Sample records for one-dimensional tight-binding model

  1. Schematic baryon models, their tight binding description and their microwave realization

    NASA Astrophysics Data System (ADS)

    Sadurní, E.; Franco-Villafañe, J. A.; Kuhl, U.; Mortessagne, F.; Seligman, T. H.

    2013-12-01

    A schematic model for baryon excitations is presented in terms of a symmetric Dirac gyroscope, a relativistic model solvable in closed form, that reduces to a rotor in the non-relativistic limit. The model is then mapped on a nearest neighbour tight binding model. In its simplest one-dimensional form this model yields a finite equidistant spectrum. This is experimentally implemented as a chain of dielectric resonators under conditions where their coupling is evanescent and a good agreement with the prediction is achieved.

  2. Tight-Binding Study of Polarons in Two-Dimensional Systems: Implications for Organic Field-Effect Transistor Materials

    NASA Astrophysics Data System (ADS)

    Lei, Jie

    2011-03-01

    In order to understand the electronic and transport properties of organic field-effect transistor (FET) materials, we theoretically studied the polarons in two-dimensional systems using a tight-binding model with the Holstein type and Su--Schrieffer--Heeger type electron--lattice couplings. By numerical calculations, it was found that a carrier accepts four kinds of localization, which are named the point polaron, two-dimensional polaron, one-dimensional polaron, and the extended state. The degree of localization is sensitive to the following parameters in the model: the strength and type of electron--lattice couplings, and the signs and relative magnitudes of transfer integrals. When a parameter set for a single-crystal phase of pentacene is applied within the Holstein model, a considerably delocalized hole polaron is found, consistent with the bandlike transport mechanism.

  3. First Experimental Realization of the Dirac Oscillator

    NASA Astrophysics Data System (ADS)

    Franco-Villafañe, J. A.; Sadurní, E.; Barkhofen, S.; Kuhl, U.; Mortessagne, F.; Seligman, T. H.

    2013-10-01

    We present the first experimental microwave realization of the one-dimensional Dirac oscillator, a paradigm in exactly solvable relativistic systems. The experiment relies on a relation of the Dirac oscillator to a corresponding tight-binding system. This tight-binding system is implemented as a microwave system by a chain of coupled dielectric disks, where the coupling is evanescent and can be adjusted appropriately. The resonances of the finite microwave system yield the spectrum of the one-dimensional Dirac oscillator with and without a mass term. The flexibility of the experimental setup allows the implementation of other one-dimensional Dirac-type equations.

  4. Microscopic theory of the superconducting gap in the quasi-one-dimensional organic conductor (TMTSF) 2ClO4 : Model derivation and two-particle self-consistent analysis

    NASA Astrophysics Data System (ADS)

    Aizawa, Hirohito; Kuroki, Kazuhiko

    2018-03-01

    We present a first-principles band calculation for the quasi-one-dimensional (Q1D) organic superconductor (TMTSF) 2ClO4 . An effective tight-binding model with the TMTSF molecule to be regarded as the site is derived from a calculation based on maximally localized Wannier orbitals. We apply a two-particle self-consistent (TPSC) analysis by using a four-site Hubbard model, which is composed of the tight-binding model and an onsite (intramolecular) repulsive interaction, which serves as a variable parameter. We assume that the pairing mechanism is mediated by the spin fluctuation, and the sign of the superconducting gap changes between the inner and outer Fermi surfaces, which correspond to a d -wave gap function in a simplified Q1D model. With the parameters we adopt, the critical temperature for superconductivity estimated by the TPSC approach is approximately 1 K, which is consistent with experiment.

  5. Excitons in boron nitride single layer

    NASA Astrophysics Data System (ADS)

    Galvani, Thomas; Paleari, Fulvio; Miranda, Henrique P. C.; Molina-Sánchez, Alejandro; Wirtz, Ludger; Latil, Sylvain; Amara, Hakim; Ducastelle, François

    2016-09-01

    Boron nitride single layer belongs to the family of two-dimensional materials whose optical properties are currently receiving considerable attention. Strong excitonic effects have already been observed in the bulk and still stronger effects are predicted for single layers. We present here a detailed study of these properties by combining ab initio calculations and a tight-binding Wannier analysis in both real and reciprocal space. Due to the simplicity of the band structure with single valence (π ) and conduction (π*) bands the tight-binding analysis becomes quasiquantitative with only two adjustable parameters and provides tools for a detailed analysis of the exciton properties. Strong deviations from the usual hydrogenic model are evidenced. The ground-state exciton is not a genuine Frenkel exciton, but a very localized tightly bound one. The other ones are similar to those found in transition-metal dichalcogenides and, although more localized, can be described within a Wannier-Mott scheme.

  6. Spin fluctuations and superconductivity in a 3D tight-binding model for BaFe2As2

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Graser, Siegfried; Kemper, Alexander F; Maier, Thomas A

    2010-01-01

    Despite the wealth of experimental data on the Fe-pnictide compounds of the KFe2As2 type, K=Ba, Ca, or Sr, the main theoretical work based on multiorbital tight-binding models has been restricted so far to the study of the related 1111 compounds. This can be ascribed to the more three-dimensional electronic structure found by ab initio calculations for the 122 materials, making this system less amenable to model development. In addition, the more complicated Brillouin zone BZ of the body-centered tetragonal symmetry does not allow a straightforward unfolding of the electronic band structure into an effective 1Fe/unit cell BZ. Here we presentmore » an effective five-orbital tight-binding fit of the full density functional theory band structure for BaFe2As2 including the kz dispersions. We compare the five-orbital spin fluctuation model to one previously studied for LaOFeAs and calculate the random-phase approximation enhanced susceptibility. Using the fluctuation ex- change approximation to determine the leading pairing instability, we then examine the differences between a strictly two-dimensional model calculation over a single kz cut of the BZ and a completely three-dimensional approach. We find pairing states quite similar to the 1111 materials, with generic quasi-isotropic pairing on the hole sheets and nodal states on the electron sheets at kz=0, which however are gapped as the system is hole doped. On the other hand, a substantial kz dependence of the order parameter remains, with most of the pairing strength deriving from processes near kz=?. These states exhibit a tendency for an enhanced anisotropy on the hole sheets and a reduced anisotropy on the electron sheets near the top of the BZ.« less

  7. Tight-binding model of the photosystem II reaction center: application to two-dimensional electronic spectroscopy

    NASA Astrophysics Data System (ADS)

    Gelzinis, Andrius; Valkunas, Leonas; Fuller, Franklin D.; Ogilvie, Jennifer P.; Mukamel, Shaul; Abramavicius, Darius

    2013-07-01

    We propose an optimized tight-binding electron-hole model of the photosystem II (PSII) reaction center (RC). Our model incorporates two charge separation pathways and spatial correlations of both static disorder and fast fluctuations of energy levels. It captures the main experimental features observed in time-resolved two-dimensional (2D) optical spectra at 77 K: peak pattern, lineshapes and time traces. Analysis of 2D spectra kinetics reveals that specific regions of the 2D spectra of the PSII RC are sensitive to the charge transfer states. We find that the energy disorder of two peripheral chlorophylls is four times larger than the other RC pigments.

  8. Analytical solutions of the two-dimensional Dirac equation for a topological channel intersection

    NASA Astrophysics Data System (ADS)

    Anglin, J. R.; Schulz, A.

    2017-01-01

    Numerical simulations in a tight-binding model have shown that an intersection of topologically protected one-dimensional chiral channels can function as a beam splitter for noninteracting fermions on a two-dimensional lattice [Qiao, Jung, and MacDonald, Nano Lett. 11, 3453 (2011), 10.1021/nl201941f; Qiao et al., Phys. Rev. Lett. 112, 206601 (2014), 10.1103/PhysRevLett.112.206601]. Here we confirm this result analytically in the corresponding continuum k .p model, by solving the associated two-dimensional Dirac equation, in the presence of a "checkerboard" potential that provides a right-angled intersection between two zero-line modes. The method by which we obtain our analytical solutions is systematic and potentially generalizable to similar problems involving intersections of one-dimensional systems.

  9. Quantum interference on electron scattering in graphene by carbon impurities in underlying h -BN

    NASA Astrophysics Data System (ADS)

    Kaneko, Tomoaki; Koshino, Mikito; Saito, Riichiro

    2017-03-01

    Electronic structures and transport properties of graphene on h -BN with carbon impurities are investigated by first-principles calculation and the tight-binding model. We show that the coupling between the impurity level and the graphene's Dirac cone sensitively depends on the impurity position, and in particular, it nearly vanishes when the impurity is located right below the center of the six membered ring of graphene. The Bloch phase factor at the Brillouin zone edge plays a decisive role in the cancellation of the hopping integrals. The impurity position dependence on the electronic structures of graphene on h -BN is investigated by the first-principles calculation, and its qualitative feature is well explained by a tight-binding model with graphene and a single impurity site. We also propose a simple one-dimensional chain-impurity model to analytically describe the role of the quantum interference in the position-dependent coupling.

  10. Perfect transmission at oblique incidence by trigonal warping in graphene P-N junctions

    NASA Astrophysics Data System (ADS)

    Zhang, Shu-Hui; Yang, Wen

    2018-01-01

    We develop an analytical mode-matching technique for the tight-binding model to describe electron transport across graphene P-N junctions. This method shares the simplicity of the conventional mode-matching technique for the low-energy continuum model and the accuracy of the tight-binding model over a wide range of energies. It further reveals an interesting phenomenon on a sharp P-N junction: the disappearance of the well-known Klein tunneling (i.e., perfect transmission) at normal incidence and the appearance of perfect transmission at oblique incidence due to trigonal warping at energies beyond the linear Dirac regime. We show that this phenomenon arises from the conservation of a generalized pseudospin in the tight-binding model. We expect this effect to be experimentally observable in graphene and other Dirac fermions systems, such as the surface of three-dimensional topological insulators.

  11. Landau level splitting due to graphene superlattices

    NASA Astrophysics Data System (ADS)

    Pal, G.; Apel, W.; Schweitzer, L.

    2012-06-01

    The Landau level spectrum of graphene superlattices is studied using a tight-binding approach. We consider noninteracting particles moving on a hexagonal lattice with an additional one-dimensional superlattice made up of periodic square potential barriers, which are oriented along the zigzag or along the armchair directions of graphene. In the presence of a perpendicular magnetic field, such systems can be described by a set of one-dimensional tight-binding equations, the Harper equations. The qualitative behavior of the energy spectrum with respect to the strength of the superlattice potential depends on the relation between the superlattice period and the magnetic length. When the potential barriers are oriented along the armchair direction of graphene, we find for strong magnetic fields that the zeroth Landau level of graphene splits into two well-separated sublevels, if the width of the barriers is smaller than the magnetic length. In this situation, which persists even in the presence of disorder, a plateau with zero Hall conductivity can be observed around the Dirac point. This Landau level splitting is a true lattice effect that cannot be obtained from the generally used continuum Dirac-fermion model.

  12. Effect of disorder on the optical properties of short period superlattices

    NASA Technical Reports Server (NTRS)

    Strozier, J. A.; Zhang, Y. A.; Horton, C.; Ignatiev, A.; Shih, H. D.

    1993-01-01

    The optical properties of disordered short period superlattices are studied using a one-dimensional tight-binding model. A difference vector and disorder structure factor are proposed to characterize the disordered superlattice. The density of states, participation number, and optical absorption coefficients for both ordered and disordered superlattices are calculated as a function of energy. The results show that introduction of disorder into an indirect band gap material enhances the optical transition near the indirect band edge.

  13. Green's function calculations for semi-infinite carbon nanotubes

    NASA Astrophysics Data System (ADS)

    John, D. L.; Pulfrey, D. L.

    2006-02-01

    In the modeling of nanoscale electronic devices, the non-equilibrium Green's function technique is gaining increasing popularity. One complication in this method is the need for computation of the self-energy functions that account for the interactions between the active portion of a device and its leads. In the one-dimensional case, these functions may be computed analytically. In higher dimensions, a numerical approach is required. In this work, we generalize earlier methods that were developed for tight-binding Hamiltonians, and present results for the case of a carbon nanotube.

  14. Wavepacket dynamics in one-dimensional system with long-range correlated disorder

    NASA Astrophysics Data System (ADS)

    Yamada, Hiroaki S.

    2018-03-01

    We numerically investigate dynamical property in the one-dimensional tight-binding model with long-range correlated disorder having power spectrum 1 /fα (α: spectrum exponent) generated by Fourier filtering method. For relatively small α <αc (=2) time-dependence of mean square displacement (MSD) of the initially localized wavepacket shows ballistic spread and localizes as time elapses. It is shown that α-dependence of the dynamical localization length determined by the MSD exhibits a simple scaling law in the localization regime for the relatively weak disorder strength W. Furthermore, scaled MSD by the dynamical localization length almost obeys an universal function from the ballistic to the localization regime in the various combinations of the parameters α and W.

  15. Transferable tight-binding model for strained group IV and III-V materials and heterostructures

    NASA Astrophysics Data System (ADS)

    Tan, Yaohua; Povolotskyi, Michael; Kubis, Tillmann; Boykin, Timothy B.; Klimeck, Gerhard

    2016-07-01

    It is critical to capture the effect due to strain and material interface for device level transistor modeling. We introduce a transferable s p3d5s* tight-binding model with nearest-neighbor interactions for arbitrarily strained group IV and III-V materials. The tight-binding model is parametrized with respect to hybrid functional (HSE06) calculations for varieties of strained systems. The tight-binding calculations of ultrasmall superlattices formed by group IV and group III-V materials show good agreement with the corresponding HSE06 calculations. The application of the tight-binding model to superlattices demonstrates that the transferable tight-binding model with nearest-neighbor interactions can be obtained for group IV and III-V materials.

  16. Cross-circularly polarized two-exciton states in one to three dimensions

    NASA Astrophysics Data System (ADS)

    Ajiki, Hiroshi

    2015-03-01

    Biexciton and two-exciton dissociated states of Frenkel-type excitons are studied theoretically using an exciton tight-binding (TB) model including a polarization degree of freedom. Because the biexciton consists of two cross-circularly polarized excitons, an on-site interaction (V) between the two excitons should be considered in addition to a nearest-neighbor two-exciton attractive interaction (δ). Although there are an infinitely large number of combinations of V and δ providing the observed binding energy of a biexciton, the wave function of the biexciton and two-exciton dissociated states is nearly independent of these parameter sets. This means that all the two-exciton states are uniquely determined from the exciton TB model. There are a spatially symmetric and an antisymmetric biexciton state for a one-dimensional (1D) lattice and two symmetric and one antisymmetric biexciton states at most for two- (2D) and three-dimensional (3D) lattices. In contrast, when the polarization degree of freedom is ignored, there is one biexciton state for 1D, 2D, and 3D lattices. For this study, a rapid and memory-saving calculation method for two-exciton states is extended to include the polarization degree of freedom.

  17. Cross-circularly polarized two-exciton states in one to three dimensions.

    PubMed

    Ajiki, Hiroshi

    2015-03-14

    Biexciton and two-exciton dissociated states of Frenkel-type excitons are studied theoretically using an exciton tight-binding (TB) model including a polarization degree of freedom. Because the biexciton consists of two cross-circularly polarized excitons, an on-site interaction (V) between the two excitons should be considered in addition to a nearest-neighbor two-exciton attractive interaction (δ). Although there are an infinitely large number of combinations of V and δ providing the observed binding energy of a biexciton, the wave function of the biexciton and two-exciton dissociated states is nearly independent of these parameter sets. This means that all the two-exciton states are uniquely determined from the exciton TB model. There are a spatially symmetric and an antisymmetric biexciton state for a one-dimensional (1D) lattice and two symmetric and one antisymmetric biexciton states at most for two- (2D) and three-dimensional (3D) lattices. In contrast, when the polarization degree of freedom is ignored, there is one biexciton state for 1D, 2D, and 3D lattices. For this study, a rapid and memory-saving calculation method for two-exciton states is extended to include the polarization degree of freedom.

  18. Mobile spin impurity in an optical lattice

    NASA Astrophysics Data System (ADS)

    Duncan, C. W.; Bellotti, F. F.; Öhberg, P.; Zinner, N. T.; Valiente, M.

    2017-07-01

    We investigate the Fermi polaron problem in a spin-1/2 Fermi gas in an optical lattice for the limit of both strong repulsive contact interactions and one dimension. In this limit, a polaronic-like behaviour is not expected, and the physics is that of a magnon or impurity. While the charge degrees of freedom of the system are frozen, the resulting tight-binding Hamiltonian for the impurity’s spin exhibits an intriguing structure that strongly depends on the filling factor of the lattice potential. This filling dependency also transfers to the nature of the interactions for the case of two magnons and the important spin balanced case. At low filling, and up until near unit filling, the single impurity Hamiltonian faithfully reproduces a single-band, quasi-homogeneous tight-binding problem. As the filling is increased and the second band of the single particle spectrum of the periodic potential is progressively filled, the impurity Hamiltonian, at low energies, describes a single particle trapped in a multi-well potential. Interestingly, once the first two bands are fully filled, the impurity Hamiltonian is a near-perfect realisation of the Su-Schrieffer-Heeger model. Our studies, which go well beyond the single-band approximation, that is, the Hubbard model, pave the way for the realisation of interacting one-dimensional models of condensed matter physics.

  19. Scattering of an electronic wave packet by a one-dimensional electron-phonon-coupled structure

    NASA Astrophysics Data System (ADS)

    Brockt, C.; Jeckelmann, E.

    2017-02-01

    We investigate the scattering of an electron by phonons in a small structure between two one-dimensional tight-binding leads. This model mimics the quantum electron transport through atomic wires or molecular junctions coupled to metallic leads. The electron-phonon-coupled structure is represented by the Holstein model. We observe permanent energy transfer from the electron to the phonon system (dissipation), transient self-trapping of the electron in the electron-phonon-coupled structure (due to polaron formation and multiple reflections at the structure edges), and transmission resonances that depend strongly on the strength of the electron-phonon coupling and the adiabaticity ratio. A recently developed TEBD algorithm, optimized for bosonic degrees of freedom, is used to simulate the quantum dynamics of a wave packet launched against the electron-phonon-coupled structure. Exact results are calculated for a single electron-phonon site using scattering theory and analytical approximations are obtained for limiting cases.

  20. Tight-binding chains with off-diagonal disorder: Bands of extended electronic states induced by minimal quasi-one-dimensionality

    NASA Astrophysics Data System (ADS)

    Nandy, Atanu; Pal, Biplab; Chakrabarti, Arunava

    2016-08-01

    It is shown that an entire class of off-diagonally disordered linear lattices composed of two basic building blocks and described within a tight-binding model can be tailored to generate absolutely continuous energy bands. It can be achieved if linear atomic clusters of an appropriate size are side-coupled to a suitable subset of sites in the backbone, and if the nearest-neighbor hopping integrals, in the backbone and in the side-coupled cluster, bear a certain ratio. We work out the precise relationship between the number of atoms in one of the building blocks in the backbone and that in the side attachment. In addition, we also evaluate the definite correlation between the numerical values of the hopping integrals at different subsections of the chain, that can convert an otherwise point spectrum (or a singular continuous one for deterministically disordered lattices) with exponentially (or power law) localized eigenfunctions to an absolutely continuous spectrum comprising one or more bands (subbands) populated by extended, totally transparent eigenstates. The results, which are analytically exact, put forward a non-trivial variation of the Anderson localization (Anderson P. W., Phys. Rev., 109 (1958) 1492), pointing towards its unusual sensitivity to the numerical values of the system parameters and, go well beyond the other related models such as the Random Dimer Model (RDM) (Dunlap D. H. et al., Phys. Rev. Lett., 65 (1990) 88).

  1. Landau damping of Bogoliubov excitations in two- and three-dimensional optical lattices at finite temperatures

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tsuchiya, Shunji; Department of Physics, Waseda University, 3-4-1 Okubo, Tokyo 169-8555; Griffin, Allan

    2005-11-15

    We study the Landau damping of Bogoliubov excitations in two- and three-dimensional optical lattices at finite temperatures, extending our recent work on one-dimensional (1D) optical lattices. We use a Bose-Hubbard tight-binding model and the Popov approximation to calculate the temperature dependence of the number of condensate atoms n{sup c0}(T) in each lattice well. As with 1D optical lattices, damping only occurs if the Bogoliubov excitations exhibit anomalous dispersion (i.e., the excitation energy bends upward at low momentum), analogous to the case of phonons in superfluid {sup 4}He. This leads to the disappearance of all damping processes in a D-dimensional simplemore » cubic optical lattice when Un{sup c0}{>=}6DJ, where U is the on-site interaction, and J is the hopping matrix element.« less

  2. Maximum group velocity in a one-dimensional model with a sinusoidally varying staggered potential

    NASA Astrophysics Data System (ADS)

    Nag, Tanay; Sen, Diptiman; Dutta, Amit

    2015-06-01

    We use Floquet theory to study the maximum value of the stroboscopic group velocity in a one-dimensional tight-binding model subjected to an on-site staggered potential varying sinusoidally in time. The results obtained by numerically diagonalizing the Floquet operator are analyzed using a variety of analytical schemes. In the low-frequency limit we use adiabatic theory, while in the high-frequency limit the Magnus expansion of the Floquet Hamiltonian turns out to be appropriate. When the magnitude of the staggered potential is much greater or much less than the hopping, we use degenerate Floquet perturbation theory; we find that dynamical localization occurs in the former case when the maximum group velocity vanishes. Finally, starting from an "engineered" initial state where the particles (taken to be hard-core bosons) are localized in one part of the chain, we demonstrate that the existence of a maximum stroboscopic group velocity manifests in a light-cone-like spreading of the particles in real space.

  3. Bipolaron assisted Bloch-like oscillations in organic lattices

    NASA Astrophysics Data System (ADS)

    Ribeiro, Luiz Antonio; Ferreira da Cunha, Wiliam; Magela e Silva, Geraldo

    2017-06-01

    The transport of a dissociated bipolaron in organic one-dimensional lattices is theoretically investigated in the scope of a tight-binding model that includes electron-lattice interactions and an external electric field. Remarkably, the results point to a physical picture in which the dissociated bipolaron propagates as a combined state of two free-like electrons that coherently perform spatial Bloch oscillations (BO) above a critical field strength. It was also obtained that the BO's trajectory presents a net forward motion in the direction of the applied electric field. The impact of dynamical disorder in the formation of electronic BOs is determined.

  4. Dirac fermions and pseudomagnetic fields in two-dimensional electron gases with triangular antidot lattices

    NASA Astrophysics Data System (ADS)

    Li, Yun-Mei; Zhou, Xiaoying; Zhang, Yan-Yang; Zhang, Dong; Chang, Kai

    2017-07-01

    We investigate theoretically the electronic properties of two-dimensional electron gases (2DEGs) with regular and distorted triangular antidot lattices. We show that the triangular antidot lattices embedded in 2DEGs behave like artificial graphene and host Dirac fermions. By introducing the Wannier representation, we obtain a tight-binding Hamiltonian including the second-nearest-neighboring hopping, which agrees well with the numerically exact solutions. Based on the tight-binding model, we find that spatially nonuniform distortions of the antidot lattices strongly modify the electronic structures, generate pseudomagnetic fields and the well-defined Landau levels. In contrast to graphene, we can design the nonuniform distortions to generate various configurations of pseudomagnetic fields. We show that the snake orbital states arise by designing the ±B pseudomagnetic field configuration. We find that the disorders of antidot lattices during fabrication would not affect the basic feature of the Dirac electrons, but they lead to a reduction in conductance in strong disorder cases.

  5. Surface passivation for tight-binding calculations of covalent solids.

    PubMed

    Bernstein, N

    2007-07-04

    Simulation of a cluster representing a finite portion of a larger covalently bonded system requires the passivation of the cluster surface. We compute the effects of an explicit hybrid orbital passivation (EHOP) on the atomic structure in a model bulk, three-dimensional, narrow gap semiconductor, which is very different from the wide gap, quasi-one-dimensional organic molecules where most passivation schemes have been studied in detail. The EHOP approach is directly applicable to minimal atomic orbital basis methods such as tight-binding. Each broken bond is passivated by a hybrid created from an explicitly expressed linear combination of basis orbitals, chosen to represent the contribution of the missing neighbour, e.g. a sp(3) hybrid for a single bond. The method is tested by computing the forces on atoms near a point defect as a function of cluster geometry. We show that, compared to alternatives such as pseudo-hydrogen passivation, the force on an atom converges to the correct bulk limit more quickly as a function of cluster radius, and that the force is more stable with respect to perturbations in the position of the cluster centre. The EHOP method also obviates the need for parameterizing the interactions between the system atoms and the passivating atoms. The method is useful for cluster calculations of non-periodic defects in large systems and for hybrid schemes that simulate large systems by treating finite regions with a quantum-mechanical model, coupled to an interatomic potential description of the rest of the system.

  6. Surface passivation for tight-binding calculations of covalent solids

    NASA Astrophysics Data System (ADS)

    Bernstein, N.

    2007-07-01

    Simulation of a cluster representing a finite portion of a larger covalently bonded system requires the passivation of the cluster surface. We compute the effects of an explicit hybrid orbital passivation (EHOP) on the atomic structure in a model bulk, three-dimensional, narrow gap semiconductor, which is very different from the wide gap, quasi-one-dimensional organic molecules where most passivation schemes have been studied in detail. The EHOP approach is directly applicable to minimal atomic orbital basis methods such as tight-binding. Each broken bond is passivated by a hybrid created from an explicitly expressed linear combination of basis orbitals, chosen to represent the contribution of the missing neighbour, e.g. a sp3 hybrid for a single bond. The method is tested by computing the forces on atoms near a point defect as a function of cluster geometry. We show that, compared to alternatives such as pseudo-hydrogen passivation, the force on an atom converges to the correct bulk limit more quickly as a function of cluster radius, and that the force is more stable with respect to perturbations in the position of the cluster centre. The EHOP method also obviates the need for parameterizing the interactions between the system atoms and the passivating atoms. The method is useful for cluster calculations of non-periodic defects in large systems and for hybrid schemes that simulate large systems by treating finite regions with a quantum-mechanical model, coupled to an interatomic potential description of the rest of the system.

  7. Pairing phase diagram of three holes in the generalized Hubbard model

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Navarro, O.; Espinosa, J.E.

    Investigations of high-{Tc} superconductors suggest that the electronic correlation may play a significant role in the formation of pairs. Although the main interest is on the physic of two-dimensional highly correlated electron systems, the one-dimensional models related to high temperature superconductivity are very popular due to the conjecture that properties of the 1D and 2D variants of certain models have common aspects. Within the models for correlated electron systems, that attempt to capture the essential physics of high-temperature superconductors and parent compounds, the Hubbard model is one of the simplest. Here, the pairing problem of a three electrons system hasmore » been studied by using a real-space method and the generalized Hubbard Hamiltonian. This method includes the correlated hopping interactions as an extension of the previously proposed mapping method, and is based on mapping the correlated many body problem onto an equivalent site- and bond-impurity tight-binding one in a higher dimensional space, where the problem was solved in a non-perturbative way. In a linear chain, the authors analyzed the pairing phase diagram of three correlated holes for different values of the Hamiltonian parameters. For some value of the hopping parameters they obtain an analytical solution for all kind of interactions.« less

  8. Dirac topological insulator in the dz2 manifold of a honeycomb oxide

    NASA Astrophysics Data System (ADS)

    Lado, J. L.; Pardo, V.

    2016-09-01

    We show by means of ab initio calculations and tight-binding modeling that an oxide system based on a honeycomb lattice can sustain topologically nontrivial states if a single orbital dominates the spectrum close to the Fermi level. In such a situation, the low-energy spectrum is described by two Dirac equations that become nontrivially gapped when spin-orbit coupling (SOC) is switched on. We provide one specific example but the recipe is general. We discuss a realization of this starting from a conventional spin-1/2 honeycomb antiferromagnet whose states close to the Fermi energy are dz2 orbitals. Switching off magnetism by atomic substitution and ensuring that the electronic structure becomes two-dimensional is sufficient for topologicality to arise in such a system. By deriving a tight-binding Wannier Hamiltonian, we find that the gap in such a model scales linearly with SOC, opposed to other oxide-based topological insulators, where smaller gaps tend to appear by construction of the lattice. We show that the quantum spin Hall state in this system survives in the presence of off-plane magnetism and the orbital magnetic field and we discuss its Landau level spectra, showing that our recipe provides a dz2 realization of the Kane-Mele model.

  9. Localization and mobility edges in one-dimensional deterministic potentials

    NASA Astrophysics Data System (ADS)

    Tong, Peiqing

    1994-10-01

    In this paper, we study the localization properties of the wave function of a one-dimensional tight-binding electron moving in an asymptotic periodic potential, Vn=λ cos(2πQn+παnν), where n is the site index and 0<ν<1. For Q rational, the electronic energy band consists of many subbands, and the number of subbands is determined by Q. For λ<2, there are two mobility edges where the eigenstates at the subband center are all extended, whereas the subband-edge states are all localized in every subband. We develop some heuristic arguments to calculate exactly the mobility edges for this model and carry out numerical work to study the localization properties of the model. Our theoretical results are essentially in exact agreement with the numerical results. We calculate the critical exponents δ and β at mobility edges. We also study the nature of the localized, extended eigenstates and mobility edges of this system as a function of λ, α, and ν.

  10. X-ray Raman scattering from molecules and solids in the framework of the Mahan-Nozières-De Dominicis model

    NASA Astrophysics Data System (ADS)

    Privalov, Timofei; Gel'mukhanov, Faris; Ågren, Hans

    2001-10-01

    We have developed a formulation of resonant x-ray Raman scattering of molecules and solids based on the Mahan-Nozières-De Dominicis model. A key step in the formulation is given by a reduction of the Keldysh-Dyson equations for the Green's function to a set of linear algebraic equations. This gave way for a tractable scheme that can be used to analyze the resonant x-ray scattering in the whole time domain. The formalism is used to investigate the role of core-hole relaxation, interference, band filling, detuning, and size of the scattering target. Numerical applications are performed with a one-dimensional tight-binding model.

  11. Modeling direct interband tunneling. II. Lower-dimensional structures

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pan, Andrew, E-mail: pandrew@ucla.edu; Chui, Chi On; California NanoSystems Institute, University of California, Los Angeles, Los Angeles, California 90095

    We investigate the applicability of the two-band Hamiltonian and the widely used Kane analytical formula to interband tunneling along unconfined directions in nanostructures. Through comparisons with k·p and tight-binding calculations and quantum transport simulations, we find that the primary correction is the change in effective band gap. For both constant fields and realistic tunnel field-effect transistors, dimensionally consistent band gap scaling of the Kane formula allows analytical and numerical device simulations to approximate non-equilibrium Green's function current characteristics without arbitrary fitting. This allows efficient first-order calibration of semiclassical models for interband tunneling in nanodevices.

  12. Investigation of the effect of scattering centers on low dimensional nanowire channel

    NASA Astrophysics Data System (ADS)

    Cariappa, K. S.; Shukla, Raja; Sarkar, Niladri

    2018-05-01

    In this work, we studied the effect of scattering centers on the electron density profiles of a one dimensional Nanowire channel. Density Matrix Formalism is used for calculating the local electron densities at room temperature. Various scattering centers have been simulated in the channel. The nearest neighbor tight binding method is applied to construct the Hamiltonian of nanoscale devices. We invoke scattering centers by adding local scattering potentials to the Hamiltonian. This analysis could give an insight into the understanding and utilization of defects for device engineering.

  13. Topological states in a two-dimensional metal alloy in Si surface: BiAg/Si(111)-4 ×4 surface

    NASA Astrophysics Data System (ADS)

    Zhang, Xiaoming; Cui, Bin; Zhao, Mingwen; Liu, Feng

    2018-02-01

    A bridging topological state with a conventional semiconductor platform offers an attractive route towards future spintronics and quantum device applications. Here, based on first-principles and tight-binding calculations, we demonstrate the existence of topological states hosted by a two-dimensional (2D) metal alloy in a Si surface, the BiAg/Si(111)-4 ×4 surface, which has already been synthesized experimentally. It exhibits a topological insulating state with an energy gap of 71 meV (˜819 K ) above the Fermi level and a topological metallic state with quasiquantized conductance below the Fermi level. The underlying mechanism leading to the formation of such nontrivial states is revealed by analysis of the "charge-transfer" and "orbital-filtering" effect of the Si substrate. A minimal effective tight-binding model is employed to reveal the formation mechanism of the topological states. Our finding opens opportunities to detect topological states and measure its quantized conductance in a large family of 2D surface metal alloys, which have been or are to be grown on semiconductor substrates.

  14. Density-functional tight-binding investigation of the structure, stability and material properties of nickel hydroxide nanotubes

    NASA Astrophysics Data System (ADS)

    Jahangiri, Soran; Mosey, Nicholas J.

    2018-01-01

    Nickel hydroxide is a material composed of two-dimensional layers that can be rolled up to form cylindrical nanotubes belonging to a class of inorganic metal hydroxide nanotubes that are candidates for applications in catalysis, energy storage, and microelectronics. The stabilities and other properties of this class of inorganic nanotubes have not yet been investigated in detail. The present study uses self-consistent-charge density-functional tight-binding calculations to examine the stabilities, mechanical properties, and electronic properties of nickel hydroxide nanotubes along with the energetics associated with the adsorption of water by these systems. The tight-binding model was parametrized for this system based on the results of first-principles calculations. The stabilities of the nanotubes were examined by calculating strain energies and performing molecular dynamics simulations. The results indicate that single-walled nickel hydroxide nanotubes are stable at room temperature, which is consistent with experimental investigations. The nanotubes possess size-dependent mechanical properties that are similar in magnitude to those of other inorganic nanotubes. The electronic properties of the nanotubes were also found to be size-dependent and small nickel oxyhydroxide nanotubes are predicted to be semiconductors. Despite this size-dependence, both the mechanical and electronic properties were found to be almost independent of the helical structure of the nanotubes. The calculations also show that water molecules have higher adsorption energies when binding to the interior of the nickel hydroxide nanotubes when compared to adsorption in nanotubes formed from other two-dimensional materials such as graphene. The increased adsorption energy is due to the hydrophilic nature of nickel hydroxide. Due to the broad applications of nickel hydroxide, the nanotubes investigated here are also expected to be used in catalysis, electronics, and clean energy production.

  15. Electronic properties of one-dimensional nanostructures of the Bi2Se3 topological insulator

    NASA Astrophysics Data System (ADS)

    Virk, Naunidh; Autès, Gabriel; Yazyev, Oleg V.

    2018-04-01

    We theoretically study the electronic structure and spin properties of one-dimensional nanostructures of the prototypical bulk topological insulator Bi2Se3 . Realistic models of experimentally observed Bi2Se3 nanowires and nanoribbons are considered using the tight-binding method. At low energies, the band structures are composed of a series of evenly spaced degenerate subbands resulting from circumferential confinement of the topological surface states. The direct band gaps due to the nontrivial π Berry phase show a clear dependence on the circumference. The spin-momentum locking of the topological surface states results in a pronounced 2 π spin rotation around the circumference with the degree of spin polarization dependent on the momentum along the nanostructure. Overall, the band structures and spin textures are more complicated for nanoribbons, which expose two distinct facets. The effects of reduced dimensionality are rationalized with the help of a simple model that considers circumferential quantization of the topological surface states. Furthermore, the surface spin density induced by an electric current along the nanostructure shows a pronounced oscillatory dependence on the charge-carrier energy, which can be exploited in spintronics applications.

  16. Edge currents in frustrated Josephson junction ladders

    NASA Astrophysics Data System (ADS)

    Marques, A. M.; Santos, F. D. R.; Dias, R. G.

    2016-09-01

    We present a numerical study of quasi-1D frustrated Josephson junction ladders with diagonal couplings and open boundary conditions, in the large capacitance limit. We derive a correspondence between the energy of this Josephson junction ladder and the expectation value of the Hamiltonian of an analogous tight-binding model, and show how the overall superconducting state of the chain is equivalent to the minimum energy state of the tight-binding model in the subspace of one-particle states with uniform density. To satisfy the constraint of uniform density, the superconducting state of the ladder is written as a linear combination of the allowed k-states of the tight-binding model with open boundaries. Above a critical value of the parameter t (ratio between the intra-rung and inter-rung Josephson couplings) the ladder spontaneously develops currents at the edges, which spread to the bulk as t is increased until complete coverage is reached. Above a certain value of t, which varies with ladder size (t = 1 for an infinite-sized ladder), the edge currents are destroyed. The value t = 1 corresponds, in the tight-binding model, to the opening of a gap between two bands. We argue that the disappearance of the edge currents with this gap opening is not coincidental, and that this points to a topological origin for these edge current states.

  17. Tight-binding model for materials at mesoscale

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tai, Yuan-Yen; Choi, Hongchul; Zhu, Wei

    2016-12-21

    TBM3 is an open source package for computational simulations of quantum materials at multiple scales in length and time. The project originated to investigate the multiferroic behavior in transition-metal oxide heterostructures. The framework has also been designed to study emergent phemona in other quantum materials like 2-dimensional transition-metal dichalcogenides, graphene, topological insulators, and skyrmion in materials, etc. In the long term, we will enable the package for transport and time-resolved phenomena. TBM3 is currently a C++ based numerical tool package and framework for the design and construction of any kind of lattice structures with multi-orbital and spin degrees of freedom.more » The fortran based portion of the package will be added in the near future. The design of TBM3 is in a highly flexible and reusable framework and the tight-binding parameters can be modeled or informed by DFT calculations. It is currently GPU enabled and feature of CPU enabled MPI will be added in the future.« less

  18. Quasiclassical analysis of Bloch oscillations in non-Hermitian tight-binding lattices

    NASA Astrophysics Data System (ADS)

    Graefe, E. M.; Korsch, H. J.; Rush, A.

    2016-07-01

    Many features of Bloch oscillations in one-dimensional quantum lattices with a static force can be described by quasiclassical considerations for example by means of the acceleration theorem, at least for Hermitian systems. Here the quasiclassical approach is extended to non-Hermitian lattices, which are of increasing interest. The analysis is based on a generalised non-Hermitian phase space dynamics developed recently. Applications to a single-band tight-binding system demonstrate that many features of the quantum dynamics can be understood from this classical description qualitatively and even quantitatively. Two non-Hermitian and PT-symmetric examples are studied, a Hatano-Nelson lattice with real coupling constants and a system with purely imaginary couplings, both for initially localised states in space or in momentum. It is shown that the time-evolution of the norm of the wave packet and the expectation values of position and momentum can be described in a classical picture.

  19. ProbeZT: Simulation of transport coefficients of molecular electronic junctions under environmental effects using Büttiker's probes

    NASA Astrophysics Data System (ADS)

    Korol, Roman; Kilgour, Michael; Segal, Dvira

    2018-03-01

    We present our in-house quantum transport package, ProbeZT. This program provides linear response coefficients: electrical and electronic thermal conductances, as well as the thermopower of molecular junctions in which electrons interact with the surrounding thermal environment. Calculations are performed based on the Büttiker probe method, which introduces decoherence, energy exchange and dissipation effects phenomenologically using virtual electrode terminals called probes. The program can realize different types of probes, each introducing various environmental effects, including elastic and inelastic scattering of electrons. The molecular system is described by an arbitrary tight-binding Hamiltonian, allowing the study of different geometries beyond simple one-dimensional wires. Applications of the program to study the thermoelectric performance of molecular junctions are illustrated. The program also has a built-in functionality to simulate electron transport in double-stranded DNA molecules based on a tight-binding (ladder) description of the junction.

  20. Playing relativistic billiards beyond graphene

    NASA Astrophysics Data System (ADS)

    Sadurní, E.; Seligman, T. H.; Mortessagne, F.

    2010-05-01

    The possibility of using hexagonal structures in general, and graphene in particular, to emulate the Dirac equation is the topic under consideration here. We show that Dirac oscillators with or without rest mass can be emulated by distorting a tight-binding model on a hexagonal structure. In the quest to make a toy model for such relativistic equations, we first show that a hexagonal lattice of attractive potential wells would be a good candidate. Firstly, we consider the corresponding one-dimensional (1D) model giving rise to a 1D Dirac oscillator and then construct explicitly the deformations needed in the 2D case. Finally, we discuss how such a model can be implemented as an electromagnetic billiard using arrays of dielectric resonators between two conducting plates that ensure evanescent modes outside the resonators for transversal electric modes, and we describe a feasible experimental setup.

  1. Quasi one-dimensional band dispersion and surface metallization in long-range ordered polymeric wires

    DOE PAGES

    Vasseur, Guillaume; Fagot-Revurat, Yannick; Sicot, Muriel; ...

    2016-01-04

    We study the electronic structure of an ordered array of poly(para-phenylene) chains produced by surface-catalyzed dehalogenative polymerization of 1,4-dibromobenzene on copper (110). The quantization of unoccupied molecular states is measured as a function of oligomer length by scanning tunnelling spectroscopy, with Fermi level crossings observed for chains longer than ten phenyl rings. Angle-resolved photoelectron spectroscopy reveals a quasi-one-dimensional valence band as well as a direct gap of 1.15 eV, as the conduction band is partially filled through adsorption on the surface. Tight-binding modelling and ab initio density functional theory calculations lead to a full description of the organic band-structure, includingmore » the k-dispersion, the gap size and electron charge transfer mechanisms, highlighting a strong substrate-molecule interaction that drives the system into a metallic behaviour. In summary, we have fully characterized the band structure of a carbon-based conducting wire. This model system may be considered as a fingerprint of -conjugation of surface organic frameworks.« less

  2. A Model for Predicting Thermoelectric Properties of Bi2Te3

    NASA Technical Reports Server (NTRS)

    Lee, Seungwon; VonAllmen, Paul

    2009-01-01

    A parameterized orthogonal tight-binding mathematical model of the quantum electronic structure of the bismuth telluride molecule has been devised for use in conjunction with a semiclassical transport model in predicting the thermoelectric properties of doped bismuth telluride. This model is expected to be useful in designing and analyzing Bi2Te3 thermoelectric devices, including ones that contain such nano - structures as quantum wells and wires. In addition, the understanding gained in the use of this model can be expected to lead to the development of better models that could be useful for developing other thermoelectric materials and devices having enhanced thermoelectric properties. Bi2Te3 is one of the best bulk thermoelectric materials and is widely used in commercial thermoelectric devices. Most prior theoretical studies of the thermoelectric properties of Bi2Te3 have involved either continuum models or ab-initio models. Continuum models are computationally very efficient, but do not account for atomic-level effects. Ab-initio models are atomistic by definition, but do not scale well in that computation times increase excessively with increasing numbers of atoms. The present tight-binding model bridges the gap between the well-scalable but non-atomistic continuum models and the atomistic but poorly scalable ab-initio models: The present tight-binding model is atomistic, yet also computationally efficient because of the reduced (relative to an ab-initio model) number of basis orbitals and flexible parameterization of the Hamiltonian.

  3. Generalized Kubo formulas for the transport properties of incommensurate 2D atomic heterostructures

    NASA Astrophysics Data System (ADS)

    Cancès, Eric; Cazeaux, Paul; Luskin, Mitchell

    2017-06-01

    We give an exact formulation for the transport coefficients of incommensurate two-dimensional atomic multilayer systems in the tight-binding approximation. This formulation is based upon the C* algebra framework introduced by Bellissard and collaborators [Coherent and Dissipative Transport in Aperiodic Solids, Lecture Notes in Physics (Springer, 2003), Vol. 597, pp. 413-486 and J. Math. Phys. 35(10), 5373-5451 (1994)] to study aperiodic solids (disordered crystals, quasicrystals, and amorphous materials), notably in the presence of magnetic fields (quantum Hall effect). We also present numerical approximations and test our methods on a one-dimensional incommensurate bilayer system.

  4. First-principles simulation and low-energy effective modeling of three-dimensional skyrmion in MnGe

    NASA Astrophysics Data System (ADS)

    Choi, Hongchul; Tai, Yuan-Yen; Zhu, Jian-Xin; T-4 Team

    The skyrmion spin textures are mostly observed in two-dimensional (2D) space, which can be topologically mapped onto the surface of the sphere with an integer multiple of topological winding number. Recently, MnGe has been reported as a candidate of 3D skyrmion crystal, showing the variation of the skyrmion size along the z-direction. We have performed the first-principles simulation and constructed a tight-binding model with calculated electronic-structure information to investigate the 3D skyrmion phase in MnGe. Our first-principles study within density functional theory shows that the calculated magnetic moment is larger than that for MnSi (with different lattice constant), implying the possibility of a multiple magnetic transition under pressure. We have also found that the small-sized skyrmion could be stabilized in a 2D structure. Such a high density of the skyrmion is in good agreement with the experimental finding of large topological Hall effect. Finally, we will extend our study to consider the 3D skyrmion structure based on the constructed tight-binding model. This work was carried out under the auspices of the National Nuclear Security Administration of the U.S. Department of Energy at Los Alamos National Laboratory (LANL) under Contract No. DE-AC52-06NA25396, and was supported by the LANL LDRD Program.

  5. Dielectric response of molecules in empirical tight-binding theory

    NASA Astrophysics Data System (ADS)

    Boykin, Timothy B.; Vogl, P.

    2002-01-01

    In this paper we generalize our previous approach to electromagnetic interactions within empirical tight-binding theory to encompass molecular solids and isolated molecules. In order to guarantee physically meaningful results, we rederive the expressions for relevant observables using commutation relations appropriate to the finite tight-binding Hilbert space. In carrying out this generalization, we examine in detail the consequences of various prescriptions for the position and momentum operators in tight binding. We show that attempting to fit parameters of the momentum matrix directly generally results in a momentum operator which is incompatible with the underlying tight-binding model, while adding extra position parameters results in numerous difficulties, including the loss of gauge invariance. We have applied our scheme, which we term the Peierls-coupling tight-binding method, to the optical dielectric function of the molecular solid PPP, showing that this approach successfully predicts its known optical properties even in the limit of isolated molecules.

  6. Tight-binding modeling and low-energy behavior of the semi-Dirac point.

    PubMed

    Banerjee, S; Singh, R R P; Pardo, V; Pickett, W E

    2009-07-03

    We develop a tight-binding model description of semi-Dirac electronic spectra, with highly anisotropic dispersion around point Fermi surfaces, recently discovered in electronic structure calculations of VO2-TiO2 nanoheterostructures. We contrast their spectral properties with the well-known Dirac points on the honeycomb lattice relevant to graphene layers and the spectra of bands touching each other in zero-gap semiconductors. We also consider the lowest order dispersion around one of the semi-Dirac points and calculate the resulting electronic energy levels in an external magnetic field. In spite of apparently similar electronic structures, Dirac and semi-Dirac systems support diverse low-energy physics.

  7. Pseudo-magnetic fields of strongly-curved graphene nanobubbles

    NASA Astrophysics Data System (ADS)

    Liu, Li-Chi

    2018-04-01

    We use the π-orbital axis vector (POAV) analysis to deal with large curvature effect of graphene in the tight-binding model. To test the validities of pseudo-magnetic fields (PMFs) derived from the tight-binding model and the model with Dirac equation coupled to a curved surface, we propose two types of spatially constant-field topographies for strongly-curved graphene nanobubbles, which correspond to these two models, respectively. It is shown from the latter model that the PMF induced by any spherical graphene nanobubble is always equivalent to the magnetic field caused by one magnetic monopole charge distributed on a complete spherical surface with the same radius. Such a PMF might be attributed to the isometry breaking of a graphene layer attached conformably to a spherical substrate with adhesion.

  8. Coherent wave transmission in quasi-one-dimensional systems with Lévy disorder

    NASA Astrophysics Data System (ADS)

    Amanatidis, Ilias; Kleftogiannis, Ioannis; Falceto, Fernando; Gopar, Víctor A.

    2017-12-01

    We study the random fluctuations of the transmission in disordered quasi-one-dimensional systems such as disordered waveguides and/or quantum wires whose random configurations of disorder are characterized by density distributions with a long tail known as Lévy distributions. The presence of Lévy disorder leads to large fluctuations of the transmission and anomalous localization, in relation to the standard exponential localization (Anderson localization). We calculate the complete distribution of the transmission fluctuations for a different number of transmission channels in the presence and absence of time-reversal symmetry. Significant differences in the transmission statistics between disordered systems with Anderson and anomalous localizations are revealed. The theoretical predictions are independently confirmed by tight-binding numerical simulations.

  9. Theory of a peristaltic pump for fermionic quantum fluids

    NASA Astrophysics Data System (ADS)

    Romeo, F.; Citro, R.

    2018-05-01

    Motivated by the recent developments in fermionic cold atoms and in nanostructured systems, we propose the model of a peristaltic quantum pump. Differently from the Thouless paradigm, a peristaltic pump is a quantum device that generates a particle flux as the effect of a sliding finite-size microlattice. A one-dimensional tight-binding Hamiltonian model of this quantum machine is formulated and analyzed within a lattice Green's function formalism on the Keldysh contour. The pump observables, as, e.g., the pumped particles per cycle, are studied as a function of the pumping frequency, the width of the pumping potential, the particles mean free path, and system temperature. The proposed analysis applies to arbitrary peristaltic potentials acting on fermionic quantum fluids confined to one dimension. These confinement conditions can be realized in nanostructured systems or, in a more controllable way, in cold atoms experiments. In view of the validation of the theoretical results, we describe the outcomes of the model considering a fermionic cold atoms system as a paradigmatic example.

  10. Dynamical Reduction of the Dimensionality of Exchange Interactions and the "Spin-Liquid" Phase of κ-(BEDT-TTF)_{2}X.

    PubMed

    Powell, B J; Kenny, E P; Merino, J

    2017-08-25

    We show that the anisotropy of the effective spin model for the dimer Mott insulator phase of κ-(BEDT-TTF)_{2}X salts is dramatically different from that of the underlying tight-binding model. Intradimer quantum interference results in a model of coupled spin chains, where frustrated interchain interactions suppress long-range magnetic order. Thus, we argue, the "spin liquid" phase observed in some of these materials is a remnant of the Tomonaga-Luttinger physics of a single chain. This is consistent with previous experiments and resolves some outstanding puzzles.

  11. Landau quantization in monolayer GaAs

    NASA Astrophysics Data System (ADS)

    Chung, Hsien-Ching; Ho, Ching-Hong; Chang, Cheng-Peng; Chen, Chun-Nan; Chiu, Chih-Wei; Lin, Ming-Fa

    In the past decade, the discovery of graphene has opened the possibility of two-dimensional materials both in fundamental researches and technological applications. However, the gapless feature shrinks the applications of pristine graphene. Recently, researchers have new challenges and opportunities for post-graphene two-dimensional nanomaterials, such as silicene (Si), germanene (Ge), and tinene (Sn), due to the large enough energy gap (of the size comparable to the thermal energy at room temperature). Apart from the graphene analogs of group IV elements, the buckled honeycomb lattices of the binary compositions of group III-V elements have been proposed as a new class of post-graphene two-dimensional nanomaterials. In this study, the generalized tight-binding model considering the spin-orbital coupling is used to investigate the essential properties of monolayer GaAs. The Landau quantization, band structure, wave function, and density of states are discussed in detail. One of us (Hsien-Ching Chung) thanks Ming-Hui Chung and Su-Ming Chen for financial support. This work was supported in part by the Ministry of Science and Technology of Taiwan under Grant Number MOST 105-2811-M-017-003.

  12. Superresolution imaging of transcription units on newt lampbrush chromosomes

    PubMed Central

    Kaufmann, Rainer; Cremer, Christoph; Gall, Joseph G.

    2013-01-01

    We have examined transcription loops on lampbrush chromosomes of the newt Notophthalmus by superresolution microscopy. Because of the favorable, essentially two-dimensional morphology of these loops, an average optical resolution in the x-y plane of about 50 nm was achieved. We analyzed the distribution of the multifunctional RNA-binding protein CELF1 on specific loops. CELF1 distribution is consistent with a model in which individual transcripts are tightly folded and hence closely packed against the loop axis. PMID:22892678

  13. Non-Hermitian bidirectional robust transport

    NASA Astrophysics Data System (ADS)

    Longhi, Stefano

    2017-01-01

    Transport of quantum or classical waves in open systems is known to be strongly affected by non-Hermitian terms that arise from an effective description of system-environment interaction. A simple and paradigmatic example of non-Hermitian transport, originally introduced by Hatano and Nelson two decades ago [N. Hatano and D. R. Nelson, Phys. Rev. Lett. 77, 570 (1996), 10.1103/PhysRevLett.77.570], is the hopping dynamics of a quantum particle on a one-dimensional tight-binding lattice in the presence of an imaginary vectorial potential. The imaginary gauge field can prevent Anderson localization via non-Hermitian delocalization, opening up a mobility region and realizing robust transport immune to disorder and backscattering. Like for robust transport of topologically protected edge states in quantum Hall and topological insulator systems, non-Hermitian robust transport in the Hatano-Nelson model is unidirectional. However, there is not any physical impediment to observe robust bidirectional non-Hermitian transport. Here it is shown that in a quasi-one-dimensional zigzag lattice, with non-Hermitian (imaginary) hopping amplitudes and a synthetic gauge field, robust transport immune to backscattering can occur bidirectionally along the lattice.

  14. Perspectives from ab-initio and tight-binding: Applications to transition metal compounds and superlattices

    NASA Astrophysics Data System (ADS)

    Venkataraman, Vijay Shankar

    The experimental and theoretical study of transition metal compounds have occupied condensed matter physicists for the best part of the last century. The rich variety of physical behaviour exhibited by these compounds owes its origin to the subtle balance of the energy scales at play for the d orbitals. In this thesis, we study three different systems comprised of transition metal atoms from the third, the fourth, and the fifth group of the periodic table using a combination of ab-initio density functional theory (DFT) computations and effective tight-binding models for the electronic properties. We first consider the electronic properties of artificially fabricated perovskite superlattices of the form [(SrIrO3)m / SrTiO3] with integer m denoting the number of layers of SrIrO3. After discussing the results of experiments undertaken by our collaborators, we present the results of our DFT calculations and build tight-binding models for the m = 1 and m = 2 superlattices. The active ingredient is found to be the 5d orbitals with significant spin-orbit coupling. We then study the energies of magnetic ground states within DFT and compare and contrast our results with those obtained for the bulk Ruddlesden-Popper iridates. Together with experimental measurements, our results suggest that these superlattices are an exciting venue to probe the magnetism and metal-insulator transitions that occur from the intricate balance of the spin-orbit coupling and electron interactions, as has been reported for their bulk counterparts. Next, we consider alpha-RuCl3, a honeycomb lattice compound. We first show using DFT calculations in conjunction with experiments performed by our collaborators, how spin-orbit coupling in the 4d orbitals of Ru is essential to understand the insulating state realized in this compound. Then, in the latter half of the chapter, we study the magnetic ground states of a two-dimensional analogue of alpha-RuCl3 in weak and strong-coupling regimes obtained from a tight-binding model for the 4d orbitals. We further compare these results with energies obtained from DFT calculations. We obtain a zig-zag magnetic ground state for this compound, in all the three approaches. Within DFT, we find that correlations enhance the spin-orbit coupling in this compound and that the anisotropic Kitaev interactions between the spins are dominant in a strong-coupling model. Then, we move on to study the electronic band structures of the higher manganese silicides, which are good thermoelectric materials. Using results from DFT calculations on Mn4Si7 and structural arguments, we construct an effective tight-binding model for the first three members of this series - Mn4Si7, Mn11Si19, and Mn15Si26.

  15. Bak Conformational Changes Induced by Ligand Binding: Insight into BH3 Domain Binding and Bak Homo-Oligomerization

    PubMed Central

    Pang, Yuan-Ping; Dai, Haiming; Smith, Alyson; Meng, X. Wei; Schneider, Paula A.; Kaufmann, Scott H.

    2012-01-01

    Recently we reported that the BH3-only proteins Bim and Noxa bind tightly but transiently to the BH3-binding groove of Bak to initiate Bak homo-oligomerization. However, it is unclear how such tight binding can induce Bak homo-oligomerization. Here we report the ligand-induced Bak conformational changes observed in 3D models of Noxa·Bak and Bim·Bak refined by molecular dynamics simulations. In particular, upon binding to the BH3-binding groove, Bim and Noxa induce a large conformational change of the loop between helices 1 and 2 and in turn partially expose a remote groove between helices 1 and 6 in Bak. These observations, coupled with the reported experimental data, suggest formation of a pore-forming Bak octamer, in which the BH3-binding groove is at the interface on one side of each monomer and the groove between helices 1 and 6 is at the interface on the opposite side, initiated by ligand binding to the BH3-binding groove. PMID:22355769

  16. Bloch oscillations as generators of polarons in a 1D crystal

    NASA Astrophysics Data System (ADS)

    Nazareno, H. N.; Brito, P. E. de

    2016-08-01

    The main purpose of this work is to characterize the kind of propagation/localization of carriers in a one-dimensional crystalline structure along the tight-binding model while the electron-phonon interaction is taken into account through a deformation potential and the system is under the action of a dc electric field. The lattice was treated in the classical formalism of harmonic vibrations. A remarkable effect is obtained due to the presence of the electric field. On one side the particle performs Bloch oscillations and at the same time it interacts with the lattice and as a result at each turning point of its trajectory phonons are generated that carry with them a fraction of the electronic wave packet, it is the polaron formation. This way the Bloch oscillations pump polarons into the system. We explain why the polaron is formed at returning points of the oscillations.

  17. Electrical control of spin dynamics in finite one-dimensional systems

    NASA Astrophysics Data System (ADS)

    Pertsova, A.; Stamenova, M.; Sanvito, S.

    2011-10-01

    We investigate the possibility of the electrical control of spin transfer in monoatomic chains incorporating spin impurities. Our theoretical framework is the mixed quantum-classical (Ehrenfest) description of the spin dynamics, in the spirit of the s-d model, where the itinerant electrons are described by a tight-binding model while localized spins are treated classically. Our main focus is on the dynamical exchange interaction between two well-separated spins. This can be quantified by the transfer of excitations in the form of transverse spin oscillations. We systematically study the effect of an electrostatic gate bias Vg on the interconnecting channel and we map out the long-range dynamical spin transfer as a function of Vg. We identify regions of Vg giving rise to significant amplification of the spin transmission at low frequencies and relate this to the electronic structure of the channel.

  18. Multiple period s-p hybridization in nano-strip embedded photonic crystal.

    PubMed

    Han, Seunghoon; Lee, Il-Min; Kim, Hwi; Lee, Byoungho

    2005-04-04

    We report and analyze hybridization of s-state and p-state modes in photonic crystal one-dimensional defect cavity array. When embedding a nano-strip into a dielectric rod photonic crystal, an effective cavity array is made, where each cavity possesses two cavity modes: s-state and p-state. The two modes are laterally even versus the nano-strip direction, and interact with each other, producing defect bands, of which the group velocity becomes zero within the first Brillouin zone. We could model and describe the phenomena by using the tight-binding method, well agreeing with the plane-wave expansion method analysis. We note that the reported s- and p-state mode interaction corresponds to the hybridization of atomic orbital in solid-state physics. The concept of multiple period s-p hybridization and the proposed model can be useful for analyzing and developing novel photonic crystal waveguides and devices.

  19. Exploring excited eigenstates of many-body systems using the functional renormalization group

    NASA Astrophysics Data System (ADS)

    Klöckner, Christian; Kennes, Dante Marvin; Karrasch, Christoph

    2018-05-01

    We introduce approximate, functional renormalization group based schemes to obtain correlation functions in pure excited eigenstates of large fermionic many-body systems at arbitrary energies. The algorithms are thoroughly benchmarked and their strengths and shortcomings are documented using a one-dimensional interacting tight-binding chain as a prototypical testbed. We study two "toy applications" from the world of Luttinger liquid physics: the survival of power laws in lowly excited states as well as the spectral function of high-energy "block" excitations, which feature several single-particle Fermi edges.

  20. Regulation of tight junction assembly and epithelial morphogenesis by the heat shock protein Apg-2

    PubMed Central

    Aijaz, Saima; Sanchez-Heras, Elena; Balda, Maria S; Matter, Karl

    2007-01-01

    Background Tight junctions are required for epithelial barrier formation and participate in the regulation of signalling mechanisms that control proliferation and differentiation. ZO-1 is a tight junction-associated adaptor protein that regulates gene expression, junction assembly and epithelial morphogenesis. We have previously demonstrated that the heat shock protein Apg-2 binds ZO-1 and thereby regulates its role in cell proliferation. Here, we addressed the question whether Apg-2 is also important for junction formation and epithelial morphogenesis. Results We demonstrate that depletion of Apg-2 by RNAi in MDCK cells did not prevent formation of functional tight junctions. Similar to ZO-1, however, reduced expression of Apg-2 retarded de novo junction assembly if analysed in a Ca-switch model. Formation of functional junctions, as monitored by measuring transepithelial electrical resistance, and recruitment of tight and adherens junction markers were retarded. If cultured in three dimensional extracellular matrix gels, Apg-2 depleted cells, as previously shown for ZO-1 depleted cells, did not form hollow polarised cysts but poorly organised, irregular structures. Conclusion Our data indicate that Apg-2 regulates junction assembly and is required for normal epithelial morphogenesis in a three-dimensional culture system, suggesting that Apg-2 is an important regulator of epithelial differentiation. As the observed phenotypes are similar to those previously described for ZO-1 depleted cells and depletion of Apg-2 retards junctional recruitment of ZO-1, regulation of ZO-1 is likely to be an important functional role for Apg-2 during epithelial differentiation. PMID:18028534

  1. Regulation of tight junction assembly and epithelial morphogenesis by the heat shock protein Apg-2.

    PubMed

    Aijaz, Saima; Sanchez-Heras, Elena; Balda, Maria S; Matter, Karl

    2007-11-20

    Tight junctions are required for epithelial barrier formation and participate in the regulation of signalling mechanisms that control proliferation and differentiation. ZO-1 is a tight junction-associated adaptor protein that regulates gene expression, junction assembly and epithelial morphogenesis. We have previously demonstrated that the heat shock protein Apg-2 binds ZO-1 and thereby regulates its role in cell proliferation. Here, we addressed the question whether Apg-2 is also important for junction formation and epithelial morphogenesis. We demonstrate that depletion of Apg-2 by RNAi in MDCK cells did not prevent formation of functional tight junctions. Similar to ZO-1, however, reduced expression of Apg-2 retarded de novo junction assembly if analysed in a Ca-switch model. Formation of functional junctions, as monitored by measuring transepithelial electrical resistance, and recruitment of tight and adherens junction markers were retarded. If cultured in three dimensional extracellular matrix gels, Apg-2 depleted cells, as previously shown for ZO-1 depleted cells, did not form hollow polarised cysts but poorly organised, irregular structures. Our data indicate that Apg-2 regulates junction assembly and is required for normal epithelial morphogenesis in a three-dimensional culture system, suggesting that Apg-2 is an important regulator of epithelial differentiation. As the observed phenotypes are similar to those previously described for ZO-1 depleted cells and depletion of Apg-2 retards junctional recruitment of ZO-1, regulation of ZO-1 is likely to be an important functional role for Apg-2 during epithelial differentiation.

  2. Rapid calculation method for Frenkel-type two-exciton states in one to three dimensions

    NASA Astrophysics Data System (ADS)

    Ajiki, Hiroshi

    2014-07-01

    Biexciton and two-exciton dissociated states of Frenkel-type excitons are well described by a tight-binding model with a nearest-neighbor approximation. Such two-exciton states in a finite-size lattice are usually calculated by numerical diagonalization of the Hamiltonian, which requires an increasing amount of computational time and memory as the lattice size increases. I develop here a rapid, memory-saving method to calculate the energies and wave functions of two-exciton states by employing a bisection method. In addition, an attractive interaction between two excitons in the tight-binding model can be obtained directly so that the biexciton energy agrees with the observed energy, without the need for the trial-and-error procedure implemented in the numerical diagonalization method.

  3. Bcc and Fcc transition metals and alloys: a central role for the Jahn-Teller effect in explaining their ideal and distorted structures.

    PubMed

    Lee, Stephen; Hoffmann, Roald

    2002-05-01

    Transition metal elements, alloys, and intermetallic compounds often adopt the body centered cubic (bcc) and face centered cubic (fcc) structures. By comparing quantitative density functional with qualitative tight-binding calculations, we analyze the electronic factors which make the bcc and fcc structures energetically favorable. To do so, we develop a tight-binding function, DeltaE(star), a function that measures the energetic effects of transferring electrons within wave vector stars. This function allows one to connect distortions in solids to the Jahn-Teller effect in molecules and to provide an orbital perspective on structure determining deformations in alloys. We illustrate its use by considering first a two-dimensional square net. We then turn to three-dimensional fcc and bcc structures, and distortions of these. Using DeltaE(star), we rationalize the differences in energy of these structures. We are able to deduce which orbitals are responsible for instabilities in seven to nine valence electron per atom (e(-)/a) bcc systems and five and six e(-)/a fcc structures. Finally we demonstrate that these results account for the bcc and fcc type structures found in both the elements and binary intermetallic compounds of group 4 through 9 transition metal atoms. The outline of a theory of metal structure deformations based on loss of point group operation rather than translational symmetry is presented.

  4. Extended Lagrangian formulation of charge-constrained tight-binding molecular dynamics.

    PubMed

    Cawkwell, M J; Coe, J D; Yadav, S K; Liu, X-Y; Niklasson, A M N

    2015-06-09

    The extended Lagrangian Born-Oppenheimer molecular dynamics formalism [Niklasson, Phys. Rev. Lett., 2008, 100, 123004] has been applied to a tight-binding model under the constraint of local charge neutrality to yield microcanonical trajectories with both precise, long-term energy conservation and a reduced number of self-consistent field optimizations at each time step. The extended Lagrangian molecular dynamics formalism restores time reversal symmetry in the propagation of the electronic degrees of freedom, and it enables the efficient and accurate self-consistent optimization of the chemical potential and atomwise potential energy shifts in the on-site elements of the tight-binding Hamiltonian that are required when enforcing local charge neutrality. These capabilities are illustrated with microcanonical molecular dynamics simulations of a small metallic cluster using an sd-valent tight-binding model for titanium. The effects of weak dissipation on the propagation of the auxiliary degrees of freedom for the chemical potential and on-site Hamiltonian matrix elements that is used to counteract the accumulation of numerical noise during trajectories was also investigated.

  5. Symposium DD: Low-Dimensional Materials-Synthesis, Assembly, Property Scaling and Modeling. Held in San Francisco, CA on April 9-13, 2007

    DTIC Science & Technology

    2008-06-01

    Ciencia e Ingenieria de los Materiales , Universidad de Costa Rica, San Jose, Costa Rica. We have developed a new unifying tight-binding theory that...Fisico Matem6ticas, Universidad Aut6noma de Nuevo Le6n, San Nicolas de los Garza, Nuevo LeAfA3n, Mexico; 2Chemical Engineering Department and Texas...ORNL), Oak Ridge, Tennessee; 2Departamento de Ciencia de los Materiales e IM y QI, Universidad de Cadiz, Puerto Real, Cadiz, Spain; 3Departamento de

  6. Steady-state and quench-dependent relaxation of a quantum dot coupled to one-dimensional leads

    NASA Astrophysics Data System (ADS)

    Nuss, Martin; Ganahl, Martin; Evertz, Hans Gerd; Arrigoni, Enrico; von der Linden, Wolfgang

    2013-07-01

    We study the time evolution and steady state of the charge current in a single-impurity Anderson model, using matrix product states techniques. A nonequilibrium situation is imposed by applying a bias voltage across one-dimensional tight-binding leads. Focusing on particle-hole symmetry, we extract current-voltage characteristics from universal low-bias up to high-bias regimes, where band effects start to play a dominant role. We discuss three quenches, which after strongly quench-dependent transients yield the same steady-state current. Among these quenches we identify those favorable for extracting steady-state observables. The period of short-time oscillations is shown to compare well to real-time renormalization group results for a simpler model of spinless fermions. We find indications that many-body effects play an important role at high-bias voltage and finite bandwidth of the metallic leads. The growth of entanglement entropy after a certain time scale ∝Δ-1 is the major limiting factor for calculating the time evolution. We show that the magnitude of the steady-state current positively correlates with entanglement entropy. The role of high-energy states for the steady-state current is explored by considering a damping term in the time evolution.

  7. Dimensionality of Motion and Binding Valency Govern Receptor-Ligand Kinetics As Revealed by Agent-Based Modeling.

    PubMed

    Lehnert, Teresa; Figge, Marc Thilo

    2017-01-01

    Mathematical modeling and computer simulations have become an integral part of modern biological research. The strength of theoretical approaches is in the simplification of complex biological systems. We here consider the general problem of receptor-ligand binding in the context of antibody-antigen binding. On the one hand, we establish a quantitative mapping between macroscopic binding rates of a deterministic differential equation model and their microscopic equivalents as obtained from simulating the spatiotemporal binding kinetics by stochastic agent-based models. On the other hand, we investigate the impact of various properties of B cell-derived receptors-such as their dimensionality of motion, morphology, and binding valency-on the receptor-ligand binding kinetics. To this end, we implemented an algorithm that simulates antigen binding by B cell-derived receptors with a Y-shaped morphology that can move in different dimensionalities, i.e., either as membrane-anchored receptors or as soluble receptors. The mapping of the macroscopic and microscopic binding rates allowed us to quantitatively compare different agent-based model variants for the different types of B cell-derived receptors. Our results indicate that the dimensionality of motion governs the binding kinetics and that this predominant impact is quantitatively compensated by the bivalency of these receptors.

  8. Dimensionality of Motion and Binding Valency Govern Receptor–Ligand Kinetics As Revealed by Agent-Based Modeling

    PubMed Central

    Lehnert, Teresa; Figge, Marc Thilo

    2017-01-01

    Mathematical modeling and computer simulations have become an integral part of modern biological research. The strength of theoretical approaches is in the simplification of complex biological systems. We here consider the general problem of receptor–ligand binding in the context of antibody–antigen binding. On the one hand, we establish a quantitative mapping between macroscopic binding rates of a deterministic differential equation model and their microscopic equivalents as obtained from simulating the spatiotemporal binding kinetics by stochastic agent-based models. On the other hand, we investigate the impact of various properties of B cell-derived receptors—such as their dimensionality of motion, morphology, and binding valency—on the receptor–ligand binding kinetics. To this end, we implemented an algorithm that simulates antigen binding by B cell-derived receptors with a Y-shaped morphology that can move in different dimensionalities, i.e., either as membrane-anchored receptors or as soluble receptors. The mapping of the macroscopic and microscopic binding rates allowed us to quantitatively compare different agent-based model variants for the different types of B cell-derived receptors. Our results indicate that the dimensionality of motion governs the binding kinetics and that this predominant impact is quantitatively compensated by the bivalency of these receptors. PMID:29250071

  9. Order, criticality, and excitations in the extended Falicov-Kimball model.

    PubMed

    Ejima, S; Kaneko, T; Ohta, Y; Fehske, H

    2014-01-17

    Using exact numerical techniques, we investigate the nature of excitonic (electron-hole) bound states and the development of exciton coherence in the one-dimensional half-filled extended Falicov-Kimball model. The ground-state phase diagram of the model exhibits, besides band-insulator and staggered orbital ordered phases, an excitonic insulator (EI) with power-law correlations. The criticality of the EI state shows up in the von Neumann entropy. The anomalous spectral function and condensation amplitude provide the binding energy and coherence length of the electron-hole pairs which, on their part, point towards a Coulomb interaction driven crossover from BCS-like electron-hole pairing fluctuations to tightly bound excitons. We show that while a mass imbalance between electrons and holes does not affect the location of the BCS-BEC crossover regime, it favors staggered orbital ordering to the disadvantage of the EI. Within the Bose-Einstein condensation (BEC) regime, the quasiparticle dispersion develops a flat valence-band top, in accord with the experimental finding for Ta2NiSe5.

  10. Wavefunctions, quantum diffusion, and scaling exponents in golden-mean quasiperiodic tilings.

    PubMed

    Thiem, Stefanie; Schreiber, Michael

    2013-02-20

    We study the properties of wavefunctions and the wavepacket dynamics in quasiperiodic tight-binding models in one, two, and three dimensions. The atoms in the one-dimensional quasiperiodic chains are coupled by weak and strong bonds aligned according to the Fibonacci sequence. The associated d-dimensional quasiperiodic tilings are constructed from the direct product of d such chains, which yields either the hypercubic tiling or the labyrinth tiling. This approach allows us to consider fairly large systems numerically. We show that the wavefunctions of the system are multifractal and that their properties can be related to the structure of the system in the regime of strong quasiperiodic modulation by a renormalization group (RG) approach. We also study the dynamics of wavepackets to get information about the electronic transport properties. In particular, we investigate the scaling behaviour of the return probability of the wavepacket with time. Applying again the RG approach we show that in the regime of strong quasiperiodic modulation the return probability is governed by the underlying quasiperiodic structure. Further, we also discuss lower bounds for the scaling exponent of the width of the wavepacket and propose a modified lower bound for the absolute continuous regime.

  11. Tight-Binding study of Boron structures

    NASA Astrophysics Data System (ADS)

    McGrady, Joseph W.; Papaconstantopoulos, Dimitrios A.; Mehl, Michael J.

    2014-10-01

    We have performed Linearized Augmented Plane Wave (LAPW) calculations for five crystal structures (alpha, dhcp, sc, fcc, bcc) of Boron which we then fitted to a non-orthogonal tight-binding model following the Naval Research Laboratory Tight-Binding (NRL-TB) method. The predictions of the NRL-TB approach for complicated Boron structures such as R105 (or β-rhombohedral) and T190 are in agreement with recent first-principles calculations. Fully utilizing the computational speed of the NRL-TB method we calculated the energy differences of various structures, including those containing vacancies using supercells with up to 5000 atoms.

  12. Tunnel Field-Effect Transistors in 2-D Transition Metal Dichalcogenide Materials

    NASA Astrophysics Data System (ADS)

    Ilatikhameneh, Hesameddin; Tan, Yaohua; Novakovic, Bozidar; Klimeck, Gerhard; Rahman, Rajib; Appenzeller, Joerg

    2015-12-01

    In this work, the performance of Tunnel Field-Effect Transistors (TFETs) based on two-dimensional Transition Metal Dichalcogenide (TMD) materials is investigated by atomistic quantum transport simulations. One of the major challenges of TFETs is their low ON-currents. 2D material based TFETs can have tight gate control and high electric fields at the tunnel junction, and can in principle generate high ON-currents along with a sub-threshold swing smaller than 60 mV/dec. Our simulations reveal that high performance TMD TFETs, not only require good gate control, but also rely on the choice of the right channel material with optimum band gap, effective mass and source/drain doping level. Unlike previous works, a full band atomistic tight binding method is used self-consistently with 3D Poisson equation to simulate ballistic quantum transport in these devices. The effect of the choice of TMD material on the performance of the device and its transfer characteristics are discussed. Moreover, the criteria for high ON-currents are explained with a simple analytic model, showing the related fundamental factors. Finally, the subthreshold swing and energy-delay of these TFETs are compared with conventional CMOS devices.

  13. Modeling Tight Junction Dynamics and Oscillations

    PubMed Central

    Kassab, Fuad; Marques, Ricardo Paulino; Lacaz-Vieira, Francisco

    2002-01-01

    Tight junction (TJ) permeability responds to changes of extracellular Ca2+ concentration. This can be gauged through changes of the transepithelial electrical conductance (G) determined in the absence of apical Na+. The early events of TJ dynamics were evaluated by the fast Ca2+ switch assay (FCSA) (Lacaz-Vieira, 2000), which consists of opening the TJs by removing basal calcium (Ca2+ bl) and closing by returning Ca2+ bl to normal values. Oscillations of TJ permeability were observed when Ca2+ bl is removed in the presence of apical calcium (Ca2+ ap) and were interpreted as resulting from oscillations of a feedback control loop which involves: (a) a sensor (the Ca2+ binding sites of zonula adhaerens), (b) a control unit (the cell signaling machinery), and (c) an effector (the TJs). A mathematical model to explain the dynamical behavior of the TJs and oscillations was developed. The extracellular route (ER), which comprises the paracellular space in series with the submucosal interstitial fluid, was modeled as a continuous aqueous medium having the TJ as a controlled barrier located at its apical end. The ER was approximated as a linear array of cells. The most apical cell is separated from the apical solution by the TJ and this cell bears the Ca2+ binding sites of zonula adhaerens that control the TJs. According to the model, the control unit receives information from the Ca2+ binding sites and delivers a signal that regulates the TJ barrier. Ca2+ moves along the ER according to one-dimensional diffusion following Fick's second law. Across the TJ, Ca2+ diffusion follows Fick's first law. Our first approach was to simulate the experimental results in a semiquantitative way. The model tested against experiment results performed in the frog urinary bladder adequately predicts the responses obtained in different experimental conditions, such as: (a) TJ opening and closing in a FCSA, (b) opening by the presence of apical Ca2+ and attainment of a new steady-state, (c) the escape phase which follows the halt of TJ opening induced by apical Ca2+, (d) the oscillations of TJ permeability, and (e) the effect of Ca2+ ap concentration on the frequency of oscillations. PMID:12149284

  14. Multiscale real-space quantum-mechanical tight-binding calculations of electronic structure in crystals with defects using perfectly matched layers

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pourmatin, Hossein, E-mail: mpourmat@andrew.cmu.edu; Dayal, Kaushik, E-mail: kaushik@cmu.edu

    2016-10-15

    Graphical abstract: - Abstract: We consider the scattering of incident plane-wave electrons from a defect in a crystal modeled by the time-harmonic Schrödinger equation. While the defect potential is localized, the far-field potential is periodic, unlike standard free-space scattering problems. Previous work on the Schrödinger equation has been almost entirely in free-space conditions; a few works on crystals have been in one-dimension. We construct absorbing boundary conditions for this problem using perfectly matched layers in a tight-binding formulation. Using the example of a point defect in graphene, we examine the efficiency and convergence of the proposed absorbing boundary condition.

  15. Localization in one-dimensional lattices with non-nearest-neighbor hopping: Generalized Anderson and Aubry-Andre models

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Biddle, J.; Priour, D. J. Jr.; Wang, B.

    We study the quantum localization phenomena of noninteracting particles in one-dimensional lattices based on tight-binding models with various forms of hopping terms beyond the nearest neighbor, which are generalizations of the famous Aubry-Andre and noninteracting Anderson models. For the case with deterministic disordered potential induced by a secondary incommensurate lattice (i.e., the Aubry-Andre model), we identify a class of self-dual models, for which the boundary between localized and extended eigenstates are determined analytically by employing a generalized Aubry-Andre transformation. We also numerically investigate the localization properties of nondual models with next-nearest-neighbor hopping, Gaussian, and power-law decay hopping terms. We findmore » that even for these nondual models, the numerically obtained mobility edges can be well approximated by the analytically obtained condition for localization transition in the self-dual models, as long as the decay of the hopping rate with respect to distance is sufficiently fast. For the disordered potential with genuinely random character, we examine scenarios with next-nearest-neighbor hopping, exponential, Gaussian, and power-law decay hopping terms numerically. We find that the higher-order hopping terms can remove the symmetry in the localization length about the energy band center compared to the Anderson model. Furthermore, our results demonstrate that for the power-law decay case, there exists a critical exponent below which mobility edges can be found. Our theoretical results could, in principle, be directly tested in shallow atomic optical lattice systems enabling non-nearest-neighbor hopping.« less

  16. Tightness of the Ising-Kac Model on the Two-Dimensional Torus

    NASA Astrophysics Data System (ADS)

    Hairer, Martin; Iberti, Massimo

    2018-05-01

    We consider the sequence of Gibbs measures of Ising models with Kac interaction defined on a periodic two-dimensional discrete torus near criticality. Using the convergence of the Glauber dynamic proven by Mourrat and Weber (Commun Pure Appl Math 70:717-812, 2017) and a method by Tsatsoulis and Weber employed in (arXiv:1609.08447 2016), we show tightness for the sequence of Gibbs measures of the Ising-Kac model near criticality and characterise the law of the limit as the Φ ^4_2 measure on the torus. Our result is very similar to the one obtained by Cassandro et al. (J Stat Phys 78(3):1131-1138, 1995) on Z^2, but our strategy takes advantage of the dynamic, instead of correlation inequalities. In particular, our result covers the whole critical regime and does not require the large temperature/large mass/small coupling assumption present in earlier results.

  17. Three-dimensional graphdiyne as a topological nodal-line semimetal

    NASA Astrophysics Data System (ADS)

    Nomura, Takafumi; Habe, Tetsuro; Sakamoto, Ryota; Koshino, Mikito

    2018-05-01

    We study the electronic band structure of three-dimensional ABC-stacked (rhombohedral) graphdiyne, which is a new planar carbon allotrope recently fabricated. Using first-principles calculation, we show that the system is a nodal-line semimetal, in which the conduction band and valence band cross at a closed ring in the momentum space. We derive the minimum tight-binding model and the low-energy effective Hamiltonian in a 4 ×4 matrix form. The nodal line is protected by a nontrivial winding number, and it ensures the existence of the topological surface state in a finite-thickness slab. The Fermi surface of the doped system exhibits a peculiar, self-intersecting hourglass structure, which is quite different from the torus or pipe shape in the previously proposed nodal semimetals. Despite its simple configuration, three-dimensional graphdiyne offers unique electronic properties distinct from any other carbon allotropes.

  18. Phonon-limited carrier mobility and resistivity from carbon nanotubes to graphene

    NASA Astrophysics Data System (ADS)

    Li, Jing; Miranda, Henrique Pereira Coutada; Niquet, Yann-Michel; Genovese, Luigi; Duchemin, Ivan; Wirtz, Ludger; Delerue, Christophe

    2015-08-01

    Under which conditions do the electrical transport properties of one-dimensional (1D) carbon nanotubes (CNTs) and 2D graphene become equivalent? We have performed atomistic calculations of the phonon-limited electrical mobility in graphene and in a wide range of CNTs of different types to address this issue. The theoretical study is based on a tight-binding method and a force-constant model from which all possible electron-phonon couplings are computed. The electrical resistivity of graphene is found in very good agreement with experiments performed at high carrier density. A common methodology is applied to study the transition from one to two dimensions by considering CNTs with diameter up to 16 nm. It is found that the mobility in CNTs of increasing diameter converges to the same value, i.e., the mobility in graphene. This convergence is much faster at high temperature and high carrier density. For small-diameter CNTs, the mobility depends strongly on chirality, diameter, and the existence of a band gap.

  19. General theoretical description of angle-resolved photoemission spectroscopy of van der Waals structures

    NASA Astrophysics Data System (ADS)

    Amorim, B.

    2018-04-01

    We develop a general theory to model the angle-resolved photoemission spectroscopy (ARPES) of commensurate and incommensurate van der Waals (vdW) structures, formed by lattice mismatched and/or misaligned stacked layers of two-dimensional materials. The present theory is based on a tight-binding description of the structure and the concept of generalized umklapp processes, going beyond previous descriptions of ARPES in incommensurate vdW structures, which are based on continuous, low-energy models, being limited to structures with small lattice mismatch/misalignment. As applications of the general formalism, we study the ARPES bands and constant energy maps for two structures: twisted bilayer graphene and twisted bilayer MoS2. The present theory should be useful in correctly interpreting experimental results of ARPES of vdW structures and other systems displaying competition between different periodicities, such as two-dimensional materials weakly coupled to a substrate and materials with density wave phases.

  20. Substantial optical dielectric enhancement by volume compression in LiAsSe 2

    DOE PAGES

    Zheng, Fan; Brehm, John A.; Young, Steve M.; ...

    2016-05-15

    Based on first-principles calculations, we predict a substantial increase in the optical dielectric function of LiAsSemore » $$_2$$ under pressure. We find that the optical dielectric constant is enhanced threefold under volume compression. This enhancement is mainly due to the dimerization strength reduction of the one-dimensional (1D) As--Se chains in LiAsSe$$_2$$, which significantly alters the wavefunction phase mismatch between two neighboring chains and changes the transition intensity. By developing a tight-binding model of the interacting 1D chains, the essential features of the low-energy electronic structure of LiAsSe$$_2$$ are captured. In conclusion, our findings are important for understanding the fundamental physics of LiAsSe$$_2$$ and provide a feasible way to enhance the material optical response that can be applied to light harvesting for energy applications.« less

  1. Dynamics of Polarons in Organic Conjugated Polymers with Side Radicals.

    PubMed

    Liu, J J; Wei, Z J; Zhang, Y L; Meng, Y; Di, B

    2017-03-16

    Based on the one-dimensional tight-binding Su-Schrieffer-Heeger (SSH) model, and using the molecular dynamics method, we discuss the dynamics of electron and hole polarons propagating along a polymer chain, as a function of the distance between side radicals and the magnitude of the transfer integrals between the main chain and the side radicals. We first discuss the average velocities of electron and hole polarons as a function of the distance between side radicals. It is found that the average velocities of the electron polarons remain almost unchanged, while the average velocities of hole polarons decrease significantly when the radical distance is comparable to the polaron width. Second, we have found that the average velocities of electron polarons decrease with increasing transfer integral, but the average velocities of hole polarons increase. These results may provide a theoretical basis for understanding carriers transport properties in polymers chain with side radicals.

  2. Toward tailoring Majorana bound states in artificially constructed magnetic atom chains on elemental superconductors

    PubMed Central

    Thorwart, Michael

    2018-01-01

    Realizing Majorana bound states (MBS) in condensed matter systems is a key challenge on the way toward topological quantum computing. As a promising platform, one-dimensional magnetic chains on conventional superconductors were theoretically predicted to host MBS at the chain ends. We demonstrate a novel approach to design of model-type atomic-scale systems for studying MBS using single-atom manipulation techniques. Our artificially constructed atomic Fe chains on a Re surface exhibit spin spiral states and a remarkable enhancement of the local density of states at zero energy being strongly localized at the chain ends. Moreover, the zero-energy modes at the chain ends are shown to emerge and become stabilized with increasing chain length. Tight-binding model calculations based on parameters obtained from ab initio calculations corroborate that the system resides in the topological phase. Our work opens new pathways to design MBS in atomic-scale hybrid structures as a basis for fault-tolerant topological quantum computing. PMID:29756034

  3. Toward tailoring Majorana bound states in artificially constructed magnetic atom chains on elemental superconductors.

    PubMed

    Kim, Howon; Palacio-Morales, Alexandra; Posske, Thore; Rózsa, Levente; Palotás, Krisztián; Szunyogh, László; Thorwart, Michael; Wiesendanger, Roland

    2018-05-01

    Realizing Majorana bound states (MBS) in condensed matter systems is a key challenge on the way toward topological quantum computing. As a promising platform, one-dimensional magnetic chains on conventional superconductors were theoretically predicted to host MBS at the chain ends. We demonstrate a novel approach to design of model-type atomic-scale systems for studying MBS using single-atom manipulation techniques. Our artificially constructed atomic Fe chains on a Re surface exhibit spin spiral states and a remarkable enhancement of the local density of states at zero energy being strongly localized at the chain ends. Moreover, the zero-energy modes at the chain ends are shown to emerge and become stabilized with increasing chain length. Tight-binding model calculations based on parameters obtained from ab initio calculations corroborate that the system resides in the topological phase. Our work opens new pathways to design MBS in atomic-scale hybrid structures as a basis for fault-tolerant topological quantum computing.

  4. Tight-binding calculation of single-band and generalized Wannier functions of graphene

    NASA Astrophysics Data System (ADS)

    Ribeiro, Allan Victor; Bruno-Alfonso, Alexys

    Recent work has shown that a tight-binding approach associated with Wannier functions (WFs) provides an intuitive physical image of the electronic structure of graphene. Regarding the case of graphene, Marzari et al. displayed the calculated WFs and presented a comparison between the Wannier-interpolated bands and the bands generated by using the density-functional code. Jung and MacDonald provided a tight-binding model for the π-bands of graphene that involves maximally localized Wannier functions (MLWFs). The mixing of the bands yields better localized WFs. In the present work, the MLWFs of graphene are calculated by combining the Quantum-ESPRESSO code and tight-binding approach. The MLWFs of graphene are calculated from the Bloch functions obtained through a tight binding approach that includes interactions and overlapping obtained by partially fitting the DFT bands. The phase of the Bloch functions of each band is appropriately chosen to produce MLWFs. The same thing applies to the coefficients of their linear combination in the generalized case. The method allows for an intuitive understanding of the maximally localized WFs of graphene and shows excellent agreement with the literature. Moreover, it provides accurate results at reduced computational cost.

  5. Accurate modeling of defects in graphene transport calculations

    NASA Astrophysics Data System (ADS)

    Linhart, Lukas; Burgdörfer, Joachim; Libisch, Florian

    2018-01-01

    We present an approach for embedding defect structures modeled by density functional theory into large-scale tight-binding simulations. We extract local tight-binding parameters for the vicinity of the defect site using Wannier functions. In the transition region between the bulk lattice and the defect the tight-binding parameters are continuously adjusted to approach the bulk limit far away from the defect. This embedding approach allows for an accurate high-level treatment of the defect orbitals using as many as ten nearest neighbors while keeping a small number of nearest neighbors in the bulk to render the overall computational cost reasonable. As an example of our approach, we consider an extended graphene lattice decorated with Stone-Wales defects, flower defects, double vacancies, or silicon substitutes. We predict distinct scattering patterns mirroring the defect symmetries and magnitude that should be experimentally accessible.

  6. Proton transfer along water bridges in biological systems with density-functional tight-binding

    NASA Astrophysics Data System (ADS)

    Reiss, Krystle; Wise, Abigail; Mazzuca, James

    2015-03-01

    When examining the dynamics of charge transfer in high dimensional enzymatic systems, the cost of quantum mechanical treatment of electrons increases exponentially with the size of the system. As a semi-empirical method, density-functional tight-binding aids in shortening these calculation times, but can be inaccurate in the regime where bonds are being formed and broken. To address these inaccuracies with respect to proton transfer in an enzymatic system, DFTB is being used to calculate small model systems containing only a single amino acid residue donor, represented by an imidazole molecule, and a water acceptor. When DFTB calculations are compared to B3LYP geometry calculations of the donor molecule, we observe a bond angle error on the order of 1.2 degrees and a bond length error on the order of 0.011 Å. As we move forward with small donor-acceptor systems, comparisons between DFTB and B3LYP energy profiles will provide a better clue as to what extent improvements need to be made. To improve the accuracy of the DFTB calculations, the internuclear repulsion term may be altered. This would result in energy profiles that closely resemble those produced by higher-level theory. Alma College Provost's Office.

  7. Topological mosaics in moiré superlattices of van der Waals heterobilayers

    NASA Astrophysics Data System (ADS)

    Tong, Qingjun; Yu, Hongyi; Zhu, Qizhong; Wang, Yong; Xu, Xiaodong; Yao, Wang

    2017-04-01

    Van der Waals (vdW) heterostructures formed by two-dimensional atomic crystals provide a powerful approach towards designer condensed matter systems. Incommensurate heterobilayers with small twisting and/or lattice mismatch lead to the interesting concept of moiré superlattices, where the atomic registry is locally indistinguishable from commensurate bilayers but has local-to-local variation over long range. Here we show that such moiré superlattices can lead to periodic modulation of local topological order in vdW heterobilayers formed by two massive Dirac materials. By tuning the vdW heterojunction from normal to the inverted type-II regime via an interlayer bias, the commensurate heterobilayer can become a topological insulator (TI), depending on the interlayer hybridization controlled by the atomic registry between the vdW layers. This results in a mosaic pattern of TI regions and normal insulator (NI) regions in moiré superlattices, where topologically protected helical modes exist at the TI/NI phase boundaries. By using symmetry-based k .p and tight-binding models, we predict that this topological phenomenon can be present in inverted transition metal dichalcogenides heterobilayers. Our work points to a new means of realizing programmable and electrically switchable topological superstructures from two-dimensional arrays of TI nano-dots to one-dimensional arrays of TI nano-stripes.

  8. A tight binding model study of tunneling conductance spectra of spin and orbitally ordered CMR manganites

    NASA Astrophysics Data System (ADS)

    Panda, Saswati; Sahoo, D. D.; Rout, G. C.

    2018-04-01

    We report here a tight binding model for colossal magnetoresistive (CMR) manganites to study the pseudo gap (PG) behavior near Fermi level. In the Kubo-Ohata type DE model, we consider first and second nearest neighbor interactions for transverse spin fluctuations in core band and hopping integrals in conduction band, in the presence of static band Jahn-Teller distortion. The model Hamiltonian is solved using Zubarev's Green's function technique. The electron density of states (DOS) is found out from the Green's functions. We observe clear PG near Fermi level in the electron DOS.

  9. Linear optical response of carbon nanotubes under axial magnetic field

    NASA Astrophysics Data System (ADS)

    Moradian, Rostam; Chegel, Raad; Behzad, Somayeh

    2010-04-01

    We considered single walled carbon naotubes (SWCNTs) as real three dimensional (3D) systems in a cylindrical coordinate. The optical matrix elements and linear susceptibility, χ(ω), in the tight binding approximation in terms of one-dimensional wave vector, kz and subband index, l are calculated. In an external axial magnetic field optical frequency dependence of linear susceptibility are investigated. We found that axial magnetic field has two effects on the imaginary part of the linear susceptibility spectrum, in agreement with experimental results. The first effect is broadening and the second, splitting. Also we found that for all metallic zigzag and armchair SWCNTs, the axial magnetic field leads to the creation of a peak with energy less than 1.5 eV, contrary to what is observed in the absence of a magnetic field.

  10. Electronic transport across a junction between armchair graphene nanotube and zigzag nanoribbon. Transmission in an armchair nanotube without a zigzag half-line of dimers

    NASA Astrophysics Data System (ADS)

    Sharma, Basant Lal

    2018-05-01

    Based on the well known nearest-neighbor tight-binding approximation for graphene, an exact expression for the electronic conductance across a zigzag nanoribbon/armchair nanotube junction is presented for non-interacting electrons. The junction results from the removal of a half-row of zigzag dimers in armchair nanotube, or equivalently by partial rolling of zigzag nanoribbon and insertion of a half-row of zigzag dimers in between. From the former point of view, a discrete form of Dirichlet condition is imposed on a zigzag half-line of dimers assuming the vanishing of wave function outside the physical structure. A closed form expression is provided for the reflection and transmission moduli for the outgoing wave modes for each given electronic wave mode incident from either side of the junction. It is demonstrated that such a contact junction between the nanotube and nanoribbon exhibits negligible backscattering, and the transmission has been found to be nearly ballistic. In contrast to the previously reported studies for partially unzipped carbon nanotubes (CNTs), using the same tight binding model, it is found that due to the "defect" there is certain amount of mixing between the electronic wave modes with even and odd reflection symmetries. But the junction remains a perfect valley filter for CNTs at certain energy ranges. Applications aside from the electronic case, include wave propagation in quasi-one-dimensional honeycomb structures of graphene-like constitution. The paper includes several numerical calculations, analytical derivations, and graphical results, which complement the provision of succinct closed form expressions.

  11. Colloidal nanocrystals as LEGO® bricks for building electronic band structure models.

    PubMed

    Tadjine, Athmane; Delerue, Christophe

    2018-03-28

    The synthesis of self-assembled semiconductor nanocrystal (NC) superlattices using oriented attachment recently became a flourishing research topic. This technique already produced remarkable forms of NC superlattices, such as linear chains, mono and multilayer square lattices, and silicene-like honeycomb lattices. In the case of lead chalcogenide semiconductors where NCs are in the form of truncated nanocubes, the attachment mostly occurs via (100) facets. In this work, we show that all these structures can be seen as sub-structures of a simple cubic lattice. From this, we investigate a rich variety of one-dimensional or two-dimensional superlattices that could be built as few lines or few layers taken from the same cubic system following different crystallographic orientations. Each NC can be therefore considered as a LEGO® brick, and any superlattice can be obtained from another one by rearranging the bricks. Moreover, we show that this concept of LEGO® bricks can be extended to the calculation of the electronic band structure of the superlattices. This leads to a simple yet powerful way to build analytical Hamiltonians that present band structures in excellent agreement with more elaborate atomistic tight-binding calculations. This LEGO® concept could guide the synthesis of superlattices and LEGO® Hamiltonians should greatly simplify further studies on the (opto-)electronic properties of such structures.

  12. Model construction and superconductivity analysis of organic conductors β-(BDA-TTP)2MF6 (M = P, As, Sb and Ta) based on first-principles band calculation

    NASA Astrophysics Data System (ADS)

    Aizawa, H.; Kuroki, K.; Yasuzuka, S.; Yamada, J.

    2012-11-01

    We perform a first-principles band calculation for a group of quasi-two-dimensional organic conductors β-(BDA-TTP)2MF6 (M = P, As, Sb and Ta). The ab-initio calculation shows that the density of states is correlated with the bandwidth of the singly occupied (highest) molecular orbital, while it is not necessarily correlated with the unit-cell volume. The direction of the major axis of the cross section of the Fermi surface lies in the Γ-B-direction, which differs from that obtained by the extended Hückel calculation. Then, we construct a tight-binding model which accurately reproduces the ab-initio band structure. The obtained transfer energies give a smaller dimerization than in the extended Hückel band. As to the difference in the anisotropy of the Fermi surface, the transfer energies along the inter-stacking direction are smaller than those obtained in the extended Hückel calculation. Assuming spin-fluctuation-mediated superconductivity, we apply random phase approximation to a two-band Hubbard model. This two-band Hubbard model is composed of the tight-binding model derived from the first-principles band structure and an on-site (intra-molecule) repulsive interaction taken as a variable parameter. The obtained superconducting gap changes sign four times along the Fermi surface like in a d-wave gap, and the nodal direction is different from that obtained in the extended Hückel model. Anion dependence of Tc is qualitatively consistent with the experimental observation.

  13. Development of tight-binding based GW algorithm and its computational implementation for graphene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Majidi, Muhammad Aziz; NUSNNI-NanoCore, Department of Physics, National University of Singapore; Singapore Synchrotron Light Source

    Graphene has been a hot subject of research in the last decade as it holds a promise for various applications. One interesting issue is whether or not graphene should be classified into a strongly or weakly correlated system, as the optical properties may change upon several factors, such as the substrate, voltage bias, adatoms, etc. As the Coulomb repulsive interactions among electrons can generate the correlation effects that may modify the single-particle spectra (density of states) and the two-particle spectra (optical conductivity) of graphene, we aim to explore such interactions in this study. The understanding of such correlation effects ismore » important because eventually they play an important role in inducing the effective attractive interactions between electrons and holes that bind them into excitons. We do this study theoretically by developing a GW method implemented on the basis of the tight-binding (TB) model Hamiltonian. Unlike the well-known GW method developed within density functional theory (DFT) framework, our TB-based GW implementation may serve as an alternative technique suitable for systems which Hamiltonian is to be constructed through a tight-binding based or similar models. This study includes theoretical formulation of the Green’s function G, the renormalized interaction function W from random phase approximation (RPA), and the corresponding self energy derived from Feynman diagrams, as well as the development of the algorithm to compute those quantities. As an evaluation of the method, we perform calculations of the density of states and the optical conductivity of graphene, and analyze the results.« less

  14. Twisting dirac fermions: circular dichroism in bilayer graphene

    NASA Astrophysics Data System (ADS)

    Suárez Morell, E.; Chico, Leonor; Brey, Luis

    2017-09-01

    Twisted bilayer graphene is a chiral system which has been recently shown to present circular dichroism. In this work we show that the origin of this optical activity is the rotation of the Dirac fermions’ helicities in the top and bottom layer. Starting from the Kubo formula, we obtain a compact expression for the Hall conductivity that takes into account the dephasing of the electromagnetic field between the top and bottom layers and gathers all the symmetries of the system. Our results are based in both a continuum and a tight-binding model, and they can be generalized to any two-dimensional Dirac material with a chiral stacking between layers.

  15. One-Dimensional Brownian Motion of Charged Nanoparticles along Microtubules: A Model System for Weak Binding Interactions

    PubMed Central

    Minoura, Itsushi; Katayama, Eisaku; Sekimoto, Ken; Muto, Etsuko

    2010-01-01

    Abstract Various proteins are known to exhibit one-dimensional Brownian motion along charged rodlike polymers, such as microtubules (MTs), actin, and DNA. The electrostatic interaction between the proteins and the rodlike polymers appears to be crucial for one-dimensional Brownian motion, although the underlying mechanism has not been fully clarified. We examined the interactions of positively-charged nanoparticles composed of polyacrylamide gels with MTs. These hydrophilic nanoparticles bound to MTs and displayed one-dimensional Brownian motion in a charge-dependent manner, which indicates that nonspecific electrostatic interaction is sufficient for one-dimensional Brownian motion. The diffusion coefficient decreased exponentially with an increasing particle charge (with the exponent being 0.10 kBT per charge), whereas the duration of the interaction increased exponentially (exponent of 0.22 kBT per charge). These results can be explained semiquantitatively if one assumes that a particle repeats a cycle of binding to and movement along an MT until it finally dissociates from the MT. During the movement, a particle is still electrostatically constrained in the potential valley surrounding the MT. This entire process can be described by a three-state model analogous to the Michaelis-Menten scheme, in which the two parameters of the equilibrium constant between binding and movement, and the rate of dissociation from the MT, are derived as a function of the particle charge density. This study highlights the possibility that the weak binding interactions between proteins and rodlike polymers, e.g., MTs, are mediated by a similar, nonspecific charge-dependent mechanism. PMID:20409479

  16. One-dimensional Brownian motion of charged nanoparticles along microtubules: a model system for weak binding interactions.

    PubMed

    Minoura, Itsushi; Katayama, Eisaku; Sekimoto, Ken; Muto, Etsuko

    2010-04-21

    Various proteins are known to exhibit one-dimensional Brownian motion along charged rodlike polymers, such as microtubules (MTs), actin, and DNA. The electrostatic interaction between the proteins and the rodlike polymers appears to be crucial for one-dimensional Brownian motion, although the underlying mechanism has not been fully clarified. We examined the interactions of positively-charged nanoparticles composed of polyacrylamide gels with MTs. These hydrophilic nanoparticles bound to MTs and displayed one-dimensional Brownian motion in a charge-dependent manner, which indicates that nonspecific electrostatic interaction is sufficient for one-dimensional Brownian motion. The diffusion coefficient decreased exponentially with an increasing particle charge (with the exponent being 0.10 kBT per charge), whereas the duration of the interaction increased exponentially (exponent of 0.22 kBT per charge). These results can be explained semiquantitatively if one assumes that a particle repeats a cycle of binding to and movement along an MT until it finally dissociates from the MT. During the movement, a particle is still electrostatically constrained in the potential valley surrounding the MT. This entire process can be described by a three-state model analogous to the Michaelis-Menten scheme, in which the two parameters of the equilibrium constant between binding and movement, and the rate of dissociation from the MT, are derived as a function of the particle charge density. This study highlights the possibility that the weak binding interactions between proteins and rodlike polymers, e.g., MTs, are mediated by a similar, nonspecific charge-dependent mechanism. Copyright 2010 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  17. Exciton Scattering approach for conjugated macromolecules: from electronic spectra to electron-phonon coupling

    NASA Astrophysics Data System (ADS)

    Tretiak, Sergei

    2014-03-01

    The exciton scattering (ES) technique is a multiscale approach developed for efficient calculations of excited-state electronic structure and optical spectra in low-dimensional conjugated macromolecules. Within the ES method, the electronic excitations in the molecular structure are attributed to standing waves representing quantum quasi-particles (excitons), which reside on the graph. The exciton propagation on the linear segments is characterized by the exciton dispersion, whereas the exciton scattering on the branching centers is determined by the energy-dependent scattering matrices. Using these ES energetic parameters, the excitation energies are then found by solving a set of generalized ``particle in a box'' problems on the graph that represents the molecule. All parameters can be extracted from quantum-chemical computations of small molecular fragments and tabulated in the ES library for further applications. Subsequently, spectroscopic modeling for any macrostructure within considered molecular family could be performed with negligible numerical effort. The exciton scattering properties of molecular vertices can be further described by tight-binding or equivalently lattice models. The on-site energies and hopping constants are obtained from the exciton dispersion and scattering matrices. Such tight-binding model approach is particularly useful to describe the exciton-phonon coupling, energetic disorder and incoherent energy transfer in large branched conjugated molecules. Overall the ES applications accurately reproduce the optical spectra compared to the reference quantum chemistry results, and make possible to predict spectra of complex macromolecules, where conventional electronic structure calculations are unfeasible.

  18. Temperature-dependent band structure of SrTiO3 interfaces

    NASA Astrophysics Data System (ADS)

    Raslan, Amany; Lafleur, Patrick; Atkinson, W. A.

    2017-02-01

    We build a theoretical model for the electronic properties of the two-dimensional (2D) electron gas that forms at the interface between insulating SrTiO3 and a number of polar cap layers, including LaTiO3, LaAlO3, and GdTiO3. The model treats conduction electrons within a tight-binding approximation and the dielectric polarization via a Landau-Devonshire free energy that incorporates strontium titanate's strongly nonlinear, nonlocal, and temperature-dependent dielectric response. The self-consistent band structure comprises a mix of quantum 2D states that are tightly bound to the interface and quasi-three-dimensional (3D) states that extend hundreds of unit cells into the SrTiO3 substrate. We find that there is a substantial shift of electrons away from the interface into the 3D tails as temperature is lowered from 300 K to 10 K. This shift is least important at high electron densities (˜1014cm-2 ) but becomes substantial at low densities; for example, the total electron density within 4 nm of the interface changes by a factor of two for 2D electron densities ˜1013cm-2 . We speculate that the quasi-3D tails form the low-density high-mobility component of the interfacial electron gas that is widely inferred from magnetoresistance measurements.

  19. Molecular recognition of pyr mRNA by the Bacillus subtilis attenuation regulatory protein PyrR

    PubMed Central

    Bonner, Eric R.; D’Elia, John N.; Billips, Benjamin K.; Switzer, Robert L.

    2001-01-01

    The pyrimidine nucleotide biosynthesis (pyr) operon in Bacillus subtilis is regulated by transcriptional attenuation. The PyrR protein binds in a uridine nucleotide-dependent manner to three attenuation sites at the 5′-end of pyr mRNA. PyrR binds an RNA-binding loop, allowing a terminator hairpin to form and repressing the downstream genes. The binding of PyrR to defined RNA molecules was characterized by a gel mobility shift assay. Titration indicated that PyrR binds RNA in an equimolar ratio. PyrR bound more tightly to the binding loops from the second (BL2 RNA) and third (BL3 RNA) attenuation sites than to the binding loop from the first (BL1 RNA) attenuation site. PyrR bound BL2 RNA 4–5-fold tighter in the presence of saturating UMP or UDP and 150- fold tighter with saturating UTP, suggesting that UTP is the more important co-regulator. The minimal RNA that bound tightly to PyrR was 28 nt long. Thirty-one structural variants of BL2 RNA were tested for PyrR binding affinity. Two highly conserved regions of the RNA, the terminal loop and top of the upper stem and a purine-rich internal bulge and the base pairs below it, were crucial for tight binding. Conserved elements of RNA secondary structure were also required for tight binding. PyrR protected conserved areas of the binding loop in hydroxyl radical footprinting experiments. PyrR likely recognizes conserved RNA sequences, but only if they are properly positioned in the correct secondary structure. PMID:11726695

  20. Finite temperature magnon spectra in yttrium iron garnet from a mean field approach in a tight-binding model

    NASA Astrophysics Data System (ADS)

    Shen, Ka

    2018-04-01

    We study magnon spectra at finite temperature in yttrium iron garnet using a tight-binding model with nearest-neighbor exchange interaction. The spin reduction due to thermal magnon excitation is taken into account via the mean field approximation to the local spin and is found to be different at two sets of iron atoms. The resulting temperature dependence of the spin wave gap shows good agreement with experiment. We find that only two magnon modes are relevant to the ferromagnetic resonance.

  1. Enhanced superconductivity in atomically thin TaS2

    PubMed Central

    Navarro-Moratalla, Efrén; Island, Joshua O.; Mañas-Valero, Samuel; Pinilla-Cienfuegos, Elena; Castellanos-Gomez, Andres; Quereda, Jorge; Rubio-Bollinger, Gabino; Chirolli, Luca; Silva-Guillén, Jose Angel; Agraït, Nicolás; Steele, Gary A.; Guinea, Francisco; van der Zant, Herre S. J.; Coronado, Eugenio

    2016-01-01

    The ability to exfoliate layered materials down to the single layer limit has presented the opportunity to understand how a gradual reduction in dimensionality affects the properties of bulk materials. Here we use this top–down approach to address the problem of superconductivity in the two-dimensional limit. The transport properties of electronic devices based on 2H tantalum disulfide flakes of different thicknesses are presented. We observe that superconductivity persists down to the thinnest layer investigated (3.5 nm), and interestingly, we find a pronounced enhancement in the critical temperature from 0.5 to 2.2 K as the layers are thinned down. In addition, we propose a tight-binding model, which allows us to attribute this phenomenon to an enhancement of the effective electron–phonon coupling constant. This work provides evidence that reducing the dimensionality can strengthen superconductivity as opposed to the weakening effect that has been reported in other 2D materials so far. PMID:26984768

  2. Local nature of impurity induced spin-orbit torques

    NASA Astrophysics Data System (ADS)

    Nikolaev, Sergey; Kalitsov, Alan; Chshiev, Mairbec; Mryasov, Oleg

    Spin-orbit torques are of a great interest due to their potential applications for spin electronics. Generally, it originates from strong spin orbit coupling of heavy 4d/5d elements and its mechanism is usually attributed either to the Spin Hall effect or Rashba spin-orbit coupling. We have developed a quantum-mechanical approach based on the non-equilibrium Green's function formalism and tight binding Hamiltonian model to study spin-orbit torques and extended our theory for the case of extrinsic spin-orbit coupling induced by impurities. For the sake of simplicity, we consider a magnetic material on a two dimensional lattice with a single non-magnetic impurity. However, our model can be easily extended for three dimensional layered heterostructures. Based on our calculations, we present the detailed analysis of the origin of local spin-orbit torques and persistent charge currents around the impurity, that give rise to spin-orbit torques even in equilibrium and explain the existence of anisotropy.

  3. Band structure and orbital character of monolayer MoS2 with eleven-band tight-binding model

    NASA Astrophysics Data System (ADS)

    Shahriari, Majid; Ghalambor Dezfuli, Abdolmohammad; Sabaeian, Mohammad

    2018-02-01

    In this paper, based on a tight-binding (TB) model, first we present the calculations of eigenvalues as band structure and then present the eigenvectors as probability amplitude for finding electron in atomic orbitals for monolayer MoS2 in the first Brillouin zone. In these calculations we are considering hopping processes between the nearest-neighbor Mo-S, the next nearest-neighbor in-plan Mo-Mo, and the next nearest-neighbor in-plan and out-of-plan S-S atoms in a three-atom based unit cell of two-dimensional rhombic MoS2. The hopping integrals have been solved in terms of Slater-Koster and crystal field parameters. These parameters are calculated by comparing TB model with the density function theory (DFT) in the high-symmetry k-points (i.e. the K- and Γ-points). In our TB model all the 4d Mo orbitals and the 3p S orbitals are considered and detailed analysis of the orbital character of each energy level at the main high-symmetry points of the Brillouin zone is described. In comparison with DFT calculations, our results of TB model show a very good agreement for bands near the Fermi level. However for other bands which are far from the Fermi level, some discrepancies between our TB model and DFT calculations are observed. Upon the accuracy of Slater-Koster and crystal field parameters, on the contrary of DFT, our model provide enough accuracy to calculate all allowed transitions between energy bands that are very crucial for investigating the linear and nonlinear optical properties of monolayer MoS2.

  4. Temperature and magnetic field effects on electron transport through DNA molecules in a two-dimensional four-channel system.

    PubMed

    Joe, Yong S; Lee, Sun H; Hedin, Eric R; Kim, Young D

    2013-06-01

    We utilize a two-dimensional four-channel DNA model, with a tight-binding (TB) Hamiltonian, and investigate the temperature and the magnetic field dependence of the transport behavior of a short DNA molecule. Random variation of the hopping integrals due to the thermal structural disorder, which partially destroy phase coherence of electrons and reduce quantum interference, leads to a reduction of the localization length and causes suppressed overall transmission. We also incorporate a variation of magnetic field flux density into the hopping integrals as a phase factor and observe Aharonov-Bohm (AB) oscillations in the transmission. It is shown that for non-zero magnetic flux, the transmission zero leaves the real-energy axis and moves up into the complex-energy plane. We also point out that the hydrogen bonds between the base pair with flux variations play a role to determine the periodicity of AB oscillations in the transmission.

  5. 2D Quantum Simulation of MOSFET Using the Non Equilibrium Green's Function Method

    NASA Technical Reports Server (NTRS)

    Svizhenko, Alexel; Anantram, M. P.; Govindan, T. R.; Yan, Jerry (Technical Monitor)

    2000-01-01

    The objectives this viewgraph presentation summarizes include: (1) the development of a quantum mechanical simulator for ultra short channel MOSFET simulation, including theory, physical approximations, and computer code; (2) explore physics that is not accessible by semiclassical methods; (3) benchmarking of semiclassical and classical methods; and (4) study other two-dimensional devices and molecular structure, from discretized Hamiltonian to tight-binding Hamiltonian.

  6. Ti(IV) and the Siderophore Desferrioxamine B: A Tight Complex Has Biological and Environmental Implications.

    PubMed

    Jones, Kayleigh E; Batchler, Kathleen L; Zalouk, Célia; Valentine, Ann M

    2017-02-06

    The siderophore desferrioxamine B (DFOB) binds Ti(IV) tightly and precludes its hydrolytic precipitation under biologically and environmentally relevant conditions. This interaction of DFOB with Ti(IV) is investigated by using spectro-potentiometric and spectro-photometric titrations, mass spectrometry, isothermal titration calorimetry (ITC), and computational modeling. The data from pH 2-10 suggest two one-proton equilibria among three species, with one species predominating below pH 3.5, a second from pH 3.5 to 8, and a third above pH 8. The latter species is prone to slow hydrolytic precipitation. Electrospray mass spectrometry allowed the detection of [Ti(IV) (HDFOB)] 2+ and [Ti(DFOB)] + ; these species were assigned as the pH < 3.5 and the 3.5 < pH < 8 species, respectively. The stability constant for Ti(IV)-DFOB was determined by using UV/vis-monitored competition with ethylenediaminetetraacetic acid (EDTA). Taking into consideration the available binding constant of Ti(IV) and EDTA, the data reveal values of log β 111 = 41.7, log β 110 = 38.1, and log β 11-1 = 30.1. The former value was supported by ITC, with the transfer of Ti(IV) from EDTA to DFOB determined to be both enthalpically and entropically favorable. Computational methods yielded a model of Ti-DFOB. The physiological and environmental implications of this tight interaction and the potential role of DFOB in solubilizing Ti(IV) are discussed.

  7. The tight binding model study of the role of band filling on the charge gap in graphene-on-substrate in paramagnetic state

    NASA Astrophysics Data System (ADS)

    Panda, Rudrashish; Sahu, Sivabrata; Rout, G. C.

    2017-05-01

    We communicate here a tight binding theoretical model study of the band filling effect on the charge gap in graphene-on-substrate. The Hamiltonian consists of nearest neighbor electron hopping and substrate induced gap. Besides this the Coulomb interaction is considered here within mean-field approximation in the paramagnetic limit. The electron occupancies at two sublattices are calculated by Green's function technique and are solved self consistently. Finally the charge gap i.e. Δ ¯=U [ < na > -< nb > ] is calculated and computed numerically. The results are reported.

  8. Tight-binding model for borophene and borophane

    NASA Astrophysics Data System (ADS)

    Nakhaee, M.; Ketabi, S. A.; Peeters, F. M.

    2018-03-01

    Starting from the simplified linear combination of atomic orbitals method in combination with first-principles calculations, we construct a tight-binding (TB) model in the two-centre approximation for borophene and hydrogenated borophene (borophane). The Slater and Koster approach is applied to calculate the TB Hamiltonian of these systems. We obtain expressions for the Hamiltonian and overlap matrix elements between different orbitals for the different atoms and present the SK coefficients in a nonorthogonal basis set. An anisotropic Dirac cone is found in the band structure of borophane. We derive a Dirac low-energy Hamiltonian and compare the Fermi velocities with that of graphene.

  9. A complex mechanism determines polarity of DNA replication fork arrest by the replication terminator complex of Bacillus subtilis.

    PubMed

    Duggin, Iain G; Matthews, Jacqueline M; Dixon, Nicholas E; Wake, R Gerry; Mackay, Joel P

    2005-04-01

    Two dimers of the replication terminator protein (RTP) of Bacillus subtilis bind to a chromosomal DNA terminator site to effect polar replication fork arrest. Cooperative binding of the dimers to overlapping half-sites within the terminator is essential for arrest. It was suggested previously that polarity of fork arrest is the result of the RTP dimer at the blocking (proximal) side within the complex binding very tightly and the permissive-side RTP dimer binding relatively weakly. In order to investigate this "differential binding affinity" model, we have constructed a series of mutant terminators that contain half-sites of widely different RTP binding affinities in various combinations. Although there appeared to be a correlation between binding affinity at the proximal half-site and fork arrest efficiency in vivo for some terminators, several deviated significantly from this correlation. Some terminators exhibited greatly reduced binding cooperativity (and therefore have reduced affinity at each half-site) but were highly efficient in fork arrest, whereas one terminator had normal affinity over the proximal half-site, yet had low fork arrest efficiency. The results show clearly that there is no direct correlation between the RTP binding affinity (either within the full complex or at the proximal half-site within the full complex) and the efficiency of replication fork arrest in vivo. Thus, the differential binding affinity over the proximal and distal half-sites cannot be solely responsible for functional polarity of fork arrest. Furthermore, efficient fork arrest relies on features in addition to the tight binding of RTP to terminator DNA.

  10. Spin-orbit coupling, electron transport and pairing instabilities in two-dimensional square structures

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kocharian, Armen N.; Fernando, Gayanath W.; Fang, Kun

    Rashba spin-orbit effects and electron correlations in the two-dimensional cylindrical lattices of square geometries are assessed using mesoscopic two-, three- and four-leg ladder structures. Here the electron transport properties are systematically calculated by including the spin-orbit coupling in tight binding and Hubbard models threaded by a magnetic flux. These results highlight important aspects of possible symmetry breaking mechanisms in square ladder geometries driven by the combined effect of a magnetic gauge field spin-orbit interaction and temperature. The observed persistent current, spin and charge polarizations in the presence of spin-orbit coupling are driven by separation of electron and hole charges andmore » opposite spins in real-space. The modeled spin-flip processes on the pairing mechanism induced by the spin-orbit coupling in assembled nanostructures (as arrays of clusters) engineered in various two-dimensional multi-leg structures provide an ideal playground for understanding spatial charge and spin density inhomogeneities leading to electron pairing and spontaneous phase separation instabilities in unconventional superconductors. Such studies also fall under the scope of current challenging problems in superconductivity and magnetism, topological insulators and spin dependent transport associated with numerous interfaces and heterostructures.« less

  11. Effective mass in bilayer graphene at low carrier densities: The role of potential disorder and electron-electron interaction

    NASA Astrophysics Data System (ADS)

    Li, J.; Tan, L. Z.; Zou, K.; Stabile, A. A.; Seiwell, D. J.; Watanabe, K.; Taniguchi, T.; Louie, Steven G.; Zhu, J.

    2016-10-01

    In a two-dimensional electron gas, the electron-electron interaction generally becomes stronger at lower carrier densities and renormalizes the Fermi-liquid parameters, such as the effective mass of carriers. We combine experiment and theory to study the effective masses of electrons and holes me* and mh* in bilayer graphene in the low carrier density regime on the order of 1 ×1011c m-2 . Measurements use temperature-dependent low-field Shubnikov-de Haas oscillations observed in high-mobility hexagonal boron nitride supported samples. We find that while me* follows a tight-binding description in the whole density range, mh* starts to drop rapidly below the tight-binding description at a carrier density of n =6 ×1011c m-2 and exhibits a strong suppression of 30% when n reaches 2 ×1011c m-2 . Contributions from the electron-electron interaction alone, evaluated using several different approximations, cannot explain the experimental trend. Instead, the effect of the potential fluctuation and the resulting electron-hole puddles play a crucial role. Calculations including both the electron-electron interaction and disorder effects explain the experimental data qualitatively and quantitatively. This Rapid Communication reveals an unusual disorder effect unique to two-dimensional semimetallic systems.

  12. Structural analysis of the binding modes of minor groove ligands comprised of disubstituted benzenes

    PubMed Central

    Hawkins, Cheryl A.; Watson, Charles; Yan, Yinfa; Gong, Bing; Wemmer, David E.

    2001-01-01

    Two-dimensional homonuclear NMR was used to characterize synthetic DNA minor groove-binding ligands in complexes with oligonucleotides containing three different A-T binding sites. The three ligands studied have a C2 axis of symmetry and have the same general structural motif of a central para-substituted benzene ring flanked by two meta-substituted rings, giving the molecules a crescent shape. As with other ligands of this shape, specificity seems to arise from a tight fit in the narrow minor groove of the preferred A-T-rich sequences. We found that these ligands slide between binding subsites, behavior attributed to the fact that all of the amide protons in the ligand backbone cannot hydrogen bond to the minor groove simultaneously. PMID:11160926

  13. Calculation of the Energy-Band Structure of the Kronig-Penney Model Using the Nearly-Free and Tightly-Bound-Electron Approximations

    ERIC Educational Resources Information Center

    Wetsel, Grover C., Jr.

    1978-01-01

    Calculates the energy-band structure of noninteracting electrons in a one-dimensional crystal using exact and approximate methods for a rectangular-well atomic potential. A comparison of the two solutions as a function of potential-well depth and ratio of lattice spacing to well width is presented. (Author/GA)

  14. Grain-Boundary Resistance in Copper Interconnects: From an Atomistic Model to a Neural Network

    NASA Astrophysics Data System (ADS)

    Valencia, Daniel; Wilson, Evan; Jiang, Zhengping; Valencia-Zapata, Gustavo A.; Wang, Kuang-Chung; Klimeck, Gerhard; Povolotskyi, Michael

    2018-04-01

    Orientation effects on the specific resistance of copper grain boundaries are studied systematically with two different atomistic tight-binding methods. A methodology is developed to model the specific resistance of grain boundaries in the ballistic limit using the embedded atom model, tight- binding methods, and nonequilibrium Green's functions. The methodology is validated against first-principles calculations for thin films with a single coincident grain boundary, with 6.4% deviation in the specific resistance. A statistical ensemble of 600 large, random structures with grains is studied. For structures with three grains, it is found that the distribution of specific resistances is close to normal. Finally, a compact model for grain-boundary-specific resistance is constructed based on a neural network.

  15. Symmetry and optical selection rules in graphene quantum dots

    NASA Astrophysics Data System (ADS)

    Pohle, Rico; Kavousanaki, Eleftheria G.; Dani, Keshav M.; Shannon, Nic

    2018-03-01

    Graphene quantum dots (GQD's) have optical properties which are very different from those of an extended graphene sheet. In this paper, we explore how the size, shape, and edge structure of a GQD affect its optical conductivity. Using representation theory, we derive optical selection rules for regular-shaped dots, starting from the symmetry properties of the current operator. We find that, where the x and y components of the current operator transform with the same irreducible representation (irrep) of the point group (for example in triangular or hexagonal GQD's), the optical conductivity is independent of the polarization of the light. On the other hand, where these components transform with different irreps (for example in rectangular GQD's), the optical conductivity depends on the polarization of light. We carry out explicit calculations of the optical conductivity of GQD's described by a simple tight-binding model and, for dots of intermediate size, find an absorption peak in the low-frequency range of the spectrum which allows us to distinguish between dots with zigzag and armchair edges. We also clarify the one-dimensional nature of states at the Van Hove singularity in graphene, providing a possible explanation for very high exciton-binding energies. Finally, we discuss the role of atomic vacancies and shape asymmetry.

  16. First-principles modeling of the thermoelectric properties of SrTiO3/SrRuO3 superlattices

    NASA Astrophysics Data System (ADS)

    García-Fernández, Pablo; Verissimo-Alves, Marcos; Bilc, Daniel I.; Ghosez, Philippe; Junquera, Javier

    2012-08-01

    Using a combination of first-principles simulations, based on density functional theory and Boltzmann's semiclassical theory, we have calculated the transport and thermoelectric properties of the half-metallic two-dimensional electron gas confined in single SrRuO3 layers of SrTiO3/SrRuO3 periodic superlattices. Close to the Fermi energy, we find that the semiconducting majority-spin channel displays a very large in-plane component of the Seebeck tensor at room temperature, S˜ 1500 μV/K, and the minority-spin channel shows good in-plane conductivity, σ=2.5 (mΩ cm)-1. However, we find that the total power factor and thermoelectric figure of merit for reduced doping is too small for practical applications. Our results support that the confinement of the electronic motion is not the only thing that matters to describe the main features of the transport and thermoelectric properties with respect the chemical doping, but the shape of the electronic density of states, which in our case departs from the free-electron behavior, is also important. The evolution of the electronic structure, electrical conductivity, Seebeck coefficient, and power factor as a function of the chemical potential is explained by a simplified tight-binding model. We find that the electron gas in our system is composed by a pair of one-dimensional electron gases orthogonal to each other. This reflects the fact the physical dimensionality of the electronic system (1D) can be even smaller than that of the spacial confinement of the carriers (2D).

  17. Hybrid k .p tight-binding model for intersubband optics in atomically thin InSe films

    NASA Astrophysics Data System (ADS)

    Magorrian, S. J.; Ceferino, A.; Zólyomi, V.; Fal'ko, V. I.

    2018-04-01

    We propose atomic films of n -doped γ -InSe as a platform for intersubband optics in the infrared and far-infrared range, coupled to out-of-plane polarized light. Depending on the film thickness (number of layers) and the amount of n -doping of the InSe film, these transitions span from ˜0.7 eV for bilayer to ˜0.05 eV for 15-layer InSe. We use a hybrid k .p theory and tight-binding model, fully parametrized using density-functional theory, to predict their oscillator strengths and thermal linewidths at room temperature.

  18. The tight binding model study of the role of anisotropic AFM spin ordering in the charge ordered CMR manganites

    NASA Astrophysics Data System (ADS)

    Kar, J. K.; Panda, Saswati; Rout, G. C.

    2017-05-01

    We propose here a tight binding model study of the interplay between charge and spin orderings in the CMR manganites taking anisotropic effect due to electron hoppings and spin exchanges. The Hamiltonian consists of the kinetic energies of eg and t2g electrons of manganese ion. It further includes double exchange and Heisenberg interactions. The charge density wave interaction (CDW) describes an extra mechanism for the insulating character of the system. The CDW gap and spin parameters are calculated using Zubarev's Green's function technique and computed self-consistently. The results are reported in this communication.

  19. How actin binds and assembles onto plasma membranes from Dictyostelium discoideum

    PubMed Central

    1988-01-01

    We have shown previously (Schwartz, M. A., and E. J. Luna. 1986. J. Cell Biol. 102: 2067-2075) that actin binds with positive cooperativity to plasma membranes from Dictyostelium discoideum. Actin is polymerized at the membrane surface even at concentrations well below the critical concentration for polymerization in solution. Low salt buffer that blocks actin polymerization in solution also prevents actin binding to membranes. To further explore the relationship between actin polymerization and binding to membranes, we prepared four chemically modified actins that appear to be incapable of polymerizing in solution. Three of these derivatives also lost their ability to bind to membranes. The fourth derivative (EF actin), in which histidine-40 is labeled with ethoxyformic anhydride, binds to membranes with reduced affinity. Binding curves exhibit positive cooperativity, and cross- linking experiments show that membrane-bound actin is multimeric. Thus, binding and polymerization are tightly coupled, and the ability of these membranes to polymerize actin is dramatically demonstrated. EF actin coassembles weakly with untreated actin in solution, but coassembles well on membranes. Binding by untreated actin and EF actin are mutually competitive, indicating that they bind to the same membrane sites. Hill plots indicate that an actin trimer is the minimum assembly state required for tight binding to membranes. The best explanation for our data is a model in which actin oligomers assemble by binding to clustered membrane sites with successive monomers on one side of the actin filament bound to the membrane. Individual binding affinities are expected to be low, but the overall actin-membrane avidity is high, due to multivalency. Our results imply that extracellular factors that cluster membrane proteins may create sites for the formation of actin nuclei and thus trigger actin polymerization in the cell. PMID:3392099

  20. Quasiparticle Energies and Band Gaps in Graphene Nanoribbons

    NASA Astrophysics Data System (ADS)

    Yang, Li; Park, Cheol-Hwan; Son, Young-Woo; Cohen, Marvin L.; Louie, Steven G.

    2007-11-01

    We present calculations of the quasiparticle energies and band gaps of graphene nanoribbons (GNRs) carried out using a first-principles many-electron Green’s function approach within the GW approximation. Because of the quasi-one-dimensional nature of a GNR, electron-electron interaction effects due to the enhanced screened Coulomb interaction and confinement geometry greatly influence the quasiparticle band gap. Compared with previous tight-binding and density functional theory studies, our calculated quasiparticle band gaps show significant self-energy corrections for both armchair and zigzag GNRs, in the range of 0.5 3.0 eV for ribbons of width 2.4 0.4 nm. The quasiparticle band gaps found here suggest that use of GNRs for electronic device components in ambient conditions may be viable.

  1. The tightly bound nuclei in the liquid drop model

    NASA Astrophysics Data System (ADS)

    Sree Harsha, N. R.

    2018-05-01

    In this paper, we shall maximise the binding energy per nucleon function in the semi-empirical mass formula of the liquid drop model of the atomic nuclei to analytically prove that the mean binding energy per nucleon curve has local extrema at A ≈ 58.6960, Z ≈ 26.3908 and at A ≈ 62.0178, Z ≈ 27.7506. The Lagrange method of multipliers is used to arrive at these results, while we have let the values of A and Z take continuous fractional values. The shell model that shows why 62Ni is the most tightly bound nucleus is outlined. A brief account on stellar nucleosynthesis is presented to show why 56Fe is more abundant than 62Ni and 58Fe. We believe that the analytical proof presented in this paper can be a useful tool to the instructors to introduce the nucleus with the highest mean binding energy per nucleon.

  2. Loose coupling in the bacterial flagellar motor

    PubMed Central

    Boschert, Ryan; Adler, Frederick R.; Blair, David F.

    2015-01-01

    Physiological properties of the flagellar rotary motor have been taken to indicate a tightly coupled mechanism in which each revolution is driven by a fixed number of energizing ions. Measurements that would directly test the tight-coupling hypothesis have not been made. Energizing ions flow through membrane-bound complexes formed from the proteins MotA and MotB, which are anchored to the cell wall and constitute the stator. Genetic and biochemical evidence points to a “power stroke” mechanism in which the ions interact with an aspartate residue of MotB to drive conformational changes in MotA that are transmitted to the rotor protein FliG. Each stator complex contains two separate ion-binding sites, raising the question of whether the power stroke is driven by one, two, or either number of ions. Here, we describe simulations of a model in which the conformational change can be driven by either one or two ions. This loosely coupled model can account for the observed physiological properties of the motor, including those that have been taken to indicate tight coupling; it also accords with recent measurements of motor torque at high load that are harder to explain in tight-coupling models. Under loads relevant to a swimming cell, the loosely coupled motor would perform about as well as a two-proton motor and significantly better than a one-proton motor. The loosely coupled motor is predicted to be especially advantageous under conditions of diminished energy supply, or of reduced temperature, turning faster than an obligatorily two-proton motor while using fewer ions. PMID:25825730

  3. Dpb11 may function with RPA and DNA to initiate DNA replication.

    PubMed

    Bruck, Irina; Dhingra, Nalini; Martinez, Matthew P; Kaplan, Daniel L

    2017-01-01

    Dpb11 is required for the initiation of DNA replication in budding yeast. We found that Dpb11 binds tightly to single-stranded DNA (ssDNA) or branched DNA structures, while its human homolog, TopBP1, binds tightly to branched-DNA structures. We also found that Dpb11 binds stably to CDK-phosphorylated RPA, the eukaryotic ssDNA binding protein, in the presence of branched DNA. A Dpb11 mutant specifically defective for DNA binding did not exhibit tight binding to RPA in the presence of DNA, suggesting that Dpb11-interaction with DNA may promote the recruitment of RPA to melted DNA. We then characterized a mutant of Dpb11 that is specifically defective in DNA binding in budding yeast cells. Expression of dpb11-m1,2,3,5,ΔC results in a substantial decrease in RPA recruitment to origins, suggesting that Dpb11 interaction with DNA may be required for RPA recruitment to origins. Expression of dpb11-m1,2,3,5,ΔC also results in diminished GINS interaction with Mcm2-7 during S phase, while Cdc45 interaction with Mcm2-7 is like wild-type. The reduced GINS interaction with Mcm2-7 may be an indirect consequence of diminished origin melting. We propose that the tight interaction between Dpb11, CDK-phosphorylated RPA, and branched-DNA may be required for the essential function of stabilizing melted origin DNA in vivo. We also propose an alternative model, wherein Dpb11-DNA interaction is required for some other function in DNA replication initiation, such as helicase activation.

  4. Correspondence between a shaken honeycomb lattice and the Haldane model

    NASA Astrophysics Data System (ADS)

    Modugno, Michele; Pettini, Giulio

    2017-11-01

    We investigate the correspondence between the tight-binding Floquet Hamiltonian of a periodically modulated honeycomb lattice and the Haldane model. We show that—though the two systems share the same topological phase diagram, as reported in a breakthrough experiment with ultracold atoms in a stretched honeycomb lattice [G. Jotzu et al., Nature (London) 515, 237 (2014), 10.1038/nature13915]—the corresponding Hamiltonians are not equivalent, the one of the shaken lattice presenting a much richer structure.

  5. The role of leak air in a double-wall chimney

    NASA Astrophysics Data System (ADS)

    Lichtenegger, Klaus; Hebenstreit, Babette; Pointner, Christian; Schmidl, Christoph; Höftberger, Ernst

    2015-06-01

    In modern buildings with tight shells, often room-independent air supply is required for proper operation of biomass stoves. One possibility to arrange this supply is to use a double-wall chimney with flue gas leaving through the pipe and fresh air entering through the annular gap. A one-dimensional quasi-static model based on balance equations has been developed and compared with experimental data. Inclusion of leak air is crucial for reproduction of the experimental results.

  6. Influence of magnetic disorders on quantum anomalous Hall effect in magnetic topological insulator films beyond the two-dimensional limit

    NASA Astrophysics Data System (ADS)

    Xing, Yanxia; Xu, Fuming; Cheung, King Tai; Sun, Qing-feng; Wang, Jian; Yao, Yugui

    2018-04-01

    Quantum anomalous Hall effect (QAHE) has been experimentally realized in magnetic topological insulator (MTI) thin films fabricated on magnetically doped {({{Bi}},{{Sb}})}2{{{Te}}}3. In an MTI thin film with the magnetic easy axis along the normal direction (z-direction), orientations of magnetic dopants are randomly distributed around the magnetic easy axis, acting as magnetic disorders. With the aid of the non-equilibrium Green's function and Landauer–Büttiker formalism, we numerically study the influence of magnetic disorders on QAHE in an MTI thin film modeled by a three-dimensional tight-binding Hamiltonian. It is found that, due to the existence of gapless side surface states, QAHE is protected even in the presence of magnetic disorders as long as the z-component of magnetic moment of all magnetic dopants are positive. More importantly, such magnetic disorders also suppress the dissipation of the chiral edge states and enhance the quality of QAHE in MTI films. In addition, the effect of magnetic disorders depends very much on the film thickness, and the optimal influence is achieved at certain thickness. These findings are new features for QAHE in three-dimensional systems, not present in two-dimensional systems.

  7. Surface alloy engineering in 2D trigonal lattice: giant Rashba spin splitting and two large topological gaps

    NASA Astrophysics Data System (ADS)

    Liu, Zhao; Jin, Yingdi; Yang, Yuchen; Wang, Z. F.; Yang, Jinlong

    2018-02-01

    We demonstrate that sp 2 based trigonal lattice can exhibit giant Rashba splitting and two large topological gaps simultaneously. First, an effective tight binding model is developed to describe the Rashba spin-orbit coupling (SOC) on a real surface and give a topological phase diagram based on two independent SOC parameters. Second, based on density functional theory calculations, it is proposed that Au/Si(111)-\\sqrt{3}× \\sqrt{3} surface with 1/3 monolayer Bi coverage is a good material candidate to realize both giant Rashba splitting and two large topological gaps. These results would inspire great research interests for searching two-dimensional topological insulator and manipulating Rashba spin splitting through surface alloy engineering.

  8. Spin-orbit torque in a three-dimensional topological insulator-ferromagnet heterostructure: Crossover between bulk and surface transport

    NASA Astrophysics Data System (ADS)

    Ghosh, S.; Manchon, A.

    2018-04-01

    Current-driven spin-orbit torques are investigated in a heterostructure composed of a ferromagnet deposited on top of a three-dimensional topological insulator using the linear response formalism. We develop a tight-binding model of the heterostructure adopting a minimal interfacial hybridization scheme that promotes induced magnetic exchange on the topological surface states, as well as induced Rashba-like spin-orbit coupling in the ferromagnet. Therefore our model accounts for the spin Hall effect from bulk states together with inverse spin galvanic and magnetoelectric effects at the interface on equal footing. By varying the transport energy across the band structure, we uncover a crossover from surface-dominated to bulk-dominated transport regimes. We show that the spin density profile and the nature of the spin-orbit torques differ substantially in both regimes. Our results, which compare favorably with experimental observations, demonstrate that the large dampinglike torque reported recently is more likely attributed to the Berry curvature of interfacial states, while spin Hall torque remains small even in the bulk-dominated regime.

  9. Interplay between topology and disorder in a two-dimensional semi-Dirac material

    NASA Astrophysics Data System (ADS)

    Sriluckshmy, P. V.; Saha, Kush; Moessner, Roderich

    2018-01-01

    We investigate the role of disorder in a two-dimensional semi-Dirac material characterized by a linear dispersion in one direction and a parabolic dispersion in the orthogonal direction. Using the self-consistent Born approximation, we show that disorder can drive a topological Lifshitz transition from an insulator to a semimetal, as it generates a momentum-independent off-diagonal contribution to the self-energy. Breaking time-reversal symmetry enriches the topological phase diagram with three distinct regimes—single-node trivial, two-node trivial, and two-node Chern. We find that disorder can drive topological transitions from both the single- and two-node trivial to the two-node Chern regime. We further analyze these transitions in an appropriate tight-binding Hamiltonian of an anisotropic hexagonal lattice by calculating the real-space Chern number. Additionally, we compute the disorder-averaged entanglement entropy which signals both the topological Lifshitz and Chern transition as a function of the anisotropy of the hexagonal lattice. Finally, we discuss experimental aspects of our results.

  10. Effect of the degree of disorder on electronic and optical properties in random superlattices

    NASA Technical Reports Server (NTRS)

    Wang, E. G.; Su, W. P.; Ting, C. S.

    1994-01-01

    A three-dimensional tight-binding calculation is developed and used to study disorder effects in a realistic random superlattice. With increasing disorder, a tendency of possible indirect-direct band-gap transition is suggested. Direct evidence of mobility edges between localized and extended states in three-dimensional random systems is given. As system disorder increases, the optical absorption intensities increase dramatically from five to forty-five times stronger than the ordered (GaAs)(sub 1)/(AlAs)(sub 1) superlattice. It is believed that the degree of disorder significantly affects electronic and optical properties of GaAs/AlAs random superlattices.

  11. Three-dimensional structure and dynamics of wine tannin-saliva protein complexes. A multitechnique approach.

    PubMed

    Simon, Cécile; Barathieu, Karine; Laguerre, Michel; Schmitter, Jean-Marie; Fouquet, Eric; Pianet, Isabelle; Dufourc, Erick J

    2003-09-09

    The interactions between the B3 (catechin-4alpha,8-catechin) red wine tannin and the human salivary protein fragment IB7(14) (SPPGKPQGPPPQGG) were monitored by (1)H magic angle spinning NMR, circular dichroism, electrospray ionization mass spectrometry, and molecular modeling. It is found that the secondary structure of IB7(14) is made of a type II helix (collagen helix) and random coil. The central glycine 8 appears to act as a flexible rotula separating two helix II regions. Three tannin molecules tightly complex the peptide, without modifying its secondary structure, but seem to reduce its conformational dynamics. The binding dissociation constant is in the millimolar range. B3 tannins with a "tweezers" conformation bind to the hydrophilic side of the saliva peptide, suggesting that the principal driving forces toward association are governed by hydrogen bonding between the carbonyl functions of proline residues and both the phenol and catechol OH groups. These findings are further discussed in the frame of an astringency phenomenon.

  12. Pairing tendencies in a two-orbital Hubbard model in one dimension

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Patel, Niravkumar D.; Nocera, Adriana; Alvarez, Gonzalo

    The recent discovery of superconductivity under high pressure in the ladder compound BaFe2S3 has opened a new field of research in iron-based superconductors with focus on quasi-one-dimensional geometries. In this publication, using the density matrix renormalization group technique, we study a two-orbital Hubbard model defined in one-dimensional chains. Our main result is the presence of hole binding tendencies at intermediate Hubbard U repulsion and robust Hund coupling JH / U = 0.25. Binding does not occur either in weak coupling or at very strong coupling. The pair-pair correlations that are dominant near half-filling, or of similar strength as the chargemore » and spin correlation channels, involve hole-pair operators that are spin singlets, use nearest-neighbor sites, and employ different orbitals for each hole. As a result, the Hund coupling strength, presence of robust magnetic moments, and antiferromagnetic correlations among them are important for the binding tendencies found here.« less

  13. Tight-binding study of Si2Cn (n = 3 to 42) fullerene-like or nanodiamonds microclusters: are Si atoms isolated or adjacent?

    NASA Astrophysics Data System (ADS)

    Leleyter, M.; Olivi-Tran, N.

    2008-12-01

    We studied in tight-binding approximation involving spν hybridization (ν=2,3), some Si2Cn (n=3 to 42) microclusters. We then investigated, on one hand, fragments of fullerene-like structures (sp2), and on the other hand, nanodiamonds (sp3) of adamantane-type or a 44-atom nanodiamond (with 2 inner atoms which are assumed to play the role of bulk atoms). We compared the stabilities, i.e. the electronic energies of these clusters, according to the various positions of the 2 Si atoms. Results are very different in the two kinds of hybridization. Besides, they can be analysed according to two different points of view: either the clusters are considered as small particles with limited sizes, or they are assumed to be used as models in order to simulate the Si-atom behaviour in very larger systems. In sp2 hybridization (fullerene-like geometries), the most stable isomer is always encountered when the 2 Si atoms build a Si2 group, and this result holds for both viewpoints quoted above. Conversely, in sp3 hybridization (nanodiamonds), since Si atoms “prefer” sites having the minimum connectivity, they are never found in adjacent sites. We see that with a simple and fast computational method we can explain an experimental fact which is very interesting such as the relative position of two heteroatoms in the cluster. This enhances the generality and the fecondity in the tight binding approximation due essentially to the link between this model and the graph theory, link based on the topology of the clusters.

  14. DFTB+ and lanthanides

    NASA Astrophysics Data System (ADS)

    Hourahine, B.; Aradi, B.; Frauenheim, T.

    2010-07-01

    DFTB+ is a recent general purpose implementation of density-functional based tight binding. One of the early motivators to develop this code was to investigate lanthanide impurities in nitride semiconductors, leading to a series of successful studies into structure and electrical properties of these systems. Here we describe our general framework to treat the physical effects needed for these problematic impurities within a tight-binding formalism, additionally discussing forces and stresses in DFTB. We also present an approach to evaluate the general case of Slater-Koster transforms and all of their derivatives in Cartesian coordinates. These developments are illustrated by simulating isolated Gd impurities in GaN.

  15. Thermodynamic studies of a series of homologous HIV-1 TAR RNA ligands reveal that loose binders are stronger Tat competitors than tight ones

    PubMed Central

    Pascale, Lise; Azoulay, Stéphane; Di Giorgio, Audrey; Zenacker, Laura; Gaysinski, Marc; Clayette, Pascal; Patino, Nadia

    2013-01-01

    RNA is a major drug target, but the design of small molecules that modulate RNA function remains a great challenge. In this context, a series of structurally homologous ‘polyamide amino acids’ (PAA) was studied as HIV-1 trans-activating response (TAR) RNA ligands. An extensive thermodynamic study revealed the occurence of an enthalpy–entropy compensation phenomenon resulting in very close TAR affinities for all PAA. However, their binding modes and their ability to compete with the Tat fragment strongly differ according to their structure. Surprisingly, PAA that form loose complexes with TAR were shown to be stronger Tat competitors than those forming tight ones, and thermal denaturation studies demonstrated that loose complexes are more stable than tight ones. This could be correlated to the fact that loose and tight ligands induce distinct RNA conformational changes as revealed by circular dichroism experiments, although nuclear magnetic resonance (NMR) experiments showed that the TAR binding site is the same in all cases. Finally, some loose PAA also display promising inhibitory activities on HIV-infected cells. Altogether, these results lead to a better understanding of RNA interaction modes that could be very useful for devising new ligands of relevant RNA targets. PMID:23605042

  16. Thermodynamic studies of a series of homologous HIV-1 TAR RNA ligands reveal that loose binders are stronger Tat competitors than tight ones.

    PubMed

    Pascale, Lise; Azoulay, Stéphane; Di Giorgio, Audrey; Zenacker, Laura; Gaysinski, Marc; Clayette, Pascal; Patino, Nadia

    2013-06-01

    RNA is a major drug target, but the design of small molecules that modulate RNA function remains a great challenge. In this context, a series of structurally homologous 'polyamide amino acids' (PAA) was studied as HIV-1 trans-activating response (TAR) RNA ligands. An extensive thermodynamic study revealed the occurence of an enthalpy-entropy compensation phenomenon resulting in very close TAR affinities for all PAA. However, their binding modes and their ability to compete with the Tat fragment strongly differ according to their structure. Surprisingly, PAA that form loose complexes with TAR were shown to be stronger Tat competitors than those forming tight ones, and thermal denaturation studies demonstrated that loose complexes are more stable than tight ones. This could be correlated to the fact that loose and tight ligands induce distinct RNA conformational changes as revealed by circular dichroism experiments, although nuclear magnetic resonance (NMR) experiments showed that the TAR binding site is the same in all cases. Finally, some loose PAA also display promising inhibitory activities on HIV-infected cells. Altogether, these results lead to a better understanding of RNA interaction modes that could be very useful for devising new ligands of relevant RNA targets.

  17. Dpb11 may function with RPA and DNA to initiate DNA replication

    PubMed Central

    Bruck, Irina; Dhingra, Nalini; Martinez, Matthew P.

    2017-01-01

    Dpb11 is required for the initiation of DNA replication in budding yeast. We found that Dpb11 binds tightly to single-stranded DNA (ssDNA) or branched DNA structures, while its human homolog, TopBP1, binds tightly to branched-DNA structures. We also found that Dpb11 binds stably to CDK-phosphorylated RPA, the eukaryotic ssDNA binding protein, in the presence of branched DNA. A Dpb11 mutant specifically defective for DNA binding did not exhibit tight binding to RPA in the presence of DNA, suggesting that Dpb11-interaction with DNA may promote the recruitment of RPA to melted DNA. We then characterized a mutant of Dpb11 that is specifically defective in DNA binding in budding yeast cells. Expression of dpb11-m1,2,3,5,ΔC results in a substantial decrease in RPA recruitment to origins, suggesting that Dpb11 interaction with DNA may be required for RPA recruitment to origins. Expression of dpb11-m1,2,3,5,ΔC also results in diminished GINS interaction with Mcm2-7 during S phase, while Cdc45 interaction with Mcm2-7 is like wild-type. The reduced GINS interaction with Mcm2-7 may be an indirect consequence of diminished origin melting. We propose that the tight interaction between Dpb11, CDK-phosphorylated RPA, and branched-DNA may be required for the essential function of stabilizing melted origin DNA in vivo. We also propose an alternative model, wherein Dpb11-DNA interaction is required for some other function in DNA replication initiation, such as helicase activation. PMID:28467467

  18. Benchmarking density functional tight binding models for barrier heights and reaction energetics of organic molecules.

    PubMed

    Gruden, Maja; Andjeklović, Ljubica; Jissy, Akkarapattiakal Kuriappan; Stepanović, Stepan; Zlatar, Matija; Cui, Qiang; Elstner, Marcus

    2017-09-30

    Density Functional Tight Binding (DFTB) models are two to three orders of magnitude faster than ab initio and Density Functional Theory (DFT) methods and therefore are particularly attractive in applications to large molecules and condensed phase systems. To establish the applicability of DFTB models to general chemical reactions, we conduct benchmark calculations for barrier heights and reaction energetics of organic molecules using existing databases and several new ones compiled in this study. Structures for the transition states and stable species have been fully optimized at the DFTB level, making it possible to characterize the reliability of DFTB models in a more thorough fashion compared to conducting single point energy calculations as done in previous benchmark studies. The encouraging results for the diverse sets of reactions studied here suggest that DFTB models, especially the most recent third-order version (DFTB3/3OB augmented with dispersion correction), in most cases provide satisfactory description of organic chemical reactions with accuracy almost comparable to popular DFT methods with large basis sets, although larger errors are also seen for certain cases. Therefore, DFTB models can be effective for mechanistic analysis (e.g., transition state search) of large (bio)molecules, especially when coupled with single point energy calculations at higher levels of theory. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  19. Generating Neuron Geometries for Detailed Three-Dimensional Simulations Using AnaMorph.

    PubMed

    Mörschel, Konstantin; Breit, Markus; Queisser, Gillian

    2017-07-01

    Generating realistic and complex computational domains for numerical simulations is often a challenging task. In neuroscientific research, more and more one-dimensional morphology data is becoming publicly available through databases. This data, however, only contains point and diameter information not suitable for detailed three-dimensional simulations. In this paper, we present a novel framework, AnaMorph, that automatically generates water-tight surface meshes from one-dimensional point-diameter files. These surface triangulations can be used to simulate the electrical and biochemical behavior of the underlying cell. In addition to morphology generation, AnaMorph also performs quality control of the semi-automatically reconstructed cells coming from anatomical reconstructions. This toolset allows an extension from the classical dimension-reduced modeling and simulation of cellular processes to a full three-dimensional and morphology-including method, leading to novel structure-function interplay studies in the medical field. The developed numerical methods can further be employed in other areas where complex geometries are an essential component of numerical simulations.

  20. Investigation of electronic transport through a ladder-like graphene nanoribbon including random distributed impurities

    NASA Astrophysics Data System (ADS)

    Esmaili, Esmat; Mardaani, Mohammad; Rabani, Hassan

    2018-01-01

    The electronic transport of a ladder-like graphene nanoribbon which the on-site or hopping energies of a small part of it can be random is modeled by using the Green's function technique within the nearest neighbor tight-binding approach. We employ a unitary transformation in order to convert the Hamiltonian of the nanoribbon to the Hamiltonian of a tight-binding ladder-like network. In this case, the disturbed part of the system includes the second neighbor hopping interactions. While, the converted Hamiltonian of each ideal part is equivalent to the Hamiltonian of two periodic on-site chains. Therefore, we can insert the self-energies of the alternative on-site tight-binding chains to the inverse of the Green's function matrix of the ladder-like part. In this viewpoint, the conductance is constructed from two trans and cis contributions. The results show that increasing the disorder strength causes the increase and decrease of the conductance of the trans and cis contributions, respectively.

  1. Multi-orbit tight binding calculations for spin transfer torque in magnetic tunneling junctions

    NASA Astrophysics Data System (ADS)

    You, Chun-Yeol; Han, Jae-Ho; Lee, Hyun-Woo

    2012-04-01

    We investigate the spin transfer torque (STT) with multi-orbit tight binding model in the magnetic tunneling junctions (MTJs). So far, most of the theoretical works based on the non-equilibrium Keldysh Green's function method employ a single band model for the simplicity, except a few first principle studies. Even though the single band model captures main physics of STT in MTJ, multi-band calculation reveals new features of the STT that depend on band parameters, such as insulator bandgap, inter-band hopping energy of the ferromagnetic layer. We find that the sign change of perpendicular torkance with bandgap of the insulator layer, and when we allow the inter-band hopping, the bias dependences of perpendicular STT are dramatically changed, while no noticeable changes in parallel STT are found.

  2. Universal tight binding model for chemical reactions in solution and at surfaces. II. Water.

    PubMed

    Lozovoi, A Y; Sheppard, T J; Pashov, D L; Kohanoff, J J; Paxton, A T

    2014-07-28

    A revised water model intended for use in condensed phase simulations in the framework of the self consistent polarizable ion tight binding theory is constructed. The model is applied to water monomer, dimer, hexamers, ice, and liquid, where it demonstrates good agreement with theoretical results obtained by more accurate methods, such as DFT and CCSD(T), and with experiment. In particular, the temperature dependence of the self diffusion coefficient in liquid water predicted by the model, closely reproduces experimental curves in the temperature interval between 230 K and 350 K. In addition, and in contrast to standard DFT, the model properly orders the relative densities of liquid water and ice. A notable, but inevitable, shortcoming of the model is underestimation of the static dielectric constant by a factor of two. We demonstrate that the description of inter and intramolecular forces embodied in the tight binding approximation in quantum mechanics leads to a number of valuable insights which can be missing from ab initio quantum chemistry and classical force fields. These include a discussion of the origin of the enhanced molecular electric dipole moment in the condensed phases, and a detailed explanation for the increase of coordination number in liquid water as a function of temperature and compared with ice--leading to insights into the anomalous expansion on freezing. The theory holds out the prospect of an understanding of the currently unexplained density maximum of water near the freezing point.

  3. Hofstadter butterfly evolution in the space of two-dimensional Bravais lattices

    NASA Astrophysics Data System (ADS)

    Yılmaz, F.; Oktel, M. Ö.

    2017-06-01

    The self-similar energy spectrum of a particle in a periodic potential under a magnetic field, known as the Hofstadter butterfly, is determined by the lattice geometry as well as the external field. Recent realizations of artificial gauge fields and adjustable optical lattices in cold-atom experiments necessitate the consideration of these self-similar spectra for the most general two-dimensional lattice. In a previous work [F. Yılmaz et al., Phys. Rev. A 91, 063628 (2015), 10.1103/PhysRevA.91.063628], we investigated the evolution of the spectrum for an experimentally realized lattice which was tuned by changing the unit-cell structure but keeping the square Bravais lattice fixed. We now consider all possible Bravais lattices in two dimensions and investigate the structure of the Hofstadter butterfly as the lattice is deformed between lattices with different point-symmetry groups. We model the optical lattice with a sinusoidal real-space potential and obtain the tight-binding model for any lattice geometry by calculating the Wannier functions. We introduce the magnetic field via Peierls substitution and numerically calculate the energy spectrum. The transition between the two most symmetric lattices, i.e., the triangular and the square lattices, displays the importance of bipartite symmetry featuring deformation as well as closing of some of the major energy gaps. The transitions from the square to rectangular lattice and from the triangular to centered rectangular lattices are analyzed in terms of coupling of one-dimensional chains. We calculate the Chern numbers of the major gaps and Chern number transfer between bands during the transitions. We use gap Chern numbers to identify distinct topological regions in the space of Bravais lattices.

  4. A general intermolecular force field based on tight-binding quantum chemical calculations

    NASA Astrophysics Data System (ADS)

    Grimme, Stefan; Bannwarth, Christoph; Caldeweyher, Eike; Pisarek, Jana; Hansen, Andreas

    2017-10-01

    A black-box type procedure is presented for the generation of a molecule-specific, intermolecular potential energy function. The method uses quantum chemical (QC) information from our recently published extended tight-binding semi-empirical scheme (GFN-xTB) and can treat non-covalently bound complexes and aggregates with almost arbitrary chemical structure. The necessary QC information consists of the equilibrium structure, Mulliken atomic charges, charge centers of localized molecular orbitals, and also of frontier orbitals and orbital energies. The molecular pair potential includes model density dependent Pauli repulsion, penetration, as well as point charge electrostatics, the newly developed D4 dispersion energy model, Drude oscillators for polarization, and a charge-transfer term. Only one element-specific and about 20 global empirical parameters are needed to cover systems with nuclear charges up to radon (Z = 86). The method is tested for standard small molecule interaction energy benchmark sets where it provides accurate intermolecular energies and equilibrium distances. Examples for structures with a few hundred atoms including charged systems demonstrate the versatility of the approach. The method is implemented in a stand-alone computer code which enables rigid-body, global minimum energy searches for molecular aggregation or alignment.

  5. Quantum spin Hall phase in 2D trigonal lattice

    PubMed Central

    Wang, Z. F.; Jin, Kyung-Hwan; Liu, Feng

    2016-01-01

    The quantum spin Hall (QSH) phase is an exotic phenomena in condensed-matter physics. Here we show that a minimal basis of three orbitals (s, px, py) is required to produce a QSH phase via nearest-neighbour hopping in a two-dimensional trigonal lattice. Tight-binding model analyses and calculations show that the QSH phase arises from a spin–orbit coupling (SOC)-induced s–p band inversion or p–p bandgap opening at Brillouin zone centre (Γ point), whose topological phase diagram is mapped out in the parameter space of orbital energy and SOC. Remarkably, based on first-principles calculations, this exact model of QSH phase is shown to be realizable in an experimental system of Au/GaAs(111) surface with an SOC gap of ∼73 meV, facilitating the possible room-temperature measurement. Our results will extend the search for substrate supported QSH materials to new lattice and orbital types. PMID:27599580

  6. Effective lattice Hamiltonian for monolayer tin disulfide: Tailoring electronic structure with electric and magnetic fields

    NASA Astrophysics Data System (ADS)

    Yu, Jin; van Veen, Edo; Katsnelson, Mikhail I.; Yuan, Shengjun

    2018-06-01

    The electronic properties of monolayer tin dilsulfide (ML -Sn S2 ), a recently synthesized metal dichalcogenide, are studied by a combination of first-principles calculations and tight-binding (TB) approximation. An effective lattice Hamiltonian based on six hybrid s p -like orbitals with trigonal rotation symmetry are proposed to calculate the band structure and density of states for ML -Sn S2 , which demonstrates good quantitative agreement with relativistic density-functional-theory calculations in a wide energy range. We show that the proposed TB model can be easily applied to the case of an external electric field, yielding results consistent with those obtained from full Hamiltonian results. In the presence of a perpendicular magnetic field, highly degenerate equidistant Landau levels are obtained, showing typical two-dimensional electron gas behavior. Thus, the proposed TB model provides a simple way in describing properties in ML -Sn S2 .

  7. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Akabayov, B.; Akabayov, S; Lee , S

    Gene 5 of bacteriophage T7 encodes a DNA polymerase (gp5) responsible for the replication of the phage DNA. Gp5 polymerizes nucleotides with low processivity, dissociating after the incorporation of 1 to 50 nucleotides. Thioredoxin (trx) of Escherichia coli binds tightly (Kd = 5 nM) to a unique segment in the thumb subdomain of gp5 and increases processivity. We have probed the molecular basis for the increase in processivity. A single-molecule experiment reveals differences in rates of enzymatic activity and processivity between gp5 and gp5/trx. Small angle X-ray scattering studies combined with nuclease footprinting reveal two conformations of gp5, one inmore » the free state and one upon binding to trx. Comparative analysis of the DNA binding clefts of DNA polymerases and DNA binding proteins show that the binding surface contains more hydrophobic residues than other DNA binding proteins. The balanced composition between hydrophobic and charged residues of the binding site allows for efficient sliding of gp5/trx on the DNA. We propose a model for trx-induced conformational changes in gp5 that enhance the processivity by increasing the interaction of gp5 with DNA.« less

  8. Acoustic frequency filter based on anisotropic topological phononic crystals.

    PubMed

    Chen, Ze-Guo; Zhao, Jiajun; Mei, Jun; Wu, Ying

    2017-11-08

    We present a design of acoustic frequency filter based on a two-dimensional anisotropic phononic crystal. The anisotropic band structure exhibits either a directional or a combined (global + directional) bandgap at certain frequency regions, depending on the geometry. When the time-reversal symmetry is broken, it may introduce a topologically nontrivial bandgap. The induced nontrivial bandgap and the original directional bandgap result in various interesting wave propagation behaviors, such as frequency filter. We develop a tight-binding model to characterize the effective Hamiltonian of the system, from which the contribution of anisotropy is explicitly shown. Different from the isotropic cases, the Zeeman-type splitting is not linear and the anisotropic bandgap makes it possible to achieve anisotropic propagation characteristics along different directions and at different frequencies.

  9. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Morris, J.R.; Lu, Z.; Ring, D.M.

    We have examined a variety of structures for the {l_brace}510{r_brace} symmetric tilt boundary in Si and Ge, using tight-binding and first-principles calculations. These calculations show that the observed structure in Si is the lowest-energy structure, despite the fact that it is more complicated than what is necessary to preserve fourfold coordination. Contrary to calculations using a Tersoff potential, first-principles calculations show that the energy depends strongly upon the structure. A recently developed tight-binding model for Si produces results in very good agreement with the first-principles calculations. Electronic density of states calculations based upon this model show no evidence of midgapmore » states and little evidence of electronic states localized to the grain boundary. {copyright} {ital 1998} {ital The American Physical Society}« less

  10. III-Nitride, SiC and Diamond Materials for Electronic Devices. Symposium Held April 8-12 1996, San Francisco, California, U.S.A. Volume 423.

    DTIC Science & Technology

    1996-12-01

    gallium, nitrogen and gallium nitride structures. Thus it can be shown to be transferable and efficient for predictive molecular -dynamic simulations on...potentials and forces for the molecular dynamics simulations are derived by means of a density-functional based nonorthogonal tight-binding (DF-TB) scheme...LDA). Molecular -dynamics simulations for determining the different reconstructions of the SiC surface use the slab method (two-dimensional periodic

  11. Tight binding simulation study on zigzag single-walled carbon nanotubes

    NASA Astrophysics Data System (ADS)

    Sharma, Deepa; Jaggi, Neena; Gupta, Vishu

    2018-01-01

    Tight binding simulation studies using the density functional tight binding (DFTB) model have been performed on various zigzag single-walled carbon-nanotubes (SWCNTs) to investigate their electronic properties using DFTB module of the Material Studio Software version 7.0. Various combinations of different eigen-solvers and charge mixing schemes available in the DFTB Module have been tried to chalk out the electronic structure. The analytically deduced values of the bandgap of (9, 0) SWCNT were compared with the experimentally determined value reported in the literature. On comparison, it was found that the tight binding approximations tend to drastically underestimate the bandgap values. However, the combination of Anderson charge mixing method with standard eigensolver when implemented using the smart algorithm was found to produce fairly close results. These optimized model parameters were then used to determine the band structures of various zigzag SWCNTs. (9, 0) Single-walled Nanotube which is extensively being used for sensing NH3, CH4 and NO2 has been picked up as a reference material since its experimental bandgap value has been reported in the literature. It has been found to exhibit a finite energy bandgap in contrast to its expected metallic nature. The study is of utmost significance as it not only probes and validates the simulation route for predicting suitable properties of nanomaterials but also throws light on the comparative efficacy of the different approximation and rationalization quantum mechanical techniques used in simulation studies. Such simulation studies if used intelligently prove to be immensely useful to the material scientists as they not only save time and effort but also pave the way to new experiments by making valuable predictions.

  12. Dual binding in cohesin-dockerin complexes: the energy landscape and the role of short, terminal segments of the dockerin module.

    PubMed

    Wojciechowski, Michał; Różycki, Bartosz; Huy, Pham Dinh Quoc; Li, Mai Suan; Bayer, Edward A; Cieplak, Marek

    2018-03-22

    The assembly of the polysaccharide degradating cellulosome machinery is mediated by tight binding between cohesin and dockerin domains. We have used an empirical model known as FoldX as well as molecular mechanics methods to determine the free energy of binding between a cohesin and a dockerin from Clostridium thermocellum in two possible modes that differ by an approximately 180° rotation. Our studies suggest that the full-length wild-type complex exhibits dual binding at room temperature, i.e., the two modes of binding have comparable probabilities at equilibrium. The ability to bind in the two modes persists at elevated temperatures. However, single-point mutations or truncations of terminal segments in the dockerin result in shifting the equilibrium towards one of the binding modes. Our molecular dynamics simulations of mechanical stretching of the full-length wild-type cohesin-dockerin complex indicate that each mode of binding leads to two kinds of stretching pathways, which may be mistakenly taken as evidence of dual binding.

  13. Band warping, band non-parabolicity, and Dirac points in electronic and lattice structures

    NASA Astrophysics Data System (ADS)

    Resca, Lorenzo; Mecholsky, Nicholas A.; Pegg, Ian L.

    2017-10-01

    We illustrate at a fundamental level the physical and mathematical origins of band warping and band non-parabolicity in electronic and vibrational structures. We point out a robust presence of pairs of topologically induced Dirac points in a primitive-rectangular lattice using a p-type tight-binding approximation. We analyze two-dimensional primitive-rectangular and square Bravais lattices with implications that are expected to generalize to more complex structures. Band warping is shown to arise at the onset of a singular transition to a crystal lattice with a larger symmetry group, which allows the possibility of irreducible representations of higher dimensions, hence band degeneracy, at special symmetry points in reciprocal space. Band warping is incompatible with a multi-dimensional Taylor series expansion, whereas band non-parabolicities are associated with multi-dimensional Taylor series expansions to all orders. Still band non-parabolicities may merge into band warping at the onset of a larger symmetry group. Remarkably, while still maintaining a clear connection with that merging, band non-parabolicities may produce pairs of conical intersections at relatively low-symmetry points. Apparently, such conical intersections are robustly maintained by global topology requirements, rather than any local symmetry protection. For two p-type tight-binding bands, we find such pairs of conical intersections drifting along the edges of restricted Brillouin zones of primitive-rectangular Bravais lattices as lattice constants vary relatively to each other, until these conical intersections merge into degenerate warped bands at high-symmetry points at the onset of a square lattice. The conical intersections that we found appear to have similar topological characteristics as Dirac points extensively studied in graphene and other topological insulators, even though our conical intersections have none of the symmetry complexity and protection afforded by the latter more complex structures.

  14. Anderson localized state as a predissipative state: irreversible emission of thermalized quanta from a dynamically delocalized state.

    PubMed

    Yamada, Hiroaki; Ikeda, Kensuke S

    2002-04-01

    It was shown that localization in one-dimensional disordered (quantum) electronic system is destroyed against coherent harmonic perturbations and the delocalized electron exhibits an unlimited diffusive motion [Yamada and Ikeda, Phys. Rev. E 59, 5214 (1999)]. The appearance of diffusion implies that the system has potential for irreversibility and dissipation. In the present paper, we investigate dissipative property of the dynamically delocalized state, and we show that an irreversible quasistationary energy flow indeed appears in the form of a "heat" flow when we couple the system with another dynamical degree of freedom. In the concrete we numerically investigate dissipative properties of a one-dimensional tight-binding electronic system perturbed by time-dependent harmonic forces, by coupling it with a quantum harmonic oscillator or a quantum anharmonic oscillator. It is demonstrated that if the on-site potential is spatially irregular an irreversible energy transfer from the scattered electron to the test oscillator occurs. Moreover, the test oscillator promptly approaches a thermalized state characterized by a well-defined time-dependent temperature. On the contrary, such a relaxation process cannot be observed at all for periodic potential systems. Our system is one of the minimal quantum systems in which a distinct nonequilibrium statistical behavior is self-induced.

  15. Diffraction catastrophes and semiclassical quantum mechanics for Veselago lensing in graphene

    NASA Astrophysics Data System (ADS)

    Reijnders, K. J. A.; Katsnelson, M. I.

    2017-07-01

    We study the effect of trigonal warping on the focusing of electrons by n-p junctions in graphene. We find that perfect focusing, which was predicted for massless Dirac fermions, is only preserved for one specific lattice orientation. In the general case, trigonal warping leads to the formation of cusp caustics, with a different position of the focus for graphene's two valleys. We develop a semiclassical theory to compute these positions and find very good agreement with tight-binding simulations. Considering the transmission as a function of potential strength, we find that trigonal warping splits the single Dirac peak into two distinct peaks, leading to valley polarization. We obtain the transmission curves from tight-binding simulations and find that they are in very good agreement with the results of a billiard model that incorporates trigonal warping. Furthermore, the positions of the transmission maxima and the scaling of the peak width are accurately predicted by our semiclassical theory. Our semiclassical analysis can easily be carried over to other Dirac materials, which generally have different Fermi surface distortions.

  16. Emergent pseudospin-1 Maxwell fermions with a threefold degeneracy in optical lattices

    NASA Astrophysics Data System (ADS)

    Zhu, Yan-Qing; Zhang, Dan-Wei; Yan, Hui; Xing, Ding-Yu; Zhu, Shi-Liang

    2017-09-01

    The discovery of relativistic spin-1/2 fermions such as Dirac and Weyl fermions in condensed-matter or artificial systems opens a new era in modern physics. An interesting but rarely explored question is whether other relativistic spinal excitations could be realized with artificial systems. Here, we construct two- and three-dimensional tight-binding models realizable with cold fermionic atoms in optical lattices, where the low energy excitations are effectively described by the spin-1 Maxwell equations in the Hamiltonian form. These relativistic (linear dispersion) excitations with unconventional integer pseudospin, beyond the Dirac-Weyl-Majorana fermions, are an exotic kind of fermions named as Maxwell fermions. We demonstrate that the systems have rich topological features. For instance, the threefold degenerate points called Maxwell points may have quantized Berry phases and anomalous quantum Hall effects with spin-momentum locking may appear in topological Maxwell insulators in the two-dimensional lattices. In three dimensions, Maxwell points may have nontrivial monopole charges of ±2 with two Fermi arcs connecting them, and the merging of the Maxwell points leads to topological phase transitions. Finally, we propose realistic schemes for realizing the model Hamiltonians and detecting the topological properties of the emergent Maxwell quasiparticles in optical lattices.

  17. Fast trimers in a one-dimensional extended Fermi-Hubbard model

    NASA Astrophysics Data System (ADS)

    Dhar, A.; Törmä, P.; Kinnunen, J. J.

    2018-04-01

    We consider a one-dimensional two-component extended Fermi-Hubbard model with nearest-neighbor interactions and mass imbalance between the two species. We study the binding energy of trimers, various observables for detecting them, and expansion dynamics. We generalize the definition of the trimer gap to include the formation of different types of clusters originating from nearest-neighbor interactions. Expansion dynamics reveal rapidly propagating trimers, with speeds exceeding doublon propagation in the strongly interacting regime. We present a simple model for understanding this unique feature of the movement of the trimers, and we discuss the potential for experimental realization.

  18. Gaussian polarizable-ion tight binding.

    PubMed

    Boleininger, Max; Guilbert, Anne Ay; Horsfield, Andrew P

    2016-10-14

    To interpret ultrafast dynamics experiments on large molecules, computer simulation is required due to the complex response to the laser field. We present a method capable of efficiently computing the static electronic response of large systems to external electric fields. This is achieved by extending the density-functional tight binding method to include larger basis sets and by multipole expansion of the charge density into electrostatically interacting Gaussian distributions. Polarizabilities for a range of hydrocarbon molecules are computed for a multipole expansion up to quadrupole order, giving excellent agreement with experimental values, with average errors similar to those from density functional theory, but at a small fraction of the cost. We apply the model in conjunction with the polarizable-point-dipoles model to estimate the internal fields in amorphous poly(3-hexylthiophene-2,5-diyl).

  19. Gaussian polarizable-ion tight binding

    NASA Astrophysics Data System (ADS)

    Boleininger, Max; Guilbert, Anne AY; Horsfield, Andrew P.

    2016-10-01

    To interpret ultrafast dynamics experiments on large molecules, computer simulation is required due to the complex response to the laser field. We present a method capable of efficiently computing the static electronic response of large systems to external electric fields. This is achieved by extending the density-functional tight binding method to include larger basis sets and by multipole expansion of the charge density into electrostatically interacting Gaussian distributions. Polarizabilities for a range of hydrocarbon molecules are computed for a multipole expansion up to quadrupole order, giving excellent agreement with experimental values, with average errors similar to those from density functional theory, but at a small fraction of the cost. We apply the model in conjunction with the polarizable-point-dipoles model to estimate the internal fields in amorphous poly(3-hexylthiophene-2,5-diyl).

  20. The effects of temperature and magnetic flux on electron transport through a four-channel DNA model

    NASA Astrophysics Data System (ADS)

    Lee, Sunhee; Hedin, Eric; Joe, Yong

    2010-03-01

    The temperature dependence of the conductivity of lambda phage DNA has been measured by Tran et al [1] experimentally, where the conductivity displayed strong (weak) temperature dependence above (below) a threshold temperature. In order to understand the temperature effects of electron transport theoretically, we study a two-dimensional and four-channel DNA model using a tight-binding (TB) Hamiltonian. The thermal effects within a TB model are incorporated into the hopping integral and the relative twist angle from its equilibrium value between base-pairs. Since these thermal structural fluctuations localize the electronic wave functions in DNA, we examine a temperature-dependent localization length, a temperature-driven transmission, and current-voltage characteristics in this system. In addition, we incorporate magnetic field effects into the analysis of the transmission through DNA in order to modulate the quantum interference between the electron paths that comprise the 4-channel structure. [1] P. Tran, B. Alavi, and G. Gruner, PRL 85, 1564 (2000).

  1. Complex absorbing potential based Lorentzian fitting scheme and time dependent quantum transport.

    PubMed

    Xie, Hang; Kwok, Yanho; Jiang, Feng; Zheng, Xiao; Chen, GuanHua

    2014-10-28

    Based on the complex absorbing potential (CAP) method, a Lorentzian expansion scheme is developed to express the self-energy. The CAP-based Lorentzian expansion of self-energy is employed to solve efficiently the Liouville-von Neumann equation of one-electron density matrix. The resulting method is applicable for both tight-binding and first-principles models and is used to simulate the transient currents through graphene nanoribbons and a benzene molecule sandwiched between two carbon-atom chains.

  2. Proteomic and cellular localisation studies suggest non-tight junction cytoplasmic and nuclear roles for occludin in astrocytes.

    PubMed

    Morgan, Sarah V; Garwood, Claire J; Jennings, Luke; Simpson, Julie E; Castelli, Lydia M; Heath, Paul R; Mihaylov, Simeon R; Vaquéz-Villaseñor, Irina; Minshull, Thomas C; Ince, Paul G; Dickman, Mark J; Hautbergue, Guillaume M; Wharton, Stephen B

    2018-05-08

    Occludin is a component of tight junctions, which are essential structural components of the blood-brain barrier. However, occludin is expressed in cells without tight junctions, implying additional functions. We determined the expression and localisation of occludin in astrocytes in cell culture and in human brain tissue, and sought novel binding partners using a proteomic approach. Expression was investigated by immunocytochemistry and immunoblotting in the 1321N1 astrocytoma cell line and ScienCell human primary astrocytes, and by immunohistochemistry in human autopsy brain tissue. Recombinant N- and C-terminal occludin was used to pull-down proteins from 1321N1 cell lysates and protein-binding partners identified by mass spectrometry analysis. Occludin was expressed in both the cytoplasm and nucleus of astrocytes in vitro and in vivo. Mass spectrometry identified binding to nuclear and cytoplasmic proteins, particularly those related to RNA metabolism and nuclear function. Occludin is expressed in several subcellular compartments of brain cell-types that do not form tight junctions and the expression patterns in cell culture reflect those in human brain tissue, indicating they are suitable model systems. Proteomic analysis suggests that occludin has novel functions in neuroepithelial cells that are unrelated to tight junction formation. Further research will establish the roles of these functions in both cellular physiology and in disease states. © 2018 The Authors. European Journal of Neuroscience published by Federation of European Neuroscience Societies and John Wiley & Sons Ltd.

  3. Identification of Tight-Binding Plasmepsin II and Falcipain 2 Inhibitors in Aqueous Extracts of Marine Invertebrates by the Combination of Enzymatic and Interaction-Based Assays

    PubMed Central

    Salas-Sarduy, Emir; Guerra, Yasel; Covaleda Cortés, Giovanni; Avilés, Francesc Xavier; Chávez Planes, María A.

    2017-01-01

    Natural products from marine origin constitute a very promising and underexplored source of interesting compounds for modern biotechnological and pharmaceutical industries. However, their evaluation is quite challenging and requires specifically designed assays to reliably identify the compounds of interest in a highly heterogeneous and interfering context. In the present study, we describe a general strategy for the confident identification of tight-binding protease inhibitors in the aqueous extracts of 62 Cuban marine invertebrates, using Plasmodium falciparum hemoglobinases Plasmepsin II and Falcipain 2 as model enzymes. To this end, we first developed a screening strategy that combined enzymatic with interaction-based assays and then validated screening conditions using five reference extracts. Interferences were evaluated and minimized. The results from the massive screening of such extracts, the validation of several hits by a variety of interaction-based assays and the purification and functional characterization of PhPI, a multifunctional and reversible tight-binding inhibitor for Plasmepsin II and Falcipain 2 from the gorgonian Plexaura homomalla, are presented. PMID:28430158

  4. Low-Symmetry Gap Functions of Organic Superconductors

    NASA Astrophysics Data System (ADS)

    Mori, Takehiko

    2018-04-01

    Superconducting gap functions of various low-symmetry organic superconductors are investigated starting from the tight-binding energy band and the random phase approximation by numerically solving Eliashberg's equation. The obtained singlet gap function is approximately represented by an asymmetrical dx2 - y2 form, where two cosine functions are mixed in an appropriate ratio. This is usually called d + s wave, where the ratio of the two cosine functions varies from 1:1 in the two-dimensional limit to 1:0 in the one-dimensional limit. A single cosine function does not make a superconducting gap in an ideal one-dimensional conductor, but works as a relevant gap function in quasi-one-dimensional conductors with slight interchain transfer integrals. Even when the Fermi surface is composed of small pockets, the gap function is obtained supposing a globally connected elliptical Fermi surface. In such a case, we have to connect the second energy band in the second Brillouin zone. The periodicity of the resulting gap function is larger than the first Brillouin zone. This is because the susceptibility has peaks at 2kF, where the periodicity has to be twice the size of the global Fermi surface. In general, periodicity of gap function corresponds to one electron or two molecules in the real space. In the κ-phase, two axes are nonequivalent, but the exact dx2 - y2 symmetry is maintained because the diagonal transfer integral introduced to a square lattice is oriented to the node direction of the dx2 - y2 wave. By contrast, the θ-phase gap function shows considerable anisotropy because a quarter-filled square lattice has a different dxy symmetry.

  5. Electron-phonon effects in graphene and an armchair (10,10) single-wall carbon nanotube

    NASA Astrophysics Data System (ADS)

    Woods, Lilia Milcheva Rapatinska

    New effects due to the electron-phonon interaction in some low-dimensional tight-binding systems are discussed. A sheet of graphite (two-dimensional) and an armchair single wall carbon nanotube (SWNT) (quasi-one dimensional) are taken as examples. The geometrical structure and the linear dispersion of the energy with respect to the electron wave vector are expected to play a significant role. For the ordinary electron-phonon coupling which includes modulated hopping and linear electron-phonon interaction the matrix elements for both systems are derived in the context of a two parameter model for the phonon vibrational spectrum. It is found that they (for both structures) strongly depend on the geometry, display a deformation type of potential and are reduced by a factor of (1 - R), where R depends uniquely on the introduced phonon parameters. Next a new type of interaction is derived; it arises from the phonon modulation of the electron-electron interaction. After writing the matrix elements for the new Hamiltonian, the problem is considered in the context of many body physics. There are two contributions. One of them is the random phase approximation with one phonon line. The electron self-energy for it is calculated. It is shown that one might expect that this is not a large effect. Analytical expressions are obtained for the armchair single wall carbon nanotube. The exchange interaction in the one-phonon approximation is another term that arises and is also considered. One is able to write four new Feynman diagrams and derive an expression for -ImSk⃗ . The contribution from this type of coupling could be large and comparable to the one from the modulated hopping. These results are supported by numerical estimates of some characteristics of graphene and SWNT. The values of the electron-phonon coupling constant, lambda, and the electron lifetime, tau, are compared between the traditional electron-phonon interaction and the phonon modulated electron-electron interaction. Finally, for a perfect (defect-free) arm chair SWNT the diffusion thermopower and the phonon drag thermopower should be zero because of the complete symmetry of the energy bands of the system.

  6. Generalized virial theorem for massless electrons in graphene and other Dirac materials

    NASA Astrophysics Data System (ADS)

    Sokolik, A. A.; Zabolotskiy, A. D.; Lozovik, Yu. E.

    2016-05-01

    The virial theorem for a system of interacting electrons in a crystal, which is described within the framework of the tight-binding model, is derived. We show that, in the particular case of interacting massless electrons in graphene and other Dirac materials, the conventional virial theorem is violated. Starting from the tight-binding model, we derive the generalized virial theorem for Dirac electron systems, which contains an additional term associated with a momentum cutoff at the bottom of the energy band. Additionally, we derive the generalized virial theorem within the Dirac model using the minimization of the variational energy. The obtained theorem is illustrated by many-body calculations of the ground-state energy of an electron gas in graphene carried out in Hartree-Fock and self-consistent random-phase approximations. Experimental verification of the theorem in the case of graphene is discussed.

  7. New Computational Approach to Electron Transport in Irregular Graphene Nanostructures

    NASA Astrophysics Data System (ADS)

    Mason, Douglas; Heller, Eric; Prendergast, David; Neaton, Jeffrey

    2009-03-01

    For novel graphene devices of nanoscale-to-macroscopic scale, many aspects of their transport properties are not easily understood due to difficulties in fabricating devices with regular edges. Here we develop a framework to efficiently calculate and potentially screen electronic transport properties of arbitrary nanoscale graphene device structures. A generalization of the established recursive Green's function method is presented, providing access to arbitrary device and lead geometries with substantial computer-time savings. Using single-orbital nearest-neighbor tight-binding models and the Green's function-Landauer scattering formalism, we will explore the transmission function of irregular two-dimensional graphene-based nanostructures with arbitrary lead orientation. Prepared by LBNL under contract DE-AC02-05CH11231 and supported by the U.S. Dept. of Energy Computer Science Graduate Fellowship under grant DE-FG02-97ER25308.

  8. Spin Hall Effect and Weak Antilocalization in Graphene/Transition Metal Dichalcogenide Heterostructures.

    PubMed

    Garcia, Jose H; Cummings, Aron W; Roche, Stephan

    2017-08-09

    We report on a theoretical study of the spin Hall Effect (SHE) and weak antilocalization (WAL) in graphene/transition metal dichalcogenide (TMDC) heterostructures, computed through efficient real-space quantum transport methods, and using realistic tight-binding models parametrized from ab initio calculations. The graphene/WS 2 system is found to maximize spin proximity effects compared to graphene on MoS 2 , WSe 2 , or MoSe 2 with a crucial role played by disorder, given the disappearance of SHE signals in the presence of strong intervalley scattering. Notably, we found that stronger WAL effects are concomitant with weaker charge-to-spin conversion efficiency. For further experimental studies of graphene/TMDC heterostructures, our findings provide guidelines for reaching the upper limit of spin current formation and for fully harvesting the potential of two-dimensional materials for spintronic applications.

  9. Bloch oscillations in organic and inorganic polymers

    NASA Astrophysics Data System (ADS)

    Ribeiro, Luiz Antonio; Ferreira da Cunha, Wiliam; de Almeida Fonseca, Antonio Luciano; e Silva, Geraldo Magela

    2017-04-01

    The transport of polarons above the mobility threshold in organic and inorganic polymers is theoretically investigated in the framework of a one-dimensional tight-binding model that includes lattice relaxation. The computational approach is based on parameters for which the model Hamiltonian suitably describes different polymer lattices in the presence of external electric fields. Our findings show that, above critical field strengths, a dissociated polaron moves through the polymer lattice as a free electron performing Bloch oscillations. These critical electric fields are considerably smaller for inorganic lattices in comparison to organic polymers. Interestingly, for inorganic lattices, the free electron propagates preserving charge and spin densities' localization which is a characteristic of a static polaron. Moreover, in the turning points of the spatial Bloch oscillations, transient polaron levels are formed inside the band gap, thus generating a fully characterized polaron structure. For the organic case, on the other hand, no polaron signature is observed: neither in the shape of the distortion—those polaron profile signatures are absent—nor in the energy levels—as no such polaron levels are formed during the simulation. These results solve controversial aspects concerning Bloch oscillations recently reported in the literature and may enlighten the understanding about the charge transport mechanism in polymers above their mobility edge.

  10. A pseudoreceptor modelling study of the varicella-zoster virus and human thymidine kinase binding sites

    NASA Astrophysics Data System (ADS)

    Greenidge, Paulette A.; Merz, Alfred; Folkers, Gerd

    1995-12-01

    A representative range of pyrimidine nucleoside analogues that are known to inhibit herpes simplex virus (HSV) replication have been used to construct receptor binding site models for the varicella-zoster virus (VZV), thymidine kinase (TK) and human TK1. Given a set of interacting ligands, superimposed in such a manner as to define a pharmacophore, the pseudoreceptor modelling technique Yak provides a means of building binding site models of macromolecules for which no three-dimensional experimental structures are available. Once the models have been evaluated by their ability to reproduce experimental binding data [Vedani et al., J. Am. Chem. Soc., 117 (1995) 4987], they can be used for predictive purposes. Calculated and experimental values of relative binding affinity are compared. Our models suggest that the substitution of one residue may be sufficient to determine ligand subtype affinity.

  11. Modeling Magnetic Properties in EZTB

    NASA Technical Reports Server (NTRS)

    Lee, Seungwon; vonAllmen, Paul

    2007-01-01

    A software module that calculates magnetic properties of a semiconducting material has been written for incorporation into, and execution within, the Easy (Modular) Tight-Binding (EZTB) software infrastructure. [EZTB is designed to model the electronic structures of semiconductor devices ranging from bulk semiconductors, to quantum wells, quantum wires, and quantum dots. EZTB implements an empirical tight-binding mathematical model of the underlying physics.] This module can model the effect of a magnetic field applied along any direction and does not require any adjustment of model parameters. The module has thus far been applied to study the performances of silicon-based quantum computers in the presence of magnetic fields and of miscut angles in quantum wells. The module is expected to assist experimentalists in fabricating a spin qubit in a Si/SiGe quantum dot. This software can be executed in almost any Unix operating system, utilizes parallel computing, can be run as a Web-portal application program. The module has been validated by comparison of its predictions with experimental data available in the literature.

  12. Analytic and numeric Green's functions for a two-dimensional electron gas in an orthogonal magnetic field

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cresti, Alessandro; Grosso, Giuseppe; Parravicini, Giuseppe Pastori

    2006-05-15

    We have derived closed analytic expressions for the Green's function of an electron in a two-dimensional electron gas threaded by a uniform perpendicular magnetic field, also in the presence of a uniform electric field and of a parabolic spatial confinement. A workable and powerful numerical procedure for the calculation of the Green's functions for a large infinitely extended quantum wire is considered exploiting a lattice model for the wire, the tight-binding representation for the corresponding matrix Green's function, and the Peierls phase factor in the Hamiltonian hopping matrix element to account for the magnetic field. The numerical evaluation of themore » Green's function has been performed by means of the decimation-renormalization method, and quite satisfactorily compared with the analytic results worked out in this paper. As an example of the versatility of the numerical and analytic tools here presented, the peculiar semilocal character of the magnetic Green's function is studied in detail because of its basic importance in determining magneto-transport properties in mesoscopic systems.« less

  13. Coupling effect of topological states and Chern insulators in two-dimensional triangular lattices

    NASA Astrophysics Data System (ADS)

    Zhang, Jiayong; Zhao, Bao; Xue, Yang; Zhou, Tong; Yang, Zhongqin

    2018-03-01

    We investigate topological states of two-dimensional (2D) triangular lattices with multiorbitals. Tight-binding model calculations of a 2D triangular lattice based on px and py orbitals exhibit very interesting doubly degenerate energy points at different positions (Γ and K /K' ) in momentum space, with quadratic non-Dirac and linear Dirac band dispersions, respectively. Counterintuitively, the system shows a global topologically trivial rather than nontrivial state with consideration of spin-orbit coupling due to the "destructive interference effect" between the topological states at the Γ and K /K' points. The topologically nontrivial state can emerge by introducing another set of triangular lattices to the system (bitriangular lattices) due to the breakdown of the interference effect. With first-principles calculations, we predict an intrinsic Chern insulating behavior (quantum anomalous Hall effect) in a family of the 2D triangular lattice metal-organic framework of Co(C21N3H15) (TPyB-Co) from this scheme. Our results provide a different path and theoretical guidance for the search for and design of new 2D topological quantum materials.

  14. Quasiparticle dynamics and spin-orbital texture of the SrTiO3 two-dimensional electron gas.

    PubMed

    King, P D C; McKeown Walker, S; Tamai, A; de la Torre, A; Eknapakul, T; Buaphet, P; Mo, S-K; Meevasana, W; Bahramy, M S; Baumberger, F

    2014-02-27

    Two-dimensional electron gases (2DEGs) in SrTiO3 have become model systems for engineering emergent behaviour in complex transition metal oxides. Understanding the collective interactions that enable this, however, has thus far proved elusive. Here we demonstrate that angle-resolved photoemission can directly image the quasiparticle dynamics of the d-electron subband ladder of this complex-oxide 2DEG. Combined with realistic tight-binding supercell calculations, we uncover how quantum confinement and inversion symmetry breaking collectively tune the delicate interplay of charge, spin, orbital and lattice degrees of freedom in this system. We reveal how they lead to pronounced orbital ordering, mediate an orbitally enhanced Rashba splitting with complex subband-dependent spin-orbital textures and markedly change the character of electron-phonon coupling, co-operatively shaping the low-energy electronic structure of the 2DEG. Our results allow for a unified understanding of spectroscopic and transport measurements across different classes of SrTiO3-based 2DEGs, and yield new microscopic insights on their functional properties.

  15. Maximally localized Wannier functions in LaMnO3 within PBE + U, hybrid functionals and partially self-consistent GW: an efficient route to construct ab initio tight-binding parameters for eg perovskites.

    PubMed

    Franchini, C; Kováčik, R; Marsman, M; Murthy, S Sathyanarayana; He, J; Ederer, C; Kresse, G

    2012-06-13

    Using the newly developed VASP2WANNIER90 interface we have constructed maximally localized Wannier functions (MLWFs) for the e(g) states of the prototypical Jahn-Teller magnetic perovskite LaMnO(3) at different levels of approximation for the exchange-correlation kernel. These include conventional density functional theory (DFT) with and without the additional on-site Hubbard U term, hybrid DFT and partially self-consistent GW. By suitably mapping the MLWFs onto an effective e(g) tight-binding (TB) Hamiltonian we have computed a complete set of TB parameters which should serve as guidance for more elaborate treatments of correlation effects in effective Hamiltonian-based approaches. The method-dependent changes of the calculated TB parameters and their interplay with the electron-electron (el-el) interaction term are discussed and interpreted. We discuss two alternative model parameterizations: one in which the effects of the el-el interaction are implicitly incorporated in the otherwise 'noninteracting' TB parameters and a second where we include an explicit mean-field el-el interaction term in the TB Hamiltonian. Both models yield a set of tabulated TB parameters which provide the band dispersion in excellent agreement with the underlying ab initio and MLWF bands.

  16. Three-Dimensional Structures Reveal Multiple ADP/ATP Binding Modes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    C Simmons; C Magee; D Smith

    The creation of synthetic enzymes with predefined functions represents a major challenge in future synthetic biology applications. Here, we describe six structures of de novo proteins that have been determined using protein crystallography to address how simple enzymes perform catalysis. Three structures are of a protein, DX, selected for its stability and ability to tightly bind ATP. Despite the addition of ATP to the crystallization conditions, the presence of a bound but distorted ATP was found only under excess ATP conditions, with ADP being present under equimolar conditions or when crystallized for a prolonged period of time. A bound ADPmore » cofactor was evident when Asp was substituted for Val at residue 65, but ATP in a linear configuration is present when Phe was substituted for Tyr at residue 43. These new structures complement previously determined structures of DX and the protein with the Phe 43 to Tyr substitution [Simmons, C. R., et al. (2009) ACS Chem. Biol. 4, 649-658] and together demonstrate the multiple ADP/ATP binding modes from which a model emerges in which the DX protein binds ATP in a configuration that represents a transitional state for the catalysis of ATP to ADP through a slow, metal-free reaction capable of multiple turnovers. This unusual observation suggests that design-free methods can be used to generate novel protein scaffolds that are tailor-made for catalysis.« less

  17. FAST TRACK COMMUNICATION: Finite-temperature magnetism in bcc Fe under compression

    NASA Astrophysics Data System (ADS)

    Sha, Xianwei; Cohen, R. E.

    2010-09-01

    We investigate the contributions of finite-temperature magnetic fluctuations to the thermodynamic properties of bcc Fe as functions of pressure. First, we apply a tight-binding total-energy model parameterized to first-principles linearized augmented plane-wave computations to examine various ferromagnetic, anti-ferromagnetic, and noncollinear spin spiral states at zero temperature. The tight-binding data are fit to a generalized Heisenberg Hamiltonian to describe the magnetic energy functional based on local moments. We then use Monte Carlo simulations to compute the magnetic susceptibility, the Curie temperature, heat capacity, and magnetic free energy. Including the finite-temperature magnetism improves the agreement with experiment for the calculated thermal expansion coefficients.

  18. Interactions of 2’-O-methyl oligoribonucleotides with the RNA models of the 30S subunit A-site

    PubMed Central

    Jasiński, Maciej; Kulik, Marta; Wojciechowska, Monika; Stolarski, Ryszard

    2018-01-01

    Synthetic oligonucleotides targeting functional regions of the prokaryotic rRNA could be promising antimicrobial agents. Indeed, such oligonucleotides were proven to inhibit bacterial growth. 2’-O-methylated (2’-O-Me) oligoribonucleotides with a sequence complementary to the decoding site in 16S rRNA were reported as inhibitors of bacterial translation. However, the binding mode and structures of the formed complexes, as well as the level of selectivity of the oligonucleotides between the prokaryotic and eukaryotic target, were not determined. We have analyzed three 2’-O-Me oligoribonucleotides designed to hybridize with the models of the prokaryotic rRNA containing two neighboring aminoglycoside binding pockets. One pocket is the paromomycin/kanamycin binding site corresponding to the decoding site in the small ribosomal subunit and the other one is the close-by hygromycin B binding site whose dynamics has not been previously reported. Molecular dynamics (MD) simulations, as well as isothermal titration calorimetry, gel electrophoresis and spectroscopic studies have shown that the eukaryotic rRNA model is less conformationally stable (in terms of hydrogen bonds and stacking interactions) than the corresponding prokaryotic one. In MD simulations of the eukaryotic construct, the nucleotide U1498, which plays an important role in correct positioning of mRNA during translation, is flexible and spontaneously flips out into the solvent. In solution studies, the 2’-O-Me oligoribonucleotides did not interact with the double stranded rRNA models but all formed stable complexes with the single-stranded prokaryotic target. 2’-O-Me oligoribonucleotides with one and two mismatches bound less tightly to the eukaryotic target. This shows that at least three mismatches between the 2’-O-Me oligoribonucleotide and eukaryotic rRNA are required to ensure target selectivity. The results also suggest that, in the ribosome environment, the strand invasion is the preferred binding mode of 2’-O-Me oligoribonucleotides targeting the aminoglycoside binding sites in 16S rRNA. PMID:29351348

  19. Functionalized Fullerene Targeting Human Voltage-Gated Sodium Channel, hNav1.7.

    PubMed

    Hilder, Tamsyn A; Robinson, Anna; Chung, Shin-Ho

    2017-08-16

    Mutations of hNa v 1.7 that cause its activities to be enhanced contribute to severe neuropathic pain. Only a small number of hNa v 1.7 specific inhibitors have been identified, most of which interact with the voltage-sensing domain of the voltage-activated sodium ion channel. In our previous computational study, we demonstrated that a [Lys 6 ]-C 84 fullerene binds tightly (affinity of 46 nM) to Na v Ab, the voltage-gated sodium channel from the bacterium Arcobacter butzleri. Here, we extend this work and, using molecular dynamics simulations, demonstrate that the same [Lys 6 ]-C 84 fullerene binds strongly (2.7 nM) to the pore of a modeled human sodium ion channel hNa v 1.7. In contrast, the fullerene binds only weakly to a mutated model of hNa v 1.7 (I1399D) (14.5 mM) and a model of the skeletal muscle hNa v 1.4 (3.7 mM). Comparison of one representative sequence from each of the nine human sodium channel isoforms shows that only hNa v 1.7 possesses residues that are critical for binding the fullerene derivative and blocking the channel pore.

  20. Microwave emulations and tight-binding calculations of transport in polyacetylene

    NASA Astrophysics Data System (ADS)

    Stegmann, Thomas; Franco-Villafañe, John A.; Ortiz, Yenni P.; Kuhl, Ulrich; Mortessagne, Fabrice; Seligman, Thomas H.

    2017-01-01

    A novel approach to investigate the electron transport of cis- and trans-polyacetylene chains in the single-electron approximation is presented by using microwave emulation measurements and tight-binding calculations. In the emulation we take into account the different electronic couplings due to the double bonds leading to coupled dimer chains. The relative coupling constants are adjusted by DFT calculations. For sufficiently long chains a transport band gap is observed if the double bonds are present, whereas for identical couplings no band gap opens. The band gap can be observed also in relatively short chains, if additional edge atoms are absent, which cause strong resonance peaks within the band gap. The experimental results are in agreement with our tight-binding calculations using the nonequilibrium Green's function method. The tight-binding calculations show that it is crucial to include third nearest neighbor couplings to obtain the gap in the cis-polyacetylene.

  1. Membrane association of the PTEN tumor suppressor: electrostatic interaction with phosphatidylserine-containing bilayers and regulatory role of the C-terminal tail.

    PubMed

    Shenoy, Siddharth S; Nanda, Hirsh; Lösche, Mathias

    2012-12-01

    The phosphatidylinositolphosphate phosphatase PTEN is the second most frequently mutated protein in human tumors. Its membrane association, allosteric activation and membrane dissociation are poorly understood. We recently reported PTEN binding affinities to membranes of different compositions (Shenoy et al., 2012, PLoS ONE 7, e32591) and a preliminary investigation of the protein-membrane complex with neutron reflectometry (NR). Here we use NR to validate molecular dynamics (MD) simulations of the protein and study conformational differences of the protein in solution and on anionic membranes. NR shows that full-length PTEN binds to such membranes roughly in the conformation and orientation suggested by the crystal structure of a truncated PTEN protein, in contrast with a recently presented model which suggested that membrane binding depends critically on the SUMOylation of the CBR3 loop of PTEN's C2 domain. Our MD simulations confirm that PTEN is peripherally bound to the bilayer surface and show slight differences of the protein structure in solution and in the membrane-bound state, where the protein body flattens against the bilayer surface. PTEN's C2 domain binds phosphatidylserine (PS) tightly through its CBR3 loop, and its phosphatase domain also forms electrostatic interactions with PS. NR and MD results show consistently that PTEN's unstructured, anionic C-terminal tail is repelled from the bilayer surface. In contrast, this tail is tightly tugged against the C2 domain in solution, partially obstructing the membrane-binding interface of the protein. Arresting the C-terminal tail in this conformation by phosphorylation may provide a control mechanism for PTEN's membrane binding and activity. Copyright © 2012 Elsevier Inc. All rights reserved.

  2. The tight junction protein ZO-1 and an interacting transcription factor regulate ErbB-2 expression

    PubMed Central

    Balda, Maria S.; Matter, Karl

    2000-01-01

    Epithelial tight junctions regulate paracellular diffusion and restrict the intermixing of apical and basolateral plasma membrane components. We now identify a Y-box transcription factor, ZONAB (ZO-1-associated nucleic acid-binding protein), that binds to the SH3 domain of ZO-1, a submembrane protein of tight junctions. ZONAB localizes to the nucleus and at tight junctions, and binds to sequences of specific promoters containing an inverted CCAAT box. In reporter assays, ZONAB and ZO-1 functionally interact in the regulation of the ErbB-2 promoter in a cell density-dependent manner. In stably transfected overexpressing cells, ZO-1 and ZONAB control expression of endogenous ErbB-2 and function in the regulation of paracellular permeability. These data indicate that tight junctions directly participate in the control of gene expression and suggest that they function in the regulation of epithelial cell differentiation. PMID:10790369

  3. Majorana quasiparticles in semiconducting carbon nanotubes

    NASA Astrophysics Data System (ADS)

    Marganska, Magdalena; Milz, Lars; Izumida, Wataru; Strunk, Christoph; Grifoni, Milena

    2018-02-01

    Engineering effective p -wave superconductors hosting Majorana quasiparticles (MQPs) is nowadays of particular interest, also in view of the possible utilization of MQPs in fault-tolerant topological quantum computation. In quasi-one-dimensional systems, the parameter space for topological superconductivity is significantly reduced by the coupling between transverse modes. Together with the requirement of achieving the topological phase under experimentally feasible conditions, this strongly restricts in practice the choice of systems which can host MQPs. Here, we demonstrate that semiconducting carbon nanotubes (CNTs) in proximity with ultrathin s -wave superconductors, e.g., exfoliated NbSe2, satisfy these needs. By precise numerical tight-binding calculations in the real space, we show the emergence of localized zero-energy states at the CNT ends above a critical value of the applied magnetic field, of which we show the spatial evolution. Knowing the microscopic wave functions, we unequivocally demonstrate the Majorana nature of the localized states. An effective four-band model in the k -space, with parameters determined from the numerical spectrum, is used to calculate the topological phase diagram and its phase boundaries in analytic form. Finally, the impact of symmetry breaking contributions, like disorder and an axial component of the magnetic field, is investigated.

  4. Intrinsic quantum spin Hall and anomalous Hall effects in h-Sb/Bi epitaxial growth on a ferromagnetic MnO2 thin film.

    PubMed

    Zhou, Jian; Sun, Qiang; Wang, Qian; Kawazoe, Yoshiyuki; Jena, Puru

    2016-06-07

    Exploring a two-dimensional intrinsic quantum spin Hall state with a large band gap as well as an anomalous Hall state in realizable materials is one of the most fundamental and important goals for future applications in spintronics, valleytronics, and quantum computing. Here, by combining first-principles calculations with a tight-binding model, we predict that Sb or Bi can epitaxially grow on a stable and ferromagnetic MnO2 thin film substrate, forming a flat honeycomb sheet. The flatness of Sb or Bi provides an opportunity for the existence of Dirac points in the Brillouin zone, with its position effectively tuned by surface hydrogenation. The Dirac points in spin up and spin down channels split due to the proximity effects induced by MnO2. In the presence of both intrinsic and Rashba spin-orbit coupling, we find two band gaps exhibiting a large band gap quantum spin Hall state and a nearly quantized anomalous Hall state which can be tuned by adjusting the Fermi level. Our findings provide an efficient way to realize both quantized intrinsic spin Hall conductivity and anomalous Hall conductivity in a single material.

  5. Effects of polarons on static polarizabilities and second order hyperpolarizabilities of conjugated polymers

    NASA Astrophysics Data System (ADS)

    Wang, Ya-Dong; Meng, Yan; Di, Bing; Wang, Shu-Ling; An, Zhong

    2010-12-01

    According to the one-dimensional tight-binding Su—Schrieffer—Heeger model, we have investigated the effects of charged polarons on the static polarizability, αxx, and the second order hyperpolarizabilities, γxxxx, of conjugated polymers. Our results are consistent qualitatively with previous ab initio and semi-empirical calculations. The origin of the universal growth is discussed using a local-view formalism that is based on the local atomic charge derivatives. Furthermore, combining the Su-Schrieffer-Heeger model and the extended Hubbard model, we have investigated systematically the effects of electron-electron interactions on αxx and γxxxx of charged polymer chains. For a fixed value of the nearest-neighbour interaction V, the values of αxx and γxxxx increase as the on-site Coulomb interaction U increases for U < Uc and decrease with U for U > Uc, where Uc is a critical value of U at which the static polarizability or the second order hyperpolarizability reaches a maximal value of αmax or γmax. It is found that the effect of the e-e interaction on the value of αxx is dependent on the ratio between U and V for either a short or a long charged polymer. Whereas, that effect on the value of γxxxx is sensitive both to the ratio of U to V and to the size of the molecule.

  6. Transferable tight binding model for strained group IV and III-V heterostructures

    NASA Astrophysics Data System (ADS)

    Tan, Yaohua; Povolotskyi, Micheal; Kubis, Tillmann; Boykin, Timothy; Klimeck, Gerhard

    Modern semiconductor devices have reached critical device dimensions in the range of several nanometers. For reliable prediction of device performance, it is critical to have a numerical efficient model that are transferable to material interfaces. In this work, we present an empirical tight binding (ETB) model with transferable parameters for strained IV and III-V group semiconductors. The ETB model is numerically highly efficient as it make use of an orthogonal sp3d5s* basis set with nearest neighbor inter-atomic interactions. The ETB parameters are generated from HSE06 hybrid functional calculations. Band structures of strained group IV and III-V materials by ETB model are in good agreement with corresponding HSE06 calculations. Furthermore, the ETB model is applied to strained superlattices which consist of group IV and III-V elements. The ETB model turns out to be transferable to nano-scale hetero-structure. The ETB band structures agree with the corresponding HSE06 results in the whole Brillouin zone. The ETB band gaps of superlattices with common cations or common anions have discrepancies within 0.05eV.

  7. Formation of fivefold axes in the FCC-metal nanoclusters

    NASA Astrophysics Data System (ADS)

    Myasnichenko, Vladimir S.; Starostenkov, Mikhail D.

    2012-11-01

    Formation of atomistic structures of metallic Cu, Au, Ag clusters and bimetallic Cu-Au clusters was studied with the help of molecular dynamics using the many-body tight-binding interatomic potential. The simulation of the crystallization process of clusters with the number of atoms ranging from 300 to 1092 was carried out. The most stable configurations of atoms in the system, corresponding to the minimum of potential energy, was found during super-fast cooling from 1000 K. Atoms corresponding to fcc, hcp, and Ih phases were identified by the method of common neighbor analysis. Incomplete icosahedral core can be discovered at the intersection of one of the Ih axes with the surface of monometallic cluster. The decahedron-shaped structure of bimetallic Cu-Au cluster with seven completed icosahedral cores was obtained. The principles of the construction of small bimetallic clusters with icosahedral symmetry and increased fractal dimensionality were offered.

  8. Quantum spin Hall phase in 2D trigonal lattice

    DOE PAGES

    Wang, Z. F.; Jin, Kyung -Hwan; Liu, Feng

    2016-09-07

    The quantum spin Hall (QSH) phase is an exotic phenomena in condensed-matter physics. Here we show that a minimal basis of three orbitals (s, p x, p y) is required to produce a QSH phase via nearest-neighbour hopping in a two-dimensional trigonal lattice. Tight-binding model analyses and calculations show that the QSH phase arises from a spin–orbit coupling (SOC)-induced s–p band inversion or p–p bandgap opening at Brillouin zone centre (Γ point), whose topological phase diagram is mapped out in the parameter space of orbital energy and SOC. Remarkably, based on first-principles calculations, this exact model of QSH phase ismore » shown to be realizable in an experimental system of Au/GaAs(111) surface with an SOC gap of ~73 meV, facilitating the possible room-temperature measurement. Finally, our results will extend the search for substrate supported QSH materials to new lattice and orbital types.« less

  9. Nonlinear susceptibilities of finite conjugated organic polymers

    NASA Technical Reports Server (NTRS)

    Beratan, David N.; Onuchic, Jose Nelson; Perry, Joseph W.

    1987-01-01

    Tight-binding calculations of the length dependence of the third-order molecular hyperpolarizability for polyenes and polyynes are reported. The pi-electron wave functions were determined by exploiting the limited translational symmetry of the molecules. Perturbation theory was used to calculate the longitudinal component of the electronic nonresonant hyperpolarizability. This is the first two-'band' calculation of third-order hyperpolarizabilities on finite pi-electron systems of varying length. In contrast to the results of the one-'band' models, the hyperpolarizability densities increase rapidly and then, after about 10-15 repeating units, approach an asymptotic value.

  10. Influence of gap states on the nonresonant second hyperpolarizabilities of conjugated organic polymers

    NASA Technical Reports Server (NTRS)

    Beratan, David N.

    1989-01-01

    The presence of conjugation and substitution defects introduces gap states in finite polyenes that are shown to influence the size and sign of the second molecular hyperpolarizability (SMH). Using a one-electron tight-binding model, the dependence of SMH on the defect-state occupancy and energy in finite polyenes is calculated. Defects can cause a significant decrease or enhancement of SMH by impeding charge delocalization or by creating partly filled bands (mimicking the one-band limit), respectively. Concomitant sign changes in SMH are predicted. Calculation results suggest strategies for designing molecules that can be either photochemically or electrochemically switched between states with considerably different SMHs.

  11. Simulation studies of carbon nanotube field-effect transistors

    NASA Astrophysics Data System (ADS)

    John, David Llewellyn

    Simulation studies of carbon nanotube field-effect transistors (CNFETs) are presented using models of increasing rigour and versatility that have been systematically developed. Firstly, it is demonstrated how one may compute the standard tight-binding band structure. From this foundation, a self-consistent solution for computing the equilibrium energy band diagram of devices with Schottky-barrier source and drain contacts is developed. While this does provide insight into the likely behaviour of CNFETs, a non-equilibrium model is required in order to predict the current-voltage relation. To this end, the effective-mass approximation is utilized, where a parabolic fit to the band structure is used in order to develop a Schrodinger-Poisson solver. This model is employed to predict both DC behaviour and switching times for CNFETs, and was one of the first models that captured quantum effects, such as tunneling and resonance, in these devices. In addition, this model has been used in order to validate compact models that incorporated tunneling via the WKB approximation. A modified WKB derivation is provided in order to account for the non-zero reflection of carriers above a potential energy step. In order to allow for greater flexibility in the CNFET geometries, and to lift the effective-mass approximation, a non-equilibrium Green's function method is finally developed, which uses an atomistic tight-binding Hamiltonian to model doped-contact, as opposed to Schottky-barrier-contact, devices. This approach benefits by being able to account for both inter- and intra-band tunneling, and by utilizing a quadratic matrix equation in order to improve the computation time for the required self-energy matrices. Within this technique, an expression for the local inter-atomic current is derived in order to provide more detailed information than the usual compact expression for the terminal current. With this final model, an investigation is presented into the effects of geometrical variations, contact thicknesses, and azimuthal variation in the surface potential of the nanotube.

  12. Voltage dependency of transmission probability of aperiodic DNA molecule

    NASA Astrophysics Data System (ADS)

    Wiliyanti, V.; Yudiarsah, E.

    2017-07-01

    Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

  13. Tailoring Dirac Fermions in Molecular Graphene

    NASA Astrophysics Data System (ADS)

    Gomes, Kenjiro K.; Mar, Warren; Ko, Wonhee; Camp, Charlie D.; Rastawicki, Dominik K.; Guinea, Francisco; Manoharan, Hari C.

    2012-02-01

    The dynamics of electrons in solids is tied to the band structure created by a periodic atomic potential. The design of artificial lattices, assembled through atomic manipulation, opens the door to engineer electronic band structure and to create novel quantum states. We present scanning tunneling spectroscopic measurements of a nanoassembled honeycomb lattice displaying a Dirac fermion band structure. The artificial lattice is created by atomic manipulation of single CO molecules with the scanning tunneling microscope on the surface of Cu(111). The periodic potential generated by the assembled CO molecules reshapes the band structure of the two-dimensional electron gas, present as a surface state of Cu(111), into a ``molecular graphene'' system. We create local defects in the lattice to observe the quasiparticle interference patterns that unveil the underlying band structure. We present direct comparison between the tunneling data, first-principles calculations of the band structure, and tight-binding models.

  14. Plasmon excitations in doped square-lattice atomic clusters

    NASA Astrophysics Data System (ADS)

    Wang, Yaxin; Yu, Ya-Bin

    2017-12-01

    Employing the tight-binding model, we theoretically study the properties of the plasmon excitations in doped square-lattice atomic clusters. The results show that the dopant atoms would blur the absorption spectra, and give rise to extra plasmon resonant peaks as reported in the literature; however, our calculated external-field induced oscillating charge density shows that no obvious evidences indicate the so-called local mode of plasmon appearing in two-dimensional-doped atomic clusters, but the dopants may change the symmetry of the charge distribution. Furthermore, we show that the disorder of the energy level due to dopant makes the absorption spectrum has a red- or blue-shift, which depends on the position of impurities; disorder of hopping due to dopant makes a blue- or red-shift, a larger (smaller) hopping gives a blue-shift (red-shift); and a larger (smaller) host-dopant and dopant-dopant intersite coulomb repulsion induces a blue-shift (red-shift).

  15. Interface engineering of quantum Hall effects in digital transition metal oxide heterostructures.

    PubMed

    Xiao, Di; Zhu, Wenguang; Ran, Ying; Nagaosa, Naoto; Okamoto, Satoshi

    2011-12-20

    Topological insulators are characterized by a non-trivial band topology driven by the spin-orbit coupling. To fully explore the fundamental science and application of topological insulators, material realization is indispensable. Here we predict, based on tight-binding modelling and first-principles calculations, that bilayers of perovskite-type transition-metal oxides grown along the [111] crystallographic axis are potential candidates for two-dimensional topological insulators. The topological band structure of these materials can be fine-tuned by changing dopant ions, substrates and external gate voltages. We predict that LaAuO(3) bilayers have a topologically non-trivial energy gap of about 0.15 eV, which is sufficiently large to realize the quantum spin Hall effect at room temperature. Intriguing phenomena, such as fractional quantum Hall effect, associated with the nearly flat topologically non-trivial bands found in e(g) systems are also discussed.

  16. Angular dependence of spin-orbit spin-transfer torques

    NASA Astrophysics Data System (ADS)

    Lee, Ki-Seung; Go, Dongwook; Manchon, Aurélien; Haney, Paul M.; Stiles, M. D.; Lee, Hyun-Woo; Lee, Kyung-Jin

    2015-04-01

    In ferromagnet/heavy-metal bilayers, an in-plane current gives rise to spin-orbit spin-transfer torque, which is usually decomposed into fieldlike and dampinglike torques. For two-dimensional free-electron and tight-binding models with Rashba spin-orbit coupling, the fieldlike torque acquires nontrivial dependence on the magnetization direction when the Rashba spin-orbit coupling becomes comparable to the exchange interaction. This nontrivial angular dependence of the fieldlike torque is related to the Fermi surface distortion, determined by the ratio of the Rashba spin-orbit coupling to the exchange interaction. On the other hand, the dampinglike torque acquires nontrivial angular dependence when the Rashba spin-orbit coupling is comparable to or stronger than the exchange interaction. It is related to the combined effects of the Fermi surface distortion and the Fermi sea contribution. The angular dependence is consistent with experimental observations and can be important to understand magnetization dynamics induced by spin-orbit spin-transfer torques.

  17. Exact evaluation of the causal spectrum and localization properties of electronic states on a scale-free network

    NASA Astrophysics Data System (ADS)

    Xie, Pinchen; Yang, Bingjia; Zhang, Zhongzhi; Andrade, Roberto F. S.

    2018-07-01

    A deterministic network with tree structure is considered, for which the spectrum of its adjacency matrix can be exactly evaluated by a recursive renormalization approach. It amounts to successively increasing number of contributions at any finite step of construction of the tree, resulting in a causal chain. The resulting eigenvalues can be related the full energy spectrum of a nearest-neighbor tight-binding model defined on this structure. Given this association, it turns out that further properties of the eigenvectors can be evaluated, like the degree of quantum localization of the tight-binding eigenstates, expressed by the inverse participation ratio (IPR). It happens that, for the current model, the IPR's are also suitable to be analytically expressed in terms in corresponding eigenvalue chain. The resulting IPR scaling behavior is expressed by the tails of eigenvalue chains as well.

  18. Density functional tight-binding and infrequent metadynamics can capture entropic effects in intramolecular hydrogen transfer reactions

    NASA Astrophysics Data System (ADS)

    Oliveira, Luiz F. L.; Fu, Christopher D.; Pfaendtner, Jim

    2018-04-01

    Infrequent metadynamics uses biased simulations to estimate the unbiased kinetics of a system, facilitating the calculation of rates and barriers. Here the method is applied to study intramolecular hydrogen transfer reactions involving peroxy radicals, a class of reactions that is challenging to model due to the entropic contributions of the formation of ring structures in the transition state. Using the self-consistent charge density-functional based tight-binding (DFTB) method, we applied infrequent metadynamics to the study of four intramolecular H-transfer reactions, demonstrating that the method can qualitatively reproduce these high entropic contributions, as observed in experiments and those predicted by transition state theory modeled by higher levels of theory. We also show that infrequent metadynamics and DFTB are successful in describing the relationship between transition state ring size and kinetic coefficients (e.g., activation energies and the pre-exponential factors).

  19. An environment-dependent semi-empirical tight binding model suitable for electron transport in bulk metals, metal alloys, metallic interfaces, and metallic nanostructures. II. Application—Effect of quantum confinement and homogeneous strain on Cu conductance

    NASA Astrophysics Data System (ADS)

    Hegde, Ganesh; Povolotskyi, Michael; Kubis, Tillmann; Charles, James; Klimeck, Gerhard

    2014-03-01

    The Semi-Empirical tight binding model developed in Part I Hegde et al. [J. Appl. Phys. 115, 123703 (2014)] is applied to metal transport problems of current relevance in Part II. A systematic study of the effect of quantum confinement, transport orientation, and homogeneous strain on electronic transport properties of Cu is carried out. It is found that quantum confinement from bulk to nanowire boundary conditions leads to significant anisotropy in conductance of Cu along different transport orientations. Compressive homogeneous strain is found to reduce resistivity by increasing the density of conducting modes in Cu. The [110] transport orientation in Cu nanowires is found to be the most favorable for mitigating conductivity degradation since it shows least reduction in conductance with confinement and responds most favorably to compressive strain.

  20. Modeling chain folding in protein-constrained circular DNA.

    PubMed Central

    Martino, J A; Olson, W K

    1998-01-01

    An efficient method for sampling equilibrium configurations of DNA chains binding one or more DNA-bending proteins is presented. The technique is applied to obtain the tertiary structures of minimal bending energy for a selection of dinucleosomal minichromosomes that differ in degree of protein-DNA interaction, protein spacing along the DNA chain contour, and ring size. The protein-bound portions of the DNA chains are represented by tight, left-handed supercoils of fixed geometry. The protein-free regions are modeled individually as elastic rods. For each random spatial arrangement of the two nucleosomes assumed during a stochastic search for the global minimum, the paths of the flexible connecting DNA segments are determined through a numerical solution of the equations of equilibrium for torsionally relaxed elastic rods. The minimal energy forms reveal how protein binding and spacing and plasmid size differentially affect folding and offer new insights into experimental minichromosome systems. PMID:9591675

  1. Controlling Directionality and Dimensionality of Radiation by Perturbing Separable Bound States in the Continuum

    DOE PAGES

    Rivera, Nicholas; Hsu, Chia Wei; Zhen, Bo; ...

    2016-09-19

    Here, a bound state in the continuum (BIC) is an unusual localized state that is embedded in a continuum of extended states. Here, we present the general condition for BICs to arise from wave equation separability. Then we show that by exploiting perturbations of certain symmetry such BICs can be turned into resonances that radiate with a tailorable directionality and dimensionality. Using this general framework, we construct new examples of separable BICs and resonances that can exist in optical potentials for ultracold atoms, photonic systems, and systems described by tight binding. Such resonances with easily reconfigurable radiation allow for applicationsmore » such as the storage and release of waves at a controllable rate and direction, as well systems that switch between different dimensions of confinement.« less

  2. Mechanism of calmodulin recognition of the binding domain of isoform 1b of the plasma membrane Ca2+-ATPase: kinetic pathway and effects of methionine oxidation

    PubMed Central

    Slaughter, Brian D.; Bieber Urbauer, Ramona J.; Urbauer, Jeffrey L.; Johnson, Carey K.

    2008-01-01

    Calmodulin (CaM) binds to a domain near the C-terminus of the plasma-membrane Ca2+-ATPase (PMCA), causing the release of this domain and relief of its autoinhibitory function. We investigated the kinetics of dissociation and binding of Ca2+-CaM with a 28-residue peptide (C28W(1b)) corresponding to the CaM binding domain of isoform 1b of PMCA. CaM was labeled with a fluorescent probe on either the N-terminal domain at residue 34 or on the C-terminal domain at residue 110. Formation of complexes of CaM with C28W(1b) results in a decrease in the fluorescence yield of the fluorophore, allowing the kinetics of dissociation or binding to be detected. Using a maximum entropy method, we determined the minimum number and magnitudes of rate constants required to fit the data. Comparison of the fluorescence changes for CaM labeled on the C-terminal or N-terminal domain suggests sequential and ordered binding of the C-terminal and N-terminal domains of CaM with C28W(1b). For dissociation of C28W(1b) from CaM labeled on the N-terminal domain, we observed three time constants, indicating the presence of two intermediate states in the dissociation pathway. However, for CaM labeled on the C-terminal domain, we observed only two time constants, suggesting that the fluorescence label on the C-terminal domain was not sensitive to one of the kinetic steps. The results were modeled by a kinetic mechanism where an initial complex forms upon binding of the C-terminal domain of CaM to C28W(1b), followed by binding of the N-terminal domain, and then formation of a tight binding complex. Oxidation of methionine residues in CaM resulted in significant perturbations to the binding kinetics. The rate of formation of a tight binding complex was reduced, consistent with the lower effectiveness of oxidized CaM in activating the Ca2+ pump. PMID:17343368

  3. Crystal structure of the YGR205w protein from Saccharomyces cerevisiae: close structural resemblance to E. coli pantothenate kinase.

    PubMed

    Li de La Sierra-Gallay, Ines; Collinet, Bruno; Graille, Marc; Quevillon-Cheruel, Sophie; Liger, Dominique; Minard, Philippe; Blondeau, Karine; Henckes, Gilles; Aufrère, Robert; Leulliot, Nicolas; Zhou, Cong-Zhao; Sorel, Isabelle; Ferrer, Jean-Luc; Poupon, Anne; Janin, Joël; van Tilbeurgh, Herman

    2004-03-01

    The protein product of the YGR205w gene of Saccharomyces cerevisiae was targeted as part of our yeast structural genomics project. YGR205w codes for a small (290 amino acids) protein with unknown structure and function. The only recognizable sequence feature is the presence of a Walker A motif (P loop) indicating a possible nucleotide binding/converting function. We determined the three-dimensional crystal structure of Se-methionine substituted protein using multiple anomalous diffraction. The structure revealed a well known mononucleotide fold and strong resemblance to the structure of small metabolite phosphorylating enzymes such as pantothenate and phosphoribulo kinase. Biochemical experiments show that YGR205w binds specifically ATP and, less tightly, ADP. The structure also revealed the presence of two bound sulphate ions, occupying opposite niches in a canyon that corresponds to the active site of the protein. One sulphate is bound to the P-loop in a position that corresponds to the position of beta-phosphate in mononucleotide protein ATP complex, suggesting the protein is indeed a kinase. The nature of the phosphate accepting substrate remains to be determined. Copyright 2004 Wiley-Liss, Inc.

  4. Evaluation of the grand-canonical partition function using expanded Wang-Landau simulations. IV. Performance of many-body force fields and tight-binding schemes for the fluid phases of silicon

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Desgranges, Caroline; Delhommelle, Jerome

    We extend Expanded Wang-Landau (EWL) simulations beyond classical systems and develop the EWL method for systems modeled with a tight-binding Hamiltonian. We then apply the method to determine the partition function and thus all thermodynamic properties, including the Gibbs free energy and entropy, of the fluid phases of Si. We compare the results from quantum many-body (QMB) tight binding models, which explicitly calculate the overlap between the atomic orbitals of neighboring atoms, to those obtained with classical many-body (CMB) force fields, which allow to recover the tetrahedral organization in condensed phases of Si through, e.g., a repulsive 3-body term thatmore » favors the ideal tetrahedral angle. Along the vapor-liquid coexistence, between 3000 K and 6000 K, the densities for the two coexisting phases are found to vary significantly (by 5 orders of magnitude for the vapor and by up to 25% for the liquid) and to provide a stringent test of the models. Transitions from vapor to liquid are predicted to occur for chemical potentials that are 10%–15% higher for CMB models than for QMB models, and a ranking of the force fields is provided by comparing the predictions for the vapor pressure to the experimental data. QMB models also reveal the formation of a gap in the electronic density of states of the coexisting liquid at high temperatures. Subjecting Si to a nanoscopic confinement has a dramatic effect on the phase diagram with, e.g. at 6000 K, a decrease in liquid densities by about 50% for both CMB and QMB models and an increase in vapor densities between 90% (CMB) and 170% (QMB). The results presented here provide a full picture of the impact of the strategy (CMB or QMB) chosen to model many-body effects on the thermodynamic properties of the fluid phases of Si.« less

  5. HIV-1 gp120 Glycoprotein Interacting with Dendritic Cell-specific Intercellular Adhesion Molecule 3-grabbing Non-integrin (DC-SIGN) Down-Regulates Tight Junction Proteins to Disrupt the Blood Retinal Barrier and Increase Its Permeability.

    PubMed

    Qian, Yi-Wen; Li, Chuan; Jiang, Ai-Ping; Ge, Shengfang; Gu, Ping; Fan, Xianqun; Li, Tai-Sheng; Jin, Xia; Wang, Jian-Hua; Wang, Zhi-Liang

    2016-10-28

    Approximately 70% of HIV-1 infected patients acquire ocular opportunistic infections and manifest eye disorders during the course of their illness. The mechanisms by which pathogens invade the ocular site, however, are unclear. Under normal circumstances, vascular endothelium and retinal pigment epithelium (RPE), which possess a well developed tight junction complex, form the blood-retinal barrier (BRB) to prevent pathogen invasion. We hypothesize that disruption of the BRB allows pathogen entry into ocular sites. The hypothesis was tested using in vitro models. We discovered that human RPE cells could bind to either HIV-1 gp120 glycoproteins or HIV-1 viral particles. Furthermore, the binding was mediated by dendritic cell-specific intercellular adhesion molecule 3-grabbing non-integrin (DC-SIGN) expressed on RPE cells. Upon gp120 binding to DC-SIGN, cellular NF-κB signaling was triggered, leading to the induction of matrix metalloproteinases, which subsequently degraded tight junction proteins and disrupted the BRB integrity. DC-SIGN knockdown or prior blocking with a specific antibody abolished gp120-induced matrix metalloproteinase expression and reduced the degradation of tight junction proteins. This study elucidates a novel mechanism by which HIV, type 1 invades ocular tissues and provides additional insights into the translocation or invasion process of ocular complication-associated pathogens. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  6. [Kinematics of the triangular fibrocartilage complex during forearm rotation in vivo].

    PubMed

    Xu, Jing; Tang, Jin-bo; Jia, Zhong-zheng; Xie, Ren-guo

    2009-11-01

    To investigate three-dimensional kinematics of the superficial and deep portion of triangular fibrocartilage complex (TFCC) in different parts of the forearm rotation. Six wrists of 6 volunteers were used to obtain CT scans at different positions of the wrist. The wrists were scanned from 90 degrees of pronation to 90 degrees of supination at an interval of 30 degrees. The 3-dimensional radius and ulna were reconstructed with customized software and changes in length of the superficial and deep portion of TFCC during forearm rotation. In forearm pronation, the superficial dorsal portion and the deep palmar portion of the TFCC were tight. While the superficial palmar portion and the deep dorsal potion of the TFCC were lax. In supination, the changes in length of all these fibers were reverse. In forearm rotation one portion fibers of dorsal TFCC and one portion fibers of palmar TFCC are tight, and this mechanism controls stability during DRUJ rotation.

  7. Stochastic Model of Supercoiling-Dependent Transcription

    NASA Astrophysics Data System (ADS)

    Brackley, C. A.; Johnson, J.; Bentivoglio, A.; Corless, S.; Gilbert, N.; Gonnella, G.; Marenduzzo, D.

    2016-07-01

    We propose a stochastic model for gene transcription coupled to DNA supercoiling, where we incorporate the experimental observation that polymerases create supercoiling as they unwind the DNA helix and that these enzymes bind more favorably to regions where the genome is unwound. Within this model, we show that when the transcriptionally induced flux of supercoiling increases, there is a sharp crossover from a regime where torsional stresses relax quickly and gene transcription is random, to one where gene expression is highly correlated and tightly regulated by supercoiling. In the latter regime, the model displays transcriptional bursts, waves of supercoiling, and up regulation of divergent or bidirectional genes. It also predicts that topological enzymes which relax twist and writhe should provide a pathway to down regulate transcription.

  8. Time-dependent density-functional tight-binding method with the third-order expansion of electron density

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nishimoto, Yoshio, E-mail: nishimoto.yoshio@fukui.kyoto-u.ac.jp

    2015-09-07

    We develop a formalism for the calculation of excitation energies and excited state gradients for the self-consistent-charge density-functional tight-binding method with the third-order contributions of a Taylor series of the density functional theory energy with respect to the fluctuation of electron density (time-dependent density-functional tight-binding (TD-DFTB3)). The formulation of the excitation energy is based on the existing time-dependent density functional theory and the older TD-DFTB2 formulae. The analytical gradient is computed by solving Z-vector equations, and it requires one to calculate the third-order derivative of the total energy with respect to density matrix elements due to the inclusion of themore » third-order contributions. The comparison of adiabatic excitation energies for selected small and medium-size molecules using the TD-DFTB2 and TD-DFTB3 methods shows that the inclusion of the third-order contributions does not affect excitation energies significantly. A different set of parameters, which are optimized for DFTB3, slightly improves the prediction of adiabatic excitation energies statistically. The application of TD-DFTB for the prediction of absorption and fluorescence energies of cresyl violet demonstrates that TD-DFTB3 reproduced the experimental fluorescence energy quite well.« less

  9. Time-dependent density-functional tight-binding method with the third-order expansion of electron density.

    PubMed

    Nishimoto, Yoshio

    2015-09-07

    We develop a formalism for the calculation of excitation energies and excited state gradients for the self-consistent-charge density-functional tight-binding method with the third-order contributions of a Taylor series of the density functional theory energy with respect to the fluctuation of electron density (time-dependent density-functional tight-binding (TD-DFTB3)). The formulation of the excitation energy is based on the existing time-dependent density functional theory and the older TD-DFTB2 formulae. The analytical gradient is computed by solving Z-vector equations, and it requires one to calculate the third-order derivative of the total energy with respect to density matrix elements due to the inclusion of the third-order contributions. The comparison of adiabatic excitation energies for selected small and medium-size molecules using the TD-DFTB2 and TD-DFTB3 methods shows that the inclusion of the third-order contributions does not affect excitation energies significantly. A different set of parameters, which are optimized for DFTB3, slightly improves the prediction of adiabatic excitation energies statistically. The application of TD-DFTB for the prediction of absorption and fluorescence energies of cresyl violet demonstrates that TD-DFTB3 reproduced the experimental fluorescence energy quite well.

  10. Resonant scattering due to adatoms in graphene: Top, bridge, and hollow positions

    NASA Astrophysics Data System (ADS)

    Irmer, Susanne; Kochan, Denis; Lee, Jeongsu; Fabian, Jaroslav

    2018-02-01

    We present a theoretical study of resonance characteristics in graphene from adatoms with s or pz character binding in top, bridge, and hollow positions. The adatoms are described by two tight-binding parameters: on-site energy and hybridization strength. We explore a wide range of different magnitudes of these parameters by employing T -matrix calculations in the single adatom limit and by tight-binding supercell calculations for dilute adatom coverage. We calculate the density of states and the momentum relaxation rate and extract the resonance level and resonance width. The top position with a large hybridization strength or, equivalently, small on-site energy, induces resonances close to zero energy. The bridge position, compared to top, is more sensitive to variation in the orbital tight-binding parameters. Resonances within the experimentally relevant energy window are found mainly for bridge adatoms with negative on-site energies. The effect of resonances from the top and bridge positions on the density of states and momentum relaxation rate is comparable and both positions give rise to a power-law decay of the resonant state in graphene. The hollow position with s orbital character is affected from destructive interference, which is seen from the very narrow resonance peaks in the density of states and momentum relaxation rate. The resonant state shows no clear tendency to a power-law decay around the impurity and its magnitude decreases strongly with lowering the adatom content in the supercell calculations. This is in contrast to the top and bridge positions. We conclude our study with a comparison to models of pointlike vacancies and strong midgap scatterers. The latter model gives rise to significantly higher momentum relaxation rates than caused by single adatoms.

  11. The mode of inhibitor binding to peptidyl-tRNA hydrolase: binding studies and structure determination of unbound and bound peptidyl-tRNA hydrolase from Acinetobacter baumannii.

    PubMed

    Kaushik, Sanket; Singh, Nagendra; Yamini, Shavait; Singh, Avinash; Sinha, Mau; Arora, Ashish; Kaur, Punit; Sharma, Sujata; Singh, Tej P

    2013-01-01

    The incidences of infections caused by an aerobic Gram-negative bacterium, Acinetobacter baumannii are very common in hospital environments. It usually causes soft tissue infections including urinary tract infections and pneumonia. It is difficult to treat due to acquired resistance to available antibiotics is well known. In order to design specific inhibitors against one of the important enzymes, peptidyl-tRNA hydrolase from Acinetobacter baumannii, we have determined its three-dimensional structure. Peptidyl-tRNA hydrolase (AbPth) is involved in recycling of peptidyl-tRNAs which are produced in the cell as a result of premature termination of translation process. We have also determined the structures of two complexes of AbPth with cytidine and uridine. AbPth was cloned, expressed and crystallized in unbound and in two bound states with cytidine and uridine. The binding studies carried out using fluorescence spectroscopic and surface plasmon resonance techniques revealed that both cytidine and uridine bound to AbPth at nanomolar concentrations. The structure determinations of the complexes revealed that both ligands were located in the active site cleft of AbPth. The introduction of ligands to AbPth caused a significant widening of the entrance gate to the active site region and in the process of binding, it expelled several water molecules from the active site. As a result of interactions with protein atoms, the ligands caused conformational changes in several residues to attain the induced tight fittings. Such a binding capability of this protein makes it a versatile molecule for hydrolysis of peptidyl-tRNAs having variable peptide sequences. These are the first studies that revealed the mode of inhibitor binding in Peptidyl-tRNA hydrolases which will facilitate the structure based ligand design.

  12. Interaction of sucralose with whey protein: Experimental and molecular modeling studies

    NASA Astrophysics Data System (ADS)

    Zhang, Hongmei; Sun, Shixin; Wang, Yanqing; Cao, Jian

    2017-12-01

    The objective of this research was to study the interactions of sucralose with whey protein isolate (WPI) by using the three-dimensional fluorescence spectroscopy, circular dichroism spectroscopy and molecular modeling. The results showed that the peptide strands structure of WPI had been changed by sucralose. Sucralose binding induced the secondary structural changes and increased content of aperiodic structure of WPI. Sucralose decreased the thermal stability of WPI and acted as a structure destabilizer during the thermal unfolding process of protein. In addition, the existence of sucralose decreased the reversibility of the unfolding of WPI. Nonetheless, sucralose-WPI complex was less stable than protein alone. The molecular modeling result showed that van der Waals and hydrogen bonding interactions contribute to the complexation free binding energy. There are more than one possible binding sites of WPI with sucralose by surface binding mode.

  13. Tight-Binding Description of Impurity States in Semiconductors

    ERIC Educational Resources Information Center

    Dominguez-Adame, F.

    2012-01-01

    Introductory textbooks in solid state physics usually present the hydrogenic impurity model to calculate the energy of carriers bound to donors or acceptors in semiconductors. This model treats the pure semiconductor as a homogeneous medium and the impurity is represented as a fixed point charge. This approach is only valid for shallow impurities…

  14. Development of a Multicenter Density Functional Tight Binding Model for Plutonium Surface Hydriding.

    PubMed

    Goldman, Nir; Aradi, Bálint; Lindsey, Rebecca K; Fried, Laurence E

    2018-05-08

    We detail the creation of a multicenter density functional tight binding (DFTB) model for hydrogen on δ-plutonium, using a framework of new Slater-Koster interaction parameters and a repulsive energy based on the Chebyshev Interaction Model for Efficient Simulation (ChIMES), where two- and three-center atomic interactions are represented by linear combinations of Chebyshev polynomials. We find that our DFTB/ChIMES model yields a total electron density of states for bulk δ-Pu that compares well to that from Density Functional Theory, as well as to a grid of energy calculations representing approximate H 2 dissociation paths on the δ-Pu (100) surface. We then perform molecular dynamics simulations and minimum energy pathway calculations to determine the energetics of surface dissociation and subsurface diffusion on the (100) and (111) surfaces. Our approach allows for the efficient creation of multicenter repulsive energies with a relatively small investment in initial DFT calculations. Our efforts are particularly pertinent to studies that rely on quantum calculations for interpretation and validation, such as experimental determination of chemical reactivity both on surfaces and in condensed phases.

  15. Coxibs interfere with the action of aspirin by binding tightly to one monomer of cyclooxygenase-1

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rimon, Gilad; Sidhu, Ranjinder S.; Lauver, D. Adam

    Pain associated with inflammation involves prostaglandins synthesized from arachidonic acid (AA) through cyclooxygenase-2 (COX-2) pathways while thromboxane A{sub 2} formed by platelets from AA via cyclooxygenase-1 (COX-1) mediates thrombosis. COX-1 and COX-2 are both targets of nonselective nonsteroidal antiinflammatory drugs (nsNSAIDs) including aspirin whereas COX-2 activity is preferentially blocked by COX-2 inhibitors called coxibs. COXs are homodimers composed of identical subunits, but we have shown that only one subunit is active at a time during catalysis; moreover, many nsNSAIDS bind to a single subunit of a COX dimer to inhibit the COX activity of the entire dimer. Here, we reportmore » the surprising observation that celecoxib and other coxibs bind tightly to a subunit of COX-1. Although celecoxib binding to one monomer of COX-1 does not affect the normal catalytic processing of AA by the second, partner subunit, celecoxib does interfere with the inhibition of COX-1 by aspirin in vitro. X-ray crystallographic results obtained with a celecoxib/COX-1 complex show how celecoxib can bind to one of the two available COX sites of the COX-1 dimer. Finally, we find that administration of celecoxib to dogs interferes with the ability of a low dose of aspirin to inhibit AA-induced ex vivo platelet aggregation. COX-2 inhibitors such as celecoxib are widely used for pain relief. Because coxibs exhibit cardiovascular side effects, they are often prescribed in combination with low-dose aspirin to prevent thrombosis. Our studies predict that the cardioprotective effect of low-dose aspirin on COX-1 may be blunted when taken with coxibs.« less

  16. Plasmonic eigenmodes in individual and bow-tie graphene nanotriangles

    NASA Astrophysics Data System (ADS)

    Wang, Weihua; Christensen, Thomas; Jauho, Antti-Pekka; Thygesen, Kristian S.; Wubs, Martijn; Mortensen, N. Asger

    2015-04-01

    In classical electrodynamics, nanostructured graphene is commonly modeled by the computationally demanding problem of a three-dimensional conducting film of atomic-scale thickness. Here, we propose an efficient alternative two-dimensional electrostatic approach where all calculation procedures are restricted to the graphene sheet. Furthermore, to explore possible quantum effects, we perform tight-binding calculations, adopting a random-phase approximation. We investigate multiple plasmon modes in 20 nm equilateral triangles of graphene, treating the optical response classically as well as quantum mechanically. Compared to the classical plasmonic spectrum which is ``blind'' to the edge termination, we find that the quantum plasmon frequencies exhibit blueshifts in the case of armchair edge termination of the underlying atomic lattice, while redshifts are found for zigzag edges. Furthermore, we find spectral features in the zigzag case which are associated with electronic edge states not present for armchair termination. Merging pairs of triangles into dimers, plasmon hybridization leads to energy splitting that appears strongest in classical calculations while splitting is lower for armchair edges and even more reduced for zigzag edges. Our various results illustrate a surprising phenomenon: Even 20 nm large graphene structures clearly exhibit quantum plasmonic features due to atomic-scale details in the edge termination.

  17. Extended Lagrangian Density Functional Tight-Binding Molecular Dynamics for Molecules and Solids.

    PubMed

    Aradi, Bálint; Niklasson, Anders M N; Frauenheim, Thomas

    2015-07-14

    A computationally fast quantum mechanical molecular dynamics scheme using an extended Lagrangian density functional tight-binding formulation has been developed and implemented in the DFTB+ electronic structure program package for simulations of solids and molecular systems. The scheme combines the computational speed of self-consistent density functional tight-binding theory with the efficiency and long-term accuracy of extended Lagrangian Born-Oppenheimer molecular dynamics. For systems without self-consistent charge instabilities, only a single diagonalization or construction of the single-particle density matrix is required in each time step. The molecular dynamics simulation scheme can be applied to a broad range of problems in materials science, chemistry, and biology.

  18. Quantifying the Effect of DNA Packaging on Gene Expression Level

    NASA Astrophysics Data System (ADS)

    Kim, Harold

    2010-10-01

    Gene expression, the process by which the genetic code comes alive in the form of proteins, is one of the most important biological processes in living cells, and begins when transcription factors bind to specific DNA sequences in the promoter region upstream of a gene. The relationship between gene expression output and transcription factor input which is termed the gene regulation function is specific to each promoter, and predicting this gene regulation function from the locations of transcription factor binding sites is one of the challenges in biology. In eukaryotic organisms (for example, animals, plants, fungi etc), DNA is highly compacted into nucleosomes, 147-bp segments of DNA tightly wrapped around histone protein core, and therefore, the accessibility of transcription factor binding sites depends on their locations with respect to nucleosomes - sites inside nucleosomes are less accessible than those outside nucleosomes. To understand how transcription factor binding sites contribute to gene expression in a quantitative manner, we obtain gene regulation functions of promoters with various configurations of transcription factor binding sites by using fluorescent protein reporters to measure transcription factor input and gene expression output in single yeast cells. In this talk, I will show that the affinity of a transcription factor binding site inside and outside the nucleosome controls different aspects of the gene regulation function, and explain this finding based on a mass-action kinetic model that includes competition between nucleosomes and transcription factors.

  19. Intermediate band formation in a δ-doped like QW superlattices of GaAs/AlxGa1-xAs for solar cell design

    NASA Astrophysics Data System (ADS)

    Del Río-De Santiago, A.; Martínez-Orozco, J. C.; Rodríguez-Magdaleno, K. A.; Contreras-Solorio, D. A.; Rodríguez-Vargas, I.; Ungan, F.

    2018-03-01

    It is reported a numerical computation of the local density of states for a δ-doped like QW superlattices of AlxGa1-xAs, as a possible heterostructure that, being integrated into a solar cell device design, can provide an intermediate band of allowed states to assist the absorption of photons with lower energies than that of the energy gap of the solar-cell constituent materials. This work was performed using the nearest neighbors sp3s* tight-binding model including spin. The confining potential caused by the ionized donor impurities in δ-doped impurities seeding that was obtained analytically within the lines of the Thomas-Fermi approximation was reproduced here by the Al concentration x variation. This potential is considered as an external perturbation in the tight-binding methodology and it is included in the diagonal terms of the tight-binding Hamiltonian. Special attention is paid to the width of the intermediate band caused by the change in the considered aluminium concentration x, the inter-well distance between δ-doped like QW wells and the number of them in the superlattice. In general we can conclude that this kind of superlattices can be suitable for intermediate band formation for possible intermediate-band solar cell design.

  20. Fibrinogen and fibrin.

    PubMed

    Weisel, John W

    2005-01-01

    Fibrinogen is a large, complex, fibrous glycoprotein with three pairs of polypeptide chains linked together by 29 disulfide bonds. It is 45 nm in length, with globular domains at each end and in the middle connected by alpha-helical coiled-coil rods. Both strongly and weakly bound calcium ions are important for maintenance of fibrinogen's structure and functions. The fibrinopeptides, which are in the central region, are cleaved by thrombin to convert soluble fibrinogen to insoluble fibrin polymer, via intermolecular interactions of the "knobs" exposed by fibrinopeptide removal with "holes" always exposed at the ends of the molecules. Fibrin monomers polymerize via these specific and tightly controlled binding interactions to make half-staggered oligomers that lengthen into protofibrils. The protofibrils aggregate laterally to make fibers, which then branch to yield a three-dimensional network-the fibrin clot-essential for hemostasis. X-ray crystallographic structures of portions of fibrinogen have provided some details on how these interactions occur. Finally, the transglutaminase, Factor XIIIa, covalently binds specific glutamine residues in one fibrin molecule to lysine residues in another via isopeptide bonds, stabilizing the clot against mechanical, chemical, and proteolytic insults. The gene regulation of fibrinogen synthesis and its assembly into multichain complexes proceed via a series of well-defined steps. Alternate splicing of two of the chains yields common variant molecular isoforms. The mechanical properties of clots, which can be quite variable, are essential to fibrin's functions in hemostasis and wound healing. The fibrinolytic system, with the zymogen plasminogen binding to fibrin together with tissue-type plasminogen activator to promote activation to the active enzyme plasmin, results in digestion of fibrin at specific lysine residues. Fibrin(ogen) also specifically binds a variety of other proteins, including fibronectin, albumin, thrombospondin, von Willebrand factor, fibulin, fibroblast growth factor-2, vascular endothelial growth factor, and interleukin-1. Studies of naturally occurring dysfibrinogenemias and variant molecules have increased our understanding of fibrinogen's functions. Fibrinogen binds to activated alphaIIbbeta3 integrin on the platelet surface, forming bridges responsible for platelet aggregation in hemostasis, and also has important adhesive and inflammatory functions through specific interactions with other cells. Fibrinogen-like domains originated early in evolution, and it is likely that their specific and tightly controlled intermolecular interactions are involved in other aspects of cellular function and developmental biology.

  1. Binding of various ovotransferrin fragments to chick-embryo red cells.

    PubMed Central

    Oratore, A; D'Andrea, G; Moreton, K; Williams, J

    1989-01-01

    1. The ability of N- and C-terminal half-molecule fragments of hen ovotransferrin to interact with chick red blood cells (CERBC) has been studied under conditions that allow binding of the transferrin to transferrin receptors to take place, but not the delivery of iron to the cell. Two kinds of half-molecule fragments were used: (a) those which can associate with one another to give a dimer resembling native transferrin and (b) those which cannot associate in this way because they lack a few amino acid residues from their C-terminal ends. 2. Neither N nor C half-molecules alone can bind to the CERBC, but, when both are present, tight binding occurs. 3. Whether or not the half-molecules can associate with one another makes little difference to receptor binding. 4. Given that one of the half-molecules is iron-saturated, the presence or absence of iron in the contralateral half-molecule again makes little difference to receptor binding. PMID:2920021

  2. Crystal-Phase Quantum Wires: One-Dimensional Heterostructures with Atomically Flat Interfaces.

    PubMed

    Corfdir, Pierre; Li, Hong; Marquardt, Oliver; Gao, Guanhui; Molas, Maciej R; Zettler, Johannes K; van Treeck, David; Flissikowski, Timur; Potemski, Marek; Draxl, Claudia; Trampert, Achim; Fernández-Garrido, Sergio; Grahn, Holger T; Brandt, Oliver

    2018-01-10

    In semiconductor quantum-wire heterostructures, interface roughness leads to exciton localization and to a radiative decay rate much smaller than that expected for structures with flat interfaces. Here, we uncover the electronic and optical properties of the one-dimensional extended defects that form at the intersection between stacking faults and inversion domain boundaries in GaN nanowires. We show that they act as crystal-phase quantum wires, a novel one-dimensional quantum system with atomically flat interfaces. These quantum wires efficiently capture excitons whose radiative decay gives rise to an optical doublet at 3.36 eV at 4.2 K. The binding energy of excitons confined in crystal-phase quantum wires is measured to be more than twice larger than that of the bulk. As a result of their unprecedented interface quality, these crystal-phase quantum wires constitute a model system for the study of one-dimensional excitons.

  3. Anisotropic Nanomechanics of Boron Nitride Nanotubes: Nanostructured "Skin" Effect

    NASA Technical Reports Server (NTRS)

    Srivastava, Deepak; Menon, Madhu; Cho, KyeongJae

    2000-01-01

    The stiffness and plasticity of boron nitride nanotubes are investigated using generalized tight-binding molecular dynamics and ab-initio total energy methods. Due to boron-nitride BN bond buckling effects, compressed zigzag BN nanotubes are found to undergo novel anisotropic strain release followed by anisotropic plastic buckling. The strain is preferentially released towards N atoms in the rotated BN bonds. The tubes buckle anisotropically towards only one end when uniaxially compressed from both. A "skin-effect" model of smart nanocomposite materials is proposed which will localize the structural damage towards the 'skin' or surface side of the material.

  4. An environment-dependent semi-empirical tight binding model suitable for electron transport in bulk metals, metal alloys, metallic interfaces, and metallic nanostructures. I. Model and validation

    NASA Astrophysics Data System (ADS)

    Hegde, Ganesh; Povolotskyi, Michael; Kubis, Tillmann; Boykin, Timothy; Klimeck, Gerhard

    2014-03-01

    Semi-empirical Tight Binding (TB) is known to be a scalable and accurate atomistic representation for electron transport for realistically extended nano-scaled semiconductor devices that might contain millions of atoms. In this paper, an environment-aware and transferable TB model suitable for electronic structure and transport simulations in technologically relevant metals, metallic alloys, metal nanostructures, and metallic interface systems are described. Part I of this paper describes the development and validation of the new TB model. The new model incorporates intra-atomic diagonal and off-diagonal elements for implicit self-consistency and greater transferability across bonding environments. The dependence of the on-site energies on strain has been obtained by appealing to the Moments Theorem that links closed electron paths in the system to energy moments of angular momentum resolved local density of states obtained ab initio. The model matches self-consistent density functional theory electronic structure results for bulk face centered cubic metals with and without strain, metallic alloys, metallic interfaces, and metallic nanostructures with high accuracy and can be used in predictive electronic structure and transport problems in metallic systems at realistically extended length scales.

  5. Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

    NASA Astrophysics Data System (ADS)

    Sinurat, E. N.; Yudiarsah, E.

    2017-07-01

    The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

  6. Magneto-transport properties of a two-dimensional electron gas under lateral periodic modulation

    NASA Astrophysics Data System (ADS)

    Shi, Qinwei

    Several physical systems related to two-dimensional electron gas (2DEG) subjected to an electric or a magnetic modulation at various strength have been theoretically studied. In Chapter 3, a quantum transport theory is developed for the calculation of magnetoresistance rhoxx in a 2DEG subjected to strong one-dimensional periodic potential and at low uniform magnetic field (the Weiss oscillations regime). The theory is based on the exact diagonalization of the Hamiltonian and the constant relaxation time approximation. The theoretical predictions are in good agreement with the experimental results. The discrepancy between the classical calculation and the experiment is removed in our quantum treatment. In particular, the quenching of the Weiss oscillations is understood in this framework. In Chapter 4, the non-perturbative method for electric modulated system (EMS) is used to calculate the magnetoresistance rhoxx for a magnetic modulated system (MMS), which is a 2DEG subjected to strong one-dimensional periodic magnetic modulation and at low uniform magnetic field. As the amplitude of magnetic modulation increases we first find a quenching of the low fields oscillations. This is similar to the quenching of the Weiss oscillations in the EMS case. As the strength of the magnetic modulation increases further, a new series of oscillations appears in our calculation. The temperature dependence of these new oscillations shows that the basic mechanism of these oscillations is similar to Weiss oscillations, and the origin can be identified with the extra term in the Hamiltonian for the MMS case. In Chapter 5, a self-consistent quantum transport theory is developed to calculate magnetocoductivities in a 2DEG subjected to strong one-dimensional periodic potential and at high uniform magnetic field (SdH oscillation regime). The theory is based on the self-consistent Born approximation (SCBA) for the randomly distributed short-range impurities together with an exact diagonalization of the Hamiltonian. Quantum oscillations of magneto conductivities as a function of the amplitude of electric modulation are calculated and the basic mechanism behind these oscillations is discussed. In chapter 6, a tight-binding model is used to discuss the energy spectrum of 2DEG subjected to a strong two-dimensional magnetic modulation and a uniform magnetic field corresponding to a rational value of magnetic flux per unit cell f=pqf0. Some symmetries broken in the case of one-dimensional magnetic modulation are recovered in the two-dimensional case. Furthermore, when q is even, the magnetic Bloch band is broken into q subbands; while for odd q, the magnetic Bloch band is broken into 2 q subbands. This has interesting implication on the magnetotransport properties as one changes f . Our energy spectrum is similar but more complex than the Hofstadter's butterfly. Some suggestions to observe the new fractal energy spectrum are made.

  7. Band-gap tuning and optical response of two-dimensional Si x C 1 - x : A first-principles real-space study of disordered two-dimensional materials

    DOE PAGES

    Sadhukhan, Banasree; Singh, Prashant; Nayak, Arabinda; ...

    2017-08-09

    We present a real-space formulation for calculating the electronic structure and optical conductivity of random alloys based on Kubo-Greenwood formalism interfaced with augmented space recursion technique formulated with the tight-binding linear muffin-tin orbital basis with the van Leeuwen–Baerends corrected exchange potential. This approach has been used to quantitatively analyze the effect of chemical disorder on the configuration averaged electronic properties and optical response of two-dimensional honeycomb siliphene Si xC 1–x beyond the usual Dirac-cone approximation. We predicted the quantitative effect of disorder on both the electronic structure and optical response over a wide energy range, and the results are discussedmore » in the light of the available experimental and other theoretical data. As a result, our proposed formalism may open up a facile way for planned band-gap engineering in optoelectronic applications.« less

  8. Enhanced thermopower in ZnO two-dimensional electron gas

    PubMed Central

    Shimizu, Sunao; Bahramy, Mohammad Saeed; Iizuka, Takahiko; Ono, Shimpei; Miwa, Kazumoto; Tokura, Yoshinori; Iwasa, Yoshihiro

    2016-01-01

    Control of dimensionality has proven to be an effective way to manipulate the electronic properties of materials, thereby enabling exotic quantum phenomena, such as superconductivity, quantum Hall effects, and valleytronic effects. Another example is thermoelectricity, which has been theoretically proposed to be favorably controllable by reducing the dimensionality. Here, we verify this proposal by performing a systematic study on a gate-tuned 2D electron gas (2DEG) system formed at the surface of ZnO. Combining state-of-the-art electric-double-layer transistor experiments and realistic tight-binding calculations, we show that, for a wide range of carrier densities, the 2DEG channel comprises a single subband, and its effective thickness can be reduced to ∼ 1 nm at sufficiently high gate biases. We also demonstrate that the thermoelectric performance of the 2DEG region is significantly higher than that of bulk ZnO. Our approach opens up a route to exploit the peculiar behavior of 2DEG electronic states and realize thermoelectric devices with advanced functionalities. PMID:27222585

  9. Band-gap tuning and optical response of two-dimensional Si x C 1 - x : A first-principles real-space study of disordered two-dimensional materials

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sadhukhan, Banasree; Singh, Prashant; Nayak, Arabinda

    We present a real-space formulation for calculating the electronic structure and optical conductivity of random alloys based on Kubo-Greenwood formalism interfaced with augmented space recursion technique formulated with the tight-binding linear muffin-tin orbital basis with the van Leeuwen–Baerends corrected exchange potential. This approach has been used to quantitatively analyze the effect of chemical disorder on the configuration averaged electronic properties and optical response of two-dimensional honeycomb siliphene Si xC 1–x beyond the usual Dirac-cone approximation. We predicted the quantitative effect of disorder on both the electronic structure and optical response over a wide energy range, and the results are discussedmore » in the light of the available experimental and other theoretical data. As a result, our proposed formalism may open up a facile way for planned band-gap engineering in optoelectronic applications.« less

  10. Conformation-controlled binding kinetics of antibodies

    NASA Astrophysics Data System (ADS)

    Galanti, Marta; Fanelli, Duccio; Piazza, Francesco

    2016-01-01

    Antibodies are large, extremely flexible molecules, whose internal dynamics is certainly key to their astounding ability to bind antigens of all sizes, from small hormones to giant viruses. In this paper, we build a shape-based coarse-grained model of IgG molecules and show that it can be used to generate 3D conformations in agreement with single-molecule Cryo-Electron Tomography data. Furthermore, we elaborate a theoretical model that can be solved exactly to compute the binding rate constant of a small antigen to an IgG in a prescribed 3D conformation. Our model shows that the antigen binding process is tightly related to the internal dynamics of the IgG. Our findings pave the way for further investigation of the subtle connection between the dynamics and the function of large, flexible multi-valent molecular machines.

  11. Conductance of three-terminal molecular bridge based on tight-binding theory

    NASA Astrophysics Data System (ADS)

    Wang, Li-Guang; Li, Yong; Yu, Ding-Wen; Katsunori, Tagami; Masaru, Tsukada

    2005-05-01

    The quantum transmission characteristic of three-benzene ring nano-molecular bridge is investigated theoretically by using Green's function approach based on tight-binding theory with only a π orbital per carbon atom at the site. The transmission probabilities that electrons transport through the molecular bridge from one terminal to the other two terminals are obtained. The electronic current distributions inside the molecular bridge are calculated and shown in graphical analogy by the current density method based on Fisher-Lee formula at the energy points E = ±0.42, ±1.06 and ±1.5, respectively, where the transmission spectra appear peaks. We find that the transmission spectra are related to the incident electronic energy and the molecular levels strongly and the current distributions agree well with Kirchhoff quantum current momentum conservation law.

  12. Improving performance of armchair graphene nanoribbon field effect transistors via boron nitride doping

    NASA Astrophysics Data System (ADS)

    Goharrizi, A. Yazdanpanah; Sanaeepur, M.; Sharifi, M. J.

    2015-09-01

    Device performance of 10 nm length armchair graphene nanoribbon field effect transistors with 1.5 nm and 4 nm width (13 and 33 atoms in width respectively) are compared in terms of Ion /Ioff , trans-conductance, and sub-threshold swing. While narrow devices suffer from edge roughness wider devices are subject to more substrate surface roughness and reduced bandgap. Boron Nitride doping is employed to compensate reduced bandgap in wider devices. Simultaneous effects of edge and substrate surface roughness are considered. Results show that in the presence of both the edge and substrate surface roughness the 4 nm wide device with boron nitride doping shows improved performance with respect to the 1.5 nm one (both of which incorporate the same bandgap AGNR as channel material). Electronic simulations are performed via NEGF method along with tight-binding Hamiltonian. Edge and surface roughness are created by means of one and two dimensional auto correlation functions respectively. Electronic characteristics are averaged over a large number of devices due to statistic nature of both the edge and surface roughness.

  13. Quantum spin Hall insulator BiXH (XH = OH, SH) monolayers with a large bulk band gap.

    PubMed

    Hu, Xing-Kai; Lyu, Ji-Kai; Zhang, Chang-Wen; Wang, Pei-Ji; Ji, Wei-Xiao; Li, Ping

    2018-05-16

    A large bulk band gap is critical for the application of two-dimensional topological insulators (TIs) in spintronic devices operating at room temperature. On the basis of first-principles calculations, we predict BiXH (X = OH, SH) monolayers as TIs with an extraordinarily large bulk gap of 820 meV for BiOH and 850 meV for BiSH, and propose a tight-binding model considering spin-orbit coupling to describe the electronic properties of BiXH. These large gaps are entirely due to the strong spin-orbit interaction related to the pxy orbitals of the Bi atoms of the honeycomb lattice. The orbital filtering mechanism can be used to understand the topological properties of BiXH. The XH groups simply remove one branch of orbitals (pz of Bi) and reduce the trivial 6-band lattice into a 4-band, which is topologically non-trivial. The topological characteristics of BiXH monolayers are confirmed by nonzero topological invariant Z2 and a single pair of gapless helical edge states in the bulk gap. Owing to these features, the BiXH monolayers of the large-gap TIs are an ideal platform to realize many exotic phenomena and fabricate new quantum devices working at room temperature.

  14. Long tailed trions in monolayer MoS2: Temperature dependent asymmetry and resulting red-shift of trion photoluminescence spectra.

    PubMed

    Christopher, Jason W; Goldberg, Bennett B; Swan, Anna K

    2017-10-25

    Monolayer molybdenum disulfide (MoS 2 ) has emerged as a model system for studying many-body physics because the low dimensionality reduces screening leading to tightly bound states stable at room temperature. Further, the many-body states possess a pseudo-spin degree of freedom that corresponds with the two direct-gap valleys of the band structure, which can be optically manipulated. Here we focus on one bound state, the negatively charged trion. Unlike excitons, trions can radiatively decay with non-zero momentum by kicking out an electron, resulting in an asymmetric trion photoluminescence (PL) peak with a long low-energy tail and peak position that differs from the zero momentum trion energy. The asymmetry of the trion PL peak and resulting peak red-shift depends both on the trion size and a temperature-dependent contribution. Ignoring the trion asymmetry will result in over estimating the trion binding energy by nearly 20 meV at room temperature. We analyze the temperature-dependent PL to reveal the effective trion size, consistent with the literature, and the temperature dependence of the band gap and spin-orbit splitting of the valence band. This is the first time the temperature-dependence of the trion PL has been analyzed with such detail in any system.

  15. Tight-binding calculation studies of vacancy and adatom defects in graphene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhang, Wei; Lu, Wen-Cai; Zhang, Hong-Xing

    2016-02-19

    Computational studies of complex defects in graphene usually need to deal with a larger number of atoms than the current first-principles methods can handle. We show a recently developed three-center tight-binding potential for carbon is very efficient for large scale atomistic simulations and can accurately describe the structures and energies of various defects in graphene. Using the three-center tight-binding potential, we have systematically studied the stable structures and formation energies of vacancy and embedded-atom defects of various sizes up to 4 vacancies and 4 embedded atoms in graphene. In conclusion, our calculations reveal low-energy defect structures and provide a moremore » comprehensive understanding of the structures and stability of defects in graphene.« less

  16. Extended Lagrangian Density Functional Tight-Binding Molecular Dynamics for Molecules and Solids

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Aradi, Bálint; Niklasson, Anders M. N.; Frauenheim, Thomas

    A computationally fast quantum mechanical molecular dynamics scheme using an extended Lagrangian density functional tight-binding formulation has been developed and implemented in the DFTB+ electronic structure program package for simulations of solids and molecular systems. The scheme combines the computational speed of self-consistent density functional tight-binding theory with the efficiency and long-term accuracy of extended Lagrangian Born–Oppenheimer molecular dynamics. Furthermore, for systems without self-consistent charge instabilities, only a single diagonalization or construction of the single-particle density matrix is required in each time step. The molecular dynamics simulation scheme can also be applied to a broad range of problems in materialsmore » science, chemistry, and biology.« less

  17. Extended Lagrangian Density Functional Tight-Binding Molecular Dynamics for Molecules and Solids

    DOE PAGES

    Aradi, Bálint; Niklasson, Anders M. N.; Frauenheim, Thomas

    2015-06-26

    A computationally fast quantum mechanical molecular dynamics scheme using an extended Lagrangian density functional tight-binding formulation has been developed and implemented in the DFTB+ electronic structure program package for simulations of solids and molecular systems. The scheme combines the computational speed of self-consistent density functional tight-binding theory with the efficiency and long-term accuracy of extended Lagrangian Born–Oppenheimer molecular dynamics. Furthermore, for systems without self-consistent charge instabilities, only a single diagonalization or construction of the single-particle density matrix is required in each time step. The molecular dynamics simulation scheme can also be applied to a broad range of problems in materialsmore » science, chemistry, and biology.« less

  18. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ramírez-Morales, A.; Martínez-Orozco, J. C.; Rodríguez-Vargas, I.

    The main characteristics of the quantum confined Stark effect (QCSE) are studied theoretically in quantum wells of Gaussian profile. The semi-empirical tight-binding model and the Green function formalism are applied in the numerical calculations. A comparison of the QCSE in quantum wells with different kinds of confining potential is presented.

  19. Detecting sign-changing superconducting gap in LiFeAs using quasiparticle interference

    NASA Astrophysics Data System (ADS)

    Altenfeld, D.; Hirschfeld, P. J.; Mazin, I. I.; Eremin, I.

    2018-02-01

    Using a realistic ten-orbital tight-binding model Hamiltonian fitted to the angle-resolved photoemission spectroscopy data on LiFeAs, we analyze the temperature, frequency, and momentum dependencies of quasiparticle interference to identify gap sign changes in a qualitative way, following our original proposal [Phys. Rev. B 92, 184513 (2015), 10.1103/PhysRevB.92.184513]. We show that all features present for the simple two-band model for the sign-changing s+--wave superconducting gap employed previously are still present in the realistic tight-binding approximation and gap values observed experimentally. We discuss various superconducting gap structures proposed for LiFeAs and identify various features of these superconducting gap functions in the quasiparticle interference patterns. On the other hand, we show that it will be difficult to identify the more complicated possible sign structures of the hole pocket gaps in LiFeAs due to the smallness of the pockets and the near proximity of two of the gap energies.

  20. Flow Analysis of a Gas Turbine Low- Pressure Subsystem

    NASA Technical Reports Server (NTRS)

    Veres, Joseph P.

    1997-01-01

    The NASA Lewis Research Center is coordinating a project to numerically simulate aerodynamic flow in the complete low-pressure subsystem (LPS) of a gas turbine engine. The numerical model solves the three-dimensional Navier-Stokes flow equations through all components within the low-pressure subsystem as well as the external flow around the engine nacelle. The Advanced Ducted Propfan Analysis Code (ADPAC), which is being developed jointly by Allison Engine Company and NASA, is the Navier-Stokes flow code being used for LPS simulation. The majority of the LPS project is being done under a NASA Lewis contract with Allison. Other contributors to the project are NYMA and the University of Toledo. For this project, the Energy Efficient Engine designed by GE Aircraft Engines is being modeled. This engine includes a low-pressure system and a high-pressure system. An inlet, a fan, a booster stage, a bypass duct, a lobed mixer, a low-pressure turbine, and a jet nozzle comprise the low-pressure subsystem within this engine. The tightly coupled flow analysis evaluates aerodynamic interactions between all components of the LPS. The high-pressure core engine of this engine is simulated with a one-dimensional thermodynamic cycle code in order to provide boundary conditions to the detailed LPS model. This core engine consists of a high-pressure compressor, a combustor, and a high-pressure turbine. The three-dimensional LPS flow model is coupled to the one-dimensional core engine model to provide a "hybrid" flow model of the complete gas turbine Energy Efficient Engine. The resulting hybrid engine model evaluates the detailed interaction between the LPS components at design and off-design engine operating conditions while considering the lumped-parameter performance of the core engine.

  1. Model many-body Stoner Hamiltonian for binary FeCr alloys

    NASA Astrophysics Data System (ADS)

    Nguyen-Manh, D.; Dudarev, S. L.

    2009-09-01

    We derive a model tight-binding many-body d -electron Stoner Hamiltonian for FeCr binary alloys and investigate the sensitivity of its mean-field solutions to the choice of hopping integrals and the Stoner exchange parameters. By applying the local charge-neutrality condition within a self-consistent treatment we show that the negative enthalpy-of-mixing anomaly characterizing the alloy in the low chromium concentration limit is due entirely to the presence of the on-site exchange Stoner terms and that the occurrence of this anomaly is not specifically related to the choice of hopping integrals describing conventional chemical bonding between atoms in the alloy. The Bain transformation pathway computed, using the proposed model Hamiltonian, for the Fe15Cr alloy configuration is in excellent agreement with ab initio total-energy calculations. Our investigation also shows how the parameters of a tight-binding many-body model Hamiltonian for a magnetic alloy can be derived from the comparison of its mean-field solutions with other, more accurate, mean-field approximations (e.g., density-functional calculations), hence stimulating the development of large-scale computational algorithms for modeling radiation damage effects in magnetic alloys and steels.

  2. Grain boundaries in bcc-Fe: a density-functional theory and tight-binding study

    NASA Astrophysics Data System (ADS)

    Wang, Jingliang; Madsen, Georg K. H.; Drautz, Ralf

    2018-02-01

    Grain boundaries (GBs) have a significant influence on material properties. In the present paper, we calculate the energies of eleven low-Σ ({{Σ }}≤slant 13) symmetrical tilt GBs and two twist GBs in ferromagnetic bcc iron using first-principles density functional theory (DFT) calculations. The results demonstrate the importance of a sufficient sampling of initial rigid body translations in all three directions. We show that the relative GB energies can be explained by the miscoordination of atoms at the GB region. While the main features of the studied GB structures were captured by previous empirical interatomic potential calculations, it is shown that the absolute values of GB energies calculated were substantially underestimated. Based on DFT-calculated GB structures and energies, we construct a new d-band orthogonal tight-binding (TB) model for bcc iron. The TB model is validated by its predictive power on all the studied GBs. We apply the TB model to block boundaries in lath martensite and demonstrate that the experimentally observed GB character distribution can be explained from the viewpoint of interface energy.

  3. Specific heat and Knight shift of cuprates within the van Hove scenario

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sarkar, S.; Das, A.N.

    1996-12-01

    The jump in the specific heat at {ital T}{sub {ital c}}, the specific heat in both the superconducting and normal states, and the Knight shift in the superconducting state are studied within the van Hove singularity scenario considering density of states for a two-dimensional tight-binding system and with an extended saddle-point singularity. The role of the electron-phonon interaction strength, band narrowing, second-nearest-neighbor hopping, and orthorhombic distortion on such properties is investigated. The experimental results on the specific heat and Knight shift of the Y-123 system are compared with the theoretical predictions. {copyright} {ital 1996 The American Physical Society.}

  4. Soliton-sound interactions in quasi-one-dimensional Bose-Einstein condensates.

    PubMed

    Parker, N G; Proukakis, N P; Leadbeater, M; Adams, C S

    2003-06-06

    Longitudinal confinement of dark solitons in quasi-one-dimensional Bose-Einstein condensates leads to sound emission and reabsorption. We perform quantitative studies of the dynamics of a soliton oscillating in a tight dimple trap, embedded in a weaker harmonic trap. The dimple depth provides a sensitive handle to control the soliton-sound interaction. In the limit of no reabsorption, the power radiated is found to be proportional to the soliton acceleration squared. An experiment is proposed to detect sound emission as a change in amplitude and frequency of soliton oscillations.

  5. Three-Dimensional Blood-Brain Barrier Model for in vitro Studies of Neurovascular Pathology

    NASA Astrophysics Data System (ADS)

    Cho, Hansang; Seo, Ji Hae; Wong, Keith H. K.; Terasaki, Yasukazu; Park, Joseph; Bong, Kiwan; Arai, Ken; Lo, Eng H.; Irimia, Daniel

    2015-10-01

    Blood-brain barrier (BBB) pathology leads to neurovascular disorders and is an important target for therapies. However, the study of BBB pathology is difficult in the absence of models that are simple and relevant. In vivo animal models are highly relevant, however they are hampered by complex, multi-cellular interactions that are difficult to decouple. In vitro models of BBB are simpler, however they have limited functionality and relevance to disease processes. To address these limitations, we developed a 3-dimensional (3D) model of BBB on a microfluidic platform. We verified the tightness of the BBB by showing its ability to reduce the leakage of dyes and to block the transmigration of immune cells towards chemoattractants. Moreover, we verified the localization at endothelial cell boundaries of ZO-1 and VE-Cadherin, two components of tight and adherens junctions. To validate the functionality of the BBB model, we probed its disruption by neuro-inflammation mediators and ischemic conditions and measured the protective function of antioxidant and ROCK-inhibitor treatments. Overall, our 3D BBB model provides a robust platform, adequate for detailed functional studies of BBB and for the screening of BBB-targeting drugs in neurological diseases.

  6. High-throughput screening in two dimensions: binding intensity and off-rate on a peptide microarray.

    PubMed

    Greving, Matthew P; Belcher, Paul E; Cox, Conor D; Daniel, Douglas; Diehnelt, Chris W; Woodbury, Neal W

    2010-07-01

    We report a high-throughput two-dimensional microarray-based screen, incorporating both target binding intensity and off-rate, which can be used to analyze thousands of compounds in a single binding assay. Relative binding intensities and time-resolved dissociation are measured for labeled tumor necrosis factor alpha (TNF-alpha) bound to a peptide microarray. The time-resolved dissociation is fitted to a one-component exponential decay model, from which relative dissociation rates are determined for all peptides with binding intensities above background. We show that most peptides with the slowest off-rates on the microarray also have the slowest off-rates when measured by surface plasmon resonance (SPR). 2010 Elsevier Inc. All rights reserved.

  7. Coherent Effects in Tiny Optics: Tunneling Through the Looking Glass

    NASA Technical Reports Server (NTRS)

    Smith, David D.

    2003-01-01

    I will discuss two types of one-dimensional photonic bandgap (PBG) effects that can arise in systems of coupled spherical resonators: (1) nearly-free-photon Fabry-Perot photonic bands that arise in quarter-wave concentrically stratified spheres and, (2) tight- binding photonic bands that arise in weakly-coupled mutually-resonant spheres as a result of whispering-gallery mode splitting. These effects can be derived directly from Mie theory, in a more straightforward manner, by exploiting an analogy with stratified planar systems. For odd numbers of mutually-resonant lossless coupled ring resonators, the circulating intensity can increase exponentially with the number of resonators, which can potentially be exploited for the development of advanced sensors. For even numbers of resonators, mode splitting and classical destructive interference lead to a cancellation of absorption and slow light on-resonance, reminiscent of electromagnetic induced transparency. The analogy between these coherent photon trapping effects and population trapping in an atomic system will be explored.

  8. Asteroid clusters similar to asteroid pairs

    NASA Astrophysics Data System (ADS)

    Pravec, Petr; Vokrouhlicky, David; Fatka, Petr; Kusnirák, Peter; Hornoch, Kamil; Galád, Adrián

    2016-10-01

    We study five small, tight and young clusters of asteroids. They are placed around following largest (primary) bodies: (11842) Kap'bos, (14627) Emilkowalski, (16598) 1992 YC2, (21509) Lucascavin and (39991) 1998 HR37. Each cluster has 2-4 secondaries that are tightly clustered around the primary body, with distance in the 5-dimensional space of mean orbital elements mostly within 10 m/s, and always < 23 m/s. Backward orbital integrations indicate that they formed between 105 and 106 yr ago. In the P1-q space, where P1 is the primary's spin period and q = Σ Mj/M1 is the total secondary-to-primary mass ratio, the clusters lie in the same range as asteroid pairs formed by rotational fission. We have extended the model of a proto-system separation after rotational fission by Pravec et al. (2010) for application to systems with more than one secondary and found a perfect match for the five tight clusters. We find these clusters to be similar to asteroid pairs and we suggest that they are "extended pairs", having 2-4 escaped secondaries rather than just one secondary as in the case of an asteroid pair. We compare them to six young mini-families (1270) Datura, (2384) Schulhof, (3152) Jones, (6825) Irvine, (10321) Rampo and (20674) 1999 VT1. These mini-families have similar ages, but they have a higher number of members and/or they show a significantly larger spread in the mean orbital elements (dmean on an order of tens m/s) than the five tight clusters. In the P1-q space, all but one of the mini-families lie in the same range as asteroid pairs and the tight clusters; the exception is the mini-family of (3152) Jones which appears to be a collisional family. A possibility that the other five mini-families were also formed by rotational fission as we suggest for the tight clusters ("extended asteroid pairs") is being explored.Reference:Pravec, P., et al. Formation of asteroid pairs by rotational fission. Nature 466, 1085-1088.

  9. Cascaded spintronic logic with low-dimensional carbon

    NASA Astrophysics Data System (ADS)

    Friedman, Joseph S.; Girdhar, Anuj; Gelfand, Ryan M.; Memik, Gokhan; Mohseni, Hooman; Taflove, Allen; Wessels, Bruce W.; Leburton, Jean-Pierre; Sahakian, Alan V.

    2017-06-01

    Remarkable breakthroughs have established the functionality of graphene and carbon nanotube transistors as replacements to silicon in conventional computing structures, and numerous spintronic logic gates have been presented. However, an efficient cascaded logic structure that exploits electron spin has not yet been demonstrated. In this work, we introduce and analyse a cascaded spintronic computing system composed solely of low-dimensional carbon materials. We propose a spintronic switch based on the recent discovery of negative magnetoresistance in graphene nanoribbons, and demonstrate its feasibility through tight-binding calculations of the band structure. Covalently connected carbon nanotubes create magnetic fields through graphene nanoribbons, cascading logic gates through incoherent spintronic switching. The exceptional material properties of carbon materials permit Terahertz operation and two orders of magnitude decrease in power-delay product compared to cutting-edge microprocessors. We hope to inspire the fabrication of these cascaded logic circuits to stimulate a transformative generation of energy-efficient computing.

  10. Anion-induced reconstitution of a self-assembling system to express a chloride-binding Co10L15 pentagonal prism.

    PubMed

    Riddell, Imogen A; Smulders, Maarten M J; Clegg, Jack K; Hristova, Yana R; Breiner, Boris; Thoburn, John D; Nitschke, Jonathan R

    2012-09-01

    Biochemical systems are adaptable, capable of reconstitution at all levels to achieve the functions associated with life. Synthetic chemical systems are more limited in their ability to reorganize to achieve new functions; they can reconfigure to bind an added substrate (template effect) or one binding event may modulate a receptor's affinity for a second substrate (allosteric effect). Here we describe a synthetic chemical system that is capable of structural reconstitution on receipt of one anionic signal (perchlorate) to create a tight binding pocket for another anion (chloride). The complex, barrel-like structure of the chloride receptor is templated by five perchlorate anions. This second-order templation phenomenon allows chemical networks to be envisaged that express more complex responses to chemical signals than is currently feasible.

  11. Semiconducting behavior of substitutionally doped bilayer graphene

    NASA Astrophysics Data System (ADS)

    Mousavi, Hamze; Khodadadi, Jabbar; Grabowski, Marek

    2018-02-01

    In the framework of the Green's functions approach, random tight-binding model and using the coherent potential approximation, electronic characteristics of the bilayer graphene are investigated by exploring various forms of substitutional doping of a single or both layers of the system by either boron and (or) nitrogen atoms. The results for displacement of the Fermi level resemble the behavior of acceptor or donor doping in a conventional semiconductor, dependent on the impurity type and concentration. The particular pattern of doping of just one layer with one impurity type is most efficient for opening a gap within the energy bands which could be tuned directly by impurity concentration. Doping both layers at the same time, each with one impurity type, leads to an anomaly whereby the gap decreases with increasing impurity concentration.

  12. Electro-optical properties of zigzag and armchair boron nitride nanotubes under a transverse electric field: Tight binding calculations

    NASA Astrophysics Data System (ADS)

    Chegel, Raad; Behzad, Somayeh

    2012-02-01

    The electro-optical properties of zigzag and armchair BNNTs in a uniform transverse electric field are investigated within tight binding approximation. It is found that the electric field modifies the band structure and splits band degeneracy where these effects reflect in the DOS and JDOS spectra. A decrease in the band gap, as a function of the electric field, is observed. This gap reduction increases with the diameter and it is independent of chirality. An analytic function to estimate the electric field needed for band gap closing is proposed which is in good agreement with DFT results. In additional, we show that the larger diameter tubes are more sensitive than small ones. Number and position of peaks in DOS and JDOS spectra for armchair and zigzag tubes with similar radius are dependent on electric field strength.

  13. Numerical Optimization of Density Functional Tight Binding Models: Application to Molecules Containing Carbon, Hydrogen, Nitrogen, and Oxygen

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Krishnapriyan, A.; Yang, P.; Niklasson, A. M. N.

    New parametrizations for semiempirical density functional tight binding (DFTB) theory have been developed by the numerical optimization of adjustable parameters to minimize errors in the atomization energy and interatomic forces with respect to ab initio calculated data. Initial guesses for the radial dependences of the Slater- Koster bond integrals and overlap integrals were obtained from minimum basis density functional theory calculations. The radial dependences of the pair potentials and the bond and overlap integrals were represented by simple analytic functions. The adjustable parameters in these functions were optimized by simulated annealing and steepest descent algorithms to minimize the value ofmore » an objective function that quantifies the error between the DFTB model and ab initio calculated data. The accuracy and transferability of the resulting DFTB models for the C, H, N, and O system were assessed by comparing the predicted atomization energies and equilibrium molecular geometries of small molecules that were not included in the training data from DFTB to ab initio data. The DFTB models provide accurate predictions of the properties of hydrocarbons and more complex molecules containing C, H, N, and O.« less

  14. Numerical Optimization of Density Functional Tight Binding Models: Application to Molecules Containing Carbon, Hydrogen, Nitrogen, and Oxygen

    DOE PAGES

    Krishnapriyan, A.; Yang, P.; Niklasson, A. M. N.; ...

    2017-10-17

    New parametrizations for semiempirical density functional tight binding (DFTB) theory have been developed by the numerical optimization of adjustable parameters to minimize errors in the atomization energy and interatomic forces with respect to ab initio calculated data. Initial guesses for the radial dependences of the Slater- Koster bond integrals and overlap integrals were obtained from minimum basis density functional theory calculations. The radial dependences of the pair potentials and the bond and overlap integrals were represented by simple analytic functions. The adjustable parameters in these functions were optimized by simulated annealing and steepest descent algorithms to minimize the value ofmore » an objective function that quantifies the error between the DFTB model and ab initio calculated data. The accuracy and transferability of the resulting DFTB models for the C, H, N, and O system were assessed by comparing the predicted atomization energies and equilibrium molecular geometries of small molecules that were not included in the training data from DFTB to ab initio data. The DFTB models provide accurate predictions of the properties of hydrocarbons and more complex molecules containing C, H, N, and O.« less

  15. Modeling extracellular fields for a three-dimensional network of cells using NEURON.

    PubMed

    Appukuttan, Shailesh; Brain, Keith L; Manchanda, Rohit

    2017-10-01

    Computational modeling of biological cells usually ignores their extracellular fields, assuming them to be inconsequential. Though such an assumption might be justified in certain cases, it is debatable for networks of tightly packed cells, such as in the central nervous system and the syncytial tissues of cardiac and smooth muscle. In the present work, we demonstrate a technique to couple the extracellular fields of individual cells within the NEURON simulation environment. The existing features of the simulator are extended by explicitly defining current balance equations, resulting in the coupling of the extracellular fields of adjacent cells. With this technique, we achieved continuity of extracellular space for a network model, thereby allowing the exploration of extracellular interactions computationally. Using a three-dimensional network model, passive and active electrical properties were evaluated under varying levels of extracellular volumes. Simultaneous intracellular and extracellular recordings for synaptic and action potentials were analyzed, and the potential of ephaptic transmission towards functional coupling of cells was explored. We have implemented a true bi-domain representation of a network of cells, with the extracellular domain being continuous throughout the entire model. This has hitherto not been achieved using NEURON, or other compartmental modeling platforms. We have demonstrated the coupling of the extracellular field of every cell in a three-dimensional model to obtain a continuous uniform extracellular space. This technique provides a framework for the investigation of interactions in tightly packed networks of cells via their extracellular fields. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. Three-dimensional structure-activity relationship modeling of cocaine binding to two monoclonal antibodies by comparative molecular field analysis.

    PubMed

    Paula, Stefan; Tabet, Michael R; Keenan, Susan M; Welsh, William J; Ball, W James

    2003-01-17

    Successful immunotherapy of cocaine addiction and overdoses requires cocaine-binding antibodies with specific properties, such as high affinity and selectivity for cocaine. We have determined the affinities of two cocaine-binding murine monoclonal antibodies (mAb: clones 3P1A6 and MM0240PA) for cocaine and its metabolites by [3H]-radioligand binding assays. mAb 3P1A6 (K(d) = 0.22 nM) displayed a 50-fold higher affinity for cocaine than mAb MM0240PA (K(d) = 11 nM) and also had a greater specificity for cocaine. For the systematic exploration of both antibodies' binding specificities, we used a set of approximately 35 cocaine analogues as structural probes by determining their relative binding affinities (RBAs) using an enzyme-linked immunosorbent competition assay. Three-dimensional quantitative structure-activity relationship (3D-QSAR) models on the basis of comparative molecular field analysis (CoMFA) techniques correlated the binding data with structural features of the ligands. The analysis indicated that despite the mAbs' differing specificities for cocaine, the relative contributions of the steric (approximately 80%) and electrostatic (approximately 20%) field interactions to ligand-binding were similar. Generated three-dimensional CoMFA contour plots then located the specific regions about cocaine where the ligand/receptor interactions occurred. While the overall binding patterns of the two mAbs had many features in common, distinct differences were observed about the phenyl ring and the methylester group of cocaine. Furthermore, using previously published data, a 3D-QSAR model was developed for cocaine binding to the dopamine reuptake transporter (DAT) that was compared to the mAb models. Although the relative steric and electrostatic field contributions were similar to those of the mAbs, the DAT cocaine-binding site showed a preference for negatively charged ligands. Besides establishing molecular level insight into the interactions that govern cocaine binding specificity by biopolymers, the three-dimensional images obtained reflect the properties of the mAbs binding pockets and provide the initial information needed for the possible design of novel antibodies with properties optimized for immunotherapy. Copyright 2003 Elsevier Science Ltd.

  17. Uncoupling protein 1 binds one nucleotide per monomer and is stabilized by tightly bound cardiolipin

    PubMed Central

    Lee, Yang; Willers, Chrissie; Kunji, Edmund R. S.; Crichton, Paul G.

    2015-01-01

    Uncoupling protein 1 (UCP1) catalyzes fatty acid-activated, purine nucleotide-sensitive proton leak across the mitochondrial inner membrane of brown adipose tissue to produce heat, and could help combat obesity and metabolic disease in humans. Studies over the last 30 years conclude that the protein is a dimer, binding one nucleotide molecule per two proteins, and unlike the related mitochondrial ADP/ATP carrier, does not bind cardiolipin. Here, we have developed novel methods to purify milligram amounts of UCP1 from native sources by using covalent chromatography that, unlike past methods, allows the protein to be prepared in defined conditions, free of excess detergent and lipid. Assessment of purified preparations by TLC reveal that UCP1 retains tightly bound cardiolipin, with a lipid phosphorus content equating to three molecules per protein, like the ADP/ATP carrier. Cardiolipin stabilizes UCP1, as demonstrated by reconstitution experiments and thermostability assays, indicating that the lipid has an integral role in the functioning of the protein, similar to other mitochondrial carriers. Furthermore, we find that UCP1 is not dimeric but monomeric, as indicated by size exclusion analysis, and has a ligand titration profile in isothermal calorimetric measurements that clearly shows that one nucleotide binds per monomer. These findings reveal the fundamental composition of UCP1, which is essential for understanding the mechanism of the protein. Our assessment of the properties of UCP1 indicate that it is not unique among mitochondrial carriers and so is likely to use a common exchange mechanism in its primary function in brown adipose tissue mitochondria. PMID:26038550

  18. Strong interlayer coupling in phosphorene/graphene van der Waals heterostructure: A first-principles investigation

    NASA Astrophysics Data System (ADS)

    Hu, Xue-Rong; Zheng, Ji-Ming; Ren, Zhao-Yu

    2018-04-01

    Based on first-principles calculations within the framework of density functional theory, we study the electronic properties of phosphorene/graphene heterostructures. Band gaps with different sizes are observed in the heterostructure, and charges transfer from graphene to phosphorene, causing the Fermi level of the heterostructure to shift downward with respect to the Dirac point of graphene. Significantly, strong coupling between two layers is discovered in the band spectrum even though it has a van der Waals heterostructure. A tight-binding Hamiltonian model is used to reveal that the resonance of the Bloch states between the phosphorene and graphene layers in certain K points combines with the symmetry matching between band states, which explains the reason for the strong coupling in such heterostructures. This work may enhance the understanding of interlayer interaction and composition mechanisms in van der Waals heterostructures consisting of two-dimensional layered nanomaterials, and may indicate potential reference information for nanoelectronic and optoelectronic applications.

  19. The Biotin/Avidin complex adhesion force

    NASA Astrophysics Data System (ADS)

    Balsera, Manel A.; Izrailev, Sergei; Stepaniants, Sergey; Oono, Yoshitsugu; Schulten, Klaus

    1997-03-01

    The vitamin Biotin and the protein avidin form one of the strongest non-covalent bonds between biological molecules. We have performed molecular and stochastic dynamic modeling of the unbinding of this complex(Izrailev et al., Biophysical Journal, In press). These simulations provide insight into the effect of particular residues and water on the tight binding of the system. With the aid of simple phenomenological models we have related qualitatively our results to Atomic Force Microscopy adhesion force measurements (E.-L. Florin, V. T. Moy and H. E. Gaub Science) 264:415-417 and kinetic dissociation experiments( A. Chilcotti and P. S. Stayton, J. Am. Chem. Soc.) 117:10622-10628. We will discuss the difficulties preventing a more quantitative understanding of the unbinding force and kinetics.

  20. Robust light transport in non-Hermitian photonic lattices

    PubMed Central

    Longhi, Stefano; Gatti, Davide; Valle, Giuseppe Della

    2015-01-01

    Combating the effects of disorder on light transport in micro- and nano-integrated photonic devices is of major importance from both fundamental and applied viewpoints. In ordinary waveguides, imperfections and disorder cause unwanted back-reflections, which hinder large-scale optical integration. Topological photonic structures, a new class of optical systems inspired by quantum Hall effect and topological insulators, can realize robust transport via topologically-protected unidirectional edge modes. Such waveguides are realized by the introduction of synthetic gauge fields for photons in a two-dimensional structure, which break time reversal symmetry and enable one-way guiding at the edge of the medium. Here we suggest a different route toward robust transport of light in lower-dimensional (1D) photonic lattices, in which time reversal symmetry is broken because of the non-Hermitian nature of transport. While a forward propagating mode in the lattice is amplified, the corresponding backward propagating mode is damped, thus resulting in an asymmetric transport insensitive to disorder or imperfections in the structure. Non-Hermitian asymmetric transport can occur in tight-binding lattices with an imaginary gauge field via a non-Hermitian delocalization transition, and in periodically-driven superlattices. The possibility to observe non-Hermitian delocalization is suggested using an engineered coupled-resonator optical waveguide (CROW) structure. PMID:26314932

  1. Robust light transport in non-Hermitian photonic lattices.

    PubMed

    Longhi, Stefano; Gatti, Davide; Della Valle, Giuseppe

    2015-08-28

    Combating the effects of disorder on light transport in micro- and nano-integrated photonic devices is of major importance from both fundamental and applied viewpoints. In ordinary waveguides, imperfections and disorder cause unwanted back-reflections, which hinder large-scale optical integration. Topological photonic structures, a new class of optical systems inspired by quantum Hall effect and topological insulators, can realize robust transport via topologically-protected unidirectional edge modes. Such waveguides are realized by the introduction of synthetic gauge fields for photons in a two-dimensional structure, which break time reversal symmetry and enable one-way guiding at the edge of the medium. Here we suggest a different route toward robust transport of light in lower-dimensional (1D) photonic lattices, in which time reversal symmetry is broken because of the non-Hermitian nature of transport. While a forward propagating mode in the lattice is amplified, the corresponding backward propagating mode is damped, thus resulting in an asymmetric transport insensitive to disorder or imperfections in the structure. Non-Hermitian asymmetric transport can occur in tight-binding lattices with an imaginary gauge field via a non-Hermitian delocalization transition, and in periodically-driven superlattices. The possibility to observe non-Hermitian delocalization is suggested using an engineered coupled-resonator optical waveguide (CROW) structure.

  2. Theoretical kinetic studies of models for binding myosin subfragment-1 to regulated actin: Hill model versus Geeves model.

    PubMed Central

    Chen , Y; Yan, B; Chalovich, J M; Brenner, B

    2001-01-01

    It was previously shown that a one-dimensional Ising model could successfully simulate the equilibrium binding of myosin S1 to regulated actin filaments (T. L. Hill, E. Eisenberg and L. Greene, Proc. Natl. Acad. Sci. U.S.A. 77:3186-3190, 1980). However, the time course of myosin S1 binding to regulated actin was thought to be incompatible with this model, and a three-state model was subsequently developed (D. F. McKillop and M. A. Geeves, Biophys. J. 65:693-701, 1993). A quantitative analysis of the predicted time course of myosin S1 binding to regulated actin, however, was never done for either model. Here we present the procedure for the theoretical evaluation of the time course of myosin S1 binding for both models and then show that 1) the Hill model can predict the "lag" in the binding of myosin S1 to regulated actin that is observed in the absence of Ca++ when S1 is in excess of actin, and 2) both models generate very similar families of binding curves when [S1]/[actin] is varied. This result shows that, just based on the equilibrium and pre-steady-state kinetic binding data alone, it is not possible to differentiate between the two models. Thus, the model of Hill et al. cannot be ruled out on the basis of existing pre-steady-state and equilibrium binding data. Physical mechanisms underlying the generation of the lag in the Hill model are discussed. PMID:11325734

  3. The role of enzyme and substrate concentration in the evaluation of serum angiotensin converting enzyme (ACE) inhibition by enalaprilat in vitro.

    PubMed

    Weisser, K; Schloos, J

    1991-10-09

    The relationship between serum angiotensin converting enzyme (ACE) activity and concentration of the ACE inhibitor enalaprilat was determined in vitro in the presence of different concentrations (S = 4-200 mM) of the substrate Hip-Gly-Gly. From Henderson plots, a competitive tight-binding relationship between enalaprilat and serum ACE was found yielding a value of approximately 5 nM for serum ACE concentration (Et) and an inhibition constant (Ki) for enalaprilat of approximately 0.1 nM. A plot of reaction velocity (Vi) versus total inhibitor concentration (It) exhibited a non-parallel shift of the inhibition curve to the right with increasing S. This was reflected by apparent Hill coefficients greater than 1 when the commonly used inhibitory sigmoid concentration-effect model (Emax model) was applied to the data. Slopes greater than 1 were obviously due to discrepancies between the free inhibitor concentration (If) present in the assay and It plotted on the abscissa and could, therefore, be indicators of tight-binding conditions. Thus, the sigmoid Emax model leads to an overestimation of Ki. Therefore, a modification of the inhibitory sigmoid Emax model (called "Emax tight model") was applied, which accounts for the depletion of If by binding, refers to It and allows estimation of the parameters Et and IC50f (free concentration of inhibitor when 50% inhibition occurs) using non-linear regression analysis. This model could describe the non-symmetrical shape of the inhibition curves and the results for Ki and Et correlated very well with those derived from the Henderson plots. The latter findings confirm that the degree of ACE inhibition measured in vitro is, in fact, dependent on the concentration of substrate and enzyme present in the assay. This is of importance not only for the correct evaluation of Ki but also for the interpretation of the time course of serum ACE inhibition measured ex vivo. The non-linear model has some advantages over the linear Henderson equation: it is directly applicable without conversion of the data and avoids the stochastic dependency of the variables, allowing non-linear regression of all data points contributing with the same weight.

  4. Mechanistic Basis Of Calmodulin Mediated Estrogen Receptor Alpha Activation and Antiestrogen Resistance

    DTIC Science & Technology

    2010-06-01

    for solubility (Figure 5). We call this protein Trx -ERA241-320. We also produced a similar protein construct, but with only residues 241-273 of...ERa, as a “control” (Figure 5). We call this protein Trx -ERA241-273. Because CaM binds tightly to the N-terminal extended ligand binding domain of...ERa (residues 286- 552, see above), we hypothesized that Trx - ERA241-320 would bind tightly to CaM, but that Trx -ERA241-273 would not. The genetic

  5. The heat-shock protein Apg-2 binds to the tight junction protein ZO-1 and regulates transcriptional activity of ZONAB.

    PubMed

    Tsapara, Anna; Matter, Karl; Balda, Maria S

    2006-03-01

    The tight junction adaptor protein ZO-1 regulates intracellular signaling and cell proliferation. Its Src homology 3 (SH3) domain is required for the regulation of proliferation and binds to the Y-box transcription factor ZO-1-associated nucleic acid binding protein (ZONAB). Binding of ZO-1 to ZONAB results in cytoplasmic sequestration and hence inhibition of ZONAB's transcriptional activity. Here, we identify a new binding partner of the SH3 domain that modulates ZO-1-ZONAB signaling. Expression screening of a cDNA library with a fusion protein containing the SH3 domain yielded a cDNA coding for Apg-2, a member of the heat-shock protein 110 (Hsp 110) subfamily of Hsp70 heat-shock proteins, which is overexpressed in carcinomas. Regulated depletion of Apg-2 in Madin-Darby canine kidney cells inhibits G(1)/S phase progression. Apg-2 coimmunoprecipitates with ZO-1 and partially localizes to intercellular junctions. Junctional recruitment and coimmunoprecipitation with ZO-1 are stimulated by heat shock. Apg-2 competes with ZONAB for binding to the SH3 domain in vitro and regulates ZONAB's transcriptional activity in reporter gene assays. Our data hence support a model in which Apg-2 regulates ZONAB function by competing for binding to the SH3 domain of ZO-1 and suggest that Apg-2 functions as a regulator of ZO-1-ZONAB signaling in epithelial cells in response to cellular stress.

  6. The Heat-Shock Protein Apg-2 Binds to the Tight Junction Protein ZO-1 and Regulates Transcriptional Activity of ZONAB

    PubMed Central

    Tsapara, Anna; Matter, Karl; Balda, Maria S.

    2006-01-01

    The tight junction adaptor protein ZO-1 regulates intracellular signaling and cell proliferation. Its Src homology 3 (SH3) domain is required for the regulation of proliferation and binds to the Y-box transcription factor ZO-1-associated nucleic acid binding protein (ZONAB). Binding of ZO-1 to ZONAB results in cytoplasmic sequestration and hence inhibition of ZONAB's transcriptional activity. Here, we identify a new binding partner of the SH3 domain that modulates ZO-1–ZONAB signaling. Expression screening of a cDNA library with a fusion protein containing the SH3 domain yielded a cDNA coding for Apg-2, a member of the heat-shock protein 110 (Hsp 110) subfamily of Hsp70 heat-shock proteins, which is overexpressed in carcinomas. Regulated depletion of Apg-2 in Madin-Darby canine kidney cells inhibits G1/S phase progression. Apg-2 coimmunoprecipitates with ZO-1 and partially localizes to intercellular junctions. Junctional recruitment and coimmunoprecipitation with ZO-1 are stimulated by heat shock. Apg-2 competes with ZONAB for binding to the SH3 domain in vitro and regulates ZONAB's transcriptional activity in reporter gene assays. Our data hence support a model in which Apg-2 regulates ZONAB function by competing for binding to the SH3 domain of ZO-1 and suggest that Apg-2 functions as a regulator of ZO-1–ZONAB signaling in epithelial cells in response to cellular stress. PMID:16407410

  7. Majorana-Hubbard model on the square lattice

    NASA Astrophysics Data System (ADS)

    Affleck, Ian; Rahmani, Armin; Pikulin, Dmitry

    2017-09-01

    We study a tight-binding model of interacting Majorana (Hermitian) modes on a square lattice. The model may have an experimental realization in a superconducting-film-topological-insulator heterostructure in a magnetic field. We find a rich phase diagram, as a function of interaction strength, including an emergent superfluid phase with spontaneous breaking of an emergent U (1 ) symmetry, separated by a supersymmetric transition from a gapless normal phase.

  8. Structural insights into the anti-HIV activity of the Oscillatoria agardhii agglutinin homolog lectin family.

    PubMed

    Koharudin, Leonardus M I; Kollipara, Sireesha; Aiken, Christopher; Gronenborn, Angela M

    2012-09-28

    Oscillatoria agardhii agglutinin homolog (OAAH) proteins belong to a recently discovered lectin family. All members contain a sequence repeat of ~66 amino acids, with the number of repeats varying among different family members. Apart from data for the founding member OAA, neither three-dimensional structures, information about carbohydrate binding specificities, nor antiviral activity data have been available up to now for any other members of the OAAH family. To elucidate the structural basis for the antiviral mechanism of OAAHs, we determined the crystal structures of Pseudomonas fluorescens and Myxococcus xanthus lectins. Both proteins exhibit the same fold, resembling the founding family member, OAA, with minor differences in loop conformations. Carbohydrate binding studies by NMR and x-ray structures of glycan-lectin complexes reveal that the number of sugar binding sites corresponds to the number of sequence repeats in each protein. As for OAA, tight and specific binding to α3,α6-mannopentaose was observed. All the OAAH proteins described here exhibit potent anti-HIV activity at comparable levels. Altogether, our results provide structural details of the protein-carbohydrate interaction for this novel lectin family and insights into the molecular basis of their HIV inactivation properties.

  9. Magnetic quantization in monolayer bismuthene

    NASA Astrophysics Data System (ADS)

    Chen, Szu-Chao; Chiu, Chih-Wei; Lin, Hui-Chi; Lin, Ming-Fa

    The magnetic quantization in monolayer bismuthene is investigated by the generalized tight-binding model. The quite large Hamiltonian matrix is built from the tight-binding functions of the various sublattices, atomic orbitals and spin states. Due to the strong spin orbital coupling and sp3 bonding, monolayer bismuthene has the diverse low-lying energy bands such as the parabolic, linear and oscillating energy bands. The main features of band structures are further reflected in the rich magnetic quantization. Under a uniform perpendicular magnetic field (Bz) , three groups of Landau levels (LLs) with distinct features are revealed near the Fermi level. Their Bz-dependent energy spectra display the linear, square-root and non-monotonous dependences, respectively. These LLs are dominated by the combinations of the 6pz orbital and (6px,6py) orbitals as a result of strong sp3 bonding. Specifically, the LL anti-crossings only occur between LLs originating from the oscillating energy band.

  10. Chirality dependence of dipole matrix element of carbon nanotubes in axial magnetic field: A third neighbor tight binding approach

    NASA Astrophysics Data System (ADS)

    Chegel, Raad; Behzad, Somayeh

    2014-02-01

    We have studied the electronic structure and dipole matrix element, D, of carbon nanotubes (CNTs) under magnetic field, using the third nearest neighbor tight binding model. It is shown that the 1NN and 3NN-TB band structures show differences such as the spacing and mixing of neighbor subbands. Applying the magnetic field leads to breaking the degeneracy behavior in the D transitions and creates new allowed transitions corresponding to the band modifications. It is found that |D| is proportional to the inverse tube radius and chiral angle. Our numerical results show that amount of filed induced splitting for the first optical peak is proportional to the magnetic field by the splitting rate ν11. It is shown that ν11 changes linearly and parabolicly with the chiral angle and radius, respectively.

  11. Dynamic hysteresis in a one-dimensional Ising model: application to allosteric proteins.

    PubMed

    Graham, I; Duke, T A J

    2005-06-01

    We solve exactly the problem of dynamic hysteresis for a finite one-dimensional Ising model at low temperature. We find that the area of the hysteresis loop, as the field is varied periodically, scales as the square root of the field frequency for a large range of frequencies. Below a critical frequency there is a correction to the scaling law, resulting in a linear relationship between hysteresis area and frequency. The one-dimensional Ising model provides a simplified description of switchlike behavior in allosteric proteins, such as hemoglobin. Thus our analysis predicts the switching dynamics of allosteric proteins when they are exposed to a ligand concentration which changes with time. Many allosteric proteins bind a regulator that is maintained at a nonequilibrium concentration by active signal transduction processes. In the light of our analysis, we discuss to what extent allosteric proteins can respond to changes in regulator concentration caused by an upstream signaling event, while remaining insensitive to the intrinsic nonequilibrium fluctuations in regulator level which occur in the absence of a signal.

  12. Thermodynamics of cooperative binding of FAD to human NQO1: Implications to understanding cofactor-dependent function and stability of the flavoproteome.

    PubMed

    Clavería-Gimeno, Rafael; Velazquez-Campoy, Adrian; Pey, Angel Luis

    2017-12-15

    The stability of human flavoproteins strongly depends on flavin levels, although the structural and energetic basis of this relationship is poorly understood. Here, we report an in-depth analysis on the thermodynamics of FAD binding to one of the most representative examples of such relationship, NAD(P)H:quinone oxidoreductase 1 (NQO1). NQO1 is a dimeric enzyme that tightly binds FAD, which triggers large structural changes upon binding. A common cancer-associated polymorphism (P187S) severely compromises FAD binding. We show that FAD binding is described well by a thermodynamic model explicitly incorporating binding cooperativity when applied to different sets of calorimetric analyses and NQO1 variants, thus providing insight on the effects in vitro and in cells of cancer-associated P187S, its suppressor mutation H80R and the role of NQO1 C-terminal domain to modulate binding cooperativity and energetics. Furthermore, we show that FAD binding to NQO1 is very sensitive to physiologically relevant environmental conditions, such as the presence of phosphate buffer and salts. Overall, our results contribute to understanding at the molecular level the link between NQO1 stability and fluctuations of FAD levels intracellularly, and supports the notion that FAD binding energetics and cooperativity are fundamentally linked with the dynamic nature of apo-NQO1 conformational ensemble. Copyright © 2017 Elsevier Inc. All rights reserved.

  13. Substrate-Triggered Exosite Binding: Synergistic Dendrimer/Folic Acid Action for Achieving Specific, Tight-Binding to Folate Binding Protein.

    PubMed

    Chen, Junjie; van Dongen, Mallory A; Merzel, Rachel L; Dougherty, Casey A; Orr, Bradford G; Kanduluru, Ananda Kumar; Low, Philip S; Marsh, E Neil G; Banaszak Holl, Mark M

    2016-03-14

    Polymer-ligand conjugates are designed to bind proteins for applications as drugs, imaging agents, and transport scaffolds. In this work, we demonstrate a folic acid (FA)-triggered exosite binding of a generation five poly(amidoamine) (G5 PAMAM) dendrimer scaffold to bovine folate binding protein (bFBP). The protein exosite is a secondary binding site on the protein surface, separate from the FA binding pocket, to which the dendrimer binds. Exosite binding is required to achieve the greatly enhanced binding constants and protein structural change observed in this study. The G5Ac-COG-FA1.0 conjugate bound tightly to bFBP, was not displaced by a 28-fold excess of FA, and quenched roughly 80% of the initial fluorescence. Two-step binding kinetics were measured using the intrinsic fluorescence of the FBP tryptophan residues to give a KD in the low nanomolar range for formation of the initial G5Ac-COG-FA1.0/FBP* complex, and a slow conversion to the tight complex formed between the dendrimer and the FBP exosite. The extent of quenching was sensitive to the choice of FA-dendrimer linker chemistry. Direct amide conjugation of FA to G5-PAMAM resulted in roughly 50% fluorescence quenching of the FBP. The G5Ac-COG-FA, which has a longer linker containing a 1,2,3-triazole ring, exhibited an ∼80% fluorescence quenching. The binding of the G5Ac-COG-FA1.0 conjugate was compared to poly(ethylene glycol) (PEG) conjugates of FA (PEGn-FA). PEG2k-FA had a binding strength similar to that of FA, whereas other PEG conjugates with higher molecular weight showed weaker binding. However, no PEG conjugates gave an increased degree of total fluorescence quenching.

  14. Total-energy Assisted Tight-binding Method Based on Local Density Approximation of Density Functional Theory

    NASA Astrophysics Data System (ADS)

    Fujiwara, Takeo; Nishino, Shinya; Yamamoto, Susumu; Suzuki, Takashi; Ikeda, Minoru; Ohtani, Yasuaki

    2018-06-01

    A novel tight-binding method is developed, based on the extended Hückel approximation and charge self-consistency, with referring the band structure and the total energy of the local density approximation of the density functional theory. The parameters are so adjusted by computer that the result reproduces the band structure and the total energy, and the algorithm for determining parameters is established. The set of determined parameters is applicable to a variety of crystalline compounds and change of lattice constants, and, in other words, it is transferable. Examples are demonstrated for Si crystals of several crystalline structures varying lattice constants. Since the set of parameters is transferable, the present tight-binding method may be applicable also to molecular dynamics simulations of large-scale systems and long-time dynamical processes.

  15. DFTBaby: A software package for non-adiabatic molecular dynamics simulations based on long-range corrected tight-binding TD-DFT(B)

    NASA Astrophysics Data System (ADS)

    Humeniuk, Alexander; Mitrić, Roland

    2017-12-01

    A software package, called DFTBaby, is published, which provides the electronic structure needed for running non-adiabatic molecular dynamics simulations at the level of tight-binding DFT. A long-range correction is incorporated to avoid spurious charge transfer states. Excited state energies, their analytic gradients and scalar non-adiabatic couplings are computed using tight-binding TD-DFT. These quantities are fed into a molecular dynamics code, which integrates Newton's equations of motion for the nuclei together with the electronic Schrödinger equation. Non-adiabatic effects are included by surface hopping. As an example, the program is applied to the optimization of excited states and non-adiabatic dynamics of polyfluorene. The python and Fortran source code is available at http://www.dftbaby.chemie.uni-wuerzburg.de.

  16. Exact solution of corner-modified banded block-Toeplitz eigensystems

    NASA Astrophysics Data System (ADS)

    Cobanera, Emilio; Alase, Abhijeet; Ortiz, Gerardo; Viola, Lorenza

    2017-05-01

    Motivated by the challenge of seeking a rigorous foundation for the bulk-boundary correspondence for free fermions, we introduce an algorithm for determining exactly the spectrum and a generalized-eigenvector basis of a class of banded block quasi-Toeplitz matrices that we call corner-modified. Corner modifications of otherwise arbitrary banded block-Toeplitz matrices capture the effect of boundary conditions and the associated breakdown of translational invariance. Our algorithm leverages the interplay between a non-standard, projector-based method of kernel determination (physically, a bulk-boundary separation) and families of linear representations of the algebra of matrix Laurent polynomials. Thanks to the fact that these representations act on infinite-dimensional carrier spaces in which translation symmetry is restored, it becomes possible to determine the eigensystem of an auxiliary projected block-Laurent matrix. This results in an analytic eigenvector Ansatz, independent of the system size, which we prove is guaranteed to contain the full solution of the original finite-dimensional problem. The actual solution is then obtained by imposing compatibility with a boundary matrix, whose shape is also independent of system size. As an application, we show analytically that eigenvectors of short-ranged fermionic tight-binding models may display power-law corrections to exponential behavior, and demonstrate the phenomenon for the paradigmatic Majorana chain of Kitaev.

  17. A maximally particle-hole asymmetric spectrum emanating from a semi-Dirac point.

    PubMed

    Quan, Yundi; Pickett, Warren E

    2018-02-21

    Tight binding models have proven an effective means of revealing Dirac (massless) dispersion, flat bands (infinite mass), and intermediate cases such as the semi-Dirac (sD) dispersion. This approach is extended to a three band model that yields, with chosen parameters in a two-band limit, a closed line with maximally asymmetric particle-hole dispersion: infinite mass holes, zero mass particles. The model retains the sD points for a general set of parameters. Adjacent to this limiting case, hole Fermi surfaces are tiny and needle-like. A pair of large electron Fermi surfaces at low doping merge and collapse at half filling to a flat (zero energy) closed contour with infinite mass along the contour and enclosing no carriers on either side, while the hole Fermi surface has shrunk to a point at zero energy, also containing no carriers. The tight binding model is used to study several characteristics of the dispersion and density of states. The model inspired generalization of sD dispersion to a general  ±[Formula: see text] form, for which analysis reveals that both n and m must be odd to provide a diabolical point with topological character. Evolution of the Hofstadter spectrum of this three band system with interband coupling strength is presented and discussed.

  18. A maximally particle-hole asymmetric spectrum emanating from a semi-Dirac point

    NASA Astrophysics Data System (ADS)

    Quan, Yundi; Pickett, Warren E.

    2018-02-01

    Tight binding models have proven an effective means of revealing Dirac (massless) dispersion, flat bands (infinite mass), and intermediate cases such as the semi-Dirac (sD) dispersion. This approach is extended to a three band model that yields, with chosen parameters in a two-band limit, a closed line with maximally asymmetric particle-hole dispersion: infinite mass holes, zero mass particles. The model retains the sD points for a general set of parameters. Adjacent to this limiting case, hole Fermi surfaces are tiny and needle-like. A pair of large electron Fermi surfaces at low doping merge and collapse at half filling to a flat (zero energy) closed contour with infinite mass along the contour and enclosing no carriers on either side, while the hole Fermi surface has shrunk to a point at zero energy, also containing no carriers. The tight binding model is used to study several characteristics of the dispersion and density of states. The model inspired generalization of sD dispersion to a general  ± \\sqrt{k_x2n +k_y2m} form, for which analysis reveals that both n and m must be odd to provide a diabolical point with topological character. Evolution of the Hofstadter spectrum of this three band system with interband coupling strength is presented and discussed.

  19. Structure and Regulatory Interactions of the Cytoplasmic Terminal Domains of Serotonin Transporter

    PubMed Central

    2014-01-01

    Uptake of neurotransmitters by sodium-coupled monoamine transporters of the NSS family is required for termination of synaptic transmission. Transport is tightly regulated by protein–protein interactions involving the small cytoplasmic segments at the amino- and carboxy-terminal ends of the transporter. Although structures of homologues provide information about the transmembrane regions of these transporters, the structural arrangement of the terminal domains remains largely unknown. Here, we combined molecular modeling, biochemical, and biophysical approaches in an iterative manner to investigate the structure of the 82-residue N-terminal and 30-residue C-terminal domains of human serotonin transporter (SERT). Several secondary structures were predicted in these domains, and structural models were built using the Rosetta fragment-based methodology. One-dimensional 1H nuclear magnetic resonance and circular dichroism spectroscopy supported the presence of helical elements in the isolated SERT N-terminal domain. Moreover, introducing helix-breaking residues within those elements altered the fluorescence resonance energy transfer signal between terminal cyan fluorescent protein and yellow fluorescent protein tags attached to full-length SERT, consistent with the notion that the fold of the terminal domains is relatively well-defined. Full-length models of SERT that are consistent with these and published experimental data were generated. The resultant models predict confined loci for the terminal domains and predict that they move apart during the transport-related conformational cycle, as predicted by structures of homologues and by the “rocking bundle” hypothesis, which is consistent with spectroscopic measurements. The models also suggest the nature of binding to regulatory interaction partners. This study provides a structural context for functional and regulatory mechanisms involving SERT terminal domains. PMID:25093911

  20. Combined first-principles and model Hamiltonian study of the perovskite series R MnO 3 (R =La ,Pr ,Nd ,Sm ,Eu , and Gd )

    NASA Astrophysics Data System (ADS)

    Kováčik, Roman; Murthy, Sowmya Sathyanarayana; Quiroga, Carmen E.; Ederer, Claude; Franchini, Cesare

    2016-02-01

    We merge advanced ab initio schemes (standard density functional theory, hybrid functionals, and the G W approximation) with model Hamiltonian approaches (tight-binding and Heisenberg Hamiltonian) to study the evolution of the electronic, magnetic, and dielectric properties of the manganite family R MnO3 (R =La,Pr,Nd,Sm,Eu, and Gd) . The link between first principles and tight binding is established by downfolding the physically relevant subset of 3 d bands with eg character by means of maximally localized Wannier functions (MLWFs) using the VASP2WANNIER90 interface. The MLWFs are then used to construct a general tight-binding Hamiltonian written as a sum of the kinetic term, the Hund's rule coupling, the JT coupling, and the electron-electron interaction. The dispersion of the tight-binding (TB) eg bands at all levels are found to match closely the MLWFs. We provide a complete set of TB parameters which can serve as guidance for the interpretation of future studies based on many-body Hamiltonian approaches. In particular, we find that the Hund's rule coupling strength, the Jahn-Teller coupling strength, and the Hubbard interaction parameter U remain nearly constant for all the members of the R MnO3 series, whereas the nearest-neighbor hopping amplitudes show a monotonic attenuation as expected from the trend of the tolerance factor. Magnetic exchange interactions, computed by mapping a large set of hybrid functional total energies onto an Heisenberg Hamiltonian, clarify the origin of the A-type magnetic ordering observed in the early rare-earth manganite series as arising from a net negative out-of-plane interaction energy. The obtained exchange parameters are used to estimate the Néel temperature by means of Monte Carlo simulations. The resulting data capture well the monotonic decrease of the ordering temperature down the series from R =La to Gd, in agreement with experiments. This trend correlates well with the modulation of structural properties, in particular with the progressive reduction of the Mn-O-Mn bond angle which is associated with the quenching of the volume and the decrease of the tolerance factor due to the shrinkage of the ionic radii of R going from La to Gd.

  1. Quantum solution for the one-dimensional Coulomb problem

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nunez-Yepez, H. N.; Salas-Brito, A. L.; Solis, Didier A.

    2011-06-15

    The one-dimensional hydrogen atom has been a much studied system with a wide range of applications. Since the pioneering work of Loudon [R. Loudon, Am. J. Phys. 27, 649 (1959).], a number of different features related to the nature of the eigenfunctions have been found. However, many of the claims made throughout the years in this regard are not correct--such as the existence of only odd eigenstates or of an infinite binding-energy ground state. We explicitly show that the one-dimensional hydrogen atom does not admit a ground state of infinite binding energy and that the one-dimensional Coulomb potential is notmore » its own supersymmetric partner. Furthermore, we argue that at the root of many such false claims lies the omission of a superselection rule that effectively separates the right side from the left side of the singularity of the Coulomb potential.« less

  2. Compound activity prediction using models of binding pockets or ligand properties in 3D

    PubMed Central

    Kufareva, Irina; Chen, Yu-Chen; Ilatovskiy, Andrey V.; Abagyan, Ruben

    2014-01-01

    Transient interactions of endogenous and exogenous small molecules with flexible binding sites in proteins or macromolecular assemblies play a critical role in all biological processes. Current advances in high-resolution protein structure determination, database development, and docking methodology make it possible to design three-dimensional models for prediction of such interactions with increasing accuracy and specificity. Using the data collected in the Pocketome encyclopedia, we here provide an overview of two types of the three-dimensional ligand activity models, pocket-based and ligand property-based, for two important classes of proteins, nuclear and G-protein coupled receptors. For half the targets, the pocket models discriminate actives from property matched decoys with acceptable accuracy (the area under ROC curve, AUC, exceeding 84%) and for about one fifth of the targets with high accuracy (AUC > 95%). The 3D ligand property field models performed better than 95% in half of the cases. The high performance models can already become a basis of activity predictions for new chemicals. Family-wide benchmarking of the models highlights strengths of both approaches and helps identify their inherent bottlenecks and challenges. PMID:23116466

  3. Electric-field-induced plasmon in AA-stacked bilayer graphene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chuang, Y.C., E-mail: yingchih.chuang@gmail.com; Wu, J.Y., E-mail: yarst5@gmail.com; Lin, M.F., E-mail: mflin@mail.ncku.edu.tw

    2013-12-15

    The collective excitations in AA-stacked bilayer graphene for a perpendicular electric field are investigated analytically within the tight-binding model and the random-phase approximation. Such a field destroys the uniform probability distribution of the four sublattices. This drives a symmetry breaking between the intralayer and interlayer polarization intensities from the intrapair band excitations. A field-induced acoustic plasmon thus emerges in addition to the strongly field-tunable intrinsic acoustic and optical plasmons. At long wavelengths, the three modes show different dispersions and field dependence. The definite physical mechanism of the electrically inducible and tunable mode can be expected to also be present inmore » other AA-stacked few-layer graphenes. -- Highlights: •The analytical derivations are performed by the tight-binding model. •An electric field drives the non-uniformity of the charge distribution. •A symmetry breaking between the intralayer and interlayer polarizations is illustrated. •An extra plasmon emerges besides two intrinsic modes in AA-stacked bilayer graphene. •The mechanism of a field-induced mode is present in AA-stacked few-layer graphenes.« less

  4. Free energy of RNA-counterion interactions in a tight-binding model computed by a discrete space mapping

    NASA Astrophysics Data System (ADS)

    Henke, Paul S.; Mak, Chi H.

    2014-08-01

    The thermodynamic stability of a folded RNA is intricately tied to the counterions and the free energy of this interaction must be accounted for in any realistic RNA simulations. Extending a tight-binding model published previously, in this paper we investigate the fundamental structure of charges arising from the interaction between small functional RNA molecules and divalent ions such as Mg2+ that are especially conducive to stabilizing folded conformations. The characteristic nature of these charges is utilized to construct a discretely connected energy landscape that is then traversed via a novel application of a deterministic graph search technique. This search method can be incorporated into larger simulations of small RNA molecules and provides a fast and accurate way to calculate the free energy arising from the interactions between an RNA and divalent counterions. The utility of this algorithm is demonstrated within a fully atomistic Monte Carlo simulation of the P4-P6 domain of the Tetrahymena group I intron, in which it is shown that the counterion-mediated free energy conclusively directs folding into a compact structure.

  5. Spin textures on general surfaces of the correlated topological insulator SmB6

    NASA Astrophysics Data System (ADS)

    Baruselli, Pier Paolo; Vojta, Matthias

    2016-05-01

    Employing the k .p expansion for a family of tight-binding models for SmB6, we analytically compute topological surface states on a generic (l m n ) surface. We show how the Dirac-cone spin structure depends on model ingredients and on the angle θ between the surface normal and the main crystal axes. We apply the general theory to (001), (110), (111), and (210) surfaces, for which we provide concrete predictions for the spin pattern of surface states which we also compare with tight-binding results. As shown in previous work, the spin pattern on a (001 ) surface can be related to the value of mirror Chern numbers, and we explore the possibility of topological phase transitions between states with different mirror Chern numbers and the associated change of the spin structure of surface states. Such transitions may be accessed by varying either the hybridization between conduction and f electrons or the crystal-field splitting of the low-energy f multiplets, and we compute corresponding phase diagrams. Experimentally, chemical doping is a promising route to realize such transitions.

  6. Free energy of RNA-counterion interactions in a tight-binding model computed by a discrete space mapping.

    PubMed

    Henke, Paul S; Mak, Chi H

    2014-08-14

    The thermodynamic stability of a folded RNA is intricately tied to the counterions and the free energy of this interaction must be accounted for in any realistic RNA simulations. Extending a tight-binding model published previously, in this paper we investigate the fundamental structure of charges arising from the interaction between small functional RNA molecules and divalent ions such as Mg(2+) that are especially conducive to stabilizing folded conformations. The characteristic nature of these charges is utilized to construct a discretely connected energy landscape that is then traversed via a novel application of a deterministic graph search technique. This search method can be incorporated into larger simulations of small RNA molecules and provides a fast and accurate way to calculate the free energy arising from the interactions between an RNA and divalent counterions. The utility of this algorithm is demonstrated within a fully atomistic Monte Carlo simulation of the P4-P6 domain of the Tetrahymena group I intron, in which it is shown that the counterion-mediated free energy conclusively directs folding into a compact structure.

  7. Tight-binding analysis of Si and GaAs ultrathin bodies with subatomic wave-function resolution

    NASA Astrophysics Data System (ADS)

    Tan, Yaohua P.; Povolotskyi, Michael; Kubis, Tillmann; Boykin, Timothy B.; Klimeck, Gerhard

    2015-08-01

    Empirical tight-binding (ETB) methods are widely used in atomistic device simulations. Traditional ways of generating the ETB parameters rely on direct fitting to bulk experiments or theoretical electronic bands. However, ETB calculations based on existing parameters lead to unphysical results in ultrasmall structures like the As-terminated GaAs ultrathin bodies (UTBs). In this work, it is shown that more transferable ETB parameters with a short interaction range can be obtained by a process of mapping ab initio bands and wave functions to ETB models. This process enables the calibration of not only the ETB energy bands but also the ETB wave functions with corresponding ab initio calculations. Based on the mapping process, ETB models of Si and GaAs are parameterized with respect to hybrid functional calculations. Highly localized ETB basis functions are obtained. Both the ETB energy bands and wave functions with subatomic resolution of UTBs show good agreement with the corresponding hybrid functional calculations. The ETB methods can then be used to explain realistically extended devices in nonequilibrium that cannot be tackled with ab initio methods.

  8. Nonlocal torque operators in ab initio theory of the Gilbert damping in random ferromagnetic alloys

    NASA Astrophysics Data System (ADS)

    Turek, I.; Kudrnovský, J.; Drchal, V.

    2015-12-01

    We present an ab initio theory of the Gilbert damping in substitutionally disordered ferromagnetic alloys. The theory rests on introduced nonlocal torques which replace traditional local torque operators in the well-known torque-correlation formula and which can be formulated within the atomic-sphere approximation. The formalism is sketched in a simple tight-binding model and worked out in detail in the relativistic tight-binding linear muffin-tin orbital method and the coherent potential approximation (CPA). The resulting nonlocal torques are represented by nonrandom, non-site-diagonal, and spin-independent matrices, which simplifies the configuration averaging. The CPA-vertex corrections play a crucial role for the internal consistency of the theory and for its exact equivalence to other first-principles approaches based on the random local torques. This equivalence is also illustrated by the calculated Gilbert damping parameters for binary NiFe and FeCo random alloys, for pure iron with a model atomic-level disorder, and for stoichiometric FePt alloys with a varying degree of L 10 atomic long-range order.

  9. Intense conductivity suppression by edge defects in zigzag MoS2 and WSe2 nanoribbons: a density functional based tight-binding study.

    PubMed

    Silva, F W N; Costa, A L M T; Liu, Lei; Barros, E B

    2016-11-04

    The effects of edge vacancies on the electron transport properties of zigzag MoS2/WSe2 nanoribbons are studied using a density functional theory (DFT)-based tight-binding model with a sp(3)d(5) basis set for the electronic structure calculation and applying the Landauer-Büttiker approach for the electronic transport. Our results show that the presence of a single edge vacancy, with a missing MoS2/WSe2 triplet, is enough to suppress the conductance of the system by almost one half for most energies around the Fermi level. Furthermore, the presence of other single defects along the same edge has little effect on the overall conductance, indicating that the conductance of that particular edge has been strongly suppressed by the first defect. The presence of another defect on the opposite edge further suppresses the quantum conductance, independently of the relative position between the two defects in opposite edges. The introduction of other defects cause the suppression to be energy dependent, leading to conductance peaks which depend on the geometry of the edges. The strong conductance dependence on the presence of edge defects is corroborated by DFT calculations using SIESTA, which show that the electronic bands near the Fermi energy are strongly localized at the edge.

  10. Electronic Structure and Properties of Deformed Carbon Nanotubes

    NASA Technical Reports Server (NTRS)

    Yang, Liu; Arnold, Jim (Technical Monitor)

    2001-01-01

    A theoretical framework based on Huckel tight-binding model has been formulated to analyze the electronic structure of carbon nanotubes under uniform deformation. The model successfully quantifies the dispersion relation, density of states and bandgap change of nanotubes under uniform stretching, compression, torsion and bending. Our analysis shows that the shifting of the Fermi point away from the Brillouin zone vertices is the key reason for these changes. As a result of this shifting, the electronic structure of deformed carbon nanotubes varies dramatically depending on their chirality and deformation mode. Treating the Fermi point as a function of strain and tube chirality, the analytical solution preserves the concise form of undeformed carbon nanotubes. It predicts the shifting, merging and splitting of the Van Hove singularities in the density of states and the zigzag pattern of bandgap change under strains. Four orbital tight-binding simulations of carbon nanotubes under uniform stretching, compression, torsion and bending have been performed to verify the analytical solution. Extension to more complex systems are being performed to relate this analytical solution to the spectroscopic characterization, device performance and proposed quantum structures induced by the deformation. The limitations of this model will also be discussed.

  11. Band-gap tuning and optical response of two-dimensional SixC1 -x : A first-principles real-space study of disordered two-dimensional materials

    NASA Astrophysics Data System (ADS)

    Sadhukhan, Banasree; Singh, Prashant; Nayak, Arabinda; Datta, Sujoy; Johnson, Duane D.; Mookerjee, Abhijit

    2017-08-01

    We present a real-space formulation for calculating the electronic structure and optical conductivity of random alloys based on Kubo-Greenwood formalism interfaced with augmented space recursion technique [Mookerjee, J. Phys. C 6, 1340 (1973), 10.1088/0022-3719/6/8/003] formulated with the tight-binding linear muffin-tin orbital basis with the van Leeuwen-Baerends corrected exchange potential [Singh, Harbola, Hemanadhan, Mookerjee, and Johnson, Phys. Rev. B 93, 085204 (2016), 10.1103/PhysRevB.93.085204]. This approach has been used to quantitatively analyze the effect of chemical disorder on the configuration averaged electronic properties and optical response of two-dimensional honeycomb siliphene SixC1 -x beyond the usual Dirac-cone approximation. We predicted the quantitative effect of disorder on both the electronic structure and optical response over a wide energy range, and the results are discussed in the light of the available experimental and other theoretical data. Our proposed formalism may open up a facile way for planned band-gap engineering in optoelectronic applications.

  12. NMR structure and conformational dynamics of AtPDFL2.1, a defensin-like peptide from Arabidopsis thaliana.

    PubMed

    Omidvar, Reza; Xia, Youlin; Porcelli, Fernando; Bohlmann, Holger; Veglia, Gianluigi

    2016-12-01

    Plant defensins constitute the innate immune response against pathogens such as fungi and bacteria. Typical plant defensins are small, basic peptides that possess a characteristic three-dimensional fold stabilized by three or four disulfide bridges. In addition to known defensin genes, the Arabidopsis genome comprises >300 defensin-like genes coding for small cysteine-rich peptides. One of such genes encodes for AtPDFL2.1, a putative antifungal peptide of 55 amino acids, with six cysteine residues in its primary sequence. To understand the functional role of AtPDFL2.1, we carried out antifungal activity assays and determined its high-resolution three-dimensional structure using multidimensional solution NMR spectroscopy. We found that AtPDFL2.1 displays a strong inhibitory effect against Fusarium graminearum (IC 50 ≈4μM). This peptide folds in the canonical cysteine-stabilized αβ (CSαβ) motif, consisting of one α-helix and one triple-stranded antiparallel β-sheet stabilized by three disulfide bridges and a hydrophobic cluster of residues within its core where the α-helix packs tightly against the β-sheets. Nuclear spin relaxation measurements show that the structure of AtPDFL2.1 is essentially rigid, with the L3 loop located between β-strands 2 and 3 being more flexible and displaying conformational exchange. Interestingly, the dynamic features of loop L3 are conserved among defensins and are probably correlated to the antifungal and receptor binding activities. Copyright © 2016 Elsevier B.V. All rights reserved.

  13. The Mode of Inhibitor Binding to Peptidyl-tRNA Hydrolase: Binding Studies and Structure Determination of Unbound and Bound Peptidyl-tRNA Hydrolase from Acinetobacter baumannii

    PubMed Central

    Kaushik, Sanket; Singh, Nagendra; Yamini, Shavait; Singh, Avinash; Sinha, Mau; Arora, Ashish; Kaur, Punit; Sharma, Sujata; Singh, Tej P.

    2013-01-01

    The incidences of infections caused by an aerobic Gram-negative bacterium, Acinetobacter baumannii are very common in hospital environments. It usually causes soft tissue infections including urinary tract infections and pneumonia. It is difficult to treat due to acquired resistance to available antibiotics is well known. In order to design specific inhibitors against one of the important enzymes, peptidyl-tRNA hydrolase from Acinetobacter baumannii, we have determined its three-dimensional structure. Peptidyl-tRNA hydrolase (AbPth) is involved in recycling of peptidyl-tRNAs which are produced in the cell as a result of premature termination of translation process. We have also determined the structures of two complexes of AbPth with cytidine and uridine. AbPth was cloned, expressed and crystallized in unbound and in two bound states with cytidine and uridine. The binding studies carried out using fluorescence spectroscopic and surface plasmon resonance techniques revealed that both cytidine and uridine bound to AbPth at nanomolar concentrations. The structure determinations of the complexes revealed that both ligands were located in the active site cleft of AbPth. The introduction of ligands to AbPth caused a significant widening of the entrance gate to the active site region and in the process of binding, it expelled several water molecules from the active site. As a result of interactions with protein atoms, the ligands caused conformational changes in several residues to attain the induced tight fittings. Such a binding capability of this protein makes it a versatile molecule for hydrolysis of peptidyl-tRNAs having variable peptide sequences. These are the first studies that revealed the mode of inhibitor binding in Peptidyl-tRNA hydrolases which will facilitate the structure based ligand design. PMID:23844024

  14. Manipulative interplay of two adozelesin molecules with d(ATTAAT)₂achieving ligand-stacked Watson-Crick and Hoogsteen base-paired duplex adducts.

    PubMed

    Hopton, Suzanne R; Thompson, Andrew S

    2011-05-17

    Previous structural studies of the cyclopropapyrroloindole (CPI) antitumor antibiotics have shown that these ligands bind covalently edge-on into the minor groove of double-stranded DNA. Reversible covalent modification of the DNA via N3 of adenine occurs in a sequence-specific fashion. Early nuclear magnetic resonance and molecular modeling studies with both mono- and bis-alkylating ligands indicated that the ligands fit tightly within the minor groove, causing little distortion of the helix. In this study, we propose a new binding model for several of the CPI-based analogues, in which the aromatic secondary rings form π-stacked complexes within the minor groove. One of the adducts, formed with adozelesin and the d(ATTAAT)(2) sequence, also demonstrates the ability of these ligands to manipulate the DNA of the binding site, resulting in a Hoogsteen base-paired adduct. Although this type of base pairing has been previously observed with the bisfunctional CPI analogue bizelesin, this is the first time that such an observation has been made with a monoalkylating nondimeric analogue. Together, these results provide a new model for the design of CPI-based antitumor antibiotics, which also has a significant bearing on other structurally related and structurally unrelated minor groove-binding ligands. They indicate the dynamic nature of ligand-DNA interactions, demonstrating both DNA conformational flexibility and the ability of two DNA-bound ligands to interact to form stable covalent modified complexes.

  15. Ubiquitin-like domains can target to the proteasome but proteolysis requires a disordered region.

    PubMed

    Yu, Houqing; Kago, Grace; Yellman, Christopher M; Matouschek, Andreas

    2016-07-15

    Ubiquitin and some of its homologues target proteins to the proteasome for degradation. Other ubiquitin-like domains are involved in cellular processes unrelated to the proteasome, and proteins containing these domains remain stable in the cell. We find that the 10 yeast ubiquitin-like domains tested bind to the proteasome, and that all 11 identified domains can target proteins for degradation. Their apparent proteasome affinities are not directly related to their stabilities or functions. That is, ubiquitin-like domains in proteins not part of the ubiquitin proteasome system may bind the proteasome more tightly than domains in proteins that are bona fide components. We propose that proteins with ubiquitin-like domains have properties other than proteasome binding that confer stability. We show that one of these properties is the absence of accessible disordered regions that allow the proteasome to initiate degradation. In support of this model, we find that Mdy2 is degraded in yeast when a disordered region in the protein becomes exposed and that the attachment of a disordered region to Ubp6 leads to its degradation. © 2016 The Authors.

  16. Nuclear magnetic resonance and restrained molecular dynamics studies of the interaction of an epidermal growth factor-derived peptide with protein tyrosine phosphatase 1B.

    PubMed

    Glover, N R; Tracey, A S

    1999-04-20

    The epidermal growth factor-derived (EGFR988) fluorophosphonate peptide, DADE(F2Pmp)L, is a potent (30 pM) inhibitor of the protein tyrosine phosphatase PTP1B. Nuclear magnetic resonance (NMR) transferred nuclear Overhauser effect (nOe) experiments have been used to determine the conformation of DADE(F2Pmp)L while bound in the active site of PTP1B. When bound, the peptide adopts an extended beta-strand conformation. Molecular modeling and molecular dynamics simulations allowed the elucidation of the sources of many of the interactions leading to binding of this inhibitor. Electrostatic, hydrophobic, and hydrogen-bonding interactions were all found to contribute significantly to its binding. However, despite the overall tight binding of this inhibitor, the N-terminal and adjacent residue of the peptide were virtually unrestrained in their motion. The major contributions to binding arose from hydrophobic interactions at the leucine and at the aromatic center, hydrogen bonding to the pro-R fluorine of the fluorophosphonomethyl group, and electrostatic interactions involving the carboxylate functionalities of the aspartate and glutamate residues. These latter two residues were found to form tight contacts with surface recognition elements (arginine and lysine) situated near the active-site cleft.

  17. Investigation of charge injection and transport behavior in multilayer structure consisted of ferromagnetic metal and organic polymer under external fields

    NASA Astrophysics Data System (ADS)

    Zhao, Hua; Meng, Wei-Feng

    2017-10-01

    In this paper a five layer organic electronic device with alternately placed ferromagnetic metals and organic polymers: ferromagnetic metal/organic layer/ferromagnetic metal/organic layer/ferromagnetic metal, which is injected a spin-polarized electron from outsides, is studied theoretically using one-dimensional tight binding model Hamiltonian. We calculated equilibrium state behavior after an electron with spin is injected into the organic layer of this structure, charge density distribution and spin polarization density distribution of this injected spin-polarized electron, and mainly studied possible transport behavior of the injected spin polarized electron in this multilayer structure under different external electric fields. We analyze the physical process of the injected electron in this multilayer system. It is found by our calculation that the injected spin polarized electron exists as an electron-polaron state with spin polarization in the organic layer and it can pass through the middle ferromagnetic layer from the right-hand organic layer to the left-hand organic layer by the action of increasing external electric fields, which indicates that this structure may be used as a possible spin-polarized charge electronic device and also may provide a theoretical base for the organic electronic devices and it is also found that in the boundaries between the ferromagnetic layer and the organic layer there exist induced interface local dipoles due to the external electric fields.

  18. Study of the effect of soil disturbance on vapor transport through integrated modeling of the atmospheric boundary layer and shallow subsurface

    NASA Astrophysics Data System (ADS)

    Trautz, A.; Smits, K. M.; Cihan, A.; Wallen, B.

    2014-12-01

    Soil-water evaporation is one of the governing processes responsible for controlling water and energy exchanges between the land and atmosphere. Despite its wide relevance and application in many natural and manmade environments (e.g. soil tillage practices, wheel-track compaction, fire burn environments, textural layering and buried ordinances), there are very few studies of evaporation from disturbed soil profiles. The purpose of this study was to explore the effect of soil disturbance and capillary coupling on water distribution and fluxes. We modified a theory previously developed by the authors that allows for coupling single-phase (gas), two-component (air and water vapor) transfer in the atmosphere and two-phase (gas, liquid), two-component (air and water vapor) flow in porous media at the REV scale under non-isothermal, non-equilibrium conditions to better account for the hydraulic and thermal interactions within the media. Modeling results were validated and compared using precision data generated in a two-dimensional soil tank consisting of a loosely packed soil surrounded by a tightly packed soil. The soil tank was outfitted with an array of sensors for the measurement of wind velocity, soil and air temperature, relative humidity, soil moisture, and weight. Results demonstrated that, by using this coupling approach, it is possible to predict the different stages of the drying process in heterogeneous soils with good accuracy. Evaporation from a heterogeneous soil consisting of a loose and tight packing condition is larger than the homogeneous equivalent systems. Liquid water is supplied from the loosely packed soil region to the tightly packed soil regions, sustaining a longer Stage I evaporation in the tightly packed regions with overall greater evaporation rate than uniform homogeneous packing. In contrast, lower evaporation rates from the loosely packed regions are observed due to a limited liquid water supply resulting from capillary flow to the tightly packed regions and a shorter stage 1 evaporation period.

  19. Time-efficient simulations of tight-binding electronic structures with Intel Xeon PhiTM many-core processors

    NASA Astrophysics Data System (ADS)

    Ryu, Hoon; Jeong, Yosang; Kang, Ji-Hoon; Cho, Kyu Nam

    2016-12-01

    Modelling of multi-million atomic semiconductor structures is important as it not only predicts properties of physically realizable novel materials, but can accelerate advanced device designs. This work elaborates a new Technology-Computer-Aided-Design (TCAD) tool for nanoelectronics modelling, which uses a sp3d5s∗ tight-binding approach to describe multi-million atomic structures, and simulate electronic structures with high performance computing (HPC), including atomic effects such as alloy and dopant disorders. Being named as Quantum simulation tool for Advanced Nanoscale Devices (Q-AND), the tool shows nice scalability on traditional multi-core HPC clusters implying the strong capability of large-scale electronic structure simulations, particularly with remarkable performance enhancement on latest clusters of Intel Xeon PhiTM coprocessors. A review of the recent modelling study conducted to understand an experimental work of highly phosphorus-doped silicon nanowires, is presented to demonstrate the utility of Q-AND. Having been developed via Intel Parallel Computing Center project, Q-AND will be open to public to establish a sound framework of nanoelectronics modelling with advanced HPC clusters of a many-core base. With details of the development methodology and exemplary study of dopant electronics, this work will present a practical guideline for TCAD development to researchers in the field of computational nanoelectronics.

  20. The effects of the glycation of transferrin on chromium binding and the transport and distribution of chromium in vivo.

    PubMed

    Deng, Ge; Dyroff, Samantha L; Lockart, Molly; Bowman, Michael K; Vincent, John B

    2016-11-01

    Chromium (III) has been shown to act as a pharmacological agent improving insulin sensitivity in rodent models of obesity, insulin resistance, and diabetes. To act in beneficial fashion, chromium must reach insulin-sensitive tissues. Chromium is transported from the bloodstream to the tissues by the iron-transport protein transferrin. When blood concentrations of glucose are high (as in a diabetic subject), transferrin can be glycated, modifying its ability to bind and transport iron. However, the effects of glycation of transferrin on its ability to bind and transport Cr have not been examined previously. Storage of transferrin at 37°C in the presence and absence of glucose has significant effects on the binding of Cr. Transferrin stored in the absence of glucose only binds one equivalent of Cr tightly, compared to the normal binding of two equivalents of Cr by transferrin. Glycated transferrin (stored in the presence of glucose) binds two equivalents of Cr but the changes in its extinction coefficient at 245nm that accompany binding suggest that the Cr-bound transferrin possesses a conformation that deviates appreciably from untreated transferrin. These changes have dramatic effects, greatly reducing the ability of transferrin to transport Cr in vivo in rats. The results suggest that glycation of transferrin in subjects with high blood glucose concentrations should reduce the ability of Cr from pharmacological agents to enter tissues. Copyright © 2016 Elsevier Inc. All rights reserved.

  1. Valley density-wave (VDW) and Superconductivity in Iron-Pnictides

    NASA Astrophysics Data System (ADS)

    Cvetkovic, Vladimir; Tesanovic, Zlatko

    2009-03-01

    One of the experimentally observed features of iron-pnictide superconductors is the structural transition and SDW ordering occurring at almost the same temperature. Starting from a tight-binding model [1], we construct an effective theory for iron-pnictides with the distinctive two hole and two electron Fermi surfaces. This theory is then mapped onto a negative-U Hubbard model with additional orbital and spin flavors [2]. We demonstrate that the superconducting instability of the attractive Hubbard model --- valley density-wave (VDW) --- corresponds to the observed structural and SDW orders. The deviations from perfect nesting between the hole and electron Fermi surfaces are mapped onto the Zeeman field which causes portions of Fermi surface to remain ungapped. The origin of pnictide superconductivity in this model, and its ties to the VDW are discussed. [1] V. Cvetkovic and Z. Tesanovic, http://arxiv.org/abs/0804.4678. [2] V. Cvetkovic and Z. Tesanovic, http://arxiv.org/abs/0808.3742.

  2. A Rat α-Fetoprotein Binding Activity Prediction Model to Facilitate Assessment of the Endocrine Disruption Potential of Environmental Chemicals.

    PubMed

    Hong, Huixiao; Shen, Jie; Ng, Hui Wen; Sakkiah, Sugunadevi; Ye, Hao; Ge, Weigong; Gong, Ping; Xiao, Wenming; Tong, Weida

    2016-03-25

    Endocrine disruptors such as polychlorinated biphenyls (PCBs), diethylstilbestrol (DES) and dichlorodiphenyltrichloroethane (DDT) are agents that interfere with the endocrine system and cause adverse health effects. Huge public health concern about endocrine disruptors has arisen. One of the mechanisms of endocrine disruption is through binding of endocrine disruptors with the hormone receptors in the target cells. Entrance of endocrine disruptors into target cells is the precondition of endocrine disruption. The binding capability of a chemical with proteins in the blood affects its entrance into the target cells and, thus, is very informative for the assessment of potential endocrine disruption of chemicals. α-fetoprotein is one of the major serum proteins that binds to a variety of chemicals such as estrogens. To better facilitate assessment of endocrine disruption of environmental chemicals, we developed a model for α-fetoprotein binding activity prediction using the novel pattern recognition method (Decision Forest) and the molecular descriptors calculated from two-dimensional structures by Mold² software. The predictive capability of the model has been evaluated through internal validation using 125 training chemicals (average balanced accuracy of 69%) and external validations using 22 chemicals (balanced accuracy of 71%). Prediction confidence analysis revealed the model performed much better at high prediction confidence. Our results indicate that the model is useful (when predictions are in high confidence) in endocrine disruption risk assessment of environmental chemicals though improvement by increasing number of training chemicals is needed.

  3. Dynamical Localization for Discrete and Continuous Random Schrödinger Operators

    NASA Astrophysics Data System (ADS)

    Germinet, F.; De Bièvre, S.

    We show for a large class of random Schrödinger operators Ho on and on that dynamical localization holds, i.e. that, with probability one, for a suitable energy interval I and for q a positive real, Here ψ is a function of sufficiently rapid decrease, and PI(Ho) is the spectral projector of Ho corresponding to the interval I. The result is obtained through the control of the decay of the eigenfunctions of Ho and covers, in the discrete case, the Anderson tight-binding model with Bernoulli potential (dimension ν = 1) or singular potential (ν > 1), and in the continuous case Anderson as well as random Landau Hamiltonians.

  4. Spin and charge transport across cobalt/graphene interfaces

    NASA Astrophysics Data System (ADS)

    Chshiev, Mairbek; Kalitsov, Alan; Mryasov, Oleg

    We report ballistic calculations of in-plane and out-of-plane spin and charge transport through graphene attached to the hcp-Co electrodes. Our calculations are based on the Keldysh non-equilibrium Green Function formalism and the tight binding Hamiltonian model tailored to treat both lateral and vertical device configurations. We present results for (i) vertical device that consists of a one-side fluorinated C4F graphene sandwiched between two hcp Co electrodes and (ii) lateral device consisting of pristine graphene/C4F graphene bilayer with two top hcp-Co electrodes Our calculations predict large magnetoresistance with small resistance-area product and significant deviation from sinusoidal behavior of spin transfer torque for the vertical device configuration.

  5. Physical and metabolic requirements for early interaction of poliovirus and human rhinovirus with HeLa cells.

    PubMed Central

    Lonberg-Holm, K; Whiteley, N M

    1976-01-01

    Attachment, ""tight binding'' and eclipse of radioactive poliovirus 2 (P2) and human rhinovirus 2 (HRV 2) were investigated. The activation energy for attachment of both HRV2 and P2 was about 13 kcal/mol. HRV2 differed from P2 in two respects: the Arrhenius plot for attachment of HRV2 showed a break at 15 to 19 degrees C when the cells were first treated several hours at 0 degrees C, and attachment of HRV2 was inhibited by treatment of cells with metabolic poisons able to reduce cellular ATP by more than 90%. Tight binding was determined by isolation of a specific P2-membrane complex or by loss of EDTA dissociability of HRV2. Tight binding of both viruses was slowed by 0.01 M iodoacetamide but not by 0.02 M F-; F- plus 0.002 M CN- slowed tight binding of HRV2 but not of P2. Eclipse, the irreversible alteration of parental virions, was detected by isolation of cell-associated subviral particles or by loss of cell-associated infectious virus. Eclipse of both viruses is slowed by iodoacetamide or F-. It seems likely that the early steps of infection with picornaviruses may be sensitive to alterations in the cell membrane produced by metabolic inhibitors or by treatment at low temperature. PMID:184301

  6. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Morris, J.R.; Lu, Z.Y.; Xiang, J.B.

    We have examined a variety of structures for the (510) symmetric tilt boundary in Si, using first-principles calculations. These calculations show that the observed structure in Si is the lowest energy structure. This structure is more complicated than what is necessary to preserve four-fold coordination. We compare the results to classical and tight-binding models, in order to test these empirical problems.

  7. Three pillars for achieving quantum mechanical molecular dynamics simulations of huge systems: Divide-and-conquer, density-functional tight-binding, and massively parallel computation.

    PubMed

    Nishizawa, Hiroaki; Nishimura, Yoshifumi; Kobayashi, Masato; Irle, Stephan; Nakai, Hiromi

    2016-08-05

    The linear-scaling divide-and-conquer (DC) quantum chemical methodology is applied to the density-functional tight-binding (DFTB) theory to develop a massively parallel program that achieves on-the-fly molecular reaction dynamics simulations of huge systems from scratch. The functions to perform large scale geometry optimization and molecular dynamics with DC-DFTB potential energy surface are implemented to the program called DC-DFTB-K. A novel interpolation-based algorithm is developed for parallelizing the determination of the Fermi level in the DC method. The performance of the DC-DFTB-K program is assessed using a laboratory computer and the K computer. Numerical tests show the high efficiency of the DC-DFTB-K program, a single-point energy gradient calculation of a one-million-atom system is completed within 60 s using 7290 nodes of the K computer. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  8. Bandstructure modulation for Si-h and Si-g nanotubes in a transverse electric field: Tight binding approach

    NASA Astrophysics Data System (ADS)

    Chegel, Raad; Behzad, Somayeh

    2013-11-01

    We have investigated the electronic properties of SiNTs, under the external electric field, using Tight Binding (TB) approximation. It was found that the energy levels, energy gaps, and density of states (DOS) strongly depend on the electric field strength. The large electric strength leads to coupling the neighbor subbands and induce destruction of subband degeneracy, increase of low-energy states, and strong modulation of energy gap which these effects reflect in the DOS spectrum. It has been shown that, the band gap reduction of Si g-NTs is linearly proportional to the electric field strength. The band gap variation for Si h-NTs increases first and later decreases (Metallic) or first remains constant and then decreases (semiconductor). Also we show that the larger diameter tubes are more sensitive to the field strength than smaller ones. The semiconducting metallic transition or vice versa can be achieved through an increasing of applied fields. Number and position of peaks in DOS spectrum are dependent on electric field strength.

  9. NMR Studies of the C-Terminus of alpha4 Reveal Possible Mechanism of Its Interaction with MID1 and Protein Phosphatase 2A

    PubMed Central

    Du, Haijuan; Massiah, Michael A.

    2011-01-01

    Alpha4 is a regulatory subunit of the protein phosphatase family of enzymes and plays an essential role in regulating the catalytic subunit of PP2A (PP2Ac) within the rapamycin-sensitive signaling pathway. Alpha4 also interacts with MID1, a microtubule-associated ubiquitin E3 ligase that appears to regulate the function of PP2A. The C-terminal region of alpha4 plays a key role in the binding interaction of PP2Ac and MID1. Here we report on the solution structure of a 45-amino acid region derived from the C-terminus of alpha4 (alpha45) that binds tightly to MID1. In aqueous solution, alpha45 has properties of an intrinsically unstructured peptide although chemical shift index and dihedral angle estimation based on chemical shifts of backbone atoms indicate the presence of a transient α-helix. Alpha45 adopts a helix-turn-helix HEAT-like structure in 1% SDS micelles, which may mimic a negatively charged surface for which alpha45 could bind. Alpha45 binds tightly to the Bbox1 domain of MID1 in aqueous solution and adopts a structure consistent with the helix-turn-helix structure observed in 1% SDS. The structure of alpha45 reveals two distinct surfaces, one that can interact with a negatively charged surface, which is present on PP2A, and one that interacts with the Bbox1 domain of MID1. PMID:22194938

  10. Quasi-one-dimensional density of states in a single quantum ring.

    PubMed

    Kim, Heedae; Lee, Woojin; Park, Seongho; Kyhm, Kwangseuk; Je, Koochul; Taylor, Robert A; Nogues, Gilles; Dang, Le Si; Song, Jin Dong

    2017-01-05

    Generally confinement size is considered to determine the dimensionality of nanostructures. While the exciton Bohr radius is used as a criterion to define either weak or strong confinement in optical experiments, the binding energy of confined excitons is difficult to measure experimentally. One alternative is to use the temperature dependence of the radiative recombination time, which has been employed previously in quantum wells and quantum wires. A one-dimensional loop structure is often assumed to model quantum rings, but this approximation ceases to be valid when the rim width becomes comparable to the ring radius. We have evaluated the density of states in a single quantum ring by measuring the temperature dependence of the radiative recombination of excitons, where the photoluminescence decay time as a function of temperature was calibrated by using the low temperature integrated intensity and linewidth. We conclude that the quasi-continuous finely-spaced levels arising from the rotation energy give rise to a quasi-one-dimensional density of states, as long as the confined exciton is allowed to rotate around the opening of the anisotropic ring structure, which has a finite rim width.

  11. Trimeric Structure of (+)-Pinoresinol-forming Dirigent Protein at 1.95 Å Resolution with Three Isolated Active Sites

    DOE PAGES

    Kim, Kye-Won; Smith, Clyde A.; Daily, Michael D.; ...

    2014-11-19

    Control over phenoxy radical-radical coupling reactions in vivo in vascular plants was enigmatic until our discovery of dirigent proteins (DPs, from the Latin dirigere, to guide or align). The first three-dimensional structure of a DP ((+)-pinoresinol-forming DP, 1.95 Å resolution, rhombohedral space group H32)) is reported herein. It has a tightly packed trimeric structure with an eight-stranded β-barrel topology for each DP monomer. Each putative substrate binding and orientation coupling site is located on the trimer surface but too far apart for intermolecular coupling between sites. It is proposed that each site enables stereoselective coupling (using either two coniferyl alcoholmore » radicals or a radical and a monolignol). Interestingly, there are six differentially conserved residues in DPs affording either the (+)- or (₋)-antipodes in the vicinity of the putative binding site and region known to control stereoselectivity. We find DPs are involved in lignan biosynthesis, whereas dirigent domains/sites have been implicated in lignin deposition.« less

  12. Determinants for Tight and Selective Binding of a Medicinal Dicarbene Gold(I) Complex to a Telomeric DNA G-Quadruplex: a Joint ESI MS and XRD Investigation.

    PubMed

    Bazzicalupi, Carla; Ferraroni, Marta; Papi, Francesco; Massai, Lara; Bertrand, Benoît; Messori, Luigi; Gratteri, Paola; Casini, Angela

    2016-03-18

    The dicarbene gold(I) complex [Au(9-methylcaffein-8-ylidene)2 ]BF4 is an exceptional organometallic compound of profound interest as a prospective anticancer agent. This gold(I) complex was previously reported to be highly cytotoxic toward various cancer cell lines in vitro and behaves as a selective G-quadruplex stabilizer. Interactions of the gold complex with various telomeric DNA models have been analyzed by a combined ESI MS and X-ray diffraction (XRD) approach. ESI MS measurements confirmed formation of stable adducts between the intact gold(I) complex and Tel 23 DNA sequence. The crystal structure of the adduct formed between [Au(9-methylcaffein-8-ylidene)2 ](+) and Tel 23 DNA G-quadruplex was solved. Tel 23 maintains a characteristic propeller conformation while binding three gold(I) dicarbene moieties at two distinct sites. Stacking interactions appear to drive noncovalent binding of the gold(I) complex. The structural basis for tight gold(I) complex/G-quadruplex recognition and its selectivity are described. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. The probability of false positives in zero-dimensional analyses of one-dimensional kinematic, force and EMG trajectories.

    PubMed

    Pataky, Todd C; Vanrenterghem, Jos; Robinson, Mark A

    2016-06-14

    A false positive is the mistake of inferring an effect when none exists, and although α controls the false positive (Type I error) rate in classical hypothesis testing, a given α value is accurate only if the underlying model of randomness appropriately reflects experimentally observed variance. Hypotheses pertaining to one-dimensional (1D) (e.g. time-varying) biomechanical trajectories are most often tested using a traditional zero-dimensional (0D) Gaussian model of randomness, but variance in these datasets is clearly 1D. The purpose of this study was to determine the likelihood that analyzing smooth 1D data with a 0D model of variance will produce false positives. We first used random field theory (RFT) to predict the probability of false positives in 0D analyses. We then validated RFT predictions via numerical simulations of smooth Gaussian 1D trajectories. Results showed that, across a range of public kinematic, force/moment and EMG datasets, the median false positive rate was 0.382 and not the assumed α=0.05, even for a simple two-sample t test involving N=10 trajectories per group. The median false positive rate for experiments involving three-component vector trajectories was p=0.764. This rate increased to p=0.945 for two three-component vector trajectories, and to p=0.999 for six three-component vectors. This implies that experiments involving vector trajectories have a high probability of yielding 0D statistical significance when there is, in fact, no 1D effect. Either (a) explicit a priori identification of 0D variables or (b) adoption of 1D methods can more tightly control α. Copyright © 2016 Elsevier Ltd. All rights reserved.

  14. Application of hierarchical equations of motion (HEOM) to time dependent quantum transport at zero and finite temperatures

    NASA Astrophysics Data System (ADS)

    Tian, Heng; Chen, GuanHua

    2013-10-01

    Going beyond the limitations of our earlier works [X. Zheng, F. Wang, C.Y. Yam, Y. Mo, G.H. Chen, Phys. Rev. B 75, 195127 (2007); X. Zheng, G.H. Chen, Y. Mo, S.K. Koo, H. Tian, C.Y. Yam, Y.J. Yan, J. Chem. Phys. 133, 114101 (2010)], we propose, in this manuscript, a new alternative approach to simulate time-dependent quantum transport phenomenon from first-principles. This new practical approach, still retaining the formal exactness of HEOM framework, does not rely on any intractable parametrization scheme and the pole structure of Fermi distribution function, thus, can seamlessly incorporated into first-principles simulation and treat transient response of an open electronic systems to an external bias voltage at both zero and finite temperatures on the equal footing. The salient feature of this approach is surveyed, and its time complexity is analysed. As a proof-of-principle of this approach, simulation of the transient current of one dimensional tight-binding chain, driven by some direct external voltages, is demonstrated.

  15. Flat bands in fractal-like geometry

    NASA Astrophysics Data System (ADS)

    Pal, Biplab; Saha, Kush

    2018-05-01

    We report the presence of multiple flat bands in a class of two-dimensional lattices formed by Sierpinski gasket (SPG) fractal geometries as the basic unit cells. Solving the tight-binding Hamiltonian for such lattices with different generations of a SPG network, we find multiple degenerate and nondegenerate completely flat bands, depending on the configuration of parameters of the Hamiltonian. Moreover, we establish a generic formula to determine the number of such bands as a function of the generation index ℓ of the fractal geometry. We show that the flat bands and their neighboring dispersive bands have remarkable features, the most interesting one being the spin-1 conical-type spectrum at the band center without any staggered magnetic flux, in contrast to the kagome lattice. We furthermore investigate the effect of magnetic flux in these lattice settings and show that different combinations of fluxes through such fractal unit cells lead to a richer spectrum with a single isolated flat band or gapless electron- or holelike flat bands. Finally, we discuss a possible experimental setup to engineer such a fractal flat-band network using single-mode laser-induced photonic waveguides.

  16. Quantitative analysis on electric dipole energy in Rashba band splitting.

    PubMed

    Hong, Jisook; Rhim, Jun-Won; Kim, Changyoung; Ryong Park, Seung; Hoon Shim, Ji

    2015-09-01

    We report on quantitative comparison between the electric dipole energy and the Rashba band splitting in model systems of Bi and Sb triangular monolayers under a perpendicular electric field. We used both first-principles and tight binding calculations on p-orbitals with spin-orbit coupling. First-principles calculation shows Rashba band splitting in both systems. It also shows asymmetric charge distributions in the Rashba split bands which are induced by the orbital angular momentum. We calculated the electric dipole energies from coupling of the asymmetric charge distribution and external electric field, and compared it to the Rashba splitting. Remarkably, the total split energy is found to come mostly from the difference in the electric dipole energy for both Bi and Sb systems. A perturbative approach for long wave length limit starting from tight binding calculation also supports that the Rashba band splitting originates mostly from the electric dipole energy difference in the strong atomic spin-orbit coupling regime.

  17. Quantitative analysis on electric dipole energy in Rashba band splitting

    PubMed Central

    Hong, Jisook; Rhim, Jun-Won; Kim, Changyoung; Ryong Park, Seung; Hoon Shim, Ji

    2015-01-01

    We report on quantitative comparison between the electric dipole energy and the Rashba band splitting in model systems of Bi and Sb triangular monolayers under a perpendicular electric field. We used both first-principles and tight binding calculations on p-orbitals with spin-orbit coupling. First-principles calculation shows Rashba band splitting in both systems. It also shows asymmetric charge distributions in the Rashba split bands which are induced by the orbital angular momentum. We calculated the electric dipole energies from coupling of the asymmetric charge distribution and external electric field, and compared it to the Rashba splitting. Remarkably, the total split energy is found to come mostly from the difference in the electric dipole energy for both Bi and Sb systems. A perturbative approach for long wave length limit starting from tight binding calculation also supports that the Rashba band splitting originates mostly from the electric dipole energy difference in the strong atomic spin-orbit coupling regime. PMID:26323493

  18. Structure and Stability of Molecular Crystals with Many-Body Dispersion-Inclusive Density Functional Tight Binding.

    PubMed

    Mortazavi, Majid; Brandenburg, Jan Gerit; Maurer, Reinhard J; Tkatchenko, Alexandre

    2018-01-18

    Accurate prediction of structure and stability of molecular crystals is crucial in materials science and requires reliable modeling of long-range dispersion interactions. Semiempirical electronic structure methods are computationally more efficient than their ab initio counterparts, allowing structure sampling with significant speedups. We combine the Tkatchenko-Scheffler van der Waals method (TS) and the many-body dispersion method (MBD) with third-order density functional tight-binding (DFTB3) via a charge population-based method. We find an overall good performance for the X23 benchmark database of molecular crystals, despite an underestimation of crystal volume that can be traced to the DFTB parametrization. We achieve accurate lattice energy predictions with DFT+MBD energetics on top of vdW-inclusive DFTB3 structures, resulting in a speedup of up to 3000 times compared with a full DFT treatment. This suggests that vdW-inclusive DFTB3 can serve as a viable structural prescreening tool in crystal structure prediction.

  19. The apical scaffold big bang binds to spectrins and regulates the growth of Drosophila melanogaster wing discs.

    PubMed

    Forest, Elodie; Logeay, Rémi; Géminard, Charles; Kantar, Diala; Frayssinoux, Florence; Heron-Milhavet, Lisa; Djiane, Alexandre

    2018-03-05

    During development, cell numbers are tightly regulated, ensuring that tissues and organs reach their correct size and shape. Recent evidence has highlighted the intricate connections between the cytoskeleton and the regulation of the key growth control Hippo pathway. Looking for apical scaffolds regulating tissue growth, we describe that Drosophila melanogaster big bang (Bbg), a poorly characterized multi-PDZ scaffold, controls epithelial tissue growth without affecting epithelial polarity and architecture. bbg -mutant tissues are smaller, with fewer cells that are less apically constricted than normal. We show that Bbg binds to and colocalizes tightly with the β-heavy-Spectrin/Kst subunit at the apical cortex and promotes Yki activity, F-actin enrichment, and the phosphorylation of the myosin II regulatory light chain Spaghetti squash. We propose a model in which the spectrin cytoskeleton recruits Bbg to the cortex, where Bbg promotes actomyosin contractility to regulate epithelial tissue growth. © 2018 Forest et al.

  20. Magnetic susceptibilities of actinide 3d-metal intermetallic compounds

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Muniz, R.B.; d'Albuquerque e Castro, J.; Troper, A.

    1988-04-15

    We have numerically calculated the magnetic susceptibilities which appear in the Hartree--Fock instability criterion for actinide 3d transition-metal intermetallic compounds. This calculation is based on a previous tight-binding description of these actinide-based compounds (A. Troper and A. A. Gomes, Phys. Rev. B 34, 6487 (1986)). The parameters of the calculation, which starts from simple tight-binding d and f bands are (i) occupation numbers, (ii) ratio of d-f hybridization to d bandwidth, and (iii) electron-electron Coulomb-type interactions.

  1. Crumbs3 Is Essential for Proper Epithelial Development and Viability

    PubMed Central

    Whiteman, Eileen L.; Fan, Shuling; Harder, Jennifer L.; Walton, Katherine D.; Liu, Chia-Jen; Soofi, Abdul; Fogg, Vanessa C.; Hershenson, Marc B.; Dressler, Gregory R.; Deutsch, Gail H.; Gumucio, Deborah L.

    2014-01-01

    First identified in Drosophila, the Crumbs (Crb) proteins are important in epithelial polarity, apical membrane formation, and tight junction (TJ) assembly. The conserved Crb intracellular region includes a FERM (band 4.1/ezrin/radixin/moesin) binding domain (FBD) whose mammalian binding partners are not well understood and a PDZ binding motif that interacts with mammalian Pals1 (protein associated with lin seven) (also known as MPP5). Pals1 binds Patj (Pals1-associated tight-junction protein), a multi-PDZ-domain protein that associates with many tight junction proteins. The Crb complex also binds the conserved Par3/Par6/atypical protein kinase C (aPKC) polarity cassette that restricts migration of basolateral proteins through phosphorylation. Here, we describe a Crb3 knockout mouse that demonstrates extensive defects in epithelial morphogenesis. The mice die shortly after birth, with cystic kidneys and proteinaceous debris throughout the lungs. The intestines display villus fusion, apical membrane blebs, and disrupted microvilli. These intestinal defects phenocopy those of Ezrin knockout mice, and we demonstrate an interaction between Crumbs3 and ezrin. Taken together, our data indicate that Crumbs3 is crucial for epithelial morphogenesis and plays a role in linking the apical membrane to the underlying ezrin-containing cytoskeleton. PMID:24164893

  2. Water-induced polaron formation at the pentacene surface: Quantum mechanical molecular mechanics simulations

    NASA Astrophysics Data System (ADS)

    Cramer, Tobias; Steinbrecher, Thomas; Koslowski, Thorsten; Case, David A.; Biscarini, Fabio; Zerbetto, Francesco

    2009-04-01

    Water is an omnipresent polar impurity that is expected to be the origin of many electric degradation phenomena observed in organic semiconductors. Here, we describe a microscopic model for polaron formation in the outermost layer of a pentacene crystal due to the polarization of a nearby water layer. The efficient coupling of a classical force field that describes the liquid with a tight-binding model that represents the π system of the organic layer permits the calculation of nanosecond length trajectories. The model predicts that the reorientation of water dipoles stabilizes positive charge carriers on average by 0.6 eV and thus leads to a polaron trap state at the liquid interface. Thermal fluctuations of the water molecules provoke two-dimensional diffusive hopping of the charge carrier parallel to the interface with mobilities of up to 0.6cm2s-1V-1 and lead to an amorphous broadening of the valence-band tail. As a consequence, water-filled nanocavities act as trapping sites in pentacene transistors. Instead, a complete wetting of the organic film is expected to result in fast thermally activated hopping transport. Polaron trapping is thus not expected to be a limiting factor for transistor-based sensors that operate under water.

  3. Commensurability effects in one-dimensional Anderson localization: Anomalies in eigenfunction statistics

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kravtsov, V.E., E-mail: kravtsov@ictp.it; Landau Institute for Theoretical Physics, 2 Kosygina st., 117940 Moscow; Yudson, V.I., E-mail: yudson@isan.troitsk.ru

    Highlights: > Statistics of normalized eigenfunctions in one-dimensional Anderson localization at E = 0 is studied. > Moments of inverse participation ratio are calculated. > Equation for generating function is derived at E = 0. > An exact solution for generating function at E = 0 is obtained. > Relation of the generating function to the phase distribution function is established. - Abstract: The one-dimensional (1d) Anderson model (AM), i.e. a tight-binding chain with random uncorrelated on-site energies, has statistical anomalies at any rational point f=(2a)/({lambda}{sub E}) , where a is the lattice constant and {lambda}{sub E} is the demore » Broglie wavelength. We develop a regular approach to anomalous statistics of normalized eigenfunctions {psi}(r) at such commensurability points. The approach is based on an exact integral transfer-matrix equation for a generating function {Phi}{sub r}(u, {phi}) (u and {phi} have a meaning of the squared amplitude and phase of eigenfunctions, r is the position of the observation point). This generating function can be used to compute local statistics of eigenfunctions of 1d AM at any disorder and to address the problem of higher-order anomalies at f=p/q with q > 2. The descender of the generating function P{sub r}({phi}){identical_to}{Phi}{sub r}(u=0,{phi}) is shown to be the distribution function of phase which determines the Lyapunov exponent and the local density of states. In the leading order in the small disorder we derived a second-order partial differential equation for the r-independent ('zero-mode') component {Phi}(u, {phi}) at the E = 0 (f=1/2 ) anomaly. This equation is nonseparable in variables u and {phi}. Yet, we show that due to a hidden symmetry, it is integrable and we construct an exact solution for {Phi}(u, {phi}) explicitly in quadratures. Using this solution we computed moments I{sub m} = N< vertical bar {psi} vertical bar {sup 2m}> (m {>=} 1) for a chain of the length N {yields} {infinity} and found an essential difference between their m-behavior in the center-of-band anomaly and for energies outside this anomaly. Outside the anomaly the 'extrinsic' localization length defined from the Lyapunov exponent coincides with that defined from the inverse participation ratio ('intrinsic' localization length). This is not the case at the E = 0 anomaly where the extrinsic localization length is smaller than the intrinsic one. At E = 0 one also observes an anomalous enhancement of large moments compatible with existence of yet another, much smaller characteristic length scale.« less

  4. Quantitative analyses of bifunctional molecules.

    PubMed

    Braun, Patrick D; Wandless, Thomas J

    2004-05-11

    Small molecules can be discovered or engineered to bind tightly to biologically relevant proteins, and these molecules have proven to be powerful tools for both basic research and therapeutic applications. In many cases, detailed biophysical analyses of the intermolecular binding events are essential for improving the activity of the small molecules. These interactions can often be characterized as straightforward bimolecular binding events, and a variety of experimental and analytical techniques have been developed and refined to facilitate these analyses. Several investigators have recently synthesized heterodimeric molecules that are designed to bind simultaneously with two different proteins to form ternary complexes. These heterodimeric molecules often display compelling biological activity; however, they are difficult to characterize. The bimolecular interaction between one protein and the heterodimeric ligand (primary dissociation constant) can be determined by a number of methods. However, the interaction between that protein-ligand complex and the second protein (secondary dissociation constant) is more difficult to measure due to the noncovalent nature of the original protein-ligand complex. Consequently, these heterodimeric compounds are often characterized in terms of their activity, which is an experimentally dependent metric. We have developed a general quantitative mathematical model that can be used to measure both the primary (protein + ligand) and secondary (protein-ligand + protein) dissociation constants for heterodimeric small molecules. These values are largely independent of the experimental technique used and furthermore provide a direct measure of the thermodynamic stability of the ternary complexes that are formed. Fluorescence polarization and this model were used to characterize the heterodimeric molecule, SLFpYEEI, which binds to both FKBP12 and the Fyn SH2 domain, demonstrating that the model is useful for both predictive as well as ex post facto analytical applications.

  5. Efficient self-consistency for magnetic tight binding

    NASA Astrophysics Data System (ADS)

    Soin, Preetma; Horsfield, A. P.; Nguyen-Manh, D.

    2011-06-01

    Tight binding can be extended to magnetic systems by including an exchange interaction on an atomic site that favours net spin polarisation. We have used a published model, extended to include long-ranged Coulomb interactions, to study defects in iron. We have found that achieving self-consistency using conventional techniques was either unstable or very slow. By formulating the problem of achieving charge and spin self-consistency as a search for stationary points of a Harris-Foulkes functional, extended to include spin, we have derived a much more efficient scheme based on a Newton-Raphson procedure. We demonstrate the capabilities of our method by looking at vacancies and self-interstitials in iron. Self-consistency can indeed be achieved in a more efficient and stable manner, but care needs to be taken to manage this. The algorithm is implemented in the code PLATO. Program summaryProgram title:PLATO Catalogue identifier: AEFC_v2_0 Program summary URL:http://cpc.cs.qub.ac.uk/summaries/AEFC_v2_0.html Program obtainable from: CPC Program Library, Queen's University, Belfast, N. Ireland Licensing provisions: Standard CPC licence, http://cpc.cs.qub.ac.uk/licence/licence.html No. of lines in distributed program, including test data, etc.: 228 747 No. of bytes in distributed program, including test data, etc.: 1 880 369 Distribution format: tar.gz Programming language: C and PERL Computer: Apple Macintosh, PC, Unix machines Operating system: Unix, Linux, Mac OS X, Windows XP Has the code been vectorised or parallelised?: Yes. Up to 256 processors tested RAM: Up to 2 Gbytes per processor Classification: 7.3 External routines: LAPACK, BLAS and optionally ScaLAPACK, BLACS, PBLAS, FFTW Catalogue identifier of previous version: AEFC_v1_0 Journal reference of previous version: Comput. Phys. Comm. 180 (2009) 2616 Does the new version supersede the previous version?: Yes Nature of problem: Achieving charge and spin self-consistency in magnetic tight binding can be very difficult. Our existing schemes failed altogether, or were very slow. Solution method: A new scheme for achieving self-consistency in orthogonal tight binding has been introduced that explicitly evaluates the first and second derivatives of the energy with respect to input charge and spin, and then uses these to search for stationary values of the energy. Reasons for new version: Bug fixes and new functionality. Summary of revisions: New charge and spin mixing scheme for orthogonal tight binding. Numerous small bug fixes. Restrictions: The new mixing scheme scales poorly with system size. In particular the memory usage scales as number of atoms to the power 4. It is restricted to systems with about 200 atoms or less. Running time: Test cases will run in a few minutes, large calculations may run for several days.

  6. The three-dimensional structure of a T-cell antigen receptor V alpha V beta heterodimer reveals a novel arrangement of the V beta domain.

    PubMed Central

    Housset, D; Mazza, G; Grégoire, C; Piras, C; Malissen, B; Fontecilla-Camps, J C

    1997-01-01

    The crystal structure of a mouse T-cell antigen receptor (TCR) Fv fragment complexed to the Fab fragment of a specific anti-clonotypic antibody has been determined to 2.6 A resolution. The polypeptide backbone of the TCR V alpha domain is very similar to those of other crystallographically determined V alphas, whereas the V beta structure is so far unique among TCR V beta domains in that it displays a switch of the c" strand from the inner to the outer beta-sheet. The beta chain variable region of this TCR antigen-binding site is characterized by a rather elongated third complementarity-determining region (CDR3beta) that packs tightly against the CDR3 loop of the alpha chain, without leaving any intervening hydrophobic pocket. Thus, the conformation of the CDR loops with the highest potential diversity distinguishes the structure of this TCR antigen-binding site from those for which crystallographic data are available. On the basis of all these results, we infer that a significant conformational change of the CDR3beta loop found in our TCR is required for binding to its cognate peptide-MHC ligand. PMID:9250664

  7. Problems in hard and soft matter: From brain folds and Levy localization to active elasticity

    NASA Astrophysics Data System (ADS)

    Mayett, David

    This thesis presents a study of condensed matter systems at different length scales. The first part presents a study of elastic instabilities in biological systems ranging from the cerebral cortex in the brain to the lining of the intestines. Such instabilities lead to a zoo of morphologies ranging from primary folds to villi and crypts to secondary folds and are brought about by growth, mechanical stresses, or a combination of the two. We propose a novel model for the description of primary folds in the cerebral cortex. Motivated by the spatial structure of the cortex, we model its elasticity as a smectic liquid crystal. With this novel description we show that vertical pulling forces via axonal tension from the brain underlying white matter can lead to buckling, which initiates the primary folds. Moreover, we are able to obtain a reasonable estimate of the critical wavelength and strain for buckling. We also model the formation of secondary folds in the cortex to obtain a more comprehensive theory. We continue this study of elastic instabilities due to growth by studying a more general system comprised of two coupled elastic membranes, one of which undergoes growth and one that does not. We employ an active formulation of growth and compare it to the one due to Rodriguez (Rodriguez). We show that different morphologies corresponding to different systems, such as the cerebral cortex and the lining of the intestines, can be obtained from our model by choosing different active stress functional forms to begin to classify the zoo of morphologies observed in seemingly different biological systems. In the second part of this thesis, to work towards a more microscopic view of biological tissues such as the brain tissue, which is composed of neurons, glial cells, and progenitor cells, we model an experiment (Theveneau) studying the dynamic interaction between neural crest cells and placodal cells in which the placodal cells run away from the neural crest cells following contact between the two. Our modeling contributes towards generalizing the rules governing the interplay between different cell types, particularly during collective cell migration. In the final part of this thesis, we move to an even smaller length scale. Our main motivations come from a series of experiments on the localization of light and the application of tight-binding models to the electronic transport properties of DNA sequences. To this end, we study the statistical properties of the conductance distribution and Lyapunov exponents in the Anderson tight-binding model with Levy-type disorder.

  8. Numerical simulation of multi-dimensional NMR response in tight sandstone

    NASA Astrophysics Data System (ADS)

    Guo, Jiangfeng; Xie, Ranhong; Zou, Youlong; Ding, Yejiao

    2016-06-01

    Conventional logging methods have limitations in the evaluation of tight sandstone reservoirs. The multi-dimensional nuclear magnetic resonance (NMR) logging method has the advantage that it can simultaneously measure transverse relaxation time (T 2), longitudinal relaxation time (T 1) and diffusion coefficient (D). In this paper, we simulate NMR measurements of tight sandstone with different wettability and saturations by the random walk method and obtain the magnetization decays of Carr-Purcell-Meiboom-Gill pulse sequences with different wait times (TW) and echo spacings (TE) under a magnetic field gradient, resulting in D-T 2-T 1 maps by the multiple echo trains joint inversion method. We also study the effects of wettability, saturation, signal-to-noise ratio (SNR) of data and restricted diffusion on the D-T 2-T 1 maps in tight sandstone. The results show that with decreasing wetting fluid saturation, the surface relaxation rate of the wetting fluid gradually increases and the restricted diffusion phenomenon becomes more and more obvious, which leads to the wetting fluid signal moving along the direction of short relaxation and the direction of the diffusion coefficient decreasing in D-T 2-T 1 maps. Meanwhile, the non-wetting fluid position in D-T 2-T 1 maps does not change with saturation variation. With decreasing SNR, the ability to identify water and oil signals based on NMR maps gradually decreases. The wetting fluid D-T 1 and D-T 2 correlations in NMR diffusion-relaxation maps of tight sandstone are obtained through expanding the wetting fluid restricted diffusion models, and are further applied to recognize the wetting fluid in simulated D-T 2 maps and D-T 1 maps.

  9. Phononic crystals of spherical particles: A tight binding approach

    NASA Astrophysics Data System (ADS)

    Mattarelli, M.; Secchi, M.; Montagna, M.

    2013-11-01

    The vibrational dynamics of a fcc phononic crystal of spheres is studied and compared with that of a single free sphere, modelled either by a continuous homogeneous medium or by a finite cluster of atoms. For weak interaction among the spheres, the vibrational dynamics of the phononic crystal is described by shallow bands, with low degree of dispersion, corresponding to the acoustic spheroidal and torsional modes of the single sphere. The phonon displacements are therefore related to the vibrations of a sphere, as the electron wave functions in a crystal are related to the atomic wave functions in a tight binding model. Important dispersion is found for the two lowest phonon bands, which correspond to zero frequency free translation and rotation of a free sphere. Brillouin scattering spectra are calculated at some values of the exchanged wavevectors of the light, and compared with those of a single sphere. With weak interaction between particles, given the high acoustic impedance mismatch in dry systems, the density of phonon states consist of sharp bands separated by large gaps, which can be well accounted for by a single particle model. Based on the width of the frequency gaps, tunable with the particle size, and on the small number of dispersive acoustic phonons, such systems may provide excellent materials for application as sound or heat filters.

  10. Slater-Koster Tight-Binding parametrization of single and few-layer Black-Phosphorus from first-principles calculations

    NASA Astrophysics Data System (ADS)

    Menezes, Marcos; Capaz, Rodrigo

    Black Phosphorus (BP) is a promising material for applications in electronics, especially due to the tuning of its band gap by increasing the number of layers. In single-layer BP, also called Phosphorene, the P atoms form two staggered chains bonded by sp3 hybridization, while neighboring layers are bonded by Van-der-Waals interactions. In this work, we present a Tight-Binding (TB) parametrization of the electronic structure of single and few-layer BP, based on the Slater-Koster model within the two-center approximation. Our model includes all 3s and 3p orbitals, which makes this problem more complex than that of graphene, where only 2pz orbitals are needed for most purposes. The TB parameters are obtained from a least-squares fit of DFT calculations carried on the SIESTA code. We compare the results for different basis-sets used to expand the ab-initio wavefunctions and discuss their applicability. Our model can fit a larger number of bands than previously reported calculations based on Wannier functions. Moreover, our parameters have a clear physical interpretation based on chemical bonding. As such, we expect our results to be useful in a further understanding of multilayer BP and other 2D-materials characterized by strong sp3 hybridization. CNPq, FAPERJ, INCT-Nanomateriais de Carbono.

  11. Proximity enhanced quantum spin Hall state in graphene

    DOE PAGES

    Kou, Liangzhi; Hu, Feiming; Yan, Binghai; ...

    2015-02-23

    Graphene is the first model system of two-dimensional topological insulator (TI), also known as quantum spin Hall (QSH) insulator. The QSH effect in graphene, however, has eluded direct experimental detection because of its extremely small energy gap due to the weak spin–orbit coupling. Here we predict by ab initio calculations a giant (three orders of magnitude) proximity induced enhancement of the TI energy gap in the graphene layer that is sandwiched between thin slabs of Sb 2Te 3 (or MoTe 2). This gap (1.5 meV) is accessible by existing experimental techniques, and it can be further enhanced by tuning themore » interlayer distance via compression. We reveal by a tight-binding study that the QSH state in graphene is driven by the Kane–Mele interaction in competition with Kekulé deformation and symmetry breaking. As a result, the present work identifies a new family of graphene-based TIs with an observable and controllable bulk energy gap in the graphene layer, thus opening a new avenue for direct verification and exploration of the long-sought QSH effect in graphene.« less

  12. Extra-domain B in oncofetal fibronectin structurally promotes fibrillar head-to-tail dimerization of extracellular matrix protein.

    PubMed

    Schiefner, André; Gebauer, Michaela; Skerra, Arne

    2012-05-18

    The type III extra-domain B (ED-B) is specifically spliced into fibronectin (Fn) during embryogenesis and neoangiogenesis, including many cancers. The x-ray structure of the recombinant four-domain fragment Fn(III)7B89 reveals a tightly associated, extended head-to-tail dimer, which is stabilized via pair-wise shape and charge complementarity. A tendency toward ED-B-dependent dimer formation in solution was supported by size exclusion chromatography and analytical ultracentrifugation. When amending the model with the known three-dimensional structure of the Fn(III)10 domain, its RGD loop as well as the adhesion synergy region in Fn(III)9-10 become displayed on the same face of the dimer; this should allow simultaneous binding of at least two integrins and, thus, receptor clustering on the cell surface and intracellular signaling. Insertion of ED-B appears to stabilize overall head-to-tail dimerization of two separate Fn chains, which, together with alternating homodimer formation via disulfide bridges at the C-terminal Fn tail, should lead to the known macromolecular fibril formation.

  13. Role of spin diffusion in current-induced domain wall motion for disordered ferromagnets

    NASA Astrophysics Data System (ADS)

    Akosa, Collins Ashu; Kim, Won-Seok; Bisig, André; Kläui, Mathias; Lee, Kyung-Jin; Manchon, Aurélien

    2015-03-01

    Current-induced spin transfer torque and magnetization dynamics in the presence of spin diffusion in disordered magnetic textures is studied theoretically. We demonstrate using tight-binding calculations that weak, spin-conserving impurity scattering dramatically enhances the nonadiabaticity. To further explore this mechanism, a phenomenological drift-diffusion model for incoherent spin transport is investigated. We show that incoherent spin diffusion indeed produces an additional spatially dependent torque of the form ˜∇2[m ×(u .∇ ) m ] +ξ ∇2[(u .∇ ) m ] , where m is the local magnetization direction, u is the direction of injected current, and ξ is a parameter characterizing the spin dynamics (precession, dephasing, and spin-flip). This torque, which scales as the inverse square of the domain wall width, only weakly enhances the longitudinal velocity of a transverse domain wall but significantly enhances the transverse velocity of vortex walls. The spatial-dependent spin transfer torque uncovered in this study is expected to have significant impact on the current-driven motion of abrupt two-dimensional textures such as vortices, skyrmions, and merons.

  14. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Morris, J.R.; Lu, Z.Y.; Ring, D.M.

    The authors have examined a variety of structures for the {l_brace}510{r_brace} symmetric tilt boundary in Si, using first-principles calculations. These calculations show that the observed structure in Si is the lowest energy structure. This structure is more complicated than what is necessary to preserve four-fold coordination. They compare the results to classical and tight-binding models, in order to test these empirical approaches.

  15. Inhibition of ATP Synthase by Chlorinated Adenosine Analogue

    PubMed Central

    Chen, Lisa S.; Nowak, Billie J.; Ayres, Mary L.; Krett, Nancy L.; Rosen, Steven T.; Zhang, Shuxing; Gandhi, Varsha

    2009-01-01

    8-Chloroadenosine (8-Cl-Ado) is a ribonucleoside analogue that is currently in clinical trial for chronic lymphocytic leukemia. Based on the decline in cellular ATP pool following 8-Cl-Ado treatment, we hypothesized that 8-Cl-ADP and 8-Cl-ATP may interfere with ATP synthase, a key enzyme in ATP production. Mitochondrial ATP synthase is composed of two major parts; FO intermembrane base and F1 domain, containing α and β subunits. Crystal structures of both α and β subunits that bind to the substrate, ADP, are known in tight binding (αdpβdp) and loose binding (αtpβtp) states. Molecular docking demonstrated that 8-Cl-ADP/8-Cl-ATP occupied similar binding modes as ADP/ATP in the tight and loose binding sites of ATP synthase, respectively, suggesting that the chlorinated nucleotide metabolites may be functional substrates and inhibitors of the enzyme. The computational predictions were consistent with our whole cell biochemical results. Oligomycin, an established pharmacological inhibitor of ATP synthase, decreased both ATP and 8-Cl-ATP formation from exogenous substrates, however, did not affect pyrimidine nucleoside analogue triphosphate accumulation. Synthesis of ATP from ADP was inhibited in cells loaded with 8-Cl-ATP. These biochemical studies are in consent with the computational modeling; in the αtpβtp state 8-Cl-ATP occupies similar binding as ANP, a non-hydrolyzable ATP mimic that is a known inhibitor. Similarly, in the substrate binding site (αdpβdp) 8-Cl-ATP occupies a similar position as ATP mimic ADP-BeF3 −. Collectively, our current work suggests that 8-Cl-ADP may serve as a substrate and the 8-Cl-ATP may be an inhibitor of ATP synthase. PMID:19477165

  16. ARPES study of the evolution of band structure and charge density wave properties in RTe3 ( R=Y , La, Ce, Sm, Gd, Tb, and Dy)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hussain, Zahid; Brouet, Veronique; Yang, Wanli

    2008-01-16

    We present a detailed angle-resolved photoemission spectroscopy (ARPES) investigation of the RTe3 family, which sets this system as an ideal"textbook" example for the formation of a nesting driven charge density wave (CDW). This family indeed exhibits the full range of phenomena that can be associated to CDWinstabilities, from the opening of large gaps on the best nested parts of Fermi surface (up to 0.4 eV), to the existence of residual metallic pockets. ARPES is the best suited technique to characterize these features, thanks to its unique ability to resolve the electronic structure in k space. An additional advantage of RTe3more » is that theband structure can be very accurately described by a simple two dimensional tight-binding (TB) model, which allows one to understand and easily reproduce many characteristics of the CDW. In this paper, we first establish the main features of the electronic structure by comparing our ARPES measurements with the linear muffin-tinorbital band calculations. We use this to define the validity and limits of the TB model. We then present a complete description of the CDW properties and of their strong evolution as a function of R. Using simple models, we are able to reproduce perfectly the evolution of gaps in k space, the evolution of the CDW wave vector with R, and the shape of the residual metallic pockets. Finally, we give an estimation of the CDWinteraction parameters and find that the change in the electronic density of states n (EF), due to lattice expansion when different R ions are inserted, has the correct order of magnitude to explain the evolution of the CDW properties.« less

  17. Electrical design of InAs-Sb/GaSb superlattices for optical detectors using full bandstructure sp3s* tight-binding method and Bloch boundary conditions

    NASA Astrophysics Data System (ADS)

    Mir, Raja N.; Frensley, William R.

    2013-10-01

    InAs-Sb/GaSb type-II strain compensated superlattices (SLS) are currently being used in mid-wave and long-wave infrared photodetectors. The electronic bandstructure of InSb and GaSb shows very strong anisotropy and non-parabolicity close to the Γ-point for the conduction band (CB) minimum and the valence band (VB) maximum. Particularly around the energy range of 45-80 meV from band-edge we observe strong non-parabolicity in the CB and light hole VB. The band-edge dispersion determines the electrical properties of a material. When the bulk materials are combined to form a superlattice we need a model of bandstructure which takes into account the full bandstructure details of the constituents and also the strong interaction between the conduction band of InAs and valence bands of GaSb. There can also be contact potentials near the interface between two dissimilar superlattices which will not be captured unless a full bandstructure calculation is done. In this study, we have done a calculation using second nearest neighbor tight binding model in order to accurately reproduce the effective masses. The calculation of mini-band structure is done by finding the wavefunctions within one SL period subject to Bloch boundary conditions ψ(L)=ψ(0)eikL. We demonstrate in this paper how a calculation of carrier concentration as a function of the position of the Fermi level (EF) within bandgap(Eg) should be done in order to take into account the full bandstructure of broken-bandgap material systems. This calculation is key for determining electron transport particularly when we have an interface between two dissimilar superlattices.

  18. Shaping planetary nebulae with jets in inclined triple stellar systems

    NASA Astrophysics Data System (ADS)

    Akashi, Muhammad; Soker, Noam

    2017-08-01

    We conduct three-dimensional hydrodynamical simulations of two opposite jets launched obliquely to the orbital plane around an asymptotic giant branch (AGB) star and within its dense wind, and demonstrate the formation of a 'messy' planetary nebula (PN), namely a PN lacking any type of symmetry (I.e. highly irregular). In building the initial conditions, we assume that a tight binary system orbits the AGB star and that the orbital plane of the tight binary system is inclined to the orbital plane of the binary system and the AGB star (the triple system plane). We further assume that the accreted mass on to the tight binary system forms an accretion disc around one of the stars and that the plane of the disc is tilted to the orbital plane of the triple system. The highly asymmetrical and filamentary structures that we obtain support the notion that messy PNe might be shaped by triple stellar systems.

  19. Shaping planetary nebulae with jets in inclined triple stellar systems

    NASA Astrophysics Data System (ADS)

    Akashi, Muhammad; Soker, Noam

    2017-10-01

    We conduct three-dimensional hydrodynamical simulations of two opposite jets launched obliquely to the orbital plane around an asymptotic giant branch (AGB) star and within its dense wind, and demonstrate the formation of a `messy' planetary nebula (PN), namely, a PN lacking any type of symmetry (highly irregular). In building the initial conditions we assume that a tight binary system orbits the AGB star, and that the orbital plane of the tight binary system is inclined to the orbital plane of binary system and the AGB star. We further assume that the accreted mass onto the tight binary system forms an accretion disk around one of the stars, and that the plane of the disk is in between the two orbital planes. The highly asymmetrical lobes that we obtain support the notion that messy PNe might be shaped by triple stellar systems.

  20. Exciton size and binding energy limitations in one-dimensional organic materials.

    PubMed

    Kraner, S; Scholz, R; Plasser, F; Koerner, C; Leo, K

    2015-12-28

    In current organic photovoltaic devices, the loss in energy caused by the charge transfer step necessary for exciton dissociation leads to a low open circuit voltage, being one of the main reasons for rather low power conversion efficiencies. A possible approach to avoid these losses is to tune the exciton binding energy to a value of the order of thermal energy, which would lead to free charges upon absorption of a photon, and therefore increase the power conversion efficiency towards the Shockley-Queisser limit. We determine the size of the excitons for different organic molecules and polymers by time dependent density functional theory calculations. For optically relevant transitions, the exciton size saturates around 0.7 nm for one-dimensional molecules with a size longer than about 4 nm. For the ladder-type polymer poly(benzimidazobenzophenanthroline), we obtain an exciton binding energy of about 0.3 eV, serving as a lower limit of the exciton binding energy for the organic materials investigated. Furthermore, we show that charge transfer transitions increase the exciton size and thus identify possible routes towards a further decrease of the exciton binding energy.

  1. Sliding of proteins non-specifically bound to DNA: Brownian dynamics studies with coarse-grained protein and DNA models.

    PubMed

    Ando, Tadashi; Skolnick, Jeffrey

    2014-12-01

    DNA binding proteins efficiently search for their cognitive sites on long genomic DNA by combining 3D diffusion and 1D diffusion (sliding) along the DNA. Recent experimental results and theoretical analyses revealed that the proteins show a rotation-coupled sliding along DNA helical pitch. Here, we performed Brownian dynamics simulations using newly developed coarse-grained protein and DNA models for evaluating how hydrodynamic interactions between the protein and DNA molecules, binding affinity of the protein to DNA, and DNA fluctuations affect the one dimensional diffusion of the protein on the DNA. Our results indicate that intermolecular hydrodynamic interactions reduce 1D diffusivity by 30%. On the other hand, structural fluctuations of DNA give rise to steric collisions between the CG-proteins and DNA, resulting in faster 1D sliding of the protein. Proteins with low binding affinities consistent with experimental estimates of non-specific DNA binding show hopping along the CG-DNA. This hopping significantly increases sliding speed. These simulation studies provide additional insights into the mechanism of how DNA binding proteins find their target sites on the genome.

  2. Analytic second derivative of the energy for density-functional tight-binding combined with the fragment molecular orbital method

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nakata, Hiroya, E-mail: hiroya.nakata.gt@kyocera.jp; Nishimoto, Yoshio; Fedorov, Dmitri G.

    2016-07-28

    The analytic second derivative of the energy is developed for the fragment molecular orbital (FMO) method combined with density-functional tight-binding (DFTB), enabling simulations of infrared and Raman spectra of large molecular systems. The accuracy of the method is established in comparison to full DFTB without fragmentation for a set of representative systems. The performance of the FMO-DFTB Hessian is discussed for molecular systems containing up to 10 041 atoms. The method is applied to the study of the binding of α-cyclodextrin to polyethylene glycol, and the calculated IR spectrum of an epoxy amine oligomer reproduces experiment reasonably well.

  3. Increasing the affinity of selective bZIP-binding peptides through surface residue redesign.

    PubMed

    Kaplan, Jenifer B; Reinke, Aaron W; Keating, Amy E

    2014-07-01

    The coiled-coil dimer is a prevalent protein interaction motif that is important for many cellular processes. The basic leucine-zipper (bZIP) transcription factors are one family of proteins for which coiled-coil mediated dimerization is essential for function, and misregulation of bZIPs can lead to disease states including cancer. This makes coiled coils attractive protein-protein interaction targets to disrupt using engineered molecules. Previous work designing peptides to compete with native coiled-coil interactions focused primarily on designing the core residues of the interface to achieve affinity and specificity. However, folding studies on the model bZIP GCN4 show that coiled-coil surface residues also contribute to binding affinity. Here we extend a prior study in which peptides were designed to bind tightly and specifically to representative members of each of 20 human bZIP families. These "anti-bZIP" peptides were designed with an emphasis on target-binding specificity, with contributions to design-target specificity and affinity engineered considering only the coiled-coil core residues. High-throughput testing using peptide arrays indicated many successes. We have now measured the binding affinities and specificities of anti-bZIPs that bind to FOS, XBP1, ATF6, and CREBZF in solution and tested whether redesigning the surface residues can increase design-target affinity. Incorporating residues that favor helix formation into the designs increased binding affinities in all cases, providing low-nanomolar binders of each target. However, changes in surface electrostatic interactions sometimes changed the binding specificity of the designed peptides. © 2014 The Protein Society.

  4. The Mismetallation of Enzymes during Oxidative Stress*

    PubMed Central

    Imlay, James A.

    2014-01-01

    Mononuclear iron enzymes can tightly bind non-activating metals. How do cells avoid mismetallation? The model bacterium Escherichia coli may control its metal pools so that thermodynamics favor the correct metallation of each enzyme. This system is disrupted, however, by superoxide and hydrogen peroxide. These species oxidize ferrous iron and thereby displace it from many iron-dependent mononuclear enzymes. Ultimately, zinc binds in its place, confers little activity, and imposes metabolic bottlenecks. Data suggest that E. coli compensates by using thiols to extract the zinc and by importing manganese to replace the catalytic iron atom. Manganese resists oxidants and provides substantial activity. PMID:25160623

  5. Binding Mode Analyses and Pharmacophore Model Development for Stilbene Derivatives as a Novel and Competitive Class of α-Glucosidase Inhibitors

    PubMed Central

    Kim, Jun Young; Arooj, Mahreen; Kim, Siu; Hwang, Swan; Kim, Byeong-Woo; Park, Ki Hun; Lee, Keun Woo

    2014-01-01

    Stilbene urea derivatives as a novel and competitive class of non-glycosidic α-glucosidase inhibitors are effective for the treatment of type II diabetes and obesity. The main purposes of our molecular modeling study are to explore the most suitable binding poses of stilbene derivatives with analyzing the binding affinity differences and finally to develop a pharmacophore model which would represents critical features responsible for α-glucosidase inhibitory activity. Three-dimensional structure of S. cerevisiae α-glucosidase was built by homology modeling method and the structure was used for the molecular docking study to find out the initial binding mode of compound 12, which is the most highly active one. The initial structure was subjected to molecular dynamics (MD) simulations for protein structure adjustment at compound 12-bound state. Based on the adjusted conformation, the more reasonable binding modes of the stilbene urea derivatives were obtained from molecular docking and MD simulations. The binding mode of the derivatives was validated by correlation analysis between experimental Ki value and interaction energy. Our results revealed that the binding modes of the potent inhibitors were engaged with important hydrogen bond, hydrophobic, and π-interactions. With the validated compound 12-bound structure obtained from combining approach of docking and MD simulation, a proper four featured pharmacophore model was generated. It was also validated by comparison of fit values with the Ki values. Thus, these results will be helpful for understanding the relationship between binding mode and bioactivity and for designing better inhibitors from stilbene derivatives. PMID:24465730

  6. Tight-binding calculation of radiation loss in photonic crystal CROW.

    PubMed

    Ma, Jing; Martínez, Luis Javier; Fan, Shanhui; Povinelli, Michelle L

    2013-01-28

    The tight binding approximation (TBA) is used to relate the intrinsic, radiation loss of a coupled resonator optical waveguide (CROW) to that of a single constituent resonator within a light cone picture. We verify the validity of the TBA via direct, full-field simulation of CROWs based on the L2 photonic crystal cavity. The TBA predicts that the quality factor of the CROW increases with that of the isolated cavity. Moreover, our results provide a method to design CROWs with low intrinsic loss across the entire waveguide band.

  7. OLIFE: Tight Binding Code for Transmission Coefficient Calculation

    NASA Astrophysics Data System (ADS)

    Mijbil, Zainelabideen Yousif

    2018-05-01

    A new and human friendly transport calculation code has been developed. It requires a simple tight binding Hamiltonian as the only input file and uses a convenient graphical user interface to control calculations. The effect of magnetic field on junction has also been included. Furthermore the transmission coefficient can be calculated between any two points on the scatterer which ensures high flexibility to check the system. Therefore Olife can highly be recommended as an essential tool for pretesting studying and teaching electron transport in molecular devices that saves a lot of time and effort.

  8. Electronic Structure of Alpha-Quartz and the Influence of Some Local Disorder: A Tight Binding Study,

    DTIC Science & Technology

    1977-01-01

    An s extended summary of the theoretical and ex- perimental work on Si02 is to be found in that paper. The tight-binding basis con- sists of the four... theoretical and experimental works contained therein. 4. B. Fischer, R. A. Pollak, T. H. Distefano and W. D. Grobman, "Electronic Structure of SiO 2, SixGe 1 x...and GeO 2 from Photoemission Spectroscopy," Phys. Rev. BI5, 3193 (1977), and references to earlier works therein. 5. J. H. Scofield , "Hartree-Slater

  9. Density-functional expansion methods: Grand challenges.

    PubMed

    Giese, Timothy J; York, Darrin M

    2012-03-01

    We discuss the source of errors in semiempirical density functional expansion (VE) methods. In particular, we show that VE methods are capable of well-reproducing their standard Kohn-Sham density functional method counterparts, but suffer from large errors upon using one or more of these approximations: the limited size of the atomic orbital basis, the Slater monopole auxiliary basis description of the response density, and the one- and two-body treatment of the core-Hamiltonian matrix elements. In the process of discussing these approximations and highlighting their symptoms, we introduce a new model that supplements the second-order density-functional tight-binding model with a self-consistent charge-dependent chemical potential equalization correction; we review our recently reported method for generalizing the auxiliary basis description of the atomic orbital response density; and we decompose the first-order potential into a summation of additive atomic components and many-body corrections, and from this examination, we provide new insights and preliminary results that motivate and inspire new approximate treatments of the core-Hamiltonian.

  10. Study of Gas Flow Characteristics in Tight Porous Media with a Microscale Lattice Boltzmann Model

    PubMed Central

    Zhao, Jianlin; Yao, Jun; Zhang, Min; Zhang, Lei; Yang, Yongfei; Sun, Hai; An, Senyou; Li, Aifen

    2016-01-01

    To investigate the gas flow characteristics in tight porous media, a microscale lattice Boltzmann (LB) model with the regularization procedure is firstly adopted to simulate gas flow in three-dimensional (3D) digital rocks. A shale digital rock and a sandstone digital rock are reconstructed to study the effects of pressure, temperature and pore size on microscale gas flow. The simulation results show that because of the microscale effect in tight porous media, the apparent permeability is always higher than the intrinsic permeability, and with the decrease of pressure or pore size, or with the increase of temperature, the difference between apparent permeability and intrinsic permeability increases. In addition, the Knudsen numbers under different conditions are calculated and the results show that gas flow characteristics in the digital rocks under different Knudsen numbers are quite different. With the increase of Knudsen number, gas flow in the digital rocks becomes more uniform and the effect of heterogeneity of the porous media on gas flow decreases. Finally, two commonly used apparent permeability calculation models are evaluated by the simulation results and the Klinkenberg model shows better accuracy. In addition, a better proportionality factor in Klinkenberg model is proposed according to the simulation results. PMID:27587293

  11. The ZO-1–associated Y-box factor ZONAB regulates epithelial cell proliferation and cell density

    PubMed Central

    Balda, Maria S.; Garrett, Michelle D.; Matter, Karl

    2003-01-01

    Epithelial tight junctions regulate paracellular permeability, restrict apical/basolateral intramembrane diffusion of lipids, and have been proposed to participate in the control of epithelial cell proliferation and differentiation. Previously, we have identified ZO-1–associated nucleic acid binding proteins (ZONAB), a Y-box transcription factor whose nuclear localization and transcriptional activity is regulated by the tight junction–associated candidate tumor suppressor ZO-1. Now, we found that reduction of ZONAB expression using an antisense approach or by RNA interference strongly reduced proliferation of MDCK cells. Transfection of wild-type or ZONAB-binding fragments of ZO-1 reduced proliferation as well as nuclear ZONAB pools, indicating that promotion of proliferation by ZONAB requires its nuclear accumulation. Overexpression of ZONAB resulted in increased cell density in mature monolayers, and depletion of ZONAB or overexpression of ZO-1 reduced cell density. ZONAB was found to associate with cell division kinase (CDK) 4, and reduction of nuclear ZONAB levels resulted in reduced nuclear CDK4. Thus, our data indicate that tight junctions can regulate epithelial cell proliferation and cell density via a ZONAB/ZO-1–based pathway. Although this regulatory process may also involve regulation of transcription by ZONAB, our data suggest that one mechanism by which ZONAB and ZO-1 influence proliferation is by regulating the nuclear accumulation of CDK4. PMID:12566432

  12. Electrostatic Interactions in the Binding Pathway of a Transient Protein Complex Studied by NMR and Isothermal Titration Calorimetry*

    PubMed Central

    Meneses, Erick; Mittermaier, Anthony

    2014-01-01

    Much of our knowledge of protein binding pathways is derived from extremely stable complexes that interact very tightly, with lifetimes of hours to days. Much less is known about weaker interactions and transient complexes because these are challenging to characterize experimentally. Nevertheless, these types of interactions are ubiquitous in living systems. The combination of NMR relaxation dispersion Carr–Purcell–Meiboom–Gill (CPMG) experiments and isothermal titration calorimetry allows the quantification of rapid binding kinetics for complexes with submillisecond lifetimes that are difficult to study using conventional techniques. We have used this approach to investigate the binding pathway of the Src homology 3 (SH3) domain from the Fyn tyrosine kinase, which forms complexes with peptide targets whose lifetimes are on the order of about a millisecond. Long range electrostatic interactions have been shown to play a critical role in the binding pathways of tightly binding complexes. The role of electrostatics in the binding pathways of transient complexes is less well understood. Similarly to previously studied tight complexes, we find that SH3 domain association rates are enhanced by long range electrostatics, whereas short range interactions are formed late in the docking process. However, the extent of electrostatic association rate enhancement is several orders of magnitudes less, whereas the electrostatic-free basal association rate is significantly greater. Thus, the SH3 domain is far less reliant on electrostatic enhancement to achieve rapid association kinetics than are previously studied systems. This suggests that there may be overall differences in the role played by electrostatics in the binding pathways of extremely stable versus transient complexes. PMID:25122758

  13. Efficient Stochastic Inversion Using Adjoint Models and Kernel-PCA

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Thimmisetty, Charanraj A.; Zhao, Wenju; Chen, Xiao

    2017-10-18

    Performing stochastic inversion on a computationally expensive forward simulation model with a high-dimensional uncertain parameter space (e.g. a spatial random field) is computationally prohibitive even when gradient information can be computed efficiently. Moreover, the ‘nonlinear’ mapping from parameters to observables generally gives rise to non-Gaussian posteriors even with Gaussian priors, thus hampering the use of efficient inversion algorithms designed for models with Gaussian assumptions. In this paper, we propose a novel Bayesian stochastic inversion methodology, which is characterized by a tight coupling between the gradient-based Langevin Markov Chain Monte Carlo (LMCMC) method and a kernel principal component analysis (KPCA). Thismore » approach addresses the ‘curse-of-dimensionality’ via KPCA to identify a low-dimensional feature space within the high-dimensional and nonlinearly correlated parameter space. In addition, non-Gaussian posterior distributions are estimated via an efficient LMCMC method on the projected low-dimensional feature space. We will demonstrate this computational framework by integrating and adapting our recent data-driven statistics-on-manifolds constructions and reduction-through-projection techniques to a linear elasticity model.« less

  14. Deconvoluting AMP-activated protein kinase (AMPK) adenine nucleotide binding and sensing

    PubMed Central

    Gu, Xin; Yan, Yan; Novick, Scott J.; Kovach, Amanda; Goswami, Devrishi; Ke, Jiyuan; Tan, M. H. Eileen; Wang, Lili; Li, Xiaodan; de Waal, Parker W.; Webb, Martin R.; Griffin, Patrick R.; Xu, H. Eric

    2017-01-01

    AMP-activated protein kinase (AMPK) is a central cellular energy sensor that adapts metabolism and growth to the energy state of the cell. AMPK senses the ratio of adenine nucleotides (adenylate energy charge) by competitive binding of AMP, ADP, and ATP to three sites (CBS1, CBS3, and CBS4) in its γ-subunit. Because these three binding sites are functionally interconnected, it remains unclear how nucleotides bind to individual sites, which nucleotides occupy each site under physiological conditions, and how binding to one site affects binding to the other sites. Here, we comprehensively analyze nucleotide binding to wild-type and mutant AMPK protein complexes by quantitative competition assays and by hydrogen-deuterium exchange MS. We also demonstrate that NADPH, in addition to the known AMPK ligand NADH, directly and competitively binds AMPK at the AMP-sensing CBS3 site. Our findings reveal how AMP binding to one site affects the conformation and adenine nucleotide binding at the other two sites and establish CBS3, and not CBS1, as the high affinity exchangeable AMP/ADP/ATP-binding site. We further show that AMP binding at CBS4 increases AMP binding at CBS3 by 2 orders of magnitude and reverses the AMP/ATP preference of CBS3. Together, these results illustrate how the three CBS sites collaborate to enable highly sensitive detection of cellular energy states to maintain the tight ATP homeostastis required for cellular metabolism. PMID:28615457

  15. Refining the boundaries of the classical de Sitter landscape

    NASA Astrophysics Data System (ADS)

    Andriot, David; Blåbäck, Johan

    2017-03-01

    We derive highly constraining no-go theorems for classical de Sitter backgrounds of string theory, with parallel sources; this should impact the embedding of cosmological models. We study ten-dimensional vacua of type II supergravities with parallel and backreacted orientifold O p -planes and D p -branes, on four-dimensional de Sitter spacetime times a compact manifold. Vacua for p = 3, 7 or 8 are completely excluded, and we obtain tight constraints for p = 4, 5, 6. This is achieved through the derivation of an enlightening expression for the four-dimensional Ricci scalar. Further interesting expressions and no-go theorems are obtained. The paper is self-contained so technical aspects, including conventions, might be of more general interest.

  16. 3D chromosome rendering from Hi-C data using virtual reality

    NASA Astrophysics Data System (ADS)

    Zhu, Yixin; Selvaraj, Siddarth; Weber, Philip; Fang, Jennifer; Schulze, Jürgen P.; Ren, Bing

    2015-01-01

    Most genome browsers display DNA linearly, using single-dimensional depictions that are useful to examine certain epigenetic mechanisms such as DNA methylation. However, these representations are insufficient to visualize intrachromosomal interactions and relationships between distal genome features. Relationships between DNA regions may be difficult to decipher or missed entirely if those regions are distant in one dimension but could be spatially proximal when mapped to three-dimensional space. For example, the visualization of enhancers folding over genes is only fully expressed in three-dimensional space. Thus, to accurately understand DNA behavior during gene expression, a means to model chromosomes is essential. Using coordinates generated from Hi-C interaction frequency data, we have created interactive 3D models of whole chromosome structures and its respective domains. We have also rendered information on genomic features such as genes, CTCF binding sites, and enhancers. The goal of this article is to present the procedure, findings, and conclusions of our models and renderings.

  17. Out-of-equilibrium dynamics of repulsive Fermi gases in quasiperiodic potentials: A density functional theory study

    NASA Astrophysics Data System (ADS)

    Ancilotto, Francesco; Rossini, Davide; Pilati, Sebastiano

    2018-04-01

    The dynamics of a one-dimensional two-component Fermi gas in the presence of a quasiperiodic optical lattice (OL) is investigated by means of a density functional theory approach. Inspired by the protocol implemented in recent cold-atom experiments—designed to identify the many-body localization transition—we analyze the relaxation of an initially prepared imbalance between the occupation number of odd and of even sites. For quasidisorder strength beyond the Anderson localization transition, the imbalance survives for long times, indicating the inability of the system to reach local equilibrium. The late-time value of the imbalance diminishes for increasing interaction strength. Close to the critical quasidisorder strength corresponding to the noninteracting (Anderson) transition, the interacting system displays an extremely slow relaxation dynamics, consistent with subdiffusive behavior. The amplitude of the imbalance fluctuations around its running average is found to decrease with time, and such damping is more effective with increasing interaction strengths. While our study addresses the setup with two equally intense OLs, very similar effects due to interactions have been observed also in recent cold-atom experiments performed in the tight-binding regime, i.e., where one of the two OLs is very deep and the other is much weaker.

  18. Membrane Association of the PTEN Tumor Suppressor: Electrostatic Interaction with Phos-phatidylserine-Containing Bilayers and Regulatory Role of the C-Terminal Tail

    PubMed Central

    Shenoy, Siddharth S.; Nanda, Hirsh; Lösche, Mathias

    2012-01-01

    The phosphatidylinositolphosphate phosphatase PTEN is the second most frequently mutated protein in human tumors. Its membrane association, allosteric activation and membrane dissociation are poorly understood. We recently reported PTEN binding affinities to membranes of different compositions and a preliminary investigation of the protein-membrane complex with neutron reflectometry (NR). Here we use NR to validate molecular dynamics (MD) simulations of the protein and study conformational differences of the protein in solution and on anionic membranes. NR shows that full-length PTEN binds to such membranes roughly in the conformation and orientation suggested by the crystal structure of a truncated PTEN protein, in contrast with a recently presented model which suggested that membrane binding depends critically on the SUMOylation of the CBR3 loop of PTEN’s C2 domain. Our MD simulations confirm that PTEN is peripherally bound to the bilayer surface and show slight differences of the protein structure in solution and in the membrane-bound state, where the protein body flattens against the bilayer surface. PTEN’s C2 domain binds phosphatidylserine (PS) tightly through its CBR3 loop, and its phosphatase domain also forms electrostatic interactions with PS. NR and MD results show consistently that PTEN’s unstructured, anionic C-terminal tail is repelled from the bilayer surface. In contrast, this tail is tightly tugged against the C2 domain in solution, partially obstructing the membrane-binding interface of the protein. Arresting the C-terminal tail in this conformation by phosphorylation may provide a control mechanism for PTEN’s membrane binding and activity. PMID:23073177

  19. Implementation and benchmark of a long-range corrected functional in the density functional based tight-binding method

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lutsker, V.; Niehaus, T. A., E-mail: thomas.niehaus@physik.uni-regensburg.de; Aradi, B.

    2015-11-14

    Bridging the gap between first principles methods and empirical schemes, the density functional based tight-binding method (DFTB) has become a versatile tool in predictive atomistic simulations over the past years. One of the major restrictions of this method is the limitation to local or gradient corrected exchange-correlation functionals. This excludes the important class of hybrid or long-range corrected functionals, which are advantageous in thermochemistry, as well as in the computation of vibrational, photoelectron, and optical spectra. The present work provides a detailed account of the implementation of DFTB for a long-range corrected functional in generalized Kohn-Sham theory. We apply themore » method to a set of organic molecules and compare ionization potentials and electron affinities with the original DFTB method and higher level theory. The new scheme cures the significant overpolarization in electric fields found for local DFTB, which parallels the functional dependence in first principles density functional theory (DFT). At the same time, the computational savings with respect to full DFT calculations are not compromised as evidenced by numerical benchmark data.« less

  20. A Sparse Self-Consistent Field Algorithm and Its Parallel Implementation: Application to Density-Functional-Based Tight Binding.

    PubMed

    Scemama, Anthony; Renon, Nicolas; Rapacioli, Mathias

    2014-06-10

    We present an algorithm and its parallel implementation for solving a self-consistent problem as encountered in Hartree-Fock or density functional theory. The algorithm takes advantage of the sparsity of matrices through the use of local molecular orbitals. The implementation allows one to exploit efficiently modern symmetric multiprocessing (SMP) computer architectures. As a first application, the algorithm is used within the density-functional-based tight binding method, for which most of the computational time is spent in the linear algebra routines (diagonalization of the Fock/Kohn-Sham matrix). We show that with this algorithm (i) single point calculations on very large systems (millions of atoms) can be performed on large SMP machines, (ii) calculations involving intermediate size systems (1000-100 000 atoms) are also strongly accelerated and can run efficiently on standard servers, and (iii) the error on the total energy due to the use of a cutoff in the molecular orbital coefficients can be controlled such that it remains smaller than the SCF convergence criterion.

  1. Designing ligands to bind proteins

    PubMed Central

    Whitesides, George M.; Krishnamurthy, Vijay M.

    2009-01-01

    The ability to design drugs (so-called ‘rational drug design’) has been one of the long-term objectives of chemistry for 50 years. It is an exceptionally difficult problem, and many of its parts lie outside the expertise of chemistry. The much more limited problem – how to design tight-binding ligands (rational ligand design) – would seem to be one that chemistry could solve, but has also proved remarkably recalcitrant. The question is ‘Why is it so difficult?’ and the answer is ‘We still don't entirely know’. This perspective discusses some of the technical issues – potential functions, protein plasticity, enthalpy/entropy compensation, and others – that contribute, and suggests areas where fundamental understanding of protein–ligand interactions falls short of what is needed. It surveys recent technological developments (in particular, isothermal titration calorimetry) that will, hopefully, make now the time for serious progress in this area. It concludes with the calorimetric examination of the association of a series of systematically varied ligands with a model protein. The counterintuitive thermodynamic results observed serve to illustrate that, even in relatively simple systems, understanding protein–ligand association is challenging. PMID:16817982

  2. Quantum simulation of disordered systems with cold atoms

    NASA Astrophysics Data System (ADS)

    Garreau, Jean-Claude

    2017-01-01

    This paper reviews the physics of quantum disorder in relation with a series of experiments using laser-cooled atoms exposed to "kicks" of a standing wave, realizing a paradigmatic model of quantum chaos, the kicked rotor. This dynamical system can be mapped onto a tight-binding Hamiltonian with pseudo-disorder, formally equivalent to the Anderson model of quantum disorder, with quantum chaos playing the role of disorder. This provides a very good quantum simulator for the Anderson physics. xml:lang="fr"

  3. Model of gas adsorption on magnetic surfaces

    NASA Astrophysics Data System (ADS)

    Pick, S.˛te˛´n.; D´, Hugues

    1997-12-01

    The semi-empirical self-consistent tight-binding model of gas (C, N, O) chemisorption is suggested to study its influence on surface magnetism. For the strongly ferromagnetic Fe(001), we find that the adsorbates are not effective in magnetism reduction. For the hypothetical magnetic V(001) surface, the magnetization is very sensitive to the vanadium d-band occupation used in the calculation. Supposing that the magnetization is weak, it can be essentially suppressed by the gas contamination. The effect is explained by the Stoner criterion.

  4. A Fortran 90 Hartree-Fock program for one-dimensional periodic π-conjugated systems using Pariser-Parr-Pople model

    NASA Astrophysics Data System (ADS)

    Kondayya, Gundra; Shukla, Alok

    2012-03-01

    Pariser-Parr-Pople (P-P-P) model Hamiltonian is employed frequently to study the electronic structure and optical properties of π-conjugated systems. In this paper we describe a Fortran 90 computer program which uses the P-P-P model Hamiltonian to solve the Hartree-Fock (HF) equation for infinitely long, one-dimensional, periodic, π-electron systems. The code is capable of computing the band structure, as also the linear optical absorption spectrum, by using the tight-binding and the HF methods. Furthermore, using our program the user can solve the HF equation in the presence of a finite external electric field, thereby, allowing the simulation of gated systems. We apply our code to compute various properties of polymers such as trans-polyacetylene, poly- para-phenylene, and armchair and zigzag graphene nanoribbons, in the infinite length limit. Program summaryProgram title: ppp_bulk.x Catalogue identifier: AEKW_v1_0 Program summary URL:http://cpc.cs.qub.ac.uk/summaries/AEKW_v1_0.html Program obtainable from: CPC Program Library, Queen's University, Belfast, N. Ireland Licensing provisions: Standard CPC licence, http://cpc.cs.qub.ac.uk/licence/licence.html No. of lines in distributed program, including test data, etc.: 87 464 No. of bytes in distributed program, including test data, etc.: 2 046 933 Distribution format: tar.gz Programming language: Fortran 90 Computer: PCs and workstations Operating system: Linux, Code was developed and tested on various recent versions of 64-bit Fedora including Fedora 14 (kernel version 2.6.35.12-90). Classification: 7.3 External routines: This program needs to link with LAPACK/BLAS libraries compiled with the same compiler as the program. For the Intel Fortran Compiler we used the ACML library version 4.4.0, while for the gfortran compiler we used the libraries supplied with the Fedora distribution. Nature of problem: The electronic structure of one-dimensional periodic π-conjugated systems is an intense area of research at present because of the tremendous interest in the physics of conjugated polymers and graphene nanoribbons. The computer program described in this paper provides an efficient way of solving the Hartree-Fock equations for such systems within the P-P-P model. In addition to the Bloch orbitals, band structure, and the density of states, the program can also compute quantities such as the linear absorption spectrum, and the electro-absorption spectrum of these systems. Solution method: For a one-dimensional periodic π-conjugated system lying in the xy-plane, the single-particle Bloch orbitals are expressed as linear combinations of p-orbitals of individual atoms. Then using various parameters defining the P-P-P Hamiltonian, the Hartree-Fock equations are set up as a matrix eigenvalue problem in the k-space. Thereby, its solutions are obtained in a self-consistent manner, using the iterative diagonalizing technique at several k points. The band structure and the corresponding Bloch orbitals thus obtained are used to perform a variety of calculations such as the density of states, linear optical absorption spectrum, electro-absorption spectrum, etc. Running time: Most of the examples provided take only a few seconds to run. For a large system, however, depending on the system size, the run time may be a few minutes to a few hours.

  5. Catalystlike effect of orbital angular momentum on the conversion of transverse to three-dimensional spin states within tightly focused radially polarized beams

    NASA Astrophysics Data System (ADS)

    Han, Lei; Liu, Sheng; Li, Peng; Zhang, Yi; Cheng, Huachao; Zhao, Jianlin

    2018-05-01

    We report on the catalystlike effect of orbital angular momentum (OAM) on local spin-state conversion within the tightly focused radially polarized beams associated with optical spin-orbit interaction. It is theoretically demonstrated that the incident OAM can lead to a conversion of purely transverse spin state to a three-dimensional spin state on the focal plane. This conversion can be conveniently manipulated by altering the sign and value of the OAM. By comparing the total OAM and spin angular momentum (SAM) on the incident plane to those on the focal plane, it is indicated that the incident OAM have no participation in the angular momentum intertransfer, and just play a role as a catalyst of local SAM conversion. Such an effect of OAM sheds new light on the optical spin-orbit interaction in tight-focusing processes. The resultant three-dimensional spin states may provide more degrees of freedom in optical manipulation and spin-dependent directive coupling.

  6. Entanglement properties of the antiferromagnetic-singlet transition in the Hubbard model on bilayer square lattices

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chang, Chia-Chen; Singh, Rajiv R. P.; Scalettar, Richard T.

    Here, we calculate the bipartite R enyi entanglement entropy of an L x L x 2 bilayer Hubbard model using a determinantal quantum Monte Carlo method recently proposed by Grover [Phys. Rev. Lett. 111, 130402 (2013)]. Two types of bipartition are studied: (i) One that divides the lattice into two L x L planes, and (ii) One that divides the lattice into two equal-size (L x L=2 x 2) bilayers. Furthermore, we compare our calculations with those for the tight-binding model studied by the correlation matrix method. As expected, the entropy for bipartition (i) scales as L 2, while themore » latter scales with L with possible logarithmic corrections. The onset of the antiferromagnet to singlet transition shows up by a saturation of the former to a maximal value and the latter to a small value in the singlet phase. We also comment on the large uncertainties in the numerical results with increasing U, which would have to be overcome before the critical behavior and logarithmic corrections can be quanti ed.« less

  7. Entanglement properties of the antiferromagnetic-singlet transition in the Hubbard model on bilayer square lattices

    DOE PAGES

    Chang, Chia-Chen; Singh, Rajiv R. P.; Scalettar, Richard T.

    2014-10-10

    Here, we calculate the bipartite R enyi entanglement entropy of an L x L x 2 bilayer Hubbard model using a determinantal quantum Monte Carlo method recently proposed by Grover [Phys. Rev. Lett. 111, 130402 (2013)]. Two types of bipartition are studied: (i) One that divides the lattice into two L x L planes, and (ii) One that divides the lattice into two equal-size (L x L=2 x 2) bilayers. Furthermore, we compare our calculations with those for the tight-binding model studied by the correlation matrix method. As expected, the entropy for bipartition (i) scales as L 2, while themore » latter scales with L with possible logarithmic corrections. The onset of the antiferromagnet to singlet transition shows up by a saturation of the former to a maximal value and the latter to a small value in the singlet phase. We also comment on the large uncertainties in the numerical results with increasing U, which would have to be overcome before the critical behavior and logarithmic corrections can be quanti ed.« less

  8. Molecular mechanism of DNA association with single-stranded DNA binding protein

    PubMed Central

    Maffeo, Christopher

    2017-01-01

    Abstract During DNA replication, the single-stranded DNA binding protein (SSB) wraps single-stranded DNA (ssDNA) with high affinity to protect it from degradation and prevent secondary structure formation. Although SSB binds ssDNA tightly, it can be repositioned along ssDNA to follow the advancement of the replication fork. Using all-atom molecular dynamics simulations, we characterized the molecular mechanism of ssDNA association with SSB. Placed in solution, ssDNA–SSB assemblies were observed to change their structure spontaneously; such structural changes were suppressed in the crystallographic environment. Repeat simulations of the SSB–ssDNA complex under mechanical tension revealed a multitude of possible pathways for ssDNA to come off SSB punctuated by prolonged arrests at reproducible sites at the SSB surface. Ensemble simulations of spontaneous association of short ssDNA fragments with SSB detailed a three-dimensional map of local affinity to DNA; the equilibrium amount of ssDNA bound to SSB was found to depend on the electrolyte concentration but not on the presence of the acidic tips of the SSB tails. Spontaneous formation of ssDNA bulges and their diffusive motion along SSB surface was directly observed in multiple 10-µs-long simulations. Such reptation-like motion was confined by DNA binding to high-affinity spots, suggesting a two-step mechanism for SSB diffusion. PMID:29059392

  9. A Computational Analysis of ATP Binding of SV40 Large Tumor Antigen Helicase Motor

    PubMed Central

    Shi, Yemin; Liu, Hanbin; Gai, Dahai; Ma, Jianpeng; Chen, Xiaojiang S.

    2009-01-01

    Simian Virus 40 Large Tumor Antigen (LTag) is an efficient helicase motor that unwinds and translocates DNA. The DNA unwinding and translocation of LTag is powered by ATP binding and hydrolysis at the nucleotide pocket between two adjacent subunits of an LTag hexamer. Based on the set of high-resolution hexameric structures of LTag helicase in different nucleotide binding states, we simulated a conformational transition pathway of the ATP binding process using the targeted molecular dynamics method and calculated the corresponding energy profile using the linear response approximation (LRA) version of the semi-macroscopic Protein Dipoles Langevin Dipoles method (PDLD/S). The simulation results suggest a three-step process for the ATP binding from the initial interaction to the final tight binding at the nucleotide pocket, in which ATP is eventually “locked” by three pairs of charge-charge interactions across the pocket. Such a “cross-locking” ATP binding process is similar to the binding zipper model reported for the F1-ATPase hexameric motor. The simulation also shows a transition mechanism of Mg2+ coordination to form the Mg-ATP complex during ATP binding, which is accompanied by the large conformational changes of LTag. This simulation study of the ATP binding process to an LTag and the accompanying conformational changes in the context of a hexamer leads to a refined cooperative iris model that has been proposed previously. PMID:19779548

  10. Tight-binding tunneling amplitude of an optical lattice

    NASA Astrophysics Data System (ADS)

    Arzamasovs, Maksims; Liu, Bo

    2017-11-01

    The particle in a periodic potential is an important topic in an undergraduate quantum mechanics curriculum and a stepping stone on the way to more advanced topics, such as courses on interacting electrons in crystalline solids, and graduate-level research in solid-state and condensed matter physics. The interacting many-body phenomena are usually described in terms of the second quantized lattice Hamiltonians which treat single-particle physics on the level of tight-binding approximation and add interactions on top of it. The aim of this paper is to show how the tight-binding tunneling amplitude can be related to the strength of the periodic potential for the case of a cosine potential used in the burgeoning field of ultracold atoms. We show how to approach the problem of computing the tunneling amplitude of a deep lattice using the JWKB (Jeffreys-Wentzel-Kramers-Brillouin, also known as semiclassical) approximation. We also point out that care should be taken when applying the method of the linear combination of atomic orbitals (LCAO) in an optical lattice context. A summary of the exact solution in terms of Mathieu functions is also given.

  11. Molecular modeling studies of HIV-1 reverse transcriptase nonnucleoside inhibitors: total energy of complexation as a predictor of drug placement and activity.

    PubMed Central

    Kroeger Smith, M. B.; Rouzer, C. A.; Taneyhill, L. A.; Smith, N. A.; Hughes, S. H.; Boyer, P. L.; Janssen, P. A.; Moereels, H.; Koymans, L.; Arnold, E.

    1995-01-01

    Computer modeling studies have been carried out on three nonnucleoside inhibitors complexed with human immunodeficiency virus type 1 (HIV-1) reverse transcriptase (RT), using crystal coordinate data from a subset of the protein surrounding the binding pocket region. Results from the minimizations of solvated complexes of 2-cyclopropyl-4-methyl-5,11-dihydro-5H-dipyrido[3,2-b :2',3'-e][1,4] diazepin-6-one (nevirapine), alpha-anilino-2, 6-dibromophenylacetamide (alpha-APA), and 8-chloro-tetrahydro-imidazo(4,5,1-jk)(1,4)-benzodiazepin-2(1H)-thi one (TIBO) show that all three inhibitors maintain a very similar conformational shape, roughly overlay each other in the binding pocket, and appear to function as pi-electron donors to aromatic side-chain residues surrounding the pocket. However, side-chain residues adapt to each bound inhibitor in a highly specific manner, closing down around the surface of the drug to make tight van der Waals contacts. Consequently, the results from the calculated minimizations reveal that only when the inhibitors are modeled in a site constructed from coordinate data obtained from their particular RT complex can the calculated binding energies be relied upon to predict the correct orientation of the drug in the pocket. In the correct site, these binding energies correlate with EC50 values determined for all three inhibitors in our laboratory. Analysis of the components of the binding energy reveals that, for all three inhibitors, solvation of the drug is endothermic, but solvation of the protein is exothermic, and the sum favors complex formation. In general, the protein is energetically more stable and the drug less stable in their complexes as compared to the reactant conformations. For all three inhibitors, interaction with the protein in the complex is highly favorable. Interactions of the inhibitors with individual residues correlate with crystallographic and site-specific mutational data. pi-Stacking interactions are important in binding and correlate with drug HOMO RHF/6-31G* energies. Modeling results are discussed with respect to the mechanism of complex formation and the design of nonnucleoside inhibitors that will be more effective against mutants of HIV-1 RT that are resistant to the currently available drugs. PMID:8535257

  12. Computational Exploration of a Protein Receptor Binding Space with Student Proposed Peptide Ligands

    ERIC Educational Resources Information Center

    King, Matthew D.; Phillips, Paul; Turner, Matthew W.; Katz, Michael; Lew, Sarah; Bradburn, Sarah; Andersen, Tim; McDougal, Owen M.

    2016-01-01

    Computational molecular docking is a fast and effective "in silico" method for the analysis of binding between a protein receptor model and a ligand. The visualization and manipulation of protein to ligand binding in three-dimensional space represents a powerful tool in the biochemistry curriculum to enhance student learning. The…

  13. Modeling Carbon and Hydrocarbon Molecular Structures in EZTB

    NASA Technical Reports Server (NTRS)

    Lee, Seungwon; vonAllmen, Paul

    2007-01-01

    A software module that models the electronic and mechanical aspects of hydrocarbon molecules and carbon molecular structures on the basis of first principles has been written for incorporation into, and execution within, the Easy (Modular) Tight-Binding (EZTB) software infrastructure, which is summarized briefly in the immediately preceding article. Of particular interest, this module can model carbon crystals and nanotubes characterized by various coordinates and containing defects, without need to adjust parameters of the physical model. The module has been used to study the changes in electronic properties of carbon nanotubes, caused by bending of the nanotubes, for potential utility as the basis of a nonvolatile, electriccharge- free memory devices. For example, in one application of the module, it was found that an initially 50-nmlong carbon, (10,10)-chirality nanotube, which is a metallic conductor when straight, becomes a semiconductor with an energy gap of .3 meV when bent to a lateral displacement of 4 nm at the middle.

  14. Two atoms in an anisotropic harmonic trap

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Idziaszek, Z.; Centrum Fizyki Teoretycznej, Polska Akademia Nauk, 02-668 Warsaw; Calarco, T.

    2005-05-15

    We consider the system of two interacting atoms confined in axially symmetric harmonic trap. Within the pseudopotential approximation, we solve the Schroedinger equation exactly, discussing the limits of quasi-one-and quasi-two-dimensional geometries. Finally, we discuss the application of an energy-dependent pseudopotential, which allows us to extend the validity of our results to the case of tight traps and large scattering lengths.

  15. In tight junctions, claudins regulate the interactions between occludin, tricellulin and marvelD3, which, inversely, modulate claudin oligomerization.

    PubMed

    Cording, Jimmi; Berg, Johanna; Käding, Nadja; Bellmann, Christian; Tscheik, Christian; Westphal, Julie K; Milatz, Susanne; Günzel, Dorothee; Wolburg, Hartwig; Piontek, Jörg; Huber, Otmar; Blasig, Ingolf Ernst

    2013-01-15

    Tight junctions seal the paracellular cleft of epithelia and endothelia, form vital barriers between tissue compartments and consist of tight-junction-associated marvel proteins (TAMPs) and claudins. The function of TAMPs and the interaction with claudins are not understood. We therefore investigated the binding between the TAMPs occludin, tricellulin, and marvelD3 and their interaction with claudins in living tight-junction-free human embryonic kidney-293 cells. In contrast to claudins and occludin, tricellulin and marvelD3 showed no enrichment at cell-cell contacts indicating lack of homophilic trans-interaction between two opposing cell membranes. However, occludin, marvelD3 and tricellulin exhibited homophilic cis-interactions, along one plasma membrane, as measured by fluorescence resonance energy transfer. MarvelD3 also cis-interacted with occludin and tricellulin heterophilically. Classic claudins, such as claudin-1 to -5 may show cis-oligomerization with TAMPs, whereas the non-classic claudin-11 did not. Claudin-1 and -5 improved enrichment of occludin and tricellulin at cell-cell contacts. The low mobile claudin-1 reduced the membrane mobility of the highly mobile occludin and tricellulin, as studied by fluorescence recovery after photobleaching. Co-transfection of claudin-1 with TAMPs led to changes of the tight junction strand network of this claudin to a more physiological morphology, depicted by freeze-fracture electron microscopy. The results demonstrate multilateral interactions between the tight junction proteins, in which claudins determine the function of TAMPs and vice versa, and provide deeper insights into the tight junction assembly.

  16. Non-classical photon correlation in a two-dimensional photonic lattice.

    PubMed

    Gao, Jun; Qiao, Lu-Feng; Lin, Xiao-Feng; Jiao, Zhi-Qiang; Feng, Zhen; Zhou, Zheng; Gao, Zhen-Wei; Xu, Xiao-Yun; Chen, Yuan; Tang, Hao; Jin, Xian-Min

    2016-06-13

    Quantum interference and quantum correlation, as two main features of quantum optics, play an essential role in quantum information applications, such as multi-particle quantum walk and boson sampling. While many experimental demonstrations have been done in one-dimensional waveguide arrays, it remains unexplored in higher dimensions due to tight requirement of manipulating and detecting photons in large-scale. Here, we experimentally observe non-classical correlation of two identical photons in a fully coupled two-dimensional structure, i.e. photonic lattice manufactured by three-dimensional femtosecond laser writing. Photon interference consists of 36 Hong-Ou-Mandel interference and 9 bunching. The overlap between measured and simulated distribution is up to 0.890 ± 0.001. Clear photon correlation is observed in the two-dimensional photonic lattice. Combining with controllably engineered disorder, our results open new perspectives towards large-scale implementation of quantum simulation on integrated photonic chips.

  17. Exciton size and binding energy limitations in one-dimensional organic materials

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kraner, S., E-mail: stefan.kraner@iapp.de; Koerner, C.; Leo, K.

    2015-12-28

    In current organic photovoltaic devices, the loss in energy caused by the charge transfer step necessary for exciton dissociation leads to a low open circuit voltage, being one of the main reasons for rather low power conversion efficiencies. A possible approach to avoid these losses is to tune the exciton binding energy to a value of the order of thermal energy, which would lead to free charges upon absorption of a photon, and therefore increase the power conversion efficiency towards the Shockley-Queisser limit. We determine the size of the excitons for different organic molecules and polymers by time dependent densitymore » functional theory calculations. For optically relevant transitions, the exciton size saturates around 0.7 nm for one-dimensional molecules with a size longer than about 4 nm. For the ladder-type polymer poly(benzimidazobenzophenanthroline), we obtain an exciton binding energy of about 0.3 eV, serving as a lower limit of the exciton binding energy for the organic materials investigated. Furthermore, we show that charge transfer transitions increase the exciton size and thus identify possible routes towards a further decrease of the exciton binding energy.« less

  18. Current's Fluctuations through Molecular Wires Composed of Thiophene Rings.

    PubMed

    Ojeda Silva, Judith Helena; Cortés Peñaranda, Juan Camilo; Gómez Castaño, Jovanny A; Duque, Carlos Alberto

    2018-04-11

    We study theoretically the electronic transport and quantum fluctuations in single-molecule systems using thiophene rings as integrated elementary functions, as well as the dependence of these properties with the increase of the coupled rings, i.e., as a quantum wire. In order to analyze the current flow through these molecular systems, the thiophene rings are considered to be connected to metal contacts, which, in general terms, will be related to the application of voltages (bias voltages or gate voltages) to generate non-equilibrium behavior between the contacts. Due to the nonlinear behavior that is generated when said voltages are applied, it is possible to observe quantum fluctuations in the transport properties of these molecular wires. For the calculation of the transport properties, we applied a tight-binding approach using the Landauer-Büttiker formalism and the Fischer-Lee relationship, by means of a semi-analytic Green's function method within a real-space renormalization (decimation procedure). Our results showed an excellent agreement with results using a tight-binding model with a minimal number of parameters reported so far for these molecular systems.

  19. Magnetic-flux-driven topological quantum phase transition and manipulation of perfect edge states in graphene tube.

    PubMed

    Lin, S; Zhang, G; Li, C; Song, Z

    2016-08-24

    We study the tight-binding model for a graphene tube with perimeter N threaded by a magnetic field. We show exactly that this model has different nontrivial topological phases as the flux changes. The winding number, as an indicator of topological quantum phase transition (QPT) fixes at N/3 if N/3 equals to its integer part [N/3], otherwise it jumps between [N/3] and [N/3] + 1 periodically as the flux varies a flux quantum. For an open tube with zigzag boundary condition, exact edge states are obtained. There exist two perfect midgap edge states, in which the particle is completely located at the boundary, even for a tube with finite length. The threading flux can be employed to control the quantum states: transferring the perfect edge state from one end to the other, or generating maximal entanglement between them.

  20. Origami rules for the construction of localized eigenstates of the Hubbard model in decorated lattices

    NASA Astrophysics Data System (ADS)

    Dias, R. G.; Gouveia, J. D.

    2015-11-01

    We present a method of construction of exact localized many-body eigenstates of the Hubbard model in decorated lattices, both for U = 0 and U → ∞. These states are localized in what concerns both hole and particle movement. The starting point of the method is the construction of a plaquette or a set of plaquettes with a higher symmetry than that of the whole lattice. Using a simple set of rules, the tight-binding localized state in such a plaquette can be divided, folded and unfolded to new plaquette geometries. This set of rules is also valid for the construction of a localized state for one hole in the U → ∞ limit of the same plaquette, assuming a spin configuration which is a uniform linear combination of all possible permutations of the set of spins in the plaquette.

  1. Band gap engineering in finite elongated graphene nanoribbon heterojunctions: Tight-binding model

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tayo, Benjamin O.

    2015-08-15

    A simple model based on the divide and conquer rule and tight-binding (TB) approximation is employed for studying the role of finite size effect on the electronic properties of elongated graphene nanoribbon (GNR) heterojunctions. In our model, the GNR heterojunction is divided into three parts: a left (L) part, middle (M) part, and right (R) part. The left part is a GNR of width W{sub L}, the middle part is a GNR of width W{sub M}, and the right part is a GNR of width W{sub R}. We assume that the left and right parts of the GNR heterojunction interactmore » with the middle part only. Under this approximation, the Hamiltonian of the system can be expressed as a block tridiagonal matrix. The matrix elements of the tridiagonal matrix are computed using real space nearest neighbor orthogonal TB approximation. The electronic structure of the GNR heterojunction is analyzed by computing the density of states. We demonstrate that for heterojunctions for which W{sub L} = W{sub R}, the band gap of the system can be tuned continuously by varying the length of the middle part, thus providing a new approach to band gap engineering in GNRs. Our TB results were compared with calculations employing divide and conquer rule in combination with density functional theory (DFT) and were found to agree nicely.« less

  2. Heterogeneous fluorescence intermittency in single layer reduced graphene oxide

    NASA Astrophysics Data System (ADS)

    Si, Jixin; Volkan-Kacso, Sandor; Eltom, Ahmed; Morozov, Yurii; McDonald, Matthew P.; Ruth, Anthony; Kuno, Masaru; Janko, Boldizsar

    Fluorescence intermittency, or blinking, has been observed in a wide range of systems, including quantum dots, nanorods, and nanowires. Striking similarities have been documented in the optical response of these nanoscale emitters. However, the mechanism behind blinking still remains elusive. For the first time, blinking has been observed in a two-dimensional system in recent experiments on reduced graphene oxide (rGO). Here we reveal the power spectral density (PSD) of the blinking in rGO shares the same 1/f-like behavior of previously known blinking systems; meanwhile, the heterogeneous dynamic evolution and spatial correlation make rGO a unique blinking system. To investigate the origin of blinking, we self-consistently explain the evolution of rGO blinking using the phenomenological multiple recombination center (MRC) model that captures common features of nanoscale blinking. Furthermore, tight binding method and ab-initio method calculations of carbon nanodots are utilized to look for the microscopic structure corresponding to the RCs in the MRC model. M. K. thanks the American Chemical Society Petroleum Research Fund, the Army Research Office (W911NF-12-1-0578) for support. B.J. was supported in part by the U. S. DOE, Office of Science, Office of Basic Energy Sciences, under Contract W-31-109-Eng-38.

  3. A small cellulose binding domain protein (CBD1) is highly variable in the nonbinding amino terminus

    USDA-ARS?s Scientific Manuscript database

    The small cellulose binding domain protein CBD1 is tightly bound to the cellulosic cell wall of the plant pathogenic stramenophile Phytophthora infestans. Transgene expression of the protein in plants has also demonstrated binding to plant cell walls. A study was undertaken using 47 isolates of P. ...

  4. Rationalizing Tight Ligand Binding through Cooperative Interaction Networks

    PubMed Central

    2011-01-01

    Small modifications of the molecular structure of a ligand sometimes cause strong gains in binding affinity to a protein target, rendering a weakly active chemical series suddenly attractive for further optimization. Our goal in this study is to better rationalize and predict the occurrence of such interaction hot-spots in receptor binding sites. To this end, we introduce two new concepts into the computational description of molecular recognition. First, we take a broader view of noncovalent interactions and describe protein–ligand binding with a comprehensive set of favorable and unfavorable contact types, including for example halogen bonding and orthogonal multipolar interactions. Second, we go beyond the commonly used pairwise additive treatment of atomic interactions and use a small world network approach to describe how interactions are modulated by their environment. This approach allows us to capture local cooperativity effects and considerably improves the performance of a newly derived empirical scoring function, ScorpionScore. More importantly, however, we demonstrate how an intuitive visualization of key intermolecular interactions, interaction networks, and binding hot-spots supports the identification and rationalization of tight ligand binding. PMID:22087588

  5. Trimeric structure of (+)-pinoresinol-forming dirigent protein at 1.95 Å resolution with three isolated active sites.

    PubMed

    Kim, Kye-Won; Smith, Clyde A; Daily, Michael D; Cort, John R; Davin, Laurence B; Lewis, Norman G

    2015-01-16

    Control over phenoxy radical-radical coupling reactions in vivo in vascular plants was enigmatic until our discovery of dirigent proteins (DPs, from the Latin dirigere, to guide or align). The first three-dimensional structure of a DP ((+)-pinoresinol-forming DP, 1.95 Å resolution, rhombohedral space group H32)) is reported herein. It has a tightly packed trimeric structure with an eight-stranded β-barrel topology for each DP monomer. Each putative substrate binding and orientation coupling site is located on the trimer surface but too far apart for intermolecular coupling between sites. It is proposed that each site enables stereoselective coupling (using either two coniferyl alcohol radicals or a radical and a monolignol). Interestingly, there are six differentially conserved residues in DPs affording either the (+)- or (-)-antipodes in the vicinity of the putative binding site and region known to control stereoselectivity. DPs are involved in lignan biosynthesis, whereas dirigent domains/sites have been implicated in lignin deposition. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  6. Crystal structure of coelenterazine-binding protein from Renilla muelleri at 1.7 A: why it is not a calcium-regulated photoprotein.

    PubMed

    Stepanyuk, Galina A; Liu, Zhi-Jie; Markova, Svetlana S; Frank, Ludmila A; Lee, John; Vysotski, Eugene S; Wang, Bi-Cheng

    2008-04-01

    Bioluminescence in the sea pansy Renilla involves two distinct proteins, a Ca2+-triggered coelenterazine-binding protein (CBP), and Renilla luciferase. CBP contains one tightly bound coelenterazine molecule, which becomes available for reaction with luciferase and O2 only subsequent to Ca2+ binding. CBP belongs to the EF-hand superfamily of Ca2+-binding proteins and contains three "EF-hand" Ca2+-binding sites. The overall spatial structure of recombinant selenomethionine-labeled CBP determined at 1.7 A, is found to approximate the protein scaffold characteristic of the class of Ca2+-regulated photoproteins. Photoproteins however, catalyze molecular oxygen addition to coelenterazine producing a 2-hydroperoxycoelenterazine intermediate, which is stabilized within the binding cavity in the absence of Ca2+. Addition of Ca2+ triggers the bioluminescence reaction. However in CBP this first step of oxygen addition is not allowed. The different amino acid environments and hydrogen bond interactions within the binding cavity, are proposed to account for the different properties of the two classes of proteins.

  7. MCM ring hexamerization is a prerequisite for DNA-binding

    DOE PAGES

    Froelich, Clifford A.; Nourse, Amanda; Enemark, Eric J.

    2015-09-13

    The hexameric Minichromosome Maintenance (MCM) protein complex forms a ring that unwinds DNA at the replication fork in eukaryotes and archaea. Our recent crystal structure of an archaeal MCM N-terminal domain bound to single-stranded DNA (ssDNA) revealed ssDNA associating across tight subunit interfaces but not at the loose interfaces, indicating that DNA-binding is governed not only by the DNA-binding residues of the subunits (MCM ssDNA-binding motif, MSSB) but also by the relative orientation of the subunits. We now extend these findings to show that DNA-binding by the MCM N-terminal domain of the archaeal organism Pyrococcus furiosus occurs specifically in themore » hexameric oligomeric form. We show that mutants defective for hexamerization are defective in binding ssDNA despite retaining all the residues observed to interact with ssDNA in the crystal structure. One mutation that exhibits severely defective hexamerization and ssDNA-binding is at a conserved phenylalanine that aligns with the mouse Mcm4(Chaos3) mutation associated with chromosomal instability, cancer, and decreased intersubunit association.« less

  8. Objective Molecular Dynamics with Self-consistent Charge Density Functional Tight-Binding (SCC-DFTB) Method

    NASA Astrophysics Data System (ADS)

    Dumitrica, Traian; Hourahine, Ben; Aradi, Balint; Frauenheim, Thomas

    We discus the coupling of the objective boundary conditions into the SCC density functional-based tight binding code DFTB+. The implementation is enabled by a generalization to the helical case of the classical Ewald method, specifically by Ewald-like formulas that do not rely on a unit cell with translational symmetry. The robustness of the method in addressing complex hetero-nuclear nano- and bio-fibrous systems is demonstrated with illustrative simulations on a helical boron nitride nanotube, a screw dislocated zinc oxide nanowire, and an ideal double-strand DNA. Work supported by NSF CMMI 1332228.

  9. Scattering matrix of arbitrary tight-binding Hamiltonians

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ramírez, C., E-mail: carlos@ciencias.unam.mx; Medina-Amayo, L.A.

    2017-03-15

    A novel efficient method to calculate the scattering matrix (SM) of arbitrary tight-binding Hamiltonians is proposed, including cases with multiterminal structures. In particular, the SM of two kinds of fundamental structures is given, which can be used to obtain the SM of bigger systems iteratively. Also, a procedure to obtain the SM of layer-composed periodic leads is described. This method allows renormalization approaches, which permits computations over macroscopic length systems without introducing additional approximations. Finally, the transmission coefficient of a ring-shaped multiterminal system and the transmission function of a square-lattice nanoribbon with a reduced width region are calculated.

  10. The Modified Hartmann Potential Effects on γ-rigid Bohr Hamiltonian

    NASA Astrophysics Data System (ADS)

    Suparmi, A.; Cari, C.; Nur Pratiwi, Beta

    2018-04-01

    In this paper, we present the solution of Bohr Hamiltonian in the case of γ-rigid for the modified Hartmann potential. The modified Hartmann potential was formed from the original Hartmann potential, consists of β function and θ function. By using the separation method, the three-dimensional Bohr Hamiltonian equation was reduced into three one-dimensional Schrodinger-like equation which was solved analytically. The results for the wavefunction were shown in mathematically, while for the binding energy was solved numerically. The numerical binding energy for the presence of the modified Hartmann potential is lower than the binding energy value in the absence of modified Hartmann potential effect.

  11. Identification of key residues for the binding of glucagon to the N-terminal domain of its receptor: an alanine scan and modeling study.

    PubMed

    Prévost, M; Vertongen, P; Waelbroeck, M

    2012-10-01

    Glucagon plays an essential role in the glycemia maintenance during fasting, but also aggravates hyperglycemia in diabetic patients. A series of analogues of glucagon were synthesized replacing each amino acid of the C-terminal region (residues 15-29) with alanine. The residues affecting the binding to the glucagon receptor are found to be located on one face of the glucagon helix. Several 3-dimensional models of the N-terminal domain of the glucagon receptor in complex with its ligand peptide were built and used to analyze the peptide-receptor interface in terms of the nature of the peptide residues and the interactions they form with the receptor. The models suggest that glucagon keeps its native helical structure upon binding, and that a large part of the interface formed with the receptor is hydrophobic. We find that in the C-terminal region, F22, V23, M27, and D15 are the most important residues for peptide binding. They bury a large portion of their solvent accessible surface area and make numerous interactions with the receptor mainly of the hydrophobic type. © Georg Thieme Verlag KG Stuttgart · New York.

  12. Carbon Nanotube Field Emission Arrays

    DTIC Science & Technology

    2011-06-01

    K , and M [14]. Using the tight binding energy model, the energy dispersion relations for graphene can be calculated for the triangle formed from...The corresponding reciprocal lattice vectors, b1 and b2, and Brillouin zone of graphene [14]. 19 graphene band structure is the six K ...points where the two bands are degenerate and the Fermi level passes. It has been shown through thorough calculations that at T = 0 K , the density

  13. Various Stone-Wales defects in phagraphene

    NASA Astrophysics Data System (ADS)

    Openov, L. A.; Podlivaev, A. I.

    2016-08-01

    Various Stone-Wales defects in phagraphene, which is a graphene allotrope, predicted recently are studied in terms of the nonorthogonal tight-binding model. The energies of the defect formation and the heights of energy barriers preventing the formation and annealing of the defects are found. Corresponding frequency factors in the Arrhenius formula are calculated. The evolution of the defect structure is studied in the real-time mode using the molecular dynamics method.

  14. Amino acid analogues bind to carbon nanotube via π-π interactions: Comparison of molecular mechanical and quantum mechanical calculations

    NASA Astrophysics Data System (ADS)

    Yang, Zaixing; Wang, Zhigang; Tian, Xingling; Xiu, Peng; Zhou, Ruhong

    2012-01-01

    Understanding the interaction between carbon nanotubes (CNTs) and biomolecules is essential to the CNT-based nanotechnology and biotechnology. Some recent experiments have suggested that the π-π stacking interactions between protein's aromatic residues and CNTs might play a key role in their binding, which raises interest in large scale modeling of protein-CNT complexes and associated π-π interactions at atomic detail. However, there is concern on the accuracy of classical fixed-charge molecular force fields due to their classical treatments and lack of polarizability. Here, we study the binding of three aromatic residue analogues (mimicking phenylalanine, tyrosine, and tryptophan) and benzene to a single-walled CNT, and compare the molecular mechanical (MM) calculations using three popular fixed-charge force fields (OPLSAA, AMBER, and CHARMM), with quantum mechanical (QM) calculations using the density-functional tight-binding method with the inclusion of dispersion correction (DFTB-D). Two typical configurations commonly found in π-π interactions are used, one with the aromatic rings parallel to the CNT surface (flat), and the other perpendicular (edge). Our calculations reveal that compared to the QM results the MM approaches can appropriately reproduce the strength of π-π interactions for both configurations, and more importantly, the energy difference between them, indicating that the various contributions to π-π interactions have been implicitly included in the van der Waals parameters of the standard MM force fields. Meanwhile, these MM models are less accurate in predicting the exact structural binding patterns (matching surface), meaning there are still rooms to be improved. In addition, we have provided a comprehensive and reliable QM picture for the π-π interactions of aromatic molecules with CNTs in gas phase, which might be used as a benchmark for future force field developments.

  15. Amino acid analogues bind to carbon nanotube via π-π interactions: comparison of molecular mechanical and quantum mechanical calculations.

    PubMed

    Yang, Zaixing; Wang, Zhigang; Tian, Xingling; Xiu, Peng; Zhou, Ruhong

    2012-01-14

    Understanding the interaction between carbon nanotubes (CNTs) and biomolecules is essential to the CNT-based nanotechnology and biotechnology. Some recent experiments have suggested that the π-π stacking interactions between protein's aromatic residues and CNTs might play a key role in their binding, which raises interest in large scale modeling of protein-CNT complexes and associated π-π interactions at atomic detail. However, there is concern on the accuracy of classical fixed-charge molecular force fields due to their classical treatments and lack of polarizability. Here, we study the binding of three aromatic residue analogues (mimicking phenylalanine, tyrosine, and tryptophan) and benzene to a single-walled CNT, and compare the molecular mechanical (MM) calculations using three popular fixed-charge force fields (OPLSAA, AMBER, and CHARMM), with quantum mechanical (QM) calculations using the density-functional tight-binding method with the inclusion of dispersion correction (DFTB-D). Two typical configurations commonly found in π-π interactions are used, one with the aromatic rings parallel to the CNT surface (flat), and the other perpendicular (edge). Our calculations reveal that compared to the QM results the MM approaches can appropriately reproduce the strength of π-π interactions for both configurations, and more importantly, the energy difference between them, indicating that the various contributions to π-π interactions have been implicitly included in the van der Waals parameters of the standard MM force fields. Meanwhile, these MM models are less accurate in predicting the exact structural binding patterns (matching surface), meaning there are still rooms to be improved. In addition, we have provided a comprehensive and reliable QM picture for the π-π interactions of aromatic molecules with CNTs in gas phase, which might be used as a benchmark for future force field developments.

  16. Single-molecule FRET studies of the cooperative and non-cooperative binding kinetics of the bacteriophage T4 single-stranded DNA binding protein (gp32) to ssDNA lattices at replication fork junctions

    PubMed Central

    Lee, Wonbae; Gillies, John P.; Jose, Davis; Israels, Brett A.; von Hippel, Peter H.; Marcus, Andrew H.

    2016-01-01

    Gene 32 protein (gp32) is the single-stranded (ss) DNA binding protein of the bacteriophage T4. It binds transiently and cooperatively to ssDNA sequences exposed during the DNA replication process and regulates the interactions of the other sub-assemblies of the replication complex during the replication cycle. We here use single-molecule FRET techniques to build on previous thermodynamic studies of gp32 binding to initiate studies of the dynamics of the isolated and cooperative binding of gp32 molecules within the replication complex. DNA primer/template (p/t) constructs are used as models to determine the effects of ssDNA lattice length, gp32 concentration, salt concentration, binding cooperativity and binding polarity at p/t junctions. Hidden Markov models (HMMs) and transition density plots (TDPs) are used to characterize the dynamics of the multi-step assembly pathway of gp32 at p/t junctions of differing polarity, and show that isolated gp32 molecules bind to their ssDNA targets weakly and dissociate quickly, while cooperatively bound dimeric or trimeric clusters of gp32 bind much more tightly, can ‘slide’ on ssDNA sequences, and exhibit binding dynamics that depend on p/t junction polarities. The potential relationships of these binding dynamics to interactions with other components of the T4 DNA replication complex are discussed. PMID:27694621

  17. Low-dimensional manifold of actin polymerization dynamics

    NASA Astrophysics Data System (ADS)

    Floyd, Carlos; Jarzynski, Christopher; Papoian, Garegin

    2017-12-01

    Actin filaments are critical components of the eukaryotic cytoskeleton, playing important roles in a number of cellular functions, such as cell migration, organelle transport, and mechanosensation. They are helical polymers with a well-defined polarity, composed of globular subunits that bind nucleotides in one of three hydrolysis states (ATP, ADP-Pi, or ADP). Mean-field models of the dynamics of actin polymerization have succeeded in, among other things, determining the nucleotide profile of an average filament and resolving the mechanisms of accessory proteins. However, these models require numerical solution of a high-dimensional system of nonlinear ordinary differential equations. By truncating a set of recursion equations, the Brooks-Carlsson (BC) model reduces dimensionality to 11, but it still remains nonlinear and does not admit an analytical solution, hence, significantly hindering understanding of its resulting dynamics. In this work, by taking advantage of the fast timescales of the hydrolysis states of the filament tips, we propose two model reduction schemes: the quasi steady-state approximation model is five-dimensional and nonlinear, whereas the constant tip (CT) model is five-dimensional and linear, resulting from the approximation that the tip states are not dynamic variables. We provide an exact solution of the CT model and use it to shed light on the dynamical behaviors of the full BC model, highlighting the relative ordering of the timescales of various collective processes, and explaining some unusual dependence of the steady-state behavior on initial conditions.

  18. cis-trans Germanium chains in the intermetallic compounds ALi{sub 1-x}In{sub x}Ge{sub 2} and A{sub 2}(Li{sub 1-x}In{sub x}){sub 2}Ge{sub 3} (A=Sr, Ba, Eu)-experimental and theoretical studies

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    You, Tae-Soo; Bobev, Svilen, E-mail: bobev@udel.ed

    Two types of strontium-, barium- and europium-containing germanides have been synthesized using high temperature reactions and characterized by single-crystal X-ray diffraction. All reported compounds also contain mixed-occupied Li and In atoms, resulting in quaternary phases with narrow homogeneity ranges. The first type comprises EuLi{sub 0.91(1)}In{sub 0.09}Ge{sub 2}, SrLi{sub 0.95(1)}In{sub 0.05}Ge{sub 2} and BaLi{sub 0.99(1)}In{sub 0.01}Ge{sub 2}, which crystallize in the orthorhombic space group Pnma (BaLi{sub 0.9}Mg{sub 0.1}Si{sub 2} structure type, Pearson code oP16). The lattice parameters are a=7.129(4)-7.405(4) A; b=4.426(3)-4.638(2) A; and c=11.462(7)-11.872(6) A. The second type includes Eu{sub 2}Li{sub 1.36(1)}In{sub 0.64}Ge{sub 3} and Sr{sub 2}Li{sub 1.45(1)}In{sub 0.55}Ge{sub 3}, whichmore » adopt the orthorhombic space group Cmcm (Ce{sub 2}Li{sub 2}Ge{sub 3} structure type, Pearson code oC28) with lattice parameters a=4.534(2)-4.618(2) A; b=19.347(8)-19.685(9) A; and c=7.164(3)-7.260(3) A. The polyanionic sub-structures in both cases feature one-dimensional Ge chains with alternating Ge-Ge bonds in cis- and trans-conformation. Theoretical studies using the tight-binding linear muffin-tin orbital (LMTO) method provide the rationale for optimizing the overall bonding by diminishing the {pi}-p delocalization along the Ge chains, accounting for the experimentally confirmed substitution of Li forIn. -- Graphical abstract: Presented are the single-crystal structures of two types of closely related intermetallics, as well as their band structures, calculated using tight-binding linear muffin-tin orbital (TB-LMTO-ASA) method. Display Omitted« less

  19. Linear Scaling of the Exciton Binding Energy versus the Band Gap of Two-Dimensional Materials

    NASA Astrophysics Data System (ADS)

    Choi, Jin-Ho; Cui, Ping; Lan, Haiping; Zhang, Zhenyu

    2015-08-01

    The exciton is one of the most crucial physical entities in the performance of optoelectronic and photonic devices, and widely varying exciton binding energies have been reported in different classes of materials. Using first-principles calculations within the G W -Bethe-Salpeter equation approach, here we investigate the excitonic properties of two recently discovered layered materials: phosphorene and graphene fluoride. We first confirm large exciton binding energies of, respectively, 0.85 and 2.03 eV in these systems. Next, by comparing these systems with several other representative two-dimensional materials, we discover a striking linear relationship between the exciton binding energy and the band gap and interpret the existence of the linear scaling law within a simple hydrogenic picture. The broad applicability of this novel scaling law is further demonstrated by using strained graphene fluoride. These findings are expected to stimulate related studies in higher and lower dimensions, potentially resulting in a deeper understanding of excitonic effects in materials of all dimensionalities.

  20. Synergistic effects of ATP and RNA binding to human DEAD-box protein DDX1.

    PubMed

    Kellner, Julian N; Reinstein, Jochen; Meinhart, Anton

    2015-03-11

    RNA helicases of the DEAD-box protein family form the largest group of helicases. The human DEAD-box protein 1 (DDX1) plays an important role in tRNA and mRNA processing, is involved in tumor progression and is also hijacked by several virus families such as HIV-1 for replication and nuclear export. Although important in many cellular processes, the mechanism of DDX1's enzymatic function is unknown. We have performed equilibrium titrations and transient kinetics to determine affinities for nucleotides and RNA. We find an exceptional tight binding of DDX1 to adenosine diphosphate (ADP), one of the strongest affinities observed for DEAD-box helicases. ADP binds tighter by three orders of magnitude when compared to adenosine triphosphate (ATP), arresting the enzyme in a potential dead-end ADP conformation under physiological conditions. We thus suggest that a nucleotide exchange factor leads to DDX1 recycling. Furthermore, we find a strong cooperativity in binding of RNA and ATP to DDX1 that is also reflected in ATP hydrolysis. We present a model in which either ATP or RNA binding alone can partially shift the equilibrium from an 'open' to a 'closed'-state; this shift appears to be not further pronounced substantially even in the presence of both RNA and ATP as the low rate of ATP hydrolysis does not change. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  1. Prediction of Carbohydrate Binding Sites on Protein Surfaces with 3-Dimensional Probability Density Distributions of Interacting Atoms

    PubMed Central

    Tsai, Keng-Chang; Jian, Jhih-Wei; Yang, Ei-Wen; Hsu, Po-Chiang; Peng, Hung-Pin; Chen, Ching-Tai; Chen, Jun-Bo; Chang, Jeng-Yih; Hsu, Wen-Lian; Yang, An-Suei

    2012-01-01

    Non-covalent protein-carbohydrate interactions mediate molecular targeting in many biological processes. Prediction of non-covalent carbohydrate binding sites on protein surfaces not only provides insights into the functions of the query proteins; information on key carbohydrate-binding residues could suggest site-directed mutagenesis experiments, design therapeutics targeting carbohydrate-binding proteins, and provide guidance in engineering protein-carbohydrate interactions. In this work, we show that non-covalent carbohydrate binding sites on protein surfaces can be predicted with relatively high accuracy when the query protein structures are known. The prediction capabilities were based on a novel encoding scheme of the three-dimensional probability density maps describing the distributions of 36 non-covalent interacting atom types around protein surfaces. One machine learning model was trained for each of the 30 protein atom types. The machine learning algorithms predicted tentative carbohydrate binding sites on query proteins by recognizing the characteristic interacting atom distribution patterns specific for carbohydrate binding sites from known protein structures. The prediction results for all protein atom types were integrated into surface patches as tentative carbohydrate binding sites based on normalized prediction confidence level. The prediction capabilities of the predictors were benchmarked by a 10-fold cross validation on 497 non-redundant proteins with known carbohydrate binding sites. The predictors were further tested on an independent test set with 108 proteins. The residue-based Matthews correlation coefficient (MCC) for the independent test was 0.45, with prediction precision and sensitivity (or recall) of 0.45 and 0.49 respectively. In addition, 111 unbound carbohydrate-binding protein structures for which the structures were determined in the absence of the carbohydrate ligands were predicted with the trained predictors. The overall prediction MCC was 0.49. Independent tests on anti-carbohydrate antibodies showed that the carbohydrate antigen binding sites were predicted with comparable accuracy. These results demonstrate that the predictors are among the best in carbohydrate binding site predictions to date. PMID:22848404

  2. Molecular determinants of ligand binding modes in the histamine H(4) receptor: linking ligand-based three-dimensional quantitative structure-activity relationship (3D-QSAR) models to in silico guided receptor mutagenesis studies.

    PubMed

    Istyastono, Enade P; Nijmeijer, Saskia; Lim, Herman D; van de Stolpe, Andrea; Roumen, Luc; Kooistra, Albert J; Vischer, Henry F; de Esch, Iwan J P; Leurs, Rob; de Graaf, Chris

    2011-12-08

    The histamine H(4) receptor (H(4)R) is a G protein-coupled receptor (GPCR) that plays an important role in inflammation. Similar to the homologous histamine H(3) receptor (H(3)R), two acidic residues in the H(4)R binding pocket, D(3.32) and E(5.46), act as essential hydrogen bond acceptors of positively ionizable hydrogen bond donors in H(4)R ligands. Given the symmetric distribution of these complementary pharmacophore features in H(4)R and its ligands, different alternative ligand binding mode hypotheses have been proposed. The current study focuses on the elucidation of the molecular determinants of H(4)R-ligand binding modes by combining (3D) quantitative structure-activity relationship (QSAR), protein homology modeling, molecular dynamics simulations, and site-directed mutagenesis studies. We have designed and synthesized a series of clobenpropit (N-(4-chlorobenzyl)-S-[3-(4(5)-imidazolyl)propyl]isothiourea) derivatives to investigate H(4)R-ligand interactions and ligand binding orientations. Interestingly, our studies indicate that clobenpropit (2) itself can bind to H(4)R in two distinct binding modes, while the addition of a cyclohexyl group to the clobenpropit isothiourea moiety allows VUF5228 (5) to adopt only one specific binding mode in the H(4)R binding pocket. Our ligand-steered, experimentally supported protein modeling method gives new insights into ligand recognition by H(4)R and can be used as a general approach to elucidate the structure of protein-ligand complexes.

  3. Spectroscopic properties and STM images of carbon nanotubes

    NASA Astrophysics Data System (ADS)

    Rubio, A.

    We present a theoretical study of the role of the local environment in the electronic properties of carbon nanotubes: isolated single- and multi-wall nanotubes, nanotube ropes, tubes supported on gold and cut to finite length. Interaction with the substrate or with other tubes does not alter the scanning tunneling microscopy patterns (STM) observed for isolated tubes. A finite-length nanotube shows standing-wave patterns that can be completely characterized by a set of four different three-dimensional shapes. These patterns are understood in terms of a simple π-electron tight-binding (TB) model. STM-topographic images of topological defects ani (pentagon/heptagon pair) and tube caps have also been studied. In both cases the image obtained depends on the sign of the applied voltage and can be described in terms of the previous catalog of STM images (interference between electronic waves scattered by the defect). We have also computed the electronic density of states for isolated tubes with different chiralities and radii, confirming a correlation between the peak structure in the DOS and nanotube diameter. However, the metallic plateau in the DOS also depends on the nanotube chirality. Furthermore the conduction an valence band structures are not fully symmetrical to one another. This anisotropy shows up in the DOS and indicates the limitations of the π-TB model in describing spectroscopic data. In contrast to STM images, here the interaction with the substrate does modify the energy levels of the nanotube. We observe opening of small pseudogaps around the Fermi level and broadening of the sharp van Hove singularities of the isolated single-walled nanotubes that can be used to extract useful information about the tube structure and bonding. The combination of STM and spectroscopic studies provides a new way to address the electronic and structural properties of carbon and composite nanotubes.

  4. Genome-wide overlap in the binding location and function of chromatin-remodeling proteins | Center for Cancer Research

    Cancer.gov

    A single strand of DNA can stretch several meters. Yet dozens of these strands, which can be one-tenth as thin as a human hair, need to fit into the cell’s nucleus. To pack those strands into such a small space, DNA tightly winds itself around histone proteins, forming nucleosomes that are strung together into complexes called chromatin. Beyond efficiently packaging DNA,

  5. First-Principles Study on the Gilbert Damping Constants of Transition Metal Alloys, Fe--Ni and Fe--Pt Systems

    NASA Astrophysics Data System (ADS)

    Sakuma, Akimasa

    2012-08-01

    We adapt the tight-binding linear muffin-tin orbital (TB-LMTO) method to the torque-correlation model for the Gilbert damping constant α and perform the first-principles calculation for disordered transition metal alloys, Fe--Ni and Fe--Pt systems, within the framework of the CPA. Quantitatively, the calculated α values are about one-half of the experimental values, whereas the variations in the Fermi level dependence of α are much larger than these discrepancies. As expected, we confirm in the (Fe--Ni)1-XPtX and FePt systems that Pt atoms certainly enhance α owing to their large spin--orbit coupling. For the disordered alloys, we find that α decreases with increasing chemical degree of order in a wide range.

  6. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kuechler, Erich R.; Department of Chemistry, University of Minnesota, Minneapolis, Minnesota 55455-0431; Giese, Timothy J.

    To better represent the solvation effects observed along reaction pathways, and of ionic species in general, a charge-dependent variable-radii smooth conductor-like screening model (VR-SCOSMO) is developed. This model is implemented and parameterized with a third order density-functional tight binding quantum model, DFTB3/3OB-OPhyd, a quantum method which was developed for organic and biological compounds, utilizing a specific parameterization for phosphate hydrolysis reactions. Unlike most other applications with the DFTB3/3OB model, an auxiliary set of atomic multipoles is constructed from the underlying DFTB3 density matrix which is used to interact the solute with the solvent response surface. The resulting method is variational,more » produces smooth energies, and has analytic gradients. As a baseline, a conventional SCOSMO model with fixed radii is also parameterized. The SCOSMO and VR-SCOSMO models shown have comparable accuracy in reproducing neutral-molecule absolute solvation free energies; however, the VR-SCOSMO model is shown to reduce the mean unsigned errors (MUEs) of ionic compounds by half (about 2-3 kcal/mol). The VR-SCOSMO model presents similar accuracy as a charge-dependent Poisson-Boltzmann model introduced by Hou et al. [J. Chem. Theory Comput. 6, 2303 (2010)]. VR-SCOSMO is then used to examine the hydrolysis of trimethylphosphate and seven other phosphoryl transesterification reactions with different leaving groups. Two-dimensional energy landscapes are constructed for these reactions and calculated barriers are compared to those obtained from ab initio polarizable continuum calculations and experiment. Results of the VR-SCOSMO model are in good agreement in both cases, capturing the rate-limiting reaction barrier and the nature of the transition state.« less

  7. Three-dimensional quantitative structure-activity relationship modeling of cocaine binding by a novel human monoclonal antibody.

    PubMed

    Paula, Stefan; Tabet, Michael R; Farr, Carol D; Norman, Andrew B; Ball, W James

    2004-01-01

    Human monoclonal antibodies (mAbs) designed for immunotherapy have a high potential for avoiding the complications that may result from human immune system responses to the introduction of nonhuman mAbs into patients. This study presents a characterization of cocaine/antibody interactions that determine the binding properties of the novel human sequence mAb 2E2 using three-dimensional quantitative structure-activity relationship (3D-QSAR) methodology. We have experimentally determined the binding affinities of mAb 2E2 for cocaine and 38 cocaine analogues. The K(d) of mAb 2E2 for cocaine was 4 nM, indicating a high affinity. Also, mAb 2E2 displayed good cocaine specificity, as reflected in its 10-, 1500-, and 25000-fold lower binding affinities for the three physiologically relevant cocaine metabolites benzoylecgonine, ecgonine methyl ester, and ecgonine, respectively. 3D-QSAR models of cocaine binding were developed by comparative molecular similarity index analysis (CoMSIA). A model of high statistical quality was generated showing that cocaine binds to mAb 2E2 in a sterically restricted binding site that leaves the methyl group attached to the ring nitrogen of cocaine solvent-exposed. The methyl ester group of cocaine appears to engage in attractive van der Waals interactions with mAb 2E2, whereas the phenyl group contributes to the binding primarily via hydrophobic interactions. The model further indicated that an increase in partial positive charge near the nitrogen proton and methyl ester carbonyl group enhances binding affinity and that the ester oxygen likely forms an intermolecular hydrogen bond with mAb 2E2. Overall, the cocaine binding properties of mAb 2E2 support its clinical potential for development as a treatment of cocaine overdose and addiction.

  8. Control of the Ability of Profilin to Bind and Facilitate Nucleotide Exchange from G-actin*

    PubMed Central

    Wen, Kuo-Kuang; McKane, Melissa; Houtman, Jon C. D.; Rubenstein, Peter A.

    2008-01-01

    A major factor in profilin regulation of actin cytoskeletal dynamics is its facilitation of G-actin nucleotide exchange. However, the mechanism of this facilitation is unknown. We studied the interaction of yeast (YPF) and human profilin 1 (HPF1) with yeast and mammalian skeletal muscle actins. Homologous pairs (YPF and yeast actin, HPF1 and muscle actin) bound more tightly to one another than heterologous pairs. However, with saturating profilin, HPF1 caused a faster etheno-ATP exchange with both yeast and muscle actins than did YPF. Based on the -fold change in ATP exchange rate/Kd, however, the homologous pairs are more efficient than the heterologous pairs. Thus, strength of binding of profilin to actin and nucleotide exchange rate are not tightly coupled. Actin/HPF interactions were entropically driven, whereas YPF interactions were enthalpically driven. Hybrid yeast actins containing subdomain 1 (sub1) or subdomain 1 and 2 (sub12) muscle actin residues bound more weakly to YPF than did yeast actin (Kd = 2 μm versus 0.6 μm). These hybrids bound even more weakly to HPF than did yeast actin (Kd = 5 μm versus 3.2 μm). sub1/YPF interactions were entropically driven, whereas the sub12/YPF binding was enthalpically driven. Compared with WT yeast actin, YPF binding to sub1 occurred with a 5 times faster koff and a 2 times faster kon. sub12 bound with a 3 times faster koff and a 1.5 times slower kon. Profilin controls the energetics of its interaction with nonhybrid actin, but interactions between actin subdomains 1 and 2 affect the topography of the profilin binding site. PMID:18223293

  9. DOS cones along atomic chains

    NASA Astrophysics Data System (ADS)

    Kwapiński, Tomasz

    2017-03-01

    The electron transport properties of a linear atomic chain are studied theoretically within the tight-binding Hamiltonian and the Green’s function method. Variations of the local density of states (DOS) along the chain are investigated. They are crucial in scanning tunnelling experiments and give important insight into the electron transport mechanism and charge distribution inside chains. It is found that depending on the chain parity the local DOS at the Fermi level can form cone-like structures (DOS cones) along the chain. The general condition for the local DOS oscillations is obtained and the linear behaviour of the local density function is confirmed analytically. DOS cones are characterized by a linear decay towards the chain which is in contrast to the propagation properties of charge density waves, end states and Friedel oscillations in one-dimensional systems. We find that DOS cones can appear due to non-resonant electron transport, the spin-orbit scattering or for chains fabricated on a substrate with localized electrons. It is also shown that for imperfect chains (e.g. with a reduced coupling strength between two neighboring sites) a diamond-like structure of the local DOS along the chain appears.

  10. Interface Schottky barrier engineering via strain in metal-semiconductor composites

    NASA Astrophysics Data System (ADS)

    Ma, Xiangchao; Dai, Ying; Yu, Lin; Huang, Baibiao

    2016-01-01

    The interfacial carrier transfer property, which is dominated by the interface Schottky barrier height (SBH), plays a crucial role in determining the performance of metal-semiconductor heterostructures in a variety of applications. Therefore, artificially controlling the interface SBH is of great importance for their industrial applications. As a model system, the Au/TiO2 (001) heterostructure is studied using first-principles calculations and the tight-binding method in the present study. Our investigation demonstrates that strain can be an effective way to decrease the interface SBH and that the n-type SBH can be more effectively decreased than the p-type SBH. Astonishingly, strain affects the interface SBH mainly by changing the intrinsic properties of Au and TiO2, whereas the interfacial potential alignment is almost independent of strain due to two opposite effects, which are induced by strain at the interfacial region. These observed trends can be understood on the basis of the general free-electron gas model of typical metals, the tight-binding theory and the crystal-field theory, which suggest that similar trends may be generalized for many other metal-semiconductor heterostructures. Given the commonness and tunability of strain in typical heterostructures, we anticipate that the tunability of the interface SBH with strain described here can provide an alternative effective way for realizing more efficient applications of relevant heterostructures.The interfacial carrier transfer property, which is dominated by the interface Schottky barrier height (SBH), plays a crucial role in determining the performance of metal-semiconductor heterostructures in a variety of applications. Therefore, artificially controlling the interface SBH is of great importance for their industrial applications. As a model system, the Au/TiO2 (001) heterostructure is studied using first-principles calculations and the tight-binding method in the present study. Our investigation demonstrates that strain can be an effective way to decrease the interface SBH and that the n-type SBH can be more effectively decreased than the p-type SBH. Astonishingly, strain affects the interface SBH mainly by changing the intrinsic properties of Au and TiO2, whereas the interfacial potential alignment is almost independent of strain due to two opposite effects, which are induced by strain at the interfacial region. These observed trends can be understood on the basis of the general free-electron gas model of typical metals, the tight-binding theory and the crystal-field theory, which suggest that similar trends may be generalized for many other metal-semiconductor heterostructures. Given the commonness and tunability of strain in typical heterostructures, we anticipate that the tunability of the interface SBH with strain described here can provide an alternative effective way for realizing more efficient applications of relevant heterostructures. Electronic supplementary information (ESI) available: The changes of Au 5d DOS, valence bands of TiO2, the interfacial bond length and interfacial energy with strain, and the local DOS results for the change of SBH with strain. See DOI: 10.1039/c5nr05583k

  11. Design of graphene nanoparticle undergoing axial compression: quantum study

    NASA Astrophysics Data System (ADS)

    Glukhova, O. E.; Kirillova, I. V.; Saliy, I. N.; Kolesnikova, A. S.; Slepchenkov, M. M.

    2011-03-01

    We report the results of quantum mechanical investigations of the atomic structure and deformations of graphene nanoparticle undergoing axial compression. We applied the tight-binding (TB) method. Our transferable tightbinding potential correctly reproduced tight-binding changes in the electronic configuration as a function of the local bonding geometry around each carbon atom. The tight-binding method applied provided the consideration and calculation of the rehybridization between σ- and π-orbitals. To research nanoribbons using tight-binding potential our own program was used. We adapted TB method to be able to run the algorithm on a parallel computing machine (computer cluster). To simulate axial compression of graphene nanoparticles the atoms on the ends were fixed on the plates. The plates were moved towards each other to decrease the length at some percent. Plane atomic network undergoing axial compression became wave-like. The amplitude of wave and its period were not constant and changed along axis. This is a phase transition. The strain energy collapse occurs at the value of axial compression 0.03-0.04. The strain energy increased up to the quantity compression 0.03, then collapsed sharply and decreased. So according to our theoretical investigation, the elasticity of graphene nanoparticles is more than the elasticity of nanotubes the same width and length. The curvature of the atomic network because of compression will decrease the reactivity of graphene nanoparticles. We have calculated the atomic structure and electronic structure of the compression graphene nanopaticle at each step of strain of axial compression. We have come to the conclusion that the wave-like graphenes adsorbing protein and nucleic acid are the effective nanosensors and bionanosensors.

  12. Effective Hamiltonian for protected edge states in graphene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Winkler, R.; Deshpande, H.

    Edge states in topological insulators (TIs) disperse symmetrically about one of the time-reversal invariant momenta Λ in the Brillouin zone (BZ) with protected degeneracies at Λ. Commonly TIs are distinguished from trivial insulators by the values of one or multiple topological invariants that require an analysis of the bulk band structure across the BZ. We propose an effective two-band Hamiltonian for the electronic states in graphene based on a Taylor expansion of the tight-binding Hamiltonian about the time-reversal invariant M point at the edge of the BZ. This Hamiltonian provides a faithful description of the protected edge states for bothmore » zigzag and armchair ribbons, though the concept of a BZ is not part of such an effective model. In conclusion, we show that the edge states are determined by a band inversion in both reciprocal and real space, which allows one to select Λ for the edge states without affecting the bulk spectrum.« less

  13. Effective Hamiltonian for protected edge states in graphene

    DOE PAGES

    Winkler, R.; Deshpande, H.

    2017-06-15

    Edge states in topological insulators (TIs) disperse symmetrically about one of the time-reversal invariant momenta Λ in the Brillouin zone (BZ) with protected degeneracies at Λ. Commonly TIs are distinguished from trivial insulators by the values of one or multiple topological invariants that require an analysis of the bulk band structure across the BZ. We propose an effective two-band Hamiltonian for the electronic states in graphene based on a Taylor expansion of the tight-binding Hamiltonian about the time-reversal invariant M point at the edge of the BZ. This Hamiltonian provides a faithful description of the protected edge states for bothmore » zigzag and armchair ribbons, though the concept of a BZ is not part of such an effective model. In conclusion, we show that the edge states are determined by a band inversion in both reciprocal and real space, which allows one to select Λ for the edge states without affecting the bulk spectrum.« less

  14. Spin filter for arbitrary spins by substrate engineering

    NASA Astrophysics Data System (ADS)

    Pal, Biplab; Römer, Rudolf A.; Chakrabarti, Arunava

    2016-08-01

    We design spin filters for particles with potentially arbitrary spin S≤ft(=1/2,1,3/2,\\ldots \\right) using a one-dimensional periodic chain of magnetic atoms as a quantum device. Describing the system within a tight-binding formalism we present an analytical method to unravel the analogy between a one-dimensional magnetic chain and a multi-strand ladder network. This analogy is crucial, and is subsequently exploited to engineer gaps in the energy spectrum by an appropriate choice of the magnetic substrate. We obtain an exact correlation between the magnitude of the spin of the incoming beam of particles and the magnetic moment of the substrate atoms in the chain desired for opening up of a spectral gap. Results of spin polarized transport, calculated within a transfer matrix formalism, are presented for particles having half-integer as well as higher spin states. We find that the chain can be made to act as a quantum device which opens a transmission window only for selected spin components over certain ranges of the Fermi energy, blocking them in the remaining part of the spectrum. The results appear to be robust even when the choice of the substrate atoms deviates substantially from the ideal situation, as verified by extending the ideas to the case of a ‘spin spiral’. Interestingly, the spin spiral geometry, apart from exhibiting the filtering effect, is also seen to act as a device flipping spins—an effect that can be monitored by an interplay of the system size and the period of the spiral. Our scheme is applicable to ultracold quantum gases, and might inspire future experiments in this direction.

  15. The Design and Analysis of the Hydraulic-pressure Seal of the Engine Box

    NASA Astrophysics Data System (ADS)

    Chen, Zhenya; Shen, Xingquan; Xin, Zhijie; Guo, Tingting; Liao, Kewei

    2017-12-01

    According to the sealing requirements of engine casing, using NX software to establish three-dimensional solid model of the engine box. Designing two seals suppress schemes basing on analyzing the characteristics of the case structure, one of seal is using two pins on one side to localize, the other is using cylinder to top tight and fasten, Clarifying the reasons for the using the former scheme have a lower cost. At the same time analysesing of the forces and deformation of the former scheme using finite element analysis software and the NX software, results proved that the pressure scheme can meet the actual needs of the program. It illustrated the composition of the basic principles of manual pressure and hydraulic system, verifed the feasibility of the seal program using experiment, providing reference for the experimental program of hydrostatic pressure in the future.

  16. A mathematical model of the mevalonate cholesterol biosynthesis pathway.

    PubMed

    Pool, Frances; Currie, Richard; Sweby, Peter K; Salazar, José Domingo; Tindall, Marcus J

    2018-04-14

    We formulate, parameterise and analyse a mathematical model of the mevalonate pathway, a key pathway in the synthesis of cholesterol. Of high clinical importance, the pathway incorporates rate limiting enzymatic reactions with multiple negative feedbacks. In this work we investigate the pathway dynamics and demonstrate that rate limiting steps and negative feedbacks within it act in concert to tightly regulate intracellular cholesterol levels. Formulated using the theory of nonlinear ordinary differential equations and parameterised in the context of a hepatocyte, the governing equations are analysed numerically and analytically. Sensitivity and mathematical analysis demonstrate the importance of the two rate limiting enzymes 3-hydroxy-3-methylglutaryl-CoA reductase and squalene synthase in controlling the concentration of substrates within the pathway as well as that of cholesterol. The role of individual feedbacks, both global (between that of cholesterol and sterol regulatory element-binding protein 2; SREBP-2) and local internal (between substrates in the pathway) are investigated. We find that whilst the cholesterol SREBP-2 feedback regulates the overall system dynamics, local feedbacks activate within the pathway to tightly regulate the overall cellular cholesterol concentration. The network stability is analysed by constructing a reduced model of the full pathway and is shown to exhibit one real, stable steady-state. We close by addressing the biological question as to how farnesyl-PP levels are affected by CYP51 inhibition, and demonstrate that the regulatory mechanisms within the network work in unison to ensure they remain bounded. Copyright © 2018 Elsevier Ltd. All rights reserved.

  17. Using a model comparison approach to describe the assembly pathway for histone H1

    PubMed Central

    Contreras, Carlos; Villasana, Minaya; Hendzel, Michael J.

    2018-01-01

    Histones H1 or linker histones are highly dynamic proteins that diffuse throughout the cell nucleus and associate with chromatin (DNA and associated proteins). This binding interaction of histone H1 with the chromatin is thought to regulate chromatin organization and DNA accessibility to transcription factors and has been proven to involve a kinetic process characterized by a population that associates weakly with chromatin and rapidly dissociates and another population that resides at a binding site for up to several minutes before dissociating. When considering differences between these two classes of interactions in a mathematical model for the purpose of describing and quantifying the dynamics of histone H1, it becomes apparent that there could be several assembly pathways that explain the kinetic data obtained in living cells. In this work, we model these different pathways using systems of reaction-diffusion equations and carry out a model comparison analysis using FRAP (fluorescence recovery after photobleaching) experimental data from different histone H1 variants to determine the most feasible mechanism to explain histone H1 binding to chromatin. The analysis favors four different chromatin assembly pathways for histone H1 which share common features and provide meaningful biological information on histone H1 dynamics. We show, using perturbation analysis, that the explicit consideration of high- and low-affinity associations of histone H1 with chromatin in the favored assembly pathways improves the interpretation of histone H1 experimental FRAP data. To illustrate the results, we use one of the favored models to assess the kinetic changes of histone H1 after core histone hyperacetylation, and conclude that this post-transcriptional modification does not affect significantly the transition of histone H1 from a weakly bound state to a tightly bound state. PMID:29352283

  18. CD70 is downregulated by interaction with CD27

    PubMed Central

    Kuka, Mirela; Munitic, Ivana; Torchia, Maria Letizia Giardino; Ashwell, Jonathan D.

    2013-01-01

    Engagement of the receptor CD27 by CD70 affects the magnitude and quality of T cell responses in a variety of infection models, and exaggerated signaling via this pathway results in enhanced immune responses and autoimmunity. One means by which signaling is regulated is tight control of cell surface CD70, which is expressed on dendritic, T, and B cells only upon activation. Here we show that there is a second level of regulation. First, although undetectable on the cell surface by flow cytometry, immature dendritic cells (DC) have a small pool of CD70 that continuously recycles from the plasma membrane. In addition, surface levels of CD70 on DC and T cells were higher in mice deficient in CD27, or on DC for which the interaction between CD70 and CD27 was precluded by blocking antibodies. Binding of CD70 by its receptor resulted in downregulation of CD70 transcription and protein levels, suggesting that CD70-mediated “reverse signals” regulate its own levels. Therefore, the ability of CD70 to trigger costimulation is self-regulated when it binds its complementary receptor. PMID:23913967

  19. Dissipative time-dependent quantum transport theory.

    PubMed

    Zhang, Yu; Yam, Chi Yung; Chen, GuanHua

    2013-04-28

    A dissipative time-dependent quantum transport theory is developed to treat the transient current through molecular or nanoscopic devices in presence of electron-phonon interaction. The dissipation via phonon is taken into account by introducing a self-energy for the electron-phonon coupling in addition to the self-energy caused by the electrodes. Based on this, a numerical method is proposed. For practical implementation, the lowest order expansion is employed for the weak electron-phonon coupling case and the wide-band limit approximation is adopted for device and electrodes coupling. The corresponding hierarchical equation of motion is derived, which leads to an efficient and accurate time-dependent treatment of inelastic effect on transport for the weak electron-phonon interaction. The resulting method is applied to a one-level model system and a gold wire described by tight-binding model to demonstrate its validity and the importance of electron-phonon interaction for the quantum transport. As it is based on the effective single-electron model, the method can be readily extended to time-dependent density functional theory.

  20. Engineering the Substrate Specificity of a Thermophilic Penicillin Acylase from Thermus thermophilus

    PubMed Central

    Torres, Leticia L.; Cantero, Ángel; del Valle, Mercedes; Marina, Anabel; López-Gallego, Fernando; Guisán, José M.

    2013-01-01

    A homologue of the Escherichia coli penicillin acylase is encoded in the genomes of several thermophiles, including in different Thermus thermophilus strains. Although the natural substrate of this enzyme is not known, this acylase shows a marked preference for penicillin K over penicillin G. Three-dimensional models were created in which the catalytic residues and the substrate binding pocket were identified. Through rational redesign, residues were replaced to mimic the aromatic binding site of the E. coli penicillin G acylase. A set of enzyme variants containing between one and four amino acid replacements was generated, with altered catalytic properties in the hydrolyses of penicillins K and G. The introduction of a single phenylalanine residue in position α188, α189, or β24 improved the Km for penicillin G between 9- and 12-fold, and the catalytic efficiency of these variants for penicillin G was improved up to 6.6-fold. Structural models, as well as docking analyses, can predict the positioning of penicillins G and K for catalysis and can demonstrate how binding in a productive pose is compromised when more than one bulky phenylalanine residue is introduced into the active site. PMID:23263966

  1. Optical absorption of zigzag single walled boron nitride nanotubes

    NASA Astrophysics Data System (ADS)

    Moradian, Rostam; Chegel, Raad; Behzad, Somayeh

    2010-11-01

    In a realistic three-dimensional model, optical matrix element and linear optical absorption of zigzag single walled boron nitride nanotubes (BNNTs) in the tight binding approximation are studied. In terms of absolute value of dipole matrix elements of the first three direct transitions at kz=0, we divided the zigzag BNNTs into three groups and investigated their optical absorption spectrum in energy ranges E<5, 77.5 eV. We found that in lower energies, E<5 eV, all groups show different behaviors while in the higher energies, 77.5 eV, their behaviors depend on their even or odd nanotube index. We also found that in the energy range 7

  2. Master equation for open two-band systems and its applications to Hall conductance

    NASA Astrophysics Data System (ADS)

    Shen, H. Z.; Zhang, S. S.; Dai, C. M.; Yi, X. X.

    2018-02-01

    Hall conductivity in the presence of a dephasing environment has recently been investigated with a dissipative term introduced phenomenologically. In this paper, we study the dissipative topological insulator (TI) and its topological transition in the presence of quantized electromagnetic environments. A Lindblad-type equation is derived to determine the dynamics of a two-band system. When the two-band model describes TIs, the environment may be the fluctuations of radiation that surround the TIs. We find the dependence of decay rates in the master equation on Bloch vectors in the two-band system, which leads to a mixing of the band occupations. Hence the environment-induced current is in general not perfectly topological in the presence of coupling to the environment, although deviations are small in the weak limit. As an illustration, we apply the Bloch-vector-dependent master equation to TIs and calculate the Hall conductance of tight-binding electrons in a two-dimensional lattice. The influence of environments on the Hall conductance is presented and discussed. The calculations show that the phase transition points of the TIs are robust against the quantized electromagnetic environment. The results might bridge the gap between quantum optics and topological photonic materials.

  3. Nonlocal plasmonic response of doped and optically pumped graphene, MoS2, and black phosphorus

    NASA Astrophysics Data System (ADS)

    Petersen, René; Pedersen, Thomas Garm; Javier García de Abajo, F.

    2017-11-01

    Plasmons in two-dimensional (2D) materials have emerged as a new source of physical phenomena and optoelectronic applications due in part to the relatively small number of charge carriers on which they are supported. Unlike conventional plasmonic materials, they possess a large Fermi wavelength, which can be comparable with the plasmon wavelength, thus leading to unusually strong nonlocal effects. Here, we study the optical response of a selection of 2D crystal layers (graphene, MoS2, and black phosphorus) with inclusion of nonlocal and thermal effects. We extensively analyze their plasmon dispersion relations and focus on the Purcell factor for the decay of an optical emitter in close proximity to the material as a way to probe nonlocal and thermal effects, with emphasis placed on the interplay between temperature and doping. The results are based on tight-binding modeling of the electronic structure combined with the random-phase approximation response function in which the temperature enters through the Fermi-Dirac electronic occupation distribution. Our study provides a route map for the exploration and exploitation of the ultrafast optical response of 2D materials.

  4. Band structure and spin texture of Bi2Se3 3 d ferromagnetic metal interface

    NASA Astrophysics Data System (ADS)

    Zhang, Jia; Velev, Julian P.; Dang, Xiaoqian; Tsymbal, Evgeny Y.

    2016-07-01

    The spin-helical surface states in a three-dimensional topological insulator (TI), such as Bi2Se3 , are predicted to have superior efficiency in converting charge current into spin polarization. This property is said to be responsible for the giant spin-orbit torques observed in ferromagnetic metal/TI structures. In this work, using first-principles and model tight-binding calculations, we investigate the interface between the topological insulator Bi2Se3 and 3 d -transition ferromagnetic metals Ni and Co. We find that the difference in the work functions of the topological insulator and the ferromagnetic metals shift the topological surface states down about 0.5 eV below the Fermi energy where the hybridization of these surface states with the metal bands destroys their helical spin structure. The band alignment of Bi2Se3 and Ni (Co) places the Fermi energy far in the conduction band of bulk Bi2Se3 , where the spin of the carriers is aligned with the magnetization in the metal. Our results indicate that the topological surface states are unlikely to be responsible for the huge spin-orbit torque effect observed experimentally in these systems.

  5. Trans-polyacetylene within the extended tight-binding picture and evidence for next-nearest neighbour hopping from the dispersion of interband transition edges

    NASA Astrophysics Data System (ADS)

    Drechsler, S. L.; Heiner, E.; Osipov, V. A.

    1986-11-01

    The influence of additional non-nearest neighbour hopping processes is investigated in a SSH-like model. The enhanced splitting of absorption peaks due to Π-Π ∗ interband transitions (deduced from new electron loss data of Fink and Leising /17/) can be explained by a reasonable value of the next-nearest neighbour hopping integral |t 2| ≈0.05 t 0.

  6. Electronic transport in methylated fragments of DNA

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Almeida, M. L. de; Oliveira, J. I. N.; Lima Neto, J. X.

    2015-11-16

    We investigate the electronic transport properties of methylated deoxyribonucleic-acid (DNA) strands, a biological system in which methyl groups are added to DNA (a major epigenetic modification in gene expression), sandwiched between two metallic platinum electrodes. Our theoretical simulations apply an effective Hamiltonian based on a tight-binding model to obtain current-voltage curves related to the non-methylated/methylated DNA strands. The results suggest potential applications in the development of novel biosensors for molecular diagnostics.

  7. Electronic transport in methylated fragments of DNA

    NASA Astrophysics Data System (ADS)

    de Almeida, M. L.; Oliveira, J. I. N.; Lima Neto, J. X.; Gomes, C. E. M.; Fulco, U. L.; Albuquerque, E. L.; Freire, V. N.; Caetano, E. W. S.; de Moura, F. A. B. F.; Lyra, M. L.

    2015-11-01

    We investigate the electronic transport properties of methylated deoxyribonucleic-acid (DNA) strands, a biological system in which methyl groups are added to DNA (a major epigenetic modification in gene expression), sandwiched between two metallic platinum electrodes. Our theoretical simulations apply an effective Hamiltonian based on a tight-binding model to obtain current-voltage curves related to the non-methylated/methylated DNA strands. The results suggest potential applications in the development of novel biosensors for molecular diagnostics.

  8. Assessing Modeled CO2 Retention and Rebreathing of a Facemask Designed for Efficient Delivery of Aerosols to Infants

    PubMed Central

    Mundt, Christian; Sventitskiy, Alexander; Cehelsky, Jeffrey E.; Patters, Andrea B.; Tservistas, Markus; Hahn, Michael C.; Juhl, Gerd; DeVincenzo, John P.

    2012-01-01

    Background. New aerosol drugs for infants may require more efficient delivery systems, including face masks. Maximizing delivery efficiency requires tight-fitting masks with minimal internal mask volumes, which could cause carbon dioxide (CO2) retention. An RNA-interference-based antiviral for treatment of respiratory syncytial virus in populations that may include young children is designed for aerosol administration. CO2 accumulation within inhalation face masks has not been evaluated. Methods. We simulated airflow and CO2 concentrations accumulating over time within a new facemask designed for infants and young children (PARI SMARTMASK® Baby). A one-dimensional model was first examined, followed by 3-dimensional unsteady computational fluid dynamics analyses. Normal infant breathing patterns and respiratory distress were simulated. Results. The maximum average modeled CO2 concentration within the mask reached steady state (3.2% and 3% for normal and distressed breathing patterns resp.) after approximately the 5th respiratory cycle. After steady state, the mean CO2 concentration inspired into the nostril was 2.24% and 2.26% for normal and distressed breathing patterns, respectively. Conclusion. The mask is predicted to cause minimal CO2 retention and rebreathing. Infants with normal and distressed breathing should tolerate the mask intermittently delivering aerosols over brief time frames. PMID:22792479

  9. Non-Arrhenius temperature dependence of the island density of one-dimensional Al chains on Si(100): A kinetic Monte Carlo study

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Albia, Jason R.; Albao, Marvin A., E-mail: maalbao@uplb.edu.ph

    Classical nucleation theory predicts that the evolution of mean island density with temperature during growth in one-dimensional systems obeys the Arrhenius relation. In this study, kinetic Monte Carlo simulations of a suitable atomistic lattice-gas model were performed to investigate the experimentally observed non-Arrhenius scaling behavior of island density in the case of one-dimensional Al islands grown on Si(100). Previously, it was proposed that adatom desorption resulted in a transition temperature signaling the departure from classical predictions. Here, the authors demonstrate that desorption above the transition temperature is not possible. Instead, the authors posit that the existence of a transition temperaturemore » is due to a combination of factors such as reversibility of island growth, presence of C-defects, adatom diffusion rates, as well as detachment rates at island ends. In addition, the authors show that the anomalous non-Arrhenius behavior vanishes when adatom binds irreversibly with C-defects as observed in In on Si(100) studies.« less

  10. Theoretical studies of protein-protein and protein-DNA binding rates

    NASA Astrophysics Data System (ADS)

    Alsallaq, Ramzi A.

    Proteins are folded chains of amino acids. Some of the amino acids (e.g. Lys, Arg, His, Asp, and Glu) carry charges under physiological conditions. Proteins almost always function through binding to other proteins or ligands, for example barnase is a ribonuclease protein, found in the bacterium Bacillus amyloliquefaceus. Barnase degrades RNA by hydrolysis. For the bacterium to inhibit the potentially lethal action of Barnase within its own cell it co-produces another protein called barstar which binds quickly, and tightly, to barnase. The biological function of this binding is to block the active site of barnase. The speeds (rates) at which proteins associate are vital to many biological processes. They span a wide range (from less than 103 to 108 M-1s-1 ). Rates greater than ˜ 106 M -1s-1 are typically found to be manifestations of enhancements by long-range electrostatic interactions between the associating proteins. A different paradigm appears in the case of protein binding to DNA. The rate in this case is enhanced through attractive surface potential that effectively reduces the dimensionality of the available search space for the diffusing protein. This thesis presents computational and theoretical models on the rate of association of ligands/proteins to other proteins or DNA. For protein-protein association we present a general strategy for computing protein-protein rates of association. The main achievements of this strategy is the ability to obtain a stringent reaction criteria based on the landscape of short-range interactions between the associating proteins, and the ability to compute the effect of the electrostatic interactions on the rates of association accurately using the best known solvers for Poisson-Boltzmann equation presently available. For protein-DNA association we present a mathematical model for proteins targeting specific sites on a circular DNA topology. The main achievements are the realization that a linear DNA with reflecting ends and specific site in the middle of the chain is kinetically indistinguishable from its circularized topology, and the ability to predict the effect of the dissociation via the ends of linear DNA on the rate of association which is to reduce the rate.* *This dissertation is a compound document (contains both a paper copy and a CD as part of the dissertation). The CD requires the following system requirements: QuickTime.

  11. Interactions of Kid-Kis toxin-antitoxin complexes with the parD operator-promoter region of plasmid R1 are piloted by the Kis antitoxin and tuned by the stoichiometry of Kid-Kis oligomers.

    PubMed

    Monti, Maria C; Hernández-Arriaga, Ana M; Kamphuis, Monique B; López-Villarejo, Juan; Heck, Albert J R; Boelens, Rolf; Díaz-Orejas, Ramón; van den Heuvel, Robert H H

    2007-01-01

    The parD operon of Escherichia coli plasmid R1 encodes a toxin-antitoxin system, which is involved in plasmid stabilization. The toxin Kid inhibits cell growth by RNA degradation and its action is neutralized by the formation of a tight complex with the antitoxin Kis. A fascinating but poorly understood aspect of the kid-kis system is its autoregulation at the transcriptional level. Using macromolecular (tandem) mass spectrometry and DNA binding assays, we here demonstrate that Kis pilots the interaction of the Kid-Kis complex in the parD regulatory region and that two discrete Kis-binding regions are present on parD. The data clearly show that only when the Kis concentration equals or exceeds the Kid concentration a strong cooperative effect exists between strong DNA binding and Kid2-Kis2-Kid2-Kis2 complex formation. We propose a model in which transcriptional repression of the parD operon is tuned by the relative molar ratio of the antitoxin and toxin proteins in solution. When the concentration of the toxin exceeds that of the antitoxin tight Kid2-Kis2-Kid2 complexes are formed, which only neutralize the lethal activity of Kid. Upon increasing the Kis concentration, (Kid2-Kis2)n complexes repress the kid-kis operon.

  12. Speeding up biomolecular interactions by molecular sledding

    DOE PAGES

    Turkin, Alexander; Zhang, Lei; Marcozzi, Alessio; ...

    2015-10-07

    In numerous biological processes associations involve a protein with its binding partner, an event that is preceded by a diffusion-mediated search bringing the two partners together. Often hindered by crowding in biologically relevant environments, three-dimensional diffusion can be slow and result in long bimolecular association times. Moreover, the initial association step between two binding partners often represents a rate-limiting step in biotechnologically relevant reactions. We also demonstrate the practical use of an 11-a.a. DNA-interacting peptide derived from adenovirus to reduce the dimensionality of diffusional search processes and speed up associations between biological macromolecules. We functionalize binding partners with the peptidemore » and demonstrate that the ability of the peptide to one-dimensionally diffuse along DNA results in a 20-fold reduction in reaction time. We also show that modifying PCR primers with the peptide sled enables significant acceleration of standard PCR reactions.« less

  13. The IκBα/NF-κB complex has two hot spots, one at either end of the interface

    PubMed Central

    Bergqvist, Simon; Ghosh, Gourisankar; Komives, Elizabeth A.

    2008-01-01

    IκBα binds to and inhibits the transcriptional activity of NF-κB family members via its ankyrin repeat (AR) domain. The binding affinity of IκBα with NF-κB(p50/p65) heterodimers and NF-κB(p65/65) homodimers is in the picomolar range, and in the cell, this results in long half-lives of the complexes. Direct binding experiments have been performed using surface plasmon resonance (SPR) and isothermal titration calorimetry (ITC) on a series of truncations and mutations in order to understand what regions of the interface are most important for the tight binding affinity of this complex. We previously showed that interactions between residues 305 and 321 of NF-κB(p65) with the first AR of IκBα are critical for the binding energy. Interactions in this region are responsible for more than 7 kcal/mol of the binding energy. Here we show equally drastic consequences for the binding energy occur upon truncation of even a few residues at the C terminus of IκBα. Thus, the interface actually has two hot spots, one at either end of the elongated and large surface of interaction. These results suggest a “squeeze” mechanism that leads to the extremely high affinity of the IκBα•NF-κB complex through stabilization of the ankyrin repeat domain. PMID:18824506

  14. DFTB3: Extension of the self-consistent-charge density-functional tight-binding method (SCC-DFTB).

    PubMed

    Gaus, Michael; Cui, Qiang; Elstner, Marcus

    2012-04-10

    The self-consistent-charge density-functional tight-binding method (SCC-DFTB) is an approximate quantum chemical method derived from density functional theory (DFT) based on a second-order expansion of the DFT total energy around a reference density. In the present study we combine earlier extensions and improve them consistently with, first, an improved Coulomb interaction between atomic partial charges, and second, the complete third-order expansion of the DFT total energy. These modifications lead us to the next generation of the DFTB methodology called DFTB3, which substantially improves the description of charged systems containing elements C, H, N, O, and P, especially regarding hydrogen binding energies and proton affinities. As a result, DFTB3 is particularly applicable to biomolecular systems. Remaining challenges and possible solutions are also briefly discussed.

  15. Theory of metal-insulator transition in the family of perovskite iridium oxides

    NASA Astrophysics Data System (ADS)

    Carter, Jean-Michel; Shankar V., Vijay; Kee, Hae-Young

    2013-07-01

    Perovskite iridium oxides Srn+1IrnO3n+1 exhibit fascinating phenomena due to the combined effects of spin-orbit coupling (SOC) and electronic interactions. It was suggested that electronic correlation amplified via the strong SOC leads to a spin-orbit Mott insulator for n=1 and 2, while three-dimensional (3D) SrIrO3 remains metallic because of the large bandwidth from the 3D structure. However, this bandwidth-controlled metal-insulator transition (MIT) is only valid when SOC is large enough to split Jeff=1/2 and 3/2 bands, while the mixing of 1/2 and 3/2 bands is conspicuous among the occupied bands. Here, we investigate the MIT as a function of n using weak-coupling theory. In this approach, the magnetic instability is determined by the states near the Fermi level rather than the entire band structure. Starting from t2g tight-binding models for n=1, 2, and ∞, the states near the Fermi level are found to be predominantly Jeff=1/2 allowing an effective single-band model. Supplementing this effective Jeff=1/2 model with Hubbard-type interactions, transitions from a metal to magnetically ordered states are obtained. Strong-coupling spin models are derived to compare the magnetic ordering patterns obtained in the weak- and strong-coupling limits. We find that they are identical, indicating that these iridates are likely in an intermediate-coupling regime.

  16. Mass spectrometry reveals that the antibiotic simocyclinone D8 binds to DNA gyrase in a "bent-over" conformation: evidence of positive cooperativity in binding.

    PubMed

    Edwards, Marcus J; Williams, Mark A; Maxwell, Anthony; McKay, Adam R

    2011-05-03

    DNA topoisomerases are enzymes that control DNA topology and are vital targets for antimicrobial and anticancer drugs. Here we present a mass spectrometry study of complexes formed between the A subunit of the topoisomerase DNA gyrase and the bifunctional inhibitor simocyclinone D8 (SD8), an antibiotic isolated from Streptomyces. These studies show that, in an alternative mode of interaction to that found by X-ray crystallography, each subunit binds a single bifunctional inhibitor with separate binding pockets for the two ends of SD8. The gyrase subunits form constitutive dimers, and fractional occupancies of inhibitor-bound states show that there is strong allosteric cooperativity in the binding of two bifunctional ligands to the dimer. We show that the mass spectrometry data can be fitted to a general model of cooperative binding via an extension of the "tight-binding" approach, providing a rigorous determination of the dissociation constants and degree of cooperativity. This general approach will be applicable to other systems with multiple binding sites and highlights mass spectrometry's role as a powerful emerging tool for unraveling the complexities of biomolecular interactions.

  17. Identification of protein-ligand binding sites by the level-set variational implicit-solvent approach.

    PubMed

    Guo, Zuojun; Li, Bo; Cheng, Li-Tien; Zhou, Shenggao; McCammon, J Andrew; Che, Jianwei

    2015-02-10

    Protein–ligand binding is a key biological process at the molecular level. The identification and characterization of small-molecule binding sites on therapeutically relevant proteins have tremendous implications for target evaluation and rational drug design. In this work, we used the recently developed level-set variational implicit-solvent model (VISM) with the Coulomb field approximation (CFA) to locate and characterize potential protein–small-molecule binding sites. We applied our method to a data set of 515 protein–ligand complexes and found that 96.9% of the cocrystallized ligands bind to the VISM-CFA-identified pockets and that 71.8% of the identified pockets are occupied by cocrystallized ligands. For 228 tight-binding protein–ligand complexes (i.e, complexes with experimental pKd values larger than 6), 99.1% of the cocrystallized ligands are in the VISM-CFA-identified pockets. In addition, it was found that the ligand binding orientations are consistent with the hydrophilic and hydrophobic descriptions provided by VISM. Quantitative characterization of binding pockets with topological and physicochemical parameters was used to assess the “ligandability” of the pockets. The results illustrate the key interactions between ligands and receptors and can be very informative for rational drug design.

  18. Effect of Fermi surface nesting on resonant spin excitations in Ba{<_1-x}K{<_x}Fe{<_2}As{<_2}.

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Castellan, J.-P.; Rosenkranz, S.; Goremychkin, E.A.

    2011-01-01

    We report inelastic neutron scattering measurements of the resonant spin excitations in Ba{sub 1-x}K{sub x}Fe{sub 2}As{sub 2} over a broad range of electron band filling. The fall in the superconducting transition temperature with hole doping coincides with the magnetic excitations splitting into two incommensurate peaks because of the growing mismatch in the hole and electron Fermi surface volumes, as confirmed by a tight-binding model with s{sub {+-}}-symmetry pairing. The reduction in Fermi surface nesting is accompanied by a collapse of the resonance binding energy and its spectral weight, caused by the weakening of electron-electron correlations.

  19. Effects of strong interactions in a half-metallic magnet: A determinant quantum Monte Carlo study

    DOE PAGES

    Jiang, M.; Pickett, W. E.; Scalettar, R. T.

    2013-04-03

    Understanding the effects of electron-electron interactions in half-metallic magnets (HMs), which have band structures with one gapped spin channel and one metallic channel, poses fundamental theoretical issues as well as having importance for their potential applications. Here we use determinant quantum Monte Carlo to study the impacts of an on-site Hubbard interaction U, finite temperature, and an external (Zeeman) magnetic field on a bilayer tight-binding model which is a half-metal in the absence of interactions, by calculating the spectral density, conductivity, spin polarization of carriers, and local magnetic properties. We quantify the effect of U on the degree of thermalmore » depolarization, and follow relative band shifts and monitor when significant gap states appear, each of which can degrade the HM character. For this model, Zeeman coupling induces, at fixed particle number, two successive transitions: compensated half-metal with spin-down band gap → metallic ferromagnet → saturated ferromagnetic insulator. However, over much of the more relevant parameter regime, the half-metallic properties are rather robust to U.« less

  20. Strongly Interacting Fermi Gases In Two Dimensions

    DTIC Science & Technology

    2012-01-03

    Correlated Quantum Fluids: From Ultracold Quantum Gases to QCD Plasmas. Figure 2 Spin Transport in Spin-Imbalanced, strongly interacting...atoms becomes confined to a stack of two-dimensional layers formed by a one-dimensional optical lattice . Decreasing the dimensionality leads to the...opening of a gap in radiofrequency spectra, even on the BCS-side of a Feshbach resonance. With increasing lattice depth, the measured binding energy

  1. Band nesting, massive Dirac fermions, and valley Landé and Zeeman effects in transition metal dichalcogenides: A tight-binding model

    NASA Astrophysics Data System (ADS)

    Bieniek, Maciej; Korkusiński, Marek; Szulakowska, Ludmiła; Potasz, Paweł; Ozfidan, Isil; Hawrylak, Paweł

    2018-02-01

    We present here the minimal tight-binding model for a single layer of transition metal dichalcogenides (TMDCs) MX 2(M , metal; X , chalcogen) which illuminates the physics and captures band nesting, massive Dirac fermions, and valley Landé and Zeeman magnetic field effects. TMDCs share the hexagonal lattice with graphene but their electronic bands require much more complex atomic orbitals. Using symmetry arguments, a minimal basis consisting of three metal d orbitals and three chalcogen dimer p orbitals is constructed. The tunneling matrix elements between nearest-neighbor metal and chalcogen orbitals are explicitly derived at K ,-K , and Γ points of the Brillouin zone. The nearest-neighbor tunneling matrix elements connect specific metal and sulfur orbitals yielding an effective 6 ×6 Hamiltonian giving correct composition of metal and chalcogen orbitals but not the direct gap at K points. The direct gap at K , correct masses, and conduction band minima at Q points responsible for band nesting are obtained by inclusion of next-neighbor Mo-Mo tunneling. The parameters of the next-nearest-neighbor model are successfully fitted to MX 2(M =Mo ; X =S ) density functional ab initio calculations of the highest valence and lowest conduction band dispersion along K -Γ line in the Brillouin zone. The effective two-band massive Dirac Hamiltonian for MoS2, Landé g factors, and valley Zeeman splitting are obtained.

  2. Neuraminidase inhibitor R-125489 - A promising drug for treating influenza virus: Steered molecular dynamics approach

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mai, Binh Khanh; Li, Mai Suan, E-mail: masli@ifpan.edu.pl

    2011-07-08

    Highlights: {yields} We study binding affinity of R-125489 and its prodrug CS-8958 to neuraminidase of pathogenic influenza viruses by molecular dynamics simulations. {yields} It is shown that, in agreement with experiments, R-125489 binds to neuraminidase more tightly than CS-8958. {yields} We predict that R-125489 can be used to treat not only wild-type but also tamiflu-resistant N294S, H274Y variants of A/H5N1 virus. {yields} The high correlation between theoretical and experimental data implies that SMD is a very promising tool for drug design. -- Abstract: Two neuraminidase inhibitors, oseltamivir and zanamivir, are important drug treatments for influenza. Oseltamivir-resistant mutants of the influenzamore » virus A/H1N1 and A/H5N1 have emerged, necessitating the development of new long-acting antiviral agents. One such agent is a new neuraminidase inhibitor R-125489 and its prodrug CS-8958. An atomic level understanding of the nature of this antiviral agents binding is still missing. We address this gap in our knowledge by applying steered molecular dynamics (SMD) simulations to different subtypes of seasonal and highly pathogenic influenza viruses. We show that, in agreement with experiments, R-125489 binds to neuraminidase more tightly than CS-8958. Based on results obtained by SMD and the molecular mechanics-Poisson-Boltzmann surface area method, we predict that R-125489 can be used to treat not only wild-type but also tamiflu-resistant N294S, H274Y variants of A/H5N1 virus as its binding affinity does not vary much across these systems. The high correlation level between theoretically determined rupture forces and experimental data on binding energies for the large number of systems studied here implies that SMD is a promising tool for drug design.« less

  3. Recognition and Detoxification of the Insecticide DDT by Drosophila melanogaster Glutathione S-Transferase D1

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Low, Wai Yee; Feil, Susanne C.; Ng, Hooi Ling

    2010-06-14

    GSTD1 is one of several insect glutathione S-transferases capable of metabolizing the insecticide DDT. Here we use crystallography and NMR to elucidate the binding of DDT and glutathione to GSTD1. The crystal structure of Drosophila melanogaster GSTD1 has been determined to 1.1 {angstrom} resolution, which reveals that the enzyme adopts the canonical GST fold but with a partially occluded active site caused by the packing of a C-terminal helix against one wall of the binding site for substrates. This helix would need to unwind or be displaced to enable catalysis. When the C-terminal helix is removed from the model ofmore » the crystal structure, DDT can be computationally docked into the active site in an orientation favoring catalysis. Two-dimensional {sup 1}H,{sup 15}N heteronuclear single-quantum coherence NMR experiments of GSTD1 indicate that conformational changes occur upon glutathione and DDT binding and the residues that broaden upon DDT binding support the predicted binding site. We also show that the ancestral GSTD1 is likely to have possessed DDT dehydrochlorinase activity because both GSTD1 from D. melanogaster and its sibling species, Drosophila simulans, have this activity.« less

  4. Carbon Nanotube Based Molecular Electronics

    NASA Technical Reports Server (NTRS)

    Srivastava, Deepak; Saini, Subhash; Menon, Madhu

    1998-01-01

    Carbon nanotubes and the nanotube heterojunctions have recently emerged as excellent candidates for nanoscale molecular electronic device components. Experimental measurements on the conductivity, rectifying behavior and conductivity-chirality correlation have also been made. While quasi-one dimensional simple heterojunctions between nanotubes with different electronic behavior can be generated by introduction of a pair of heptagon-pentagon defects in an otherwise all hexagon graphene sheet. Other complex 3- and 4-point junctions may require other mechanisms. Structural stability as well as local electronic density of states of various nanotube junctions are investigated using a generalized tight-binding molecular dynamics (GDBMD) scheme that incorporates non-orthogonality of the orbitals. The junctions investigated include straight and small angle heterojunctions of various chiralities and diameters; as well as more complex 'T' and 'Y' junctions which do not always obey the usual pentagon-heptagon pair rule. The study of local density of states (LDOS) reveal many interesting features, most prominent among them being the defect-induced states in the gap. The proposed three and four pointjunctions are one of the smallest possible tunnel junctions made entirely of carbon atoms. Furthermore the electronic behavior of the nanotube based device components can be taylored by doping with group III-V elements such as B and N, and BN nanotubes as a wide band gap semiconductor has also been realized in experiments. Structural properties of heteroatomic nanotubes comprising C, B and N will be discussed.

  5. Interface exciton at lateral heterojunction of monolayer semiconductors

    NASA Astrophysics Data System (ADS)

    Lau, Ka Wai; Gong, Zhirui; Yu, Hongyi; Yao, Wang

    Heterostructures based on 2D transition metal dichalcogenides (TMDs) have attracted extensive research interest recently due to the appealing physical properties of TMDs and new geometries for forming heterostructures. One such heterostructure is the lateral heterojunctions seamlessly formed in a monolayer crystal between two different types of TMDs, e.g. WSe2 and MoSe2. Such heterojunction exhibits a type II band alignment, with electrons (holes) having lower energy on the MoSe2 (WSe2) region. Here we present the study of an interface exciton at the 1D lateral junction of monolayer TMDs. With the distance dependent screening, we find that the interface exciton can have strong binding even though the electron-hole separation is much larger compare to the 2D excitons in TMDs. Neutral excitons are studied using two different approaches: the solution based on a real-space tight binding model, and the perturbation expansion in a hydrogen-like basis in an effective mass model. We have also used the latter method to study charged excitons at a MoSe2-WSe2-MoSe2 nanoscale junction. The work is supported by the Research Grant Council of Hong Kong (HKU705513P, HKU9/CRF/13G), the Croucher Foundation, and the HKU OYRA.

  6. Effect of impurity doping on tunneling conductance in AB-stacked bi-layer graphene: A tight-binding study

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rout, G. C., E-mail: siva1987@iopb.res.in, E-mail: skp@iopb.res.in, E-mail: gcr@iopb.res.in; Sahu, Sivabrata; Panda, S. K.

    2016-04-13

    We report here a microscopic tight-binding model calculation for AB-stacked bilayer graphene in presence of biasing potential between the two layers and the impurity effects to study the evolution of the total density of states with special emphasis on opening of band gap near Dirac point. We have calculated the electron Green’s functions for both the A and B sub-lattices by Zubarev technique. The imaginary part of the Green’s function gives the partial and total density of states of electrons. The density of states are computed numerically for 1000 × 1000 grid points of the electron momentum. The evolution ofmore » the opening of band gap near van-Hove singularities as well as near Dirac point is investigated by varying the different interlayer hoppings and the biasing potentials. The inter layer hopping splits the density of states at van-Hove singularities and produces a V-shaped gap near Dirac point. Further the biasing potential introduces a U shaped gap near Dirac point with a density minimum at the applied potential(i.e. at V/2).« less

  7. Studying the hopping parameters of half-Heusler NaAuS using maximally localized Wannier function

    NASA Astrophysics Data System (ADS)

    Sihi, Antik; Lal, Sohan; Pandey, Sudhir K.

    2018-04-01

    Here, the electronic behavior of half-Heusler NaAuS is studied using PBEsol exchange correlation functional by plotting the band structure curve. These bands are reproduced using maximally localized Wannier function using WANNIER90. Tight-binding bands are nicely matched with density functional theory bands. By fitting the tight-binding model, hopping parameter for NaAuS is obtained by including Na 2s, 2p, Au 6s, 5p, 5d and S 3s, 3p orbitals within the energy interval of -5 to 16 eV around the Fermi level. In present study, hopping integrals for NaAuS are computed for the first primitive unit cell atoms as well as the first nearest neighbor primitive unit cell. The most dominating hopping integrals are found for Na (3s) - S (3s), Na (2px) - S (2px), Au (6s) - S (3px), Au (6s) - S (3py) and Au (6s) - S (3pz) orbitals. The hopping integrals for the first nearest neighbor primitive unit cell are also discussed in this manuscript. In future, these hopping integrals are very important to find the topological invariant for NaAuS compound.

  8. Generalized theory on the mechanism of site-specific DNA-protein interactions

    NASA Astrophysics Data System (ADS)

    Niranjani, G.; Murugan, R.

    2016-05-01

    We develop a generalized theoretical framework on the binding of transcription factor proteins (TFs) with specific sites on DNA that takes into account the interplay of various factors regarding overall electrostatic potential at the DNA-protein interface, occurrence of kinetic traps along the DNA sequence, presence of other roadblock protein molecules along DNA and crowded environment, conformational fluctuations in the DNA binding domains (DBDs) of TFs, and the conformational state of the DNA. Starting from a Smolochowski type theoretical framework on site-specific binding of TFs we logically build our model by adding the effects of these factors one by one. Our generalized two-step model suggests that the electrostatic attractive forces present inbetween the positively charged DBDs of TFs and the negatively charged phosphate backbone of DNA, along with the counteracting shielding effects of solvent ions, is the core factor that creates a fluidic type environment at the DNA-protein interface. This in turn facilitates various one-dimensional diffusion (1Dd) processes such as sliding, hopping and intersegmental transfers. These facilitating processes as well as flipping dynamics of conformational states of DBDs of TFs between stationary and mobile states can enhance the 1Dd coefficient on a par with three-dimensional diffusion (3Dd). The random coil conformation of DNA also plays critical roles in enhancing the site-specific association rate. The extent of enhancement over the 3Dd controlled rate seems to be directly proportional to the maximum possible 1Dd length. We show that the overall site-specific binding rate scales with the length of DNA in an asymptotic way. For relaxed DNA, the specific binding rate will be independent of the length of DNA as length increases towards infinity. For condensed DNA as in in vivo conditions, the specific binding rate depends on the length of DNA in a turnover way with a maximum. This maximum rate seems to scale with the maximum possible 1Dd length of TFs in a square root manner. Results suggest that 1Dd processes contribute much less to the enhancement of specific binding rate under in vivo conditions for condensed DNA. There exists a critical length of binding stretch of TFs beyond which the probability associated with the random occurrence of similar specific binding sites will be close to zero. TFs in natural systems from prokaryotes to eukaryotes seem to handle sequence-mediated kinetic traps via increasing the length of their recognition stretch or combinatorial binding. TFs overcome the hurdles of roadblocks via switching efficiently between sliding, hopping and intersegmental transfer modes. The site-specific binding rate as well as the maximum possible 1Dd length seem to be directly proportional to the square root of the probability (p R) of finding a nonspecific binding site to be free from dynamic roadblocks. Here p R seems to be a function of the number of nsbs available per DNA binding protein (ϕ) inside the living cell. It seems that p R  >  0.8 when ϕ  >  10 which is true for the Escherichia coli cell system.

  9. Quasi-bound states in strained graphene

    NASA Astrophysics Data System (ADS)

    Bahamon, Dario; Qi, Zenan; Park, Harold; Pareira, Vitor; Campbell, David

    In this work, we explore the possibility of manipulating electronic states in graphene nanostructures by mechanical means. Specifically, we use molecular dynamics and tight-binding models to access the electronic and transport properties of strained graphene nanobubbles and graphene kirigami. We establish that low energy electrons can be confined in the arms of the kirigami and within the nanobubbles; under different load conditions the coupling between confined states and continuous states is modified creating different conductance line-shapes.

  10. Electron doping effects on the electrical conductivity of zigzag carbon nanotubes and corresponding unzipped armchair graphene nanoribbons

    NASA Astrophysics Data System (ADS)

    Mousavi, Hamze; Jalilvand, Samira; Kurdestany, Jamshid Moradi; Grabowski, Marek

    2017-10-01

    The Kubo formula is used to extract the electrical conductivity (EC) of different diameters of doped zigzag carbon nanotubes and their corresponding unzipped armchair graphene nanoribbons, as a function of temperature and chemical potential, within the tight-binding Hamiltonian model and Green's functions approach. The results reveal more sensitivity to temperature for semiconducting systems in addition to a decrease in EC of all systems with increasing cross-sections.

  11. Atomic scale simulations of pyrochlore oxides with a tight-binding variable-charge model: implications for radiation tolerance.

    PubMed

    Sattonnay, G; Tétot, R

    2014-02-05

    Atomistic simulations with new interatomic potentials derived from a tight-binding variable-charge model were performed in order to investigate the lattice properties and the defect formation energies in Gd2Ti2O7 and Gd2Zr2O7 pyrochlores. The main objective was to determine the role played by the defect stability on the radiation tolerance of these compounds. Calculations show that the titanate has a more covalent character than the zirconate. Moreover, the properties of oxygen Frenkel pairs, cation antisite defects and cation Frenkel pairs were studied. In Gd2Ti2O7 the cation antisite defect and the Ti-Frenkel pair are not stable: they evolve towards more stable defect configurations during the atomic relaxation process. This phenomenon is driven by a decrease of the Ti coordination number down to five which leads to a local atomic reorganization and strong structural distortions around the defects. These kinds of atomic rearrangements are not observed around defects in Gd2Zr2O7. Therefore, the defect stability in A2B2O7 depends on the ability of B atoms to accommodate high coordination number (higher than six seems impossible for Ti). The accumulation of structural distortions around Ti-defects due to this phenomenon could drive the Gd2Ti2O7 amorphization induced by irradiation.

  12. Structural Analysis of the Phenol-Responsive Sensory Domain of the Transcription Activator PoxR.

    PubMed

    Patil, Vinod Vikas; Park, Kwang-Hyun; Lee, Seung-Goo; Woo, Euijeon

    2016-04-05

    Positive phenol-degradative gene regulator (PoxR) is a σ(54)-dependent AAA+ ATPase transcription activator that regulates the catabolism of phenols. The PoxR sensory domain detects phenols and relays signals for the activation of transcription. Here we report the first structure of the phenol sensory domain bound to phenol and five derivatives. It exists as a tightly intertwined homodimer with a phenol-binding pocket buried inside, placing two C termini on the same side of the dimer. His102 and Trp130 interact with the hydroxyl group of the phenol in a cavity surrounded by rigid hydrophobic residues on one side and a flexible region on the other. Each monomer has a V4R fold with a unique zinc-binding site. A shift at the C-terminal helix suggests that there is a possible conformational change upon ligand binding. The results provide a structural basis of chemical effector binding for transcriptional regulation with broad implications for protein engineering. Copyright © 2016 Elsevier Ltd. All rights reserved.

  13. Sequence and characterization of cytoplasmic nuclear protein import factor p97

    PubMed Central

    1995-01-01

    Nuclear location sequence-mediated binding of karyophilic proteins to the nuclear pore complexes is one of the earliest steps in nuclear protein import. We previously identified two cytosolic proteins that reconstitute this step in a permeabilized cell assay: the 54/56-kD NLS receptor and p97. A monoclonal antibody to p97 localizes the protein to the cytoplasm and the nuclear envelope. p97 is extracted from nuclear envelopes under the same conditions as the O-glycosylated nucleoporins indicating a tight association with the pore complex. The antibody inhibits import in a permeabilized cell assay but does not affect binding of karyophiles to the nuclear pore complex. Immunodepletion of p97 renders the cytosol inactive for import and identifies at least three other cytosolic proteins that interact with p97. cDNA cloning of p97 shows that it is a unique protein containing 23 cysteine residues. Recombinant p97 binds zinc and a bound metal ion is required for the nuclear envelope binding activity of the protein. PMID:7615630

  14. VR-SCOSMO: A smooth conductor-like screening model with charge-dependent radii for modeling chemical reactions.

    PubMed

    Kuechler, Erich R; Giese, Timothy J; York, Darrin M

    2016-04-28

    To better represent the solvation effects observed along reaction pathways, and of ionic species in general, a charge-dependent variable-radii smooth conductor-like screening model (VR-SCOSMO) is developed. This model is implemented and parameterized with a third order density-functional tight binding quantum model, DFTB3/3OB-OPhyd, a quantum method which was developed for organic and biological compounds, utilizing a specific parameterization for phosphate hydrolysis reactions. Unlike most other applications with the DFTB3/3OB model, an auxiliary set of atomic multipoles is constructed from the underlying DFTB3 density matrix which is used to interact the solute with the solvent response surface. The resulting method is variational, produces smooth energies, and has analytic gradients. As a baseline, a conventional SCOSMO model with fixed radii is also parameterized. The SCOSMO and VR-SCOSMO models shown have comparable accuracy in reproducing neutral-molecule absolute solvation free energies; however, the VR-SCOSMO model is shown to reduce the mean unsigned errors (MUEs) of ionic compounds by half (about 2-3 kcal/mol). The VR-SCOSMO model presents similar accuracy as a charge-dependent Poisson-Boltzmann model introduced by Hou et al. [J. Chem. Theory Comput. 6, 2303 (2010)]. VR-SCOSMO is then used to examine the hydrolysis of trimethylphosphate and seven other phosphoryl transesterification reactions with different leaving groups. Two-dimensional energy landscapes are constructed for these reactions and calculated barriers are compared to those obtained from ab initio polarizable continuum calculations and experiment. Results of the VR-SCOSMO model are in good agreement in both cases, capturing the rate-limiting reaction barrier and the nature of the transition state.

  15. Multi-scale predictive modeling of nano-material and realistic electron devices

    NASA Astrophysics Data System (ADS)

    Palaria, Amritanshu

    Among the challenges faced in further miniaturization of electronic devices, heavy influence of the detailed atomic configuration of the material(s) involved, which often differs significantly from that of the bulk material(s), is prominent. Device design has therefore become highly interrelated with material engineering at the atomic level. This thesis aims at outlining, with examples, a multi-scale simulation procedure that allows one to integrate material and device aspects of nano-electronic design to predict behavior of novel devices with novel material. This is followed in four parts: (1) An approach that combines a higher time scale reactive force field analysis with density functional theory to predict structure of new material is demonstrated for the first time for nanowires. Novel stable structures for very small diameter silicon nanowires are predicted. (2) Density functional theory is used to show that the new nanowire structures derived in 1 above have properties different from diamond core wires even though the surface bonds in some may be similar to the surface of bulk silicon. (3) Electronic structure of relatively large-scale germanium sections of realistically strained Si/strained Ge/ strained Si nanowire heterostructures is computed using empirical tight binding and it is shown that the average non-homogeneous strain in these structures drives their interesting non-conventional electronic characteristics such as hole effective masses which decrease as the wire cross-section is reduced. (4) It is shown that tight binding, though empirical in nature, is not necessarily limited to the material and atomic structure for which the parameters have been empirically derived, but that simple changes may adapt the derived parameters to new bond environments. Si (100) surface electronic structure is obtained from bulk Si parameters.

  16. Tightly coupled low cost 3D RISS/GPS integration using a mixture particle filter for vehicular navigation.

    PubMed

    Georgy, Jacques; Noureldin, Aboelmagd

    2011-01-01

    Satellite navigation systems such as the global positioning system (GPS) are currently the most common technique used for land vehicle positioning. However, in GPS-denied environments, there is an interruption in the positioning information. Low-cost micro-electro mechanical system (MEMS)-based inertial sensors can be integrated with GPS and enhance the performance in denied GPS environments. The traditional technique for this integration problem is Kalman filtering (KF). Due to the inherent errors of low-cost MEMS inertial sensors and their large stochastic drifts, KF, with its linearized models, has limited capabilities in providing accurate positioning. Particle filtering (PF) was recently suggested as a nonlinear filtering technique to accommodate for arbitrary inertial sensor characteristics, motion dynamics and noise distributions. An enhanced version of PF called the Mixture PF is utilized in this study to perform tightly coupled integration of a three dimensional (3D) reduced inertial sensors system (RISS) with GPS. In this work, the RISS consists of one single-axis gyroscope and a two-axis accelerometer used together with the vehicle's odometer to obtain 3D navigation states. These sensors are then integrated with GPS in a tightly coupled scheme. In loosely-coupled integration, at least four satellites are needed to provide acceptable GPS position and velocity updates for the integration filter. The advantage of the tightly-coupled integration is that it can provide GPS measurement update(s) even when the number of visible satellites is three or lower, thereby improving the operation of the navigation system in environments with partial blockages by providing continuous aiding to the inertial sensors even during limited GPS satellite availability. To effectively exploit the capabilities of PF, advanced modeling for the stochastic drift of the vertically aligned gyroscope is used. In order to benefit from measurement updates for such drift, which are loosely-coupled updates, a hybrid loosely/tightly coupled solution is proposed. This solution is suitable for downtown environments because of the long natural outages or degradation of GPS. The performance of the proposed 3D Navigation solution using Mixture PF for 3D RISS/GPS integration is examined by road test trajectories in a land vehicle and compared to the KF counterpart.

  17. Tightly Coupled Low Cost 3D RISS/GPS Integration Using a Mixture Particle Filter for Vehicular Navigation

    PubMed Central

    Georgy, Jacques; Noureldin, Aboelmagd

    2011-01-01

    Satellite navigation systems such as the global positioning system (GPS) are currently the most common technique used for land vehicle positioning. However, in GPS-denied environments, there is an interruption in the positioning information. Low-cost micro-electro mechanical system (MEMS)-based inertial sensors can be integrated with GPS and enhance the performance in denied GPS environments. The traditional technique for this integration problem is Kalman filtering (KF). Due to the inherent errors of low-cost MEMS inertial sensors and their large stochastic drifts, KF, with its linearized models, has limited capabilities in providing accurate positioning. Particle filtering (PF) was recently suggested as a nonlinear filtering technique to accommodate for arbitrary inertial sensor characteristics, motion dynamics and noise distributions. An enhanced version of PF called the Mixture PF is utilized in this study to perform tightly coupled integration of a three dimensional (3D) reduced inertial sensors system (RISS) with GPS. In this work, the RISS consists of one single-axis gyroscope and a two-axis accelerometer used together with the vehicle’s odometer to obtain 3D navigation states. These sensors are then integrated with GPS in a tightly coupled scheme. In loosely-coupled integration, at least four satellites are needed to provide acceptable GPS position and velocity updates for the integration filter. The advantage of the tightly-coupled integration is that it can provide GPS measurement update(s) even when the number of visible satellites is three or lower, thereby improving the operation of the navigation system in environments with partial blockages by providing continuous aiding to the inertial sensors even during limited GPS satellite availability. To effectively exploit the capabilities of PF, advanced modeling for the stochastic drift of the vertically aligned gyroscope is used. In order to benefit from measurement updates for such drift, which are loosely-coupled updates, a hybrid loosely/tightly coupled solution is proposed. This solution is suitable for downtown environments because of the long natural outages or degradation of GPS. The performance of the proposed 3D Navigation solution using Mixture PF for 3D RISS/GPS integration is examined by road test trajectories in a land vehicle and compared to the KF counterpart. PMID:22163846

  18. Binding Blocks: Building the Universe One Nucleus at a Time

    ERIC Educational Resources Information Center

    Diget, C. Aa.; Pastore, A.; Leech, K.; Haylett, T.; Lock, S.; Sanders, T.; Shelley, M.; Willett, H. V.; Keegans, J.; Sinclair, L.; Simpson, E. C.

    2017-01-01

    We present a new teaching and outreach activity based around the construction of a three-dimensional chart of isotopes using LEGO® bricks. The activity, "binding blocks", demonstrates nuclear and astrophysical processes through a seven-meter chart of all nuclear isotopes, built from over 26000 LEGO® bricks. It integrates A-Level and GCSE…

  19. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shirokov, M. E.

    We analyse two possible definitions of the squashed entanglement in an infinite-dimensional bipartite system: direct translation of the finite-dimensional definition and its universal extension. It is shown that the both definitions produce the same lower semicontinuous entanglement measure possessing all basis properties of the squashed entanglement on the set of states having at least one finite marginal entropy. It is also shown that the second definition gives an adequate lower semicontinuous extension of this measure to all states of the infinite-dimensional bipartite system. A general condition relating continuity of the squashed entanglement to continuity of the quantum mutual information ismore » proved and its corollaries are considered. Continuity bound for the squashed entanglement under the energy constraint on one subsystem is obtained by using the tight continuity bound for quantum conditional mutual information (proved in the Appendix by using Winter’s technique). It is shown that the same continuity bound is valid for the entanglement of formation. As a result the asymptotic continuity of the both entanglement measures under the energy constraint on one subsystem is proved.« less

  20. The relationship between water binding and desiccation tolerance in tissues

    NASA Technical Reports Server (NTRS)

    Vertucci, C. W.; Leopold, A. C.

    1987-01-01

    In an effort to define the nature of desiccation tolerance, a comparison of the water sorption characteristics was made between tissues that were resistant and tissues that were sensitive to desiccation. Water sorption isotherms were constructed for germinated and ungerminated soybean axes and also for fronds of several species of Polypodium with varying tolerance to dehydration. The strength of water binding was determined by van't Hoff as well as D'Arcy/Watt analyses of the isotherms at 5, 15, and/or 25 degrees C. Tissues which were sensitive to desiccation had a poor capacity to bind water tightly. Tightly bound water can be removed from soybean and pea seeds by equilibration at 35 degrees C over very low relative humidities; this results in a reduction in the viability of the seed. We suggest that region 1 water (i.e. water bound with very negative enthalpy values) is an important component of desiccation tolerance.

  1. A Tightly Coupled Non-Equilibrium Magneto-Hydrodynamic Model for Inductively Coupled RF Plasmas

    DTIC Science & Technology

    2016-02-29

    development a tightly coupled magneto-hydrodynamic model for Inductively Coupled Radio- Frequency (RF) Plasmas. Non Local Thermodynamic Equilibrium (NLTE...for Inductively Coupled Radio-Frequency (RF) Plasmas. Non Local Thermodynamic Equilibrium (NLTE) effects are described based on a hybrid State-to-State... thermodynamic variable. This choice allows one to hide the non-linearity of the gas (total) thermal conductivity κ and can partially alle- 2 viate numerical

  2. Three-dimensional modeling of glucose-6-phosphate dehydrogenase-deficient variants from German ancestry.

    PubMed

    Kiani, Farooq; Schwarzl, Sonja; Fischer, Stefan; Efferth, Thomas

    2007-07-18

    Loss of function of dimeric glucose-6-phosphate dehydrogenase (G6PD) represents the most common inborn error of metabolism throughout the world affecting an estimated 400 million people. In Germany, this enzymopathy is very rare. On the basis of G6PD crystal structures, we have analyzed six G6PD variants of German ancestry by three-dimensional modeling. All mutations present in the German population are either close to one of the three G6P or NADP(+) units or to the interface of the two monomers. Two of the three mutated amino acids of G6PD Vancouver are closer to the binding site of NADP(+). The G6PD Aachen mutation is also closer to the second NADP(+) unit. The G6PD Wayne mutation is closer to the G6P binding region. These mutations may affect the binding of G6P and NADP(+) units. Three mutations, i.e. G6PD Munich, G6PD Riverside and G6PD Gastonia, lie closer to the interface of the two monomers. These may also affect the interface of two monomers. None of these G6PD variants share mutations with the common G6PD variants known from the Mediterranean, Near East, or Africa indicating that they have developed independently. The G6PD variants have been compared with mutants from other populations and the implications for survival of G6PD variants from natural selection have been discussed.

  3. Binding of Dihydrostreptomycin to Escherichia coli Ribosomes: Characteristics and Equilibrium of the Reaction

    PubMed Central

    Chang, F. N.; Flaks, Joel G.

    1972-01-01

    The binding of dihydrostreptomycin to ribosomes and ribosomal subunits of a number of different Escherichia coli strains was studied, and the Mg2+ and pH dependence, as well as the effect of salts and polynucleotides, was determined. The only requirement for binding with ribosomes and subunits from susceptible strains was 10 mm Mg2+. Monovalent salts weakened the binding in a manner similar to the effects on ribonucleic acid secondary structure, and this was antagonized to some extent by increased amounts of Mg2+. Bound dihydrostreptomycin could be readily exchanged by streptomycin and any antibiotically active derivative, but not by fragments of the antibiotic or any other aminoglycoside. With native (run-off) 70S ribosomes from streptomycin-susceptible strains, the binding was rapid and relatively temperature independent over the range from 0 to 37 C. Polynucleotides did not stimulate the binding. With concentrations of dihydrostreptomycin up to 10−5m, greater than 95% of native 70S ribosomes bound exactly 1 molecule of the antibiotic tightly, with a Kdiss for the bound complex at 25 C of 9.4 × 10−8m. The following thermodynamic parameters were found for the binding with 70S ribosomes at 25 C:ΔG° = −9.6 kcal/mole, ΔH° = −6.2 kcal/mole, and ΔS° = +11.4 entropy units/mole. Differences in affinity for the antibiotic were found between ribosomes of K-12 strains and those of other E. coli strains. There was insignificant binding to 70S ribosomes or subunits from streptomycin-resistant or -dependent strains, and to 50S subunits from susceptible strains. The binding to 30S subunits from susceptible strains was weaker by an order of magnitude than that to the 70S particle, with a Kdiss at 25 C of 10−6m. Polyuridylic acid stimulated this binding slightly but did not influence the affinity of the bound molecule. At antibiotic concentrations above 10−5m, streptomycin-susceptible 70S and 30S particles bound additional molecules of the antibiotic, and binding also occurred to ribosomes from streptomycin-resistant and -dependent strains, as well as to 50S subunits from all strains. Kdiss for all of these binding equilibria were [Formula: see text] 10−4m. This weaker non-specific binding coincided with the beginning of aggregation phenomena involving the particles, and occurred at sites distinct from the single site which binds the antibiotic tightly. This latter site was completely lost after the one-step mutation to high-level resistance or dependence. PMID:4133236

  4. Flies expand the repertoire of protein structures that bind ice.

    PubMed

    Basu, Koli; Graham, Laurie A; Campbell, Robert L; Davies, Peter L

    2015-01-20

    An antifreeze protein (AFP) with no known homologs has been identified in Lake Ontario midges (Chironomidae). The midge AFP is expressed as a family of isoforms at low levels in adults, which emerge from fresh water in spring before the threat of freezing temperatures has passed. The 9.1-kDa major isoform derived from a preproprotein precursor is glycosylated and has a 10-residue tandem repeating sequence xxCxGxYCxG, with regularly spaced cysteines, glycines, and tyrosines comprising one-half its 79 residues. Modeling and molecular dynamics predict a tightly wound left-handed solenoid fold in which the cysteines form a disulfide core to brace each of the eight 10-residue coils. The solenoid is reinforced by intrachain hydrogen bonds, side-chain salt bridges, and a row of seven stacked tyrosines on the hydrophobic side that forms the putative ice-binding site. A disulfide core is also a feature of the similar-sized beetle AFP that is a β-helix with seven 12-residue coils and a comparable circular dichroism spectrum. The midge and beetle AFPs are not homologous and their ice-binding sites are radically different, with the latter comprising two parallel arrays of outward-pointing threonines. However, their structural similarities is an amazing example of convergent evolution in different orders of insects to cope with change to a colder climate and provide confirmation about the physical features needed for a protein to bind ice.

  5. Structure-based optimization of Cephalothin-analogue boronic acids as β-lactamase inhibitors

    PubMed Central

    Morandi, Stefania; Morandi, Federica; Caselli, Emilia; Shoichet, Brian K.; Prati, Fabio

    2008-01-01

    Boronic acids have proved to be promising selective inhibitors of β-lactamases, acting as transition state analogues. Starting from a previously described nanomolar inhibitor of AmpC β-lactamase, three new inhibitors were designed to gain interactions with highly conserved residues, such as Asn343, and to bind more tightly to the enzyme. Among these, one was obtained by stereoselective synthesis and succeeded in placing its anionic group into the carboxylate binding site of the enzyme, as revealed by X-ray crystallography of the complex inhibitor/AmpC. Nevertheless, it failed at improving affinity, when compared to the lead from which it was derived. The origins of this structural and energetic discrepancy are discussed. PMID:17997318

  6. Molecular Bases of cyclodextrin Adapter Interactions with Engineered Protein Nanopores

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Banerjee, A.; Mikhailova, E; Cheley, S

    2010-01-01

    Engineered protein pores have several potential applications in biotechnology: as sensor elements in stochastic detection and ultrarapid DNA sequencing, as nanoreactors to observe single-molecule chemistry, and in the construction of nano- and micro-devices. One important class of pores contains molecular adapters, which provide internal binding sites for small molecules. Mutants of the {alpha}-hemolysin ({alpha}HL) pore that bind the adapter {beta}-cyclodextrin ({beta}CD) {approx}10{sup 4} times more tightly than the wild type have been obtained. We now use single-channel electrical recording, protein engineering including unnatural amino acid mutagenesis, and high-resolution x-ray crystallography to provide definitive structural information on these engineered protein nanoporesmore » in unparalleled detail.« less

  7. Modeling of three dimensional structure of human alpha-fetoprotein complexed with diethylstilbestrol: docking and molecular dynamics simulation study.

    PubMed

    Terentiev, Alexander A; Moldogazieva, Nurbubu T; Levtsova, Olga V; Maximenko, Dmitry M; Borozdenko, Denis A; Shaitan, Konstantin V

    2012-04-01

    It has been long experimentally demonstrated that human alpha-fetoprotein (HAFP) has an ability to bind immobilized estrogens with the most efficiency for synthetic estrogen analog - diethylstilbestrol (DES). However, the question remains why the human AFP (HAFP), unlike rodent AFP, cannot bind free estrogens. Moreover, despite the fact that AFP was first discovered more than 50 years ago and is presently recognized as a "golden standard" among onco-biomarkers, its three-dimensional (3D) structure has not been experimentally solved yet. In this work using MODELLER program, we generated 3D model of HAFP on the basis of homology with human serum albumin (HSA) and Vitamin D-binding protein (VTDB) with subsequent molecular docking of DES to the model structure and molecular dynamics (MD) simulation study of the complex obtained. The model constructed has U-shaped structure in which a cavity may be distinguished. In this cavity the putative estrogen-binding site is localized. Validation by RMSD calculation and with the use of PROCHECK program showed good quality of the model and stability of extended region of four alpha-helical structures that contains putative hormone-binding residues. Data extracted from MD simulation trajectory allow proposing two types of interactions between amino acid residues of HAFP and DES molecule: (1) hydrogen bonding with involvement of residues S445, R452, and E551; (2) hydrophobic interactions with participation of L138, M448, and M548 residues. A suggestion is made that immobilization of the hormone using a long spacer provides delivery of the estrogen molecule to the binding site and, thereby, facilitates interaction between HAFP and the hormone.

  8. Dynamics and molecular determinants of cytoplasmic lipid droplet clustering and dispersion.

    PubMed

    Orlicky, David J; Monks, Jenifer; Stefanski, Adrianne L; McManaman, James L

    2013-01-01

    Perilipin-1 (Plin1), a prominent cytoplasmic lipid droplet (CLD) binding phosphoprotein and key physiological regulator of triglyceride storage and lipolysis in adipocytes, is thought to regulate the fragmentation and dispersion of CLD that occurs in response to β-adrenergic activation of adenylate cyclase. Here we investigate the dynamics and molecular determinants of these processes using cell lines stably expressing recombinant forms of Plin1 and/or other members of the perilipin family. Plin1 and a C-terminal CLD-binding fragment of Plin1 (Plin1CT) induced formation of single dense CLD clusters near the microtubule organizing center, whereas neither an N-terminal CLD-binding fragment of Plin1, nor Plin2 or Plin3 induced clustering. Clustered CLD coated by Plin1, or Plin1CT, dispersed in response to isoproterenol, or other agents that activate adenylate cyclase, in a process inhibited by the protein kinase A inhibitor, H89, and blocked by microtubule disruption. Isoproterenol-stimulated phosphorylation of CLD-associated Plin1 on serine 492 preceded their dispersion, and live cell imaging showed that cluster dispersion involved initial fragmentation of tight clusters into multiple smaller clusters, which then fragmented into well-dispersed individual CLD. siRNA knockdown of the cortical actin binding protein, moesin, induced disaggregation of tight clusters into multiple smaller clusters, and inhibited the reaggregation of dispersed CLD into tight clusters. Together these data suggest that the clustering and dispersion processes involve a complex orchestration of phosphorylation-dependent, microtubule-dependent and independent, and microfilament dependent steps.

  9. Studies of the interaction between FNC and human hemoglobin: a spectroscopic analysis and molecular docking.

    PubMed

    Li, Huiyi; Dou, Huanjing; Zhang, Yuhai; Li, Zhigang; Wang, Ruiyong; Chang, Junbiao

    2015-02-05

    FNC (2'-deoxy-2'-bfluoro-4'-azidocytidine) is a novel nucleoside analogue with pharmacologic effects on several human diseases. In this work, the binding of FNC to human hemoglobin (HHb) have been investigated by absorption spectroscopy, fluorescence quenching technique, synchronous fluorescence, three-dimensional fluorescence and molecular modeling methods. Analysis of fluorescence data showed that the binding of FNC to HHb occurred via a static quenching mechanism. Thermodynamic analysis and molecular modeling suggest that hydrogen bond and van der Waals force are the mainly binding force in the binding of FNC to HHb. Copyright © 2014 Elsevier B.V. All rights reserved.

  10. Physical signals for protein-DNA recognition

    NASA Astrophysics Data System (ADS)

    Cao, Xiao-Qin; Zeng, Jia; Yan, Hong

    2009-09-01

    This paper discovers consensus physical signals around eukaryotic splice sites, transcription start sites, and replication origin start and end sites on a genome-wide scale based on their DNA flexibility profiles calculated by three different flexibility models. These salient physical signals are localized highly rigid and flexible DNAs, which may play important roles in protein-DNA recognition by the sliding search mechanism. The found physical signals lead us to a detailed hypothetical view of the search process in which a DNA-binding protein first finds a genomic region close to the target site from an arbitrary starting location by three-dimensional (3D) hopping and intersegment transfer mechanisms for long distances, and subsequently uses the one-dimensional (1D) sliding mechanism facilitated by the localized highly rigid DNAs to accurately locate the target flexible binding site within 30 bp (base pair) short distances. Guided by these physical signals, DNA-binding proteins rapidly search the entire genome to recognize a specific target site from the 3D to 1D pathway. Our findings also show that current promoter prediction programs (PPPs) based on DNA physical properties may suffer from lots of false positives because other functional sites such as splice sites and replication origins have similar physical signals as promoters do.

  11. Substrate specificity of pyrimidine nucleoside phosphorylases of NP-II family probed by X-ray crystallography and molecular modeling

    NASA Astrophysics Data System (ADS)

    Balaev, V. V.; Lashkov, A. A.; Prokofev, I. I.; Gabdulkhakov, A. G.; Seregina, T. A.; Mironov, A. S.; Betzel, C.; Mikhailov, A. M.

    2016-09-01

    Pyrimidine nucleoside phosphorylases, which are widely used in the biotechnological production of nucleosides, have different substrate specificity for pyrimidine nucleosides. An interesting feature of these enzymes is that the three-dimensional structure of thymidine-specific nucleoside phosphorylase is similar to the structure of nonspecific pyrimidine nucleoside phosphorylase. The three-dimensional structures of thymidine phosphorylase from Salmonella typhimurium and nonspecific pyrimidine nucleoside phosphorylase from Bacillus subtilis in complexes with a sulfate anion were determined for the first time by X-ray crystallography. An analysis of the structural differences between these enzymes demonstrated that Lys108, which is involved in the phosphate binding in pyrimidine nucleoside phosphorylase, corresponds to Met111 in thymidine phosphorylases. This difference results in a decrease in the charge on one of the hydroxyl oxygens of the phosphate anion in thymidine phosphorylase and facilitates the catalysis through SN2 nucleophilic substitution. Based on the results of X-ray crystallography, the virtual screening was performed for identifying a potent inhibitor (anticancer agent) of nonspecific pyrimidine nucleoside phosphorylase, which does not bind to thymidine phosphorylase. The molecular dynamics simulation revealed the stable binding of the discovered compound—2-pyrimidin-2-yl-1H-imidazole-4-carboxylic acid—to the active site of pyrimidine nucleoside phosphorylase.

  12. Understanding the length dependence of molecular junction thermopower.

    PubMed

    Karlström, Olov; Strange, Mikkel; Solomon, Gemma C

    2014-01-28

    Thermopower of molecular junctions is sensitive to details in the junction and may increase, decrease, or saturate with increasing chain length, depending on the system. Using McConnell's theory for exponentially suppressed transport together with a simple and easily interpretable tight binding model, we show how these different behaviors depend on the molecular backbone and its binding to the contacts. We distinguish between resonances from binding groups or undercoordinated electrode atoms, and those from the periodic backbone. It is demonstrated that while the former gives a length-independent contribution to the thermopower, possibly changing its sign, the latter determines its length dependence. This means that the question of which orbitals from the periodic chain that dominate the transport should not be inferred from the sign of the thermopower but from its length dependence. We find that the same molecular backbone can, in principle, show four qualitatively different thermopower trends depending on the binding group: It can be positive or negative for short chains, and it can either increase or decrease with length.

  13. Is DNA a metal, semiconductor or insulator? A theoretical approach

    NASA Astrophysics Data System (ADS)

    Rey-Gonzalez, Rafael; Fonseca-Romero, Karen; Plazas, Carlos; Grupo de Óptica e Información Cuántica Team

    Over the last years, scientific interest for designing and making low dimensional electronic devices with traditional or novel materials has been increased. These experimental and theoretical researches in electronic properties at molecular scale are looking for developing efficient devices able to carry out tasks which are currently done by silicon transistors and devices. Among the new materials DNA strands are highlighted, but the experimental results have been contradictories pointing to behaviors as conductor, semiconductor or insulator. To contribute to the understanding of the origin of the disparity of the measurements, we perform a numerical calculation of the electrical conductance of DNA segments, modeled as 1D disordered finite chains. The system is described into a Tight binding model with nearest neighbor interactions and a s orbital per site. Hydration effects are included as random variations of self-energies. The electronic current as a function of applied bias is calculated using Launder formalism, where the transmission probability is determined into the transfer matrix formalism. We find a conductor-to-semiconductor-to-insulator transition as a function of the three effects taken into account: chain size, intrinsic disorder, and hydration We thank Fundación para la Promoción de la Investigación y la Tecnología, Colombia, and Dirección de Investigación de Bogotá, Universidad Nacional de Colombia, for partial financial support.

  14. Patterning of Functional Antibodies and Other Proteins by Photolithography of Silane Monolayers

    NASA Astrophysics Data System (ADS)

    Mooney, J. F.; Hunt, A. J.; McIntosh, J. R.; Liberko, C. A.; Walba, D. M.; Rogers, C. T.

    1996-10-01

    We have demonstrated the assembly of two-dimensional patterns of functional antibodies on a surface. In particular, we have selectively adsorbed micrometer-scale regions of biotinylated immunoglobulin that exhibit specific antigen binding after adsorption. The advantage of this technique is its potential adaptability to adsorbing arbitrary proteins in tightly packed monolayers while retaining functionality. The procedure begins with the formation of a self-assembled monolayer of n-octadecyltrimethoxysilane (OTMS) on a silicon dioxide surface. This monolayer can then be selectively removed by UV photolithography. Under appropriate solution conditions, the OTMS regions will adsorb a monolayer of bovine serum albumin (BSA), while the silicon dioxide regions where the OTMS has been removed by UV light will adsorb less than 2% of a monolayer, thus creating high contrast patterned adsorption of BSA. The attachment of the molecule biotin to the BSA allows the pattern to be replicated in a layer of streptavidin, which bonds to the biotinylated BSA and in turn will bond an additional layer of an arbitrary biotinylated protein. In our test case, functionality of the biotinylated goat antibodies raised against mouse immunoglobulin was demonstrated by the specific binding of fluorescently labeled mouse IgG.

  15. A Novel, Highly Stable Fold of the Immunoglobulin Binding Domain of Streptococcal Protein G

    NASA Astrophysics Data System (ADS)

    Gronenborn, Angela M.; Filpula, David R.; Essig, Nina Z.; Achari, Aniruddha; Whitlow, Marc; Wingfield, Paul T.; Marius Clore, G.

    1991-08-01

    The high-resolution three-dimensional structure of a single immunoglobulin binding domain (B1, which comprises 56 residues including the NH_2-terminal Met) of protein G from group G Streptococcus has been determined in solution by nuclear magnetic resonance spectroscopy on the basis of 1058 experimental restraints. The average atomic root-mean-square distribution about the mean coordinate positions is 0.27 angstrom (overset{circ}{mathrm A}) for the backbone atoms, 0.65 overset{circ}{mathrm A} for all atoms, and 0.39 overset{circ}{mathrm A} for atoms excluding disordered surface side chains. The structure has no disulfide bridges and is composed of a four-stranded β sheet, on top of which lies a long helix. The central two strands (β 1 and β 4), comprising the NH_2- and COOH-termini, are parallel, and the outer two strands (β 2 and β 3) are connected by the helix in a +3x crossover. This novel topology (-1, +3x, -1), coupled with an extensive hydrogen-bonding network and a tightly packed and buried hydrophobic core, is probably responsible for the extreme thermal stability of this small domain (reversible melting at 87^circC).

  16. In silico ligand binding studies of cyanogenic β-glucosidase, dhurrinase-2 from Sorghum bicolor.

    PubMed

    Mahajan, Chavi; Patel, Krunal; Khan, Bashir M; Rawal, Shuban S

    2015-07-01

    Dhurrinase, a cyanogenic β-glucosidase from Sorghum bicolor is the key enzyme responsible for the hydrolysis of dhurrin to produce toxic hydrogen cyanide, as a part of plant defence mechanism. Dhurrinase 1 (SbDhr1) and dhurrinase 2 (SbDhr2), two isozymes have been isolated and characterized from S. bicolor. However, there is no information in the literature about the three dimensional (3D) structure of SbDhr2 and molecular interactions involved between the protein and ligand. In this study, the three dimensional structure of SbDhr2 was built based on homology modeling by using the X-ray crystallographic structure of its close homologue SbDhr1 as the template. The generated 3D model was energy minimized and the quality was validated by Ramachndran plot, various bioinformatic tools and their relevant parameters. Stability, folding-unfolding and flexibility of the modeled SbDhr2 was evaluated on the basis of RMSD, radius of gyration (Rg) and RMSF values respectively, obtained through molecular dynamic (MD) simulation. Further, molecular docking was performed with its natural substrate dhurrin, one substrate analogue, three un-natural substrates, and one inhibitor. Analysis of molecular interactions in the SbDhr2-ligand complexes revealed the key amino acid residues responsible to stabilize the ligands within the binding pocket through non-bonded interactions and some of them were found to be conserved (Glu239, Tyr381, Trp426, Glu454, Trp511). Reasonably broader substrate specificity of SbDhr2 was explained through the wider entrance passage observed in comparison to SbDhr1.

  17. Superposition and alignment of labeled point clouds.

    PubMed

    Fober, Thomas; Glinca, Serghei; Klebe, Gerhard; Hüllermeier, Eyke

    2011-01-01

    Geometric objects are often represented approximately in terms of a finite set of points in three-dimensional euclidean space. In this paper, we extend this representation to what we call labeled point clouds. A labeled point cloud is a finite set of points, where each point is not only associated with a position in three-dimensional space, but also with a discrete class label that represents a specific property. This type of model is especially suitable for modeling biomolecules such as proteins and protein binding sites, where a label may represent an atom type or a physico-chemical property. Proceeding from this representation, we address the question of how to compare two labeled points clouds in terms of their similarity. Using fuzzy modeling techniques, we develop a suitable similarity measure as well as an efficient evolutionary algorithm to compute it. Moreover, we consider the problem of establishing an alignment of the structures in the sense of a one-to-one correspondence between their basic constituents. From a biological point of view, alignments of this kind are of great interest, since mutually corresponding molecular constituents offer important information about evolution and heredity, and can also serve as a means to explain a degree of similarity. In this paper, we therefore develop a method for computing pairwise or multiple alignments of labeled point clouds. To this end, we proceed from an optimal superposition of the corresponding point clouds and construct an alignment which is as much as possible in agreement with the neighborhood structure established by this superposition. We apply our methods to the structural analysis of protein binding sites.

  18. Modeling of protein binary complexes using structural mass spectrometry data

    PubMed Central

    Kamal, J.K. Amisha; Chance, Mark R.

    2008-01-01

    In this article, we describe a general approach to modeling the structure of binary protein complexes using structural mass spectrometry data combined with molecular docking. In the first step, hydroxyl radical mediated oxidative protein footprinting is used to identify residues that experience conformational reorganization due to binding or participate in the binding interface. In the second step, a three-dimensional atomic structure of the complex is derived by computational modeling. Homology modeling approaches are used to define the structures of the individual proteins if footprinting detects significant conformational reorganization as a function of complex formation. A three-dimensional model of the complex is constructed from these binary partners using the ClusPro program, which is composed of docking, energy filtering, and clustering steps. Footprinting data are used to incorporate constraints—positive and/or negative—in the docking step and are also used to decide the type of energy filter—electrostatics or desolvation—in the successive energy-filtering step. By using this approach, we examine the structure of a number of binary complexes of monomeric actin and compare the results to crystallographic data. Based on docking alone, a number of competing models with widely varying structures are observed, one of which is likely to agree with crystallographic data. When the docking steps are guided by footprinting data, accurate models emerge as top scoring. We demonstrate this method with the actin/gelsolin segment-1 complex. We also provide a structural model for the actin/cofilin complex using this approach which does not have a crystal or NMR structure. PMID:18042684

  19. Novel acetylcholinesterase inhibitors from Zijuan tea and biosynthetic pathway of caffeoylated catechin in tea plant.

    PubMed

    Wang, Wei; Fu, Xi-Wen; Dai, Xin-Long; Hua, Fang; Chu, Gang-Xiu; Chu, Ming-Jie; Hu, Feng-Lin; Ling, Tie-Jun; Gao, Li-Ping; Xie, Zhong-Wen; Wan, Xiao-Chun; Bao, Guan-Hu

    2017-12-15

    Zijuan tea is a special cultivar of Yunnan broad-leaf tea (Camellia sinensis var. assamica) with purple buds, leaves, and stems. Phytochemical study on this tea led to the discovery of three hydroxycinnamoylated catechins (HCCs) (1-3), seven other catechins (4-10), three proanthocyanidins (11-13), five flavones and flavone glycosides (14-18), two alkaloids (19, 20), one steroid (21), and one phenylpropanoid glycoside (22). The isolation and structural elucidation of the caffeoylated catechin (1) by means of spectroscopic techniques were described. We also provide the first evidence that 1 is synthesized via a two-step pathway in tea plant. The three HCCs (1-3) were investigated on their bioactivity through molecular modeling simulation and biochemical experiments. Our results show that they bind acetylcholinesterase (AChE) tightly and have strong AChE inhibitory activity with IC 50 value at 2.49, 11.41, 62.26μM, respectively. Copyright © 2017 Elsevier Ltd. All rights reserved.

  20. Spin Transfer torques in Antiferromagnets

    NASA Astrophysics Data System (ADS)

    Saidaoui, Hamed; Waintal, Xavier; Manchon, Aurelien; Spsms, Cea, Grenoble France Collaboration

    2013-03-01

    Spin Transfer Torque (STT) has attracted tremendously growing interest in the past two decades. Consisting on the transfer of spin angular momentum of a spin polarized current to local magnetic moments, the STT gives rise to a complex dynamics of the magnetization. Depending on the the structure, the STT shows a dominated In plane component for spin valves, whereas both components coexist for magnetic tunneling junctions (MTJ). For latter case the symmetry of the structure is considered to be decisive in identifying the nature and behavior of the torque. In the present study we are interested in magnetic structures where we substitute either one or both of the magnetic layers by antiferromagnets (AF). We use Non-equilibrium Green's function formalism applied on a tight-binding model to investigate the nature of the spin torque. We notice the presence of two types of torque exerted on (AF), a torque which tends to rotate the order parameter and another one that competes with the exchange interaction. We conclude by comparison with previous works.

  1. Three-dimensional organotypic co-culture model of intestinal epithelial cells and macrophages to study Salmonella enterica colonization patterns.

    PubMed

    Barrila, Jennifer; Yang, Jiseon; Crabbé, Aurélie; Sarker, Shameema F; Liu, Yulong; Ott, C Mark; Nelman-Gonzalez, Mayra A; Clemett, Simon J; Nydam, Seth D; Forsyth, Rebecca J; Davis, Richard R; Crucian, Brian E; Quiriarte, Heather; Roland, Kenneth L; Brenneman, Karen; Sams, Clarence; Loscher, Christine; Nickerson, Cheryl A

    2017-01-01

    Three-dimensional models of human intestinal epithelium mimic the differentiated form and function of parental tissues often not exhibited by two-dimensional monolayers and respond to Salmonella in key ways that reflect in vivo infections. To further enhance the physiological relevance of three-dimensional models to more closely approximate in vivo intestinal microenvironments encountered by Salmonella , we developed and validated a novel three-dimensional co-culture infection model of colonic epithelial cells and macrophages using the NASA Rotating Wall Vessel bioreactor. First, U937 cells were activated upon collagen-coated scaffolds. HT-29 epithelial cells were then added and the three-dimensional model was cultured in the bioreactor until optimal differentiation was reached, as assessed by immunohistochemical profiling and bead uptake assays. The new co-culture model exhibited in vivo-like structural and phenotypic characteristics, including three-dimensional architecture, apical-basolateral polarity, well-formed tight/adherens junctions, mucin, multiple epithelial cell types, and functional macrophages. Phagocytic activity of macrophages was confirmed by uptake of inert, bacteria-sized beads. Contribution of macrophages to infection was assessed by colonization studies of Salmonella pathovars with different host adaptations and disease phenotypes (Typhimurium ST19 strain SL1344 and ST313 strain D23580; Typhi Ty2). In addition, Salmonella were cultured aerobically or microaerobically, recapitulating environments encountered prior to and during intestinal infection, respectively. All Salmonella strains exhibited decreased colonization in co-culture (HT-29-U937) relative to epithelial (HT-29) models, indicating antimicrobial function of macrophages. Interestingly, D23580 exhibited enhanced replication/survival in both models following invasion. Pathovar-specific differences in colonization and intracellular co-localization patterns were observed. These findings emphasize the power of incorporating a series of related three-dimensional models within a study to identify microenvironmental factors important for regulating infection.

  2. Strain-modulated anisotropy of quantum transport properties in single-layer silicene: Spin and valley filtering

    NASA Astrophysics Data System (ADS)

    Farokhnezhad, M.; Esmaeilzadeh, M.; Shakouri, Kh.

    2017-11-01

    Strained two-dimensional crystals often offer novel physical properties that are usable to improve their electronic performance. Here we show by the theory of elasticity combined with the tight-binding approximation that local strains in silicene can open up new prospects for generating fully polarized spin and valley currents. The trajectory of electrons flowing through locally strained regions obeys the same behavior as light waves propagating in uniaxial anisotropic materials. The refraction angle of electrons at local strain boundaries exhibits a strong dependence on the valley degree of freedom, allowing for valley filtering based on the strain direction. The ability to control the spin polarization direction additionally requires a perpendicular electric field to be involved in combination with the local strain. Further similarities of the problem with optics of anisotropic materials are elucidated and possible applications in spin- and valleytronic nanodevices are discussed.

  3. Solvation of fluoro-acetonitrile in water by 2D-IR spectroscopy: A combined experimental-computational study

    NASA Astrophysics Data System (ADS)

    Cazade, Pierre-André; Tran, Halina; Bereau, Tristan; Das, Akshaya K.; Kläsi, Felix; Hamm, Peter; Meuwly, Markus

    2015-06-01

    The solvent dynamics around fluorinated acetonitrile is characterized by 2-dimensional infrared spectroscopy and atomistic simulations. The lineshape of the linear infrared spectrum is better captured by semiempirical (density functional tight binding) mixed quantum mechanical/molecular mechanics simulations, whereas force field simulations with multipolar interactions yield lineshapes that are significantly too narrow. For the solvent dynamics, a relatively slow time scale of 2 ps is found from the experiments and supported by the mixed quantum mechanical/molecular mechanics simulations. With multipolar force fields fitted to the available thermodynamical data, the time scale is considerably faster—on the 0.5 ps time scale. The simulations provide evidence for a well established CF-HOH hydrogen bond (population of 25%) which is found from the radial distribution function g(r) from both, force field and quantum mechanics/molecular mechanics simulations.

  4. Probing the human estrogen receptor-α binding requirements for phenolic mono- and di-hydroxyl compounds: A combined synthesis, binding and docking study

    PubMed Central

    McCullough, Christopher; Neumann, Terrence S.; Gone, Jayapal Reddy; He, Zhengjie; Herrild, Christian; Wondergem, Julie; Pandey, Rajesh K.; Donaldson, William A.; Sem, Daniel S.

    2014-01-01

    Various estrogen analogs were synthesized and tested for binding to human ERα using a fluorescence polarization displacement assay. Binding affinity and orientation were also predicted using docking calculations. Docking was able to accurately predict relative binding affinity and orientation for estradiol, but only if a tightly bound water molecule bridging Arg394/Glu353 is present. Di-hydroxyl compounds sometimes bind in two orientations, which are flipped in terms of relative positioning of their hydroxyl groups. Di-hydroxyl compounds were predicted to bind with their aliphatic hydroxyl group interacting with His524 in ERα. One nonsteroid-based dihdroxyl compound was 1000-fold specific for ERβ over ERα, and was also 25-fold specific for agonist ERβ versus antagonist activity. Docking predictions suggest this specificity may be due to interaction of the aliphatic hydroxyl with His475 in the agonist form of ERβ, versus with Thr299 in the antagonist form. But, the presence of this aliphatic hydroxyl is not required in all compounds, since mono-hydroxyl (phenolic) compounds bind ERα with high affinity, via hydroxyl hydrogen bonding interactions with the ERα Arg394/Glu353/water triad, and van der Waals interactions with the rest of the molecule. PMID:24315190

  5. Weak partitioning chromatography for anion exchange purification of monoclonal antibodies.

    PubMed

    Kelley, Brian D; Tobler, Scott A; Brown, Paul; Coffman, Jonathan L; Godavarti, Ranga; Iskra, Timothy; Switzer, Mary; Vunnum, Suresh

    2008-10-15

    Weak partitioning chromatography (WPC) is an isocratic chromatographic protein separation method performed under mobile phase conditions where a significant amount of the product protein binds to the resin, well in excess of typical flowthrough operations. The more stringent load and wash conditions lead to improved removal of more tightly binding impurities, although at the cost of a reduction in step yield. The step yield can be restored by extending the column load and incorporating a short wash at the end of the load stage. The use of WPC with anion exchange resins enables a two-column cGMP purification platform to be used for many different mAbs. The operating window for WPC can be easily established using high throughput batch-binding screens. Under conditions that favor very strong product binding, competitive effects from product binding can give rise to a reduction in column loading capacity. Robust performance of WPC anion exchange chromatography has been demonstrated in multiple cGMP mAb purification processes. Excellent clearance of host cell proteins, leached Protein A, DNA, high molecular weight species, and model virus has been achieved. (c) 2008 Wiley Periodicals, Inc.

  6. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kolmann, Stephen J.; D'Arcy, Jordan H.; Jordan, Meredith J. T., E-mail: m.jordan@chem.usyd.edu.au

    Quantum and anharmonic effects are investigated in H{sub 2}-Li{sup +}-benzene, a model for hydrogen adsorption in metal-organic frameworks and carbon-based materials. Three- and 8-dimensional quantum diffusion Monte Carlo (QDMC) and rigid-body diffusion Monte Carlo (RBDMC) simulations are performed on potential energy surfaces interpolated from electronic structure calculations at the M05-2X/6-31+G(d,p) and M05-2X/6-311+G(2df,p) levels of theory using a three-dimensional spline or a modified Shepard interpolation. These calculations investigate the intermolecular interactions in this system, with three- and 8-dimensional 0 K H{sub 2} binding enthalpy estimates, ΔH{sub bind} (0 K), being 16.5 kJ mol{sup −1} and 12.4 kJ mol{sup −1}, respectively: 0.1 and 0.6more » kJ mol{sup −1} higher than harmonic values. Zero-point energy effects are 35% of the value of ΔH{sub bind} (0 K) at M05-2X/6-311+G(2df,p) and cannot be neglected; uncorrected electronic binding energies overestimate ΔH{sub bind} (0 K) by at least 6 kJ mol{sup −1}. Harmonic intermolecular binding enthalpies can be corrected by treating the H{sub 2} “helicopter” and “ferris wheel” rotations as free and hindered rotations, respectively. These simple corrections yield results within 2% of the 8-dimensional anharmonic calculations. Nuclear ground state probability density histograms obtained from the QDMC and RBDMC simulations indicate the H{sub 2} molecule is delocalized above the Li{sup +}-benzene system at 0 K.« less

  7. Dissipation of the Herbicide Benzobicyclon Hydrolysate in a Model California Rice Field Soil.

    PubMed

    Williams, Katryn L; Gladfelder, Joshua J; Quigley, Lindsay L; Ball, David B; Tjeerdema, Ronald S

    2017-10-25

    The herbicide benzobicyclon (BZB; 3-(2-chloro-4-(methylsulfonyl)benzoyl)-2-phenylthiobicyclo[3.2.1]oct-2-en-4-one) has recently been approved for use on California rice fields by the United States Environmental Protection Agency (U.S. EPA). Hydrolysis of BZB rapidly forms the active compound, benzobicyclon hydrolysate (BH), whose fate is currently not well understood. A model California rice soil was used to determine BH soil dissipation. The pK a and aqueous solubility were also determined, as experimental values are not currently available. Sorption data indicate BH does not bind tightly, or irreversibly, with this soil. Flooding resulted in decreased BH loss, indicating anaerobic microbes are less likely to transform BH compared to aerobic microorganisms. Temperature increased dissipation, while autoclaving decreased BH loss. Overall, dissipation was slow regardless of treatment. Further investigation is needed to elucidate the exact routes of loss in soil, though BH is expected to dissipate slowly in flooded rice field soil.

  8. Simple extrapolation method to predict the electronic structure of conjugated polymers from calculations on oligomers

    DOE PAGES

    Larsen, Ross E.

    2016-04-12

    In this study, we introduce two simple tight-binding models, which we call fragment frontier orbital extrapolations (FFOE), to extrapolate important electronic properties to the polymer limit using electronic structure calculations on only a few small oligomers. In particular, we demonstrate by comparison to explicit density functional theory calculations that for long oligomers the energies of the highest occupied molecular orbital (HOMO), the lowest unoccupied molecular orbital (LUMO), and of the first electronic excited state are accurately described as a function of number of repeat units by a simple effective Hamiltonian parameterized from electronic structure calculations on monomers, dimers and, optionally,more » tetramers. For the alternating copolymer materials that currently comprise some of the most efficient polymer organic photovoltaic devices one can use these simple but rigorous models to extrapolate computed properties to the polymer limit based on calculations on a small number of low-molecular-weight oligomers.« less

  9. Structural Elucidation of the Cell-Penetrating Penetratin Peptide in Model Membranes at the Atomic Level: Probing Hydrophobic Interactions in the Blood-Brain Barrier.

    PubMed

    Bera, Swapna; Kar, Rajiv K; Mondal, Susanta; Pahan, Kalipada; Bhunia, Anirban

    2016-09-06

    Cell-penetrating peptides (CPPs) have shown promise in nonpermeable therapeutic drug delivery, because of their ability to transport a variety of cargo molecules across the cell membranes and their noncytotoxicity. Drosophila antennapedia homeodomain-derived CPP penetratin (RQIKIWFQNRRMKWKK), being rich in positively charged residues, has been increasingly used as a potential drug carrier for various purposes. Penetratin can breach the tight endothelial network known as the blood-brain barrier (BBB), permitting treatment of several neurodegenerative maladies, including Alzheimer's disease, Parkinson's disease, and Huntington's disease. However, a detailed structural understanding of penetratin and its mechanism of action is lacking. This study defines structural features of the penetratin-derived peptide, DK17 (DRQIKIWFQNRRMKWKK), in several model membranes and describes a membrane-induced conformational transition of the DK17 peptide in these environments. A series of biophysical experiments, including high-resolution nuclear magnetic resonance spectroscopy, provides the three-dimensional structure of DK17 in different membranes mimicking the BBB or total brain lipid extract. Molecular dynamics simulations support the experimental results showing preferential binding of DK17 to particular lipids at atomic resolution. The peptide conserves the structure of the subdomain spanning residues Ile6-Arg11, despite considerable conformational variation in different membrane models. In vivo data suggest that the wild type, not a mutated sequence, enters the central nervous system. Together, these data highlight important structural and functional attributes of DK17 that could be utilized in drug delivery for neurodegenerative disorders.

  10. Predicting Ligand Binding Sites on Protein Surfaces by 3-Dimensional Probability Density Distributions of Interacting Atoms

    PubMed Central

    Jian, Jhih-Wei; Elumalai, Pavadai; Pitti, Thejkiran; Wu, Chih Yuan; Tsai, Keng-Chang; Chang, Jeng-Yih; Peng, Hung-Pin; Yang, An-Suei

    2016-01-01

    Predicting ligand binding sites (LBSs) on protein structures, which are obtained either from experimental or computational methods, is a useful first step in functional annotation or structure-based drug design for the protein structures. In this work, the structure-based machine learning algorithm ISMBLab-LIG was developed to predict LBSs on protein surfaces with input attributes derived from the three-dimensional probability density maps of interacting atoms, which were reconstructed on the query protein surfaces and were relatively insensitive to local conformational variations of the tentative ligand binding sites. The prediction accuracy of the ISMBLab-LIG predictors is comparable to that of the best LBS predictors benchmarked on several well-established testing datasets. More importantly, the ISMBLab-LIG algorithm has substantial tolerance to the prediction uncertainties of computationally derived protein structure models. As such, the method is particularly useful for predicting LBSs not only on experimental protein structures without known LBS templates in the database but also on computationally predicted model protein structures with structural uncertainties in the tentative ligand binding sites. PMID:27513851

  11. Chemically Doped Double-Walled Carbon Nanotubes: Cylindrical Molecular Capacitors

    NASA Astrophysics Data System (ADS)

    Chen, Gugang; Bandow, S.; Margine, E. R.; Nisoli, C.; Kolmogorov, A. N.; Crespi, Vincent H.; Gupta, R.; Sumanasekera, G. U.; Iijima, S.; Eklund, P. C.

    2003-06-01

    A double-walled carbon nanotube is used to study the radial charge distribution on the positive inner electrode of a cylindrical molecular capacitor. The outer electrode is a shell of bromine anions. Resonant Raman scattering from phonons on each carbon shell reveals the radial charge distribution. A self-consistent tight-binding model confirms the observed molecular Faraday cage effect, i.e., most of the charge resides on the outer wall, even when this wall was originally semiconducting and the inner wall was metallic.

  12. Chemically doped double-walled carbon nanotubes: cylindrical molecular capacitors.

    PubMed

    Chen, Gugang; Bandow, S; Margine, E R; Nisoli, C; Kolmogorov, A N; Crespi, Vincent H; Gupta, R; Sumanasekera, G U; Iijima, S; Eklund, P C

    2003-06-27

    A double-walled carbon nanotube is used to study the radial charge distribution on the positive inner electrode of a cylindrical molecular capacitor. The outer electrode is a shell of bromine anions. Resonant Raman scattering from phonons on each carbon shell reveals the radial charge distribution. A self-consistent tight-binding model confirms the observed molecular Faraday cage effect, i.e., most of the charge resides on the outer wall, even when this wall was originally semiconducting and the inner wall was metallic.

  13. Methylation effect on the ohmic resistance of a poly-GC DNA-like chain

    NASA Astrophysics Data System (ADS)

    de Moura, F. A. B. F.; Lyra, M. L.; de Almeida, M. L.; Ourique, G. S.; Fulco, U. L.; Albuquerque, E. L.

    2016-10-01

    We determine, by using a tight-binding model Hamiltonian, the characteristic current-voltage (IxV) curves of a 5-methylated cytosine single strand poly-GC DNA-like finite segment, considering the methyl groups attached laterally to a random fraction of the cytosine basis. Striking, we found that the methylation significantly impacts the ohmic resistance (R) of the DNA-like segments, indicating that measurements of R can be used as a biosensor tool to probe the presence of anomalous methylation.

  14. Interactions of Kid–Kis toxin–antitoxin complexes with the parD operator-promoter region of plasmid R1 are piloted by the Kis antitoxin and tuned by the stoichiometry of Kid–Kis oligomers

    PubMed Central

    Monti, Maria C.; Hernández-Arriaga, Ana M.; Kamphuis, Monique B.; López-Villarejo, Juan; Heck, Albert J. R.; Boelens, Rolf; Díaz-Orejas, Ramón; van den Heuvel, Robert H. H.

    2007-01-01

    The parD operon of Escherichia coli plasmid R1 encodes a toxin–antitoxin system, which is involved in plasmid stabilization. The toxin Kid inhibits cell growth by RNA degradation and its action is neutralized by the formation of a tight complex with the antitoxin Kis. A fascinating but poorly understood aspect of the kid–kis system is its autoregulation at the transcriptional level. Using macromolecular (tandem) mass spectrometry and DNA binding assays, we here demonstrate that Kis pilots the interaction of the Kid–Kis complex in the parD regulatory region and that two discrete Kis-binding regions are present on parD. The data clearly show that only when the Kis concentration equals or exceeds the Kid concentration a strong cooperative effect exists between strong DNA binding and Kid2–Kis2–Kid2–Kis2 complex formation. We propose a model in which transcriptional repression of the parD operon is tuned by the relative molar ratio of the antitoxin and toxin proteins in solution. When the concentration of the toxin exceeds that of the antitoxin tight Kid2–Kis2–Kid2 complexes are formed, which only neutralize the lethal activity of Kid. Upon increasing the Kis concentration, (Kid2–Kis2)n complexes repress the kid–kis operon. PMID:17317682

  15. Comparisons between thermodynamic and one-dimensional combustion models of spark-ignition engines

    NASA Technical Reports Server (NTRS)

    Ramos, J. I.

    1986-01-01

    Results from a one-dimensional combustion model employing a constant eddy diffusivity and a one-step chemical reaction are compared with those of one-zone and two-zone thermodynamic models to study the flame propagation in a spark-ignition engine. One-dimensional model predictions are found to be very sensitive to the eddy diffusivity and reaction rate data. The average mixing temperature found using the one-zone thermodynamic model is higher than those of the two-zone and one-dimensional models during the compression stroke, and that of the one-dimensional model is higher than those predicted by both thermodynamic models during the expansion stroke. The one-dimensional model is shown to predict an accelerating flame even when the front approaches the cold cylinder wall.

  16. Two potential calmodulin-binding sequences in the ryanodine receptor contribute to a mobile, intra-subunit calmodulin-binding domain

    PubMed Central

    Huang, Xiaojun; Liu, Ying; Wang, Ruiwu; Zhong, Xiaowei; Liu, Yingjie; Koop, Andrea; Chen, S. R. Wayne; Wagenknecht, Terence; Liu, Zheng

    2013-01-01

    Summary Calmodulin (CaM), a 16 kDa ubiquitous calcium-sensing protein, is known to bind tightly to the calcium release channel/ryanodine receptor (RyR), and modulate RyR function. CaM binding studies using RyR fragments or synthetic peptides have revealed the presence of multiple, potential CaM-binding regions in the primary sequence of RyR. In the present study, we inserted GFP into two of these proposed CaM-binding sequences and mapped them onto the three-dimensional structure of intact cardiac RyR2 by cryo-electron microscopy. Interestingly, we found that the two potential CaM-binding regions encompassing, Arg3595 and Lys4269, respectively, are in close proximity and are adjacent to the previously mapped CaM-binding sites. To monitor the conformational dynamics of these CaM-binding regions, we generated a fluorescence resonance energy transfer (FRET) pair, a dual CFP- and YFP-labeled RyR2 (RyR2R3595-CFP/K4269-YFP) with CFP inserted after Arg3595 and YFP inserted after Lys4269. We transfected HEK293 cells with the RyR2R3595-CFP/K4269-YFP cDNA, and examined their FRET signal in live cells. We detected significant FRET signals in transfected cells that are sensitive to the channel activator caffeine, suggesting that caffeine is able to induce conformational changes in these CaM-binding regions. Importantly, no significant FRET signals were detected in cells co-transfected with cDNAs encoding the single CFP (RyR2R3595-CFP) and single YFP (RyR2K4269-YFP) insertions, indicating that the FRET signal stemmed from the interaction between R3595–CFP and K4269–YFP that are in the same RyR subunit. These observations suggest that multiple regions in the RyR2 sequence may contribute to an intra-subunit CaM-binding pocket that undergoes conformational changes during channel gating. PMID:23868982

  17. Prominence Mass Supply and the Cavity

    NASA Technical Reports Server (NTRS)

    Schmit, Donald J.; Gibson, S.; Luna, M.; Karpen, J.; Innes, D.

    2013-01-01

    A prevalent but untested paradigm is often used to describe the prominence-cavity system; the cavity is under-dense because it it evacuated by supplying mass to the condensed prominence. The thermal non-equilibrium (TNE) model of prominence formation offers a theoretical framework to predict the thermodynamic evolutin of the prominence and the surrounding corona. We examine the evidence for a prominence-cavity connection by comparing the TNE model and diagnostics of dynamic extreme ultraviolet (EUV) emission surrounding the prominence, specifically prominence horns. Horns are correlated extensions of prminence plasma and coronal plasma which appear to connect the prominence and cavity. The TNE model predicts that large-scale brightenings will occur in the Solar Dynamics Observatory Atmospheric Imaging Assembly 171 A badpass near he prominence that are associated with the cooling phase of condensation formation. In our simulations, variations in the magnitude of footpoint heating lead to variations in the duration, spatial scale, and temporal offset between emission enhancements in the other EUV bandpasses. While these predictions match well a subset of the horn observations, the range of variations in the observed structures is not captured by the model. We discuss the implications of one-dimensional loop simulations for the three-dimensional time-averaged equilibrium in the prominence and the cavity. Evidence suggests that horns are likely caused by condensing prominence plasma, but the larger question of whether this process produces a density-depleted cavity requires a more tightly constrained model of heating and better knowledge of the associated magnetic structure.

  18. Self-Consistent Charge Density Functional Tight-Binding Study of Poly(3,4-ethylenedioxythiophene): Poly(styrenesulfonate) Ammonia Gas Sensor.

    PubMed

    Marutaphan, Ampaiwan; Seekaew, Yotsarayuth; Wongchoosuk, Chatchawal

    2017-12-01

    Geometric and electronic properties of 3,4-ethylenedioxythiophene (EDOT), styrene sulfonate (SS), and EDOT: SS oligomers up to 10 repeating units were studied by the self-consistent charge density functional tight-binding (SCC-DFTB) method. An application of PEDOT:PSS for ammonia (NH 3 ) detection was highlighted and investigated both experimentally and theoretically. The results showed an important role of H-bonds in EDOT:SS oligomers complex conformation. Electrical conductivity of EDOT increased with increasing oligomers and doping SS due to enhancement of π conjugation. Printed PEDOT:PSS gas sensor exhibited relatively high response and selectivity to NH 3 . The SCC-DFTB calculation suggested domination of direct charge transfer process in changing of PEDOT:PSS conductivity upon NH 3 exposure at room temperature. The NH 3 molecules preferred to bind with PEDOT:PSS via physisorption. The most favorable adsorption site for PEDOT:PSS-NH 3 interaction was found to be at the nitrogen atom of NH 3 and hydrogen atoms of SS with an average optimal binding distance of 2.00 Å.

  19. Response of melanoma tumor phospholipid metabolism to chloroethyle nitrosourea: a high resolution proton NMR spectroscopy study.

    PubMed

    Morvan, Daniel; Demidem, Aïcha; Madelmont, Jean-Claude

    2003-07-01

    Phospholipid metabolism is tightly involved in tumor growth regulation and tumor cell survival. The response of phospholipid metabolism to chloroethyle nitrosourea treatment is investigated in a murine B16 melanoma model. Measurements of phospholipid derivatives are performed on intact tumor tissue samples using one- and two-dimensional proton NMR spectroscopy. During the tumor growth inhibition phase under treatment, tumors overexpress phosphocholine, phosphoethanolamine, glycerophosphocholine and glycerophosphoethanolamine, whereas phosphatidylcholine and phosphatidylethanolamine levels are maintained to control levels. During re-growth, which remained quantitatively much below control growth, chloroethyle nitrosourea-treated melanoma tumors overexpress phosphocholine and phosphoethanolamine only. In treated melanoma, phosphatidylcholine levels show an inverse relationship with tumor growth rates. In conclusion, chloroethyle nitrosourea-treated melanoma tumors maintain their phosphatidylcholine levels and exhibit transformed phospholipid metabolism phenotype, by mechanisms that could participate in tumor cell survival.

  20. PyPLIF: Python-based Protein-Ligand Interaction Fingerprinting.

    PubMed

    Radifar, Muhammad; Yuniarti, Nunung; Istyastono, Enade Perdana

    2013-01-01

    Structure-based virtual screening (SBVS) methods often rely on docking score. The docking score is an over-simplification of the actual ligand-target binding. Its capability to model and predict the actual binding reality is limited. Recently, interaction fingerprinting (IFP) has come and offered us an alternative way to model reality. IFP provides us an alternate way to examine protein-ligand interactions. The docking score indicates the approximate affinity and IFP shows the interaction specificity. IFP is a method to convert three dimensional (3D) protein-ligand interactions into one dimensional (1D) bitstrings. The bitstrings are subsequently employed to compare the protein-ligand interaction predicted by the docking tool against the reference ligand. These comparisons produce scores that can be used to enhance the quality of SBVS campaigns. However, some IFP tools are either proprietary or using a proprietary library, which limits the access to the tools and the development of customized IFP algorithm. Therefore, we have developed PyPLIF, a Python-based open source tool to analyze IFP. In this article, we describe PyPLIF and its application to enhance the quality of SBVS in order to identify antagonists for estrogen α receptor (ERα). PyPLIF is freely available at http://code.google.com/p/pyplif.

Top