Verrotti, Alberto; Loiacono, Giulia; Rossi, Alessandra; Tartaro, Armando; Delli Pizzi, Andrea; Coppola, Giangennaro
2015-07-01
Schizencephaly is an uncommon malformation of cortical development. Patients with schizencephaly present with a broad range of severe neurologic symptoms including pharmacoresistant epilepsy. Rufinamide is a new antiepileptic drug approved for use as adjunctive therapy of seizures associated with Lennox-Gastaut syndrome and it is also effective for refractory partial seizures. We report 3 cases of pediatric patients aged 7.2, 8.1, and 10.1 years, respectively, with intractable epilepsy associated with bilateral open-lip schizencephaly and septo-optic dysplasia. The follow-up ranged from 3.8 to 4.1 years. In our patients, the introduction of rufinamide as adjunctive drug led to a dramatic decline in the number of seizures and an improvement in EEG epileptic activity without side effects. Rufinamide seems to be efficacious and safe in patients with epileptic encephalopathies associated with pharmacoresistant epilepsy; further and larger clinical reports and controlled studies could confirm the usefulness of this anticonvulsant drug. © The Author(s) 2014.
Kopyta, Ilona; Jamroz, Ewa; Kluczewska, Ewa; Sarecka-Hujar, Beata
2014-04-01
Schizencephaly is a rare and severe congenital brain defect. Its etiology is not unequivocal and its clinical course differs with every case. The aim of the study was to analyze correlations between clinical and radiologic features of schizencephaly in Polish patients. The study group consisted of 25 children. Epileptic seizures were observed in 60% of cases and in 32% epilepsy was drug resistant. Generalized hypotonia was found in 24%, spastic diparesis in 48%, and spastic hemiparesis in 28% of cases. Seizures were more frequent in the bilateral than unilateral schizencephaly subgroup (72% vs 29%, P = .045). There was a correlation between the presence of the bilateral type II schizencephaly and the occurrence of seizures (P = .002, r = 0.578). There is a correlation between the type of schizencephaly and the presence of seizures in Polish pediatric patients. In most of the patients, schizencephaly leads to developmental retardation and epileptic seizures.
... body, but may have average to near-average intelligence. Individuals with schizencephaly may also have an abnormally ... body, but may have average to near-average intelligence. Individuals with schizencephaly may also have an abnormally ...
Prenatal and postnatal evaluation of polymicrogyria with band heterotopia.
Nagaraj, Usha D; Hopkin, Robert; Schapiro, Mark; Kline-Fath, Beth
2017-09-01
The coexistence of band heterotopia and polymicrogyria is extremely rare though it has been reported in the presence of corpus callosum anomalies and megalencephaly. We present prenatal and postnatal MRI findings of a rare case of diffuse cortical malformation characterized by polymicrogyria and band heterotopia. Agenesis of the corpus callosum and megalencephaly were also noted. In addition, bilateral closed-lip schizencephaly was identified on postnatal MRI, which has not been previously reported with this combination of imaging findings. Polymicrogyria with band heterotopia can occur and can be diagnosed with fetal MRI. The coexistence of corpus callosum anomalies and megalencephaly comprises a rare phenotype that has been previously described, suggesting an underlying genetic abnormality.
Lv, Yudan; Ma, Dihui; Meng, Hongmei; Zan, Wang; Li, Cui
2013-10-01
Schizencephaly is a congenital malformation of the cerebral hemispheres, with communication between the lateral ventricle and the subarachnoid space. Marinelli reported that schizencephaly may be associated with continuous involuntary hand movements, such as dystonia or epilepsia partialis continua (EPC). We describe a young Chinese patient with continuous involuntary movements of the contralateral hand affected by schizencephaly. He has a normal scalp electroencephalogram (EEG) but abnormal intracranial EEG, with synchronized periodic lateralized epileptiform discharges. The results obtained from these EEG investigations and the clinical features of the involuntary movements are in favor of a diagnosis of secondary EPC.
Continuous involuntary hand movements and schizencephaly: epilepsia partialis continua or dystonia?
Marinelli, Lucio; Bonzano, Laura; Saitta, Laura; Trompetto, Carlo; Abbruzzese, Giovanni
2012-04-01
Schizencephaly is regarded as a malformation of cortical development (due to abnormal neuronal organization) and may be associated with continuous involuntary hand movements. The mechanisms underlying these movements are not clear and both dystonia and epilepsia partialis continua have been considered in previously reported cases. We describe a young patient affected by schizencephaly and continuous involuntary movements of the contralateral hand. Functional MRI showed bilateral cerebral activation, while the subject performed tapping movements with the affected hand and no significant difference in the activation pattern after diazepam infusion. Standard and back-averaged EEG showed no alterations. The results obtained from these investigations and the clinical features of the involuntary movements are not in favor of an epileptic genesis, while support the diagnosis of secondary dystonia.
Do you know this syndrome? Xeroderma pigmentosum (XP).
Viana, Fernanda de Oliveira; Cavaleiro, Luíza Helena dos Santos; Carneiro, Clívia Maria Moraes de Oliveira; Bittencourt, Maraya de Jesus Semblano; Barros, Renata Silva; Fonseca, Diana Mendes da
2011-01-01
Xeroderma pigmentosum is a rare genetic disease characterized by clinical and cellular hypersensitivity to ultraviolet radiation and DNA repair defects. Patients with xeroderma pigmentosum experience sun-induced cutaneous and ocular abnormalities, including cancer. Some develop neurological disorders. We describe the case of a 2 year-old child with DeSanctis-Cacchione's syndrome, with severe neurological deterioration associated with schizencephaly. In the current clinical classification of xeroderma pigmentosum, the term is reserved for cases with severe neurological disorders linked to dwarfism and immature sexual development. The association of xeroderma pigmentosum with schizencephaly has not to date been reported in the literature.
Unit Advancement Flap for Lower Lip Reconstruction.
Ogino, Akihiro; Onishi, Kiyoshi; Okada, Emi; Nakamichi, Miho
2018-05-01
Lower lip reconstruction requires consideration of esthetic and functional outcome in selecting a surgical procedure, and reconstruction with local tissue is useful. The authors reconstructed full-thickness defects with a unit advancement flap. Reconstruction was performed using this method in 4 patients with lower lip squamous cell carcinoma in whom tumor resection with preservation of the mouth angle was possible. The lower lip resection width was 30 to 45 mm, accounting for 50% to 68% of the entire width of the lower lip. The flap was prepared by lateral extension from above the mental unit and matched with the potential wrinkle line of the lower lip in order to design a unit morphology surrounded by the anterior margin of the depressor labii inferioris muscle. It was elevated as a full-thickness flap composed of the orbicularis oris muscle, skin, and mucosa of the residual lower lip from the bilateral sides, and advanced to the defect. Flap transfer was adjusted by small triangular resection of the skin on the lateral side of the mental unit. The postoperative scar was inconspicuous in all patients and there was no impairment of the mouth opening-closing or articulation functions. This was a relatively simple surgical procedure. A blood supply of the flap was stable, and continuity of the orbicularis oris muscle was reconstructed by transferred the residual lower lip advancement flap from the bilateral sides. The postoperative mouth opening-closing function was sufficient, and dentures could be placed from an early phase in elderly patients. The postoperative scar was consistent with the lip unit morphology, being esthetically superior. This procedure may be applicable for reconstruction of defects approximately 1/3 to 2/3 the width of the lower lip where the mouth angle is preserved.
Sulfamethoxazole/Trimethoprim (Bactrim or Septra) and Pregnancy
... defects, neural tube defects (opening in the spine), cleft lip or palate (lip or roof of mouth do not form correctly), and urinary tract defects. Trimethoprim might decrease the ... bifida, oral clefts and heart defects. It is recommended that pregnant ...
Shu, Zhengyu; Lin, Hong; Shi, Shaolei; Mu, Xiangduo; Liu, Yanru; Huang, Jianzhong
2016-05-03
The whole-cell lipase from Burkholderia cepacia has been used as a biocatalyst in organic synthesis. However, there is no report in the literature on the component or the gene sequence of the cell-bound lipase from this species. Qualitative analysis of the cell-bound lipase would help to illuminate the regulation mechanism of gene expression and further improve the yield of the cell-bound lipase by gene engineering. Three predictive cell-bound lipases, lipA, lipC21 and lipC24, from Burkholderia sp. ZYB002 were cloned and expressed in E. coli. Both LipA and LipC24 displayed the lipase activity. LipC24 was a novel mesophilic enzyme and displayed preference for medium-chain-length acyl groups (C10-C14). The 3D structural model of LipC24 revealed the open Y-type active site. LipA displayed 96 % amino acid sequence identity with the known extracellular lipase. lipA-inactivation and lipC24-inactivation decreased the total cell-bound lipase activity of Burkholderia sp. ZYB002 by 42 % and 14 %, respectively. The cell-bound lipase activity from Burkholderia sp. ZYB002 originated from a multi-enzyme mixture with LipA as the main component. LipC24 was a novel lipase and displayed different enzymatic characteristics and structural model with LipA. Besides LipA and LipC24, other type of the cell-bound lipases (or esterases) should exist.
Deregulation of the endogenous C/EBPβ LIP isoform predisposes to tumorigenesis.
Bégay, Valérie; Smink, Jeske J; Loddenkemper, Christoph; Zimmermann, Karin; Rudolph, Cornelia; Scheller, Marina; Steinemann, Doris; Leser, Ulf; Schlegelberger, Brigitte; Stein, Harald; Leutz, Achim
2015-01-01
Two long and one truncated isoforms (termed LAP*, LAP, and LIP, respectively) of the transcription factor CCAAT enhancer binding protein beta (C/EBPβ) are expressed from a single intronless Cebpb gene by alternative translation initiation. Isoform expression is sensitive to mammalian target of rapamycin (mTOR)-mediated activation of the translation initiation machinery and relayed through an upstream open reading frame (uORF) on the C/EBPβ mRNA. The truncated C/EBPβ LIP, initiated by high mTOR activity, has been implied in neoplasia, but it was never shown whether endogenous C/EBPβ LIP may function as an oncogene. In this study, we examined spontaneous tumor formation in C/EBPβ knockin mice that constitutively express only the C/EBPβ LIP isoform from its own locus. Our data show that deregulated C/EBPβ LIP predisposes to oncogenesis in many tissues. Gene expression profiling suggests that C/EBPβ LIP supports a pro-tumorigenic microenvironment, resistance to apoptosis, and alteration of cytokine/chemokine expression. The results imply that enhanced translation reinitiation of C/EBPβ LIP promotes tumorigenesis. Accordingly, pharmacological restriction of mTOR function might be a therapeutic option in tumorigenesis that involves enhanced expression of the truncated C/EBPβ LIP isoform. Elevated C/EBPβ LIP promotes cancer in mice. C/EBPβ LIP is upregulated in B-NHL. Deregulated C/EBPβ LIP alters apoptosis and cytokine/chemokine networks. Deregulated C/EBPβ LIP may support a pro-tumorigenic microenvironment.
Buzzell, Gerald R; Tariq, Saeed; Traversa, Donato; Schuster, Rolf
2011-03-01
The infective larva of the spirurid nematode Habronema muscae, a parasite of houseflies, was measured and specimens fixed in Karnovsky's fluid were examined by scanning electron microscopy. The oral opening contains six teeth and is surrounded by large bilobed dorsal and ventral lips and smaller lateral lips. A pair of amphids lie behind the lateral lips. There are two rows of four cephalic papillae. The body is deeply ridged, both transversely and longitudinally. The caudal end of the worm is studded by small papillae. The position of the anal opening is somewhat ambiguous. These larval morphological features are discussed, as well as the changes which must have occurred in the metamorphosis of the infective larva to the adult in the stomach of horses.
King, Amy M; Bartpho, Thanatchaporn; Sermswan, Rasana W; Bulach, Dieter M; Eshghi, Azad; Picardeau, Mathieu; Adler, Ben; Murray, Gerald L
2013-08-01
Leptospirosis is a worldwide zoonosis caused by pathogenic Leptospira spp., but knowledge of leptospiral pathogenesis remains limited. However, the development of mutagenesis systems has allowed the investigation of putative virulence factors and their involvement in leptospirosis. LipL41 is the third most abundant lipoprotein found in the outer membranes of pathogenic leptospires and has been considered a putative virulence factor. LipL41 is encoded on the large chromosome 28 bp upstream of a small open reading frame encoding a hypothetical protein of unknown function. This gene was named lep, for LipL41 expression partner. In this study, lipL41 was found to be cotranscribed with lep. Two transposon mutants were characterized: a lipL41 mutant and a lep mutant. In the lep mutant, LipL41 protein levels were reduced by approximately 90%. Lep was shown through cross-linking and coexpression experiments to bind to LipL41. Lep is proposed to be a molecular chaperone essential for the stable expression of LipL41. The roles of LipL41 and Lep in the pathogenesis of Leptospira interrogans were investigated; surprisingly, neither of these two unique proteins was essential for acute leptospirosis.
Eski, Muhitdin; Aykan, Andac; Alhan, Dogan; Zor, Fatih; Isik, Selcuk
2015-06-01
We aimed to evaluate the results of simultaneous rhinoplasty and Abbe flap for the reconstruction of the secondary bilateral cleft and nasal deformity by means of a newly developed software-based method. A total of 16 patients with the bilateral cleft lip nasal deformity received Abbe flap and simultaneous open rhinoplasty between 2004 and 2010. The mean age of the patients was 21 years, and the average follow-up time was 2.4 years. After the open rhinoplasty procedure, the upper lip was reconstructed with the Abbe flap. Preoperative and postoperative photographs that had been taken laterally were evaluated by using Adobe Photoshop(®) CS4 and Adobe InDesign(®) software. The length of the columella and the relative changes of the most anterior point of the upper lip to the vertical plane tangent to the most anterior point of the lower lip were measured in pixels on standardized preoperative and postoperative images. The differences were calculated and compared as a percentage (%). There was no flap loss and associated problems. The measurements of columellar length revealed an average increase of 51.8 ± 11.3%, while the relative change of the most anterior point of the upper lip revealed an average increase of 68.6 ± 11.2%. The results of the treatment modality were successfully evaluated by a newly developed software-based method. Copyright © 2015 British Association of Plastic, Reconstructive and Aesthetic Surgeons. Published by Elsevier Ltd. All rights reserved.
Chen, S C; Shao, C L; Liang, C K; Lin, S W; Huang, T H; Hsieh, M C; Yang, C H; Luo, C H; Wuo, C M
2004-01-01
In this paper, we present a text input system for the seriously disabled by using lips image recognition based on LabVIEW. This system can be divided into the software subsystem and the hardware subsystem. In the software subsystem, we adopted the technique of image processing to recognize the status of mouth-opened or mouth-closed depending the relative distance between the upper lip and the lower lip. In the hardware subsystem, parallel port built in PC is used to transmit the recognized result of mouth status to the Morse-code text input system. Integrating the software subsystem with the hardware subsystem, we implement a text input system by using lips image recognition programmed in LabVIEW language. We hope the system can help the seriously disabled to communicate with normal people more easily.
Toyoda, Aru; Maruhashi, Tamaki; Malaivijitnond, Suchinda; Koda, Hiroki
2017-10-01
Speech is unique to humans and characterized by facial actions of ∼5 Hz oscillations of lip, mouth or jaw movements. Lip-smacking, a facial display of primates characterized by oscillatory actions involving the vertical opening and closing of the jaw and lips, exhibits stable 5-Hz oscillation patterns, matching that of speech, suggesting that lip-smacking is a precursor of speech. We tested if facial or vocal actions exhibiting the same rate of oscillation are found in wide forms of facial or vocal displays in various social contexts, exhibiting diversity among species. We observed facial and vocal actions of wild stump-tailed macaques (Macaca arctoides), and selected video clips including facial displays (teeth chattering; TC), panting calls, and feeding. Ten open-to-open mouth durations during TC and feeding and five amplitude peak-to-peak durations in panting were analyzed. Facial display (TC) and vocalization (panting) oscillated within 5.74 ± 1.19 and 6.71 ± 2.91 Hz, respectively, similar to the reported lip-smacking of long-tailed macaques and the speech of humans. These results indicated a common mechanism for the central pattern generator underlying orofacial movements, which would evolve to speech. Similar oscillations in panting, which evolved from different muscular control than the orofacial action, suggested the sensory foundations for perceptual saliency particular to 5-Hz rhythms in macaques. This supports the pre-adaptation hypothesis of speech evolution, which states a central pattern generator for 5-Hz facial oscillation and perceptual background tuned to 5-Hz actions existed in common ancestors of macaques and humans, before the emergence of speech. © 2017 Wiley Periodicals, Inc.
Abbs, J H; Gracco, V L
1984-04-01
The contribution of ascending afferents to the control of speech movement was evaluated by applying unanticipated loads to the lower lip during the generation of combined upper lip-lower lip speech gestures. To eliminate potential contamination due to anticipation or adaptation, loads were applied randomly on only 10-15% of the trials. Physical characteristics of the perturbations were within the normal range of forces and movements involved in natural lip actions for speech. Compensatory responses in multiple facial muscles and lip movements were observed the first time a load was introduced, and achievement of the multimovement speech goals was never disrupted by these perturbations. Muscle responses were seen in the lower lip muscles, implicating corrective, feedback processes. Additionally, compensatory responses to these lower lip loads were also observed in the independently controlled muscles of the upper lip, reflecting the parallel operation of open-loop, sensorimotor mechanisms. Compensatory responses from both the upper and lower lip muscles were observed with small (1 mm) as well as large (15 mm) perturbations. The latencies of these compensatory responses were not discernible by conventional ensemble averaging. Moreover, responses at latencies of lower brain stem-mediated reflexes (i.e., 10-18 ms) were not apparent with inspection of individual records. Response latencies were determined on individual loaded trials through the use of a computer algorithm that took into account the variability of electromyograms (EMG) among the control trials. These latency measures confirmed the absence of brain stem-mediated responses and yielded response latencies that ranged from 22 to 75 ms. Response latencies appeared to be influenced by the time relation between load onset and the initiation of muscle activation. Examination of muscle activity changes for individual loaded trials revealed complementary variations in the magnitude of responses among multiple muscles contributing to a movement compensation. These observations may have implications for limb movement control if multimovement speech gestures are considered analogous to a limb action requiring coordinated movements around multiple joints. In this context, these speech motor control data might be interpreted to suggest that for complex movements, both corrective feedback and open-loop predictive processes are operating, with the latter involved in the control of coordination among multiple movement subcomponents.
Montero, J; Gómez Polo, C; Rosel, E; Barrios, R; Albaladejo, A; López-Valverde, A
2016-01-01
Symmetric, aligned and luminous smiles are usually classified as 'beautiful' and aesthetic. However, smile perception is not strictly governed by standardised rules. Personal traits may influence the perception of non-ideal smiles. We aimed to determine the influence of personality traits in self-rated oral health and satisfaction and in the aesthetic preference for different strategically flawed smiles shown in photographs. Smiles with dark teeth, with uneven teeth, with lip asymmetry and dental asymmetry were ordered from 1 to 4 as a function of the degree of beauty by 548 participants, of which 50·7% were females with a mean age of 41·5 ± 17·6 years (range: 16-89 years). Self-assessment and oral satisfaction were recorded on a Likert scale. Personality was measured by means of the Big Five Inventory (extraversion, agreeableness, conscientiousness, neuroticism and openness), and the Life Orientation Test was used to measure optimism and pessimism. Of the four photographs with imperfect smiles, dental asymmetry was the most highly assessed in 63% of the sample, and the worst was lip asymmetry, in 43·7% of the sample. Some personality traits (above all conscientiousness and openness) were significantly correlated with the position assigned to the photographs with dental and lip asymmetry or with misaligned teeth. The extraversion, agreeableness and openness traits were correlated with the self-perceptions of oral health and aesthetics of the participants. Dental asymmetry seems to be better tolerated than lip asymmetry. Personality traits are weakly but significantly correlated with the aesthetic preference and oral health values, conscientiousness and openness being the most relevant domains in this sense. © 2015 John Wiley & Sons Ltd.
Dos Santos, Ana Nunes; de Oliveira Rodrigues, Allan Rodrigo; Dos Santos Rocha, Fábio José; Dos Santos, Jeannie Nascimento; González, Cynthya Elizabeth; de Vasconcelos Melo, Francisco Tiago
2018-03-01
Neocosmocercella fisherae n. sp. is the first nematode species found parasitising Phyllomedusa bicolor from the Brazilian Amazon Region. The new species has a triangular oral opening, with bi-lobed lips, and is distinguished from N. bakeri (triangular oral opening with simple lips), and from N. paraguayensis (hexagonal oral opening with bi-lobed lips). Additionally, the new species has ciliated cephalic papillae, which are absent in the other species of the genus. The reduced uterine sac and the presence of a single egg in the uterus in females are the main morphological characters that differentiate the new species from its congeners N. bakeri (8-10 eggs) and N. paraguayensis (10 eggs, based on the allotype). Additionally, the new species differs from the other two species of the genus by morphometric characters such as the size of spicules and gubernaculum in males and the vagina in females. Until now, phyllomedusid anurans are the only known hosts for the nematodes of this genus. The present work describes the third species of the genus and the first species of nematode parasitising P. bicolor.
Does access to open water affect the health of Pekin ducks (Anas platyrhynchos)?
O'Driscoll, K K M; Broom, D M
2011-02-01
Access to open water is considered good for the welfare of Pekin ducks. These studies investigated the effect that the type of water resource, provided over either straw bedding or a rubber mesh, had on measures of duck health. Pekin strain ducklings (n = 2,600) were managed in pens of 100 on straw over a solid concrete floor. In study 1, one of two water resources (nipple, n = 5 pens; wide-lip bell drinker, n = 5 pens), was located directly over the straw. In study 2, one of three water resources (narrow-lip bell drinker, n = 6 pens; trough, n = 5 pens; and bath, n = 5 pens) was located over a rubber mesh. On d 16, 24, 29, 35, and 43, (study 1) or d 21, 29, 35, and 43 posthatch (study 2), 10 birds were selected from each pen and weighed, and then feather hygiene, footpad dermatitis, eye health, gait score, and nostril condition scores were taken. Treatment had no effect on BW in either study, but in study 2, ducks in the open water treatments had higher scores (P < 0.001) than those in the narrow-lip bell drinker treatment by d 43. In study 1, treatment had no effect on hygiene scores, but scores increased over time (P < 0.001). In study 2, ducks in the narrow-lip bell drinker treatment were dirtier than those in the bath treatment (P = 0.01), with those in the trough treatment being intermediate. In both studies, ducks with bell drinkers had worse gait scores than those in the other treatments (study 1, P < 0.01; study 2, P < 0.05). Treatment had no effect on eye health scores. However, ducks were less likely to have dirty nostrils when provided with more open water resources in both studies (P < 0.01), or were less likely to have blocked nostrils in the trough and bath treatments than in the narrow-lip bell drinker treatment in study 2 (P = 0.01). Provision of open water, particularly over a properly constructed drainage area, improved some aspects of duck health (improved feather hygiene and BW, and fewer dirty and blocked nostrils). However, further work is needed to investigate these treatments on a commercial scale.
Marzouk, Eiman S; Kassem, Hassan E
2018-03-01
To evaluate soft tissue changes and their long-term stability in skeletal anterior open bite adults treated by maxillary posterior teeth intrusion using zygomatic miniplates and premolar extractions. Lateral cephalograms of 26 patients were taken at pretreatment (T1), posttreatment (T2), 1 year posttreatment (T3), and 4 years posttreatment (T4). At the end of treatment, the soft tissue facial height and profile convexity were reduced. The lips increased in length and thickness, with backward movement of the upper lip and forward movement of the lower lip. The total relapse rate ranged from 20.2% to 31.1%. At 4 years posttreatment, 68.9% to 79.8% of the soft tissue treatment effects were stable. The changes in the first year posttreatment accounted for approximately 70% of the total relapse. Soft tissue changes following maxillary posterior teeth intrusion with zygomatic miniplates and premolar extractions appear to be stable 4 years after treatment.
Makino, Elizabeth T; Tan, Priscilla; Qian, Kun; Babcock, Michael; Mehta, Rahul C
2017-04-01
Key features of lip aging include loss of volume, color, and definition as well as increases in lines/wrinkles and uneven skin texture. A single-center, open-label clinical study was conducted to assess the efficacy and tolerability of a novel, topical two-step lip treatment (HA5 LS) in female subjects presenting with mild to moderate lip dryness and mild to severe lip condition. Subjects were instructed to apply HA5 LS at least three times a day to ensure coverage 8 hours a day for four weeks. Clinical assessments for efficacy and tolerability were conducted at baseline, baseline post-application, week 2, and week 4. Standardized digital photography, subject self-assessment questionnaires, and instrumentation measurements for skin hydration (corneometer) and lip plumpness (digital caliper) were also conducted. Thirty-six female subjects aged 22-40 years enrolled in the study. HA5 LS provided instant and long term effects, achieving significant improvements in all clinical grading parameters including lip texture, color, definition/contour, scaling, cupping, lines/wrinkles, lip plumpness, and overall lip condition from baseline post-application to week 4 (all P less than equal to .001; Wilcoxon signed-rank test). Instrumentation measurements for hydration and digital caliper at weeks 2 and 4 were also significant (all P less than equal to .032; paired t-test). HA5 LS was also well-tolerated and highly-rated by subjects throughout the study duration. Results from this study suggest that HA5 LS addresses the key features of lip aging, providing both instant and long-term benefits.
J Drugs Dermatol. 2017;16(4):366-371.
.Matsuya, Tokuzo; Iida, Seiji; Kogo, Mikihiko
2003-08-01
To correct the nasal deformity in cleft lip patients, a new procedure of open rhinoplasty using a "flying-bird" incision in the nostril tip with a vestibule "tornado"-shaped incision in the cleft side is presented. The newly designed vestibular incision produces effective vestibular advancement with the freed lower lateral cartilage. The flying-bird incision makes it possible to produce a suitable nostril tip appearance with symmetrical external nostril vestibules. If the vestibular defect after flap advancement is wide, a full-thickness skin graft is used to give priority for making a good external nostril shape. This procedure is useful for most cleft lip noses, particularly in cases of moderate to severe deformity.
Chapter 50 Geology and tectonic development of the Amerasia and Canada Basins, Arctic Ocean
Grantz, Arthur; Hart, Patrick E.; Childers, Vicki A
2011-01-01
Amerasia Basin is the product of two phases of counterclockwise rotational opening about a pole in the lower Mackenzie Valley of NW Canada. Phase 1 opening brought ocean–continent transition crust (serpentinized peridotite?) to near the seafloor of the proto-Amerasia Basin, created detachment on the Eskimo Lakes Fault Zone of the Canadian Arctic margin and thinned the continental crust between the fault zone and the proto-Amerasia Basin to the west, beginning about 195 Ma and ending prior to perhaps about 160 Ma. The symmetry of the proto-Amerasia Basin was disrupted by clockwise rotation of the Chukchi Microcontinent into the basin from an original position along the Eurasia margin about a pole near 72°N, 165 W about 145.5–140 Ma. Phase 2 opening enlarged the proto-Amerasia Basin by intrusion of mid-ocean ridge basalt along its axis between about 131 and 127.5 Ma. Following intrusion of the Phase 2 crust an oceanic volcanic plateau, the Alpha–Mendeleev Ridge LIP (large igneous province), was extruded over the northern Amerasia Basin from about 127 to 89–75 Ma. Emplacement of the LIP halved the area of the Amerasia Basin, and the area lying south of the LIP became the Canada Basin.
Chapter 50: Geology and tectonic development of the Amerasia and Canada Basins, Arctic Ocean
Grantz, A.; Hart, P.E.; Childers, V.A.
2011-01-01
Amerasia Basin is the product of two phases of counterclockwise rotational opening about a pole in the lower Mackenzie Valley of NW Canada. Phase 1 opening brought ocean-continent transition crust (serpentinized peridotite?) to near the seafloor of the proto-Amerasia Basin, created detachment on the Eskimo Lakes Fault Zone of the Canadian Arctic margin and thinned the continental crust between the fault zone and the proto-Amerasia Basin to the west, beginning about 195 Ma and ending prior to perhaps about 160 Ma. The symmetry of the proto-Amerasia Basin was disrupted by clockwise rotation of the Chukchi Microcontinent into the basin from an original position along the Eurasia margin about a pole near 72??N, 165 Wabout 145.5-140 Ma. Phase 2 opening enlarged the proto-Amerasia Basin by intrusion of mid-ocean ridge basalt along its axis between about 131 and 127.5 Ma. Following intrusion of the Phase 2 crust an oceanic volcanic plateau, the Alpha-Mendeleev Ridge LIP (large igneous province), was extruded over the northern Amerasia Basin from about 127 to 89-75 Ma. Emplacement of the LIP halved the area of the Amerasia Basin, and the area lying south of the LIP became the Canada Basin. ?? 2011 The Geological Society of London.
Malformations of cortical development: 3T magnetic resonance imaging features
Battal, Bilal; Ince, Selami; Akgun, Veysel; Kocaoglu, Murat; Ozcan, Emrah; Tasar, Mustafa
2015-01-01
Malformation of cortical development (MCD) is a term representing an inhomogeneous group of central nervous system abnormalities, referring particularly to embriyological aspect as a consequence of any of the three developmental stages, i.e., cell proliferation, cell migration and cortical organization. These include cotical dysgenesis, microcephaly, polymicrogyria, schizencephaly, lissencephaly, hemimegalencephaly, heterotopia and focal cortical dysplasia. Since magnetic resonance imaging is the modality of choice that best identifies the structural anomalies of the brain cortex, we aimed to provide a mini review of MCD by using 3T magnetic resonance scanner images. PMID:26516429
Statistical organelle dissection of Arabidopsis guard cells using image database LIPS.
Higaki, Takumi; Kutsuna, Natsumaro; Hosokawa, Yoichiroh; Akita, Kae; Ebine, Kazuo; Ueda, Takashi; Kondo, Noriaki; Hasezawa, Seiichiro
2012-01-01
To comprehensively grasp cell biological events in plant stomatal movement, we have captured microscopic images of guard cells with various organelles markers. The 28,530 serial optical sections of 930 pairs of Arabidopsis guard cells have been released as a new image database, named Live Images of Plant Stomata (LIPS). We visualized the average organellar distributions in guard cells using probabilistic mapping and image clustering techniques. The results indicated that actin microfilaments and endoplasmic reticulum (ER) are mainly localized to the dorsal side and connection regions of guard cells. Subtractive images of open and closed stomata showed distribution changes in intracellular structures, including the ER, during stomatal movement. Time-lapse imaging showed that similar ER distribution changes occurred during stomatal opening induced by light irradiation or femtosecond laser shots on neighboring epidermal cells, indicating that our image analysis approach has identified a novel ER relocation in stomatal opening.
Method of making a modular off-axis solar concentrator
DOE Office of Scientific and Technical Information (OSTI.GOV)
Plesniak, Adam P.; Hall, John C.
A method of making a solar concentrator may include forming a receiving wall having an elongated wall, a first side wall and a second side wall; attaching the first side wall and the second side wall to a reflecting wall to form a housing having an internal volume with an opening; forming a lip on the receiving wall and the reflecting wall; attaching a cover to the receiving wall and the reflecting wall at the lip to seal the opening into the internal volume, thereby creating a rigid structure; and mounting at least one receiver having at least one photovoltaicmore » cell on the elongated wall to receive solar radiation entering the housing and reflected by the receiving wall, the receiver having an axis parallel with a surface normal of the photovoltaic cell, such that the axis is disposed at a non-zero angle relative to the vertical axis of the opening.« less
Yasuno, Rie; Wada, Hajime
1998-01-01
Lipoic acid is a coenzyme that is essential for the activity of enzyme complexes such as those of pyruvate dehydrogenase and glycine decarboxylase. We report here the isolation and characterization of LIP1 cDNA for lipoic acid synthase of Arabidopsis. The Arabidopsis LIP1 cDNA was isolated using an expressed sequence tag homologous to the lipoic acid synthase of Escherichia coli. This cDNA was shown to code for Arabidopsis lipoic acid synthase by its ability to complement a lipA mutant of E. coli defective in lipoic acid synthase. DNA-sequence analysis of the LIP1 cDNA revealed an open reading frame predicting a protein of 374 amino acids. Comparisons of the deduced amino acid sequence with those of E. coli and yeast lipoic acid synthase homologs showed a high degree of sequence similarity and the presence of a leader sequence presumably required for import into the mitochondria. Southern-hybridization analysis suggested that LIP1 is a single-copy gene in Arabidopsis. Western analysis with an antibody against lipoic acid synthase demonstrated that this enzyme is located in the mitochondrial compartment in Arabidopsis cells as a 43-kD polypeptide. PMID:9808738
Epidemiology of appendicitis and appendectomy for the low-income population in Taiwan, 2003-2011.
Lin, Kai-Biao; Chan, Chien-Lung; Yang, Nan-Ping; Lai, Robert K; Liu, Yuan-Hung; Zhu, Shun-Zhi; Pan, Ren-Hao
2015-02-13
Although numerous epidemiological studies on appendicitis have been conducted worldwide, only a few studies have paid attention to the effect of socioeconomic status on appendicitis, particularly studies focusing on the low-income population (LIP). We analyzed the epidemiological features of appendicitis in Taiwan using data from the National Health Insurance Research Database from 2003 to 2011. All cases diagnosed as appendicitis were enrolled. Between 2003 and 2011, 2,916 patients from the LIP and 209,206 patients from the normal population (NP) were diagnosed with appendicitis. Our finding revealed that the ratios of comorbidities, complicated appendicitis, and readmissions in LIP patients were slightly higher than those of NP patients. LIP patients were more likely to live in suburban and rural areas, and hence a higher proportion of them were hospitalized in a district or regional hospital compared with NP patients. The crucially finding was that the overall incidence ratios of appendicitis, acute appendicitis, and perforated appendicitis in the LIP were substantially higher than those in the NP (36.25%, 35.33%, and 37.28%, respectively). The mean LOS in LIP patients was longer than that of NP patients. The overall case-fatality ratio of appendectomy in the LIP was higher when compared with the NP (0.41% versus 0.12%, p < 0.05). We also observed that appendicitis was occurred frequently in male patients, with a higher incidence for those aged 15-29 years in both the LIP and NP. The incidences of incidental appendectomy showed a decreasing trend in both the LIP and NP. Finally, a valuable discovery was that the total hospital cost was comparable between the laparoscopic appendectomy (LA) and open appendectomy (OA) (1,178 ± 13 USD versus 1,191 ± 19 USD, p < 0.05) in LIP patients because they saved more hospitalization costs than NP patients when the previous one chose the LA. This study confirmed that a lower socioeconomic status has significantly negative impact on the occurrence and treatment of appendicitis and appendectomy. In terms of hospital costs and LOS, LIP patients benefit more from the LA approach than they do from the OA approach in the treatment of appendicitis.
Fluorouracil is also sometimes used to treat cancer of the cervix (opening of the uterus) and esophagus, head and neck cancer (including cancer of the mouth, lip, cheek, tongue, palate, throat, tonsils, and sinuses), ...
Environmental dew point and skin and lip weathering.
Devillers, C; Piérard, G E; Quatresooz, P; Piérard, S
2010-05-01
Xerosis represents a physiological response of the stratum corneum (SC) to environmental threats. The influence of the environmental dew point (DP) is not fully understood. This parameter is the air temperature at which the relative humidity is maximum. This study aimed to assess the relationship between the environmental DP and the water-holding capacity of the skin and lower lip vermilion. For comparison, SC property was evaluated after occlusive application of cooled and uncooled hydrogel pads. Electrometric measurements using a dermal phase meter (DPM) device were performed on the back of the hands, the cheeks and the lower lip of 40 healthy menopausal women. Assessments were performed in the outdoor conditions during winter and spring. The same measurements were recorded after hydrogel pads, at room temperature or cooled to 4 degrees C, were placed for 15 min on the test sites. The environmental DP was recorded at each evaluation time. The SC water-holding capacity was discretely influenced by the DP. In the open-air environmental conditions, a positive linear relationship was found on the cheeks between the DP and DPM values. The relationship was weaker on the lips. Conversely, a consistent increase in DPM values was recorded immediately after removal of the cooled and uncooled hydrogel pads. The observations made in the open-air testing conditions are consistent with the predicted events following the Arrhenius law. By contrast, the combination of cooling and occlusion by the hydrogel pads is responsible for the reverse effect on the SC.
Genetics Home Reference: Baraitser-Winter syndrome
... eyes ( hypertelorism ), large eyelid openings, droopy eyelids ( ptosis ), high-arched eyebrows , a broad nasal bridge and tip of the nose , a long space between the nose and upper lip ( philtrum ), full ...
A new regulatory mechanism for bacterial lipoic acid synthesis.
Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun
2015-01-22
Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. © 2015 The Authors. MicrobiologyOpen published by John Wiley & Sons Ltd.
Camón, J; Ruberte, J; Ordóñez, G
1990-05-01
A diprosopic cat is described. In the head, two snouts, three eyes and two pinnae were present. The mandible was single and immobile because labial skin of both upper lips and single lower lip was partly fused. Superimposition of upper and lower dental arches was impossible and the mouths remained permanently open. Two incomplete oral cavities were present and the two tongues were joined at their base. The brain was duplicated in part. In the cranium only occipital and temporal bones were normal, the basisphenoid was bifurcated and the remaining bones were duplicated. Embryological mechanisms are discussed.
Malformations of cortical development and epilepsy: evaluation of 101 cases (part II).
Güngör, Serdal; Yalnizoğlu, Dilek; Turanli, Güzide; Saatçi, Işil; Erdoğan-Bakar, Emel; Topçu, Meral
2007-01-01
Malformations of cortical development (MCD) form a spectrum of lesions produced by insult to the developing neocortex. Clinical presentation and electrophysiologic findings of MCD are variable and depend on the affected cortical area. We evaluated epilepsy, EEG, and response to antiepileptic treatment in patients with MCD with respect to the neuroimaging findings. We studied 101 patients, ranging between 1 month and 19 years of age. Fifty-four patients were diagnosed with polymicrogyria (PMG), 23 patients with lissencephaly, 12 patients with schizencephaly, and 12 patients with heterotopia. With regards to epilepsy and seizure type, 72/101 (71.3%) patients had epilepsy, and 62/101 (61.4%) patients presented with seizures. Overall, 32.7% of patients had generalized seizures, and 25.7% had complex partial seizures. Mean age at the onset of seizures was 2.7 +/- 3.4 years. The onset of epilepsy tended to be younger in patients with lissencephaly and older in patients with heterotopias. Of the cases, 79.2% had abnormal EEG (56.3% with epileptiform abnormality, 22.9% with non-epileptiform abnormality). EEG was abnormal in 44.9% (13/29) of the cases without epilepsy. EEG showed bilateral synchronous and diffuse epileptiform discharges in 90% of patients with lissencephaly. Patients with schizencephaly had mostly focal epileptiform discharges. Heterotopia cases had a high rate of EEG abnormalities (72.7%). Patients with PMG had epileptiform abnormality in 59.5% of the cases. Patients with heterotopias and PMG achieved better seizure control in comparison with the other groups. In conclusion, epilepsy is the most common problem in MCD. Epilepsy and EEG findings of patients with MCD are variable and seem to be correlated with the extent of cortical involvement.
Differential pressure pin discharge apparatus
Oakley, David J.
1987-02-03
Disclosed is a discharge assembly for allowing elongate pins to be discharged from an area of relatively low pressure to an area of relatively greater pressure. The discharge assembly includes a duck valve having a lip piece made of flexible material. The flexible lip piece responds to a fluctuating pressure created downstream by an aspirator. The aspirator reduces the downstream pressure sensed by the duck valve when the discharge assembly is in the open position. This allows elongate pins to be moved through the duck valve with no backflow because the aspirator pressure is less than the pressure in the low pressure area from which the pins originate. Closure of the assembly causes the aspirator static pressure to force the flexible duck valve lip piece into a tightly sealed position also preventing backflow. The discharge assembly can be easily controlled using a single control valve which blocks the flow of aspirator gas and closes the pin passageway extending through the assembly.
Differential pressure pin discharge apparatus
Oakley, D.J.
1984-05-30
Disclosed is a discharge assembly for allowing elongate pins to be discharged from an area of relatively low pressure to an area of relatively greater pressure. The discharge assembly includes a duck valve having a lip piece made of flexible material. The flexible lip piece responds to a fluctuating pressure created downstream by an aspirator. The aspirator reduces the downstream pressure sensed by the duck valve when the discharge assembly is in the open position. This allows elongate pins to be moved through the duck valve with no backflow because the aspirator pressure is less than the pressure in the low pressure area from which the pins originate. Closure of the assembly causes the aspirator static pressure to force the flexible duck valve lip piece into a tightly sealed position also preventing backflow. The discharge assembly can be easily controlled using a single control valve which blocks the flow of aspirator gas and closes the pins passageway extending through the assembly.
Differential pressure pin discharge apparatus
Oakley, David J.
1987-01-01
Disclosed is a discharge assembly for allowing elongate pins to be discharged from an area of relatively low pressure to an area of relatively greater pressure. The discharge assembly includes a duck valve having a lip piece made of flexible material. The flexible lip piece responds to a fluctuating pressure created downstream by an aspirator. The aspirator reduces the downstream pressure sensed by the duck valve when the discharge assembly is in the open position. This allows elongate pins to be moved through the duck valve with no backflow because the aspirator pressure is less than the pressure in the low pressure area from which the pins originate. Closure of the assembly causes the aspirator static pressure to force the flexible duck valve lip piece into a tightly sealed position also preventing backflow. The discharge assembly can be easily controlled using a single control valve which blocks the flow of aspirator gas and closes the pin passageway extending through the assembly.
Phillips, C; Kim, S H; Tucker, M; Turvey, T A
2010-08-01
Assess the long-term effect of sensory retraining exercises, age, gender, type of surgery, and pre-surgical psychological distress on patients' perception of the interference related to altered sensation 2 years after orthognathic surgery. A total of 186 subjects with a developmental dentofacial disharmony were enrolled in a multicenter randomized clinical trial: one center was a community-based practice and the other a university-based center. Subjects were randomly allocated to two groups: standard of care mouth opening exercises after BSSO or a progressive series of sensory retraining facial exercises in addition to the opening exercises. At 1, 3, 6, 12, and 24 months after surgery, subjects scored unusual feelings on the face, numbness, and loss of lip sensitivity from 'no problem (1)' to 'serious problem (7)'. A marginal proportional odds model was fit for each of the ordinal outcomes. Up to 2 years after surgery, the opening exercise only group had a higher likelihood of reporting interference in daily activities related to numbness and loss of lip sensitivity than the sensory retraining exercise group. The difference between the two groups was relatively constant. Older subjects and those with elevated psychological distress before surgery reported higher burdens related to unusual facial feelings, numbness, and loss of lip sensitivity (p < 0.02). The positive effect of sensory retraining facial exercises observed after surgery is maintained over time. Clinicians should consider the patient's age and psychological well-being prior to providing pre-surgical counseling regarding the impact on daily life of persistent altered sensation following a mandibular osteotomy.
Restrictions in oral functions caused by oral manifestations of epidermolysis bullosa.
Stellingsma, Cornelis; Dijkstra, Pieter U; Dijkstra, Janke; Duipmans, José C; Jonkman, Marcel F; Dekker, Rienk
2011-01-01
Several forms of epidermolysis bullosa (EB) present oral manifestations. Blistering of the (peri)oral mucosa affects the opening of the mouth, the mobility of the tongue and lips, thereby restricting oral functions. We describe the prevalence and characteristics of oral manifestations of EB in relation to loss of oral functions in a cross-sectional study of different types of EB patients using standardized measurement techniques. Twenty-two patients were included. The mobility of the mandible, lips and tongue was measured, the mandibular function impairment questionnaire (MFIQ) was filled out and additional questions regarding hindrance of EB during oral hygiene and intelligibility of speech (being understood) were asked in structured interviews. The median age was 11.8 yrs. Mobility of the mandible, tongue and lip was restricted, oral hygiene procedures were hindered in most patients. A data comparison was made between the recessive dystrophic EB (RDEB) and junctional EB (JEB) groups. Mandibular function was impaired in both groups but more severely in the RDEB-population. Intelligibility in both groups was almost unaffected. Restrictions in mobility of the mouth, tongue and lips are frequently present in EB patients. These are most severe in the RDEB group and support the clinical relevance of optimizing symptomatic treatment.
A Zero-Gravity Cup for Drinking Beverages in Microgravity
NASA Technical Reports Server (NTRS)
Pettit, Donald R.; Weislogel, Mark; Concus, Paul; Finn, Robert
2011-01-01
To date, the method for astronauts to drink liquids in microgravity or weightless environments is to suck the liquid from a bag or pouch through a straw. A new beverage cup works in microgravity and allows astronauts to drink liquids from a cup in a manner consistent with that on Earth. The cup is capable of holding beverages with an angled channel running along the wall from the bottom to the lip. In microgravity, a beverage is placed into the cup using the galley dispenser. The angled channel acts as an open passage that contains only two sides where capillary forces move the liquid along the channel until it reaches the top lip where the forces reach an equilibrium and the flow stops. When one sips the liquid at the lip of the channel, the capillary force equilibrium is upset and more liquid flows to the lip from the reservoir at the bottom to re-establish the equilibrium. This sipping process can continue until the total liquid contents of the cup is consumed, leaving only a few residual drops about the same quantity as in a ceramic cup when it is drunk dry on Earth.
Beautemps, D; Badin, P; Bailly, G
2001-05-01
The following contribution addresses several issues concerning speech degrees of freedom in French oral vowels, stop, and fricative consonants based on an analysis of tongue and lip shapes extracted from cineradio- and labio-films. The midsagittal tongue shapes have been submitted to a linear decomposition where some of the loading factors were selected such as jaw and larynx position while four other components were derived from principal component analysis (PCA). For the lips, in addition to the more traditional protrusion and opening components, a supplementary component was extracted to explain the upward movement of both the upper and lower lips in [v] production. A linear articulatory model was developed; the six tongue degrees of freedom were used as the articulatory control parameters of the midsagittal tongue contours and explained 96% of the tongue data variance. These control parameters were also used to specify the frontal lip width dimension derived from the labio-film front views. Finally, this model was complemented by a conversion model going from the midsagittal to the area function, based on a fitting of the midsagittal distances and the formant frequencies for both vowels and consonants.
Vulvar cancer usually forms slowly, most often on the vaginal lips or the sides of the vaginal opening. Having vulvar intraepithelial neoplasia or human papillomavirus (HPV) infection can increase the risk of developing vulvar cancer. Start here to find information on vulvar cancer treatment, research, and statistics.
[Macro- and microscopic systematization of cerebral cortex malformations in children].
Milovanov, A P; Milovanova, O A
2011-01-01
For the first time in pediatric pathologicoanatomic practice the complete systematization of cerebral cortex malformations is represented. Organ, macroscopic forms: microencephaly, macroencephaly, micropolygyria, pachygyria, schizencephaly, porencephaly, lissencephaly. Histic microdysgenesis of cortex: type I includes isolated abnormalities such as radial (IA) and tangential (I B) subtypes of cortical dislamination; type II includes sublocal cortical dislamination with immature dysmorphic neurons (II A) and balloon cells (II B); type III are the combination focal cortical dysplasia with tuberous sclerosis of the hippocampus (III A), tumors (III B) and malformations of vessels, traumatic and hypoxic disorders (III C). Band heterotopias. Subependimal nodular heterotopias. Tuberous sclerosis. Cellular typification of cortical dysplasia: immature neurons and balloon cells.
Phillips, C; Kim, S H; Tucker, M; Turvey, T A
2010-01-01
Objective Assess the long-term effect of sensory re-training exercises, age, gender, type of surgery, and pre-surgical psychological distress on patients' perception of the interference related to altered sensation two years after orthognathic surgery. Setting and Sample Population 186 subjects with a developmental dentofacial disharmony were enrolled in a multicenter randomized clinical trial: one center was a community based practice and the other a university-based center. Methods and Materials Subjects were randomly allocated to two groups: standard of care mouth opening exercises after BSSO or a progressive series of sensory retraining facial exercises in addition to the opening exercises. At 1, 3, 6, 12, and 24 months after surgery, subjects scored unusual feelings on the face, numbness, and loss of lip sensitivity from “no problem(1)” to “serious problem(7)”. A marginal proportional odds model was fit for each of the ordinal outcomes. Results Up to two years after surgery, the opening exercise only group had a higher likelihood of reporting interference in daily activities related to numbness and loss of lip sensitivity than the sensory retraining exercise group. The difference between the two groups was relatively constant. Older subjects and those with elevated psychological distress before surgery reported higher burdens related to unusual facial feelings, numbness, and loss of lip sensitivity (P<0.02). Conclusion The positive effect of sensory retraining facial exercises observed after surgery is maintained over time. Clinicians should consider the patient's age and psychological well-being prior to providing pre-surgical counseling regarding the impact on daily life of persistent altered sensation following a mandibular osteotomy. PMID:20618719
Sex differences in oral asymmetries during wordrepetition.
Hausmann, M; Behrendt-Körbitz, S; Kautz, H; Lamm, C; Radelt, F; Güntürkün, O
1998-12-01
During speech production the right side of the mouth is opened to a larger degree in most people. This facial asymmetry is thought to be related to a left hemisphere dominance in language processing and/or motor programming. We investigated asymmetrical lip separations during discrete or serial word productions in right handed persons. The results revealed a right sided lip separation bias in both genders during discrete word production in which the words had to be uttered once. As soon as the words had to be produced continuously, however, a clear sex difference appeared with males having the usual right bias but females now showing no clear asymmetry, with a tendency for larger lip separations on the left side. These results suggest the existence of two separate neural systems from which one controls the discrete task and which is left hemisphere dominant in both genders. The other is probably involved in serial word productions and shows a sex difference with regard to its asymmetry pattern.
Differential pressure pin discharge apparatus
DOE Office of Scientific and Technical Information (OSTI.GOV)
Oakley, D.J.
Disclosed is a discharge assembly for allowing elongate pins to be discharged from an area of relatively low pressure to an area of relatively greater pressure. The discharge assembly includes a duck valve having a lip piece made of flexible material. The flexible lip piece responds to a fluctuating pressure created downstream by an aspirator. The aspirator reduces the downstream pressure sensed by the duck valve when the discharge assembly is in the open position. This allows elongate pins to be moved through the duck valve with no backflow because the aspirator pressure is less than the pressure in themore » low pressure area from which the pins originate. Closure of the assembly causes the aspirator static pressure to force the flexible duck valve lip piece into a tightly sealed position also preventing backflow. The discharge assembly can be easily controlled using a single control valve which blocks the flow of aspirator gas and closes the pins passageway extending through the assembly.« less
Individual Differences in Affect.
ERIC Educational Resources Information Center
Haviland, Jeannette
This paper argues that infants' affect patterns are innate and are meaningful indicators of individual differences in internal state. Videotapes of seven infants' faces were coded using an ethogram; the movement of the eyebrow, eye direction, eye openness, mouth shape, mouth position, lip position, and tongue protrusion were assessed…
[Open rhinoplasty. 5-years experience].
Rangel, C; Sanches, F; Almeida, J E
1998-02-01
The principle advantages of open rhinoplasty concern diagnosis as well as technical facilities. The transcolumelar approach, initially described by Rheti in 1934 for surgical corrections of the cleft lip nose, was adopted by us since 1992 in 48 patients. We have systematically made a "staggered incision" at the collumella's narrowest point, that allows a great view of nasal structures. The results were considered good, even in difficult rhinoplasties. The scars were inconspicous, without cicatricial hypertrophies or deformities.
Genetics Home Reference: Hajdu-Cheney syndrome
... of the face ( midface hypoplasia ), and a large space between the nose and upper lip (a long philtrum ). Some affected children are born with an opening in the roof of the mouth called a cleft palate or with a high arched palate. In affected adults, the facial features ...
Ontogeny of Infantile Oral Reflexes and Emerging Chewing.
ERIC Educational Resources Information Center
Sheppard, Justine Joan; Mysak, Edward D.
1984-01-01
To document movement patterns and to examine developmental interrelationships, the ontogeny of rooting, lip, lateral tongue, mouth opening, biting, and Babkin reflexes and the development of emerging chewing behaviors were observed in two normal infants over a period from 1 week to 35 weeks of age. (Author/RH)
Cai, Xianghai; Chen, Siqi; Yang, Hong; Wang, Wei; Lin, Lin; Shen, Yaling; Wei, Wei; Wei, Dong-Zhi
2016-07-01
A lipase-producing bacterial strain was isolated from oil-well-produced water in Shengli oilfield (Shandong province, China) and was identified as Pseudomonas synxantha by 16S rDNA sequence analysis (named Pseudomonas synxantha PS1). Strain PS1 showed a maximum lipase activity of 10.8 U/mL after culturing for 48 h at 30 °C, with lactose (4 g/L) as carbon source, tryptone (8 g/L) as nitrogen source, olive oil (0.5%, v/v) as inductor, and the initial pH 8.0. Meanwhile, the lipase gene from P. synxantha PS1 was cloned and expressed in Escherichia coli BL21 with the vector pET28a. The novel gene (lipPS1) has an open reading frame of 1425 bp and encodes a 474 aa lipase (LipPS1) sharing the most identity (87%) with the lipase in Pseudomonas fluorescens. LipPS1 preferably acted on substrates with a long chain (C10-C18) of fatty acids. The optimum pH and temperature of the recombinant enzyme were 8.0 and 40 °C, respectively, towards the optimum substrate p-nitrophenyl palmitate. The LipPS1 showed remarkable stability under alkaline conditions and was stable at pH 7.0-10.0 (retaining more than 60% activity). From the organic solvents tests, the lipase was activated by 15% (v/v) methanol (112%), 15% ethanol (127%), and 15% n-butyl alcohol (116%). LipPS1 presented strong biodegradability of waste grease; 93% of waste grease was hydrolyzed into fatty acid after 12 h at 30 °C. This is the first report of the lipase activity and lipase gene obtained from P. synxantha (including wild strain and recombinant strain) and of the recombinant LipPS1 with the detailed enzymatic properties. Also a preliminary study of the biodegradability of waste greases shows the potential value in industry applications.
Vigneron, A; Morand, B; Lafontaine, V; Lesne, V; Lesne, C; Bettega, G
2015-11-01
Maxillary hypoplasia is a common sequela of cleft lip and palate. Its surgical treatment consists in a maxillary advancement by distraction or by conventional orthognathic surgery but morphological results are unpredictable. Our goal in this study was to see if the esthetical results (on the lip and the nose) of maxillary advancement were correlated to the preservation of lateral incisor space of the cleft side. This retrospective study included 38 patients operated between 2002 and 2013. Unilateral clefts were studied independently from bilateral clefts. Profile aesthetics was evaluated independently and subjectively by two surgeons and scored on an 8-point scale. The result was classified as "good" if the score was superior or equal to 6. The score was correlated to the following parameters: amount of maxillary advancement, upper incisor axis, preservation of the missing lateral incisor space. In the "good result" group, the space of the lateral incisor was less often preserved. The nasolabial angle was more open and the upper central incisor axis more vertical. These results were more pronounced in bilateral clefts, but also found in unilateral clefts. Under reservation of the subjective evaluation and of the small number of patients, it seemed that lateral incisor space closure improved the profile of patients treated by maxillary advancement for cleft lip and palate sequelae. Copyright © 2015 Elsevier Masson SAS. All rights reserved.
Two years of on-orbit gallium arsenide performance from the LIPS solar cell panel experiment
NASA Technical Reports Server (NTRS)
Francis, R. W.; Betz, F. E.
1985-01-01
The LIPS on-orbit performance of the gallium arsenide panel experiment was analyzed from flight operation telemetry data. Algorithms were developed to calculate the daily maximum power and associated solar array parameters by two independent methods. The first technique utilizes a least mean square polynomial fit to the power curve obtained with intensity and temperature corrected currents and voltages; whereas, the second incorporates an empirical expression for fill factor based on an open circuit voltage and the calculated series resistance. Maximum power, fill factor, open circuit voltage, short circuit current and series resistance of the solar cell array are examined as a function of flight time. Trends are analyzed with respect to possible mechanisms which may affect successive periods of output power during 2 years of flight operation. Degradation factors responsible for the on-orbit performance characteristics of gallium arsenide are discussed in relation to the calculated solar cell parameters. Performance trends and the potential degradation mechanisms are correlated with existing laboratory and flight data on both gallium arsenide and silicon solar cells for similar environments.
Morphometric Differences of Vocal Tract Articulators in Different Loudness Conditions in Singing.
Echternach, Matthias; Burk, Fabian; Burdumy, Michael; Traser, Louisa; Richter, Bernhard
2016-01-01
Dynamic MRI analysis of phonation has gathered interest in voice and speech physiology. However, there are limited data addressing the extent to which articulation is dependent on loudness. 12 professional singer subjects of different voice classifications were analysed concerning the vocal tract profiles recorded with dynamic real-time MRI with 25fps in different pitch and loudness conditions. The subjects were asked to sing ascending scales on the vowel /a/ in three loudness conditions (comfortable=mf, very soft=pp, very loud=ff, respectively). Furthermore, fundamental frequency and sound pressure level were analysed from the simultaneously recorded optical audio signal after noise cancellation. The data show articulatory differences with respect to changes of both pitch and loudness. Here, lip opening and pharynx width were increased. While the vertical larynx position was rising with pitch it was lower for greater loudness. Especially, the lip opening and pharynx width were more strongly correlated with the sound pressure level than with pitch. For the vowel /a/ loudness has an effect on articulation during singing which should be considered when articulatory vocal tract data are interpreted.
Luo, Dong-jiao; Yan, Jie; Mao, Ya-fei; Li, Shu-ping; Luo, Yi-hui; Li, Li-wei
2005-01-01
To construct lipL32/1-lipL41/1 fusion gene and its prokaryotic expression system and to determine frequencies of carrying and expression of lipL32 and lipL41 genes in L.interrogans wild strains and specific antibody levels in sera from leptospirosis patients. lipL32/1-lipL41/1 fusion gene was constructed using linking primer PCR method and the prokaryotic expression system of the fusion gene done with routine techniques. SDS-PAGE was used to examine expression of the target recombinant protein rLipL32/1-rLipL41/1. Immunogenicity of rLipL32/1-rLipL41/1 was identified by Western blot. PCR and MAT were performed to detect carrying and expression of lipL32 and lipL41 genes in 97 wild L.interrogans strains. Antibodies against products of lipL32 and lipL41 genes in serum samples from 228 leptospirosis patients were detected by ELISA method. The homogeneity of nucleotide and putative amino acid sequence of lipL32/1-lipL41/1 fusion gene were 99.9 % and 99.8 % in comparison with the reported sequences. Expression output of the target recombinant protein rLipL32/1-rLipL41/1, mainly present in inclusion body, accounted for 10 % of the total bacterial proteins. Both the rabbit antisera against rLipL32/1 and rLipL41/1 could combine to rLipL32/1-rLipL41/1. 97.9 % and 87.6 % of the L.interrogans wild strains had lipL32 and lipL41 genes, respectively. 95.9 % and 84.5 % of the wild strains were positive for MAT with titers of 1:4 - 1:128 using rabbit anti-rLipL32s or anti-rLipL41s sera, respectively. 94.7 % - 97.4 % of the patients'serum samples were positive for rLipL32s antibodies, while 78.5 % - 84.6 % of them were rLipL41s antibodies detectable. lipL32/1-jlipL41/1 fusion gene and its prokaryotic expression system were successfully constructed. The expressed fusion protein had qualified immunogenicity. Both the lipL32 and lipL41 genes are extensively carried and frequently expressed by different serogroups of L.interrogans, and their expression products exhibit cross-antigenicity.
Ai, Li; Huang, Yaping; Wang, Chuan
2018-06-04
A halophilic lipase (LipS2) was produced by Chromohalobacter canadensis strain which was isolated from ancient salt well of Zigong, China. LipS2 was purified to homogeneity and showed a single band with molecular mass of 58 kDa by SDS-PAGE. LipS2 preferred middle-to-long acyl chain esters with C14 triglycerides as optimum substrate. It was noteworthy that LipS2 displayed efficient hydrolysis activity to some vegetable oils which were composed of polyunsaturated fatty acid. LipS2 showed high activity in range of 2.5-3.5 M NaCl, no activity without salt. Optimum temperature and pH were 55 °C and pH 8.5, respectively. Notably, the thermostability and pH stability of LipS2, varying with salt concentration, reached optimum in the presence of 3.0 M NaCl. LipS2 was stimulated by Ca 2+ and Mg 2+ , inhibited by Zn 2+ , Cu 2+ , Mn 2+ , Fe 2+ , and Hg 2+ . Moreover, LipS2 displayed significant tolerance to organic solvents including methanol, ethanol, ethyl acetate and acetone, especially, LipS2 activity was enhanced markedly by the hexane and benzene. Non-ionic surfactants increased LipS2 activity, while ionic surfactants decreased activity. This was the first report on halophilic lipase of Chromohalobacter from ancient salt well. The results suggested that LipS2 may have considerable potential for biotechnological applications. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Yan, Wei; Li, Furong; Wang, Li; Zhu, Yaxin; Dong, Zhiyang; Bai, Linhan
2017-03-01
A new gene encoding a lipase (designated as Lip-1 ) was identified from a metagenomic bacterial artificial chromosome(BAC) library prepared from a concentrated water sample collected from a hot spring field in Niujie, Eryuan of Yunnan province in China. The open reading frame of this gene encoded 622 amino acid residues. It was cloned, fused with the oleosin gene and over expressed in Escherichia coli to prepare immobilized lipase artificial oil body AOB-sole-lip-1. The monomeric Sole-lip-1 fusion protein presented a molecular mass of 102.4 kDa. Enzyme assays using olive oil and methanol as the substrates in petroleum ether confirmed its transesterification activity. Hexadecanoic acid methyl ester, 8,11-Octadecadienoic acid methyl ester, 8-Octadecenoic acid methyl ester, and Octadecanoic acid methyl ester were detected. It showed favorable transesterification activity with optimal temperature 45 °C. Besides, the maximal biodiesel yield was obtained when the petroleum ether system as the organic solvent and the substrate methanol in 350 mmol/L (at a molar ratio of methanol of 10.5:1) and the water content was 1%. In light of these advantages, this lipase presents a promising resource for biodiesel production.
Luo, Dong-jiao; Qiu, Xiao-feng; Wang, Jiang; Yan, Jin; Wang, Hai-bin; Zhou, Jin-cheng; Yan, Jie
2008-11-01
To construct lipL32/1-lipL21-OmpL1/2 fusion gene of Leptospira interrogans and its prokaryotic expression system, and to identify the immunogenicity of its products. PCR using linking primers was applied to construct lipL32/1-lipL21-OmpL1/2 fusion gene and a prokaryotic expression system of the fusion gene was then established using routine genetic engineering technique. SDS-PAGE was used to examine output of the target recombinant protein rLipL32/1-LipL21-OmpL1/2. Double immunodiffusion and Western Blot assay were applied to identify immunogenicity of rLipL32/1-LipL21-OmpL1/2. lipL32/1-lipL21-OmpL1/2 fusion gene with correct sequence and its prokaryotic expression system E.coli BL21DE3pET42a-lipL32/1-lipL21-ompL1/2 was obtained in this study. The output of rLipL32/1-LipL21- OmpL1/2 after optimisation was 37.78 mg/L. The immunodiffusion titer of rabbit antiserum against rLipL32/1-LipL21-OmpL1/2 was 1:4. The rLipL32/1-LipL21-OmpL1/2 antiserum was able to recognize rLipL32/1-LipL21-OmpL1/2, rLipL32/1, rLipL21 and rOmpL1/2. Positive Western hybridization signals were found among rLipL32/1-LipL21-OmpL1/2 and rabbit antiserum against whole cell of strain 56601 and serum from patients infected with L.interrogans serogroups Icterohaemorrhagiae, Grippotyphosa, Autumnalis and Pomona. The fusion gene lipL32/1-lipL21-OmpL1/2 and its prokaryotic expression system were successfully constructed in this study. The expressed fusion protein can be used as the antigen for developing universal genetic engineering vaccine and universal serological tests of leptospirosis.
Leathers, Marvin L; Olson, Carl R
2017-04-01
Neurons in the lateral intraparietal (LIP) area of macaque monkey parietal cortex respond to cues predicting rewards and penalties of variable size in a manner that depends on the motivational salience of the predicted outcome (strong for both large reward and large penalty) rather than on its value (positive for large reward and negative for large penalty). This finding suggests that LIP mediates the capture of attention by salient events and does not encode value in the service of value-based decision making. It leaves open the question whether neurons elsewhere in the brain encode value in the identical task. To resolve this issue, we recorded neuronal activity in the amygdala in the context of the task employed in the LIP study. We found that responses to reward-predicting cues were similar between areas, with the majority of reward-sensitive neurons responding more strongly to cues that predicted large reward than to those that predicted small reward. Responses to penalty-predicting cues were, however, markedly different. In the amygdala, unlike LIP, few neurons were sensitive to penalty size, few penalty-sensitive neurons favored large over small penalty, and the dependence of firing rate on penalty size was negatively correlated with its dependence on reward size. These results indicate that amygdala neurons encoded cue value under circumstances in which LIP neurons exhibited sensitivity to motivational salience. However, the representation of negative value, as reflected in sensitivity to penalty size, was weaker than the representation of positive value, as reflected in sensitivity to reward size. NEW & NOTEWORTHY This is the first study to characterize amygdala neuronal responses to cues predicting rewards and penalties of variable size in monkeys making value-based choices. Manipulating reward and penalty size allowed distinguishing activity dependent on motivational salience from activity dependent on value. This approach revealed in a previous study that neurons of the lateral intraparietal (LIP) area encode motivational salience. Here, it reveals that amygdala neurons encode value. The results establish a sharp functional distinction between the two areas. Copyright © 2017 the American Physiological Society.
Zou, Lanyi; Chen, Yunjia; Liu, Henglang; Na, Bi; He, Jinlong; Fan, Xiaoping
2016-04-01
To establish the Chinese Han national criteria for the thickness of upper lip in Chongqing and to investigate the effect of lip thickness on lip retraction in orthodontic treatment. A total of 240 adult patients (male=120, female=120) of Chinese Han nationality aged 18-35 years in Chongqing were treated with cephalograms and measured the thickness of upper lip. We established the Chinese Han national criteria for the thickness of upper lip in Chongqing according to the results. Sixty-eight female patients with Angle II 1 from Department of Orthodontics Stomatological Hospital of Chongqing Medical University were treated with maxillary premolars extraction, and pre- and post-treated with lateral cephalograms, then divided into 3 groups according to our criteria: a thin lips group, a normal lips group and a thick lips group. The ratio of the incisors retraction and the upper lip retraction were measured and calculated. The correlation between incisors retraction and the upper lip retraction was analyzed by the Pearson correlation method. There was statistical significance in the thickness of upper lip between males and females (P<0.01). The ratio of maxillary inscior retraction to the upper lip soft tissue retraction was 1.6:1, 2.2:1 and 2.9:1 in the thin lips group, the normal lips group and the thick lips group, respectively. Gender differences exist in the thickness of upper lip. Upper lip retraction with the incisors was negatively correlated with the soft tissue thickness of the upper lip in females with Angle II 1.
Feteih, Rabab M
2006-01-01
Background The aim of this study was to evaluate the prevalence of signs and symptoms of temporomandibular disorders (TMD) and oral parafunction habits among Saudi adolescents in the permanent dentition stage. Methods A total of 385 (230 females and 155 males) school children age 12–16, completed a questionnaire and were examined clinically. A stratified selection technique was used for schools allocation. Results The results showed that 21.3% of the subjects exhibited at least one sign of TMD and females were generally more affected than males. Joint sounds were the most prevalent sign (13.5%) followed by restricted opening (4.7%) and opening deviation (3.9%). The amplitude of mouth opening, overbite taken into consideration, was 46.5 mm and 50.2 mm in females and males respectively. TMJ pain and muscle tenderness were rare (0.5%). Reported symptoms were 33%, headache being the most frequent symptom 22%, followed by pain during chewing 14% and hearing TMJ noises 8.7%. Difficulty during jaw opening and jaw locking were rare. Lip/cheek biting was the most common parafunction habit (41%) with females significantly more than males, followed by nail biting (29%). Bruxism and thumb sucking were only 7.4% and 7.8% respectively. Conclusion The prevalence of TMD signs were 21.3% with joint sounds being the most prevalent sign. While TMD symptoms were found to be 33% as, with headache being the most prevalent. Among the oral parafunctions, lip/cheek biting was the most prevalent 41% followed by nail biting 29%. PMID:16914032
Intrafamilial variation in Cohen syndrome.
Young, I D; Moore, J R
1987-01-01
Three sibs with Cohen syndrome are presented. Abnormalities present in all three children include mental retardation, hypotonia, and short philtrum with open mouth and prominent lips. The older two sibs have a similar facies and an engaging personality. The youngest child shows a different facial appearance and marked behavioural problems, thereby illustrating the intrafamilial variability which may occur in this disorder. Images PMID:3656371
Morphometric Differences of Vocal Tract Articulators in Different Loudness Conditions in Singing
Echternach, Matthias; Burk, Fabian; Burdumy, Michael; Traser, Louisa; Richter, Bernhard
2016-01-01
Introduction Dynamic MRI analysis of phonation has gathered interest in voice and speech physiology. However, there are limited data addressing the extent to which articulation is dependent on loudness. Material and Methods 12 professional singer subjects of different voice classifications were analysed concerning the vocal tract profiles recorded with dynamic real-time MRI with 25fps in different pitch and loudness conditions. The subjects were asked to sing ascending scales on the vowel /a/ in three loudness conditions (comfortable = mf, very soft = pp, very loud = ff, respectively). Furthermore, fundamental frequency and sound pressure level were analysed from the simultaneously recorded optical audio signal after noise cancellation. Results The data show articulatory differences with respect to changes of both pitch and loudness. Here, lip opening and pharynx width were increased. While the vertical larynx position was rising with pitch it was lower for greater loudness. Especially, the lip opening and pharynx width were more strongly correlated with the sound pressure level than with pitch. Conclusion For the vowel /a/ loudness has an effect on articulation during singing which should be considered when articulatory vocal tract data are interpreted. PMID:27096935
Celli, Daniel; Gasperoni, Enrico; Deli, Roberto
2007-01-01
This case report describes the treatment of a patient with a Class II malocclusion with an anterior open bite. The patient, a girl 16 years of age, had a significant anteroposterior discrepancy and a high-angle tendency. Her face was convex, with competent lips. Intraorally she had an anterior open bite of 3 mm, space in the mandibular arch, and an overjet of 2 mm. High-pull headgear, anterior intermaxillary elastics, and appropriate wire bending were used to close the bite and to correct the anteroposterior dental relationship. Modification of a tongue thrust habit helped to correct this significant malocclusion and provided stability at 11 years posttreatment.
Numerical Study of Impingement Location of Liquid Jet Poured from a Tilting Ladle with Lip Spout
NASA Astrophysics Data System (ADS)
Castilla, R.; Gamez-Montero, P. J.; Raush, G.; Khamashta, M.; Codina, E.
2017-04-01
A new approach for simulating liquid poured from a tilting lip spout is presented, using neither a dynamic mesh nor the moving solid solution method. In this case only the tilting ladle is moving, so we propose to rotate the gravitational acceleration at an angular velocity prescribed by a geometrical and dynamical calculation to keep the poured flow rate constant. This angular velocity is applied to modify the orientation of the gravity vector in computational fluid dynamics (CFD) simulations using the OpenFOAM® toolbox. Also, fictitious forces are considered. The modified solver is used to calculate the impingement location for six spout geometries and compare the jet dispersion there. This method could offer an inexpensive tool to calculate optimal spout geometries to reduce sprue size in the metal casting industry.
NASA Technical Reports Server (NTRS)
Stimpert, D. L.
1978-01-01
An acoustic and aerodynamic test program was conducted on a 1/6.25 scale model of the Quiet, Clean, Short-Haul Experimental Engine (QCSEE) forward thrust over-the-wing (OTW) nozzle and OTW thrust reverser. In reverse thrust, the effect of reverser geometry was studied by parametric variations in blocker spacing, blocker height, lip angle, and lip length. Forward thrust nozzle tests determined the jet noise levels of the cruise and takeoff nozzles, the effect of opening side doors to achieve takeoff thrust, and scrubbing noise of the cruise and takeoff jet on a simulated wing surface. Velocity profiles are presented for both forward and reverse thrust nozzles. An estimate of the reverse thrust was made utilizing the measured centerline turning angle.
Is it possible to define the ideal lips?
Kar, M; Muluk, N B; Bafaqeeh, S A; Cingi, C
2018-02-01
The lips are an essential component of the symmetry and aesthetics of the face. Cosmetic surgery to modify the lips has recently gained in popularity, but the results are in some cases disasterous. In this review, we describe the features of the ideal lips for an individual's face. The features of the ideal lips with respect to facial anatomy, important anatomical landmarks of the face, the facial proportions of the lips and ethnic and sexual differences are described. The projection and relative sizes of the upper and lower lips are as significant to lip aesthetics as the proportion of the lips to the rest of the facial structure. Robust, pouty lips are considered to be sexually attractive by both males and females. Horizontal thirds and the golden ratio describe the proportions that contribute to the beauty and attractiveness of the lips. In young Caucasians, the ideal ratio of the vertical height of the upper lip to that of the lower lip is 1:1.6. Blacks, genetically, have a greater lip volume. The shape and volume of a person's lips are of great importance in the perception of beauty by humans. The appearance of the lips in part determines the attractiveness of a person's face. In females, fuller lips in relation to facial width as well as greater vermilion height are considered to be attractive. Copyright © 2018 Società Italiana di Otorinolaringologia e Chirurgia Cervico-Facciale, Rome, Italy.
Evolution of Lava Sheets for LIPs: Types of Local and Regional Trends
NASA Astrophysics Data System (ADS)
Rakhmenkulova, I. F.; Sharapov, V. N.
2011-12-01
The North-Atlantic Igneous Province (NAIP), the Permian-Triassic traps of the Siberian Platform (SP), and the volcanic shields of the Hawaiian Ridge can be regarded as the examples of local and regional trends for lava sheets evolution of LIPs. Complex statistical analysis for distribution functions of petrogenic and trace components showed that cyclicity and spatial asymmetry for melt compositions are typical for all lava sheets of LIPs. NAIP has the following features: 1) the formation of continental swell and its rifting; 2) the oceanic basin formation as a system of open basins at the east and the opening of the Central Atlantic to the north with the transverse volcanic zone of the Ferraro Ridge; 3) quick opening of the oceanic basin with the formation and accretion of lava sheet in the centre of the spreading zone (MOR). At the western NAIP part, during the sheet breakage, magnesian melts were forming, in the east - 'typical' trap tholeiitic association with thick lava profiles; oceanic part of the system contains various oceanic basalts. Iceland lava sheet passed through at least three subsequent formation stages with typical petrochemical igneous rock complexes. There are local petrochemical trends in the Iceland sheet: as the basalt crust thickens, acid melt amounts increase. The Permian-Triassic SP traps at the southern part of the Khatanga Rift (where the province started to develop spatially) have the following zones: layered profiles of tuffaceous rocks in the Tunguska Syncline, with various quantities of lava flows in the upper part of the profiles; to the south, within the holes between the net of fissure and central lava-breccia volcanic structures, reloaded tuff material is located; more to the south this structural zone changes to swarms of dyke-diatreme structures having typical near-vent depressions. The explosive coefficient within these zones increases from the north to the south. In the western part of trap zone there is a petrochemical zoning - in general basalts become less magnesian from the Norilsk mulde to the Angaro-Ilim iron-ore region, while intrusive rocks become more titanic and alkaline. In local time distribution functions of petrogenic and trace components various trends are recorded. The above-mentioned LIP characteristics for the Hawaiian volcanic ridge have the following specific features: 1) lava compositions and volumes change from the north to the south along the strike of the Hawaiian-Emperor Chain; 2) lava compositions in the southern part of the Hawaiian Ridge are asymmetric transversely; 3) magma compositions in local lava shields for Kea and Loa lines of the southern part of the Hawaiian Ridge are cyclic; 4) volcanogenic rocks of this area have some general properties: the compositions of petrogenic and trace components, as well as and the amounts of Pb and Hf isotopes increase in lavas from the south to the north; there are no spatial trends for Ti compounds and Sr isotopes; the amounts of Al, Fe, Mn, Na, K; P, C oxides, as well as the amounts of Sr, Eu, Tb, Rb, La, Th and Nd, Os isotopes decrease. We think that the recorded variation of LIP parameters is due to geodynamic conditions and the lithosphere rocks compositions.
The Metagenome-Derived Enzymes LipS and LipT Increase the Diversity of Known Lipases
Chow, Jennifer; Kovacic, Filip; Dall Antonia, Yuliya; Krauss, Ulrich; Fersini, Francesco; Schmeisser, Christel; Lauinger, Benjamin; Bongen, Patrick; Pietruszka, Joerg; Schmidt, Marlen; Menyes, Ina; Bornscheuer, Uwe T.; Eckstein, Marrit; Thum, Oliver; Liese, Andreas; Mueller-Dieckmann, Jochen; Jaeger, Karl-Erich; Streit, Wolfgang R.
2012-01-01
Triacylglycerol lipases (EC 3.1.1.3) catalyze both hydrolysis and synthesis reactions with a broad spectrum of substrates rendering them especially suitable for many biotechnological applications. Most lipases used today originate from mesophilic organisms and are susceptible to thermal denaturation whereas only few possess high thermotolerance. Here, we report on the identification and characterization of two novel thermostable bacterial lipases identified by functional metagenomic screenings. Metagenomic libraries were constructed from enrichment cultures maintained at 65 to 75°C and screened resulting in the identification of initially 10 clones with lipolytic activities. Subsequently, two ORFs were identified encoding lipases, LipS and LipT. Comparative sequence analyses suggested that both enzymes are members of novel lipase families. LipS is a 30.2 kDa protein and revealed a half-life of 48 h at 70°C. The lipT gene encoded for a multimeric enzyme with a half-life of 3 h at 70°C. LipS had an optimum temperature at 70°C and LipT at 75°C. Both enzymes catalyzed hydrolysis of long-chain (C12 and C14) fatty acid esters and additionally hydrolyzed a number of industry-relevant substrates. LipS was highly specific for (R)-ibuprofen-phenyl ester with an enantiomeric excess (ee) of 99%. Furthermore, LipS was able to synthesize 1-propyl laurate and 1-tetradecyl myristate at 70°C with rates similar to those of the lipase CalB from Candida antarctica. LipS represents the first example of a thermostable metagenome-derived lipase with significant synthesis activities. Its X-ray structure was solved with a resolution of 1.99 Å revealing an unusually compact lid structure. PMID:23112831
Sun, Xiao-Cai; Li, Wen-Bin; Zhao, Li; Jia, Hui-Xian; Wang, Fang; Zhang, Min; Li, Shu-Qin
2013-01-01
To observe the expression of p38 MAPK and HSP 70 in CA3 and dentate gyrus (DG) regions of the hippocampus of rats induced by limb ischemic preconditioning (LIP). Ninety-six rats were randomly divided into sham and LIP groups. And the animals in the LIP group were further divided into LIP 6 h, LIP 12 h, LIP 1 d, LIP 2 d, LIP 3 d, LIP 4 d and LIP 5 d subgroups according to the time of reperfusion after LIP. Immunohistochemical staining and Western blot were used to observe the expression of p38 MAPK and HSP 70 in CA3 and DG regions of the hippocampus. The results of the immunohistochemical staining and Western blot were consistent, which indicated that there were fluctuation in the p-p38 MAPK and HSP 70 expression in CA3 and DG regions after LIP compared with those of the sham group. The expression of p-p38 MAPK began to be up-regulated 1d after LIP and reached its peak at 3 d and lasted for 4 d after LIP. However, the expression of HSP 70 was significantly up-regulated 2 d after LIP compared to the sham group, reached its peak at 3 d and lasted until the 4 d after LIP. LIP up-regulates the expression of p38 MAPK and HSP 70 in the CA3 and DG regions of the hippocampus of rats.
Oblique lip-alveolar banding in patients with cleft lip and palate.
Naidoo, S; Bütow, K-W
2015-04-01
We report an oblique lip-alveolar band, a rare banding of soft tissue that involves the lip and alveolus, which we have found in five patients with cleft lip and palate (0.2%), compared with an incidence of the Simonartz lip-lip band of 5.7%). To our knowledge this has not been reported previously. In two patients the bands affected the cleft lip and alveolus bilaterally, with or without the palatal cleft, and in three the bands were unilateral cleft lip and alveolus with or without the palatal cleft. Copyright © 2015 The British Association of Oral and Maxillofacial Surgeons. Published by Elsevier Ltd. All rights reserved.
Discriminative analysis of lip motion features for speaker identification and speech-reading.
Cetingül, H Ertan; Yemez, Yücel; Erzin, Engin; Tekalp, A Murat
2006-10-01
There have been several studies that jointly use audio, lip intensity, and lip geometry information for speaker identification and speech-reading applications. This paper proposes using explicit lip motion information, instead of or in addition to lip intensity and/or geometry information, for speaker identification and speech-reading within a unified feature selection and discrimination analysis framework, and addresses two important issues: 1) Is using explicit lip motion information useful, and, 2) if so, what are the best lip motion features for these two applications? The best lip motion features for speaker identification are considered to be those that result in the highest discrimination of individual speakers in a population, whereas for speech-reading, the best features are those providing the highest phoneme/word/phrase recognition rate. Several lip motion feature candidates have been considered including dense motion features within a bounding box about the lip, lip contour motion features, and combination of these with lip shape features. Furthermore, a novel two-stage, spatial, and temporal discrimination analysis is introduced to select the best lip motion features for speaker identification and speech-reading applications. Experimental results using an hidden-Markov-model-based recognition system indicate that using explicit lip motion information provides additional performance gains in both applications, and lip motion features prove more valuable in the case of speech-reading application.
Lip prints and inheritance of cleft lip and cleft palate.
Cj, Manasa Ravath; Hc, Girish; Murgod, Sanjay; Hegde, Ramesh B; Jk, Savita
2014-07-01
Labial mucosa has elevations and depressions forming a pattern called 'Lip Prints'. Parents of patients with cleft lip &/or palate are known to have a particular lip print pattern. Analysis of lip prints and relationship between Cheiloscopy and inheritance of cleft lip &/or cleft palate. The study included 100 subjects [study groupparents with children having cleft lip &/or cleft palate, 50 fathers and 50 mothers) and 50 subjects (control group-parents having children without cleft lip &/or cleft palate, 25 fathers and 25 mothers. The lip prints of the subjects were obtained using the cellophane method and analysed using Suzuki & Tsuchihashi classification of lip prints. The data was subjected to Chi- Square test, Fisher Exact test and Student t-test [two tailed, independent]. A new whorl pattern was present in the study group. The groove count was higher in the fathers' than in the mothers' prints in the upper lip and vice versa in the lower lip. The new pattern was present in the study group in a significant number of cases. The groove count was significantly high in the study group. These two parameters can be of significant value to similar future studies.
Lip Prints and Inheritance of Cleft Lip and Cleft Palate
CJ, Manasa Ravath; HC, Girish; Hegde, Ramesh B; JK, Savita
2014-01-01
Background: Labial mucosa has elevations and depressions forming a pattern called ‘Lip Prints’. Parents of patients with cleft lip &/or palate are known to have a particular lip print pattern. Objectives: Analysis of lip prints and relationship between Cheiloscopy and inheritance of cleft lip &/or cleft palate. Methodology: The study included 100 subjects [study groupparents with children having cleft lip &/or cleft palate, 50 fathers and 50 mothers) and 50 subjects (control group-parents having children without cleft lip &/or cleft palate, 25 fathers and 25 mothers. The lip prints of the subjects were obtained using the cellophane method and analysed using Suzuki & Tsuchihashi classification of lip prints. The data was subjected to Chi- Square test, Fisher Exact test and Student t-test [two tailed, independent]. Results: A new whorl pattern was present in the study group. The groove count was higher in the fathers’ than in the mothers’ prints in the upper lip and vice versa in the lower lip. Conclusion: The new pattern was present in the study group in a significant number of cases. The groove count was significantly high in the study group. These two parameters can be of significant value to similar future studies. PMID:25177633
Articulation and oromyofunctional behavior in children seeking orthodontic treatment.
Van Lierde, K M; Luyten, A; D'haeseleer, E; Van Maele, G; Becue, L; Fonteyne, E; Corthals, P; De Pauw, G
2015-05-01
The purpose of this controlled study is to document articulation and oromyofunctional behavior in children seeking orthodontic treatment. In addition, relations between malocclusions, articulation, and oromyofunctional behavior are studied. The study included 56 children seeking orthodontic treatment. The control group, consisting of 54 subjects matched for age and gender, did not undergo orthodontic intervention. To determine the impact of the occlusion on speech, the Oral Health Impact Profile was used. Speech characteristics, intelligibility and several lip and tongue functions were analyzed using consensus evaluations. A significant impact of the occlusion on speech and more articulation disorders for/s,n,l,t/were found in the subjects seeking orthodontic treatment. Several other phenomena were seen more often in this group, namely more impaired lip positioning during swallowing, impaired tongue function at rest, mouth breathing, open mouth posture, lip sucking/biting, anterior tongue position at rest, and tongue thrust. Moreover, all children with a tongue thrust showed an anterior tongue position at rest. Children seeking orthodontics have articulatory and oromyofunctional disorders. To what extent a combined orthodontic and logopaedic treatment can result in optimal oral health (i.e. perfect dentofacial unit with perfect articulation) is subject for further multidisciplinary research. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Evaluation of different esthetic smile criteria.
Al-Johany, Sulieman S; Alqahtani, Abdulaziz S; Alqahtani, Fahd Y; Alzahrani, Adel H
2011-01-01
The aim of this study was to evaluate the existence of different esthetic smile criteria as determined on the smiles of celebrities, which were considered by lay people to be beautiful. An Internet search for "best smile" and "female celebrities" in the years 2007 and 2008 identified 50 celebrities who were voted to have beautiful smiles. Another search was made for images of these celebrities that showed the entire face with an open smile. The images were analyzed using Digimizer image analysis software for different esthetic smile criteria. Eighty percent of the sample was classified as having an average upper lip position, 62% showed upward upper lip curvature, and 78% had a parallel smile line. Forty-two percent of the images showed the maxillary anterior teeth not touching the lower lip, while 34% were touching, and 24% slightly covered it. Sixty percent displayed up to the second premolar, and 32% displayed up to the first molar when smiling. Midline deviation was detected in 36% of the sample. Diastema and golden proportion were not seen in any of the subjects. Female celebrities voted to have the best smile by lay people showed most of the esthetic smile criteria with slight variations, except for the golden proportion. The opinions and perceptions of lay people about beauty should be studied and evaluated.
Jiao, Zhen; Wang, Xiudong; Yin, Yuting; Xia, Jingxin; Mei, Yanan
2018-05-03
Vitamin C (VC) and folic acid (FA) are the important nutrient and antioxidant in human body. In order to improve their stability, their co-loaded liposomes (VCFA-Lip) and chitosan-coated liposomes (CS-VCFA-Lip) are prepared and characterised. The mean particle size of VCFA-Lip and CS-VCFA-Lip is 138 nm and 249 nm, respectively. The encapsulation efficiencies of both drugs for CS-VCFA-Lip are much higher than those for VCFA-Lip. Furthermore, the experimental results show that the antioxidant activity of CS-VCFA-Lip is higher than that of VCFA-Lip. Moreover, the storage stability study reveals that the chitosan coating can efficiently improve the physical stability of VCFA-Lip. These results indicate that stability of VC and FA can be greatly improved after being wrapped by liposomes. In addition, the performance of CS-VCFA-Lip is better than VCFA-Lip, indicating CS-VCFA-Lip can be applied as a promising delivery system for the antioxidant defence system to the food industry and cosmetic industry.
Rullo, R; Festa, V M; Rullo, R; Addabbo, F; Chiodini, P; Vitale, M; Perillo, L
2015-09-01
To examine the prevalence of different types of dental anomalies in children with nonsyndromic cleft lip, unilateral cleft lip-palate, and bilateral cleft lip-palate. A sample of 90 patients (aged 4-20 years) affected by isolated cleft lip, unilateral and bilateral cleft lip and palate was examined. Cleft patients were classified into one of three groups according to cleft type: (1) Unilateral Cleft Lip-Palate, (2) Bilateral Cleft Lip-Palate, and (3) Cleft Lip. Intraoral exams, panoramic radiographs and dental casts, were used to analyse the prevalence of the various dental anomalies included in this study. There were no statistically significant differences between patients with cleft lip, unilateral cleft lip and palate and bilateral cleft lip and palate. The congenital absence of the cleft-side lateral incisor was observed in 40% of the sample, and a total of 30% patients showed supernumerary teeth at the incisors region. Second premolar agenesis was found in 4.4% of patients, whereas in 18.9% of the sample there was an ectopic dental eruption. Lateral or central incisors rotation was noted in 31.1% of the sample, while shape anomaly, lateral incisor microdontia, and enamel hypoplasia were detected respectively in 25.6%, 5.6% and 18.9% of cleft patients. High prevalence of different dental anomalies in children with cleft lip and unilateral and bilateral cleft lip and palate has been confirmed. This study, in particular, shows the presence of ectopic and rotated teeth in the cleft area.
Presurgical Unilateral Cleft Lip Anthropometrics and the Presence of Dental Anomalies.
Antonarakis, Gregory S; Fisher, David M
2015-07-01
To investigate associations between cleft lip anthropometrics and dental anomalies in the permanent dentition in unilateral cleft lip patients. Retrospective cross-sectional study. Children with unilateral clefts of the lip, with or without cleft palate. Anthropometric lip measurements, made immediately prior to lip repair, were available for each patient. The presence of dental anomalies in the permanent dentition was assessed radiographically. The presence of associations between anthropometric lip measurements and prevalence rates of different dental anomalies were determined using logistic regression analyses. In the 122 included patients, the cleft lateral lip element was deficient in height in 80% and in transverse length in 84% of patients. Patients with more deficient cleft side lateral lip height and less deficient cleft side lateral lip transverse length were more likely to present with cleft side maxillary lateral incisor agenesis. On the other hand, patients with a less deficient cleft side lateral lip height and more deficient cleft side lateral lip transverse length were more likely to present with a cleft side supernumerary maxillary lateral incisor. When looking only at incomplete clefts, the cleft side lateral lip transverse length deficiency was more predictive of the presence of supernumerary maxillary lateral incisors (P = .030), while for complete clefts, the cleft side lateral lip height deficiency was more predictive of the presence of maxillary lateral incisor agenesis (P = .035). In patients with unilateral clefts, cleft lip anthropometrics have a predictive role in determining the occurrence of dental anomalies.
Four-point injection technique for lip augmentation.
Sahan, Ali; Funda, Tamer
2018-06-01
Lip augmentation procedures with hyaluronic acid dermal fillers have become increasingly popular worldwide because full lips are often considered beautiful and youthful. The goal of a lip augmentation procedure is to create smooth lips with adequate volume and a natural appearance. Various techniques for lip augmentation have been utilized and described. In the four-point injection technique, the lips were divided equally into right side and left side. Four entry points were made above the vermilion border for the upper lip and below the vermilion border for the lower lip. The filler was administered with a fanning technique through each entry point. Between January 2017 and November 2017, 50 female patients underwent a nonsurgical lip augmentation procedure with injectable fillers using this technique. Forty-five patients (90%) reported that they were satisfied or extremely satisfied with their lip enhancement procedure. No serious complications were observed. The advantages of this technique are reducing the risk of complications like erythema, edema, and vascular injuries, and providing easy access to injection sites.
Shiokawa, Kanae; Gamage, Chandika D; Koizumi, Nobuo; Sakoda, Yoshihiro; Shimizu, Kenta; Tsuda, Yoshimi; Yoshimatsu, Kumiko; Arikawa, Jiro
2016-02-01
The applicability of the recombinant LipL32 for serodiagnosis of leptospiral infection in field rodents was assessed in this study. An immunodominant region of LipL32 was determined by monoclonal antibodies, and then, truncated LipL32 (tLipL32) was designed to contain the region (87-188th amino acid). The tLipL32 was compared between two recombinant expression hosts Escherichia coli and Pichia pastoris in ELISA. With field rat sera, tLipL32 expressed by P. pastoris (tLipL32p) had high antigenicity without background reactions, while tLipL32 expressed by E. coli (tLipL32e) showed high background reactions, which were reduced by pre-adsorption of sera with E. coli. To evaluate tLipL32-ELISA, field rat sera were tentatively divided into a Leptospira infection positive (12 sera) and a negative group (12 sera) based on the results from flaB gene PCR of kidney samples and WB with whole Leptospira cell. Consequently, the sensitivity of tLipL32p-ELISA for field rat sera was 83% . A similar result was obtained from tLipL32e-ELISA with adsorbed sera, (92%). However, sensitivity of tLipL32e-ELISA using sera without an adsorption treatment was 50%. Regardless of the expression host, tLipL32-ELISA had 100% specificity and sensitivity in experimentally infected laboratory rats. These results suggest that recombinant LipL32 expressed by P. pastoris is more applicable for serodiagnosis in field rats due to a lack of background reaction.
Kaur, Gurkamaljit; Pandey, Bharati; Grover, Arbind; Garewal, Naina; Grover, Abhinav; Kaur, Jagdeep
2018-03-30
The lipolytic protein LipU was conserved in mycobacterium sp. including M. tuberculosis (MTB LipU) and M. leprae (MLP LipU). The MTB LipU was identified in extracellular fraction and was reported to be essential for the survival of mycobacterium. Therefore to address the problem of drug resistance in pathogen, LipU was selected as a drug target and the viability of finding out some FDA approved drugs as LipU inhibitors in both the cases was explored. Three-dimensional (3D) model structures of MTB LipU and MLP LipU were generated and stabilized through molecular dynamics (MD). FDA approved drugs were screened against these proteins. The result showed that the top-scoring compounds for MTB LipU were Diosmin, Acarbose and Ouabain with the Glide XP score of -12.8, -11.9 and -11.7 kcal/mol, respectively, whereas for MLP LipU protein, Digoxin (-9.2 kcal/mol), Indinavir (-8.2 kcal/mol) and Travoprost (-8.2 kcal/mol) showed highest affinity. These drugs remained bound in the active site pocket of MTB LipU and MLP LipU structure and interaction grew stronger after dynamics. RMSD, RMSF and Rg were found to be persistent throughout the simulation period. Hydrogen bonds along with large number of hydrophobic interactions stabilized the complex structures. Binding free energies obtained through Prime/MM-GBSA were found in the significant range from -63.85 kcal/mol to -34.57 kcal/mol for MTB LipU and -71.33 kcal/mol to -23.91 kcal/mol for MLP LipU. The report suggested high probability of these drugs to demolish the LipU activity and could be probable drug candidates to combat TB and leprosy disease.
Assessing Angle's malocclusion among cleft lip and/or palate patients in Jammu.
Gupta, Akshay; Gupta, Anur; Bhardwaj, Amit; Vikram, S; Gomathi, Ajeetha; Singh, Karanprakash
2016-04-01
The study was conducted to examine the patients with abnormalities of cleft lip and/or palate and its association with different types of malocclusion. This descriptive study was done among 168 patients with abnormalities of cleft lip and/or palate. Angle's classification of malocclusion was applied for assessment of occlusion as Class I, Class II, and Class III. The types of oral clefts classification such as cleft lip unilateral and cleft lip bilateral, cleft palate (CP), unilateral cleft lip with palate (UCLP) and bilateral cleft lip with palate (BCLP) was considered. Chi-square test was applied to analyze the data at P < 0.05. The study showed different categories of clefts patients as cleft lip (81), CP (31), and both cleft lip and palate (53). The occurrence of unilateral cleft lip (44) was maximum among the sample followed by UCLP (39), and bilateral cleft lip (31). Maximum subjects with Class II (10.7%) and Class III (4.9%) malocclusion were seen with unilateral cleft lip deformities. None of the patients with UCLP had Class III malocclusion. Cleft lip was the most commonly observed deformity and high frequency of Class II and III malocclusion was evident. Therefore, patients with such abnormalities should be screened timely.
Cleft lip and cleft palate are birth defects that occur when a baby's lip or mouth do not form properly. They happen early during ... A baby can have a cleft lip, a cleft palate, or both. A cleft lip happens if the ...
Rottler, Philipp; Schroeder, Henry W S; Lotze, Martin
2014-02-01
A hypoglossal-facial transfer is a common surgical strategy for reanimating the face after persistent total hemifacial palsy. We were interested in how motor recovery is associated with cortical reorganization of lip and tongue representation in the primary sensorimotor cortex after the transfer. Therefore, we used functional magnetic resonance imaging (fMRI) in 13 patients who underwent a hypoglossal-facial transfer after unilateral peripheral facial palsy. To identify primary motor and somatosensory tongue and lip representation sites, we measured repetitive tongue and lip movements during fMRI. Electromyography (EMG) of the perioral muscles during tongue and lip movements and standardized evaluation of lip elevation served as outcome parameters. We found an association of cortical representation sites in the pre- and postcentral gyrus (decreased distance of lip and tongue representation) with symmetry of recovered lip movements (lip elevation) and coactivation of the lip during voluntary tongue movements (EMG-activity of the lip during tongue movements). Overall, our study shows that hypoglossal-facial transfer resulted in an outcome-dependent cortical reorganization with activation of the cortical tongue area for restituded movement of the lip. Copyright © 2012 Wiley Periodicals, Inc.
Al-Fahdawi, Mahmood Abd; Farid, Mary Medhat; El-Fotouh, Mona Abou; El-Kassaby, Marwa Abdelwahab
2017-03-01
To assess the nasopharyngeal airway volume, cross-sectional area, and depth in previously repaired nonsyndromic unilateral cleft lip and palate versus bilateral cleft lip and palate patients compared with noncleft controls using cone-beam computed tomography with the ultimate goal of finding whether cleft lip and palate patients are more liable to nasopharyngeal airway obstruction. A retrospective analysis comparing bilateral cleft lip and palate, unilateral cleft lip and palate, and control subjects. Significance at P ≤ .05. Cleft Care Center and the outpatient clinic that are both affiliated with our faculty. Cone-beam computed tomography data were selected of 58 individuals aged 9 to 12 years: 14 with bilateral cleft lip and palate and 20 with unilateral cleft lip and palate as well as 24 age- and gender-matched noncleft controls. Volume, depth, and cross-sectional area of nasopharyngeal airway were measured. Patients with bilateral cleft lip and palate showed significantly larger nasopharyngeal airway volume than controls and patients with unilateral cleft lip and palate (P < .001). Patients with bilateral cleft lip and palate showed significantly larger cross-sectional area than those with unilateral cleft lip and palate (P < .001) and insignificant cross-sectional area compared with controls (P > .05). Patients with bilateral cleft lip and palate showed significantly larger depth than controls and those with unilateral cleft lip and palate (P < .001). Patients with unilateral cleft lip and palate showed insignificant nasopharyngeal airway volume, cross-sectional area, and depth compared with controls (P > .05). Unilateral and bilateral cleft lip and palate patients did not show significantly less volume, cross-sectional area, or depth of nasopharyngeal airway than controls. From the results of this study we conclude that unilateral and bilateral cleft lip and palate patients at the studied age and stage of repaired clefts are not more prone to nasopharyngeal airway obstruction than controls.
Slab edge insulating form system and methods
Lee, Brain E [Corral de Tierra, CA; Barsun, Stephan K [Davis, CA; Bourne, Richard C [Davis, CA; Hoeschele, Marc A [Davis, CA; Springer, David A [Winters, CA
2009-10-06
A method of forming an insulated concrete foundation is provided comprising constructing a foundation frame, the frame comprising an insulating form having an opening, inserting a pocket former into the opening; placing concrete inside the foundation frame; and removing the pocket former after the placed concrete has set, wherein the concrete forms a pocket in the placed concrete that is accessible through the opening. The method may further comprise sealing the opening by placing a sealing plug or sealing material in the opening. A system for forming an insulated concrete foundation is provided comprising a plurality of interconnected insulating forms, the insulating forms having a rigid outer member protecting and encasing an insulating material, and at least one gripping lip extending outwardly from the outer member to provide a pest barrier. At least one insulating form has an opening into which a removable pocket former is inserted. The system may also provide a tension anchor positioned in the pocket former and a tendon connected to the tension anchor.
Monfort, A; Blasco, A; Sanz, P; Prieto, J A
1999-02-01
Lipolytic baker's yeast strains able to produce extracellular active lipase have been constructed by transformation with plasmids containing the LIP1 and LIP2 genes from Geotrichum sp. under the control of the Saccharomyces cerevisiae actin promoter (pACT1). Lipase productivity differed between both constructs, YEpACT-LIP1-t and YEpACT-LIP2-t, being higher for the strain bearing the LIP2 gene in all culture media tested. This result appeared not to be the consequence of a defect in the transcription of the LIP1 gene as revealed by Northern blot analysis. Replacing the signal sequence of LIP1 by that of LIP2 in the YEpACT-LIP1-t plasmid enhanced significantly the secretion of lipase 1, but the levels of lipase activity were still lower than those found for the YEpACT-LIP2-t transformant. Recombinant lipase 2 protein produced by baker's yeast exhibited biochemical properties similar to those of the natural enzyme. Fermented dough prepared with YEpACT-LIP2-t-carrying cells rendered a bread with a higher loaf volume and a more uniform crumb structure than that prepared with control yeast. These effects were stronger by the addition in the bread dough formulas of a preferment enriched in recombinant lipase 2.
Machado-Schiaffino, Gonzalo; Henning, Frederico; Meyer, Axel
2014-07-01
The spectacular species richness of cichlids and their diversity in morphology, coloration, and behavior have made them an ideal model for the study of speciation and adaptive evolution. Hypertrophic lips evolved repeatedly and independently in African and Neotropical cichlid radiations. Cichlids with hypertrophic lips forage predominantly in rocky crevices and it has been hypothesized that mechanical stress caused by friction could result in larger lips through phenotypic plasticity. To test the influence of the environment on the size and development of lips, we conducted a series of breeding and feeding experiments on Midas cichlids. Full-sibs of Amphilophus labiatus (thick-lipped) and Amphilophus citrinellus (thin-lipped) each were split into a control group which was fed food from the water column and a treatment group whose food was fixed to substrates. We found strong evidence for phenotypic plasticity on lip area in the thick-lipped species, but not in the thin-lipped species. Intermediate phenotypic values were observed in hybrids from thick- and thin-lipped species reared under "control" conditions. Thus, both a genetic, but also a phenotypic plastic component is involved in the development of hypertrophic lips in Neotropical cichlids. Moreover, species-specific adaptive phenotypic plasticity was found, suggesting that plasticity is selected for in recent thick-lipped species. © 2014 The Author(s). Evolution © 2014 The Society for the Study of Evolution.
Joseph, Siju; Thomas, Naicy; Thangapandian, E; Singh, Vijendra P; Verma, Rishendra; Srivastava, S K
2012-03-01
A 21-kDa leptospiral lipoprotein (LipL21) was evaluated for its diagnostic potential to detect bovine leptospirosis by ELISA. Both native LipL21 (nLipL21) and recombinant LipL21 (rLipL21) proteins were tested and compared regarding diagnostic efficiency, and no statistically significant difference was observed. The sensitivity of rLipL21 ELISA for 62 microscopic agglutination test (MAT) positive sera was 100% and the specificity with 378 MAT negative sera was 97.09%. Thus, rLipL21 protein-based ELISA could be used as an alternative to MAT for the diagnosis of bovine leptospirosis.
Herrera, Lara Maria; Fernandes, Clemente Maia da Silva; Serra, Mônica da Costa
2018-01-01
This study aimed to develop and to assess an algorithm to facilitate lip print visualization, and to digitally analyze lip prints on different supports, by superimposition. It also aimed to classify lip prints according to sex. A batch image processing algorithm was developed, which facilitated the identification and extraction of information about lip grooves. However, it performed better for lip print images with a uniform background. Paper and glass slab allowed more correct identifications than glass and the both sides of compact disks. There was no significant difference between the type of support and the amount of matching structures located in the middle area of the lower lip. There was no evidence of association between types of lip grooves and sex. Lip groove patterns of type III and type I were the most common for both sexes. The development of systems for lip print analysis is necessary, mainly concerning digital methods. © 2017 American Academy of Forensic Sciences.
A study of lip prints and its reliability as a forensic tool
Verma, Yogendra; Einstein, Arouquiaswamy; Gondhalekar, Rajesh; Verma, Anoop K.; George, Jiji; Chandra, Shaleen; Gupta, Shalini; Samadi, Fahad M.
2015-01-01
Introduction: Lip prints, like fingerprints, are unique to an individual and can be easily recorded. Therefore, we compared direct and indirect lip print patterns in males and females of different age groups, studied the inter- and intraobserver bias in recording the data, and observed any changes in the lip print patterns over a period of time, thereby, assessing the reliability of lip prints as a forensic tool. Materials and Methods: Fifty females and 50 males in the age group of 15 to 35 years were selected for the study. Lips with any deformity or scars were not included. Lip prints were registered by direct and indirect methods and transferred to a preformed registration sheet. Direct method of lip print registration was repeated after a six-month interval. All the recorded data were analyzed statistically. Results: The predominant patterns were vertical and branched. More females showed the branched pattern and males revealed an equal prevalence of vertical and reticular patterns. There was an interobserver agreement, which was 95%, and there was no change in the lip prints over time. Indirect registration of lip prints correlated with direct method prints. Conclusion: Lip prints can be used as a reliable forensic tool, considering the consistency of lip prints over time and the accurate correlation of indirect prints to direct prints. PMID:26668449
The effect of a voiced lip trill on estimated glottal closed quotient.
Gaskill, Christopher S; Erickson, Molly L
2008-11-01
The use of lip trills has been advocated for both vocal habilitation and rehabilitation. A voiced lip trill requires continuous vibration of the lips while simultaneously maintaining phonation. The mechanism of any effects of a lip trill on vocal fold vibration is still unknown. While other techniques that either constrict or artificially lengthen the vocal tract have been investigated, no studies thus far have systematically examined the effect of lip trills on vocal fold vibration. Classically trained singers and vocally untrained participants produced a lip trill for approximately 1 minute, and vocal fold closed quotient (CQ) was calculated both during the lip trill and on a sustained spoken vowel before and after the trill. Data are reported for both a group design and a single-subject design. Most participants showed a tendency for a reduction in CQ during the lip trill, with a more pronounced change in the untrained participants.
Antonarakis, Gregory S; Tompson, Bryan D; Fisher, David M
2016-11-01
Maxillary growth in patients with cleft lip and palate is highly variable. The authors' aim was to investigate associations between preoperative cleft lip measurements and maxillary growth determined cephalometrically in patients with complete unilateral cleft lip and palate (cUCLP). Retrospective cross-sectional study. Children with cUCLP. Preoperative cleft lip measurements were made at the time of primary cheiloplasty and available for each patient. Maxillary growth was evaluated on lateral cephalometric radiographs taken prior to any orthodontic treatment and alveolar bone grafting (8.5 ± 0.7 years). The presence of associations between preoperative cleft lip measurements and cephalometric measures of maxillary growth was determined using regression analyses. In the 58 patients included in the study, the cleft lateral lip element was deficient in height in 90% and in transverse width in 81% of patients. There was an inverse correlation between cleft lateral lip height and transverse width with a β coefficient of -0.382 (P = .003). Patients with a more deficient cleft lateral lip height displayed a shorter maxillary length (β coefficient = 0.336; P = .010), a less protruded maxilla (β coefficient = .334; P = .008), and a shorter anterior maxillary height (β coefficient = 0.306; P = .020) than those with a less deficient cleft lateral lip height. Patients with cUCLP present with varying degrees of lateral lip hypoplasia. Preoperative measures of lateral lip deficiency are related to later observed deficiencies of maxillary length, protrusion, and height.
Emami, Tara; Rezayat, Seyed Mahdi; Khamesipour, Ali; Madani, Rasool; Habibi, Gholamreza; Hojatizade, Mansure; Jaafari, Mahmoud Reza
2018-04-01
Adjuvants play an essential role in the induction of immunity against leishmaniasis. In this study, monophosphoryl lipid A (MPL) and imiquimod (IMQ) were used as TLR ligands adjuvants to enhance immunogenicity and rate of protection against leishmaniasis. Nanoliposomes containing soluble Leishmania antigens (SLA) and adjuvants were consisted of DSPC, DSPG and Chol prepared by using lipid film method followed by bath sonication. The size of nanoliposomes was around 95 nm and their zeta potential was negative. BALB/c mice were immunized by liposomal formulations of lip/SLA, lip/MPL/SLA, lip/IMQ/SLA, lip/MPL/IMQ/SLA, lip/SLA + lip/IMQ, lip/SLA + lip/MPL, lip/SLA + lip/MPL/IMQ and five controls of SLA, lip/MPL, lip/IMQ, lip/MPL/IMQ and buffer by subcutaneously (SC) injections, three times in 2 weeks intervals. The synergic effect of two adjuvants when they are used in one formulation showed significantly (p < .001) smaller footpad swelling and the lowest parasite burden in lymph node and foot after the challenge. IgG2a in these groups showed the higher titre compared to control groups, which is compatible with the high IFN-γ production and lowest IL-4. Taken together the results indicated that co-delivery of MPL and IMQ adjuvants and antigen in nanoliposome carrier could be an appropriate delivery system to induce cellular immunity pathway against leishmaniasis.
LipC (Rv0220) Is an Immunogenic Cell Surface Esterase of Mycobacterium tuberculosis
Shen, Guomiao; Singh, Krishna; Chandra, Dinesh; Serveau-Avesque, Carole; Maurin, Damien; Canaan, Stéphane; Singla, Rupak; Behera, Digambar
2012-01-01
We have reported previously the identification of novel proteins of Mycobacterium tuberculosis by the immunoscreening of an expression library of M. tuberculosis genomic DNA with sera obtained from M. tuberculosis-infected rabbits at 5 weeks postinfection. In this study, we report the further characterization of one of these antigens, LipC (Rv0220). LipC is annotated as a member of the Lip family based on the presence of the consensus motif “GXSXG” characteristic of esterases. Although predicted to be a cytoplasmic enzyme, we provide evidence that LipC is a cell surface protein that is present in both the cell wall and the capsule of M. tuberculosis. Consistent with this localization, LipC elicits strong humoral immune responses in both HIV-negative (HIV−) and HIV-positive (HIV+) tuberculosis (TB) patients. The absence of anti-LipC antibodies in sera from purified protein derivative-positive (PPD+) healthy subjects confirms its expression only during active M. tuberculosis infection. Epitope mapping of LipC identified 6 immunodominant epitopes, 5 of which map to the exposed surface of the modeled LipC protein. The recombinant LipC (rLipC) protein also elicits proinflammatory cytokine and chemokine responses from macrophages and pulmonary epithelial cells. rLipC can hydrolyze short-chain esters with the carbon chain containing 2 to 10 carbon atoms. Together, these studies demonstrate that LipC is a novel cell surface-associated esterase of M. tuberculosis that is highly immunogenic and elicits both antibodies and cytokines/chemokines. PMID:22038913
Zha, Daiming; Xu, Li; Zhang, Houjin; Yan, Yunjun
2014-05-01
To identify lipase LipA (PFL_0617) from Pseudomonas protegens Pf-5, a lipA deletion mutant (Pf0617) and a complementary strain (Pf0617lipA) were constructed, and their effects on the lipase production were examined. Pf0617 remarkably decreased its whole-cell lipase activity, whereas Pf0617lipA made its whole-cell lipase activity not only restore to wild-type level but also get a further increment. However, the deletion and overexpression of lipA did not affect the extracellular lipase activity. In addition, the unbroken whole cells of these strains were able to catalyze the hydrolysis of membrane-permeable p-nitrophenyl esters, but could not hydrolyze the membrane-impermeable olive oil. These results confirmed that LipA was an intracellular lipase and Pf-5 could also be used as a natural whole-cell biocatalyst. To evaluate the potential of Pf-5 as a whole-cell biocatalyst and separately characterize the whole-cell LipA, the properties of the whole-cell lipases from Pf-5 and Top10lipA were characterized. The results demonstrated that both Pf-5 and Top10lipA exhibited high tolerance to alkaline condition, high temperature, heavy metal ions, surfactants, and organic solvents. Taken together, lipA can realize functional expression in E. coli Top10, and Pf-5 and Top10lipA as whole-cell biocatalysts may have enormous potential in applications.
Luo, Dong-jiao; Hu, Ye; Dennin, R H; Yan, Jie
2007-09-01
To reconstruct the nucleotide sequence of Leptospira interrogans lipL21 gene for increasing the output of prokaryotic expression and to understand the changes on immunogenicity of the expression products before and after reconstruction, and to determine the position of envelope lipoprotein LipL21 on the surface of leptospiral body. According to the preferred codons of E.coli, the nucleotide sequence of lipL21 gene was designed and synthesized, and then its prokaryotic expression system was constructed. By using SDS-PAGE plus BioRad agarose image analysor, the expression level changes of lipL21 genes before and after reconstruction were measured. A Western blot assay using rabbit anti-TR/Patoc I serum as the first antibody was performed to identify the immunoreactivity of the two target recombinant proteins rLipL21s before and after reconstruction. The changes of cross agglutination titers of antisera against two rLipL21s before and after reconstruction to the different leptospiral serogroups were demonstrated using microscope agglutination test (MAT). Immuno-electronmicroscopy was applied to confirm the location of LipL21s. The expression outputs of original and reconstructed lipL21 genes were 8.5 % and 46.5 % of the total bacterial proteins, respectively. Both the two rLipL21s could take place immune conjugation reaction with TR/Patoc I antiserum. After immunization with each of the two rLipL21s in rabbits, the animals could produce specific antibody. Similar MAT titers with 1:80 - 1:320 of the two antisera against rLipL21s were present. LipL21 was confirmed to locate on the surface of leptospiral envelope. LipL21 is a superficial antigen of Leptospira interrogans. The expression output of the reconstructed lipL21 gene is remarkably increased. The expression rLipL21 maintains fine antigenicity and immunoreactivity and its antibody still shows an extensive cross immunoagglutination activity. The high expression of the reconstructed lipL21 gene will offer a favorable condition to use its product for further developing a novel universal vaccine as well as detection kit of leptospirosis.
Application of a barometer for assessment of oral functions: Donders space.
Hiraki, K; Yamada, Y; Kurose, M; Ofusa, W; Sugiyama, T; Ishida, R
2017-01-01
We developed a barometer applicable to a small space, to assess oral and pharyngeal functions. Negative oral pressure during rest and pressure changes during swallowing were measured in a space between the palate and tongue (STP). Twenty volunteers were asked to sit in a chair in a relaxed upright position. A sensor was placed on the posterior midline of hard palate. Recording commenced just before subjects closed their lips and continued. Subjects were asked to swallow saliva and keep the apposition. Finally, subjects were asked to open their mouth. Recordings were performed five times, and 5 s of continuous data in each phase was averaged. To verify the reliability of the system, the same procedure was accomplished with twin sensors. When the jaw and lips were closed, the pressure slightly decreased from atmospheric pressure (-0·17 ± 0·24-kPa). After swallowing, the pressure in STP showed more negative value (-0·50 ± 0·59-kPa). There is a significant difference between the values in open condition and after swallowing (P < 0·001) and between values after swallowing and final open condition (P < 0·05). Twin sensor showed almost the same trajectories of pressure changes for all the recordings. Obtained negative pressure might generate about 0·71-N of force and would be enough to keep the tongue in the palatal fossa at rest. The system detected large negative/positive pressure changes during swallowing. We conclude this system may be a tool to evaluate oral functions. © 2016 John Wiley & Sons Ltd.
Performance Correlates of Social Behavior and Organization in Non-Human Primates.
1979-09-01
Flee Other Agonistic * Lid Lip Smack Enlist Sexual Behaviors: Sexual Present Mount (no thrusting) Mount (with thrusting) Masturbate Genital...However, it has taken over a year to get through one cycle and it is clear that it is not practical to use this technique to study short term...with object(s) (14) Vocalizations (15) Self Directed Behaviors (groom, masturbate , etc.) Two replications of a test in the bare open field were
Thong, Jiun Fong; Sung, John K K; Wong, Terence K C; Tong, Michael C F
2016-08-01
To describe our experience and outcomes of auditory brainstem implantation (ABI) in Chinese patients with Neurofibromatosis Type II (NF2). Retrospective case review. Tertiary referral center. Patients with NF2 who received ABIs. Between 1997 and 2014, eight patients with NF2 received 9 ABIs after translabyrinthine removal of their vestibular schwannomas. One patient did not have auditory response using the ABI after activation. Environmental sounds could be differentiated by six (75%) patients after 6 months of ABI use (mean score 46% [range 28-60%]), and by five (63%) patients after 1 year (mean score 57% [range 36-76%]) and 2 years of ABI use (mean score 48% [range 24-76%]). Closed-set word identification was possible in four (50%) patients after 6 months (mean score 39% [range 12-72%]), 1 year (mean score 68% [range 48-92%]), and 2 years of ABI use (mean score 62% [range 28-100%]). No patient demonstrated open-set sentence recognition in quiet in the ABI-only condition. However, the use of ABI together with lip-reading conferred an improvement over lip-reading alone in open-set sentence recognition scores in two (25%) patients after 6 months of ABI use (mean improvement 46%), and five (63%) patients after 1 year (mean improvement 25%) and 2 years of ABI use (mean improvement 28%). At 2 years postoperatively, three (38%) patients remained ABI users. This is the only published study to date examining ABI outcomes in Cantonese-speaking Chinese NF2 patients and the data seems to show poorer outcomes compared with English-speaking and other nontonal language-speaking NF2 patients. Environmental sound awareness and lip-reading enhancement are the main benefits observed in our patients. More work is needed to improve auditory implant speech-processing strategies for tonal languages and these advancements may yield better speech perception outcomes in the future.
Correlations of frontal lip-line canting with craniofacial morphology and muscular activity.
Cho, Jin-Hyoung; Kim, Eun-Jung; Kim, Byeong-Chae; Cho, Ki-Hyun; Lee, Ki-Heon; Hwang, Hyeon-Shik
2007-09-01
The purpose of this study was to investigate factors affecting lip-line canting by using musculoskeletal analyses. Fifty-six adults with lip-line canting were selected as subjects. They were divided into 3 groups according to the changes of lip line during smiling: increasing (group I), decreasing (group D), and minimal (group M). Lip-line canting at rest was correlated to craniofacial morphology and muscular activity: Regarding craniofacial morphology, various craniofacial measurements in lateral and frontal cephalograms were used, including inclination of the tongue blade placed across both first molars. The zygomaticus major was the focus of the measurement of muscular activity affecting lip-line canting, and its activity during smiling was evaluated by using a needle electrode. In group I, lip-line canting at rest showed a significant correlation with the right-left (R/L) difference of muscular activity, but no significant correlation with the measurements of craniofacial morphology. In group D, lip-line canting showed a positive correlation with the measurements of craniofacial morphology, such as the inclination of the tongue blade, and a negative correlation with the R/L difference of muscular activity. In group M, lip-line canting showed no significant correlation with the R/L difference of muscular activity, but a significant correlation with inclination of the tongue blade. The results indicate that lip-line canting is caused by craniofacial morphology when the change of lip-line canting during smiling is minimal, whereas lip-line canting is affected by the R/L difference of muscular activity in addition to craniofacial morphology when the cant of lip line markedly changes during smiling. The findings suggest that the cause of lip-line canting can be identified easily by the change of canting during smiling, without complicated musculoskeletal analyses.
Infantile Hemangiomas of the Lip: Patterns, Outcomes, and Implications.
Yanes, Daniel A; Pearson, Gregory D; Witman, Patricia M
2016-09-01
Infantile hemangiomas of the lip are potentially problematic because of high visibility and risk of disfigurement and ulceration. This study examined sizes, patterns, and locations of lip hemangiomas, their prognostic value, and their implications in hemangioma pathogenesis. Records of 106 patients seen for lip hemangiomas from 2006 to 2013 at Nationwide Children's Hospital were reviewed. Localized hemangiomas were mapped to a location on the lip based on their focus. Size, location, and morphology were assessed with regard to outcome. Poor outcomes were considered to be marked anatomic deformity, scarring, functional complications, and ulceration. Of 72 untreated hemangiomas with discernible outcomes, 92% of segmental lip hemangiomas were associated with poor outcomes, as opposed to 32% of localized hemangiomas (p < 0.001). Localized lip hemangiomas originated from six distinct locations. Localized untreated hemangiomas with poor outcomes were, on average, approximately 2.36 cm(2) larger (95% confidence interval 1.47, 3.25) than those that resolved favorably (p < 0.001); 52% of upper lip untreated hemangiomas and 6% of lower lip hemangiomas had poor outcomes (p = 0.001), and 61% of untreated localized hemangiomas involving the vermilion border and 25% of those that did not had poor outcomes (p = 0.01). Hemangiomas that received early medical or surgical intervention were less likely to have poor outcomes than untreated hemangiomas (p = 0.03). Localized lip hemangiomas occur in distinct locations on the lip that are not random and appear to reflect known models of facial development. Segmental morphology is associated with poor outcomes. In localized hemangiomas, the upper lip is associated with more problematic outcomes than the lower lip. Large size and involvement of the vermilion border are also valuable prognostic indicators associated with poor outcomes. Early intervention in lip hemangiomas is associated with better outcomes. © 2016 Wiley Periodicals, Inc.
The connecting link! Lip prints and fingerprints.
Negi, Amita; Negi, Anurag
2016-01-01
Lip prints and fingerprints are considered to be unique to each individual. The study of fingerprints and lip prints is very popular in personal identification of the deceased and in criminal investigations. This study was done to find the predominant lip and fingerprint patterns in males and females in the North Indian population and also to find any correlation between lip print and fingerprint patterns within a gender. Two hundred students (100 males, 100 females) were included in the study. Lip prints were recorded for each individual using a dark-colored lipstick and the right thumb impression was recorded using an ink pad. The lip prints and fingerprints were analyzed using a magnifying glass. The Chi-square test was used for statistical analysis. The branched pattern in males and the vertical pattern in females were the predominant lip print patterns. The predominant fingerprint pattern in both males and females was found to be the loop pattern, followed by the whorl pattern and then the arch pattern. No statistically significant correlation was found between lip prints and fingeprints. However, the arch type of fingerprint was found to be associated with different lip print patterns in males and females. Lip prints and fingerprints can be used for personal identification in a forensic scenario. Further correlative studies between lip prints and fingerprints could be useful in forensic science for gender identification.
Comparative analysis of lip with thumbprints: An identification tool in personal authentication.
Naik, Rashmi; Ahmed Mujib, B R; Telagi, Neethu; Hallur, Jaydeva
2017-01-01
Identification of person living or dead using diverse characteristics is the basis in forensic science. The uniqueness of lip and fingerprints and further, association between them can be useful in establishing facts in legal issues. The present study was carried out to determine the distribution of different lip print patterns among subjects having different thumbprint patterns and to determine the correlation between lip print patterns and thumbprint patterns. The study sample comprised 100 students randomly selected from Bapuji Dental College Hospital, Davangere, Karnataka, 50 males and 50 females aged between 18 and 20 years. Red colored lipstick was applied on the lips by a lipstick applicator brush. Lip and thumb impressions were made on No. 1 Whatman filter paper and visualized using magnifying lens. Three main types of fingerprints (loop, whorl and arch) were identified; Tsuchihashi Y classification of lip print patterns was followed in the study. Chi-square test was used to see the association between lip and thumbprints. The correlation between lip and left thumb print patterns for gender identification was statistically significant. In both males and females, Type II lip pattern associated with loop finger pattern were most significant and in males, Type III lip pattern with whorl type of finger pattern showed statistical significance. We conclude that the correlation found between lip print and thumbprint can be utilized in the field of forensic science for gender identification.
Paranaiba, Lívia Máris Ribeiro; Coletta, Ricardo D; Swerts, Mário Sérgio Oliveira; Quintino, Rafaela Pacífico; de Barros, Letízia Monteiro; Martelli-Júnior, Hercílio
2013-07-01
Objective : Many studies have demonstrated a high frequency of dental anomalies in patients with cleft lip and/or palate. Because dental anomalies may complicate dental treatment, we investigated the prevalence of dental anomalies in a group of Brazilian patients with nonsyndromic cleft lip and/or palate. Design, Participants, Setting : Retrospective analysis was performed using clinical records of 296 patients aged between 12 and 30 years with repaired nonsyndromic cleft lip and/or palate without history of tooth extraction and orthodontic treatment. Associations between oral clefts and presence of dental anomalies outside the cleft area were investigated. Results : Dental anomalies were identified in 39.9% of the nonsyndromic cleft lip and/or palate patients, and tooth agenesis (47.5%), impacted tooth (13.1%), and microdontia (12.7%) were the most common anomalies. Cleft lip patients were less affected by dental anomalies compared with cleft palate or cleft lip and palate patients (p = .057). Specifically, patients with unilateral cleft lip and palate were significantly more affected by dental anomalies than those with bilateral cleft lip and palate (p = .00002), and individuals with unilateral complete cleft lip and palate (p = .002) and complete cleft palate (p = .01) were significantly more affected by tooth agenesis than other cleft types. Agenesis of the premolars (p = .043) and maxillary lateral incisors (p = .03) were significantly more frequent in patients with unilateral complete cleft lip and palate. Conclusions : The present study revealed a high frequency of dental anomalies in nonsyndromic cleft lip and/or palate patients and further demonstrated that patients with unilateral cleft lip and palate were frequently more affected by dental anomalies than those with bilateral cleft lip and palate. Moreover, our results demonstrate that dental anomalies should be considered during dental treatment planning for individuals affected by nonsyndromic cleft lip and/or palate.
Morphological patterns of lip prints in Mangaloreans based on Suzuki and Tsuchihashi classification
Jeergal, Prabhakar A; Pandit, Siddharth; Desai, Dinkar; Surekha, R; Jeergal, Vasanti A
2016-01-01
Introduction: Cheiloscopy is the study of the furrows or grooves present on the red part or vermilion border of the human lips. The present study aims to classify the characteristics of lip prints and to know the most common morphological pattern specific to Mangalorean people of Southern India. For the first time, this study also assesses the association between gender and different lip segments within a population. Materials and Methods: A total of 200 residents of Mangalore (100 males and 100 females) were included of age ranging from 18 years to 60 years. Materials used to take the impression of lips included red lipstick, A4 size white bond paper and cellophane tape. The prints obtained were scanned using a Canon Image Scanner and stored in a folder on a personal computer. The images were cropped and inverted in gray scale using Adobe Photoshop software. Each lip print was divided into eight segments and was examined. Suzuki and Tsuchihashi's classification (1970) was used to classify the types of grooves, and the results were statistically analyzed. Six types of grooves were recorded in the Mangalorean's lips. Statistical Analysis: Association between gender and different lip segments was tested using Chi-square analysis in the given population. Results: In males, the groove Type I' was the highest recorded followed by Type III, Type II, Type I, Type IV and Type V in descending order. In females, Type I' was the highest recorded followed by Type II, Type III, Type IV, Type I and Type V in descending order. Conclusion: Males and females displayed statistically significant differences in lip print patterns for different lip sites: lower medial lip, as well as upper and lower lateral segments. Only the upper medial lip segment displayed no statistically significant difference in lip print pattern between males and females. This shows that the distribution of lip prints is generally dissimilar for males and females, with varying predominance according to lip segment. PMID:27601831
Increased virulence of Mycobacterium tuberculosis H37Rv overexpressing LipY in a murine model.
Singh, Vipul K; Srivastava, Mrigank; Dasgupta, Arunava; Singh, Mohan P; Srivastava, Ranjana; Srivastava, Brahm S
2014-05-01
We have investigated the role of Rv3097c-encoded lipase (LipY) on the virulence of Mycobacterium tuberculosis. It has been shown that the overexpression of LipY in strain H37Rv induced increase in virulence of recombinant H37Rv::LipY strain. Compared to H37Rv, infection with H37Rv::LipY caused enhanced mortality, weight loss, bacterial load in lungs, splenomegaly, worsening lung morphology and pathology. Mice immunized with recombinant LipY antigen were protected against challenge with H37Rv::LipY, which correlated with enhanced survival of challenged mice and striking decrease in pathological features observed in unimmunized mice. To probe the cause of increase in virulence of H37Rv::LipY, the immune status of the host infected with H37Rv and H37Rv::LipY was compared. It was found that overexpression of LipY compromised immune responses resulting in attenuation of Th1 and Th17 responses, significant increase in IL-10, decrease in number of macrophages and T cells, and increase in numbers of Treg, and DCs in the lungs whereas in mice immunized with LipY an increased pool of T cells and DCs was observed. This led us to conclude that the increase in the virulence of H37Rv::LipY was due to downregulation of the host's protective immunity and the Rv3097c encoded LipY lipase is a virulence factor of M. tuberculosis. Copyright © 2014 Elsevier Ltd. All rights reserved.
Deficiency in mTORC1-controlled C/EBPβ-mRNA translation improves metabolic health in mice
Zidek, Laura M; Ackermann, Tobias; Hartleben, Götz; Eichwald, Sabrina; Kortman, Gertrud; Kiehntopf, Michael; Leutz, Achim; Sonenberg, Nahum; Wang, Zhao-Qi; von Maltzahn, Julia; Müller, Christine; Calkhoven, Cornelis F
2015-01-01
The mammalian target of rapamycin complex 1 (mTORC1) is a central regulator of physiological adaptations in response to changes in nutrient supply. Major downstream targets of mTORC1 signalling are the mRNA translation regulators p70 ribosomal protein S6 kinase 1 (S6K1p70) and the 4E-binding proteins (4E-BPs). However, little is known about vertebrate mRNAs that are specifically controlled by mTORC1 signalling and are engaged in regulating mTORC1-associated physiology. Here, we show that translation of the CCAAT/enhancer binding protein beta (C/EBPβ) mRNA into the C/EBPβ-LIP isoform is suppressed in response to mTORC1 inhibition either through pharmacological treatment or through calorie restriction. Our data indicate that the function of 4E-BPs is required for suppression of LIP. Intriguingly, mice lacking the cis-regulatory upstream open reading frame (uORF) in the C/EBPβ-mRNA, which is required for mTORC1-stimulated translation into C/EBPβ-LIP, display an improved metabolic phenotype with features also found under calorie restriction. Thus, our data suggest that translational adjustment of C/EBPβ-isoform expression is one of the key processes that direct metabolic adaptation in response to changes in mTORC1 activity. PMID:26113365
Antonarakis, Gregory S; Adibfar, Alex; Tompson, Bryan D; Paedo, D; Daskalogiannakis, John; Fisher, David M
2015-05-01
To investigate associations between anthropometric lip measurements and dental arch relationships in patients with complete unilateral cleft lip and palate (CUCLP). Retrospective cross-sectional study. Children with CUCLP. Anthropometric lip measurements, made immediately prior to lip repair, were available for each patient. The dental arch relationships were evaluated on dental study casts (8.6 ± 0.9 years) taken prior to any orthodontic treatment and prior to alveolar bone graft, using the modified Huddart and Bodenham (MHB) scoring system. The presence of associations between anthropometric lip measurements and dental arch relationships was determined using linear regression analysis. In the 63 patients included in the study, the cleft lateral lip element was deficient in height in 87% and in transverse width in 86% of patients. Patients with more deficient cleft-side lateral lip height were more likely to present with more negative MHB scores (r = .443; P < .001). Conversely, patients with more deficient cleft-side lateral lip transverse width more often presented with more positive MHB scores (r = .281; P = .025). In patients with CUCLP, there is a wide variability in the degree of deficiency of the cleft-side lateral lip element, both in the vertical and in the transverse dimension. The extent of this deficiency may, in part, predict the resulting dental arch relationships.
Linear theory of boundary effects in open wind tunnels with finite jet lengths
NASA Technical Reports Server (NTRS)
Katzoff, S; Gardner, Clifford S; Diesendruck, Leo; Eisenstadt, Bertram J
1950-01-01
In the first part, the boundary conditions for an open wind tunnel (incompressible flow) are examined with special reference to the effects of the closed entrance and exit sections. Basic conditions are that the velocity must be continuous at the entrance lip and that the velocities in the upstream and downstream closed portions must be equal. In the second part, solutions are derived for four types of two-dimensional open tunnels, including one in which the pressures on the two free surfaces are not equal. Numerical results are given for every case. In general, if the lifting element is more than half the tunnel height from the inlet, the boundary effect at the lifting element is the same as for an infinitely long open tunnel. In the third part, a general method is given for calculating the boundary effect in an open circular wind tunnel of finite jet length. Numerical results are given for a lifting element concentrate at a point on the axis.
Russell, James H B; Kiddy, Harriet C; Mercer, Nigel S
2014-07-01
The SymNose computer program has been proposed as an objective method for the quantitative assessment of lip symmetry following unilateral cleft lip repair. This study aims to demonstrate the use of SymNose in patients with complete bilateral cleft lip and palate (BCLP), a group previously excluded from computer-based analysis. A retrospective cohort study compared several parameters of lip symmetry between BCLP cases and non-cleft controls. 15 BCLP cases aged 10 (±1 year) who had undergone primary repair were recruited from the patient database at the South West Cleft Unit, Frenchay Hospital. Frontal facial photographs were selected for measurement. 15 age-matched controls were recruited from a local school. Lip symmetry was expressed as: percentage mismatch of left vermillion border and upper lip area over the right, horizontal lip tilt and lateral deviation of the lip. A significant increase in lip asymmetry was found in the BCLP group expressed as upper vermillion border mismatch across computer-defined and user-defined midlines (mean difference was 16.4% (p < 0.01) and 17.5% (p < 0.01) respectively). The results suggest that a significant degree of lip asymmetry remains in BCLP patients even after primary repair. This challenges previous assumptions that those with bilateral defects would be relatively symmetrical. Copyright © 2013 European Association for Cranio-Maxillo-Facial Surgery. Published by Elsevier Ltd. All rights reserved.
Alnoch, Robson Carlos; Stefanello, Adriano Alves; Paula Martini, Viviane; Richter, Jeferson Luiz; Mateo, Cesar; Souza, Emanuel Maltempi de; Mitchell, David Alexander; Muller-Santos, Marcelo; Krieger, Nadia
2018-05-30
Genes encoding lipase LipBC (lipA) and foldase LifBC (lipB) were identified in the genome of Burkholderia contaminans LTEB11. Analysis of the predicted amino acid sequence of lipA showed its high identity with lipases from Pseudomonas luteola (91%), Burkholderia cepacia (96%) and Burkholderia lata (97%), and classified LipBC lipase in the lipase subfamily I.2. The genes lipA and lipB were amplified and cloned into expression vectors pET28a(+) and pT7-7, respectively. His-tagged LipBC and native LifBC were co-expressed in Escherichia coli and purified. LipBC and LifBC have molecular weights of 35.9 kDa and 37 kDa, respectively, and remain complexed after purification. The Lip-LifBC complex was active and stable over a wide range of pH values (6.5-10) and temperatures (25-45 °C), with the highest specific activity (1426 U mg -1 ) being against tributyrin. The Lip-LifBC complex immobilized on Sepabeads was able to catalyze the synthesis of ethyl-oleate in n‑hexane with an activity of 4 U g -1 , maintaining high conversion (>80%) over 5 reaction cycles of 6 h at 45 °C. The results obtained in this work provide a basis for the development of applications of recombinant LipBC in biocatalysis. Copyright © 2018 Elsevier B.V. All rights reserved.
Modification of Perioral Stiffness in Patients With Repaired Cleft Lip and Palate
Barlow, Steven M.; Trotman, Carroll-Ann; Chu, Shin-Ying; Lee, Jaehoon
2013-01-01
Objective To measure and compare the perioral stiffness among three groups of pediatric subjects: a group of patients with a repaired cleft lip (and palate) who had a secondary lip revision surgery (revision), another group of patients with repaired cleft lip (and palate) who did not have secondary surgery (nonrevision), and a group of noncleft “normal” patients (noncleft). Design A parallel, three-group, nonrandomized clinical trial. Participants A total of 16 patients with repaired cleft lip/palate who did not have lip revision, 13 patients with repaired cleft lip/palate who had lip revision surgery and were tested at 18 to 24 months postsurgery, and 27 noncleft patients. Analysis Nonparticipatory perioral stiffness was sampled using a recently developed face-referenced measurement technology known as OroSTIFF. Perioral stiffness, derived as a quotient from resultant force and interangle lip span, was modeled with multilevel regression techniques. Real-time calculation of the perioral stiffness function demonstrated a significant quadratic relation between imposed interangle stretch and resultant force for each of the three groups. Results This nonlinear stiffness growth function was significantly elevated in the nonrevision patients compared with the noncleft controls and is likely due to the presence of scar tissue in the upper lip; it was significantly lower among patients with cleft lip/palate who completed lip revision surgery. Conclusion This study demonstrates the efficacy of applying an objective measurement to map differences in perioral tissue biomechanics among patients born with orofacial clefts. PMID:21247345
Modulation of the Activity of Mycobacterium tuberculosis LipY by Its PE Domain
Garrett, Christopher K.; Broadwell, Lindsey J.; Hayne, Cassandra K.; Neher, Saskia B.
2015-01-01
Mycobacterium tuberculosis harbors over 160 genes encoding PE/PPE proteins, several of which have roles in the pathogen’s virulence. A number of PE/PPE proteins are secreted via Type VII secretion systems known as the ESX secretion systems. One PE protein, LipY, has a triglyceride lipase domain in addition to its PE domain. LipY can regulate intracellular triglyceride levels and is also exported to the cell wall by one of the ESX family members, ESX-5. Upon export, LipY’s PE domain is removed by proteolytic cleavage. Studies using cells and crude extracts suggest that LipY’s PE domain not only directs its secretion by ESX-5, but also functions to inhibit its enzymatic activity. Here, we attempt to further elucidate the role of LipY’s PE domain in the regulation of its enzymatic activity. First, we established an improved purification method for several LipY variants using detergent micelles. We then used enzymatic assays to confirm that the PE domain down-regulates LipY activity. The PE domain must be attached to LipY in order to effectively inhibit it. Finally, we determined that full length LipY and the mature lipase lacking the PE domain (LipYΔPE) have similar melting temperatures. Based on our improved purification strategy and activity-based approach, we concluded that LipY’s PE domain down-regulates its enzymatic activity but does not impact the thermal stability of the enzyme. PMID:26270534
Park, Joo Seok; Koh, Kyung S; Choi, Jong Woo
2015-10-01
Orthognathic surgery does not yield the same cosmetic benefits in patients with Class III jaw deformities associated with clefts as for patients without clefts. Preoperative upper lip tightness caused by cleft lip repair may not fully explain this difference, suggesting that a lower lip deformity is present. The study compared the outcomes of orthognathic surgery in patients with cleft and non-cleft Class III malocclusion, focusing on lip relationship. The surgical records of 50 patients with Class III malocclusion, including 25 with and 25 without clefts, who had undergone orthognathic surgery, were retrospectively analyzed. Lateral cephalometric tracings, preoperatively and at 6 months postoperatively, were superimposed to analyze the soft tissue changes at seven reference points. At 6 months after surgery, there were no significant differences in skeletal location, whereas the soft tissues of the lower lip differed significantly between patients with and without cleft (p=0.002), indicating the persistence of a lower lip deformity in cleft patients. Moreover, the soft tissues of the lower lip receded in non-cleft patients and protruded in cleft patients after orthognathic surgery. Lower lip deformity and upper lip tightness may result in an unsatisfactory relationship between the upper and lower lips of patients with cleft-related jaw deformity after orthognathic surgery. Other factors were less important than the pathology of the lower lip. Copyright © 2015 European Association for Cranio-Maxillo-Facial Surgery. Published by Elsevier Ltd. All rights reserved.
Richardson, Matthew Allen; Rousso, Daniel Elliott; Replogle, William H
2017-01-01
To our knowledge, long-term, objective results of lip augmentation using superficial musculoaponeurotic system (SMAS) tissue transfer beyond 1 year have not been previously described. To evaluate the efficacy, longevity, and safety of lip augmentation using SMAS tissue transfer. A retrospective single-blind cohort study was designed to evaluate all patients who underwent surgical lip augmentation using SMAS following rhytidectomy between January 1, 2000, and November, 16, 2015, at a private facial plastic surgery practice in Birmingham, Alabama. Preoperative photographs of each patient served as controls and were compared with postoperative photographs at 3 months, 1 year, and 5 years after lip augmentation. A total of 104 images (from 26 individual patients) were reviewed by 12 blinded observers using a validated lip augmentation grading scale. Lip augmentation using SMAS. Median lip volumes of all patients at each postoperative interval (3 months, 1 year, and 5 years) compared with preoperative lip volumes. Secondary outcome measures included postoperative complications. A total of 423 patients were identified who underwent surgical lip augmentation using SMAS. Sixty patients with approximately 5 years or more of postoperative photographs were reviewed for complications. Twenty-six patients had 3-month, 1-year, and 5-year postoperative follow-up photographs and were included in the photographic evaluation. The mean age of these patients at the time of surgery was 54.6 years (range, 41.2-80.6 years. Fifty-nine of the 60 patients (98.3%) were female. Two of 60 patients (3.3%) with 5 years or more of postoperative follow-up developed complications requiring intervention. Both the superior lip and the inferior lip showed statistically significant increases in volume at 3 months, 1 year, and 5 years (P ≤ .004 for the superior lip after 5 years; P ≤ .001 for all other comparisons) after SMAS lip augmentation. The greatest median increase was observed in the superior lip at 3 months, while the smallest median increase was observed for the inferior lip at 5 years. The degree of increase in median volume seemed to weaken slightly over time, but remained statistically significant even at 5 years. SMAS lip augmentation is an effective and safe method for lip augmentation that can yield natural, long-lasting results with minimal risk. The degree of augmentation tends to fade slightly over time, but remains significant for at least 5 years postoperatively. 3.
Ewald, R; Hoffmann, C; Neuhaus, E; Bauwe, H
2014-01-01
Octanoyltransferases (LIP2) are important for the lipoylation of several α-ketoacid decarboxylases and glycine decarboxylase, all of which are essential multienzyme complexes of central metabolism, by attaching de novo-synthesised octanoyl moieties to the respective target subunits. Lipoyl synthase (LIP1) then inserts two sulphur atoms each into the protein-bound octanoyl chains to generate the functional lipoamide arms. In plants, most of the above multienzyme complexes occur only in mitochondria. Pyruvate dehydrogenase is an exception, since it also occurs in plastids. Plastidial LIP1 and LIP2 are known, but it is not clear how essential these enzymes are. Here, we report that not just one but two redundant LIP2 isoforms, LIP2p and LIP2p2, operate in plastids of Arabidopsis. The combined deletion of the two isoenzymes is embryo-lethal. Deletion of the plastidial lipoyl synthase LIP1p is also embryo-lethal, indicating that all plastidial LIP1 activity is due to LIP1p. These features suggest that protein lipoylation is based on an autonomous and partially redundant de novo lipoylation pathway in plastids. © 2013 German Botanical Society and The Royal Botanical Society of the Netherlands.
Sr, Ashwinirani; Suragimath, Girish; Sande, Abhijeet R; Kulkarni, Prasad; Nimbal, Anand; Shankar, T; Gowd, T Snigdha; Shetty, Prajwal K
2014-10-01
The study of lip-print pattern (cheiloscopy) is a scientific method for personal identification and plays a major role in forensic and criminal investigations. To compare the lip print patterns in Kerala and Maharashtra population and correlate between ABO blood groups. Two hundred subjects, 100 from Maharashtra and 100 from Kerala were considered for the study. Lip prints were recorded, analyzed according to Tsuchihashi classification. The lip print patterns were compared in the two populations, correlated in ABO blood groups. The data obtained was statistically analyzed with SPSS software using chi-square test. In our study, predominant lip print pattern observed in Kerala population was type IV (53%) and Maharashtra population was type II (42%). The difference between the two population was statistically significant (p<0.001). Subjects with A+ and O- blood groups had type II lip print predominance. Subjects with B+, AB+ and O+ blood groups had type IV predominance. The lip print patterns do not show any correlation in ABO blood groups. Lip prints are unique to each individual and are different even in two persons. Lip print patterns were different in the two sub populations studied, and they showed no correlation in ABO blood groups.
Inheritance pattern of lip prints among Malay population: A pilot study.
George, Renjith; Nora Afandi, Nurulain Syafinaz Binti; Zainal Abidin, Siti Nur Hayati Binti; Binti Ishak, Nur Ismawani; Soe, Htoo Htoo Kyaw; Ismail, Abdul Rashid Hj
2016-04-01
We assessed the resemblance of lip print patterns between parents and biological offspring in families of 31 Malay students as well as the distribution of different types of lip print in the study group. Only a few studies have successfully established the inheritance pattern of lip prints. Such studies can be population specific and need to be conducted in various populations. No such study have been conducted in Malay population in Malaysia, according to our knowledge. Present study was carried out to ascertain whether there is any inherence pattern in lip prints and thereby to investigate the potential role of lip prints in personal identification. We found 58.06% resemblance of lip print patterns between the parents and their biological offspring in our study. The influence of heredity in lip print pattern is still a new concept and there is lack of concrete evidence. The data from our study shows that there is potential influence of inheritance in the lip print patterns among the family members. Further researches involving larger samples size are suggested to derive more reliable and accurate results. The most common lip print pattern among the study group is type I (29.84%) followed by type II (23.12%), type III (22.45%), type I' (13.44%), type IV (9.54%) and type V (1.61%). Racial variations in lip print patterns and their prevalence may serve as an aid in forensic identification and crime scene investigation. The results of this pilot study will help in establishing guidelines for future researches on lip print analysis in Malaysia. Lip print patterns are unique and individualistic. However, there are some similarities in basic patterns of lip prints between family members which may be attributed to influence of inheritance. 1. To determine the inheritance pattern of lip prints among Malay family members of the student. 2. To identify the distribution of different types of lip prints among Malay population. and Observational pilot study. Lip prints of 124 individuals from 31 families consisting of father, mother and two children were recorded and classified based on Tsuchihashi Classification (1974). Statistical analysis was performed for resemblance pattern among family members (Karl-Pearson Correlation Coefficient) and inter-observer variability (Kappa test). 58.06% positive resemblance was found between parents and biological offspring. The highest lip print pattern in the study group was type I (29.84%) and the least was type V (1.61%). There is positive resemblance in lip print patterns among family members which may be attributed to influence of inheritance. However, further studies with larger sample sizes need to be conducted to confirm the results. Type I lip print was the most prevalent pattern among the study subjects. Copyright © 2016 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.
Yaghoubi, Ali; Pourjam, Ebrahim; Álvarez-Ortega, Sergio; Liébanas, Gracia; Atighi, Mohammad Reza; Pedram, Majid
2016-09-01
Discopersicus iranicus n. gen., n. comb., previously described from Iran as a new species under the genus Discotylenchus , is illustrated using light microscope and scanning electron microscope (SEM) observations and further studied using molecular characters. SEM studies revealed the newly proposed genus has oblique amphidial apertures on the lateral sides of the lip region. SEM images are also provided for two species of Discotylenchus , namely D. discretus and D. brevicaudatus , as the first SEM study of the genus . These results confirmed longitudinal amphidial aperture type on lateral sides of the lip region in genus Discotylenchus , as noted by Siddiqi while erecting the genus with D. discretus as the type species . Molecular phylogenetic analyses using partial small subunit (SSU) and large subunit (LSU) rDNA sequences revealed the affinity of the genus Discopersicus n. gen. with members of the subfamily Boleodorinae, as supported by morphological characters (mainly, the oblique amphidial opening).
Point, Vanessa; Malla, Raj K; Carrière, Frederic; Canaan, Stéphane; Spilling, Christopher D; Cavalier, Jean-François
2013-06-13
Four nonracemic enolphosphonate analogues of Cyclophostin were obtained by asymmetric synthesis, and their absolute configurations at both phosphorus and C-5 carbon chiral centers were unambiguously assigned. The influence of chirality was studied by testing the inhibitory effects of these four stereoisomers toward the lipolytic activity of three microbial lipases: Fusarium solani cutinase, Rv0183, and LipY from Mycobacterium tuberculosis . Cutinase was highly diastereoselective for the (Sp) configuration using (Sc) inhibitors, whereas no obvious stereopreference at phosphorus was observed with (Rc) compounds. Conversely, Rv0183 exhibited strong enantioselective discrimination for (Sp) configuration regardless of the chirality at the asymmetric carbon atom. Lastly, LipY discriminated only the unusual diastereoisomeric configuration (Rc, Rp) leading to the most potent inhibitor. This work, which provides a fundamental premise for the understanding of the stereoselective relationships between nonracemic enolphosphonates and their inhibitory activity, also opens new prospects on the design and synthesis of highly specific enantioselective antimicrobial agents.
In-situ photoluminescence imaging for passivation-layer etching process control for photovoltaics
NASA Astrophysics Data System (ADS)
Lee, J. Z.; Michaelson, L.; Munoz, K.; Tyson, T.; Gallegos, A.; Sullivan, J. T.; Buonassisi, T.
2014-07-01
Light-induced plating (LIP) of solar-cell metal contacts is a scalable alternative to silver paste. However, LIP requires an additional patterning step to create openings in the silicon nitride (SiNx) antireflection coating (ARC) layer prior to metallization. One approach to pattern the SiNx is masking and wet chemical etching. In-situ real-time photoluminescence imaging (PLI) is demonstrated as a process-monitoring method to determine when SiNx has been fully removed during etching. We demonstrate that the change in PLI signal intensity during etching is caused by a combination of (1) decreasing light absorption from the reduction in SiNx ARC layer thickness and (2) decreasing surface lifetime as the SiNx/Si interface transitions to an etch-solution/Si. Using in-situ PLI to guide the etching process, we demonstrate a full-area plated single-crystalline silicon device. In-situ PLI has the potential to be integrated into a commercial processing line to improve process control and reliability.
Zhang, Li; Wang, Yang; Yang, Yuting; Liu, Yayuan; Ruan, Shaobo; Zhang, Qianyu; Tai, Xiaowei; Chen, Jiantao; Xia, Tai; Qiu, Yue; Gao, Huile; He, Qin
2015-05-13
The network of collagen I in tumors could prevent the penetration of drugs loaded in nanoparticles, and this would lead to impaired antitumor efficacy. In this study, free losartan (an angiotensin inhibitor) was injected before treatment to reduce the level of collagen I, which could facilitate the penetration of nanoparticles. Then the pH-sensitive cleavable liposomes (Cl-Lip) were injected subsequently to exert the antitumor effect. The Cl-Lip was constituted by PEG(5K)-Hydrazone-PE and DSPE-PEG(2K)-R8. When the Cl-Lip reached to the tumor site by the enhanced permeability and retention (EPR) effect, PEG(5K)-Hydrazone-PE was hydrolyzed from the Cl-Lip under the low extra-cellular pH conditions of tumors, then the R8 peptide was exposed, and finally liposomes could be internalized into tumor cells by the mediation of R8 peptide. In vitro experiments showed both the cellular uptake of Cl-Lip by 4T1 cells and cytotoxicity of paclitaxel loaded Cl-Lip (PTX-Cl-Lip) were pH sensitive. In vivo experiments showed the Cl-Lip had a good tumor targeting ability. After depletion of collagen I, Cl-Lip could penetrate into the deep place of tumors, the tumor accumulation of Cl-Lip was further increased by 22.0%, and the oxygen distributed in tumor tissues was also enhanced. The antitumor study indicated free losartan in combination with PTX-Cl-Lip (59.8%) was more effective than injection with PTX-Cl-Lip only (37.8%) in 4T1 tumor bearing mice. All results suggested that depletion of collagen I by losartan dramatically increased the penetration of PTX-Cl-Lip and combination of free losartan and PTX-CL-Lip could lead to better antitumor efficacy of chemical drugs. Thus, the combination strategy might be a promising tactic for better treatment of solid tumors with a high level of collagen I.
PdhR, the pyruvate dehydrogenase repressor, does not regulate lipoic acid synthesis.
Feng, Youjun; Cronan, John E
2014-01-01
Lipoic acid is a covalently-bound enzyme cofactor required for central metabolism all three domains of life. In the last 20 years the pathway of lipoic acid synthesis and metabolism has been established in Escherichia coli. Expression of the genes of the lipoic acid biosynthesis pathway was believed to be constitutive. However, in 2010 Kaleta and coworkers (BMC Syst. Biol. 4:116) predicted a binding site for the pyruvate dehydrogenase operon repressor, PdhR (referred to lipA site 1) upstream of lipA, the gene encoding lipoic acid synthase and concluded that PdhR regulates lipA transcription. We report in vivo and in vitro evidence that lipA is not controlled by PdhR and that the putative regulatory site deduced by the prior workers is nonfunctional and physiologically irrelevant. E. coli PdhR was purified to homogeneity and used for electrophoretic mobility shift assays. The lipA site 1 of Kaleta and coworkers failed to bind PdhR. The binding detected by these workers is due to another site (lipA site 3) located far upstream of the lipA promoter. Relative to the canonical PdhR binding site lipA site 3 is a half-palindrome and as expected had only weak PdhR binding ability. Manipulation of lipA site 3 to construct a palindrome gave significantly enhanced PdhR binding affinity. The native lipA promoter and the version carrying the artificial lipA3 palindrome were transcriptionally fused to a LacZ reporter gene to directly assay lipA expression. Deletion of pdhR gave no significant change in lipA promoter-driven β-galactosidase activity with either the native or constructed palindrome upstream sequences, indicating that PdhR plays no physiological role in regulation of lipA expression. Copyright © 2014 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.
Molten core retention assembly
Lampe, Robert F.
1976-06-22
Molten fuel produced in a core overheating accident is caught by a molten core retention assembly consisting of a horizontal baffle plate having a plurality of openings therein, heat exchange tubes having flow holes near the top thereof mounted in the openings, and a cylindrical, imperforate baffle attached to the plate and surrounding the tubes. The baffle assembly is supported from the core support plate of the reactor by a plurality of hanger rods which are welded to radial beams passing under the baffle plate and intermittently welded thereto. Preferably the upper end of the cylindrical baffle terminates in an outwardly facing lip to which are welded a plurality of bearings having slots therein adapted to accept the hanger rods.
Oral strength in subjects with a unilateral cleft lip and palate.
Van Lierde, Kristiane M; Bettens, Kim; Luyten, Anke; Plettinck, Janne; Bonte, Katrien; Vermeersch, Hubert; Roche, Nathalie
2014-08-01
Facial appearance and speech outcome may affect psychosocial functioning in girls and boys. Several studies reported dissatisfaction with facial appearance and more specifically the lip and mouth profile in children with cleft lip and palate (CLP). The purpose of this controlled study was to measure the tongue and lip strength and endurance in boys and girls with CLP. Twenty-five subjects (mean age: 10.6 years) with a unilateral CLP and a gender- and age- matched control group were selected. All subjects with an unilateral CLP consulted the same craniofacial team and had undergone an identical surgical procedure. Surgical procedure of the lip was performed using a modified Millard technique without primary nose correction at an average age of 5.5 months. The Iowa Oral Performance instrument was used to measure lip and tongue strength and tongue endurance. The results of the Iowa Oral Performance measurement showed no significant differences between the subjects with an unilateral cleft lip and palate and the age and gender matched control group without a cleft lip and palate. There is no significant differences regarding oral strength more specifically the lip and tongue strength and endurance between subjects with and without an unilateral cleft lip and palate. ENT specialists and speech pathologists must be aware of this aspect of the normal lip and tongue functions. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
Secondary repair of cleft lip deformity.
Tessier, P; Tulasne, J F
1984-10-01
A considerable number of procedures have been described for secondary improvements of the lip. They involve the scars, the Cupid's bow, the philtrum, the alar base, the vestibulum and the columella. In fact, these procedures may give a good aesthetic result in a static position, but the truly successful results occur with normal movements. A normal motion of the lip is impossible without a proper dissection and reorientation of the muscles. Satisfactory lip motion cannot be realized with a defective alveolus or piriform aperture that retracts the alar base. Consequently, a good lip or nasal base cannot be achieved without bony restoration of the alveolus and piriform aperture. A transversely short lip never has normal mobility, and it must be widened by an Abbé flap. A tight, retruded lip on a retruded maxilla cannot be improved by a prosthetic vestibular plate because a greater tension will restrict movements. The lip must be advanced with the maxilla, then widened if necessary by an Abbé flap. A thick prolapsed lip never has normal movement; it must be raised by an infranasal excision. A cleft lip has nothing to gain from being displayed under a short nose, or, still worse, under a upturned nose. The nose must be kept long enough to cast a shadow on the lip. For the same reason, a bone graft is often necessary in bilateral clefts because the nose is short and retruded.
Characteristic patterns of lip prints in Egyptian population sample at Dakahlia Governorate.
Ragab, Ahmed Refat; El-Dakroory, Sahar Abd El-Aziz; Rahman, Rania Hamed Abdel
2013-03-01
Human identification is one of the most challenging sciences. Recently, study of lip prints has become slightly fashionable in forensic field. The aim of the present work is to determine the pattern of lip prints and evaluate its uniqueness in a sample of Egyptian population. The study included 955 subjects (2-65 years old). Lip prints were taken by direct rolling methods against hard background and each lip print was divided into six areas to be examined by magnifying hand lens. Thereafter, they were scanned and examined by the Microsoft office picture manager program. The results revealed that the lip print for each individual was unique and the complete vertical pattern was the commonest type among males and females living in Dakahlia Governorate, Egypt. Sex could not be differentiated from the lip print. It can be concluded that lip print analysis is an ancillary tool for personal identification especially in criminal investigations.
Rong, Li; Lan, Shi-Jie; Zhang, Duo; Wang, Wang-Shu; Liu, Chao; Peng, Wei-Hai
2014-09-01
In the repair of extensive lower lip and chin defects, the reconstruction of vermilion at the same time is a great challenge to plastic surgeons. We describe a novel method for the reconstruction of lower vermilion with musculomucosal flap from the upper lip in the repair of extensive lower lip and chin defects. Two patients underwent extensive lower lip and chin reconstruction together with vermilion reconstruction. This technique used 3 basic components: musculomucosal flap from the upper lip, buccal mucosal advancement flap, and cutaneous rotational flap from the neck. All the flaps survived without significant complications. Labial function in the motions of expression and speaking was maintained. The patients could basically close their mouths completely, and there were no drooping or small-mouth deformities postoperatively. Functional and cosmetically acceptable lower-lip and chin reconstructions in both patients were achieved.
ERIC Educational Resources Information Center
Murray, Lynne; Hentges, Francoise; Hill, Jonathan; Karpf, Janne; Mistry, Beejal; Kreutz, Marianne; Woodall, Peter; Moss, Tony; Goodacre, Tim
2008-01-01
Background: Children with cleft lip and palate are at risk for psychological problems. Difficulties in mother-child interactions may be relevant, and could be affected by the timing of lip repair. Method: We assessed cognitive development, behaviour problems, and attachment in 94 infants with cleft lip (with and without cleft palate) and 96…
Matsumoto, Kouzou; Nozoe, Etsuro; Okawachi, Takako; Ishihata, Kiyohide; Nishinara, Kazuhide; Nakamura, Norifumi
2016-09-01
To develop criteria for the analysis of upper lip configuration of patients with cleft lip while they produce various facial expressions by comparing the 3-dimensional (3D) facial morphology of healthy Japanese adults and patients with cleft lip. Twenty healthy adult Japanese volunteers (10 men, 10 women, controls) without any observed facial abnormalities and 8 patients (4 men, 4 women) with unilateral cleft lip and palate who had undergone secondary lip and nose repair were recruited for this study. Facial expressions (resting, smiling, and blowing out a candle) were recorded with 2 Artec MHT 3D scanners, and images were superimposed by aligning the T-zone of the faces. The positions of 14 specific points were set on each face, and the positional changes of specific points and symmetry of the upper lip cross-section were analyzed. Furthermore, the configuration observed in healthy controls was compared with that in patients with cleft lip before and after surgery. The mean absolute values for T-zone overlap ranged from 0.04 to 0.15 mm. Positional changes of specific points in the controls showed that the nose and lip moved backward and laterally upward when smiling and the lips moved forward and downward medially when blowing out a candle; these movements were bilaterally symmetrical in men and women. In patients with cleft lip, the positional changes of the specific points were minor compared with those of the controls while smiling and blowing out a candle. The left-versus-right symmetry of the upper lip cross-section exceeded 1.0 mm in patients with cleft lip, which was markedly higher than that in the controls (0.17 to 0.91 mm). These left-versus-right differences during facial expressions were decreased after surgery. By comparing healthy individuals with patients with cleft lip, this study has laid the basis for determining control values for facial expressions. Copyright © 2016 American Association of Oral and Maxillofacial Surgeons. Published by Elsevier Inc. All rights reserved.
[Antitumor effects of matrix protein of vesicular stomatic virus on EL4 lymphoma mice].
Lin, Shi-jia; Yu, Qin-mei; Meng, Wen-tong; Wen, Yan-jun; Chen, Li-juan; Niu, Ting
2011-03-01
To explore antitumor effects of plasmid pcDNA3. 1-MP encoding matrix protein of vesicular stomatitis virus (VSV) complexed with cationic liposome (DOTAP:CHOL) in mice with EL4 lymphoma. C57BL/6 mouse model with EL4 lymphoma was established. Sixty mice bearing EL4 lymphoma were divided randomly into five groups including Lip-MP, Lip-pVAX, Lip, ADM and NS groups, which were intravenously injected with liposome-pcDNA 3. 1-MP complex, liposome-pVAX complex, empty liposome, Adriamycin and normal saline respectively every three days. Tumor volumes and survival time were monitored. Microvessel density and tumor proliferative index in tumor tissues were determined by CD31, Ki-67 immunohistochemistry staining, meanwhile the tumor apoptosis index was measured by TUNEL method. From 6 days after treatments on, the tumor volume in Lip-MP group was much smaller than that in Lip-pVAX, Lip and NS group (P < 0.05). The median survival time of mice in Lip-MP group, 44 days after inoculation of tumor cells, was significantly higher than that in other groups (P < 0.05), which was 39 days, 38.5 days and 34 days in Lip-pVAX, Lip and NS groups respectively. The MVD value in tumor tissues in Lip-MP group was less than that in Lip-pVAX, Lip and NS groups (P < 0.05). Ki67 staining revealed that Lip-MP complex apparently suppressed the proliferation of EL4 tumor cells in vivo (P < 0.05). TUNEL assays showed that apoptosis index of tumor cells in Lip-MP group, 10.60 +/- 1.71, was much higher than that in other three groups (P < 0.05). Lip-MP complex, the plasmid encoding matrix protein of VSV (VSV-MP) encapsulated in cationic liposome, significantly inhibited the growth of tumor and prolonged the survival of mice bearing EL4 lymphoma, which may be related to the induction of tumor cell apoptosis, inhibition of tumor angiogenesis, and suppression of tumor cell proliferation.
... Safe Videos for Educators Search English Español Cleft Lip and Cleft Palate KidsHealth / For Kids / Cleft Lip and Cleft Palate ... the back of your mouth. What's a Cleft Lip or Cleft Palate? The word cleft means a gap or split ...
Sommer, Bettina; Overy, David P; Kerr, Russell G
2015-11-01
Dandruff, a skin disorder affecting 50% of the world population, is linked with proliferation of lipophilic yeasts of the genus Malassezia (particularly Malassezia globosa and M. restricta). Most Malassezia species show a unique lipid dependency and require external lipids for growth. Genome mining of the incomplete M. restricta genome led to the identification of eight lipase sequences. Sequences representing the class 3 and LIP lipase families were used to clone the lipases MrLip1, MrLip2 and MrLip3, recombinantly expressed in Pichia pastoris, and tested for their activity using mono-, di- and triacylglycerol substrates. Hydrolysis by the M. restricta lipase MrLip1 and MrLip2 (family class 3) was limited to the mono- and diacylglycerol, while MrLip3 (family LIP) hydrolyzed all three substrates. This result confirms that Malassezia family LIP lipases are responsible for the hydrolysis of triacylglycerols, the main component of human sebum. Furthermore, the information regarding lipases from M. restricta presented here might aid in the search for anti-dandruff agents. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Paying more than lip service to lip lesions.
Bentley, Janna M.; Barankin, Benjamin; Lauzon, Gilles J.
2003-01-01
OBJECTIVE: To review the epidemiology, etiology, diagnosis, management, and prognosis of the most common, potentially lethal, lip lesions: leukoplakia, actinic cheilitis, and squamous cell carcinoma (SCC). QUALITY OF EVIDENCE MEDLINE: was searched from 1966 to 2002 for English-language articles on prevalence of lip lesions. No articles for a family physician audience were found. MEDLINE was searched again using the terms "leukoplakia," "actinic cheilitis," and "squamous cell carcinoma." Randomized, controlled trials were selected; non-blinded trials, population-based studies, and systematic reviews were also used. MAIN MESSAGE: Leukoplakia, actinic cheilitis, and SCC of the lips are relatively common presentations that can cause substantial morbidity and, more rarely, mortality. Any abnormality of the lips can be an embarrassment. Because of the seriousness and frequency of lip disease, it is important to look for, diagnose, and treat lip lesions to prevent morbidity and mortality and also to maintain social acceptance and self-esteem. CONCLUSION: Knowledge of leukoplakia, actinic cheilitis, and SCC of the lips will aid family physicians in diagnosing and managing these lesions and in preventing associated morbidity and mortality. PMID:14526863
Dental Care for a Child with Cleft Lip and Palate
... Volunteer Efforts Dental Care for a Child with Cleft Lip and Palate skip to submenu What We Do Cleft & Craniofacial ... version of this factsheet, click here How does cleft lip/palate affect the teeth? A cleft of the lip, ...
Suragimath, Girish; Sande, Abhijeet R; Kulkarni, Prasad; Nimbal, Anand; Shankar, T.; Gowd, T. Snigdha; Shetty, Prajwal K
2014-01-01
Background: The study of lip-print pattern (cheiloscopy) is a scientific method for personal identification and plays a major role in forensic and criminal investigations. Objective: To compare the lip print patterns in Kerala and Maharashtra population and correlate between ABO blood groups. Materials and Methods: Two hundred subjects, 100 from Maharashtra and 100 from Kerala were considered for the study. Lip prints were recorded, analyzed according to Tsuchihashi classification. The lip print patterns were compared in the two populations, correlated in ABO blood groups. The data obtained was statistically analyzed with SPSS software using chi-square test. Results: In our study, predominant lip print pattern observed in Kerala population was type IV (53%) and Maharashtra population was type II (42%). The difference between the two population was statistically significant (p<0.001). Subjects with A+ and O- blood groups had type II lip print predominance. Subjects with B+, AB+ and O+ blood groups had type IV predominance. The lip print patterns do not show any correlation in ABO blood groups. Conclusion: Lip prints are unique to each individual and are different even in two persons. Lip print patterns were different in the two sub populations studied, and they showed no correlation in ABO blood groups. PMID:25478445
López-Jornet, Pía; Camacho-Alonso, Fabio; Rodríguez-Espin, Ana
2010-05-01
To study lip hydration levels when applying a lipstick sunscreen for 3 months and to evaluate the influence of size of lips, age, sex, smoking and skin phototype. The study group was formed by 140 volunteer subjects, one group consisting of 70 patients applying a commercial lipstick sunscreen three times a day and the other group of 70 controls in which no product was applied. The age range was 20-86 years. The influence in lip hydration levels of age, sex, phototype, size of the lips and smoking habits was studied using a Corneometer 825 (Courage & Khazaka Electronic GmbH, Cologne, Germany). An increase in lip hydration was found between the basal (53.49 +/- 15.259) and final (59.34 +/- 14.51) Corneometer 825 (Courage & Khazaka Electronic GmbH, Cologne, Germany) measurements over the three months of treatment, with statistically significant differences with respect to the control (p=0.002). However, no statistically significant differences in lip hydration were observed with regard to age, (p=0.48), gender (p=0.876), skin phototype (p=0.653), lip area (p=0.291) and smoking (p=0.178). Application of a lipstick sunscreen 3 times a day for 3 months increases lip hydration.
Primary Premaxillary Ostectomy and Setback: Dealing With the "Fly-away" Premaxilla.
Farhadi, Rana; Wallace, Robert D
2018-05-14
This study aimed to analyze our outcomes of primary premaxillary ostectomy and setback combined with lip adhesion as the first stage in repair of the bilateral cleft lip with fly-away premaxilla. This retrospective study included all patients who required primary premaxillary setback by a single surgeon to achieve successful lip repair between 2011 and 2017 at a tertiary children's hospital. All patients had bilateral cleft lip and complete cleft palate with significant premaxillary protrusion. All patients either had failed presurgical orthodontic manipulation or were thought to be poor candidates because of the rigidity of the premaxilla on clinical examination. Patient data were obtained from review of medical records and photographs. Surgical technique is described. Eleven patients with bilateral cleft lip, all of whom also had complete cleft palate, underwent primary premaxillary setback and lip adhesion at an average age of 8.2 months. The mean follow-up was 1.9 years (range, 139 days to 4.5 years). All patients subsequently completed formal lip repair, of which 10 have undergone palatoplasty. Serial photography documented stable premaxillary position and successful lip repair within the follow-up time frame. No patient had postoperative premaxillary instability or vascular compromise. One patient had dehiscence of the lip adhesion requiring reoperation. Primary premaxillary ostectomy and setback allows for successful staged formal lip repair in patients with bilateral cleft lip and palate who have failed presurgical infant orthopedics. Further research is required regarding long-term follow-up with respect to midfacial growth.
[Cosmetic technique application on the modification of lip deformity after cleft lip surgery].
Lixian, Chen; Huajun, Wang; Caixia, Gong; Qian, Zheng; Bing, Shi; Bihe, Zhang
2018-02-01
This study aims to explore the effect of cosmetic technique on the modification of lip deformity after cleft lip surgery. A total of 35 patients with postoperative cleft lip and who needed two-stage repair due to the nasolabial deformity were selected. Cosmetic technique was used to modify their lip deformities prior to the surgery. Front photos of the patients were taken before and after modification of their lip deformities. These photos were subsequently assessed by both the patients and the medical staff. The visual analogue method, Asher-McDade aesthetic index, and Mortier PB scale were used by patients and medical staff to evaluate changes in the lip shape by the cosmetic technique. Prior to the cosmetic technique application, the mean self-score of the patients and the mean scores of the medical staff were 56±13 and 3.22±1.11 points, respectively. After the cosmetic technique application, the mean self-score of the patients and the mean scores of the medical staff were 67±12 and 2.85±1.03 points, respectively. The differences were statistically significant for both the patients and the medical staff (P<0.05). Appropriate use of the cosmetic technique can modify the lip deformity after the cleft lip surgery to a certain degree. The use of this technique exerts evident effects in restoring the symmetry of lip peak and the continuity of the labial arch and in highlighting the philtrum column.
Zhang, Li; Wang, Yang; Gao, Hui-le; He, Qin
2015-06-01
The purpose of the study is to construct R8 peptide (RRRRRRRR) and pH sensitive polyethylene glycols (PEG) co-modified liposomes (Cl-Lip) and utilize them in breast cancer treatment. The co-modified liposomes were prepared with soybean phospholipid, cholesterol, DSPE-PEG2K-R8 and PEG5K-Hz-PE (pH sensitive PEG). The size and zeta potential of Cl-Lip were also characterized. The in vitro experiment demonstrated that the Cl-Lip had high serum stability in 50% fetal bovine serum. The cellular uptake of Cl-Lip under different pre-incubated conditions was evaluated on 4T1 cells. And the endocytosis pathway, lysosome escape ability and tumor spheroid penetration ability were also evaluated. The results showed the particle size of the Cl-Lip was (110.4 ± 5.2) nm, PDI of the Cl-Lip was 0.207 ± 0.039 and zeta potential of the Cl-Lip was (-3.46 ± 0.05) mV. The cellular uptake of Cl-Lip on 4T1 cells was pH sensitive, as the cellular uptake of Cl-Lip pre-incubated in pH 6.0 was higher than that of pH 7.4 under each time point. The main endocytosis pathways of Cl-Lip under pH 6.0 were micropinocytosis and energy-dependent pathway. At the same time, the Cl-Lip with pre-incubation in pH 6.0 had high lysosome escape ability and high tumor spheroid penetration ability. All the above results demonstrated that the Cl-Lip we constructed had high pH sensitivity and is a promising drug delivery system.
NASA Astrophysics Data System (ADS)
Zhang, Quan; Zhang, Xuanmiao; Chen, Tijia; Wang, Xinyi; Fu, Yao; Jin, Yun; Sun, Xun; Gong, Tao; Zhang, Zhirong
2015-05-01
A safe and efficient liver targeted PEGylated liposome (PEG-Lip) based on N-terminal myristoylated preS1/21-47 (preS1/21-47myr) of hepatitis B virus was successfully developed. The study aimed to elucidate the cellular uptake mechanism of preS1/21-47myr modified PEG-Lip (preS1/21-47myr-PEG-Lip) in hepatogenic cells and the distribution behavior of preS1/21-47myr-PEG-Lip in Vr:CD1 (ICR) mice. The cellular uptake results showed that preS1/21-47myr-PEG-Lip was effectively taken up by hepatogenic cells (including primary hepatocytes and liver tumor cells) through a receptor-mediated endocytosis pathway compared with non-hepatogenic cells. After systemic administration to H22 hepatoma-bearing mice, preS1/21-47myr-PEG-Lip showed significant liver-specific delivery and an increase in the distribution of preS1/21-47myr-PEG-Lip in hepatic tumor. Furthermore, the antitumor effect of preS1/21-47myr-PEG-Lip loaded with paclitaxel (PTX) was remarkably stronger than that of PTX injection and PTX loaded liposomes (including common liposomes and PEG-Lip). In safety evaluation, no acute systemic toxicity and immunotoxicity were observed after intravenous injection of preS1/21-47myr-PEG-Lip. No liver toxicity was observed despite the dramatic increase of preS1/21-47myr-PEG-Lip in liver. Taken together, preS1/21-47myr-PEG-Lip represents a promising carrier system for targeted liver disease therapy and imaging.
FERRARIO, VIRGILIO F.; SFORZA, CHIARELLA; SCHMITZ, JOHANNES H.; CIUSA, VERONICA; COLOMBO, ANNA
2000-01-01
A 3-dimensional computerised system with landmark representation of the soft-tissue facial surface allows noninvasive and fast quantitative study of facial growth. The aims of the present investigation were (1) to provide reference data for selected dimensions of lips (linear distances and ratios, vermilion area, volume); (2) to quantify the relevant growth changes; and (3) to evaluate sex differences in growth patterns. The 3-dimensional coordinates of 6 soft-tissue landmarks on the lips were obtained by an optoelectronic instrument in a mixed longitudinal and cross-sectional study (2023 examinations in 1348 healthy subjects between 6 y of age and young adulthood). From the landmarks, several linear distances (mouth width, total vermilion height, total lip height, upper lip height), the vermilion height-to-mouth width ratio, some areas (vermilion of the upper lip, vermilion of the lower lip, total vermilion) and volumes (upper lip volume, lower lip volume, total lip volume) were calculated and averaged for age and sex. Male values were compared with female values by means of Student's t test. Within each age group all lip dimensions (distances, areas, volumes) were significantly larger in boys than in girls (P < 0.05), with some exceptions in the first age groups and coinciding with the earlier female growth spurt, whereas the vermilion height-to-mouth width ratio did not show a corresponding sexual dimorphism. Linear distances in girls had almost reached adult dimensions in the 13–14 y age group, while in boys a large increase was still to occur. The attainment of adult dimensions was faster in the upper than in the lower lip, especially in girls. The method used in the present investigation allowed the noninvasive evaluation of a large sample of nonpatient subjects, leading to the definition of 3-dimensional normative data. Data collected in the present study could represent a data base for the quantitative description of human lip morphology from childhood to young adulthood. PMID:10853963
Pecyna, P M; Feeney-Giacoma, M E; Neiman, G S
1987-06-01
Studies of language acquisition in cleft lip and palate infants have not investigated the development of specific cognitive concepts, such as object permanence, which may be related to early linguistic skills. This study obtained comparative data on the development of the object permanence concept in cleft lip and palate and noncleft lip and palate infants to determine whether there were significant differences in rate or sequence of development. Infants were tested for the object permanence concept from 12 through 18 months of age. Results revealed significant improvement in all infants' scores with age, indicating progressive development of the concept. Further, while scores were not significantly different between the cleft lip and palate groups, scores for these groups were significantly better than scores for noncleft lip and palate infants. Superior performance of the cleft lip and palate infants may have resulted from increased environmental stimulation provided by their parents. Implications for intervention and future research in this area are presented.
Jarvis, G N; Strömpl, C; Moore, E R; Thiele, J H
1998-03-01
Two Gram-positive, obligately anaerobic, lipolytic bacteria, isolates LIP4 and LIP5, were obtained from the rumen contents of juvenile red deer. These mesophilic bacterial strains were capable of hydrolysing the neutral lipids, tallow, tripalmitin and oliver oil, into their constituent free long-chain fatty acid and glycerol moieties. The latter compound was dissimilated by both isolates, with isolate LIP4 producing propionate as the predominant product, while isolate LIP5 produced acetate, ethanol and succinate. The lactate-utilising isolate LIP4 grew on a limited range of saccharide substrates including glucose, fructose and ribose, and exhibited an unusual cell wall structure and morphology. The isolate LIP5 grew upon a wider range of saccharides, but was unable to use lactate as a substrate. Based upon phenotypic and 16S rRNA gene sequence analyses, isolate LIP4 clusters with species in the genus Propionibacterium, while isolate LIP5 is a member of clostridial cluster XIVa.
Cleft Lip Repair, Nasoalveolar Molding, and Primary Cleft Rhinoplasty.
Bhuskute, Aditi A; Tollefson, Travis T
2016-11-01
Cleft lip and palate are the fourth most common congenital birth defect. Management requires multidisciplinary care owing to the complexity of these clefts on midface growth, dentition, Eustachian tube function, and lip and nasal cosmesis. Repair requires planning, but can be performed systematically to reduce variability of outcomes. The use of primary rhinoplasty at the time of cleft lip repair can improve nose symmetry and reduce nasal deformity. Use of nasoalveolar molding ranging from lip taping to the use of preoperative infant orthopedics has played an important role in improving functional and cosmetic results of cleft lip repair. Copyright © 2016 Elsevier Inc. All rights reserved.
Unfavourable results in the repair of the cleft lip
Narayanan, Puthucode V.; Adenwalla, Hirji Sorab
2013-01-01
Introduction: Unfavorable results in unilateral and bilateral cleft lip repair are often easy to spot but not always easy to prevent as to treat. We have tried to deal with the more common problems and explain possible causes and the best possible management options from our experience. Unilateral cleft lip repair: Unfavorable results immediately after repair involve Dehiscence and Scaring. Delayed blemishes include vermillion notching, a short lip, deficiency in the height of the lateral vermillion on the cleft side, white roll malalignment, oro-vestibular fistula, the cleft lip nose deformity, a narrow nostril and a “high-riding” nostril. We analyze the causes of these blemishes and outline our views regarding the treatment of these. Bilateral cleft lip: Immediate problems again include dehiscence as also loss of prolabium or premaxilla. Delayed unfavorable results are central vermillion deficiency, a lip that is too tight, bilateral cleft lip nose deformity, problems with the premaxilla and maxillary growth disturbances. Here again we discuss the causation of these problems and our preferred methods of treatment. Conclusion: We have detailed the significant unfavorable results after unilateral and bilateral cleft lip surgery. The methods of treatment advocated have been layer from our own experience. PMID:24501453
Cheiloscopy and blood groups: Aid in forensic identification.
Karim, Bushra; Gupta, Devanand
2014-10-01
Every person has certain features that make them radically distinct from others. One such feature is lip prints. Lip prints remain the same throughout life and are uninfluenced by injuries, diseases, or environmental changes. Different individuals have specific blood groups according to the various antigen-antibody reactions in their bloodstream. To determine the distribution of different patterns of lip prints among subjects having different ABO and Rh blood groups. To determine the correlation between respective characteristics of subjects. In this study, lip prints were obtained from 122 subjects (62 males and 60 females), and associated blood-group matching was performed to determine the predominant lip print type and to determine any correlation between lip print types and blood groups. Tsuchihashi's classification of type I (complete vertical grooves), type I' (incomplete vertical grooves), type II (forking grooves), type III (intersecting grooves), type IV (reticular grooves), and type V (indeterminate grooves) was used to compare with the ABO and Rh blood grouping systems. No correlation was found between lip prints and blood groups. No significant correlation exists between blood group and lip prints. Lip prints play a vital role in identification because they are unique.
Neural control of the lips differs for young and older adults following a perturbation
de Miranda Marzullo, Ana Carolina; Neto, Osmar Pinto; Ballard, Kirrie J.; Robin, Donald A.; Chaitow, Lauren
2011-01-01
Aging impairs the control of many skilled movements including speech. The purpose of this paper was to investigate whether young and older adults adapt to lower lip perturbations during speech differently. Twenty men (10 young, 26 ± 3 years of age; 10 older, 60 ± 9 years of age) were requested to repeat the word (“papa”) 300 times. In 15% of the trials, the subjects experienced a mechanical perturbation on the lower lip. Displacement and neural activation (EMG) of the upper and lower lips were evaluated. Perturbations to the lower lip caused a greater increase in the maximum displacement of the lower lip for older adults compared with young adults (34.7 ± 19% vs. 13.4 ± 17%; P = 0.017). Furthermore, young adults exhibited significantly greater 30–100 Hz normalized EMG power for the lower lip compared to the upper lip (P < 0.005). In young adults, changes from normal to perturbed trials in the 30–50 Hz frequency band of the EMG were negatively correlated to the changes from normal to perturbed trials in the lower lip maximum displacement (R2 = 0.48; P = 0.025). It is concluded that young adults adapt better to lower lip perturbations compared with older adults and that the associated neural activation strategy of the involved muscle is different for the two age groups. PMID:20852991
Chi, Xiaoyuan; Su, Peng; Bi, Dan; Tai, Zhao; Li, Yingying; Pang, Yue; Li, Qingwei
2018-04-01
The lamprey (Lampetra japonica), a representative of the jawless vertebrates, is the oldest extant species in the world. LIP-1, which has a jacalin-like domain and an aerolysin pore-forming domain, has previously been identified in Lampetra japonica. However, the structure and function of the LIP-1 protein have not been described. In this study, the LIP-1 gene was overexpressed in HeLa cells and H293T cells. The results showed that the overexpression of LIP-1 in HeLa cells significantly elevated LDH release (P < 0.05), phosphatidylserine exposure and ROS accumulation. The overexpression of LIP-1 also had remarkable effects on the organelles in HeLa cells, while it had no effect on H293T cell organelles. Array data indicated that overexpression of LIP-1 primarily upregulated P53 signaling pathways in HeLa cells. Cell cycle assay results confirmed that LIP-1 caused arrest in the G 2 /M phase of the cell cycle in HeLa cells. In summary, our findings provide insights into the function and characterization of LIP-1 genes in vertebrates and establish the foundation for further research into the biological function of LIP-1. Our observations suggest that this lamprey protein has the potential for use in new applications in the medical field. Copyright © 2018. Published by Elsevier Ltd.
Arterio-Venous Anastomoses and Thermoregulation (Arterio-Veneuze Anastomosen en Thermoregulatie)
1991-08-22
in the skin of the nose, ears and lips. Furthermore, they are found in the nail bed, corpus cavernosum of the penis of the man, ovarium of the woman...diameter of the vessels was a criterion for the existence of an AVA. Enlarged capillaries or preferential channels are thus wrongly seen as AVA. 10 3.3...considerably enlarged . It makes an S-shaped curve and then narrows down to become continuous with a short funnel-shaped vein which opens at right angles, into
Giving Lip Service with an Attitude: North Korea’s China Debate
2003-12-01
during the Imjin wars in 1592–98, thousands of Korean peasants fled across the Yalu River in search of shelter and livelihood. Social dislocation, gen...Volunteers (CPVs) in the post- war recon- struction of Korea. During the socialist construction in the 1960s and 1970s, pro- tected by the Chinese...olive branch of détente with the United States without war . Perhaps, ardent Chinese intermediation may deliver the Second Opening of Korea to the West
Age-related changes of the dental aesthetic zone at rest and during spontaneous smiling and speech.
Van der Geld, Pieter; Oosterveld, Paul; Kuijpers-Jagtman, Anne Marie
2008-08-01
The aims of this study were to analyse lip line heights and age effects in an adult male population during spontaneous smiling, speech, and tooth display in the natural rest position and to determine whether lip line height follows a consistent pattern during these different functions. The sample consisted of 122 randomly selected male participants from three age cohorts (20-25 years, 35-40 years, and 50-55 years). Lip line heights were measured with a digital videographic method for smile analysis, which had previously been tested and found reliable. Statistical analysis of the data was carried out using correlation analysis, analysis of variance, and Tukey's post hoc tests. Maxillary lip line heights during spontaneous smiling were generally higher in the premolar area than at the anterior teeth. The aesthetic zone in 75 per cent of the participants included all maxillary teeth up to the first molar. Coherence in lip line heights during spontaneous smiling, speech, and tooth display in the natural rest position was confirmed by significant correlations. In older subjects, maxillary lip line heights decreased significantly in all situations. Lip line heights during spontaneous smiling were reduced by approximately 2 mm. In older participants, the mandibular lip line heights also changed significantly and teeth were displayed less during spontaneous smiling. Mandibular tooth display in the rest position increased significantly. Upper lip length increased significantly by almost 4 mm in older subjects, whereas upper lip elevation did not change significantly. The significant increasing lip coverage of the maxillary teeth indicates that the effects of age should be included in orthodontic treatment planning.
Singh, Priyankar; Nathani, Dipesh B
2017-09-01
The objective of this study was to correlate dermatoglyphics and cheiloscopy with genetic inheritance in cleft lip and cleft palate patients. This was a case-control study to look for asymmetry in finger and lip print patterns. All of the participants were divided into two equal groups (40 mothers and 40 fathers in each group). The data were analyzed by three evaluators who were blind to the study to avoid any chances of error. A sample of 160 sporadic participants were identified and evaluated. Group A was composed of 80 healthy parents not affected by cleft lip and cleft palate but had at least one child born with nonsyndromic cleft. Group B consisted of 80 healthy parents not affected by cleft lip and cleft palate and had healthy children without cleft lip and cleft palate. Main outcome measures were marked dermatoglyphic asymmetry and specific lip print pattern in the study group. We found marked asymmetry in various fingerprints and specific type II and type III lip print in the study group when compared with the control group. It was observed that groove count on the lip was significantly more frequent in study group parents. Our study determined that there is a significant correlation between increased dermatoglyphic asymmetry and specific type II and type III lip print pattern in parents of children born with cleft. This could act as an important screening marker for the prediction of cleft lip and cleft palate inheritance.
Association between Cheiloscopic Patterns and ABO Blood Groups among South Indian Population.
Khanapure, Sneha; Suhas, H G; Potdar, Shrudha; Sam, George; Sudeep, C B; Arjun, M R
2017-07-01
Human beings have few characteristics that are unique from others. Lip prints are one of such feature. They are not changed throughout the life and are not influenced by injuries, diseases, or environmental changes. According to the various antigen-antibody reactions in the bloodstream, different individuals have specific blood groups. To study the distribution of lip print patterns among individuals with different ABO and Rh blood groups and also to know the relation between their characters and blood groups. In the present study, lip prints were collected randomly from 85 individuals, and their blood group matching was performed. This is to identify the most common lip print type and to know any association between lip print types and blood groups. Tsuchihashi's classification of lip prints was used to compare with the ABO and Rh blood grouping systems. It was observed that in individuals with B+, A+, and O- blood groups, predominant pattern was Type IV and individuals having blood group O+ and AB+ common lip print pattern was Type II. This study showed strong association between lip print patterns and ABO blood groups as some blood groups were not included in statistical analysis; further studies including larger sample are essential to substantiate the results. Correlating lip print with blood group helps in identification of the suspects. Along with lip prints, another biological record that remains unchanged throughout the lifetime of a person is the blood group. Determining the blood group of a person from the samples obtained at the site of crime and also recovering lip prints from site can help identify a person.
ERIC Educational Resources Information Center
Pecyna, Paula M.; And Others
1987-01-01
The development of the concept of object permanence was investigated with eight infants with cleft lip/palate and four nonimpaired infants. Superior performance of the cleft lip/palate group was found, possibly due to increased environmental stimulation provided by parents. (DB)
Dentofacial self-perception and social perception of adults with unilateral cleft lip and palate.
Meyer-Marcotty, Philipp; Stellzig-Eisenhauer, Angelika
2009-05-01
The aim of this study was to investigate the influence of facial asymmetry on how an adult population with unilateral cleft lip and palate (CLP) perceived themselves and were perceived by others. 3D facial data of 30 adult patients with cleft lip and palate (CLP) was scanned and standardized extra- and intraoral photographs were taken. The measured degree of 3D asymmetry was computed for the entire face, midface and lower face. Subjective estimates regarding facial symmetry, attractiveness as well as satisfaction and a desire or indication for further treatment were surveyed by means of a questionnaire filled out by patients and an assessment group (10 orthodontists, 10 oral and maxillofacial (OM) surgeons, 15 laypersons). The study's results show that the largest degree of asymmetry was found in the midface of CLP patients. The vast majority of the patients were dissatisfied with their facial appearance, and patients, experts and laypersons expressed great interest in and a need of correction. We observed tangible incongruence between how the patients perceived their own faces and how others perceived them. Asymmetry, especially in the midface, appears to detract from how facial appearance is self-perceived and perceived by others, which explains the primary desire for or need of nose correction. The self-perception of patients affected by CLP does not correlate with objective results or how others perceive them. Clinicians should be open to adult patients' requests for correction, but the patient's self-perception should also be critically explored.
Lower lip reconstruction with nasolabial flap--going back to basics.
Coutinho, Inês; Ramos, Leonor; Gameiro, Ana Rita; Vieira, Ricardo; Figueiredo, Américo
2015-01-01
Squamous cell carcinoma of the lower lip is frequent, and radical excision sometimes leads to complex defects. Many lip repair techniques are aggressive requiring general anesthesia and a prolonged post-operative period. The nasolabial flap, while a common flap for the repair of other facial defects, is an under-recognized option for the reconstruction of the lower lip. We describe the use of nasolabial flap for the repair of a large defect of the lower lip in a ninety year-old male, with good functional results and acceptable cosmetic outcome. We believe the nasolabial flap is a good alternative for intermediate-to-large lower lip defects in patients with impaired general condition.
Design guide for helicopter transmission seals
NASA Technical Reports Server (NTRS)
Hayden, T. S.; Keller, C. H., Jr.
1974-01-01
A detailed approach for the selection and design of seals for helicopter transmissions is presented. There are two major types of seals presently being used and they are lip type seals and mechanical type seals. Lip type seals can be divided in conventional lip seals and hydrodynamic lip seals. Conventional lip seals can be used for slow-speed, low-pressure, low-temperature sealing. Hydrodynamic lip seals although they are as pressure and temperature limited as conventional lip seals, can operate at a higher speed. Mechanical types seals are comprised of face seals and circumferential seals. Face seals are capable of high speed, high pressure, and high temperature. Circumferential seals can be used in high-speed and high-temperature applications, but will leak excessively at moderate pressures. The performance goals of transmission seals are a life that is at least equal to the scheduled overhaul interval of the gearbox component and a leakage rate of near zero.
[Observation of oral actions using digital image processing system].
Ichikawa, T; Komoda, J; Horiuchi, M; Ichiba, H; Hada, M; Matsumoto, N
1990-04-01
A new digital image processing system to observe oral actions is proposed. The system provides analyses of motion pictures along with other physiological signals. The major components are a video tape recorder, a digital image processor, a percept scope, a CCD camera, an A/D converter and a personal computer. Five reference points were marked on the lip and eyeglasses of 9 adult subjects. Lip movements were recorded and analyzed using the system when uttering five vowels and [ka, sa, ta, ha, ra, ma, pa, ba[. 1. Positions of the lip when uttering five vowels were clearly classified. 2. Active articulatory movements of the lip were not recognized when uttering consonants [k, s, t, h, r[. It seemed lip movements were dependent on tongue and mandibular movements. Downward and rearward movements of the upper lip, and upward and forward movements of the lower lip were observed when uttering consonants [m, p, b[.
Feeding Techniques for Children Who Have Cleft Lip and Palate.
ERIC Educational Resources Information Center
Klein, Marsha Dunn
This pamphlet on feeding techniques for children who have cleft lip and palate emphasizes the role of the parent as part of a team involving many specialists. The pamphlet begins with explanations of complete and incomplete separations of the lip, unilateral and bilateral cleft lips, corrective surgical procedures, etc. The importance of weight…
Wu, K; Xu, J; Lin, Y
1996-05-01
Twelve cases of secondary deformities of the cleft lip were repaired with the apron mucosal flap of the lower lip. The operation method is described. The advantages and disadvantages are discussed. Good results were obtained in patients with mild or medium secondary deformities.
78 FR 44422 - Airworthiness Directives; Eurocopter France (Eurocopter) Helicopters
Federal Register 2010, 2011, 2012, 2013, 2014
2013-07-24
..., rust, overheating, and condition. This AD is prompted by six reports of hydraulic pump drive belt... lip seals, rust on the lip seals, evidence of overheating revealed by brown discoloring of the bearing... pulley bearing for leaking grease, a crack or tear in the lip seals, a run of rust on the lip seals...
Analysis of select facial and dental esthetic parameters.
Nold, Sarah L; Horvath, Sebastian D; Stampf, Susanne; Blatz, Markus B
2014-01-01
This clinical study examined objective smile parameters in the natural anterior dentition. Standardized intraoral and extraoral photographs were taken of 106 Caucasian adults (54 women, 52 men) with a healthy dentition. The following parameters were analyzed: correlation of dental and facial midline, upper lip position and curvature, relationship of the maxillary anterior incisal curve with lower lip, number of teeth displayed in a smile, distance between maxillary anterior teeth and lower lip, slope of tooth, and lip arc. The simple frequency distribution of measured variables revealed an average smile with coinciding dental and facial midlines, an average smile line, and a straight upper lip curvature. With an average smile, the maxillary anterior teeth did not touch the lower lip, teeth were displayed up to the second premolar, and the maxillary anterior incisal curve was parallel to the lower lip. Oval was the most prevalent tooth form. A slope of 9 degrees was detected for the mean tooth arc and 13 degrees for the mean lip arc. The outcomes of this clinical study provide a quantifiable frame for esthetic evaluation, treatment planning, and restoration fabrication.
Kumari, Arti; Baronian, Keith; Kunze, Gotthard; Gupta, Rani
2015-06-01
Lipase YlLip11 from Yarrowia lipolytica was expressed with a signal peptide encoding sequence in Arxula adeninivorans, Saccharomyces cerevisiae and Hansenula polymorpha using the Xplor®2 transformation/expression platform and an expression module with the constitutive Arxula-derived TEF1 promoter. The YlLip11 signal peptide was functional in all of the yeast hosts with 97% of the recombinant enzyme being secreted into the culture medium. However, recombinant YlLip11 with His Tag fused at C-terminal was not active. The best recombinant YlLip11 producing A. adeninivorans G1212/YRC102-YlLip11 transformant cultivated in shake flasks produced 2654 U/L lipase, followed by S. cerevisiae SEY6210/YRC103-YlLip11 (1632U/L) and H. polymorpha RB11/YRC103-YlLip11 (1144U/L). Although the biochemical parameters of YlLip11 synthesized in different hosts were similar, their glycosylation level and thermo stability differed. The protein synthesized by the H. polymorpha transformant had the highest degree of glycosylation and with a t1/2 of 60min at 70°C, exhibited the highest thermostability. Copyright © 2015 Elsevier Inc. All rights reserved.
Paiva, Tatiana Saito; Andre, Marcia; Paiva, Wellingson Silva; Mattos, Beatriz Silva Camara
2014-01-01
Esthetic evaluation of cleft lip and palate rehabilitation outcomes may assist in the determination of new surgical interventions and aid in reevaluation of treatment protocols. Our objective was to compare esthetics assessments of the nasolabial region in children with a unilateral cleft lip and palate between healthcare professionals who were experienced in the treatment of cleft lip and palate and those who were inexperienced. The study group included 55 patients between 6 and 12 years of age who had already undergone primary reconstructive surgery for unilateral cleft lip. Standardized digital photographs were obtained, and the esthetic features of the nose, lip, and nasolabial region were evaluated. We used only cropped photographic images in the assessments of healthcare professionals with and without experience in cleft lip and palate. Interrater analysis revealed highly reliable assessments made by both the experienced and inexperienced professionals. There was no statistically significant difference in the esthetic attractiveness of the lip and nose between the experienced and inexperienced professionals. Compared with the inexperienced professionals, the experienced professional evaluators showed higher satisfaction with the esthetic appearance of the nasolabial region; however, no difference was observed in the analysis of the lip or nose alone. PMID:25126560
Neiswanger, Katherine; Chirigos, Kevin W.; Klotz, Cherise M.; Cooper, Margaret E.; Bardi, Kathleen M.; Brandon, Carla A.; Weinberg, Seth M.; Vieira, Alexandre R.; Martin, Rick A.; Czeizel, Andrew E.; Castilla, Eduardo E.; Poletta, Fernando A.; Marazita, Mary L.
2009-01-01
Nonsyndromic cleft lip with or without cleft palate (CL/P) is a common birth defect due to both genetic and environmental factors. Whorl lip print patterns are circular grooves on the central upper lip and/or the left and right lower lip. To determine if whorls are more common in families with CL/P than in controls, the Pittsburgh Orofacial Cleft Study collected lip prints from over 450 subjects, i.e., individuals with CL/P, their relatives, and unrelated controls—from the U.S., Argentina, and Hungary. Using a narrow definition of lower-lip whorl, the frequency of whorls in the U.S sample was significantly elevated in cleft individuals and their family members, compared to unrelated controls (14.8% and 13.2% versus 2.3%; P = 0.003 and 0.001, respectively). Whorls were more frequent in CL/P families from Argentina than in CL/P families from the U.S. or Hungary. If these results are confirmed, whorl lip print patterns could be part of an expanded phenotypic spectrum of nonsyndromic CL/P. As such, they may eventually be useful in a clinical setting, allowing recurrence risk calculations to incorporate individual phenotypic information in addition to family history data. PMID:19921634
Interrelationship of Smoking, Lip and Gingival Melanin Pigmentation, and Periodontal Status
Multani, Suraj
2013-01-01
Background Cigarette smoking is a significant risk factor for periodontal disease. It also causes pigmentation of oral mucosa. The present study was aimed to assess the effects of smoking on lip and gingival pigmentation and periodontal status and the relationship between pigmentation and periodontal parameters. Methods A total of 109 smokers and an equal number of non-smoker controls (mean age: 35.9 years, range: 35-44 years) comprised the study sample. All the participants were assessed for pigmentation on lip and gingiva and overall periodontal status (gingival bleeding, probing depth, and loss of attachment at six points in each tooth). Findings All the smokers in this study had lip and gingival pigmentation. Two-third of non-smokers had no pigmentation. The mean scores of lip and gingival pigmentation in smokers were seven and four times higher than those of non-smokers, respectively. Pigmentation and periodontal parameters (except gingival bleeding) were found to be positively related with exposure to smoking exposure. Probing depth and loss of attachment were the highest in subjects with pigmented lips and grade three pigmented gingiva. Conclusion Smoking influenced lip and gingival pigmentation and periodontium. All individuals with lip pigmentation presented some form of gingival pigmentation. Probing depth and loss of attachment were more severe in subjects with lip and gingival pigmentation. PMID:24494159
Ear Infection in Isolated Cleft Lip: Etiological Implications.
Ruegg, Teresa A; Cooper, Margaret E; Leslie, Elizabeth J; Ford, Matthew D; Wehby, George L; Deleyiannis, Frederic W B; Czeizel, Andrew E; Hecht, Jacqueline T; Marazita, Mary L; Weinberg, Seth M
2017-03-01
Chronic ear infections are a common occurrence in children with orofacial clefts involving the secondary palate. Less is known about the middle ear status of individuals with isolated clefts of the lip, although several studies have reported elevated rates of ear infection in this group. The purpose of this retrospective study was to test the hypothesis that chronic ear infections occur more frequently in isolated cleft lip cases (n = 94) compared with controls (n = 183). A questionnaire was used to obtain information on history of chronic ear infection. The association between ear infection status (present/absent) and cleft lip status (cleft lip case/control) was tested using both chi-square and logistic regression. The reported occurrence of chronic ear infection was significantly greater in cleft lip cases (31%) compared with unaffected controls (11%). After adjusting for age and sex, having a cleft lip increased the odds of being positive for ear infection by a factor greater than 3 (odds ratio = 3.698; 95% confidence interval = 1.91 to 7.14). Within cleft lip cases, there was no difference in the occurrence of ear infection by defect laterality or by the type of clefting present in the family history. Although velopharyngeal insufficiency was present in 18.4% of our cleft lip sample, there was no statistical association between ear infection and abnormal speech patterns. These results may have potential implications both for the clinical management of isolated cleft lip cases and for understanding the etiology of orofacial clefting.
NASA Astrophysics Data System (ADS)
Madrigal, P.; Gazel, E.; Flores, K. E.; Bizimis, M.; Jicha, B. R.
2015-12-01
As the surface expression of deep mantle dynamics, Large Igneous Provinces (LIPs) are associated with the edges of large low shear velocity provinces (LLSVP) rooted at the core-mantle boundary. Instabilities in the LLSVP can cause periodic upwellings of material in the form of mantle plumes, which impact the lithosphere forming LIPs. However, the time frames of these massive lava outpourings are still uncertain. While continental LIPs are more readily accessible, oceanic LIPs have only been studied through drilling and sampling of fragments accreted to continental margins or island arcs, hence, they are relatively less understood. The impact of oceanic LIPs on oceanic biota is conspicuously recorded in global occurrences of black shale deposits that evidence episodes of anoxia and mass extinctions shortly after the formation of LIPs that ultimately can affect life on the entire planet. Our new geochemical and geochronological data of accreted Pacific LIPs found in the coasts of Nicoya Peninsula in Costa Rica record three LIP pulses possibly reflecting upwelling periods of the LLSVP at 140, 120 and 90 Ma. In order to test different models of origin of these LIPS, we created a complete reconstruction of the Pacific Plate configuration from the Mid-Jurassic to Upper-Cretaceous to show the existing correlation between upwelling pulses at edges of the Pacific LLSVP, oceanic anoxic events and the age from Pacific LIPs. We propose that since the formation of the Pacific plate at circa 175-180 Ma, a series of upwellings that interacted with mid-ocean ridge systems separated by 10-20 Ma have affected the planet periodically forming oceanic LIPs that still can be found today on the Pacific seafloor and accreted along the plate margins.
Acoustic properties of healthy and reconstructed cleft lip
NASA Astrophysics Data System (ADS)
Thijssen, Johan M.; van Hees, Nancy J.; Weijers, Gert G.; Huyskens, Rinske W.; Nillesen, Maartje; Katsaros, Christos; de Korte, Chris L.
2006-03-01
The feasibility of echographic imaging of the tissues in healthy lip and in reconstructed cleft lip and estimating the dimensions and the normalized echo level of these tissues is investigated. Echographic images of the upper lip were made with commercial medical ultrasound equipment, using a linear array transducer (7-11 MHz bandwidth) and a non-contact gel coupling. Tissue dimensions were measured by means of software calipers. Echo levels were calibrated and corrected for beam characteristics, gel path and tissue attenuation by using a tissue-mimicking phantom. At central position of philtrum, mean thickness (and standard deviation) of lip loose connective tissue layer, orbicularis oris muscle and dense connective layer was 4.0 (sd 0.1) mm, 2.3 (sd 0.7) mm, 2.2 (sd 0.7) mm, respectively, in healthy lip at rest. Mean (sd) echo level of muscle and dense connective tissue layer with respect to echo level of lip loose connective tissue layer was in relaxed condition: - 19.3 (sd 0.6) dB and - 10.7 (sd 4.0) dB, respectively. Echo level of loose connective tissue layer was +25.6 (sd 4.2) dB relative to phantom echo level obtained in the focus of the transducer. Color mode echo images were calculated, after adaptive filtering of the images, which show the tissues in separate colors and highlight the details of healthy lip and reconstructed cleft lip. Quantitative assessment of thickness and echo level of various lip tissues is feasible after proper calibration of the echographic equipment. Diagnostic potentials of the developed quantitative echographic techniques for non-invasive evaluation of the outcome of cleft lip reconstruction are promising.
Self-reports of psychosocial functioning among children and young adults with cleft lip and palate.
Hunt, Orlagh; Burden, Donald; Hepper, Peter; Stevenson, Mike; Johnston, Chris
2006-09-01
A cross-sectional study was employed to determine the psychosocial effects of cleft lip and/or palate among children and young adults, compared with a control group of children and young adults without cleft lip and palate. The study comprised 160 children and young adults with cleft lip and/or palate and 113 children and young adults without cleft lip and/or palate. All participants were between 8 and 21 years of age. Psychological functioning (anxiety, self-esteem, depression, and behavioral problems) was assessed using validated psychological questionnaires. Happiness with facial appearance was rated using a visual analog scale. Social functioning, including experience of teasing/bullying and satisfaction with speech, was assessed using a semistructured interview. Participants with cleft lip and/or palate reported greater behavioral problems (p < .001) and more symptoms of depression (p < .01); they were teased more often (p < .001) and were less happy with their facial appearance (p < .01) and speech (p < .001), compared with controls. There were no significant difference between subjects with cleft lip and/or palate and subjects without cleft lip and/or palate in terms of anxiety (p > .05) or self-esteem (p > .05). Having been teased was a significant predictor of poor psychological functioning, more so than having a cleft lip and/or palate per se (p < .001). Teasing was greater among participants who had cleft lip and/ or palate and it was a significant predictor of poorer psychosocial functioning. Children and young adults with cleft lip and/or palate require psychological assessment, specifically focusing on their experience of teasing, as part of their routine cleft care.
van Etten, E W; ten Kate, M T; Stearne, L E; Bakker-Woudenberg, I A
1995-01-01
Pegylated amphotericin B (AmB) liposomes (PEG-AmB-LIP) were compared with laboratory-prepared nonpegylated AmB liposomes (AmB-LIP), a formulation with a lipid composition the same as that in AmBisome, as well as with industrially prepared AmBisome regarding their in vitro antifungal activities, toxicities, blood residence times, and therapeutic efficacies. Killing of Candida albicans (> 99.9%) during short-term (6-h) incubation was observed at 0.2 mg of AmB per liter for AmB desoxycholate, 0.4 mg of AmB per liter for PEG-AmB-LIP, 0.8 mg of AmB per liter for AmB-LIP, and 12.8 mg of AmB per liter for AmBisome. The maximum tolerated doses of PEG-AmB-LIP, AmB-LIP, and AmBisome were 15, 19, and > 31 mg of AmB per kg of body weight, respectively. In contrast to AmB-LIP, the blood residence time of PEG-AmB-LIP was prolonged and dose independent. In a model of systemic candidiasis in leukopenic mice at a dose of 5 mg of AmB per kg, PEG-AmB-LIP was completely effective and AmB-LIP was partially effective, whereas AmBisome was not effective. AmB-LIP at 11 mg of AmB per kg was partially effective. AmBisome at 29 mg of AmB per kg was completely effective. In conclusion, the therapeutic efficacies of AmB liposomes can be improved by preparing AmB liposomes in which a substantial reduction in toxicity is achieved while antifungal activity is retained. In addition, therapeutic efficacy is favored by a prolonged residence time of AmB liposomes in blood. PMID:8540697
Can commonly used profile planes be used to evaluate changes in lower lip position?
Buschang, Peter H; Fretty, Kimberly; Campbell, Phillip M
2011-07-01
To determine the validity of five profile planes commonly used to describe the horizontal changes of the lower lip during orthodontic treatment. Pretreatment and posttreatment cephalograms of 79 patients (12.4 ± 2.8 years of age) were evaluated. Lower lip (labrale inferiorus) changes over time were measured relative to the Rickett's E-line, Steiner's S1-line, Burstone's B-line, Sushner's S2-line, and Holdaway's H-line. As an independent measure of actual horizontal lip changes, the labrale inferiorus was measured relative to a stable reference plane registered on the sella and oriented on the SN-7°. The lower lip actually moved anteriorly 2.35 ± 3.35 mm during orthodontic treatment; the five profile planes indicated that the lower lip moved to a more retrusive, posterior position. The five profile planes also showed no statistically significant sex differences in terms of the treatment changes that occurred, while the actual lip changes showed that males exhibited significantly greater changes than females. Actual treatment changes showed that the lower lip moved to a more protrusive position with nonextraction than with extraction treatments, changes that were not evident based on the five profile lines. While lip changes based on the five profile planes demonstrated moderately high to high intercorrelations ranging from 0.81 to 0.97, they showed only weak correlations (r < .35) with the actual horizontal changes of the labrale inferiorus. While all five planes measured similar aspects of positional change, none of them closely reflected the actual lower lip changes that occurred. These planes should not be used to measure changes in lip position that occur during treatment.
Skalicky, Jack J.; Arii, Jun; Wenzel, Dawn M.; Stubblefield, William-May B.; Katsuyama, Angela; Uter, Nathan T.; Bajorek, Monika; Myszka, David G.; Sundquist, Wesley I.
2012-01-01
The endosomal sorting complex required for transport (ESCRT) pathway remodels membranes during multivesicular body biogenesis, the abscission stage of cytokinesis, and enveloped virus budding. The ESCRT-III and VPS4 ATPase complexes catalyze the membrane fission events associated with these processes, and the LIP5 protein helps regulate their interactions by binding directly to a subset of ESCRT-III proteins and to VPS4. We have investigated the biochemical and structural basis for different LIP5-ligand interactions and show that the first microtubule-interacting and trafficking (MIT) module of the tandem LIP5 MIT domain binds CHMP1B (and other ESCRT-III proteins) through canonical type 1 MIT-interacting motif (MIM1) interactions. In contrast, the second LIP5 MIT module binds with unusually high affinity to a novel MIM element within the ESCRT-III protein CHMP5. A solution structure of the relevant LIP5-CHMP5 complex reveals that CHMP5 helices 5 and 6 and adjacent linkers form an amphipathic “leucine collar” that wraps almost completely around the second LIP5 MIT module but makes only limited contacts with the first MIT module. LIP5 binds MIM1-containing ESCRT-III proteins and CHMP5 and VPS4 ligands independently in vitro, but these interactions are coupled within cells because formation of stable VPS4 complexes with both LIP5 and CHMP5 requires LIP5 to bind both a MIM1-containing ESCRT-III protein and CHMP5. Our studies thus reveal how the tandem MIT domain of LIP5 binds different types of ESCRT-III proteins, promoting assembly of active VPS4 enzymes on the polymeric ESCRT-III substrate. PMID:23105106
The structure of Serratia marcescens Lip, a membrane-bound component of the type VI secretion system
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rao, Vincenzo A.; Shepherd, Sharon M.; English, Grant
2011-12-01
The high-resolution crystal structure of S. marcescens Lip reveals a new member of the transthyretin family of proteins. Lip, a core component of the type VI secretion apparatus, is localized to the outer membrane and is positioned to interact with other proteins forming this complex system. Lip is a membrane-bound lipoprotein and a core component of the type VI secretion system found in Gram-negative bacteria. The structure of a Lip construct (residues 29–176) from Serratia marcescens (SmLip) has been determined at 1.92 Å resolution. Experimental phases were derived using a single-wavelength anomalous dispersion approach on a sample cocrystallized with iodide.more » The membrane localization of the native protein was confirmed. The structure is that of the globular domain lacking only the lipoprotein signal peptide and the lipidated N-terminus of the mature protein. The protein fold is dominated by an eight-stranded β-sandwich and identifies SmLip as a new member of the transthyretin family of proteins. Transthyretin and the only other member of the family fold, 5-hydroxyisourate hydrolase, form homotetramers important for their function. The asymmetric unit of SmLip is a tetramer with 222 symmetry, but the assembly is distinct from that previously noted for the transthyretin protein family. However, structural comparisons and bacterial two-hybrid data suggest that the SmLip tetramer is not relevant to its role as a core component of the type VI secretion system, but rather reflects a propensity for SmLip to participate in protein–protein interactions. A relatively low level of sequence conservation amongst Lip homologues is noted and is restricted to parts of the structure that might be involved in interactions with physiological partners.« less
Ye, Cuilian; Yan, Weiwei; McDonough, Patrick L.; McDonough, Sean P.; Mohamed, Hussni; Divers, Thomas J.; Chang, Yung-Fu
2014-01-01
Leptospirosis, caused by Leptospira spp., is one of the most common zoonotic diseases in the world. We tested four recombinant proteins of Leptospira interrogans, namely, rLipL21, rLoa22, rLipL32, and rLigACon4-8, to evaluate their potential for use as antigens for the diagnosis of equine leptospirosis. We employed equine sera (n = 130) that were microscopic agglutination test (MAT) negative and sera (n = 176) that were MAT positive for the 5 serovars that most commonly cause equine leptospirosis. The sensitivity and specificity of ELISA compared to MAT were 82.39% and 86.15%, respectively, for LigACon4-8, 77.84% and 92.31%, respectively, for Loa22, 77.84% and 86.15%, respectively, for LipL32, and 84.66% and 83.85%, respectively, for LipL21. When one of the two antigens was test positive, the sensitivity and specificity of ELISA were 93.75% and 78.46%, respectively, for rLigACon4-8 and LipL32, 93.18% and 76.15%, respectively, for rLigACon4-8 and LipL21, 89.77% and 80.77%, respectively, for rLigACon4-8 and Loa22, 91.48% and 78.46%, respectively, for LipL21 and Loa22, 93.75% and 76.92%, respectively, for LipL21 and LipL32, and 90.34% and 80.77%, respectively, for Loa22 and LipL32. In conclusion, we have developed an indirect ELISA utilizing rLigACon4-8, rLoa22, rLipL32, and rLipL21 as diagnostic antigens for equine leptospirosis. The use of four antigens in the ELISA was found to be sensitive and specific, the assay was easy to perform, and the results concurred with the results of the standard Leptospira MAT. PMID:24451330
Wang, Fei; Yang, Yan; Wang, Zhe; Zhou, Jie; Fan, Baofang; Chen, Zhixiang
2015-01-01
Multivesicular bodies (MVBs) are unique endosomes containing vesicles in the lumen and play critical roles in many cellular processes. We have recently shown that Arabidopsis (Arabidopsis thaliana) Lyst-Interacting Protein5 (LIP5), a positive regulator of the Suppressor of K+ Transport Growth Defect1 (SKD1) AAA ATPase in MVB biogenesis, is a critical target of the mitogen-activated protein kinases MPK3 and MPK6 and plays an important role in the plant immune system. In this study, we report that the LIP5-regulated MVB pathway also plays a critical role in plant responses to abiotic stresses. Disruption of LIP5 causes compromised tolerance to both heat and salt stresses. The critical role of LIP5 in plant tolerance to abiotic stresses is dependent on its ability to interact with Suppressor of K+ Transport Growth Defect1. When compared with wild-type plants, lip5 mutants accumulate increased levels of ubiquitinated protein aggregates and NaCl under heat and salt stresses, respectively. Further analysis using fluorescent dye and MVB markers reveals that abiotic stress increases the formation of endocytic vesicles and MVBs in a largely LIP5-dependent manner. LIP5 is also required for the salt-induced increase of intracellular reactive oxygen species, which have been implicated in signaling of salt stress responses. Basal levels of LIP5 phosphorylation by MPKs and the stability of LIP5 are elevated by salt stress, and mutation of MPK phosphorylation sites in LIP5 reduces the stability and compromises the ability to complement the lip5 salt-sensitive mutant phenotype. These results collectively indicate that the MVB pathway is positively regulated by pathogen/stress-responsive MPK3/6 through LIP5 phosphorylation and plays a critical role in broad plant responses to biotic and abiotic stresses. PMID:26229051
Theoretical evaluation of engine auxiliary inlet design for supersonic V/STOL aircraft
NASA Technical Reports Server (NTRS)
Boles, Michael A.; Heavner, Richard L.
1988-01-01
A higher order panel method is used to evaluate the potential flow of a two dimensional supersonic V/STOL inlet. A non-symmetric analytical inlet model is developed to closely match a wind tunnel model. The analytical inlet is analyzed for flow characteristics around the lower cowl lip and auxiliary inlets. The results are obtained from the output of a computer program that is based on the Hess Panel Method which determines source strengths of panels distributed over a three dimensional body. The analytical model was designed for the implementation of drooped/translated cowl lip and auxiliary inlets as flow improvement concepts. A 40 or 70 degree droop lip can be incorporated on the inlet to determine if these geometry modifications result in flow improvements which may reduce the propensity for flow separation on the interior portion of the lip. Auxiliary inlets are employed to decrease the mass flow over the inlet lip. Thus, the peak flow velocity is reduced at the lip which also lessens the likelihood of flow separation on the interior portion of the lip. A 2, 4, and 6 inch translated lip can be employed to also decrease mass flow over the inlet lower lip in the same manner as the auxiliary inlet. The performance results of the flow improvement concepts show that three possible inlet configurations provide a situation where separation is less likely to occur. A 70 degree droop lip maintains flow conditions such that attached flow over the lower cowl lip may exist for the entire angle of attack range studied. A 0 degree droop and translated lip combination provides similar results for the angle of attack range. The third configuration consists of a 0 degree droop and auxiliary inlet combination. This configuration provides slightly less favorable results than the other two, but still allows for conditions favorable to attached flow within the inlet.
Wang, David M; Kraft, Stefan; Rohani, Pooyan; Murphy, George F; Besaw, Robert J; Karia, Pritesh S; Morgan, Frederick C; Schmults, Chrysalyne D
2018-06-01
Although the lip is considered a high-risk location in cutaneous squamous cell carcinoma (cSCC), it has not been established whether this risk stems from vermilion or cutaneous locations or both. To compare differences in risks of recurrence, metastasis, and death from cSCCs on the vermilion vs cutaneous lip. Retrospective cohort study of 303 patients with 310 primary cSCCs of the lip (138 cutaneous, 172 vermilion) diagnosed between 2000 and 2015 at 2 academic tertiary care centers in Boston, Massachusetts. Development of local recurrence, nodal metastasis, distant metastasis, disease-specific death, and all-cause death. Of the 303 study participants with 310 SCCs of the lip, 153 (50.5%) were men, and 150 (49.5%) were women; median age at diagnosis, 68 years (range, 27-93 years). Outcomes were as follows for vermilion vs cutaneous locations: local recurrence, 6.4% (11 of 172) vs 2.9% (4 of 138); nodal metastasis, 7.6% (13 of 172) vs 1.5% (2 of 138); distant metastasis, 0.6% (1 of 172) vs 0.7% (1 of 138); disease-specific death, 3.5% (6 of 172) vs 2.9% (4 of 138); and all-cause death, 26.7% (46 of 172) vs 29.0% (40 of 138). The difference was statistically significant for nodal metastasis (P = .01). In multivariable analysis, nodal metastasis was associated with vermilion lip location (subhazard ratio, 5.0; 95% CI, 1.1-23.8) and invasion beyond fat (fascia or beyond for vermilion lip) (subhazard ratio, 4.4; 95% CI, 1.3-14.9). The risk of nodal metastasis is 5-fold greater for cSCCs on the vermilion lip compared with those on the cutaneous lip. Squamous cell carcinomas of the cutaneous lip have a nodal metastasis risk similar to cSCCs in general (1.5%). Thus, vermilion involvement appears responsible for the increased risk associated with cSCC of lip. Vermilion involvement may merit radiologic nodal staging and inclusion in future tumor staging, since it was independently associated with higher-risk cSCC of the lip region.
Asgher, Muhammad; Iqbal, Hafiz Muhammad Nasir; Irshad, Muhammad
2012-08-03
Cost-effective production of industrially important enzymes is a key for their successful exploitation on industrial scale. Keeping in view the extensive industrial applications of lignin peroxidase (LiP), this study was performed to purify and characterize the LiP from an indigenous strain of Trametes versicolor IBL-04. Xerogel matrix enzyme immobilization technique was applied to improve the kinetic and thermo-stability characteristics of LiP to fulfil the requirements of the modern enzyme consumer sector of biotechnology. A novel LiP was isolated from an indigenous T. versicolor IBL-04 strain. T. versicolor IBL-04 was cultured in solid state fermentation (SSF) medium of corn cobs and maximum LiP activity of 592 ± 6 U/mL was recorded after five days of incubation under optimum culture conditions. The crude LiP was 3.3-fold purified with specific activity of 553 U/mg after passing through the DEAE-cellulose and Sephadex-G-100 chromatography columns. The purified LiP exhibited a relatively low molecular weight (30 kDa) homogenous single band on native and SDS-PAGE. The LiP was immobilized by entrapping in xerogel matrix of trimethoxysilane (TMOS) and proplytetramethoxysilane (PTMS) and maximum immobilization efficiency of 88.6% was achieved. The free and immobilized LiPs were characterized and the results showed that the free and immobilized LiPs had optimum pH 6 and 5 while optimum temperatures were 60°C and 80°C, respectively. Immobilization was found to enhance the activity and thermo-stability potential of LiP significantly and immobilized LiP remained stable over broad pH and temperature range as compare to free enzyme. Kinetic constants K(m) and V(max) were 70 and 56 μM and 588 and 417 U/mg for the free and immobilized LiPs, respectively. Activity of this novel extra thermo-stable LiP was stimulated to variable extents by Cu(2+), Mn(2+) and Fe(2+) whereas, Cystein, EDTA and Ag(+) showed inhibitory effects. The indigenously isolated white rot fungal strain T. versicolor IBL-04 showed tremendous potential for LiP synthesis in SSF of corncobs in high titters (592 U/mL) than other reported Trametes (Coriolus, Polyporus) species. The results obtained after dual phase characterization suggested xerogel matrix entrapment a promising tool for enzyme immobilization, hyper-activation and stabilization against high temperature and inactivating agents. The pH and temperature optima, extra thermo-stability features and kinetic characteristics of this novel LiP of T. versicolor IBL-04 make it a versatile enzyme for various industrial and biotechnological applications.
2012-01-01
Background Cost-effective production of industrially important enzymes is a key for their successful exploitation on industrial scale. Keeping in view the extensive industrial applications of lignin peroxidase (LiP), this study was performed to purify and characterize the LiP from an indigenous strain of Trametes versicolor IBL-04. Xerogel matrix enzyme immobilization technique was applied to improve the kinetic and thermo-stability characteristics of LiP to fulfil the requirements of the modern enzyme consumer sector of biotechnology. Results A novel LiP was isolated from an indigenous T. versicolor IBL-04 strain. T. versicolor IBL-04 was cultured in solid state fermentation (SSF) medium of corn cobs and maximum LiP activity of 592 ± 6 U/mL was recorded after five days of incubation under optimum culture conditions. The crude LiP was 3.3-fold purified with specific activity of 553 U/mg after passing through the DEAE-cellulose and Sephadex-G-100 chromatography columns. The purified LiP exhibited a relatively low molecular weight (30 kDa) homogenous single band on native and SDS-PAGE. The LiP was immobilized by entrapping in xerogel matrix of trimethoxysilane (TMOS) and proplytetramethoxysilane (PTMS) and maximum immobilization efficiency of 88.6% was achieved. The free and immobilized LiPs were characterized and the results showed that the free and immobilized LiPs had optimum pH 6 and 5 while optimum temperatures were 60°C and 80°C, respectively. Immobilization was found to enhance the activity and thermo-stability potential of LiP significantly and immobilized LiP remained stable over broad pH and temperature range as compare to free enzyme. Kinetic constants Km and Vmax were 70 and 56 μM and 588 and 417 U/mg for the free and immobilized LiPs, respectively. Activity of this novel extra thermo-stable LiP was stimulated to variable extents by Cu2+, Mn2+ and Fe2+ whereas, Cystein, EDTA and Ag+ showed inhibitory effects. Conclusions The indigenously isolated white rot fungal strain T. versicolor IBL-04 showed tremendous potential for LiP synthesis in SSF of corncobs in high titters (592 U/mL) than other reported Trametes (Coriolus, Polyporus) species. The results obtained after dual phase characterization suggested xerogel matrix entrapment a promising tool for enzyme immobilization, hyper-activation and stabilization against high temperature and inactivating agents. The pH and temperature optima, extra thermo-stability features and kinetic characteristics of this novel LiP of T. versicolor IBL-04 make it a versatile enzyme for various industrial and biotechnological applications. PMID:22862820
Lip Movements for an Unfamiliar Vowel: Mandarin Front Rounded Vowel Produced by Japanese Speakers
ERIC Educational Resources Information Center
Saito, Haruka
2016-01-01
Purpose: The study was aimed at investigating what kind of lip positions are selected by Japanese adult participants for an unfamiliar Mandarin rounded vowel /y/ and if their lip positions are related to and/or differentiated from those for their native vowels. Method: Videotaping and post hoc tracking measurements for lip positions, namely…
2013-01-01
Children with severe hearing loss most likely receive the greatest benefit from a cochlear implant (CI) when implanted at less than 2 years of age. Children with a hearing loss may also benefit greater from binaural sensory stimulation. Four children who received their first CI under 12 months of age were included in this study. Effects on auditory development were determined using the German LittlEARS Auditory Questionnaire, closed- and open-set monosyllabic word tests, aided free-field, the Mainzer and Göttinger speech discrimination tests, Monosyllabic-Trochee-Polysyllabic (MTP), and Listening Progress Profile (LiP). Speech production and grammar development were evaluated using a German language speech development test (SETK), reception of grammar test (TROG-D) and active vocabulary test (AWST-R). The data showed that children implanted under 12 months of age reached open-set monosyllabic word discrimination at an age of 24 months. LiP results improved over time, and children recognized 100% of words in the MTP test after 12 months. All children performed as well as or better than their hearing peers in speech production and grammar development. SETK showed that the speech development of these children was in general age appropriate. The data suggests that early hearing loss intervention benefits speech and language development and supports the trend towards early cochlear implantation. Furthermore, the data emphasizes the potential benefits associated with bilateral implantation. PMID:23509653
May-Mederake, Birgit; Shehata-Dieler, Wafaa
2013-01-01
Children with severe hearing loss most likely receive the greatest benefit from a cochlear implant (CI) when implanted at less than 2 years of age. Children with a hearing loss may also benefit greater from binaural sensory stimulation. Four children who received their first CI under 12 months of age were included in this study. Effects on auditory development were determined using the German LittlEARS Auditory Questionnaire, closed- and open-set monosyllabic word tests, aided free-field, the Mainzer and Göttinger speech discrimination tests, Monosyllabic-Trochee-Polysyllabic (MTP), and Listening Progress Profile (LiP). Speech production and grammar development were evaluated using a German language speech development test (SETK), reception of grammar test (TROG-D) and active vocabulary test (AWST-R). The data showed that children implanted under 12 months of age reached open-set monosyllabic word discrimination at an age of 24 months. LiP results improved over time, and children recognized 100% of words in the MTP test after 12 months. All children performed as well as or better than their hearing peers in speech production and grammar development. SETK showed that the speech development of these children was in general age appropriate. The data suggests that early hearing loss intervention benefits speech and language development and supports the trend towards early cochlear implantation. Furthermore, the data emphasizes the potential benefits associated with bilateral implantation.
Vild, Cody J.; Li, Yan; Guo, Emily Z.; ...
2015-01-30
Disassembly of the endosomal sorting complex required for transport (ESCRT) machinery from biological membranes is a critical final step in cellular processes that require the ESCRT function. This reaction is catalyzed by VPS4, an AAA-ATPase whose activity is tightly regulated by a host of proteins, including LIP5 and the ESCRT-III proteins. In this paper, we present structural and functional analyses of molecular interactions between human VPS4, LIP5, and the ESCRT-III proteins. The N-terminal domain of LIP5 (LIP5NTD) is required for LIP5-mediated stimulation of VPS4, and the ESCRT-III protein CHMP5 strongly inhibits the stimulation. Both of these observations are distinct frommore » what was previously described for homologous yeast proteins. The crystal structure of LIP5NTD in complex with the MIT (microtubule-interacting and transport)-interacting motifs of CHMP5 and a second ESCRT-III protein, CHMP1B, was determined at 1 Å resolution. It reveals an ESCRT-III binding induced moderate conformational change in LIP5NTD, which results from insertion of a conserved CHMP5 tyrosine residue (Tyr 182) at the core of LIP5NTD structure. Finally, mutation of Tyr 182 partially relieves the inhibition displayed by CHMP5. Together, these results suggest a novel mechanism of VPS4 regulation in metazoans, where CHMP5 functions as a negative allosteric switch to control LIP5-mediated stimulation of VPS4.« less
Comparison of upper and lower lip muscle activity between stutterers and fluent speakers.
de Felício, Cláudia Maria; Freitas, Rosana Luiza Rodrigues Gomes; Vitti, Mathias; Regalo, Simone Cecilio Hallak
2007-08-01
There is a widespread clinical view that stuttering is associated with high levels of muscles activity. The proposal of this research was to compare stutterers and fluent speakers with respect to the electromyographic activity of the upper and lower lip muscles. Ten individuals who stutter and 10 fluent speakers (control group) paired by gender and age were studied (mean age: 13.4 years). Groups were defined by the speech sample analysis of the ABFW-Language Test. A K6-I EMG (Myo-tronics Co., Seattle, WA, USA) with double disposable silver electrodes (Duotrodes, Myo-tronics Co., Seattle, WA) being used in order to analyze lip muscle activity. The clinical conditions investigated were movements during speech, orofacial non-speech tasks, and rest. Electromyographic data were normalized by lip pursing activity. The non-parametric Mann-Whitney test was used for the comparison of speech fluency profile, and the Student t-test for independent samples for group comparison regarding electromyographic data. There was a statistically significant difference between groups regarding speech fluency profile and upper lip activity in the following conditions: lip lateralization to the right and to the left and rest before exercises (P<0.05). There was no significant difference between groups regarding lower lip activity (P>0.05). The EMG activity of the upper lip muscle in the group with stuttering was significantly lower than in the control group in some of the clinical conditions analyzed. There was no significant difference between groups regarding the lower lip muscle. The subjects who stutter did not present higher levels of muscle activity in lip muscles than fluent speakers.
Michel, F C; Dass, S B; Grulke, E A; Reddy, C A
1991-08-01
The role of lignin peroxidases (LIPs) and manganese peroxidases (MNPs) of Phanerochaete chrysosporium in decolorizing kraft bleach plant effluent (BPE) was investigated. Negligible BPE decolorization was exhibited by a per mutant, which lacks the ability to produce both the LIPs and the MNPs. Also, little decolorization was seen when the wild type was grown in high-nitrogen medium, in which the production of LIPs and MNPs is blocked. A lip mutant of P. chrysosporium, which produces MNPs but not LIPs, showed about 80% of the activity exhibited by the wild type, indicating that the MNPs play an important role in BPE decolorization. When P. chrysosporium was grown in a medium with 100 ppm of Mn(II), high levels of MNPs but no LIPs were produced, and this culture also exhibited high rates of BPE decolorization, lending further support to the idea that MNPs play a key role in BPE decolorization. When P. chrysosporium was grown in a medium with no Mn(II), high levels of LIPs but negligible levels of MNPs were produced and the rate and extent of BPE decolorization by such cultures were quite low, indicating that LIPs play a relatively minor role in BPE decolorization. Furthermore, high rates of BPE decolorization were seen on days 3 and 4 of incubation, when the cultures exhibit high levels of MNP activity but little or no LIP activity. These results indicate that MNPs play a relatively more important role than LIPs in BPE decolorization by P. chrysosporium.
Deall, Ciara E; Kornmann, Nirvana S S; Bella, Husam; Wallis, Katy L; Hardwicke, Joseph T; Su, Ting-Li; Richard, Bruce M
2016-10-01
High-quality aesthetic outcomes are of paramount importance to children growing up after cleft lip and palate surgery. Establishing a validated and reliable assessment tool for cleft professionals and families will facilitate cleft units, surgeons, techniques, and protocols to be audited and compared with greater confidence. This study used exemplar images across a five-point aesthetic scale, identified in a pilot project, to score lips and noses as separate units and compared these human scores with computer-based SymNose symmetry scores. Forty-five assessors (17 cleft surgeons nationally and 28 other cleft professionals from the UK South West Tri-centre units), scored 25 standardized photographs, uploaded randomly onto a Web-based platform, twice. Each photograph was shown in three forms: lip and nose together, and separately cropped images of nose only and lip only. The same images were analyzed using the SymNose software program. Scoring lips gave the best intrarater and interrater reliabilities. Nose scores were more variable. Lip scoring associated most closely with the whole-image score. SymNose ranking of the lip images related highly to the same ranking by humans (p = 0.001). The exemplar images maintained their established previous ranking. Images illustrating the aesthetic outcome grades are confirmed. The lip score is reliable and seems to dominate in the whole-image score. Noses are much harder to score reliably. It appears that SymNose can score lip images very effectively by symmetry. Further use of SymNose will be investigated, and families of children with cleft will trial the scoring system. Therapeutic, III.
Kam, Yew Chee; Woo, Kwan Kit; Ong, Lisa Gaik Ai
2017-12-08
Lipases with unique characteristics are of value in industrial applications, especially those targeting cost-effectiveness and less downstream processes. The aims of this research were to: (i) optimize the fermentation parameters via solid state fermentation (SSF); and (ii) study the performance in hydrolysis and esterification processes of the one-step partially purified Schizophyllum commune UTARA1 lipases. Lipase was produced by cultivating S. commune UTARA1 on sugarcane bagasse (SB) with used cooking oil (UCO) via SSF and its production was optimized using Design-Expert ® 7.0.0. Fractions 30% ( Sc LipA) and 70% ( Sc LipB) which contained high lipase activity were obtained by stepwise (NH₄)₂SO₄ precipitation. Crude fish oil, coconut oil and butter were used to investigate the lipase hydrolysis capabilities by a free glycerol assay. Results showed that Sc LipA has affinities for long, medium and short chain triglycerides, as all the oils investigated were degraded, whereas Sc LipB has affinities for long chain triglycerides as it only degrades crude fish oil. During esterification, Sc LipA was able to synthesize trilaurin and triacetin. Conversely, Sc LipB was specific towards the formation of 2-mono-olein and triacetin. From the results obtained, it was determined that Sc LipA and Sc LipB are sn -2 regioselective lipases. Hence, the one-step partial purification strategy proved to be feasible for partial purification of S. commune UTARA1 lipases that has potential use in industrial applications.
Kuo, Yung-Chih; Lin, Che-Yu; Li, Jay-Shake; Lou, Yung-I
2017-01-01
Curcumin (CRM) and nerve growth factor (NGF) were entrapped in liposomes (LIP) with surface wheat germ agglutinin (WGA) to downregulate the phosphorylation of kinases in Alzheimer’s disease (AD) therapy. Cardiolipin (CL)-conjugated LIP carrying CRM (CRM-CL/LIP) and also carrying NGF (NGF-CL/LIP) were used with AD models of SK-N-MC cells and Wistar rats after an insult with β-amyloid peptide (Aβ). We found that CRM-CL/LIP inhibited the expression of phosphorylated p38 (p-p38), phosphorylated c-Jun N-terminal kinase (p-JNK), and p-tau protein at serine 202 and prevented neurodegeneration of SK-N-MC cells. In addition, NGF-CL/LIP could enhance the quantities of p-neurotrophic tyrosine kinase receptor type 1 and p-extracellular signal-regulated kinase 5 for neuronal rescue. Moreover, WGA-grafted CRM-CL/LIP and WGA-grafted NGF-CL/LIP significantly improved the permeation of CRM and NGF across the blood–brain barrier, reduced Aβ plaque deposition and the malondialdehyde level, and increased the percentage of normal neurons and cholinergic activity in the hippocampus of AD rats. Based on the marker expressions and in vivo evidence, current LIP carriers can be promising drug delivery systems to protect nervous tissue against Aβ-induced apoptosis in the brain during the clinical management of AD. PMID:28280340
Bauman, Zachary M.; Gassner, Marika Y.; Coughlin, Megan A.; Mahan, Meredith; Watras, Jill
2015-01-01
Background. Lung injury prediction score (LIPS) is valuable for early recognition of ventilated patients at high risk for developing acute respiratory distress syndrome (ARDS). This study analyzes the value of LIPS in predicting ARDS and mortality among ventilated surgical patients. Methods. IRB approved, prospective observational study including all ventilated patients admitted to the surgical intensive care unit at a single tertiary center over 6 months. ARDS was defined using the Berlin criteria. LIPS were calculated for all patients and analyzed. Logistic regression models evaluated the ability of LIPS to predict development of ARDS and mortality. A receiver operator characteristic (ROC) curve demonstrated the optimal LIPS value to statistically predict development of ARDS. Results. 268 ventilated patients were observed; 141 developed ARDS and 127 did not. The average LIPS for patients who developed ARDS was 8.8 ± 2.8 versus 5.4 ± 2.8 for those who did not (p < 0.001). An ROC area under the curve of 0.79 demonstrates LIPS is statistically powerful for predicting ARDS development. Furthermore, for every 1-unit increase in LIPS, the odds of developing ARDS increase by 1.50 (p < 0.001) and odds of ICU mortality increase by 1.22 (p < 0.001). Conclusion. LIPS is reliable for predicting development of ARDS and predicting mortality in critically ill surgical patients. PMID:26301105
PVR/CD155 Ala67Thr Mutation and Cleft Lip/Palate.
Vieira, Alexandre R; Letra, Ariadne; Silva, Renato M; Granjeiro, Jose M; Shimizu, Takehiko; Poletta, Fernando A; Mereb, Juan C; Castilla, Eduardo E; Orioli, Iêda M
2018-03-01
The 19q13 locus has been linked to cleft lip and palate by our group and independently by others. Here we fine mapped the region in an attempt to identify an etiological variant that can explain cleft lip and palate occurrence. A total of 2739 individuals born with cleft lip and palate, related to individuals born with cleft lip and palate, and unrelated were studied. We used linkage and association approaches to fine map the interval between D19S714 and D19S433 and genotypes were defined by the use of TaqMan chemistry. We confirmed our previous findings that markers in PVR/CD155 are associated with cleft lip and palate. We studied the mutation Ala67Thr further and calculated its penetrance. We also attempted to detect PVR/CD155 expression in human whole saliva. Our results showed that markers in PVR/CD155 are associated with cleft lip and palate and the penetrance of the Ala67Thr is very low (between 1% and 5%). We could not detect PVR/CD155 expression in adult human whole saliva and PVR/CD155 possibly interacts with maternal infection to predispose children to cleft lip only.
Incidence angle bounds for lip flow separation of three 13.97-centimeter-diameter inlets
NASA Technical Reports Server (NTRS)
Luidens, R. W.; Abbott, J. M.
1976-01-01
Low speed wind tunnel tests were conducted to establish a procedure for determining inlet-lip flow separation and to make preliminary examination of the incidence angle bounds for lip flow separation on inlets intended for the nacelles of STOL (short takeoff and landing) aircraft. Three inlets were tested. Two of the inlets had short centerbodies with lower lip area contraction ratios of 1.30 and 1.44. The third inlet had a cylindrical centerbody extended forward into the inlet throat with a lower lip area contraction ratio of 1.44. The inlets were sized to fit a 13.97 centimeter-diameter fan. For inlet throat Mach numbers less than about 0.43, the lip flow separation angle was increased by either increasing the ratio of throat velocity to freestream velocity (Vt/Vo) or by increasing the lower lip area contraction ratio. For throat Mach numbers greater than a certain value (ranging from 0.43 to 0.52), increasing throat Mach number in some cases resulted in a decrease in the lip flow separation angle. Extending a cylindrical centerbody into the inlet throat increased the flow separation angle for nearly all values of Vt/Vo.
Fatigue testing of metric bolts fitted with lip-type nuts
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dragoni, E.
This paper addresses the effect of the external shape of lip-type nuts on the fatigue strength of commercial M10 bolts loaded in tension. Evolving from the standard configuration, six nut geometries are compared, characterized by lips of different shape (cylindrical, tapered or both) and length. Testing and statistical treatment of the data are performed in accordance with a JSME standard involving 14 specimens for each geometry. Within the class of merely cylindrical lips, only limited advantages over the standard assembly are detected. In particular, the bolt strength remains mostly unaffected by lengthening of the lip beyond one third of themore » nut height. Conversely, tapering of the lip end so as to thin its wall around the entry section of the bolt results in substantial improvements. In this case, the strength increase is roughly proportional to the taper length. Adoption of a tapered lip covering two thirds of the nut height enhances the bolt strength by about one fourth with respect to the standard geometry.« less
Yang, Zhaoyong; Unrine, Jason; Nonaka, Koichi; Van Lanen, Steven G
2012-01-01
Several nucleoside antibiotics from various actinomycetes contain a high-carbon sugar nucleoside that is putatively derived via C-5'-modification of the canonical nucleoside. Two prominent examples are the 5'-C-carbamoyluridine- and 5'-C-glycyluridine-containing nucleosides, both families of which were discovered using screens aimed at finding inhibitors of bacterial translocase I involved in the assembly of the bacterial peptidoglycan cell wall. A shared open reading frame was identified whose gene product is similar to enzymes of the nonheme, Fe(II)-, and α-ketoglutarate-dependent dioxygenases. The enzyme LipL from the biosynthetic pathway for A-90289, a 5'-C-glycyluridine-containing nucleoside, was functionally characterized as an UMP:α-ketoglutarate dioxygenase, providing the enzymatic imperative for the generation of a nucleoside-5'-aldehdye that serves as a downstream substrate for an aldol or aldol-type reaction leading to the high-carbon sugar scaffold. The functional assignment of LipL and the homologous enzymes-including bioinformatic analysis, iron detection and quantification, and assay development for biochemical characterization-is presented herein. Copyright © 2012 Elsevier Inc. All rights reserved.
Faqeih, Eissa; Al-Akash, Samhar I; Sakati, Nadia; Teebi, Prof Ahmad S
2007-09-01
We report on four siblings (three males, one female) born to first cousin Arab parents with the constellation of distal renal tubular acidosis (RTA), small kidneys, nephrocalcinosis, neurobehavioral impairment, short stature, and distinctive facial features. They presented with early developmental delay with subsequent severe mental, behavioral and social impairment and autistic-like features. Their facial features are unique with prominent cheeks, well-defined philtrum, large bulbous nose, V-shaped upper lip border, full lower lip, open mouth with protruded tongue, and pits on the ear lobule. All had proteinuria, hypercalciuria, hypercalcemia, and normal anion-gap metabolic acidosis. Renal ultrasound examinations revealed small kidneys, with varying degrees of hyperechogenicity and nephrocalcinosis. Additional findings included dilated ventricles and cerebral demyelination on brain imaging studies. Other than distal RTA, common causes of nephrocalcinosis were excluded. The constellation of features in this family currently likely represents a possibly new autosomal recessive syndrome providing further evidence of heterogeneity of nephrocalcinosis syndromes. Copyright 2007 Wiley-Liss, Inc.
Management of an infant with cleft lip and palate with phocomelia in dental practice.
Muthu, M S
2000-12-01
Cleft lip and palate is a severe birth defect occurring approximately one in 800-1000 newborn infants. The incidence varies widely among races. Cleft lip and palate together account for approximately 50% of all cases whereas isolated cleft lip and isolated cleft palate occur in about 25% of cases. Many of these congenital anomalies appear to be genetically determined though the majority are of unknown causes or teratogenic influences. Presented here is a 3 day old infant with bilateral cleft lip and palate and phocomelia for whom a feeding obturator was made and delivered to facilitate feeding.
... poisoning URL of this page: //medlineplus.gov/ency/article/002723.htm Lip moisturizer poisoning To use the sharing features on this page, please enable JavaScript. This poisoning results from eating or swallowing lip ...
Unilateral cleft lip and palate: Simultaneous early repair of the nose, anterior palate and lip
Laberge, Louise Caouette
2007-01-01
Unilateral cleft lip and palate is a defect involving the lip, nose and maxilla. These structures are inter-related, and simultaneous early correction of all the aspects of the defect is necessary to obtain a satisfactory result that will be maintained with growth. The surgical technique combining various procedures is presented and compared with previously published reports. PMID:19554125
2014-11-17
Recurrent Skin Cancer; Recurrent Squamous Cell Carcinoma of the Lip and Oral Cavity; Squamous Cell Carcinoma of the Skin; Stage III Squamous Cell Carcinoma of the Lip and Oral Cavity; Stage IVA Squamous Cell Carcinoma of the Lip and Oral Cavity; Stage IVB Squamous Cell Carcinoma of the Lip and Oral Cavity
Spillage and flux density on a receiver aperture lip. [of solar thermal collector
NASA Technical Reports Server (NTRS)
Jaffe, L. D.
1985-01-01
In a dish-type point-focusing solar thermal collector, the spillage and the flux density on the receiver aperture lip are related in a very simple way, if the aperture is circular and centered on the optical axis. Specifically, the flux density on the lip is equal to the spillage times the peak flux density in the plane of the lip.
Gatti, Gian Luca; Freda, Nicola; Giacomina, Alessandro; Montemagni, Marina; Sisti, Andrea
2017-11-01
Cleft lip and palate is the most frequent congenital craniofacial deformity. In this article, the authors describe their experience with cleft lip and palate repair. Data regarding patients presenting with primary diagnosis of cleft lip and/or palate, between 2009 and 2015, were reviewed. Details including demographics, type of cleft, presence of known risk factors, surgical details, and follow-up visits were collected. Documented complications were reported. Caregivers' satisfaction was assessed with a survey. The survey used to assess satisfaction with cleft-related features was based on the cleft evaluation profile (CEP). In addition, 4 assessors used visual analog scale (VAS) to assess the aesthetic satisfaction. Seven hundred fifty-two patients with primary diagnosis of cleft lip and/or palate underwent surgical correction at "S. Chiara" Hospital, 432 (57.45%) male and 320 (42.55%) female. The most common cleft types in our study were incomplete cleft palate (152 patients) and left unilateral complete cleft lip and palate (152 patients). Associated syndromes were found in 46 patients (6.12%). Cleft lip was repaired using a modified Tennison-Randall technique when the defect was unilateral, whereas a modified Mulliken technique was used for bilateral cleft lip. Cleft palate was repaired using the Bardach technique or Von Langenbeck technique at 5 to 6 months of age. Cleft lip and palate was repaired in several surgical steps. In total, complications were reported in 81 of 752 patients (14.16%). Average fathers' satisfaction score assessed using CEP was 4.5 (lip), 4.8 (nose), 4.7 (teeth), 4.8 (bite), 4.2 (breathing), 4.6 (profile). Average mothers' satisfaction score assessed using CEP was 4.3 (lip), 4.6 (nose), 4.4 (teeth), 4.5 (bite), 4.1 (breathing), 4.4 (profile). Average level of aesthetic satisfaction, assessed using VAS, was 8.7 (fathers), 8.1 (mothers), 7.9 (lay person), and 8.0 (senior cleft surgeon). The multidisciplinary management of children with oral cleft determinated good results, in terms of satisfaction and aesthetic appearance. From our experience, periosteoplasty and lip-adhesion are key surgical techniques.
Discrimination of speech and non-speech sounds following theta-burst stimulation of the motor cortex
Rogers, Jack C.; Möttönen, Riikka; Boyles, Rowan; Watkins, Kate E.
2014-01-01
Perceiving speech engages parts of the motor system involved in speech production. The role of the motor cortex in speech perception has been demonstrated using low-frequency repetitive transcranial magnetic stimulation (rTMS) to suppress motor excitability in the lip representation and disrupt discrimination of lip-articulated speech sounds (Möttönen and Watkins, 2009). Another form of rTMS, continuous theta-burst stimulation (cTBS), can produce longer-lasting disruptive effects following a brief train of stimulation. We investigated the effects of cTBS on motor excitability and discrimination of speech and non-speech sounds. cTBS was applied for 40 s over either the hand or the lip representation of motor cortex. Motor-evoked potentials recorded from the lip and hand muscles in response to single pulses of TMS revealed no measurable change in motor excitability due to cTBS. This failure to replicate previous findings may reflect the unreliability of measurements of motor excitability related to inter-individual variability. We also measured the effects of cTBS on a listener’s ability to discriminate: (1) lip-articulated speech sounds from sounds not articulated by the lips (“ba” vs. “da”); (2) two speech sounds not articulated by the lips (“ga” vs. “da”); and (3) non-speech sounds produced by the hands (“claps” vs. “clicks”). Discrimination of lip-articulated speech sounds was impaired between 20 and 35 min after cTBS over the lip motor representation. Specifically, discrimination of across-category ba–da sounds presented with an 800-ms inter-stimulus interval was reduced to chance level performance. This effect was absent for speech sounds that do not require the lips for articulation and non-speech sounds. Stimulation over the hand motor representation did not affect discrimination of speech or non-speech sounds. These findings show that stimulation of the lip motor representation disrupts discrimination of speech sounds in an articulatory feature-specific way. PMID:25076928
Rogers, Jack C; Möttönen, Riikka; Boyles, Rowan; Watkins, Kate E
2014-01-01
Perceiving speech engages parts of the motor system involved in speech production. The role of the motor cortex in speech perception has been demonstrated using low-frequency repetitive transcranial magnetic stimulation (rTMS) to suppress motor excitability in the lip representation and disrupt discrimination of lip-articulated speech sounds (Möttönen and Watkins, 2009). Another form of rTMS, continuous theta-burst stimulation (cTBS), can produce longer-lasting disruptive effects following a brief train of stimulation. We investigated the effects of cTBS on motor excitability and discrimination of speech and non-speech sounds. cTBS was applied for 40 s over either the hand or the lip representation of motor cortex. Motor-evoked potentials recorded from the lip and hand muscles in response to single pulses of TMS revealed no measurable change in motor excitability due to cTBS. This failure to replicate previous findings may reflect the unreliability of measurements of motor excitability related to inter-individual variability. We also measured the effects of cTBS on a listener's ability to discriminate: (1) lip-articulated speech sounds from sounds not articulated by the lips ("ba" vs. "da"); (2) two speech sounds not articulated by the lips ("ga" vs. "da"); and (3) non-speech sounds produced by the hands ("claps" vs. "clicks"). Discrimination of lip-articulated speech sounds was impaired between 20 and 35 min after cTBS over the lip motor representation. Specifically, discrimination of across-category ba-da sounds presented with an 800-ms inter-stimulus interval was reduced to chance level performance. This effect was absent for speech sounds that do not require the lips for articulation and non-speech sounds. Stimulation over the hand motor representation did not affect discrimination of speech or non-speech sounds. These findings show that stimulation of the lip motor representation disrupts discrimination of speech sounds in an articulatory feature-specific way.
Cadaveric Assessment of Lip Injections: Locating the Serious Threats.
Tansatit, Tanvaa; Apinuntrum, Prawit; Phetudom, Thavorn
2017-04-01
Lip augmentation could be a possible cause of blindness following filler injections. This study evaluated the risk by simulating clinical scenarios of marginal injections to the upper and lower lips and then evaluated the risk of vascular injuries. A 22G cannula was inserted bilaterally along the wet-dry junction of the upper and lower lip margins in fifteen cadavers, and then both lips were dissected to verify possible injuries to the superior and inferior labial arteries. The position of the labial arteries in the vermilion zone was documented to determine the appropriate injection technique. In the marginal injections to the lips, arterial injuries occurred at the medial segment of the vermilion zone of both the upper and lower lips, at the terminal part of the labial arteries or a distal branch. Considering arterial anatomy, the upper lip has a higher chance of arterial injury than the lower lip. The cannula should not be inserted in the submucosa as it is recommended to evert the vermilion because both the superior and inferior labial arteries are located in the submucosa of the medial and middle segments of the vermilion in all specimens. Awareness of the possibility of vascular injury is necessary during injections of the medial segments of the vermilion of the lips. Vermilion border and marginal injections are recommended for safe and effective lip augmentation. Deep injection around the oral commissure and submucosal injection of the medial and middle segments of the vermilion zone are prohibited because of the high risk of arterial injury. This journal requires that authors assign a level of evidence to each submission to which Evidence-Based Medicine rankings are applicable. This excludes Review Articles, Book Reviews, and manuscripts that concern Basic Science, Animal Studies, Cadaver Studies, and Experimental Studies. For a full description of these Evidence-Based Medicine ratings, please refer to the Table of Contents or the online Instructions to Authors www.springer.com/00266.
NASA Astrophysics Data System (ADS)
Burke, K.
2001-12-01
Restoration, by plate rotation, of the 25 LIPs (Table 1 of Coffin and Eldholm in AGU Monog.121) that have erupted at the Earth's surface since 200 Ma to their original eruption sites shows that at their times of eruption 24 of the LIPs lay above one or other of the "Sub-African" and "Sub-Pacific" DMLVVs (Garnero:AREPS 2000 Fig.5). The Columbia River LIP is the exception. This concentration of LIPs over DMLVVs is indicative of a possible role for DMLVVs in LIP formation. Persistence of an association of LIPs with DMLVVs for 200 My indicates that DMLVVs are long-lived mantle features consistent with the suggestion that no refrigerating subducted slabs have penetrated the two DMLVVs during the past 200 My. The two LIP provinces provide complementary information about how DMLVVs may interact with the Earth's surface. That in the Pacific, where plate motion has been fast, is better for revealing short-term changes. By contrast plate motion has generally been slow over the "Sub-African" DMLVV and there the longer-term record of interaction with the surface is better. That record, which extends back as far as 200 Ma, includes evidence of (1) A DMLVV role in the break-up of the Super-continent of Pangea, with LIP formation, intra-continental rifting and the establishment of new plate boundaries.(2) The construction of plate-wide Basin and Swell topography on the African plate during the past 30 My.(3) The eruption of 9 LIPs into pre-existing intra-continental rifts, which I suggest has been a consequence of "upside-down drainage"along the base of the lithosphere (Cf. Sleep 1997) and (4) The eruption of as many as 7 LIPs within a 10 M sq.km. region around Kerguelen
Zeng, Chang-chun; Yang, Li; Xu, Ying; Liu, Pei-pei; Guo, Shi-jun; Liu, Song-hao
2011-09-01
Using the data from normal tongue and lip colors of normal people which were collected by the visible reflection spectrum, we analyzed the colorimetric parameters of tongue and lip colors. In this study, 516 healthy students aging from 19 to 26 from the colleges and universities of Guangdong Province of China were taken as research subjects. After collecting the data of tongue and lip colors of the 516 subjects using visible reflectance spectroscopy, CIE XYZ tristimulus values as defined by the International Commission on Illumination in 1964 were calculated, and the colorimetric parameters of the normal tongue and lip colors were obtained, such as the CIE 1964 chromaticity coordinate, brightness, dominant wavelength and excitation purity. The results of CIE 1964 chromaticity diagram calculated on the visible reflection spectrum showed that the normal tongue color chromaticity coordinate x(10) was 0.341 3±0.008 5 and y(10) was 0.332 6±0.005 1, and the normal lip color chromaticity coordinate x(10) was 0.357 7±0.009 2 and y(10) was 0.338 3±0.005 7; the brightness Y values of the normal tongue color and lip colors were 17.96±3.78 and 19.78±3.72, the dominant wavelength values of the normal tongue color and lip color were (626.3±51.6) nm and (600.4±18.2) nm, and the excitation purity values of the normal tongue color and lip color were 0.083±0.031 and 0.144±0.036, respectively. Application of the visible reflection spectrum is a standard way to collect colorimetric data for inspection of the complexion. The investigation of chromaticity coordinates, brightness, dominant wavelength and excitation purity of the normal tongue and lip colors may offer the basic reference for diagnosing morbid complexion on the tongue and lip colors in traditional Chinese medicine.
Abualfaraj, Raed; Daly, Blanaid; McDonald, Fraser; Scambler, Sasha
2018-07-01
Cleft lip and palate is a common congenital anomaly affecting males and females. While there is psychological research on cleft lip and palate, there is relatively little research exploring the social context of cleft lip and palate and the experiences of living with the condition on a daily basis. Drawing on common themes emerging from sociological work which have explored the experiences of people living with long-term conditions (uncertainty, social relations, self-esteem and self-image and biomedical concerns), we argue that these themes can be used to help elucidate the experiences of people living with cleft lip and palate. Within this framework, the findings of a qualitative study exploring the experiences of people living with cleft lip and palate are presented. The results suggest that all four themes can be found within the accounts of people living with cleft lip and palate, and there are many commonalities between the experiences of these people and those living with other long-term conditions. Conversely there are interesting areas of divergence. Unlike most long-term conditions, cleft lip and palate is not degenerative and treatment means symptoms will reduce over time. This is reflected in narratives around 'normality' as the endpoint of the care pathway. In addition, prenatal diagnosis means that the vast majority of participants within this study were born into, and grew up within, the care pathway. This has implications for the way in which cleft lip and palate is understood and the provision of information, relationships with members of the care team over time and the temporal and contextualised impact of cleft lip and palate on social relations and the self.
Suzuki, Akira; Nakano, Masayuki; Yoshizaki, Keigo; Yasunaga, Atsushi; Haruyama, Naoto; Takahashi, Ichiro
2017-05-01
The aim is to survey primary and permanent dental anomalies: hypodontia, microdontia, a supernumerary tooth, and fused teeth in patients with cleft lip and/or palate. Retrospective longitudinal study Subjects : The subjects were selected from all 1724 patients with cleft lip and/or palate who were registered at the orthodontic clinic of Kyushu University Hospital, Fukuoka, Japan, from 1970 to 2009. Finally, 994 subjects were evaluated for primary dentition, 1352 for permanent dentition, and 871 for the longitudinal changes from primary to permanent dentition. The prevalence of dental anomalies was compared for each tooth type, among various cleft types, between males and females, and between the alveolar cleft area and the noncleft area. The prevalence of hypodontia was 16.2% for primary dentition and 52.7% for permanent dentition in the subjects with cleft lip and/or palate. Hypodontia increased with the severity of the cleft type. Multiple hypodontia was found more frequently in the subjects with bilateral cleft lip and palate and the subjects with unilateral cleft lip and palate. Microformed lateral incisors were found in 22.7% of permanent lateral incisors but not in primary dentition. Supernumerary teeth were found in 17.7% of the subjects with cleft lip and/or palate for primary maxillary dentition and in 5.7% for permanent maxillary dentition. The prevalence of hypodontia was greater in permanent dentition than in primary dentition; although, it was not much different between males and females or between the right and left sides. The prevalence of dental anomalies was significantly different among four groups by cleft type: cleft lip, cleft lip and alveolus, cleft lip and palate, and cleft palate.
Miki, Yuta; Pogni, Rebecca; Acebes, Sandra; Lucas, Fátima; Fernández-Fueyo, Elena; Baratto, Maria Camilla; Fernández, María I; de los Ríos, Vivian; Ruiz-Dueñas, Francisco J; Sinicropi, Adalgisa; Basosi, Riccardo; Hammel, Kenneth E; Guallar, Victor; Martínez, Angel T
2013-06-15
LiP (lignin peroxidase) from Trametopsis cervina has an exposed catalytic tyrosine residue (Tyr181) instead of the tryptophan conserved in other lignin-degrading peroxidases. Pristine LiP showed a lag period in VA (veratryl alcohol) oxidation. However, VA-LiP (LiP after treatment with H2O2 and VA) lacked this lag, and H2O2-LiP (H2O2-treated LiP) was inactive. MS analyses revealed that VA-LiP includes one VA molecule covalently bound to the side chain of Tyr181, whereas H2O2-LiP contains a hydroxylated Tyr181. No adduct is formed in the Y171N variant. Molecular docking showed that VA binding is favoured by sandwich π stacking with Tyr181 and Phe89. EPR spectroscopy after peroxide activation of the pre-treated LiPs showed protein radicals other than the tyrosine radical found in pristine LiP, which were assigned to a tyrosine-VA adduct radical in VA-LiP and a dihydroxyphenyalanine radical in H2O2-LiP. Both radicals are able to oxidize large low-redox-potential substrates, but H2O2-LiP is unable to oxidize high-redox-potential substrates. Transient-state kinetics showed that the tyrosine-VA adduct strongly promotes (>100-fold) substrate oxidation by compound II, the rate-limiting step in catalysis. The novel activation mechanism is involved in ligninolysis, as demonstrated using lignin model substrates. The present paper is the first report on autocatalytic modification, resulting in functional alteration, among class II peroxidases.
Estimation of gender using cheiloscopy and dermatoglyphics
Tandon, Aanchal; Srivastava, Abhinav; Jaiswal, Rohit; Patidar, Madhvika; Khare, Aashish
2017-01-01
Background and Objective: Forensic dentistry plays a vital role in detection and resolution of crime, civil proceedings and personal identification. With ever-increasing demands placed upon law enforcement to provide sufficient physical evidence linking a perpetrator to a crime, it makes sense to utilize any type of physical characteristic to identify a suspect of an offense. The least invasive and cost-effective procedure among all methods of human identification is the study of lip prints and fingerprints. This study is done to determine the predominant pattern of fingerprint and lip print in males and females and to correlate it for gender identification. Materials and Methods: The study sample comprised 100 individuals (50 males and 50 females) aged between 20 and 50 years; dark-colored lipstick was applied uniformly on the lips. The glued portion of cellophane tape was dabbed first in the center and then pressed uniformly over the corner of lips. Cellophane tape was then stuck to a white chart sheet for the purpose of permanent record. Lip print patterns were analyzed following the classification of Suzuki and Tsuchihashi. The imprint of left thumb was taken on a white chart sheet using a blue ink stamp pad and visualized using magnifying lens. Fingerprints were analyzed by following the classification given by Kücken. Correlation of lip print and fingerprint was analyzed using Chi-square test. Results: The overall correlation of lip prints with fingerprints in males revealed branched lip pattern associated with whorl fingerprint and in females as vertical lip print pattern associated with loop fingerprint. Conclusion: We conclude that the study between lip print and fingerprint can aid in gender determination. PMID:29386811
DOE Office of Scientific and Technical Information (OSTI.GOV)
Not Available
1992-07-01
We have expanded the work on the LIP genes to Trametes versicolor, the second most studied white-rot fungus after P. chrysosporium. Six LIP genes have been cloned from this organism and one of these has been completely sequenced and compared to the known LIP genes that have been described to date. Our studies gave us further insights into the novel non-integrative transformation system of P. chrysosporium. Our recombinant plasmid pUGLGl-kan, which contains a LIP gene disrupted by the insertion of kan{sup r} determinant, also failed to integrate into the chromosome. Instead, it was maintained as a circular extrachromosomal element andmore » was recoverable as a plasmid both from the meiotic and mitotic progeny. Basic characterization of the lignin peroxidase-negative mutant (lip mutant) and nitrogen-deregulated mutant has been completed. We also investigated the question whether carbon, nitrogen, and Mn(II) regulate LIP expression coordinately or independently. Results indicate that these three environmental controls independently regulate LIP and MNP gene expression. Furthermore, an idiophasic protease has been shown to be responsible for the sharp decline in LIP activity after day 6 of incubation in low nitrogen cultures and addition of glucose to these day 6 cultures has been shown to suppress the protease levels and maintain high levels of LIP. The results further indicated that this protease is synthesized de novo during the idiophase. Additional studies showed that MNPs play a dominant role in the decolorization of chlorolignols in bleached kraft pulp effluents and that LIPs play a relatively minor role in this process. These studies have since been confirmed independently by an Austrian group.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Not Available
1992-01-01
We have expanded the work on the LIP genes to Trametes versicolor, the second most studied white-rot fungus after P. chrysosporium. Six LIP genes have been cloned from this organism and one of these has been completely sequenced and compared to the known LIP genes that have been described to date. Our studies gave us further insights into the novel non-integrative transformation system of P. chrysosporium. Our recombinant plasmid pUGLGl-kan, which contains a LIP gene disrupted by the insertion of kan{sup r} determinant, also failed to integrate into the chromosome. Instead, it was maintained as a circular extrachromosomal element andmore » was recoverable as a plasmid both from the meiotic and mitotic progeny. Basic characterization of the lignin peroxidase-negative mutant (lip mutant) and nitrogen-deregulated mutant has been completed. We also investigated the question whether carbon, nitrogen, and Mn(II) regulate LIP expression coordinately or independently. Results indicate that these three environmental controls independently regulate LIP and MNP gene expression. Furthermore, an idiophasic protease has been shown to be responsible for the sharp decline in LIP activity after day 6 of incubation in low nitrogen cultures and addition of glucose to these day 6 cultures has been shown to suppress the protease levels and maintain high levels of LIP. The results further indicated that this protease is synthesized de novo during the idiophase. Additional studies showed that MNPs play a dominant role in the decolorization of chlorolignols in bleached kraft pulp effluents and that LIPs play a relatively minor role in this process. These studies have since been confirmed independently by an Austrian group.« less
How to breathe when you are short of breath
... pursed lip breathing; Hypoxia - pursed lip breathing; Chronic respiratory failure - pursed lip breathing ... et al, eds. Murray and Nadel's Textbook of Respiratory Medicine . 6th ed. Philadelphia, PA: Elsevier Saunders; 2016: ...
Galea and subgalea graft for lip augmentation revision.
de Benito, J; Fernández-Sanza, I
1996-01-01
In this paper we will review the results obtained during the last 2 years with the aponeurotic galea and subgalea for vermillion lip augmentation. The survey was carried out on 42 patients who displayed either an absence of or reduction in the vermillion of one or both lips or a senile lip. In all cases the surgical procedure introduced aponeurotic galea and subgalea in the space found between the orbicular lip muscle and the vestibular mucus, just behind the vermillion. All the operations were performed under local anaesthetic. The size of the aponeurotic galea fragment removed varied in length between 10 and 12 cms. and in width between 1 and 2 cms., using the following parameters for its dimensions: the previous volume of the lips, and the distance between the two buccal commissures when in the "smile position."
Surgical Correction of Whistle Deformity Using Cross-Muscle Flap in Secondary Cleft Lip
Choi, Woo Young; Kim, Gyu Bo; Han, Yun Ju
2012-01-01
Background The whistle deformity is one of the common sequelae of secondary cleft lip deformities. Santos reported using a crossed-denuded flap for primary cleft lip repair to prevent a vermilion notching. The authors modified this technique to correct the whistle deformity, calling their version the cross-muscle flap. Methods From May 2005 to January 2011, 14 secondary unilateral cleft lip patients were treated. All suffered from a whistle deformity, which is characterized by the deficiency of the central tubercle, notching in the upper lip, and bulging on the lateral segment. The mean age of the patients was 13.8 years and the mean follow-up period was 21.8 weeks. After elevation from the lateral vermilion and medial tubercle, two muscle flaps were crossed and turned over. The authors measured the three vertical heights and compared the two height ratios before and after surgery for evaluation of the postoperative results. Results None of the patients had any notable complications and the whistle deformity was corrected in all cases. The vertical height ratios at the midline on the upper lip and the affected Cupid's bow point were increased (P<0.05). The motion of the upper lip was acceptable. Conclusions A cross muscle flap is simple and it leaves a minimal scar on the lip. We were able to reconstruct the whistle deformity in secondary unilateral cleft lip patients with a single state procedure using a cross-muscle flap. PMID:23094241
Lip-reading enhancement for law enforcement
NASA Astrophysics Data System (ADS)
Theobald, Barry J.; Harvey, Richard; Cox, Stephen J.; Lewis, Colin; Owen, Gari P.
2006-09-01
Accurate lip-reading techniques would be of enormous benefit for agencies involved in counter-terrorism and other law-enforcement areas. Unfortunately, there are very few skilled lip-readers, and it is apparently a difficult skill to transmit, so the area is under-resourced. In this paper we investigate the possibility of making the lip-reading task more amenable to a wider range of operators by enhancing lip movements in video sequences using active appearance models. These are generative, parametric models commonly used to track faces in images and video sequences. The parametric nature of the model allows a face in an image to be encoded in terms of a few tens of parameters, while the generative nature allows faces to be re-synthesised using the parameters. The aim of this study is to determine if exaggerating lip-motions in video sequences by amplifying the parameters of the model improves lip-reading ability. We also present results of lip-reading tests undertaken by experienced (but non-expert) adult subjects who claim to use lip-reading in their speech recognition process. The results, which are comparisons of word error-rates on unprocessed and processed video, are mixed. We find that there appears to be the potential to improve the word error rate but, for the method to improve the intelligibility there is need for more sophisticated tracking and visual modelling. Our technique can also act as an expression or visual gesture amplifier and so has applications to animation and the presentation of information via avatars or synthetic humans.
Expression and purification of the non-tagged LipL32 of pathogenic Leptospira.
Hauk, P; Carvalho, E; Ho, P L
2011-04-01
Leptospirosis is a reemerging infectious disease and the most disseminated zoonosis worldwide. A leptospiral surface protein, LipL32, only occurs in pathogenic Leptospira, and is the most abundant protein on the bacterial surface, being described as an important factor in host immunogenic response and also in bacterial infection. We describe here an alternative and simple purification protocol for non-tagged recombinant LipL32. The recombinant LipL32(21-272) was expressed in Escherichia coli without His-tag or any other tag used to facilitate recombinant protein purification. The recombinant protein was expressed in the soluble form, and the purification was based on ion exchange (anionic and cationic) and hydrophobic interactions. The final purification yielded 3 mg soluble LipL32(21-272) per liter of the induced culture. Antiserum produced against the recombinant protein was effective to detect native LipL32 from cell extracts of several Leptospira serovars. The purified recombinant LipL32(21-272) produced by this protocol can be used for structural, biochemical and functional studies and avoids the risk of possible interactions and interferences of the tags commonly used as well as the time consuming and almost always inefficient methods to cleave these tags when a tag-free LipL32 is needed. Non-tagged LipL32 may represent an alternative antigen for biochemical studies, for serodiagnosis and for the development of a vaccine against leptospirosis.
Prevalence of dental anomalies in a population of cleft lip and palate patients.
Al Jamal, Ghaida A; Hazza'a, Abdalla M; Rawashdeh, Ma'amon A
2010-07-01
The aim of our study was to investigate radiographically the prevalence of dental anomalies in a group of Jordanian cleft lip and/or palate subjects. This is a retrospective review of panoramic radiographs of 78 subjects with cleft lip and/or palate that were evaluated from their file records and investigated for possible dental anomalies. Dental anomalies were found frequently in cleft lip and/or palate subjects. Missing teeth were found in 66.7% of the patients; the tooth most commonly missing was the maxillary lateral incisor. Supernumerary teeth were found in 16.7% of patients; 37% had microdontia; 70.5% had taurodontism; 30.8% had transposition and/or ectopic teeth; 19.2% had dilacerations; and 30.8% had hypoplastic teeth. There was no statistically significant difference in the above anomalies' prevalence between males and females. However, it was found that subjects with bilateral cleft lip and/or palate had significantly more microdontia (p = .005), dilaceration (p = .002), and hypoplastic teeth (p = .0001) than subjects with unilateral cleft lip and/or palate. The prevalence of dental anomalies in cleft lip and/or palate patients was higher than what had been reported in the normal Jordanian population. This emphasizes the relation of cleft lip and/or palate to all dental anomalies studied. Although our study represents a thorough and complete description of dental anomalies present in a sample of cleft lip and/or palate subjects, larger samples are required to effectively determine the relationship of each dental anomaly with cleft type.
A Study of the Combined Use of a Hearing Aid and Tactual Aid in an Adult with Profound Hearing Loss
ERIC Educational Resources Information Center
Reed, Charlotte M.; Delhorne, Lorraine A.
2006-01-01
This study examined the benefits of the combined used of a hearing aid and tactual aid to supplement lip-reading in the reception of speech and for the recognition of environmental sounds in an adult with profound hearing loss. Speech conditions included lip-reading alone (L), lip-reading + tactual aid (L+TA) lip-reading + hearing aid (L+HA) and…
[Improving care for cleft lip and palate patients: uniform and patient-orientated outcome measures].
Haj, M; de Gier, H H W; van Veen-van der Hoek, M; Versnel, S L; van Adrichem, L N; Wolvius, E B; Hazelzet, J A; Koudstaal, M J
2018-02-01
The quality of care for patients with cleft lip and palate is extremely variable across the world. Treatment protocols differ and methods of data registration are not uniform. Improving this care by means of comparative research is challenging. The best treatment programmes can be identified by uniformly registering patient-orientated outcomes and comparing the outcomes with those of other treatment centres. That knowledge can be used to improve one's own care. An international team consisting of specialists and cleft lip and palate patients has developed a set of outcome measures that are considered by patients to be most important. This team is coordinated by the International Consortium of Health Outcomes Measurement (ICHOM). The cleft lip and palate outcome set can be used by all centres worldwide in following up on cleft lip and palate patients. In the Erasmus Medical Centre in Rotterdam, the 'Zorgmonitor Schisis' (Care Monitor Cleft Lip and Palate) has been built, an application in which these outcome measures are collected at fixed times. Implementing this set of outcome measures in other cleft lip and palate treatment centres and using the outcomes as (inter)national benchmarks will result in transparency and the improvement of the treatment of cleft lip and palate worldwide.
Szyszka-Sommerfeld, Liliana; Woźniak, Krzysztof; Matthews-Brzozowska, Teresa; Kawala, Beata; Mikulewicz, Marcin
2017-09-01
The aim of this study was to assess the electrical activity of the superior orbicularis oris muscle in children surgically treated for unilateral complete cleft lip and palate (UCCLP). The sample comprised 45 patients 6.38-12.68 years of age with UCCLP and 40 subjects 6.61-11.71 years of age with no clefts. Electromyographical (EMG) recordings were taken with a DAB-Bluetooth Instrument (Zebris Medical GmbH, Germany) in the rest position and during saliva swallowing, lip protrusion and reciprocal compression of the lips, as well as while producing the phonemes /p/, /b/, and /m/ combined with the vowel /a/. The electrical activity of the upper lip during saliva swallowing and lip compression was significantly greater in the cleft group. Similar resting level activity was observed in both groups. During the production of the /p/, /b/, and /m/ phonemes combined with the vowel /a/ the results showed no significant differences in the EMG activity between children with UCCLP and noncleft subjects. Patients with UCCLP have abnormal upper lip function characterized by increased activity of the superior orbicularis oris muscle during saliva swallowing and lip compression, and this may affect facial morphology. Copyright © 2017 The Author(s). Published by Elsevier Ltd.. All rights reserved.
Tooth display and lip position during spontaneous and posed smiling in adults.
Van Der Geld, Pieter; Oosterveld, Paul; Berge, Stefaan J; Kuijpers-Jagtman, Anne M
2008-08-01
To analyze differences in tooth display, lip-line height, and smile width between the posed smiling record, traditionally produced for orthodontic diagnosis, and the spontaneous (Duchenne) smile of joy. The faces of 122 male participants were each filmed during spontaneous and posed smiling. Spontaneous smiles were elicited through the participants watching a comical movie. Maxillary and mandibular lip-line heights, tooth display, and smile width were measured using a digital videographic method for smile analysis. Paired sample t-tests were used to compare measurements of posed and spontaneous smiling. Maxillary lip-line heights during spontaneous smiling were significantly higher than during posed smiling. Compared to spontaneous smiling, tooth display in the (pre)molar area during posed smiling decreased by up to 30%, along with a significant reduction of smile width. During posed smiling, also mandibular lip-line heights changed and the teeth were more covered by the lower lip than during spontaneous smiling. Reduced lip-line heights, tooth display, and smile width on a posed smiling record can have implications for the diagnostics of lip-line height, smile arc, buccal corridors, and plane of occlusion. Spontaneous smiling records next to posed smiling records are therefore recommended for diagnostic purposes. Because of the dynamic nature of spontaneous smiling, it is proposed to switch to dynamic video recording of the smile.
Genetic dissection of adaptive form and function in rapidly speciating cichlid fishes.
Henning, Frederico; Machado-Schiaffino, Gonzalo; Baumgarten, Lukas; Meyer, Axel
2017-05-01
Genes of major phenotypic effects and strong genetic correlations can facilitate adaptation, direct selective responses, and potentially lead to phenotypic convergence. However, the preponderance of this type of genetic architecture in repeatedly evolved adaptations remains unknown. Using hybrids between Haplochromis chilotes (thick-lipped) and Pundamilia nyererei (thin-lipped) we investigated the genetics underlying hypertrophied lips and elongated heads, traits that evolved repeatedly in cichlids. At least 25 loci of small-to-moderate and mainly additive effects were detected. Phenotypic variation in lip and head morphology was largely independent. Although several QTL overlapped for lip and head morphology traits, they were often of opposite effects. The distribution of effect signs suggests strong selection on lips. The fitness implications of several detected loci were demonstrated using a laboratory assay testing for the association between genotype and variation in foraging performance. The persistence of low fitness alleles in head morphology appears to be maintained through antagonistic pleiotropy/close linkage with positive-effect lip morphology alleles. Rather than being based on few major loci with strong positive genetic correlations, our results indicate that the evolution of the Lake Victoria thick-lipped ecomorph is the result of selection on numerous loci distributed throughout the genome. © 2017 The Author(s). Evolution © 2017 The Society for the Study of Evolution.
The effects of lip revision surgery on nasolabial esthetics in patients with cleft lip.
Mercado, A M; Phillips, C; Vig, K W L; Trotman, C-A
2014-11-01
1) To determine the concordance among surgeons on subjective assessments of nasolabial esthetics in children with repaired cleft lip; and 2) to evaluate longitudinal changes in nasolabial esthetics in relation to cleft lip revision surgery. School of Dentistry at University of North Carolina, Chapel Hill. Children with repaired unilateral cleft lip: 32 had lip revision surgery and 27 did not have surgery. Retrospective observational study from a non-randomized clinical trial. Ratings of nasolabial esthetics performed by six surgeons using the Asher-McDade scale at baseline and 12-month follow-up. Concordance among surgeons ranged from poor to acceptable. Nasolabial ratings at follow-up were better in the Revision group than in the Non-Revision group, although differences were small. The most prevalent change in the Revision Group was improvement in one or more units on the scale, while 'no change' was most prevalent in the Non-Revision group. Participants in the Revision group were more likely to receive a 'no' in relation to the need for lip or nose revision at the follow-up visit. There were mild esthetic improvements observed in relation to lip revision surgery, which should be interpreted with caution given the subjectivity of the rating method used. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
In vivo reflectance confocal microscopy evaluation of cheilitis glandularis: a report of 5 cases.
Lourenço, Silvia V; Kos, Eliana; Borguezan Nunes, Thais; Bologna, Sheyla B; Sangueza, Martin; Nico, Marcello M S
2015-03-01
Cheilitis glandularis (CG) is an uncommon condition of unknown origin; it is clinically characterized by variable degrees of macrocheilia associated with red dilated ostia of minor salivary glands on the vermilion area, which secrete viscous saliva. Histopathological characteristics of CG are comprised of chronic sialadenitis with engorged acinar lobules and dilated ducts; CG also features chronic sun damage (actinic cheilitis and squamous cell carcinoma). These changes may be localized, and a punch biopsy specimen might fail to reveal enough criteria to support the diagnosis of CG. Reflectance confocal microscopy (RCM) is a noninvasive imaging technique that enables an in vivo en face visualization of tissues with a resolution close to conventional histopathology. Its use allows analysis of the entire lip, without excision. We reported the evaluation of 5 cases of CG based on clinical RCM and histopathological correlation. RCM examination of the lip vermilion mainly revealed a bright aspect of the superficial epithelial layers, which corresponded to labial keratosis. Alteration of the classical epithelial honeycomb pattern was observed in RCM, which corresponded to epithelial changes in actinic cheilitis at histopathology. Round, dark empty spaces intermingling the epithelium, corresponded to the ectopic excretory salivary gland ducts that open their ostia within the lip vermilion. In the lamina propria, the most striking feature was superficial salivary gland lobules, seen as dark gray lobular structures. Our study, demonstrated the use of RCM in the evaluation of CG, showing that a correlation between the clinical, digital RCM images and histopathology improved the diagnostic skills in CG evaluation.
Hover and wind-tunnel testing of shrouded rotors for improved micro air vehicle design
NASA Astrophysics Data System (ADS)
Pereira, Jason L.
The shrouded-rotor configuration has emerged as the most popular choice for rotary-wing Micro Air Vehicles (MAVs), because of the inherent safety of the design and the potential for significant performance improvements. However, traditional design philosophies based on experience with large-scale ducted propellers may not apply to the low-Reynolds-number (˜20,000) regime in which MAVs operate. An experimental investigation of the effects of varying the shroud profile shape on the performance of MAV-scale shrouded rotors has therefore been conducted. Hover tests were performed on seventeen models with a nominal rotor diameter of 16 cm (6.3 in) and various values of diffuser expansion angle, diffuser length, inlet lip radius and blade tip clearance, at various rotor collective angles. Compared to the baseline open rotor, the shrouded rotors showed increases in thrust by up to 94%, at the same power consumption, or reductions in power by up to 62% at the same thrust. These improvements surpass those predicted by momentum theory, due to the additional effect of the shrouds in reducing the non-ideal power losses of the rotor. Increasing the lip radius and decreasing the blade tip clearance caused performance to improve, while optimal values of diffuser angle and length were found to be 10 and 50% of the shroud throat diameter, respectively. With the exception of the lip radius, the effects of changing any of the shrouded-rotor parameters on performance became more pronounced as the values of the other parameters were changed to degrade performance. Measurements were also made of the wake velocity profiles and the shroud surface pressure distributions. The uniformity of the wake was improved by the presence of the shrouds and by decreasing the blade tip clearance, resulting in lower induced power losses. For high net shroud thrust, a favorable pressure distribution over the inlet was seen to be more important than in the diffuser. Strong suction pressures were observed above the blade-passage region on the inlet surface; taking advantage of this phenomenon could enable further increases in thrust. However, trade studies showed that, for a given overall aircraft size limitation, and ignoring considerations of the safety benefits of a shroud, a larger-diameter open rotor is more likely to give better performance than a smaller-diameter shrouded rotor. The open rotor and a single shrouded-rotor model were subsequently tested at a single collective in translational flight, at angles of attack from 0° (axial flow) to 90° (edgewise flow), and at various advance ratios. In axial flow, the net thrust and the power consumption of the shrouded rotor were lower than those of the open rotor. In edgewise flow, the shrouded rotor produced greater thrust than the open rotor, while consuming less power. Measurements of the shroud surface pressure distributions illustrated the extreme longitudinal asymmetry of the flow around the shroud, with consequent pitch moments much greater than those exerted on the open rotor. Except at low airspeeds and high angles of attack, the static pressure in the wake did not reach ambient atmospheric values at the diffuser exit plane; this challenges the validity of the fundamental assumption of the simple-momentum-theory flow model for short-chord shrouds in translational flight.
[Progress in studies on the genetic risk factors for nonsyndromic cleft lip or palate in China].
Huang, Y Q
2017-04-09
Cleft lip and palate is the most common congenital defects of oral and maxillofacial region in human beings. The etiology of this malformation is complex, with both genetic and environmental causal factors are involved. To provide a better understanding in the genetic etiology of cleft lip or palate, the author summarized recent years studies based on Chinese population. Those researches included validation of some candidate genes for cleft lip or palate, using genome wide association analysis which included six independent cohorts from China to elucidate the genetic architecture of non-syndromic cleft lip with or without cleft palate in Chinese population and finally found a new susceptibility locus. This locus was on the 16p13.3 (rs8049367) between CREBBP and ADCY9. It has been mentioned common methods of genetic analysis involved in the researches on cleft lip or palate in this paper. Furthermore, we try to discuss new methods to illustrate the etiology of cleft lip and palate that could provide more inspiration on future researches.
Kim, Jee; Topolski, Richard; Dickinson, Douglas; Ramos, Van
2017-09-01
Information is lacking for viewer preferences for incisal display with lips in repose. The purpose of this online survey was to establish measurement parameters to classify and define a lip form and to evaluate the influence of lip form on dentists' and laypersons' preferences for the amount of incisal display with lips in repose. Computer-generated male and female models were created using 3 different lip forms each, straight, moderate, and high. Three images of these models (frontal full face, zoomed-in frontal around the mouth, and oblique zoomed-in image of the mouth) were arranged in an interactive survey that was disseminated on the Websites Facebook, Instagram, DentalTown and by word-of-mouth. Respondents manipulated the incisal display of all 3 images in unison, using a slide bar, and the resulting incisal display was measured in millimeters and served as the primary dependent measure. Survey demographic data were obtained from an online survey site. Data were assessed for skewness, kurtosis, and outliers and analyzed with 5-way ANOVA: 2 sex levels for model, 2 levels for sex of respondent, 3 levels for lip height, 3 levels for occupation, and 5 levels of ethnicity, with multiple comparisons corrected with Bonferroni adjustments and post hoc comparisons performed using the Scheffé test (α=.05 for all comparisons). A total of 1039 individuals consented to the study. A final sample size of 687 respondents was obtained after excluding 352 who failed to complete the survey. The results indicated that lip form affected the esthetic perception of incisal display significantly (P<.001), with a preference for a greater amount of incisal display corresponding with increasing lip forms. Sex of the model was also significant, with greater incisal display being preferred for female faces. A significant difference was found for respondents' ethnicity, with African Americans generally preferring smaller incisal displays than other ethnic groups. No other main effects were found to be statistically significant. Only 2 interactions were shown to be statistically significant. Post hoc tests examining the interaction between lip form and sex of model showed a preference for greater incisal displays for female faces with high lip forms. A 3-way interaction was observed between lip form, sex of respondent, and occupation. Significant differences were identified for the 3 different lip forms for both sexes of models. As the lip form changed from straight to moderate to high, there was a preference for increased incisal display. Incisal display preferences for male and female models were the same for all respondents, except for the high lip form, for which a greater amount of incisal display was preferred for the female model. Sex and occupation of respondent failed to produce main effects. Respondents' ethnicity was shown to be statistically significant, with African Americans generally preferring shorter incisal displays. Copyright © 2016 Editorial Council for the Journal of Prosthetic Dentistry. Published by Elsevier Inc. All rights reserved.
... The experts in face, mouth and jaw surgery. Cleft Lip / Palate and Craniofacial Surgery This type of surgery is ... the carefully orchestrated, multiple-stage correctional program for cleft lip and palate patients. The goal is to help restore the ...
... to obese women may have increased risk of cleft lip and palate. Males are more likely to have a cleft ... more common in females. In the United States, cleft lip and palate are reportedly most common in Native Americans and ...
Dental Care for a Child with Cleft Lip and Palate
... Donor Spotlight Fundraising Ideas Vehicle Donation Volunteer Efforts Dental Care for a Child with Cleft Lip and ... submenu What We Do Cleft & Craniofacial Educational Materials Dental Care for a Child with Cleft Lip and ...
“Partial duplication of lower lip and hemimandible” A rare case
Nayak, Bibhuti Bhusan; Mohanty, Nilamani
2012-01-01
Duplication of mandible and lower lip is a very rare congenital entity. We report an extremely uncommon case of Congenital Duplication of Lower lip and Mandible in a 3 year old girl, who was treated surgically in a single stage for correction of both lip and mandible. This was a commissure preserving single staged procedure. The Surgical procedure, the problems related to this anomaly and the embryology are discussed. PMID:23450337
The convergence rate of approximate solutions for nonlinear scalar conservation laws
NASA Technical Reports Server (NTRS)
Nessyahu, Haim; Tadmor, Eitan
1991-01-01
The convergence rate is discussed of approximate solutions for the nonlinear scalar conservation law. The linear convergence theory is extended into a weak regime. The extension is based on the usual two ingredients of stability and consistency. On the one hand, the counterexamples show that one must strengthen the linearized L(sup 2)-stability requirement. It is assumed that the approximate solutions are Lip(sup +)-stable in the sense that they satisfy a one-sided Lipschitz condition, in agreement with Oleinik's E-condition for the entropy solution. On the other hand, the lack of smoothness requires to weaken the consistency requirement, which is measured in the Lip'-(semi)norm. It is proved for Lip(sup +)-stable approximate solutions, that their Lip'convergence rate to the entropy solution is of the same order as their Lip'-consistency. The Lip'-convergence rate is then converted into stronger L(sup p) convergence rate estimates.
Morohoshi, Tomohiro; Oikawa, Manabu; Sato, Shoko; Kikuchi, Noriko; Kato, Norihiro; Ikeda, Tsukasa
2011-10-01
Members of the genus Nepenthes are carnivorous plants that use the pitfall method of insect capture as a supplementary nutritional source. We extracted metagenomic DNA from the microbial community found in the pitcher fluid of Nepenthes and constructed a plasmid-based metagenomic library. An activity-based screening method enabled the isolation of two lipase genes, lip1 and lip2. Both Lip1 and Lip2 belong to a novel family or subfamily of lipases and show lipase activities in acidic conditions, such as those found in pitcher fluid. This study was conducted under the assumption that the secreted Lip1 and Lip2 were capable of enzymatic activity in the acidic pitcher fluid. Copyright © 2011 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
Seo, Bin Na; Park, Su Han; Yang, Jeong Yeol; Son, Kyung Min; Cheon, Ji Seon
2015-04-01
Nasoalveolar molding (NAM) device is an effective treatment for protruding maxilla in infants with cleft palate. However, only a few studies have investigated the effect of NAM devices on the treatment of protruding maxilla in infants with cleft lip only. We have designed a combination treatment using NAM devices prior to cheiloplasy for cleft lip-only patients with severe anterior protrusion of the premaxilla. Three cleft lip-only infants with 1-cm or more of premaxilla protrusion were included. Definitive cheiloplasty was performed at 6 months of age without any preoperative correction in infant 1. Cheiloplasty was performed in conjunction with the use of NAM device and lip adhesion in infants 2 and 3. Postoperative columella length and anterior-posterior dimension of the protruding premaxilla were compared amongst the infants. We were able to obtain satisfactory postoperative columella length and general nasal appearance.
Koike, Takashi; Kanno, Takahiro; Karino, Masaaki; Sekine, Joji
2017-11-01
Surgery is generally indicated for the treatment of lower lip carcinoma. However, surgery can lead to esthetic as well as functional issues, with disturbances in eating and articulation. If the defect involves less than one-third of the width of the lower lip, primary closure is possible. If the defect is wider, reconstructive local flaps may be necessary for both esthetic and functional recovery. This report describes a case of lower lip verrucous carcinoma in which a tongue flap was used to treat a defect involving more than half the width of the lower lip following resection. The patient was a 91-year-old woman who complained of lower lip discomfort. A biopsy revealed verrucous carcinoma, and we performed resection. After a 3-week waiting period, we performed secondary tongue flap reconstruction. Satisfactory function and cosmetic results were achieved.
Yan, Jie; Zhao, Shou-feng; Mao, Ya-fei; Ruan, Ping; Luo, Yi-hui; Li, Shu-ping; Li, Li-wei
2005-01-01
To construct the eukaryotic expression system of L.interrogans lipL32/1-ompL1/1 fusion gene and to identify the immunoreactivity of expression products. PCR with linking primer was used to construct the fusion gene lipL32/1-ompL1/1. The P.pastoris eukaryotic expression system of the fusion gene, pPIC9K-lipL32/1-ompL1/1-P. pastorisGS115, was constructed after the fusion gene was cloned and sequenced. Colony with phenotype His(+)Mut(+) was isolated by using MD and MM plates and His(+) Mut(+) transformant with high resistance to G418 was screened out by using YPD plate. Using lysate of His(+) Mut(+) colony with high copies of the target gene digested with yeast lyase as the template and 5'AOX1 and 3'AOX1 as the primers, the target fusion gene in chromosome DNA of the constructed P. pastoris engineering strain was detected by PCR. Methanol in BMMY medium was used to induce the target recombinant protein rLipL32/1-rOmpL1/1 expression. rLipL32/1-rOmpL1/1 in the medium supernatant was extracted by using ammonium sulfate precipitation and Ni-NTA affinity chromatography. Output and immunoreactivity of rLipL32/1-rOmpL1/1 were measured by SDS-PAGE and Western blot methods, respectively. Amplification fragments of the obtained fusion gene lipL32/1-ompL1/1 was 1794 bp in size. The homogeneity of nucleotide and putative amino acid sequences of the fusion gene were as high as 99.94 % and 100 %, respectively, compared with the sequences of original lipL32/1 and ompL1/1 genotypes. The constructed eukaryotic expression system was able to secrete rLipL32/1-rOmpL1/1 with an output of 10 % of the total proteins in the supernatant, which located the expected position after SDS-PAGE. The rabbit anti-rLipL32/1 and anti-rOmpL1/1 sera could combine the expressed rLipL32/1-rOmpL1/1. An eukaryotic expression system with high efficiency in P.pastoris of L.interrogans lipL32/1-ompL1/1 fusion gene was successfully constructed in this study. The expressed fusion protein shows specific immunoreactivity, which can be used as a potential antigen for developing a novel vaccine of L.interrogans.
Prevalence of cleft lip and/or palate in children from Lodz between years 1981-2010.
Antoszewski, Bogusław; Fijałkowska, Marta
2016-03-01
Congenital malformations constitute a serious problem of both medical and social nature. Cleft lip and/or palate represent the most common congenital anomaly of the face that is why it is essential to know the real frequency of the described phenomenon. The aim of this paper is to determine the frequency of cleft lip and/or palate and the types of malformations that occurred in Lodz city between the years 1981-2010. Our clinic has been carrying on the studies concerning the incidence of cleft lip and/or palate since 1981. The Polish Registry of Congenital Malformations has been operating in Poland since 1 April 1997. The team has managed to obtain data, from the Registry, concerning the total number of all live born infants and the number of children with cleft lip and/or palate, who were born in Lodz, between 1998 and 2010. In years 1981-2010, 319 children, in 210 952 live born infants, were born with cleft lip and/or palate in Lodz. The isolated cleft palate was observed more frequently in girls and the unilateral cleft of lip and palate in boys. In all three decades palate clefts are more common whereas bilateral lip, alveolus and palate clefts are more infrequent. A small tendency to decrease in actual cleft lip and/or palate frequency among children, in the period of 30 years, is observed in Lodz. Over the years it has still been observed that the isolated cleft palate is the most common type of defect. © 2015 Japanese Teratology Society.
Practical Repair Method for Unilateral Cleft Lips: Straight-Line Advanced Release Technique.
Baek, Rong-Min; Choi, Jun-Ho; Kim, Baek-Kyu
2016-04-01
Straight-line closure repair of unilateral cleft lips was first introduced in the 1840s, and since then, many different techniques have been attempted for cleft repair. However, these methods have several disadvantages and are difficult to adopt. In this study, we describe our novel technique, known as Straight-Line Advanced Release Technique (StART), and its application in treating several cases of unilateral cleft lip. The preoperative design of the surgical method is drawn on the skin, the vermilion, and the oral mucosa. A total of 13 points are marked (points 0-12). The A flap, B flap, triangular flap, M (medial mucosal) flap, and L (lateral mucosal) flap are designed. After completion of the preoperative marking, the wide dissection is performed to separate the orbicularis oris muscle completely from the abnormally inserted bony structure and the enveloped skin-mucosal flap. The freed orbicularis oris muscle is then reconstructed with full width. After all planes of the lip wound are closed, a straight vertical skin suture line is achieved without any unnecessary transverse scar. Unilateral cleft lip repair using StART was conducted in 145 patients between 1993 and 2012. Cases of microform cleft lip were excluded. A total of 21 patients (14%) required a secondary operation on the lip after the first unilateral cheiloplasty. In all patients, satisfactory surgical outcomes were obtained with an indistinct straight-lined scar and a well-aligned lip contour. To acquire a natural and balanced shape in unilateral cleft lip repair, we recommend the novel StART.
Furuta, Rika A; Ma, Guangyong; Matsuoka, Masao; Otani, Satoshi; Matsukura, Harumichi; Hirayama, Fumiya
2015-04-01
Recently, Japanese Red Cross blood centers have changed the confirmatory test method from an indirect immunofluorescence (IF) technique to Western blotting (WB) for antibodies against human T-cell leukemia virus Type 1 (HTLV-1). In this study, these HTLV-1 tests were assessed using another sensitive method, that is, a luciferase immunoprecipitation system (LIPS), to identify a better confirmatory test for HTLV-1 infection. Plasma samples from 54 qualified donors and 114 HTLV-1 screening-positive donors were tested by LIPS for antibodies against HTLV-1 Gag, Tax, Env, and HBZ recombinant proteins. The donors were categorized into six groups, namely, (Group I) qualified donors, screening positive; (Group II) IF positive; (Group III) IF negative; (Group IV) WB positive; (Group V) WB negative; and (Group VI) screening positive in the previous blood donation, but WB-indeterminate during this study period. In Groups II and IV, all plasma samples tested positive by LIPS for antibodies against Gag and Env proteins. In Group V, all samples tested negative by LIPS, whereas some Group III samples reacted with single or double antigens in LIPS. In Group VI, the LIPS test identified a donor with suspected HTLV-1 infection. The first case of a blood donor with plasma that reacted with HBZ was identified by LIPS. Reevaluation of the current HTLV-1 screening method using the LIPS test showed that both confirmatory tests had similar sensitivity and specificity only when WB indeterminate results were eliminated. LIPS is a promising method for detecting and characterizing HTLV-1 antibodies. © 2014 AABB.
The influence of lower lip position on the perceived attractiveness of chin prominence.
Modarai, Faranak; Donaldson, Jane Catalina; Naini, Farhad B
2013-09-01
To evaluate the influence of the lower lip prominence for varying degrees of chin prominence in the sagittal plane and to establish whether lower lip prominence affects the perceived desire for surgery. To assess differences in preference between orthodontists and laypeople as well as the effect of age, gender, and ethnicity of observers on perceptions of attractiveness and desire for surgery. A silhouette of an idealized profile image was created. The image was manipulated to create six images demonstrating different degrees of retrogenia and progenia altered in 4-mm increments from -12 mm to +12 mm and six images demonstrating chin and lower lip prominence in 4-mm increments from -12 mm to +12 mm. One hundred laypeople and 30 orthodontists ranked the images from the most to the least attractive. A duplicate of one of the images was used in order to assess intraexaminer reliability. The amount and direction of sagittal chin position and the prominence of the lower lip were found to have a significant effect on image rank. Chin protrusion was less attractive than retrusion and surgery was desired more often for these images. The overall direction of opinion was the same for laypeople and orthodontists. The chin prominence observed in a progenic patient is deemed less attractive than the combined chin and lower lip prominence observed in a patient with mandibular prognathism. In profiles with a more prominent chin a more protrusive lower lip position was preferred. When the chin was retrusive, a normal lower lip position was preferred to a retrusive lip.
Gender determination: Role of lip prints, finger prints and mandibular canine index
KRISHNAN, RESHMA POOTHAKULATH; THANGAVELU, RADHIKA; RATHNAVELU, VIDHYA; NARASIMHAN, MALATHI
2016-01-01
Personal identification has a pivotal role in forensic investigations. Gender determination is an essential step in personal identification. Despite the advent of advanced techniques such as DNA fingerprinting, methods such as lip print and fingerprint analysis and mandibular canine index calculations are routinely used in gender determination, as they are simple and cost-effective. The present study investigated the hypothesis that lip print analysis is an effective tool in gender determination compared with fingerprint analysis and the mandibular canine index. The predominant patterns of lip prints and fingerprints were analyzed in males and females, and the efficacy of the mandibular canine index in gender determination was evaluated. The study group comprised 50 students, 25 males and 25 females who were 18–25 years of age. Lip prints and fingerprints were obtained and classified according to Tsuchihashi's classification and Kücken and Newell's classification, respectively. Mandibular impressions were made and the mandibular canine index was calculated. Type I and Type I' lip prints were predominant in females, and Type IV lip prints were predominant in males. The analysis of fingerprints revealed that the loop fingerprint pattern was predominant in both males and females. The mandibular canine index was not found to be significant in gender identification. The predominant patterns of lip prints were distinct for males and females; conversely, fingerprints were demonstrated to be similar in both genders. Therefore, lip prints hold an increased potential for gender determination, as compared with fingerprints, and the mandibular canine index is not a reliable indicator of gender. PMID:27284316
The ecological and genetic basis of convergent thick-lipped phenotypes in cichlid fishes.
Colombo, Marco; Diepeveen, Eveline T; Muschick, Moritz; Santos, M Emilia; Indermaur, Adrian; Boileau, Nicolas; Barluenga, Marta; Salzburger, Walter
2013-02-01
The evolution of convergent phenotypes is one of the most interesting outcomes of replicate adaptive radiations. Remarkable cases of convergence involve the thick-lipped phenotype found across cichlid species flocks in the East African Great Lakes. Unlike most other convergent forms in cichlids, which are restricted to East Africa, the thick-lipped phenotype also occurs elsewhere, for example in the Central American Midas Cichlid assemblage. Here, we use an ecological genomic approach to study the function, the evolution and the genetic basis of this phenotype in two independent cichlid adaptive radiations on two continents. We applied phylogenetic, demographic, geometric morphometric and stomach content analyses to an African (Lobochilotes labiatus) and a Central American (Amphilophus labiatus) thick-lipped species. We found that similar morphological adaptations occur in both thick-lipped species and that the 'fleshy' lips are associated with hard-shelled prey in the form of molluscs and invertebrates. We then used comparative Illumina RNA sequencing of thick vs. normal lip tissue in East African cichlids and identified a set of 141 candidate genes that appear to be involved in the morphogenesis of this trait. A more detailed analysis of six of these genes led to three strong candidates: Actb, Cldn7 and Copb. The function of these genes can be linked to the loose connective tissue constituting the fleshy lips. Similar trends in gene expression between African and Central American thick-lipped species appear to indicate that an overlapping set of genes was independently recruited to build this particular phenotype in both lineages. © 2012 Blackwell Publishing Ltd.
Chen, Ke-Cai; Zheng, Ming-Min; Pan, Jiang; Li, Chun-Xiu; Xu, Jian-He
2017-10-01
The lipase isolated from Serratia marcescens (LipA) is a useful biocatalyst for kinetic resolution of a pharmaceutically relevant epoxyester, (±)-3-(4'-methoxyphenyl) glycidic acid methyl ester [(±)-MPGM], to afford optically pure (-)-MPGM, a key intermediate for the synthesis of diltiazem hydrochloride. Two mutants, LipA L315S and LipA S271F , were identified from the combinatorial saturation mutation library of 14 amino acid residues lining the substrate-binding pocket. LipA L315S , LipA S271F , and their combination LipA L315S/S271F showed 2.6-, 2.2-, and 4.6-fold improvements in their specific activities towards para-nitrophenyl butyrate (pNPB), respectively. Among these positive mutants, LipA S271F displayed a 3.5-fold higher specific activity towards the pharmaco substrate (±)-MPGM. Kinetic study showed that the improvement in catalytic efficiency of LipA S271F against (±)-MPGM was mainly resulted from the enhanced affinity between substrate and enzyme, as indicated by the decrease of K m . Furthermore, to address the insoluble expression issue in Escherichia coli, the homologous expression of LipA gene in S. marcescens was achieved by introducing it into an expression vector pUC18, resulting in ca. 20-fold higher lipase production. The significantly improved volumeric production and specific activity of S. marcescens lipase make it very attractive as a new-generation biocatalyst for more efficient and economical manufacturing of (-)-MPGM.
Valentová-Strenáčiková, Silvia; Malina, Radovan
2016-01-01
Objectives. The objective of this study is to compare the impact of early and late reconstruction of complete unilateral cleft lip and palate on the growth and development of the front of the dentoalveolar arch. Methods. This study was carried out in the years 2012-2015 at the Clinic of Plastic, Reconstructive and Aesthetic Surgery in Banska Bystrica. Infants with unilateral complete cleft lip and palate were divided into 2 groups according to the timing of lip reconstruction. Group A consisted of infants with early lip reconstruction-realised in the first 14 days of life. Group B consisted of infants with later lip reconstruction-realised in the third month of age. Maxillary dental casts were obtained for each child in four periods-in the first 14 days of life, in the third month, in the sixth month and in the age of one year. These were followed by the identification, measurement and evaluation of anthropometric parameters. Results. Significant differences were occurred after the reconstruction of the lips in linear and angle measurements between infants in the A and B groups. Conclusion. The early surgical reconstruction of the lips in the first 14 days of life has a positive effect on the growth and development of the anterior segment of the dentoalveolar arch. Early lip reconstruction forms a continuous pressure on the frontal segment, resulting in the earlier remedy of anatomical properties and creates appropriate conditions for the best development of this area.
2016-01-01
Objectives. The objective of this study is to compare the impact of early and late reconstruction of complete unilateral cleft lip and palate on the growth and development of the front of the dentoalveolar arch. Methods. This study was carried out in the years 2012–2015 at the Clinic of Plastic, Reconstructive and Aesthetic Surgery in Banska Bystrica. Infants with unilateral complete cleft lip and palate were divided into 2 groups according to the timing of lip reconstruction. Group A consisted of infants with early lip reconstruction–realised in the first 14 days of life. Group B consisted of infants with later lip reconstruction–realised in the third month of age. Maxillary dental casts were obtained for each child in four periods–in the first 14 days of life, in the third month, in the sixth month and in the age of one year. These were followed by the identification, measurement and evaluation of anthropometric parameters. Results. Significant differences were occurred after the reconstruction of the lips in linear and angle measurements between infants in the A and B groups. Conclusion. The early surgical reconstruction of the lips in the first 14 days of life has a positive effect on the growth and development of the anterior segment of the dentoalveolar arch. Early lip reconstruction forms a continuous pressure on the frontal segment, resulting in the earlier remedy of anatomical properties and creates appropriate conditions for the best development of this area. PMID:26893957
Matsunaka, Eriko; Ueki, Shingo; Makimoto, Kiyoko
2015-10-01
The objective of this systematic review is to examine the impact of breastfeeding or bottle-feeding on surgical wound dehiscence after cleft lip repair in infants. Immediately after cleft lip repair in infants, breastfeeding and bottle-feeding are generally restricted. Alternative feeding methods such as spoon-feeding are recommended to avoid placing tension on the surgical wound. However, some studies have reported that alternative feeding methods are a source of stress to the infant and cause them to cry incessantly, resulting in postoperative weight loss. This suggests that these alternative feeding methods may have an unfavorable impact on surgical wound healing. However, a consensus on this topic has not been reached. The objective of this systematic review is to examine the impact of breastfeeding or bottle-feeding on surgical wound dehiscence after cleft lip repair in infants.Cleft lip and/or palate is a craniofacial anomaly and one of the most common birth defects. The incidence of cleft lip and/or palate differs among races, ethnic groups and geographical areas. The prevalence of cleft lip and/or palate is highest in South American countries (Bolivia: 22.94 per 10,000 live births; Paraguay: 14.90 per 10,000 live births), followed by Asian countries (China: 13.60 per 10,000 live births; Japan: 16.04 per 10,000 live births). The prevalence is lowest in African countries (3.54 per 10,000 live births). The overall worldwide prevalence is 7.9 per 10,000 births.A cleft lip and/or a cleft palate can occur separately, although they are more likely to occur together early in pregnancy. These anomalies can be surgically repaired. Without proper treatment, patients have aesthetic and functional problems, such as feeding disorders, otitis media and speech difficulties.Patients with cleft lip and/or palate usually undergo a combination of surgical procedures, speech therapy and orthodontic treatment from infancy to young adulthood. Comprehensive treatment is provided with thoughtful consideration of the balance between intervention and growth. Cleft lip repair is carried out first in comprehensive treatment regimens. The aim of cleft lip repair is to create contrast between the lip and external nose and provide good muscular continuity across the cleft without any scarring. It is usually performed from three to six months of age. Surgery is delayed until this age to allow for growth of the lip structure and assessment of the patient for the presence of comorbidities. The ability of newborn patients with cleft lip and/or palate to drink milk is important for proper growth and development.For cleft lip and/or palate patients in the newborn developmental stage, feeding can be an area of great concern and anxiety for their parents. One study found that 32% of newborn patients with cleft lip and/or palate had poor feeding skills. Feeding difficulties lead to poor growth and development in early infancy and increase the burden of care. Therefore, it is important for new parents to learn appropriate feeding techniques. Infants with cleft lip can generally drink milk from the breast through various ways of feeding. In contrast, infants with both cleft lip and palate have difficulty sucking the nipple because of weak intraoral negative pressure, and specially designed nipples are generally used. Although such infants suckle with weakened pressure, these nipples enable them to drink milk by lightly pushing them through their lip. However, after cleft lip repair, infants with cleft lip and/or palate are forced to change their feeding methods (even infants who have managed to drink milk before the repair).Breastfeeding and bottle-feeding are generally restricted immediately after cleft lip repair. Alternative feeding methods such as the use of a spoon, cup or syringe are recommended to avoid placing tension on the surgical incision. The use of a very soft nipple of sufficient size is recommended to provide a dripping milk flow, thus avoiding tension on the operative site. Some authors have recommended that patients with cleft lip and/or palate be spoon-fed for a certain period of time after cleft lip repair to avoid tension on the surgical site. However, management of the surgical site after surgical repair of cleft lip and/or palate varies among countries and healthcare centers. Little evidence-based research is available to guide healthcare staff members through the many treatment protocols for cleft lip and/or palate. No consensus about feeding methods after cleft lip repair has been reached.The above mentioned alternative feeding methods might influence the process of surgical wound healing. Minimizing crying has been considered to be the most important factor in avoiding tension on the surgical wound. In one study, however, 21.7% of infants who were given milk by a spoon on the first day after cleft lip repair resisted feeding by crying and/or moving the head laterally, while all infants fed by the nipple that had been used preoperatively accepted feeding without a major observable response. In another study, infants who were breastfed or bottle-fed after the repair were reportedly more relaxed than spoon-fed or syringe-fed infants. Changes in feeding methods seem to stress the infants and cause them to cry, which places tension on the wound.These alternative feeding methods may also have other impacts on surgical wound healing. One study reported that infants took longer to drink milk using alternative feeding methods than when using traditional feeding methods after the surgery. A systematic review suggested that alternative feeding methods were associated with less postoperative weight gain in patients than traditional feeding methods. Postoperative nutritional intake also influences wound healing. A long duration of feeding milk coupled with weight loss after the surgery suggests unnecessary energy consumption associated with the alternative feeding methods. Wound healing may consequently be inhibited or delayed.Wound healing complications after surgery include wound infection, dehiscence and proliferative scarring. Surgical wound dehiscence has been regarded as a typical complication after cleft lip and/or palate repair, followed by pyrexia. In one case series, post-surgical complications were found in 11 of 2100 infants who underwent surgical cleft lip and/or palate repair during a seven-year period. Wound dehiscence results from tissue failure rather than improper suturing technique. Therefore, alternative feeding methods are recommended to avoid placing tension on the surgical wound. However, no strong evidence has been presented to show that breastfeeding or bottle-feeding after cleft lip repair may cause surgical wound dehiscence among infants with cleft lip.Our initial search failed to find any systematic review examining the impact of breastfeeding or bottle-feeding on surgical wound dehiscence after cleft lip repair using the Cochrane Library, the JBI Database of Systematic Reviews and Implementation Reports, and other bibliographic databases, including MEDLINE and CINAHL. The proposed systematic review will contribute to the understanding of this topic and identify areas for further research. If breastfeeding or bottle-feeding is recommended immediately after cleft lip repair, the patients will experience less stress and crying, placing less tension on the wound than with alternative feeding methods. Breastfeeding or bottle-feeding will result in more weight gain, facilitating wound healing.
Pattaranit, Rumpan; Songsung, Chainarong; Simmalee, Krisda; Pradubvong, Suteera; Thanapaisal, Chaiwit
2012-11-01
The incidence of cleft lip and cleft palate in Thailand is based on reports from three hospitals in Northeastern Thailand. There are 2.49 new babies born with cleft lip and cleft palate and craniofacial deformities for every 1,000 babies the highest incidence in the world. Area 7 Office of the National Health Security Office (NHSO) comprises Khon Kaen, Roi Et, Mahasarakam and Kalasin. The number of newborns with cleft lip and palate is an estimated 114 cases/year. A retrospective geoinformatics study was conducted using the medical records of 4- to 5-year-olds with cleft lip and cleft palate registered with the Tawanchai Center Srinagarind Hospital. To study the distribution of 4- to 5-year-olds with cleft lip and palate using geoinformatics. This retrospective study was conducted using data from the medical records, which contains the records of 4- to 5-year-olds with cleft lip and cleft palate admitted to Srinagarind Hospital. The 54-patient sample groups were registered at the Tawanchai Center Faculty of Medicine, Khon Kaen University, under the aegis of the NHSO (Area 7-Khon Kaen). The data were collected using self-administered questionnaires between May and June 2012 and geoinformatics, to study the distribution of patients' vis-a-vis the various parameters. Among the 27 male and 27femalepatients, 51.85% had cleft lip with cleft palate. Most of the cleft lip patients (7 cases; 41.18%) were in Khon Kaen, while 4 (44.44%) of the cleft palate patients were in Roi-Et and 11 (39.29%) of the cleft lip with palate patients were in Khon Kaen. Most cleft lip patients were in Roi-Et province: 1 case in each of four districts. Similarly, most cases of cleft palate were in Roi-Et province: 1 case in each of four districts. Finally, most cases (5; 50%) of cleft lip with cleft palate were found in Roi-Et province, mostly in the central (Muang) district. The use of Arc View software as an instrument for geoinformatics, spatial data collection helped to clarify the district level distribution of patients with CLP; this information is needed for policy planning and resource allocation.
Pierpont, J W; St Jacques, D; Seaver, L H; Erickson, R P
1995-03-01
An unusual family with Waardenburg syndrome type 1 (WSI), cleft lip (palate), and Hirschsprung disease is not linked to the PAX 3 gene since there is an obligate crossover which has occurred between PAX 3 DNA markers and the disorder in this family. This family may also have anticipation of the WSI traits as the proband's grandmother is nonpenetrant, his mother has dystopia canthorum, and severe cleft lip (palate), while the proband has dystopia canthorum, severe cleft lip (palate), and Hirschsprung disease. Thus, a locus other than PAX 3 is implicated in this Waardenburg-like syndrome with Hirschsprung disease and cleft lip (palate).
Storrer, Carmen Lucia Mueller; Valverde, Fabiane Kristine Bochenek; Santos, Felipe Rychuv; Deliberador, Tatiana Miranda
2014-09-01
The containment of the elevator muscle of the upper lip and wing of nose was used for the treatment of patients with gummy smile. This technique had corrected esthetic alterations of smile, reducing the upper lip elevation, which results in a smaller gingival display. An upper lip lengthening as well as a reduction in the upper lip shortening when the patient smiled could be observed. The high smile line was corrected without compromising the labial harmony. This study presents an innovative and effective therapeutic option to obtain a natural and harmonious smile. The patient expressed a high degree of satisfaction.
Surgical Tip for Prevention of Lip Injury During Orthognathic and Facial Bone Contouring Surgery.
Lee, Tae Sung; Park, Sanghoon
2017-10-01
Iatrogenic lip injury is a rather common complication after facial bone surgery, but is usually treated lightly by the surgeon compared with other more severe functional complications. However, these injuries can have permanent sequelae and can therefore be a reason for patient dissatisfaction, especially after cosmetic surgery. Intraoperative lip injuries during facial bone surgery are usually caused by heat-generating surgical instruments or forced traction on the operative fields. The authors have applied a special technical strategy using a hydrocolloid dressing material to avoid these intraoperative lip injuries. This method does not disturb the operative procedure itself, but efficiently prevents lip injuries and decreases surgical morbidities and postoperative swelling.
Two-Piece Extraoral Prosthetic Rehabilitation to a Perineural Invasion Lip Cancer.
Şahan, Makbule Heval; Eskiizmir, Görkem; Ateş, Pınar
2018-03-01
Lip cancers can severely affect a person in terms of function, esthetics, and psychological trauma. After surgical resection, lip defects require special rehabilitation. This clinical report describes a neck prosthesis of a male patient diagnosed with lower lip squamous cell carcinoma with perineural involvement. The neck prosthesis was connected to the mandibular complete denture with cobalt samarium magnets. Both prostheses improved the patient's mastication, deglutition, and esthetics. © 2016 by the American College of Prosthodontists.
Hilton, Said; Sattler, Gerhard; Berg, Anna-Karin; Samuelson, Ulf; Wong, Cindy
2018-02-01
Hyaluronic acid (HA) fillers may differ in terms of gel characteristics and ease of use and it is of interest whether this might affect safety and duration of effect. To compare the long-term safety and effect of 2 HA fillers produced by 2 different technologies for lip enhancement. Subjects with very thin to moderately thick lips were randomized and treated with HA-RK (N = 31) or HA-JV (N = 29) to improve lip fullness by ≥ 1 grade on a 5-point scale, using a maximum of 3 mL of product. A smaller volume of HA-RK compared with HA-JV was required to improve lip fullness by ≥ 1 grade (mean: 1.54 mL vs 1.94 mL, p < .001). Despite the smaller volume, lip fullness and global aesthetic improvement were comparably sustained in both groups. At 6 months, 60.0% versus 57.7% of subjects (HA-RK vs HA-JV) had improved lip fullness. At 12 months, 71.4% versus 76.0% had aesthetic improvement (blinded evaluations) and 85.7% versus 86.2% felt more attractive. Both products were well tolerated. Both products achieved durable improvement in lip fullness and aesthetic appearance. A significantly smaller amount of HA-RK was required compared with HA-JV to achieve optimal treatment effect.
Sattler, Gerhard; Berg, Anna-Karin; Samuelson, Ulf; Wong, Cindy
2018-01-01
BACKGROUND Hyaluronic acid (HA) fillers may differ in terms of gel characteristics and ease of use and it is of interest whether this might affect safety and duration of effect. OBJECTIVE To compare the long-term safety and effect of 2 HA fillers produced by 2 different technologies for lip enhancement. MATERIALS AND METHODS Subjects with very thin to moderately thick lips were randomized and treated with HA-RK (N = 31) or HA-JV (N = 29) to improve lip fullness by ≥ 1 grade on a 5-point scale, using a maximum of 3 mL of product. RESULTS A smaller volume of HA-RK compared with HA-JV was required to improve lip fullness by ≥ 1 grade (mean: 1.54 mL vs 1.94 mL, p < .001). Despite the smaller volume, lip fullness and global aesthetic improvement were comparably sustained in both groups. At 6 months, 60.0% versus 57.7% of subjects (HA-RK vs HA-JV) had improved lip fullness. At 12 months, 71.4% versus 76.0% had aesthetic improvement (blinded evaluations) and 85.7% versus 86.2% felt more attractive. Both products were well tolerated. CONCLUSION Both products achieved durable improvement in lip fullness and aesthetic appearance. A significantly smaller amount of HA-RK was required compared with HA-JV to achieve optimal treatment effect. PMID:29059146
NASA Astrophysics Data System (ADS)
Su, Hongfei; Mai, Zhimao; Zhang, Si
2016-12-01
A lipase gene, lip1233, isolated from Pseudoalteromonas lipolytica SCSIO 04301, was cloned and expressed in E. coli. The enzyme comprised 810 amino acid residues with a deduced molecular weight of 80 kDa. Lip1233 was grouped into the lipase family X because it contained a highly conserved motif GHSLG. The recombinant enzyme was purified with Ni-NTA affinity chromatography. The optimal temperature and pH value of Lip1233 were 45°C and 8.0, respectively. It retained more than 70% of original activity after being incubated in pH ranging from 6.0 to 9.5 for 30 min. It was stable when the temperature was below 45°C, but was unstable when the temperature was above 55°C. Most metal ions tested had no significant effect on the activity of Lip1233. Lip1233 remained more than original activity in some organic solvents at the concentration of 30% (v/v). It retained more than 30% activity after incubated in pure organic solvents for 12 h, while in hexane the activity was nearly 100%. Additionally, Lip1233 exhibited typical halotolerant characteristic as it was active under 4M NaCl. Lip1233 powder could catalyze efficiently the synthesis of fructose esters in hexane at 40°C. These characteristics demonstrated that Lip1233 is applicable to elaborate food processing and organic synthesis.
Paknahad, Maryam; Shahidi, Shoaleh; Bahrampour, Ehsan; Beladi, Amir Saied; Khojastepour, Leila
2018-01-01
Objective The purpose of the present study was to compare mandibular vertical asymmetry in patients with unilateral and bilateral cleft lip and palate and subjects with normal occlusion. Materials and Methods Cone beam computed tomography scans of three groups consisting of 20 patients with unilateral cleft lip and palate, 20 patients affected by bilateral cleft lip and palate, and a control group of 20 subjects with normal occlusion were analyzed for this study. Condylar, ramal, and condylar plus ramal asymmetry indices were measured for all subjects using the method of Habets et al. Kruskal-Wallis and Mann-Whitney tests were used to determine any significant differences between the groups for all indices at the 95% level of confidence. Results There were no significant differences regarding sex for all mandibular asymmetry indices in all three groups. All Asymmetry indices (condylar, ramal, and condylar plus ramal asymmetry) were significantly higher in the unilateral cleft group compared with the other two groups. Conclusion Cone beam computed tomography images showed that patients with cleft lip and palate suffered from mandibular asymmetry. Subjects with unilateral cleft lip and palate had a more asymmetric mandible compared with the bilateral cleft lip and palate and control groups. Therefore, the mandible appears to be the leading factor in facial asymmetry in subjects with unilateral cleft lip and palate.
Upper lip changes and gingival exposure on smiling: vertical dimension analysis.
Miron, Hagai; Calderon, Shlomo; Allon, Dror
2012-01-01
Our objectives were to evaluate and quantify upper lip soft-tissue changes in the vertical dimensions both at rest and at maximum smile, and to examine the correlation between upper labial vestibular attachment height and maxillary gingival exposure on smiling. Seventy-two volunteers (36 men, 36 women) aged 20 to 40 (mean, 30.49 years) were recruited for this study. For each subject, 9 measurements of upper lip position and maxillary incisor crown height at rest and in maximum smile were recorded. A statistically significant sexual dimorphism was apparent in most of the measured variables. Relaxed external upper lip length was 3.1 mm shorter in the women than in the men. The mean maxillary central incisor display at rest was 1.78 mm greater in the women than in the men. A high smile line was 2.5 times more prevalent in the women. The upper lip was shortened by 30% in subjects with a high smile line compared with 23% in subjects with a low smile line. The following findings were observed in subjects with a high smile pattern: (1) short upper lip length, (2) low smiling/resting upper lip length ratio, (3) inferior attachment of the upper labial vestibule, and (4) prominent upper lip vermilion. Copyright © 2012 American Association of Orthodontists. Published by Mosby, Inc. All rights reserved.
Lip line preference for variant face types.
Anwar, Nabila; Fida, Mubassar
2012-06-01
To determine the effect of altered lip line on attractiveness and to find preferred lip line for vertical face types in both genders. Cross-sectional analytical study. The Aga Khan University Hospital, Karachi, from May to July 2009. Photographs of two selected subjects were altered to produce three face types for the same individual with the aim of keeping the frame of the smile constant. Lip line was then altered for both the subjects as: both dentitions visible, upper incisors visible, upper incisors and 2 mm gum and 4 mm gum visible. The pictures were rated by different professionals for attractiveness. Descriptive statistics for the raters and multiple factor ANOVA was used to find the most attractive lip line. The total number of raters was 100 with the mean age of 30.3 ± 8 years. The alterations in the smile parameters produced statistically significant difference in the attractiveness of faces, whereas the perception difference was found to be insignificant amongst raters of different professions. Preferred lip line was the one showing only the upper incisors in dolico and mesofacial male and female genders whereas 2 mm gum show was preferred in brachyfacial subjects. The variability in lip line showed significant difference in the perceived attractiveness. Preferred lip lines as the one showing only the upper incisors in dolico and mesofacial male and female genders whereas 2 mm gum show was preferred in brachyfacial subjects.
Sánchez, Isis M; Gaud-Quintana, Sadja; Stern, Jacob K
Lip repositioning surgery to address excessive gingival display induced by different etiologies has received major attention recently. Several techniques and variations have been reported, including myotomy or repositioning of the levator labii superioris muscle, Le Fort impaction, maxillary gingivectomies, botulinum toxin injections, and lip stabilization. This study reports a case of excessive gingival display treated by a modified combined approach. A 25-year-old woman with a 4- to 8-mm gingival display when smiling caused by a combination of short clinical crowns induced by an altered passive eruption and hypermobility of the upper lip underwent a staged esthetic crown-lengthening procedure followed by a modified lip repositioning technique. A description of the technique and a comparison with other modes of therapy is discussed. This modified approach for treating the hypermobile lip included a bilateral removal of a partial-thickness strip of mucosa from the maxillary buccal vestibule without severing the muscle, leaving the midline frenum intact and suturing the lip mucosa to the mucogingival line. The narrower vestibule and increased tooth length resulted in a symmetric and pleasing gingival display when smiling that remained stable over time. With proper diagnosis and sequence of therapy, modified lip repositioning surgery combined with esthetic crown lengthening can be used predictably to treat excessive gingival display and enhance smile esthetics.
Oliveira, Tatiane R; Longhi, Mariana T; Gonçales, Amane P; de Morais, Zenaide M; Vasconcellos, Silvio A; Nascimento, Ana L T O
2010-03-01
The regulation of gene expression by environmental signals, such as temperature and osmolarity, has been correlated with virulence. In this study, we characterize the protein LipL53 from Leptospira interrogans, previously shown to react with serum sample of individual diagnosed with leptospirosis and to be up-regulated by shift to physiological osmolarity. The recombinant protein was expressed in Escherichia coli system, in insoluble form, recovered by urea solubilization and further refolded by decreasing the denaturing agent concentration during the purification procedure. The secondary structure content of the recombinant LipL53, as assessed by circular dichroism, showed a mixture of beta-strands and alpha-helix. The presence of LipL53 transcript at 28 degrees C was only detected within the virulent strains. However, upon shifted of attenuated cultures of pathogenic strains from 28 degrees C to 37 degrees C and to 39 degrees C, this transcript could also be observed. LipL53 binds laminin, collagen IV, cellular and plasma fibronectin in dose-dependent and saturable manner. Animal challenge studies showed that LipL53, although immunogenic, elicited only partial protection in hamsters. LipL53 is probably surface exposed as seen through immunofluorescence confocal microscopy. Our results suggest that LipL53 is a novel temperature regulated adhesin of L. interrogans that may be relevant in the leptospiral pathogenesis. Copyright 2009 Elsevier Masson SAS. All rights reserved.
A Novel Amidotransferase Required for Lipoic Acid Cofactor Assembly in Bacillus subtilis
Christensen, Quin H.; Martin, Natalia; Mansilla, Maria C.; de Mendoza, Diego; Cronan, John E.
2011-01-01
SUMMARY In the companion paper (Martin et al., 2011) we reported that Bacillus subtilis requires three proteins for lipoic acid metabolism, all of which are members of the lipoate protein ligase family. Two of the proteins, LipM and LplJ, have been shown to be an octanoyltransferase and a lipoate:protein ligase, respectively. The third protein, LipL, is essential for lipoic acid synthesis, but had no detectable octanoyltransferase or ligase activity either in vitro or in vivo. We report that LipM specifically modifies the glycine cleavage system protein, GcvH, and therefore another mechanism must exist for modification of other lipoic acid requiring enzymes (e.g., pyruvate dehydrogenase). We show that this function is provided by LipL which catalyzes the amidotransfer (transamidation) of the octanoyl moiety from octanoyl-GcvH to the E2 subunit of pyruvate dehydrogenase. LipL activity was demonstrated in vitro with purified components and proceeds via a thioester-linked acyl-enzyme intermediate. As predicted, ΔgcvH strains are lipoate auxotrophs. LipL represents a new enzyme activity. It is a GcvH:[lipoyl domain] amidotransferase that probably employs a Cys-Lys catalytic dyad. Although the active site cysteine residues of LipL and LipB are located in different positions within the polypeptide chains, alignment of their structures show these residues occupy similar positions. Thus, these two homologous enzymes have convergent architectures. PMID:21338421
An unexpected presentation of a traumatic wound on the lower lip: a case report
2014-01-01
Introduction Traumatic lip injuries present major challenges in terms of reconstructive options and the outcome of surgical management. The aetiology of lip injuries includes human bite as interpersonal violence. Bite wounds are always considered to be complex injuries contaminated with unique polymicrobial inoculum. A classification of facial bite injuries has been included and the surgical management of these lesions has also been discussed. We report a rare bite injury on the lower lip that resembled an ulcerative process. Case presentation A 30-year-old African man presented with a severe tissue defect on his lower lip to a Dental and Oral Department in Tanzania. He explained that 12 days ago he had been involved in a fight and someone had bitten his lower lip. An orofacial examination confirmed a serious loss of lip tissue that resembled a chronic ulcerative process. Accurate assessment of the lesion was made by a thorough evaluation of some parameters such as size, depth, presence of granulation tissue, fibrin coverage, wound edges, exudates and/or necrosis. A surgical debridement under local anaesthesia was carried out. Afterwards a layered suture was performed. Eventually the healing was complete and satisfactory. Conclusions A severe bite avulsive wound on the lower lip, despite the elapsed time before treatment, may have an excellent prognosis after a simple surgical procedure. PMID:25196423
Morphological evaluation of clefts of the lip, palate, or both in dogs.
Peralta, Santiago; Fiani, Nadine; Kan-Rohrer, Kimi H; Verstraete, Frank J M
2017-08-01
OBJECTIVE To systematically characterize the morphology of cleft lip, cleft palate, and cleft lip and palate in dogs. ANIMALS 32 client-owned dogs with clefts of the lip (n = 5), palate (23), or both (4) that had undergone a CT or cone-beam CT scan of the head prior to any surgical procedures involving the oral cavity or face. PROCEDURES Dog signalment and skull type were recorded. The anatomic form of each defect was characterized by use of a widely used human oral-cleft classification system on the basis of CT findings and clinical images. Other defect morphological features, including shape, relative size, facial symmetry, and vomer involvement, were also recorded. RESULTS 9 anatomic forms of cleft were identified. Two anatomic forms were identified in the 23 dogs with cleft palate, in which differences in defect shape and size as well as vomer abnormalities were also evident. Seven anatomic forms were observed in 9 dogs with cleft lip or cleft lip and palate, and most of these dogs had incisive bone abnormalities and facial asymmetry. CONCLUSIONS AND CLINICAL RELEVANCE The morphological features of congenitally acquired cleft lip, cleft palate, and cleft lip and palate were complex and varied among dogs. The features identified here may be useful for surgical planning, developing of clinical coding schemes, or informing genetic, embryological, or clinical research into birth defects in dogs and other species.
Xu, Jian Z; Zhang, Jun L; Hu, Kai H; Zhang, Wei G
2013-01-01
Mushrooms are able to secrete lignin peroxidase (LiP) and manganese peroxidase (MnP), and able to use the cellulose as sources of carbon. This article focuses on the relation between peroxidase-secreting capacity and cultivation period of mushrooms with non-laccase activity. Methylene blue and methyl catechol qualitative assay and spectrophotometry quantitative assay show LiP secreting unvaryingly accompanies the MnP secreting in mushroom strains. The growth rates of hyphae are detected by detecting the dry hyphal mass. We link the peroxidase activities to growth rate of mushrooms and then probe into the relationship between them. The results show that there are close relationships between LiP- and/or MnP-secretory capacities and the cultivation periods of mushrooms. The strains with high LiP and MnP activities have short cultivation periods. However, those strains have long cultivation periods because of the low levels of secreted LiP and/or MnP, even no detectable LiP and/or MnP activity. This study provides the first evidence on the imitate relation between the level of secreted LiP and MnP activities and cultivation periods of mushrooms with non-laccase activity. Our study has significantly increased the understanding of the role of LiP and MnP in the growth and development of mushrooms with non-laccase activity. PMID:22966760
Dental and periodontal complications of lip and tongue piercing: prevalence and influencing factors.
Plessas, A; Pepelassi, E
2012-03-01
The aim of this study was to compare the prevalence of lip and tongue piercing complications and explore the effect of ornament time wear period, habits, ornament morphology and periodontal biotype on the development of complications. One hundred and ten subjects with 110 lip and 51 tongue piercings were assessed for abnormal toothwear and/or tooth chipping/cracking (dental defects), gingival recession, clinical attachment loss and probing depth of teeth adjacent to the pierced site. Piercing habits (biting, rolling, stroking, sucking) were recorded. Wear time and habits significantly affected the prevalence of dental defects and gingival recession. Pierced site significantly affected dental defects prevalence, with greater prevalence for tongue than lip piercing. Wear time significantly affected attachment loss and probing depth. Attachment loss and probing depth did not significantly differ between tongue and lip piercings. Gingival recession was significantly associated with ornament height closure and stem length of tongue ornaments. Periodontal biotype was not significantly associated with gingival recession, attachment loss and probing depth. Dental defects prevalence is greater for tongue than lip piercing. Gingival recession is similar for tongue and lip piercing. Longer wear time of tongue and lip piercing is associated with greater prevalence of dental defects and gingival recession, as well as greater attachment loss and probing depth of teeth adjacent to pierced sites. Ornament morphology affects gingival recession prevalence. © 2012 Australian Dental Association.
Sun, Xiao-Cai; Xian, Xiao-Hui; Li, Wen-Bin; Li, Li; Yan, Cai-Zhen; Li, Qing-Jun; Zhang, Min
2010-08-01
This study investigates whether activation of p38 MAPK by the up-regulation of HSP 70 participates in the induction of brain ischemic tolerance by limb ischemic preconditioning (LIP). Western blot and immunohistochemical assays indicated that p38 MAPK activation occurred earlier than HSP 70 induction in the CA1 region of the hippocampus after LIP. P-p38 MAPK expression was up-regulated at 6h and reached its peak 12h after LIP, while HSP 70 expression was not significantly increased until 1 day and peaked 2 days after LIP. Neuropathological evaluation by thionin staining showed that quercetin (4 ml/kg, 50mg/kg, intraperitoneal injection), an inhibitor of HSP 70, blocked the protective effect of LIP against delayed neuronal death that is normally induced by lethal brain ischemic insult, indicating that HSP 70 participates in the induction of brain ischemic tolerance by LIP. Furthermore, SB 203580, an inhibitor of HSP 70, inhibited HSP 70 activation in the CA1 region of the hippocampus induced by LIP either with or without the presence of subsequent brain ischemic insult. Based on the above results, it can be concluded that activation of p38 MAPK participates in the brain ischemic tolerance induced by LIP at least partly by the up-regulation of HSP 70 expression. (c) 2010 Elsevier Inc. All rights reserved.
Large Igneous Provinces, Their Giant Mafic Dyke Swarms, and Links to Metallogeny
NASA Astrophysics Data System (ADS)
Jowitt, S.; Ernst, R. E.
2017-12-01
The relationships between large igneous provinces (LIPs), their giant dyke swarms and differing metallogenic systems can be condensed into five distinct although partially overlapping classifications: (1) LIP magmas that directly generate mineral deposits such as orthomagmatic Ni-Cu-PGE sulfides. Many carbonatites (Nb, Ta REE deposits) and kimberlites (diamonds) are also often LIP related. On the other hand, LIP-related thermal pulses (from a mantle plume) can sometimes destroy diamond potential in the overlying lithosphere. A key locus for Ni-Cu-PGE mineralization is within a few hundred km of the plume center region and plume centers are best located using giant radiating dyke swarms. Dyke subswarms with chalcophile element depletions can also be tracked "upstream" toward the plume center to identify exploration targets. (2) LIP magmas that provide energy, fluids, and/or metals for ore types such as hydrothermal volcanogenic massive sulfide (VMS) and iron oxide-copper-gold (IOCG) deposits. Heat loss from the margins of dykes and sills can also generate local enrichments in key metals (e.g. Co) within the surrounding sedimentary rocks. (3) LIP rocks (particularly sills and dykes) can act barriers to fluid flow and/or as reaction zones that control mineralizing events, act as structural traps within hydrocarbon systems, and form impermeable barriers that control water flow and hence aquifer formation (4) surficial effects, such as the formation of Ni-Co laterites and Al bauxites from tropical weathering of LIP mafic-ultramafic rocks (including volcanics fed by radiating dykes as well as the dykes themselves). This category also includes LIP-related anoxia events that generate hydrocarbon source rocks; and (5) indirect links between LIPs and ore deposits, where continental breakup-related LIP events define a `barcode' record (usually dominated by dyke swarms) that can be used to correlate and reconstruct Precambrian supercontinents. This fifth classification type also includes links between major continental breakup (linked to LIPs and their dyke swarms) and distal compression and transpression in the plate tectonic circuit, leading to the formation of orogeny-related deposits such as orogenic Au mineralization.
Cheiloscopy and dactyloscopy: Do they dictate personality patterns?
Abidullah, Mohammed; Kumar, M Naveen; Bhorgonde, Kavita D; Reddy, D Shyam Prasad
2015-01-01
Cheiloscopy and dactyloscopy, both are well-established forensic tools used in individual identification in any scenario be it a crime scene or civil cause. Like finger prints, lip prints are unique and distinguishable for every individual. But their relationship to personality types has not been established excepting the hypothesis stating that finger prints could explain these personality patterns. The study was aimed to record and correlate the lip and finger prints with that of character/personality of a person. The lip and finger prints and character of a person were recorded and the data obtained was subjected for statistical analysis, especially for Pearson's Chi-square test and correlation/association between the groups was also studied. The study sample comprised of 200 subjects, 100 males and 100 females, aged between 18 and 30 years. For recording lip prints, brown/pink-colored lipstick was applied on the lips and the subjects were asked to spread uniformly over the lips. Lip prints were traced in the normal rest position on a plain white bond paper. For recording the finger prints, imprints of the fingers were taken on a plain white bond paper using ink pad. The collected prints were visualized using magnifying lens. To record the character of person, a pro forma manual for multivariable personality inventory by Dr. BC Muthayya was used. Data obtained was subjected for statistical analysis, especially for Pearson's Chi-square test and correlation/association between the groups was also studied. In males, predominant lip pattern recorded was Type I with whorls-type finger pattern and the character being ego ideal, pessimism, introvert, and dogmatic; whereas in females, predominant lip pattern recorded was Type II with loops-type finger pattern and the character being neurotic, need achievers, and dominant. Many studies on lip pattern, finger pattern, palatal rugae, etc., for individual identification and gender determination exist, but correlative studies are scanty. This is the first study done on correlating patterns, that is, lip and finger pattern with the character of a person. With this study we conclude that this correlation can be used as an adjunct in the investigatory process in forensic sciences.
Congenital Median Upper Lip Fistula
al Aithan, Bandar
2012-01-01
Congenital median upper lip fistula (MULF) is an extremely rare condition resulting from abnormal fusion of embryologic structures. We present a new case of congenital medial upper lip fistula located in the midline of the philtrum of a 6 year old girl. PMID:22953305
Rational evolution of the unusual Y-type oxyanion hole of Rhodococcus sp. CR53 lipase LipR.
Infanzón, Belén; Sotelo, Pablo H; Martínez, Josefina; Diaz, Pilar
2018-01-01
Rhodococcus sp CR-53 lipase LipR was the first characterized member of bacterial lipase family X. Interestingly, LipR displays some similarity with α/β-hydrolases of the C. antartica lipase A (CAL-A)-like superfamily (abH38), bearing a Y-type oxyanion hole, never found before among bacterial lipases. In order to explore this unusual Y-type oxyanion hole, and to improve LipR performance, two modification strategies based on site directed or saturation mutagenesis were addressed. Initially, a small library of mutants was designed to convert LipR Y-type oxyanion hole (YDS) into one closer to those most frequently found in bacteria (GGG(X)). However, activity was completely lost in all mutants obtained, indicating that the Y-type oxyanion hole of LipR is required for activity. A second approach was addressed to modify the two main oxyanion hole residues Tyr 110 and Asp 111 , previously described for CAL-A as the most relevant amino acids involved in stabilization of the enzyme-substrate complex. A saturation mutagenesis library was prepared for each residue (Tyr 110 and Asp 111 ), and activity of the resulting variants was assayed on different chain length substrates. No functional LipR variants could be obtained when Tyr 110 was replaced by any other amino acids, indicating that this is a crucial residue for catalysis. However, among the Asp 111 variants obtained, LipR D111G produced a functional enzyme. Interestingly, this LipR-YGS variant showed less activity than wild type LipR on short- or mid- chain substrates but displayed a 5.6-fold increased activity on long chain length substrates. Analysis of the 3D model and in silico docking studies of this enzyme variant suggest that substitution of Asp by Gly produces a wider entrance tunnel that would allow for a better and tight accommodation of larger substrates, thus justifying the experimental results obtained. Copyright © 2017 Elsevier Inc. All rights reserved.
European survey on the content of lead in lip products.
Piccinini, Paola; Piecha, Małgorzata; Torrent, Salvador Fortaner
2013-03-25
223 lip articles (representing 55 brands) were purchased in 15 European Union Member States and analysed for lead content. Various lip products (lipsticks and lip glosses), shades (red, brown, purple and pink) and price ranges (3 categories) were investigated. The analytical method employed a microwave-assisted acid digestion followed by ICP-MS determination. The results revealed that 49 samples (22%) contained lead at a level higher than 1mg/kg, representing 31% of the tested lipsticks and 4% of the lip glosses. On average, the lead content found in lipsticks (0.75mg/kg) was nearly double that found in lip glosses (0.38mg/kg) and this difference was judged statistically significant at 95% probability. Apart from brown, statistically significant higher levels of lead were also found when comparing the average lead contents in lipsticks and lip glosses of the same shade: pink (0.81 and 0.38mg/kg), purple (0.88 and 0.37mg/kg) and red (0.58 and 0.25mg/kg). The influence of price on lead content was studied on the two lip product types separately. In the case of lip glosses no differences were found. In the case of lipsticks, the more expensive items (price category III) contained a significantly lower quantity of lead in comparison to the cheapest articles (price category I). The lipsticks containing the highest levels of lead belonged to the price category II. In all cases, however, the actual lead concentration measured in the finished products is far below the recommended limits for Germany (20mg/kg) or Canada (10mg/kg). The outcome of this work delivers information about the current situation on the European market and provides information to policy-makers about the quantities of lead in lip articles and technically achievable levels. Copyright © 2012 Elsevier B.V. All rights reserved.
Qiao-ling, Z; Yi, Z; Min, G; Di-jia, Y; Xiao-feng, Z; Yang, L; Jing-yu, X; Ying, W; Zong-lin, G; Kong-lang, X; Ai-jun, Z; Wei-liang, C; Lin-sen, S; Xue-nong, Z; Qiang, Z
2012-01-01
Liposomes loaded with lactosyl-norcantharidin phospholipid complex (LPC) were prepared, in which soybean phosphatidylcholine was used to improve the liposolubility of lactosyl-norcantharidin (Lac-NCTD). The pH-sensitive LPC liposomes (pH-LPC-lips) were obtained by electrostatic adsorption of the carboxymethyl chitosan onto the surface of the liposomes. The in vitro drug release of pH-LPC-lips and LPC-lips was investigated in dissolution media with pH ranging from 1.0 to 8.0. The in vitro antitumor activity and cellular uptake of Lac-NCTD and its liposomes to HepG2 cells were studied. The pH-LPC-lips demonstrated strong cytotoxicity against the cells and easily permeated the cell membrane. The in vivo antitumor activities of Lac-NCTD and its liposomes were evaluated in mice bearing H22 liver tumors. The pH-LPC-lips displayed the best tumor inhibitory effect. The optical imaging results indicated that Cy7- labeled pH-LPC-lips showed excellent hepatocyte specificity in H22 tumor-bearing mice. Therefore, pH-LPC-lips can be regarded as liver-targeting agents that combine targeting and active releasing.
A case of labio-facial necrotizing fasciitis complicating acne.
Eltayeb, Amel Salah; Ahmad, Abdelnasir Gafar; Elbeshir, Elnour Ibrahim
2016-04-23
Facial necrotizing fasciitis is extremely rare. Most of the cases reported in literature are related to dental, sinus, tonsillar and salivary glands causes, but rarely as consequence of skin infection. We report a unique case of lower lip cellulitis, which was initially misdiagnosed as angioedema and subsequently progressed into lower lip necrotizing fasciitis. This is a case report of necrotizing fasciitis involving the lower lip as a consequence of infected skin acne in a 19 year old black female. The patient had been diagnosed earlier as a case of angioedema by a physician and treated accordingly. She was mildly anemic, hyponatremic and hypokalemic. Treatment was started immediately by incision, drainage and full debridement of the whole necrotic tissue. Triple antibiotic therapy was administered and daily irrigation and dressing were performed until full recovery. Complete healing occurred within a month by secondary intention. This case demonstrates the misdiagnosis of a lip swelling leading to the development of labiofacial necrotizing fasciitis, a serious and life threatening condition. Lip angioedema is a common condition; however, lip fasciitis is rare. A broad differential diagnosis in case of lower lip swelling is essential to avoid inappropriate treatment delay.
Lip Movement Exaggerations During Infant-Directed Speech
Green, Jordan R.; Nip, Ignatius S. B.; Wilson, Erin M.; Mefferd, Antje S.; Yunusova, Yana
2011-01-01
Purpose Although a growing body of literature has indentified the positive effects of visual speech on speech and language learning, oral movements of infant-directed speech (IDS) have rarely been studied. This investigation used 3-dimensional motion capture technology to describe how mothers modify their lip movements when talking to their infants. Method Lip movements were recorded from 25 mothers as they spoke to their infants and other adults. Lip shapes were analyzed for differences across speaking conditions. The maximum fundamental frequency, duration, acoustic intensity, and first and second formant frequency of each vowel also were measured. Results Lip movements were significantly larger during IDS than during adult-directed speech, although the exaggerations were vowel specific. All of the vowels produced during IDS were characterized by an elevated vocal pitch and a slowed speaking rate when compared with vowels produced during adult-directed speech. Conclusion The pattern of lip-shape exaggerations did not provide support for the hypothesis that mothers produce exemplar visual models of vowels during IDS. Future work is required to determine whether the observed increases in vertical lip aperture engender visual and acoustic enhancements that facilitate the early learning of speech. PMID:20699342
Ueki, Koichiro; Moroi, Akinori; Sotobori, Megumi; Ishihara, Yuri; Marukawa, Kohei; Iguchi, Ran; Kosaka, Akihiko; Ikawa, Hiroumi; Nakazawa, Ryuichi; Higuchi, Masatoshi
2014-10-01
The purpose of this study was to evaluate the relationship between lip closing force, occlusal contact area and occlusal force after orthognathic surgery in skeletal Class III patients. The subjects consisted of 54 patients (28 female and 26 male) diagnosed with mandibular prognathism who underwent sagittal split ramus osteotomy with and without Le Fort I osteotomy. Maximum and minimum lip closing forces, occlusal contact area and occlusal force were measured pre-operatively, 6 months and 1 year post-operative. Maximum and minimum lip closing forces, occlusal contact area and occlusal force increased with time after surgery, however a significant increase was not found in the occlusal contact area in women. In increased ratio (6 months/pre-operative and 1 year/pre-operative), the maximum lip closing force was significantly correlated with the occlusal contact area (P < 0.0001). This study suggested that orthognathic surgery could improve the occlusal force, contact area and lip closing force, and an increase ratio in maximum lip closing force was associated with an increased ratio in occlusal contact area. Copyright © 2014 European Association for Cranio-Maxillo-Facial Surgery. Published by Elsevier Ltd. All rights reserved.
Kalaskar, Ritesh; Kalaskar, Ashita; Naqvi, Fatama Sana; Tawani, Gopal S; Walke, Damayanti R
2013-01-01
Cleft lip and palate, the most common developmental deformity seen worldwide, may be either genetic or environmental in origin. Recent research clearly shows the inter-relationship between environmental risk factors and development of oral clefts. The purpose of this study was to determine the prevalence of cleft lip and palate in the Nagpur region of India and to evaluate environmental risk factors associated with the occurrence of this orofacial abnormality. The parents of infants born with or without cleft lip and palate were subjected to questionnaires that elicited sociodemographic profiles and histories of maternal dietary, medical, and environmental risk factors as well family histories of cleft. A multifactorial comparison of environmental risk factors associated with this deformity was performed. The prevalence of cleft lip and palate and cleft palate was found to be 0.66% and 0.27%, respectively, in the Nagpur region. The results demonstrated a positive association between cleft lip and palate and the environmental risk factors of nutritional deficiency, anemia, and self-administered medications. Several environmental risk factors appear to play an important role in the development of cleft lip and palate in a Central Indian population of low socioeconomic status.
Photodynamic Therapy With HPPH in Treating Patients With Squamous Cell Carcinoma of the Oral Cavity
2016-04-19
Recurrent Squamous Cell Carcinoma of the Lip and Oral Cavity; Recurrent Squamous Cell Carcinoma of the Oropharynx; Recurrent Verrucous Carcinoma of the Oral Cavity; Stage I Squamous Cell Carcinoma of the Lip and Oral Cavity; Stage I Squamous Cell Carcinoma of the Oropharynx; Stage I Verrucous Carcinoma of the Oral Cavity; Stage II Squamous Cell Carcinoma of the Lip and Oral Cavity; Stage II Squamous Cell Carcinoma of the Oropharynx; Stage II Verrucous Carcinoma of the Oral Cavity; Stage III Squamous Cell Carcinoma of the Lip and Oral Cavity; Stage III Squamous Cell Carcinoma of the Oropharynx; Stage III Verrucous Carcinoma of the Oral Cavity; Stage IVA Squamous Cell Carcinoma of the Lip and Oral Cavity; Stage IVA Squamous Cell Carcinoma of the Oropharynx; Stage IVA Verrucous Carcinoma of the Oral Cavity; Stage IVB Squamous Cell Carcinoma of the Lip and Oral Cavity; Stage IVB Squamous Cell Carcinoma of the Oropharynx; Stage IVB Verrucous Carcinoma of the Oral Cavity; Stage IVC Squamous Cell Carcinoma of the Lip and Oral Cavity; Stage IVC Squamous Cell Carcinoma of the Oropharynx; Stage IVC Verrucous Carcinoma of the Oral Cavity
NASA Astrophysics Data System (ADS)
Ameen, Sheeraz; Taher, Taha; Ahmed, Thamir M.
2018-06-01
Hydrostatics and hydrodynamics forces are generated and applied on the vertical lift tunnel gates due to the influence of a wide range of dam operating conditions. One of the most important forces is the uplift force resulting from the jet flow issuing below the gate. This force is based mainly upon many hydraulic and geometrical parameters. In this work, the uplift force is studied in terms of bottom pressure coefficient. The investigation is made paying particular attention on the effects of various three discharges and three gate lip angles on values of bottom pressure coefficients in addition to four different tunnel longitudinal slopes whose impact has not been studied in many previous works. Hydraulic model is constructed in this work for the sake of measuring all parameters required for estimating the bottom pressure coefficients, which are all examined against gate openings. The results show that the bottom pressure coefficient is related to the said variables, however, its behaviour and values are not necessary regular with variance of studied variables. The values are seen more significantly related to the flow rates and for some extent to the slopes of tunnel. An attempt by using the nonlinear regression of Statistical package of social sciences (SPSS) is made to set equations relating bottom pressure coefficient with gate openings for several angles of gate lips. The obtained equations are shown in good agreement with the selected cases of experimental results. The results are applicable for design purposes for similar geometrical and flow parameters considered in this study.
Lower Lip Suspension Using Bilateral Temporalis Muscle Flaps and Fascia Lata Grafts
2012-01-01
from recurrent lower lip drooping, mani- fested as drooling, dribbling, and speech problems, and it is a cause of much social embarrassment. The ideal...to simulate the lower lip in repose , erring on the tight side with the expectation that some laxity will result postoperatively (Fig. 2). Fig. 1. A...lower lip in repose , erring on the tight side with the expec- tation that some laxity will result postoperatively. Fig. 3. A 16-year-old girl
NASA Technical Reports Server (NTRS)
Hoffman, T. R.
2000-01-01
Researchers at the NASA Glenn Research Center at Lewis Field successfully tested a variable cowl lip inlet at simulated takeoff conditions in Glenn s 10- by 10-Foot Supersonic Wind Tunnel (10x10 SWT) as part of the High-Speed Research Program. The test was a follow-on to the Two-Dimensional Bifurcated (2DB) Inlet/Engine test. At the takeoff condition for a High-Speed Civil Transport aircraft, the inlet must provide adequate airflow to the engine with an acceptable distortion level and high-pressure recovery. The test was conducted to study the effectiveness of installing two rotating lips on the 2DB Inlet cowls to increase mass flow rate and eliminate or reduce boundary layer flow separation near the lips. Hardware was mounted vertically in the test section so that it extended through the tunnel ceiling and that the 2DB Inlet was exposed to the atmosphere above the test section. The tunnel was configured in the aerodynamic mode, and exhausters were used to pump down the tunnel to vacuum levels and to provide a maximum flow rate of approximately 58 lb/sec. The test determined the (1) maximum flow in the 2DB Inlet for each variable cowl lip, (2) distortion level and pressure recovery for each lip configuration, (3) boundary layer conditions near variable lips inside the 2DB Inlet, (4) effects of a wing structure adjacent to the 2DB Inlet, and (5) effects of different 2DB Inlet exit configurations. It also employed flow visualization to generate enough qualitative data on variable lips to optimize the variable lip concept. This test was a collaborative effort between the Boeing Company and Glenn. Extensive inhouse support at Glenn contributed significantly to the progress and accomplishment of this test.
Sobol, Danielle L; Allori, Alexander C; Carlson, Anna R; Pien, Irene J; Watkins, Stephanie E; Aylsworth, Arthur S; Meyer, Robert E; Pimenta, Luiz A; Strauss, Ronald P; Ramsey, Barry L; Raynor, Eileen; Marcus, Jeffrey R
2016-12-01
The aesthetic aspects of the cleft lip nasal deformity have been appreciated for over a century, but the functional implications have remained largely underappreciated or misunderstood. This study describes the frequency and severity of nasal obstructive symptoms among children with cleft lip and/or cleft palate, addressing the hypotheses that age, cleft type, and severity are associated with the development of nasal obstructive symptoms. Children with nonsyndromic cleft lip and/or cleft palate and a comparison group of unaffected children born from 1997 to 2003 were identified through the North Carolina Birth Defects Monitoring Program and birth certificates. Nasal airway obstruction was measured using the validated Nasal Obstruction Symptom Evaluation scale. The survey was completed by parental proxy for 176 children with cleft lip and/or cleft palate and 333 unaffected children. Nasal obstructive symptoms were more frequently reported in cleft lip with cleft palate compared with unaffected children (p < 0.0001); children who had isolated cleft lip with or without alveolus and isolated cleft palate were not statistically different from unaffected children. Patients with unilateral cleft lip with cleft palate were found to be more severely affected than bilateral cases. Nasal obstruction was observed in early childhood, although severity worsened in adolescence. This population-based study reports a high prevalence of nasal obstructive symptoms in children with cleft lip and/or cleft palate based on type and severity of the cleft. The authors encourage cleft teams to consider using this or similar screening methods to identify which children may benefit from functional rhinoplasty. Risk, I.
Ma, Xiaoran; McPherson, Bradley; Ma, Lian
2016-03-01
Objective Children with nonsyndromic cleft lip and/or palate often have a high prevalence of middle ear dysfunction. However, there are also indications that they may have a higher prevalence of (central) auditory processing disorder. This study used Fisher's Auditory Problems Checklist for caregivers to determine whether children with nonsyndromic cleft lip and/or palate have potentially more auditory processing difficulties compared with craniofacially normal children. Methods Caregivers of 147 school-aged children with nonsyndromic cleft lip and/or palate were recruited for the study. This group was divided into three subgroups: cleft lip, cleft palate, and cleft lip and palate. Caregivers of 60 craniofacially normal children were recruited as a control group. Hearing health tests were conducted to evaluate peripheral hearing. Caregivers of children who passed this assessment battery completed Fisher's Auditory Problems Checklist, which contains 25 questions related to behaviors linked to (central) auditory processing disorder. Results Children with cleft palate showed the lowest scores on the Fisher's Auditory Problems Checklist questionnaire, consistent with a higher index of suspicion for (central) auditory processing disorder. There was a significant difference in the manifestation of (central) auditory processing disorder-linked behaviors between the cleft palate and the control groups. The most common behaviors reported in the nonsyndromic cleft lip and/or palate group were short attention span and reduced learning motivation, along with hearing difficulties in noise. Conclusion A higher occurrence of (central) auditory processing disorder-linked behaviors were found in children with nonsyndromic cleft lip and/or palate, particularly cleft palate. Auditory processing abilities should not be ignored in children with nonsyndromic cleft lip and/or palate, and it is necessary to consider assessment tests for (central) auditory processing disorder when an auditory diagnosis is made for this population.
Perceptual distortion of face deletion by local anaesthesia of the human lips and teeth.
Türker, Kemal S; Yeo, Purdee L M; Gandevia, Simon C
2005-08-01
As visual guidance of facial movements is impossible, accurate movements for speech and mastication require an established body image that is formed via the information from mechanoreceptors in the skin, mucosa, periodontium, and proprioceptors in the facial and masticatory muscles and in the jaw joints. In this study we aimed to investigate how the acute deafferentation of lips and teeth alters the established image of lips, teeth and the thumb. We used a psychophysical method to determine whether the perceived sizes of the upper lip and front teeth change when the sensory input from the lips and front teeth is fully blocked. We also examined the perceived size of the thumb to test for acute interactions between the thumb and facial structures. Local anaesthetic blocking of upper lip and upper front teeth significantly increased the perceived size of the upper lip by as much as 100% (range 21-100%) in ten out of eleven subjects tested (overall mean 52%; p=0.001). The perceived size of the upper teeth also significantly increased by as much as 155% (range 30-155%) in eight of the eleven subjects during anaesthesia (overall mean 41%; p=0.035). When the region of anaesthesia was increased and both upper and lower teeth and lips were anaesthetised, the perceived size of the upper lip again increased, by 53% (p=0.040), but the change in perceived size of the upper front teeth (18%) was not significant (p=0.206). In both studies there was no change in perceived size of the thumb. The results illustrate the labile central interaction between sensory inputs and the importance of feedback from peripheral afferents in generating the subjective facial image. The timing, level, and area of anaesthesia may be important modifiers of these interactions.
Shay, Paul L; Goldstein, Jesse A; Paliga, J Thomas; Wink, Jason; Jackson, Oksana A; Low, David; Bartlett, Scott P; Taylor, Jesse A
2015-12-01
Patients with complete cleft lip and palate may benefit from cleft lip adhesion or nasoalveolar molding before formal cleft lip repair. The authors compared the relative costs to insurers of these two treatment modalities and the burden of care to families. A retrospective analysis was performed of cleft lip and palate patients treated with nasoalveolar molding or cleft lip adhesion at The Children's Hospital of Philadelphia between January of 2007 and June of 2012. Demographic, appointment, and surgical data were reviewed; surgical, inpatient hospital, and orthodontic charges and costs were obtained. Multivariate linear regression and two-sample, two-tailed independent t tests were performed to compare cost and appointment data between groups. Forty-two cleft adhesion and 35 nasoalveolar molding patients met inclusion criteria. Mean costs for nasoalveolar molding were $3550.24 ± $667.27. Cleft adhesion costs, consisting of both hospital and surgical costs, were $9370.55 ± $1691.79. Analysis of log costs demonstrated a significant difference between the groups, with the mean total cost for nasoalveolar molding significantly lower than that for adhesion (p < 0.0001). Nasoalveolar molding patients had significantly more made, cancelled, no-show, and missed visits and a higher missed percentage than adhesion patients (p < 0.0001) for all except no-show appointments, (p = 0.0199), indicating a higher burden of care to families. Nasoalveolar molding may cost less before formal cleft lip repair treatment than cleft lip adhesion. Third-party payers who cover adhesion and not nasoalveolar molding may not be acting in their own best interest. Nasoalveolar molding places a higher burden of care on families, and this fact should be considered in planning treatment.
Manousaki, Tereza; Hull, Pincelli M; Kusche, Henrik; Machado-Schiaffino, Gonzalo; Franchini, Paolo; Harrod, Chris; Elmer, Kathryn R; Meyer, Axel
2013-02-01
The study of parallel evolution facilitates the discovery of common rules of diversification. Here, we examine the repeated evolution of thick lips in Midas cichlid fishes (the Amphilophus citrinellus species complex)-from two Great Lakes and two crater lakes in Nicaragua-to assess whether similar changes in ecology, phenotypic trophic traits and gene expression accompany parallel trait evolution. Using next-generation sequencing technology, we characterize transcriptome-wide differential gene expression in the lips of wild-caught sympatric thick- and thin-lipped cichlids from all four instances of repeated thick-lip evolution. Six genes (apolipoprotein D, myelin-associated glycoprotein precursor, four-and-a-half LIM domain protein 2, calpain-9, GTPase IMAP family member 8-like and one hypothetical protein) are significantly underexpressed in the thick-lipped morph across all four lakes. However, other aspects of lips' gene expression in sympatric morphs differ in a lake-specific pattern, including the magnitude of differentially expressed genes (97-510). Generally, fewer genes are differentially expressed among morphs in the younger crater lakes than in those from the older Great Lakes. Body shape, lower pharyngeal jaw size and shape, and stable isotopes (δ(13)C and δ(15)N) differ between all sympatric morphs, with the greatest differentiation in the Great Lake Nicaragua. Some ecological traits evolve in parallel (those related to foraging ecology; e.g. lip size, body and head shape) but others, somewhat surprisingly, do not (those related to diet and food processing; e.g. jaw size and shape, stable isotopes). Taken together, this case of parallelism among thick- and thin-lipped cichlids shows a mosaic pattern of parallel and nonparallel evolution. © 2012 Blackwell Publishing Ltd.
Attaluri, Anilchandra; Seshadri, Madhav; Mirpour, Sahar; Wabler, Michele; Marinho, Thomas; Furqan, Muhammad; Zhou, Haoming; De Paoli, Silvia; Gruettner, Cordula; Gilson, Wesley; DeWeese, Theodore; Garcia, Monica; Ivkov, Robert; Liapi, Eleni
2016-01-01
Purpose/objective The aim of this study was to develop and investigate the properties of a magnetic iron oxide nanoparticle–ethiodised oil formulation for image-guided thermal therapy of liver cancer. Materials and methods The formulation comprises bionised nano-ferrite (BNF) nanoparticles suspended in ethiodised oil, emulsified with polysorbate 20 (BNF-lip). Nanoparticle size was measured via photon correlation spectroscopy and transmission electron microscopy. In vivo thermal therapy capability was tested in two groups of male Foxn1nu mice bearing subcutaneous HepG2 xenograft tumours. Group I (n =12) was used to screen conditions for group II (n =48). In group II, mice received one of BNF-lip (n =18), BNF alone (n =16), or PBS (n =14), followed by alternating magnetic field (AMF) hyperthermia, with either varied duration (15 or 20 min) or amplitude (0, 16, 20, or 24 kA/m). Image-guided fluoroscopic intra-arterial injection of BNF-lip was tested in New Zealand white rabbits (n =10), bearing liver VX2 tumours. The animals were subsequently imaged with CT and 3 T MRI, up to 7 days post-injection. The tumours were histopathologically evaluated for distribution of BNF-lip. Results The BNF showed larger aggregate diameters when suspended in BNF-lip, compared to clear solution. The BNF-lip formulation produced maximum tumour temperatures with AMF >20 kA/m and showed positive X-ray visibility and substantial shortening of T1 and T2 relaxation time, with sustained intratumoural retention up to 7 days post-injection. On pathology, intratumoural BNF-lip distribution correlated well with CT imaging of intratumoural BNF-lip distribution. Conclusion The BNF-lip formulation has favourable thermal and dual imaging capabilities for image-guided thermal therapy of liver cancer, suggesting further exploration for clinical applications. PMID:27151045
Pisula, Ewa; Lukowska, Ewa; Fudalej, Piotr S
2014-05-01
Objectives : To evaluate self-esteem, coping styles, and health-related quality of life and their relationships in Polish adolescents and young adults with unilateral complete cleft lip and palate and related sex differences. Design and Participants : Self-report questionnaires measuring self-esteem (Multidimensional Self-Esteem Inventory), coping styles (Coping Inventory for Stressful Situations), and health-related quality of life (WHOQOL-BREF) were completed by 48 participants with cleft lip and palate (age, 16 to 23 years; 31 males, 17 females) and 48 controls without cleft lip and palate (age, 16 to 23 years; 28 males, 20 females) matched for age, place of residence, and socioeconomic status. Results : Regarding self-esteem, individuals with cleft lip and palate scored higher on body functioning (P < .01) and defensive self-enhancement (P < .05). Self-control showed an interaction effect: Females with cleft lip and palate scored higher than controls, but males did not differ between groups (P < .05). Males with cleft lip and palate scored lower than controls in personal power but higher in body functioning (P < .05); females showed no differences between groups. The groups did not differ with regard to coping styles or quality of life, but several correlations were found between self-esteem and coping styles, and quality of life (P < .01). Conclusions : Late adolescents and young adults with and without cleft lip and palate differed little in terms of psychological adjustment measures. The higher scores in defensive self-enhancement of individuals with cleft lip and palate suggest the need for instruments measuring social approval in psychosocial adjustment research involving this group.
Kumari, Arti; Gupta, Rani
2014-01-01
One of the major issues with heterologous production of proteins in Pichia pastoris X33 under AOX1 promoter is repeated methanol induction. To obviate repeated methanol induction, methyl esters were used as a slow release source of methanol in lipase expressing mut+ recombinant. Experimental design was based on the strategy that in presence of lipase, methyl esters can be hydrolysed to release their products as methanol and fatty acid. Hence, upon break down of methyl esters by lipase, first methanol will be used as a carbon source and inducer. Then P. pastoris can switch over to fatty acid as a carbon source for multiplication and biomass maintenance till further induction by methyl esters. We validated this strategy using recombinant P. pastoris expressing Lip A, Lip C from Trichosporon asahii and Lip11 from Yarrowia lipolytica. We found that the optimum lipase yield under repeated methanol induction after 120 h was 32866 U/L, 28271 U/L and 21978 U/L for Lip C, Lip A and Lip 11 respectively. In addition, we found that a single dose of methyl ester supported higher production than repeated methanol induction. Among various methyl esters tested, methyl oleate (0.5%) caused 1.2 fold higher yield for LipA and LipC and 1.4 fold for Lip11 after 120 h of induction. Sequential utilization of methanol and oleic acid by P. pastoris was observed and was supported by differential peroxisome proliferation studies by transmission electron microscopy. Our study identifies a novel strategy of using methyl esters as slow release methanol source during lipase expression. PMID:25170843
Improving lip wrinkles: lipstick-related image analysis.
Ryu, Jong-Seong; Park, Sun-Gyoo; Kwak, Taek-Jong; Chang, Min-Youl; Park, Moon-Eok; Choi, Khee-Hwan; Sung, Kyung-Hye; Shin, Hyun-Jong; Lee, Cheon-Koo; Kang, Yun-Seok; Yoon, Moung-Seok; Rang, Moon-Jeong; Kim, Seong-Jin
2005-08-01
The appearance of lip wrinkles is problematic if it is adversely influenced by lipstick make-up causing incomplete color tone, spread phenomenon and pigment remnants. It is mandatory to develop an objective assessment method for lip wrinkle status by which the potential of wrinkle-improving products to lips can be screened. The present study is aimed at finding out the useful parameters from the image analysis of lip wrinkles that is affected by lipstick application. The digital photograph image of lips before and after lipstick application was assessed from 20 female volunteers. Color tone was measured by Hue, Saturation and Intensity parameters, and time-related pigment spread was calculated by the area over vermilion border by image-analysis software (Image-Pro). The efficacy of wrinkle-improving lipstick containing asiaticoside was evaluated from 50 women by using subjective and objective methods including image analysis in a double-blind placebo-controlled fashion. The color tone and spread phenomenon after lipstick make-up were remarkably affected by lip wrinkles. The level of standard deviation by saturation value of image-analysis software was revealed as a good parameter for lip wrinkles. By using the lipstick containing asiaticoside for 8 weeks, the change of visual grading scores and replica analysis indicated the wrinkle-improving effect. As the depth and number of wrinkles were reduced, the lipstick make-up appearance by image analysis also improved significantly. The lip wrinkle pattern together with lipstick make-up can be evaluated by the image-analysis system in addition to traditional assessment methods. Thus, this evaluation system is expected to test the efficacy of wrinkle-reducing lipstick that was not described in previous dermatologic clinical studies.
Matsui, Mariko; Soupé, Marie-Estelle; Becam, Jérôme; Goarant, Cyrille
2012-09-01
Transcripts of Leptospira 16S rRNA, FlaB, LigB, LipL21, LipL32, LipL36, LipL41, and OmpL37 were quantified in the blood of susceptible (hamsters) and resistant (mice) animal models of leptospirosis. We first validated adequate reference genes and then evaluated expression patterns in vivo compared to in vitro cultures. LipL32 expression was downregulated in vivo and differentially regulated in resistant and susceptible animals. FlaB expression was also repressed in mice but not in hamsters. In contrast, LigB and OmpL37 were upregulated in vivo. Thus, we demonstrated that a virulent strain of Leptospira differentially adapts its gene expression in the blood of infected animals.
Interaction Between Spatial and Feature Attention in Posterior Parietal Cortex
Ibos, Guilhem; Freedman, David J.
2016-01-01
Summary Lateral intraparietal (LIP) neurons encode a vast array of sensory and cognitive variables. Recently, we proposed that the flexibility of feature representations in LIP reflect the bottom-up integration of sensory signals, modulated by feature-based attention (FBA), from upstream feature-selective cortical neurons. Moreover, LIP activity is also strongly modulated by the position of space-based attention (SBA). However, the mechanisms by which SBA and FBA interact to facilitate the representation of task-relevant spatial and non-spatial features in LIP remain unclear. We recorded from LIP neurons during performance of a task which required monkeys to detect specific conjunctions of color, motion-direction, and stimulus position. Here we show that FBA and SBA potentiate each other’s effect in a manner consistent with attention gating the flow of visual information along the cortical visual pathway. Our results suggest that linear bottom-up integrative mechanisms allow LIP neurons to emphasize task-relevant spatial and non-spatial features. PMID:27499082
C/EBPβ LIP augments cell death by inducing osteoglycin.
Wassermann-Dozorets, Rina; Rubinstein, Menachem
2017-04-06
Many types of tumor cell are devoid of the extracellular matrix proteoglycan osteoglycin (Ogn), but its role in tumor biology is poorly studied. Here we show that RNAi of Ogn attenuates stress-triggered cell death, whereas its overexpression increases cell death. We found that the transcription factor C/EBPβ regulates the expression of Ogn. C/EBPβ is expressed as a full-length, active form (LAP) and as a truncated, dominant-negative form (LIP), and the LIP/LAP ratio is positively correlated with the extent of cell death under stress. For example, we reported that drug-resistant tumor cells lack LIP altogether, and its supplementation abolished their resistance to chemotherapy and to endoplasmic reticulum (ER) stress. Here we further show that elevated LIP/LAP ratio robustly increased Ogn expression and cell death under stress by modulating the mitogen-activated protein kinase/activator protein 1 pathway (MAPK/AP-1). Our findings suggest that LIP deficiency renders tumor cell resistant to ER stress by preventing the induction of Ogn.
Liquid nitrogen cryotherapy for lip mucous membrane venous malformation in infants.
Zhang, Da-Ming; Wang, You-Yuan; Lin, Zhao-Yu; Yang, Zhao-Hui; Chen, Wei-Liang
2015-03-01
Lip mucous membrane venous malformations are common benign lesions in infants. This clinical study evaluates the efficacy and safety of liquid nitrogen cryotherapy used to treat this condition. A total of 84 pediatric patients undergoing liquid nitrogen cryotherapy for venous malformations involving the lips were reviewed, with 45 males and 39 females treated. The overall median age at mucous membrane venous malformation diagnosis was 5.6 months (range 2-18 months). The venous malformations involved the vermilion of the lower lip in 44 cases, the vermilion of the upper lip in 31 cases, and both vermilions in 9 cases. No complications due to anesthesia occurred. After a follow-up period of 2-38 months (mean 25 months), 65 lesions (77.4 %) were completely involuted, 14 lesions (16.7 %) were mostly involuted, and 5 lesions (5.9 %) were partially involuted; no lesions showed a minor amount of involution. Liquid nitrogen cryotherapy is an effective, simple, and safe management tool for mucous membrane venous malformations of the lip in infants.
Prevalence of cleft lip and cleft palate in rural north-central guatemala.
Matute, Jorge; Lydick, Elaine A; Torres, Olga R; Owen, Karen K; Jacobsen, Kathryn H
2015-05-01
To estimate the number of new cases of cleft lip and cleft palate in the department (state) of Alta Verapaz, Guatemala, in 2012. Cross-sectional survey of midwives from communities identified through a two-stage cluster-sampling process. Midwives were asked how many babies they had delivered in the past year and how many of those newborns had various types of birth defects, as illustrated in pictures. Indigenous Mayan communities in rural north-central Guatemala. Midwives (n = 129) who had delivered babies in the previous year. Reports of babies born with cleft lip and cleft palate. A 1-year prevalence rate of 18.9 per 10,000 for cleft lip and 4.7 per 10,000 for cleft palate was estimated for Alta Verapaz. None of the cases of cleft lip also had cleft palate. The indigenous communities in north-central Guatemala might have a relatively high cleft lip prevalence rate compared with the global average.
Interaction between Spatial and Feature Attention in Posterior Parietal Cortex.
Ibos, Guilhem; Freedman, David J
2016-08-17
Lateral intraparietal (LIP) neurons encode a vast array of sensory and cognitive variables. Recently, we proposed that the flexibility of feature representations in LIP reflect the bottom-up integration of sensory signals, modulated by feature-based attention (FBA), from upstream feature-selective cortical neurons. Moreover, LIP activity is also strongly modulated by the position of space-based attention (SBA). However, the mechanisms by which SBA and FBA interact to facilitate the representation of task-relevant spatial and non-spatial features in LIP remain unclear. We recorded from LIP neurons during performance of a task that required monkeys to detect specific conjunctions of color, motion direction, and stimulus position. Here we show that FBA and SBA potentiate each other's effect in a manner consistent with attention gating the flow of visual information along the cortical visual pathway. Our results suggest that linear bottom-up integrative mechanisms allow LIP neurons to emphasize task-relevant spatial and non-spatial features. Copyright © 2016 Elsevier Inc. All rights reserved.
Park, Hyojin; Kayser, Christoph; Thut, Gregor; Gross, Joachim
2016-01-01
During continuous speech, lip movements provide visual temporal signals that facilitate speech processing. Here, using MEG we directly investigated how these visual signals interact with rhythmic brain activity in participants listening to and seeing the speaker. First, we investigated coherence between oscillatory brain activity and speaker’s lip movements and demonstrated significant entrainment in visual cortex. We then used partial coherence to remove contributions of the coherent auditory speech signal from the lip-brain coherence. Comparing this synchronization between different attention conditions revealed that attending visual speech enhances the coherence between activity in visual cortex and the speaker’s lips. Further, we identified a significant partial coherence between left motor cortex and lip movements and this partial coherence directly predicted comprehension accuracy. Our results emphasize the importance of visually entrained and attention-modulated rhythmic brain activity for the enhancement of audiovisual speech processing. DOI: http://dx.doi.org/10.7554/eLife.14521.001 PMID:27146891
NASA Astrophysics Data System (ADS)
Zirakparvar, N. A.; Mathez, E. A.; Rajesh, H.; Vervoort, J. D.; Choe, S.
2016-12-01
The Bushveld Large Igneous Province (B-LIP) comprises a diverse array of >30 magma bodies that intruded the Kaapvaal Craton at 2.06 Ga. In this talk we use zircon and bulk-rock Lu-Hf isotope data to show that the B-LIP formed in response to the arrival of a plume(s) from the deep mantle. New zircon Hf isotope compositions for four B-LIP bodies yield intrusion-specific average ɛHf (2.06 Ga) values that range from -20.7 ± 2.8 to -2.7 ± 2.8, largely consistent with literature zircon data for other B-LIP intrusions. Bulk-rock solution ɛHf (2.06 Ga) values for a variety of B-LIP intrusions range from -2.1 ± 0.2 to -10.6 ± 0.2. Because the most radiogenic Hf isotope compositions across the entire B-LIP are nearly primordial with an ɛHf (2.06 Ga) close to 0, it is likely that the heat source of the B-LIP was a plume(s) from deep mantle. The Hf isotope data further suggests that individual intrusions in the B-LIP can be grouped into four categories based on their ultimate sources: 1) melts generated in subduction and plume modified continental lithospheric mantle; 2) melts generated by melting of a mafic-ultramafic reservoir composed of older ( 2.7 Ga) plume-related material trapped in the Kaapvaal lithosphere; 3) melts generated in the mid- to upper crust; and 4) melts generated from the 2.06 Ga mantle plume itself. The presence of 2.7 Ga mafic-ultramafic material in the Kaapvaal lithosphere may have acted to strengthen the lithosphere so that it was able to resist being dispered by the arrival of the B-LIP plume at 2.06 Ga. Because the B-LIP extends into a 2.7 Ga aged suture zone between the Kaapvaal and Zimbabwe cratons, it is also possible to understand the role of the lithospheric mantle in producing the Lu-Hf signatures observed in the various B-LIP intrusions as a function of two different types of the continental lithosphere: The very old lithosphere comprising the Kaapvaal Craton and the somewhat younger lithosphere comprising the suture zone. A basic observation is that the Hf isotope signature of the plume source is only directly expressed in B-LIP bodies that intruded the suture zone, providing further evidence that the craton was already underlain by thick lithospheric mantle at the time of B-LIP magmatism.
Dissaux, Caroline; Bodin, Frédéric; Grollemund, Bruno; Picard, Arnaud; Vazquez, Marie-Paule; Morand, Béatrice; James, Isabelle; Kauffmann, Isabelle; Bruant-Rodier, Catherine
2015-12-01
Cleft surgery is marked by all the controversies and the multiplication of protocols, as it has been shown by the Eurocleft study. The objective of this pilot study is to start a comparison and analyzing procedure between primary surgical protocols in French centers. Four French centers with different primary surgical protocols for cleft lip and palate repair, have accepted to be involved in this retrospective study. In each center, 20 consecutive patients with complete cleft lip and palate (10 UCLP and 10 BCLP per center), non syndromic, have been evaluated at a mean age of 5 [4,6]. In this first part, the aesthetic results of nose and lip repair were assessed based on the scale established by Mortier et al. (1997). Considering nose outcome, primary cleft repair surgery including a nasal dissection gives a statistically significant benefit in terms of septum deviation. Considering lip result, muscular dehiscence rate is significantly higher in BCLP patients with a two-stage lip closure. The centers using Millard one-stage lip closure do not have uniform results. For UCLP patients, the quality of scar is not statistically different between Skoog and Millard techniques. Primary results based on a simple, reproducible evaluation protocol. Extension to other centers required. Therapeutic study. Level III/retrospective multicenter comparative study. Copyright © 2015 European Association for Cranio-Maxillo-Facial Surgery. Published by Elsevier Ltd. All rights reserved.
The Effectiveness of Psychosocial Intervention for Individuals With Cleft Lip and/or Palate.
Norman, Alyson; Persson, Martin; Stock, Nicola; Rumsey, Nichola; Sandy, Jonathan; Waylen, Andrea; Edwards, Zoe; Hammond, Vanessa; Partridge, Lucy; Ness, Andy
2015-05-01
The aim of this review was to assess the effectiveness of different psychological interventions for children and adults with cleft lip and/or palate and their parents. We searched six databases including MEDLINE and EMBASE to June 2013 and checked bibliographies. We included research that evaluated any psychological intervention in studies in which at least 90% of the participants had cleft lip and/or palate or were parents of those with cleft lip and/or palate. Studies containing less than 90% were excluded unless they reported results separately for those with cleft lip and/or palate, or raw data were available upon request from the authors. Inclusion assessment, data extraction, and risk of bias assessment were carried out independently by two reviewers. Seven studies were identified as inclusions, with only two studies being included in the full data analysis (one of which failed to meet the full inclusion criteria). The five remaining studies were included only in a narrative synthesis because data were available for people or parents of those with cleft lip and/or palate only. This highlights a distinct dearth of research into psychological intervention within the field of cleft lip and/or palate. The review found no evidence to support any specific intervention. Key uncertainties need to be identified and addressed. Adequately powered, methodologically rigorous randomized controlled trials are needed to provide a secure evidence base for psychological intervention techniques in participants with cleft lip and/or palate and their parents.
Bremmer, Frank; Kaminiarz, Andre; Klingenhoefer, Steffen; Churan, Jan
2016-01-01
Primates perform saccadic eye movements in order to bring the image of an interesting target onto the fovea. Compared to stationary targets, saccades toward moving targets are computationally more demanding since the oculomotor system must use speed and direction information about the target as well as knowledge about its own processing latency to program an adequate, predictive saccade vector. In monkeys, different brain regions have been implicated in the control of voluntary saccades, among them the lateral intraparietal area (LIP). Here we asked, if activity in area LIP reflects the distance between fovea and saccade target, or the amplitude of an upcoming saccade, or both. We recorded single unit activity in area LIP of two macaque monkeys. First, we determined for each neuron its preferred saccade direction. Then, monkeys performed visually guided saccades along the preferred direction toward either stationary or moving targets in pseudo-randomized order. LIP population activity allowed to decode both, the distance between fovea and saccade target as well as the size of an upcoming saccade. Previous work has shown comparable results for saccade direction (Graf and Andersen, 2014a,b). Hence, LIP population activity allows to predict any two-dimensional saccade vector. Functional equivalents of macaque area LIP have been identified in humans. Accordingly, our results provide further support for the concept of activity from area LIP as neural basis for the control of an oculomotor brain-machine interface. PMID:27630547
Booth, A D; Magnuson, A M; Cox-York, K A; Wei, Y; Wang, D; Pagliassotti, M J; Foster, M T
2017-04-01
Adipose tissue plays a fundamental role in glucose homeostasis. For example, fat removal (lipectomy, LipX) in lean mice, resulting in a compensatory 50% increase in total fat mass, is associated with significant improvement in glucose tolerance. This study was designed to further examine the link between fat removal, adipose tissue compensation and glucose homeostasis using a peroxisome proliferator-activated receptor γ (PPAR γ; activator of adipogenesis) knockout mouse. The study involved PPARγ knockout (FKOγ) or control mice (CON), subdivided into groups that received LipX or Sham surgery. We reasoned that as the ability of adipose tissue to expand in response to LipX would be compromised in FKOγ mice, so would improvements in glucose homeostasis. In CON mice, LipX increased total adipose depot mass (~60%), adipocyte number (~45%) and changed adipocyte distribution to smaller cells. Glucose tolerance was improved (~30%) in LipX CON mice compared to Shams. In FKOγ mice, LipX did not result in any significant changes in adipose depot mass, adipocyte number or distribution. LipX FKOγ mice were also characterized by reduction of glucose tolerance (~30%) compared to shams. Inhibition of adipose tissue PPARγ prevented LipX-induced increases in adipocyte expansion and produced a glucose-intolerant phenotype. These data support the notion that adipose tissue expansion is critical to maintain and/or improvement in glucose homeostasis. © 2016 John Wiley & Sons Ltd.
Dehghani, Mahboobe; Jahanbin, Arezoo; Omidkhoda, Maryam; Entezari, Mostafa; Shadkam, Elaheh
2018-03-01
Craniofacial anthropometric studies measure the differences in humans' craniofacial dimensions. The aim of this study was to determine facial anthropometric dimensions of newborn to 12-year-old girls with nonsyndromic unilateral cleft lip and palate (UCLP). In this cross-sectional analytical study, data was collected from 65 infant to 12-year old girls with UCLP. Digital frontal and profile facial photographs were transferred to a computer and desired anthropometric landmarks were traced on each image. Fifteen anthropometric parameters were measured which were the angles of facial, nasofacial, nasomental, Z, nasolabial, inclination of nasal base and labial fissure, nasal deviation, mentocervical, facial convexity and also ratios of nasal prominence relative to nasal height, middle to lower facial third, upper lip to lower lip height, columellar length relative to upper lip, and incisal show relative to incisal width. Pearson coefficient and linear regression were used for statistical analysis. Upper lip to lower lip height ratio and angles of nasofacial, nasolabial, and facial convexity decreased with the age of the patients. In contrast, nasomental angle and the ratios of columellar length to upper lip length, middle facial height to lower facial height, and incisal show relative to incisal width increased. Other parameters studied did not appear to have any significant correlation with age. In the girls with UCLP, various craniofacial dimensions have different growth rates with some parts growing slower than others. Some of the parameters studied were significantly correlated with age, thus growth-related curves and equations were obtained and presented.
A novel technique for performing a tongue-lip adhesion-the tongue suspension technique.
Mann, Robert J; Neaman, Keith C; Hill, Brian; Bajnrauh, Robert; Martin, Matthew D
2012-01-01
The tongue-lip adhesion has undergone several modifications in an attempt to reduce surgical complications and failure rates. Current techniques rely on the use of a button at the tongue base for suspension, which raises concerns about possible aspiration and interference with oral motor function and bottle-feeding. A new technique for tongue-lip adhesion is proposed that adds a tongue suspension to the standard surgical adhesion. A total of 22 patients with Pierre Robin sequence who received a tongue-lip adhesion via a tongue suspension technique were reviewed. The surgical technique differs from the standard surgical approach by the use of a suture weave across the base of the tongue instead of a standard button to suspend the tongue anteriorly. Average age at the time of tongue-lip adhesion was 13.9 days, with a mean operative time of 88.8 minutes. A marked improvement in postoperative oxygenation was seen in the majority of patients. One dehiscence occurred secondary to a traumatic postoperative extubation, eventually requiring a tracheostomy for subglottic stenosis. A technical innovation for performing a tongue-lip adhesion using a tongue suspension in conjunction with a standard transverse adhesion of the lip is described. The advantage of the tongue-lip adhesion with suspension includes immediate postoperative extubation, as well as removal of concerns regarding button aspiration and possible interference in early developmental oral motor function and bottle-feeding. This technique is reproducible, expanding the craniofacial surgeon's armamentarium for the management of difficult airways in Pierre Robin sequence.
Hutchinson, Kathleen; Wellman, Maria A; Noe, Douglas A; Kahn, Alice
2011-09-01
A meta-analytic study was conducted to examine the cross-cultural psychosocial impact of cleft lip and/or palate in non-Anglo populations. A total of 333 citations were initially identified for review using electronic and hand-search strategies. Of the six studies that met inclusion criteria, two were later excluded due to insufficient data. The four remaining studies represented a combined sample size of 2276 adolescents and adults with cleft lip and/or palate from China, Hong Kong, Taiwan, and Norway. Effect size using Cohen's d and confidence intervals were estimated using data from four studies of empirical, controlled study designs. The magnitude of effect sizes indicated that men (d = -0.75) with cleft lip and/or palate in non-Anglo cultures are more prone to psychosocial issues than women (d = -0.33). Adults (d = -0.50) are more impacted than adolescents (d = -0.04). Overall, regardless of age, gender, or culture, individuals with cleft lip and/or palate have lower psychosocial development than individuals without cleft lip and/or palate (d = -0.42). The effects for the cross-cultural comparisons were moderated by the age group and gender of the participants; however, most studies resulted in negative effect sizes. Health care teams for cleft lip and/or palate should recognize the importance of psychological intervention and family support in the treatment of all patients with cleft lip and/or palate throughout the life span.
Xu, Jian Z; Zhang, Jun L; Hu, Kai H; Zhang, Wei G
2013-05-01
Mushrooms are able to secrete lignin peroxidase (LiP) and manganese peroxidase (MnP), and able to use the cellulose as sources of carbon. This article focuses on the relation between peroxidase-secreting capacity and cultivation period of mushrooms with non-laccase activity. Methylene blue and methyl catechol qualitative assay and spectrophotometry quantitative assay show LiP secreting unvaryingly accompanies the MnP secreting in mushroom strains. The growth rates of hyphae are detected by detecting the dry hyphal mass. We link the peroxidase activities to growth rate of mushrooms and then probe into the relationship between them. The results show that there are close relationships between LiP- and/or MnP-secretory capacities and the cultivation periods of mushrooms. The strains with high LiP and MnP activities have short cultivation periods. However, those strains have long cultivation periods because of the low levels of secreted LiP and/or MnP, even no detectable LiP and/or MnP activity. This study provides the first evidence on the imitate relation between the level of secreted LiP and MnP activities and cultivation periods of mushrooms with non-laccase activity. Our study has significantly increased the understanding of the role of LiP and MnP in the growth and development of mushrooms with non-laccase activity. © 2012 The Authors. Microbial Biotechnology © 2012 Society for Applied Microbiology and Blackwell Publishing Ltd.
The impact of a single surgical intervention for patients with a cleft lip living in rural Ethiopia.
Fell, Matthew J; Hoyle, Tom; Abebe, Mekonen E; Kebede, Yegeremu; Medhin, Yohannes D; Hiwot, Fikre A; Cifeta, Taye H; Ali, Ibrahim M; McGurk, Mark
2014-09-01
Humanitarian organisations commonly provide reconstructive treatment for patients with cleft lip within developing countries, but follow-up is often non-existent, particularly for those living in rural areas. This study aimed to assess whether a single surgical intervention was sufficient to produce an observable change to the life of a patient with cleft lip living in rural Hararghe in eastern Ethiopia. 356 patients with isolated cleft lips, who received a single surgical treatment at least 6 months previously, were evaluated in 21 rural health centres. Patients and their families expressed unhappiness before treatment, mainly because the society reacted negatively towards the deformities, isolating the patients from community activities. Postoperatively, the percentage of school-aged children participating in education increased from 46% to 79%, some older patients were able to marry, but employment was unaffected. The prevalence of wound dehiscence in the lip repair was 3% and occurred more frequently in patients with a bilateral cleft lip compared to a unilateral cleft lip (p < 0.001, RR 49.25, 95% CI 6.7-1037.35). We demonstrated that follow-up can be achieved by charitable organisations treating rural patients and that the majority of patients report a positive impact following surgical intervention. We recommend that bilateral cleft lips have a more intense rural aftercare. Copyright © 2014 British Association of Plastic, Reconstructive and Aesthetic Surgeons. Published by Elsevier Ltd. All rights reserved.
Neuronal pattern separation of motion-relevant input in LIP activity
Berberian, Nareg; MacPherson, Amanda; Giraud, Eloïse; Richardson, Lydia
2016-01-01
In various regions of the brain, neurons discriminate sensory stimuli by decreasing the similarity between ambiguous input patterns. Here, we examine whether this process of pattern separation may drive the rapid discrimination of visual motion stimuli in the lateral intraparietal area (LIP). Starting with a simple mean-rate population model that captures neuronal activity in LIP, we show that overlapping input patterns can be reformatted dynamically to give rise to separated patterns of neuronal activity. The population model predicts that a key ingredient of pattern separation is the presence of heterogeneity in the response of individual units. Furthermore, the model proposes that pattern separation relies on heterogeneity in the temporal dynamics of neural activity and not merely in the mean firing rates of individual neurons over time. We confirm these predictions in recordings of macaque LIP neurons and show that the accuracy of pattern separation is a strong predictor of behavioral performance. Overall, results propose that LIP relies on neuronal pattern separation to facilitate decision-relevant discrimination of sensory stimuli. NEW & NOTEWORTHY A new hypothesis is proposed on the role of the lateral intraparietal (LIP) region of cortex during rapid decision making. This hypothesis suggests that LIP alters the representation of ambiguous inputs to reduce their overlap, thus improving sensory discrimination. A combination of computational modeling, theoretical analysis, and electrophysiological data shows that the pattern separation hypothesis links neural activity to behavior and offers novel predictions on the role of LIP during sensory discrimination. PMID:27881719
Large igneous provinces (LIPs) and carbonatites
NASA Astrophysics Data System (ADS)
Ernst, Richard E.; Bell, Keith
2010-03-01
There is increasing evidence that many carbonatites are linked both spatially and temporally with large igneous provinces (LIPs), i.e. high volume, short duration, intraplate-type, magmatic events consisting mainly of flood basalts and their plumbing systems (of dykes, sills and layered intrusions). Examples of LIP-carbonatite associations include: i. the 66 Ma Deccan flood basalt province associated with the Amba Dongar, Sarnu-Dandali (Barmer), and Mundwara carbonatites and associated alkali rocks, ii. the 130 Ma Paraná-Etendeka (e.g. Jacupiranga, Messum); iii. the 250 Ma Siberian LIP that includes a major alkaline province, Maimecha-Kotui with numerous carbonatites, iv. the ca. 370 Ma Kola Alkaline Province coeval with basaltic magmatism widespread in parts of the East European craton, and v. the 615-555 Ma CIMP (Central Iapetus Magmatic Province) of eastern Laurentia and western Baltica. In the Superior craton, Canada, a number of carbonatites are associated with the 1114-1085 Ma Keweenawan LIP and some are coeval with the pan-Superior 1880 Ma mafic-ultramafic magmatism. In addition, the Phalaborwa and Shiel carbonatites are associated with the 2055 Ma Bushveld event of the Kaapvaal craton. The frequency of this LIP-carbonatite association suggests that LIPs and carbonatites might be considered as different evolutionary ‘pathways’ in a single magmatic process/system. The isotopic mantle components FOZO, HIMU, EM1 but not DMM, along with primitive noble gas signatures in some carbonatites, suggest a sub-lithospheric mantle source for carbonatites, consistent with a plume/asthenospheric upwelling origin proposed for many LIPs.
[Psychosocial adjustment in children with a cleft lip and/or palate].
Hoek, Ineke H C; Kraaimaat, Floris W; Admiraal, Ronald J C; Kuijpers-Jagtman, Anne Marie; Verhaak, Christianne M
2009-01-01
To gain insight into the psychosocial health of children aged 9 to 12 years with a cleft lip and/or palate; to determine the relation between their health and the nature and severity of the cleft as well as other individual characteristics. Descriptive, cross-sectional study. Questionnaires completed by parents, teachers and children were used to obtain information about the psychosocial health, nature and severity of the cleft lip and/or palate, and individual characteristics of 80 children. The interrelationship between these parameters was assessed using chi-square tests, single-factor analysis of variance and correlational analysis. In general, the psychosocial health of children with a cleft lip and/or palate did not differ from that of the norm groups. Parents of children with a cleft lip/and or palate reported more withdrawn or depressive behaviour in their child than parents from the norm groups. Children with a cleft lip and/or palate exhibited less rule-breaking behaviour. Teachers reported relatively more social problems. One-third of the children had learning problems. A better psychosocial health was associated with fewer speech problems but not with a more or less abnormal physical appearance. Self-image showed a negative correlation with psychosocial health problems, while learning problems showed a positive correlation. In general, the psychosocial health of children with a cleft lip and/or palate does not differ from children without this condition. However, children with a cleft lip and/or palate do exhibit more learning problems.
Ear Infection in Isolated Cleft Lip: Etiological Implications
Ruegg, Teresa A.; Cooper, Margaret E.; Leslie, Elizabeth J.; Ford, Matthew D.; Wehby, George L.; Deleyiannis, Frederic W.B.; Czeizel, Andrew E.; Hecht, Jacqueline T.; Marazita, Mary L.; Weinberg, Seth M.
2015-01-01
Background and Hypothesis Chronic ear infections are a common occurrence in children with orofacial clefts involving the secondary palate. Less is known about the middle ear status of individuals with isolated clefts of the lip, although several studies have reported elevated rates of ear infection in this group. The purpose of this retrospective study was to test the hypothesis that chronic ear infections occur more frequently in isolated cleft lip cases (n=94) compared with controls (n=183). Methods A questionnaire was used to obtain information on history of chronic ear infection. The association between ear infection status (present/absent) and cleft lip status (cleft lip case/control) was tested using both chi-square and logistic regression. Results and Conclusions The reported occurrence of chronic ear infection was significantly greater in cleft lipcases (31%) compared to unaffected controls (11%). After adjusting for age and sex, having a cleft lip increased the odds of being positive for ear infection by a factor greater than three (OR=3.698; 95%CI=1.91–7.14). Within cleft lipcases, there was no difference in the occurrence of ear infection by defect laterality or by the type of clefting present in the family history. Although velopharyngeal insufficiency was present in 18.4% of our cleft lip sample, there was no statistical association between ear infection and abnormal speech patterns. These results may have potential implications both for the clinical management of isolated cleft lip cases and for understanding the etiology of orofacial clefting. PMID:26153759
Rafighdoost, Houshang; Hashemi, Mohammad; Asadi, Hossein; Bahari, Gholamreza
2018-01-22
Nonsyndromic cleft lip with or without cleft palate is a common congenital deformity worldwide with multifaceted etiology. Interaction of genes and environmental factors has been indicated to be related with susceptibility to nonsyndromic cleft lip with or without cleft palate. Some WNT genes which are involved in craniofacial embryogenesis may play a key role in the pathogenesis of nonsyndromic cleft lip with or without cleft palate. In the present study, we aimed to inspect the relationship between WNT3 (rs3809857 and rs9890413), WNT3A (rs752107 and rs3121310), and WNT10a rs201002930 (c.392 C>T) polymorphisms and nonsyndromic cleft lip with or without cleft palate in an Iranian population. The present case-control study was carried out on 120 unrelated nonsyndromic cleft lip with or without cleft palate patients and 112 healthy subjects. The variants were genotyped by polymerase chain reaction-restriction fragment length polymorphism method. The findings suggest that the rs3809857 polymorphism significantly decreased the risk of nonsyndromic cleft lip with or without cleft palate in codominant (odds ratio = 0.16, 95% confidence interval = 0.03-0.75, P = 0.020, TT vs GG), recessive (odds ratio = 0.16, 95% confidence interval = 0.03-0.72, P = 0.009, TT vs GG + GT) inheritance models. The rs9890413 variant marginally decreased the risk of nonsyndromic cleft lip with or without cleft palate in codominant (odds ratio = 0.41, 95% confidence interval = 0.17-0.99, P = 0.047, AG vs AA) model. Regarding C392T variant, the findings revealed that this variant significantly decreased the risk of nonsyndromic cleft lip with or without cleft palate in codominant (odds ratio = 0.24, 95% confidence interval = 0.10-0.58, P = 0.002, CT vs CC) and allele (odds ratio = 0.26, 95% confidence interval = 0.11-0.62, P = 0.002, T vs C) models. No significant association was observed between the rs752107 and rs3121310 variants and risk/protection of nonsyndromic cleft lip with or without cleft palate. Stratified analysis showed that WNT10a rs201002930 (c.392 C>T) significantly decreased the risk of cleft lip with cleft palate and cleft palate only. In summary, the results suggest an association between WNT genes polymorphisms and the risk nonsyndromic cleft lip with or without cleft palate in a sample of the southeast Iranian population. © 2018 Japanese Teratology Society.
Topographic Organization for Delayed Saccades in Human Posterior Parietal Cortex
Schluppeck, Denis; Glimcher, Paul; Heeger, David J.
2008-01-01
Posterior parietal cortex (PPC) is thought to play a critical role in decision making, sensory attention, motor intention, and/or working memory. Research on the PPC in non-human primates has focused on the lateral intraparietal area (LIP) in the intraparietal sulcus (IPS). Neurons in LIP respond after the onset of visual targets, just before saccades to those targets, and during the delay period in between. To study the function of posterior parietal cortex in humans, it will be crucial to have a routine and reliable method for localizing specific parietal areas in individual subjects. Here, we show that human PPC contains at least two topographically organized regions, which are candidates for the human homologue of LIP. We mapped the topographic organization of human PPC for delayed (memory guided) saccades using fMRI. Subjects were instructed to fixate centrally while a peripheral target was briefly presented. After a further 3-s delay, subjects made a saccade to the remembered target location followed by a saccade back to fixation and a 1-s inter-trial interval. Targets appeared at successive locations “around the clock” (same eccentricity, ≈30° angular steps), to produce a traveling wave of activity in areas that are topographically organized. PPC exhibited topographic organization for delayed saccades. We defined two areas in each hemisphere that contained topographic maps of the contralateral visual field. These two areas were immediately rostral to V7 as defined by standard retinotopic mapping. The two areas were separated from each other and from V7 by reversals in visual field orientation. However, we leave open the possibility that these two areas will be further subdivided in future studies. Our results demonstrate that topographic maps tile the cortex continuously from V1 well into PPC. PMID:15817644
The Dynamic Features of Lip Corners in Genuine and Posed Smiles
Guo, Hui; Zhang, Xiao-Hui; Liang, Jun; Yan, Wen-Jing
2018-01-01
The smile is a frequently expressed facial expression that typically conveys a positive emotional state and friendly intent. However, human beings have also learned how to fake smiles, typically by controlling the mouth to provide a genuine-looking expression. This is often accompanied by inaccuracies that can allow others to determine that the smile is false. Mouth movement is one of the most striking features of the smile, yet our understanding of its dynamic elements is still limited. The present study analyzes the dynamic features of lip corners, and considers how they differ between genuine and posed smiles. Employing computer vision techniques, we investigated elements such as the duration, intensity, speed, symmetry of the lip corners, and certain irregularities in genuine and posed smiles obtained from the UvA-NEMO Smile Database. After utilizing the facial analysis tool OpenFace, we further propose a new approach to segmenting the onset, apex, and offset phases of smiles, as well as a means of measuring irregularities and symmetry in facial expressions. We extracted these features according to 2D and 3D coordinates, and conducted an analysis. The results reveal that genuine smiles have higher values for onset, offset, apex, and total durations, as well as offset displacement, and a variable we termed Irregularity-b (the SD of the apex phase) than do posed smiles. Conversely, values tended to be lower for onset and offset Speeds, and Irregularity-a (the rate of peaks), Symmetry-a (the correlation between left and right facial movements), and Symmetry-d (differences in onset frame numbers between the left and right faces). The findings from the present study have been compared to those of previous research, and certain speculations are made. PMID:29515508
Storage assignment optimization in a multi-tier shuttle warehousing system
NASA Astrophysics Data System (ADS)
Wang, Yanyan; Mou, Shandong; Wu, Yaohua
2016-03-01
The current mathematical models for the storage assignment problem are generally established based on the traveling salesman problem(TSP), which has been widely applied in the conventional automated storage and retrieval system(AS/RS). However, the previous mathematical models in conventional AS/RS do not match multi-tier shuttle warehousing systems(MSWS) because the characteristics of parallel retrieval in multiple tiers and progressive vertical movement destroy the foundation of TSP. In this study, a two-stage open queuing network model in which shuttles and a lift are regarded as servers at different stages is proposed to analyze system performance in the terms of shuttle waiting period (SWP) and lift idle period (LIP) during transaction cycle time. A mean arrival time difference matrix for pairwise stock keeping units(SKUs) is presented to determine the mean waiting time and queue length to optimize the storage assignment problem on the basis of SKU correlation. The decomposition method is applied to analyze the interactions among outbound task time, SWP, and LIP. The ant colony clustering algorithm is designed to determine storage partitions using clustering items. In addition, goods are assigned for storage according to the rearranging permutation and the combination of storage partitions in a 2D plane. This combination is derived based on the analysis results of the queuing network model and on three basic principles. The storage assignment method and its entire optimization algorithm method as applied in a MSWS are verified through a practical engineering project conducted in the tobacco industry. The applying results show that the total SWP and LIP can be reduced effectively to improve the utilization rates of all devices and to increase the throughput of the distribution center.
Interdisciplinary team care of cleft lip and palate: social and psychological aspects.
Strauss, R P; Broder, H
1985-10-01
The organizational example of a university-based team and two patient case studies illustrate how team interaction affects decision making. The model presented for effective team organization is an egalitarian one. Interdependency, flexibility, and open communication among members are essential. Cleft lip and palate teams provide evaluation and treatment that include input from a variety of professional disciplines. The team context makes it possible for care to be coordinated and alleviates the fragmentation of seeking treatment from several independent specialists. Teams also have a special opportunity to address the complex social and psychological issues prevalent in treating persons with birth defects. Specialists, like psychologists and social workers, identify these issues so that surgeons, dentists, and other clinicians may provide a comprehensive treatment plan and management approach. If psychologists or social workers are not available to a team, the group may still successfully integrate a variety of social and personal factors into their decision making. Examples of problem areas and of issues that may be associated with difficulties in adjusting to cleft therapy are included in this article. Teams that effectively address the psychosocial needs of their patients will enhance patient satisfaction, cooperation, and treatment outcomes.
Phonation Threshold Pressure Measurement With a Semi-Occluded Vocal Tract
Titze, Ingo R.
2015-01-01
Purpose The purpose of this article was to determine if a semi-occluded vocal tract could be used to measure phonation threshold pressure. This is in contrast to the shutter technique, where an alternation between a fully occluded tract and an unoccluded tract is used. Method Five male and 5 female volunteers phonated through a thin straw held between the lips. Oral pressure behind the lips was measured. Mathematical predictions of phonation threshold pressures were compared to the measured ones over a range of frequencies. Results It was shown that, for a 2.5-mm diameter straw, phonation threshold pressures were obtainable over a 2-octave range of fundamental frequency by all volunteers. In magnitude, the pressures agreed with the 0.2–0.5 kPa values obtained in previous investigations. Sensitivity to viscoelastic and geometric properties of the vocal folds was generally not compromised with greater oral impedance, but some differences were predicted theoretically in contrast to an open mouth configuration. Conclusion Because phonation threshold pressure is always dependent on vocal tract interaction, it may be advantageous to choose an exact and fixed oral semi-occlusion for the measurement and interpret the results in light of the known acoustic load. PMID:19641082
Computer Aided Lip Reading Training Tool
ERIC Educational Resources Information Center
Sarmasik, Gamze; Dalkilic, Gokhan; Kut, Alp; Cebi, Yalcin; Serbetcioglu, Bulent
2007-01-01
Worldwide auditory-verbal education is becoming widespread for deaf children. But many prelingually, late-diagnosed deaf children and adults may utilize neither hearing aids nor cochlear implants and needed the support of lip-reading. Therefore, lip-reading skill remains to be important for oral education programmes of hearing impaired. The…
Toxoplasma gondii antibodies in wild white-lipped peccary (Tayassu pecari) from Peru
USDA-ARS?s Scientific Manuscript database
In the Peruvian Amazon, the white-lipped peccary (Tayassu pecari) is a desirable game and is important for local rural economy. Blood samples from 101 white-lipped peccary from Peru were collected from 3 different conservation areas located in the municipalities of Manu and Tambopata, southeastern r...
7 CFR 3201.26 - Lip care products.
Code of Federal Regulations, 2012 CFR
2012-01-01
... 7 Agriculture 15 2012-01-01 2012-01-01 false Lip care products. 3201.26 Section 3201.26 Agriculture Regulations of the Department of Agriculture (Continued) OFFICE OF PROCUREMENT AND PROPERTY MANAGEMENT, DEPARTMENT OF AGRICULTURE GUIDELINES FOR DESIGNATING BIOBASED PRODUCTS FOR FEDERAL PROCUREMENT Designated Items § 3201.26 Lip care products. (a...
7 CFR 3201.26 - Lip care products.
Code of Federal Regulations, 2013 CFR
2013-01-01
... 7 Agriculture 15 2013-01-01 2013-01-01 false Lip care products. 3201.26 Section 3201.26 Agriculture Regulations of the Department of Agriculture (Continued) OFFICE OF PROCUREMENT AND PROPERTY MANAGEMENT, DEPARTMENT OF AGRICULTURE GUIDELINES FOR DESIGNATING BIOBASED PRODUCTS FOR FEDERAL PROCUREMENT Designated Items § 3201.26 Lip care products. (a...
7 CFR 3201.26 - Lip care products.
Code of Federal Regulations, 2014 CFR
2014-01-01
... 7 Agriculture 15 2014-01-01 2014-01-01 false Lip care products. 3201.26 Section 3201.26 Agriculture Regulations of the Department of Agriculture (Continued) OFFICE OF PROCUREMENT AND PROPERTY MANAGEMENT, DEPARTMENT OF AGRICULTURE GUIDELINES FOR DESIGNATING BIOBASED PRODUCTS FOR FEDERAL PROCUREMENT Designated Items § 3201.26 Lip care products. (a...
Magnetic resonance imaging of the kinked fetal brain stem: a sign of severe dysgenesis.
Stroustrup Smith, Annemarie; Levine, Deborah; Barnes, Patrick D; Robertson, Richard L
2005-12-01
Magnetic resonance imaging (MRI) allows visualization of the fetal brain stem in a manner not previously possible. A "kinked" brain stem is a sign of severe neurodysgenesis. The purpose of this series was to describe cases of a kinked brain stem detected on prenatal MRI and to discuss the possible genetic and syndromic etiologies. Seven cases of a kinked brain stem on fetal MRI (gestational age range, 18-34 weeks) were reviewed and correlated with other clinical, genetic, imaging, and autopsy findings. In all cases, there was associated cerebellar hypogenesis. Additional findings were ventriculomegaly (4 cases), cerebral hypogenesis (3 cases), microcephaly (4 cases), schizencephaly (1 case), cephalocele (1 case), hypogenesis of the corpus callosum (1 case), and hydrocephalus (1 case). In 2 cases, prenatal sonography misidentified the kinked brain stem as the cerebellum. A kinked brain stem is an indicator of severe neurodysgenesis arising early in gestation. Magnetic resonance imaging provides the necessary resolution to detect this sign and delineate any associated anomalies in utero to assist with further genetic evaluation, management, and counseling.
Salivary duct cyst on lower lip: A rare entity and literature review
Tandon, Ankita; Sircar, Keya; Chowdhry, Aman; Bablani, Deepika
2014-01-01
Mucocele forms because of salivary gland mucous extravasation or retention and is usually related to trauma in the area of the lower lips. Salivary duct cyst, however, is a type of mucous retention cyst which is almost never located on the lower lip. The aim of this paper is to report this extremely rare salivary duct cyst present on the lower lip and to critically review the literature to build important concepts that would help clinicians in the diagnosis and treatment of this pathology. PMID:25364168
Salivary duct cyst on lower lip: A rare entity and literature review.
Tandon, Ankita; Sircar, Keya; Chowdhry, Aman; Bablani, Deepika
2014-09-01
Mucocele forms because of salivary gland mucous extravasation or retention and is usually related to trauma in the area of the lower lips. Salivary duct cyst, however, is a type of mucous retention cyst which is almost never located on the lower lip. The aim of this paper is to report this extremely rare salivary duct cyst present on the lower lip and to critically review the literature to build important concepts that would help clinicians in the diagnosis and treatment of this pathology.
Fonseca, Gabriel M.; Bonfigli, Esteban; Cantín, Mario
2014-01-01
Background: The interaction between the offender and the victim produces visible or latent prints on objects and utensils. The study of lip prints has reportedly stayed away from the basic cinematic concept of the lip-to-surface relationship. Materials and Methods: Three regular powders were used to reveal the latent lip prints on a typical metallic straw called bombilla, and the revealed prints were photographed, preserved, and analyzed. Results: Better definition was observed in the lower lip print, and nine anatomical patterns were identified, but a higher definition of wrinkles was observed with indestructible white powder. Conclusion: Knowledge of labial dynamics, the real value of the processed surfaces, and the need for testing in field conditions are discussed. PMID:25125921
Repair of bilateral cleft lip and its variants
Mulliken, John B.
2009-01-01
The surgeon who lifts a scalpel to repair a bilateral cleft lip and nasal deformity is accountable for: 1) precise craftsmanship based on three-dimensional features and four-dimensional changes; 2) periodic assessment throughout the child's growth; and 3) technical modifications during primary closure based on knowledge gained from long-term follow-up evaluation. These children should not have to endure the stares prompted by nasolabial stigmata that result from outdated concepts and technical misadventures. The principles for repair of bilateral complete cleft lip have evolved to such a level that the child's appearance should be equivalent to, or surpass, that of a unilateral complete cleft lip. These same principles also apply to the repair of the variants of bilateral cleft lip, although strategies and execution differ slightly. PMID:19884685
Matsui, Mariko; Soupé, Marie-Estelle; Becam, Jérôme
2012-01-01
Transcripts of Leptospira 16S rRNA, FlaB, LigB, LipL21, LipL32, LipL36, LipL41, and OmpL37 were quantified in the blood of susceptible (hamsters) and resistant (mice) animal models of leptospirosis. We first validated adequate reference genes and then evaluated expression patterns in vivo compared to in vitro cultures. LipL32 expression was downregulated in vivo and differentially regulated in resistant and susceptible animals. FlaB expression was also repressed in mice but not in hamsters. In contrast, LigB and OmpL37 were upregulated in vivo. Thus, we demonstrated that a virulent strain of Leptospira differentially adapts its gene expression in the blood of infected animals. PMID:22729538
Kono, Taro; Frederick Groff, William; Chan, Henry H; Sakurai, Hiroyuki; Yamaki, Takashi
2009-03-01
Pulsed dye laser (PDL) treatment of hypertrophic port-wine stains (PWSs) on the lips has demonstrated poor efficacy and a potential risk of dyspigmentation. PDL-resistant hypertrophic PWS may require treatment with deeper penetrating lasers such as a 1064-nm neodymium:yttrium-aluminum-garnet (Nd:YAG) laser. The objective of this clinical study was to evaluate the efficacy and safety of a Nd:YAG laser for the treatment of hypertrophic PWSs on the lips. Ten patients (four were male and six were female) with hypertrophic PWSs on the lips were recruited in this study. Eight patients showed good to excellent improvement without complications. In conclusion, the Nd:YAG laser is safe and effective for treating hypertrophic PWSs on the lips.
NASA Astrophysics Data System (ADS)
Simorangkir, H. J.; Hak, M. S.; Tofani, I.
2017-08-01
Rehabilitation of patients with unilateral cleft lip and palate (UCLP) requires multiple steps and coordination of multidisciplinary sciences to produce optimal results. Alveolar bone-grafting (ABG) is an important procedure in the treatment of such patients because it influences the eruption of teeth and stabilizes the maxilla. To evaluate the effect and suitability of alveolar bone grafting procedure at Cleft Center Harapan Kita Maternal and Child Hospital on nasal deformity from anthropometry with photogrammetry and aesthetic proportional in patients with unilateral cleft lip and palate with UCLP. Patients with UCLP were evaluated post-ABG using anthropometry and photogrammetry to investigate the results anteriorly, laterally, and basally. Anthropometric measurements taken photogrammetrically used 14 points and 11 distance items. Evaluations were made of upper lip length, upper lip projection, and nostril sill elevation for both the cleft and non-cleft sides of patients’ faces. A t-test showed that the values for upper lip length and projection were significantly increased, and a correction test using a Fisher exam gave a value of 1. The ABG treatment protocol for patients with UCLP at the Cleft Lip and Palate Unit at Harapan Kita Maternal and Child Hospital is suitable to be performed; it aesthetically satisfies patients and their families.
2018-04-26
Caregiver; Malignant Head and Neck Neoplasm; Paranasal Sinus Squamous Cell Carcinoma; Salivary Gland Squamous Cell Carcinoma; Stage I Hypopharyngeal Squamous Cell Carcinoma; Stage I Laryngeal Squamous Cell Carcinoma; Stage I Lip and Oral Cavity Squamous Cell Carcinoma; Stage I Oropharyngeal Squamous Cell Carcinoma; Stage II Hypopharyngeal Squamous Cell Carcinoma; Stage II Laryngeal Squamous Cell Carcinoma; Stage II Lip and Oral Cavity Squamous Cell Carcinoma; Stage II Oropharyngeal Squamous Cell Carcinoma; Stage III Hypopharyngeal Squamous Cell Carcinoma; Stage III Laryngeal Squamous Cell Carcinoma; Stage III Lip and Oral Cavity Squamous Cell Carcinoma; Stage III Oropharyngeal Squamous Cell Carcinoma; Stage IV Hypopharyngeal Squamous Cell Carcinoma; Stage IV Laryngeal Squamous Cell Carcinoma; Stage IV Lip and Oral Cavity Squamous Cell Carcinoma; Stage IV Oropharyngeal Squamous Cell Carcinoma; Stage IVA Hypopharyngeal Squamous Cell Carcinoma; Stage IVA Laryngeal Squamous Cell Carcinoma; Stage IVA Lip and Oral Cavity Squamous Cell Carcinoma; Stage IVA Oropharyngeal Squamous Cell Carcinoma; Stage IVB Hypopharyngeal Squamous Cell Carcinoma; Stage IVB Laryngeal Squamous Cell Carcinoma; Stage IVB Lip and Oral Cavity Squamous Cell Carcinoma; Stage IVB Oropharyngeal Squamous Cell Carcinoma; Stage IVC Hypopharyngeal Squamous Cell Carcinoma; Stage IVC Laryngeal Squamous Cell Carcinoma; Stage IVC Lip and Oral Cavity Squamous Cell Carcinoma; Stage IVC Oropharyngeal Squamous Cell Carcinoma
Hu, Shunwen; Niu, Mengmeng; Hu, Fuqiang; Lu, Yi; Qi, Jianping; Yin, Zongning; Wu, Wei
2013-01-30
The objective of this study was to investigate the integrtity and stability of oral liposomes containing glycocholate (SGC-Lip) in simulated gastrointestinal (GI) media and ex vivo GI media from rats in comparison with conventional liposomes (CH-Lip) composed of soybean phosphatidylcholine and cholesterol. Membrane integrity of liposomes was evaluated by monitoring calcein release, particle size and distribution in different simulated GI media. The stability of liposomes encapsulating insulin was investigated in simulated GI fluids containing pepsin or pancreatin and ex vivo GI enzyme fluids. Simulated GI media with low pH or physiological bile salts resulted in significant increase in calcein release, but dynamic laser scattering data showed that the size and distribution were generally stable. SGC-Lip retained the major amount of the initially encapsulated insulin as compared with CH-Lip in simulated GI fluids (SGF, FaSSGF, SIF and FeSSIF-V2). SGC-Lip retained respectively 17.1% and 20.5% of the initially encapsulated insulin in ex vivo GI fluid, which were also significantly more than CH-Lip. These results suggested that SGC-Lip could protect insulin from degradation to some degree during their transit through the gastrointestinal tract and contributed to enhanced oral absorption. Copyright © 2012 Elsevier B.V. All rights reserved.
Spelling Processes of Children With Nonsyndromic Cleft Lip and/or Palate: A Preliminary Study.
Lee, Karen Shi Mei; Young, Selena Ee-Li; Liow, Susan Jane Rickard; Purcell, Alison Anne
2015-01-01
Objective : To compare the cognitive-linguistic processes underlying spelling performance of children with cleft lip and/or palate with those of typically developing children. Design : An assessment battery including tests of hearing, articulation, verbal short-term and working memory, and phonological awareness, as well as word and nonword spelling, was administered to both groups. Participants : A total of 15 children with nonsyndromic cleft lip and/or palate were case-matched by age and sex to 15 typically developing children. The children were aged between 6 and 8 years and were bilingual, with English the dominant language. Results : Wilcoxon signed-rank tests revealed that the performance of children with cleft lip and/or palate was significantly poorer on phoneme deletion and nonword spelling (P < .05) compared with typically developing children. Spearman correlation analyses revealed different relationships between the cognitive-linguistic and spelling measures for the cleft lip and/or palate and typically developing groups. Conclusions : Children with cleft lip and/or palate underachieve in phonological awareness and spelling skills. To facilitate early intervention for literacy problems, speech-language pathologists should routinely assess the cognitive-linguistic processing of children with cleft lip and/or palate, especially phonological awareness, as part of their case management protocols.
[Pursed Lips Inspiration for Vocal Cord Dysfunction].
Maruyama, Yumiko; Tsukada, Yayoi; Hirai, Nobuyuki; Nakanishi, Yosuke; Yoshizaki, Tomokazu
2015-01-01
Paradoxical vocal cord motion (PVCM) during vocal cord dysfunction (VCD) generally occurs spasmodically and transiently. After we had experienced 36 cases of VCD and successfully treated with conservative treatment including "pursed lips inspiration" method, we experienced a boy who had persistent PVCM. It was observed his PVCM vanished when he breathed in through pursed lips, while it appeared again when he stopped pursed lips inspiration. An airway reflex has been reported where the negative pressure in the subglottic space resulting from the inspiratory effort against a narrowed glottis activates the vocal cord adductor. VCD is considered to have both acceleration of laryngeal closure reflex against airway stimuli and active adductive movement of vocal cords against negative pressure in the subglottic space as underlying factors. The pursed lips inspiration method enables VCD patients not only to accomplish slow and light breathing but also to decrease the difference in the pressure between the supra--and subglottic space by occluding the nasal cavity and voluntary puckering up of the mouth which generate negative pressure in the supraglottic space. This is the first report of the pursed lips inspiration method as a treatment for VCD. Pursed lips inspiration is a simple method which is easy to perform anytime, anywhere without any special equipment, and is considered to be worth trying for VCD.
Cheiloscopy and dactyloscopy: Do they dictate personality patterns?
Abidullah, Mohammed; Kumar, M. Naveen; Bhorgonde, Kavita D.; Reddy, D. Shyam Prasad
2015-01-01
Context: Cheiloscopy and dactyloscopy, both are well-established forensic tools used in individual identification in any scenario be it a crime scene or civil cause. Like finger prints, lip prints are unique and distinguishable for every individual. But their relationship to personality types has not been established excepting the hypothesis stating that finger prints could explain these personality patterns. Aims: The study was aimed to record and correlate the lip and finger prints with that of character/personality of a person. Settings and Design: The lip and finger prints and character of a person were recorded and the data obtained was subjected for statistical analysis, especially for Pearson's Chi-square test and correlation/association between the groups was also studied. Materials and Methods: The study sample comprised of 200 subjects, 100 males and 100 females, aged between 18 and 30 years. For recording lip prints, brown/pink-colored lipstick was applied on the lips and the subjects were asked to spread uniformly over the lips. Lip prints were traced in the normal rest position on a plain white bond paper. For recording the finger prints, imprints of the fingers were taken on a plain white bond paper using ink pad. The collected prints were visualized using magnifying lens. To record the character of person, a pro forma manual for multivariable personality inventory by Dr. BC Muthayya was used. Statistical Analysis Used: Data obtained was subjected for statistical analysis, especially for Pearson's Chi-square test and correlation/association between the groups was also studied. Results: In males, predominant lip pattern recorded was Type I with whorls-type finger pattern and the character being ego ideal, pessimism, introvert, and dogmatic; whereas in females, predominant lip pattern recorded was Type II with loops-type finger pattern and the character being neurotic, need achievers, and dominant. Conclusion: Many studies on lip pattern, finger pattern, palatal rugae, etc., for individual identification and gender determination exist, but correlative studies are scanty. This is the first study done on correlating patterns, that is, lip and finger pattern with the character of a person. With this study we conclude that this correlation can be used as an adjunct in the investigatory process in forensic sciences. PMID:26005299
Design and operation of a fast electromagnetic inductive massive gas injection valve for NSTX-U.
Raman, R; Jarboe, T R; Nelson, B A; Gerhardt, S P; Lay, W-S; Plunkett, G J
2014-11-01
Results from the operation of an electromagnetic valve, that does not incorporate ferromagnetic materials, are presented. Image currents induced on a conducting disc placed near a pancake solenoid cause it to move away from the solenoid and open the vacuum seal. A new and important design feature is the use of Lip Seals for the sliding piston. The pressure rise in the test chamber is measured directly using a fast time response Baratron gauge. The valve injects over 200 Torr l of nitrogen in less than 3 ms, which remains unchanged at moderate magnetic fields.
Design and operation of a fast electromagnetic inductive massive gas injection valve for NSTX-U
NASA Astrophysics Data System (ADS)
Raman, R.; Jarboe, T. R.; Nelson, B. A.; Gerhardt, S. P.; Lay, W.-S.; Plunkett, G. J.
2014-11-01
Results from the operation of an electromagnetic valve, that does not incorporate ferromagnetic materials, are presented. Image currents induced on a conducting disc placed near a pancake solenoid cause it to move away from the solenoid and open the vacuum seal. A new and important design feature is the use of Lip Seals for the sliding piston. The pressure rise in the test chamber is measured directly using a fast time response Baratron gauge. The valve injects over 200 Torr l of nitrogen in less than 3 ms, which remains unchanged at moderate magnetic fields.
Popenko, Natalie A; Tripathi, Prem B; Devcic, Zlatko; Karimi, Koohyar; Osann, Kathryn; Wong, Brian J F
2017-07-01
Aesthetic proportions of the lips and their effect on facial attractiveness are poorly defined. Established guidelines would aid practitioners in achieving optimal aesthetic outcomes during cosmetic augmentation. To assess the most attractive lip dimensions of white women based on attractiveness ranking of surface area, ratio of upper to lower lip, and dimensions of the lip surface area relative to the lower third of the face. In phase 1 of this study, synthetic morph frontal digital images of the faces of 20 white women ages 18 to 25 years old were used to generate 5 varied lip surface areas for each face. These 100 faces were cardinally ranked by attractiveness through our developed conventional and internet-based focus groups by 150 participants. A summed ranking score of each face was plotted to quantify the most attractive surface area. In phase 2 of the study, 4 variants for each face were created with 15 of the most attractive images manipulating upper to lower lip ratios while maintaining the most attractive surface area from phase 1. A total of 60 faces were created, and each ratio was ranked by attractiveness by 428 participants (internet-based focus groups). In phase 3, the surface area from the most attractive faces was used to determine the total lip surface area relative to the lower facial third. Data were collected from March 1 to November 31, 2010, and analyzed from June 1 to October 31, 2016. Most attractive lip surface area, ratio of upper to lower lip, and dimension of the lips relative to the lower facial third. In phase 1, all 100 faces were cardinally ranked by 150 individuals (internet-based focus groups [n = 130] and raters from conventional focus groups [conventional raters] [n = 20]). In phase 2, all 60 faces were cardinally ranked by 428 participants (internet-based focus groups [n = 408] and conventional raters [n = 20]). The surface area that corresponded to the range of 2.0 to 2.5 × 104 pixels represented the highest summed rank, generating a pool of 14 images. This surface area was determined to be the most attractive and corresponded to a 53.5% increase in surface area from the original image. With the highest mean and highest proportions of most attractive rankings, the 1:2 ratio was deemed most attractive. Conversely, the ratio of 2:1 was deemed least attractive, having the lowest mean at 1.61 and the highest proportion of ranks within 1 with 310 votes (72.3%). Using a robust sample size, this study found that the most attractive lip surface area represents a 53.5% increase from baseline, an upper to lower lip ratio of 1:2, and a surface area equal to 9.6% of the lower third of the face. Lip dimensions and ratios derived in this study may provide guidelines in improving overall facial aesthetics and have clinical relevance to the field of facial plastic surgery. NA.
Mishra, Brijesh; Singh, Arun K.; Zaidi, Javed; Singh, G. K.; Agrawal, Rajiv; Kumar, Vijay
2010-01-01
Context: The cleft lip type nasal deformity presents one of the most complex surgical challenges. The long-term postoperative results are still not satisfactory despite an emphasis on primary nasal correction. This is attributed to tissue memory and healing. Nasoalveolar molding is used effectively to reshape the nasal cartilage and to mold the maxillary arch before cleft lip repair. Aims: This study was undertaken to evaluate the role of presurgical nasoalveolar molding in correction of cleft lip nasal deformity for patients with unilateral and bilateral clefts of the lip. Settings and Design: Twenty-three cases of clefts of lip and palate with nasal deformity were subjected to present study from May 2004 to May 2006. These cases were initially treated on outpatient basis, and they were admitted at the time of operation. All of these patients were children of less than 1 year of age, belonging to north Indian population. Material and Methods: Study consisted of patients of cleft lip and palate who were given presurgical nasoalveolar splints at early age. Lip repair was done after at least 2 months of molding. These patients along with control group (without presurgical nasoalveolar molding) were followed up for 1 year. Measurements were taken at different intervals in study over dental cast and on patients. Data obtained from comparison of 2 groups were analyzed using “MSTAT” analysis software (developed by Dr Russel Freed, Professor & Director, Crop & Soil Sciences Department, Michigan State University, East Lansing, Michigan). Results: In our study, we found that nostril height was more in patients of experimental group (P = .18), while nostril width and alar perimeter were not changed significantly. Children with nasoalveolar molding had significant lengthening of columella (P = .02). Patients of unilateral cleft lip had more reduction in alveolar gap (P = .08) than bilateral group (P = .15). Conclusions: Nasoalveolar molding can be a useful adjunct for treatment of cleft lip nasal deformity. It is a cost-effective technique that can reduce the number of future surgeries such as alveolar bone grafting and secondary rhinoplasties. PMID:20694165
Post-translational Modification of LipL32 during Leptospira interrogans Infection
Witchell, Timothy D.; Eshghi, Azad; Nally, Jarlath E.; Hof, Rebecca; Boulanger, Martin J.; Wunder, Elsio A.; Ko, Albert I.; Haake, David A.; Cameron, Caroline E.
2014-01-01
Background Leptospirosis, a re-emerging disease of global importance caused by pathogenic Leptospira spp., is considered the world's most widespread zoonotic disease. Rats serve as asymptomatic carriers of pathogenic Leptospira and are critical for disease spread. In such reservoir hosts, leptospires colonize the kidney, are shed in the urine, persist in fresh water and gain access to a new mammalian host through breaches in the skin. Methodology/Principal Findings Previous studies have provided evidence for post-translational modification (PTM) of leptospiral proteins. In the current study, we used proteomic analyses to determine the presence of PTMs on the highly abundant leptospiral protein, LipL32, from rat urine-isolated L. interrogans serovar Copenhageni compared to in vitro-grown organisms. We observed either acetylation or tri-methylation of lysine residues within multiple LipL32 peptides, including peptides corresponding to regions of LipL32 previously identified as epitopes. Intriguingly, the PTMs were unique to the LipL32 peptides originating from in vivo relative to in vitro grown leptospires. The identity of each modified lysine residue was confirmed by fragmentation pattern analysis of the peptide mass spectra. A synthetic peptide containing an identified tri-methylated lysine, which corresponds to a previously identified LipL32 epitope, demonstrated significantly reduced immunoreactivity with serum collected from leptospirosis patients compared to the peptide version lacking the tri-methylation. Further, a subset of the identified PTMs are in close proximity to the established calcium-binding and putative collagen-binding sites that have been identified within LipL32. Conclusions/Significance The exclusive detection of PTMs on lysine residues within LipL32 from in vivo-isolated L. interrogans implies that infection-generated modification of leptospiral proteins may have a biologically relevant function during the course of infection. Although definitive determination of the role of these PTMs must await further investigations, the reduced immune recognition of a modified LipL32 epitope suggests the intriguing possibility that LipL32 modification represents a novel mechanism of immune evasion within Leptospira. PMID:25356675
Outpatient versus Inpatient Primary Cleft Lip and Palate Surgery: Analysis of Early Complications.
Kantar, Rami S; Cammarata, Michael J; Rifkin, William J; Plana, Natalie M; Diaz-Siso, J Rodrigo; Flores, Roberto L
2018-05-01
Fiscal constraints are driving shorter hospital lengths of stay. Outpatient primary cleft lip surgery has been shown to be safe, but outpatient primary cleft palate surgery remains controversial. This study evaluates outcomes following outpatient versus inpatient primary cleft lip and palate surgery. The American College of Surgeons National Surgical Quality Improvement Program Pediatric database was used to identify patients undergoing primary cleft lip and palate surgery between 2012 and 2015. Patient clinical factors and 30-day complications were compared for outpatient versus inpatient primary cleft lip and palate surgery. Univariate and multivariate analyses were performed. Three thousand one hundred forty-two patients were included in the primary cleft lip surgery group and 4191 in the primary cleft palate surgery group. Patients in the cleft lip surgery group with structural pulmonary abnormalities had a significantly longer hospital length of stay (β, 4.94; p = 0.001). Patients undergoing outpatient surgery had a significantly higher risk of superficial (OR, 1.99; p = 0.01) and deep wound dehiscence (OR, 2.22; p = 0.01), and were at a significantly lower risk of reoperation (OR, 0.36; p = 0.04) and readmission (OR, 0.52; p = 0.02). Outpatient primary cleft lip surgery is safe and has a complication profile similar to that of inpatient surgery. Outpatient primary cleft palate surgery is common practice in many U.S. hospitals and has a significantly higher rate of wound complications, and lower rates of reoperation and readmission. In properly selected patients, outpatient palatoplasty can be performed safely. Therapeutic, III.
Esper, Luis Augusto; Sbrana, Michyele Cristhiane; Cunha, Mércia Jussara da Silva; Moreira, Guilherme Santos; de Almeida, Ana Lúcia Pompéia Fraga
2012-01-01
Objective. To evaluate characteristics of smile related to visibility in individuals with cleft lip, alveolus, and palate. Design. Cross-sectional. Setting. HRAC/USP, Brazil. Patients. Individuals with repaired complete unilateral cleft lip and palate (n = 45), aged 15-30 years. Interventions. Frontal facial photographs were obtained in natural and forced smiles (n = 135). Six specialists in periodontics evaluated the photographs as to the smile line, thickness, and curve of the upper lip. Main Outcome Measures. The cleft area was compared with the contralateral region. Results were expressed as percentages and means. The findings were compared between groups of periodontists. Results. Statistically significant relationship was observed in the smile line between examiners and between natural and forced smiles, regardless of the association with the cleft side. The lip was thicker at rest and thinner in the forced smile, as also evaluated by the group not experienced with cleft care. The curve of the upper lip in natural and forced smiles was considered as close to straight by both groups, regardless of the cleft. Conclusion. The smile in individuals with clefts was regarded as average for both cleft and noncleft sides. The thickness was characterized as average to thin, being thinner in forced smile and when analyzed by the group not experienced with cleft care. In the average, the curve of the upper lip was considered as straight. The present study elucidates some characteristics related to the smile in individuals with repaired unilateral cleft lip, alveolus, and palate.
Esper, Luis Augusto; Sbrana, Michyele Cristhiane; Cunha, Mércia Jussara da Silva; Moreira, Guilherme Santos; de Almeida, Ana Lúcia Pompéia Fraga
2012-01-01
Objective. To evaluate characteristics of smile related to visibility in individuals with cleft lip, alveolus, and palate. Design. Cross-sectional. Setting. HRAC/USP, Brazil. Patients. Individuals with repaired complete unilateral cleft lip and palate (n = 45), aged 15–30 years. Interventions. Frontal facial photographs were obtained in natural and forced smiles (n = 135). Six specialists in periodontics evaluated the photographs as to the smile line, thickness, and curve of the upper lip. Main Outcome Measures. The cleft area was compared with the contralateral region. Results were expressed as percentages and means. The findings were compared between groups of periodontists. Results. Statistically significant relationship was observed in the smile line between examiners and between natural and forced smiles, regardless of the association with the cleft side. The lip was thicker at rest and thinner in the forced smile, as also evaluated by the group not experienced with cleft care. The curve of the upper lip in natural and forced smiles was considered as close to straight by both groups, regardless of the cleft. Conclusion. The smile in individuals with clefts was regarded as average for both cleft and noncleft sides. The thickness was characterized as average to thin, being thinner in forced smile and when analyzed by the group not experienced with cleft care. In the average, the curve of the upper lip was considered as straight. The present study elucidates some characteristics related to the smile in individuals with repaired unilateral cleft lip, alveolus, and palate. PMID:23227326
NASA Astrophysics Data System (ADS)
Hochmuth, Katharina; Gohl, Karsten; Uenzelmann-Neben, Gabriele
2015-11-01
The three largest Large Igneous Provinces (LIP) of the western Pacific—Ontong Java, Manihiki, and Hikurangi Plateaus—were emplaced during the Cretaceous Normal Superchron and show strong similarities in their geochemistry and petrology. The plate tectonic relationship between those LIPs, herein referred to as Ontong Java Nui, is uncertain, but a joined emplacement was proposed by Taylor (2006). Since this hypothesis is still highly debated and struggles to explain features such as the strong differences in crustal thickness between the different plateaus, we revisited the joined emplacement of Ontong Java Nui in light of new data from the Manihiki Plateau. By evaluating seismic refraction/wide-angle reflection data along with seismic reflection records of the margins of the proposed "Super"-LIP, a detailed scenario for the emplacement and the initial phase of breakup has been developed. The LIP is a result of an interaction of the arriving plume head with the Phoenix-Pacific spreading ridge in the Early Cretaceous. The breakup of the LIP shows a complicated interplay between multiple microplates and tectonic forces such as rifting, shearing, and rotation. Our plate kinematic model of the western Pacific incorporates new evidence from the breakup margins of the LIPs, the tectonic fabric of the seafloor, as well as previously published tectonic concepts such as the rotation of the LIPs. The updated rotation poles of the western Pacific allow a detailed plate tectonic reconstruction of the region during the Cretaceous Normal Superchron and highlight the important role of LIPs in the plate tectonic framework.
Vaginal orgasm is more prevalent among women with a prominent tubercle of the upper lip.
Brody, Stuart; Costa, Rui Miguel
2011-10-01
Recent studies have uncovered multiple markers of vaginal orgasm history (unblocked pelvic movement during walking, less use of immature psychological defense mechanisms, greater urethrovaginal space). Other markers (perhaps of prenatal origin) even without obvious mechanistic roles in vaginal orgasm might exist, and a clinical observation led to the novel hypothesis that a prominent tubercle of the upper lip is such a marker. To examine the hypothesis that a prominent tubercle of the upper lip is associated specifically with greater likelihood of experiencing vaginal orgasm (orgasm elicited by penile-vaginal intercourse [PVI] without concurrent masturbation). Women (N = 258, predominantly Scottish) completed an online survey reporting their frequencies of various sexual activities and corresponding orgasms, age, and the prominence of the tubercle of their upper lip. Social desirability response bias was also assessed. Multivariate associations of lip tubercle prominence with vaginal orgasm (ever and past month consistency) and with orgasm by other means. RESULTS.: A prominent and sharply raised lip tubercle was associated with greater odds (odds ratio = 12.3) of ever having a vaginal orgasm, and also with greater past month vaginal orgasm consistency (an effect driven by the women who never had a vaginal orgasm), than less prominent lip tubercle categories. Lip tubercle was not associated with social desirability responding, or with orgasm triggered by masturbation during PVI, solitary or partner clitoral or vaginal masturbation, vibrator, or cunnilingus. The results are discussed in light of the unique nature of vaginal orgasm and the possibility of prenatal developmental influences. © 2011 International Society for Sexual Medicine.
Bo, Chen; Ningbei, Yin
2014-01-01
Surgeons need references to undertake cleft lip repairs. We aimed to establish a three-dimensional model of upper lip muscles. We examined specimens from 2 adult cadaver heads and 8 adult cadaver lips, obtaining serial sections in the axial, sagittal, and coronal planes. Sections were stained to observe the philtrum, Cupid bow, vermilion, and nostril sill. Reconstruction was done with three-dimensional software (eg, 3D-DOCTOR, MicroMR). Parallel circular muscle fibers existed between modioli. The orbicularis oris deep layer contained fan muscle fibers inclining inward. Some ended at the anterior nasal crest. Others migrated to the depressor septum, crossed the midline, and migrated to the nasalis muscle. At the nostril floor, the depressor septum muscle bundle and ipsilateral orbicularis oris overlapped the nasalis muscle and the contralateral orbicularis oris. This construction shaped the nostril sill. The levator labii superioris alaeque nasi, levator labii superioris, and zygomaticus minor crossed the nasolabial groove and migrated to the superficial orbicularis oris, entering the outer edge of the nasal alar to the upper lip near the vermilion border and philtrum ridge, shaping Cupid bow. Contralateral deep orbicularis oris muscle fibers crossed the philtrum dimple to the lateral philtrum ridge (axial plane). Superficial reticular muscle fibers of the levator labii superioris, zygomaticus minor, zygomaticus major, and orbicularis oris inserted into the medial philtrum ridge (coronal plane). They intersected to form the philtrum ridge. A three-dimensional upper lip muscular system model was established that can be referenced for cleft lip repair and lip operations.
Loss of cytokeratin 10 indicates malignant transformation in actinic cheilitis.
Garcia, Natália Galvão; Oliveira, Denise Tostes; Lauris, José Roberto Pereira; Domingues, Maria Aparecida Custódio; Minicucci, Eliana Maria; Soares, Cléverson Teixeira
2016-05-01
The aim of this study was to investigate the relationship the expression of cytokeratins (CK10 and CK13) and the cell proliferation index determined by Ki-67 of lip squamous cell carcinoma and actinic cheilitis with different degrees of dysplasia. Forty-five paraffin-embedded actinic cheilitis with and without dysplasia and 20 lip squamous cell carcinoma were analyzed by immunohistochemistry using anti-human anti-CK10, anti-CK13, and anti-Ki-67 antibodies. The majority of actinic cheilitis showed immunopositivity for CK10 and CK13 with decrease or loss of expression in dysplastic areas. In lip squamous cell carcinoma of the lip, heterogeneous expression of CK13 and immunonegativity for CK10 were observed. There was a statistically significant difference between CK10 expression in lip squamous cell carcinoma and in actinic cheilitis with or without dysplasia (p < 0.001). The cell proliferation index was higher in actinic cheilitis with dysplasia and lip squamous cell carcinoma than in actinic cheilitis without epithelial dysplasia. A significant correlation was found between the intensity of the epithelial dysplasia and the cell proliferation index (p < 0.001). These results provide evidence that there is a downregulation of CK10 expression in dysplastic areas of patients with actinic cheilitis and in those with lip squamous cell carcinoma (LSCC) and that the index of cell proliferation, determined by Ki-67, is directly correlated with the intensity of the epithelial dysplasia. Altogether, these results suggest that CK10 expression and the epithelial cell proliferation index can help to identify malignant transformation in the lip region.
Na, Renhua; Laaksonen, Maarit A; Grulich, Andrew E; Meagher, Nicola S; McCaughan, Geoffrey W; Keogh, Anne M; Vajdic, Claire M
2016-06-01
Iatrogenic immunosuppression is a risk factor for lip cancer but the determinants are unknown. We sought to quantify the association between the type, dose, and duration of iatrogenic immunosuppression and lip cancer risk in solid organ transplant recipients. We conducted a population-based cohort study of all adult Australian liver, heart, and lung transplant recipients from 1984 to 2006 (n = 4141). We abstracted longitudinal data from medical records and ascertained incident lip cancer (n = 58) and deaths (n = 1434) by linkage with national registries. We estimated multivariable hazard ratios (HR) for lip cancer using the Fine and Gray proportional subdistribution hazards model, accounting for death as a competing risk. Lip cancer risk (n = 58) increased with high mean daily dose of azathioprine (HR 2.28, 95% confidence interval [CI] 1.18-4.38), longer duration of immunosuppression (HR 9.86, 95% CI 2.10-46.3), increasing year of age at transplantation (HR 1.14, 95% CI 1.04-1.25), earlier transplantation era (HR 8.73, 95% CI 1.11-68.7), and history of smoking (HR 2.71, 95% CI 1.09-6.70). Data on potential confounders such as personal solar ultraviolet radiation exposure were not available. Higher doses of azathioprine increase lip cancer risk, with implications for managing immunosuppressed populations and our understanding of the relationship between solar ultraviolet radiation and lip cancer. Copyright © 2016 American Academy of Dermatology, Inc. Published by Elsevier Inc. All rights reserved.
Saujanya, K; Prasad, M Ghanashyam; Sushma, B; Kumar, J Raghavendra; Reddy, Y S N; Niranjani, K
2016-01-01
Determining the relative risk of cleft lip and palate (CL[P]) on the basis of lip prints and dermatoglyphics as genetic background may be useful for genetic counseling, and the development of future preventive measures. (1) To analyze the various pattern types of lip prints and dermatoglyphics in parents of CL(P) children and to detect if any specific type can be contemplated as a genetic marker in the transmission of CL(P). (2) To compare these patterns with that of parents of unaffected children. 31 parents of children with CL(P) as a study group, and 31 parents of unaffected children as control group were included. Lip prints and finger prints were collected from all subjects and analysis of both patterns was carried out followed by a comparison of the patterns of unaffected parents with the controls statistically. Among the mothers of the study group, type O followed by type IIa lip patterns were found to be significantly higher in upper and lower lips, and in fathers type IIa followed by type O were significantly higher. In the control group, type IIb followed by type III were higher in both fathers and mothers. Dermatoglyphic analysis of palm and finger prints revealed no significant difference in the pattern types and total ridge counts, but the Atd angle asymmetry was found to be significant between study and control group. Types IIa and O lip patterns, asymmetry of Atd angles can be considered as genetic markers for the transmission of CL(P) deformity to offsprings.
CLEFT PALATE. FOUNDATIONS OF SPEECH PATHOLOGY SERIES.
ERIC Educational Resources Information Center
RUTHERFORD, DAVID; WESTLAKE, HAROLD
DESIGNED TO PROVIDE AN ESSENTIAL CORE OF INFORMATION, THIS BOOK TREATS NORMAL AND ABNORMAL DEVELOPMENT, STRUCTURE, AND FUNCTION OF THE LIPS AND PALATE AND THEIR RELATIONSHIPS TO CLEFT LIP AND CLEFT PALATE SPEECH. PROBLEMS OF PERSONAL AND SOCIAL ADJUSTMENT, HEARING, AND SPEECH IN CLEFT LIP OR CLEFT PALATE INDIVIDUALS ARE DISCUSSED. NASAL RESONANCE…
Coupling Dynamics Interlip Coordination in Lower Lip Load Compensation
ERIC Educational Resources Information Center
van Lieshout, Pascal; Neufeld, Chris
2014-01-01
Purpose: To study the effects of lower lip loading on lower and upper lip movements and their coordination to test predictions on coupling dynamics derived from studies in limb control. Method: Movement data were acquired using electromagnetic midsagittal articulography under 4 conditions: (a) without restrictions, serving as a baseline; (b) with…
7 CFR 760.102 - Administration of ELAP, LFP, LIP, SURE, and TAP.
Code of Federal Regulations, 2011 CFR
2011-01-01
... 7 Agriculture 7 2011-01-01 2011-01-01 false Administration of ELAP, LFP, LIP, SURE, and TAP. 760.102 Section 760.102 Agriculture Regulations of the Department of Agriculture (Continued) FARM SERVICE... Supplemental Agricultural Disaster Assistance Programs § 760.102 Administration of ELAP, LFP, LIP, SURE, and...
7 CFR 760.108 - Payment limitation.
Code of Federal Regulations, 2011 CFR
2011-01-01
...,000 total for the 2008 program year under ELAP, LFP, LIP, and SURE combined or (2) $100,000 for the... receive, directly or indirectly, more than: (1) $100,000 per program year total under ELAP, LFP, LIP, and..., LIP, SURE, and TAP if the individual's or entity's average adjusted gross income (AGI) exceeds $2.5...
Bright Promise for Your Child with Cleft Lip and Cleft Palate. Revised Edition.
ERIC Educational Resources Information Center
McDonald, Eugene T.; Berlin, Asa J.
Intended for parents of children with cleft lip and cleft palate, the booklet provides an overview of the condition. Addressed are the following topics (sample subtopics in parentheses): prenatal development and birth defects (facial development); possible causes of cleft lip/cleft palate (common misconceptions, genetic factors, environmental…
7 CFR 2902.26 - Lip care products.
Code of Federal Regulations, 2011 CFR
2011-01-01
... 7 Agriculture 15 2011-01-01 2011-01-01 false Lip care products. 2902.26 Section 2902.26 Agriculture Regulations of the Department of Agriculture (Continued) OFFICE OF ENERGY POLICY AND NEW USES, DEPARTMENT OF AGRICULTURE GUIDELINES FOR DESIGNATING BIOBASED PRODUCTS FOR FEDERAL PROCUREMENT Designated Items § 2902.26 Lip care products. (a)...
Nur Yilmaz, Rahime Burcu; Germeç Çakan, Derya
2018-06-01
The aim of the present study is to evaluate the effects of nasoalveolar molding (NAM) therapy on nasolabial morphology three dimensionally, and compare the nasolabial linear and surface distance measurements in infants with unilateral cleft lip and palate. Facial plaster casts of 42 infants with unilateral cleft lip and palate taken at the onset (pre-NAM) and finishing stage (post-NAM) of NAM were scanned with 3dMDface stereophotogrammetry system (3dMD, Atlanta, GA). Nineteen nasolabial linear and surface distance measurements were performed on three-dimensional images. In addition to standard descriptive statistical calculations (means and SDs), pre- and post-NAM measurements were evaluated by paired t test. All measurements except lip gap, nostril floor width, and nostril diameter increased between pre-NAM and post-NAM. Nostril and lip height increased significantly on the cleft side (P < 0.05). No differences were present between linear and surface distance measurements except for nasal width measurement. Nasal and lip symmetry improved with NAM. The use of surface distance measurements may be advised particularly for continuous and curved anatomic structures in which circumference differences are expected.
Structure of LiPs ground and excited states
NASA Astrophysics Data System (ADS)
Bressanini, Dario
2018-01-01
The lithium atom in its ground state can bind positronium (Ps) forming LiPs, an electronically stable system. In this study we use the fixed node diffusion Monte Carlo method to perform a detailed investigation of the internal structure of LiPs, establishing to what extent it could be described by smaller interacting subsystems. To study the internal structure of positronic systems we propose a way to analyze the particle distribution functions: We first order the particle-nucleus distances, from the closest to the farthest. We then bin the ordered distances obtaining, for LiPs, five distribution functions that we call sorted distribution functions. We used them to show that Ps is a quite well-defined entity inside LiPs: The positron is forming positronium not only when it is far away from the nucleus, but also when it is in the same region of space occupied by the 2 s electrons. Hence, it is not correct to describe LiPs as positronium "orbiting" around a lithium atom, as sometimes has been done, since the positron penetrates the electronic distribution and can be found close to the nucleus.
[Clinical effect of functional repair of bilateral cleft lip in 66 patients].
Li, Ming; Jiang, Hong-bing; Yuan, Hua; DU, Yi-fei; Wu, Yu-nong; Wan, Lin-zhong
2014-10-01
To explore the clinical effect of functional repair for bilateral cleft lip using modified Mulliken method. Sixty-six patients with bilateral cleft lip were selected and assigned to receive modified Mulliken method. During the operation, the prolabium was kept as narrow "tie" shape, the orbicularis oris was anatomically repositioned, and the orbicularis oris ring was re-built. Vermilion tubercle was reconstructed with the lateral red vermillion. The nasal deformity was preliminarily repaired. and the nasal columella was elongated at the same time. All the patients were followed-up for 0.5-2 years, there was no "trisection upper lip". The symmetry and natural shape of Cupid's bow were obtained in more than 80% patients. The width of philtrum was similar to normal children. Full vermilion of the lips, moderate-size vermilion tubercles and good dynamic and static shape were obtained without whistle deformities. Normal width of nasal base and nostril symmetry were gained. The columella was elongated. Satisfactory contour of the nasal tip was achieved. Modified Mulliken method could functionally repair bilateral cleft lip and effectively correct nasolabial deformities. It is worthy of wide clinical application.
2018-03-04
Stage I Squamous Cell Carcinoma of the Lip and Oral Cavity; Stage I Squamous Cell Carcinoma of the Oropharynx; Stage I Verrucous Carcinoma of the Oral Cavity; Stage II Squamous Cell Carcinoma of the Lip and Oral Cavity; Stage II Squamous Cell Carcinoma of the Oropharynx; Stage II Verrucous Carcinoma of the Oral Cavity; Stage III Squamous Cell Carcinoma of the Lip and Oral Cavity; Stage III Squamous Cell Carcinoma of the Oropharynx; Stage III Verrucous Carcinoma of the Oral Cavity; Stage IVA Squamous Cell Carcinoma of the Lip and Oral Cavity; Stage IVA Squamous Cell Carcinoma of the Oropharynx; Stage IVA Verrucous Carcinoma of the Oral Cavity; Stage IVB Squamous Cell Carcinoma of the Lip and Oral Cavity; Stage IVB Squamous Cell Carcinoma of the Oropharynx; Stage IVB Verrucous Carcinoma of the Oral Cavity; Stage IVC Squamous Cell Carcinoma of the Lip and Oral Cavity; Stage IVC Squamous Cell Carcinoma of the Oropharynx; Stage IVC Verrucous Carcinoma of the Oral Cavity; Tongue Cancer
Lip movements affect infants' audiovisual speech perception.
Yeung, H Henny; Werker, Janet F
2013-05-01
Speech is robustly audiovisual from early in infancy. Here we show that audiovisual speech perception in 4.5-month-old infants is influenced by sensorimotor information related to the lip movements they make while chewing or sucking. Experiment 1 consisted of a classic audiovisual matching procedure, in which two simultaneously displayed talking faces (visual [i] and [u]) were presented with a synchronous vowel sound (audio /i/ or /u/). Infants' looking patterns were selectively biased away from the audiovisual matching face when the infants were producing lip movements similar to those needed to produce the heard vowel. Infants' looking patterns returned to those of a baseline condition (no lip movements, looking longer at the audiovisual matching face) when they were producing lip movements that did not match the heard vowel. Experiment 2 confirmed that these sensorimotor effects interacted with the heard vowel, as looking patterns differed when infants produced these same lip movements while seeing and hearing a talking face producing an unrelated vowel (audio /a/). These findings suggest that the development of speech perception and speech production may be mutually informative.
C/EBPβ LIP and c-Jun synergize to regulate expression of the murine progesterone receptor.
Wang, Weizhong; Do, Han Ngoc; Aupperlee, Mark D; Durairaj, Srinivasan; Flynn, Emily E; Miksicek, Richard J; Haslam, Sandra Z; Schwartz, Richard C
2018-06-02
CCAAT/enhancer binding protein β (C/EBPβ) is required for murine mammary ductal morphogenesis and alveologenesis. Progesterone is critical for proliferation and alveologenesis in adult mammary glands, and there is a similar requirement for progesterone receptor isoform B (PRB) in alveologenesis. We examined C/EBPβ regulation of PR expression. All three C/EBPβ isoforms, including typically inhibitory LIP, transactivated the PR promoter. LIP, particularly, strongly synergized with c-Jun to drive PR transcription. Endogenous C/EBPβ and c-Jun stimulated a PR promoter-reporter and these two factors showed promoter occupancy on the endogenous PR gene. Additionally, LIP overexpression elevated endogenous PR protein expression. In pregnancy, both PRB and the relative abundance of LIP among C/EBPβ isoforms increase. Consistent with a role in PRB expression, in vivo C/EBPβ and PR isoform A expression showed mutually exclusive localization in mammary epithelium, while C/EBPβ and PRB largely co-localized. We suggest a critical role for C/EBPβ, particularly LIP, in PRB expression. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.
Mantovani, Matheus Bortoluzzi; Souza, Eduardo Clemente; Marson, Fabiano Carlos; Corrêa, Giovani Oliveira; Progiante, Patrícia Saram; Silva, Cléverson Oliveira
2016-01-01
Excessive gingival display during smile can result in compromised esthetics. This study aims to report a case of excessive gingival display with multiple etiologies treated by means of modified lip repositioning technique associated with esthetic crown lengthening. A 23-year-old female patient, with 5-mm gingival display during smile caused by altered passive eruption and hypermobility of the upper lip, underwent the modified lip repositioning technique associated with gingivectomy followed by flap elevation and ostectomy/osteoplasty. Seven months after the second procedure, the patient had her esthetic complaint solved appearing stable in the observation period. The modified lip repositioning technique is an effective procedure employed to reduce gingival display and when associated with esthetic clinical crown lengthening, can appropriately treat cases of gummy smile. PMID:27041845
One-Stage Cleft Lip and Palate Repair in an Older Population.
Guneren, Ethem; Canter, Halil Ibrahim; Yildiz, Kemalettin; Kayan, Resit Burak; Ozpur, Mustafa Aykut; Baygol, Emre Gonenc; Sagir, Haci Omer; Kuzu, Ismail Melih; Akman, Onur; Arslan, Serap
2015-07-01
In underdeveloped countries one-stage definitive repair of cleft lip and palate is considered for late-presenting patients. A total of 25 patients with unoperated cleft lip and palate more than 2 years of age were enrolled in this study for one-stage simultaneous repair of cleft lip and palate. According to Veau-Wardill-Kilner push-back technique, 2 flap palatoplasties were performed for palatal repairs; all of the lips were repaired with the Millard II rotation-advancement technique. The authors experienced no perioperative or postoperative life-threatening complications. With respect to the registered operation periods, longer times were required to perform these double operations, but this elongation is shorter than the sum of the periods if the 2 operations had been performed separately. Although the authors were unable to evaluate the late postoperative results because the authors could not follow-up the patients after they were discharged the day after surgery, the early results related to the success of the operation without any surgical complication were prone to meet the parents' and patients' expectations. The authors presented their experiences with many volunteer cleft lip and palate trips to third world countries; however the structure of this article is not a new hypothesis and data based to support a scientific study, but observations are objective to get a conclusion. To perform one-stage definitive repair of the cleft lip and palate in late-presented patients was the reality that they had only 1 chance to undergo these operations. According to the terms and conditions of this challenging operation, one-stage simultaneous repair of cleft lip and palate is a more demanding and time-consuming procedure than is isolated cleft lip repair or cleft palate repair. Although technically challenging, single-stage repair of the whole deformity in late-presenting patients is a feasible, reliable, successful, and safe procedure in authors' experience.
Luyten, Anke; D'haeseleer, Evelien; Budolfsen, Dorte; Hodges, Andrew; Galiwango, George; Vermeersch, Hubert; Van Lierde, Kristiane
2013-01-01
The purpose of the present case control study was to assess parental satisfaction with speech and facial appearance in Ugandan children with complete unilateral or bilateral cleft lip and palate (CLP), who underwent a synchronous lip and palatal closure. The results are compared with an age- and gender-matched control group. The experimental group consisted of the parents or guardians of 44 Ugandan patients (21 males, 23 females) with complete unilateral or bilateral CLP (mean age: 3;1 years). The control group included the foster mothers of 44 orphan children matched by age and gender (mean age: 3;7 years). A survey based on the Cleft Evaluation Profile was used to assess the perceived satisfaction for individual features related to cleft care. Overall high levels of satisfaction were observed in the experimental group for all features (range: 56-100%). No significant differences could be established regarding age, gender, age of lip and palatal closure, cleft type or maternal vs. paternal judgments. In participants who were dissatisfied with the appearance of the lip, the time period between the cleft closure and the survey was significantly larger compared with satisfied participants. Furthermore, significantly lower levels of satisfaction were observed in the cleft group for speech and the appearance of the teeth and the nose compared with the control group. Satisfaction with speech and facial appearance in Ugandan children with cleft lip and/or palate is important since normal esthetics and speech predominantly determine the children's social acceptance in the Ugandan society. As a result of reading this manuscript, the reader will be able to explain the attitudes of parents toward the surgical repair of their children's cleft lip and palate. As a result of reading this manuscript, the reader will be able to identify differences in parental attitudes toward synchronous lip and palate repair. Copyright © 2013 Elsevier Inc. All rights reserved.
The use of throat packs in pediatric cleft lip/palate surgery: a retrospective study.
Smarius, B J A; Guillaume, C H A L; Jonker, G; van der Molen, A B Mink; Breugem, C C
2018-02-22
Throat packs are commonly used to prevent ingestion or aspiration of blood and other debris during cleft lip/palate surgery. However, dislodgement or (partial) retainment after extubation could have serious consequences. The aim of the present study was to investigate the effect of omitting pharyngeal packing during cleft lip/palate surgery on the incidence of early postoperative complications in children. A retrospective study was performed on all children who underwent cleft lip/palate surgery at the Wilhelmina Children's Hospital. This study compared the period January 2010 through December 2012 when pharyngeal packing was applied according to local protocol (group A) with the period January 2013 till December 2015 when pharyngeal packing was no longer applied after removal from the protocol (group B). Data were collected for sex, age at operation, cleft lip/palate type, type of repair, lateral incisions, length of hospital stay, and complications in the first 6 weeks after surgery. Early complications included wound dehiscence, postoperative bleeding, infection, fever, upper respiratory tract infection (URTI), and lower respiratory tract infection (LRTI). This study included 489 cleft lip/palate operations (group A n = 246, group B n = 243). A total of 39 (15.9%) early complications were recorded in group A and a total of 40 (16.5%) in group B. There were no significant differences (P = 0.902) in complications between the two groups; however, there was a significant difference (P < 0.001) in length of hospital stay between the two groups (group A 3.6 days vs group B 3.2 days). Omitting routine placement of throat packs in cleft lip/palate surgery was not associated with an increased early postoperative complication rate. Therefore, the traditional, routine placement of a throat pack during cleft lip/palate surgery can be questioned. The traditional, routine placement of a throat pack during cleft lip/palate surgery can be questioned.
Ma, Ran Jing; Wang, Yan Hong; Liu, Lu; Bai, Lei Lei; Ban, Rui
2018-02-01
Lipases are among the most versatile biocatalysts, and are used in a range of industrially relevant bioconversion reactions. However, the production of LipA in recombinant Bacillus subtilis is still limited, due to unresolved issues surrounding the regulation of the expression and secretion systems. In this study, the gene encoding LipA from B. subtilis 168 was expressed in BNA under the control of the P 43 and the P AE promoter. The extracellular lipase activity of the resulting strains BNACL and BNAAL was 7.8 U ml -1 and 12.6 U ml -1 , respectively. To further enhance the expression of LipA, pHP13L was constructed by inserting the P AE -lip into the shuttle vector pHP13, which produced an extracellular lipase activity of 180.5 U ml -1 of BNA/pHP13L. The strain BNAY8 described in Supplement data which lacks eight extracellular proteins was constructed and the deletion a few of the much weaker secreting proteins had no significant effect on the secretion of LipA. Moreover, the four Sec pathway components, secA-prfB, secDF, secYEG, prsA, were individually overexpressed in BNA. The overexpression of secDF and prsA enhanced the production of LipA by 28% and 49%, respectively. Furthermore, the co-overexpression of secDF with prsA improved the extracellular amount of LipA by 59% over that of BNA/pHP13L, reaching 287.8 U ml -1 . It can therefore be said that both regulatory elements and secretion pathway had an impact on the production of secreted LipA. Their optimization and modification is a useful strategy to improve the homologous overproduction of other extracellular proteins in B. subtilis. Copyright © 2017. Published by Elsevier Inc.
A new regulatory mechanism for bacterial lipoic acid synthesis
Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun
2015-01-01
Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID:25611823
Borziak, Kirill; Posner, Mareike G; Upadhyay, Abhishek; Danson, Michael J; Bagby, Stefan; Dorus, Steve
2014-01-01
Metagenomic analyses have advanced our understanding of ecological microbial diversity, but to what extent can metagenomic data be used to predict the metabolic capacity of difficult-to-study organisms and their abiotic environmental interactions? We tackle this question, using a comparative genomic approach, by considering the molecular basis of aerobiosis within archaea. Lipoylation, the covalent attachment of lipoic acid to 2-oxoacid dehydrogenase multienzyme complexes (OADHCs), is essential for metabolism in aerobic bacteria and eukarya. Lipoylation is catalysed either by lipoate protein ligase (LplA), which in archaea is typically encoded by two genes (LplA-N and LplA-C), or by a lipoyl(octanoyl) transferase (LipB or LipM) plus a lipoic acid synthetase (LipA). Does the genomic presence of lipoylation and OADHC genes across archaea from diverse habitats correlate with aerobiosis? First, analyses of 11,826 biotin protein ligase (BPL)-LplA-LipB transferase family members and 147 archaeal genomes identified 85 species with lipoylation capabilities and provided support for multiple ancestral acquisitions of lipoylation pathways during archaeal evolution. Second, with the exception of the Sulfolobales order, the majority of species possessing lipoylation systems exclusively retain LplA, or either LipB or LipM, consistent with archaeal genome streamlining. Third, obligate anaerobic archaea display widespread loss of lipoylation and OADHC genes. Conversely, a high level of correspondence is observed between aerobiosis and the presence of LplA/LipB/LipM, LipA and OADHC E2, consistent with the role of lipoylation in aerobic metabolism. This correspondence between OADHC lipoylation capacity and aerobiosis indicates that genomic pathway profiling in archaea is informative and that well characterized pathways may be predictive in relation to abiotic conditions in difficult-to-study extremophiles. Given the highly variable retention of gene repertoires across the archaea, the extension of comparative genomic pathway profiling to broader metabolic and homeostasis networks should be useful in revealing characteristics from metagenomic datasets related to adaptations to diverse environments.
Sakai, Kotomi; Nakayama, Enri; Tohara, Haruka; Kodama, Keiji; Takehisa, Takahiro; Takehisa, Yozo; Ueda, Koichiro
2017-01-01
Objective The objective of this study was to clarify the relationship between tongue strength, lip strength, and nutrition-related sarcopenia (NRS). Patients and methods A total of 201 older inpatients aged ≥65 years (70 men, median age: 84 years, interquartile range: 79–89 years) consecutively admitted for rehabilitation were included in this cross-sectional study. The main factors evaluated were the presence of NRS diagnosed by malnutrition using the Mini-Nutrition Assessment – Short Form, sarcopenia based on the criteria of the Asian Working Group for Sarcopenia, tongue strength, and lip strength. Other factors such as age, sex, comorbidity, physical function, cognitive function, and oral intake level were also assessed. Results In all, 78 (38.8%) patients were allocated to the NRS group, and 123 (61.2%) patients were allocated to the non-NRS group. The median tongue strength and lip strength (interquartile range) were significantly lower in the NRS group (tongue: 22.9 kPa [17.7–27.7 kPa] and lip: 7.2 N [5.6–9.8 N]) compared with the non-NRS group (tongue: 29.7 kPa [24.8–35.1 kPa] and lip: 9.9 N [8.4–12.3 N], P<0.001 for both). Multivariable logistic regression analysis showed that NRS was independently associated with tongue strength (odds ratio [OR] =0.93, 95% confidence interval [CI] 0.87–0.98, P=0.012) and lip strength (OR =0.76, 95% CI 0.66–0.88, P<0.001), even after adjusting for age, sex, comorbidity, physical function, cognitive function, and oral intake level. Conclusion The likelihood of occurrence of NRS decreased when tongue strength or lip strength increased. Tongue strength and lip strength may be important factors for preventing and improving NRS, regardless of the presence of low oral intake level in older rehabilitation inpatients. PMID:28814847
Abdel Aziz, Manal H; Badr El Dine, Fatma M M; Saeed, Nourhan M M
2016-11-01
Identification of sex and ethnicity has always been a challenge in the fields of forensic medicine and criminal investigations. Fingerprinting and DNA comparisons are probably the most common techniques used in this context. However, since they cannot always be used, it is necessary to apply different and less known techniques such as lip prints. Is to study the pattern of lip print in Egyptian and Malaysian populations and its relation to sex and populations difference. Also, to develop equations for sex and populations detection using lip print pattern by different populations (Egyptian and Malaysian). The sample comprised of 120 adults volunteers divided into two ethnic groups; sixty adult Egyptians (30 males and 30 females) and sixty adult Malaysians (30 males and 30 females). The lip prints were collected on a white paper. Each lip print was divided into four compartments and were classified and scored according to Suzuki and Tsuchihashi classification. Data were statistically analyzed. The results showed that type III lip print pattern (intersected grooves) was the predominant type in both the Egyptian and Malaysian populations. Type II and III were the most frequent in Egyptian males (28.3% each), while in Egyptian females type III pattern was predominant (46.7%). As regards Malaysian males, type III lip print pattern was the predominant one (41.7%), while type II lip print pattern was predominant (30.8%) in Malaysian females. Statistical analysis of different quadrants showed significant differences between males and females in the Egyptian population in the third and fourth quadrants. On the other hand, significant differences were detected only in the second quadrant between Malaysian males and females. Also, a statistically significant difference was present in the second quadrant between Egyptian and Malaysian males. Using the regression analysis, four regression equations were obtained. Copyright © 2016 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.
Ambulatory cleft lip surgery: A value analysis.
Arneja, Jugpal S; Mitton, Craig
2013-01-01
Socialized health systems face fiscal constraints due to a limited supply of resources and few reliable ways to control patient demand. Some form of prioritization must occur as to what services to offer and which programs to fund. A data-driven approach to decision making that incorporates outcomes, including safety and quality, in the setting of fiscal prudence is required. A value model championed by Michael Porter encompasses these parameters, in which value is defined as outcomes divided by cost. To assess ambulatory cleft lip surgery from a quality and safety perspective, and to assess the costs associated with ambulatory cleft lip surgery in North America. Conclusions will be drawn as to how the overall value of cleft lip surgery may be enhanced. A value analysis of published articles related to ambulatory cleft lip repair over the past 30 years was performed to determine what percentage of patients would be candidates for ambulatory cleft lip repair from a quality and safety perspective. An economic model was constructed based on costs associated with the inpatient stay related to cleft lip repair. On analysis of the published reports in the literature, a minority (28%) of patients are currently discharged in an ambulatory fashion following cleft lip repair. Further analysis suggests that 88.9% of patients would be safe candidates for same-day discharge. From an economic perspective, the mean cost per patient for the overnight admission component of ambulatory cleft surgery to the health care system in the United States was USD$2,390 and $1,800 in Canada. The present analysis reviewed germane publications over a 30-year period, ultimately suggesting that ambulatory cleft lip surgery results in preservation of quality and safety metrics for most patients. The financial model illustrates a potential cost saving through the adoption of such a practice change. For appropriately selected patients, ambulatory cleft surgery enhances overall health care value.
A De Novo Floral Transcriptome Reveals Clues into Phalaenopsis Orchid Flower Development
Huang, Jian-Zhi; Lin, Chih-Peng; Cheng, Ting-Chi; Chang, Bill Chia-Han; Cheng, Shu-Yu; Chen, Yi-Wen; Lee, Chen-Yu; Chin, Shih-Wen; Chen, Fure-Chyi
2015-01-01
Phalaenopsis has a zygomorphic floral structure, including three outer tepals, two lateral inner tepals and a highly modified inner median tepal called labellum or lip; however, the regulation of its organ development remains unelucidated. We generated RNA-seq reads with the Illumina platform for floral organs of the Phalaenopsis wild-type and peloric mutant with a lip-like petal. A total of 43,552 contigs were obtained after de novo assembly. We used differentially expressed gene profiling to compare the transcriptional changes in floral organs for both the wild-type and peloric mutant. Pair-wise comparison of sepals, petals and labellum between peloric mutant and its wild-type revealed 1,838, 758 and 1,147 contigs, respectively, with significant differential expression. PhAGL6a (CUFF.17763), PhAGL6b (CUFF.17763.1), PhMADS1 (CUFF.36625.1), PhMADS4 (CUFF.25909) and PhMADS5 (CUFF.39479.1) were significantly upregulated in the lip-like petal of the peloric mutant. We used real-time PCR analysis of lip-like petals, lip-like sepals and the big lip of peloric mutants to confirm the five genes’ expression patterns. PhAGL6a, PhAGL6b and PhMADS4 were strongly expressed in the labellum and significantly upregulated in lip-like petals and lip-like sepals of peloric-mutant flowers. In addition, PhAGL6b was significantly downregulated in the labellum of the big lip mutant, with no change in expression of PhAGL6a. We provide a comprehensive transcript profile and functional analysis of Phalaenopsis floral organs. PhAGL6a PhAGL6b, and PhMADS4 might play crucial roles in the development of the labellum in Phalaenopsis. Our study provides new insights into how the orchid labellum differs and why the petal or sepal converts to a labellum in Phalaenopsis floral mutants. PMID:25970572
Retinal and anterior eye compartments derive from a common progenitor pool in the avian optic cup
Venters, Sara J.; Cuenca, Paulina D.
2011-01-01
Purpose The optic cup is created through invagination of the optic vesicle. The morphogenetic rearrangement creates a double-layered cup, with a hinge (the Optic Cup Lip) where the epithelium bends back upon itself. Shortly after the optic cup forms, it is thought to be sub-divided into separate lineages: i) pigmented epithelium in the outer layer; ii) presumptive iris and ciliary body at the most anterior aspect of the inner layer; and iii) presumptive neural retina in the remainder of the inner layer. We test the native developmental potential of the anterior cup to determine if it normally contributes to the retina. Methods Vital dye and green fluorescent protein (GFP) expressing replication-incompetent retroviral vectors were used to label cells in the nascent optic cup and follow their direct progeny throughout development. Label was applied to either the optic cup lip (n=40), or to the domain just posterior to the lip (n=20). Retroviral labeling is a permanent lineage marker and enabled the analysis of advanced stages of development. Results Labeling within the optic cup gave rise to labeled progeny in the posterior optic cup that differentiated as neural retina (20 of 20). In contrast, labeling cells in the optic cup lip gave rise to progeny of labeled cells arrayed in a linear progression, from the lip into the neural retina (36 of 40). Label was retained in cells at the optic cup lip, regardless of age at examination. In older embryos, labeled progeny delaminated from the optic cup lip to differentiate as muscle of the pupillary margin. Conclusions The data show that the cells at the optic cup lip are a common progenitor population for pigmented epithelium, anterior eye tissues (ciliary body, iris, and pupillary muscle) and retinal neurons. The findings are supportive of an interpretation where the optic cup lip is a specialized niche containing a multipotent progenitor population. PMID:22219630
The attractive lip: A photomorphometric analysis.
Penna, V; Fricke, A; Iblher, N; Eisenhardt, S U; Stark, G B
2015-07-01
Throughout literature, there are different parameters defining the ideal shape of the lip and lower third of the face. This study was conducted to clarify what it is that makes lips attractive - and whether there are gender-related differences of an attractive lip and lower third of the face. Pictures of the lip and chin region of 176 patients were photographed in a standardised way and evaluated by 250 voluntary judges through an internet presentation by means of an analogue Likert scaling system. We found a significant higher ratio of upper vermillion height/mouth-nose distance in frontal-view images of attractive compared to unattractive female (p < 0.001) and male (p < 0.05) perioral regions. Furthermore, the ratio of upper vermillion height/chin-nose distance was significantly higher in attractive than in unattractive female (p < 0.005) and male (p < 0.05) lip and chin regions. The nasolabial angle was significantly sharper in attractive compared to unattractive female perioral regions (p < 0.001). Moreover, attractive female lip and chin regions showed a wider mentolabial angle compared to unattractive female lip and chin regions (p < 0.05). Comparing men and women, we found that attractive female perioral regions showed a higher ratio of lower vermillion height/chin-mouth distance (p < 0.05) and lower vermillion height/chin-nose distance than attractive male perioral regions (p < 0.05). We were able to define certain parameters of the lip and lower third of the face that seem to add to the attractivity of female and male individuals and prove that there are gender-related differences in form and shape of an attractive lower third of the face. Copyright © 2015 British Association of Plastic, Reconstructive and Aesthetic Surgeons. Published by Elsevier Ltd. All rights reserved.
Nasoalveolar molding in a case of incomplete cleft lip: Is it worth doing?
Esenlik, Elçin; Aydin, Mustafa Asim
2015-01-01
The purpose of this study was to evaluate the effects of presurgical nasoalveolar molding in an infant with incomplete cleft lip and alveolar notch. The patient was a 15-day-old female infant with a two-thirds vertical separation of the left side of the upper lip, with an intact nasal sill. A modified molding appliance was made to improve nasal esthetics and correct the alveolar notch. Although the nasal and alveolar region abnormalities were not serious, the molding appliance improved the nasal and lip esthetics and was stable during the 4-year follow-up.
1986-01-01
1984). La segmentacion fonologica y silabica en ninos de preescolar y primer grado. Lectura y Vida, 5, 4-13. "-:" " Marcel, A. (1980). Phonological...vaibe (L i rtuin A-li prue r xrse Figuent fo. B ilabial sks:tA. tok sacen th.Cld ie dimninflpaentue ( LA )arabe (LP lip protrusion, LAP) Lip aperture...beutioen (7) copetans alontan selip yaicpraees, and gi rtuinb h orinthe movements for the bitabiar-onstridction og the dimesions loe lips prur ( LA ) ande lip
Van der Woude syndrome: Management in the mixed dentition.
Agarwal, Sonahita; Dinesh, M R; Dharma, R M; Amarnath, B C
2013-01-01
This article presents the case of a patient with Van der Woude syndrome treated with orthodontic and orthopedic intervention in the mixed dentition stage. The patient had a bilateral cleft of the lip and alveolus accompanied by lip pits on the lower lip. Intra-orally, there was bilateral anterior and posterior cross-bite with a collapsed maxilla. The maxillary transverse deficiency was managed with orthopedic expansion and the second phase of treatment involved secondary alveolar bone grafting followed by retention with functional regulator-3. The mild maxillary retrognathia and deficient lip support was managed with dental compensation.
Van der Woude syndrome: Management in the mixed dentition
Agarwal, Sonahita; Dinesh, M. R.; Dharma, R. M.; Amarnath, B. C.
2013-01-01
This article presents the case of a patient with Van der Woude syndrome treated with orthodontic and orthopedic intervention in the mixed dentition stage. The patient had a bilateral cleft of the lip and alveolus accompanied by lip pits on the lower lip. Intra-orally, there was bilateral anterior and posterior cross-bite with a collapsed maxilla. The maxillary transverse deficiency was managed with orthopedic expansion and the second phase of treatment involved secondary alveolar bone grafting followed by retention with functional regulator-3. The mild maxillary retrognathia and deficient lip support was managed with dental compensation. PMID:23853466
Congenital Double Lip: A Rare Deformity Treated Surgically
Aggarwal, Titiksha; Chawla, Kirti; Lamba, Arundeep Kaur; Faraz, Farukh; Tandon, Shruti
2016-01-01
Lip is an important aspect of facial features affecting ones personality. A deformity of the lip characterized by excessive tissue sagging below the usual giving it thicker wider appearance is referred to as double lip. It is a rare occurrence with a proposed male predilection. This article is a report of a 20 years old male with this deformity who presented with the complaint of difficult speech and poor aesthetics. There was no other history patient being systemically healthy. It was successively treated with a simple surgical technique without recurrence over a period of 12 months. PMID:27853696
Lip colour affects perceived sex typicality and attractiveness of human faces.
Stephen, Ian D; McKeegan, Angela M
2010-01-01
The luminance contrast between facial features and facial skin is greater in women than in men, and women's use of make-up enhances this contrast. In black-and-white photographs, increased luminance contrast enhances femininity and attractiveness in women's faces, but reduces masculinity and attractiveness in men's faces. In Caucasians, much of the contrast between the lips and facial skin is in redness. Red lips have been considered attractive in women in geographically and temporally diverse cultures, possibly because they mimic vasodilation associated with sexual arousal. Here, we investigate the effects of lip luminance and colour contrast on the attractiveness and sex typicality (masculinity/femininity) of human faces. In a Caucasian sample, we allowed participants to manipulate the colour of the lips in colour-calibrated face photographs along CIELab L* (light--dark), a* (red--green), and b* (yellow--blue) axes to enhance apparent attractiveness and sex typicality. Participants increased redness contrast to enhance femininity and attractiveness of female faces, but reduced redness contrast to enhance masculinity of men's faces. Lip blueness was reduced more in female than male faces. Increased lightness contrast enhanced the attractiveness of both sexes, and had little effect on perceptions of sex typicality. The association between lip colour contrast and attractiveness in women's faces may be attributable to its association with oxygenated blood perfusion indicating oestrogen levels, sexual arousal, and cardiac and respiratory health.
Huang, Andrew H; Patel, Kamlesh B; Maschhoff, Clayton W; Huebener, Donald V; Skolnick, Gary B; Naidoo, Sybill D; Woo, Albert S
2015-09-01
To determine a correlation between the width of the cleft palate measured at the time of lip adhesion, definitive lip repair, and palatoplasty and the subsequent occlusal classification of patients born with unilateral cleft lip and palate. Retrospective, observational study. Referral, urban, children's hospital Participants : Dental models and records of 270 patients were analyzed. None. Angle occlusion classification. The mean age at which occlusal classification was determined was 11 ± 0.3 years. Of the children studies, 84 were diagnosed with Class I or II occlusion, 67 were diagnosed with Class III occlusion, and 119 were lost to follow up or transferred care. Mean cleft widths were significantly larger in subjects with Class III occlusion for all measures at time of lip adhesion and definitive lip repair (P < .02). At time of palatoplasty, cleft widths were significantly greater at the alveolus (P = .025) but not at the midportion of the hard palate (P = .35) or posterior hard palate (P = .10). Cleft widths from the lip through to the posterior hard palate are generally greater in children who are diagnosed with Class III occlusion later in life. Notably, the alveolar cleft width is significantly greater at each time point for patients who went on to develop Class III occlusion. There were no significant differences in cleft widths between patients diagnosed later with Class I and Class II occlusions.
Characterisation and Expression Analysis of MrLip1, a Class 3 Family Lipase of Malassezia restricta.
Park, Minji; Jung, Won Hee; Han, Song Hee; Lee, Young Hoon; Lee, Yang Won
2015-11-01
The genus Malassezia is associated with a wide range of skin diseases and is the predominant fungal genus isolated from human skin. Of the 14 Malassezia species identified, M. restricta is the most abundant fungal species found from both healthy and diseased skin. Emerging evidences have suggested that extracellular lipases of Malassezia play a critical role in its survival on the host skin surface. This study aimed to characterise the lipase 1 homologue (MrLip1) in M. restricta and to analyse its expression under different environmental conditions. The full sequence of the gene encoding MrLip1 was determined by rapid amplification of cDNA ends, and it was then heterologously expressed in Pichia pastoris. MrLip1 protein was successfully purified and used for lipase assay and specific antibody generation for use in expression analysis. The optimum pH and temperature for the activity of purified MrLip1 were pH 5.0 and 34 °C respectively. Furthermore, the expression of MrLip1 peaked at a similar pH and temperature, suggesting that the optimal conditions for MrLip1 protein activity and expression are similar to that found on the human skin surface. This study provides data to improve our understanding of the role and characteristics of lipase 1 in M. restricta. © 2015 Blackwell Verlag GmbH.
Kapoor, Neeti; Badiye, Ashish
2017-09-01
Lip prints are very useful in forensic investigations. The objective of this study is to determine predominant lip print pattern found among a central Indian population, to evaluate whether any sex difference exists and to study the permanence of the pattern over a 6 month duration. This study included 200 healthy adult subjects comprising of 100 males and 100 females in the age group of 18-25 years. A convenient and easier method of data collection i.e., digital photography was used instead of the traditional lipstick methods. Lip prints were then divided into four quadrants and recognized as per Suzuki and Tsuchihashi's classification. Type I (30.63%) was found to be most predominant overall in the Marathi population. Type I (29.75%) and Type III (35.75%) were found most prevalent in males and females respectively. Applying the Chi-Square test, statistically significant differences ( p < 0.05) were observed between male and female lip print patterns in each of the quadrants individually and all quadrants taken together. The lip print patterns remained stable over a period of six-months. Being stable and with significant sex differences, lip prints can be effectively used as an important tool in forensic investigations for individualization as well as identification of sex of the donor, thus, narrowing down the scope of investigation to almost half.
Camacho, M; Noller, M W; Zaghi, S; Reckley, L K; Fernandez-Salvador, C; Ho, E; Dunn, B; Chan, D K
2017-05-01
To search for studies on tongue-lip adhesion and tongue repositioning used as isolated treatments for obstructive sleep apnoea in children with Pierre Robin sequence. A systematic literature search of PubMed/Medline and three additional databases, from inception through to 8 July 2016, was performed by two authors. Seven studies with 90 patients (59 tongue-lip adhesion and 31 tongue repositioning patients) met the inclusion criteria. Tongue-lip adhesion reduced the mean (± standard deviation) apnoea/hypopnoea index from 30.8 ± 22.3 to 15.4 ± 18.9 events per hour (50 per cent reduction). The apnoea/hypopnoea index mean difference for tongue-lip adhesion was -15.28 events per hour (95 per cent confidence interval = -30.70 to 0.15; p = 0.05). Tongue-lip adhesion improved the lowest oxygen saturation from 75.8 ± 6.8 to 84.4 ± 7.3 per cent. Tongue repositioning reduced the apnoea/hypopnoea index from 46.5 to 17.4 events per hour (62.6 per cent reduction). Tongue repositioning improved the mean oxygen saturation from 90.8 ± 1.2 to 95.0 ± 0.5 per cent. Tongue-lip adhesion and tongue repositioning can improve apnoea/hypopnoea index and oxygenation parameters in children with Pierre Robin sequence and obstructive sleep apnoea.
Gong, Cai-xia; Zheng, Qian; Shi, Bing
2011-02-01
To evaluate the psychological conditions of parents of children with cleft lip and palate, and to discuss the clinical psychological treatment methods of these parents. 100 parents of children with cleft lip and palate were selected as the parents of children with cleft lip and palate group, and 34 normal adults were selected as the control group. Two groups were tested by the life event scale (LES) and self-rating anxiety scale (SAS) to analyze their psychological states. After the study group was treated by psychological counseling, two groups were tested by the LES and SAS again. The LES total scores of the patients of children with cleft lip and palate had significant differences compared with the normal adults (P < 0.05) before and after psychological counseling, and the LES scores of negative life event of these patients also significantly decreased before and after psychological counseling (P < 0.05). While the SAS total scores of the patients of children with cleft lip and palate had no significant differences compared with the normal adults before and after psychological counseling (P > 0.05). Analyzing the psychological conditions of parents of children with cleft lip and palate by using psychological scales and then treating them by counseling, is an effective psychological treatment method.
LIP: The Livermore Interpolation Package, Version 1.6
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fritsch, F. N.
2016-01-04
This report describes LIP, the Livermore Interpolation Package. LIP was totally rewritten from the package described in [1]. In particular, the independent variables are now referred to as x and y, since it is a general-purpose package that need not be restricted to equation of state data, which uses variables ρ (density) and T (temperature).
Measuring lip force by oral screens. Part 1: Importance of screen size and individual variability.
Wertsén, Madeleine; Stenberg, Manne
2017-06-01
To reduce drooling and facilitate food transport in rehabilitation of patients with oral motor dysfunction, lip force can be trained using an oral screen. Longitudinal studies evaluating the effect of training require objective methods. The aim of this study was to evaluate a method for measuring lip strength, to investigate normal values and fluctuation of lip force in healthy adults on 1 occasion and over time, to study how the size of the screen affects the force, to evaluate the most appropriate measure of reliability, and to identify force performed in relation to gender. Three different sizes of oral screens were used to measure the lip force for 24 healthy adults on 3 different occasions, during a period of 6 months, using an apparatus based on strain gauge. The maximum lip force as evaluated with this method depends on the area of the screen size. By calculating the projected area of the screen, the lip force could be normalized to an oral screen pressure quantity expressed in kPa, which can be used for comparing measurements from screens with different sizes. Both the mean value and standard deviation were shown to vary between individuals. The study showed no differences regarding gender and only small variation with age. Normal variation over time (months) may be up to 3 times greater than the standard error of measurement at a certain occasion. The lip force increases in relation to the projected area of the screen. No general standard deviation can be assigned to the method and all measurements should be analyzed individually based on oral screen pressure to compensate for different screen sizes.
Internationally adopted children with cleft lip and/or palate: A retrospective cohort study.
Werker, C L; de Wilde, H; Mink van der Molen, A B; Breugem, C C
2017-12-01
The treatment approach for internationally adopted children with cleft lip and/or palate differs from locally born children with cleft lip and/or palate. They are older at initial presentation, may have had treatment abroad of different quality, and are establishing new and still fragile relationships with their adoptive parents. The aim of this study was to describe the characteristics and initial care and treatment of this group. A retrospective cohort study was performed including all internationally adopted children with cleft lip and/or palate presenting to the cleft team outpatient clinic in the Wilhelmina Children's Hospital between January 1994 and December 2014. Medical records of all patients were reviewed; information concerning demographic characteristics, characteristics at initial presentation, and treatment were obtained. A total number of 132 adopted patients were included: 15% had cleft lip, 7% had cleft palate, and 78% had cleft lip and palate. The average age at the time of adoption was 26.5 months. In most cases, China was the country of origin. Seventy-eight percent had surgery in their country of origin, primarily lip repair. Fistulae in need of revision surgery were found in 8% of the patients. Pharyngoplasty was needed in 48% of the patients. No significant differences were found for mean age at adoption, gender, cleft type, and one- or two-stage palatal closure. Internationally adopted children with cleft lip and/or palate are a very diverse group of patients with challenging treatment. These children undergo surgery late and frequently need additional surgery. Copyright © 2017 British Association of Plastic, Reconstructive and Aesthetic Surgeons. Published by Elsevier Ltd. All rights reserved.
Meng, Tian; Ma, Lian; Wang, Zhi
2015-10-01
This cross-sectional study aimed to compare subjective assessments among patients with cleft lip and palate (CLP), cleft surgeons, and lay people regarding the soft tissue lateral profile of CLP patients. We also investigated the correlations between subjective assessments and photogrammetric measurements. A total of 150 CLP patients who wished to have treatment for their unattractive appearance were randomly selected. A standard lateral profile color photograph was taken. Panels of three cleft surgeons, ten CLP patients, and ten lay people were selected to be assessors. They rated nasal tip projection, nasolabial esthetics, upper and lower lip esthetics, and the profile for each photograph. Three angular measurements (nasal prominence angle, nasolabial angle, and lip angle) were measured for each photograph. Kendall's coefficient of concordance and logistic regression were used for statistical analysis. Kendall's coefficient of concordance of nasal tip projection, nasolabial esthetics, upper and lower lip esthetics, and the profile were 0.734, 0.683, 0.828, and 0.747, respectively (p < 0.001). Lip angle was associated with the profile scores for cleft surgeons and CLP patients (p < 0.001). The nasal prominence angle and lip angle were associated with the profile scores for lay people (p < 0.001). CLP patients, cleft surgeons, and lay people have similar attitudes to the appearance of CLP patients. Upper and lower lip esthetics is associated with the assessment of the cleft profile that is provided by CLP patients, cleft surgeons, and lay people. In addition, nasal tip projection is another determining factor for lay people. This journal requires that authors assign a level of evidence to each article. For a full description of these Evidence-Based Medicine ratings, please refer to the Table of Contents or the online Instructions to Authors www.springer.com/00266 .
Analysis of dynamic smile and upper lip curvature in young Chinese
Liang, Ling-Zhi; Hu, Wen-Jie; Zhang, Yan-Ling; Chung, Kwok-Hung
2013-01-01
During smile evaluation and anterior esthetic construction, the anatomic and racial variations should be considered in order to achieve better matching results. The aims of this study were to validate an objective method for recording spontaneous smile process and to categorize the smile and upper lip curvature of Chinese Han-nationality youth. One hundred and eighty-eight Chinese Han-nationality youths (88 males and 100 females) ranged from 20 to 35 years of age were selected. Spontaneous smiles were elicited by watching comical movies and the dynamics of the spontaneous smile were captured continuously with a digital video camera. All subjects' smiles were categorized into three types: commissure, cuspid and gummy smile based on video editing software and final images. Subjects' upper lip curvatures were also measured and divided into three groups: upward, straight and downward. Reliability analysis was conducted to obtain intra-rater reliabilities on twice measurements. The Pearson Chi-square test was used to compare differences for each parameters (α=0.05). In smile classification, 60.6% commissure smile, 33.5% cuspid smile and 5.9% gummy smile were obtained. In upper lip measurement, 26.1% upward, 39.9% straight and 34.0% downward upper lip curvature were determined. The commissure smile group showed statistically significant higher percentage of straight (46.5%) and upward (40.4%) in upper lip curvatures (P<0.05), while cuspid smile group (65.1%) and gummy smile group (72.7%) showed statistically significant higher frequency in downward upper lip curvature (P<0.05). It is evident that differences in upper lip curvature and smile classification exist based on race, when comparing Chinese subjects with those of Caucasian descent, and gender. PMID:23558343
Pre Surgical Nasoalveolar Molding: Changing Paradigms in Early Cleft Lip and Palate Rehabilitation
Murthy, Prashanth Sadashiva; Deshmukh, Seema; Bhagyalakshmi, A; Srilatha, KT
2013-01-01
Background: Alveolar and nasal reconstruction for patients with cleft lip and palate is a challenge for the reconstructive surgeon. Various procedures have been attempted to reduce the cleft gap so as to obtain esthetic results post surgically. Yet there is need of continuous exploration of newer and better methods. Rehabilitation of cleft lip and palate generally requires a team approach with paedodontists playing a major role of performing nasoalveolar molding. Presurgical Nasoalveolar Molding (PNAM) was introduced to reshape the alveolar and nasal segments prior to surgical repair. Over the time there have been changes in the concepts of the same. To assess these changing concepts a pubmed search was performed with different related terminologies and articles over a period of 30 years were obtained. Among the articles retrieved, studies performed over different concepts in early management of cleft lip and palate was selected for the systematic review. Aims This paper describes the changing paradigms in the management of patients with cleft lip and palate, focuses on the current concept of Presurgical nasoalveolar molding(PNAM) and discusses the long term benefits of the same. Conclusion The concept of the management of cleft lip and palate has changed over the time with more emphasis on the nasal and alveolar molding prior to the primary lip repair. This molding reduces the number reconstructive surgeries performed later for the purpose of esthetics. How to cite this article: Murthy P S, Deshmukh S, Bhagyalakshmi A, Srilatha K T. Pre Surgical Nasoalveolar Molding: Changing Paradigms in Early Cleft Lip and Palate Rehabilitation. J Int Oral Health 2013; 5(2):76-86. PMID:24155594
Mikulewicz, Marcin; Kachniarz, Krzysztof; Chojnacka, Katarzyna
2015-01-01
The Objective The aim of the study was evaluation of metal ions (nickel and chromium) released from orthodontic appliances in cleft lip and palate patients and the usefulness of non-invasive matrices (saliva and hair). Materials and Methods The material studied consisted of 100 individuals, including 59 females and 41 males of 5 to 16 years of age, which were divided into 3 groups: experimental–patients with cleft lip and palate (36 individuals, the average treatment time 5.74 years); control group–patients without cleft lip and palate, during orthodontic treatment (32 individuals, the average treatment time 1.78 years) and the control group patients without cleft lip and palate, without any orthodontic appliances (32 individuals). Samples (saliva, hair) were collected and subjects underwent a survey by questionnaire. Multi-elemental analyses of the composition of non-invasive matrices was conducted in an accredited laboratory by inductively coupled plasma spectrometry technique ICP-OES. The results were reported as mean contents of particular elements (Cd, Cr, Cu, Fe, Mn, Mo, Ni, Si) in hair and in saliva. Results The concentration of Cr, Ni, Fe and Cu ions in saliva of cleft lip and palate patients were several times higher as compared with not treated orthodontically control groups and higher than in the group with orthodontic appliances. Among the assessed matrices, hair of cleft lip and palate patients seem to be not a meaningful biomarker. Conclusion It was found that orthodontic appliances used in long-term treatment of cleft lip and palate patients do not release toxic levels of Cr and Ni ions. PMID:26544176
Garfinkle, Judah S; King, Timothy W; Grayson, Barry H; Brecht, Lawrence E; Cutting, Court B
2011-04-01
Patients with bilateral cleft lip-cleft palate have nasal deformities including reduced nasal tip projection, widened ala base, and a deficient or absent columella. The authors compare the nasal morphology of patients treated with presurgical nasoalveolar molding followed by primary lip/nasal reconstruction with age-matched noncleft controls. A longitudinal, retrospective review of 77 nonsyndromic patients with bilateral cleft lip-cleft palate was performed. Nasal tip protrusion, alar base width, alar width, columella length, and columella width were measured at five time points spanning 12.5 years. A one-sample t test was used for statistical comparison to an age-matched noncleft population published by Farkas. All five measurements demonstrated parallel, proportional growth in the treatment group relative to the noncleft group. The nasal tip protrusion, alar base width, alar width, columella length, and columella width were not statistically different from those of the noncleft, age-matched control group at age 12.5 years. The nasal tip protrusion also showed no difference in length at 7 and 12.5 years. The alar width and alar base width were significantly wider at the first four time points. This is the first study to describe nasal morphology following nasoalveolar molding and primary surgical repair in patients with bilateral cleft lip-cleft palate through the age of 12.5 years. In this investigation, the authors have shown that patients with bilateral cleft lip-cleft palate treated at their institution with nasoalveolar molding and primary nasal reconstruction, performed at the time of their lip repair, attained nearly normal nasal morphology through 12.5 years of age.
Zanganeh, Saeid; Xu, Yan; Hamby, Carl V; Backer, Marina V; Backer, Joseph M; Zhu, Quing
2013-12-01
To develop an indocyanine green (ICG) tracer with slower clearance kinetics, we explored ICG-encapsulating liposomes (Lip) in three different formulations: untargeted (Lip/ICG), targeted to vascular endothelial growth factor (VEGF) receptors (scVEGF-Lip/ICG) by the receptor-binding moiety single-chain VEGF (scVEGF), or decorated with inactivated scVEGF (inactive-Lip/ICG) that does not bind to VEGF receptors. Experiments were conducted with tumor-bearing mice that were placed in a scattering medium with tumors located at imaging depths of either 1.5 or 2.0 cm. Near-infrared fluorescence diffuse optical tomography that provides depth-resolved spatial distributions of fluorescence in tumor was used for the detection of postinjection fluorescent signals. All liposome-based tracers, as well as free ICG, were injected intravenously into mice in the amounts corresponding to 5 nmol of ICG/mouse, and the kinetics of increase and decrease of fluorescent signals in tumors were monitored. A signal from free ICG reached maximum at 15-min postinjection and then rapidly declined with t1/2 of ~20 min. The signals from untargeted Lip/ICG and inactive-Lip/ICG also reached maximum at 15-min postinjection, however, declined somewhat slower than free ICG with t1/2 of ~30 min. By contrast, a signal from targeted scVEGF-Lip/ICG grew slower than that of all other tracers, reaching maximum at 30-min postinjection and declined much slower than that of other tracers with t1/2 of ~90 min, providing a more extended observation window. Higher scVEGF-Lip/ICG tumor accumulation was further confirmed by the analysis of fluorescence on cryosections of tumors that were harvested from animals at 400 min after injection with different tracers.
Characterization of dendritic cells in lip and oral cavity squamous cell carcinoma.
Costa, Nádia Lago; Gonçalves, Andréia Souza; Martins, Allisson Filipe Lopes; Arantes, Diego Antônio Costa; Silva, Tarcília Aparecida; Batista, Aline Carvalho
2016-07-01
There may be differences in the antitumor immunity induced by dendritic cells (DCs) during the development of squamous cell carcinoma (SCC) located in the lip rather than in the oral cavity. The aim of this study was to evaluate the number of immature and mature DCs in SCC and potentially malignant disorders of the oral cavity and lip. Immunohistochemistry was used to identify the number (cells/mm(2) ) of immature (CD1a(+) ) or mature (CD83(+) ) DCs in samples of oral cavity SCC (OCSCC) (n = 39), lip SCC (LSCC) (n = 23), leukoplakia (LK) (n = 21), actinic cheilitis (AC) (n = 13), and normal mucosa of the oral cavity (OC control, n = 12) and the lip (lip control, n = 11). The number of CD1a(+) cells tended to be higher in the OC control samples compared with the LK (P = 0.04) and OCSCC (P = 0.21). Unlike, this cell population was lower in the lip control than in AC or LSCC (P < 0.05). The number of CD83(+) cells was increased in the LSCC samples compared with the AC and lip control (P = 0.0001) and in OCSCC compared with both the LK (P = 0.001) and OC control (P = 0.0001) samples. LSCC showed an elevated number of CD1a(+) and CD83(+) cells compared with OCSCC (P = 0.03). The population of mature DCs was lower than the population of immature DCs in all of the tested groups (P < 0.05). There were a greater number of both mature and immature DC populations in the LSCC samples than in the OCSCC, which could contribute to establishing a more effective immune antitumor response for this neoplasm. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Ranganathan, Kavitha; Vercler, Christian J; Warschausky, Seth A; MacEachern, Mark P; Buchman, Steven R; Waljee, Jennifer F
2015-01-01
Health care policy makers are increasingly encouraging comparative effectiveness research. Little is known regarding comparative studies among children with cleft lip and/or palate. Cleft lip and/or palate profoundly influences self-perception and social functioning, and patient-reported outcomes provide a unique perspective on the success of reconstruction. The purpose of this study was to systematically review the literature regarding patient-reported outcomes among patients with cleft lip and/or palate. The authors reviewed articles from MEDLINE, Embase, and PsycInfo that examined the use of patient-reported outcome instruments for cleft lip and/or palate. Studies of patients with cleft lip and/or palate across any age that described the use of patient-completed measures in patient and control populations were included. A research librarian confirmed the search, and two independent, blinded reviewers performed full-text review. The authors identified 1979 articles and selected 30 for inclusion. Forty-two different assessment tools were used to analyze factors such as self-esteem, behavior, and social support. The Strengths and Difficulties Questionnaire was most commonly used (n = 7), followed by the Childhood Experience Questionnaire (n = 5), and the Satisfaction with Appearance survey (n = 4). Barriers to analysis included lack of standardization of survey administration, effect of publication bias, and variations in patient populations between individual studies. Comparative studies of patient-reported outcomes among patients with cleft lip and/or palate are infrequent. Many instruments exist to measure patient-reported outcomes in this population, but no specific standard exists. Identifying efficient and targeted forms of instrument selection and administration will enhance comparative studies among children with cleft lip and/or palate. Diagnostic, III.
Fernandes, Cláudia P H; Seixas, Fabiana K; Coutinho, Mariana L; Vasconcellos, Flávia A; Seyffert, Núbia; Croda, Julio; McBride, Alan J; Ko, Albert I; Dellagostin, Odir A; Aleixo, José A G
2007-02-01
Pathogenic serovars of Leptospira have a wide antigenic diversity attributed mainly to the lipopolysaccharide present in the outer membrane. In contrast, antigens conserved among pathogenic serovars are mainly represented by outer membrane proteins. Surface exposure of a major and highly conserved outer membrane lipoprotein (LipL32) was recently demonstrated on pathogenic Leptospira. LipL32 in its recombinant form (rLipL32) was used to immunize BALB/c mice to develop murine monoclonal antibodies (MAbs). Three MAbs against rLipL32 were produced, isotyped, and evaluated for further use in diagnostic tests of leptospirosis using different approaches. MAbs were conjugated to peroxidase and evaluated in a native protein enzyme-linked immunosorbent assay (ELISA) with intact and heat-treated leptospiral cells, conjugated to fluorescein isothiocyanate (FITC) for indirect immunofluorescence with intact and methanol fixed cells and were used for LipL32 immunoprecipitation from leptospiral cells. rLipL32 MAbs conjugated to peroxidase or used as primary antibody bound to intact and heat-treated cells in ELISA, proving that they could be used in enzyme immunoassays for detection of the native protein. In immunofluorescence assay, MAbs labeled bacterial cells either intact or methanol fixed. Two MAbs were able to immunoprecipitate the native protein from live and motile leptospiral cells and, adsorbed onto magnetic beads, captured intact bacteria from artificially contaminated human sera for detection by polymerase chain reaction (PCR) amplification. Results of this study suggest that the MAbs produced can be useful for the development of diagnostic tests based on detection of LipL32 leptospiral antigen in biological fluids.
The Last Gasp - the Terminal Magmatic Stages of the Keweenaw LIP
NASA Astrophysics Data System (ADS)
Rooney, T. O.; Brown, E.; Moucha, R.; Stein, C. A.; Stein, S.
2016-12-01
The Keweenaw Flood Basalts, which represent the magmatic record of the best preserved example of a Precambrian Large Igneous Province (LIP), erupted contemporaneously with the development of the failed Mid-Continent Rift ca. 1.1 Ga. At 2 x 106 km3 in volume, the Keweenaw LIP is roughly equivalent in scale to the Parana-Etendeka LIP, but the origin and evolution of the magmatic source of the Keweenaw LIP remains poorly constrained. Specifically, while modern LIPs have a primary magmatic pulse lasting <5Ma, followed by a long phase of waning activity, the Keweenaw LIP underwent significant flood basalt eruptions for ca. 21 Myr. Here we examine the geochemical characteristics of the final phases of magmatic activity within the Keweenaw LIP - the Lake Shore Traps - which erupted ca. 1087 Ma within an alluvial fan sequence (Copper Harbor Conglomerate). The Lake Shore Traps are best exposed at High Rock Bay, where 62 flows ( 1-30m thick) are observed intercalated with thin paleosols over a 530m thickness. Thus, while this late-stage activity might represent a waning phase of magmatism, the thickness represents some half of the total average thickness of modern continental flood basalt provinces. Our initial data suggests a dominantly tholeiitic magma series spanning an unexpectedly wide and continuous range of compositions from basalt to andesite; rare alkaline lavas are also evident. Distinctive geochemical stratigraphic patterns were observed suggesting crystal fractionation and recharge events dominated the magma system. Our initial data do not show any unambiguous parallels between the geochemical characteristics of the Lake Shore Traps and prior phases of magmatic activity in the province. We explore the potential source characteristics of these lavas to refine the source and conditions of melt generation during the terminal phase of activity in the region.
Srinivasan, Bhadrinath; Kailasam, Vignesh; Chitharanjan, Arun; Ramalingam, Arthi
2013-01-01
The present study aimed to measure the magnitude of the collum angle (crown-root angulation) of maxillary central incisors present in Class II, division 2 malocclusion and to relate the changes in its magnitude with variations in the lower lip line. A set of 120 conventional lateral cephalograms were selected and divided into three groups of 40 each based on the type of malocclusion presented: Class II, division 2 (group 1); Class II, division 1 (group 2); and Class I (group 3). The collum angle of the maxillary central incisor was measured, and the lower lip line was recorded. Analysis of variance (ANOVA) revealed that the mean collum angle was statistically significantly different in the three groups. The mean collum angle was greatest in Class II, division 2 malocclusion (group 1). The mean collum angles were 3.24 ± 4.69 degrees, 0.95 ± 1.06 degrees, and 1.05 ± 1.50 degrees in groups 1, 2, and 3 respectively. In χ ² test comparison of the location of the lower lip line (incisal, middle, or apical third of the central incisor) among the three groups, the lower lip line was found to contact the middle third of the central incisor most frequently in Class II, division 2 malocclusion. ANOVA followed by Tukey honestly significant difference (HSD) test showed that the mean collum angle is significantly increased when the lower lip is in the middle third (P < .05) of the central incisor. Variations in magnitude of the collum angle with the change in the lower lip line suggest a probable etiologic role of the lower lip line in the development of the collum angle.
Gelotophobia and the Challenges of Implementing Laughter into Virtual Agents Interactions
Ruch, Willibald F.; Platt, Tracey; Hofmann, Jennifer; Niewiadomski, Radosław; Urbain, Jérôme; Mancini, Maurizio; Dupont, Stéphane
2014-01-01
This study investigated which features of AVATAR laughter are perceived threatening for individuals with a fear of being laughed at (gelotophobia), and individuals with no gelotophobia. Laughter samples were systematically varied (e.g., intensity, laughter pitch, and energy for the voice, intensity of facial actions of the face) in three modalities: animated facial expressions, synthesized auditory laughter vocalizations, and motion capture generated puppets displaying laughter body movements. In the online study 123 adults completed, the GELOPH <15 > (Ruch and Proyer, 2008a,b) and rated randomly presented videos of the three modalities for how malicious, how friendly, how real the laughter was (0 not at all to 8 extremely). Additionally, an open question asked which markers led to the perception of friendliness/maliciousness. The current study identified features in all modalities of laughter stimuli that were perceived as malicious in general, and some that were gelotophobia specific. For facial expressions of AVATARS, medium intensity laughs triggered highest maliciousness in the gelotophobes. In the auditory stimuli, the fundamental frequency modulations and the variation in intensity were indicative of maliciousness. In the body, backwards and forward movements and rocking vs. jerking movements distinguished the most malicious from the least malicious laugh. From the open answers, the shape and appearance of the lips curling induced feelings that the expression was malicious for non-gelotophobes and that the movement round the eyes, elicited the face to appear as friendly. This was opposite for gelotophobes. Gelotophobia savvy AVATARS should be of high intensity, containing lip and eye movements and be fast, non-repetitive voiced vocalization, variable and of short duration. It should not contain any features that indicate a down-regulation in the voice or body, or indicate voluntary/cognitive modulation. PMID:25477803
Yang, Ying-yang; DU, Sheng-nan; Lv, Zong-kai
2015-08-01
To compare the results of high-speed handpiece and minimally invasive extraction in impacted mandibular third molar extraction. From May 2011 to May 2014, 83 patients undergoing impacted mandibular third molar extraction were enrolled into the study and randomly divided into 2 groups: 42 patients in group A (experimental group) and 41 patients in group B (control group). Group B underwent extraction with traditional method and group A underwent high-speed handpiece and minimally invasive extraction of the impacted mandibular third molar. The occurrences of the root fracture, gingival laceration, tooth mobility, lingual bone plate fracture, jaw fracture and dislocation of temporomandibular joint during operation and lower lip numbness, dry socket, facial swelling and limitation of mouth opening after operation were observed and compared between 2 groups. The operation time, integrity of extraction sockets, VAS pain score and satisfaction from patients were collected and compared. SPSS 19.0 software package was used for statistical analysis. The occurrences of root fracture, gingival laceration, tooth mobility, lingual bone plate fracture, jaw fracture, and dislocation of temporomandibular joint during operation in group A significantly decreased compared with group B (P<0.05). The occurrences of lower lip numbness, dry socket, facial swelling and limitation of mouth opening after operation in group A significantly decreased compared with group B (P<0.05). The operation time, integrity of extraction sockets, VAS pain scores and satisfaction scores in group A improved significantly compared with group B (P<0.05). High-speed handpiece and minimally invasive extraction should be widely used in impacted mandibular third molar extraction, due to the advantages of simple operation, high efficiency, minimal trauma, and few perioperative complications.
Actinic prurigo of the lip: Two case reports
Miranda, Ana MO; Ferrari, Thiago M; Werneck, Juliana T; Junior, Arley Silva; Cunha, Karin S; Dias, Eliane P
2014-01-01
Actinic prurigo is a photodermatosis that can affect the skin, conjunctiva and lips. It is caused by an abnormal reaction to sunlight and is more common in high-altitude living people, mainly in indigenous descendants. The diagnosis of actinic prurigo can be challenging, mainly when lip lesions are the only manifestation, which is not a common clinical presentation. The aim of this article is to report two cases of actinic prurigo showing only lip lesions. The patients were Afro-American and were unaware of possible Indian ancestry. Clinical exam, photographs, videoroscopy examination and biopsy were performed, and the diagnosis of actinic prurigo was established. Topical corticosteroid and lip balm with ultraviolet protection were prescribed with excellent results. The relevance of this report is to show that although some patients may not demonstrate the classical clinical presentation of actinic prurigo, the associated clinical and histological exams are determinants for the correct diagnosis and successful treatment of this disease. PMID:25133153
Akamatsu, Tadashi; Hanai, Ushio; Nakajima, Serina; Kobayashi, Megumi; Miyasaka, Muneo; Matsuda, Shinichi; Ikegami, Mariko
2015-06-20
We report a case of lip repair surgery performed for bilateral cleft lip and palate in a patient diagnosed with trisomy 13 and holoprosencephaly. At the age of 2 years and 7 months, the surgery was performed using a modified De Hann design under general anesthesia. The operation was completed in 1 h and 21 min without large fluctuations in the child's general condition. The precise measurement of the intraoperative design was omitted, and the operation was completed using minimal skin sutures. It is possible to perform less-invasive and short surgical procedures after careful consideration during the preoperative planning. Considering the recent improvements in the life expectancy of patients with trisomy 13, we conclude that surgical treatments for non-life threatening malformations such as cleft lip and palate should be performed for such patients.
[Nasolabial muscle finite-element study and clinical application].
Yin, Ningbei; Wu, Jiajun; Chen, Bo; Wang, Yongqian; Song, Tao; Ma, Hengyuan
2015-05-01
To investigate the nasolabial muscle anatomy and biomechanical characteristics. Micro-computed tomography scan was performed in 8 cases of spontaneous abortion fetus lip nasal specimens to construct a three-dimensional model. The nasolabial muscle structure was analyzed using Mimics software. The three-dimensional configuration model of nasolabial muscle was established based on local anatomy and tissue section, and compared with tissue section. Three dimensional finite element analysis was performed on lip nasal muscle related biomechanics and surface deformation in Application verification was carried out in 263 cases of microform cleft lip surgery. There was close relationship between nasolabial muscle. The nasolabial muscle tension system was constituted, based on which a new cleft lip repair surgery was designed and satisfied results were achieved. There is close relationship among nasolabial muscle in anatomy, histology and biomechanics. To obtain better effect, cleft lip repair should be performed on the basis of recovering muscle tension system.
Hu, Zunfang; Xu, Longqian; Wen, Xianghua
2013-01-01
Immobilization of enzymes on mesoporous silicas (MS) allows for good reusability. MS with two-dimensional hexagonal pores in diameter up to 14.13 nm were synthesized using Pluronic P123 as template and 1,3,5-triisopropylbenzene as a swelling agent in acetate buffer. The surface of MS was modified by the silanization reagents 3-aminopropyltriethoxysilane. Lignin peroxidase (LiP) was successfully immobilized on the modified MS through covalent binding method by four agents: glutaraldehyde, 1,4-phenylene diisothiocyanate, cyanotic chloride and water-soluble carbodiimide. Results showed that cyanotic chloride provided the best performance for LIP immobilization. The loaded protein concentration was 12.15 mg/g and the immobilized LiP activity was 812.9 U/L. Immobilized LiP had better pH stability. Acid Orange II was used to examine the reusability of immobilized LiP, showing more than 50% of the dye was decolorized at the fifth cycle.
It's a privilege to smile: impact of cleft lip palate on families.
Zeytinoglu, Senem; Davey, Maureen P
2012-09-01
In this article we describe prior cross-sectional and longitudinal research conducted with children who were born with cleft lip and/or palate and their families in the United States and internationally. The findings and clinical implications from different times and cultures are synthesized using the Biopsychosocial Model. Our primary aim is to summarize the attachment styles, cognitive, psychological and social functioning, self-concept, neurological functioning, and speech difficulties prevalent among individuals who are born with cleft lip/palate at different developmental stages (e.g., infancy, toddler, childhood, adolescence). Additionally, bystander reactions to the speech and appearance of individuals coping with cleft lip and/or palate and its effects on the family are described. Finally we examine the diversity of samples from prior clinical research and provide clinical recommendations for more collaborative family-based practice among medical and mental health providers treating families coping with cleft lip and/or palate.
Finite element elastic-plastic-creep and cyclic life analysis of a cowl lip
NASA Technical Reports Server (NTRS)
Arya, Vinod K.; Melis, Matthew E.; Halford, Gary R.
1990-01-01
Results are presented of elastic, elastic-plastic, and elastic-plastic-creep analyses of a test-rig component of an actively cooled cowl lip. A cowl lip is part of the leading edge of an engine inlet of proposed hypersonic aircraft and is subject to severe thermal loadings and gradients during flight. Values of stresses calculated by elastic analysis are well above the yield strength of the cowl lip material. Such values are highly unrealistic, and thus elastic stress analyses are inappropriate. The inelastic (elastic-plastic and elastic-plastic-creep) analyses produce more reasonable and acceptable stress and strain distributions in the component. Finally, using the results from these analyses, predictions are made for the cyclic crack initiation life of a cowl lip. A comparison of predicted cyclic lives shows the cyclic life prediction from the elastic-plastic-creep analysis to be the lowest and, hence, most realistic.
Drago, Fabiana B; Núñez, Verónica; Lunaschi, Lía I
2018-03-01
Studying the Helminthological Collection of Museo de La Plata (MLP-He), several specimens of digeneans, recovered parasitizing a long-winged harrier, Circus buffoni (Accipitridae) from Buenos Aires Argentina, were analysed. The morphological and morphometric analysis of these specimens revealed the presence of two strigeid species, one of them new for science. Parastrigea buffoni n. sp. is characterised by a forebody differentiated in a retractile cephalic region with a large opening and a balloon-shaped collar region or collerette, suckers located in cephalic region, holdfast organ with well development dorsal and ventral lips that can emerge through opening, a claviform hindbody, a large copulatory bursa with muscular ring (Ringnapf) and a genital cone well delimited, crossed by a sinuous hermaphroditic duct with internal rugae. The euryxenous parasite, Strigea falconis brasiliana, is briefly described, parasitizing a new host. This is the first record of helminths parasitizing long-winged harrier.
ERIC Educational Resources Information Center
Kalland, Mirjam
This study focused on the psychosocial aspects of cleft lip and/or palate on maternal emotional reactions and the family, with emphasis on the effect on the maternal-infant bond. Interviews were conducted with 40 mothers of 1-year-old infants with non-syndromic cleft lip and/or palate. The interviews were analyzed using the phenomenological…
Yuta Miki; Rebecca Pogni; Sandra Acebes; Fatima Lucas; Elena Fernandez-Fueyo; Maria Camilla Baratto; Maria I. Fernandez; Vivian De Los Rios; Francisco J. Ruiz-duenas; Adalgisa Sinicropi; Riccardo Basosi; Kenneth E. Hammel; Victor Guallar; Angel T. Martinez
2013-01-01
LiP (lignin peroxidase) from Trametopsis cervina has an exposed catalytic tyrosine residue (Tyr181) instead of the tryptophan conserved in other lignin-degrading peroxidases. Pristine LiP showed a lag period in VA (veratryl alcohol) oxidation. However, VA-LiP (LiP after treatment with H2O2...
An Optimal Set of Flesh Points on Tongue and Lips for Speech-Movement Classification
ERIC Educational Resources Information Center
Wang, Jun; Samal, Ashok; Rong, Panying; Green, Jordan R.
2016-01-01
Purpose: The authors sought to determine an optimal set of flesh points on the tongue and lips for classifying speech movements. Method: The authors used electromagnetic articulographs (Carstens AG500 and NDI Wave) to record tongue and lip movements from 13 healthy talkers who articulated 8 vowels, 11 consonants, a phonetically balanced set of…
EF5 to Evaluate Tumor Hypoxia in Patients With High-Grade Soft Tissue Sarcoma or Mouth Cancer
2013-01-15
Stage I Adult Soft Tissue Sarcoma; Stage I Squamous Cell Carcinoma of the Lip and Oral Cavity; Stage II Adult Soft Tissue Sarcoma; Stage II Squamous Cell Carcinoma of the Lip and Oral Cavity; Stage III Adult Soft Tissue Sarcoma; Stage III Squamous Cell Carcinoma of the Lip and Oral Cavity
ERIC Educational Resources Information Center
Humensky, Jennifer L.; Gil, Rosa M.; Mazzula, Silvia; Diaz, Samantha; Lewis-Fernández, Roberto
2017-01-01
Life is Precious (LIP) was developed to help reduce suicidal behavior in Latina adolescents. As part of an external evaluation of the LIP program, we conducted focus groups with adolescent participants and mothers to learn whether participants and families believe that the activities of LIP address risks for suicidal behavior. Four focus groups…
Lip cancer in Zimbabwe. Report of 14 cases.
Chidzonga, M M
2005-03-01
Lip cancer, relatively common among fair-skinned males, is uncommon among Black-skinned males. In a 10-year review period of 358 Black African patients with orofacial squamous cell carcinoma, 3.9% (n = 14) were found on the lip with a male to female ratio of 2.5:1. Fifty percent (n = 7) of the patients were albinos and two were children with xeroderma pigmentosum. The lower lip was most commonly affected (78.6%). The well-differentiated and moderately differentiated histopathologic types each comprised 42.9% of the lesions. Alcohol consumption and tobacco usage was admitted to in 42.9% (n = 6) of the patients.
Kushwaha, Jitendra Kumar
2013-01-01
Approximation theory is a very important field which has various applications in pure and applied mathematics. The present study deals with a new theorem on the approximation of functions of Lipschitz class by using Euler's mean of conjugate series of Fourier series. In this paper, the degree of approximation by using Euler's means of conjugate of functions belonging to Lip (ξ(t), p) class has been obtained. Lipα and Lip (α, p) classes are the particular cases of Lip (ξ(t), p) class. The main result of this paper generalizes some well-known results in this direction. PMID:24379744
[Presurgical nasoalveolar molding in infants with cleft lip and palate: analysis of 29 cases].
Hou, Yu-xia; Ren, Zhan-ping; Li, Jin-feng; Li, Xiang-lin; Ma, Si-wei; Cao, Hui-qin
2011-12-01
The objective of this study was to treat the cleft lip and alveolus, nasal deformity with presurgical nasoalveolar molding (PNAM), to elucidate the problems and treatment methods, which may be helpful for the use of PNAM in clinic. Twenty nine infants with cleft lip and palate (CLP) were treated with PNAM in our center. There were 19 unilateral and 10 bilateral CLP patients. The initial visit time was 3 to 150 days after birth. Treatment time ranged from 2.5 to 3 months. The appliance was modified at 2-week interval. According to the evaluation standards, 17 infants were treated successfully with the closure of cleft lip and alveolar processes, reposition of the deformed nasal cartilages, and increased length of columella. The lip and nasal deformities of 9 infants were corrected partly, which were helpful for surgery. There were 3 infants giving up PNAM. There were five important facts for the successful treatment, including initial visit time, impression of the intraoral cleft defect, modification of the plate and the nasal stent, and use of nasal splints. Orthodontics and plastic surgeons should have the same views for PNAM in infants, which will advance the treatment level for cleft lip and palate.
The Role of the Lateral Intraparietal Area in (the Study of) Decision Making.
Huk, Alexander C; Katz, Leor N; Yates, Jacob L
2017-07-25
Over the past two decades, neurophysiological responses in the lateral intraparietal area (LIP) have received extensive study for insight into decision making. In a parallel manner, inferred cognitive processes have enriched interpretations of LIP activity. Because of this bidirectional interplay between physiology and cognition, LIP has served as fertile ground for developing quantitative models that link neural activity with decision making. These models stand as some of the most important frameworks for linking brain and mind, and they are now mature enough to be evaluated in finer detail and integrated with other lines of investigation of LIP function. Here, we focus on the relationship between LIP responses and known sensory and motor events in perceptual decision-making tasks, as assessed by correlative and causal methods. The resulting sensorimotor-focused approach offers an account of LIP activity as a multiplexed amalgam of sensory, cognitive, and motor-related activity, with a complex and often indirect relationship to decision processes. Our data-driven focus on multiplexing (and de-multiplexing) of various response components can complement decision-focused models and provides more detailed insight into how neural signals might relate to cognitive processes such as decision making.
Kang, Sang-Hoon; Kim, Moon-Key; An, Sang-In; Lee, Ji-Yeon
2016-12-01
The aim of this study was to examine the relationship between improvements in lip asymmetry at rest and while smiling after orthognathic surgery in patients with skeletal class III malocclusion. This study included 21 patients with skeletal class III malocclusion and facial asymmetry. We used preoperative and postoperative CT data and photographs to measure the vertical distance of the lips when smiling. The photographs were calibrated based on these distances and the CT image. We compared preoperative and postoperative results with the t test and correlations between measurements at rest and when smiling by regression analyses. There were significant correlations between the postoperative changes in canting of the mouth corners at rest, canting of the canines, canting of the first molars, the slope of the line connecting the canines, and the slope of the line connecting first molars. The magnitude of the postoperative lip line improvement while smiling was not significantly correlated with changes in the canting and slopes of the canines, molars, and lip lines at rest. It remains difficult to predict lip line changes while smiling compared with at rest after orthognathic surgery in patients with mandibular prognathism, accompanied by facial asymmetry.
Song, Jiao J; Tian, Wen J; Kwok, Lai-Yu; Wang, Ya L; Shang, Yi N; Menghe, Bilige; Wang, Jun G
2017-10-01
The in vivo effects of administering free and microencapsulated Lactobacillus plantarum LIP-1 cells (2·0×109 colony-forming units/d) were evaluated in high-fat-diet-induced hyperlipidaemic rats. Results from real-time quantitative PCR targeting to LIP-1 cells showed a higher colon colonisation count of LIP-1 in the rats receiving microencapsulated cells compared with free cells (P<0·05). Moreover, the microencapsulated LIP-1 treatment resulted in a more obvious lipid-lowering effect (P<0·05). Meanwhile, their faecal samples had significantly less lipopolysaccharide-producing bacteria (especially Bilophila, Sutterella and Oscillibacter) and mucosa-damaging bacteria (Bilophila and Akkermansia muciniphila), whereas significantly more SCFA-producing bacteria (P<0·05) (namely Lactobacillus, Alloprevotella, Coprococcus, Eubacterium and Ruminococcus) and bacteria that potentially possessed bile salt hydrolase activity (Bacteroides, Clostridium, Eubacterium and Lactobacillus), and other beneficial bacteria (Alistipes and Turicibacter). Further, Spearman's correlation analysis showed significant correlations between some of the modulated gut bacteria and the serum lipid levels. These results together confirm that microcapsulation enhanced the colon colonisation of LIP-1 cells, which subsequently exhibited more pronounced effects in improving the gut microbiota composition of hyperlipidaemic rats and lipid reduction.
Automatic lip reading by using multimodal visual features
NASA Astrophysics Data System (ADS)
Takahashi, Shohei; Ohya, Jun
2013-12-01
Since long time ago, speech recognition has been researched, though it does not work well in noisy places such as in the car or in the train. In addition, people with hearing-impaired or difficulties in hearing cannot receive benefits from speech recognition. To recognize the speech automatically, visual information is also important. People understand speeches from not only audio information, but also visual information such as temporal changes in the lip shape. A vision based speech recognition method could work well in noisy places, and could be useful also for people with hearing disabilities. In this paper, we propose an automatic lip-reading method for recognizing the speech by using multimodal visual information without using any audio information such as speech recognition. First, the ASM (Active Shape Model) is used to track and detect the face and lip in a video sequence. Second, the shape, optical flow and spatial frequencies of the lip features are extracted from the lip detected by ASM. Next, the extracted multimodal features are ordered chronologically so that Support Vector Machine is performed in order to learn and classify the spoken words. Experiments for classifying several words show promising results of this proposed method.
NASA Astrophysics Data System (ADS)
Sheth, Hetu C.
2007-12-01
This article is an appeal for the adoption of a correct and appropriate terminology with respect to the so-called Large Igneous Provinces (LIPs). The term LIP has been widely applied to large basaltic provinces such as the Deccan Traps, and the term Silicic Large Igneous Province (SLIP) to volcanic provinces of dominantly felsic composition, such as the Whitsunday Province. However, neither term (LIP, SLIP) has been applied to the large granitic batholiths of the world (e.g., Andes) to which both terms are perfectly applicable. LIP has also not been applied to broad areas of contemporaneous basalt magmatism (e.g., Indochina, Mongolia) and sizeable layered mafic intrusions (e.g., Bushveld) which in many significant respects may also be considered to represent 'Large Igneous Provinces'. Here, I suggest that the term LIP is used in its broadest sense and that it should designate igneous provinces with outcrop areas ≥ 50,000 km 2. I propose a simple hierarchical classification of LIPs that is independent of composition, tectonic setting, or emplacement mechanism. I suggest that provinces such as the Deccan and Whitsunday provinces should be called Large Volcanic Provinces (LVPs), whereas large intrusive provinces (mafic-ultramafic intrusions, dyke/sill swarms, granitic batholiths) should be called Large Plutonic Provinces (LPPs). LVPs and LPPs thus together cover all LIPs, which can be felsic, mafic, or ultramafic, of sub-alkalic or alkalic affinity, and emplaced in continental or oceanic settings. LVPs are subdivided here into four groups: (i) the dominantly/wholly mafic Large Basaltic Provinces (LBPs) (e.g., Deccan, Ontong Java); (ii) the dominantly felsic Large Rhyolitic Provinces (LRPs) (e.g., Whitsunday, Sierra Madre Occidental); (iii) the dominantly andesitic Large Andesitic Provinces (LAPs) (e.g., Andes, Indonesia, Cascades), and (iv) the bimodal Large Basaltic-Rhyolitic Provinces (LBRPs) (e.g., Snake River-High Lava Plains). The intrusive equivalents of LRPs are the Large Granitic Provinces (LGPs) (e.g., the Andean batholiths), although an equivalent term for intrusive equivalents of LBPs is not necessary or warranted. The accuracy and usefulness of the terms flood basalt, plateau basalt, and trap are also examined. The largest LBP, LVP, and LIP is, of course, the bulk of the ocean floor. It is contended that the proposed LIP nomenclature and classification will lead to more accurate and precise terminology and hence better understanding of the wide variety of Large Igneous Provinces.
Mosmuller, David; Tan, Robin; Mulder, Frans; Bachour, Yara; de Vet, Henrica; Don Griot, Peter
2016-10-01
It is essential to have a reliable assessment method in order to compare the results of cleft lip and palate surgery. In this study the computer-based program SymNose, a method for quantitative assessment of the nose and lip, will be assessed on usability and reliability. The symmetry of the nose and lip was measured twice in 50 six-year-old complete and incomplete unilateral cleft lip and palate patients by four observers. For the frontal view the asymmetry level of the nose and upper lip were evaluated and for the basal view the asymmetry level of the nose and nostrils were evaluated. A mean inter-observer reliability when tracing each image once or twice was 0.70 and 0.75, respectively. Tracing the photographs with 2 observers and 4 observers gave a mean inter-observer score of 0.86 and 0.92, respectively. The mean intra-observer reliability varied between 0.80 and 0.84. SymNose is a practical and reliable tool for the retrospective assessment of large caseloads of 2D photographs of cleft patients for research purposes. Moderate to high single inter-observer reliability was found. For future research with SymNose reliable outcomes can be achieved by using the average outcomes of single tracings of two observers. Copyright © 2016 European Association for Cranio-Maxillo-Facial Surgery. Published by Elsevier Ltd. All rights reserved.
Radiology of Cleft Lip and Palate: Imaging for the Prenatal Period and throughout Life.
Abramson, Zachary R; Peacock, Zachary S; Cohen, Harris L; Choudhri, Asim F
2015-01-01
Recent advances in prenatal imaging have made possible the in utero diagnosis of cleft lip and palate and associated deformities. Postnatal diagnosis of cleft lip is made clinically, but imaging still plays a role in detection of associated abnormalities, surgical treatment planning, and screening for or surveillance of secondary deformities. This article describes the clinical entities of cleft lip with or without cleft palate (CLP) and isolated cleft palate and documents their prenatal and postnatal appearances at radiography, ultrasonography (US), magnetic resonance (MR) imaging, and computed tomography (CT). Imaging protocols and findings for prenatal screening, detection of associated anomalies, and evaluation of secondary deformities throughout life are described and illustrated. CLP and isolated cleft palate are distinct entities with shared radiologic appearances. Prenatal US and MR imaging can depict clefting of the lip or palate and associated anomalies. While two- and three-dimensional US often can depict cleft lip, visualization of cleft palate is more difficult, and repeat US or fetal MR imaging should be performed if cleft palate is suspected. Postnatal imaging can assist in identifying associated abnormalities and dentofacial deformities. Dentofacial sequelae of cleft lip and palate include missing and supernumerary teeth, oronasal fistulas, velopharyngeal insufficiency, hearing loss, maxillary growth restriction, and airway abnormalities. Secondary deformities can often be found incidentally at imaging performed for other purposes, but detection is necessary because they may have considerable implications for the patient. (©)RSNA, 2015.
Binding of human plasminogen by the lipoprotein LipL46 of Leptospira interrogans.
Santos, Jadson V; Pereira, Priscila R M; Fernandes, Luis G V; Siqueira, Gabriela Hase; de Souza, Gisele O; Souza Filho, Antônio; Vasconcellos, Silvio A; Heinemann, Marcos B; Chapola, Erica G B; Nascimento, Ana L T O
2018-02-01
Leptospirosis is a widespread zoonosis caused by pathogenic Leptospira. Bacteria disseminate via the bloodstream and colonize the renal tubules of reservoir hosts. Leptospiral surface-exposed proteins are important targets, because due to their location they can elicit immune response and mediate adhesion and invasion processes. LipL46 has been previously reported to be located at the leptospiral outer membrane and recognized by antibodies present in serum of infected hamsters. In this study, we have confirmed the cellular location of this protein by immunofluorescence and FACS. We have cloned and expressed the recombinant protein LipL46 in its soluble form. LipL46 was recognized by confirmed leptospirosis human serum, suggesting its expression during infection. Binding screening of LipL46 with extracellular matrix (ECM) and plasma components showed that this protein interacts with plasminogen. The binding is dose-dependent on protein concentration, but saturation was not reached with the range of protein concentration used. Kringle domains of plasminogen and lysine residues of the recombinant protein are involved in the binding because the lysine analog, amino caproic acid (ACA) almost totally inhibited the reaction. The interaction of LipL46 with plasminogen generates plasmin in the presence of plasminogen activator uPA. Because plasmin generated at the leptospiral surface can degrade ECM molecules and decrease opsonophagocytosis, we tentatively infer that Lip46 has a role in helping the invasion process of pathogenic Leptospira. Copyright © 2017. Published by Elsevier Ltd.
Deveson Lucas, Deanna S; Lo, Miranda; Bulach, Dieter M; Quinsey, Noelene S; Murray, Gerald L; Allen, Andy; Adler, Ben
2014-03-14
Leptospira borgpetersenii serovar Hardjo subtype Hardjobovis (Hardjobovis) is the main causative agent of bovine leptospirosis in Australia, New Zealand, North America and elsewhere. Bovine leptospirosis can result in spontaneous abortion, stillbirth and reduced milk output. The organism is shed in the urine of infected animals and contact with contaminated materials can result in zoonotic infections in humans. Protective immunity in cattle against Hardjobovis involves stimulation of a Th1 cell mediated immune response, which can be characterized by the production of IFN-γ when blood from vaccinated animals is exposed to Hardjobovis antigens. However, the leptospiral components involved in stimulating this response have yet to be identified. In this study, 238 recombinant leptospiral proteins were evaluated for their ability to stimulate IFN-γ production in blood of cattle vaccinated with a commercial monovalent Hardjobovis vaccine. The conserved lipoprotein LipL32 is the major outer membrane protein of pathogenic Leptospira spp. A pool of soluble recombinant proteins which included LipL32, as well as LipL32 alone, stimulated significant IFN-γ production in blood of vaccinated cattle. A number of recombinant LipL32 fragments was generated, which identified the amino acids between 20 and 200 as containing the bovine T-cell reactive regions of LipL32. However, whether LipL32 plays a role in stimulating protective immunity in mammals has yet to be conclusively determined. Copyright © 2014 Elsevier B.V. All rights reserved.
Bioaccessible trace metals in lip cosmetics and their health risks to female consumers.
Gao, Peng; Lei, Tingting; Jia, Liming; Yury, Badmatsybenov; Zhang, Zhaohan; Du, Yingqiu; Feng, Yujie; Xing, Baoshan
2018-07-01
Females can be exposed to toxic elements in lip cosmetics following ingestion. The bioaccessibility of Cr, Mn, Co, Ni, Cu, Cd, Sb and Pb in lip cosmetics (n = 32) were assessed via the dilute HCl extraction method, In Vitro Gastrointestinal protocol (IVG) and the United States Pharmacopeia Methodology (USPM), and then health risks were characterized. The total concentrations of trace metals (TMs) in lip cosmetics were in the range of 15.55-111.97 mg/kg (Mean: 60.99 mg/kg). Cu, Pb and Cr were the three major TMs and accounting for >75% of the total concentrations. Except Sb and Pb in 4/32 and 4/32 samples were higher than the US FDA (Food and Drug Administration of the United States) limits, the other TMs were lower than that limits. Only bioaccessible Pb in all samples significantly exceeded the FDA limit 0.1 mg/kg in candy. Using IVG or USPM might be preferable for evaluating the TMs exposure over HCl since they better represent gastrointestinal physiology. The estimated average daily intake (ADI) of bioaccessible ∑TMs through lip cosmetics ingestion of career women and female college students were under safety level. The long-term exposure of bioaccessible TMs by lip cosmetics using would inevitably cause non-carcinogenic health risk. This is the first report on the in vitro tests used for evaluating bioaccessible TMs in lip cosmetics. Copyright © 2018. Published by Elsevier Ltd.
Grueter, Cyril C.; Zhu, Pingfen; Allen, William L.; Higham, James P.; Ren, Baoping; Li, Ming
2015-01-01
Sexual selection typically produces ornaments in response to mate choice, and armaments in response to male–male competition. Unusually among mammals, many primates exhibit colour signals that may be related to one or both processes. Here, we document for the first time correlates of facial coloration in one of the more brightly coloured primates, the black-and-white snub-nosed monkey (Rhinopithecus bieti). Snub-nosed monkeys have a one-male unit (OMU) based social organization, but these units aggregate semi-permanently into larger bands. This form of mating system causes many males to become associated with bachelor groups. We quantified redness of the prominent lower lip in 15 males (eight bachelors, seven OMU holders) in a group at Xiangguqing, China. Using mixed models, our results show that lip redness increases with age. More interestingly, there is a significant effect of the interaction of group-holding status and mating season on redness; that is, lip colour of OMU males undergoes reddening in the mating season, whereas the lips of subadult and juvenile bachelor males become paler at that time of year. These results indicate that lip coloration is a badge of (group-holding) status during the mating season, with non-adults undergoing facial differentiation, perhaps to avoid the costs of reproductive competition. Future research should investigate whether lip coloration is a product of male–male competition, and/or female mate choice. PMID:27019735
Parent satisfaction with primary repair of paediatric cleft lip in Southwest China.
Ha, P; Li, C; Shi, B
2017-03-01
The purpose of this study was to investigate the key factors in relation to parent satisfaction with the primary repair of paediatric cleft lip. One hundred and ninety-five children born with cleft lip and/or palate aged between 3 months and 1 year were recruited, along with their caregivers. All patients underwent primary cleft lip repair, and a telephone interview was held with their main caregivers at 3 months postoperative. The level of satisfaction with each item included in a simplified Cleft Evaluation Profile was ascertained and recorded. Patient clinical data were obtained from the medical records. One hundred and thirty-eight (71%) parents reported satisfaction with the general outcome of surgery. Parents were satisfied with the appearance of the lip and profile of the face, but were dissatisfied with the appearance of the nose and teeth. Mothers of patients showed lower satisfaction levels than fathers and grandparents. Parental satisfaction with the appearance of the lip was lower for patients without a cleft palate than for those with a cleft palate. The results of this study suggest that most Chinese parents of children who undergo primary cleft lip repair express satisfaction with the surgical outcomes. Satisfaction with the appearance of the nose and teeth is low and this needs to be improved. Other factors are likely to influence expressions of satisfaction. Copyright © 2016 International Association of Oral and Maxillofacial Surgeons. Published by Elsevier Ltd. All rights reserved.
Factors associated with lip and oral cavity cancer.
Ribeiro, Isabella Lima Arrais; de Medeiros, Júlia Julliêta; Rodrigues, Larycia Vicente; Valença, Ana Maria Gondim; Lima Neto, Eufrásio de Andrade
2015-01-01
This study aimed to identify factors associated with the occurrence of primary cancer of the lip and oral cavity regions compared to other types of head and neck cancers according to demographic, socioeconomic data and lifestyle, in Brazil, from 2000 to 2011. A study was conducted using Hospital Cancer Records (Instituto Nacional do Câncer), from 2000 to 2011, totaling 23,153 cases. Data were analyzed by binary logistic regression (response category: primary cancers located in the lip and oral cavity; comparison category; other types of primary cancer in the head and neck, which does not affect the lip and oral cavity) at a significance level α = 5%. The study showed factors associated with higher incidence of cancer in the lip and oral cavity: being of advanced age (OR = 1.16), not having a family history of cancer (OR = 2.38), alcohol consumption (OR = 1.17); former tobacco use (OR = 1.51) or current tobacco use (OR = 1.65); having a previous diagnosis of cancer without treatment (OR =1.66). Being female (OR = 0.92), having completed basic (OR = 0.71) and higher (OR = 0.46) education and having previous diagnosis of cancer with treatment (OR = 0.74) constituted factors associated with lower prevalence of cancer of the lip and oral cavity. Age, absence of family history of cancer, smoking habits and alcohol consumption, and previous diagnosis of cancer without treatment were associated with a higher incidence of cancer of the lip and oral cavity.
LIP: The Livermore Interpolation Package, Version 1.4
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fritsch, F N
2011-07-06
This report describes LIP, the Livermore Interpolation Package. Because LIP is a stand-alone version of the interpolation package in the Livermore Equation of State (LEOS) access library, the initials LIP alternatively stand for the 'LEOS Interpolation Package'. LIP was totally rewritten from the package described in [1]. In particular, the independent variables are now referred to as x and y, since the package need not be restricted to equation of state data, which uses variables {rho} (density) and T (temperature). LIP is primarily concerned with the interpolation of two-dimensional data on a rectangular mesh. The interpolation methods provided include piecewisemore » bilinear, reduced (12-term) bicubic, and bicubic Hermite (biherm). There is a monotonicity-preserving variant of the latter, known as bimond. For historical reasons, there is also a biquadratic interpolator, but this option is not recommended for general use. A birational method was added at version 1.3. In addition to direct interpolation of two-dimensional data, LIP includes a facility for inverse interpolation (at present, only in the second independent variable). For completeness, however, the package also supports a compatible one-dimensional interpolation capability. Parametric interpolation of points on a two-dimensional curve can be accomplished by treating the components as a pair of one-dimensional functions with a common independent variable. LIP has an object-oriented design, but it is implemented in ANSI Standard C for efficiency and compatibility with existing applications. First, a 'LIP interpolation object' is created and initialized with the data to be interpolated. Then the interpolation coefficients for the selected method are computed and added to the object. Since version 1.1, LIP has options to instead estimate derivative values or merely store data in the object. (These are referred to as 'partial setup' options.) It is then possible to pass the object to functions that interpolate or invert the interpolant at an arbitrary number of points. The first section of this report describes the overall design of the package, including both forward and inverse interpolation. Sections 2-6 describe each interpolation method in detail. The software that implements this design is summarized function-by-function in Section 7. For a complete example of package usage, refer to Section 8. The report concludes with a few brief notes on possible software enhancements. For guidance on adding other functional forms to LIP, refer to Appendix B. The reader who is primarily interested in using LIP to solve a problem should skim Section 1, then skip to Sections 7.1-4. Finally, jump ahead to Section 8 and study the example. The remaining sections can be referred to in case more details are desired. Changes since version 1.1 of this document include the new Section 3.2.1 that discusses derivative estimation and new Section 6 that discusses the birational interpolation method. Section numbers following the latter have been modified accordingly.« less
LIP: The Livermore Interpolation Package, Version 1.3
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fritsch, F N
2011-01-04
This report describes LIP, the Livermore Interpolation Package. Because LIP is a stand-alone version of the interpolation package in the Livermore Equation of State (LEOS) access library, the initials LIP alternatively stand for the ''LEOS Interpolation Package''. LIP was totally rewritten from the package described in [1]. In particular, the independent variables are now referred to as x and y, since the package need not be restricted to equation of state data, which uses variables {rho} (density) and T (temperature). LIP is primarily concerned with the interpolation of two-dimensional data on a rectangular mesh. The interpolation methods provided include piecewisemore » bilinear, reduced (12-term) bicubic, and bicubic Hermite (biherm). There is a monotonicity-preserving variant of the latter, known as bimond. For historical reasons, there is also a biquadratic interpolator, but this option is not recommended for general use. A birational method was added at version 1.3. In addition to direct interpolation of two-dimensional data, LIP includes a facility for inverse interpolation (at present, only in the second independent variable). For completeness, however, the package also supports a compatible one-dimensional interpolation capability. Parametric interpolation of points on a two-dimensional curve can be accomplished by treating the components as a pair of one-dimensional functions with a common independent variable. LIP has an object-oriented design, but it is implemented in ANSI Standard C for efficiency and compatibility with existing applications. First, a ''LIP interpolation object'' is created and initialized with the data to be interpolated. Then the interpolation coefficients for the selected method are computed and added to the object. Since version 1.1, LIP has options to instead estimate derivative values or merely store data in the object. (These are referred to as ''partial setup'' options.) It is then possible to pass the object to functions that interpolate or invert the interpolant at an arbitrary number of points. The first section of this report describes the overall design of the package, including both forward and inverse interpolation. Sections 2-6 describe each interpolation method in detail. The software that implements this design is summarized function-by-function in Section 7. For a complete example of package usage, refer to Section 8. The report concludes with a few brief notes on possible software enhancements. For guidance on adding other functional forms to LIP, refer to Appendix B. The reader who is primarily interested in using LIP to solve a problem should skim Section 1, then skip to Sections 7.1-4. Finally, jump ahead to Section 8 and study the example. The remaining sections can be referred to in case more details are desired. Changes since version 1.1 of this document include the new Section 3.2.1 that discusses derivative estimation and new Section 6 that discusses the birational interpolation method. Section numbers following the latter have been modified accordingly.« less
Warthin tumor of the upper lip: an unusual location of a benign salivary gland tumor.
dos Santos Almeida, Aroldo; Costa Hanemann, João Adolfo; Tostes Oliveira, Denise
2011-06-01
Warthin tumor (papillary cystadenoma lymphomatosum) is a benign salivary gland tumor involving almost exclusively the parotid gland. The lip is a very unusual location for this type of tumor, which develops only rarely in minor salivary glands. The case of 42-year-old woman with Warthin tumor arising in minor salivary glands of the upper lip is reported.
Cleft Lip and Cleft Palate--What to Know and Who Can Help
ERIC Educational Resources Information Center
Apel, Laura
2008-01-01
Craniofacial defects such as cleft lip and cleft palate are among the most common of all birth defects in the United States, with one in every 600 newborns affected. Cleft lip and/or palate can occur as an isolated condition or may be one component of an inherited disease or syndrome. Dealing with the condition is an extremely difficult and…
1999-05-01
cleft palate / lip , upper alimentary, male reproductive, and urinary tract birth defects than the active surveillance database. Prevalence for the...the passive CEIS surveillance contained a smaller number of cleft palate / lip , upper alimentary, male reproductive, and urinary tract birth defects...Cardiovascular 33 29 8 63 Respiratory 4 3 0 4 Cleft palate / lip 12 4 3 14 Upper alimentary
ERIC Educational Resources Information Center
Murdoch, Bruce E.; Cheng, Hei-Yan; Goozee, Justine V.
2012-01-01
This study investigated the developmental variability of lip and tongue movement in 48 children and adults. Motion of the tongue-tip, tongue-body and lower lip was recorded using electromagnetic articulography during productions of sentences containing /t/, /s/, /l/, /k/ and /p/. Four groups of speakers participated in the study: (1) aged 6-7…
Philip Stewart; Daniel Cullen
1999-06-01
The lignin peroxidases of Phanerochaete chrysosporium are encoded by a minimum of 10 closely related genes. Physical and genetic mapping of a cluster of eight lip genes revealed six genes occurring in pairs and transcriptionally convergent, suggesting that portions of the lip family arose by gene duplication events. The completed sequence of 1ipG and lipJ, together...
2013-09-27
Stage II Squamous Cell Carcinoma of the Lip and Oral Cavity; Stage II Squamous Cell Carcinoma of the Oropharynx; Stage III Squamous Cell Carcinoma of the Lip and Oral Cavity; Stage III Squamous Cell Carcinoma of the Oropharynx; Stage IV Squamous Cell Carcinoma of the Lip and Oral Cavity; Stage IV Squamous Cell Carcinoma of the Oropharynx
[Decolorization of skin and hair-derived melanin by three ligninolytic enzymes].
Miao, F; Lei, T C; Su, M Y; Yi, W J; Jiang, S; Xu, S Z
2017-11-21
Objective: To compare the decolorization efficiency of lignin peroxidase (LiP), manganese peroxidase (MnP) and laccase on eumelanin and pheomelanin, and to investigate the effect of topical administration of LiP solution on hyperpigmented guinea pigs skin induced by 308 nm excimer light. Methods: Pheomelanin-enriched specimens were prepared from human hair and cutaneous melanoma tissue using alkaline lysis method.Synthetic eumelanin was purchased from a commercial supplier.The same amount (0.02%) of melanin was incubated with the equal enzyme activity (0.2 U/ml) of ligninolytic enzymes for 3 h respectively.The absorbance at 475 nm ( A (475)) in the enzyme-catalyzed solution was measured using ELISA microplate reader.The experimental hyperpigmentation model was established in the dorsal skin of brownish guinea pigs using 308 nm excimer light radiation.LiP and heat-inactivated LiP solution were topically applied at each site.Meanwhile, 3% hydroquinone and vehicle cream were used as control.The skin color (L value) was recorded using a CR-10 Minolta chromameter.Corneocytes were collected using adhesive taping method.The amount and distribution of melanin in the corneocytes and skin tissues was visualized by Fontana-Masson staining. Results: All three ligninolytic enzymes showed various degree of eumelanin and pheomelanin decolorization activity.The decolorization activity of LiP, MnP and laccase was 40%-70%, 22%-42% and 9%-21%, respectively.The similar lightening was shown in the skin treated with LiP solution and 3% hydroquinone.The amount of melanin granules in the corneocytes was 199±11 by LiP, which was less than that in untreated control (923±12) and heat-inactive control (989±13). The amount of melanin was decreased in the whole epidermis treated with hydroquinone, the epidermis thickness was increased as well. In contrast, melanin of LiP group was decreased only in the superficial epidermis, the epidermis thickness seemed to be normal. Conclusion: LiP exerts a potent decolorization activity for hair- or skin-derived pheomelanin as well as eumelanin.It remains to be further investigated whether LiP serves as a substitute for hydroquinone in skin lightening products.
FUEL SUBASSEMBLY CONSTRUCTION FOR RADIAL FLOW IN A NUCLEAR REACTOR
Treshow, M.
1962-12-25
An assembly of fuel elements for a boiling water reactor arranged for radial flow of the coolant is described. The ingress for the coolant is through a central header tube, perforated with parallel circumferertial rows of openings each having a lip to direct the coolant flow downward. Around the central tube there are a number of equally spaced concentric trays, closely fitiing the central header tube. Cylindrical fuel elements are placed in a regular pattern around the central tube, piercing the trays. A larger tube encloses the arrangement, with space provided for upward flow of coolart beyond the edge of the trays. (AEC)
Organic Rankine cycle receiver development
NASA Technical Reports Server (NTRS)
Haskins, H. J.
1981-01-01
The selected receiver concept is a direct-heated, once-through, monotube boiler operated at supercritical pressure. The cavity is formed by a cylindrical copper shell and backwall, with stainless steel tubing brazed to the outside surface. This core is surrounded by lightweight refractory insulation, load-bearing struts, and an outer case. The aperture plate is made of copper to provide long life by conduction and reradiation of heat away from the aperture lip. The receiver thermal efficiency is estimated to be 97 percent at rated conditions (energy transferred to toluene divided by energy incident on aperture opening). Development of the core manufacturing and corrosion protection methods is complete.
Ozçelik, Derya; Sağlam, Ibrahim; SIlan, Fatma; Sezen, Gülbin; Unveren, Toygar
2008-05-01
We report that a 4-year-old boy presented with right unilateral complete cleft lip and palate, right anophthalmos, left congenital nystagmus, absence of the vomer bone, mental-motor retardation, and normal lymphocyte karyotype (46, XY). For reconstruction of the deformities, we performed cleft lip repair by Millard's rotation-advancement technique and planned cleft palate repair. This combination of cleft lip and palate, anophthalmos, congenital nystagmus, absent vomer bone, and mental-motor retardation has not, to our knowledge, previously been described. We suggest that this represents either another case of the rare Fryns "anophthalmia-plus" syndrome or a new syndrome.
NASA Technical Reports Server (NTRS)
Lee, R. B., III; Gandrud, B. W.; Robbins, D. E.; Rossi, L. C.; Swann, N. R. W.
1982-01-01
The Limb Infrared Monitor of the Stratosphere (LIMS) LIP balloon experiment was used to obtain correlative temperature, ozone, water vapor, and nitric acid data at altitudes between 10 and 36 kilometers. The performance of the LIMS sensor flown on the Nimbus 7 Satellite was assessed. The LIP consists of the modified electrochemical concentration cell ozonesonde, the ultraviolet absorption photometric of ozone, the water vapor infrared radiometer sonde, the chemical absorption filter instrument for nitric acid vapor, and the infrared radiometer for nitric acid vapor. The limb instrument package (LIP), its correlative sensors, and the resulting data obtained from an engineering and four correlative flights are described.
Effect of Initial Condition on Subsonic Jet Noise from Two Rectangular Nozzles
NASA Technical Reports Server (NTRS)
Zaman, K. B. M. Q.
2012-01-01
Differences in jet noise data from two small 8:1 aspect ratio nozzles are investigated experimentally. The interiors of the two nozzles are identical but one has a thin-lip at the exit while the has a perpendicular face at the exit (thick-lip). It is found that the thin-lip nozzle is substantially noisier throughout the subsonic Mach number range. As much as 5dB difference in OASPL is noticed around Mj =0.96. Hot-wire measurements are carried out for the characteristics of the exit boundary layer and, overall, the noise difference can be ascribed to differences in the boundary layer state. The boundary layer of the quieter (thick-lip) nozzle goes through transition around M(sub j) =0.25 and at higher M(sub j) it remains "nominally turbulent". In comparison, the boundary layer of the thin-lip nozzle is found to remain "nominally laminar". at high subsonic conditions. The nominally laminar state involves significantly larger turbulence intensities commensurate with the higher radiated noise.
Zan, Xinyi; Tang, Xin; Chu, Linfang; Song, Yuanda
2018-03-21
Although multiple roles of lipases have been reported in yeasts and microalgae, the functions of lipases have not been studied in oleaginous filamentous fungi. Lipase Lip6 has been reported in the oleaginous filamentous fungus Mucor circinelloides with the consensus lipase motif GXSXG and the typical acyltransferase motif of H-(X) 4 -D. To demonstrate that Lip6 might play dual roles as a lipase and an acyltransferase, we performed site-directed mutagenesis in the lipase motif and the acyltransferase motif of Lip6. Mutation in the lipase motif increased cell biomass by 12%-18% and promoted lipid accumulation by 9%-24%, while mutation in the acyltransferase motif induced lipid degradation. In vitro, purified Lip6 had a slight lipase activity but had a stronger phospholipid:DAG acyltransferase activity. Enzyme activity assays in vivo and phospholipid synthesis pathway analysis suggested that phosphatidyl serine and phosphatidyl ethanolamine can be the supplier of a fatty acyl moiety to form TAG in M. circinelloides.
Akarsu-Guven, Bengisu; Arisan, Arda; Ozgur, Figen; Aksu, Muge
2018-04-01
The aim of this retrospective study was to assess the influence of presurgical nasoalveolar molding (NAM) on skeletal development in patients with operated unilateral cleft lip and palate at 5 years of age. Lateral cephalometric radiographs of 26 unilateral cleft lip and palate patients who had undergone presurgical NAM (NAM group) and 20 unilateral cleft lip and palate patients who did not have any presurgical NAM (non-NAM group) were analyzed. The radiographs were digitally traced using Quick Ceph Studio software (version 3.5.1.r (1151); Quick Ceph Systems, San Diego, Calif). Independent samples t tests were performed for statistical analysis. No significant differences were observed in sagittal and vertical skeletal measurements between the NAM and non-NAM groups. NAM resulted in no significant difference in skeletal development in unilateral cleft lip and palate patients compared with those without NAM in early childhood. Copyright © 2018. Published by Elsevier Inc.
Huang, Bi; Bao, Lang; Zhong, Qi; Shang, Zheng-ling; Zhang, Hui-dong; Zhang, Ying
2008-02-01
To construct the eukaryotic experssion vector of LipL32 gene from Leptospira serovar Lai and express the recombinant plasmid in COS-7 cell. The LipL32 gene was amplified from Leptospira strain 017 genomic DNA by PCR and cloned into pcDNA3.1, through restriction nuclease enzyme digestion. Then the recombinant plasmid was transformed into E.coli DH5alpha. After identified by nuclease digestion, PCR and sequencing analysis, the recombinant vector was transfected into COS-7 cell with lipsome. The expression of the target gene was detected by RT-PCR and Western blot. The eukaryotic experssion vector pcDNA3.1-LipL32 was successfully constructed and stably expressed in COS-7 cell. The eukaryotic recombinant vector of outer membrane protein LipL32 gene from Leptospira serovar Lai can be expressed in mammalian cell, which provides an experimental basis for the application of the Leptospira DNA vaccine.
Montirosso, Rosario; Fedeli, Claudia; Murray, Lynne; Morandi, Francesco; Brusati, Roberto; Perego, Guenda Ghezzi; Borgatti, Renato
2012-03-01
The study examined the early interaction between mothers and their infants with cleft lip, assessing the role of maternal affective state and expressiveness and differences in infant temperament. Mother-infant interactions were assessed in 25 2-month-old infants with cleft lip and 25 age-matched healthy infants. Self-report and behavioral observations were used to assess maternal depressive symptoms and expressions. Mothers rated infant temperament. Infants with cleft lip were less engaged and their mothers showed more difficulty in interaction than control group dyads. Mothers of infants with cleft lip displayed more negative affectivity, but did not report more self-rated depressive symptoms than control group mothers. No group differences were found in infant temperament. In order to support the mother's experience and facilitate her ongoing parental role, findings highlight the importance of identifying maternal negative affectivity during early interactions, even when they seem have little awareness of their depressive symptoms.
The Physiologic Development of Speech Motor Control: Lip and Jaw Coordination
Green, Jordan R.; Moore, Christopher A.; Higashikawa, Masahiko; Steeve, Roger W.
2010-01-01
This investigation was designed to describe the development of lip and jaw coordination during speech and to evaluate the potential influence of speech motor development on phonologic development. Productions of syllables containing bilabial consonants were observed from speakers in four age groups (i.e., 1-year-olds, 2-year-olds, 6-year-olds, and young adults). A video-based movement tracking system was used to transduce movement of the upper lip, lower lip, and jaw. The coordinative organization of these articulatory gestures was shown to change dramatically during the first several years of life and to continue to undergo refinement past age 6. The present results are consistent with three primary phases in the development of lip and jaw coordination for speech: integration, differentiation, and refinement. Each of these developmental processes entails the existence of distinct coordinative constraints on early articulatory movement. It is suggested that these constraints will have predictable consequences for the sequence of phonologic development. PMID:10668666
Learning to Rank the Severity of Unrepaired Cleft Lip Nasal Deformity on 3D Mesh Data.
Wu, Jia; Tse, Raymond; Shapiro, Linda G
2014-08-01
Cleft lip is a birth defect that results in deformity of the upper lip and nose. Its severity is widely variable and the results of treatment are influenced by the initial deformity. Objective assessment of severity would help to guide prognosis and treatment. However, most assessments are subjective. The purpose of this study is to develop and test quantitative computer-based methods of measuring cleft lip severity. In this paper, a grid-patch based measurement of symmetry is introduced, with which a computer program learns to rank the severity of cleft lip on 3D meshes of human infant faces. Three computer-based methods to define the midfacial reference plane were compared to two manual methods. Four different symmetry features were calculated based upon these reference planes, and evaluated. The result shows that the rankings predicted by the proposed features were highly correlated with the ranking orders provided by experts that were used as the ground truth.
Pereira, Felipe B; Tavares, Luiz E R; Paiva, Fernando; Scholz, Tomáš; Luque, José L
2015-08-01
Spectatus spectatus Travassos, 1923 (Nematoda: Kathlaniidae) found in the intestine of Piaractus mesopotamicus (Holmberg, 1887) (Characiformes: Serrasalmidae) from the River Miranda, Mato Grosso do Sul, Brazil is redescribed based on morphological evaluation of newly collected material and examination of type and voucher specimens from the Coleção Helmintológica do Instituto Oswaldo Cruz. The following characteristics previously unreported or insufficiently described were observed: morphology of lips, presence of lamellae-like supplementary lips, presence of pharynx and cuticular ring surrounding the oral opening associated with a complex cuticular apparatus anterior to the pharynx, the number and arrangement of caudal papillae (13 pairs plus 1 unpaired), and the position of nerve ring. Since S. spectatus is the type species of Spectatus, the diagnosis of this Neotropical genus is amended. Synonymy of Chabaudinema Díaz-Ungría, 1968 with Spectatus, first proposed in 1980 by Baker, is supported by the present data. Molecular data that include the first sequence of the SSU rDNA for any species of Spectatus indicate a basal position of S. spectatus within Cosmocercoidea, forming a distant lineage from that comprising 2 species of Falcaustra Lane, 1915. This separate position of S. spectatus supports validity of the genus.
Similarity and Differences of Cretaceous Magmatism in the Arctic Region
NASA Astrophysics Data System (ADS)
Peyve, A. A.
2018-03-01
The paper considers Cretaceous magmatism at the continental margin of the Arctic Region. It is shown that Cretaceous igneous rocks of this region are rather heterogeneous in age, composition, and geodynamic formation setting. This differentiates them from rocks of typical large igneous provinces (LIPs). Local areas of magmatic activity, their substantial remoteness them from one another, and significant distinctions in age, composition of rocks, and formation conditions prevent us from unreservedly combining all occurrences of Cretaceous magmatism at the continental margin of the Arctic Region into a common igneous province. The stage of tholeiitic magmatism in the Svalbard Archipelago, Franz Josef Land, Arctic Canada, and the Alpha-Mendeleev Rise, which can be considered an LIP, began in the Early Cretaceous and continued for a long time, at least until the Campanian. The magmatism apparently had a plume source and was caused by extension during opening of the Canada Basin. Tholeiitic magmatism gave way to the alkaline magmatism stage from the Campanian to the onset of the Paleocene, related to continental rifting at the initial stage of formation of Eurasian Basin in the Arctic Region. No convincing evidence for a genetic link between Early Cretaceous tholeiitic and Late Cretaceous alkaline magmatism is known at present, nor for the alkaline magmatism belonging to a plume source.
Kato, Charles Drago; Kisekka, Majid; Owori Wadunde, Akisoferi
2017-01-01
Histomorphological studies of the digestive system of Alestes baremoze captured from Lake Albert, Uganda, were done using standard procedures. These revealed that A. baremoze has a fleshy-lipped terminal small mouth, large molar, short oesophagus, a three-lobed liver, pouch-like stomach, a nine-fingered caeca, and a long tubular intestine. A stratified squamous epithelium with numerous mucus-secreting cells lined the lips with no taste buds. Stratified squamous epithelia lined the oesophagus in the anterior portion which turned into a columnar epithelium towards the stomach. The lamina propria had numerous tubular glands throughout the entire oesophageal length. The stomach consisted of three distinct regions (cardiac, fundic, and pyloric) with distinguished lamina propria glands. The intestinal mucosa was thrown into villi of varying heights, with the tallest in the anterior part, lined with a simple columnar epithelium with numerous lymphocytes-like infiltrations. Numerous goblet cells appeared in the intestinal lamina epithelialis; these increased uniformly towards the anal opening. The liver was divided into lobules, with a central vein. Hepatocytes were visibly arranged closely, forming irregular cords, and the scattered tubular acinar glands formed the exocrine pancreas (hepatopancreas). Stomach content analysis indicated that the fish eats plankton, mollusks, crustaceans, and insects as the main proportion of its diet. PMID:28798951
Omiya, Tomoko; Ito, Mikiko; Yamazaki, Yoshihiko
2014-12-16
The present study investigated when and how Japanese people with cleft lip and palate (CL/P) learn that their condition is congenital; the perceived effects of withholding the CL/P diagnosis on patients; and whether the resulting social experience and self-esteem are related. A questionnaire survey was conducted in 71 adults with CL/P recruited through a hospital, a patients' association, and by snowball sampling. The participants became aware of their physical difference in childhood, but many reported difficulty in understanding their condition. Participants reported that their families avoided the topic of diagnosis. Participants who understood their condition during childhood rather than in adulthood were significantly more likely to consider this scenario as positive (p < 0.001). Although stigmatising experiences were extremely painful, most patients hid their suffering, making it more difficult to obtain social support. Participants with high self-esteem were more likely to feel that they received adequate support. It is important to explain the congenital nature of CL/P sufficiently and early. In addition, openness by the family about the diagnosis, rather than avoidance, may improve patients' self-esteem. Sufficient support from family, health care providers, and significant others is needed for patients to develop adequate self-esteem.
NASA Astrophysics Data System (ADS)
Navarrete, César; Gianni, Guido; Echaurren, Andrés; Kingler, Federico Lince; Folguera, Andrés
2016-12-01
From Lower Jurassic to Lower Cretaceous, several intraplate compression events affected discrete sectors of Central Patagonia, under a general context of crustal extension associated with Gondwana breakup. This was demonstrated by means of 2D and 3D seismic and borehole data, which show partial inversion of Lower and Middle Jurassic extensional structures of the Chubut and Cañadón Asfalto basins, during the earliest stages of breakup. A comparison with surrounding areas in Patagonia, where similar Jurassic intraplate compression was described, allowed the discrimination of three discrete pulses of subtle compression (C1: ∼188-185 Ma; C2: ∼170-163; C3: ∼157-136? Ma). Interestingly, episodic intraplate compressional events are closely followed by high flux magmatic events linked to the westward expansion of the Karoo-Ferrar thermal anomaly, which impacted on the lithosphere of southwest Gondwana in Lower Jurassic. In addition, we determined the approximate direction of the main compressive strain (σ1) compatible with other Jurassic intraplate belts of South America. These observations led us to propose a linkage between a thermo mechanically weakened continental crust due to LIPs activity, changes in plate motions and ridge-push forces generated by the opening of the Weddell Sea, in order to explain intraplate shortening, interrupted while Karoo LIPs magmatic invigoration took place.
Garcia, Anthony R.; Johnston, Roger G.; Martinez, Ronald K.
1999-05-25
A fluid sampling tool for sampling fluid from a container. The tool has a fluid collecting portion which is drilled into the container wall, thereby affixing it to the wall. The tool may have a fluid extracting section which withdraws fluid collected by the fluid collecting section. The fluid collecting section has a fluted shank with an end configured to drill a hole into a container wall. The shank has a threaded portion for tapping the borehole. The shank is threadably engaged to a cylindrical housing having an inner axial passageway sealed at one end by a septum. A flexible member having a cylindrical portion and a bulbous portion is provided. The housing can be slid into an inner axial passageway in the cylindrical portion and sealed to the flexible member. The bulbous portion has an outer lip defining an opening. The housing is clamped into the chuck of a drill, the lip of the bulbous section is pressed against a container wall until the shank touches the wall, and the user operates the drill. Wall shavings (kerf) are confined in a chamber formed in the bulbous section as it folds when the shank advances inside the container. After sufficient advancement of the shank, an o-ring makes a seal with the container wall.
Garcia, A.R.; Johnston, R.G.; Martinez, R.K.
1999-05-25
A fluid sampling tool is described for sampling fluid from a container. The tool has a fluid collecting portion which is drilled into the container wall, thereby affixing it to the wall. The tool may have a fluid extracting section which withdraws fluid collected by the fluid collecting section. The fluid collecting section has a fluted shank with an end configured to drill a hole into a container wall. The shank has a threaded portion for tapping the borehole. The shank is threadably engaged to a cylindrical housing having an inner axial passageway sealed at one end by a septum. A flexible member having a cylindrical portion and a bulbous portion is provided. The housing can be slid into an inner axial passageway in the cylindrical portion and sealed to the flexible member. The bulbous portion has an outer lip defining an opening. The housing is clamped into the chuck of a drill, the lip of the bulbous section is pressed against a container wall until the shank touches the wall, and the user operates the drill. Wall shavings (kerf) are confined in a chamber formed in the bulbous section as it folds when the shank advances inside the container. After sufficient advancement of the shank, an o-ring makes a seal with the container wall. 6 figs.
Lewis, Jennifer; Roberson, Debi
2017-01-01
Research has demonstrated that how “cute” an infant is perceived to be has consequences for caregiving. Infants with facial abnormalities receive lower ratings of cuteness, but relatively little is known about how different abnormalities and their location affect these aesthetic judgements. The objective of the current study was to compare the impact of different abnormalities on the perception of infant faces, while controlling for infant identity. In two experiments, adult participants gave ratings of cuteness and attractiveness in response to face images that had been edited to introduce common facial abnormalities. Stimulus faces displayed either a haemangioma (a small, benign birth mark), strabismus (an abnormal alignment of the eyes) or a cleft lip (an abnormal opening in the upper lip). In Experiment 1, haemangioma had less of a detrimental effect on ratings than the more severe abnormalities. In Experiment 2, we manipulated the position of a haemangioma on the face. We found small but robust effects of this position, with abnormalities in the top and on the left of the face receiving lower cuteness ratings. This is consistent with previous research showing that people attend more to the top of the face (particularly the eyes) and to the left hemifield. PMID:28749958
2017-11-15
Stage III Squamous Cell Carcinoma of the Lip and Oral Cavity; Stage III Verrucous Carcinoma of the Oral Cavity; Stage IVA Squamous Cell Carcinoma of the Lip and Oral Cavity; Stage IVA Verrucous Carcinoma of the Oral Cavity; Stage IVB Squamous Cell Carcinoma of the Lip and Oral Cavity; Stage IVB Verrucous Carcinoma of the Oral Cavity; Tongue Cancer
Psychological Effect of Prenatal Diagnosis of Cleft Lip and Palate: A Systematic Review.
Sreejith, V P; Arun, V; Devarajan, Anooj P; Gopinath, Arjun; Sunil, Madhuri
2018-01-01
Cleft lip and/or palate is the most common congenital craniofacial anomaly. Prenatal diagnosis of the craniofacial anomalies is possible with the advent of newer imaging modalities. The identification of the defect at an early stage in the pregnancy helps the parents to be well informed and counseled regarding the treatment possibilities and outcomes of cleft lip and palate (CLP) treatment. To analyze the psychological effects of prenatal diagnosis of CLP on the parents. PubMed, Cochrane, and Google Scholar searches were made with search strings "prenatal diagnosis cleft lip palate," "antenatal diagnosis," "anomaly scan," "psychological effect cleft lip palate," and "prenatal counseling cleft lip palate." Of the results obtained, studies which evaluated the psychological aspects of parents of cleft children were further included in the study. Electronic search yielded 500 articles after duplication removal. Forty studies concentrated on the results of the scan and their implications predominantly in the diagnosis and management of cleft and other related abnormalities. Eight studies discussed the effects of prenatal diagnosis and counseling on the parents. Prenatal diagnosis enables appropriate and timely counseling of the parents by the cleft team and helps instill a sense of preparedness for the family which highly improves the quality of treatment received by the child enabling a near-to-normal quality and standard of life.
Moragas, Joan San Miguel; Vercruysse, Herman Junior; Mommaerts, Maurice Y
2014-09-01
Ideal lip augmentation techniques have good longevity, low complication rates, and optimal functional and aesthetic results. No systematic review is currently available regarding the efficacy of lip augmentation techniques. This review will focus only on non-filling procedures for lip augmentation (NFPLAs). Current databases Elsevier Science Direct, PubMed, HighWire Press, Springer Standard Collection, SAGE, DOAJ, Sweetswise, Free E-Journals, Ovid Lippincott Williams & Wilkins, Willey Online Library Journals and Cochrane Plus were scrutinized and relevant article reference sections were studied for additional publications. The search heading sequence used was ("Lip" or "Mouth" or "Perioral" or "Nasolabial") and ("Augmentation" or "Enhancement" or "Surgery" or "Lift" or "V-Y" or "Corner"). Exclusion criteria applied to 6436 initial keyword-search retrievals yielded 12 articles. Eight more articles were retrieved from reference sections, for a total of 18 papers assessed. Only one article made a direct comparison of efficacy between two surgical techniques for lip augmentation, and none directly compared complications associated with different NFPLAs. Although this systematic review revealed a lack of quality data in comparing the efficacy and complications among different NFPLAs, it is important to review and pool the existing studies to better suggest proper treatment to patients. Copyright © 2014 European Association for Cranio-Maxillo-Facial Surgery. Published by Elsevier Ltd. All rights reserved.
Invariant principles of speech motor control that are not language-specific.
Chakraborty, Rahul
2012-12-01
Bilingual speakers must learn to modify their speech motor control mechanism based on the linguistic parameters and rules specified by the target language. This study examines if there are aspects of speech motor control which remain invariant regardless of the first (L1) and second (L2) language targets. Based on the age of academic exposure and proficiency in L2, 21 Bengali-English bilingual participants were classified into high (n = 11) and low (n = 10) L2 (English) proficiency groups. Using the Optotrak 3020 motion sensitive camera system, the lips and jaw movements were recorded while participants produced Bengali (L1) and English (L2) sentences. Based on kinematic analyses of the lip and jaw movements, two different variability measures (i.e., lip aperture and lower lip/jaw complex) were computed for English and Bengali sentences. Analyses demonstrated that the two groups of bilingual speakers produced lip aperture complexes (a higher order synergy) that were more consistent in co-ordination than were the lower lip/jaw complexes (a lower order synergy). Similar findings were reported earlier in monolingual English speakers by Smith and Zelaznik. Thus, this hierarchical organization may be viewed as a fundamental principle of speech motor control, since it is maintained even in bilingual speakers.
Actinic lesions in fishermen’s lower lip: clinical, cytopathological and histopathologic analysis
Piñera-Marques, Karine; Lorenço, Silvia Vanessa; da Silva, Luiz Fernando Ferraz; Sotto, Mirian Nacagami; Carneiro, Paulo Campos
2010-01-01
INTRODUCTION Actinic cheilitis (AC) is considered to be a pre-malignant lesion or an incipient and superficial form of lip squamous cell carcinoma. It is commonly found in individuals whose occupational activities are related to chronic sun exposure and the definitive diagnosis is performed with biopsy. Althoug Exfoliative cytology has been used as a screening procedure to evaluate cancer of the oral cavity no studies have proposed the use of exfoliative cytologic analysis to evaluate and diagnose AC. OBJECTIVE The purpose of this study was to evaluate lower lip lesions on fishermen related to chronic solar exposure using clinical, cytologic and histopathologic analyses. PATIENTS AND METHODS Smears taken from the vermilion of the lower lips of 125 fishermen and 30 control individuals were subjected to cytologic analysis. RESULTS The harvested cells were sufficient for cytologic analysis in 83.2% of the samples. Sixteen fishermen exhibited prominent lower lip lesions that justified biopsy and histological studies. In total, 4 specimens were malignant (3.2%), and 12 displayed epithelial dysplasia, demonstrating that the prevalence of epithelial dysplasia and malignant lesions was high among the fishermen population. These conditions were strongly associated with infiltration and blurring of the vermilion margin of the lower lip. CONCLUSION The cytologic analysis was not useful for detecting epithelial dysplasia or malignant alterations. PMID:20454492
Resource utilization in primary repair of cleft lip.
Owusu, James A; Liu, Meixia; Sidman, James D; Scott, Andrew R
2013-03-01
To determine national variations in resource utilization for primary repair of cleft lip, identify patient and institutional factors associated with high resource use, and estimate the current incidence of cleft lip in the United States. Retrospective analysis of a national, pediatric database (2009 Kids' Inpatient Database [KID]). Patients aged 1 year and younger were selected using international classification of disease codes for cleft lip and procedure codes for cleft lip repair. A number of demographic variables were analyzed, and hospital charges were considered as a measure of resource utilization. There were 1318 patients identified. The national incidence was 0.09%, with a male to female ratio of 1.8:1. Regional incidence varied from 0.07% (Northeast) to 0.10% (West). The mean age at surgery was 4.2 months. The average length of stay was 1.4 days. The national average hospital charge was $20,147, ranging from $14,635 (South) to $23,663 (West). Teaching hospitals charge an average of $9764 higher than nonteaching hospitals. The strongest predictor of charge was length of stay, increasing charge by $8102 for every additional hospital day (P < .01). Regional variations exist in resource utilization for primary cleft lip repair. Resource use is higher in the West and among teaching hospitals.
Spatial updating in area LIP is independent of saccade direction.
Heiser, Laura M; Colby, Carol L
2006-05-01
We explore the world around us by making rapid eye movements to objects of interest. Remarkably, these eye movements go unnoticed, and we perceive the world as stable. Spatial updating is one of the neural mechanisms that contributes to this perception of spatial constancy. Previous studies in macaque lateral intraparietal cortex (area LIP) have shown that individual neurons update, or "remap," the locations of salient visual stimuli at the time of an eye movement. The existence of remapping implies that neurons have access to visual information from regions far beyond the classically defined receptive field. We hypothesized that neurons have access to information located anywhere in the visual field. We tested this by recording the activity of LIP neurons while systematically varying the direction in which a stimulus location must be updated. Our primary finding is that individual neurons remap stimulus traces in multiple directions, indicating that LIP neurons have access to information throughout the visual field. At the population level, stimulus traces are updated in conjunction with all saccade directions, even when we consider direction as a function of receptive field location. These results show that spatial updating in LIP is effectively independent of saccade direction. Our findings support the hypothesis that the activity of LIP neurons contributes to the maintenance of spatial constancy throughout the visual field.
Social life aspects of young adults with cleft lip and palate: grounded theory approach.
Chetpakdeechit, Woranuch; Hallberg, Ulrika; Hagberg, Catharina; Mohlin, Bengt
2009-01-01
The findings of many questionnaire and inventory studies suggest that people with cleft lip and/or palate report a decreased quality of life. Common problems include dissatisfaction with the external appearance of the lips and nose, speech problems, depression, and anxiety. This qualitative study aimed to explore the subjective perceptions and values of young adults with clefts, particularly with regard to their social lives. Twelve persons participated in an in-depth interview. Among those, seven had a repaired isolated cleft palate involving only the hard/soft palate. Five had a repaired bilateral cleft lip and palate that had been a continuous lesion of the lip, the alveolar process, and the palate. A grounded theory approach was used to conduct and analyze the interviews. The study revealed seven important categories--hoping to be like other people, being treated differently from others, experiencing deviation from others, regarding oneself as being different from others, lack of recognition, low self-esteem, and receiving recognition from significant others--with hoping to be like other people as the core category. Young adults with either cleft lip and palate or isolated cleft palate who received recognition from significant others reported increased self-esteem and greater ability to cope with their social lives.
The effect of western adaptation of Hispanic-Americans on their assessment of Korean facial profiles
Toureno, Leo; Kook, Yoon-Ah; Bayome, Mohamed
2014-01-01
Objective To determine Korean facial profile preferences based on lip position as assessed by Hispanic-Americans of varying western adaptation levels and to determine whether the age and sex of the rater had any influence. Methods For this study, 132 Hispanic-Americans and 68 Caucasians of varying age, sex and western adaptation levels volunteered to rate their preference of Korean male and female facial silhouettes having lips ranging from retruding to protruding. The Hispanic-Americans were also asked to complete a Bidimensional Acculturation Scale questionnaire to determine their western adaptation status: low-acculturated Hispanics (LAH; lesser western-adapted Hispanic participants) or high-acculturated Hispanics (HAH; higher western-adapted Hispanic participants). Results The LAHs preferred significantly more retruded lip positions (p < 0.05) while HAHs showed some similarities with Caucasian participants in the results for the Korean male profile, even though HAHs preferred more retruded lip positions for the Korean female profile than Caucasians did (p < 0.05). The age and sex of raters did not influence the preference of facial profiles (p > 0.05). Conclusions The results of this study suggest that Hispanic-Americans prefer a flatter Korean lip profile. It would be prudent for orthodontists to offer patients the option of altering lip profile through orthodontic and/or orthognathic surgery treatments. PMID:24511513
Toureno, Leo; Kook, Yoon-Ah; Bayome, Mohamed; Park, Jae Hyun
2014-01-01
To determine Korean facial profile preferences based on lip position as assessed by Hispanic-Americans of varying western adaptation levels and to determine whether the age and sex of the rater had any influence. For this study, 132 Hispanic-Americans and 68 Caucasians of varying age, sex and western adaptation levels volunteered to rate their preference of Korean male and female facial silhouettes having lips ranging from retruding to protruding. The Hispanic-Americans were also asked to complete a Bidimensional Acculturation Scale questionnaire to determine their western adaptation status: low-acculturated Hispanics (LAH; lesser western-adapted Hispanic participants) or high-acculturated Hispanics (HAH; higher western-adapted Hispanic participants). The LAHs preferred significantly more retruded lip positions (p < 0.05) while HAHs showed some similarities with Caucasian participants in the results for the Korean male profile, even though HAHs preferred more retruded lip positions for the Korean female profile than Caucasians did (p < 0.05). The age and sex of raters did not influence the preference of facial profiles (p > 0.05). The results of this study suggest that Hispanic-Americans prefer a flatter Korean lip profile. It would be prudent for orthodontists to offer patients the option of altering lip profile through orthodontic and/or orthognathic surgery treatments.
Cazas-Duran, Eymi Valery; Fischer Rubira-Bullen, Izabel Regina; Pagin, Otávio; Stuchi Centurion-Pagin, Bruna
Tonsilloliths and abnormal stylohyoid complex may have similar symptoms to others of different aetiology. Individuals with cleft lip and palate describe similar symptoms because of the anatomical implications that are peculiar to this anomaly. The aim of this study was to determine the prevalence of abnormal stylohyoid complex and tonsilloliths on cone beam computed tomography in individuals with cleft lip and palate. According to the inclusion and exclusion criteria, 66 CT scans out of of 2,794 were analysed, on i- Cat ® vision software with 0.8 index Kappa intra-examiner. The total prevalence of ossification of the incomplete stylohyoid complex in individuals with cleft lip and palate was 66.6%; the prevalence of these findings in females was 75% and 61.9% in males. The total prevalence of tonsilloliths was 7.5%. It is important to ascertain calcification of the stylohyoid complex and tonsilloliths in the radiological report, due to the anatomical proximity and similarsymptomatology to other orofacial impairments inindividuals with cleft lip and palate, focusing on females with oral cleft formation, patients with incisive trans foramen cleft and incisive post foramen cleft because they are more prevalent. Greater knowledge of the anatomical morphometry of individuals with cleft lip and palate greatly contributes towards the selection of clinical behaviours and the quality of life of these patients, since cleft lip and palateis one of the most common anomalies. Copyright © 2017 Elsevier España, S.L.U. and Sociedad Española de Otorrinolaringología y Cirugía de Cabeza y Cuello. All rights reserved.
Bandini, Andrea; Green, Jordan R; Wang, Jun; Campbell, Thomas F; Zinman, Lorne; Yunusova, Yana
2018-05-17
The goals of this study were to (a) classify speech movements of patients with amyotrophic lateral sclerosis (ALS) in presymptomatic and symptomatic phases of bulbar function decline relying solely on kinematic features of lips and jaw and (b) identify the most important measures that detect the transition between early and late bulbar changes. One hundred ninety-two recordings obtained from 64 patients with ALS were considered for the analysis. Feature selection and classification algorithms were used to analyze lip and jaw movements recorded with Optotrak Certus (Northern Digital Inc.) during a sentence task. A feature set, which included 35 measures of movement range, velocity, acceleration, jerk, and area measures of lips and jaw, was used to classify sessions according to the speaking rate into presymptomatic (> 160 words per minute) and symptomatic (< 160 words per minute) groups. Presymptomatic and symptomatic phases of bulbar decline were distinguished with high accuracy (87%), relying only on lip and jaw movements. The best features that allowed detecting the differences between early and later bulbar stages included cumulative path of lower lip and jaw, peak values of velocity, acceleration, and jerk of lower lip and jaw. The results established a relationship between facial kinematics and bulbar function decline in ALS. Considering that facial movements can be recorded by means of novel inexpensive and easy-to-use, video-based methods, this work supports the development of an automatic system for facial movement analysis to help clinicians in tracking the disease progression in ALS.
Vascular and Psychophysical Effects of Topical Capsaicin Application to Orofacial Tissues
Boudreau, Shellie A.; Wang, Kelun; Svensson, Peter; Sessle, Barry J.; Arendt-Nielsen, Lars
2011-01-01
Aims To characterize and contrast human sensory and vascular changes produced by topical application of the algesic chemical capsaicin to the glabrous lips and tongue. Methods Applications of 1% capsaicin or vehicle cream to the glabrous lips and tongue were randomized between two two-trial sessions. The capsaicin trial followed the vehicle trial for each session. Before and 5, 15, and 30 minutes after capsaicin or vehicle cream application, six parameters were recorded from the glabrous lips or the tongue dorsum: (1) burning pain intensity, as measured on a visual analog scale; (2) burning pain area, as indicated by subjects on an orofacial drawing; (3) mechanical sensitivity, as measured by a von Frey filament; (4) visual flare; (5) blood flow and temperature, as measured by laser-Doppler imaging and thermography, respectively; and (6) areas of increased temperature (hot spots), as calculated by a digital tracer from the thermographs. Data were analyzed by ANOVAs and Pearson’s correlations. Results Compared to vehicle application, capsaicin elicited burning pain, increases in blood flow and temperature, but no change in mechanical sensitivity in the glabrous lips or tongue. Greater increases in blood flow and temperature paralleled more intense burning pain and larger areas of perceived pain for the lips compared to the tongue. The location of distinct areas of increased temperature within the orofacial area differed between the capsaicin-lip and capsaicin-tongue trials. Conclusion The several differences between these responses to noxious stimulation of the glabrous lips and tongue may have implications for examinations of orofacial somatosensory functions. PMID:19639105
Kim, Kayoung; Choi, Sung-Hwan; Choi, Eun-Hee; Choi, Yoon-Jeong; Hwang, Chung-Ju; Cha, Jung-Yul
2017-03-01
To compare soft and hard tissue responses based on the degree of maxillary incisor retraction using maximum anchorage in patients with Class II division 1 malocclusion. This retrospective study sample was divided into moderate retraction (<8.0 mm; n = 28) and maximum retraction (≥8.0 mm; n = 29) groups based on the amount of maxillary incisor retraction after extraction of the maxillary and mandibular first premolars for camouflage treatment. Pre- and posttreatment lateral cephalograms were analyzed. There were 2.3 mm and 3.0 mm of upper and lower lip retraction, respectively, in the moderate group; and 4.0 mm and 5.3 mm, respectively, in the maximum group. In the moderate group, the upper lip was most influenced by posterior movement of the cervical point of the maxillary incisor (β = 0.94). The lower lip was most influenced by posterior movement of B-point (β = 0.84) and the cervical point of the mandibular incisor (β = 0.83). Prediction was difficult in the maximum group; no variable showed a significant influence on upper lip changes. The lower lip was highly influenced by posterior movement of the cervical point of the maxillary incisor (β = 0.50), but this correlation was weak in the maximum group. Posterior movement of the cervical point of the anterior teeth is necessary for increased lip retraction. However, periodic evaluation of the lip profile is needed during maximum retraction of the anterior teeth because of limitations in predicting soft tissue responses.
Diouf, Joseph Samba; Diallo, Bay Karim; Diop-Ba, Khady; Badiane, Alpha; Ngom, Papa Ibrahima; Sonko, Ousmane; Diagne, Falou
2018-06-01
The role of obstructive tonsils in ventilatory disorders and abnormal lip posture is widely discussed in the literature but remains controversial. The data reported on the probable relationship between obstructive tonsils and an existing breathing disorder or lip incompetence were subjective. The purpose of this study was to evaluate the relationship between the obstructive character of the tonsils and the type of ventilation and lip posture. This is a cross-sectional study performed in children aged from 6 to 12 years old. The subjects were divided into two groups (A and B) according to the obstructive or non-obstructive character of the palatal tonsils. Type of ventilation and lip posture at rest were recorded for each child. The collected data were analysed using the SPSS 20.0 software (for Windows). A Student's t-test and a Chi 2 test were respectively used to compare quantitative and qualitative variables according to the obstructive character of the tonsils for each group. The level of significance is fixed at P=0.05. The subjects in group B with obstructive palatal tonsils were significantly more likely to oral breathing and lip incompetence than the subjects with non-obstructive tonsils (group A). The clinical examination of children with ventilatory and postural disorders with lip incompetence must be directed towards the search for associated obstructive palatal tonsils in order to plan an early etiological treatment. This would allow to avoid subsequent problems in the dentofacial structures. Copyright © 2018. Published by Elsevier Masson SAS.
Heiser, Laura M; Berman, Rebecca A; Saunders, Richard C; Colby, Carol L
2005-11-01
With each eye movement, a new image impinges on the retina, yet we do not notice any shift in visual perception. This perceptual stability indicates that the brain must be able to update visual representations to take our eye movements into account. Neurons in the lateral intraparietal area (LIP) update visual representations when the eyes move. The circuitry that supports these updated representations remains unknown, however. In this experiment, we asked whether the forebrain commissures are necessary for updating in area LIP when stimulus representations must be updated from one visual hemifield to the other. We addressed this question by recording from LIP neurons in split-brain monkeys during two conditions: stimulus traces were updated either across or within hemifields. Our expectation was that across-hemifield updating activity in LIP would be reduced or abolished after transection of the forebrain commissures. Our principal finding is that LIP neurons can update stimulus traces from one hemifield to the other even in the absence of the forebrain commissures. This finding provides the first evidence that representations in parietal cortex can be updated without the use of direct cortico-cortical links. The second main finding is that updating activity in LIP is modified in the split-brain monkey: across-hemifield signals are reduced in magnitude and delayed in onset compared with within-hemifield signals, which indicates that the pathways for across-hemifield updating are less effective in the absence of the forebrain commissures. Together these findings reveal a dynamic circuit that contributes to updating spatial representations.
Isolation and analysis of lipase-overproducing mutants of Serratia marcescens.
Kawai, E; Akatsuka, H; Sakurai, N; Idei, A; Matsumae, H; Shibatani, T; Komatsubara, S; Omori, K
2001-01-01
We have isolated a lipase-overproducing mutant, GE14, from Serratia marcescens 8000 after three rounds of N-methyl-N'-nitro-N-nitrosoguanidine mutagenesis. The mutant GE14 produced 95 kU/ml of extracellular lipase in the lipase medium, which was about threefold higher than that of produced by the original strain 8000. Enzymatic characteristics including specific activity of purified lipases from culture supernatants of GE14 and 8000 were almost same. The lipase gene (lipA) of GE14 contained two base substitutions; one in the promoter region and another in the N-terminal region of the lipA gene without an amino acid substitution. Promoter analysis using lipA-lacZ fusion plasmids revealed that these substitutions were responsible for the increase in the lipA expression level, independently. In contrast, no base substitution was found in the genes encoding the lipase secretion device, the Lip system. In addition, the genes coding for metalloprotease and the cell surface layer protein which are both secreted through the Lip system and associated with extracellular lipase production, also contained no base substitution. The strain GE14 carrying a high-copy-number lipA plasmid produced a larger amount of the extracellular lipase than the recombinant strains of 8000 and other mutants also did, indicating that GE14 was not only a lipase-overproducing strain, but also an advantageous host strain for overproducing the lipase by a recombinant DNA technique. These results suggest that the lipase-overproducing mutant GE14 and its recombinant strains are promising candidates for the industrial production of the S. marcescens lipase.
Cleft lip and palate treatment of 530 children over a decade in a single centre.
Vlastos, I M; Koudoumnakis, E; Houlakis, M; Nasika, M; Griva, M; Stylogianni, E
2009-07-01
We sought to evaluate the process of care and the outcomes of cleft lip and palate operations carried by a multidisciplinary team at a centre of craniofacial anomalies with a high patients' volume. A retrospective review of all cleft lips and/or palates cases treated in the centre from 1995 to 2007 was performed. Direct and long term complication rates, clinical, audiologic, speech intelligibility and dental arch assessments were analyzed. A total of 530 children have been operated this period in the centre (64 isolated cleft lip closures). A detailed presentation of the outcomes is performed in relation to the various types of cleft lip and palates. The majority of parents (70%) reported very good or excellent results 2-5 years after the lip closure with the Millard technique, although those with bilateral clefts were significantly less satisfied (P<0.002). Forty-two percent of children with cleft palate and otitis media with effusion were self-improved 2-8 months after palate reconstruction and 83.3% of children treated with the two flaps palatoplasty technique had a rather high or very high intelligibility score. Muscles' retropositioning had a significant effect on intelligibility (P=0.04). Children with cleft lips and palates have a variety of conditions and functional limitations even after the surgical correction of their problem that need to be evaluated and treated by several specialists. The treatment protocol utilized by the multidisciplinary team of our centre is efficient with a relative low percentage of complications and unfavorable results.
Surgical attitude in premalignant lesions and malignant tumors of the lower lip
Calcaianu, N; Popescu, SA; Diveica, D; Lascar, I
2015-01-01
Introduction. Malignant tumors of the lower lip may have a variety of histopathology forms. The diagnosis and treatment of premalignant lesions are extremely important to avoid their malignant evolution. The lower lip tumor diagnosis is based on a series of correlations: anamnestic, clinical, laboratory and histopathological (the latter giving the certain diagnose). Material and methods. This study was carried out by selecting the cases with lower lip tumors operated between January 2012 and July 2014, in the Plastic Surgery and Reconstructive Microsurgery Clinic of Bucharest Clinical Emergency Hospital. The variables considered in the study were the following: age, gender, exposure to risk factors, diagnosis, and histopathology. Results. The histopathological examination revealed 63% squamous cell carcinoma, 30% basal cell carcinomas, 5% keratoacanthoma and 2% actinic keratosis. Men were the predominantly affected genre, with a percentage of 70%. In the group of patients studied, 66% were smokers. Discussions. The rate of the malignant transformation of premalignant lesion was 32.6% for keratoacanthoma, 16.9% for actinic cheilitis, 10% for actinic keratoses. Conclusions. There were no clinical or laboratory features to plead for the pre-malignant or malignant character of the of a lower lip tumor, consequently histopathological examination was used for the diagnosis of the lesion. Due to the high percentage of malignant transformation of precancerous lesions, particularly in the form of squamous cell carcinoma, the surgical attitude intending to eradicate a lower lip tumor from an oncological point of view was the excision with oncologic safety margins followed by a lip reconstruction. PMID:25914752
Incipient speciation driven by hypertrophied lips in Midas cichlid fishes?
Machado-Schiaffino, Gonzalo; Kautt, Andreas F; Torres-Dowdall, Julian; Baumgarten, Lukas; Henning, Frederico; Meyer, Axel
2017-04-01
Sympatric speciation has been debated in evolutionary biology for decades. Although it has gained in acceptance recently, still only a handful of empirical examples are seen as valid (e.g. crater lake cichlids). In this study, we disentangle the role of hypertrophied lips in the repeated adaptive radiations of Nicaraguan crater lake cichlid fish. We assessed the role of disruptive selection and assortative mating during the early stages of divergence and found a functional trade-off in feeding behaviour between thick- and thin-lipped ecotypes, suggesting that this trait is a target of disruptive selection. Thick-lipped fish perform better on nonevasive prey at the cost of a poorer performance on evasive prey. Using enclosures in the wild, we found that thick-lipped fish perform significantly better in rocky than in sandy habitats. We found almost no mixed pairs during two breeding seasons and hence significant assortative mating. Genetic differentiation between ecotypes seems to be related to the time since colonization, being subtle in L. Masaya (1600 generations ago) and absent in the younger L. Apoyeque (<600 generations ago). Genome-wide differentiation between ecotypes was higher in the old source lakes than in the young crater lakes. Our results suggest that hypertrophied lips might be promoting incipient sympatric speciation through divergent selection (ecological divergence in feeding performance) and nonrandom mating (assortative mating) in the young Nicaraguan crater lakes. Nonetheless, further manipulative experiments are needed in order to confirm the role of hypertrophied lips as the main cue for assortative mating. © 2017 John Wiley & Sons Ltd.
Falkner, Annegret L; Goldberg, Michael E; Krishna, B Suresh
2013-10-09
The lateral intraparietal area (LIP) in the macaque contains a priority-based representation of the visual scene. We previously showed that the mean spike rate of LIP neurons is strongly influenced by spatially wide-ranging surround suppression in a manner that effectively sharpens the priority map. Reducing response variability can also improve the precision of LIP's priority map. We show that when a monkey plans a visually guided delayed saccade with an intervening distractor, variability (measured by the Fano factor) decreases both for neurons representing the saccade goal and for neurons representing the broad spatial surround. The reduction in Fano factor is maximal for neurons representing the saccade goal and steadily decreases for neurons representing more distant locations. LIP Fano factor changes are behaviorally significant: increasing expected reward leads to lower variability for the LIP representation of both the target and distractor locations, and trials with shorter latency saccades are associated with lower Fano factors in neurons representing the surround. Thus, the LIP Fano factor reflects both stimulus and behavioral engagement. Quantitative modeling shows that the interaction between mean spike count and target-receptive field (RF) distance in the surround during the predistractor epoch is multiplicative: the Fano factor increases more steeply with mean spike count further away from the RF. A negative-binomial model for LIP spike counts captures these findings quantitatively, suggests underlying mechanisms based on trial-by-trial variations in mean spike rate or burst-firing patterns, and potentially provides a principled framework to account simultaneously for the previously observed unsystematic relationships between spike rate and variability in different brain areas.
Costa, Marco; Corazza, Leonardo
2006-01-01
In the first study, eye and lip size and roundness, and lower-face roundness were compared between a control sample of 289 photographic portraits and an experimental sample of 776 artistic portraits covering the whole period of the history of art. Results showed that eye roundness, lip roundness, eye height, eye width, and lip height were significantly enhanced in artistic portraits compared to photographic ones. Lip width and lower-face roundness, on the contrary, were less prominent in artistic than in photographic portraits. In a second study, forty-two art academy students were requested to draw two self-portraits, one with a mirror and one without (from memory). Eye, lip, and lower-face roundness in artistic self-portraits was compared to the same features derived from photographic portraits of the participants. The results obtained confirmed those found in the first study. Eye and lip size and roundness were greater in artistic self-portraits, while lower-face roundness was significantly reduced. The same degree of modification was found also when a mirror was available to the subjects. In a third study the effect of lower-face roundness on the perception of attractiveness was assessed: fifty-three participants had to adjust the face width of 24 photographic portraits in order to achieve the highest level of attractiveness. Participants contracted the face width by a mean value of 5.26%, showing a preference for a reduced lower-face roundness. All results are discussed in terms of the importance of the 'supernormalisation' process as a means of assigning aesthetic value to perceptual stimuli.
A Visual Cortical Network for Deriving Phonological Information from Intelligible Lip Movements.
Hauswald, Anne; Lithari, Chrysa; Collignon, Olivier; Leonardelli, Elisa; Weisz, Nathan
2018-05-07
Successful lip-reading requires a mapping from visual to phonological information [1]. Recently, visual and motor cortices have been implicated in tracking lip movements (e.g., [2]). It remains unclear, however, whether visuo-phonological mapping occurs already at the level of the visual cortex-that is, whether this structure tracks the acoustic signal in a functionally relevant manner. To elucidate this, we investigated how the cortex tracks (i.e., entrains to) absent acoustic speech signals carried by silent lip movements. Crucially, we contrasted the entrainment to unheard forward (intelligible) and backward (unintelligible) acoustic speech. We observed that the visual cortex exhibited stronger entrainment to the unheard forward acoustic speech envelope compared to the unheard backward acoustic speech envelope. Supporting the notion of a visuo-phonological mapping process, this forward-backward difference of occipital entrainment was not present for actually observed lip movements. Importantly, the respective occipital region received more top-down input, especially from left premotor, primary motor, and somatosensory regions and, to a lesser extent, also from posterior temporal cortex. Strikingly, across participants, the extent of top-down modulation of the visual cortex stemming from these regions partially correlated with the strength of entrainment to absent acoustic forward speech envelope, but not to present forward lip movements. Our findings demonstrate that a distributed cortical network, including key dorsal stream auditory regions [3-5], influences how the visual cortex shows sensitivity to the intelligibility of speech while tracking silent lip movements. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.
Gurunluoglu, Raffi; Glasgow, Mark; Williams, Susan A; Gurunluoglu, Aslin; Antrobus, Jarod; Eusterman, Vincent
2012-10-01
Reconstruction of total full-thickness lower lip defects combined with extensive composite mandibular defects particularly in the setting of close-range high-energy ballistic injury presents a formidable challenge for the reconstructive plastic surgeon. While the fibular flap has been widely accepted for its usefulness in the reconstruction of composite mandibular defects, to date, there is no definitive widely established method of total lower lip reconstruction. The article presents authors' approach using innervated gracilis muscle flap for total lower lip reconstruction in the setting of high-energy gunshot injuries to the face. Three patients underwent composite mandibular defect reconstruction using fibular osteocutaneous flap and functional lower lip reconstruction using innervated gracilis muscle flap. Lip lining was reconstructed using the skin paddle of the fibular flap. The external surface of the gracilis muscle was skin-grafted. Facial artery myomucosal flap provided vermilion reconstruction in two patients. All fibular (n=3) and gracilis flap transfers (n=3) were viable. An electromyographic study at 1 year postoperatively demonstrated successful re-innervation of the gracilis muscle. Starting at about 10 weeks postoperatively, patients exhibited voluntary lip movements and oral competence. In addition, all patients achieved near-normal speech, evidence of recovered protective sensitivity and satisfactory appearance. The mean follow-up was 16.1 months. Our preliminary report in three patients demonstrated that innervated gracilis muscle transfer combined with fibular flap provides a successful reconstruction of extensive composite mandibular and total lower lip defects resulting from gunshot injuries to the face. Oral continence was achieved by combination of regained tonicity and voluntary movement of the gracilis muscle following re-innervation and assistance of the cheek muscles on the gracilis muscle. The described technique was reliable and the results were promising. Copyright © 2012 British Association of Plastic, Reconstructive and Aesthetic Surgeons. Published by Elsevier Ltd. All rights reserved.
A Reliable Method to Measure Lip Height Using Photogrammetry in Unilateral Cleft Lip Patients.
van der Zeeuw, Frederique; Murabit, Amera; Volcano, Johnny; Torensma, Bart; Patel, Brijesh; Hay, Norman; Thorburn, Guy; Morris, Paul; Sommerlad, Brian; Gnarra, Maria; van der Horst, Chantal; Kangesu, Loshan
2015-09-01
There is still no reliable tool to determine the outcome of the repaired unilateral cleft lip (UCL). The aim of this study was therefore to develop an accurate, reliable tool to measure vertical lip height from photographs. The authors measured the vertical height of the cutaneous and vermilion parts of the lip in 72 anterior-posterior view photographs of 17 patients with repairs to a UCL. Points on the lip's white roll and vermillion were marked on both the cleft and the noncleft sides on each image. Two new concepts were tested. First, photographs were standardized using the horizontal (medial to lateral) eye fissure width (EFW) for calibration. Second, the authors tested the interpupillary line (IPL) and the alar base line (ABL) for their reliability as horizontal lines of reference. Measurements were taken by 2 independent researchers, at 2 different time points each. Overall 2304 data points were obtained and analyzed. Results showed that the method was very effective in measuring the height of the lip on the cleft side with the noncleft side. When using the IPL, inter- and intra-rater reliability was 0.99 to 1.0, with the ABL it varied from 0.91 to 0.99 with one exception at 0.84. The IPL was easier to define because in some subjects the overhanging nasal tip obscured the alar base and gave more consistent measurements possibly because the reconstructed alar base was sometimes indistinct. However, measurements from the IPL can only give the percentage difference between the left and right sides of the lip, whereas those from the ABL can also give exact measurements. Patient examples were given that show how the measurements correlate with clinical assessment. The authors propose this method of photogrammetry with the innovative use of the IPL as a reliable horizontal plane and use of the EFW for calibration as a useful and reliable tool to assess the outcome of UCL repair.
Mala, Sankeerti; Rathod, Vanita; Pundir, Siddharth; Dixit, Sudhanshu
2017-01-01
The unique pattern and structural diversity of fingerprints, lip prints, palatal rugae, and their occurrence in different patterns among individuals make it questionable whether they are completely unique even in a family hierarchy? Do they have any repetition of the patterns among the generations? Or is this a mere chaos theory? The present study aims to assess the pattern self-repetition of fingerprints, lip prints, and palatal rugae among three generations of ten different families. The present study was conducted at Rungta College of Dental Science and Research, Bhilai, India. Participants birth by origin of Chhattisgarh were only included in the study. Thirty participants from three consecutive generations of ten different families were briefed about the purpose of the study, and their fingerprints, lip prints, and palatal rugae impression were recorded and analyzed for the pattern of self-repetition. Multiple comparisons among the generations and one-way analysis of variance test were performed using SPSS 20 trial version. Among the pattern of primary palatal rugae, 10% showed repetition in all the three generations. Thirty percent showed repetition of the pattern of thumb fingerprints in all the three generation. The pattern of lip prints in the middle 1/3 rd of lower lip, 20% showed repetition in alternative generations. The evaluations of fingerprints, lip prints, and palatal rugae showed fractal dimensions, occurring variations in dimensions according to the complexity of each structure. Even though a minute self-repetition in the patterns of lip, thumb, and palate among the three consequent generations in a family was observed considering the sample size, these results need to be confirmed in a larger sample, either to establish the role of chaos theory in forensic science or identifying a particular pattern of the individual in his family hierarchy.
The importance of early detection of lip cancer risk groups
NASA Astrophysics Data System (ADS)
Fratila, M.; Rosu, S.
2014-03-01
Oral maxillo-facial region cancer carries major importance in the tumour pathology of the organism being characterized by a high frequency as well as by the variety of the clinical anatomical and topographic forms through which it is presented. Over 60% of labial carcinoma begins as an asymptomatic ulceration, therefore patients do not pay due attention, considering it a "rebellious thrush" and they make a specialized medical appointment in an advanced stage of the tumor. In this study we pursued the frequency of the lip cancer pathology compared to the total CMF; the distribution the lip cancer by sex and age in patients who submitted to the specialized service; the originating environment of the patient with lip cancer; the anatomical location of the lip cancer; the frequency of relapses after treatment; the presence of adenopathy in the first consultation. The study was performed at the Clinic of Cranio-Maxillofacial Surgery, University of Medicine and Pharmacy "Victor Babes" Timişoara and pursued statistical aspects of the lip cancer incidence over a period of five years (2007-2012). Pre- and postoperative patients were monitored constantly, registering in individual sheets the evolution of the disease, monitoring the relapses after treatment and the presence of adenopathy in the first consultation. As shown in the statistics made in the last five years (2007-2012), from a total of 8135 cases with CMF pathology hospitalized in the Timisoara surgery clinic, 163 cases, or 2%, were cancer of the lip. Analyzing the gender distribution shows that males represent 81% of cases while the remaining 19% were found in women. From the study of age distribution, we found that the number of cases increases with age: 153 cases over 60 years old and 58 cases between 20 - 60 years. Personal statistics from the 212 cases of cancer of the lip reveal that 143 (67%) patients were from the rural areas and 69 (33%) from urban areas. Neoplastic pathology is constantly increasing both in frequency as well as in the therapeutic problems raised. In the face and oral cavity cancer catagory, lip represents 2% of all cases and 19-25% of the total facial cancer area. Lip cancer is one of the localizations that, when detected early, can benefit from an effective therapy with high chances of healing. In order to achieve a complex treatment, interdisciplinary collaboration is required, only thus being able to determine both the therapeutic methods as well as their association.
Lin, Jiahao; Wang, Xiuli; Wu, Qing; Dai, Jundong; Guan, Huida; Cao, Weiyi; He, Liangying; Wang, Yurong
2014-02-28
The aim of this study was to systematically optimize and characterize the co-encapsulation process of Salvianolic acid B (Sal B), Tanshinone II A (TSN) and Glycyrrhetinic acid (GA) into liposomes. The liposomes (GTS-lip) were prepared using film hydration method combined with probe sonication to encapsulate two hydrophobic components (TSN and GA), and using pH gradient method to load hydrophilic component Sal B. The concentration of encapsulated drugs was measured by a reversed phase high performance liquid chromatography (RP-HPLC) method. Systematic optimization of encapsulation process was performed using single factor test, orthogonal test in combination with Box-Behnken Design. Optimum conditions are as follows: ratio of GA to lipid (w/w)=0.08, ratio of Sal B to lipid (w/w)=0.12 and pH of buffer=3.3. Based on the conditions mentioned above, encapsulation efficiency of Sal B, TSN and GA reached target levels: (96.03 ± 0.28)%, (80.63 ± 0.91)% and (88.56 ± 0.17)%, respectively. The GTS-lip had a unimodal size-distribution and a mean diameter of 191.3 ± 6.31 nm. Morphology determination of the GTS-lip indicated that the liposomes were spherical, and there was no free drug crystal in the visual field of transmission electron microscopy. Also, the ζ potential of GTS-lip was detected to be -11.6 ± 0.35 mV. In vitro release investigation of GTS-lip suggested that the release rate of GTS-lip significantly decreased compared to drug solution. The accumulative release percentage of TSN, GA and Sal B were 10% in 36 h, 4% in 36 h and 77% in 24 h. Meanwhile, GTS-lip exhibited definite activity on proliferative inhibition of hepatic stellate cells (HSC). GTS-lip decreased the viability of the HSC to higher than 75% at two high drug concentration groups in 24h. At the same time, GTS-lip of two low drug concentration groups increased the inhibition rates by 2.3 folds and 1.9 folds separately at 48 h compared to 24h. By contrast, inhibition activity of G-T-S solution group showed less change between 48 h and 24 h. The prolonged and enhanced activity in 48 h which GTS-lip group manifested might contribute to its sustained release effect. Copyright © 2014 Elsevier B.V. All rights reserved.
CIRPLAST: Cleft Lip and Palate Missions in Peru.
Navarro, Carlos E
2015-06-01
The author presents a 20-year experience leading cleft lip and palate surgical volunteer missions in Peru for CIRPLAST, a nonprofit volunteer plastic surgery goodwill program that has provided free surgery for patients with cleft lip and palate deformities in remote areas of Peru. Surgical procedures were performed by the author, together with a group of experienced plastic surgeons, under the auspices of the Peruvian Plastic Surgery Society, and local health authorities. CIRPLAST missions are scheduled annually in different locations around Peru. Selected patients for surgery after adequate screening are photographed, and their cleft deformity is recorded. Scheduled patients or their parents, when they are minors, sign an informed consent form. Patients operated on in any given day are examined and photographed 1 day after surgery, before discharge. Between 30 and 35 patients are operated on at each mission site. About 2 weeks after the mission, patients are checked and photographed, and the outcome of surgery is recorded. Complications that may occur are recorded and treated by the CIRPLAST team as soon as possible. Almost all operations are performed under general endotracheal anesthesia coupled by local anesthesia containing a vasoconstrictor, to reduce bleeding and facilitate tissue dissection. All wounds of the lip and palate are closed with absorbable sutures, to avoid the need for suture removal. After cleft lip surgery, patients go to the recovery room for monitoring by nurses until they recover completely. A total of 6108 cleft lip and palate repairs, primary and secondary, were performed by CIRPLAST in 141 missions, between May 12, 1994, and October 15, 2014. The medical records of the 5162 patients (84.5%) who returned for follow-up (ranging from 12 days to 9 years) were reviewed retrospectively. Between 45% and 70% of the patients operated on a mission have returned for early follow-up and some the following year. There were 3176 males (51.9%) and 2932 females (48.1%). The incidence of isolated lip clefts was 1546 patients (25.3%); of isolated palate clefts, 2223 patients (36.4%); and combined defects, 2339 patients (38.3%). Of the 5162 patients who returned for follow-up, 377 patients (7.3%) had complications. Lip wound dehiscence was present in 58 patients (15.4). Palate fistula formation in 33 patients (8.8%): 24 (6.4%) after primary palate closure, and 9 (2.4%) after previous fistula closure. Infection occurred in 37 cleft lip patients (9.8%). Hypertrophic lip scars were seen in 56 patients (14.9%). Bleeding occurred in the recovery room after palatoplasty in 48 patients (12.7%), and in most cases, it was contained by applying pressure. No blood transfusions were used. Residual deformities of varying degree of the nose and/or lip occurred in 145 patients (38.5%). All required reoperation for correction. There were no intraoperative deaths in this series. During the past 20 years, the CIRPLAST team has offered free surgery with good outcomes and few complications, to more than 6000 cleft lip and/or palate patients in remote areas of Peru.
2018-04-17
Mucositis; Oral Complications; Recurrent Adenoid Cystic Carcinoma of the Oral Cavity; Recurrent Basal Cell Carcinoma of the Lip; Recurrent Lymphoepithelioma of the Nasopharynx; Recurrent Lymphoepithelioma of the Oropharynx; Recurrent Mucoepidermoid Carcinoma of the Oral Cavity; Recurrent Salivary Gland Cancer; Recurrent Squamous Cell Carcinoma of the Larynx; Recurrent Squamous Cell Carcinoma of the Lip and Oral Cavity; Recurrent Squamous Cell Carcinoma of the Nasopharynx; Recurrent Squamous Cell Carcinoma of the Oropharynx; Recurrent Verrucous Carcinoma of the Larynx; Recurrent Verrucous Carcinoma of the Oral Cavity; Stage I Adenoid Cystic Carcinoma of the Oral Cavity; Stage I Basal Cell Carcinoma of the Lip; Stage I Lymphoepithelioma of the Nasopharynx; Stage I Lymphoepithelioma of the Oropharynx; Stage I Mucoepidermoid Carcinoma of the Oral Cavity; Stage I Salivary Gland Cancer; Stage I Squamous Cell Carcinoma of the Larynx; Stage I Squamous Cell Carcinoma of the Lip and Oral Cavity; Stage I Squamous Cell Carcinoma of the Nasopharynx; Stage I Squamous Cell Carcinoma of the Oropharynx; Stage I Verrucous Carcinoma of the Larynx; Stage I Verrucous Carcinoma of the Oral Cavity; Stage II Adenoid Cystic Carcinoma of the Oral Cavity; Stage II Basal Cell Carcinoma of the Lip; Stage II Lymphoepithelioma of the Nasopharynx; Stage II Lymphoepithelioma of the Oropharynx; Stage II Mucoepidermoid Carcinoma of the Oral Cavity; Stage II Salivary Gland Cancer; Stage II Squamous Cell Carcinoma of the Larynx; Stage II Squamous Cell Carcinoma of the Lip and Oral Cavity; Stage II Squamous Cell Carcinoma of the Nasopharynx; Stage II Squamous Cell Carcinoma of the Oropharynx; Stage II Verrucous Carcinoma of the Larynx; Stage II Verrucous Carcinoma of the Oral Cavity; Stage III Adenoid Cystic Carcinoma of the Oral Cavity; Stage III Basal Cell Carcinoma of the Lip; Stage III Lymphoepithelioma of the Nasopharynx; Stage III Lymphoepithelioma of the Oropharynx; Stage III Mucoepidermoid Carcinoma of the Oral Cavity; Stage III Salivary Gland Cancer; Stage III Squamous Cell Carcinoma of the Larynx; Stage III Squamous Cell Carcinoma of the Lip and Oral Cavity; Stage III Squamous Cell Carcinoma of the Nasopharynx; Stage III Squamous Cell Carcinoma of the Oropharynx; Stage III Verrucous Carcinoma of the Larynx; Stage III Verrucous Carcinoma of the Oral Cavity; Stage IV Lymphoepithelioma of the Nasopharynx; Stage IV Squamous Cell Carcinoma of the Nasopharynx; Stage IVA Adenoid Cystic Carcinoma of the Oral Cavity; Stage IVA Basal Cell Carcinoma of the Lip; Stage IVA Lymphoepithelioma of the Oropharynx; Stage IVA Mucoepidermoid Carcinoma of the Oral Cavity; Stage IVA Salivary Gland Cancer; Stage IVA Squamous Cell Carcinoma of the Larynx; Stage IVA Squamous Cell Carcinoma of the Lip and Oral Cavity; Stage IVA Squamous Cell Carcinoma of the Oropharynx; Stage IVA Verrucous Carcinoma of the Larynx; Stage IVA Verrucous Carcinoma of the Oral Cavity; Stage IVB Adenoid Cystic Carcinoma of the Oral Cavity; Stage IVB Basal Cell Carcinoma of the Lip; Stage IVB Lymphoepithelioma of the Oropharynx; Stage IVB Mucoepidermoid Carcinoma of the Oral Cavity; Stage IVB Salivary Gland Cancer; Stage IVB Squamous Cell Carcinoma of the Larynx; Stage IVB Squamous Cell Carcinoma of the Lip and Oral Cavity; Stage IVB Squamous Cell Carcinoma of the Oropharynx; Stage IVB Verrucous Carcinoma of the Larynx; Stage IVB Verrucous Carcinoma of the Oral Cavity; Stage IVC Adenoid Cystic Carcinoma of the Oral Cavity; Stage IVC Basal Cell Carcinoma of the Lip; Stage IVC Lymphoepithelioma of the Oropharynx; Stage IVC Mucoepidermoid Carcinoma of the Oral Cavity; Stage IVC Salivary Gland Cancer; Stage IVC Squamous Cell Carcinoma of the Larynx; Stage IVC Squamous Cell Carcinoma of the Lip and Oral Cavity; Stage IVC Squamous Cell Carcinoma of the Oropharynx; Stage IVC Verrucous Carcinoma of the Larynx; Stage IVC Verrucous Carcinoma of the Oral Cavity; Tongue Cancer
Philip Stewart; Philip Kersten; Amber J. Vanden Wymelenberg; Jill A. Gaskell; Daniel Cullen
1992-01-01
Lignin peroxidases (LiP) of Phanerochaete chrysosporium are encoded by a family of six closely related genes. Five LiP genes have been localized to the same dimorphic chromosome. In this investigation, relative transcript levels of the LiP genes were determined. Transcripts of the LiPA, LiPB, and 0282 genes were at similar levels in both carbon-and nitrogen-limited...
[Anesthesia in a child operated for cleft lip associated with Patau's syndrome].
Kamal, Manoj; Varghese, Don; Bhagde, Jeet; Singariya, Geeta; Simon, Annie Miju; Singh, Amar
Patients with Patau's syndrome (Trisomy 13) have multiple craniofacial, cardiac, neurological and renal anomalies with very less life expectancy. Among craniofacial anomalies cleft lip and palate are common. These craniofacial and cardiac anomalies present difficulties with anesthesia. We therefore describe the anesthetic management in the case of a Trisomy 13 child for operated for cleft lip at 10 months of age. Copyright © 2017. Publicado por Elsevier Editora Ltda.
Boonsathorn, Naphatsawan; Konghom, Ganokrot; Mongkolsiri, Kaveewan; Jirapongwattana, Chanin; Balachandra, Kruavon; Naigowit, Pimjai; Sawanpanyalert, Pathom
2009-01-01
Leptospira interrogans serovar autumnalis, a causative agent of leptospirosis in Thailand, was isolated from a patient for DNA extraction and amplification of LipL32 gene by polymerase chain reaction (PCR). The 782 bp PCR product was obtained, which was inserted into pAE plasmid with polyhistidine (His6 tag) to construct pAE-LipL32. This recombinant plasmid was transfected into E. coli BL21 (DE3). His6-LipL32 was purified by Ni-NTA affinity chromatography. The recombinant protein was used as antigen for testing with sera from leptospirosis and syphilis patients by dot-ELISA technique. It reacted positively with leptospirosis patient sera and negatively with syphilis and healthy sera.
Hartwig, Daiane D; Bacelo, Kátia L; Oliveira, Thaís L; Schuch, Rodrigo; Seixas, Fabiana K; Collares, Tiago; Rodrigues, Oscar; Hartleben, Cláudia P; Dellagostin, Odir A
2015-02-01
We studied the feasibility of using halloysite clay nanotubes (HNTs) and carboxyl-functionalised multi-walled carbon nanotubes (COOH-MWCNTs) as antigen carriers to improve immune responses against a recombinant LipL32 protein (rLipL32). Immunisation using the HNTs or COOH-MWCNTs significantly increased the rLipL32-specific IgG antibody titres (p < 0.05) of Golden Syrian hamsters. None of the vaccines tested conferred protection against a challenge using a virulent Leptospira interrogans strain. These results demonstrated that nanotubes can be used as antigen carriers for delivery in hosts and the induction of a humoral immune response against purified leptospiral antigens used in subunit vaccine preparations.
Some observations on computer lip-reading: moving from the dream to the reality
NASA Astrophysics Data System (ADS)
Bear, Helen L.; Owen, Gari; Harvey, Richard; Theobald, Barry-John
2014-10-01
In the quest for greater computer lip-reading performance there are a number of tacit assumptions which are either present in the datasets (high resolution for example) or in the methods (recognition of spoken visual units called "visemes" for example). Here we review these and other assumptions and show the surprising result that computer lip-reading is not heavily constrained by video resolution, pose, lighting and other practical factors. However, the working assumption that visemes, which are the visual equivalent of phonemes, are the best unit for recognition does need further examination. We conclude that visemes, which were defined over a century ago, are unlikely to be optimal for a modern computer lip-reading system.
Gender variation in morphological patterns of lip prints among some north Indian populations.
Vats, Yogesh; Dhall, Jasmine Kaur; Kapoor, Ak
2012-01-01
Personal identification is an integral part of forensic investigations. For the same, DNA profiling and fingerprints are the most commonly used tools. But these evidences are not ubiquitous and may not necessarily be obtained from the crime scene. In such a scenario, other physical and trace evidences play a pivotal role and subsequently the branches employed are forensic osteology, odontology, biometrics, etc. A relatively recent field in the branch of forensic odontology is cheiloscopy or the study of lip prints. A comparison of lip prints from the crime scene and those obtained from the suspects may be useful in the identification or narrowing down the investigation. The purpose of the present study is to determine the gender and population variability in the morphological patterns of lip prints among brahmins, Jats, and scheduled castes of Delhi and Haryana, India. Samples were collected from Jats, brahmins, and scheduled castes of Delhi and Haryana. The total sample size consisted of 1399 individuals including 781 males and 618 females in the age group of 8-60 years. Care was taken not to collect samples from genetically related individuals. The technique was standardized by recording lip prints of 20 persons and analyzing them. Lip prints were collected by using a corporate's invisible tape and analyzed using a hand lens. The patterns were studied along the entire length and breadth of both the upper and the lower lip. The data were analyzed by SPSS statistical package version 17 to determine the frequencies and percentages of occurrence of the pattern types in each population group and a comparison between males and females among the groups was carried out by using the z test. The z-test comparison between patterns of males and females shows significant differences with respect to pattern types I', II, III, and IV among brahmins; I', II, III, IV, and Y among Jats; and I, I', II, III, and V among scheduled castes. Thus, it can be concluded that the variability of the lip print pattern can help sex differentiation among groups and that more studies on the lip print pattern should be carried out to bring new dimensions to forensic anthropology and to aid the law enforcement agencies.
NASA Astrophysics Data System (ADS)
Ashwal, L. D.
2017-12-01
The Archean Kaapvaal Craton of southern Africa hosts at least four spatially overlapping Large Igneous Provinces (LIPs), each of which generated substantial volumes ( 1-3 x 106 km3) of mafic magmatic rocks, over short time intervals (5 m.y. or less), between 2.7 and 0.18 Ga: the Ventersdorp Supergroup (2714 Ma, 0.7 x 106 km3), the Bushveld layered intrusion (2056 Ma, 1.5 x 106 km3), the Umkondo Igneous Province (1105 Ma, 2 x 106 km3) and the Karoo LIP (182 Ma, 3 x 106 km3). Therefore, over a time interval of >2500 m.y., a minimum collective volume of 7.2 x 106 km3 of mantle-derived, mafic lavas, sills, dikes and derivative cumulate rocks, was periodically emplaced through, into and/or onto the same cratonic region of Archean lithosphere. This long-term spatial superposition of Kaapvaal LIPs can be used as input to the vigorous debate on the nature of LIP mantle sources, and the possible role of crustal contamination in their petrogenesis. Continental LIP magmas, including all four of the Kaapvaal examples, have commonly been interpreted as products of direct partial melting of sub-continental lithospheric mantle (SCLM) sources, with little or no contribution from upwelling, plume-related, asthenospheric materials that provided the heat for melting. The Kaapvaal SCLM was stabilized at 3 Ga by prior melt extraction events that rendered it chemically depleted, and hence buoyant; it seems unlikely that it might have been capable of generating 1-3 x 106 km3 of basaltic magmas four times during its history. This would require repeated, substantial refertilization to counteract the extensive chemical depletion caused by recurrent extraction of LIP magmas. Chemical enrichment events sufficient to yield such extensive volumes of basaltic magma would necessarily increase bulk SCLM density, compromising its long-term buoyancy and stability. It seems far more likely, therefore, that the Kaapvaal LIPs were generated from sub-lithospheric sources, and that their diverse geochemical and isotopic signatures represent variable assimilation of Archean (dominantly 3.0-3.6 Ga) granitoid crustal contaminants, as many have suggested. These arguments challenge the plausibility of SCLM melting as a viable general process for the origin of other continental LIPs.
Higaki, Takumi; Kutsuna, Natsumaro; Hasezawa, Seiichiro
2013-05-16
Intracellular configuration is an important feature of cell status. Recent advances in microscopic imaging techniques allow us to easily obtain a large number of microscopic images of intracellular structures. In this circumstance, automated microscopic image recognition techniques are of extreme importance to future phenomics/visible screening approaches. However, there was no benchmark microscopic image dataset for intracellular organelles in a specified plant cell type. We previously established the Live Images of Plant Stomata (LIPS) database, a publicly available collection of optical-section images of various intracellular structures of plant guard cells, as a model system of environmental signal perception and transduction. Here we report recent updates to the LIPS database and the establishment of a database table, LIPService. We updated the LIPS dataset and established a new interface named LIPService to promote efficient inspection of intracellular structure configurations. Cell nuclei, microtubules, actin microfilaments, mitochondria, chloroplasts, endoplasmic reticulum, peroxisomes, endosomes, Golgi bodies, and vacuoles can be filtered using probe names or morphometric parameters such as stomatal aperture. In addition to the serial optical sectional images of the original LIPS database, new volume-rendering data for easy web browsing of three-dimensional intracellular structures have been released to allow easy inspection of their configurations or relationships with cell status/morphology. We also demonstrated the utility of the new LIPS image database for automated organelle recognition of images from another plant cell image database with image clustering analyses. The updated LIPS database provides a benchmark image dataset for representative intracellular structures in Arabidopsis guard cells. The newly released LIPService allows users to inspect the relationship between organellar three-dimensional configurations and morphometrical parameters.
Sullivan, James A.; Gray, John C.
2000-01-01
The pea lip1 (light-independent photomorphogenesis1) mutant shows many of the characteristics of light-grown development when grown in continuous darkness. To investigate the identity of LIP1, cDNAs encoding the pea homolog of COP1, a repressor of photomorphogenesis identified in Arabidopsis, were isolated from wild-type and lip1 pea seedlings. lip1 seedlings contained a wild-type COP1 transcript as well as a larger COP1′ transcript that contained an internal in-frame duplication of 894 bp. The COP1′ transcript segregated with the lip1 phenotype in F2 seedlings and could be translated in vitro to produce a protein of ∼100 kD. The COP1 gene in lip1 peas contained a 7.5-kb duplication, consisting of exons 1 to 7 of the wild-type sequence, located 2.5 kb upstream of a region of genomic DNA identical to the wild-type COP1 DNA sequence. Transcription and splicing of the mutant COP1 gene was predicted to produce the COP1′ transcript, whereas transcription from an internal promoter in the 2.5-kb region of DNA located between the duplicated regions of COP1 would produce the wild-type COP1 transcript. The presence of small quantities of wild-type COP1 transcripts may reduce the severity of the phenotype produced by the mutated COP1′ protein. The genomic DNA sequences of the COP1 gene from wild-type and lip1 peas and the cDNA sequences of COP1 and COP1′ transcripts have been submitted to the EMBL database under the EMBL accession numbers AJ276591, AJ276592, AJ289773, and AJ289774, respectively. PMID:11041887