps4U with RNase A was studied by CD difference spectroscopy. The use of 4-thiouridine (s4U) containing oligonucleotides enables to distinguish between the interaction of the different components of the ligand with the enzyme. The mode of binding of the oligonucleotides to the enzyme is described. From this mode of binding it is explained why Aps4U, for example, inhibits RNase A, while s4UpA serves as a substrate. PMID:866194
Rapid purification of circular DNA by triplex-mediated affinity capture
Ji, Huamin; Smith, Lloyd M.
1997-01-01
A single-step capture of a target supercoiled double-stranded DNA molecule is accomplished by forming a local triple-helix among two strands of the supercoiled circular DNA and an oligonucleotide probe. The oligonucleotide is bound to an immobilizing support which facilitates the immobilization and purification of target DNA molecules. Non-target DNA molecules and other contaminating cellular material are easily removed by washing. The triple-helical structure is destabilized by raising the pH, leaving purified target DNA in the supernatant and reusable affinity capture oligonucleotide secured to the immobilizing support.
Mirzabekov, Andrei; Guschin, Dmitry Y.; Chik, Valentine; Drobyshev, Aleksei; Fotin, Alexander; Yershov, Gennadiy; Lysov, Yuri
2002-01-01
This invention relates to using customized oligonucleotide microchips as biosensors for the detection and identification of nucleic acids specific for different genes, organisms and/or individuals in the environment, in food and in biological samples. The microchips are designed to convert multiple bits of genetic information into simpler patterns of signals that are interpreted as a unit. Because of an improved method of hybridizing oligonucleotides from samples to microchips, microchips are reusable and transportable. For field study, portable laser or bar code scanners are suitable.
Functional regulation of RNA-induced silencing complex by photoreactive oligonucleotides.
Matsuyama, Yohei; Yamayoshi, Asako; Kobori, Akio; Murakami, Akira
2014-02-01
We developed a novel method for regulation of RISC function by photoreactive oligonucleotides (Ps-Oligo) containing 2'-O-psoralenylmethoxyethyl adenosine (Aps). We observed that inhibitory effects of Ps-Oligos on RISC function were enhanced by UV-irradiation compared with 2'-O-methyl-oligonucleotide without Aps. These results suggest Ps-Oligo inhibited RISC function by cross-linking effect, and we propose that the concept described in this report may be promising and applicable one to regulate the small RNA-mediated post-transcriptional regulation. Crown Copyright © 2013. Published by Elsevier Ltd. All rights reserved.
Oligonucleotide Array for Identification and Detection of Pythium Species†
Tambong, J. T.; de Cock, A. W. A. M.; Tinker, N. A.; Lévesque, C. A.
2006-01-01
A DNA array containing 172 oligonucleotides complementary to specific diagnostic regions of internal transcribed spacers (ITS) of more than 100 species was developed for identification and detection of Pythium species. All of the species studied, with the exception of Pythium ostracodes, exhibited a positive hybridization reaction with at least one corresponding species-specific oligonucleotide. Hybridization patterns were distinct for each species. The array hybridization patterns included cluster-specific oligonucleotides that facilitated the recognition of species, including new ones, belonging to groups such as those producing filamentous or globose sporangia. BLAST analyses against 500 publicly available Pythium sequences in GenBank confirmed that species-specific oligonucleotides were unique to all of the available strains of each species, of which there were numerous economically important ones. GenBank entries of newly described species that are not putative synonyms showed no homology to sequences of the spotted species-specific oligonucleotides, but most new species did match some of the cluster-specific oligonucleotides. Further verification of the specificity of the DNA array was done with 50 additional Pythium isolates obtained by soil dilution plating. The hybridization patterns obtained were consistent with the identification of these isolates based on morphology and ITS sequence analyses. In another blind test, total DNA of the same soil samples was amplified and hybridized on the array, and the results were compared to those of 130 Pythium isolates obtained by soil dilution plating and root baiting. The 13 species detected by the DNA array corresponded to the isolates obtained by a combination of soil dilution plating and baiting, except for one new species that was not represented on the array. We conclude that the reported DNA array is a reliable tool for identification and detection of the majority of Pythium species in environmental samples. Simultaneous detection and identification of multiple species of soilborne pathogens such as Pythium species could be a major step forward for epidemiological and ecological studies. PMID:16597974
Echigoya, Yusuke; Mouly, Vincent; Garcia, Luis; Yokota, Toshifumi; Duddy, William
2015-01-01
The use of antisense ‘splice-switching’ oligonucleotides to induce exon skipping represents a potential therapeutic approach to various human genetic diseases. It has achieved greatest maturity in exon skipping of the dystrophin transcript in Duchenne muscular dystrophy (DMD), for which several clinical trials are completed or ongoing, and a large body of data exists describing tested oligonucleotides and their efficacy. The rational design of an exon skipping oligonucleotide involves the choice of an antisense sequence, usually between 15 and 32 nucleotides, targeting the exon that is to be skipped. Although parameters describing the target site can be computationally estimated and several have been identified to correlate with efficacy, methods to predict efficacy are limited. Here, an in silico pre-screening approach is proposed, based on predictive statistical modelling. Previous DMD data were compiled together and, for each oligonucleotide, some 60 descriptors were considered. Statistical modelling approaches were applied to derive algorithms that predict exon skipping for a given target site. We confirmed (1) the binding energetics of the oligonucleotide to the RNA, and (2) the distance in bases of the target site from the splice acceptor site, as the two most predictive parameters, and we included these and several other parameters (while discounting many) into an in silico screening process, based on their capacity to predict high or low efficacy in either phosphorodiamidate morpholino oligomers (89% correctly predicted) and/or 2’O Methyl RNA oligonucleotides (76% correctly predicted). Predictions correlated strongly with in vitro testing for sixteen de novo PMO sequences targeting various positions on DMD exons 44 (R2 0.89) and 53 (R2 0.89), one of which represents a potential novel candidate for clinical trials. We provide these algorithms together with a computational tool that facilitates screening to predict exon skipping efficacy at each position of a target exon. PMID:25816009
Brotons, Ariadna; Mas, Luis Alcaraz; Metters, Jonathan P; Banks, Craig E; Iniesta, Jesús
2013-09-21
Improvements in analytical methods for the determination and quantification of methylcytosine in DNA are vital since it has the potential to be used as a biomarker to detect different diseases in the first stage such as in the case of carcinomas and sterility. In this work we utilized screen printed graphite electrodes (SPGE) for studying the electrochemical response of all free DNA bases, methylcytosine and short oligonucleotides by cyclic voltammetry (CV) and square wave voltammetry (SWV). CV and SWV responses of free DNA bases and methylcytosine have been investigated by using SPGE platforms and the feasibility of detecting and quantifying cytosine and methylcytosine as free DNA moieties has been evaluated as a function of pH, concentration and the presence of the other free DNA bases in solution simultaneously. Repeatability of using SWV has been performed for the electrochemical behavior of both 250 μM cytosine and 250 μM methylcytosine in the presence of 25 μM guanine, with coefficient of variations of 6.9% and 2.6% respectively based upon peak current (N = 5). Six-mer oligonucleotides with a sequence 5'-XXXCGC-3', where the XXX motif corresponds to TTT, TTA, TAA and AAA have been performed using SWV in 0.1 M acetate buffer pH 5.0 to explore how the DNA base position effects the electrooxidation of guanine and cytosine into the oligonucleotide. Furthermore SWV comparisons of the electrooxidation of the oligonucleotides 5'-CGCGCG-3' and its methylated 5'-mCGmCGmCG-3' have been performed with concentrations in acetate buffer solutions, and the interaction of both oligonucleotides with the graphitic surface of the SPGE has been demonstrated by fitting well-known adsorption models such as Freundlich and Langmuir kinetics according to the SWV current response of guanine, cytosine and methylcytosine into the oligonucleotide.
Non-Enzymatic Detection of Bacterial Genomic DNA Using the Bio-Barcode Assay
Hill, Haley D.; Vega, Rafael A.; Mirkin, Chad A.
2011-01-01
The detection of bacterial genomic DNA through a non-enzymatic nanomaterials based amplification method, the bio-barcode assay, is reported. The assay utilizes oligonucleotide functionalized magnetic microparticles to capture the target of interest from the sample. A critical step in the new assay involves the use of blocking oligonucleotides during heat denaturation of the double stranded DNA. These blockers bind to specific regions of the target DNA upon cooling, and prevent the duplex DNA from re-hybridizing, which allows the particle probes to bind. Following target isolation using the magnetic particles, oligonucleotide functionalized gold nanoparticles act as target recognition agents. The oligonucleotides on the nanoparticle (barcodes) act as amplification surrogates. The barcodes are then detected using the Scanometric method. The limit of detection for this assay was determined to be 2.5 femtomolar, and this is the first demonstration of a barcode type assay for the detection of double stranded, genomic DNA. PMID:17927207
Persistence and breakdown of strand symmetry in the human genome.
Zhang, Shang-Hong
2015-04-07
Afreixo, V., Bastos, C.A.C., Garcia, S.P., Rodrigues, J.M.O.S., Pinho, A.J., Ferreira, P.J.S.G., 2013. The breakdown of the word symmetry in the human genome. J. Theor. Biol. 335, 153-159 analyzed the word symmetry (strand symmetry or the second parity rule) in the human genome. They concluded that strand symmetry holds for oligonucleotides up to 6 nt and is no longer statistically significant for oligonucleotides of higher orders. However, although they provided some new results for the issue, their interpretation would not be fully justified. Also, their conclusion needs to be further evaluated. Further analysis of their results, especially those of equivalence tests and word symmetry distance, shows that strand symmetry would persist for higher-order oligonucleotides up to 9 nt in the human genome, at least for its overall frequency framework (oligonucleotide frequency pattern). Copyright © 2015 Elsevier Ltd. All rights reserved.
Use of continuous/contiguous stacking hybridization as a diagnostic tool
Mirzabekov, Andrei Darievich; Yershov, Gennadiy Moseyevich; Kirillov, Eugene Vladislavovich; Parinov, Sergei Valeryevich; Barski, Victor Evgenievich; Lysov, Yuri Petrovich
1999-01-01
A method for detecting disease-associated alleles in patient genetic material is provided whereby a first group of oligonucleotide molecules, synthesized to compliment base sequences of the disease associated alleles is immobilized on a predetermined position on a substrate, and then contacted with patient genetic material to form duplexes. The duplexes are then contacted with a second group of oligonucleotide molecules which are synthesized to extend the predetermined length of the oligonucleotide molecules of the first group, and where each of the oligonucleotide molecules of the second group are tagged and either incorporate universal bases or a mixture of guanine, cytosine, thymine, and adenine, or complementary nucleotide strands that are tagged with a different fluorochrome which radiates light at a predetermined wavelength. The treated substrate is then washed and the light patterns radiating therefrom are compared with predetermined light patterns of various diseases that were prepared on identical substrates.
Use of continuous/contiguous stacking hybridization as a diagnostic tool
Mirzabekov, A.D.; Yershov, G.M.; Kirillov, E.V.; Parinov, S.V.; Barski, V.E.; Lysov, Y.P.
1999-06-01
A method for detecting disease-associated alleles in patient genetic material is provided whereby a first group of oligonucleotide molecules, synthesized to compliment base sequences of the disease associated alleles is immobilized on a predetermined position on a substrate, and then contacted with patient genetic material to form duplexes. The duplexes are then contacted with a second group of oligonucleotide molecules which are synthesized to extend the predetermined length of the oligonucleotide molecules of the first group, and where each of the oligonucleotide molecules of the second group are tagged and either incorporate universal bases or a mixture of guanine, cytosine, thymine, and adenine, or complementary nucleotide strands that are tagged with a different fluorochrome which radiates light at a predetermined wavelength. The treated substrate is then washed and the light patterns radiating therefrom are compared with predetermined light patterns of various diseases that were prepared on identical substrates. 5 figs.
Narihiro, Takashi; Sekiguchi, Yuji
2011-01-01
Summary For the identification and quantification of methanogenic archaea (methanogens) in environmental samples, various oligonucleotide probes/primers targeting phylogenetic markers of methanogens, such as 16S rRNA, 16S rRNA gene and the gene for the α‐subunit of methyl coenzyme M reductase (mcrA), have been extensively developed and characterized experimentally. These oligonucleotides were designed to resolve different groups of methanogens at different taxonomic levels, and have been widely used as hybridization probes or polymerase chain reaction primers for membrane hybridization, fluorescence in situ hybridization, rRNA cleavage method, gene cloning, DNA microarray and quantitative polymerase chain reaction for studies in environmental and determinative microbiology. In this review, we present a comprehensive list of such oligonucleotide probes/primers, which enable us to determine methanogen populations in an environment quantitatively and hierarchically, with examples of the practical applications of the probes and primers. PMID:21375721
Hwang, Byungjin; Bang, Duhee
2016-01-01
All synthetic DNA materials require prior programming of the building blocks of the oligonucleotide sequences. The development of a programmable microarray platform provides cost-effective and time-efficient solutions in the field of data storage using DNA. However, the scalability of the synthesis is not on par with the accelerating sequencing capacity. Here, we report on a new paradigm of generating genetic material (writing) using a degenerate oligonucleotide and optomechanical retrieval method that leverages sequencing (reading) throughput to generate the desired number of oligonucleotides. As a proof of concept, we demonstrate the feasibility of our concept in digital information storage in DNA. In simulation, the ability to store data is expected to exponentially increase with increase in degenerate space. The present study highlights the major framework change in conventional DNA writing paradigm as a sequencer itself can become a potential source of making genetic materials. PMID:27876825
Kim, Jaeseung; Kreller, Cortney R.; Greenberg, Marc M.
2005-01-01
The C4′-oxidized abasic site (C4-AP) is produced by a variety of DNA damaging agents. This alkali labile lesion can exist in up to four diastereomeric cyclic forms, in addition to the acyclic keto-aldehyde. Synthetic oligonucleotides containing the lesion were prepared from a stable photochemical precursor. Chemical integrity of the lesion containing oligonucleotides was probed using phosphodiesterase lability. Analysis of the 3′,5′-phosphate diester of the monomeric lesion released from single diastereomers of photolabile precursors by 1H NMR indicates that isomerization of the hemiacetal and/or hemiketal is rapid. The syntheses and characterization of oligonucleotides containing configurationally stable analogues of C4-AP, which serve as mechanistic probes for deciphering the structural basis of the biochemical and biological effects of the C4′-oxidized abasic lesion, are also described. PMID:16277338
Hwang, Byungjin; Bang, Duhee
2016-11-23
All synthetic DNA materials require prior programming of the building blocks of the oligonucleotide sequences. The development of a programmable microarray platform provides cost-effective and time-efficient solutions in the field of data storage using DNA. However, the scalability of the synthesis is not on par with the accelerating sequencing capacity. Here, we report on a new paradigm of generating genetic material (writing) using a degenerate oligonucleotide and optomechanical retrieval method that leverages sequencing (reading) throughput to generate the desired number of oligonucleotides. As a proof of concept, we demonstrate the feasibility of our concept in digital information storage in DNA. In simulation, the ability to store data is expected to exponentially increase with increase in degenerate space. The present study highlights the major framework change in conventional DNA writing paradigm as a sequencer itself can become a potential source of making genetic materials.
Silver Nanoparticle Oligonucleotide Conjugates Based on DNA with Triple Cyclic Disulfide Moieties
Lee, Jae-Seung; Lytton-Jean, Abigail K. R.; Hurst, Sarah J.; Mirkin, Chad A.
2011-01-01
We report a new strategy for preparing silver nanoparticle oligonucleotide conjugates that are based upon DNA with cyclic disulfide-anchoring groups. These particles are extremely stable and can withstand NaCl concentrations up to 1.0 M. When silver nanoparticles functionalized with complementary sequences are combined, they assemble to form DNA-linked nanoparticle networks. This assembly process is reversible with heating and is associated with a red-shifting of the particle surface plasmon resonance and a concomitant color change from yellow to pale red. Analogous to the oligonucleotide-functionalized gold nanoparticles, these particles also exhibit highly cooperative binding properties with extremely sharp melting transitions. This work is an important step towards being able to use silver nanoparticle oligonucleotide conjugates for a variety of purposes, including molecular diagnostic labels, synthons in programmable materials synthesis approaches, and functional components for nanoelectronic and plasmonic devices. PMID:17571909
Secondary binding sites for heavily modified triplex forming oligonucleotides
Cardew, Antonia S.; Brown, Tom; Fox, Keith R.
2012-01-01
In order to enhance DNA triple helix stability synthetic oligonucleotides have been developed that bear amino groups on the sugar or base. One of the most effective of these is bis-amino-U (B), which possesses 5-propargylamino and 2′-aminoethoxy modifications. Inclusion of this modified nucleotide not only greatly enhances triplex stability, but also increases the affinity for related sequences. We have used a restriction enzyme protection, selection and amplification assay (REPSA) to isolate sequences that are bound by the heavily modified 9-mer triplex-forming oligonucleotide B6CBT. The isolated sequences contain An tracts (n = 6), suggesting that the 5′-end of this TFO was responsible for successful triplex formation. DNase I footprinting with these sequences confirmed triple helix formation at these secondary targets and demonstrated no interaction with similar oligonucleotides containing T or 5-propargylamino-dU. PMID:22180535
Gene silencing by siRNAs and antisense oligonucleotides in the laboratory and the clinic
Watts, Jonathan K.; Corey, David R.
2014-01-01
Synthetic nucleic acids are commonly used laboratory tools for modulating gene expression and have the potential to be widely used in the clinic. Progress towards nucleic acid drugs, however, has been slow and many challenges remain to be overcome before their full impact on patient care can be understood. Antisense oligonucleotides (ASOs) and small interfering RNAs (siRNAs) are the two most widely used strategies for silencing gene expression. We first describe these two approaches and contrast their relative strengths and weaknesses for laboratory applications. We then review the choices faced during development of clinical candidates and the current state of clinical trials. Attitudes towards clinical development of nucleic acid silencing strategies have repeatedly swung from optimism to depression during the past twenty years. Our goal is to provide the information needed to design robust studies with oligonucleotides, making use of the strengths of each oligonucleotide technology. PMID:22069063
Repair of Thalassemic Human β -globin mRNA in Mammalian Cells by Antisense Oligonucleotides
NASA Astrophysics Data System (ADS)
Sierakowska, Halina; Sambade, Maria J.; Agrawal, Sudhir; Kole, Ryszard
1996-11-01
In one form of β -thalassemia, a genetic blood disorder, a mutation in intron 2 of the β -globin gene (IVS2-654) causes aberrant splicing of β -globin pre-mRNA and, consequently, β -globin deficiency. Treatment of mammalian cells stably expressing the IVS2-654 human β -globin gene with antisense oligonucleotides targeted at the aberrant splice sites restored correct splicing in a dose-dependent fashion, generating correct human β -globin mRNA and polypeptide. Both products persisted for up to 72 hr posttreatment. The oligonucleotides modified splicing by a true antisense mechanism without overt unspecific effects on cell growth and splicing of other pre-mRNAs. This novel approach in which antisense oligonucleotides are used to restore rather than to down-regulate the activity of the target gene is applicable to other splicing mutants and is of potential clinical interest.
Enzymatic production of single-molecule FISH and RNA capture probes.
Gaspar, Imre; Wippich, Frank; Ephrussi, Anne
2017-10-01
Arrays of singly labeled short oligonucleotides that hybridize to a specific target revolutionized RNA biology, enabling quantitative, single-molecule microscopy analysis and high-efficiency RNA/RNP capture. Here, we describe a simple and efficient method that allows flexible functionalization of inexpensive DNA oligonucleotides by different fluorescent dyes or biotin using terminal deoxynucleotidyl transferase and custom-made functional group conjugated dideoxy-UTP. We show that (i) all steps of the oligonucleotide labeling-including conjugation, enzymatic synthesis, and product purification-can be performed in a standard biology laboratory, (ii) the process yields >90%, often >95% labeled product with minimal carryover of impurities, and (iii) the oligonucleotides can be labeled with different dyes or biotin, allowing single-molecule FISH, RNA affinity purification, and Northern blot analysis to be performed. © 2017 Gaspar et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.
Universal Oligonucleotide Microarray for Sub-Typing of Influenza A Virus
Ryabinin, Vladimir A.; Kostina, Elena V.; Maksakova, Galiya A.; Neverov, Alexander A.; Chumakov, Konstantin M.; Sinyakov, Alexander N.
2011-01-01
A universal microchip was developed for genotyping Influenza A viruses. It contains two sets of oligonucleotide probes allowing viruses to be classified by the subtypes of hemagglutinin (H1–H13, H15, H16) and neuraminidase (N1–N9). Additional sets of probes are used to detect H1N1 swine influenza viruses. Selection of probes was done in two steps. Initially, amino acid sequences specific to each subtype were identified, and then the most specific and representative oligonucleotide probes were selected. Overall, between 19 and 24 probes were used to identify each subtype of hemagglutinin (HA) and neuraminidase (NA). Genotyping included preparation of fluorescently labeled PCR amplicons of influenza virus cDNA and their hybridization to microarrays of specific oligonucleotide probes. Out of 40 samples tested, 36 unambiguously identified HA and NA subtypes of Influenza A virus. PMID:21559081
Synthesis of nucleosides and oligonucleotides containing adducts of acrolein and vinyl chloride.
Nechev, L V; Harris, C M; Harris, T M
2000-05-01
Vinyl chloride and acrolein are important industrial chemicals. Both form DNA adducts, vinyl chloride after enzymatic oxidation to chlorooxirane and acrolein by direct reaction. Reaction at the N(2) position of guanine is a major pathway. The resulting 2-oxoethyl and 3-oxopropyl adducts cyclize spontaneously to hydroxyethano and hydroxypropano derivatives, respectively. The two cyclic adducts have been detected in DNA exposed to these mutagens. A new method has been developed for the synthesis of deoxyguanosine adducts of chlorooxirane and acrolein, as well as oligonucleotides containing these adducts. Reaction of O(6)-[(trimethylsilyl)ethyl]-2-fluoro-2'-deoxyinosine with the appropriate aminodiol followed by oxidative cleavage of the diol with NaIO(4) gave the adducts in excellent yields. Reaction of oligonucleotides containing the halonucleoside with the aminodiols followed by NaIO(4) efficiently created the nucleosides in the oligonucleotides. Deoxyadenosine adducts were created similarly using 6-chloropurine 9-(2'-deoxyriboside).
Mohapatra, Gayatry; Engler, David A; Starbuck, Kristen D; Kim, James C; Bernay, Derek C; Scangas, George A; Rousseau, Audrey; Batchelor, Tracy T; Betensky, Rebecca A; Louis, David N
2011-04-01
Array comparative genomic hybridization (aCGH) is a powerful tool for detecting DNA copy number alterations (CNA). Because diffuse malignant gliomas are often sampled by small biopsies, formalin-fixed paraffin-embedded (FFPE) blocks are often the only tissue available for genetic analysis; FFPE tissues are also needed to study the intratumoral heterogeneity that characterizes these neoplasms. In this paper, we present a combination of evaluations and technical advances that provide strong support for the ready use of oligonucleotide aCGH on FFPE diffuse gliomas. We first compared aCGH using bacterial artificial chromosome (BAC) arrays in 45 paired frozen and FFPE gliomas, and demonstrate a high concordance rate between FFPE and frozen DNA in an individual clone-level analysis of sensitivity and specificity, assuring that under certain array conditions, frozen and FFPE DNA can perform nearly identically. However, because oligonucleotide arrays offer advantages to BAC arrays in genomic coverage and practical availability, we next developed a method of labeling DNA from FFPE tissue that allows efficient hybridization to oligonucleotide arrays. To demonstrate utility in FFPE tissues, we applied this approach to biphasic anaplastic oligoastrocytomas and demonstrate CNA differences between DNA obtained from the two components. Therefore, BAC and oligonucleotide aCGH can be sensitive and specific tools for detecting CNAs in FFPE DNA, and novel labeling techniques enable the routine use of oligonucleotide arrays for FFPE DNA. In combination, these advances should facilitate genome-wide analysis of rare, small and/or histologically heterogeneous gliomas from FFPE tissues.
PRACTICAL STRATEGIES FOR PROCESSING AND ANALYZING SPOTTED OLIGONUCLEOTIDE MICROARRAY DATA
Thoughtful data analysis is as important as experimental design, biological sample quality, and appropriate experimental procedures for making microarrays a useful supplement to traditional toxicology. In the present study, spotted oligonucleotide microarrays were used to profile...
NASA Technical Reports Server (NTRS)
Meyer, Michael (Technical Monitor); Wu, Xiaolin; Guntha, Sreenivasulu; Ferenclc, Mathias; Krishnamurthy, Ramanarayanan; Eschenmoser, Albert
2002-01-01
(3'NH)- and (2'NH)-TNA, two isomeric phosphoramidate analogues of TNA (alpha-threofuranosyl-(3'-2') oligonucleotides), are shown to be efficient Watson-Crick base-pairing systems and to undergo intersystem crosspairing with TNA, RNA, and DNA.
Validation of the Swine Protein-Annotated Oligonucleotide Microarray
USDA-ARS?s Scientific Manuscript database
The specificity and utility of the Swine Protein-Annotated Oligonucleotide Microarray, or Pigoligoarray (www.pigoligoarray.org), has been evaluated by profiling the expression of transcripts from four porcine tissues. Tools for comparative analyses of expression on the Pigoligoarray were developed i...
Identifying members of the domain Archaea with rRNA-targeted oligonucleotide probes.
Burggraf, S; Mayer, T; Amann, R; Schadhauser, S; Woese, C R; Stetter, K O
1994-09-01
Two 16S rRNA-targeted oligonucleotide probes were designed for the archaeal kingdoms Euryachaeota and Crenarchaeota. Probe specificities were evaluated by nonradioactive dot blot hybridization against selected reference organisms. The successful application of fluorescent-probe derivatives for whole-cell hybridization required organism-specific optimizations of fixation and hybridization conditions to assure probe penetration and morphological integrity of the cells. The probes allowed preliminary grouping of three new hyperthermophilic isolates. Together with other group-specific rRNA-targeted oligonucleotide probes, these probes will facilitate rapid in situ monitoring of the populations present in hydrothermal systems and support cultivation attempts.
Nucleic acid amplification using modular branched primers
Ulanovsky, Levy; Raja, Mugasimangalam C.
2001-01-01
Methods and compositions expand the options for making primers for use in amplifying nucleic acid segments. The invention eliminates the step of custom synthesis of primers for Polymerase Chain Reactions (PCR). Instead of being custom-synthesized, a primer is replaced by a combination of several oligonucleotide modules selected from a pre-synthesized library. A modular combination of just a few oligonucleotides essentially mimics the performance of a conventional, custom-made primer by matching the sequence of the priming site in the template. Each oligonucleotide module has a segment that matches one of the stretches within the priming site.
Rapid purification of circular DNA by triplex-mediated affinity capture
Ji, H.; Smith, L.M.
1997-01-07
A single-step capture of a target supercoiled double-stranded DNA molecule is accomplished by forming a local triple-helix among two strands of the supercoiled circular DNA and an oligonucleotide probe. The oligonucleotide is bound to an immobilizing support which facilitates the immobilization and purification of target DNA molecules. Non-target DNA molecules and other contaminating cellular material are easily removed by washing. The triple-helical structure is destabilized by raising the pH, leaving purified target DNA in the supernatant and reusable affinity capture oligonucleotide secured to the immobilizing support. 3 figs.
Fluorescent triplex-forming DNA oligonucleotides labeled with a thiazole orange dimer unit
Ikeda, Shuji; Yanagisawa, Hiroyuki; Yuki, Mizue; Okamoto, Akimitsu
2013-01-01
Fluorescent probes for the detection of a double-stranded DNA were prepared by labeling a triplex-forming DNA oligonucleotide with a thiazole orange (TO) dimer unit. They belong to ECHO (exciton-controlled hybridization-sensitive fluorescent oligonucleotide) probes which we have previously reported. The excitonic interaction between the two TO molecules was expected to effectively suppress the background fluorescence of the probes. The applicability of the ECHO probes for the detection of double-stranded DNA was confirmed by examining the thermal stability and photophysical and kinetic properties of the DNA triplexes formed by the ECHO probes. PMID:23445822
Ikehara, M; Tezuka, T
1975-01-01
A dinucleoside monophosphate, 8,2'-anhydro-8-mercapto-9-beta-D-arabinofuranosyladenine phosphoryl-(3'-5')-inosine (AspI) was synthesized by the condensation of protected 8-mercapto-adenosine 2',3'-cyclic phosphate and 2',3'-isopropylideneinosine with diphenylphosphorochloridate. 8-Mercaptoadenosine 2',3'-cyclic phosphate was polymerized by using tetraphenyl pyrophosphate as the condensing reagent. As oligonucleotides, thus obtained, contained some uncyclized 8-mercaptoadenosine residues and were cleaved at these sites with 0.3N KOH. As 5'-phosphate was synthesized and polymerized with DCC to give oligonucleotides with chain lengths 2 to 9. PMID:170595
Kostov, Ondřej; Páv, Ondřej; Rosenberg, Ivan
2017-09-18
This unit comprises the straightforward synthesis of protected 2'-deoxyribonucleoside-O-methyl-(H)-phosphinates in both 3'- and 5'-series. These compounds represent a new class of monomers compatible with the solid-phase synthesis of oligonucleotides using H-phosphonate chemistry and are suitable for the preparation of both 3'- and 5'-O-methylphosphonate oligonucleotides. The synthesis of 4-toluenesulfonyloxymethyl-(H)-phosphinic acid as a new reagent for the preparation of O-methyl-(H)-phosphinic acid derivatives is described. © 2017 by John Wiley & Sons, Inc. Copyright © 2017 John Wiley & Sons, Inc.
FDA-Approved Oligonucleotide Therapies in 2017.
Stein, Cy A; Castanotto, Daniela
2017-05-03
Oligonucleotides (oligos) have been under clinical development for approximately the past 30 years, beginning with antisense oligonucleotides (ASOs) and apatmers and followed about 15 years ago by siRNAs. During that lengthy period of time, numerous clinical trials have been performed and thousands of trial participants accrued onto studies. Of all the molecules evaluated as of January 2017, the regulatory authorities assessed that six provided clear clinical benefit in rigorously controlled trials. The story of these six is given in this review. Copyright © 2017 The American Society of Gene and Cell Therapy. Published by Elsevier Inc. All rights reserved.
Martien, Ronny; Hoyer, Herbert; Perera, Glen; Schnürch, Andreas Bernkop
2011-08-01
The purpose of this study was to develop and evaluate an oral oligonucleotide delivery system based on a thiolated polymer/reduced glutathione (GSH) system providing a protective effect toward nucleases and permeation enhancement. A polycarbophil-cysteine conjugate (PCP-Cys) was synthesized. Enzymatic degradation of a model oligonucleotide by DNase I and within freshly collected intestinal fluid was investigated in the absence and presence of PCP-Cys. Permeation studies with PCP-Cys/GSH versus control were performed in vitro on Caco-2 cell monolayers and ex vivo on rat intestinal mucosa. PCP-Cys displayed 223 ± 13.8 μmol thiol groups per gram polymer. After 4h, 61% of the free oligonucleotides were degraded by DNase I and 80% within intestinal fluid. In contrast, less than 41% (DNase I) and 60% (intestinal fluid) were degraded in the presence of 0.02% (m/v) PCP-Cys. Permeation studies revealed an 8-fold (Caco-2) and 10-fold (intestinal mucosa) increase in apparent permeability compared to buffer control. Hence, this PCP-Cys/GSH system might be a promising tool for the oral administration of oligonucleotides as it allows a significant protection toward degrading enzymes and facilitates their transport across intestinal membranes. Copyright © 2011 Elsevier B.V. All rights reserved.
Erlandsen, Stanley L; Jarroll, Edward; Wallis, Peter; van Keulen, Harry
2005-08-01
In this study, we describe the development of fluorescent oligonucleotide probes to variable regions in the small subunit of 16S rRNA in three distinct Giardia species. Sense and antisense probes (17-22 mer) to variable regions 1, 3, and 8 were labeled with digoxygenin or selected fluorochomes (FluorX, Cy3, or Cy5). Optimal results were obtained with fluorochome-labeled oligonucleotides for detection of rRNA in Giardia cysts. Specificity of fluorescent in situ hybridization (FISH) was shown using RNase digestion and high stringency to diminish the hybridization signal, and oligonucleotide probes for rRNA in Giardia lamblia, Giardia muris, and Giardia ardeae were shown to specifically stain rRNA only within cysts or trophozoites of those species. The fluorescent oligonucleotide specific for rRNA in human isolates of Giardia was positive for ten different strains. A method for simultaneous FISH detection of cysts using fluorescent antibody (genotype marker) and two oligonucleotide probes (species marker) permitted visualization of G. lamblia and G. muris cysts in the same preparation. Testing of an environmental water sample revealed the presence of FISH-positive G. lamblia cysts with a specific rDNA probe for rRNA, while negative cysts were presumed to be of animal or bird origin.
Ning, Dianhua; He, Changtian; Liu, Zhengjie; Liu, Cui; Wu, Qilong; Zhao, TingTing; Liu, Renyong
2017-05-21
Human telomerase RNA (hTR), which is one component of telomerase, was deemed to be a biomarker to monitor tumor cells due to its different expression levels in tumor cells and normal somatic cells. Thus far, plentiful fluorescent probes have been designed to investigate nucleic acids. However, most of them are limited since they are time-consuming, require professional operators and even result in false positive signals in the cellular environment. Herein, we report a dual-colored ratiometric-fluorescent oligonucleotide probe to achieve the reliable detection of human telomerase RNA in cell extracts. The probe is constructed using a dual-labeled fluorescent oligonucleotide hybridized with target-complemented Dabcyl-labeled oligonucleotide. In the presence of the target, the dual-labeled fluorescent oligonucleotide translates into a hairpin structure, which leads to the generation of the fluorescence resonance energy transfer (FRET) phenomenon under UV excitation. Compared to conventional methods, this strategy could effectively avoid false positive signals, and it not only possesses the advantages of simplicity and high specificity but also has the merits of signal stability and distinguishable color variation. Moreover, the quantitative assay of hTR would have a far-reaching impact on the telomerase mechanism and even tumor diagnosis research.
Single-Cell in Situ RNA Analysis With Switchable Fluorescent Oligonucleotides.
Xiao, Lu; Guo, Jia
2018-01-01
Comprehensive RNA analyses in individual cells in their native spatial contexts promise to transform our understanding of normal physiology and disease pathogenesis. Here we report a single-cell in situ RNA analysis approach using switchable fluorescent oligonucleotides (SFO). In this method, transcripts are first hybridized by pre-decoding oligonucleotides. These oligonucleotides subsequently recruit SFO to stain their corresponding RNA targets. After fluorescence imaging, all the SFO in the whole specimen are simultaneously removed by DNA strand displacement reactions. Through continuous cycles of target staining, fluorescence imaging, and SFO removal, a large number of different transcripts can be identified by unique fluorophore sequences and visualized at the optical resolution. To demonstrate the feasibility of this approach, we show that the hybridized SFO can be efficiently stripped by strand displacement reactions within 30 min. We also demonstrate that this SFO removal process maintains the integrity of the RNA targets and the pre-decoding oligonucleotides, and keeps them hybridized. Applying this approach, we show that transcripts can be restained in at least eight hybridization cycles with high analysis accuracy, which theoretically would enable the whole transcriptome to be quantified at the single molecule sensitivity in individual cells. This in situ RNA analysis technology will have wide applications in systems biology, molecular diagnosis, and targeted therapies.
Thermodynamics of Oligonucleotide Duplex Melting
ERIC Educational Resources Information Center
Schreiber-Gosche, Sherrie; Edwards, Robert A.
2009-01-01
Melting temperatures of oligonucleotides are useful for a number of molecular biology applications, such as the polymerase chain reaction (PCR). Although melting temperatures are often calculated with simplistic empirical equations, application of thermodynamics provides more accurate melting temperatures and an opportunity for students to apply…
Gas-phase Reactivity of meta-Benzyne Analogs Toward Small Oligonucleotides of Differing Lengths
NASA Astrophysics Data System (ADS)
Widjaja, Fanny; Max, Joann P.; Jin, Zhicheng; Nash, John J.; Kenttämaa, Hilkka I.
2017-07-01
The gas-phase reactivity of two aromatic carbon-centered σ,σ-biradicals ( meta-benzyne analogs) and a related monoradical towards small oligonucleotides of differing lengths was investigated in a Fourier-transform ion cyclotron resonance (FT-ICR) mass spectrometer coupled with laser-induced acoustic desorption (LIAD). The mono- and biradicals were positively charged to allow for manipulation in the mass spectrometer. The oligonucleotides were evaporated into the gas phase as intact neutral molecules by using LIAD. One of the biradicals was found to be unreactive. The reactive biradical reacts with dinucleoside phosphates and trinucleoside diphosphates mainly by addition to a nucleobase moiety followed by cleavage of the glycosidic bond, leading to a nucleobase radical (e.g., base-H) abstraction. In some instances, after the initial cleavage, the unquenched radical site of the biradical abstracts a hydrogen atom from the neutral fragment, which results in a net nucleobase abstraction. In sharp contrast, the related monoradical mainly undergoes facile hydrogen atom abstraction from the sugar moiety. As the size of the oligonucleotides increases, the rate of hydrogen atom abstraction from the sugar moiety by the monoradical was found to increase due to the presence of more hydrogen atom donor sites, and it is the only reaction observed for tetranucleoside triphosphates. Hence, the monoradical only attacks sugar moieties in these substrates. The biradical also shows significant attack at the sugar moiety for tetranucleoside triphosphates. This drastic change in reactivity indicates that the size of the oligonucleotides plays a key role in the outcome of these reactions. This finding is attributed to more compact conformations in the gas phase for the tetranucleoside triphosphates than for the smaller oligonucleotides, which result from stronger stabilizing interactions between the nucleobases.
NASA Technical Reports Server (NTRS)
Zhang, Zhengdong; Willson, Richard C.; Fox, George E.
2002-01-01
MOTIVATION: The phylogenetic structure of the bacterial world has been intensively studied by comparing sequences of 16S ribosomal RNA (16S rRNA). This database of sequences is now widely used to design probes for the detection of specific bacteria or groups of bacteria one at a time. The success of such methods reflects the fact that there are local sequence segments that are highly characteristic of particular organisms or groups of organisms. It is not clear, however, the extent to which such signature sequences exist in the 16S rRNA dataset. A better understanding of the numbers and distribution of highly informative oligonucleotide sequences may facilitate the design of hybridization arrays that can characterize the phylogenetic position of an unknown organism or serve as the basis for the development of novel approaches for use in bacterial identification. RESULTS: A computer-based algorithm that characterizes the extent to which any individual oligonucleotide sequence in 16S rRNA is characteristic of any particular bacterial grouping was developed. A measure of signature quality, Q(s), was formulated and subsequently calculated for every individual oligonucleotide sequence in the size range of 5-11 nucleotides and for 15mers with reference to each cluster and subcluster in a 929 organism representative phylogenetic tree. Subsequently, the perfect signature sequences were compared to the full set of 7322 sequences to see how common false positives were. The work completed here establishes beyond any doubt that highly characteristic oligonucleotides exist in the bacterial 16S rRNA sequence dataset in large numbers. Over 16,000 15mers were identified that might be useful as signatures. Signature oligonucleotides are available for over 80% of the nodes in the representative tree.
Li, S K; Ghanem, A H; Teng, C L; Hardee, G E; Higuchi, W I
2001-07-01
The objective of this study was to investigate the transport behavior of a series of oligonucleotides with human epidermal membrane (HEM) and to examine the applicability of the modified NERNST-PLANCK model to transdermal iontophoresis of these macromolecules. Iontophoretic transport experiments were first carried out in a synthetic model membrane system (Nuclepore membranes) with a four-electrode potentiostat to examine the baseline modified NERNST-PLANCK model. The modified NERNST-PLANCK model derived from the Einstein relation and the Stokes-Einstein equation taken from previous work did not hold for the oligonucleotides. Results obtained in the Nuclepore studies were, however, consistent with predictions of the modified NERNST-PLANCK model using the experimentally determined electromobilities and diffusion coefficients. The electromobilities of the oligonucleotides (determined by capillary electrophoresis) were found to be more than a factor of two smaller than expected from the Einstein relation between electromobilities and diffusion coefficients (the latter determined in diffusion cell experiments). A correlation between these electromobilities and the theoretical electromobilities estimated by considering the effects of counterion binding and the effects of mobility reduction according to colloid theory was also observed. These results suggest that the modified NERNST-PLANCK model predictions are satisfactory only when the electromobilities and the effective molecular size of the oligonucleotides are known and are used directly to predict the iontophoretically enhanced transport. Results with the HEM experiments generally agreed with model predictions based on the experimental electromobilities. The oligonucleotide HEM flux data also suggest the existence of pores with effective pore radii greater than the effective radii estimated in previous studies with small molecular weight model permeants.
Cowsert, L M; Fox, M C; Zon, G; Mirabelli, C K
1993-01-01
Papillomaviruses induce benign proliferative lesions, such as genital warts, in humans. The E2 gene product is thought to play a major role in the regulation of viral transcription and DNA replication and may represent a rational target for an antisense oligonucleotide drug action. Phosphorothioate oligonucleotides complementary to E2 mRNAs were synthesized and tested in a series of in vitro bovine papillomavirus (BPV) and human papillomavirus (HPV) models for the ability to inhibit E2 transactivation and virus-induced focus formation. The most active BPV-specific compounds were complementary to the mRNA cap region (ISIS 1751), the translation initiation region for the full-length E2 transactivator (ISIS 1753), and the translation initiation region for the E2 transrepressor mRNA (ISIS 1755). ISIS 1751 and ISIS 1753 were found to reduce E2-dependent transactivation and viral focus formation in a sequence-specific and concentration-dependent manner. ISIS 1755 increased E2 transactivation in a dose-dependent manner but had no effect on focus formation. Oligonucleotides with a chain length of 20 residues had optimal activity in the E2 transactivation assay. On the basis of the above observations, ISIS 2105, a 20-residue phosphorothioate oligonucleotide targeted to the translation initiation of both HPV type 6 (HPV-6) and HPV-11 E2 mRNA, was designed and shown to inhibit E2-dependent transactivation by HPV-11 E2 expressed from a surrogate promoter. These observations support the rationale of E2 as a target for antiviral therapy against papillomavirus infections and specifically identify ISIS 2105 as a candidate antisense oligonucleotide for the treatment of genital warts induced by HPV-6 and HPV-11. Images PMID:8383937
Delivery of gene biotechnologies to plants: Pathogen and pest control
USDA-ARS?s Scientific Manuscript database
Treatment of oligonucleotides to plants for host delivered suppression of microbes and insect pests of citrus was successful. FANA_ASO, (2'-deoxy-2'-fluoro-D- arabinonucleic acid)_( antisense oligonucleotides- AUM LifeTech) designed to: Asian citrus psyllid; Citrus plant bacterial pathogen of citru...
Gao, Zhong Feng; Chen, Dong Mei; Lei, Jing Lei; Luo, Hong Qun; Li, Nian Bing
2015-10-15
Improving the reproducibility of electrochemical signal remains a great challenge over the past decades. In this work, i-motif oligonucleotide probe-based electrochemical DNA (E-DNA) sensor is introduced for the first time as a regenerated sensing platform, which enhances the reproducibility of electrochemical signal, for label-free detection of glucose and urea. The addition of glucose or urea is able to activate glucose oxidase-catalyzed or urease-catalyzed reaction, inducing or destroying the formation of i-motif oligonucleotide probe. The conformational switch of oligonucleotide probe can be recorded by electrochemical impedance spectroscopy. Thus, the difference of electron transfer resistance is utilized for the quantitative determination of glucose and urea. We further demonstrate that the E-DNA sensor exhibits high selectivity, excellent stability, and remarkable regenerated ability. The human serum analysis indicates that this simple and regenerated strategy holds promising potential in future biosensing applications. Copyright © 2015 Elsevier B.V. All rights reserved.
The estimation of quantitative parameters of oligonucleotides immobilization on mica surface
NASA Astrophysics Data System (ADS)
Sharipov, T. I.; Bakhtizin, R. Z.
2017-05-01
Immobilization of nucleic acids on the surface of various materials is increasingly being used in research and some practical applications. Currently, the DNA chip technology is rapidly developing. The basis of the immobilization process can be both physical adsorption and chemisorption. A useful way to control the immobilization of nucleic acids on a surface is to use atomic force microscopy. It allows you to investigate the topography of the surface by its direct imaging with high resolution. Usually, to fix the DNA on the surface of mica are used cations which mediate the interaction between the mica surface and the DNA molecules. In our work we have developed a method for estimation of quantitative parameter of immobilization of oligonucleotides is their degree of aggregation depending on the fixation conditions on the surface of mica. The results on study of aggregation of oligonucleotides immobilized on mica surface will be presented. The single oligonucleotides molecules have been imaged clearly, whereas their surface areas have been calculated and calibration curve has been plotted.
Werz, Emma; Korneev, Sergei; Montilla-Martinez, Malayko; Wagner, Richard; Hemmler, Roland; Walter, Claudius; Eisfeld, Jörg; Gall, Karsten; Rosemeyer, Helmut
2012-02-01
A novel technique is described which comprises a base-specific DNA duplex formation at a lipid bilayer-H(2) O-phase boundary layer. Two different probes of oligonucleotides both carrying a double-tailed lipid at the 5'-terminus were incorporated into stable artificial lipid bilayers separating two compartments (cis/trans-channel) of an optically transparent microfluidic sample carrier with perfusion capabilities. Both the cis- and trans-channels are filled with saline buffer. Injection of a cyanine-5-labeled target DNA sequence, which is complementary to only one of the oligonucleotide probes, into the cis-channel, followed by a thorough perfusion, leads to an immobilization of the labeled complementary oligonucleotide on the membrane as detected by single-molecule fluorescence spectroscopy and microscopy. In the case of fluorescent but non-complementary DNA sequences, no immobilized fluorescent oligonucleotide duplex could be detected on the membrane. This clearly verifies a specific duplex formation at the membrane interface. Copyright © 2012 Verlag Helvetica Chimica Acta AG, Zürich.
Gasc, Cyrielle; Constantin, Antony; Jaziri, Faouzi; Peyret, Pierre
2017-01-01
The detection and identification of bacterial pathogens involved in acts of bio- and agroterrorism are essential to avoid pathogen dispersal in the environment and propagation within the population. Conventional molecular methods, such as PCR amplification, DNA microarrays or shotgun sequencing, are subject to various limitations when assessing environmental samples, which can lead to inaccurate findings. We developed a hybridization capture strategy that uses a set of oligonucleotide probes to target and enrich biomarkers of interest in environmental samples. Here, we present Oligonucleotide Capture Probes for Pathogen Identification Database (OCaPPI-Db), an online capture probe database containing a set of 1,685 oligonucleotide probes allowing for the detection and identification of 30 biothreat agents up to the species level. This probe set can be used in its entirety as a comprehensive diagnostic tool or can be restricted to a set of probes targeting a specific pathogen or virulence factor according to the user's needs. : http://ocappidb.uca.works. © The Author(s) 2017. Published by Oxford University Press.
Peroxide-mediated desulfurization of phosphorothioate oligonucleotides and its prevention.
Krotz, Achim H; Mehta, Rahul C; Hardee, Gregory E
2005-02-01
Desulfurization at the internucleotide phosphorothioate linkage of antisense oligonucleotides (ASOs) in dermatological formulations has been investigated using strong ion exchange chromatography and mass spectroscopy. The formation of phosphate diester linkages appeared to arise from a reaction between the phosphorothioate oligonucleotide and a potent oxidizing agent. Screening of excipients used in the formulation indicated that the cause of desulfurization was related to the presence of polyethylene glycol-derived nonionic surfactants MYRJ 52 or BRIJ 58. Autoxidation of the polyethylene glycol chain is suggested as the probable origin for the observed incompatibility. The ability of various antioxidants to prevent oxidative degradation of ASO-1 in simple test systems and in oil-in-water emulsions is described. It is found that in test systems both lipophilic and hydrophilic antioxidants are effective. However, in cream formulation (oil-in-water emulsions) of ASO-1 the addition of hydrophilic antioxidants L-cysteine or DL-alpha-lipoic acid has been shown to be superior in protecting the oligonucleotide from desulfurization upon storage. Copyright 2004 Wiley-Liss, Inc.
Modulating nanoparticle superlattice structure using proteins with tunable bond distributions
McMillan, Janet R.; Brodin, Jeffrey D.; Millan, Jaime A.; ...
2017-01-25
Here, we investigate the use of proteins with tunable DNA modification distributions to modulate nanoparticle superlattice structure. Using Beta-galactosidase (βgal) as a model system, we have employed the orthogonal chemical reactivities of surface amines and thiols to synthesize protein-DNA conjugates with 36 evenly distributed or 8 specifically positioned oligonucleotides. When assembled into crystalline superlattices with AuNPs, we find that the distribution of DNA modifications modulates the favored structure: βgal with uniformly distributed DNA bonding elements results in body-centered cubic crystals, whereas DNA functionalization of cysteines results in AB 2 packing. We probe the role of protein oligonucleotide number and conjugatemore » size on this observation, which revealed the importance of oligonucleotide distribution and number in this observed assembly behavior. These results indicate that proteins with defined DNA-modification patterns are powerful tools to control the nanoparticle superlattices architecture, and establish the importance of oligonucleotide distribution in the assembly behavior of protein-DNA conjugates.« less
DNA/RNA heteroduplex oligonucleotide for highly efficient gene silencing
Nishina, Kazutaka; Piao, Wenying; Yoshida-Tanaka, Kie; Sujino, Yumiko; Nishina, Tomoko; Yamamoto, Tsuyoshi; Nitta, Keiko; Yoshioka, Kotaro; Kuwahara, Hiroya; Yasuhara, Hidenori; Baba, Takeshi; Ono, Fumiko; Miyata, Kanjiro; Miyake, Koichi; Seth, Punit P.; Low, Audrey; Yoshida, Masayuki; Bennett, C. Frank; Kataoka, Kazunori; Mizusawa, Hidehiro; Obika, Satoshi; Yokota, Takanori
2015-01-01
Antisense oligonucleotides (ASOs) are recognized therapeutic agents for the modulation of specific genes at the post-transcriptional level. Similar to any medical drugs, there are opportunities to improve their efficacy and safety. Here we develop a short DNA/RNA heteroduplex oligonucleotide (HDO) with a structure different from double-stranded RNA used for short interfering RNA and single-stranded DNA used for ASO. A DNA/locked nucleotide acid gapmer duplex with an α-tocopherol-conjugated complementary RNA (Toc-HDO) is significantly more potent at reducing the expression of the targeted mRNA in liver compared with the parent single-stranded gapmer ASO. Toc-HDO also improves the phenotype in disease models more effectively. In addition, the high potency of Toc-HDO results in a reduction of liver dysfunction observed in the parent ASO at a similar silencing effect. HDO technology offers a novel concept of therapeutic oligonucleotides, and the development of this molecular design opens a new therapeutic field. PMID:26258894
Selective Detection of Peptide-Oligonucleotide Heteroconjugates Utilizing Capillary HPLC-ICPMS
NASA Astrophysics Data System (ADS)
Catron, Brittany; Caruso, Joseph A.; Limbach, Patrick A.
2012-06-01
A method for the selective detection and quantification of peptide:oligonucleotide heteroconjugates, such as those generated by protein:nucleic acid cross-links, using capillary reversed-phase high performance liquid chromatography (cap-RPHPLC) coupled with inductively coupled plasma mass spectrometry detection (ICPMS) is described. The selective detection of phosphorus as 31P+, the only natural isotope, in peptide-oligonucleotide heteroconjugates is enabled by the elemental detection capabilities of the ICPMS. Mobile phase conditions that allow separation of heteroconjugates while maintaining ICPMS compatibility were investigated. We found that trifluoroacetic acid (TFA) mobile phases, used in conventional peptide separations, and hexafluoroisopropanol/triethylamine (HFIP/TEA) mobile phases, used in conventional oligonucleotide separations, both are compatible with ICPMS and enable heteroconjugate separation. The TFA-based separations yielded limits of detection (LOD) of ~40 ppb phosphorus, which is nearly seven times lower than the LOD for HFIP/TEA-based separations. Using the TFA mobile phase, 1-2 pmol of a model heteroconjugate were routinely separated and detected by this optimized capLC-ICPMS method.
Schönhuber, Wilhelm; Zarda, Boris; Eix, Stella; Rippka, Rosmarie; Herdman, Michael; Ludwig, Wolfgang; Amann, Rudolf
1999-01-01
Individual cyanobacterial cells are normally identified in environmental samples only on the basis of their pigmentation and morphology. However, these criteria are often insufficient for the differentiation of species. Here, a whole-cell hybridization technique is presented that uses horseradish peroxidase (HRP)-labeled, rRNA-targeted oligonucleotides for in situ identification of cyanobacteria. This indirect method, in which the probe-conferred enzyme has to be visualized in an additional step, was necessary since fluorescently monolabeled oligonucleotides were insufficient to overstain the autofluorescence of the target cells. Initially, a nonfluorescent detection assay was developed and successfully applied to cyanobacterial mats. Later, it was demonstrated that tyramide signal amplification (TSA) resulted in fluorescent signals far above the level of autofluorescence. Furthermore, TSA-based detection of HRP was more sensitive than that based on nonfluorescent substrates. Critical points of the assay, such as cell fixation and permeabilization, specificity, and sensitivity, were systematically investigated by using four oligonucleotides newly designed to target groups of cyanobacteria. PMID:10049892
Effect of Molecular Crowding and Ionic Strength on the Isothermal Hybridization of Oligonucleotides
Markarian, Marie Z.; Schlenoff, Joseph B.
2010-01-01
The isothermal hybridization of complimentary oligonucleotides, 15-mer, 25-mer, 35-mer, and a molecular beacon, was investigated under varying conditions of molecular crowding and ionic strength, using hypochromicity to follow strand pairing and polyethylene glycol as a crowding agent. Thermodynamic analysis of the results revealed the addition of counterions to the oligonucleotide backbones, Δψ, to be dependent on the strand G-C content and the molecular crowding. A decrease in Δψ was observed with both increasing GC% and solution PEG content. In contrast, the number of bound water molecules depended on the activity of Na+, where two regimes were observed. At aNa+⟨0.05 and increasing molecular crowding, water molecules were released into the DNA solutions and oligonucleotide pairing was favored with both increasing hydrophobic forces, while at aNa+≥0.05, water molecules were bound to the strands and the extent of double strand formation decreased with increasing PEG wt%. PMID:20701389
Therapeutic Antisense Oligonucleotides against Cancer: Hurdling to the Clinic
NASA Astrophysics Data System (ADS)
Moreno, Pedro; Pêgo, Ana
2014-10-01
Under clinical development since the early 90’s and with two successfully approved drugs (Fomivirsen and Mipomersen), oligonucleotide-based therapeutics have not yet delivered a clinical drug to the market in the cancer field. Whilst many pre-clinical data has been generated, a lack of understanding still exists on how to efficiently tackle all the different challenges presented for cancer targeting in a clinical setting. Namely, effective drug vectorization, careful choice of target gene or synergistic multi-gene targeting are surely decisive, while caution must be exerted to avoid potential toxic, often misleading off-target-effects. Here a brief overview will be given on the nucleic acid chemistry advances that established oligonucleotide technologies as a promising therapeutic alternative and ongoing cancer related clinical trials. Special attention will be given towards a perspective on the hurdles encountered specifically in the cancer field by this class of therapeutic oligonucleotides and a view on possible avenues for success is presented, with particular focus on the contribution from nanotechnology to the field.
Therapeutic antisense oligonucleotides against cancer: hurdling to the clinic
Moreno, Pedro M. D.; Pêgo, Ana P.
2014-01-01
Under clinical development since the early 90's and with two successfully approved drugs (Fomivirsen and Mipomersen), oligonucleotide-based therapeutics has not yet delivered a clinical drug to the market in the cancer field. Whilst many pre-clinical data has been generated, a lack of understanding still exists on how to efficiently tackle all the different challenges presented for cancer targeting in a clinical setting. Namely, effective drug vectorization, careful choice of target gene or synergistic multi-gene targeting are surely decisive, while caution must be exerted to avoid potential toxic, often misleading off-target-effects. Here a brief overview will be given on the nucleic acid chemistry advances that established oligonucleotide technologies as a promising therapeutic alternative and ongoing cancer related clinical trials. Special attention will be given toward a perspective on the hurdles encountered specifically in the cancer field by this class of therapeutic oligonucleotides and a view on possible avenues for success is presented, with particular focus on the contribution from nanotechnology to the field. PMID:25353019
NASA Astrophysics Data System (ADS)
Martirosyan, A.; Olesen, M. J.; Fenton, R. A.; Kjems, J.; Howard, K. A.
2016-06-01
This work demonstrates gastric mucin-triggered nanocarrier disassembly for release of antisense oligonucleotides and consequent unassisted cellular entry as a novel oral delivery strategy. A fluorescence activation-based reporter system was used to investigate the interaction and mucin-mediated disassembly of chitosan-based nanocarriers containing a 13-mer DNA oligonucleotide with a flanked locked RNA nucleic acid gapmer design. Gastric mucins were shown to trigger gapmer release from nanocarriers that was dependent on the interaction time, mucin concentration and N : P ratio with a maximal release at N : P 10. In contrast to siRNA, naked gapmers exhibited uptake into mucus producing HT-MTX mono-cultures and HT-MTX co-cultured with the carcinoma epithelial cell line Caco-2. Importantly, in vivo gapmer uptake was observed in epithelial tissue 30 min post-injection in murine intestinal loops. The findings present a mucosal design-based system tailored for local delivery of oligonucleotides that may maximize the effectiveness of gene silencing therapeutics within tumours at mucosal sites.This work demonstrates gastric mucin-triggered nanocarrier disassembly for release of antisense oligonucleotides and consequent unassisted cellular entry as a novel oral delivery strategy. A fluorescence activation-based reporter system was used to investigate the interaction and mucin-mediated disassembly of chitosan-based nanocarriers containing a 13-mer DNA oligonucleotide with a flanked locked RNA nucleic acid gapmer design. Gastric mucins were shown to trigger gapmer release from nanocarriers that was dependent on the interaction time, mucin concentration and N : P ratio with a maximal release at N : P 10. In contrast to siRNA, naked gapmers exhibited uptake into mucus producing HT-MTX mono-cultures and HT-MTX co-cultured with the carcinoma epithelial cell line Caco-2. Importantly, in vivo gapmer uptake was observed in epithelial tissue 30 min post-injection in murine intestinal loops. The findings present a mucosal design-based system tailored for local delivery of oligonucleotides that may maximize the effectiveness of gene silencing therapeutics within tumours at mucosal sites. Electronic supplementary information (ESI) available. See DOI: 10.1039/c5nr07206a
NASA Technical Reports Server (NTRS)
Kawamura, K.; Ferris, J. P.
1994-01-01
The rate constants for the condensation reaction of the 5'-phosphorimidazolide of adenosine (ImpA) to form dinucleotides and oligonucleotides have been measured in the presence of Na(+)-volclay (a Na(+)-montmorillonite) in pH 8 aqueous solution at 25 degrees C. The rates of the reaction of ImpA with an excess of adenosine 5'-monophosphoramidate (NH2pA), P1,P2-diadenosine 5',5'-pyrophosphate (A5'ppA), or adenosine 5'-monophosphate (5'-AMP or pA) in the presence of the montmorillonite to form NH2pA3'pA, A5'ppA3'pA, and pA3'pA, respectively, were measured. Only 3',5'-linked products were observed. The magnitude of the rate constants decrease in the order NH2pA3'pA > A5'-ppA3'pA > pA3'pA. The binding of ImpA to montmorillonite was measured, and the adsorption isotherm was determined. The binding of ImpA to montmorillonite and the formation of higher oligonucleotides is not observed in the absence of salts. Mg2+ enhances binding and oligonucleotide formation more than Ca2+ and Na+. The rate constants for the oligonucleotide formation were determined from the reaction products formed from 10 to 40 mM ImpA in the presence of Na(+)-montmorillonite using the computer program SIMFIT. The magnitudes of the rate constants for the formation of oligonucleotides increased in the order 2-mer < 3-mer < 4-mer ... 7-mer. The rate constants for dinucleotide and trinucleotide formation are more than 1000 times larger than those measured in the absence of montmorillonite. The rate constants for the formation of dinucleotide, trinucleotide, and tetranucleotide are 41,2.6, and 3.7 times larger than those for the formation of oligo(G)s with a poly(C) template. The hydrolysis of ImpA was accelerated 35 times in the presence of the montmorillonite. The catalytic ability of montmorillonite to form dinucleotides and oligonucleotides is quantitatively evaluated and possible pathways for oligo(A) formation are proposed.
Oligonucleotide-based therapy for neurodegenerative diseases.
Magen, Iddo; Hornstein, Eran
2014-10-10
Molecular genetics insight into the pathogenesis of several neurodegenerative diseases, such as Alzheimer׳s disease, Parkinson׳s disease, Huntington׳s disease and amyotrophic lateral sclerosis, encourages direct interference with the activity of neurotoxic genes or the molecular activation of neuroprotective pathways. Oligonucleotide-based therapies are recently emerging as an efficient strategy for drug development and these can be employed as new treatments of neurodegenerative states. Here we review advances in this field in recent years which suggest an encouraging assessment that oligonucleotide technologies for targeting of RNAs will enable the development of new therapies and will contribute to preservation of brain integrity. Copyright © 2014 Elsevier B.V. All rights reserved.
Inhibition of B cell proliferation by antisense DNA to both alpha and beta forms of Fc epsilon R II.
Bhatti, L; Behle, K; Stevens, R H
1992-10-01
Epstein-Barr Virus (EBV) infection activates B lymphocyte proliferation through partially understood mechanisms, resulting in phenotypic changes, including the appearance of new antigens. One such antigen is Fc epsilon R II/CD-23 which may be relevant for B cell proliferation. We have used anti-sense oligonucleotides to study the importance of the two forms of this molecule for proliferation in the EBV-transformed, Fc epsilon R II +ve lymphoblastoid B cell line, RPMI 8866. Anti-sense oligodeoxynucleotides were generated to the two forms of Fc epsilon R II; Fc epsilon R IIa (alpha) and IIb (beta) which differ only in their intracytoplasmic domains. Addition of increasing concentrations of anti-sense oligonucleotides, ranging from 1 to 30 microM, significantly decreased cellular proliferation as measured by the incorporation of [3H]thymidine (inhibition range 8-88%). Optimum inhibition of cellular proliferation was apparent at 15 microM concentration of both anti-sense Fc epsilon R IIa and IIb (Fc epsilon R IIa, mean +/- SE = 75 +/- 7% inhibition, p less than 0.001; Fc epsilon R IIb, mean +/- SE = 71 +/- 7% inhibition, p less than 0.001). Anti-sense oligonucleotides complementary to the common part of Fc epsilon R II resulted in a similar inhibition of proliferation. Sense oligonucleotides did not induce significant inhibition. Preincubation of sense and anti-sense oligonucleotides resulted in an abrogation of proliferation inhibition. Moreover, none of these oligonucleotides had any effect on a Fc epsilon R II -ve cell line. Incubation with both anti-sense IIa and IIb resulted in additive, but not synergistic inhibition of proliferation. Addition of soluble Fc epsilon R II did not reverse inhibition of proliferation, suggesting that membrane-bound or intracellular rather than soluble Fc epsilon R II was important for the induced proliferation. Analysis of cell surface expression for Fc epsilon II indicated that while there was a pronounced effect on cell number following incubation with anti-sense oligonucleotides, surface expression of Fc epsilon R II was consistent as measured over different time points. PCR analysis revealed that while most cells expressed either the alpha or the beta form of Fc epsilon R II, EBV-transformed cell lines, particularly RPMI 8866, were found to express both alpha and beta forms simultaneously. This may constitute a mechanism whereby EBV infection confers an immortal state to the cell, resulting in its uncontrolled proliferation. Cell lines expressing only one receptor form, either alpha or beta, were unaffected after incubation with anti-sense oligonucleotides.(ABSTRACT TRUNCATED AT 400 WORDS)
Liver as a target for oligonucleotide therapeutics.
Sehgal, Alfica; Vaishnaw, Akshay; Fitzgerald, Kevin
2013-12-01
Oligonucleotide-based therapeutics are an emerging class of drugs that hold the promise for silencing "un-druggable" targets,thus creating unique opportunities for innovative medicines. As opposed to gene therapy, oligonucleotides are considered to be more akin to small molecule therapeutics because they are small,completely synthetic in origin, do not integrate into the host genome,and have a defined duration of therapeutic activity after which effects recover to baseline. They offer a high degree of specificity at the genetic level, thereby reducing off-target effects.At the same time, they provide a strategy for targeting any gene in the genome, including transcripts that produce mutated proteins.Oligonucleotide-based therapeutics include short interfering RNA (siRNA), that degrade target mRNA through RISC mediated RNAi; anti-miRs, that target miRNAs; miRNA mimics, that regulate target mRNA; antisense oligonucleotides, that may be working through RNAseH mediated mRNA decay; mRNA upregulation,by targeting long non-coding RNAs; and oligonucleotides induced alternative splicing [1]. All these approaches require some minimal degree of homology at the nucleic acid sequence level for them to be functional. The different mechanisms of action and their relevant activity are outlined in Fig. 1. Besides homology,RNA secondary structure has also been exploited in the case of ribozymes and aptamers, which act by binding to nucleic acids or proteins, respectively. While there have been many reports of gene knockdown and gene modulation in cell lines and mice with all these methods, very few have advanced to clinical stages.The main obstacle to date has been the safe and effective intracellular delivery of these compounds in higher species, including humans. Indeed, their action requires direct interaction with DNA/RNA within the target cell so even when one solves the issues of tissue and cellular access, intracellular/intranuclear location represents yet another barrier to overcome. To date,hepatic delivery of oligonucleotides has been the area with greatest progress, and thus we have focused on liver-targeted therapeutics that have shown promise at the preclinical and/or clinical level.The liver is the largest internal organ in the body, playing a central role in metabolism, detoxification, synthesis, and secretion of major plasma proteins (carrier proteins, coagulation factors,complement components, hormones, and apolipoproteins),and iron homeostasis. It is therefore not surprising that a large number of disease targets reside in the liver where they are susceptible to modulation by oligonucleotide therapies.
Svinarchuk, F; Monnot, M; Merle, A; Malvy, C; Fermandjian, S
1995-01-01
In our previous works we have shown that the oligonucleotides 5'-GGGGAGGGGGAGG-3' and 5'-GGAGGGGGAGGGG-3' give very stable and specific triplexes with their target double stranded DNAs [Svinarchuk, F., Bertrand, J.-R. and Malvy, C. (1994) Nucleic Acids Res., 22, 3742-3747; Svinarchuk, F., Paoletti, J. and Malvy, C. (1995) J. Biol. Chem., 270, 14 068-14,071]. The target for the invariable part of these oligonucleotides, 5'-GGAGGGGGAGG-3', is found in a highly conserved 20 bp long purine/pyrimidine tract of the vpx gene of the SIV and HIV-2 viruses and could be a target for oligonucleotide directed antivirus therapy. Here were report on the ability of four purine oligonucleotides with different lengths (11-, 14-, 17- and 20-mer) to form triplexes with the purine/pyrimidine stretch of the vpx gene. Triplex formation was tested by joint dimethyl sulfate (DMS) footprint, gel-retardation assay, circular dichroism (CD) and UV-melting studies. Dimethyl sulfate footprint studies revealed the antiparallel orientation of the third strand to the purine strand of the Watson-Crick duplex. However, the protection of the guanines at the ends of the target sequence decreased as the length of the third strand oligonucleotide increased. Melting temperature studies provided profiles with only one transition for all of the triplexes. The melting temperatures of the triplexes were found to be the same as for the targeted duplex in the case of the 11- and 14-mer third strands while for the 17- and 20-mer third strands the melting temperature of the triplexes were correspondingly 4 and 8 degrees C higher than for the duplex. Heating and cooling melting curves were reversible for all of the tested triplexes except one with the 20-mer third strand oligonucleotide. Circular dichroism spectra showed the ability of the target DNA to adopt an A-like DNA conformation. Upon triplex formation the A-DNA form becomes even more pronounced. This effect depends on the length of the third strand oligonucleotide: the CD spectrum shows a 'classical' A-DNA shape with the 20-mer. This is not observed with the purine/pyrimidine stretch of the HIV-1 DNA which keeps a B-like spectrum even after triplex formation. We suggest, that an A-like duplex DNA is required for the formation of a stable DNA purine(purine-pyrimidine) triplex. Images PMID:7479024
Pyrophosphorolytic dismutation of oligodeoxy-nucleotides by terminal deoxynucleotidyltransferase.
Anderson, R S; Bollum, F J; Beattie, K L
1999-01-01
Terminal transferase (TdT), when incubated with a purified(32)P-5"-end-labeled oligonucleotide of defined length in the presence of Co(2+), Mn(2+)or Mg(2+)and 2-mercaptoethanol in cacodylate or HEPES buffer, pH 7.2, exhibits the ability to remove a 3"-nucleotide from one oligonucleotide and add it to the 3"-end of another. When analyzed by urea-PAGE, this activity is observed as a disproportionation of the starting oligonucleotide into a ladder of shorter and longer oligonucleotides distributed around the starting material. Optimal metal ion concentration is 1-2 mM. All three metal ions support this activity with Co(2+)> Mn(2+) congruent with Mg(2+). Oligonucleotides p(dT) and p(dA) are more efficient substrates than p(dG) and p(dC) because the latter may form secondary structures. The dismutase activity is significant even in the presence of dNTP concentrations comparable to those that exist in the nucleus during the G(1)phase of the cell cycle. Using BetaScope image analysis the rate of pyrophosphorolytic dismutase activity was found to be only moderately slower than the poly-merization activity. These results may help explain the GC-richness of immunoglobulin gene segment joins (N regions) and the loss of bases that occur during gene rearrangements in pre-B and pre-T cells. PMID:10454617
2013-01-01
Background Hybridization based assays and capture systems depend on the specificity of hybridization between a probe and its intended target. A common guideline in the construction of DNA microarrays, for instance, is that avoiding complementary stretches of more than 15 nucleic acids in a 50 or 60-mer probe will eliminate sequence specific cross-hybridization reactions. Here we present a study of the behavior of partially matched oligonucleotide pairs with complementary stretches starting well below this threshold complementarity length – in silico, in solution, and at the microarray surface. The modeled behavior of pairs of oligonucleotide probes and their targets suggests that even a complementary stretch of sequence 12 nt in length would give rise to specific cross-hybridization. We designed a set of binding partners to a 50-mer oligonucleotide containing complementary stretches from 6 nt to 21 nt in length. Results Solution melting experiments demonstrate that stable partial duplexes can form when only 12 bp of complementary sequence are present; surface hybridization experiments confirm that a signal close in magnitude to full-strength signal can be obtained from hybridization of a 12 bp duplex within a 50mer oligonucleotide. Conclusions Microarray and other molecular capture strategies that rely on a 15 nt lower complementarity bound for eliminating specific cross-hybridization may not be sufficiently conservative. PMID:23445545
Qiao, Jun-Qin; Liang, Chao; Wei, Lan-Chun; Cao, Zhao-Ming; Lian, Hong-Zhen
2016-12-01
The study on nucleic acid retention in ion-pair reversed-phase high-performance liquid chromatography mainly focuses on size-dependence, however, other factors influencing retention behaviors have not been comprehensively clarified up to date. In this present work, the retention behaviors of oligonucleotides and double-stranded DNAs were investigated on silica-based C 18 stationary phase by ion-pair reversed-phase high-performance liquid chromatography. It is found that the retention of oligonucleotides was influenced by base composition and base sequence as well as size, and oligonucleotides prone to self-dimerization have weaker retention than those not prone to self-dimerization but with the same base composition. However, homo-oligonucleotides are suitable for the size-dependent separation as a special case of oligonucleotides. For double-stranded DNAs, the retention is also influenced by base composition and base sequence, as well as size. This may be attributed to the interaction of exposed bases in major or minor grooves with the hydrophobic alky chains of stationary phase. In addition, no specific influence of guanine and cytosine content was confirmed on retention of double-stranded DNAs. Notably, the space effect resulted from the stereostructure of nucleic acids also influences the retention behavior in ion-pair reversed-phase high-performance liquid chromatography. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Moriguchi, Tomohisa; Azam, A T M Zafrul; Shinozuka, Kazuo
2011-06-15
Two types of anthraquinone conjugates were synthesized as non-nucleosidic oligonucleotide components. These include an anthraquinone derivative conjugated with 2,2-bis(hydroxymethyl)propionic acid and an anthraquinone--polyamine derivative conjugated with 2,2-bis(hydroxymethyl)propionic acid. The conjugates were successfully incorporated into the "linking-region" of the α-β chimeric oligonucleotides via phosphoramidite method as non-nucleosidic backbone units. The resultant novel α-β chimeric oligonucleotides possessed two diastereomers that were generated by the introduction of the anthraquinone conjugate with a stereogenic carbon atom. The isomers were successfully separated by a reversed-phase HPLC. UV-melting experiments revealed that both stereoisomers formed a substantially stable alternate-strand triple helix, irrespective of the stereochemistry of the incorporated non-nucleosidic backbone unit. However, the enhancing effect on thermal stability depended on the length of the alkyl linker connecting anthraquinone moiety and the propionic acid moiety. The sequence discrimination ability of the chimeric oligonucleotides toward mismatch target duplex was also examined. The T(m) values of the triplexes containing the mismatch target were substantially lower than the T(m) values of those containing the full-match target. The thermodynamic parameters (ΔH°, ΔS°, and ΔG°) required for the dissociation of the triplexes into the third strand and target duplex were also measured.
Identification of clinically relevant viridans streptococci by an oligonucleotide array.
Chen, Chao Chien; Teng, Lee Jene; Kaiung, Seng; Chang, Tsung Chain
2005-04-01
Viridans streptococci (VS) are common etiologic agents of subacute infective endocarditis and are capable of causing a variety of pyogenic infections. Many species of VS are difficult to differentiate by phenotypic traits. An oligonucleotide array based on 16S-23S rRNA gene intergenic spacer (ITS) sequences was developed to identify 11 clinically relevant VS. These 11 species were Streptococcus anginosus, S. constellatus, S. gordonii, S. intermedius, S. mitis, S. mutans, S. oralis, S. parasanguinis, S. salivarius, S. sanguinis, and S. uberis. The method consisted of PCR amplification of the ITS regions by using a pair of universal primers, followed by hybridization of the digoxigenin-labeled PCR products to a panel of species-specific oligonucleotides immobilized on a nylon membrane. After 120 strains of the 11 species of VG and 91 strains of other bacteria were tested, the sensitivity and specificity of the oligonucleotide array were found to be 100% (120 of 120 strains) and 95.6% (87 of 91 strains), respectively. S. pneumoniae cross-hybridized to the probes used for the identification of S. mitis, and simple biochemical tests such as optochin susceptibility or bile solubility should be used to differentiate S. pneumoniae from S. mitis. In conclusion, identification of species of VS by use of the present oligonucleotide array is accurate and could be used as an alternative reliable method for species identification of strains of VS.
Lindholm, Marie W; Elmén, Joacim; Fisker, Niels; Hansen, Henrik F; Persson, Robert; Møller, Marianne R; Rosenbohm, Christoph; Ørum, Henrik; Straarup, Ellen M; Koch, Troels
2012-02-01
Proprotein convertase subtilisin/kexin type 9 (PCSK9) has emerged as a therapeutic target for the reduction of low-density lipoprotein cholesterol (LDL-C). PCSK9 increases the degradation of the LDL receptor, resulting in high LDL-C in individuals with high PCSK9 activity. Here, we show that two locked nucleic acid (LNA) antisense oligonucleotides targeting PCSK9 produce sustained reduction of LDL-C in nonhuman primates after a loading dose (20 mg/kg) and four weekly maintenance doses (5 mg/kg). PCSK9 messenger RNA (mRNA) and serum PCSK9 protein were reduced by 85% which resulted in a 50% reduction in circulating LDL-C. Serum total cholesterol (TC) levels were reduced to the same extent as LDL-C with no reduction in high-density lipoprotein levels, demonstrating a specific pharmacological effect on LDL-C. The reduction in hepatic PCSK9 mRNA correlated with liver LNA oligonucleotide content. This verified that anti-PCSK9 LNA oligonucleotides regulated LDL-C through an antisense mechanism. The compounds were well tolerated with no observed effects on toxicological parameters (liver and kidney histology, alanine aminotransferase, aspartate aminotransferase, urea, and creatinine). The pharmacologic evidence and initial safety profile of the compounds used in this study indicate that LNA antisense oligonucleotides targeting PCSK9 provide a viable therapeutic strategy and are potential complements to statins in managing high LDL-C.
2007-05-01
AD_________________ Award Number: W81XWH-04-1-0183 TITLE: Mechanistic Studies of Oligonucleotide...Ph.D. CONTRACTING ORGANIZATION: University of Louisville...Louisville, KY 40292-0001 REPORT DATE: May 2007 TYPE OF REPORT: Final PREPARED FOR: U.S. Army Medical Research and Materiel Command
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yeo, Hyun Koo; Lee, Jae Young
2012-04-18
The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapor diffusion and diffracted to 2.8 {angstrom} resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 {angstrom}, {alpha} = 91.37, {beta} = 93.21, {gamma} = 92.35{sup o}.
Yeo, Hyun Koo; Lee, Jae Young
2010-05-01
The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapour diffusion and diffracted to 2.8 A resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 A, alpha = 91.37, beta = 93.21, gamma = 92.35 degrees .
USDA-ARS?s Scientific Manuscript database
We have evaluated the new Swine Protein-Annotated Oligonucleotide Microarray (http://www.pigoligoarray.org) by analyzing transcriptional profiles for longissimus dorsi muscle (LD), Bronchial lymph node (BLN) and Lung. Four LD samples were used to assess the stringency of hybridization conditions com...
Chiaruttini, C; Expert-Bezançon, A; Hayes, D; Ehresmann, B
1982-01-01
1-ethyl-3-dimethyl aminopropylcarbodiimide (EDC) was used to cross-link 30S ribosomal proteins to 16S rRNA within the E. coli 3OS ribosomal subunit. Covalently linked complexes containing 30S proteins and 16S rRNA, isolated by sedimentation of dissociated crosslinked 30S subunits through SDS containing sucrose gradients, were digested with RNase T1, and the resulting oligonucleotide-protein complexes were fractionated on SDS containing polyacrylamide gels. Eluted complexes containing 30S proteins S9 and S12 linked to oligonucleotides were obtained in pure form. Oligonucleotide 5'terminal labelling was successful in the case of S12 containing but not of the S9 containing complex and led to identification of the S12 bound oligonucleotide as CAACUCG which is located at positions 1316-1322 in the 16S rRNA sequence. Protein S12 is crosslinked to the terminal G of this heptanucleotide. Images PMID:6760129
Rant, Ulrich; Arinaga, Kenji; Fujita, Shozo; Yokoyama, Naoki; Abstreiter, Gerhard; Tornow, Marc
2004-11-09
We present optical investigations on the conformation of oligonucleotide layers on Au surfaces. Our studies concentrate on the effect of varying surface coverage densities on the structural properties of layers of 12- and 24mer single-stranded DNA, tethered to the Au surface at one end while being labeled with a fluorescent marker at the opposing end. The distance-dependent energy transfer from the marker dye to the metal surface, which causes quenching of the observed fluorescence, is used to provide information on the orientation of the DNA strands relative to the surface. Variations in the oligonucleotide coverage density, as determined from electrochemical quantification, over 2 orders of magnitude are achieved by employing different preparation conditions. The observed enhancement in fluorescence intensity with increasing DNA coverage can be related to a model involving mutual steric interactions of oligonucleotides on the surface, as well as fluorescence quenching theory. Finally, the applicability of the presented concepts for investigations of heterogeneous monolayers is demonstrated by means of studying the coadsorption of mercaptohexanol onto DNA-modified Au surfaces.
Akagi, H; Patton, D E; Miledi, R
1989-01-01
Three synthetic oligodeoxynucleotides complementary to different parts of an RNA encoding a glycine receptor subunit were used to discriminate heterogenous mRNAs coding for glycine receptors in adult and neonatal rat spinal cord. Injection of the three antisense oligonucleotides into Xenopus oocytes specifically inhibited the expression of glycine receptors by adult spinal cord mRNA. In contrast, the antisense oligonucleotides were much less potent in inhibiting the expression of glycine receptors encoded by neonatal spinal cord mRNA. Northern blot analysis revealed that the oligonucleotides hybridized mostly to an adult cord transcript of approximately 10 kilobases in size. This band was also present in neonatal spinal cord mRNA but its density was about one-fourth of the adult cord message. There was no intense band in the low molecular weight position (approximately 2 kilobases), the existence of which was expected from electrophysiological studies with size-fractionated mRNA of neonatal spinal cord. Our results suggest that in the rat spinal cord there are at least three different types of mRNAs encoding functional strychnine-sensitive glycine receptors. Images PMID:2479016
Use of continuous/contiguous stacking hybridization as a diagnostic tool
Mirzabekov, Andrei Darievich; Kirillov, Eugene Vladislavovich; Parinov, Sergei Valeryevich; Barski, Victor Evgenievich; Dubiley, Svetlana Alekseevna
2002-01-01
A method for detecting disease-associated alleles in patient genetic material is provided whereby a first group of oligonucleotide molecules, synthesized to compliment base sequences of the disease associated alleles is immobilized on a predetermined position on a substrate, and then contacted with patient genetic material to form duplexes. The duplexes are then contacted with a second group of oligonucleotide molecules which are synthesized to extend the predetermined length of the oligonucleotide molecules of the first group, and where each of the oligonucleotide molecules of the second group are tagged and either incorporate universal bases or a mixture of guanine, cytosine, thymine, and adenine, or complementary nucleotide strands that are tagged with a different fluorochrome which radiates light at a predetermined wavelength. The treated substrate is then washed and the light patterns radiating therefrom are compared with predetermined light patterns of various diseases that were prepared on identical substrates. A method is also provided for determining the length of a repeat sequence in DNA or RNA, and also for determining the base sequence of unknown DNA or RNA.
Use of continuous/contiguous stacking hybridization as a diagnostic tool
Mirzabekov, Andrei Darievich; Kirillov, Eugene Vladislavovich; Parinov, Sergei Valeryevich; Barski, Victor Evgenievich; Dubiley, Svetlana Alekseevna
2000-01-01
A method for detecting disease-associated alleles in patient genetic material is provided whereby a first group of oligonucleotide molecules, synthesized to compliment base sequences of the disease associated alleles is immobilized on a predetermined position on a substrate, and then contacted with patient genetic material to form duplexes. The duplexes are then contacted with a second group of oligonucleotide molecules which are synthesized to extend the predetermined length of the oligonucleotide molecules of the first group, and where each of the oligonucleotide molecules of the second group are tagged and either incorporate universal bases or a mixture of guanine, cytosine, thymine, and adenine, or complementary nucleotide strands that are tagged with a different fluorochrome which radiates light at a predetermined wavelength. The treated substrate is then washed and the light patterns radiating therefrom are compared with predetermined light patterns of various diseases that were prepared on identical substrates. A method is also provided for determining the length of a repeat sequence in DNA or RNA, and also for determining the base sequence of unknown DNA or RNA.
Tran, Tuan; Childs-Disney, Jessica L; Liu, Biao; Guan, Lirui; Rzuczek, Suzanne; Disney, Matthew D
2014-04-18
We designed small molecules that bind the structure of the RNA that causes fragile X-associated tremor ataxia syndrome (FXTAS), an incurable neuromuscular disease. FXTAS is caused by an expanded r(CGG) repeat (r(CGG)(exp)) that inactivates a protein regulator of alternative pre-mRNA splicing. Our designed compounds modulate r(CGG)(exp) toxicity in cellular models of FXTAS, and pull-down experiments confirm that they bind r(CGG)(exp) in vivo. Importantly, compound binding does not affect translation of the downstream open reading frame (ORF). We compared molecular recognition properties of our optimal compound to oligonucleotides. Studies show that r(CGG)(exp)'s self-structure is a significant energetic barrier for oligonucleotide binding. A fully modified 2'-OMethyl phosphorothioate is incapable of completely reversing an FXTAS-associated splicing defect and inhibits translation of the downstream ORF, which could have deleterious effects. Taken together, these studies suggest that a small molecule that recognizes structure may be more well suited for targeting highly structured RNAs that require strand invasion by a complementary oligonucleotide.
2015-01-01
We designed small molecules that bind the structure of the RNA that causes fragile X-associated tremor ataxia syndrome (FXTAS), an incurable neuromuscular disease. FXTAS is caused by an expanded r(CGG) repeat (r(CGG)exp) that inactivates a protein regulator of alternative pre-mRNA splicing. Our designed compounds modulate r(CGG)exp toxicity in cellular models of FXTAS, and pull-down experiments confirm that they bind r(CGG)expin vivo. Importantly, compound binding does not affect translation of the downstream open reading frame (ORF). We compared molecular recognition properties of our optimal compound to oligonucleotides. Studies show that r(CGG)exp’s self-structure is a significant energetic barrier for oligonucleotide binding. A fully modified 2′-OMethyl phosphorothioate is incapable of completely reversing an FXTAS-associated splicing defect and inhibits translation of the downstream ORF, which could have deleterious effects. Taken together, these studies suggest that a small molecule that recognizes structure may be more well suited for targeting highly structured RNAs that require strand invasion by a complementary oligonucleotide. PMID:24506227
Analytical Devices Based on Direct Synthesis of DNA on Paper.
Glavan, Ana C; Niu, Jia; Chen, Zhen; Güder, Firat; Cheng, Chao-Min; Liu, David; Whitesides, George M
2016-01-05
This paper addresses a growing need in clinical diagnostics for parallel, multiplex analysis of biomarkers from small biological samples. It describes a new procedure for assembling arrays of ssDNA and proteins on paper. This method starts with the synthesis of DNA oligonucleotides covalently linked to paper and proceeds to assemble microzones of DNA-conjugated paper into arrays capable of simultaneously capturing DNA, DNA-conjugated protein antigens, and DNA-conjugated antibodies. The synthesis of ssDNA oligonucleotides on paper is convenient and effective with 32% of the oligonucleotides cleaved and eluted from the paper substrate being full-length by HPLC for a 32-mer. These ssDNA arrays can be used to detect fluorophore-linked DNA oligonucleotides in solution, and as the basis for DNA-directed assembly of arrays of DNA-conjugated capture antibodies on paper, detect protein antigens by sandwich ELISAs. Paper-anchored ssDNA arrays with different sequences can be used to assemble paper-based devices capable of detecting DNA and antibodies in the same device and enable simple microfluidic paper-based devices.
Method for performing site-specific affinity fractionation for use in DNA sequencing
Mirzabekov, Andrei Darievich; Lysov, Yuri Petrovich; Dubley, Svetlana A.
1999-01-01
A method for fractionating and sequencing DNA via affinity interaction is provided comprising contacting cleaved DNA to a first array of oligonucleotide molecules to facilitate hybridization between said cleaved DNA and the molecules; extracting the hybridized DNA from the molecules; contacting said extracted hybridized DNA with a second array of oligonucleotide molecules, wherein the oligonucleotide molecules in the second array have specified base sequences that are complementary to said extracted hybridized DNA; and attaching labeled DNA to the second array of oligonucleotide molecules, wherein the labeled re-hybridized DNA have sequences that are complementary to the oligomers. The invention further provides a method for performing multi-step conversions of the chemical structure of compounds comprising supplying an array of polyacrylamide vessels separated by hydrophobic surfaces; immobilizing a plurality of reactants, such as enzymes, in the vessels so that each vessel contains one reactant; contacting the compounds to each of the vessels in a predetermined sequence and for a sufficient time to convert the compounds to a desired state; and isolating the converted compounds from said array.
Mirzabekov, Andrei Darievich; Lysov, Yuri Petrovich; Dubley, Svetlana A.
2000-01-01
A method for fractionating and sequencing DNA via affinity interaction is provided comprising contacting cleaved DNA to a first array of oligonucleotide molecules to facilitate hybridization between said cleaved DNA and the molecules; extracting the hybridized DNA from the molecules; contacting said extracted hybridized DNA with a second array of oligonucleotide molecules, wherein the oligonucleotide molecules in the second array have specified base sequences that are complementary to said extracted hybridized DNA; and attaching labeled DNA to the second array of oligonucleotide molecules, wherein the labeled re-hybridized DNA have sequences that are complementary to the oligomers. The invention further provides a method for performing multi-step conversions of the chemical structure of compounds comprising supplying an array of polyacrylamide vessels separated by hydrophobic surfaces; immobilizing a plurality of reactants, such as enzymes, in the vessels so that each vessel contains one reactant; contacting the compounds to each of the vessels in a predetermined sequence and for a sufficient time to convert the compounds to a desired state; and isolating the converted compounds from said array.
G-Quadruplex Forming Oligonucleotides as Anti-HIV Agents.
Musumeci, Domenica; Riccardi, Claudia; Montesarchio, Daniela
2015-09-22
Though a variety of different non-canonical nucleic acids conformations have been recognized, G-quadruplex structures are probably the structural motifs most commonly found within known oligonucleotide-based aptamers. This could be ascribed to several factors, as their large conformational diversity, marked responsiveness of their folding/unfolding processes to external stimuli, high structural compactness and chemo-enzymatic and thermodynamic stability. A number of G-quadruplex-forming oligonucleotides having relevant in vitro anti-HIV activity have been discovered in the last two decades through either SELEX or rational design approaches. Improved aptamers have been obtained by chemical modifications of natural oligonucleotides, as terminal conjugations with large hydrophobic groups, replacement of phosphodiester linkages with phosphorothioate bonds or other surrogates, insertion of base-modified monomers, etc. In turn, detailed structural studies have elucidated the peculiar architectures adopted by many G-quadruplex-based aptamers and provided insight into their mechanism of action. An overview of the state-of-the-art knowledge of the relevance of putative G-quadruplex forming sequences within the viral genome and of the most studied G-quadruplex-forming aptamers, selectively targeting HIV proteins, is here presented.
Formation of oligonucleotide adducts in pharmaceutical formulations.
Krotz, Achim H; Gaus, Hans; Hardee, Gregory E
2005-01-01
During preformulation studies, we observed that oligonucleotide extracted from topical formulations contained considerable amounts of covalently modified oligonucleotide adducts. In this report, we describe the identification and characterization of reaction products that form when PS-oligodeoxyribonucleotide ISIS 2302 (1) is brought into contact with aqueous solutions of glycerol-derived excipients. Compatibility tests showed that the presence of certain glycerides in the formulation lead to adduct formation (1+58x amu, 1+72x amu, 1+58x+72y amu, x, and y are the number of modifications on one oligonucleotide strand). No adduct formation was observed in the presence of triglycerides or propylene glycol-derived excipients used in the study. Using nucleosides as model compounds, two modifications of deoxyguanosine were isolated by preparative reversed phase (RP)-high pressure liquid chromatography (HPLC) and characterized by nuclear magnetic resonance (NMR) and HPLC-mass spectrometry (MS). Modifications were identified as N2-(1-carboxymethyl)- and N2-(1-carboxyethyl) derivatives of 2'-deoxyguanosine. The mechanism of formation of these adducts may involve advanced glycation reactions possibly caused by excipient impurities or degradation products such as glyceraldehyde or glyceraldehyde derivatives.
Regulation of the activity of the promoter of RNA-induced silencing, C3PO.
Sahu, Shriya; Williams, Leo; Perez, Alberto; Philip, Finly; Caso, Giuseppe; Zurawsky, Walter; Scarlata, Suzanne
2017-09-01
RNA-induced silencing is a process which allows cells to regulate the synthesis of specific proteins. RNA silencing is promoted by the protein C3PO (component 3 of RISC). We have previously found that phospholipase Cβ, which increases intracellular calcium levels in response to specific G protein signals, inhibits C3PO activity towards certain genes. Understanding the parameters that control C3PO activity and which genes are impacted by G protein activation would help predict which genes are more vulnerable to downregulation. Here, using a library of 10 18 oligonucleotides, we show that C3PO binds oligonucleotides with structural specificity but little sequence specificity. Alternately, C3PO hydrolyzes oligonucleotides with a rate that is sensitive to substrate stability. Importantly, we find that oligonucleotides with higher Tm values are inhibited by bound PLCβ. This finding is supported by microarray analysis in cells over-expressing PLCβ1. Taken together, this study allows predictions of the genes whose post-transcriptional regulation is responsive to the G protein/phospholipase Cβ/calcium signaling pathway. © 2017 The Protein Society.
Assembly of a biocompatible triazole-linked gene by one-pot click-DNA ligation
NASA Astrophysics Data System (ADS)
Kukwikila, Mikiembo; Gale, Nittaya; El-Sagheer, Afaf H.; Brown, Tom; Tavassoli, Ali
2017-11-01
The chemical synthesis of oligonucleotides and their enzyme-mediated assembly into genes and genomes has significantly advanced multiple scientific disciplines. However, these approaches are not without their shortcomings; enzymatic amplification and ligation of oligonucleotides into genes and genomes makes automation challenging, and site-specific incorporation of epigenetic information and/or modified bases into large constructs is not feasible. Here we present a fully chemical one-pot method for the assembly of oligonucleotides into a gene by click-DNA ligation. We synthesize the 335 base-pair gene that encodes the green fluorescent protein iLOV from ten functionalized oligonucleotides that contain 5ʹ-azide and 3ʹ-alkyne units. The resulting click-linked iLOV gene contains eight triazoles at the sites of chemical ligation, and yet is fully biocompatible; it is replicated by DNA polymerases in vitro and encodes a functional iLOV protein in Escherichia coli. We demonstrate the power and potential of our one-pot gene-assembly method by preparing an epigenetically modified variant of the iLOV gene.
Smith, Lindsay D.; Dickinson, Rachel L.; Lucas, Christian M.; Cousins, Alex; Malygin, Alexey A.; Weldon, Carika; Perrett, Andrew J.; Bottrill, Andrew R.; Searle, Mark S.; Burley, Glenn A.; Eperon, Ian C.
2014-01-01
Summary The use of oligonucleotides to activate the splicing of selected exons is limited by a poor understanding of the mechanisms affected. A targeted bifunctional oligonucleotide enhancer of splicing (TOES) anneals to SMN2 exon 7 and carries an exonic splicing enhancer (ESE) sequence. We show that it stimulates splicing specifically of intron 6 in the presence of repressing sequences in intron 7. Complementarity to the 5′ end of exon 7 increases U2AF65 binding, but the ESE sequence is required for efficient recruitment of U2 snRNP. The ESE forms at least three coexisting discrete states: a quadruplex, a complex containing only hnRNP F/H, and a complex enriched in the activator SRSF1. Neither hnRNP H nor quadruplex formation contributes to ESE activity. The results suggest that splicing limited by weak signals can be rescued by rapid exchange of TOES oligonucleotides in various complexes and raise the possibility that SR proteins associate transiently with ESEs. PMID:25263560
Carlsson, Nils; Winge, Ann-Sofie; Engström, Sven; Akerman, Björn
2005-10-06
We used a cubic liquid crystal formed by the nonionic monoglyceride monoolein and water as a porous matrix for the electrophoresis of oligonucleotides. The diamond cubic phase is thermodynamically stable when in contact with a water-rich phase, which we exploit to run the electrophoresis in the useful submarine mode. Oligonucleotides are separated according to size and secondary structure by migration through the space-filling aqueous nanometer pores of the regular liquid crystal, but the comparatively slow migration means the cubic phase will not be a replacement for the conventional DNA gels. However, our demonstration that the cubic phase can be used in submarine electrophoresis opens up the possibility for a new matrix for electrophoresis of amphiphilic molecules. From this perspective, the results on the oligonucleotides show that water-soluble particles of nanometer size, typical for the hydrophilic parts of membrane-bound proteins, may be a useful separation motif. A charged contamination in the commercial sample of monoolein, most likely oleic acid that arises from its hydrolysis, restricts useful buffer conditions to a pH below 5.6.
Method for performing site-specific affinity fractionation for use in DNA sequencing
Mirzabekov, A.D.; Lysov, Y.P.; Dubley, S.A.
1999-05-18
A method for fractionating and sequencing DNA via affinity interaction is provided comprising contacting cleaved DNA to a first array of oligonucleotide molecules to facilitate hybridization between the cleaved DNA and the molecules; extracting the hybridized DNA from the molecules; contacting the extracted hybridized DNA with a second array of oligonucleotide molecules, wherein the oligonucleotide molecules in the second array have specified base sequences that are complementary to the extracted hybridized DNA; and attaching labeled DNA to the second array of oligonucleotide molecules, wherein the labeled re-hybridized DNA have sequences that are complementary to the oligomers. The invention further provides a method for performing multi-step conversions of the chemical structure of compounds comprising supplying an array of polyacrylamide vessels separated by hydrophobic surfaces; immobilizing a plurality of reactants, such as enzymes, in the vessels so that each vessel contains one reactant; contacting the compounds to each of the vessels in a predetermined sequence and for a sufficient time to convert the compounds to a desired state; and isolating the converted compounds from the array. 14 figs.
Grineva, N I; Borovkova, T V; Sats, N V; Kurabekova, R M; Rozhitskaia, O S; Solov'ev, G Ia; Pantin, V I
1995-08-01
G11 mouse cells and SH2 rat cells transformed with simian adenovirus SA7 DNA showed inheritable oncogen-specific phenotypic normalization when treated with sense and antisense oligonucleotides complementary to long RNA sequences, plus or minus strands of the integrated adenovirus oncogenes E1A and E1B. Transitory treatment of the cells with the oligonucleotides in the absence of serum was shown to cause the appearance of normalized cell lines with fibroblastlike morphology, slower cell proliferation, and lack of ability to form colonies in soft agar. Proliferative activity and adhesion of the normalized cells that established cell lines were found to depend on the concentration of growth factors in the cultural medium. In some of the cell lines, an inhibition of transcription of the E1 oncogenes was observed. The normalization also produced cells that divided 2 - 5 times and died and cells that reverted to a transformed phenotype in 2 - 10 days. The latter appeared predominantly upon the action of the antisense oligonucleotides.
Particle-Based Microarrays of Oligonucleotides and Oligopeptides.
Nesterov-Mueller, Alexander; Maerkle, Frieder; Hahn, Lothar; Foertsch, Tobias; Schillo, Sebastian; Bykovskaya, Valentina; Sedlmayr, Martyna; Weber, Laura K; Ridder, Barbara; Soehindrijo, Miriam; Muenster, Bastian; Striffler, Jakob; Bischoff, F Ralf; Breitling, Frank; Loeffler, Felix F
2014-10-28
In this review, we describe different methods of microarray fabrication based on the use of micro-particles/-beads and point out future tendencies in the development of particle-based arrays. First, we consider oligonucleotide bead arrays, where each bead is a carrier of one specific sequence of oligonucleotides. This bead-based array approach, appearing in the late 1990s, enabled high-throughput oligonucleotide analysis and had a large impact on genome research. Furthermore, we consider particle-based peptide array fabrication using combinatorial chemistry. In this approach, particles can directly participate in both the synthesis and the transfer of synthesized combinatorial molecules to a substrate. Subsequently, we describe in more detail the synthesis of peptide arrays with amino acid polymer particles, which imbed the amino acids inside their polymer matrix. By heating these particles, the polymer matrix is transformed into a highly viscous gel, and thereby, imbedded monomers are allowed to participate in the coupling reaction. Finally, we focus on combinatorial laser fusing of particles for the synthesis of high-density peptide arrays. This method combines the advantages of particles and combinatorial lithographic approaches.
Particle-Based Microarrays of Oligonucleotides and Oligopeptides
Nesterov-Mueller, Alexander; Maerkle, Frieder; Hahn, Lothar; Foertsch, Tobias; Schillo, Sebastian; Bykovskaya, Valentina; Sedlmayr, Martyna; Weber, Laura K.; Ridder, Barbara; Soehindrijo, Miriam; Muenster, Bastian; Striffler, Jakob; Bischoff, F. Ralf; Breitling, Frank; Loeffler, Felix F.
2014-01-01
In this review, we describe different methods of microarray fabrication based on the use of micro-particles/-beads and point out future tendencies in the development of particle-based arrays. First, we consider oligonucleotide bead arrays, where each bead is a carrier of one specific sequence of oligonucleotides. This bead-based array approach, appearing in the late 1990s, enabled high-throughput oligonucleotide analysis and had a large impact on genome research. Furthermore, we consider particle-based peptide array fabrication using combinatorial chemistry. In this approach, particles can directly participate in both the synthesis and the transfer of synthesized combinatorial molecules to a substrate. Subsequently, we describe in more detail the synthesis of peptide arrays with amino acid polymer particles, which imbed the amino acids inside their polymer matrix. By heating these particles, the polymer matrix is transformed into a highly viscous gel, and thereby, imbedded monomers are allowed to participate in the coupling reaction. Finally, we focus on combinatorial laser fusing of particles for the synthesis of high-density peptide arrays. This method combines the advantages of particles and combinatorial lithographic approaches. PMID:27600347
Philipp, Katrin; Riedel, Frank; Germann, Günter; Hörmann, Karl; Sauerbier, Michael
2005-02-01
The pathology of chronic dermal ulcers is characterized by excessive proteolytic activity which degrades extracellular matrix. The transforming growth factor-beta (TGF-beta) has been identified as an important component of wound healing. Recent developments in molecular therapy offer exciting prospects for the modulation of wound healing, specifically those targeting TGF-beta. We investigated the effect of TGF-beta antisense oligonucleotides on the mRNA expression of matrix metalloproteinases in cultured human keratinocytes, fibroblasts and endothelial cells using multiplex RT-PCR. The treatment of keratinocytes and fibroblasts with TGF-beta antisense oligonucleotides resulted in a significant decrease of expression of mRNA of MMP-1 and MMP-9 compared to controls. Accordingly, a decreased expression of MMP-1 mRNA in endothelial cells was detectable. Other MMPs were not affected. Affecting all dermal wound-healing-related cell types, TGF-beta antisense oligonucleotide technology may be a potential therapeutic option for the inhibition of proteolytic tissue destruction in chronic wounds. Pharmaceutical intervention in this area ultimately may help clinicians to proactively intervene in an effort to prevent normal wounds from becoming chronic.
Das, Ushati; Wang, Li Kai; Smith, Paul; Jacewicz, Agata; Shuman, Stewart
2014-01-01
Clostridium thermocellum polynucleotide kinase (CthPnk), the 5' end-healing module of a bacterial RNA repair system, catalyzes reversible phosphoryl transfer from an NTP donor to a 5'-OH polynucleotide acceptor. Here we report the crystal structures of CthPnk-D38N in a Michaelis complex with GTP•Mg(2+) and a 5'-OH oligonucleotide and a product complex with GDP•Mg(2+) and a 5'-PO4 oligonucleotide. The O5' nucleophile is situated 3.0 Å from the GTP γ phosphorus in the Michaelis complex, where it is coordinated by Asn38 and is apical to the bridging β phosphate oxygen of the GDP leaving group. In the product complex, the transferred phosphate has undergone stereochemical inversion and Asn38 coordinates the 5'-bridging phosphate oxygen of the oligonucleotide. The D38N enzyme is poised for catalysis, but cannot execute because it lacks Asp38-hereby implicated as the essential general base catalyst that abstracts a proton from the 5'-OH during the kinase reaction. Asp38 serves as a general acid catalyst during the 'reverse kinase' reaction by donating a proton to the O5' leaving group of the 5'-PO4 strand. The acceptor strand binding mode of CthPnk is distinct from that of bacteriophage T4 Pnk.
High-Throughput Identification of Combinatorial Ligands for DNA Delivery in Cell Culture
NASA Astrophysics Data System (ADS)
Svahn, Mathias G.; Rabe, Kersten S.; Barger, Geoffrey; EL-Andaloussi, Samir; Simonson, Oscar E.; Didier, Boturyn; Olivier, Renaudet; Dumy, Pascal; Brandén, Lars J.; Niemeyer, Christof M.; Smith, C. I. Edvard
2008-10-01
Finding the optimal combinations of ligands for tissue-specific delivery is tedious even if only a few well-established compounds are tested. The cargo affects the receptor-ligand interaction, especially when it is charged like DNA. The ligand should therefore be evaluated together with its cargo. Several viruses have been shown to interact with more than one receptor, for efficient internalization. We here present a DNA oligonucleotide-based method for inexpensive and rapid screening of biotin labeled ligands for combinatorial effects on cellular binding and uptake. The oligonucleotide complex was designed as a 44 bp double-stranded DNA oligonucleotide with one central streptavidin molecule and a second streptavidin at the terminus. The use of a highly advanced robotic platform ensured stringent processing and execution of the experiments. The oligonucleotides were fluorescently labeled and used for detection and analysis of cell-bound, internalized and intra-cellular compartmentalized constructs by an automated line-scanning confocal microscope, IN Cell Analyzer 3000. All possible combinations of 22 ligands were explored in sets of 2 and tested on 6 different human cell lines in triplicates. In total, 10 000 transfections were performed on the automation platform. Cell-specific combinations of ligands were identified and their relative position on the scaffold oligonucleotide was found to be of importance. The ligands were found to be cargo dependent, carbohydrates were more potent for DNA delivery whereas cell penetrating peptides were more potent for delivery of less charged particles.
Yoga, Yano M. K.; Traore, Daouda A. K.; Sidiqi, Mahjooba; Szeto, Chris; Pendini, Nicole R.; Barker, Andrew; Leedman, Peter J.; Wilce, Jacqueline A.; Wilce, Matthew C. J.
2012-01-01
Poly-C-binding proteins are triple KH (hnRNP K homology) domain proteins with specificity for single stranded C-rich RNA and DNA. They play diverse roles in the regulation of protein expression at both transcriptional and translational levels. Here, we analyse the contributions of individual αCP1 KH domains to binding C-rich oligonucleotides using biophysical and structural methods. Using surface plasmon resonance (SPR), we demonstrate that KH1 makes the most stable interactions with both RNA and DNA, KH3 binds with intermediate affinity and KH2 only interacts detectibly with DNA. The crystal structure of KH1 bound to a 5′-CCCTCCCT-3′ DNA sequence shows a 2:1 protein:DNA stoichiometry and demonstrates a molecular arrangement of KH domains bound to immediately adjacent oligonucleotide target sites. SPR experiments, with a series of poly-C-sequences reveals that cytosine is preferred at all four positions in the oligonucleotide binding cleft and that a C-tetrad binds KH1 with 10 times higher affinity than a C-triplet. The basis for this high affinity interaction is finally detailed with the structure determination of a KH1.W.C54S mutant bound to 5′-ACCCCA-3′ DNA sequence. Together, these data establish the lead role of KH1 in oligonucleotide binding by αCP1 and reveal the molecular basis of its specificity for a C-rich tetrad. PMID:22344691
Yoga, Yano M K; Traore, Daouda A K; Sidiqi, Mahjooba; Szeto, Chris; Pendini, Nicole R; Barker, Andrew; Leedman, Peter J; Wilce, Jacqueline A; Wilce, Matthew C J
2012-06-01
Poly-C-binding proteins are triple KH (hnRNP K homology) domain proteins with specificity for single stranded C-rich RNA and DNA. They play diverse roles in the regulation of protein expression at both transcriptional and translational levels. Here, we analyse the contributions of individual αCP1 KH domains to binding C-rich oligonucleotides using biophysical and structural methods. Using surface plasmon resonance (SPR), we demonstrate that KH1 makes the most stable interactions with both RNA and DNA, KH3 binds with intermediate affinity and KH2 only interacts detectibly with DNA. The crystal structure of KH1 bound to a 5'-CCCTCCCT-3' DNA sequence shows a 2:1 protein:DNA stoichiometry and demonstrates a molecular arrangement of KH domains bound to immediately adjacent oligonucleotide target sites. SPR experiments, with a series of poly-C-sequences reveals that cytosine is preferred at all four positions in the oligonucleotide binding cleft and that a C-tetrad binds KH1 with 10 times higher affinity than a C-triplet. The basis for this high affinity interaction is finally detailed with the structure determination of a KH1.W.C54S mutant bound to 5'-ACCCCA-3' DNA sequence. Together, these data establish the lead role of KH1 in oligonucleotide binding by αCP1 and reveal the molecular basis of its specificity for a C-rich tetrad.
nuID: a universal naming scheme of oligonucleotides for Illumina, Affymetrix, and other microarrays
Du, Pan; Kibbe, Warren A; Lin, Simon M
2007-01-01
Background Oligonucleotide probes that are sequence identical may have different identifiers between manufacturers and even between different versions of the same company's microarray; and sometimes the same identifier is reused and represents a completely different oligonucleotide, resulting in ambiguity and potentially mis-identification of the genes hybridizing to that probe. Results We have devised a unique, non-degenerate encoding scheme that can be used as a universal representation to identify an oligonucleotide across manufacturers. We have named the encoded representation 'nuID', for nucleotide universal identifier. Inspired by the fact that the raw sequence of the oligonucleotide is the true definition of identity for a probe, the encoding algorithm uniquely and non-degenerately transforms the sequence itself into a compact identifier (a lossless compression). In addition, we added a redundancy check (checksum) to validate the integrity of the identifier. These two steps, encoding plus checksum, result in an nuID, which is a unique, non-degenerate, permanent, robust and efficient representation of the probe sequence. For commercial applications that require the sequence identity to be confidential, we have an encryption schema for nuID. We demonstrate the utility of nuIDs for the annotation of Illumina microarrays, and we believe it has universal applicability as a source-independent naming convention for oligomers. Reviewers This article was reviewed by Itai Yanai, Rong Chen (nominated by Mark Gerstein), and Gregory Schuler (nominated by David Lipman). PMID:17540033
Pickard, Mark R.; Williams, Gwyn T.
2016-01-01
Growth arrest-specific 5 (GAS5) lncRNA promotes apoptosis, and its expression is down-regulated in breast cancer. GAS5 lncRNA is a decoy of glucocorticoid/related receptors; a stem-loop sequence constitutes the GAS5 hormone response element mimic (HREM), which is essential for the regulation of breast cancer cell apoptosis. This preclinical study aimed to determine if the GAS5 HREM sequence alone promotes the apoptosis of breast cancer cells. Nucleofection of hormone-sensitive and –insensitive breast cancer cell lines with a GAS5 HREM DNA oligonucleotide increased both basal and ultraviolet-C-induced apoptosis, and decreased culture viability and clonogenic growth, similar to GAS5 lncRNA. The HREM oligonucleotide demonstrated similar sequence specificity to the native HREM for its functional activity and had no effect on endogenous GAS5 lncRNA levels. Certain chemically modified HREM oligonucleotides, notably DNA and RNA phosphorothioates, retained pro-apoptotic. activity. Crucially the HREM oligonucleotide could overcome apoptosis resistance secondary to deficient endogenous GAS5 lncRNA levels. Thus, the GAS5 lncRNA HREM sequence alone is sufficient to induce apoptosis in breast cancer cells, including triple-negative breast cancer cells. These findings further suggest that emerging knowledge of structure/function relationships in the field of lncRNA biology can be exploited for the development of entirely novel, oligonucleotide mimic-based, cancer therapies. PMID:26862727
Hirashima, Kyotaro; Seimiya, Hiroyuki
2015-02-27
Telomere erosion causes cell mortality, suggesting that longer telomeres enable more cell divisions. In telomerase-positive human cancer cells, however, telomeres are often kept shorter than those of surrounding normal tissues. Recently, we showed that cancer cell telomere elongation represses innate immune genes and promotes their differentiation in vivo. This implies that short telomeres contribute to cancer malignancy, but it is unclear how such genetic repression is caused by elongated telomeres. Here, we report that telomeric repeat-containing RNA (TERRA) induces a genome-wide alteration of gene expression in telomere-elongated cancer cells. Using three different cell lines, we found that telomere elongation up-regulates TERRA signal and down-regulates innate immune genes such as STAT1, ISG15 and OAS3 in vivo. Ectopic TERRA oligonucleotides repressed these genes even in cells with short telomeres under three-dimensional culture conditions. This appeared to occur from the action of G-quadruplexes (G4) in TERRA, because control oligonucleotides had no effect and a nontelomeric G4-forming oligonucleotide phenocopied the TERRA oligonucleotide. Telomere elongation and G4-forming oligonucleotides showed similar gene expression signatures. Most of the commonly suppressed genes were involved in the innate immune system and were up-regulated in various cancers. We propose that TERRA G4 counteracts cancer malignancy by suppressing innate immune genes. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Zimmermann, Aleksandra; Greco, Roberto; Walker, Isabel; Horak, Jeannie; Cavazzini, Alberto; Lämmerhofer, Michael
2014-08-08
Synthetic oligonucleotides gain increasing importance in new therapeutic concepts and as probes in biological sciences. If pharmaceutical-grade purities are required, chromatographic purification using ion-pair reversed-phase chromatography is commonly carried out. However, separation selectivity for structurally closely related impurities is often insufficient, especially at high sample loads. In this study, a "mixed-mode" reversed-phase/weak anion exchanger stationary phase has been investigated as an alternative tool for chromatographic separation of synthetic oligonucleotides with minor sequence variations. The employed mixed-mode phase shows great flexibility in method development. It has been run in various gradient elution modes, viz. one, two or three parameter (mixed) gradients (altering buffer pH, buffer concentration, and organic modifier) to find optimal elution conditions and gain further insight into retention mechanisms. Compared to ion-pair reversed-phase and mere anion-exchange separation, enhanced selectivities were observed with the mixed-mode phase for 20-23 nucleotide (nt) long oligonucleotides with similar sequences. Oligonucleotides differing by 1, 2 or 3 nucleotides in length could be readily resolved and separation factors for single nucleotide replacements declined in the order Cytosine (C)/Guanine (G)>Adenine (A)/Guanine∼Guanine/Thymine (T)>Adenine/Cytosine∼Cytosine/Thymine>Adenine/Thymine. Selectivities were larger when the modification was at the 3' terminal-end, declined when it was in the middle of the sequence and was smallest when it was located at the 5' terminus. Due to the lower surface area of the 200Å pore size mixed-mode stationary phase compared to the corresponding 100Å material, lower retention times with equal selectivities under milder elution conditions were achievable. Considering high sample loading capacities of the mixed-mode anion-exchanger phase, it should have great potential for chromatographic oligonucleotide separation and purification. Copyright © 2014 Elsevier B.V. All rights reserved.
Imincan, Gülnur; Pei, Fen; Yu, Lijia; Jin, Hongwei; Zhang, Liangren; Yang, Xiaoda; Zhang, Lihe; Tang, XinJing
2016-04-19
2'-O-(1-Pyrenylmethyl)uridine modified oligoribonucleotides provide highly sensitive pyrene fluorescent probes for detecting specific nucleotide mutation of RNA targets. To develop more stable and cost-effective oligonucleotide probes, we investigated the local microenvironmental effects of nearby nucleobases on pyrene fluorescence in duplexes of RNAs and 2'-O-(1-pyrenylmethyl)uridine modified oligonucleotides. By incorporation of deoxyribonucleotides, ribonucleotides, 2'-MeO-nucleotides and 2'-F-nucleotides at both sides of 2'-O-(1-pyrenylmethyl)uridine (U(p)) in oligodeoxynucleotide probes, we synthesized a series of pyrene modified oligonucleotide probes. Their pyrene fluorescence emission spectra indicated that only two proximal nucleotides have a substantial effect on the pyrene fluorescence properties of these oligonucleotide probes hybridized with target RNA with an order of fluorescence sensitivity of 2'-F-nucleotides > 2'-MeO-nucleotides > ribonucleotides ≫ deoxyribonucleotides. While based on circular dichroism spectra, overall helix conformations (either A- or B-form) of the duplexes have marginal effects on the sensitivity of the probes. Instead, the local substitution reflected the propensity of the nucleotide sugar ring to adopt North type conformation and, accordingly, shifted their helix geometry toward a more A-type like conformation in local microenvironments. Thus, higher enhancement of pyrene fluorescence emission favored local A-type helix structures and more polar and hydrophobic environments (F > MeO > OH at 2' substitution) of duplex minor grooves of probes with the target RNA. Further dynamic simulation revealed that local microenvironmental effect of 2'-F-nucleotides or ribonucleotides was enough for pyrene moiety to move out of nucleobases to the minor groove of duplexes; in addition, 2'-F-nucleotide had less effect on π-stack of pyrene-modified uridine with upstream and downstream nucleobases. The present oligonucleotide probes successfully distinguished target RNA from single-mutated RNA analyte during an in vitro assay of RNA synthesis.
2013-01-01
Background Drop drying is a key factor in a wide range of technical applications, including spotted microarrays. The applied nL liquid volume provides specific reaction conditions for the immobilization of probe molecules to a chemically modified surface. Results We investigated the influence of nL and μL liquid drop volumes on the process of probe immobilization and compare the results obtained to the situation in liquid solution. In our data, we observe a strong relationship between drop drying effects on immobilization and surface chemistry. In this work, we present results on the immobilization of dye labeled 20mer oligonucleotides with and without an activating 5′-aminoheptyl linker onto a 2D epoxysilane and a 3D NHS activated hydrogel surface. Conclusions Our experiments identified two basic processes determining immobilization. First, the rate of drop drying that depends on the drop volume and the ambient relative humidity. Oligonucleotides in a dried spot react unspecifically with the surface and long reaction times are needed. 3D hydrogel surfaces allow for immobilization in a liquid environment under diffusive conditions. Here, oligonucleotide immobilization is much faster and a specific reaction with the reactive linker group is observed. Second, the effect of increasing probe concentration as a result of drop drying. On a 3D hydrogel, the increasing concentration of probe molecules in nL spotting volumes accelerates immobilization dramatically. In case of μL volumes, immobilization depends on whether the drop is allowed to dry completely. At non-drying conditions, very limited immobilization is observed due to the low oligonucleotide concentration used in microarray spotting solutions. The results of our study provide a general guideline for microarray assay development. They allow for the initial definition and further optimization of reaction conditions for the immobilization of oligonucleotides and other probe molecule classes to different surfaces in dependence of the applied spotting and reaction volume. PMID:23758982
Bister, K; Löliger, H C; Duesberg, P H
1979-01-01
RNA and protein of the defective avian acute leukemia virus CMII, which causes myelocytomas in chickens, and of CMII-associated helper virus (CMIIAV) were investigated. The RNA of CMII measured 6 kilobases (kb) and that of CMIIAV measured 8.5 kb. By comparing more than 20 mapped oligonucleotides of CMII RNA with mapped and nonmapped oligonucleotides of acute leukemia viruses MC29 and MH2 and with mapped oligonucleotides of CMIIAV and other nondefective avian tumor viruses, three segments were distinguished in the oligonucleotide map of CMII RNA: (i) a 5' group-specific segment of 1.5 kb which was conserved among CMII, MC29, and MH2 and also homologous with gag-related oligonucleotides of CMIIAV and other helper viruses (hence, group specific); (ii) an internal segment of 2 kb which was conserved specifically among CMII, MC29, and MH2 and whose presence in CMII lends new support to the view that this class of genetic elements is essential for oncogenicity, because it was absent from an otherwise isogenic, nontransforming helper, CMIIAV; and (iii) a 3' group-specific segment of 2.5 kb which shared 13 of 14 oligonucleotides with CMIIAV and included env oligonucleotides of other nondefective viruses of the avian tumor virus group (hence, group specific). This segment and analogous map segments of MC29 and MH2 were not conserved at the level of shared oligonucleotides. CMII-transformed cells contained a nonstructural, gag gene-related protein of 90,000 daltons, distinguished by its size from 110,000-daltom MC29 and 100,000-dalton MH2 counterparts. The gag relatedness and similarity to the 110,000-dalton MC29 counterpart indicated that the 90,000-dalton CMII protein is translated from the 5' and internal segments of CMII RNA. The existence of conserved 5' and internal RNA segments and conserved nonstructural protein products in CMII, MC29, and MH2 indicates that these viruses belong to a related group, termed here the MC29 group. Viruses of the MC29 group differ from one another mainly in their 3' RNA segments and in minor variations of their conserved RNA segments as well as by strain-specific size markers of their gag-related proteins. Because (i) the conserved 5' gag-related and internal RNA segments and their gag-related, nonvirion protein products correlate with the conserved oncogenic spectra of the MC29 group of viruses and because (ii) the internal RNA sequences and nonvirion proteins are not found in nondefective viruses, we propose that the conserved RNA and protein elements are necessary for oncogenicity and probably are the onc gene products of the MC29 group of viruses. Images PMID:232172
Identification of Brucella spp. by using the polymerase chain reaction.
Herman, L; De Ridder, H
1992-01-01
The application of two synthetic oligonucleotides as probes and as primers in the polymerase chain reaction is presented for a specific, sensitive, and quick identification of Brucella spp. The specific oligonucleotide sequences were chosen on the basis of a 16S rRNA sequence alignment between Brucella abortus and Agrobacterium tumefaciens. Images PMID:1377903
USDA-ARS?s Scientific Manuscript database
A model paramagnetic nanoparticle (MNP) assay is demonstrated for surface-enhanced Raman scattering (SERS) detection of DNA oligonucleotides derived from the West Nile virus (WNV) genome. Detection is based on the capture of WNV target sequences by hybridization with complementary oligonucleotide pr...
Microelectroporation device for genomic screening
Perroud, Thomas D.; Renzi, Ronald F.; Negrete, Oscar; Claudnic, Mark R.
2014-09-09
We have developed an microelectroporation device that combines microarrays of oligonucleotides, microfluidic channels, and electroporation for cell transfection and high-throughput screening applications (e.g. RNA interference screens). Microarrays allow the deposition of thousands of different oligonucleotides in microscopic spots. Microfluidic channels and microwells enable efficient loading of cells into the device and prevent cross-contamination between different oligonucleotides spots. Electroporation allows optimal transfection of nucleic acids into cells (especially hard-to-transfect cells such as primary cells) by minimizing cell death while maximizing transfection efficiency. This invention has the advantage of a higher throughput and lower cost, while preventing cross-contamination compared to conventional screening technologies. Moreover, this device does not require bulky robotic liquid handling equipment and is inherently safer given that it is a closed system.
Fokina, Alesya; Wang, Meiling; Ilyina, Anna; Klabenkova, Kristina; Burakova, Ekaterina; Chelobanov, Boris; Stetsenko, Dmitry
2018-06-02
Analysis and isolation of new charge-neutral phosphoryl guanidine oligonucleotides (PGO) by vertical slab electrophoresis were tested at different pH values (3-11) or in the presence of SDS as a micelle-forming agent. The most convenient way to analyze and purify phosphoryl guanidine oligonucleotides was by denaturing PAGE (8 M urea) at pH 3. The mobility of PGO is dependent on their A + C content. To analyze PGO containing only G, T or U, denaturing PAGE at pH 11 can be used, although the conditions need to be optimized. Bands were visualized by UV shadowing or Coomassie Brilliant Blue staining. Copyright © 2018. Published by Elsevier Inc.
Efficiency, error and yield in light-directed maskless synthesis of DNA microarrays
2011-01-01
Background Light-directed in situ synthesis of DNA microarrays using computer-controlled projection from a digital micromirror device--maskless array synthesis (MAS)--has proved to be successful at both commercial and laboratory scales. The chemical synthetic cycle in MAS is quite similar to that of conventional solid-phase synthesis of oligonucleotides, but the complexity of microarrays and unique synthesis kinetics on the glass substrate require a careful tuning of parameters and unique modifications to the synthesis cycle to obtain optimal deprotection and phosphoramidite coupling. In addition, unintended deprotection due to scattering and diffraction introduce insertion errors that contribute significantly to the overall error rate. Results Stepwise phosphoramidite coupling yields have been greatly improved and are now comparable to those obtained in solid phase synthesis of oligonucleotides. Extended chemical exposure in the synthesis of complex, long oligonucleotide arrays result in lower--but still high--final average yields which approach 99%. The new synthesis chemistry includes elimination of the standard oxidation until the final step, and improved coupling and light deprotection. Coupling Insertions due to stray light are the limiting factor in sequence quality for oligonucleotide synthesis for gene assembly. Diffraction and local flare are by far the largest contributors to loss of optical contrast. Conclusions Maskless array synthesis is an efficient and versatile method for synthesizing high density arrays of long oligonucleotides for hybridization- and other molecular binding-based experiments. For applications requiring high sequence purity, such as gene assembly, diffraction and flare remain significant obstacles, but can be significantly reduced with straightforward experimental strategies. PMID:22152062
Godinho, Bruno M D C; Gilbert, James W; Haraszti, Reka A; Coles, Andrew H; Biscans, Annabelle; Roux, Loic; Nikan, Mehran; Echeverria, Dimas; Hassler, Matthew; Khvorova, Anastasia
2017-12-01
Therapeutic oligonucleotides, such as small interfering RNAs (siRNAs), hold great promise for the treatment of incurable genetically defined disorders by targeting cognate toxic gene products for degradation. To achieve meaningful tissue distribution and efficacy in vivo, siRNAs must be conjugated or formulated. Clear understanding of the pharmacokinetic (PK)/pharmacodynamic behavior of these compounds is necessary to optimize and characterize the performance of therapeutic oligonucleotides in vivo. In this study, we describe a simple and reproducible methodology for the evaluation of in vivo blood/plasma PK profiles and tissue distribution of oligonucleotides. The method is based on serial blood microsampling from the saphenous vein, coupled to peptide nucleic acid hybridization assay for quantification of guide strands. Performed with minimal number of animals, this method allowed unequivocal detection and sensitive quantification without the need for amplification, or further modification of the oligonucleotides. Using this methodology, we compared plasma clearances and tissue distribution profiles of two different hydrophobically modified siRNAs (hsiRNAs). Notably, cholesterol-hsiRNA presented slow plasma clearances and mainly accumulated in the liver, whereas, phosphocholine-docosahexaenoic acid-hsiRNA was rapidly cleared from the plasma and preferably accumulated in the kidney. These data suggest that the PK/biodistribution profiles of modified hsiRNAs are determined by the chemical nature of the conjugate. Importantly, the method described in this study constitutes a simple platform to conduct pilot assessments of the basic clearance and tissue distribution profiles, which can be broadly applied for evaluation of new chemical variants of siRNAs and micro-RNAs.
NASA Technical Reports Server (NTRS)
Frank, Natia L.; Meade, Thomas J.
2003-01-01
Incorporation of metalated nucleosides into DNA through covalent modification is crucial to measurement of thermal electron-transfer rates and the dependence of these rates with structure, distance, and position. Here, we report the first synthesis of an electron donor-acceptor pair of 5' metallonucleosides and their subsequent incorporation into oligonucleotides using solid-phase DNA synthesis techniques. Large-scale syntheses of metal-containing oligonucleotides are achieved using 5' modified phosporamidites containing [Ru(acac)(2)(IMPy)](2+) (acac is acetylacetonato; IMPy is 2'-iminomethylpyridyl-2'-deoxyuridine) (3) and [Ru(bpy)(2)(IMPy)](2+) (bpy is 2,2'-bipyridine; IMPy is 2'-iminomethylpyridyl-2'-deoxyuridine) (4). Duplexes formed with the metal-containing oligonucleotides exhibit thermal stability comparable to the corresponding unmetalated duplexes (T(m) of modified duplex = 49 degrees C vs T(m) of unmodified duplex = 47 degrees C). Electrochemical (3, E(1/2) = -0.04 V vs NHE; 4, E(1/2) = 1.12 V vs NHE), absorption (3, lambda(max) = 568, 369 nm; 4, lambda(max) = 480 nm), and emission (4, lambda(max) = 720 nm, tau = 55 ns, Phi = 1.2 x 10(-)(4)) data for the ruthenium-modified nucleosides and oligonucleotides indicate that incorporation into an oligonucleotide does not perturb the electronic properties of the ruthenium complex or the DNA significantly. In addition, the absence of any change in the emission properties upon metalated duplex formation suggests that the [Ru(bpy)(2)(IMPy)](2+)[Ru(acac)(2)(IMPy)](2+) pair will provide a valuable probe for DNA-mediated electron-transfer studies.
Kaniowski, Damian; Ebenryter-Olbińska, Katarzyna; Sobczak, Milena; Wojtczak, Błażej; Janczak, Sławomir; Leśnikowski, Zbigniew J; Nawrot, Barbara
2017-08-23
Boron cluster-modified therapeutic nucleic acids with improved properties are of interest in gene therapy and in cancer boron neutron capture therapy (BNCT). High metallacarborane-loaded antisense oligonucleotides (ASOs) targeting epidermal growth factor receptor (EGFR) were synthesized through post-synthetic Cu (I)-assisted "click" conjugation of alkyne-modified DNA-oligonucleotides with a boron cluster alkyl azide component. The obtained oligomers exhibited increased lipophilicity compared to their non-modified precursors, while their binding affinity to complementary DNA and RNA strands was slightly decreased. Multiple metallacarborane residues present in the oligonucleotide chain, each containing 18 B-H groups, enabled the use of IR spectroscopy as a convenient analytical method for these oligomers based on the diagnostic B-H signal at 2400-2650 cm -1 . The silencing activity of boron cluster-modified ASOs used at higher concentrations was similar to that of unmodified oligonucleotides. The screened ASOs, when used in low concentrations (up to 50 μM), exhibited pro-oxidative properties by inducing ROS production and an increase in mitochondrial activities in HeLa cells. In contrast, when used at higher concentrations, the ASOs exhibited anti-oxidative properties by lowering ROS species levels. In the HeLa cells (tested in the MTT assay) treated (without lipofectamine) or transfected with the screened compounds, the mitochondrial activity remained equal to the control level or only slightly changed (±30%). These findings may be useful in the design of dual-action boron cluster-modified therapeutic nucleic acids with combined antisense and anti-oxidant properties.
Antisense Oligonucleotide Therapy for Patients with Advanced Cancer | Center for Cancer Research
Colorectal cancer (CRC) is the second leading cause of cancer-related death in the U.S. Improvements in therapy have increased the survival of patients with CRC from 10 months to two years, but for patients who stop responding to treatments, such as irinotecan, options for additional therapy are limited. Antisense oligonucleotides (ASOs) may offer advantages over traditional
Shabanpoor, Fazel; Gait, Michael J
2013-11-11
We describe a general methodology for fluorescent labelling of peptide conjugates of phosphorodiamidate morpholino oligonucleotides (PMOs) by alkyne functionalization of peptides, subsequent conjugation to PMOs and labelling with a fluorescent compound (Cy5-azide). Two peptide-PMO (PPMO) examples are shown. No detrimental effect of such labelled PMOs was seen in a biological assay.
Kralovicova, Jana; Moreno, Pedro M D; Cross, Nicholas C P; Pêgo, Ana Paula; Vorechovsky, Igor
2016-12-01
ATM (ataxia-telangiectasia, mutated) is an important cancer susceptibility gene that encodes a key apical kinase in the DNA damage response pathway. ATM mutations in the germ line result in ataxia-telangiectasia (A-T), a rare genetic syndrome associated with hypersensitivity to double-strand DNA breaks and predisposition to lymphoid malignancies. ATM expression is limited by a tightly regulated nonsense-mediated RNA decay (NMD) switch exon (termed NSE) located in intron 28. In this study, we identify antisense oligonucleotides that modulate NSE inclusion in mature transcripts by systematically targeting the entire 3.1-kb-long intron. Their identification was assisted by a segmental deletion analysis of transposed elements, revealing NSE repression upon removal of a distant antisense Alu and NSE activation upon elimination of a long terminal repeat transposon MER51A. Efficient NSE repression was achieved by delivering optimized splice-switching oligonucleotides to embryonic and lymphoblastoid cells using chitosan-based nanoparticles. Together, these results provide a basis for possible sequence-specific radiosensitization of cancer cells, highlight the power of intronic antisense oligonucleotides to modify gene expression, and demonstrate transposon-mediated regulation of NSEs.
Identifying of meat species using polymerase chain reaction (PCR)
NASA Astrophysics Data System (ADS)
Foong, Chow Ming; Sani, Norrakiah Abdullah
2013-11-01
Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one's diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing.
Bai, Yu; Iwasaki, Yuki; Kanaya, Shigehiko; Zhao, Yue; Ikemura, Toshimichi
2014-01-01
With remarkable increase of genomic sequence data of a wide range of species, novel tools are needed for comprehensive analyses of the big sequence data. Self-Organizing Map (SOM) is an effective tool for clustering and visualizing high-dimensional data such as oligonucleotide composition on one map. By modifying the conventional SOM, we have previously developed Batch-Learning SOM (BLSOM), which allows classification of sequence fragments according to species, solely depending on the oligonucleotide composition. In the present study, we introduce the oligonucleotide BLSOM used for characterization of vertebrate genome sequences. We first analyzed pentanucleotide compositions in 100 kb sequences derived from a wide range of vertebrate genomes and then the compositions in the human and mouse genomes in order to investigate an efficient method for detecting differences between the closely related genomes. BLSOM can recognize the species-specific key combination of oligonucleotide frequencies in each genome, which is called a "genome signature," and the specific regions specifically enriched in transcription-factor-binding sequences. Because the classification and visualization power is very high, BLSOM is an efficient powerful tool for extracting a wide range of information from massive amounts of genomic sequences (i.e., big sequence data).
Obata, F; Ito, I; Kaneko, T; Ohkubo, M; Ishimoto, A L; Abe, A; Kashiwagi, N
1989-05-01
We synthesized pairs of four different oligonucleotides, F22, F29, F42, and F158, to analyse the HLA-DR2 (DRw15) and -DR4 haplotypes in the Japanese population. After enzymatically amplifying the HLA-DRB1 gene, we hybridized the oligonucleotide probes with DNA extracted from 42 donors. Hybridization was completed between F22 and the DNA of haplotype DR2 (DRw15)-Dw2, between F29 and the DNA of DR2 (DRw15)-Dw12, between F42 and the DNA of DR4-D"KT2", and between F158 and the DNA of DR4-Dw15. In keeping with the nucleotide sequences of the probes, F29 hybridized also with DNA from the DR9-Dw23 haplotype and F158 with that from some of the DRw8 haplotypes (DRw8-Dw8.3) in the Japanese population. Results of this study demonstrate that the four oligonucleotides make useful probes for detecting the haplotypes above.
Nesterova, Irina V.; Verdree, Vera T.; Pakhomov, Serhii; Strickler, Karen L.; Allen, Michael W.; Hammer, Robert P.; Soper, Steven A.
2011-01-01
Water soluble, metallo-pthalocyanine (MPc) near-IR fluorophores were designed, synthesized, and evaluated as highly stable and sensitive reporters for fluorescence assays. Their conjugation to oligonucleotides was achieved via succinimidyl ester-amino coupling chemistry with the conditions for conjugation extensively examined and optimized. In addition, various conjugate purification and isolation techniques were evaluated as well. Results showed that under proper conditions and following purification using reverse-phase ion-pair chromatography, labeling efficiencies near 80% could be achieved using ZnPc (Zn phthalocyanine) as the labeling fluorophore. Absorption and fluorescence spectra accumulated for the conjugates indicated that the intrinsic fluorescence properties of the MPc’s were not significantly altered by covalent attachment to oligonucleotides. As an example of the utility of MPc reporters, we used the MPc–oligonucleotide conjugates as primers for PCR (polymerase chain reaction) amplifications with the products sorted via electrophoresis and detected using near-IR fluorescence (λex = 680 nm). The MPc dyes were found to be more chemically stable under typical thermal cycling conditions used for PCR compared to the carbocyanine-based near-IR reporter systems typically used and produced single and narrow bands in the electrophoretic traces, indicative of producing a single PCR product during amplification. PMID:18030995
Identifying of meat species using polymerase chain reaction (PCR)
DOE Office of Scientific and Technical Information (OSTI.GOV)
Foong, Chow Ming; Sani, Norrakiah Abdullah
Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one’s diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reactionmore » (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing.« less
Typing of artiodactyl MHC-DRB genes with the help of intronic simple repeated DNA sequences.
Schwaiger, F W; Buitkamp, J; Weyers, E; Epplen, J T
1993-02-01
An efficient oligonucleotide typing method for the highly polymorphic MHC-DRB genes is described for artiodactyls like cattle, sheep and goat. By means of the polymerase chain reaction, the second exon of MHC-DRB is amplified as well as part of the adjacent intron containing a mixed simple repeat sequence. Using this primer combination we were able to amplify the MHC-DRB exons 2 and adjacent introns from all of the investigated 10 species of the family of Bovidae and giraffes. Therefore, the DRB genes of novel artiodactyl species can also be readily studied. Oligonucleotide probes specific for the polymorphisms of ungulate DRB genes are used with which sequences differing in at least one single base can be distinguished. Exonic polymorphism was found to be correlated with the allele lengths and the patterns of the repeat structures. Hence oligonucleotide probes specific for different simple repeats and polymorphic positions serve also for typing across species barriers. The strict correlation of sequence length and exonic polymorphism permits a preselection of specific oligonucleotides for hybridization. Thus more than 20 alleles can already be differentiated from each of the three species.
Polska, Katarzyna; Rak, Janusz; Bass, Andrew D.; Cloutier, Pierre; Sanche, Léon
2013-01-01
We measured the low energy electron stimulated desorption (ESD) of anions from thin films of native (TXT) and bromine monosubstituted (TBrXT) oligonucleotide trimers deposited on a gold surface (T = thymidine, X = T, deoxycytidine (C), deoxyadenosine (A) or deoxyguanosine (G), Br = bromine). The desorption of H−, CH3−/NH−, O−/NH2−, OH−, CN−, and Br− was induced by 0 to 20 eV electrons. Dissociative electron attachment, below 12 eV, and dipolar dissociation, above 12 eV, are responsible for the formation of these anions. The comparison of the results obtained for the native and brominated trimers suggests that the main pathways of TBrXT degradation correspond to the release of the hydride and bromide anions. Significantly, the presence of bromine in oligonucleotide trimers blocks the electron-induced degradation of nuclobases as evidenced by a dramatic decrease in CN− desorption. An increase in the yields of OH− is also observed. The debromination yield of particular oligonucleotides diminishes in the following order: BrdU > BrdA > BrdG > BrdC. Based on these results, 5-bromo-2′-deoxyuridine appears to be the best radiosensitizer among the studied bromonucleosides. PMID:22360262
Polska, Katarzyna; Rak, Janusz; Bass, Andrew D; Cloutier, Pierre; Sanche, Léon
2012-02-21
We measured the low energy electron stimulated desorption (ESD) of anions from thin films of native (TXT) and bromine monosubstituted (TBrXT) oligonucleotide trimers deposited on a gold surface (T = thymidine, X = T, deoxycytidine (C), deoxyadenosine (A) or deoxyguanosine (G), Br = bromine). The desorption of H(-), CH(3)(-)/NH(-), O(-)/NH(2)(-), OH(-), CN(-), and Br(-) was induced by 0 to 20 eV electrons. Dissociative electron attachment, below 12 eV, and dipolar dissociation, above 12 eV, are responsible for the formation of these anions. The comparison of the results obtained for the native and brominated trimers suggests that the main pathways of TBrXT degradation correspond to the release of the hydride and bromide anions. Significantly, the presence of bromine in oligonucleotide trimers blocks the electron-induced degradation of nuclobases as evidenced by a dramatic decrease in CN(-) desorption. An increase in the yields of OH(-) is also observed. The debromination yield of particular oligonucleotides diminishes in the following order: BrdU > BrdA > BrdG > BrdC. Based on these results, 5-bromo-2(')-deoxyuridine appears to be the best radiosensitizer among the studied bromonucleosides. © 2012 American Institute of Physics
NASA Astrophysics Data System (ADS)
Polska, Katarzyna; Rak, Janusz; Bass, Andrew D.; Cloutier, Pierre; Sanche, Léon
2012-02-01
We measured the low energy electron stimulated desorption (ESD) of anions from thin films of native (TXT) and bromine monosubstituted (TBrXT) oligonucleotide trimers deposited on a gold surface (T = thymidine, X = T, deoxycytidine (C), deoxyadenosine (A) or deoxyguanosine (G), Br = bromine). The desorption of H-, CH3-/NH-, O-/NH2-, OH-, CN-, and Br- was induced by 0 to 20 eV electrons. Dissociative electron attachment, below 12 eV, and dipolar dissociation, above 12 eV, are responsible for the formation of these anions. The comparison of the results obtained for the native and brominated trimers suggests that the main pathways of TBrXT degradation correspond to the release of the hydride and bromide anions. Significantly, the presence of bromine in oligonucleotide trimers blocks the electron-induced degradation of nuclobases as evidenced by a dramatic decrease in CN- desorption. An increase in the yields of OH- is also observed. The debromination yield of particular oligonucleotides diminishes in the following order: BrdU > BrdA > BrdG > BrdC. Based on these results, 5-bromo-2'-deoxyuridine appears to be the best radiosensitizer among the studied bromonucleosides.
probeBase—an online resource for rRNA-targeted oligonucleotide probes and primers: new features 2016
Greuter, Daniel; Loy, Alexander; Horn, Matthias; Rattei, Thomas
2016-01-01
probeBase http://www.probebase.net is a manually maintained and curated database of rRNA-targeted oligonucleotide probes and primers. Contextual information and multiple options for evaluating in silico hybridization performance against the most recent rRNA sequence databases are provided for each oligonucleotide entry, which makes probeBase an important and frequently used resource for microbiology research and diagnostics. Here we present a major update of probeBase, which was last featured in the NAR Database Issue 2007. This update describes a complete remodeling of the database architecture and environment to accommodate computationally efficient access. Improved search functions, sequence match tools and data output now extend the opportunities for finding suitable hierarchical probe sets that target an organism or taxon at different taxonomic levels. To facilitate the identification of complementary probe sets for organisms represented by short rRNA sequence reads generated by amplicon sequencing or metagenomic analysis with next generation sequencing technologies such as Illumina and IonTorrent, we introduce a novel tool that recovers surrogate near full-length rRNA sequences for short query sequences and finds matching oligonucleotides in probeBase. PMID:26586809
Cellular uptake of modified oligonucleotides: fluorescence approach
NASA Astrophysics Data System (ADS)
Kočišová, Eva; Praus, Petr; Rosenberg, Ivan; Seksek, Olivier; Sureau, Franck; Štěpánek, Josef; Turpin, Pierre-Yves
2005-06-01
Cellular uptake and intracellular distribution of the synthetic antisense analogue of dT 15 oligonucleotide (homogenously containing 3'-O-P-CH 2-O-5' internucleotide linkages and labeled with tetramethylrhodamine dye) was studied on B16 melanoma cell line by fluorescence micro-imaging and time-resolved microspectrofluorimetry. By using amphotericin B 3-dimethylaminopropyl amide as an enhancer molecule for the uptake process, homogenous staining of the cells with rather distinct nucleoli staining was achieved after 4 h of incubation. Two spectral components of 2.7 and 1.3 ns lifetime, respectively, were resolved in the emission collected from the cell nucleus. The way of staining and the long-lived component differed from our previous experiments demonstrating complexity of the intracellular oligonucleotide distribution and in particular of the binding inside the nucleus.
Morpholino-mediated Knockdown of DUX4 Toward Facioscapulohumeral Muscular Dystrophy Therapeutics.
Chen, Jennifer Cj; King, Oliver D; Zhang, Yuanfan; Clayton, Nicholas P; Spencer, Carrie; Wentworth, Bruce M; Emerson, Charles P; Wagner, Kathryn R
2016-08-01
Derepression of DUX4 in skeletal muscle has emerged as a likely cause of pathology in facioscapulohumeral muscular dystrophy (FSHD). Here we report on the use of antisense phosphorodiamidate morpholino oligonucleotides to suppress DUX4 expression and function in FSHD myotubes and xenografts. The most effective was phosphorodiamidate morpholino oligonucleotide FM10, which targets the polyadenylation signal of DUX4. FM10 had no significant cell toxicity, and RNA-seq analyses of FSHD and control myotubes revealed that FM10 down-regulated many transcriptional targets of DUX4, without overt off-target effects. Electroporation of FM10 into FSHD patient muscle xenografts in mice also down-regulated DUX4 and DUX4 targets. These findings demonstrate the potential of antisense phosphorodiamidate morpholino oligonucleotides as an FSHD therapeutic option.
Jiang, Sibo; Sheng, Jia
2015-01-01
Introduction In this unit, an efficient method for the synthesis of 2’-tellerium modified phosphoramidite and its incorporation into oligonucleotide are presented. We choose 5’-O-DMTr-2,2’-anhydro-uridine and -thymidine nucleosides (S.1, S.2) as starting materials due to their easy preparation. The 5’-O-DMTr-2,2’-anhydro-uridine and -thymidine can be converted to corresponding the 2’-tellerium-derivatized nucleosides by treating with the telluride nucleophiles. Subsequently, the 2’-Te-nucleosides can be transformed into 3’-phosphoramidites, which are the building blocks for DNA/RNA synthesis. The DNA synthesis, purification and applications of oligonucleotides containing 2’-Te-U or 2’-Te-T are described in this protocol. PMID:22147418
Junctions between i-motif tetramers in supramolecular structures
Guittet, Eric; Renciuk, Daniel; Leroy, Jean-Louis
2012-01-01
The symmetry of i-motif tetramers gives to cytidine-rich oligonucleotides the capacity to associate into supramolecular structures (sms). In order to determine how the tetramers are linked together in such structures, we have measured by gel filtration chromatography and NMR the formation and dissociation kinetics of sms built by oligonucleotides containing two short C stretches separated by a non-cytidine-base. We show that a stretch of only two cytidines either at the 3′- or 5′-end is long enough to link the tetramers into sms. The analysis of the properties of sms formed by oligonucleotides differing by the length of the oligo-C stretches, the sequence orientation and the nature of the non-C base provides a model of the junction connecting the tetramers in sms. PMID:22362739
Pradeepkumar, Pushpangadan I; Cheruku, Pradeep; Plashkevych, Oleksandr; Acharya, Parag; Gohil, Suresh; Chattopadhyaya, Jyoti
2004-09-22
We have earlier reported the synthesis and antisense properties of the conformationally constrained oxetane-C and -T containing oligonucleotides, which have shown effective down-regulation of the proto-oncogene c-myb mRNA in the K562 human leukemia cells. Here we report on the straightforward syntheses of the oxetane-A and oxetane-G nucleosides as well as their incorporations into antisense oligonucleotides (AONs), and compare their structural and antisense properties with those of the T and C modified AONs (including the thermostability and RNase H recruitment capability of the AON/RNA hybrid duplex by Michaelis-Menten kinetic analyses, their resistance in the human serum, as well as in the presence of exo and endonucleases).
Agarwala, Anandita; Jones, Peter; Nambi, Vijay
2015-01-01
Antisense oligonucleotide therapy is a promising approach for the treatment of a broad variety of medical conditions. It functions at the cellular level by interfering with RNA function, often leading to degradation of specifically targeted abnormal gene products implicated in the disease process. Mipomersen is a novel antisense oligonucleotide directed at apolipoprotein (apoB)-100, the primary apolipoprotein associated with low-density lipoprotein cholesterol (LDL-C), which has recently been approved for the treatment of familial hypercholesterolemia. A number of clinical studies have demonstrated its efficacy in lowering LDL-C and apoB levels in patients with elevated LDL-C despite maximal medical therapy using conventional lipid-lowering agents. This review outlines the risks and benefits of therapy and provides recommendations on the use of mipomersen.
2013-06-01
Chemicals were purchased from Sigma unless indicated otherwise. Synthetic oligonucleotides were purchased from Integrated DNA Technologies. Human insulin was...otherwise. Synthetic oligonucleotides were purchased from Integrated DNA Technolo- gies, Inc. (Coralville, IA). Antibodies against XBP1, C/EBPα, and...component of marijuana , induces human glioma cancer cell death through stimulation of ER stress-associated autophagy [92]. δ- tetrahydrocannabinol can
Cheruvallath, Zacharia S; Kumar, R Krishna; Rentel, Claus; Cole, Douglas L; Ravikumar, Vasulinga T
2003-04-01
Diethyldithiodicarbonate (DDD), a cheap and easily prepared compound, is found to be a rapid and efficient sulfurizing reagent in solid phase synthesis of phosphorothioate oligodeoxyribonucleotides via the phosphoramidite approach. Product yield and quality based on IP-LC-MS compares well with high quality oligonucleotides synthesized using phenylacetyl disulfide (PADS) which is being used for manufacture of our antisense drugs.
Exploring the Use of a Guanine-Rich Catalytic DNA for Sulfoxide Preparation
Dellafiore, María A.; Montserrat, Javier M.; Iribarren, Adolfo M.
2015-01-01
A guanine-rich DNA oligonucleotide complexed with hemin was used to catalyze controlled oxygen transfer reactions to different sulfides for sulfoxide preparation in the presence of H2O2. Comparable activities were obtained when using fully modified L-DNA. In addition, oligonucleotide immobilization led to an active catalyst which could be successfully recovered and reused without loss of activity. PMID:26066510
Holland, Joseph G; Geiger, Franz M
2012-06-07
The binding of magnesium ions to surface-bound single-stranded oligonucleotides was studied under aqueous conditions using second harmonic generation (SHG) and atomic force microscopy (AFM). The effect of strand length on the number of Mg(II) ions bound and their free binding energy was examined for 5-, 10-, 15-, and 20-mers of adenine and guanine at pH 7, 298 K, and 10 mM NaCl. The binding free energies for adenine and guanine sequences were calculated to be -32.1(4) and -35.6(2) kJ/mol, respectively, and invariant with strand length. Furthermore, the ion density for adenine oligonucleotides did not change as strand length increased, with an average value of 2(1) ions/strand. In sharp contrast, guanine oligonucleotides displayed a linear relationship between strand length and ion density, suggesting that cooperativity is important. This data gives predictive capabilities for mixed strands of various lengths, which we exploit for 20-mers of adenines and guanines. In addition, the role sequence order plays in strands of hetero-oligonucleotides was examined for 5'-A(10)G(10)-3', 5'-(AG)(10)-3', and 5'-G(10)A(10)-3' (here the -3' end is chemically modified to bind to the surface). Although the free energy of binding is the same for these three strands (averaged to be -33.3(4) kJ/mol), the total ion density increases when several guanine residues are close to the 3' end (and thus close to the solid support substrate). To further understand these results, we analyzed the height profiles of the functionalized surfaces with tapping-mode atomic force microscopy (AFM). When comparing the average surface height profiles of the oligonucleotide surfaces pre- and post- Mg(II) binding, a positive correlation was found between ion density and the subsequent height decrease following Mg(II) binding, which we attribute to reductions in Coulomb repulsion and strand collapse once a critical number of Mg(II) ions are bound to the strand.
Ashman, R F; Singh, N; Lenert, P S
2017-06-01
MRL-Fas lpr/lpr mice represent an excellent animal model for studying non-malignant lymphoproliferation, regeneration and systemic autoimmunity. Retro-transposon insertion into the second intron of the pro-apoptotic Fas gene appears to be responsible for both lymphoproliferation and autoimmunity, while other genes are more likely to contribute to the regenerative healing characteristic of this mouse strain. Previous studies have shown that neonatal thymectomy can halt the development of abnormal lymphoproliferation. Whereas at four weeks of age primary and secondary lymphoid organs appear to be grossly intact, vigorous lymphoproliferation and autoantibody production subsequently ensues. This is first noticeable at six weeks of age, at which time lymph nodes, spleens and thymuses, but not the bone marrow, become infiltrated with abnormal B220 + CD3 + CD4 - CD8 - T cells. Around the same time, thymuses show a significant drop in CD4 + CD8 + double-positive T cells generating an abnormal ratio between double-positive and single-positive thymocytes. The objective of current study was to evaluate the effect of synthetic oligonucleotides-toll-like receptor antagonists on early lymphoid development in this strain of mice. Herein, we demonstrate the ability of synthetic oligonucleotides made with the nuclease-resistant phosphorothioate backbone to partially reverse abnormal lymphoproliferation and thymic involution in pre-diseased MRL-Fas lpr/lpr mice when administered intraperitoneally starting from week four of age. This curative effect of oligonucleotides was primary sequence/secondary oligonucleotide structure-independent, suggesting an effect through the toll-like receptor 7. A similar approach may potentially benefit patients with autoimmune lymphoproliferative syndrome who, like MRL-Fas lpr/lpr mice, carry a mutation in the Fas gene.
DNA assembly with error correction on a droplet digital microfluidics platform.
Khilko, Yuliya; Weyman, Philip D; Glass, John I; Adams, Mark D; McNeil, Melanie A; Griffin, Peter B
2018-06-01
Custom synthesized DNA is in high demand for synthetic biology applications. However, current technologies to produce these sequences using assembly from DNA oligonucleotides are costly and labor-intensive. The automation and reduced sample volumes afforded by microfluidic technologies could significantly decrease materials and labor costs associated with DNA synthesis. The purpose of this study was to develop a gene assembly protocol utilizing a digital microfluidic device. Toward this goal, we adapted bench-scale oligonucleotide assembly methods followed by enzymatic error correction to the Mondrian™ digital microfluidic platform. We optimized Gibson assembly, polymerase chain reaction (PCR), and enzymatic error correction reactions in a single protocol to assemble 12 oligonucleotides into a 339-bp double- stranded DNA sequence encoding part of the human influenza virus hemagglutinin (HA) gene. The reactions were scaled down to 0.6-1.2 μL. Initial microfluidic assembly methods were successful and had an error frequency of approximately 4 errors/kb with errors originating from the original oligonucleotide synthesis. Relative to conventional benchtop procedures, PCR optimization required additional amounts of MgCl 2 , Phusion polymerase, and PEG 8000 to achieve amplification of the assembly and error correction products. After one round of error correction, error frequency was reduced to an average of 1.8 errors kb - 1 . We demonstrated that DNA assembly from oligonucleotides and error correction could be completely automated on a digital microfluidic (DMF) platform. The results demonstrate that enzymatic reactions in droplets show a strong dependence on surface interactions, and successful on-chip implementation required supplementation with surfactants, molecular crowding agents, and an excess of enzyme. Enzymatic error correction of assembled fragments improved sequence fidelity by 2-fold, which was a significant improvement but somewhat lower than expected compared to bench-top assays, suggesting an additional capacity for optimization.
Kalendar, Ruslan; Tselykh, Timofey V; Khassenov, Bekbolat; Ramanculov, Erlan M
2017-01-01
This chapter introduces the FastPCR software as an integrated tool environment for PCR primer and probe design, which predicts properties of oligonucleotides based on experimental studies of the PCR efficiency. The software provides comprehensive facilities for designing primers for most PCR applications and their combinations. These include the standard PCR as well as the multiplex, long-distance, inverse, real-time, group-specific, unique, overlap extension PCR for multi-fragments assembling cloning and loop-mediated isothermal amplification (LAMP). It also contains a built-in program to design oligonucleotide sets both for long sequence assembly by ligase chain reaction and for design of amplicons that tile across a region(s) of interest. The software calculates the melting temperature for the standard and degenerate oligonucleotides including locked nucleic acid (LNA) and other modifications. It also provides analyses for a set of primers with the prediction of oligonucleotide properties, dimer and G/C-quadruplex detection, linguistic complexity as well as a primer dilution and resuspension calculator. The program consists of various bioinformatical tools for analysis of sequences with the GC or AT skew, CG% and GA% content, and the purine-pyrimidine skew. It also analyzes the linguistic sequence complexity and performs generation of random DNA sequence as well as restriction endonucleases analysis. The program allows to find or create restriction enzyme recognition sites for coding sequences and supports the clustering of sequences. It performs efficient and complete detection of various repeat types with visual display. The FastPCR software allows the sequence file batch processing that is essential for automation. The program is available for download at http://primerdigital.com/fastpcr.html , and its online version is located at http://primerdigital.com/tools/pcr.html .
Improved DNA hybridization parameters by Twisted Intercalating Nucleic Acid (TINA).
Schneider, Uffe Vest
2012-01-01
This thesis establishes oligonucleotide design rules and applications of a novel group of DNA stabilizing molecules collectively called Twisted Intercalating Nucleic Acid - TINA. Three peer-reviewed publications form the basis for the thesis. One publication describes an improved and rapid method for determination of DNA melting points and two publications describe the effects of positioning TINA molecules in parallel triplex helix and antiparallel duplex helix forming DNA structures. The third publication establishes that TINA molecules containing oligonucleotides improve an antiparallel duplex hybridization based capture assay's analytical sensitivity compared to conventionel DNA oligonucleotides. Clinical microbiology is traditionally based on pathogenic microorganisms' culture and serological tests. The introduction of DNA target amplification methods like PCR has improved the analytical sensitivity and total turn around time involved in clinical diagnostics of infections. Due to the relatively weak hybridization between the two strands of double stranded DNA, a number of nucleic acid stabilizing molecules have been developed to improve the sensitivity of DNA based diagnostics through superior binding properties. A short introduction is given to Watson-Crick and Hoogsteen based DNA binding and the derived DNA structures. A number of other nucleic acid stabilizing molecules are described. The stabilizing effect of TINA molecules on different DNA structures is discussed and considered in relation to other nucleic acid stabilizing molecules and in relation to future use of TINA containing oligonucleotides in clinical diagnostics and therapy. In conclusion, design of TINA modified oligonucleotides for antiparallel duplex helixes and parallel triplex helixes follows simple purpose dependent rules. TINA molecules are well suited for improving multiplex PCR assays and can be used as part of novel technologies. Future research should test whether combinations of TINA molecules and other nucleic acid stabilizing molecules can increase analytical sensitivity whilst maintaining nucleobase mismatch discrimination in triplex helix based diagnostic assays.
Van Overstraeten-Schlögel, Nancy; Shim, Yong-Ho; Tevel, Virginie; Piel, Géraldine; Piette, Jacques; Dubois, Philippe; Raes, Martine
2012-02-01
Skin carcinomas are among the most commonly diagnosed tumors in the world. In this study, we investigated the transfection of immortalized keratinocytes, used as an in vitro model for skin carcinoma, using the antisense technology and poly(2-(dimethylamino)ethyl methacrylate) (PDMAEMA)-based copolymers. In order to improve the transfection efficiency of the classic PDMAEMA polymers, copolymers were synthesized including a poly(N-morpholino)ethylmethacrylate) (PMEMA) moiety for an improved proton-sponge effect, intended to favour the release of the oligonucleotide from the acidic endosome. These copolymers were synthesized either statistically (with alternating PDMAEMA and PMEMA fragments) or in blocks (one PDMAEMA block followed by one PMEMA block). MTT assays were performed using the PDMAEMA-PMEMA copolymers and revealed no significant cytotoxicity of these polymers at an N/P ratio of 7.3. Using fluorescent oligonucleotides and analyzing transfection efficiency by flow cytometry, we noticed no significant differences between the two kinds of copolymers. However copolymers with a higher DMAEMA content and a higher Mn were also those displaying the highest vectorization efficiency. Confocal microscopy showed that these copolymers induced a fine granular distribution of the transfected antisense oligonucleotides inside the cells. We also assessed the functionality of the transfected antisense oligonucleotide by transfecting immortalized GFP expressing keratinocytes with a GFP antisense oligonucleotide using these copolymers. A significant silencing was achieved with a PDMAEMA-PMEMA in block copolymer (Mn=41,000, 89 % PDMAEMA). Together, these results suggest that PDMAEMA-PMEMA copolymers combining low toxicity, vectorization and proton sponge properties, can be efficiently used to transfect immortalized keratinocytes and so open new perspectives in the therapy of skin carcinomas as well as of other skin diseases of genetic or immunological origin. © 2012 Informa Healthcare USA, Inc.
Automated detection and quantitation of bacterial RNA by using electrical microarrays.
Elsholz, B; Wörl, R; Blohm, L; Albers, J; Feucht, H; Grunwald, T; Jürgen, B; Schweder, T; Hintsche, Rainer
2006-07-15
Low-density electrical 16S rRNA specific oligonucleotide microarrays and an automated analysis system have been developed for the identification and quantitation of pathogens. The pathogens are Escherichia coli, Pseudomonas aeruginosa, Enterococcus faecalis, Staphylococcus aureus, and Staphylococcus epidermidis, which are typically involved in urinary tract infections. Interdigitated gold array electrodes (IDA-electrodes), which have structures in the nanometer range, have been used for very sensitive analysis. Thiol-modified oligonucleotides are immobilized on the gold IDA as capture probes. They mediate the specific recognition of the target 16S rRNA by hybridization. Additionally three unlabeled oligonucleotides are hybridized in close proximity to the capturing site. They are supporting molecules, because they improve the RNA hybridization at the capturing site. A biotin labeled detector oligonucleotide is also allowed to hybridize to the captured RNA sequence. The biotin labels enable the binding of avidin alkaline phophatase conjugates. The phosphatase liberates the electrochemical mediator p-aminophenol from its electrically inactive phosphate derivative. The electrical signals were generated by amperometric redox cycling and detected by a unique multipotentiostat. The read out signals of the microarray are position specific current and change over time in proportion to the analyte concentration. If two additional biotins are introduced into the affinity binding complex via the supporting oligonucleotides, the sensitivity of the assays increase more than 60%. The limit of detection of Escherichia coli total RNA has been determined to be 0.5 ng/microL. The control of fluidics for variable assay formats as well as the multichannel electrical read out and data handling have all been fully automated. The fast and easy procedure does not require any amplification of the targeted nucleic acids by PCR.
Hewett, Peter W; Daft, Emma L; Laughton, Charles A; Ahmad, Shakil; Ahmed, Asif; Murray, J Clifford
2006-01-01
The Tie receptors (Tie-1 and Tie-2/Tek) are essential for angiogenesis and vascular remodeling/integrity. Tie receptors are up-regulated in tumor-associated endothelium, and their inhibition disrupts angiogenesis and can prevent tumor growth as a consequence. To investigate the potential of anti-gene approaches to inhibit tie gene expression for anti-angiogenic therapy, we have examined triple-helical (triplex) DNA formation at 2 tandem Ets transcription factor binding motifs (designated E-1 and E-2) in the human tie-1 promoter. Various tie-1 promoter deletion/mutation luciferase reporter constructs were generated and transfected into endothelial cells to examine the relative activities of E-1 and E-2. The binding of antiparallel and parallel (control) purine motif oligonucleotides (21–22 bp) targeted to E-1 and E-2 was assessed by plasmid DNA fragment binding and electrophoretic mobility shift assays. Triplex-forming oligonucleotides were incubated with tie-1 reporter constructs and transfected into endothelial cells to determine their activity. The Ets binding motifs in the E-1 sequence were essential for human tie-1 promoter activity in endothelial cells, whereas the deletion of E-2 had no effect. Antiparallel purine motif oligonucleotides targeted at E-1 or E-2 selectively formed strong triplex DNA (Kd ~10−7 M) at 37 °C. Transfection of tie-1 reporter constructs with triplex DNA at E-1, but not E-2, specifically inhibited tie-1 promoter activity by up to 75% compared with control oligonucleotides in endothelial cells. As similar multiple Ets binding sites are important for the regulation of several endothelial-restricted genes, this approach may have broad therapeutic potential for cancer and other pathologies involving endothelial proliferation/dysfunction. PMID:16838069
Hewett, Peter W; Daft, Emma L; Laughton, Charles A; Ahmad, Shakil; Ahmed, Asif; Murray, J Clifford
2006-01-01
The Tie receptors (Tie-1 and Tie-2/Tek) are essential for angiogenesis and vascular remodeling/integrity. Tie receptors are up-regulated in tumor-associated endothelium, and their inhibition disrupts angiogenesis and can prevent tumor growth as a consequence. To investigate the potential of anti-gene approaches to inhibit tie gene expression for anti-angiogenic therapy, we have examined triple-helical (triplex) DNA formation at 2 tandem Ets transcription factor binding motifs (designated E-1 and E-2) in the human tie-1 promoter. Various tie-1 promoter deletion/mutation luciferase reporter constructs were generated and transfected into endothelial cells to examine the relative activities of E-1 and E-2. The binding of antiparallel and parallel (control) purine motif oligonucleotides (21-22 bp) targeted to E-1 and E-2 was assessed by plasmid DNA fragment binding and electrophoretic mobility shift assays. Triplex-forming oligonucleotides were incubated with tie-1 reporter constructs and transfected into endothelial cells to determine their activity. The Ets binding motifs in the E-1 sequence were essential for human tie-1 promoter activity in endothelial cells, whereas the deletion of E-2 had no effect. Antiparallel purine motif oligonucleotides targeted at E-1 or E-2 selectively formed strong triplex DNA (K(d) approximately 10(-7) M) at 37 degrees C. Transfection of tie-1 reporter constructs with triplex DNA at E-1, but not E-2, specifically inhibited tie-1 promoter activity by up to 75% compared with control oligonucleotides in endothelial cells. As similar multiple Ets binding sites are important for the regulation of several endothelial-restricted genes, this approach may have broad therapeutic potential for cancer and other pathologies involving endothelial proliferation/dysfunction.
Decoy Oligonucleotide Rescues IGF1R Expression from MicroRNA-223 Suppression
Wang, Rong; He, Bao Mei; Qi, Bing; Xu, Chang Jun; Wu, Xing Zhong
2013-01-01
A mature miRNA generally suppresses hundreds of mRNA targets. To evaluate the selective effect of synthetic oligonucleotide decoys on hsa-miR-223 activity, reporters containing 3’ untranslated regions (UTR) of IGF1R, FOXO1, POLR3G, FOXO3, CDC27, FBXW7 and PAXIP1 mRNAs were constructed for the luciferase assay. The oligonucleotide decoys were designed and synthesized according to mature miR-223 sequence and its target mRNA sequence. Quantitative RT-PCR & western analysis were used to measure miR-223-targeted mRNA expression, Interestingly, apart from the antisense oligonucleotide, decoy nucleotides which were complementary to the 5’, central or 3’ region of mature miR-223 suppressed miR-223 targeting the 3’UTR of IGF1R, FOXO1, FOXO3, CDC27, POLR3G, and FBXW7 mRNAs and rescued the expression of these genes to varying degrees from miR-223 suppression at both mRNA and protein levels. All decoys had no effect on PAXIP1 which was not targeted by miR-223. The decoy 1 that was based on the sequence of IGF1R 3’UTR rescued the expression of IGF1R more significantly than other decoy nucleotides except the antisense decoy 4. Decoy 1 also rescued the expression of FOXO3 and POLR3G of which their 3’UTRs have similar binding sites for miR-223 with IGF1R 3’UTR. However decoy 1 failed to recover Sp1, CDC27 and FBXW7 expression. These data support that the sequence-specific decoy oligonucleotides might represent exogenous competing RNA which selectively inhibits microRNA targeting. PMID:24324762
Decoy oligonucleotide rescues IGF1R expression from MicroRNA-223 suppression.
Wu, Li Hui; Cai, Qian Qian; Dong, Yi Wei; Wang, Rong; He, Bao Mei; Qi, Bing; Xu, Chang Jun; Wu, Xing Zhong
2013-01-01
A mature miRNA generally suppresses hundreds of mRNA targets. To evaluate the selective effect of synthetic oligonucleotide decoys on hsa-miR-223 activity, reporters containing 3' untranslated regions (UTR) of IGF1R, FOXO1, POLR3G, FOXO3, CDC27, FBXW7 and PAXIP1 mRNAs were constructed for the luciferase assay. The oligonucleotide decoys were designed and synthesized according to mature miR-223 sequence and its target mRNA sequence. Quantitative RT-PCR & western analysis were used to measure miR-223-targeted mRNA expression, Interestingly, apart from the antisense oligonucleotide, decoy nucleotides which were complementary to the 5', central or 3' region of mature miR-223 suppressed miR-223 targeting the 3'UTR of IGF1R, FOXO1, FOXO3, CDC27, POLR3G, and FBXW7 mRNAs and rescued the expression of these genes to varying degrees from miR-223 suppression at both mRNA and protein levels. All decoys had no effect on PAXIP1 which was not targeted by miR-223. The decoy 1 that was based on the sequence of IGF1R 3'UTR rescued the expression of IGF1R more significantly than other decoy nucleotides except the antisense decoy 4. Decoy 1 also rescued the expression of FOXO3 and POLR3G of which their 3'UTRs have similar binding sites for miR-223 with IGF1R 3'UTR. However decoy 1 failed to recover Sp1, CDC27 and FBXW7 expression. These data support that the sequence-specific decoy oligonucleotides might represent exogenous competing RNA which selectively inhibits microRNA targeting.
Oligonucleotide aptamers against tyrosine kinase receptors: Prospect for anticancer applications.
Camorani, Simona; Crescenzi, Elvira; Fedele, Monica; Cerchia, Laura
2018-04-01
Transmembrane receptor tyrosine kinases (RTKs) play crucial roles in cancer cell proliferation, survival, migration and differentiation. Area of intense research is searching for effective anticancer therapies targeting these receptors and, to date, several monoclonal antibodies and small-molecule tyrosine kinase inhibitors have entered the clinic. However, some of these drugs show limited efficacy and give rise to acquired resistance. Emerging highly selective compounds for anticancer therapy are oligonucleotide aptamers that interact with their targets by recognizing a specific three-dimensional structure. Because of their nucleic acid nature, the rational design of advanced strategies to manipulate aptamers for both diagnostic and therapeutic applications is greatly simplified over antibodies. In this manuscript, we will provide a comprehensive overview of oligonucleotide aptamers as next generation strategies to efficiently target RTKs in human cancers. Copyright © 2018 Elsevier B.V. All rights reserved.
Sochacka, E
2001-01-01
In order to efficiently assess the chemical stability of modified nucleosides to the reagents and conditions of automated oligonucleotide synthesis, we designed, developed and tested a scheme in which the modified nucleoside, directly attached to a solid support, is exposed to the cyclic chemistry of the instrument. Stability of 2-thiouridine against different oxidizers was investigated. Tertbutyl hydroperoxide (1 M) in anhydrous acetonitrile was a more effective oxidizer for the incorporation of 2-thiouridine into oligonucleotide chains than the same oxidizer in methylene chloride. Carbon tetrachloride/water in the presence of a basic catalyst was superior in maintaining the thiocarbonyl function, but its utility for RNA synthesis has yet to be fully tested, whereas 2-phenylsulfonyloxaziridine was a very efficient reagent for oxidative desulfurization of 2-thiouridine.
Heated oligonucleotide ligation assay (HOLA): an affordable single nucleotide polymorphism assay.
Black, W C; Gorrochotegui-Escalante, N; Duteau, N M
2006-03-01
Most single nucleotide polymorphism (SNP) detection requires expensive equipment and reagents. The oligonucleotide ligation assay (OLA) is an inexpensive SNP assay that detects ligation between a biotinylated "allele-specific detector" and a 3' fluorescein-labeled "reporter" oligonucleotide. No ligation occurs unless the 3' detector nucleotide is complementary to the SNP nucleotide. The original OLA used chemical denaturation and neutralization. Heated OLA (HOLA) instead uses a thermal stable ligase and cycles of denaturing and hybridization for ligation and SNP detection. The cost per genotype is approximately US$1.25 with two-allele SNPs or approximately US$1.75 with three-allele SNPs. We illustrate the development of HOLA for SNP detection in the Early Trypsin and Abundant Trypsin loci in the mosquito Aedes aegypti (L.) and at the a-glycerophosphate dehydrogenase locus in the mosquito Anopheles gambiae s.s.
Hydrated electrons react with high specificity with cisplatin bound to single-stranded DNA.
Behmand, B; Cloutier, P; Girouard, S; Wagner, J R; Sanche, L; Hunting, D J
2013-12-19
Short oligonucleotides TTTTTGTGTTT and TTTTTTTGTTT in solution with and without cisplatin (cisPt) bound to the guanine bases were irradiated with γ-rays at doses varying from 0 to 2500 Gy. To determine the effect of hydrated electrons from water radiolysis on the oligonucleotides, we quenched (•)OH radicals with ethylenediaminetetraacetic acid (EDTA) and displaced oxygen, which reacts with hydrated electrons, by bubbling the solution with wet nitrogen. DNA strand breaks and platinum detachment were quantified by gel electrophoresis. Our results demonstrate that hydrated electrons react almost exclusively at the position of the cisPt adduct, where they induce cisPt detachment from one or both guanines in the oligonucleotide. Given the high yield of hydrated electrons in irradiated tissues, this reaction may be an important step in the mechanism of radiosensitization of DNA by cisPt.
Preparation of genosensor for detection of specific DNA sequence of the hepatitis B virus
NASA Astrophysics Data System (ADS)
Honorato Castro, Ana C.; França, Erick G.; de Paula, Lucas F.; Soares, Marcia M. C. N.; Goulart, Luiz R.; Madurro, João M.; Brito-Madurro, Ana G.
2014-09-01
An electrochemical genosensor was constructed for detection of specific DNA sequence of the hepatitis B virus, based on graphite electrodes modified with poly(4-aminophenol) and incorporating a specific oligonucleotide probe. The modified electrode containing the probe was evaluated by differential pulse voltammetry, before and after incubation with the complementary oligonucleotide target. Detection was performed by monitoring oxidizable DNA bases (direct detection) or using ethidium bromide as indicator of the hybridization process (indirect detection). The device showed a detection limit for the oligonucleotide target of 2.61 nmol L-1. Indirect detection using ethidium bromide was promising in discriminating mismatches, which is a very desirable attribute for detection of disease-related point mutations. In addition, it was possible to observe differences between hybridized and non-hybridized surfaces by atomic force microscopy.
Molin, Laura; Cristoni, Simone; Crotti, Sara; Bernardi, Luigi Rossi; Seraglia, Roberta; Traldi, Pietro
2008-11-01
Spraying of oligonucleotide-matrix solutions through a stainless steel (ss) sieve (38 microm, 450 mesh) leads to the formation, on the matrix-assisted laser desorption/ionization (MALDI) sample holder, of uniformly distributed microcrystals, well separated from each other. When the resulting sample holder surface is irradiated by laser, abundant molecular species form, with a clear increase in both intensity and resolution with respect to values obtained by 'Dried Droplet', 'Double Layer', and 'Sandwich' deposition methods. In addition, unlike the usual situation, the sample is perfectly homogeneous, and identical spectra are obtained by irradiating different areas. On one hand, the data indicate that this method is highly effective for oligonucleotide MALDI analysis, and on the other, that it can be validly employed for fully automated MALDI procedures.
Targeted Delivery of Therapeutic Oligonucleotides for the Treatment of Prostate Cancer
2004-05-01
AD Award Number: DAMD17-01-1-0090 TITLE: Targeted Delivery of Therapeutic Oligonucleotides for the Treatment of Prostate Cancer PRINCIPAL...independence and chemoresistance are the major obstacles in the treatment of patients with advanced prostate cancer (Denis & Murphy, 1993; Oh & Kantoff...independence and chemoresistance in prostate cancer (McDonnell et al., 1992; Colombel et al., 1993; Berchem et al., 1995; Raffo et al., 1995; Bauer et al
Soft Lithography for Oligonucleotide Arrays Fabrication
2001-10-25
adenosine; Abbreviated T, C, G, A respectively), the other synthesis reagents and solvents except oxidation agent (seen in Table 1) were purchased...dried by cold blowing before hybridization. Oligonucleotide arrays were hybridized in 200 nM 3’-TCC TCC GAT TCA GAG AGT CC- HEX (PE Biosystems... citrate buffer), 0.1% SDS in 0.1xSSC respectively. The probe array was scanned on the Scanarray Microarray Systems (Packard Biochip Technologies, USA
DNA polymorphism identity determination using flow cytometry
Nolan, John P.; White, P. Scott; Cai, Hong
2001-01-01
DNA polymorphism identity determination using flow cytometry. Primers designed to be immobilized on microspheres are allowed to anneal to the DNA strand under investigation, and are extended by either DNA polymerase using fluorescent dideoxynucleotides or ligated by DNA ligase to fluorescent reporter oligonucleotides. The fluorescence of either the dideoxynucleotide or the reporter oligonucleotide attached to the immobilized primer is measured by flow cytometry, thereby identifying the nucleotide polymorphism on the DNA strand.
Antisense Oligonucleotide Therapy for Patients with Advanced Cancer | Center for Cancer Research
Colorectal cancer (CRC) is the second leading cause of cancer-related death in the U.S. Improvements in therapy have increased the survival of patients with CRC from 10 months to two years, but for patients who stop responding to treatments, such as irinotecan, options for additional therapy are limited. Antisense oligonucleotides (ASOs) may offer advantages over traditional therapies if an appropriate target can be identified.
Donner, Aaron J; Wancewicz, Edward V; Murray, Heather M; Greenlee, Sarah; Post, Noah; Bell, Melanie; Lima, Walt F; Swayze, Eric E; Seth, Punit P
2017-08-01
Phosphorothioate (PS) modified antisense oligonucleotides (ASOs) have progressed rapidly in the clinic for treating a variety of disease indications. We previously demonstrated that the activity of PS ASOs in the liver can be enhanced by co-infusion of an excipient oligonucleotide (EON). It was posited that the EON saturates a nonproductive uptake pathway(s) thereby permitting accumulation of the PS ASO in a productive tissue compartment. In this report, we measured PS ASO activity following administration by bolus, infusion or co-fusion with EON within hepatocytes and nonparenchymal cells (NPCs), of the liver. This revealed that while ASOs accumulate preferentially in NPCs, they are intrinsically more active in hepatocytes. Furthermore, we show that the EON enhances ASO potency when infused up to 72 h before or after administration of the active ASO suggesting that the EON can saturate and displace the ASO from nonproductive to productive compartments. Physical presence of the EON in tissues was required for optimal potentiation suggesting that there is a dynamic distribution of the ASO and EON between the compartments. Lastly, using a candidate approach, we confirmed Stabilin-2 as a molecular pathway for ASO uptake in sinusoidal endothelial cells and the ASGR as a pathway for ASO uptake into hepatocytes in the liver.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Li, Xingyuan; He, Zhili; Zhou, Jizhong
2005-10-30
The oligonucleotide specificity for microarray hybridizationcan be predicted by its sequence identity to non-targets, continuousstretch to non-targets, and/or binding free energy to non-targets. Mostcurrently available programs only use one or two of these criteria, whichmay choose 'false' specific oligonucleotides or miss 'true' optimalprobes in a considerable proportion. We have developed a software tool,called CommOligo using new algorithms and all three criteria forselection of optimal oligonucleotide probes. A series of filters,including sequence identity, free energy, continuous stretch, GC content,self-annealing, distance to the 3'-untranslated region (3'-UTR) andmelting temperature (Tm), are used to check each possibleoligonucleotide. A sequence identity is calculated based onmore » gapped globalalignments. A traversal algorithm is used to generate alignments for freeenergy calculation. The optimal Tm interval is determined based on probecandidates that have passed all other filters. Final probes are pickedusing a combination of user-configurable piece-wise linear functions andan iterative process. The thresholds for identity, stretch and freeenergy filters are automatically determined from experimental data by anaccessory software tool, CommOligo_PE (CommOligo Parameter Estimator).The program was used to design probes for both whole-genome and highlyhomologous sequence data. CommOligo and CommOligo_PE are freely availableto academic users upon request.« less
Hu, Zheng-Li; Li, Zi-Yuan; Ying, Yi-Lun; Zhang, Junji; Cao, Chan; Long, Yi-Tao; Tian, He
2018-04-03
Identification of the configuration for the photoresponsive oligonucleotide plays an important role in the ingenious design of DNA nanomolecules and nanodevices. Due to the limited resolution and sensitivity of present methods, it remains a challenge to determine the accurate configuration of photoresponsive oligonucleotides, much less a precise description of their photoconversion process. Here, we used an aerolysin (AeL) nanopore-based confined space for real-time determination and quantification of the absolute cis/ trans configuration of each azobenzene-modified oligonucleotide (Azo-ODN) with a single molecule resolution. The two completely separated current distributions with narrow peak widths at half height (<0.62 pA) are assigned to cis/ trans-Azo-ODN isomers, respectively. Due to the high current sensitivity, each isomer of Azo-ODN could be undoubtedly identified, which gives the accurate photostationary conversion values of 82.7% for trans-to- cis under UV irradiation and 82.5% for cis-to- trans under vis irradiation. Further real-time kinetic evaluation reveals that the photoresponsive rate constants of Azo-ODN from trans-to- cis and cis-to -trans are 0.43 and 0.20 min -1 , respectively. This study will promote the sophisticated design of photoresponsive ODN to achieve an efficient and applicable photocontrollable process.
Jen, Chun-Ping; Chen, Yu-Hung; Fan, Chun-sheng; Yeh, Chen-Sheng; Lin, Yu-Cheng; Shieh, Dar-Bin; Wu, Chao-Ling; Chen, Dong-Hwang; Chou, Chen-Hsi
2004-02-17
Au nanoparticles modified with 21-base thiolated-oligonucleotides have been evaluated as delivery vehicles for the development of a nonviral transfection platform. The electromigration combined with electroporation for DNA delivery in an osteoblast like cell was employed to test on microchips. Electroporation introduces foreign materials into cells by applying impulses of electric field to induce multiple transient pores on the cell membrane through dielectric breakdown of the cell membrane. On the basis of the characteristic surface plasmon of the Au particles, UV-vis absorption was utilized to qualitatively judge the efficiency of delivery. Transmission electron microscopy images and atomic absorption measurements (quantitative analysis) provided evidence of the bare Au and Au/oligonucleotide nanoparticles before and after electroporation and electromigration function. The experiments demonstrated that electrophoretic migration followed by electroporation significantly enhanced the transportation efficiency of the nanoparticle-oligonucleotide complexes as compared with electroporation alone. Most interestingly, Au capped with oligonucleotides led to optimal performance. On the other hand, the bare Au colloidal suspensions resulted in aggregation, which might be an obstacle to the internalization process. In addition, analytical results demonstrated an increase in the local particle concentrations on the cell surface that provided additional support for the mechanism underlying the improved Au nanoparticle transportation into cells in the presence of electromigration function.
In vitro selection using a dual RNA library that allows primerless selection
Jarosch, Florian; Buchner, Klaus; Klussmann, Sven
2006-01-01
High affinity target-binding aptamers are identified from random oligonucleotide libraries by an in vitro selection process called Systematic Evolution of Ligands by EXponential enrichment (SELEX). Since the SELEX process includes a PCR amplification step the randomized region of the oligonucleotide libraries need to be flanked by two fixed primer binding sequences. These primer binding sites are often difficult to truncate because they may be necessary to maintain the structure of the aptamer or may even be part of the target binding motif. We designed a novel type of RNA library that carries fixed sequences which constrain the oligonucleotides into a partly double-stranded structure, thereby minimizing the risk that the primer binding sequences become part of the target-binding motif. Moreover, the specific design of the library including the use of tandem RNA Polymerase promoters allows the selection of oligonucleotides without any primer binding sequences. The library was used to select aptamers to the mirror-image peptide of ghrelin. Ghrelin is a potent stimulator of growth-hormone release and food intake. After selection, the identified aptamer sequences were directly synthesized in their mirror-image configuration. The final 44 nt-Spiegelmer, named NOX-B11-3, blocks ghrelin action in a cell culture assay displaying an IC50 of 4.5 nM at 37°C. PMID:16855281
DOE Office of Scientific and Technical Information (OSTI.GOV)
Polska, Katarzyna; Rak, Janusz; Bass, Andrew D.
2012-02-21
We measured the low energy electron stimulated desorption (ESD) of anions from thin films of native (TXT) and bromine monosubstituted (TBrXT) oligonucleotide trimers deposited on a gold surface (T = thymidine, X = T, deoxycytidine (C), deoxyadenosine (A) or deoxyguanosine (G), Br = bromine). The desorption of H{sup -}, CH{sub 3}{sup -}/NH{sup -}, O{sup -}/NH{sub 2}{sup -}, OH{sup -}, CN{sup -}, and Br{sup -} was induced by 0 to 20 eV electrons. Dissociative electron attachment, below 12 eV, and dipolar dissociation, above 12 eV, are responsible for the formation of these anions. The comparison of the results obtained for themore » native and brominated trimers suggests that the main pathways of TBrXT degradation correspond to the release of the hydride and bromide anions. Significantly, the presence of bromine in oligonucleotide trimers blocks the electron-induced degradation of nuclobases as evidenced by a dramatic decrease in CN{sup -} desorption. An increase in the yields of OH{sup -} is also observed. The debromination yield of particular oligonucleotides diminishes in the following order: BrdU > BrdA > BrdG > BrdC. Based on these results, 5-bromo-2{sup '}-deoxyuridine appears to be the best radiosensitizer among the studied bromonucleosides.« less
Schimelman, Jacob B; Dryden, Daniel M; Poudel, Lokendra; Krawiec, Katherine E; Ma, Yingfang; Podgornik, Rudolf; Parsegian, V Adrian; Denoyer, Linda K; Ching, Wai-Yim; Steinmetz, Nicole F; French, Roger H
2015-02-14
The role of base pair composition and stacking sequence in the optical properties and electronic transitions of DNA is of fundamental interest. We present and compare the optical properties of DNA oligonucleotides (AT)10, (AT)5(GC)5, and (AT-GC)5 using both ab initio methods and UV-vis molar absorbance measurements. Our data indicate a strong dependence of both the position and intensity of UV absorbance features on oligonucleotide composition and stacking sequence. The partial densities of states for each oligonucleotide indicate that the valence band edge arises from a feature associated with the PO4(3-) complex anion, and the conduction band edge arises from anti-bonding states in DNA base pairs. The results show a strong correspondence between the ab initio and experimentally determined optical properties. These results highlight the benefit of full spectral analysis of DNA, as opposed to reductive methods that consider only the 260 nm absorbance (A260) or simple purity ratios, such as A260/A230 or A260/A280, and suggest that the slope of the absorption edge onset may provide a useful metric for the degree of base pair stacking in DNA. These insights may prove useful for applications in biology, bioelectronics, and mesoscale self-assembly.
Caruso, Gerardo; Caffo, Mariella; Raudino, Giuseppe; Alafaci, Concetta; Salpietro, Francesco M; Tomasello, Francesco
2010-01-01
Despite the intensive recent research in cancer therapy, the prognosis in patients affected by high-grade gliomas is still very unfavorable. The efficacy of classical anti-cancer strategies is seriously limited by lack of specific therapies against malignant cells. The extracellular matrix plays a pivotal role in processes such as differentiation, apoptosis, and migration in both the normal and the pathologic nervous system. Glial tumors seem to be able to create a favorable environment for the invasion of glioma cells in cerebral parenchyma when they combine with the extracellular matrix via cell surface receptors. Glioma cells synthesize matrix proteins, such as tenascin, laminin, fibronectin that facilitate the tumor cell's motility. New treatments have shown to hit the acting molecules in the tumor growth and to increase the efficacy and minimize the toxicity. Antisense oligonucleotides are synthetic stretches of DNA which hybridize with specific mRNA strands. The specificity of hybridization makes antisense method an interesting strategy to selectively modulate the expression of genes involved in tumorigenesis. In this review we will focus on the mechanisms of action of antisense oligonucleotides and report clinical and experimental studies on the treatment of high-grade gliomas. We will also report the patents of preclinical and/or clinical studies that adopt the antisense oligonucleotide therapy list in cerebral gliomas.
Crooke, Stanley T; Baker, Brenda F; Kwoh, T Jesse; Cheng, Wei; Schulz, Dan J; Xia, Shuting; Salgado, Nelson; Bui, Huynh-Hoa; Hart, Christopher E; Burel, Sebastien A; Younis, Husam S; Geary, Richard S; Henry, Scott P; Bhanot, Sanjay
2016-01-01
The common chemical and biological properties of antisense oligonucleotides provide the opportunity to identify and characterize chemical class effects across species. The chemical class that has proven to be the most versatile and best characterized is the 2′-O-methoxyethyl chimeric antisense oligonucleotides. In this report we present an integrated safety assessment of data obtained from controlled dose-ranging studies in nonhuman primates (macaques) and healthy human volunteers for 12 unique 2′-O-methoxyethyl chimeric antisense oligonucleotides. Safety was assessed by the incidence of safety signals in standardized laboratory tests for kidney and liver function, hematology, and complement activation; as well as by the mean test results as a function of dose level over time. At high doses a number of toxicities were observed in nonhuman primates. However, no class safety effects were identified in healthy human volunteers from this integrated data analysis. Effects on complement in nonhuman primates were not observed in humans. Nonhuman primates predicted safe doses in humans, but over predicted risk of complement activation and effects on platelets. Although limited to a single chemical class, comparisons from this analysis are considered valid and accurate based on the carefully controlled setting for the specified study populations and within the total exposures studied. PMID:27357629
2009-10-01
differentiation and activation of osteoclast precursors. Targeting RANKL expression with antisense oligonucleotides (RANKL- ASO ) decreased RANKL expression and...1,175 Ci/mmol at 10 mCi/mL). Two microliters of the reaction mixture were separated on a 12% SDS-polyacrylamide gel and subsequently visualized...OPG), a decoy receptor for RANKL, at the TB-interface was also increased. Targeting RANKL expression with antisense oligonucleotides (RANKL- ASO
Jin, Lian-Qun; Li, Jun-Wen; Wang, Sheng-Qi; Chao, Fu-Huan; Wang, Xin-Wei; Yuan, Zheng-Quan
2005-01-01
AIM: To detect the common intestinal pathogenic bacteria quickly and accurately. METHODS: A rapid (<3 h) experimental procedure was set up based upon the gene chip technology. Target genes were amplified and hybridized by oligonucleotide microarrays. RESULTS: One hundred and seventy strains of bacteria in pure culture belonging to 11 genera were successfully discriminated under comparatively same conditions, and a series of specific hybridization maps corresponding to each kind of bacteria were obtained. When this method was applied to 26 divided cultures, 25 (96.2%) were identified. CONCLUSION: Salmonella sp., Escherichia coli, Shigella sp., Listeria monocytogenes, Vibrio parahaemolyticus, Staphylococcus aureus, Proteus sp., Bacillus cereus, Vibrio cholerae, Enterococcus faecalis, Yersinia enterocolitica, and Campylobacter jejuni can be detected and identified by our microarrays. The accuracy, range, and discrimination power of this assay can be continually improved by adding further oligonucleotides to the arrays without any significant increase of complexity or cost. PMID:16437687
A simple physical mechanism enables homeostasis in primitive cells
NASA Astrophysics Data System (ADS)
Engelhart, Aaron E.; Adamala, Katarzyna P.; Szostak, Jack W.
2016-05-01
The emergence of homeostatic mechanisms that enable maintenance of an intracellular steady state during growth was critical to the advent of cellular life. Here, we show that concentration-dependent reversible binding of short oligonucleotides, of both specific and random sequence, can modulate ribozyme activity. In both cases, catalysis is inhibited at high concentrations, and dilution activates the ribozyme via inhibitor dissociation, thus maintaining near-constant ribozyme specific activity throughout protocell growth. To mimic the result of RNA synthesis within non-growing protocells, we co-encapsulated high concentrations of ribozyme and oligonucleotides within fatty acid vesicles, and ribozyme activity was inhibited. Following vesicle growth, the resulting internal dilution produced ribozyme activation. This simple physical system enables a primitive homeostatic behaviour: the maintenance of constant ribozyme activity per unit volume during protocell volume changes. We suggest that such systems, wherein short oligonucleotides reversibly inhibit functional RNAs, could have preceded sophisticated modern RNA regulatory mechanisms, such as those involving miRNAs.
RNA-Catalyzed RNA Ligation on an External RNA Template
NASA Technical Reports Server (NTRS)
McGinness, Kathleen E.; Joyce, Gerald F.
2002-01-01
Variants of the hc ligase ribozyme, which catalyzes ligation of the 3' end of an RNA substrate to the 5' end of the ribozyme, were utilized to evolve a ribozyme that catalyzes ligation reactions on an external RNA template. The evolved ribozyme catalyzes the joining of an oligonucleotide 3'-hydroxyl to the 5'-triphosphate of an RNA hairpin molecule. The ribozyme can also utilize various substrate sequences, demonstrating a largely sequence-independent mechanism for substrate recognition. The ribozyme also carries out the ligation of two oligonucleotides that are bound at adjacent positions on a complementary template. Finally, it catalyzes addition of mononucleoside '5-triphosphates onto the '3 end of an oligonucleotide primer in a template-dependent manner. The development of ribozymes that catalyze polymerase-type reactions contributes to the notion that an RNA world could have existed during the early history of life on Earth.
Clinical potential of oligonucleotide-based therapeutics in the respiratory system.
Moschos, Sterghios A; Usher, Louise; Lindsay, Mark A
2017-01-01
The discovery of an ever-expanding plethora of coding and non-coding RNAs with nodal and causal roles in the regulation of lung physiology and disease is reinvigorating interest in the clinical utility of the oligonucleotide therapeutic class. This is strongly supported through recent advances in nucleic acids chemistry, synthetic oligonucleotide delivery and viral gene therapy that have succeeded in bringing to market at least three nucleic acid-based drugs. As a consequence, multiple new candidates such as RNA interference modulators, antisense, and splice switching compounds are now progressing through clinical evaluation. Here, manipulation of RNA for the treatment of lung disease is explored, with emphasis on robust pharmacological evidence aligned to the five pillars of drug development: exposure to the appropriate tissue, binding to the desired molecular target, evidence of the expected mode of action, activity in the relevant patient population and commercially viable value proposition. Copyright © 2016 Elsevier Inc. All rights reserved.
Javani, Atefeh; Javadi-Zarnaghi, Fatemeh; Rasaee, Mohammad Javad
2017-11-15
Lateral flow assays (LFAs) have promising potentials for point-of-care applications. Recently, many LFAs have been reported that are based on hybridization of oligonucleotide strands. Mostly, biotinylated capture DNAs are immobilized on the surface of a nitrocellulose membrane via streptavidin interactions. During the assay, stable colorful complexes get formed that are visible by naked eyes. Here, we present an inexpensive and unique design of LFA that applies unmodified oligonucleotides at capture lines. The presented LFA do not utilize streptavidin or any other affinity protein. We employ structural switch of molecular beacons (MB) in combination with base stacking hybridization (BSH) phenomenon. The unique design of the reported LFA provided high selectivity for target oligonucleotides. We validated potential applications of the system for detection of DNA mimics of two microRNAs in multiplex assays. Copyright © 2017 Elsevier Inc. All rights reserved.
van Roon-Mom, Willeke M C; Roos, Raymund A C; de Bot, Susanne T
2018-04-01
On December 11 of 2017, Ionis Pharmaceuticals published a press release announcing dose-dependent reductions of mutant huntingtin protein in their HTTRx Phase 1/2a study in Huntington disease (HD) patients. The results from this Ionis trial have gained much attention from the patient community and the oligonucleotide therapeutics field, since it is the first trial targeting the cause of HD, namely the mutant huntingtin protein, using antisense oligonucleotides (ASOs). The press release also states that the primary endpoints of the study (safety and tolerability) were met, but does not contain data. This news follows the approval of another therapeutic ASO nusinersen (trade name Spinraza) for a neurological disease, spinal muscular atrophy, by the U.S. Food and Drug Administration and European Medicines Agency, in 2016 and 2017, respectively. Combined, this offers hope for the development of the HTTRx therapy for HD patients.
Hydrated Electrons React with High Specificity with Cisplatin Bound to Single-Stranded DNA
Behmand, B.; Cloutier, P.; Girouard, S.; Wagner, J. R.; Sanche, L.; Hunting, D. J.
2015-01-01
Short oligonucleotides TTTTTGTGTTT and TTTTTTTGTTT in solution with and without cisplatin (cisPt) bound to the guanine bases were irradiated with γ-rays at doses varying from 0 to 2500 Gy. To determine the effect of hydrated electrons from water radiolysis on the oligonucleotides, we quenched •OH radicals with ethylenediaminetetraacetic acid (EDTA) and displaced oxygen, which reacts with hydrated electrons, by bubbling the solution with wet nitrogen. DNA strand breaks and platinum detachment were quantified by gel electrophoresis. Our results demonstrate that hydrated electrons react almost exclusively at the position of the cisPt adduct, where they induce cisPt detachment from one or both guanines in the oligonucleotide. Given the high yield of hydrated electrons in irradiated tissues, this reaction may be an important step in the mechanism of radiosensitization of DNA by cisPt. PMID:24205952
Porciani, David; Tedeschi, Lorena; Marchetti, Laura; Citti, Lorenzo; Piazza, Vincenzo; Beltram, Fabio; Signore, Giovanni
2015-01-01
Aptamers able to bind efficiently cell-surface receptors differentially expressed in tumor and in healthy cells are emerging as powerful tools to perform targeted anticancer therapy. Here, we present a novel oligonucleotide chimera, composed by an RNA aptamer and a DNA decoy. Our assembly is able to (i) target tumor cells via an antitransferrin receptor RNA aptamer and (ii) perform selective codelivery of a chemotherapeutic drug (Doxorubicin) and of an inhibitor of a cell-survival factor, the nuclear factor κB decoy oligonucleotide. Both payloads are released under conditions found in endolysosomal compartments (low pH and reductive environment). Targeting and cytotoxicity of the oligonucleotidic chimera were assessed by confocal microscopy, cell viability, and Western blot analysis. These data indicated that the nuclear factor κB decoy does inhibit nuclear factor κB activity and ultimately leads to an increased therapeutic efficacy of Doxorubicin selectively in tumor cells. PMID:25919089
Detection and prevention of mycoplasma hominis infection
DelVecchio, Vito G.; Gallia, Gary L.; McCleskey, Ferne K.
1997-01-21
The present invention is directed to a rapid and sensitive method for detecting Mycoplasma hominis using M. hominis-specific probes, oligonucleotides or antibodies. In particular a target sequence can be amplified by in vitro nucleic acid amplification techniques, detected by nucleic acid hybridization using the subject probes and oligonucleotides or detected by immunoassay using M. hominis-specific antibodies. M. hominis-specific nucleic acids which do not recognize or hybridize to genomic nucleic acid of other Mycoplasma species are also provided.
Pressure-Mediated Oligonucleotide Transfection of Rat and Human Cardiovascular Tissues
NASA Astrophysics Data System (ADS)
Mann, Michael J.; Gibbons, Gary H.; Hutchinson, Howard; Poston, Robert S.; Hoyt, E. Grant; Robbins, Robert C.; Dzau, Victor J.
1999-05-01
The application of gene therapy to human disease is currently restricted by the relatively low efficiency and potential hazards of methods of oligonucleotide or gene delivery. Antisense or transcription factor decoy oligonucleotides have been shown to be effective at altering gene expression in cell culture expreriments, but their in vivo application is limited by the efficiency of cellular delivery, the intracellular stability of the compounds, and their duration of activity. We report herein the development of a highly efficient method for naked oligodeoxynucleotide (ODN) transfection into cardiovascular tissues by using controlled, nondistending pressure without the use of viral vectors, lipid formulations, or exposure to other adjunctive, potentially hazardous substances. In this study, we have documented the ability of ex vivo, pressure-mediated transfection to achieve nuclear localization of fluorescent (FITC)-labeled ODN in approximately 90% and 50% of cells in intact human saphenous vein and rat myocardium, respectively. We have further documented that pressure-mediated delivery of antisense ODN can functionally inhibited target gene expression in both of these tissues in a sequence-specific manner at the mRNA and protein levels. This oligonucleotide transfection system may represent a safe means of achieving the intraoperative genetic engineering of failure-resistant human bypass grafts and may provide an avenue for the genetic manipulation of cardiac allograft rejection, allograft vasculopathy, or other transplant diseases.
Oligo Design: a computer program for development of probes for oligonucleotide microarrays.
Herold, Keith E; Rasooly, Avraham
2003-12-01
Oligonucleotide microarrays have demonstrated potential for the analysis of gene expression, genotyping, and mutational analysis. Our work focuses primarily on the detection and identification of bacteria based on known short sequences of DNA. Oligo Design, the software described here, automates several design aspects that enable the improved selection of oligonucleotides for use with microarrays for these applications. Two major features of the program are: (i) a tiling algorithm for the design of short overlapping temperature-matched oligonucleotides of variable length, which are useful for the analysis of single nucleotide polymorphisms and (ii) a set of tools for the analysis of multiple alignments of gene families and related short DNA sequences, which allow for the identification of conserved DNA sequences for PCR primer selection and variable DNA sequences for the selection of unique probes for identification. Note that the program does not address the full genome perspective but, instead, is focused on the genetic analysis of short segments of DNA. The program is Internet-enabled and includes a built-in browser and the automated ability to download sequences from GenBank by specifying the GI number. The program also includes several utilities, including audio recital of a DNA sequence (useful for verifying sequences against a written document), a random sequence generator that provides insight into the relationship between melting temperature and GC content, and a PCR calculator.
Shabanpoor, Fazel; McClorey, Graham; Saleh, Amer F.; Järver, Peter; Wood, Matthew J.A.; Gait, Michael J.
2015-01-01
The potential for therapeutic application of splice-switching oligonucleotides (SSOs) to modulate pre-mRNA splicing is increasingly evident in a number of diseases. However, the primary drawback of this approach is poor cell and in vivo oligonucleotide uptake efficacy. Biological activities can be significantly enhanced through the use of synthetically conjugated cationic cell penetrating peptides (CPPs). Studies to date have focused on the delivery of a single SSO conjugated to a CPP, but here we describe the conjugation of two phosphorodiamidate morpholino oligonucleotide (PMO) SSOs to a single CPP for simultaneous delivery and pre-mRNA targeting of two separate genes, exon 23 of the Dmd gene and exon 5 of the Acvr2b gene, in a mouse model of Duchenne muscular dystrophy. Conjugations of PMOs to a single CPP were carried out through an amide bond in one case and through a triazole linkage (‘click chemistry’) in the other. The most active bi-specific CPP–PMOs demonstrated comparable exon skipping levels for both pre-mRNA targets when compared to individual CPP–PMO conjugates both in cell culture and in vivo in the mdx mouse model. Thus, two SSOs with different target sequences conjugated to a single CPP are biologically effective and potentially suitable for future therapeutic exploitation. PMID:25468897
Dmitrienko, E V; Pyshnaia, I A; Pyshnyĭ, D V
2010-01-01
The features of UV-induced immobilization of oligonucleotides on a nylon membranes and the effectiveness of enzymatic labeling of immobilized probes at heterophase detection of nucleic acids are studied. Short terminal oligothymidilate (up to 10 nt) sequences are suggested to attach to the probe via a flexible ethylene glycol based linker. The presence of such fragment enhances the intensity of immobilization and reduces UV-dependent degradation of the targeted (sequence-specific) part of the probe by reducing the dose needed for the immobilization of DNA. The optimum dose of UV-irradiation is determined to be ~0.4 J/cm(2) at the wavelength 254 nm. This dose provides high level of hybridization signal for immobilized probes with various nucleotide composition of the sequence specific moiety. The amide groups of the polyamide are shown to play the key role in the photoinduced immobilization of nucleic acids, whereas the primary amino groups in the structure of PA is not the center responsible for the covalent binding of DNA by UV-irradiation, as previously believed. Various additives in the soaking solution during the membrane of UV-dependent immobilization of probes are shown to influence its effectiveness. The use of alternative to UV-irradiation system of radical generation are shown to provide the immobilization of oligonucleotides onto the nylon membrane.
NASA Astrophysics Data System (ADS)
Cai, Zhongli; Dextraze, Marie-Eve; Cloutier, Pierre; Hunting, Darel; Sanche, Léon
2006-01-01
Self-assembled monolayers of 5'-P32-labeled 3'-thiolated oligonucleotides chemisorbed on gold were bombarded by low-energy electrons (LEE) of 8-68eV. Shorter 5'-P32-oligonucleotides produced by LEE-induced strand breaks were separated with denaturing polyacrylamide gel electrophoresis and quantified by phosphor imaging. The yields of short oligonucleotides (y) decrease exponentially with their length (n), following the equation y =ae-bn, where a and b are constants, which are related to the average effective cross section per nucleotide for DNA strand break (σeff) and the attenuation length (AL=1/b) of LEE, respectively. The AL decreases with LEE energies from 2.5±0.6nm at 8eVto0.8±0.1nm at 68eV, whereas σeff increases from (3±1)×10-18to(5.1±1.6)×10-17cm2 within the same energy range. The energy dependence of σeff shows a resonance peak of (2.8±0.9)×10-17cm2 at 18eV superimposed on a monotonically rising curve. Transient electron attachment to a σ* anion state of the deoxyribose group, followed by dipolar dissociation into H- and the corresponding positive-ion radical, leading to C-O bond cleavage, is proposed to account for this maximum.
Zhang, Zhaoyang; Li, Shihui; Chen, Niancao; Yang, Cheng; Wang, Yong
2013-04-08
Extensive studies have been recently carried out to achieve dynamic control of cell-material interactions primarily through physicochemical stimulation. The purpose of this study was to apply reversible intermolecular hybridization to program cell-hydrogel interactions in physiological conditions based on DNA-antibody chimeras and complementary oligonucleotides. The results showed that DNA oligonucleotides could be captured to and released from the immobilizing DNA-functionalized hydrogels with high specificity via DNA hybridization. Accordingly, DNA-antibody chimeras were captured to the hydrogels, successfully inducing specific cell attachment. The cell attachment to the hydrogels reached the plateau at approximately half an hour after the functionalized hydrogels and the cells were incubated together. The attached cells were rapidly released from the bound hydrogels when triggering complementary oligonucleotides were introduced to the system. However, the capability of the triggering complementary oligonucleotides in releasing cells was affected by the length of intermolecular hybridization. The length needed to be at least more than 20 base pairs in the current experimental setting. Notably, because the procedure of intermolecular hybridization did not involve any harsh condition, the released cells maintained the same viability as that of the cultured cells. The functionalized hydrogels also exhibited the potential to catch and release cells repeatedly. Therefore, this study demonstrates that it is promising to regulate cell-material interactions dynamically through the DNA-programmed display of DNA-protein chimeras.
NASA Astrophysics Data System (ADS)
Chen, I.-H.; Horikawa, S.; Xi, J.; Wikle, H. C.; Barbaree, J. M.; Chin, B. A.
2017-05-01
Phage based magneto-elastic (ME) biosensors have been shown to be able to rapidly detect Salmonella in various food systems to serve food pathogen monitoring purposes. In this ME biosensor platform, the free-standing strip-shaped magneto-elastic sensor is the transducer and the phage probe that recognizes Salmonella in food serves as the bio-recognition element. According to Sorokulova et al. at 2005, a developed oligonucleotide probe E2 was reported to have high specificity to Salmonella enterica Typhimurium. In the report, the specificity tests were focused in most of Enterobacterace groups outside of Salmonella family. Here, to understand the specificity of phage E2 to different Salmonella enterica serotypes within Salmonella Family, we further tested the specificity of the phage probe to thirty-two Salmonella serotypes that were present in the major foodborne outbreaks during the past ten years (according to Centers for Disease Control and Prevention). The tests were conducted through an Enzyme linked Immunosorbent Assay (ELISA) format. This assay can mimic probe immobilized conditions on the magnetoelastic biosensor platform and also enable to study the binding specificity of oligonucleotide probes toward different Salmonella while avoiding phage/ sensor lot variations. Test results confirmed that this oligonucleotide probe E2 was high specific to Salmonella Typhimurium cells but showed cross reactivity to Salmonella Tennessee and four other serotypes among the thirty-two tested Salmonella serotypes.
Veilleux, Daniel; Gopalakrishna Panicker, Rajesh Krishnan; Chevrier, Anik; Biniecki, Kristof; Lavertu, Marc; Buschmann, Michael D
2018-02-15
Chitosan (CS)/siRNA polyplexes have great therapeutic potential for treating multiple diseases by gene silencing. However, clinical application of this technology requires the development of concentrated, hemocompatible, pH neutral formulations for safe and efficient administration. In this study we evaluate physicochemical properties of chitosan polyplexes in various buffers at increasing ionic strengths, to identify conditions for freeze-drying and rehydration at higher doses of uncoated or hyaluronic acid (HA)-coated polyplexes while maintaining physiological compatibility. Optimized formulations are used to evaluate the impact of the siRNA/oligonucleotide sequence on polyplex physicochemical properties, and to measure their in vitro silencing efficiency, cytotoxicity, and hemocompatibility. Specific oligonucleotide sequences influence polyplex physical properties at low N:P ratios, as well as their stability during freeze-drying. Nanoparticles display greater stability for oligodeoxynucleotides ODN vs siRNA; AT-rich vs GC-rich; and overhangs vs blunt ends. Using this knowledge, various CS/siRNA polyplexes are prepared with and without HA coating, freeze-dried and rehydrated at increased concentrations using reduced rehydration volumes. These polyplexes are non-cytotoxic and preserve silencing activity even after rehydration to 20-fold their initial concentration, while HA-coated polyplexes at pH∼7 also displayed increased hemocompatibility. These concentrated formulations represent a critical step towards clinical development of chitosan-based oligonucleotide intravenous delivery systems. Copyright © 2017 Elsevier Inc. All rights reserved.
Kim, Jungkil; Park, Shin-Young; Kim, Sung; Lee, Dae Hun; Kim, Ju Hwan; Kim, Jong Min; Kang, Hee; Han, Joong-Soo; Park, Jun Woo; Lee, Hosun; Choi, Suk-Ho
2016-08-18
Single-Si-nanowire (NW)-based DNA sensors have been recently developed, but their sensitivity is very limited because of high noise signals, originating from small source-drain current of the single Si NW. Here, we demonstrate that chemical-vapor-deposition-grown large-scale graphene/surface-modified vertical-Si-NW-arrays junctions can be utilized as diode-type biosensors for highly-sensitive and -selective detection of specific oligonucleotides. For this, a twenty-seven-base-long synthetic oligonucleotide, which is a fragment of human DENND2D promoter sequence, is first decorated as a probe on the surface of vertical Si-NW arrays, and then the complementary oligonucleotide is hybridized to the probe. This hybridization gives rise to a doping effect on the surface of Si NWs, resulting in the increase of the current in the biosensor. The current of the biosensor increases from 19 to 120% as the concentration of the target DNA varies from 0.1 to 500 nM. In contrast, such biosensing does not come into play by the use of the oligonucleotide with incompatible or mismatched sequences. Similar results are observed from photoluminescence microscopic images and spectra. The biosensors show very-uniform current changes with standard deviations ranging ~1 to ~10% by ten-times endurance tests. These results are very promising for their applications in accurate, selective, and stable biosensing.
Studzińska, Sylwia; Krzemińska, Katarzyna; Szumski, Michał; Buszewski, Bogusław
2016-07-01
The main aim of this study was the investigation of the influence of several ion pair reagents towards both the retention and the mass spectrometry sensitivity of phosphorothioate oligonucleotides. A cholesterol stationary phase was applied for the first time in the analysis of this group of compounds. The mobile phase composition was modified by changing the concentration and the type of amines and acetates or 1,1,1,3,3,3-hexafluoroisopropanol. It has been shown that the increase of amines concentration results in the retention factor increase for each oligonucleotide, on each adsorbent. The only exception was the mobile phase composed of triethylamine and 1,1,1,3,3,3-hexafluoroisopropanol. This is a consequence of interactions taking place between a cholesterol molecule and an alcohol. This effect was convenient when the mass spectrometry detection was applied, since it allowed an increase in the sensitivity. Moreover, optimization of the mobile phase composition and its impact on the efficiency of ionization process and on the sensitivity in mass spectrometry were also presented. The optimization of this new method, based on cholesterol stationary phase coupled with mass spectrometry detection, was finally applied for the determination of phosphorothioate oligonucleotides impurity in a real sample. Copyright © 2016 Elsevier B.V. All rights reserved.
Nanomechanics for specific biological detection
NASA Astrophysics Data System (ADS)
Alvarez, Mar; Carrascosa, Laura G.; Tamayo, Javier; Calle, Ana; Lechuga, Laura M.
2003-04-01
Nanomechanical biosensors have emerged as a promising platform for specific biological. Among the advantages are direct detection without need of labelling with fluorescent or radioactive molecules, very high sensitivity, reduced sensor area, and suitability for integration using silicon technology. Here we have studied the immobilization of oligonucleotide monolayers by monitoring the microcantilever bending. Oligonucleotides were derivatized with thiol molecules for self-assembly on the gold-coated side of a microcantilever. The geometry of the binding and the surface density were studied by mixing derivatized oligonucleotides with spacer self-assembled monolayers and by controlling the oligonucleotide functional group form. These results are compared with fluoresencent and chemiluminescence techniques. Furthermore, we present the first results of direct pesticide detection with microcantilever-based biosensors. Herbicide DDT was detected by performing competitive assays, in which the cantilever was coated with a synthetic DDT hapten, and it was exposured to different rations between the monoclonal antibody and the DDT. A new technique is presented for the detection of the nanomechanical response for biosensing applications, in which the resonant frequency is measured with about two orders of magnitude higher sensitivity. The low quality factor of the microcantilever in liquid is increased up by using an active feedback control, in which the cantilever oscillation is amplified and delayed and it is used as a driving force. The technique has been applied for the detection of ethanol, proteins, and pathogens.
Jakschitz, Thomas A E; Huck, Christian W; Lubbad, Said; Bonn, Günther K
2007-04-13
In this paper the synthesis, optimisation and application of a silane based monolithic copolymer for the rapid separation of proteins and oligonucleotides is described. The monolith was prepared by thermal initiated in situ copolymerisation of trimethylsilyl-4-methylstyrene (TMSiMS) and bis(4-vinylbenzyl)dimethylsilane (BVBDMSi) in a silanised 200 microm I.D. fused silica column. Different ratios of monomer and crosslinker, as well as different ratios of micro- (toluene) and macro-porogen (2-propanol) were used for optimising the physical properties of the stationary phase regarding separation efficiency. The prepared monolithic stationary phases were characterised by measurement of permeability with different solvents, determination of pore size distribution by mercury intrusion porosimetry (MIP). Morphology was studied by scanning electron microscopy (SEM). Applying optimised conditions, a mixture comprised of five standard proteins ribunuclease A, cytochrome c, alpha-lactalbumine, myoglobine and ovalbumine was separated within 1 min by ion-pair reversed-phase liquid chromatography (IP-RPLC) obtaining half-height peak widths between 1.8 and 2.4 s. Baseline separation of oligonucleotides d(pT)(12-18) was achieved within 1.8 min obtaining half-height peak widths between 3.6 and 5.4 s. The results demonstrate the high potential of this stationary phase for fast separation of high-molecular weight biomolecules such as oligonucleotides and proteins.
Malecka, Kamila; Stachyra, Anna; Góra-Sochacka, Anna; Sirko, Agnieszka; Zagórski-Ostoja, Włodzimierz; Dehaen, Wim; Radecka, Hanna; Radecki, Jerzy
2015-03-15
This paper concerns the development of a redox-active monolayer and its application for the construction of an electrochemical genosensor designed for the detection of specific DNA and RNA oligonucleotide sequences related to the avian influenza virus (AIV) type H5N1. This new redox layer was created on a gold electrode surface step by step. Cyclic Voltammetry, Osteryoung Square-Wave Voltammetry and Differential Pulse Voltammetry were used for its characterization. This new redox-active layer was applied for the construction of the DNA biosensor. The NH2-NC3 probe (20-mer) was covalently attached to the gold electrode surface via a "click" reaction between the amine and an epoxide group. The hybridization process was monitored using the Osteryoung Square-Wave Voltammetry. The 20-mer DNA and ca. 280-mer RNA oligonucleotides were used as the targets. The constructed genosensor was capable to determine complementary oligonucleotide sequences with a detection limit in the pM range. It is able to distinguish the different position of the part RNA complementary to the DNA probe. The genosensor was very selective. The 20-mer DNA as well as the 280-mer RNA oligonucleotides without a complementary sequence generated a weak signal. Copyright © 2014 Elsevier B.V. All rights reserved.
Tsang, Ming-Kiu; Ye, WeiWei; Wang, Guojing; Li, Jingming; Yang, Mo; Hao, Jianhua
2016-01-26
Ebola outbreaks are currently of great concern, and therefore, development of effective diagnosis methods is urgently needed. The key for lethal virus detection is high sensitivity, since early-stage detection of virus may increase the probability of survival. Here, we propose a luminescence scheme of assay consisting of BaGdF5:Yb/Er upconversion nanoparticles (UCNPs) conjugated with oligonucleotide probe and gold nanoparticles (AuNPs) linked with target Ebola virus oligonucleotide. As a proof of concept, a homogeneous assay was fabricated and tested, yielding a detection limit at picomolar level. The luminescence resonance energy transfer is ascribed to the spectral overlapping of upconversion luminescence and the absorption characteristics of AuNPs. Moreover, we anchored the UCNPs and AuNPs on a nanoporous alumina (NAAO) membrane to form a heterogeneous assay. Importantly, the detection limit was greatly improved, exhibiting a remarkable value at the femtomolar level. The enhancement is attributed to the increased light-matter interaction throughout the nanopore walls of the NAAO membrane. The specificity test suggested that the nanoprobes were specific to Ebola virus oligonucleotides. The strategy combining UCNPs, AuNPs, and NAAO membrane provides new insight into low-cost, rapid, and ultrasensitive detection of different diseases. Furthermore, we explored the feasibility of clinical application by using inactivated Ebola virus samples. The detection results showed great potential of our heterogeneous design for practical application.
Souza, Elaine; Nascimento, Gustavo; Santana, Nataly; Ferreira, Danielly; Lima, Manoel; Natividade, Edna; Martins, Danyelly; Lima-Filho, José
2011-01-01
A biosensor that relies on the adsorption immobilization of the 18-mer single-stranded nucleic acid related to dengue virus gene 1 on activated pencil graphite was developed. Hybridization between the probe and its complementary oligonucleotides (the target) was investigated by monitoring guanine oxidation by differential pulse voltammetry (DPV). The pencil graphite electrode was made of ordinary pencil lead (type 4B). The polished surface of the working electrode was activated by applying a potential of 1.8 V for 5 min. Afterward, the dengue oligonucleotides probe was immobilized on the activated electrode by applying 0.5 V to the electrode in 0.5 M acetate buffer (pH 5.0) for 5 min. The hybridization process was carried out by incubating at the annealing temperature of the oligonucleotides. A time of five minutes and concentration of 1 μM were found to be the optimal conditions for probe immobilization. The electrochemical detection of annealing between the DNA probe (TS-1P) immobilized on the modified electrode, and the target (TS-1T) was achieved. The target could be quantified in a range from 1 to 40 nM with good linearity and a detection limit of 0.92 nM. The specificity of the electrochemical biosensor was tested using non-complementary sequences of dengue virus 2 and 3. PMID:22163916
Rivera-Torres, Natalia; Banas, Kelly; Bialk, Pawel; Bloh, Kevin M; Kmiec, Eric B
2017-01-01
CRISPR/Cas9 and single-stranded DNA oligonucleotides (ssODNs) have been used to direct the repair of a single base mutation in human genes. Here, we examine a method designed to increase the precision of RNA guided genome editing in human cells by utilizing a CRISPR/Cas9 ribonucleoprotein (RNP) complex to initiate DNA cleavage. The RNP is assembled in vitro and induces a double stranded break at a specific site surrounding the mutant base designated for correction by the ssODN. We use an integrated mutant eGFP gene, bearing a single base change rendering the expressed protein nonfunctional, as a single copy target in HCT 116 cells. We observe significant gene correction activity of the mutant base, promoted by the RNP and single-stranded DNA oligonucleotide with validation through genotypic and phenotypic readout. We demonstrate that all individual components must be present to obtain successful gene editing. Importantly, we examine the genotype of individually sorted corrected and uncorrected clonally expanded cell populations for the mutagenic footprint left by the action of these gene editing tools. While the DNA sequence of the corrected population is exact with no adjacent sequence modification, the uncorrected population exhibits heterogeneous mutagenicity with a wide variety of deletions and insertions surrounding the target site. We designate this type of DNA aberration as on-site mutagenicity. Analyses of two clonal populations bearing specific DNA insertions surrounding the target site, indicate that point mutation repair has occurred at the level of the gene. The phenotype, however, is not rescued because a section of the single-stranded oligonucleotide has been inserted altering the reading frame and generating truncated proteins. These data illustrate the importance of analysing mutagenicity in uncorrected cells. Our results also form the basis of a simple model for point mutation repair directed by a short single-stranded DNA oligonucleotides and CRISPR/Cas9 ribonucleoprotein complex.
Rivera-Torres, Natalia; Bialk, Pawel; Bloh, Kevin M.; Kmiec, Eric B.
2017-01-01
CRISPR/Cas9 and single-stranded DNA oligonucleotides (ssODNs) have been used to direct the repair of a single base mutation in human genes. Here, we examine a method designed to increase the precision of RNA guided genome editing in human cells by utilizing a CRISPR/Cas9 ribonucleoprotein (RNP) complex to initiate DNA cleavage. The RNP is assembled in vitro and induces a double stranded break at a specific site surrounding the mutant base designated for correction by the ssODN. We use an integrated mutant eGFP gene, bearing a single base change rendering the expressed protein nonfunctional, as a single copy target in HCT 116 cells. We observe significant gene correction activity of the mutant base, promoted by the RNP and single-stranded DNA oligonucleotide with validation through genotypic and phenotypic readout. We demonstrate that all individual components must be present to obtain successful gene editing. Importantly, we examine the genotype of individually sorted corrected and uncorrected clonally expanded cell populations for the mutagenic footprint left by the action of these gene editing tools. While the DNA sequence of the corrected population is exact with no adjacent sequence modification, the uncorrected population exhibits heterogeneous mutagenicity with a wide variety of deletions and insertions surrounding the target site. We designate this type of DNA aberration as on-site mutagenicity. Analyses of two clonal populations bearing specific DNA insertions surrounding the target site, indicate that point mutation repair has occurred at the level of the gene. The phenotype, however, is not rescued because a section of the single-stranded oligonucleotide has been inserted altering the reading frame and generating truncated proteins. These data illustrate the importance of analysing mutagenicity in uncorrected cells. Our results also form the basis of a simple model for point mutation repair directed by a short single-stranded DNA oligonucleotides and CRISPR/Cas9 ribonucleoprotein complex. PMID:28052104
Shahmuradyan, Anna; Krull, Ulrich J
2016-03-15
Quantum dots (QDs) have been widely used in chemical and biosensing due to their unique photoelectrical properties and are well suited as donors in fluorescence resonance energy transfer (FRET). Selective hybridization interactions of oligonucleotides on QDs have been determined by FRET. Typically, the QD-FRET constructs have made use of labeled targets or have implemented labeled sandwich format assays to introduce dyes in proximity to the QDs for the FRET process. The intention of this new work is to explore a method to incorporate the acceptor dye into the probe molecule. Thiazole orange (TO) derivatives are fluorescent intercalating dyes that have been used for detection of double-stranded nucleic acids. One such dye system has been reported in which single-stranded oligonucleotide probes were doubly labeled with adjacent thiazole orange derivatives. In the absence of the fully complementary (FC) oligonucleotide target, the dyes form an H-aggregate, which results in quenching of fluorescence emission due to excitonic interactions between the dyes. The hybridization of the FC target to the probe provides for dissociation of the aggregate as the dyes intercalate into the double stranded duplex, resulting in increased fluorescence. This work reports investigation of the dependence of the ratiometric signal on the type of linkage used to conjugate the dyes to the probe, the location of the dye along the length of the probe, and the distance between adjacent dye molecules. The limit of detection for 34mer and 90mer targets was found to be identical and was 10 nM (2 pmol), similar to analogous QD-FRET using labeled oligonucleotide target. The detection system could discriminate a one base pair mismatch (1BPM) target and was functional without substantial compromise of the signal in 75% serum. The 1BPM was found to reduce background signal, indicating that the structure of the mismatch affected the environment of the intercalating dyes.
Chen, Lu; Algar, W Russ; Tavares, Anthony J; Krull, Ulrich J
2011-01-01
The optical properties and surface area of quantum dots (QDs) have made them an attractive platform for the development of nucleic acid biosensors based on fluorescence resonance energy transfer (FRET). Solid-phase assays based on FRET using mixtures of immobilized QD-oligonucleotide conjugates (QD biosensors) have been developed. The typical challenges associated with solid-phase detection strategies include non-specific adsorption, slow kinetics of hybridization, and sample manipulation. The new work herein has considered the immobilization of QD biosensors onto the surfaces of microfluidic channels in order to address these challenges. Microfluidic flow can be used to dynamically control stringency by adjustment of the potential in an electrokinetic-based microfluidics environment. The shearing force, Joule heating, and the competition between electroosmotic and electrophoretic mobilities allow the optimization of hybridization conditions, convective delivery of target to the channel surface to speed hybridization, amelioration of adsorption, and regeneration of the sensing surface. Microfluidic flow can also be used to deliver (for immobilization) and remove QD biosensors. QDs that were conjugated with two different oligonucleotide sequences were used to demonstrate feasibility. One oligonucleotide sequence on the QD was available as a linker for immobilization via hybridization with complementary oligonucleotides located on a glass surface within a microfluidic channel. A second oligonucleotide sequence on the QD served as a probe to transduce hybridization with target nucleic acid in a sample solution. A Cy3 label on the target was excited by FRET using green-emitting CdSe/ZnS QD donors and provided an analytical signal to explore this detection strategy. The immobilized QDs could be removed under denaturing conditions by disrupting the duplex that was used as the surface linker and thus allowed a new layer of QD biosensors to be re-coated within the channel for re-use of the microfluidic chip.
Spherical Nucleic Acids as Intracellular Agents for Nucleic Acid Based Therapeutics
NASA Astrophysics Data System (ADS)
Hao, Liangliang
Recent functional discoveries on the noncoding sequences of human genome and transcriptome could lead to revolutionary treatment modalities because the noncoding RNAs (ncRNAs) can be applied as therapeutic agents to manipulate disease-causing genes. To date few nucleic acid-based therapeutics have been translated into the clinic due to challenges in the delivery of the oligonucleotide agents in an effective, cell specific, and non-toxic fashion. Unmodified oligonucleotide agents are destroyed rapidly in biological fluids by enzymatic degradation and have difficulty crossing the plasma membrane without the aid of transfection reagents, which often cause inflammatory, cytotoxic, or immunogenic side effects. Spherical nucleic acids (SNAs), nanoparticles consisting of densely organized and highly oriented oligonucleotides, pose one possible solution to circumventing these problems in both the antisense and RNA interference (RNAi) pathways. The unique three dimensional architecture of SNAs protects the bioactive oligonucleotides from unspecific degradation during delivery and supports their targeting of class A scavenger receptors and endocytosis via a lipid-raft-dependent, caveolae-mediated pathway. Owing to their unique structure, SNAs are able to cross cell membranes and regulate target genes expression as a single entity, without triggering the cellular innate immune response. Herein, my thesis has focused on understanding the interactions between SNAs and cellular components and developing SNA-based nanostructures to improve therapeutic capabilities. Specifically, I developed a novel SNA-based, nanoscale agent for delivery of therapeutic oligonucleotides to manipulate microRNAs (miRNAs), the endogenous post-transcriptional gene regulators. I investigated the role of SNAs involving miRNAs in anti-cancer or anti-inflammation responses in cells and in in vivo murine disease models via systemic injection. Furthermore, I explored using different strategies to construct novel SNA-based nanomaterials with desired properties and applying targeting moieties to the SNA platform to achieve cell type specific gene regulation effects. Due to the flexibility of the SNA approach, the SNA platform can potentially be applied to many genetic disorders through tailored target specificities.
NASA Astrophysics Data System (ADS)
Rull, Jordi; Nonglaton, Guillaume; Costa, Guillaume; Fontelaye, Caroline; Marchi-Delapierre, Caroline; Ménage, Stéphane; Marchand, Gilles
2015-11-01
The functionalization of silicon oxide based substrates using silanes is generally performed through liquid phase methodologies. These processes involve a huge quantity of potentially toxic solvents and present some important disadvantages for the functionalization of microdevices or porous materials, for example the low diffusion. To overcome this drawback, solvent-free methodologies like molecular vapor deposition (MVD) or supercritical fluid deposition (SFD) have been developed. In this paper, the deposition process of 3,4-epoxybutyltrimethoxysilane (EBTMOS) on silicon oxide using supercritical carbon dioxide (scCO2) as a solvent is studied for the first time. The oxirane ring of epoxy silanes readily reacts with amine group and is of particular interest for the grafting of amino-modified oligonucleotides or antibodies for diagnostic application. Then the ability of this specific EBTMOS layer to react with amine functions has been evaluated using the immobilization of amino-modified oligonucleotide probes. The presence of the probes is revealed by fluorescence using hybridization with a fluorescent target oligonucleotide. The performances of SFD of EBTMOS have been optimized and then compared with the dip coating and molecular vapor deposition methods, evidencing a better grafting efficiency and homogeneity, a lower reaction time in addition to the eco-friendly properties of the supercritical carbon dioxide. The epoxysilane layers have been characterized by surface enhanced ellipsometric contrast optical technique, atomic force microscopy, multiple internal reflection infrared spectroscopy and X-ray photoelectron spectroscopy. The shelf life of the 3,4-epoxybutyltrimethoxysilane coating layer has also been studied. Finally, two different strategies of NH2-oligonucleotide grafting on EBTMOS coating layer have been compared, i.e. reductive amination and nucleophilic substitution, SN2. This EBTMOS based coating layer can be used for a wide range of applications such as the preparation of new supported and recoverable catalysts and new integrated silicon microdevices for healthcare purposes.
NASA Technical Reports Server (NTRS)
El Fantroussi, Said; Urakawa, Hidetoshi; Bernhard, Anne E.; Kelly, John J.; Noble, Peter A.; Smidt, H.; Yershov, G. M.; Stahl, David A.
2003-01-01
Oligonucleotide microarrays were used to profile directly extracted rRNA from environmental microbial populations without PCR amplification. In our initial inspection of two distinct estuarine study sites, the hybridization patterns were reproducible and varied between estuarine sediments of differing salinities. The determination of a thermal dissociation curve (i.e., melting profile) for each probe-target duplex provided information on hybridization specificity, which is essential for confirming adequate discrimination between target and nontarget sequences.
Molecular diagnostics using magnetic nanobeads
NASA Astrophysics Data System (ADS)
Zardán Gómez de la Torre, Teresa; Strömberg, Mattias; Göransson, Jenny; Gunnarsson, Klas; Nilsson, Mats; Svedlindh, Peter; Strømme, Maria
2010-01-01
In this paper, we investigate the volume-amplified magnetic nanobead detection assay with respect to bead size, bead concentration and bead oligonucleotide surface coverage in order to improve the understanding of the underlying microscopic mechanisms. It has been shown that: (i) the immobilization efficiency of the beads depends on the surface coverage of oligonucleotides, (ii) by using lower amounts of probe-tagged beads, detection sensitivity can be improved and (iii) using small enough beads enables both turn-off and turn-on detection. Finally, biplex detection was demonstrated.
Transcript copy number estimation using a mouse whole-genome oligonucleotide microarray
Carter, Mark G; Sharov, Alexei A; VanBuren, Vincent; Dudekula, Dawood B; Carmack, Condie E; Nelson, Charlie; Ko, Minoru SH
2005-01-01
The ability to quantitatively measure the expression of all genes in a given tissue or cell with a single assay is an exciting promise of gene-expression profiling technology. An in situ-synthesized 60-mer oligonucleotide microarray designed to detect transcripts from all mouse genes was validated, as well as a set of exogenous RNA controls derived from the yeast genome (made freely available without restriction), which allow quantitative estimation of absolute endogenous transcript abundance. PMID:15998450
O-Charoen, Sirimon; Srivannavit, Onnop; Gulari, Erdogan
2008-01-01
Microfluidic microarrays have been developed for economical and rapid parallel synthesis of oligonucleotide and peptide libraries. For a synthesis system to be reproducible and uniform, it is crucial to have a uniform reagent delivery throughout the system. Computational fluid dynamics (CFD) is used to model and simulate the microfluidic microarrays to study geometrical effects on flow patterns. By proper design geometry, flow uniformity could be obtained in every microreactor in the microarrays. PMID:17480053
Sensible use of antisense: how to use oligonucleotides as research tools.
Myers, K J; Dean, N M
2000-01-01
In the past decade, there has been a vast increase in the amount of gene sequence information that has the potential to revolutionize the way diseases are both categorized and treated. Old diagnoses, largely anatomical or descriptive in nature, are likely to be superceded by the molecular characterization of the disease. The recognition that certain genes drive key disease processes will also enable the rational design of gene-specific therapeutics. Antisense oligonucleotides represent a technology that should play multiple roles in this process.
Remote Optical Switch for Localized and Selective Control of Gene Interference
Lee, Somin Eunice; Liu, Gang Logan; Kim, Franklin; Lee, Luke P.
2009-01-01
Near infrared-absorbing gold nanoplasmonic particles (GNPs) are used as optical switches of gene interference and are remotely controlled using light. We have tuned optical switches to a wavelength where cellular photodamage is minimized. Optical switches are functionalized with double-stranded oligonucleotides. At desired times and at specific intracellular locations, remote optical excitation is used to liberate gene-interfering oligonucleotides. We demonstrate a novel gene-interfering technique offering spatial and temporal control, which is otherwise impossible using conventional gene-interfering techniques. PMID:19128006
M1.3 - a small scaffold for DNA origami
NASA Astrophysics Data System (ADS)
Said, Hassan; Schüller, Verena J.; Eber, Fabian J.; Wege, Christina; Liedl, Tim; Richert, Clemens
2012-12-01
The DNA origami method produces programmable nanoscale objects that form when one long scaffold strand hybridizes to numerous oligonucleotide staple strands. One scaffold strand is dominating the field: M13mp18, a bacteriophage-derived vector 7249 nucleotides in length. The full-length M13 is typically folded by using over 200 staple oligonucleotides. Here we report the convenient preparation of a 704 nt fragment dubbed ``M1.3'' as a linear or cyclic scaffold and the assembly of small origami structures with just 15-24 staple strands. A typical M1.3 origami is large enough to be visualized by TEM, but small enough to show a cooperativity in its assembly and thermal denaturation that is reminiscent of oligonucleotide duplexes. Due to its medium size, M1.3 origami with globally modified staples is affordable. As a proof of principle, two origami structures with globally 5'-capped staples were prepared and were shown to give higher UV-melting points than the corresponding assembly with unmodified DNA. M1.3 has the size of a gene, not a genome, and may function as a model for gene-based nanostructures. Small origami with M1.3 as a scaffold may serve as a workbench for chemical, physical, and biological experiments.The DNA origami method produces programmable nanoscale objects that form when one long scaffold strand hybridizes to numerous oligonucleotide staple strands. One scaffold strand is dominating the field: M13mp18, a bacteriophage-derived vector 7249 nucleotides in length. The full-length M13 is typically folded by using over 200 staple oligonucleotides. Here we report the convenient preparation of a 704 nt fragment dubbed ``M1.3'' as a linear or cyclic scaffold and the assembly of small origami structures with just 15-24 staple strands. A typical M1.3 origami is large enough to be visualized by TEM, but small enough to show a cooperativity in its assembly and thermal denaturation that is reminiscent of oligonucleotide duplexes. Due to its medium size, M1.3 origami with globally modified staples is affordable. As a proof of principle, two origami structures with globally 5'-capped staples were prepared and were shown to give higher UV-melting points than the corresponding assembly with unmodified DNA. M1.3 has the size of a gene, not a genome, and may function as a model for gene-based nanostructures. Small origami with M1.3 as a scaffold may serve as a workbench for chemical, physical, and biological experiments. Electronic supplementary information (ESI) available: Materials, full sequence of M1.3, alternative restriction reactions, sequences and origami designs, ALEX data, estimated cost of producing M13, additional melting data for origami, and MALDI spectra of individual capped oligonucleotides. See DOI: 10.1039/c2nr32393a
High-throughput assays for DNA gyrase and other topoisomerases
Maxwell, Anthony; Burton, Nicolas P.; O'Hagan, Natasha
2006-01-01
We have developed high-throughput microtitre plate-based assays for DNA gyrase and other DNA topoisomerases. These assays exploit the fact that negatively supercoiled plasmids form intermolecular triplexes more efficiently than when they are relaxed. Two assays are presented, one using capture of a plasmid containing a single triplex-forming sequence by an oligonucleotide tethered to the surface of a microtitre plate and subsequent detection by staining with a DNA-specific fluorescent dye. The other uses capture of a plasmid containing two triplex-forming sequences by an oligonucleotide tethered to the surface of a microtitre plate and subsequent detection by a second oligonucleotide that is radiolabelled. The assays are shown to be appropriate for assaying DNA supercoiling by Escherichia coli DNA gyrase and DNA relaxation by eukaryotic topoisomerases I and II, and E.coli topoisomerase IV. The assays are readily adaptable to other enzymes that change DNA supercoiling (e.g. restriction enzymes) and are suitable for use in a high-throughput format. PMID:16936317
High-throughput assays for DNA gyrase and other topoisomerases.
Maxwell, Anthony; Burton, Nicolas P; O'Hagan, Natasha
2006-01-01
We have developed high-throughput microtitre plate-based assays for DNA gyrase and other DNA topoisomerases. These assays exploit the fact that negatively supercoiled plasmids form intermolecular triplexes more efficiently than when they are relaxed. Two assays are presented, one using capture of a plasmid containing a single triplex-forming sequence by an oligonucleotide tethered to the surface of a microtitre plate and subsequent detection by staining with a DNA-specific fluorescent dye. The other uses capture of a plasmid containing two triplex-forming sequences by an oligonucleotide tethered to the surface of a microtitre plate and subsequent detection by a second oligonucleotide that is radiolabelled. The assays are shown to be appropriate for assaying DNA supercoiling by Escherichia coli DNA gyrase and DNA relaxation by eukaryotic topoisomerases I and II, and E.coli topoisomerase IV. The assays are readily adaptable to other enzymes that change DNA supercoiling (e.g. restriction enzymes) and are suitable for use in a high-throughput format.
Template switching between PNA and RNA oligonucleotides
NASA Technical Reports Server (NTRS)
Bohler, C.; Nielsen, P. E.; Orgel, L. E.; Miller, S. L. (Principal Investigator)
1995-01-01
The origin of the RNA world is not easily understood, as effective prebiotic syntheses of the components of RNA, the beta-ribofuranoside-5'-phosphates, are hard to envisage. Recognition of this difficulty has led to the proposal that other genetic systems, the components of which are more easily formed, may have preceded RNA. This raises the question of how transitions between one genetic system and another could occur. Peptide nucleic acid (PNA) resembles RNA in its ability to form double-helical complexes stabilized by Watson-Crick hydrogen bonding between adenine and thymine and between cytosine and guanine, but has a backbone that is held together by amide rather than by phosphodiester bonds. Oligonucleotides bases on RNA are known to act as templates that catalyse the non-enzymatic synthesis of their complements from activated mononucleotides, we now show that RNA oligonucleotides facilitate the synthesis of complementary PNA strands and vice versa. This suggests that a transition between different genetic systems can occur without loss of information.
Oligo/Polynucleotide-Based Gene Modification: Strategies and Therapeutic Potential
Sargent, R. Geoffrey; Kim, Soya
2011-01-01
Oligonucleotide- and polynucleotide-based gene modification strategies were developed as an alternative to transgene-based and classical gene targeting-based gene therapy approaches for treatment of genetic disorders. Unlike the transgene-based strategies, oligo/polynucleotide gene targeting approaches maintain gene integrity and the relationship between the protein coding and gene-specific regulatory sequences. Oligo/polynucleotide-based gene modification also has several advantages over classical vector-based homologous recombination approaches. These include essentially complete homology to the target sequence and the potential to rapidly engineer patient-specific oligo/polynucleotide gene modification reagents. Several oligo/polynucleotide-based approaches have been shown to successfully mediate sequence-specific modification of genomic DNA in mammalian cells. The strategies involve the use of polynucleotide small DNA fragments, triplex-forming oligonucleotides, and single-stranded oligodeoxynucleotides to mediate homologous exchange. The primary focus of this review will be on the mechanistic aspects of the small fragment homologous replacement, triplex-forming oligonucleotide-mediated, and single-stranded oligodeoxynucleotide-mediated gene modification strategies as it relates to their therapeutic potential. PMID:21417933
Li, Qin; Lynen, Frédéric; Wang, Jian; Li, Hanlin; Xu, Guowang; Sandra, Pat
2012-09-14
A comprehensive two-dimensional HPLC approach with a high degree of orthogonality was developed for analysis of di- to deca-oligonucleotides (ONs). Hydrophilic interaction liquid chromatography (HILIC) was used in the first dimension, and ion-pair reversed-phase liquid chromatography (IP-RPLC) was employed in the second dimension. The two dimensions were connected via a ten-port valve interface equipped with octadecyl silica (ODS) traps to immobilize and focus the ONs eluting from the first dimension prior to IP-RPLC separation. An aqueous make-up flow was used for effective trapping. The comprehensive two-dimensional HPLC system was optimized with a mixture consisting of 27 oligonucleotide standards. An overall chromatographic peak capacity of 500 was obtained. The use of the volatile buffer triethylamine acetate in the second dimension allowed straightforward coupling to electrospray ionization mass spectrometry (ESI-MS) and detection of each ON in the negative ionization mode. Copyright © 2011 Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Lou, Chenguang; Martos-Maldonado, Manuel C.; Madsen, Charlotte S.; Thomsen, Rasmus P.; Midtgaard, Søren Roi; Christensen, Niels Johan; Kjems, Jørgen; Thulstrup, Peter W.; Wengel, Jesper; Jensen, Knud J.
2016-07-01
Peptide-based structures can be designed to yield artificial proteins with specific folding patterns and functions. Template-based assembly of peptide units is one design option, but the use of two orthogonal self-assembly principles, oligonucleotide triple helix and a coiled coil protein domain formation have never been realized for de novo protein design. Here, we show the applicability of peptide-oligonucleotide conjugates for self-assembly of higher-ordered protein-like structures. The resulting nano-assemblies were characterized by ultraviolet-melting, gel electrophoresis, circular dichroism (CD) spectroscopy, small-angle X-ray scattering and transmission electron microscopy. These studies revealed the formation of the desired triple helix and coiled coil domains at low concentrations, while a dimer of trimers was dominating at high concentration. CD spectroscopy showed an extraordinarily high degree of α-helicity for the peptide moieties in the assemblies. The results validate the use of orthogonal self-assembly principles as a paradigm for de novo protein design.
Mass spectrometric detection of siRNA in plasma samples for doping control purposes.
Kohler, Maxie; Thomas, Andreas; Walpurgis, Katja; Schänzer, Wilhelm; Thevis, Mario
2010-10-01
Small interfering ribonucleic acid (siRNA) molecules can effect the expression of any gene by inducing the degradation of mRNA. Therefore, these molecules can be of interest for illicit performance enhancement in sports by affecting different metabolic pathways. An example of an efficient performance-enhancing gene knockdown is the myostatin gene that regulates muscle growth. This study was carried out to provide a tool for the mass spectrometric detection of modified and unmodified siRNA from plasma samples. The oligonucleotides are purified by centrifugal filtration and the use of an miRNA purification kit, followed by flow-injection analysis using an Exactive mass spectrometer to yield the accurate masses of the sense and antisense strands. Although chromatography and sensitive mass spectrometric analysis of oligonucleotides are still challenging, a method was developed and validated that has adequate sensitivity (limit of detection 0.25-1 nmol mL(-1)) and performance (precision 11-21%, recovery 23-67%) for typical antisense oligonucleotides currently used in clinical studies.
In vitro pharmacokinetics of phosphorothioate antisense oligonucleotides.
Crooke, R M; Graham, M J; Cooke, M E; Crooke, S T
1995-10-01
ISIS 2105 (Afovirsen), a 20-mer phosphorothioate oligonucleotide that inhibits the production of a gene product essential to the growth of human papillomavirus, is in phase II clinical trials for the treatment of genital warts induced by human papillomavirus-6 and human papillomavirus-11. The uptake, subcellular distribution and metabolism of ISIS 2105 and three other similar length phosphorothioates have been studied in a variety of cell lines. Our experiments indicated that ISIS 2105 and other phosphorothioates are internalized and distributed in a time-, temperature-, concentration-, sequence- and cell line-dependent manner. Cell association was also influenced by the tissue culture medium. Several different analytical techniques revealed that phosphorothioates were more rapidly degraded in vitro than previously reported. These data suggest that phosphorothioate oligonucleotide uptake and stability observed in tissue culture can vary as a function of cellular assay conditions and analytical methods used. Comparison of these results with those obtained in vivo suggests that the pharmacokinetic behavior of this class of compounds cannot necessarily be predicted from in vitro studies.
Dekker, M; Brouwers, C; Aarts, M; van der Torre, J; de Vries, S; van de Vrugt, H; te Riele, H
2006-04-01
We have previously demonstrated that site-specific insertion, deletion or substitution of one or two nucleotides in mouse embryonic stem cells (ES cells) by single-stranded deoxyribo-oligonucleotides is several hundred-fold suppressed by DNA mismatch repair (MMR) activity. Here, we have investigated whether compound mismatches and larger insertions escape detection by the MMR machinery and can be effectively introduced in MMR-proficient cells. We identified several compound mismatches that escaped detection by the MMR machinery to some extent, but could not define general rules predicting the efficacy of complex base-pair substitutions. In contrast, we found that four-nucleotide insertions were largely subject to suppression by the MSH2/MSH3 branch of MMR and could be effectively introduced in Msh3-deficient cells. As these cells have no overt mutator phenotype and Msh3-deficient mice do not develop cancer, Msh3-deficient ES cells can be used for oligonucleotide-mediated gene disruption. As an example, we present disruption of the Fanconi anemia gene Fancf.
Sun, Jingjing; Tang, Xinjing
2015-01-01
DNA cross-linking technology is an attractive tool for the detection, regulation, and manipulation of genes. In this study, a series of photolabile 4-oxo-enal-modified oligonucleotides functionalized with photosensitive ο-nitrobenzyl derivatives were rationally designed as a new kind of photocaged cross-linking agents. A comprehensive evaluation of cross-linking reactions for different nucleobases in complementary strands under different conditions suggested that the modified DNA oligonucleotides tended to form interstrand cross-linking to nucleobases with the potential of thymidine > guanosine » cytidine ~ adenosine. Different from previous literature reports that cytidine and adenosine were preferential cross-linked nucleobases with 4-oxo-enal moieties, our study represents the first example of DNA cross-linking for T and G selectivity using 4-oxo-enal moiety. The cross-linked adducts were identified and their cross-linking mechanism was also illustrated. This greatly expands the applications of 4-oxo-enal derivatives in the studies of DNA damage and RNA structure PMID:26020694
Metastasizing patent claims on BRCA1.
Kepler, Thomas B; Crossman, Colin; Cook-Deegan, Robert
2010-05-01
Many patents make claims on DNA sequences; some include claims on oligonucleotides related to the primary patented gene. We used bioinformatics to quantify the reach of one such claim from patent 4,747,282 on BRCA1. We find that human chromosome 1 (which does not contain BRCA1) contains over 300,000 oligonucleotides covered by this claim, and that 80% of cDNA and mRNA sequences contributed to GenBank before the patent application was filed also contain at least one claimed oligonucleotide. Any "isolated" DNA molecules that include such 15 bp nucleotide sequences would fall under the claim as granted by the US Patent and Trademark Office. Anyone making, using, selling, or importing such a molecule for any purpose within the United States would thus be infringing the claim. This claim and others like it turn out, on examination, to be surprisingly broad, and if enforced would have substantial implications for medical practice and scientific research. Copyright 2010 Elsevier Inc. All rights reserved.
Skalickova, Sylvie; Nejdl, Lukas; Kudr, Jiri; Ruttkay-Nedecky, Branislav; Jimenez, Ana Maria Jimenez; Kopel, Pavel; Kremplova, Monika; Masarik, Michal; Stiborova, Marie; Eckschlager, Tomas; Adam, Vojtech; Kizek, Rene
2016-02-25
Liposome-based drug delivery systems hold great potential for cancer therapy. The aim of this study was to design a nanodevice for targeted anchoring of liposomes (with and without cholesterol) with encapsulated anticancer drugs and antisense N-myc gene oligonucleotide attached to its surface. To meet this main aim, liposomes with encapsulated doxorubicin, ellipticine and etoposide were prepared. They were further characterized by measuring their fluorescence intensity, whereas the encapsulation efficiency was estimated to be 16%. The hybridization process of individual oligonucleotides forming the nanoconstruct was investigated spectrophotometrically and electrochemically. The concentrations of ellipticine, doxorubicin and etoposide attached to the nanoconstruct in gold nanoparticle-modified liposomes were found to be 14, 5 and 2 µg·mL(-1), respectively. The study succeeded in demonstrating that liposomes are suitable for the transport of anticancer drugs and the antisense oligonucleotide, which can block the expression of the N-myc gene.
Sun, Jingjing; Tang, Xinjing
2015-05-28
DNA cross-linking technology is an attractive tool for the detection, regulation, and manipulation of genes. In this study, a series of photolabile 4-oxo-enal-modified oligonucleotides functionalized with photosensitive ο-nitrobenzyl derivatives were rationally designed as a new kind of photocaged cross-linking agents. A comprehensive evaluation of cross-linking reactions for different nucleobases in complementary strands under different conditions suggested that the modified DNA oligonucleotides tended to form interstrand cross-linking to nucleobases with the potential of thymidine > guanosine » cytidine ~ adenosine. Different from previous literature reports that cytidine and adenosine were preferential cross-linked nucleobases with 4-oxo-enal moieties, our study represents the first example of DNA cross-linking for T and G selectivity using 4-oxo-enal moiety. The cross-linked adducts were identified and their cross-linking mechanism was also illustrated. This greatly expands the applications of 4-oxo-enal derivatives in the studies of DNA damage and RNA structure.
Oligonucleotide Aptamers: New Tools for Targeted Cancer Therapy
Sun, Hongguang; Zhu, Xun; Lu, Patrick Y; Rosato, Roberto R; Tan, Wen; Zu, Youli
2014-01-01
Aptamers are a class of small nucleic acid ligands that are composed of RNA or single-stranded DNA oligonucleotides and have high specificity and affinity for their targets. Similar to antibodies, aptamers interact with their targets by recognizing a specific three-dimensional structure and are thus termed “chemical antibodies.” In contrast to protein antibodies, aptamers offer unique chemical and biological characteristics based on their oligonucleotide properties. Hence, they are more suitable for the development of novel clinical applications. Aptamer technology has been widely investigated in various biomedical fields for biomarker discovery, in vitro diagnosis, in vivo imaging, and targeted therapy. This review will discuss the potential applications of aptamer technology as a new tool for targeted cancer therapy with emphasis on the development of aptamers that are able to specifically target cell surface biomarkers. Additionally, we will describe several approaches for the use of aptamers in targeted therapeutics, including aptamer-drug conjugation, aptamer-nanoparticle conjugation, aptamer-mediated targeted gene therapy, aptamer-mediated immunotherapy, and aptamer-mediated biotherapy. PMID:25093706
Andersen, Nicolai Krog; Døssing, Holger; Jensen, Frank; Vester, Birte; Nielsen, Poul
2011-08-05
5-(1-Phenyl-1,2,3-triazol-4-yl)-2'-deoxycytidine was synthesized from a modified CuAAC protocol and incorporated into mixed pyrimidine oligonucleotide sequences together with the corresponding 5-(1-phenyl-1,2,3-triazol-4-yl)-2'-deoxyuridine. With consecutive incorporations of the two modified nucleosides, improved duplex formation with a complementary RNA and improved triplex formation with a complementary DNA duplex were observed. The improvement is due to π-π stacking of the phenyl-triazole moieties in the major groove. The strongest stacking and most pronounced positive influence on thermal stability was found in between the uridine analogues or with the cytidine analogue placed in the 3' direction to the uridine analogue. Modeling indicated a different orientation of the phenyl-triazole moieties in the major groove to account for the difference between the two nucleotides. The modified oligonucleotides were all found to be significantly stabilized toward nucleolytic degration.
Optimized oligonucleotide probes for DNA fingerprinting.
Schäfer, R; Zischler, H; Birsner, U; Becker, A; Epplen, J T
1988-08-01
The three different simple repetitive oligonucleotide probes (CT)8, (CAC)5 and (TCC)5 were hybridized to a panel of human DNAs which had been digested with the restriction endonucleases Alu I, Hinf I and Mbo I. The resulting DNA fingerprints were analyzed and different parameters calculated, such as the maximal mean allele frequency and the average number of polymorphic bands per individual. The highest number of bands was obtained after hybridization of Hinf I digested DNA with (CAC)5. The probability of finding the same band pattern as in individual A in individual B is 2 x 10(-8). The DNAs of monozygous twins show indistinguishable banding patterns and the bands are inherited according to the Mendelian laws. Thus this procedure reveals informative fingerprints that can be used for individual identification, e.g. in paternity testing and in forensic applications. In most of these experiments 32P-labelled probes were employed, yet the biotinylated oligonucleotide (GACA)4 produced results which were equivalent to those obtained by hybridization with the 32P-labelled probe (GACA)4.
Antagonists of the miRNA-Argonaute 2 Protein Complex: Anti-miR-AGOs.
Schmidt, Marco F; Korb, Oliver; Abell, Chris
2017-01-01
microRNAs (miRNAs) have been identified as high-value drug targets. A widely applied strategy in miRNA inhibition is the use of antisense agents. However, it has been shown that oligonucleotides are poorly cell permeable because of their complex chemical structure and due to their negatively charged backbone. Consequently, the general application of oligonucleotides in therapy is limited. Since miRNAs' functions are executed exclusively by the Argonaute 2 protein, we therefore describe a protocol for the design of a novel miRNA inhibitor class: antagonists of the miRNA-Argonaute 2 protein complex, so-called anti-miR-AGOs, that not only block the crucial binding site of the target miRNA but also bind to the protein's active site. Due to their lower molecular weight and, thus, more drug-like chemical structure, the novel inhibitor class may show better pharmacokinetic properties than reported oligonucleotide inhibitors, enabling them for potential therapeutic use.
Bradley, Kevin M; Benner, Steven A
2014-01-01
Synthetic biologists wishing to self-assemble large DNA (L-DNA) constructs from small DNA fragments made by automated synthesis need fragments that hybridize predictably. Such predictability is difficult to obtain with nucleotides built from just the four standard nucleotides. Natural DNA's peculiar combination of strong and weak G:C and A:T pairs, the context-dependence of the strengths of those pairs, unimolecular strand folding that competes with desired interstrand hybridization, and non-Watson-Crick interactions available to standard DNA, all contribute to this unpredictability. In principle, adding extra nucleotides to the genetic alphabet can improve the predictability and reliability of autonomous DNA self-assembly, simply by increasing the information density of oligonucleotide sequences. These extra nucleotides are now available as parts of artificially expanded genetic information systems (AEGIS), and tools are now available to generate entirely standard DNA from AEGIS DNA during PCR amplification. Here, we describe the OligArch (for "oligonucleotide architecting") software, an application that permits synthetic biologists to engineer optimally self-assembling DNA constructs from both six- and eight-letter AEGIS alphabets. This software has been used to design oligonucleotides that self-assemble to form complete genes from 20 or more single-stranded synthetic oligonucleotides. OligArch is therefore a key element of a scalable and integrated infrastructure for the rapid and designed engineering of biology.
Vasson, Aurélie; Leroux, Céline; Orhant, Lucie; Boimard, Mathieu; Toussaint, Aurélie; Leroy, Chrystel; Commere, Virginie; Ghiotti, Tiffany; Deburgrave, Nathalie; Saillour, Yoann; Atlan, Isabelle; Fouveaut, Corinne; Beldjord, Cherif; Valleix, Sophie; Leturcq, France; Dodé, Catherine; Bienvenu, Thierry; Chelly, Jamel; Cossée, Mireille
2013-01-01
The frequency of disease-related large rearrangements (referred to as copy-number mutations, CNMs) varies among genes, and search for these mutations has an important place in diagnostic strategies. In recent years, CGH method using custom-designed high-density oligonucleotide-based arrays allowed the development of a powerful tool for detection of alterations at the level of exons and made it possible to provide flexibility through the possibility of modeling chips. The aim of our study was to test custom-designed oligonucleotide CGH array in a diagnostic laboratory setting that analyses several genes involved in various genetic diseases, and to compare it with conventional strategies. To this end, we designed a 12-plex CGH array (135k; 135 000 probes/subarray) (Roche Nimblegen) with exonic and intronic oligonucleotide probes covering 26 genes routinely analyzed in the laboratory. We tested control samples with known CNMs and patients for whom genetic causes underlying their disorders were unknown. The contribution of this technique is undeniable. Indeed, it appeared reproducible, reliable and sensitive enough to detect heterozygous single-exon deletions or duplications, complex rearrangements and somatic mosaicism. In addition, it improves reliability of CNM detection and allows determination of boundaries precisely enough to direct targeted sequencing of breakpoints. All of these points, associated with the possibility of a simultaneous analysis of several genes and scalability ‘homemade' make it a valuable tool as a new diagnostic approach of CNMs. PMID:23340513
van Pijkeren, Jan-Peter; Neoh, Kar Mun; Sirias, Denise; Findley, Anthony S.; Britton, Robert A.
2012-01-01
Single-stranded DNA (ssDNA) recombineering is a technology which is used to make subtle changes in the chromosome of several bacterial genera. Cells which express a single-stranded DNA binding protein (RecT or Bet) are transformed with an oligonucleotide which is incorporated via an annealing and replication-dependent mechanism. By in silico analysis we identified ssDNA binding protein homologs in the genus Lactobacillus and Lactococcus lactis. To assess whether we could further improve the recombineering efficiency in Lactobacillus reuteri ATCC PTA 6475 we expressed several RecT homologs in this strain. RecT derived from Enterococcus faecalis CRMEN 19 yielded comparable efficiencies compared with a native RecT protein, but none of the other proteins further increased the recombineering efficiency. We successfully improved recombineering efficiency 10-fold in L. lactis by increasing oligonucleotide concentration combined with the use of oligonucleotides containing phosphorothioate-linkages (PTOs). Surprisingly, neither increased oligonucleotide concentration nor PTO linkages enhanced recombineering in L. reuteri 6475. To emphasize the utility of this technology in improving probiotic features we modified six bases in a transcriptional regulatory element region of the pdu-operon of L. reuteri 6475, yielding a 3-fold increase in the production of the antimicrobial compound reuterin. Directed genetic modification of lactic acid bacteria through ssDNA recombineering will simplify strain improvement in a way that, when mutating a single base, is genetically indistinguishable from strains obtained through directed evolution. PMID:22750793
Moon, Seok Joon; Kim, Jong Moon; Choi, Ji Youn; Kim, Seog K; Lee, Je Seung; Jang, Ho G
2005-05-01
The luminescence intensity of the Delta- and Lambda-enantiomer of [Ru(phen)2DPPZ]2+ ([Ru(phenanthroline)2 dipyrido[3,2-a:2',3'-c]phenazine]2+) complex enhanced upon binding to double stranded DNA, which has been known as "light switch effect". The enhancement of the luminescence required the intercalation of the large ligand between DNA base pairs. In this study, we report the enhancement in the luminescence intensity when the metal complexes bind to single stranded oligonucleotides, indicating that the "light switch effect" does not require intercalation of the large DPPZ ligand. Oligonucleotides may provide a hydrophobic cavity for the [Ru(phen)2DPPZ]2+ complex to prevent the quenching by the water molecule. In the cavity, the metal complex is in contact with DNA bases as is evidenced by the observation that the excited energy of the DNA bases transfer to the bound metal complex. However, the contact of the metal complex with DNA bases is different from the stacking of DPPZ in the intercalation pocket. In addition to the normal two luminescence lifetimes, a short lifetime in the range of 1-2 ns was found for both the delta- and lambda-enantiomer of [Ru(phen)2DPPZ]2+ when complexed with single stranded oligonucleotides, which may be assigned to the metal complex that is outside of the cavity, interacting with phosphate groups of DNA.
[Oligonucleotide microarray for subtyping avian influenza virus].
Xueqing, Han; Xiangmei, Lin; Yihong, Hou; Shaoqiang, Wu; Jian, Liu; Lin, Mei; Guangle, Jia; Zexiao, Yang
2008-09-01
Avian influenza viruses are important human and animal respiratory pathogens and rapid diagnosis of novel emerging avian influenza viruses is vital for effective global influenza surveillance. We developed an oligonucleotide microarray-based method for subtyping all avian influenza virus (16 HA and 9 NA subtypes). In total 25 pairs of primers specific for different subtypes and 1 pair of universal primers were carefully designed based on the genomic sequences of influenza A viruses retrieved from GenBank database. Several multiplex RT-PCR methods were then developed, and the target cDNAs of 25 subtype viruses were amplified by RT-PCR or overlapping PCR for evaluating the microarray. Further 52 oligonucleotide probes specific for all 25 subtype viruses were designed according to published gene sequences of avian influenza viruses in amplified target cDNAs domains, and a microarray for subtyping influenza A virus was developed. Then its specificity and sensitivity were validated by using different subtype strains and 2653 samples from 49 different areas. The results showed that all the subtypes of influenza virus could be identified simultaneously on this microarray with high sensitivity, which could reach to 2.47 pfu/mL virus or 2.5 ng target DNA. Furthermore, there was no cross reaction with other avian respiratory virus. An oligonucleotide microarray-based strategy for detection of avian influenza viruses has been developed. Such a diagnostic microarray will be useful in discovering and identifying all subtypes of avian influenza virus.
Studzińska, Sylwia; Mounicou, Sandra; Szpunar, Joanna; Łobiński, Ryszard; Buszewski, Bogusław
2015-01-15
This text presents a novel method for the separation and detection of phosphorothioate oligonucleotides with the use of ion pair ultra high performance liquid chromatography coupled with inductively coupled plasma mass spectrometry The research showed that hexafluoroisopropanol/triethylamine based mobile phases may be successfully used when liquid chromatography is coupled with such elemental detection. However, the concentration of both HFIP and TEA influences the final result. The lower concentration of HFIP, the lower the background in ICP-MS and the greater the sensitivity. The method applied for the analysis of serum samples was based on high resolution inductively coupled plasma mass spectrometry. Utilization of this method allows determination of fifty times lower quantity of phosphorothioate oligonucleotides than in the case of quadrupole mass analyzer. Monitoring of (31)P may be used to quantify these compounds at the level of 80 μg L(-1), while simultaneous determination of sulfur is very useful for qualitative analysis. Moreover, the results presented in this paper demonstrate the practical applicability of coupling LC with ICP-MS in determining phosphorothioate oligonucleotides and their metabolites in serum within 7 min with a very good sensitivity. The method was linear in the concentration range between 0.2 and 3 mg L(-1). The limit of detection was in the range of 0.07 and 0.13 mg L(-1). Accuracy varied with concentration, but was in the range of 3%. Copyright © 2014 Elsevier B.V. All rights reserved.
Park, Yeunsoo; Polska, Katarzyna; Rak, Janusz; Wagner, J Richard; Sanche, Léon
2012-08-16
The replacement of nucleobases with brominated analogs enhances DNA radiosensitivity. We examine the chemistry of low-energy electrons (LEEs) in this sensitization process by experiments with thin films of the oligonucleotide trimers TBrXT, where BrX = 5-BrU (5-bromouracil), 5-BrC (5-bromocytosine), 8-BrA (8-bromoadenine), or 8-BrG (8-bromoguanine). The products induced from irradiation of thin (∼ 2.5 nm) oligonucleotide films, with 10 eV electrons, under ultrahigh vacuum (UHV) are analyzed by HPLC-UV. The number of damaged brominated trimers ranges from about 12 to 15 × 10(-3) molecules per incident electron, whereas under the identical conditions, these numbers drop to 4-7 × 10(-3) for the same, but nonbrominated oligonucleotides. The results of HPLC analysis show that the main degradation pathway of trinucleotides containing brominated bases involve debromination (i.e., loss of the bromine atom and its replacement with a hydrogen atom). The electron-induced sum of products upon bromination increases by factors of 2.1 for the pyrimidines and 3.2 for the purines. Thus, substitution of any native nucleobase with a brominated one in simple models of DNA increases LEE-induced damage to DNA and hence its radiosensitivity. Furthermore, besides the brominated pyrimidines that have already been tested in clinical trials, brominated purines not only appear to be promising sensitizers for radiotherapy, but could provide a higher degree of radiosensitization.
Efficient delivery of RNA interference oligonucleotides to polarized airway epithelia in vitro
Ramachandran, Shyam; Krishnamurthy, Sateesh; Jacobi, Ashley M.; Wohlford-Lenane, Christine; Behlke, Mark A.; Davidson, Beverly L.
2013-01-01
Polarized and pseudostratified primary airway epithelia present barriers that significantly reduce their transfection efficiency and the efficacy of RNA interference oligonucleotides. This creates an impediment in studies of the airway epithelium, diminishing the utility of loss-of-function as a research tool. Here we outline methods to introduce RNAi oligonucleotides into primary human and porcine airway epithelia grown at an air-liquid interface and difficult-to-transfect transformed epithelial cell lines grown on plastic. At the time of plating, we reverse transfect small-interfering RNA (siRNA), Dicer-substrate siRNA, or microRNA oligonucleotides into cells by use of lipid or peptide transfection reagents. Using this approach we achieve significant knockdown in vitro of hypoxanthine-guanine phosphoribosyltransferase, IL-8, and CFTR expression at the mRNA and protein levels in 1–3 days. We also attain significant reduction of secreted IL-8 in polarized primary pig airway epithelia 3 days posttransfection and inhibition of CFTR-mediated Cl− conductance in polarized air-liquid interface cultures of human airway epithelia 2 wk posttransfection. These results highlight an efficient means to deliver RNA interference reagents to airway epithelial cells and achieve significant knockdown of target gene expression and function. The ability to reliably conduct loss-of-function assays in polarized primary airway epithelia offers benefits to research in studies of epithelial cell homeostasis, candidate gene function, gene-based therapeutics, microRNA biology, and targeting the replication of respiratory viruses. PMID:23624792
Natural antisense transcript-targeted regulation of inducible nitric oxide synthase mRNA levels.
Yoshigai, Emi; Hara, Takafumi; Araki, Yoshiro; Tanaka, Yoshito; Oishi, Masaharu; Tokuhara, Katsuji; Kaibori, Masaki; Okumura, Tadayoshi; Kwon, A-Hon; Nishizawa, Mikio
2013-04-01
Natural antisense transcripts (asRNAs) are frequently transcribed from mammalian genes. Recently, we found that non-coding asRNAs are transcribed from the 3' untranslated region (3'UTR) of the rat and mouse genes encoding inducible nitric oxide synthase (iNOS), which catalyzes the production of the inflammatory mediator nitric oxide. The iNOS asRNA stabilizes iNOS mRNA by interacting with the mRNA 3'UTR. Furthermore, single-stranded 'sense' oligonucleotides corresponding to the iNOS mRNA sequence were found to reduce iNOS mRNA levels by interfering with mRNA-asRNA interactions in rat hepatocytes. This method was named natural antisense transcript-targeted regulation (NATRE) technology. In this study, we detected human iNOS asRNA expressed in hepatocarcinoma and colon carcinoma tissues. The human iNOS asRNA harbored a sequence complementary to an evolutionarily conserved region of the iNOS mRNA 3'UTR. When introduced into hepatocytes, iNOS sense oligonucleotides that were modified by substitution with partial phosphorothioate bonds and locked nucleic acids or 2'-O-methyl nucleic acids greatly reduced levels of iNOS mRNA and iNOS protein. Moreover, sense oligonucleotides and short interfering RNAs decreased iNOS mRNA to comparable levels. These results suggest that NATRE technology using iNOS sense oligonucleotides could potentially be used to treat human inflammatory diseases and cancers by reducing iNOS mRNA levels. Copyright © 2013 Elsevier Inc. All rights reserved.
Use of synthetic oligonucleotide DNA probes for the identification of Bacteroides gingivalis.
Moncla, B J; Braham, P; Dix, K; Watanabe, S; Schwartz, D
1990-01-01
Six different oligonucleotide probes complementary to the hypervariable regions of 16S rRNA of Bacteroides gingivalis were tested for specificity and sensitivity against 77 field strains of B. gingivalis and 105 strains of 12 other Bacteroides species. The data demonstrated that these probes were very specific (range, 0.85 to 1.00) and sensitive (1.00). Some limited cross-reactions with other Bacteroides species were observed. Four of these probes should be useful for rapid detection and identification of B. gingivalis. Images PMID:1690217
Species-Level Identification of Orthopoxviruses with an Oligonucleotide Microchip
Lapa, Sergey; Mikheev, Maxim; Shchelkunov, Sergei; Mikhailovich, Vladimir; Sobolev, Alexander; Blinov, Vladimir; Babkin, Igor; Guskov, Alexander; Sokunova, Elena; Zasedatelev, Alexander; Sandakhchiev, Lev; Mirzabekov, Andrei
2002-01-01
A method for species-specific detection of orthopoxviruses pathogenic for humans and animals is described. The method is based on hybridization of a fluorescently labeled amplified DNA specimen with the oligonucleotide DNA probes immobilized on a microchip (MAGIChip). The probes identify species-specific sites within the crmB gene encoding the viral analogue of tumor necrosis factor receptor, one of the most important determinants of pathogenicity in this genus of viruses. The diagnostic procedure takes 6 h and does not require any sophisticated equipment (a portable fluorescence reader can be used). PMID:11880388
NASA Technical Reports Server (NTRS)
Kolb, V.; Orgel, L. E.
1995-01-01
We have prepared a [32P]-labeled oligonucleotide probe carrying a ureido (-NH-CO-NH2) function at its 3'-terminus. This labeled oligomer was used to study polycondensations of urea and formaldehyde and of various phenols and formaldehyde in aqueous solution. The formation of formaldehyde copolymers attached to the amido-function of the probe was monitored by gel electrophoresis. Our results are generally in agreement with those obtained using conventional techniques. Our method is suitable for monitoring potentially prebiotic polycondensation reactions involving formaldehyde.
Methods and kits for nucleic acid analysis using fluorescence resonance energy transfer
Kwok, Pui-Yan; Chen, Xiangning
1999-01-01
A method for detecting the presence of a target nucleotide or sequence of nucleotides in a nucleic acid is disclosed. The method is comprised of forming an oligonucleotide labeled with two fluorophores on the nucleic acid target site. The doubly labeled oligonucleotide is formed by addition of a singly labeled dideoxynucleoside triphosphate to a singly labeled polynucleotide or by ligation of two singly labeled polynucleotides. Detection of fluorescence resonance energy transfer upon denaturation indicates the presence of the target. Kits are also provided. The method is particularly applicable to genotyping.
2013-01-01
SUBJECT TERMS DNA nanotechnology, purification, origami , 2d arrays Philip S. Lukeman St. John’s University, New York 8000 Utopia Parkway Queens, NY... origami ; DNA double-crossover (“DX”) tile based arrays5 have been constructed using PNA6 and LNA7 oligonucleotides. RNA/ DNA duplexes have been used8 for...the assembly of multiply armed tiles9 and as a template10 to fold DNA origami ;11 all-RNA systems known as ‘tecto-RNA’ have been used to generate a wide
Inhibition Of Molecular And Biological Processes Using Modified Oligonucleotides
Kozyavkin, Sergei A.; Malykh, Andrei G.; Polouchine, Nikolai N.; Slesarev, Alexei I.
2003-04-15
A method of inhibiting at least one molecular process in a sample, comprising administering to the sample an oligonucleotide or polynucleotide containing at least one monomeric unit having formula (I): wherein A is an organic moiety, n is at least 1, and each X is independently selected from the group consisting of --NRCOCONu, --NHCOCR.sub.2 CR.sub.2 CONu, --NHCOCR.dbd.CRCONu, and --NHCOSSCONu, wherein each R independently represents H or a substituted or unsubstituted alkyl group, and Nu represents a nucleophile, or a salt of the compound.
NASA Technical Reports Server (NTRS)
Kolb, Vera; Orgel, Leslie E.
1995-01-01
We have prepared a (P-32)-labeled oligonucleotide probe carrying a ureido (-NH-CO-NH2) function at its 3'-terminus. This labeled oligomer was used to study polycondensations of urea and formaldehyde and of various phenols and formaldehyde in aqueous solution. The formation of formaldehyde copolymers attached to the amido-function of the probe was monitored by gel electrophoresis. Our results are generally in agreement with those obtained using conventional techniques. Our method is suitable for monitoring potentially prebiotic polycondensation reactions involving formaldehyde.
PCR amplification on microarrays of gel immobilized oligonucleotides
Strizhkov, Boris; Tillib, Sergei; Mikhailovich, Vladimir; Mirzabekov, Andrei
2003-11-04
The invention relates two general methods for performing PCR amplification, combined with the detection and analysis of the PCR products on a microchip. In the first method, the amplification occurs both outside and within a plurality of gel pads on a microchip, with at least one oligonucleotide primer immobilized in a gel pad. In the second method, PCR amplification also takes place within gel pads on a microchip, but the pads are surrounded by a hydrophobic liquid such as that which separates the individual gel pads into environments which resemble micro-miniaturized test tubes.
Kozlowska, Anna Karolina; Florczak, Anna; Smialek, Maciej; Dondajewska, Ewelina; Mackiewicz, Andrzej; Kortylewski, Marcin; Dams-Kozlowska, Hanna
2017-09-01
Cell-selective delivery and sensitivity to serum nucleases remain major hurdles to the clinical application of RNA-based oligonucleotide therapeutics, such as siRNA. Spider silk shows great potential as a biomaterial due to its biocompatibility and biodegradability. Self-assembling properties of silk proteins allow for processing into several different morphologies such as fibers, scaffolds, films, hydrogels, capsules and spheres. Moreover, bioengineering of spider silk protein sequences can functionalize silk by adding peptide moieties with specific features including binding or cell recognition domains. We demonstrated that modification of silk protein by adding the nucleic acid binding domain enabled the development of a novel oligonucleotide delivery system that can be utilized to improve pharmacokinetics of RNA-based therapeutics, such as CpG-siRNA. The MS2 bioengineered silk was functionalized with poly-lysine domain (KN) to generate hybrid silk MS2KN. CpG-siRNA efficiently bound to MS2KN in contrary to control MS2. Both MS2KN complexes and spheres protected CpG-siRNA from degradation by serum nucleases. CpG-siRNA molecules encapsulated into MS2KN spheres were efficiently internalized and processed by TLR9-positive macrophages. Importantly, CpG-STAT3siRNA loaded in silk spheres showed delayed and extended target gene silencing compared to naked oligonucleotides. The prolonged Stat3 silencing resulted in the more pronounced downregulation of interleukin 6 (IL-6), a proinflammatory cytokine and upstream activator of STAT3, which limits the efficacy of TLR9 immunostimulation. Our results demonstrate the feasibility of using spider silk spheres as a carrier of therapeutic nucleic acids. Moreover, the modified kinetic and activity of the CpG-STAT3siRNA embedded into silk spheres is likely to improve immunotherapeutic effects in vivo. We demonstrated that modification of silk protein by adding the nucleic acid binding domain enabled the development of a novel oligonucleotide delivery system that can be utilized to improve pharmacokinetics of RNA-based therapeutics. Although, the siRNA constructs have already given very promising results in the cancer therapy, the in vivo application of RNA-based oligonucleotide therapeutics still is limited due to their sensitivity to serum nucleases and some toxicity. We propose a carrier for RNA-based therapeutics that is made of bioengineered spider silk. We showed that functionalized bioengineered spider silk spheres not only protected RNA-based therapeutics from degradation by serum nucleases, but what is more important the embedding of siRNA into silk spheres delayed and extended target gene silencing compared with naked oligonucleotides. Moreover, we showed that plain silk spheres did not have unspecific effect on target gene levels proving not only to be non-cytotoxic but also very neutral vehicles in terms of TLR9/STAT3 activation in macrophages. We demonstrated advantages of novel delivery technology in safety and efficacy comparing with delivery of naked CpG-STAT3siRNA therapeutics. Copyright © 2017 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.
Yao, Yong-Xing; Jiang, Zhen; Zhao, Zhi-Qi
2011-12-01
Previous studies have demonstrated that Homer 1b/c, a postsynaptic molecular scaffolding protein that binds and clusters metabotropic glutamate receptors at neuronal synapses, has an important role in the metabotropic glutamate receptor signaling process. In the current study, we investigated the possible involvement of Homer 1b/c in secondary hyperalgesia induced by complete Freund's adjuvant (CFA). Chronic inflammation was induced by injecting CFA into the left hind ankle of Wistar rats. Homer 1b/c antisense or missense oligonucleotides were intrathecally administrated (antisense, 10 μg/10 μL, 5 μg/10 μL, or 2.5 μg/10 μL, once a day; missense, 10 μg/10 μL) from 5 to 8 days after the onset of inflammation. The withdrawal threshold and withdrawal latency to mechanical or thermal stimuli were determined before and after the intrathecal administration. The expression and distribution of Homer 1b/c were examined in the spinal cord using immunological techniques. Mechanical allodynia and thermal hyperalgesia were induced within 24 hours and maintained for >2 weeks after the CFA injection. The expression of Homer 1b/c reached the highest level 7 days after inflammation and returned to baseline at day 28. Intrathecal administration of Homer 1b/c antisense oligonucleotides markedly reduced the expression of Homer 1b/c protein in the spinal cord. Additionally, administration of Homer 1b/c antisense oligonucleotides attenuated secondary mechanical hypersensitization on days 2 to 5 and reduced thermal hypersensitization on days 3 to 4. There were no effects of missense oligonucleotides on hypersensitization and the expression of Homer 1b/c. In the naïve rats, Homer 1b/c antisense oligonucleotides did not affect the mechanical and thermal responses or locomotor activity. These novel results demonstrate that Homer 1b/c in the spinal cord contributes to the maintenance of secondary hyperalgesia induced by CFA and suggest that Homer 1b/c may be a novel target for pain therapy.
Blackbody infrared radiative dissociation of oligonucleotide anions.
Klassen, J S; Schnier, P D; Williams, E R
1998-11-01
The dissociation kinetics of a series of doubly deprotonated oligonucleotide 7-mers [d(A)7(2-), d(AATTAAT)2-, d(TTAATTA)2-, and d(CCGGCCG)2-] were measured using blackbody infrared radiative dissociation in a Fourier-transform mass spectrometer. The oligonucleotides dissociate first by cleavage at the glycosidic bond leading to the loss of a neutral nucleobase, followed by cleavage at the adjacent (5') phosphodiester bond to produce structurally informative a-base and w type ions. From the temperature dependence of the unimolecular dissociation rate constants, Arrhenius activation parameters in the zero-pressure limit are obtained for the loss of base. The measured Arrhenius parameters are dependent on the identity of the nucleobase. The process involving the loss of an adenine base from the dianions, d(A)7(2-), d(AATTAAT)2-, and d(TTAATTA)2- has an average activation energy (Ea) of approximately 1.0 eV and a preexponential factor (A) of 10(10) s-1. Both guanine and cytosine base loss occurs for d(CCGGCCG)2-. The average Arrhenius parameters for the loss of cytosine and guanine are Ea = 1.32 +/- 0.03 eV and A = 10(13.3 +/- 0.3) s-1. No loss of thymine was observed for mixed adenine-thymine oligonucleotides. Neither base loss nor any other fragmentation reactions occur for d(T)7(2-) over a 600 s reaction delay at 207 degrees C, a temperature close to the upper limit accessible with our instrument. The Arrhenius parameters indicate that the preferred cleavage sites for mixed oligonucleotides of similar mass-to-charge ratio will be strongly dependent on the internal energy of the precursor ions. At low internal energies (effective temperatures below 475 K), loss of adenine and subsequent cleavage of the adjacent phosphoester bonds will dominate, whereas at higher energies, preferential cleavage at C and G residues will occur. The magnitude of the A factors < or = 10(13) s-1 measured for the loss of the three nucleobases (A, G, and C) is indicative of an entropically neutral or disfavored process as the rate limiting step for this reaction.
Blackbody Infrared Radiative Dissociation of Oligonucleotide Anions
Klassen, John S.; Schnier, Paul D.; Williams, Evan R.
2005-01-01
The dissociation kinetics of a series of doubly deprotonated oligonucleotide 7-mers [ d(A)72-, d(AATTAAT)2−, d(TTAATTA)2−, and d(CCGGCCG)2−] were measured using blackbody infrared radiative dissociation in a Fourier-transform mass spectrometer. The oligonucleotides dissociate first by cleavage at the glycosidic bond leading to the loss of a neutral nucleobase, followed by cleavage at the adjacent (5′) phosphodiester bond to produce structurally informative a-base and w type ions. From the temperature dependence of the unimolecular dissociation rate constants, Arrhenius activation parameters in the zero-pressure limit are obtained for the loss of base. The measured Arrhenius parameters are dependent on the identity of the nucleobase. The process involving the loss of an adenine base from the dianions, d(A)72-, d(AATTAAT)2−, and d(TTAATTA)2− has an average activation energy (Ea) of ~1.0 eV and a preexponential factor (A) of 1010 s−1. Both guanine and cytosine base loss occurs for d(CCGGCCG)2−. The average Arrhenius parameters for the loss of cytosine and guanine are Ea = 1.32 ± 0.03 eV and A = 1013.3±0.3 s−1. No loss of thymine was observed for mixed adenine–thymine oligonucleotides. Neither base loss nor any other fragmentation reactions occur for d(T)72- over a 600 s reaction delay at 207 °C, a temperature close to the upper limit accessible with our instrument. The Arrhenius parameters indicate that the preferred cleavage sites for mixed oligonucleotides of similar mass-to-charge ratio will be strongly dependent on the internal energy of the precursor ions. At low internal energies (effective temperatures below 475 K), loss of adenine and subsequent cleavage of the adjacent phosphoester bonds will dominate, whereas at higher energies, preferential cleavage at C and G residues will occur. The magnitude of the A factors ≤1013 s−1 measured for the loss of the three nucleobases (A, G, and C) is indicative of an entropically neutral or disfavored process as the rate limiting step for this reaction. PMID:9794082
Cellular Interactions and Immune Response of Spherical Nucleic Acid (SNA) Nanoconjugates
NASA Astrophysics Data System (ADS)
Massich, Matthew David
Spherical nucleic acid (SNA) nanoconjugates consist of a densely packed monolayer shell of highly-oriented oligonucleotides covalently bound to a gold nanoparticle core. The nanoconjugates exhibit several important qualities, which make them useful for various biological applications, such as antisense gene regulation strategies and the intracellular detection of biomolecules. The focus of this thesis was to characterize the nanoconjugates interaction with cultured cells and specifically the immune response to their intracellular presence. The immune response of macrophage cells to internalized nanoconjugates was studied, and due to the dense functionalization of oligonucleotides on the surface of the nanoparticle and the resulting high localized salt concentration the innate immune response to the nanoconjugates is ˜25-fold less when compared to a lipoplex carrying the same sequence. Additionally, genome-wide expression profiling was used to study the biological response of cultured cells to the nanoconjugates. The biological response of HeLa cells to gold nanoparticles stabilized by weakly bound ligands was significant, yet when these same nanoparticles were stably functionalized with covalently attached oligonucleotides the cells showed no measurable response. In human keratinocytes, the oligonucleotide sequences caused 427 genes to be differentially expressed when complexed with Dharmafect, but when the oligonucleotides were conjugated to nanoparticles only 7 genes were differentially expressed. Beyond characterizing the cellular interactions and immune response of the nanoconjugates, the optimal length of siRNA (from 19--34 base pairs) that induces the most gene knockdown while maintaining limited immune activation was determined to be 24 base pairs. Further, the SNAs were shown to be useful as a potential antiviral gene therapy by demonstrating approximately 50% knockdown of the Ebola VP35 gene. Lastly, a scanning probe-enabled method was used to rapidly create nanoscale fibronectin patterns over large areas with a range of feature sizes, thereby opening the field of nanocombinatorics. This allowed the investigation of the relationship between fibronectin feature size and stem cell fate. MSCs cultured on nanoscale fibronectin features directed differentiation toward osteogenesis to a greater extent than cells grown on both microscale features and cells grown on non-patterned fibronectin substrates with osteogenic inducing media, demonstrating a new method for controlling stem cell fate.
Cardiovascular and Metabolic Effects of ANGPTL3 Antisense Oligonucleotides.
Graham, Mark J; Lee, Richard G; Brandt, Teresa A; Tai, Li-Jung; Fu, Wuxia; Peralta, Raechel; Yu, Rosie; Hurh, Eunju; Paz, Erika; McEvoy, Bradley W; Baker, Brenda F; Pham, Nguyen C; Digenio, Andres; Hughes, Steven G; Geary, Richard S; Witztum, Joseph L; Crooke, Rosanne M; Tsimikas, Sotirios
2017-07-20
Epidemiologic and genomewide association studies have linked loss-of-function variants in ANGPTL3, encoding angiopoietin-like 3, with low levels of plasma lipoproteins. We evaluated antisense oligonucleotides (ASOs) targeting Angptl3 messenger RNA (mRNA) for effects on plasma lipid levels, triglyceride clearance, liver triglyceride content, insulin sensitivity, and atherosclerosis in mice. Subsequently, 44 human participants (with triglyceride levels of either 90 to 150 mg per deciliter [1.0 to 1.7 mmol per liter] or >150 mg per deciliter, depending on the dose group) were randomly assigned to receive subcutaneous injections of placebo or an antisense oligonucleotide targeting ANGPTL3 mRNA in a single dose (20, 40, or 80 mg) or multiple doses (10, 20, 40, or 60 mg per week for 6 weeks). The main end points were safety, side-effect profile, pharmacokinetic and pharmacodynamic measures, and changes in levels of lipids and lipoproteins. The treated mice had dose-dependent reductions in levels of hepatic Angptl3 mRNA, Angptl3 protein, triglycerides, and low-density lipoprotein (LDL) cholesterol, as well as reductions in liver triglyceride content and atherosclerosis progression and increases in insulin sensitivity. After 6 weeks of treatment, persons in the multiple-dose groups had reductions in levels of ANGPTL3 protein (reductions of 46.6 to 84.5% from baseline, P<0.01 for all doses vs. placebo) and in levels of triglycerides (reductions of 33.2 to 63.1%), LDL cholesterol (1.3 to 32.9%), very-low-density lipoprotein cholesterol (27.9 to 60.0%), non-high-density lipoprotein cholesterol (10.0 to 36.6%), apolipoprotein B (3.4 to 25.7%), and apolipoprotein C-III (18.9 to 58.8%). Three participants who received the antisense oligonucleotide and three who received placebo reported dizziness or headache. There were no serious adverse events. Oligonucleotides targeting mouse Angptl3 retarded the progression of atherosclerosis and reduced levels of atherogenic lipoproteins in mice. Use of the same strategy to target human ANGPTL3 reduced levels of atherogenic lipoproteins in humans. (Funded by Ionis Pharmaceuticals; ClinicalTrials.gov number, NCT02709850 .).
Zimmerman, G; Shaltiel, G; Barbash, S; Cohen, J; Gasho, C J; Shenhar-Tsarfaty, S; Shalev, H; Berliner, S A; Shelef, I; Shoham, S; Friedman, A; Cohen, H; Soreq, H
2012-02-21
Post-traumatic anxiety notably involves inflammation, but its causes and functional significance are yet unclear. Here, we report that failure of the innate immune system Toll-like receptor 9 (TLR9) to limit inflammation is causally involved with anxiety-associated inflammation and that peripheral administration of specific oligonucleotide activators of TLR9 may prevent post-traumatic consequences in stressed mice. Suggesting involvement of NFκB-mediated enhancement of inflammatory reactions in the post-traumatic phenotype, we found association of serum interleukin-1β increases with symptoms severity and volumetric brain changes in post-traumatic stress disorder patients. In predator scent-stressed mice, the moderate NFκB-activating oligonucleotides mEN101 and its human ortholog BL-7040, but not the canonic NFκB activator oligonucleotide ODN1826, induced anxiolytic effects. In stressed mice, peripherally administered mEN101 prevented delayed stress-inducible serum interleukin-1β increases while limiting stress-characteristic hippocampal transcript modifications and the anxiety-induced EGR1-mediated neuronal activation. Attesting to the TLR9 specificity of this response, BL-7040 suppressed NFκB-mediated luciferase in transfected cells co-expressing TLR9, but not other TLRs. Furthermore, TLR9-/- mice were mEN101 and BL-7040 resistant and presented unprovoked anxiety-like behavior and anxiety-characteristic hippocampal transcripts. Our findings demonstrate functional relevance of TLR9 in protecting stressed mammals from overreacting to traumatic experiences and suggest using oligonucleotide-mediated peripheral TLR9 activation to potentiate the innate immune system and prevent post-traumatic inflammation and anxiety.
Foteeva, Lidia S; Matczuk, Magdalena; Pawlak, Katarzyna; Aleksenko, Svetlana S; Nosenko, Sergey V; Karandashev, Vasily K; Jarosz, Maciej; Timerbaev, Andrei R
2017-03-01
Determination of the DNA-binding reactivity and affinity is an important part of a successful program for the selection of metallodrug candidates. For such assaying, a range of complementary analytical techniques was proposed and tested here using one of few anticancer metal-based drugs that are currently in clinical trials, indazolium trans-[tetrachloridobis(1H-indazole)ruthenate(III), and a DNA oligonucleotide. A high reactivity of the Ru drug was confirmed in affinity capillary electrophoresis (CE) mode, where adduct formation takes place in situ (i.e., in the capillary filled with an oligonucleotide-containing electrolyte). To further characterize the binding kinetics, a drug-oligonucleotide mixture was incubated for a different period of time, followed by ultrafiltration separation into two different in molecular weight fractions (>3 and <3 kDa). The time-dependent distribution profiles of the Ru drug were then assessed by CE-inductively coupled plasma mass spectrometry (ICP-MS), revealing that at least two DNA adducts exist at equilibrium conditions. Using standalone ICP-MS, dominant equilibrium amount of the bound ruthenium was found to occur in a fraction of 5-10 kDa, which includes the oligonucleotide (ca. 6 kDa). Importantly, in all three assays, the drug was used for the first time in in-vitro studies, not in the intact form but as its active species released from the transferrin adduct at simulated cancer cytosolic conditions. This circumstance makes the established analytical platform promising to provide a detailed view on metallodrug targeting, including other possible biomolecules and ex vivo samples.
DNA-based species detection capabilities using laser transmission spectroscopy
Mahon, A. R.; Barnes, M. A.; Li, F.; Egan, S. P.; Tanner, C. E.; Ruggiero, S. T.; Feder, J. L.; Lodge, D. M.
2013-01-01
Early detection of invasive species is critical for effective biocontrol to mitigate potential ecological and economic damage. Laser transmission spectroscopy (LTS) is a powerful solution offering real-time, DNA-based species detection in the field. LTS can measure the size, shape and number of nanoparticles in a solution and was used here to detect size shifts resulting from hybridization of the polymerase chain reaction product to nanoparticles functionalized with species-specific oligonucleotide probes or with the species-specific oligonucleotide probes alone. We carried out a series of DNA detection experiments using the invasive freshwater quagga mussel (Dreissena bugensis) to evaluate the capability of the LTS platform for invasive species detection. Specifically, we tested LTS sensitivity to (i) DNA concentrations of a single target species, (ii) the presence of a target species within a mixed sample of other closely related species, (iii) species-specific functionalized nanoparticles versus species-specific oligonucleotide probes alone, and (iv) amplified DNA fragments versus unamplified genomic DNA. We demonstrate that LTS is a highly sensitive technique for rapid target species detection, with detection limits in the picomolar range, capable of successful identification in multispecies samples containing target and non-target species DNA. These results indicate that the LTS DNA detection platform will be useful for field application of target species. Additionally, we find that LTS detection is effective with species-specific oligonucleotide tags alone or when they are attached to polystyrene nanobeads and with both amplified and unamplified DNA, indicating that the technique may also have versatility for broader applications. PMID:23015524
Panpradist, Nuttada; Beck, Ingrid A.; Chung, Michael H.; Kiarie, James N.; Frenkel, Lisa M.; Lutz, Barry R.
2016-01-01
Human immunodeficiency virus (HIV) is a chronic infection that can be managed by antiretroviral treatment (ART). However, periods of suboptimal viral suppression during lifelong ART can select for HIV drug resistant (DR) variants. Transmission of drug resistant virus can lessen or abrogate ART efficacy. Therefore, testing of individuals for drug resistance prior to initiation of treatment is recommended to ensure effective ART. Sensitive and inexpensive HIV genotyping methods are needed in low-resource settings where most HIV infections occur. The oligonucleotide ligation assay (OLA) is a sensitive point mutation assay for detection of drug resistance mutations in HIV pol. The current OLA involves four main steps from sample to analysis: (1) lysis and/or nucleic acid extraction, (2) amplification of HIV RNA or DNA, (3) ligation of oligonucleotide probes designed to detect single nucleotide mutations that confer HIV drug resistance, and (4) analysis via oligonucleotide surface capture, denaturation, and detection (CDD). The relative complexity of these steps has limited its adoption in resource-limited laboratories. Here we describe a simplification of the 2.5-hour plate-format CDD to a 45-minute paper-format CDD that eliminates the need for a plate reader. Analysis of mutations at four HIV-1 DR codons (K103N, Y181C, M184V, and G190A) in 26 blood specimens showed a strong correlation of the ratios of mutant signal to total signal between the paper CDD and the plate CDD. The assay described makes the OLA easier to perform in low resource laboratories. PMID:26751207
Zimmerman, G; Shaltiel, G; Barbash, S; Cohen, J; Gasho, C J; Shenhar-Tsarfaty, S; Shalev, H; Berliner, S A; Shelef, I; Shoham, S; Friedman, A; Cohen, H; Soreq, H
2012-01-01
Post-traumatic anxiety notably involves inflammation, but its causes and functional significance are yet unclear. Here, we report that failure of the innate immune system Toll-like receptor 9 (TLR9) to limit inflammation is causally involved with anxiety-associated inflammation and that peripheral administration of specific oligonucleotide activators of TLR9 may prevent post-traumatic consequences in stressed mice. Suggesting involvement of NFκB-mediated enhancement of inflammatory reactions in the post-traumatic phenotype, we found association of serum interleukin-1β increases with symptoms severity and volumetric brain changes in post-traumatic stress disorder patients. In predator scent-stressed mice, the moderate NFκB-activating oligonucleotides mEN101 and its human ortholog BL-7040, but not the canonic NFκB activator oligonucleotide ODN1826, induced anxiolytic effects. In stressed mice, peripherally administered mEN101 prevented delayed stress-inducible serum interleukin-1β increases while limiting stress-characteristic hippocampal transcript modifications and the anxiety-induced EGR1-mediated neuronal activation. Attesting to the TLR9 specificity of this response, BL-7040 suppressed NFκB-mediated luciferase in transfected cells co-expressing TLR9, but not other TLRs. Furthermore, TLR9−/− mice were mEN101 and BL-7040 resistant and presented unprovoked anxiety-like behavior and anxiety-characteristic hippocampal transcripts. Our findings demonstrate functional relevance of TLR9 in protecting stressed mammals from overreacting to traumatic experiences and suggest using oligonucleotide-mediated peripheral TLR9 activation to potentiate the innate immune system and prevent post-traumatic inflammation and anxiety. PMID:22832815
Shah, H N; Gharbia, S E; Scully, C; Finegold, S M
1995-03-01
Eight oligonucleotides based upon regions of the small subunit 16S ribosomal RNA gene sequences were analysed against a background of their position within the molecule and their two-dimensional structure to rationalise their use in recognising Prevotella intermedia and Prevotella nigrescens. The 41 clinical isolates from both oral and respiratory sites and two reference strains were subjected to DNA-DNA hybridisation and multilocus enzyme electrophoresis to confirm their identity. Alignment of oligonucleotide probes designated I Bi-2 to I Bi-6 (for P. intermedia) and 2Bi-2 (for P. nigrescens) with the 16S rRNA suggested that these probes lacked specificity or were constructed from hypervariable regions. A 52-mer oligonucleotide (designated Bi) reliably detected both species. Because of the high degree of concordance between the 16S rRNAs of both species, it was necessary to vary the stringency of hybridisation conditions for detection of both species. Thus probe I Bi-I recognised P. intermedia while I Bi-I detected both P. intermedia and P. nigrescens at low stringency. However, under conditions of high stringency only P. nigrescens was recognised by probe 2Bi-I. These probes were highly specific and did not hybridise with DNA from the closely related P. corporis, nor other periodontal pathogens such as Fusobacterium nucleatum, Actinobacillus actinomycetemcomitans, Treponema denticola and several pigmented species such as Prevotella melaninogenica, P. denticola, P. loescheii, Porphyromonas asaccharolytica, Py. endodontalis, Py. gingivalis, Py. levii, and Py. macacae.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hara, Takamitsu; Omura-Minamisawa, Motoko; Chao Cheng
Purpose: Bcl-2, an inhibitor of apoptosis frequently shows elevated expression in human tumors, thus resulting in resistance to radiation therapy. Therefore, inhibiting Bcl-2 function may enhance the radiosensitivity of tumor cells. Tetrocarcin A (TC-A) and bcl-2 antisense oligonucleotides exhibit antitumor activity by inhibiting Bcl-2 function and transcription, respectively. We investigated whether these antitumor agents would enhance the cytotoxic effects of radiation in tumor cells overexpressing Bcl-2. Methods and materials: We used HeLa/bcl-2 cells, a stable Bcl-2-expressing cell line derived from wild-type HeLa (HeLa/wt) cells. Cells were incubated with TC-A and bcl-2 antisense oligonucleotides for 24 h after irradiation, and cellmore » viability was then determined. Apoptotic cells were quantified by flow cytometric assay. Results: The HeLa/bcl-2 cells were more resistant to radiation than HeLa/wt cells. At concentrations that are not inherently cytotoxic, both TC-A and bcl-2 antisense oligonucleotides increased the cytotoxic effects of radiation in HeLa/bcl-2 cells, but not in HeLa/wt cells. However, in HeLa/bcl-2 cells, additional treatment with TC-A in combination with radiation did not significantly increase apoptosis. Conclusions: The present results suggest that TC-A and bcl-2 antisense oligonucleotides reduce radioresistance of tumor cells overexpressing Bcl-2. Therefore, a combination of radiotherapy and Bcl-2 inhibitors may prove to be a useful therapeutic approach for treating tumors that overexpress Bcl-2.« less
Detection and discrimination of orthopoxviruses using microarrays of immobilized oligonucleotides.
Laassri, Majid; Chizhikov, Vladimir; Mikheev, Maxim; Shchelkunov, Sergei; Chumakov, Konstantin
2003-09-01
Variola virus (VARV), causing smallpox, is a potential biological weapon. Methods to detect VARV rapidly and to differentiate it from other viruses causing similar clinical syndromes are needed urgently. We have developed a new microarray-based method that detects simultaneously and discriminates four orthopoxvirus (OPV) species pathogenic for humans (variola, monkeypox, cowpox, and vaccinia viruses) and distinguishes them from chickenpox virus (varicella-zoster virus or VZV). The OPV gene C23L/B29R, encoding the CC-chemokine binding protein, was sequenced for 41 strains of seven species of orthopox viruses obtained from different geographical regions. Those C23L/B29R sequences and the ORF 62 sequences from 13 strains of VZV (selected from GenBank) were used to design oligonucleotide probes that were immobilized on an aldehyde-coated glass surface (a total of 57 probes). The microchip contained several unique 13-21 bases long oligonucleotide probes specific to each virus species to ensure redundancy and robustness of the assay. A region approximately 1100 bases long was amplified from samples of viral DNA and fluorescently labeled with Cy5-modified dNTPs, and single-stranded DNA was prepared by strand separation. Hybridization was carried out under plastic coverslips, resulting in a fluorescent pattern that was quantified using a confocal laser scanner. 49 known and blinded samples of OPV DNA, representing different OPV species, and two VZV strains were tested. The oligonucleotide microarray hybridization technique identified reliably and correctly all samples. This new procedure takes only 3 h, and it can be used for parallel testing of multiple samples.
Shabanpoor, Fazel; Hammond, Suzan M; Abendroth, Frank; Hazell, Gareth; Wood, Matthew J.A.
2017-01-01
Splice-switching antisense oligonucleotides are emerging treatments for neuromuscular diseases, with several splice-switching oligonucleotides (SSOs) currently undergoing clinical trials such as for Duchenne muscular dystrophy (DMD) and spinal muscular atrophy (SMA). However, the development of systemically delivered antisense therapeutics has been hampered by poor tissue penetration and cellular uptake, including crossing of the blood–brain barrier (BBB) to reach targets in the central nervous system (CNS). For SMA application, we have investigated the ability of various BBB-crossing peptides for CNS delivery of a splice-switching phosphorodiamidate morpholino oligonucleotide (PMO) targeting survival motor neuron 2 (SMN2) exon 7 inclusion. We identified a branched derivative of the well-known ApoE (141–150) peptide, which as a PMO conjugate was capable of exon inclusion in the CNS following systemic administration, leading to an increase in the level of full-length SMN2 transcript. Treatment of newborn SMA mice with this peptide-PMO (P-PMO) conjugate resulted in a significant increase in the average lifespan and gains in weight, muscle strength, and righting reflexes. Systemic treatment of adult SMA mice with this newly identified P-PMO also resulted in small but significant increases in the levels of SMN2 pre-messenger RNA (mRNA) exon inclusion in the CNS and peripheral tissues. This work provides proof of principle for the ability to select new peptide paradigms to enhance CNS delivery and activity of a PMO SSO through use of a peptide-based delivery platform for the treatment of SMA potentially extending to other neuromuscular and neurodegenerative diseases. PMID:28118087
Loy, Alexander; Lehner, Angelika; Lee, Natuschka; Adamczyk, Justyna; Meier, Harald; Ernst, Jens; Schleifer, Karl-Heinz; Wagner, Michael
2002-01-01
For cultivation-independent detection of sulfate-reducing prokaryotes (SRPs) an oligonucleotide microarray consisting of 132 16S rRNA gene-targeted oligonucleotide probes (18-mers) having hierarchical and parallel (identical) specificity for the detection of all known lineages of sulfate-reducing prokaryotes (SRP-PhyloChip) was designed and subsequently evaluated with 41 suitable pure cultures of SRPs. The applicability of SRP-PhyloChip for diversity screening of SRPs in environmental and clinical samples was tested by using samples from periodontal tooth pockets and from the chemocline of a hypersaline cyanobacterial mat from Solar Lake (Sinai, Egypt). Consistent with previous studies, SRP-PhyloChip indicated the occurrence of Desulfomicrobium spp. in the tooth pockets and the presence of Desulfonema- and Desulfomonile-like SRPs (together with other SRPs) in the chemocline of the mat. The SRP-PhyloChip results were confirmed by several DNA microarray-independent techniques, including specific PCR amplification, cloning, and sequencing of SRP 16S rRNA genes and the genes encoding the dissimilatory (bi)sulfite reductase (dsrAB). PMID:12324358
A fiber optic biosensor for fluorimetric detection of triple-helical DNA.
Uddin, A H; Piunno, P A; Hudson, R H; Damha, M J; Krull, U J
1997-10-15
A fiber optic biosensor was used for the fluorimetric detection of T/AT triple-helical DNA formation. The surfaces of two sets of fused silica optical fibers were functionalized with hexaethylene oxide linkers from which decaadenylic acid oligonucleotides were grown in the 3'to 5'and 5'to 3'direction, respectively, using a DNA synthesizer. Fluorescence studies of hybridization showed unequivocal hybridization between oligomers immobilized on the fibers and complementary oligonucleotides from the solution phase, as detected by fluorescence from intercalated ethidium bromide. The complementary oligonucleotide, dT10, which was expected to Watson-Crick hybridize upon cooling the system below the duplex melting temperature ( T m), provided a fluorescence intensity with a negative temperature coefficient. Upon further cooling, to the point where the pyrimidine motif T*AT triple-helix formation occurred, a fluorescence intensity change with a positive temperature coefficient was observed. The reverse-Hoogsteen T.AT triplex, which is known to form with branched nucleic acids, provided a corresponding decrease in fluorescence intensity with decreasing temperature. Full analytical signal evolution was attainable in minutes.
Will, Katrin; Warnecke, Gabriele; Wiesmüller, Lisa; Deppert, Wolfgang
1998-01-01
Mutant, but not wild-type p53 binds with high affinity to a variety of MAR-DNA elements (MARs), suggesting that MAR-binding of mutant p53 relates to the dominant-oncogenic activities proposed for mutant p53. MARs recognized by mutant p53 share AT richness and contain variations of an AATATATTT “DNA-unwinding motif,” which enhances the structural dynamics of chromatin and promotes regional DNA base-unpairing. Mutant p53 specifically interacted with MAR-derived oligonucleotides carrying such unwinding motifs, catalyzing DNA strand separation when this motif was located within a structurally labile sequence environment. Addition of GC-clamps to the respective MAR-oligonucleotides or introducing mutations into the unwinding motif strongly reduced DNA strand separation, but supported the formation of tight complexes between mutant p53 and such oligonucleotides. We conclude that the specific interaction of mutant p53 with regions of MAR-DNA with a high potential for base-unpairing provides the basis for the high-affinity binding of mutant p53 to MAR-DNA. PMID:9811860
A Carbon Nanotube Reporter of miRNA Hybridization Events In Vivo
Harvey, Jackson D.; Jena, Prakrit V.; Baker, Hanan A.; Zerze, Gül H.; Williams, Ryan M.; Galassi, Thomas V.; Roxbury, Daniel; Mittal, Jeetain
2017-01-01
MicroRNAs and other small oligonucleotides in biofluids are promising disease biomarkers, yet conventional assays require complex processing steps that are unsuitable for point-of-care testing or for implantable or wearable sensors. Single-walled carbon nanotubes are an ideal material for implantable sensors, owing to their emission in the near-infrared spectral region, photostability and exquisite sensitivity. Here, we report an engineered carbon-nanotube-based sensor capable of real-time optical quantification of hybridization events of microRNA and other oligonucleotides. The mechanism of the sensor arises from competitive effects between displacement of both oligonucleotide charge groups and water from the nanotube surface, which result in a solvatochromism-like response. The sensor, which allows for detection via single-molecule sensor elements and for multiplexing by using multiple nanotube chiralities, can monitor toehold-based strand-displacement events, which reverse the sensor response and regenerate the sensor complex. We also show that the sensor functions in whole urine and serum, and can non-invasively measure DNA and microRNA after implantation in live mice. PMID:28845337
Zinker, Bradley A; Rondinone, Cristina M; Trevillyan, James M; Gum, Rebecca J; Clampit, Jill E; Waring, Jeffrey F; Xie, Nancy; Wilcox, Denise; Jacobson, Peer; Frost, Leigh; Kroeger, Paul E; Reilly, Regina M; Koterski, Sandra; Opgenorth, Terry J; Ulrich, Roger G; Crosby, Seth; Butler, Madeline; Murray, Susan F; McKay, Robert A; Bhanot, Sanjay; Monia, Brett P; Jirousek, Michael R
2002-08-20
The role of protein-tyrosine phosphatase 1B (PTP1B) in diabetes was investigated using an antisense oligonucleotide in ob/ob and db/db mice. PTP1B antisense oligonucleotide treatment normalized plasma glucose levels, postprandial glucose excursion, and HbA(1C). Hyperinsulinemia was also reduced with improved insulin sensitivity. PTP1B protein and mRNA were reduced in liver and fat with no effect in skeletal muscle. Insulin signaling proteins, insulin receptor substrate 2 and phosphatidylinositol 3 (PI3)-kinase regulatory subunit p50alpha, were increased and PI3-kinase p85alpha expression was decreased in liver and fat. These changes in protein expression correlated with increased insulin-stimulated protein kinase B phosphorylation. The expression of liver gluconeogenic enzymes, phosphoenolpyruvate carboxykinase, and fructose-1,6-bisphosphatase was also down-regulated. These findings suggest that PTP1B modulates insulin signaling in liver and fat, and that therapeutic modalities targeting PTP1B inhibition may have clinical benefit in type 2 diabetes.
Horn, T; Chang, C A; Urdea, M S
1997-12-01
The divergent synthesis of bDNA structures is described. This new type of branched DNA contains one unique oligonucleotide, the primary sequence, covalently attached through a comb-like branching network to many identical copies of a different oligonucleotide, the secondary sequence. The bDNA comb molecules were assembled on a solid support using parameters optimized for bDNA synthesis. The chemistry was used to synthesize bDNA comb molecules containing 15 secondary sequences. The bDNA comb molecules were elaborated by enzymatic ligation into branched amplification multimers, large bDNA molecules (a total of 1068 nt) containing an average of 36 repeated DNA oligomer sequences, each capable of hybridizing specifically to an alkaline phosphatase-labeled oligonucleotide. The bDNA comb molecules were characterized by electrophoretic methods and by controlled cleavage at periodate-cleavable moieties incorporated during synthesis. The branched amplification multimers have been used as signal amplifiers in nucleic acid quantification assays for detection of viral infection. It is possible to detect as few as 50 molecules with bDNA technology.
Horn, T; Chang, C A; Urdea, M S
1997-01-01
The divergent synthesis of bDNA structures is described. This new type of branched DNA contains one unique oligonucleotide, the primary sequence, covalently attached through a comb-like branching network to many identical copies of a different oligonucleotide, the secondary sequence. The bDNA comb molecules were assembled on a solid support using parameters optimized for bDNA synthesis. The chemistry was used to synthesize bDNA comb molecules containing 15 secondary sequences. The bDNA comb molecules were elaborated by enzymatic ligation into branched amplification multimers, large bDNA molecules (a total of 1068 nt) containing an average of 36 repeated DNA oligomer sequences, each capable of hybridizing specifically to an alkaline phosphatase-labeled oligonucleotide. The bDNA comb molecules were characterized by electrophoretic methods and by controlled cleavage at periodate-cleavable moieties incorporated during synthesis. The branched amplification multimers have been used as signal amplifiers in nucleic acid quantification assays for detection of viral infection. It is possible to detect as few as 50 molecules with bDNA technology. PMID:9365266
Datinská, Vladimíra; Klepárník, Karel; Belšánová, Barbora; Minárik, Marek; Foret, František
2018-05-09
The synthesis and determination of the structure of a Förster resonance energy transfer probe intended for the detection of specific nucleic acid sequences are described here. The probe is based on the hybridization of oligonucleotide modified quantum dots with a fluorescently labeled nucleic acid sample resulting in changes of the fluorescence emission due to the energy transfer effect. The stoichiometry distribution of oligonucleotides conjugated to quantum dots was determined by capillary electrophoresis separation. The results indicate that one to four molecules of oligonucleotide are conjugated to the surface of a single nanoparticle. This conclusion is confirmed by the course of the dependence of Förster resonance energy transfer efficiency on the concentration of fluorescently labeled complementary single-stranded nucleic acid, showing saturation. While the energy transfer efficiency of the probe hybridized with complementary nucleic acid strands was 30%, negligible efficiency was observed with a non-complementary strands. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.
Kaura, Mamta; Kumar, Pawan; Hrdlicka, Patrick J
2014-07-03
Conformationally restricted nucleotides such as locked nucleic acid (LNA) are very popular as affinity-, specificity-, and stability-enhancing modifications in oligonucleotide chemistry to produce probes for nucleic acid targeting applications in molecular biology, biotechnology, and medicinal chemistry. Considerable efforts have been devoted in recent years to optimize the biophysical properties of LNA through additional modification of the sugar skeleton. We recently introduced C5-functionalization of LNA uridines as an alternative and synthetically more straightforward approach to improve the biophysical properties of LNA. In the present work, we set out to test the generality of this concept by studying the characteristics of oligonucleotides modified with four different C5-functionalized LNA cytidine and C8-functionalized LNA adenosine monomers. The results strongly suggest that C5-functionalization of LNA pyrimidines is indeed a viable approach for improving the binding affinity, target specificity, and/or enzymatic stability of LNA-modified ONs, whereas C8-functionalization of LNA adenosines is detrimental to binding affinity and specificity. These insights will impact the future design of conformationally restricted nucleotides for nucleic acid targeting applications.
Chun, Jong-Yoon; Kim, Kyoung-Joong; Hwang, In-Taek; Kim, Yun-Jee; Lee, Dae-Hoon; Lee, In-Kyoung; Kim, Jong-Kee
2007-01-01
Successful PCR starts with proper priming between an oligonucleotide primer and the template DNA. However, the inevitable risk of mismatched priming cannot be avoided in the currently used primer system, even though considerable time and effort are devoted to primer design and optimization of reaction conditions. Here, we report a novel dual priming oligonucleotide (DPO) which contains two separate priming regions joined by a polydeoxyinosine linker. The linker assumes a bubble-like structure which itself is not involved in priming, but rather delineates the boundary between the two parts of the primer. This structure results in two primer segments with distinct annealing properties: a longer 5'-segment that initiates stable priming, and a short 3'-segment that determines target-specific extension. This DPO-based system is a fundamental tool for blocking extension of non-specifically primed templates, and thereby generates consistently high PCR specificity even under less than optimal PCR conditions. The strength and utility of the DPO system are demonstrated here using multiplex PCR and SNP genotyping PCR.
Zinker, Bradley A.; Rondinone, Cristina M.; Trevillyan, James M.; Gum, Rebecca J.; Clampit, Jill E.; Waring, Jeffrey F.; Xie, Nancy; Wilcox, Denise; Jacobson, Peer; Frost, Leigh; Kroeger, Paul E.; Reilly, Regina M.; Koterski, Sandra; Opgenorth, Terry J.; Ulrich, Roger G.; Crosby, Seth; Butler, Madeline; Murray, Susan F.; McKay, Robert A.; Bhanot, Sanjay; Monia, Brett P.; Jirousek, Michael R.
2002-01-01
The role of protein-tyrosine phosphatase 1B (PTP1B) in diabetes was investigated using an antisense oligonucleotide in ob/ob and db/db mice. PTP1B antisense oligonucleotide treatment normalized plasma glucose levels, postprandial glucose excursion, and HbA1C. Hyperinsulinemia was also reduced with improved insulin sensitivity. PTP1B protein and mRNA were reduced in liver and fat with no effect in skeletal muscle. Insulin signaling proteins, insulin receptor substrate 2 and phosphatidylinositol 3 (PI3)-kinase regulatory subunit p50α, were increased and PI3-kinase p85α expression was decreased in liver and fat. These changes in protein expression correlated with increased insulin-stimulated protein kinase B phosphorylation. The expression of liver gluconeogenic enzymes, phosphoenolpyruvate carboxykinase, and fructose-1,6-bisphosphatase was also down-regulated. These findings suggest that PTP1B modulates insulin signaling in liver and fat, and that therapeutic modalities targeting PTP1B inhibition may have clinical benefit in type 2 diabetes. PMID:12169659
A method for high-throughput production of sequence-verified DNA libraries and strain collections.
Smith, Justin D; Schlecht, Ulrich; Xu, Weihong; Suresh, Sundari; Horecka, Joe; Proctor, Michael J; Aiyar, Raeka S; Bennett, Richard A O; Chu, Angela; Li, Yong Fuga; Roy, Kevin; Davis, Ronald W; Steinmetz, Lars M; Hyman, Richard W; Levy, Sasha F; St Onge, Robert P
2017-02-13
The low costs of array-synthesized oligonucleotide libraries are empowering rapid advances in quantitative and synthetic biology. However, high synthesis error rates, uneven representation, and lack of access to individual oligonucleotides limit the true potential of these libraries. We have developed a cost-effective method called Recombinase Directed Indexing (REDI), which involves integration of a complex library into yeast, site-specific recombination to index library DNA, and next-generation sequencing to identify desired clones. We used REDI to generate a library of ~3,300 DNA probes that exhibited > 96% purity and remarkable uniformity (> 95% of probes within twofold of the median abundance). Additionally, we created a collection of ~9,000 individually accessible CRISPR interference yeast strains for > 99% of genes required for either fermentative or respiratory growth, demonstrating the utility of REDI for rapid and cost-effective creation of strain collections from oligonucleotide pools. Our approach is adaptable to any complex DNA library, and fundamentally changes how these libraries can be parsed, maintained, propagated, and characterized. © 2017 The Authors. Published under the terms of the CC BY 4.0 license.
Jin, Xin; Zhou, Ling; Zhu, Bo; Jiang, Xue; Zhu, Ningning
2018-06-01
Silver-dendrimer nanocomposites were synthesized and used as oligonucleotide labels for electrochemical stripping detection of DNA hybridization. The synthesized silver-dendrimer nanocomposites were characterized by UV-vis spectrophotometry, X-ray photoelectron spectroscopy (XPS) and transmission electron microscopy (TEM). Ratios of silver/dendrimer were optimized in order to obtain stable nanocomposites with maximal silver loading in the interior of a polymeric shell. The silver-dendrimer nanocomposites were attached to sequence-known DNA probes specific to colitoxin, and used to detect probe hybridization by dissolution of the silver nanoparticles in the interior of dendrimer in a diluted nitric acid, followed by measurement of Ag + ions by anodic stripping voltammetry (ASV). Use of differential pulse voltammetry for the stripping step, along with optimization of the ASV conditions, enabled a detection limit of 0.78 pM. The present strategy, in combination with dendrimer-encapsulated copper labeled oligonucleotides probe reported previously, could potentially be used to detect single or multiple DNA targets in one sample. Copyright © 2018 Elsevier B.V. All rights reserved.
Shin, Hwa Hui; Hwang, Byeong Hee; Seo, Jeong Hyun
2014-01-01
It is important to rapidly and selectively detect and analyze pathogenic Salmonella enterica subsp. enterica in contaminated food to reduce the morbidity and mortality of Salmonella infection and to guarantee food safety. In the present work, we developed an oligonucleotide microarray containing duplicate specific capture probes based on the carB gene, which encodes the carbamoyl phosphate synthetase large subunit, as a competent biomarker evaluated by genetic analysis to selectively and efficiently detect and discriminate three S. enterica subsp. enterica serotypes: Choleraesuis, Enteritidis, and Typhimurium. Using the developed microarray system, three serotype targets were successfully analyzed in a range as low as 1.6 to 3.1 nM and were specifically discriminated from each other without nonspecific signals. In addition, the constructed microarray did not have cross-reactivity with other common pathogenic bacteria and even enabled the clear discrimination of the target Salmonella serotype from a bacterial mixture. Therefore, these results demonstrated that our novel carB-based oligonucleotide microarray can be used as an effective and specific detection system for S. enterica subsp. enterica serotypes. PMID:24185846
Shin, Hwa Hui; Hwang, Byeong Hee; Seo, Jeong Hyun; Cha, Hyung Joon
2014-01-01
It is important to rapidly and selectively detect and analyze pathogenic Salmonella enterica subsp. enterica in contaminated food to reduce the morbidity and mortality of Salmonella infection and to guarantee food safety. In the present work, we developed an oligonucleotide microarray containing duplicate specific capture probes based on the carB gene, which encodes the carbamoyl phosphate synthetase large subunit, as a competent biomarker evaluated by genetic analysis to selectively and efficiently detect and discriminate three S. enterica subsp. enterica serotypes: Choleraesuis, Enteritidis, and Typhimurium. Using the developed microarray system, three serotype targets were successfully analyzed in a range as low as 1.6 to 3.1 nM and were specifically discriminated from each other without nonspecific signals. In addition, the constructed microarray did not have cross-reactivity with other common pathogenic bacteria and even enabled the clear discrimination of the target Salmonella serotype from a bacterial mixture. Therefore, these results demonstrated that our novel carB-based oligonucleotide microarray can be used as an effective and specific detection system for S. enterica subsp. enterica serotypes.
Mirza, M S; Rademaker, J L; Janse, J D; Akkermans, A D
1993-11-01
In this article we report on the polymerase chain reaction amplification of a partial 16S rRNA gene from the plant pathogenic bacterium Clavibacter michiganensis subsp. sepedonicus. A partial sequence (about 400 base pairs) of the gene was determined that covered two variable regions important for oligonucleotide probe development. A specific 24mer oligonucleotide probe targeted against the V6 region of 16S rRNA was designed. Specificity of the probe was determined using dot blot hybridization. Under stringent conditions (60 degrees C), the probe hybridized with all 16 Cl. michiganensis subsp. sepedonicus strains tested. Hybridization did not occur with 32 plant pathogenic and saprophytic bacteria used as controls under the same conditions. Under less stringent conditions (55 degrees C) the related Clavibacter michiganensis subsp. insidiosus, Clavibacter michiganensis subsp. nebraskensis, and Clavibacter michiganensis subsp. tesselarius also showed hybridization. At even lower stringency (40 degrees C), all Cl. michiganensis subspecies tested including Clavibacter michiganensis subsp. michiganensis showed hybridization signal, suggesting that under these conditions the probe may be used as a species-specific probe for Cl. michiganensis.
Szatmari, I; Tókés, S; Dunn, C B; Bardos, T J; Aradi, J
2000-06-15
A polymerase chain reaction (PCR)-based radioactive telomerase assay was developed in our laboratory which is quantitative and does not require electrophoretic evaluation (designated as TP-TRAP; it utilizes two reverse primers). The main steps of the assay include (1) extension of a 20-mer oligonucleotide substrate (MTS) by telomerase, (2) amplification of the telomerase products in the presence of [(3)H]dTTP using the substrate oligonucleotide and two reverse primers (RPC3, 38 mer; RP, 20 mer), (3) isolation of the amplified radioactive dsDNA by precipitation and filtration, (4) determination of the radioactivity of the acid-insoluble DNA. The length of the telomerase products does not increase on amplification. This valuable feature of the assay is achieved by utilization of the two reverse primers and a highly specific PCR protocol. The assay is linear, accurate, and suitable for cell-biological studies where slight quantitative differences in telomerase activity must be detected. The assay is also suitable for screening and characterization of telomerase inhibitors, as shown with a chemically modified oligonucleotide reverse transcriptase inhibitor [(s(4)dU)(35)]. Copyright 2000 Academic Press.
5-Fluoro pyrimidines: labels to probe DNA and RNA secondary structures by 1D 19F NMR spectroscopy
Puffer, Barbara; Kreutz, Christoph; Rieder, Ulrike; Ebert, Marc-Olivier; Konrat, Robert; Micura, Ronald
2009-01-01
19F NMR spectroscopy has proved to be a valuable tool to monitor functionally important conformational transitions of nucleic acids. Here, we present a systematic investigation on the application of 5-fluoro pyrimidines to probe DNA and RNA secondary structures. Oligonucleotides with the propensity to adapt secondary structure equilibria were chosen as model systems and analyzed by 1D 19F and 1H NMR spectroscopy. A comparison with the unmodified analogs revealed that the equilibrium characteristics of the bistable DNA and RNA oligonucleotides were hardly affected upon fluorine substitution at C5 of pyrimidines. This observation was in accordance with UV spectroscopic melting experiments which demonstrated that single 5-fluoro substitutions in double helices lead to comparable thermodynamic stabilities. Thus, 5-fluoro pyrimidine labeling of DNA and RNA can be reliably applied for NMR based nucleic acid secondary structure evaluation. Furthermore, we developed a facile synthetic route towards 5-fluoro cytidine phosphoramidites that enables their convenient site-specific incorporation into oligonucleotides by solid-phase synthesis. PMID:19843610
5-Fluoro pyrimidines: labels to probe DNA and RNA secondary structures by 1D 19F NMR spectroscopy.
Puffer, Barbara; Kreutz, Christoph; Rieder, Ulrike; Ebert, Marc-Olivier; Konrat, Robert; Micura, Ronald
2009-12-01
(19)F NMR spectroscopy has proved to be a valuable tool to monitor functionally important conformational transitions of nucleic acids. Here, we present a systematic investigation on the application of 5-fluoro pyrimidines to probe DNA and RNA secondary structures. Oligonucleotides with the propensity to adapt secondary structure equilibria were chosen as model systems and analyzed by 1D (19)F and (1)H NMR spectroscopy. A comparison with the unmodified analogs revealed that the equilibrium characteristics of the bistable DNA and RNA oligonucleotides were hardly affected upon fluorine substitution at C5 of pyrimidines. This observation was in accordance with UV spectroscopic melting experiments which demonstrated that single 5-fluoro substitutions in double helices lead to comparable thermodynamic stabilities. Thus, 5-fluoro pyrimidine labeling of DNA and RNA can be reliably applied for NMR based nucleic acid secondary structure evaluation. Furthermore, we developed a facile synthetic route towards 5-fluoro cytidine phosphoramidites that enables their convenient site-specific incorporation into oligonucleotides by solid-phase synthesis.
Schuppler, M; Wagner, M; Schön, G; Göbel, U B
1998-01-01
Hitherto, few environmental samples have been investigated by a 'full cycle rRNA analysis'. Here the results of in situ hybridization experiments with specific rRNA-targeted oligonucleotide probes developed on the basis of new sequences derived from a previously described comparative 16S rRNA analysis of nocardioform actinomycetes in activated sludge are reported. Application of the specific probes enabled identification and discrimination of the distinct populations of nocardioform actinomycetes in activated sludge. One of the specific probes (DLP) detected rod-shaped bacteria which were found in 13 of the 16 investigated sludge samples from various wastewater treatment plants, suggesting their importance in the wastewater treatment process. Another probe (GLP2) hybridized with typically branched filaments of nocardioforms mainly found in samples from enhanced biological phosphorus removal plants, suggesting that these bacteria are involved in sludge foaming. The combination of in situ hybridization with fluorescently labelled rRNA-targeted oligonucleotide probes and confocal laser scanning microscopy improved the detection of nocardioform actinomycetes, which often showed only weak signals inside the activated-sludge flocs.
Analysis of oligonucleotide photoproducts produced by UV-A light and a riboflavin photosensitizer
NASA Astrophysics Data System (ADS)
Gelhaus, Stacy L.; LaCourse, William R.
2004-12-01
DNA damage is caused by a variety of foreign and endogenous compounds. There are endogenous photosensitizers in cells, such as porphyrins and flavins, which may create damage in the presence of UV-A light. Typically, samples are analyzed by 32P-postlabelling and electrophoretic separation or by LC-MS separation and detection. Separation by HPLC is common; however, in all instances, the DNA sample is hydrolyzed down to nucleosides prior to analysis. It will be shown here that ion-pairing reversed phase high performance liquid chromatography (IP-RPLC) has the ability to provide biophysical information concerning the sites of UV-A induced photosensitizer damage on an intact oligonucleotide concurrent with the separation. IP-RPLC is less labor intensive and faster than electrophoretic methods and it is less costly than LC-MS. IP-RPLC can also be used to purify modified oligonucleotides for further use and analysis. This technique is sensitive to the charge, conformation, and sequence characteristics of the nucleic acid sample and may be used to determine the damage or modifications made to DNA by a variety of compounds.
Phosphorothioate backbone modifications of nucleotide-based drugs are potent platelet activators
Flierl, Ulrike; Nero, Tracy L.; Lim, Bock; Arthur, Jane F.; Yao, Yu; Jung, Stephanie M.; Gitz, Eelo; Pollitt, Alice Y.; Zaldivia, Maria T.K.; Jandrot-Perrus, Martine; Schäfer, Andreas; Nieswandt, Bernhard; Andrews, Robert K.; Parker, Michael W.; Gardiner, Elizabeth E.
2015-01-01
Nucleotide-based drug candidates such as antisense oligonucleotides, aptamers, immunoreceptor-activating nucleotides, or (anti)microRNAs hold great therapeutic promise for many human diseases. Phosphorothioate (PS) backbone modification of nucleotide-based drugs is common practice to protect these promising drug candidates from rapid degradation by plasma and intracellular nucleases. Effects of the changes in physicochemical properties associated with PS modification on platelets have not been elucidated so far. Here we report the unexpected binding of PS-modified oligonucleotides to platelets eliciting strong platelet activation, signaling, reactive oxygen species generation, adhesion, spreading, aggregation, and thrombus formation in vitro and in vivo. Mechanistically, the platelet-specific receptor glycoprotein VI (GPVI) mediates these platelet-activating effects. Notably, platelets from GPVI function–deficient patients do not exhibit binding of PS-modified oligonucleotides, and platelet activation is fully abolished. Our data demonstrate a novel, unexpected, PS backbone–dependent, platelet-activating effect of nucleotide-based drug candidates mediated by GPVI. This unforeseen effect should be considered in the ongoing development programs for the broad range of upcoming and promising DNA/RNA therapeutics. PMID:25646267
A Carbon Nanotube Reporter of miRNA Hybridization Events In Vivo.
Harvey, Jackson D; Jena, Prakrit V; Baker, Hanan A; Zerze, Gül H; Williams, Ryan M; Galassi, Thomas V; Roxbury, Daniel; Mittal, Jeetain; Heller, Daniel A
2017-01-01
MicroRNAs and other small oligonucleotides in biofluids are promising disease biomarkers, yet conventional assays require complex processing steps that are unsuitable for point-of-care testing or for implantable or wearable sensors. Single-walled carbon nanotubes are an ideal material for implantable sensors, owing to their emission in the near-infrared spectral region, photostability and exquisite sensitivity. Here, we report an engineered carbon-nanotube-based sensor capable of real-time optical quantification of hybridization events of microRNA and other oligonucleotides. The mechanism of the sensor arises from competitive effects between displacement of both oligonucleotide charge groups and water from the nanotube surface, which result in a solvatochromism-like response. The sensor, which allows for detection via single-molecule sensor elements and for multiplexing by using multiple nanotube chiralities, can monitor toehold-based strand-displacement events, which reverse the sensor response and regenerate the sensor complex. We also show that the sensor functions in whole urine and serum, and can non-invasively measure DNA and microRNA after implantation in live mice.
Vacek, A T; Bourque, D P
1980-09-01
Oligonucleotide maps (fingerprints) of T1 RNase digests of 125I-labeled 16 S chloroplast rRNA of Nicotiana tabacum and N. gossei revealed the presence of T1 oligonucleotide fragment 100 in the 16 S rRNA of N. gossei while N. tabacum 16 S rRNA had a unique T1 oligonucleotide (fragment 101) as well as some fragment 100. From the positions in the fingerprints and from fingerprints of secondary enzymatic digestion of the fragments, we conclude that fragments 100 and 101 are similar in sequence and size, but fragment 100 probably contains an extra uracil residue. This difference is shown to be maternally inherited, thus confirming the location of 16 S chloroplast rRNA genes on chloroplast DNA and ruling out the possibility of genetically active chloroplast rRNA genes in the nucleus. The presence of both fragments 100 and 101 in N. tabacum may indicate sequence heterogeneity between the two cistrons for 16 S chloroplast rRNA. These results demonstrate the feasibility of determining the inheritance of organelle genes by genetic analysis of their primary transcripts.
Intracellular ROS mediates gas plasma-facilitated cellular transfection in 2D and 3D cultures
Xu, Dehui; Wang, Biqing; Xu, Yujing; Chen, Zeyu; Cui, Qinjie; Yang, Yanjie; Chen, Hailan; Kong, Michael G.
2016-01-01
This study reports the potential of cold atmospheric plasma (CAP) as a versatile tool for delivering oligonucleotides into mammalian cells. Compared to lipofection and electroporation methods, plasma transfection showed a better uptake efficiency and less cell death in the transfection of oligonucleotides. We demonstrated that the level of extracellular aqueous reactive oxygen species (ROS) produced by gas plasma is correlated with the uptake efficiency and that this is achieved through an increase of intracellular ROS levels and the resulting increase in cell membrane permeability. This finding was supported by the use of ROS scavengers, which reduced CAP-based uptake efficiency. In addition, we found that cold atmospheric plasma could transfer oligonucleotides such as siRNA and miRNA into cells even in 3D cultures, thus suggesting the potential for unique applications of CAP beyond those provided by standard transfection techniques. Together, our results suggest that cold plasma might provide an efficient technique for the delivery of siRNA and miRNA in 2D and 3D culture models. PMID:27296089
Oligonucleotide microarray for subtyping of influenza A viruses
NASA Astrophysics Data System (ADS)
Klotchenko, S. A.; Vasin, A. V.; Sandybaev, N. T.; Plotnikova, M. A.; Chervyakova, O. V.; Smirnova, E. A.; Kushnareva, E. V.; Strochkov, V. M.; Taylakova, E. T.; Egorov, V. V.; Koshemetov, J. K.; Kiselev, O. I.; Sansyzbay, A. R.
2012-02-01
Influenza is one of the most widespread respiratory viral diseases, infecting humans, horses, pigs, poultry and some other animal populations. Influenza A viruses (IAV) are classified into subtypes on the basis of the surface hemagglutinin (H1 to H16) and neuraminidase (N1 to N9) glycoproteins. The correct determination of IAV subtype is necessary for clinical and epidemiological studies. In this article we propose an oligonucleotide microarray for subtyping of IAV using universal one-step multisegment RT-PCR fluorescent labeling of viral gene segments. It showed to be an advanced approach for fast detection and identification of IAV.
Robles, J; Pedroso, E; Grandas, A
1995-01-01
The synthesis of a nucleopeptide with the sequence -Ser(p5'CATCAT)-Gly-Asp- has been undertaken by either convergent or stepwise solid-phase strategies, both of which use base-labile permanent protecting groups. The coupling of phosphitylated protected peptides onto oligonucleotide-resins did not afford the desired nucleopeptide, which was nevertheless obtained after oligonucleotide elongation at the hydroxyl group of the resin-bound peptide and deprotection under mild basic conditions. A preliminary study on the stability of different nucleopeptides to bases is also reported. PMID:7479079
The prebiotic synthesis of oligonucleotides
NASA Technical Reports Server (NTRS)
Oro, J.; Stephen-Sherwood, E.
1974-01-01
This paper is primarily a review of recent developments in the abiotic synthesis of nucleotides, short chain oligonucleotides, and their mode of replication in solution. It also presents preliminary results from this laboratory on the prebiotic synthesis of thymidine oligodeoxynucleotides. A discussion, based on the physicochemical properties of RNA and DNA oligomers, relevant to the molecular evolution of these compounds leads to the tentative hypothesis that oligodeoxyribonucleotides of about 12 units may have been of sufficient length to initiate a self replicating coding system. Two models are suggested to account for the synthesis of high molecular weight oligomers using short chain templates and primers.
Duesberg, Peter H.; Vogt, Peter K.
1979-01-01
The genome of the defective avian tumor virus MH2 was identified as a RNA of 5.7 kilobases by its presence in different MH2-helper virus complexes and its absence from pure helper virus, by its unique fingerprint pattern of RNase T1-resistant (T1) oligonucleotides that differed from those of two helper virus RNAs, and by its structural analogy to the RNA of MC29, another avian acute leukemia virus. Two sets of sequences were distinguished in MH2 RNA: 66% hybridized with DNA complementary to helper-independent avian tumor viruses, termed group-specific, and 34% were specific. The percentage of specific sequences is considered a minimal estimate because the MH2 RNA used was about 30% contaminated by helper virus RNA. No sequences related to the transforming src gene of avian sarcoma viruses were found in MH2. MH2 shared three large T1 oligonucleotides with MC29, two of which could also be isolated from a RNase A- and T1-resistant hybrid formed between MH2 RNA and MC29 specific cDNA. These oligonucleotides belong to a group of six that define the specific segment of MC29 RNA described previously. The group-specific sequences of MH2 and MC29 RNA shared only the two smallest out of about 20 T1 oligonucleotides associated with MH2 RNA. It is concluded that the specific sequences of MH2 and MC29 are related, and it is proposed that they are necessary for, or identical with, the onc genes of these viruses. These sequences would define a related class of transforming genes in avian tumor viruses that differs from the src genes of avian sarcoma viruses. Images PMID:221900
Kim, Bo Kyung; Lim, Seoung Ok; Park, Yun Gyu
2008-08-01
The cyclic adenosine monophosphate-response element (CRE)-transcription factor complex participates in the regulation of viral gene expression and pathologic processes caused by various viruses. The hepatitis B virus (HBV) enhancer I directs liver-specific transcription of viral genes and contains a CRE sequence (HBV-CRE); however, whether the HBV-CRE and CRE-binding protein (CREB) are required for the HBV life cycle remains to be determined. This study was designed to investigate the role of CREB in HBV replication and gene expression. Sequence-comparison analysis of 984 HBVs reported worldwide showed that the HBV-CRE sequence is highly conserved, indicating the possibility that it plays an important role in the HBV life cycle. The binding of CREB to the HBV-CRE site was markedly inhibited by oligonucleotides containing HBV-CRE and consensus CRE sequences in vitro and in vivo. The HBV promoter activity was demonstrated to be dependent upon the transactivation activity of CREB. Treatment with CRE decoy oligonucleotides reduced HBV promoter activity, and this was reversed by CREB overexpression. The levels of viral transcripts, DNA, and antigens were remarkably decreased in response to the overexpression of CREB mutants or treatment with the CRE decoy oligonucleotides, whereas enhancing CREB activity increased the levels of viral transcripts. In addition, introduction of a three-base mutation into the HBV-CRE led to a marked reduction in HBV messenger RNA synthesis. Taken together, our results demonstrate that both replication and gene expression of HBV require a functional CREB and HBV-CRE. We have also demonstrated that CRE decoy oligonucleotides and the overexpression of CREB mutants can effectively block the HBV life cycle, suggesting that interventions against CREB activity could provide a new avenue to treat HBV infection.
Kwarciak, Kamil; Radom, Marcin; Formanowicz, Piotr
2016-04-01
The classical sequencing by hybridization takes into account a binary information about sequence composition. A given element from an oligonucleotide library is or is not a part of the target sequence. However, the DNA chip technology has been developed and it enables to receive a partial information about multiplicity of each oligonucleotide the analyzed sequence consist of. Currently, it is not possible to assess the exact data of such type but even partial information should be very useful. Two realistic multiplicity information models are taken into consideration in this paper. The first one, called "one and many" assumes that it is possible to obtain information if a given oligonucleotide occurs in a reconstructed sequence once or more than once. According to the second model, called "one, two and many", one is able to receive from biochemical experiment information if a given oligonucleotide is present in an analyzed sequence once, twice or at least three times. An ant colony optimization algorithm has been implemented to verify the above models and to compare with existing algorithms for sequencing by hybridization which utilize the additional information. The proposed algorithm solves the problem with any kind of hybridization errors. Computational experiment results confirm that using even the partial information about multiplicity leads to increased quality of reconstructed sequences. Moreover, they also show that the more precise model enables to obtain better solutions and the ant colony optimization algorithm outperforms the existing ones. Test data sets and the proposed ant colony optimization algorithm are available on: http://bioserver.cs.put.poznan.pl/download/ACO4mSBH.zip. Copyright © 2016 Elsevier Ltd. All rights reserved.
Noor, M Omair; Tavares, Anthony J; Krull, Ulrich J
2013-07-25
A microfluidic based solid-phase assay for the multiplexed detection of nucleic acid hybridization using quantum dot (QD) mediated fluorescence resonance energy transfer (FRET) is described herein. The glass surface of hybrid glass-polydimethylsiloxane (PDMS) microfluidic channels was chemically modified to assemble the biorecognition interface. Multiplexing was demonstrated using a detection system that was comprised of two colors of immobilized semi-conductor QDs and two different oligonucleotide probe sequences. Green-emitting and red-emitting QDs were paired with Cy3 and Alexa Fluor 647 (A647) labeled oligonucleotides, respectively. The QDs served as energy donors for the transduction of dye labeled oligonucleotide targets. The in-channel assembly of the biorecognition interface and the subsequent introduction of oligonucleotide targets was accomplished within minutes using a combination of electroosmotic flow and electrophoretic force. The concurrent quantification of femtomole quantities of two target sequences was possible by measuring the spatial coverage of FRET sensitized emission along the length of the channel. In previous reports, multiplexed QD-FRET hybridization assays that employed a ratiometric method for quantification had challenges associated with lower analytical sensitivity arising from both donor and acceptor dilution that resulted in reduced energy transfer pathways as compared to single-color hybridization assays. Herein, a spatial method for quantification that is based on in-channel QD-FRET profiles provided higher analytical sensitivity in the multiplexed assay format as compared to single-color hybridization assays. The selectivity of the multiplexed hybridization assays was demonstrated by discrimination between a fully-complementary sequence and a 3 base pair sequence at a contrast ratio of 8 to 1. Copyright © 2013 Elsevier B.V. All rights reserved.
Noor, M Omair; Krull, Ulrich J
2013-08-06
A multiplexed solid-phase nucleic acid hybridization assay on a paper-based platform is presented using multicolor immobilized quantum dots (QDs) as donors in fluorescence resonance energy transfer (FRET). The surface of paper was modified with imidazole groups to immobilize two types of QD-probe oligonucleotide conjugates that were assembled in solution. Green-emitting QDs (gQDs) and red-emitting QDs (rQDs) served as donors with Cy3 and Alexa Fluor 647 (A647) acceptors. The gQD/Cy3 FRET pair served as an internal standard, while the rQD/A647 FRET pair served as a detection channel, combining the control and analytical test zones in one physical location. Hybridization of dye-labeled oligonucleotide targets provided the proximity for FRET sensitized emission from the acceptor dyes, which served as an analytical signal. Hybridization assays in the multicolor format provided a limit of detection of 90 fmol and an upper limit of dynamic range of 3.5 pmol. The use of an array of detection zones was designed to provide improved analytical figures of merit compared to that which could be achieved on one type of array design in terms of relative concentration of multicolor QDs. The hybridization assays showed excellent resistance to nonspecific adsorption of oligonucleotides. Selectivity of the two-plex hybridization assay was demonstrated by single nucleotide polymorphism (SNP) detection at a contrast ratio of 50:1. Additionally, it is shown that the use of preformed QD-probe oligonucleotide conjugates and consideration of the relative number density of the two types of QD-probe conjugates in the two-color assay format is advantageous to maximize assay sensitivity and the upper limit of dynamic range.
Two cis elements collaborate to spatially repress transcription from a sea urchin promoter
NASA Technical Reports Server (NTRS)
Frudakis, T. N.; Wilt, F.
1995-01-01
The expression pattern of many territory-specific genes in metazoan embryos is maintained by an active process of negative spatial regulation. However, the mechanism of this strategy of gene regulation is not well understood in any system. Here we show that reporter constructs containing regulatory sequence for the SM30-alpha gene of Stronglyocentrotus purpuratus are expressed in a pattern congruent with that of the endogenous SM30 gene(s), largely as a result of active transcriptional repression in cell lineages in which the gene is not normally expressed. Chloramphenicol acetyl transferase assays of deletion constructs from the 2600-bp upstream region showed that repressive elements were present in the region from -1628 to -300. In situ hybridization analysis showed that the spatial fidelity of expression was severely compromised when the region from -1628 to -300 was deleted. Two highly repetitive sequence motifs, (G/A/C)CCCCT and (T/C)(T/A/C)CTTTT(T/A/C), are present in the -1628 to -300 region. Representatives of these elements were analyzed by gel mobility shift experiments and were found to interact specifically with protein in crude nuclear extracts. When oligonucleotides containing either sequence element were co-injected with a correctly regulated reporter as potential competitors, the reporter was expressed in inappropriate cells. When composite oligonucleotides, containing both sequence elements, were fused to a misregulated reporter, the expression of the reporter in inappropriate cells was suppressed. Comparison of composite oligonucleotides with oligonucleotides containing single constituent elements show that both sequence elements are required for effective spatial regulation. Thus, both individual elements are required, but only a composite element containing both elements is sufficient to function as a tissue-specific repressive element.
Synthesis of oligonucleotides on a soluble support
2017-01-01
Oligonucleotides are usually prepared in lab scale on a solid support with the aid of a fully automated synthesizer. Scaling up of the equipment has allowed industrial synthesis up to kilogram scale. In spite of this, solution-phase synthesis has received continuous interest, on one hand as a technique that could enable synthesis of even larger amounts and, on the other hand, as a gram scale laboratory synthesis without any special equipment. The synthesis on a soluble support has been regarded as an approach that could combine the advantageous features of both the solution and solid-phase syntheses. The critical step of this approach is the separation of the support-anchored oligonucleotide chain from the monomeric building block and other small molecular reagents and byproducts after each coupling, oxidation and deprotection step. The techniques applied so far include precipitation, extraction, chromatography and nanofiltration. As regards coupling, all conventional chemistries, viz. phosphoramidite, H-phosphonate and phosphotriester strategies, have been attempted. While P(III)-based phosphoramidite and H-phosphonate chemistries are almost exclusively used on a solid support, the “outdated” P(V)-based phosphotriester chemistry still offers one major advantage for the synthesis on a soluble support; the omission of the oxidation step simplifies the coupling cycle. Several of protocols developed for the soluble-supported synthesis allow the preparation of both DNA and RNA oligomers of limited length in gram scale without any special equipment, being evidently of interest for research groups that need oligonucleotides in large amounts for research purposes. However, none of them has really tested at such a scale that the feasibility of their industrial use could be critically judged. PMID:28781703
Nový, Jakub; Urbanová, Marie
2007-03-01
The interactions of two different porphyrins, without axial ligands-5,10,15,20-tetrakis(1-methylpyridinium-4-yl)porphyrin-Cu(II) tetrachloride (Cu(II)TMPyP) and with bulky meso substituents-5,10,15,20-tetrakis(N,N,N-trimethylanilinium-4-yl)porphyrin tetrachloride (TMAP), with (dG-dC)10 and (dA-dT)10 were studied by combination of vibrational circular dichroism (VCD) and electronic circular dichroism (ECD) spectroscopy at different [oligonucleotide]/[porphyrin] ratios, where [oligonucleotide] and [porphyrin] are the concentrations of oligonucleotide per base-pair and porphyrin, respectively. The combination of VCD and ECD spectroscopy enables us to identify the types of interactions, and to specify the sites of interactions: The intercalative binding mode of Cu(II)TMPyP with (dG-dC)(10), which has been well described, was characterized by a new VCD "marker" and it was shown that the interaction of Cu(II)TMPyP with (dA-dT)10 via external binding to the phosphate backbone and major groove binding caused transition from the B to the non-B conformer. TMAP interacted with the major groove of (dG-dC)10, was semi-intercalated into (dA-dT)10, and caused significant variation in the structure of both oligonucleotides at the higher concentration of porphyrin. The spectroscopic techniques used in this study revealed that porphyrin binding with AT sequences caused substantial variation of the DNA structure. It was shown that VCD spectroscopy is an effective tool for the conformational studies of nucleic acid-porphyrin complexes in solution. (c) 2007 Wiley Periodicals, Inc.
Henry, Scott P; Johnson, Mark; Zanardi, Thomas A; Fey, Robert; Auyeung, Diana; Lappin, Patrick B; Levin, Arthur A
2012-11-15
The primary target organ for uptake of systemically administered phosphorothioate oligonucleotides is the kidney cortex and the proximal tubular epithelium in particular. To determine the effect of oligonucleotide uptake on renal function, a detailed renal physiology study was performed in cynomolgus monkeys treated with 10-40 mg/kg/week ISIS 113715 for 4 weeks. The concentrations of oligonucleotide in the kidney cortex ranged from 1400 to 2600 μg/g. These concentrations were associated with histologic changes in proximal tubular epithelial cells that ranged from the appearance of cytoplasmic basophilic granules to atrophic and degenerative changes at higher concentrations. However, there were no renal functional abnormalities as determined by the typical measurements of blood urea nitrogen, serum creatinine, creatinine clearance, or urine specific gravity. Nor were there changes in glomerular filtration rate, or renal blood flow. Specific urinary markers of tubular epithelial cell damage, such as N-acetyl-glucosaminidase, and α-glutathione-s-transferase were not affected. Tubular function was further evaluated by monitoring the urinary excretion of amino acids, β(2)-microglobulin, or glucose. Renal function was challenged by administering a glucose load and by examining concentrating ability after a 4-h water deprivation. Neither challenge produced any evidence of change in renal function. The only change observed was a low incidence of increased urine protein/creatinine ratio in monkeys treated with ≥40 mg/kg/week which was rapidly reversible. Collectively, these data indicate that ISIS 113715-uptake by the proximal tubular epithelium has little or no effect on renal function at concentrations of 2600 μg/g. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.
Zanardi, Thomas A; Han, Su-Cheol; Jeong, Eun Ju; Rime, Soyub; Yu, Rosie Z; Chakravarty, Kaushik; Henry, Scott P
2012-11-01
ISIS 388626, a 2'-methoxyethyl (MOE)-modified antisense oligonucleotide (ASO) that targets human sodium glucose cotransporter 2 (SGLT2) mRNA, is in clinical trials for the management of diabetes. SGLT2 plays a pivotal role in renal glucose reabsorption, and inhibition of SGLT2 is anticipated to reduce hyperglycemia in diabetic subjects by increasing urinary glucose elimination. To selectively inhibit SGLT2 in the kidney, ISIS 388626 was designed as a "shortmer" ASO, consisting of only 12 nucleotides with two 2'-MOE-modified nucleotides at the termini. Mice and monkeys received up to 30 mg/kg/week ISIS 388626 via subcutaneous injection for 6 or 13 weeks. Dose-dependent decreases in renal SGLT2 mRNA expression were observed, which correlated with dose-related increases in glucosuria without concomitant hypoglycemia. There were no histologic changes in the kidney attributed to SGLT2 inhibition after 6 or 13 weeks of treatment. The remaining changes observed in these studies were typical of those produced in these species by the administration of oligonucleotides, correlated with high doses of ISIS 388626, and were unrelated to the inhibition of SGLT2 expression. The kidney contained the highest concentration of ISIS 388626, and dose-dependent basophilic granule accumulation in tubular epithelial cells of the kidney, which is evidence of oligonucleotide accumulation in these cells, was the only histologic change identified. No changes in kidney function were observed. These results revealed only readily reversible changes after the administration of ISIS 388626 and support the continued investigation of the safety and efficacy of ISIS 388626 in human trials.
The, Frans O; de Jonge, Wouter J; Bennink, Roel J; van den Wijngaard, Rene M; Boeckxstaens, Guy E
2005-09-01
Intestinal manipulation (IM) during abdominal surgery triggers the influx of inflammatory cells, leading to postoperative ileus. Prevention of this local muscle inflammation, using intercellular adhesion molecule-1 (ICAM-1) and leukocyte function-associated antigen-1-specific antibodies, has been shown to shorten postoperative ileus. However, the therapeutic use of antibodies has considerable disadvantages. The aim of the current study was to evaluate the effect of ISIS-3082, a mouse-specific ICAM-1 antisense oligonucleotide, on postoperative ileus in mice. Mice underwent a laparotomy or a laparotomy combined with IM after treatment with ICAM-1 antibodies, 0.1-10 mg kg(-1) ISIS-3082, saline or ISIS-8997 (scrambled control antisense oligonucleotides, 1 and 3 mg kg(-1)). At 24 h after surgery, gastric emptying of a 99mTC labelled semi-liquid meal was determined using scintigraphy. Intestinal inflammation was assessed by myeloperoxidase (MPO) activity in ileal muscle whole mounts. IM significantly reduced gastric emptying compared to laparotomy. Pretreatment with ISIS-3082 (0.1-1 mg kg(-1)) as well as ICAM-1 antibodies (10 mg kg(-1)), but not ISIS-8997 or saline, improved gastric emptying in a dose-dependent manner. This effect diminished with higher doses of ISIS-3082 (3-10 mg kg(-1)). Similarly, ISIS-3082 (0.1-1 mg kg(-1)) and ICAM-1 antibodies, but not ISIS-8997 or higher doses of ISIS-3082 (3-10 mg kg(-1)), reduced manipulation-induced inflammation. Immunohistochemistry showed reduction of ICAM-1 expression with ISIS-3082 only. ISIS-3082 pretreatment prevents postoperative ileus in mice by reduction of manipulation-induced local intestinal muscle inflammation. Our data suggest that targeting ICAM-1 using antisense oligonucleotides may represent a new therapeutic approach to the prevention of postoperative ileus.
Manipulation of Cell Physiology Enables Gene Silencing in Well-differentiated Airway Epithelia
Krishnamurthy, Sateesh; Behlke, Mark A; Ramachandran, Shyam; Salem, Aliasger K; McCray Jr, Paul B; Davidson, Beverly L
2012-01-01
The application of RNA interference-based gene silencing to the airway surface epithelium holds great promise to manipulate host and pathogen gene expression for therapeutic purposes. However, well-differentiated airway epithelia display significant barriers to double-stranded small-interfering RNA (siRNA) delivery despite testing varied classes of nonviral reagents. In well-differentiated primary pig airway epithelia (PAE) or human airway epithelia (HAE) grown at the air–liquid interface (ALI), the delivery of a Dicer-substrate small-interfering RNA (DsiRNA) duplex against hypoxanthine–guanine phosphoribosyltransferase (HPRT) with several nonviral reagents showed minimal uptake and no knockdown of the target. In contrast, poorly differentiated cells (2–5-day post-seeding) exhibited significant oligonucleotide internalization and target knockdown. This finding suggested that during differentiation, the barrier properties of the epithelium are modified to an extent that impedes oligonucleotide uptake. We used two methods to overcome this inefficiency. First, we tested the impact of epidermal growth factor (EGF), a known enhancer of macropinocytosis. Treatment of the cells with EGF improved oligonucleotide uptake resulting in significant but modest levels of target knockdown. Secondly, we used the connectivity map (Cmap) database to correlate gene expression changes during small molecule treatments on various cells types with genes that change upon mucociliary differentiation. Several different drug classes were identified from this correlative assessment. Well-differentiated epithelia treated with DsiRNAs and LY294002, a PI3K inhibitor, significantly improved gene silencing and concomitantly reduced target protein levels. These novel findings reveal that well-differentiated airway epithelia, normally resistant to siRNA delivery, can be pretreated with small molecules to improve uptake of synthetic oligonucleotide and RNA interference (RNAi) responses. PMID:23344182
High-density fiber optic biosensor arrays
NASA Astrophysics Data System (ADS)
Epstein, Jason R.; Walt, David R.
2002-02-01
Novel approaches are required to coordinate the immense amounts of information derived from diverse genomes. This concept has influenced the expanded role of high-throughput DNA detection and analysis in the biological sciences. A high-density fiber optic DNA biosensor was developed consisting of oligonucleotide-functionalized, 3.1 mm diameter microspheres deposited into the etched wells on the distal face of a 500 micrometers imaging fiber bundle. Imaging fiber bundles containing thousands of optical fibers, each associated with a unique oligonucleotide probe sequence, were the foundation for an optically connected, individually addressable DNA detection platform. Different oligonucleotide-functionalized microspheres were combined in a stock solution, and randomly dispersed into the etched wells. Microsphere positions were registered from optical dyes incorporated onto the microspheres. The distribution process provided an inherent redundancy that increases the signal-to-noise ratio as the square root of the number of sensors examined. The representative amount of each probe-type in the array was dependent on their initial stock solution concentration, and as other sequences of interest arise, new microsphere elements can be added to arrays without altering the existing detection capabilities. The oligonucleotide probe sequences hybridize to fluorescently-labeled, complementary DNA target solutions. Fiber optic DNA microarray research has included DNA-protein interaction profiles, microbial strain differentiation, non-labeled target interrogation with molecular beacons, and single cell-based assays. This biosensor array is proficient in DNA detection linked to specific disease states, single nucleotide polymorphism (SNP's) discrimination, and gene expression analysis. This array platform permits multiple detection formats, provides smaller feature sizes, and enables sensor design flexibility. High-density fiber optic microarray biosensors provide a fast, reversible format with the detection limit of a few hundred molecules.
Antisense oligonucleotide technologies in drug discovery.
Aboul-Fadl, Tarek
2006-09-01
The principle of antisense oligonucleotide (AS-OD) technologies is based on the specific inhibition of unwanted gene expression by blocking mRNA activity. It has long appeared to be an ideal strategy to leverage new genomic knowledge for drug discovery and development. In recent years, AS-OD technologies have been widely used as potent and promising tools for this purpose. There is a rapid increase in the number of antisense molecules progressing in clinical trials. AS-OD technologies provide a simple and efficient approach for drug discovery and development and are expected to become a reality in the near future. This editorial describes the established and emerging AS-OD technologies in drug discovery.
Wang, Harris H; Church, George M
2011-01-01
Engineering at the scale of whole genomes requires fundamentally new molecular biology tools. Recent advances in recombineering using synthetic oligonucleotides enable the rapid generation of mutants at high efficiency and specificity and can be implemented at the genome scale. With these techniques, libraries of mutants can be generated, from which individuals with functionally useful phenotypes can be isolated. Furthermore, populations of cells can be evolved in situ by directed evolution using complex pools of oligonucleotides. Here, we discuss ways to utilize these multiplexed genome engineering methods, with special emphasis on experimental design and implementation. Copyright © 2011 Elsevier Inc. All rights reserved.
NASA Technical Reports Server (NTRS)
Kanavarioti, Anastassia
1992-01-01
A scenario is proposed for the non-enzymatic self-replication of short RNA molecules. The self-replication of an oligopyrimidine strand is considered and the process of template-directed synthesis based on recognition within a double helix is discussed. Replication mechanisms are suggested for selected oligonucleotides. The mechanisms are based on Watson-Crick base pairing between complementary nucleotides as well as Hoogsteen base pairing between a duplex and the complementary third strand. It is suggested that self-replication based on these mechanisms may be accomplished but may result in a substantial amount of misinformation transfer when mixed oligonucleotides are used.
Khodakov, Dmitriy A; Khodakova, Anastasia S; Linacre, Adrian; Ellis, Amanda V
2014-07-21
This paper reports on the modification of magnetic beads with oligonucleotide capture probes with a specially designed pendant toehold (overhang) aimed specifically to capture double-stranded PCR products. After capture, the PCR products were selectively released from the magnetic beads by means of a toehold-mediated strand displacement reaction using short artificial oligonucleotide triggers and analysed using capillary electrophoresis. The approach was successfully shown on two genes widely used in human DNA genotyping, namely human c-fms (macrophage colony-stimulating factor) proto-oncogene for the CSF-1 receptor (CSF1PO) and amelogenin.
Aptamer-siRNA Chimeras: Discovery, Progress, and Future Prospects
Kruspe, Sven; Giangrande, Paloma H.
2017-01-01
Synthetic nucleic acid ligands (aptamers) have emerged as effective delivery tools for many therapeutic oligonucleotide-based drugs, including small interfering RNAs (siRNAs). In this review, we summarize recent progress in the aptamer selection technology that has made possible the identification of cell-specific, cell-internalizing aptamers for the cell-targeted delivery of therapeutic oligonucleotides. In addition, we review the original, proof-of-concept aptamer-siRNA delivery studies and discuss recent advances in aptamer-siRNA conjugate designs for applications ranging from cancer therapy to the development of targeted antivirals. Challenges and prospects of aptamer-targeted siRNA drugs for clinical development are further highlighted. PMID:28792479
Prebiotic chemistry and nucleic acid replication
NASA Technical Reports Server (NTRS)
Orgel, L. E.; Lohrmann, R.
1974-01-01
Recent work is reviewed on some reactions that could have occurred on the primitive earth and that could have played a part in the evolution of a self-replicating system. The transition from the primitive atmosphere to the simplest replicating molecules is considered in four stages: (1) the formation of a 'prebiotic soup' of organic precursors, including the purine and pyrimidine bases and the pentose sugars; (2) the condensation of these precursors and inorganic phosphate to form monomeric nucleotides and activated nucleotide derivatives; (3) the polymerization of nucleotide derivatives to oligonucleotides; and (4) the complementary replication of oligonucleotides in a template-directed process that depends on Watson-Crick base pairing.
Oligonucleotide (GTG)5 as an epidemiological tool in the study of nontuberculous mycobacteria.
Cilliers, F J; Warren, R M; Hauman, J H; Wiid, I J; van Helden, P D
1997-01-01
Analysis of restriction fragment length polymorphisms in the genome of Mycobacterium tuberculosis (DNA fingerprinting) has proved to be a useful epidemiological tool in the study of tuberculosis within populations or communities. However, to date, no similar method has been developed to study the epidemiology of nontuberculous mycobacteria (NTM). In this communication, we report that a simple oligonucleotide repeat, (GTG)5, can be used to accurately genotype all species and strains of NTM tested. We suggest that this technology is an easily applied and accurate tool which can be used for the study of the epidemiology of NTM. PMID:9163479
Kondo, T; Ohshima, T
1998-01-01
A blind shell suddenly and unexpectedly exploded, and 20 dismembered human remains were discovered. DNA fingerprint was performed to determine whether the 20 human remains were derived from one person or not. DNA was isolated from each of the remains and digested by the restriction enzyme Hinf I and Hae III and hybridized with the oligonucleotide probe (GTG)5. DNA fingerprint using Hinf I demonstrated the same band pattern in 17 out of the 20 remains. However, in the remaining 3 samples, two novel strange bands were observed. DNA fingerprint using Hae III showed completely identical pattern in all of the remains.
Design, synthesis and selection of DNA-encoded small-molecule libraries.
Clark, Matthew A; Acharya, Raksha A; Arico-Muendel, Christopher C; Belyanskaya, Svetlana L; Benjamin, Dennis R; Carlson, Neil R; Centrella, Paolo A; Chiu, Cynthia H; Creaser, Steffen P; Cuozzo, John W; Davie, Christopher P; Ding, Yun; Franklin, G Joseph; Franzen, Kurt D; Gefter, Malcolm L; Hale, Steven P; Hansen, Nils J V; Israel, David I; Jiang, Jinwei; Kavarana, Malcolm J; Kelley, Michael S; Kollmann, Christopher S; Li, Fan; Lind, Kenneth; Mataruse, Sibongile; Medeiros, Patricia F; Messer, Jeffrey A; Myers, Paul; O'Keefe, Heather; Oliff, Matthew C; Rise, Cecil E; Satz, Alexander L; Skinner, Steven R; Svendsen, Jennifer L; Tang, Lujia; van Vloten, Kurt; Wagner, Richard W; Yao, Gang; Zhao, Baoguang; Morgan, Barry A
2009-09-01
Biochemical combinatorial techniques such as phage display, RNA display and oligonucleotide aptamers have proven to be reliable methods for generation of ligands to protein targets. Adapting these techniques to small synthetic molecules has been a long-sought goal. We report the synthesis and interrogation of an 800-million-member DNA-encoded library in which small molecules are covalently attached to an encoding oligonucleotide. The library was assembled by a combination of chemical and enzymatic synthesis, and interrogated by affinity selection. We describe methods for the selection and deconvolution of the chemical display library, and the discovery of inhibitors for two enzymes: Aurora A kinase and p38 MAP kinase.
Sasaki, S
2001-04-01
A number of cross-linking (alkylating) agents have been developed and incorporated into the oligonulceotides for sequence selective control of gene expression. Recently, potential application of such active oligonucleotides has been expanding from use for improvement of inhibition efficiency to new biotechnology that may enable chemical alteration of genetic information. These interests in active oligonucleotides have encouraged the generation of new cross-linking agents that exhibit high efficiency for application of either in vitro or in vivo. This mini review summarizes structures of alkylating agents, in particular, a new basic skeleton for cross-linking, a 2'-deoxyribose derivative of 2-amino-6-vinylpurine that has been recently developed by the author's group. The 2-amino-6-vinylpurine has been shown to form a complex with cytidine under acidic conditions, and brings the vinyl and the amino reactive groups into proximity to achieve efficient alkylation. A new strategy was designed so that the reactivity of 2-amino-6-vinylpurine can be induced from the corresponding phenylsulfoxide derivative within a duplex with the complementary strand. The validity of the new strategy has been proven by achievement of cytidine-selective cross-linking with remarkably efficiency.
Differentiation of the seven major lyssavirus species by oligonucleotide microarray.
Xi, Jin; Guo, Huancheng; Feng, Ye; Xu, Yunbin; Shao, Mingfu; Su, Nan; Wan, Jiayu; Li, Jiping; Tu, Changchun
2012-03-01
An oligonucleotide microarray, LyssaChip, has been developed and verified as a highly specific diagnostic tool for differentiation of the 7 major lyssavirus species. As with conventional typing microarray methods, the LyssaChip relies on sequence differences in the 371-nucleotide region coding for the nucleoprotein. This region was amplified using nested reverse transcription-PCR primers that bind to the 7 major lyssaviruses. The LyssaChip includes 57 pairs of species typing and corresponding control oligonucleotide probes (oligoprobes) immobilized on glass slides, and it can analyze 12 samples on a single slide within 8 h. Analysis of 111 clinical brain specimens (65 from animals with suspected rabies submitted to the laboratory and 46 of butchered dog brain tissues collected from restaurants) showed that the chip method was 100% sensitive and highly consistent with the "gold standard," a fluorescent antibody test (FAT). The chip method could detect rabies virus in highly decayed brain tissues, whereas the FAT did not, and therefore the chip test may be more applicable to highly decayed brain tissues than the FAT. LyssaChip may provide a convenient and inexpensive alternative for diagnosis and differentiation of rabies and rabies-related diseases.
Effects of non-CpG site methylation on DNA thermal stability: a fluorescence study
Nardo, Luca; Lamperti, Marco; Salerno, Domenico; Cassina, Valeria; Missana, Natalia; Bondani, Maria; Tempestini, Alessia; Mantegazza, Francesco
2015-01-01
Cytosine methylation is a widespread epigenetic regulation mechanism. In healthy mature cells, methylation occurs at CpG dinucleotides within promoters, where it primarily silences gene expression by modifying the binding affinity of transcription factors to the promoters. Conversely, a recent study showed that in stem cells and cancer cell precursors, methylation also occurs at non-CpG pairs and involves introns and even gene bodies. The epigenetic role of such methylations and the molecular mechanisms by which they induce gene regulation remain elusive. The topology of both physiological and aberrant non-CpG methylation patterns still has to be detailed and could be revealed by using the differential stability of the duplexes formed between site-specific oligonucleotide probes and the corresponding methylated regions of genomic DNA. Here, we present a systematic study of the thermal stability of a DNA oligonucleotide sequence as a function of the number and position of non-CpG methylation sites. The melting temperatures were determined by monitoring the fluorescence of donor-acceptor dual-labelled oligonucleotides at various temperatures. An empirical model that estimates the methylation-induced variations in the standard values of hybridization entropy and enthalpy was developed. PMID:26354864
Oligonucleotide-based strategies to combat polyglutamine diseases
Fiszer, Agnieszka; Krzyzosiak, Wlodzimierz J.
2014-01-01
Considerable advances have been recently made in understanding the molecular aspects of pathogenesis and in developing therapeutic approaches for polyglutamine (polyQ) diseases. Studies on pathogenic mechanisms have extended our knowledge of mutant protein toxicity, confirmed the toxicity of mutant transcript and identified other toxic RNA and protein entities. One very promising therapeutic strategy is targeting the causative gene expression with oligonucleotide (ON) based tools. This straightforward approach aimed at halting the early steps in the cascade of pathogenic events has been widely tested for Huntington's disease and spinocerebellar ataxia type 3. In this review, we gather information on the use of antisense oligonucleotides and RNA interference triggers for the experimental treatment of polyQ diseases in cellular and animal models. We present studies testing non-allele-selective and allele-selective gene silencing strategies. The latter include targeting SNP variants associated with mutations or targeting the pathologically expanded CAG repeat directly. We compare gene silencing effectors of various types in a number of aspects, including their design, efficiency in cell culture experiments and pre-clinical testing. We discuss advantages, current limitations and perspectives of various ON-based strategies used to treat polyQ diseases. PMID:24848018
Hamidi-Asl, Ezat; Raoof, Jahan Bakhsh; Naghizadeh, Nahid; Akhavan-Niaki, Haleh; Ojani, Reza; Banihashemi, Ali
2016-10-01
The main roles of DNA in the cells are to maintain and properly express genetic information. It is important to have analytical methods capable of fast and sensitive detection of DNA damage. DNA hybridization sensors are well suited for diagnostics and other purposes, including determination of bacteria and viruses. Beta thalassemias (βth) are due to mutations in the β-globin gene. In this study, an electrochemical biosensor which detects the sequences related to the β-globin gene issued from real samples amplified by polymerase chain reaction (PCR) is described for the first time. The biosensor relies on the immobilization of 20-mer single stranded oligonucleotide (probe) related to βth sequence on the carbon paste electrode (CPE) modified by 15% silver (Ag) and platinum (Pt) nanoparticles to prepare the bimetallic nanocomposite electrode and hybridization of this oligonucleotide with its complementary sequence (target). The extent of hybridization between the probe and target sequences was shown by using linear sweep voltammetry (LSV) with methylene blue (MB) as hybridization indicator. The selectivity of sensor was investigated using PCR samples containing non-complementary oligonucleotides. The detection limit of biosensor was calculated about 470.0pg/μL. Copyright © 2016 Elsevier B.V. All rights reserved.
Murray, R; Pederson, K; Prosser, H; Muller, D; Hutchison, C A; Frelinger, J A
1988-01-01
We have used random oligonucleotide mutagenesis (or saturation mutagenesis) to create a library of point mutations in the alpha 1 protein domain of a Major Histocompatibility Complex (MHC) molecule. This protein domain is critical for T cell and B cell recognition. We altered the MHC class I H-2DP gene sequence such that synthetic mutant alpha 1 exons (270 bp of coding sequence), which contain mutations identified by sequence analysis, can replace the wild type alpha 1 exon. The synthetic exons were constructed from twelve overlapping oligonucleotides which contained an average of 1.3 random point mutations per intact exon. DNA sequence analysis of mutant alpha 1 exons has shown a point mutant distribution that fits a Poisson distribution, and thus emphasizes the utility of this mutagenesis technique to "scan" a large protein sequence for important mutations. We report our use of saturation mutagenesis to scan an entire exon of the H-2DP gene, a cassette strategy to replace the wild type alpha 1 exon with individual mutant alpha 1 exons, and analysis of mutant molecules expressed on the surface of transfected mouse L cells. Images PMID:2903482
The Status of Exon Skipping as a Therapeutic Approach to Duchenne Muscular Dystrophy
Lu, Qi-Long; Yokota, Toshifumi; Takeda, Shin'ichi; Garcia, Luis; Muntoni, Francesco; Partridge, Terence
2011-01-01
Duchenne muscular dystrophy (DMD) is associated with mutations in the dystrophin gene that disrupt the open reading frame whereas the milder Becker's form is associated with mutations which leave an in-frame mRNA transcript that can be translated into a protein that includes the N- and C- terminal functional domains. It has been shown that by excluding specific exons at, or adjacent to, frame-shifting mutations, open reading frame can be restored to an out-of-frame mRNA, leading to the production of a partially functional Becker-like dystrophin protein. Such targeted exclusion can be achieved by administration of oligonucleotides that are complementary to sequences that are crucial to normal splicing of the exon into the transcript. This principle has been validated in mouse and canine models of DMD with a number of variants of oligonucleotide analogue chemistries and by transduction with adeno-associated virus (AAV)-small nuclear RNA (snRNA) reagents encoding the antisense sequence. Two different oligonucleotide agents are now being investigated in human trials for splicing out of exon 51 with some early indications of success at the biochemical level. PMID:20978473
Morvan, F; Rayner, B; Imbach, J L; Thenet, S; Bertrand, J R; Paoletti, J; Malvy, C; Paoletti, C
1987-01-01
This paper describes for the first time the synthesis of alpha-oligonucleotides containing the four usual bases. Two unnatural hexadeoxyribonucleotides: alpha-[d(CpApTpGpCpG)] and alpha-[d(CpGpCpApTpG)], consisting only of alpha-anomeric nucleotide units, were obtained by an improved phosphotriester method, in solution. Starting material was the four base-protected alpha-deoxyribonucleosides 3a-d. Pyrimidine alpha-deoxynucleosides 3a and 3b were prepared by self-anomerization reactions followed by selective deprotection of sugar hydroxyles, while the two purine alpha-deoxynucleosides 3c and 3d were prepared by glycosylation reactions. In the case of guanine alpha-nucleoside derivative a supplementary base-protecting group: N,N-diphenylcarbamoyl was introduced on O6-position in order to avoid side-reactions during oligonucleotide assembling. The hexadeoxynucleotide alpha-[d(CpApTpGpCpG)] was tested as substrate of selected endo- and exonucleases. In conditions where the natural corresponding beta-hexamer was completely degradated by nuclease S1 and calf spleen phosphodiesterase, the alpha-oligonucleotide remained almost intact. PMID:3575096
Goldstein, Darlene R
2006-10-01
Studies of gene expression using high-density short oligonucleotide arrays have become a standard in a variety of biological contexts. Of the expression measures that have been proposed to quantify expression in these arrays, multi-chip-based measures have been shown to perform well. As gene expression studies increase in size, however, utilizing multi-chip expression measures is more challenging in terms of computing memory requirements and time. A strategic alternative to exact multi-chip quantification on a full large chip set is to approximate expression values based on subsets of chips. This paper introduces an extrapolation method, Extrapolation Averaging (EA), and a resampling method, Partition Resampling (PR), to approximate expression in large studies. An examination of properties indicates that subset-based methods can perform well compared with exact expression quantification. The focus is on short oligonucleotide chips, but the same ideas apply equally well to any array type for which expression is quantified using an entire set of arrays, rather than for only a single array at a time. Software implementing Partition Resampling and Extrapolation Averaging is under development as an R package for the BioConductor project.
Comparison of Zebrafish tmem88a mutant and morpholino knockdown phenotypes
Place, Elsie S.; Smith, James C.
2017-01-01
Tmem88a is a transmembrane protein that is thought to be a negative regulator of the Wnt signalling pathway. Several groups have used antisense morpholino oligonucleotides in an effort to characterise the role of tmem88a in zebrafish cardiovascular development, but they have not obtained consistent results. Here, we generate an 8 bp deletion in the coding region of the tmem88a locus using TALENs, and we have gone on to establish a viable homozygous tmem88aΔ8 mutant line. Although tmem88aΔ8 mutants have reduced expression of some key haematopoietic genes, differentiation of erythrocytes and neutrophils is unaffected, contradicting our previous study using antisense morpholino oligonucleotides. We find that expression of the tmem88a paralogue tmem88b is not significantly changed in tmem88aΔ8 mutants and injection of the tmem88a splice-blocking morpholino oligonucleotide into tmem88aΔ8 mutants recapitulates the reduction of erythrocytes observed in morphants using o-Dianisidine. This suggests that there is a partial, but inessential, requirement for tmem88a during haematopoiesis and that morpholino injection exacerbates this phenotype in tmem88a morpholino knockdown embryos. PMID:28192479
Antisense apolipoprotein B therapy: where do we stand?
Akdim, Fatima; Stroes, Erik S G; Kastelein, John J P
2007-08-01
Antisense oligonucleotides are novel therapeutic agents that reduce the number of specific mRNAs available for translation of the encoded protein. ISIS 301012 is an antisense oligonucleotide developed to reduce the hepatic synthesis of apolipoprotein B-100. Apolipoprotein B-100 is made in the liver, and antisense oligonucleotides preferentially distribute to that organ, so antisense apolipoprotein B-100 may have potential as an efficacious lipid-lowering agent. Recently, in healthy volunteers and in mild dyslipidaemic patients, this strategy as monotherapy or in conjunction with statins has shown unparalleled efficacy in reducing apolipoprotein B-100 and LDL-cholesterol. Tolerance for this novel therapy is encouraging and safety concerns currently only relate to mild injection-site reactions and rare liver-function test abnormalities. It should be noted, however, that these safety results were obtained in relatively few individuals. ISIS 301012 has initially shown promising results in experimental animal models, and in clinical trials in humans. Besides the effect of reducing apolipoprotein B-100 and LDL-cholesterol, this compound also significantly lowers plasma triglycerides. Safety concerns related to the drug include increased liver-function tests. To date no evidence of hepatic steatosis has been reported. Nonetheless, clinical trials of longer duration are required to demonstrate further safety.
Oligonucleotide fingerprinting of rRNA genes for analysis of fungal community composition.
Valinsky, Lea; Della Vedova, Gianluca; Jiang, Tao; Borneman, James
2002-12-01
Thorough assessments of fungal diversity are currently hindered by technological limitations. Here we describe a new method for identifying fungi, oligonucleotide fingerprinting of rRNA genes (OFRG). ORFG sorts arrayed rRNA gene (ribosomal DNA [rDNA]) clones into taxonomic clusters through a series of hybridization experiments, each using a single oligonucleotide probe. A simulated annealing algorithm was used to design an OFRG probe set for fungal rDNA. Analysis of 1,536 fungal rDNA clones derived from soil generated 455 clusters. A pairwise sequence analysis showed that clones with average sequence identities of 99.2% were grouped into the same cluster. To examine the accuracy of the taxonomic identities produced by this OFRG experiment, we determined the nucleotide sequences for 117 clones distributed throughout the tree. For all but two of these clones, the taxonomic identities generated by this OFRG experiment were consistent with those generated by a nucleotide sequence analysis. Eighty-eight percent of the clones were affiliated with Ascomycota, while 12% belonged to BASIDIOMYCOTA: A large fraction of the clones were affiliated with the genera Fusarium (404 clones) and Raciborskiomyces (176 clones). Smaller assemblages of clones had high sequence identities to the Alternaria, Ascobolus, Chaetomium, Cryptococcus, and Rhizoctonia clades.
Using RNA as a tool to modify lipid nanoparticles
NASA Astrophysics Data System (ADS)
Wilner, Samantha E.
Lipid nanoparticles (LNPs) provide an attractive option for therapeutic applications because they can self-assemble and carry a diverse set of cargoes ranging from hydrophobic drugs to small interfering RNA (siRNA). Liposomes and micelles represent two classes of LNPs that have been developed for medicinal purposes; however, active targeting of LNPs to specific tissues and LNP stability in vivo remain significant challenges. We have exploited the structural characteristics and targeting ability of nucleic acids to address these obstacles. Specifically, we have introduced short nucleic acid targeting species, called aptamers, to the surface of stable nucleic acid lipid particles (SNALPs), a subset of liposomes used in siRNA delivery. In this manner, we have actively targeted SNALPs to cancer cells that overexpress the transferrin receptor (TfR). HeLa cells expressing enhanced green fluorescent protein (EGFP) were treated with SNALPs bearing an antiTfR aptamer (C2) that was identified in our lab. C2-conjugated SNALPs showed increased levels of uptake by cells by flow cytometry. More importantly, the enhanced uptake by C2-conjugated SNALPs translated to an increased level of gene knockdown when SNALPs were loaded with anti-EGFP siRNA or anti-Lamin NC siRNA. Expression of EGFP and Lamin NC decreased, respectively. These preliminary studies illustrate that aptamer-conjugated SNALPs can be designed to knock down both endogenous and exogenous genes in cancer cells with high specificity. We have also used nucleic acids to stabilize lipid micelles by introducing short quadruplex forming oligonucleotide sequences at the lipid headgroup. Micelle formation was confirmed via dynamic light scattering, transmission electron microscopy, and small angle X-ray scattering. Micelle stability was assessed using NMR and by a FRET-based assay in the presence of serum proteins. Quadruplex-stabilized micelles demonstrated enhanced stability suggesting that alterations to oligonucleotide headgroup interactions could be used to tune micelle stability. Therefore, we engineered stabilized micelles with an oligonucleotide extension and have shown that the addition of an antisense oligonucleotide leads to micelle destabilization and cargo release. The ability to control particle stability with antisense oligonucleotides represents a new paradigm in the design of programmed nanoscale devices, which we envision will find utility in the development of novel diagnostics and therapeutics.
Naiser, Thomas; Ehler, Oliver; Kayser, Jona; Mai, Timo; Michel, Wolfgang; Ott, Albrecht
2008-01-01
Background The high binding specificity of short 10 to 30 mer oligonucleotide probes enables single base mismatch (MM) discrimination and thus provides the basis for genotyping and resequencing microarray applications. Recent experiments indicate that the underlying principles governing DNA microarray hybridization – and in particular MM discrimination – are not completely understood. Microarrays usually address complex mixtures of DNA targets. In order to reduce the level of complexity and to study the problem of surface-based hybridization with point defects in more detail, we performed array based hybridization experiments in well controlled and simple situations. Results We performed microarray hybridization experiments with short 16 to 40 mer target and probe lengths (in situations without competitive hybridization) in order to systematically investigate the impact of point-mutations – varying defect type and position – on the oligonucleotide duplex binding affinity. The influence of single base bulges and single base MMs depends predominantly on position – it is largest in the middle of the strand. The position-dependent influence of base bulges is very similar to that of single base MMs, however certain bulges give rise to an unexpectedly high binding affinity. Besides the defect (MM or bulge) type, which is the second contribution in importance to hybridization affinity, there is also a sequence dependence, which extends beyond the defect next-neighbor and which is difficult to quantify. Direct comparison between binding affinities of DNA/DNA and RNA/DNA duplexes shows, that RNA/DNA purine-purine MMs are more discriminating than corresponding DNA/DNA MMs. In DNA/DNA MM discrimination the affected base pair (C·G vs. A·T) is the pertinent parameter. We attribute these differences to the different structures of the duplexes (A vs. B form). Conclusion We have shown that DNA microarrays can resolve even subtle changes in hybridization affinity for simple target mixtures. We have further shown that the impact of point defects on oligonucleotide stability can be broken down to a hierarchy of effects. In order to explain our observations we propose DNA molecular dynamics – in form of zipping of the oligonucleotide duplex – to play an important role. PMID:18477387
Wang, Xiaofeng; Zhang, Aiqun; Ren, Weizheng; Chen, Caiyu; Dong, Jiahong
2012-11-01
The cell growth, development, and regeneration of tissue and organ are associated with a large number of gene regulation events, which are mediated in part by transcription factors (TFs) binding to cis-regulatory elements involved in the genome. Predicting the binding affinity and inferring the binding specificity of TF-DNA interactions at the genomic level would be fundamentally helpful for our understanding of the molecular mechanism and biological implication underlying sequence-specific TF-DNA recognition. In this study, we report the development of a combination method to characterize the interaction behavior of a 11-mer oligonucleotide segment and its mutations with the Gcn4p protein, a homodimeric, basic leucine zipper TF, and to predict the binding affinity and specificity of potential Gcn4p binders in the genome-wide scale. In this procedure, a position-mutated energy matrix is created based on molecular modeling analysis of native and mutated Gcn4p-DNA complex structures to describe the position-independent interaction energy profile of Gcn4p with different nucleotide types at each position of the oligonucleotide, and the energy terms extracted from the matrix and their interactives are then correlated with experimentally measured affinities of 19268 distinct oligonucleotides using statistical modeling methodology. Subsequently, the best one of built regression models is successfully applied to screen those of potential high-affinity Gcn4p binders from the complete genome. The findings arising from this study are briefly listed below: (i) The 11 positions of oligonucleotides are highly interactive and non-additive in contribution to Gcn4p-DNA binding affinity; (ii) Indirect conformational effects upon nucleotide mutations as well as associated subtle changes in interfacial atomic contacts, but not the direct nonbonded interactions, are primarily responsible for the sequence-specific recognition; (iii) The intrinsic synergistic effects among the sequence positions of oligonucleotides determine Gcn4p-DNA binding affinity and specificity; (iv) Linear regression models in conjunction with variable selection seem to perform fairly well in capturing the internal dependences hidden in the Gcn4p-DNA system, albeit ignoring nonlinear factors may lead the models to systematically underestimate and overestimate high- and low-affinity samples, respectively. © 2012 John Wiley & Sons A/S.
Mercier, Frédéric; Paris, Jérôme; Kaisin, Geoffroy; Thonon, David; Flagothier, Jessica; Teller, Nathalie; Lemaire, Christian; Luxen, André
2011-01-19
The alkyne-azide Cu(I)-catalyzed Huisgen cycloaddition, a click-type reaction, was used to label a double-stranded oligonucleotide (siRNA) with fluorine-18. An alkyne solid support CPG for the preparation of monostranded oligonucleotides functionalized with alkyne has been developed. Two complementary azide labeling agents (1-(azidomethyl)-4-[(18)F]fluorobenzene) and 1-azido-4-(3-[(18)F]fluoropropoxy)benzene have been produced with 41% and 35% radiochemical yields (decay-corrected), respectively. After annealing with the complementary strand, the siRNA was directly labeled by click chemistry with [(18)F]fluoroazide to produce the [(18)F]-radiolabeled siRNA with excellent radiochemical yield and purity.
Scheiermann, Julia; Klinman, Dennis M.
2014-01-01
Synthetic oligonucleotides (ODN) that express unmethylated “CpG motifs” trigger cells that express Toll-like receptor 9. In humans this includes plasmacytoid dendritic cells and B cells. CpG ODN induce an innate immune response characterized by the production of Th1 and pro-inflammatory cytokines. Their utility as vaccine adjuvants was evaluated in a number of clinical trials. Results indicate that CpG ODN improve antigen presentation and the generation of vaccine-specific cellular and humoral responses. This work provides an up-to-date overview of the utility of CpG ODN as adjuvants for vaccines targeting infectious agents and cancer. PMID:24975812
De Stefano, Luca; Oliviero, Giorgia; Amato, Jussara; Borbone, Nicola; Piccialli, Gennaro; Mayol, Luciano; Rendina, Ivo; Terracciano, Monica; Rea, Ilaria
2013-01-01
Direct solid phase synthesis of peptides and oligonucleotides (ONs) requires high chemical stability of the support material. In this work, we have investigated the passivation ability of porous oxidized silicon multilayered structures by two aminosilane compounds, 3-aminopropyltriethoxysilane and 3-aminopropyldimethylethoxysilane (APDMES), for optical label-free ON biosensor fabrication. We have also studied by spectroscopic reflectometry the hybridization between a 13 bases ON, directly grown on the aminosilane modified porous oxidized silicon by in situ synthesis, and its complementary sequence. Even if the results show that both devices are stable to the chemicals (carbonate/methanol) used, the porous silica structure passivated by APDMES reveals higher functionalization degree due to less steric hindrance of pores. PMID:23536541
Oligonucleotide synthesis catalyzed by the Zn/2+/ ion
NASA Technical Reports Server (NTRS)
Sawai, H.; Orgel, L. E.
1975-01-01
Results of experiments are reported in which Zn(2+) ion catalyzed the formation of oligonucleotides from nucleoside phosphorimidazolides in aqueous solution, even in the absence of a template. Specifically, the imidazolides (ImpU or ImpA) polymerized to form ImpApA, and pApA, pApApA, and pApApApA, or the analogous uracil compounds. In addition, the expected hydrolysis products of the hydrolysis of ImpA were formed (pA, imidazole). Judging from the ratio of pA(n) over pA (with and without zinc ion), this ion increased the efficiency of phosphodiester-bond formation by up to 10 times. Possible mechanisms for the reaction are tentatively proposed.
Triple helix purification and sequencing
Wang, Renfeng; Smith, Lloyd M.; Tong, Xinchun E.
1995-01-01
Disclosed herein are methods, kits, and equipment for purifying single stranded circular DNA and then using the DNA for DNA sequencing purposes. Templates are provided with an insert having a hybridization region. An elongated oligonucleotide has two regions that are complementary to the insert and the oligo is bound to a magnetic anchor. The oligo hybridizes to the insert on two sides to form a stable triple helix complex. The anchor can then be used to drag the template out of solution using a magnet. The system can purify sequencing templates, and if desired the triple helix complex can be opened up to a double helix so that the oligonucleotide will act as a primer for further DNA synthesis.
Triazole-linked DNA as a primer surrogate in the synthesis of first-strand cDNA.
Fujino, Tomoko; Yasumoto, Ken-ichi; Yamazaki, Naomi; Hasome, Ai; Sogawa, Kazuhiro; Isobe, Hiroyuki
2011-11-04
A phosphate-eliminated nonnatural oligonucleotide serves as a primer surrogate in reverse transcription reaction of mRNA. Despite of the nonnatural triazole linkages in the surrogate, the reverse transcriptase effectively elongated cDNA sequences on the 3'-downstream of the primer by transcription of the complementary sequence of mRNA. A structure-activity comparison with the reference natural oligonucleotides shows the superior priming activity of the surrogate containing triazole-linkages. The nonnatural linkages also protect the transcribed cDNA from digestion reactions with 5'-exonuclease and enable us to remove noise transcripts of unknown origins. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Phosphine-free Stille-Migita chemistry for the mild and orthogonal modification of DNA and RNA.
Krause, André; Hertl, Alexander; Muttach, Fabian; Jäschke, Andres
2014-12-08
An optimized catalyst system of [Pd2 (dba)3 ] and AsPh3 efficiently catalyzes the Stille reaction between a diverse set of functionalized stannanes and halogenated mono-, di- and oligonucleotides. The methodology allows for the facile conjugation of short and long nucleic acid molecules with moieties that are not compatible with conventional chemical or enzymatic synthesis, among them acid-, base-, or fluoride-labile protecting groups, fluorogenic and synthetically challenging moieties with good to near-quantitative yields. Notably, even azides can be directly introduced into oligonucleotides and (deoxy)nucleoside triphosphates, thereby giving direct access to "clickable" nucleic acids. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Triple helix purification and sequencing
Wang, R.; Smith, L.M.; Tong, X.E.
1995-03-28
Disclosed herein are methods, kits, and equipment for purifying single stranded circular DNA and then using the DNA for DNA sequencing purposes. Templates are provided with an insert having a hybridization region. An elongated oligonucleotide has two regions that are complementary to the insert and the oligo is bound to a magnetic anchor. The oligo hybridizes to the insert on two sides to form a stable triple helix complex. The anchor can then be used to drag the template out of solution using a magnet. The system can purify sequencing templates, and if desired the triple helix complex can be opened up to a double helix so that the oligonucleotide will act as a primer for further DNA synthesis. 4 figures.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Farahani, Poupak; Chiu, Sally; Bowlus, Christopher L.
Obesity is a complex disease. To date, over 100 chromosomal loci for body weight, body fat, regional white adipose tissue weight, and other obesity-related traits have been identified in humans and in animal models. For most loci, the underlying genes are not yet identified; some of these chromosomal loci will be alleles of known obesity genes, whereas many will represent alleles of unknown genes. Microarray analysis allows simultaneous multiple gene and pathway discovery. cDNA and oligonucleotide arrays are commonly used to identify differentially expressed genes by surveys of large numbers of known and unnamed genes. Two papers previously identified genesmore » differentially expressed in adipose tissue of mouse models of obesity and diabetes by analysis of hybridization to Affymetrix oligonucleotide chips.« less
O'Dwyer, Lucia Helena; Moço, Tatiana Cristina; Paduan, Karina dos Santos; Spenassatto, Carine; da Silva, Reinaldo José; Ribolla, Paulo Eduardo Martins
2013-10-01
Hepatozoon spp. are commonly found infecting snakes. Since the latter are parasitized by diverse forms and data in the literature show divergence, we studied Hepatozoon spp. diversity on Crotalus durissus terrificus snakes using both molecular and morphological approaches. Naturally infected animals were employed. Blood was collected, blood smears were prepared and an aliquot was stored at -20°C for DNA extraction. Five specimens of C. durissus terrificus were selected, each of them infected with one gamont type. Morphological and morphometric analyses of the found gamonts led to their grouping into three populations. For molecular characterization, seven oligonucleotide pairs that amplify distinct regions of rDNA gene were tested by adopting the PCR technique. Only the oligonucleotide pairs HepF300/Hep900 and HEMO1/HEMO2 were efficient in amplifying and distinguishing different isolates of Hepatozoon spp. from snakes. The better results were obtained when both oligonucleotide pairs were used in association. Based on the molecular and morphologic differences, three new species were proposed: Hepatozoon cuestensis sp. nov.; Hepatozoon cevapii sp. nov. and Hepatozoon massardii sp. nov. This is the first description of new Hepatozoon species from snakes, based on molecular characterization and morphological data, in South America. Copyright © 2013 Elsevier Inc. All rights reserved.
Wu, Li; Wang, Yuan; Wu, Junzhou; Lv, Cong; Wang, Jie; Tang, Xinjing
2013-01-01
We synthesized three 20mer caged circular antisense oligodeoxynucleotides (R20, R20B2 and R20B4) with a photocleavable linker and an amide bond linker between two 10mer oligodeoxynucleotides. With these caged circular antisense oligodeoxynucleotides, RNA-binding affinity and its digestion by ribonuclease H were readily photomodulated. RNA cleavage rates were upregulated ∼43-, 25- and 15-fold for R20, R20B2 and R20B4, respectively, upon light activation in vitro. R20B2 and R20B4 with 2- or 4-nt gaps in the target RNA lost their ability to bind the target RNA even though a small amount of RNA digestion was still observed. The loss of binding ability indicated promising gene photoregulation through a non-enzymatic strategy. To test this strategy, three caged circular antisense oligonucleotides (PS1, PS2 and PS3) with 2′-OMe RNA and phosphorothioate modifications were synthesized to target GFP expression. Upon light activation, photomodulation of target hybridization and GFP expression in cells was successfully achieved with PS1, PS2 and PS3. These caged circular antisense oligonucleotides show promising applications of photomodulating gene expression through both ribonuclease H and non-enzyme involved antisense strategies. PMID:23104375
Augmenter of liver regeneration: An important intracellular survival factor for hepatocytes☆
Thirunavukkarasu, Chinnasamy; Wang, Lian Fu; Harvey, Stephen A.K.; Watkins, Simon C.; Chaillet, J. Richard; Prelich, John; Starzl, Thomas E.; Gandhi, Chandrashekhar R.
2010-01-01
Background/Aims Augmenter of liver regeneration (ALR), a protein synthesized and stored in hepatocytes, is associated with mitochondria, and possesses sulfhydryl oxidase and cytochrome c reductase activities. We sought to determine the effects of ALR depletion in hepatocytes by antisense oligonucleotide transfection. Methods Rat hepatocytes in primary culture were transfected with antisense oligonucleotide for ALR mRNA (ALR-AS) or scrambled oligonucleotide. Various analyses were performed at times up to 24 h after transfection. Results Treatment with ALR-AS caused a decrease in ALR mRNA, cellular depletion of ALR protein primarily from mitochondria, and decreased viability. Flow cytometric analysis of ALR-AS-transfected hepatocytes stained with annexin-Vcy3 and 7-aminoactinomycin D revealed apoptosis as the predominant cause of death up to 6 h; incubation beyond this time resulted in necrosis in addition to apoptosis. ALR-AS-transfection caused release of mitochondrial cytochrome c, activation of caspase-3, profound reduction in the ATP content, and cellular release of LDH. Inhibition of caspase-3 inhibited the early phase of ALR-AS-induced death but not the late phase that included ALR and LDH release. Conclusions These results suggest that ALR is critically important for the survival of hepatocytes by its association with mitochondria and regulation of ATP synthesis. PMID:18272248
Efficient exon skipping of SGCG mutations mediated by phosphorodiamidate morpholino oligomers.
Wyatt, Eugene J; Demonbreun, Alexis R; Kim, Ellis Y; Puckelwartz, Megan J; Vo, Andy H; Dellefave-Castillo, Lisa M; Gao, Quan Q; Vainzof, Mariz; Pavanello, Rita C M; Zatz, Mayana; McNally, Elizabeth M
2018-05-03
Exon skipping uses chemically modified antisense oligonucleotides to modulate RNA splicing. Therapeutically, exon skipping can bypass mutations and restore reading frame disruption by generating internally truncated, functional proteins to rescue the loss of native gene expression. Limb-girdle muscular dystrophy type 2C is caused by autosomal recessive mutations in the SGCG gene, which encodes the dystrophin-associated protein γ-sarcoglycan. The most common SGCG mutations disrupt the transcript reading frame abrogating γ-sarcoglycan protein expression. In order to treat most SGCG gene mutations, it is necessary to skip 4 exons in order to restore the SGCG transcript reading frame, creating an internally truncated protein referred to as Mini-Gamma. Using direct reprogramming of human cells with MyoD, myogenic cells were tested with 2 antisense oligonucleotide chemistries, 2'-O-methyl phosphorothioate oligonucleotides and vivo-phosphorodiamidate morpholino oligomers, to induce exon skipping. Treatment with vivo-phosphorodiamidate morpholino oligomers demonstrated efficient skipping of the targeted exons and corrected the mutant reading frame, resulting in the expression of a functional Mini-Gamma protein. Antisense-induced exon skipping of SGCG occurred in normal cells and those with multiple distinct SGCG mutations, including the most common 521ΔT mutation. These findings demonstrate a multiexon-skipping strategy applicable to the majority of limb-girdle muscular dystrophy 2C patients.
Kimura, Yasumasa; Soma, Takahiro; Kasahara, Naoko; Delobel, Diane; Hanami, Takeshi; Tanaka, Yuki; de Hoon, Michiel J L; Hayashizaki, Yoshihide; Usui, Kengo; Harbers, Matthias
2016-01-01
Analytical PCR experiments preferably use internal probes for monitoring the amplification reaction and specific detection of the amplicon. Such internal probes have to be designed in close context with the amplification primers, and may require additional considerations for the detection of genetic variations. Here we describe Edesign, a new online and stand-alone tool for designing sets of PCR primers together with an internal probe for conducting quantitative real-time PCR (qPCR) and genotypic experiments. Edesign can be used for selecting standard DNA oligonucleotides like for instance TaqMan probes, but has been further extended with new functions and enhanced design features for Eprobes. Eprobes, with their single thiazole orange-labelled nucleotide, allow for highly sensitive genotypic assays because of their higher DNA binding affinity as compared to standard DNA oligonucleotides. Using new thermodynamic parameters, Edesign considers unique features of Eprobes during primer and probe design for establishing qPCR experiments and genotyping by melting curve analysis. Additional functions in Edesign allow probe design for effective discrimination between wild-type sequences and genetic variations either using standard DNA oligonucleotides or Eprobes. Edesign can be freely accessed online at http://www.dnaform.com/edesign2/, and the source code is available for download.
Jensen, Michael A; Davis, Ronald W
2018-03-27
There is a growing demand for sustainable methods in research and development, where instead of hazardous chemicals, an aqueous medium is chosen to perform biological reactions. In this Perspective, we examine the history and current methodology of using enzymes to generate artificial single-stranded DNA. By using traditional solid-phase phosphoramidite chemistry as a metric, we also explore criteria for the method of template-independent enzymatic oligonucleotide synthesis (TiEOS). As its key component, we delve into the biology of one of the most enigmatic enzymes, terminal deoxynucleotidyl transferase (TdT). As TdT is found to exponentially increase antigen receptor diversity in the vertebrate immune system by adding nucleotides in a template-free manner, researchers have exploited this function as an alternative to the phosphoramidite synthesis method. Though TdT is currently the preferred enzyme for TiEOS, its random nucleotide incorporation presents a barrier in synthesis automation. Taking a closer look at the TiEOS cycle, particularly the coupling step, we find it is comprised of additions > n+1 and deletions. By tapping into the physical and biochemical properties of TdT, we strive to further elucidate its mercurial behavior and offer ways to better optimize TiEOS for production-grade oligonucleotide synthesis.
Schmidts, T; Dobler, D; Schlupp, P; Nissing, C; Garn, H; Runkel, F
2010-10-15
Multiple water-in-oil-in-water (W/O/W) emulsions are of major interest as potential skin delivery systems for water-soluble drugs like oligonucleotides due to their distinct encapsulation properties. However, multiple emulsions are highly sensitive in terms of variations of the individual components. The presence of osmotic active ingredients in the inner water phase is crucial for the generation of stable multiple emulsions. In order to stabilize the emulsions the influence of NaCl, MgSO(4), glucose and glycine and two cellulose derivatives was investigated. Briefly, multiple W/O/W emulsions using Span 80 as a lipophilic emulsifier and different hydrophilic emulsifiers (PEG-40/50 stearate, steareth-20 and polysorbate 80) were prepared. Stability of the emulsions was analyzed over a period of time using rheological measurements, droplet size observations and conductivity analysis. In this study we show that additives strongly influence the properties stability of multiple emulsions. By increasing the concentration of the osmotic active ingredients, smaller multiple droplets are formed and the viscosity is significantly increased. The thickening agents resulted in a slightly improved stability. The most promising emulsions were chosen and further evaluated for their suitability and compatibility to incorporate a DNAzyme oligonucleotide as active pharmaceutical ingredient. Copyright 2010 Elsevier B.V. All rights reserved.
Next generation 1536-well oligonucleotide synthesizer with on-the-fly dispense.
Jensen, Michael; Roberts, Lester; Johnson, Andrew; Fukushima, Marilyn; Davis, Ronald
2014-02-10
Here we report the development of our Next Generation Automated Multiplexed Oligonucleotide Synthesizer (NG-1536-AMOS), capable of producing 1536 samples in a single run using a multi-well filtered titer plate. With the potential to synthesize up to 3456 samples per plate, we converted the BioRAPTR Flying Reagent Dispenser into an open-well system where spent reagents are drained to waste under vacuum. During synthesis, reagents are delivered on-the-fly to each micro-titer well at volumes ≤5 μl with plate speeds up to 150 mm/s. Using gas-phase cleavage and deprotection, a full plate of 1536 60 mers may be processed with same-day turnaround with an average yield per well at 3.5 nmol. Final product at only $0.00277/base is eluted into a low-volume collection plate for immediate use in downstream application (e.g. Biomek FX for versatile sample handling). Also, crude oligonucleotide quality is comparable to that of commercial synthesis instrumentation, with an error rate on the NG-1536-AMOS platform of 1.53/717 bases. Furthermore, mass spectral analysis on strands synthesized up to 80 bases showed high purity with an average coupling efficiency of 99.5%. Copyright © 2013 Elsevier B.V. All rights reserved.
Erdem, S. Sibel; Nesterova, Irina V.; Soper, Steven A.; Hammer, Robert P.
2009-01-01
Phthalocyanines (Pcs) are excellent candidates for use as fluors for near-infrared (near-IR) fluorescent tagging of biomolecules for a wide variety of bioanalytical applications. Mono-functionalized Pcs, having two different types of peripheral substitutents; one for covalent conjugation of the Pc to biomolecules and others to improve the solubility of the macrocycle, ideally suit for the desired applications. To date, difficulties faced during the purification of the mono-functionalized Pcs limited their usage in various types of applications. Herein are reported a new synthetic method for rapid synthesis of the target Pcs and bioconjugation techniques for labeling of the oligonucleotides with the near-IR flours. A novel synthetic route was developed utilizing a hydrophilic, polyethylene glycol-based (PEG) support with an acid labile Rink Amide linker. The Pcs were functionalized with an amine group for covalent conjugation purposes and were decorated with short PEG chains, serving as solubilizing groups. Mwave-assisted solid-phase synthetic method was successfully applied to obtain pure asymmetrically-substituted mono-amine functionalized Pcs in a short period of time. Three different bioconjugation techniques, reductive amination, amidation and Huisgen cycloaddition, were employed for covalent conjugation of Pcs to oligonucleotides. The described μwave-assisted bioconjugation methods give an opportunity to synthesize and isolate the Pc-oligonucleotide conjugate in a few hours. PMID:19911767
Botelho, Ana; Canto, Ana; Leão, Célia; Cunha, Mónica V
2015-01-01
Typical CRISPR (clustered, regularly interspaced, short palindromic repeat) regions are constituted by short direct repeats (DRs), interspersed with similarly sized non-repetitive spacers, derived from transmissible genetic elements, acquired when the cell is challenged with foreign DNA. The analysis of the structure, in number and nature, of CRISPR spacers is a valuable tool for molecular typing since these loci are polymorphic among strains, originating characteristic signatures. The existence of CRISPR structures in the genome of the members of Mycobacterium tuberculosis complex (MTBC) enabled the development of a genotyping method, based on the analysis of the presence or absence of 43 oligonucleotide spacers separated by conserved DRs. This method, called spoligotyping, consists on PCR amplification of the DR chromosomal region and recognition after hybridization of the spacers that are present. The workflow beneath this methodology implies that the PCR products are brought onto a membrane containing synthetic oligonucleotides that have complementary sequences to the spacer sequences. Lack of hybridization of the PCR products to a specific oligonucleotide sequence indicates absence of the correspondent spacer sequence in the examined strain. Spoligotyping gained great notoriety as a robust identification and typing tool for members of MTBC, enabling multiple epidemiological studies on human and animal tuberculosis.
Lennen, Rebecca M.; Nilsson Wallin, Annika I.; Pedersen, Margit; Bonde, Mads; Luo, Hao; Herrgård, Markus J.; Sommer, Morten O. A.
2016-01-01
Homologous recombination of single-stranded oligonucleotides is a highly efficient process for introducing precise mutations into the genome of E. coli and other organisms when mismatch repair (MMR) is disabled. This can result in the rapid accumulation of off-target mutations that can mask desired phenotypes, especially when selections need to be employed following the generation of combinatorial libraries. While the use of inducible mutator phenotypes or other MMR evasion tactics have proven useful, reported methods either require non-mobile genetic modifications or costly oligonucleotides that also result in reduced efficiencies of replacement. Therefore a new system was developed, Transient Mutator Multiplex Automated Genome Engineering (TM-MAGE), that solves problems encountered in other methods for oligonucleotide-mediated recombination. TM-MAGE enables nearly equivalent efficiencies of allelic replacement to the use of strains with fully disabled MMR and with an approximately 12- to 33-fold lower off-target mutation rate. Furthermore, growth temperatures are not restricted and a version of the plasmid can be readily removed by sucrose counterselection. TM-MAGE was used to combinatorially reconstruct mutations found in evolved salt-tolerant strains, enabling the identification of causative mutations and isolation of strains with up to 75% increases in growth rate and greatly reduced lag times in 0.6 M NaCl. PMID:26496947
Wang, Shunzhi; McGuirk, C Michael; Ross, Michael B; Wang, Shuya; Chen, Pengcheng; Xing, Hang; Liu, Yuan; Mirkin, Chad A
2017-07-26
Metal-organic frameworks (MOFs) are a class of modular, crystalline, and porous materials that hold promise for storage and transport of chemical cargoes. Though MOFs have been studied in bulk forms, ways of deliberately manipulating the external surface functionality of MOF nanoparticles are less developed. A generalizable approach to modify their surfaces would allow one to impart chemical functionality onto the particle surface that is independent of the bulk MOF structure. Moreover, the use of a chemically programmable ligand, such as DNA, would allow for the manipulation of interparticle interactions. Herein, we report a coordination chemistry-based strategy for the surface functionalization of the external metal nodes of MOF nanoparticles with terminal phosphate-modified oligonucleotides. The external surfaces of nine distinct archetypical MOF particles containing four different metal species (Zr, Cr, Fe, and Al) were successfully functionalized with oligonucleotides, illustrating the generality of this strategy. By taking advantage of the programmable and specific interactions of DNA, 11 distinct MOF particle-inorganic particle core-satellite clusters were synthesized. In these hybrid nanoclusters, the relative stoichiometry, size, shape, and composition of the building blocks can all be independently controlled. This work provides access to a new set of nucleic acid-nanoparticle conjugates, which may be useful as programmable material building blocks and as probes for measuring and manipulating intracellular processes.
Cheng, Sheng; Zheng, Bin; Wang, Mozhen; Lam, Michael Hon-Wah; Ge, Xuewu
2014-02-01
A strand displacement reaction (SDR) system that runs solely on oligonucleotides has been developed for the amplification detection of adenosine triphosphate (ATP). It involves a target-induced SDR and an entropy-driven catalytic cycle of two SDRs with five oligonucleotides, denoted as substrate, fuel, catalyst, C-1, and C-2. Catalyst, released from the ATP aptamer-catalyst duplex by ATP molecule, catalyzes the SDRs to finally form the substrate-fuel duplex. All of the intermediates in the catalytic SDR processes have been identified by polyacrylamide gel electrophoresis (PAGE) analysis. The introduction of ATP into the SDR system will induce the ATP aptamer to form G-quadruplex conformation so as to release catalyst and trigger the SDR cycle. When the substrate and C-2 oligonucleotides were labeled with a carboxyfluorescein (FAM) fluorophore and a 4-([4-(dimethylamino)phenyl]azo)benzoic acid (DABCYL) quencher, this SDR catalytic system exhibited a "turn-on" response for ATP. The condition for detecting ATP, such as Mg²⁺ concentration, has been optimized to afford a detection limit of 20 nM. This work provides an enzyme-free biosensing strategy and has potential application in aptamer-based biosensing. Copyright © 2013 Elsevier Inc. All rights reserved.
NASA Technical Reports Server (NTRS)
Liu, W. T.; Mirzabekov, A. D.; Stahl, D. A.
2001-01-01
The utility of a high-density oligonucleotide microarray (microchip) for identifying strains of five closely related bacilli (Bacillus anthracis, Bacillus cereus, Bacillus mycoides, Bacillus medusa and Bacillus subtilis) was demonstrated using an approach that compares the non-equilibrium dissociation rates ('melting curves') of all probe-target duplexes simultaneously. For this study, a hierarchical set of 30 oligonucleotide probes targeting the 16S ribosomal RNA of these bacilli at multiple levels of specificity (approximate taxonomic ranks of domain, kingdom, order, genus and species) was designed and immobilized in a high-density matrix of gel pads on a glass slide. Reproducible melting curves for probes with different levels of specificity were obtained using an optimized salt concentration. Clear discrimination between perfect match (PM) and mismatch (MM) duplexes was achieved. By normalizing the signals to an internal standard (a universal probe), a more than twofold discrimination (> 2.4x) was achieved between PM and 1-MM duplexes at the dissociation temperature at which 50% of the probe-target duplexes remained intact. This provided excellent differentiation among representatives of different Bacillus species, both individually and in mixtures of two or three. The overall pattern of hybridization derived from this hierarchical probe set also provided a clear 'chip fingerprint' for each of these closely related Bacillus species.
Bonini, Jennifer; Varilh, Jessica; Raynal, Caroline; Thèze, Corinne; Beyne, Emmanuelle; Audrezet, Marie-Pierre; Ferec, Claude; Bienvenu, Thierry; Girodon, Emmanuelle; Tuffery-Giraud, Sylvie; Des Georges, Marie; Claustres, Mireille; Taulan-Cadars, Magali
2015-10-01
Although 97-99% of CFTR mutations have been identified, great efforts must be made to detect yet-unidentified mutations. We developed a small-scale next-generation sequencing approach for reliably and quickly scanning the entire gene, including noncoding regions, to identify new mutations. We applied this approach to 18 samples from patients suffering from cystic fibrosis (CF) in whom only one mutation had hitherto been identified. Using an in-house bioinformatics pipeline, we could rapidly identify a second disease-causing CFTR mutation for 16 of 18 samples. Of them, c.1680-883A>G was found in three unrelated CF patients. Analysis of minigenes and patients' transcripts showed that this mutation results in aberrantly spliced transcripts because of the inclusion of a pseudoexon. It is located only three base pairs from the c.1680-886A>G mutation (1811+1.6kbA>G), the fourth most frequent mutation in southwestern Europe. We next tested the effect of antisense oligonucleotides targeting splice sites on these two mutations on pseudoexon skipping. Oligonucleotide transfection resulted in the restoration of the full-length, in-frame CFTR transcript, demonstrating the effect of antisense oligonucleotide-induced pseudoexon skipping in CF. Our data confirm the importance of analyzing noncoding regions to find unidentified mutations, which is essential to designing targeted therapeutic approaches.
Kasahara, Naoko; Delobel, Diane; Hanami, Takeshi; Tanaka, Yuki; de Hoon, Michiel J. L.; Hayashizaki, Yoshihide; Usui, Kengo; Harbers, Matthias
2016-01-01
Analytical PCR experiments preferably use internal probes for monitoring the amplification reaction and specific detection of the amplicon. Such internal probes have to be designed in close context with the amplification primers, and may require additional considerations for the detection of genetic variations. Here we describe Edesign, a new online and stand-alone tool for designing sets of PCR primers together with an internal probe for conducting quantitative real-time PCR (qPCR) and genotypic experiments. Edesign can be used for selecting standard DNA oligonucleotides like for instance TaqMan probes, but has been further extended with new functions and enhanced design features for Eprobes. Eprobes, with their single thiazole orange-labelled nucleotide, allow for highly sensitive genotypic assays because of their higher DNA binding affinity as compared to standard DNA oligonucleotides. Using new thermodynamic parameters, Edesign considers unique features of Eprobes during primer and probe design for establishing qPCR experiments and genotyping by melting curve analysis. Additional functions in Edesign allow probe design for effective discrimination between wild-type sequences and genetic variations either using standard DNA oligonucleotides or Eprobes. Edesign can be freely accessed online at http://www.dnaform.com/edesign2/, and the source code is available for download. PMID:26863543
Oligonucleotide gap-fill ligation for mutation detection and sequencing in situ
Mignardi, Marco; Mezger, Anja; Qian, Xiaoyan; La Fleur, Linnea; Botling, Johan; Larsson, Chatarina; Nilsson, Mats
2015-01-01
In clinical diagnostics a great need exists for targeted in situ multiplex nucleic acid analysis as the mutational status can offer guidance for effective treatment. One well-established method uses padlock probes for mutation detection and multiplex expression analysis directly in cells and tissues. Here, we use oligonucleotide gap-fill ligation to further increase specificity and to capture molecular substrates for in situ sequencing. Short oligonucleotides are joined at both ends of a padlock gap probe by two ligation events and are then locally amplified by target-primed rolling circle amplification (RCA) preserving spatial information. We demonstrate the specific detection of the A3243G mutation of mitochondrial DNA and we successfully characterize a single nucleotide variant in the ACTB mRNA in cells by in situ sequencing of RCA products generated by padlock gap-fill ligation. To demonstrate the clinical applicability of our assay, we show specific detection of a point mutation in the EGFR gene in fresh frozen and formalin-fixed, paraffin-embedded (FFPE) lung cancer samples and confirm the detected mutation by in situ sequencing. This approach presents several advantages over conventional padlock probes allowing simpler assay design for multiplexed mutation detection to screen for the presence of mutations in clinically relevant mutational hotspots directly in situ. PMID:26240388
Wang, Zheng; Vora, Gary J; Stenger, David A
2004-07-01
Entamoeba histolytica, Giardia lamblia, and Cryptosporidium parvum are the most frequently identified protozoan parasites causing waterborne disease outbreaks. The morbidity and mortality associated with these intestinal parasitic infections warrant the development of rapid and accurate detection and genotyping methods to aid public health efforts aimed at preventing and controlling outbreaks. In this study, we describe the development of an oligonucleotide microarray capable of detecting and discriminating between E. histolytica, Entamoeba dispar, G. lamblia assemblages A and B, and C. parvum types 1 and 2 in a single assay. Unique hybridization patterns for each selected protozoan were generated by amplifying six to eight diagnostic sequences/organism by multiplex PCR; fluorescent labeling of the amplicons via primer extension; and subsequent hybridization to a set of genus-, species-, and subtype-specific covalently immobilized oligonucleotide probes. The profile-based specificity of this methodology not only permitted for the unequivocal identification of the six targeted species and subtypes, but also demonstrated its potential in identifying related species such as Cryptosporidium meleagridis and Cryptosporidium muris. In addition, sensitivity assays demonstrated lower detection limits of five trophozoites of G. lamblia. Taken together, the specificity and sensitivity of the microarray-based approach suggest that this methodology may provide a promising tool to detect and genotype protozoa from clinical and environmental samples.