Sample records for optimal gene expression

  1. [Effect of gene optimization on the expression and purification of HDV small antigen produced by genetic engineering].

    PubMed

    Ding, Jun-Ying; Meng, Qing-Ling; Guo, Min-Zhuo; Yi, Yao; Su, Qiu-Dong; Lu, Xue-Xin; Qiu, Feng; Bi, Sheng-Li

    2012-10-01

    To study the effect of gene optimization on the expression and purification of HDV small antigen produced by genetic engineering. Based on the colon preference of E. coli, the HDV small antigen original gene from GenBank was optimized. Both the original gene and the optimized gene expressed in prokaryotic cells, SDS-PAGE was made to analyze the protein expression yield and to decide which protein expression style was more proportion than the other. Furthermore, two antigens were purified by chromatography in order to compare the purity by SDS-PAGE and Image Lab software. SDS-PAGE indicated that the molecular weight of target proteins from two groups were the same as we expected. Gene optimization resulted in the higher yield and it could make the product more soluble. After chromatography, the purity of target protein from optimized gene was up to 96.3%, obviously purer than that from original gene. Gene optimization could increase the protein expression yield and solubility of genetic engineering HDV small antigen. In addition, the product from the optimized gene group was easier to be purified for diagnosis usage.

  2. Expression of codon-optmized phosphoenolpyruvate carboxylase gene from Glaciecola sp. HTCC2999 in Escherichia coli and its application for C4 chemical production.

    PubMed

    Park, Soohyun; Pack, Seung Pil; Lee, Jinwon

    2012-08-01

    We examined the expression of the phosphoenolpyruvate carboxylase (PEPC) gene from marine bacteria in Escherichia coli using codon optimization. The codon-optimized PEPC gene was expressed in the E. coli K-12 strain W3110. SDS-PAGE analysis revealed that the codon-optimized PEPC gene was only expressed in E. coli, and measurement of enzyme activity indicated the highest PEPC activity in the E. coli SGJS112 strain that contained the codon-optimized PEPC gene. In fermentation assays, the E. coli SGJS112 produced the highest yield of oxaloacetate using glucose as the source and produced a 20-times increase in the yield of malate compared to the control. We concluded that the codon optimization enabled E. coli to express the PEPC gene derived from the Glaciecola sp. HTCC2999. Also, the expressed protein exhibited an enzymatic activity similar to that of E. coli PEPC and increased the yield of oxaloacetate and malate in an E. coli system.

  3. A condition-specific codon optimization approach for improved heterologous gene expression in Saccharomyces cerevisiae

    PubMed Central

    2014-01-01

    Background Heterologous gene expression is an important tool for synthetic biology that enables metabolic engineering and the production of non-natural biologics in a variety of host organisms. The translational efficiency of heterologous genes can often be improved by optimizing synonymous codon usage to better match the host organism. However, traditional approaches for optimization neglect to take into account many factors known to influence synonymous codon distributions. Results Here we define an alternative approach for codon optimization that utilizes systems level information and codon context for the condition under which heterologous genes are being expressed. Furthermore, we utilize a probabilistic algorithm to generate multiple variants of a given gene. We demonstrate improved translational efficiency using this condition-specific codon optimization approach with two heterologous genes, the fluorescent protein-encoding eGFP and the catechol 1,2-dioxygenase gene CatA, expressed in S. cerevisiae. For the latter case, optimization for stationary phase production resulted in nearly 2.9-fold improvements over commercial gene optimization algorithms. Conclusions Codon optimization is now often a standard tool for protein expression, and while a variety of tools and approaches have been developed, they do not guarantee improved performance for all hosts of applications. Here, we suggest an alternative method for condition-specific codon optimization and demonstrate its utility in Saccharomyces cerevisiae as a proof of concept. However, this technique should be applicable to any organism for which gene expression data can be generated and is thus of potential interest for a variety of applications in metabolic and cellular engineering. PMID:24636000

  4. Diverse expression levels of two codon-optimized genes that encode human papilloma virus type 16 major protein L1 in Hansenula polymorpha.

    PubMed

    Liu, Cunbao; Yang, Xu; Yao, Yufeng; Huang, Weiwei; Sun, Wenjia; Ma, Yanbing

    2014-05-01

    Two versions of an optimized gene that encodes human papilloma virus type 16 major protein L1 were designed according to the codon usage frequency of Pichia pastoris. Y16 was highly expressed in both P. pastoris and Hansenula polymorpha. M16 expression was as efficient as that of Y16 in P. pastoris, but merely detectable in H. polymorpha even though transcription levels of M16 and Y16 were similar. H. polymorpha had a unique codon usage frequency that contains many more rare codons than Saccharomyces cerevisiae or P. pastoris. These findings indicate that even codon-optimized genes that are expressed well in S. cerevisiae and P. pastoris may be inefficiently expressed in H. polymorpha; thus rare codons must be avoided when universal optimized gene versions are designed to facilitate expression in a variety of yeast expression systems, especially H. polymorpha is involved.

  5. Analysis of temporal gene expression profiles: clustering by simulated annealing and determining the optimal number of clusters.

    PubMed

    Lukashin, A V; Fuchs, R

    2001-05-01

    Cluster analysis of genome-wide expression data from DNA microarray hybridization studies has proved to be a useful tool for identifying biologically relevant groupings of genes and samples. In the present paper, we focus on several important issues related to clustering algorithms that have not yet been fully studied. We describe a simple and robust algorithm for the clustering of temporal gene expression profiles that is based on the simulated annealing procedure. In general, this algorithm guarantees to eventually find the globally optimal distribution of genes over clusters. We introduce an iterative scheme that serves to evaluate quantitatively the optimal number of clusters for each specific data set. The scheme is based on standard approaches used in regular statistical tests. The basic idea is to organize the search of the optimal number of clusters simultaneously with the optimization of the distribution of genes over clusters. The efficiency of the proposed algorithm has been evaluated by means of a reverse engineering experiment, that is, a situation in which the correct distribution of genes over clusters is known a priori. The employment of this statistically rigorous test has shown that our algorithm places greater than 90% genes into correct clusters. Finally, the algorithm has been tested on real gene expression data (expression changes during yeast cell cycle) for which the fundamental patterns of gene expression and the assignment of genes to clusters are well understood from numerous previous studies.

  6. P and M gene junction is the optimal insertion site in Newcastle disease virus vaccine vector for foreign gene expression

    USDA-ARS?s Scientific Manuscript database

    Newcastle disease virus (NDV) has been developed as a vector for vaccine and gene therapy purposes. However, the optimal insertion site for foreign gene expression remained to be determined. In the present study, we inserted the green fluorescence protein (GFP) gene into five different intergenic ...

  7. Evolution of Synonymous Codon Usage in Neurospora tetrasperma and Neurospora discreta

    PubMed Central

    Whittle, C. A.; Sun, Y.; Johannesson, H.

    2011-01-01

    Neurospora comprises a primary model system for the study of fungal genetics and biology. In spite of this, little is known about genome evolution in Neurospora. For example, the evolution of synonymous codon usage is largely unknown in this genus. In the present investigation, we conducted a comprehensive analysis of synonymous codon usage and its relationship to gene expression and gene length (GL) in Neurospora tetrasperma and Neurospora discreta. For our analysis, we examined codon usage among 2,079 genes per organism and assessed gene expression using large-scale expressed sequenced tag (EST) data sets (279,323 and 453,559 ESTs for N. tetrasperma and N. discreta, respectively). Data on relative synonymous codon usage revealed 24 codons (and two putative codons) that are more frequently used in genes with high than with low expression and thus were defined as optimal codons. Although codon-usage bias was highly correlated with gene expression, it was independent of selectively neutral base composition (introns); thus demonstrating that translational selection drives synonymous codon usage in these genomes. We also report that GL (coding sequences [CDS]) was inversely associated with optimal codon usage at each gene expression level, with highly expressed short genes having the greatest frequency of optimal codons. Optimal codon frequency was moderately higher in N. tetrasperma than in N. discreta, which might be due to variation in selective pressures and/or mating systems. PMID:21402862

  8. Verification and Optimal Control of Context-Sensitive Probabilistic Boolean Networks Using Model Checking and Polynomial Optimization

    PubMed Central

    Hiraishi, Kunihiko

    2014-01-01

    One of the significant topics in systems biology is to develop control theory of gene regulatory networks (GRNs). In typical control of GRNs, expression of some genes is inhibited (activated) by manipulating external stimuli and expression of other genes. It is expected to apply control theory of GRNs to gene therapy technologies in the future. In this paper, a control method using a Boolean network (BN) is studied. A BN is widely used as a model of GRNs, and gene expression is expressed by a binary value (ON or OFF). In particular, a context-sensitive probabilistic Boolean network (CS-PBN), which is one of the extended models of BNs, is used. For CS-PBNs, the verification problem and the optimal control problem are considered. For the verification problem, a solution method using the probabilistic model checker PRISM is proposed. For the optimal control problem, a solution method using polynomial optimization is proposed. Finally, a numerical example on the WNT5A network, which is related to melanoma, is presented. The proposed methods provide us useful tools in control theory of GRNs. PMID:24587766

  9. [Modulating expression of key genes within β-carotene synthetic pathway in recombinant Escherichia coli with RBS library to improve β-carotene production].

    PubMed

    Dai, Guanping; Sun, Tao; Miao, Liangtian; Li, Qingyan; Xiao, Dongguang; Zhang, Xueli

    2014-08-01

    β-carotene belongs to carotenoids family, widely applied in pharmaceuticals, neutraceuticals, cosmetics and food industries. In this study, three key genes (dxs, idi, and crt operon) within β-carotene synthetic pathway in recombinant Escherichia coli strain CAR005 were modulated with RBS Library to improve β-carotene production. There were 7%, 11% and 17% increase of β-carotene yield respectively after modulating dxs, idi and crt operon genes with RBS Library, demonstrating that modulating gene expression with regulatory parts libraries would have more opportunities to obtain optimal production of target compound. Combined modulation of crt operon, dxs and idi genes led to 35% increase of β-carotene yield compared to parent strain CAR005. The optimal gene expression strength identified in single gene modulation would not be the optimal strength when used in combined modulation. Our study provides a new strategy for improving production of target compound through modulation of gene expression.

  10. Simulation Modeling to Compare High-Throughput, Low-Iteration Optimization Strategies for Metabolic Engineering

    PubMed Central

    Heinsch, Stephen C.; Das, Siba R.; Smanski, Michael J.

    2018-01-01

    Increasing the final titer of a multi-gene metabolic pathway can be viewed as a multivariate optimization problem. While numerous multivariate optimization algorithms exist, few are specifically designed to accommodate the constraints posed by genetic engineering workflows. We present a strategy for optimizing expression levels across an arbitrary number of genes that requires few design-build-test iterations. We compare the performance of several optimization algorithms on a series of simulated expression landscapes. We show that optimal experimental design parameters depend on the degree of landscape ruggedness. This work provides a theoretical framework for designing and executing numerical optimization on multi-gene systems. PMID:29535690

  11. OptSSeq: High-throughput sequencing readout of growth enrichment defines optimal gene expression elements for homoethanologenesis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ghosh, Indro Neil; Landick, Robert

    The optimization of synthetic pathways is a central challenge in metabolic engineering. OptSSeq (Optimization by Selection and Sequencing) is one approach to this challenge. OptSSeq couples selection of optimal enzyme expression levels linked to cell growth rate with high-throughput sequencing to track enrichment of gene expression elements (promoters and ribosomebinding sites) from a combinatorial library. OptSSeq yields information on both optimal and suboptimal enzyme levels, and helps identify constraints that limit maximal product formation. Here we report a proof-of-concept implementation of OptSSeq using homoethanologenesis, a two-step pathway consisting of pyruvate decarboxylase (Pdc) and alcohol dehydrogenase (Adh) that converts pyruvate tomore » ethanol and is naturally optimized in the bacterium Zymomonas mobilis. We used OptSSeq to determine optimal gene expression elements and enzyme levels for Z. mobilis Pdc, AdhA, and AdhB expressed in Escherichia coli. By varying both expression signals and gene order, we identified an optimal solution using only Pdc and AdhB. We resolved current uncertainty about the functions of the Fe 2+-dependent AdhB and Zn 2+- dependent AdhA by showing that AdhB is preferred over AdhA for rapid growth in both E. coli and Z. mobilis. Finally, by comparing predictions of growth-linked metabolic flux to enzyme synthesis costs, we established that optimal E. coli homoethanologenesis was achieved by our best pdc-adhB expression cassette and that the remaining constraints lie in the E. coli metabolic network or inefficient Pdc or AdhB function in E. coli. Furthermore, OptSSeq is a general tool for synthetic biology to tune enzyme levels in any pathway whose optimal function can be linked to cell growth or survival.« less

  12. OptSSeq: High-throughput sequencing readout of growth enrichment defines optimal gene expression elements for homoethanologenesis

    DOE PAGES

    Ghosh, Indro Neil; Landick, Robert

    2016-07-16

    The optimization of synthetic pathways is a central challenge in metabolic engineering. OptSSeq (Optimization by Selection and Sequencing) is one approach to this challenge. OptSSeq couples selection of optimal enzyme expression levels linked to cell growth rate with high-throughput sequencing to track enrichment of gene expression elements (promoters and ribosomebinding sites) from a combinatorial library. OptSSeq yields information on both optimal and suboptimal enzyme levels, and helps identify constraints that limit maximal product formation. Here we report a proof-of-concept implementation of OptSSeq using homoethanologenesis, a two-step pathway consisting of pyruvate decarboxylase (Pdc) and alcohol dehydrogenase (Adh) that converts pyruvate tomore » ethanol and is naturally optimized in the bacterium Zymomonas mobilis. We used OptSSeq to determine optimal gene expression elements and enzyme levels for Z. mobilis Pdc, AdhA, and AdhB expressed in Escherichia coli. By varying both expression signals and gene order, we identified an optimal solution using only Pdc and AdhB. We resolved current uncertainty about the functions of the Fe 2+-dependent AdhB and Zn 2+- dependent AdhA by showing that AdhB is preferred over AdhA for rapid growth in both E. coli and Z. mobilis. Finally, by comparing predictions of growth-linked metabolic flux to enzyme synthesis costs, we established that optimal E. coli homoethanologenesis was achieved by our best pdc-adhB expression cassette and that the remaining constraints lie in the E. coli metabolic network or inefficient Pdc or AdhB function in E. coli. Furthermore, OptSSeq is a general tool for synthetic biology to tune enzyme levels in any pathway whose optimal function can be linked to cell growth or survival.« less

  13. Efficient Coproduction of Mannanase and Cellulase by the Transformation of a Codon-Optimized Endomannanase Gene from Aspergillus niger into Trichoderma reesei.

    PubMed

    Sun, Xianhua; Xue, Xianli; Li, Mengzhu; Gao, Fei; Hao, Zhenzhen; Huang, Huoqing; Luo, Huiying; Qin, Lina; Yao, Bin; Su, Xiaoyun

    2017-12-20

    Cellulase and mannanase are both important enzyme additives in animal feeds. Expressing the two enzymes simultaneously within one microbial host could potentially lead to cost reductions in the feeding of animals. For this purpose, we codon-optimized the Aspergillus niger Man5A gene to the codon-usage bias of Trichoderma reesei. By comparing the free energies and the local structures of the nucleotide sequences, one optimized sequence was finally selected and transformed into the T. reesei pyridine-auxotrophic strain TU-6. The codon-optimized gene was expressed to a higher level than the original one. Further expressing the codon-optimized gene in a mutated T. reesei strain through fed-batch cultivation resulted in coproduction of cellulase and mannanase up to 1376 U·mL -1 and 1204 U·mL -1 , respectively.

  14. Protein expression of preferred human codon-optimized Gaussia luciferase genes with an artificial open-reading frame in mammalian and bacterial cells.

    PubMed

    Inouye, Satoshi; Suzuki, Takahiro

    2016-12-01

    The protein expressions of three preferred human codon-optimized Gaussia luciferase genes (pGLuc, EpGLuc, and KpGLuc) were characterized in mammalian and bacterial cells by comparing them with those of wild-type Gaussia luciferase gene (wGLuc) and human codon-optimized Gaussia luciferase gene (hGLuc). Two synthetic genes of EpGLuc and KpGLuc containing the complete preferred human codons have an artificial open-reading frame; however, they had the similar protein expression levels to those of pGLuc and hGLuc in mammalian cells. In bacterial cells, the protein expressions of pGLuc, EpGLuc, and KpGLuc with approximately 65% GC content were the same and showed approximately 60% activities of wGLuc and hGLuc. The artificial open-reading frame in EpGLuc and KpGLuc did not affect the protein expression in mammalian and bacterial cells. Copyright © 2016 Elsevier Inc. All rights reserved.

  15. A stochastic model for optimizing composite predictors based on gene expression profiles.

    PubMed

    Ramanathan, Murali

    2003-07-01

    This project was done to develop a mathematical model for optimizing composite predictors based on gene expression profiles from DNA arrays and proteomics. The problem was amenable to a formulation and solution analogous to the portfolio optimization problem in mathematical finance: it requires the optimization of a quadratic function subject to linear constraints. The performance of the approach was compared to that of neighborhood analysis using a data set containing cDNA array-derived gene expression profiles from 14 multiple sclerosis patients receiving intramuscular inteferon-beta1a. The Markowitz portfolio model predicts that the covariance between genes can be exploited to construct an efficient composite. The model predicts that a composite is not needed for maximizing the mean value of a treatment effect: only a single gene is needed, but the usefulness of the effect measure may be compromised by high variability. The model optimized the composite to yield the highest mean for a given level of variability or the least variability for a given mean level. The choices that meet this optimization criteria lie on a curve of composite mean vs. composite variability plot referred to as the "efficient frontier." When a composite is constructed using the model, it outperforms the composite constructed using the neighborhood analysis method. The Markowitz portfolio model may find potential applications in constructing composite biomarkers and in the pharmacogenomic modeling of treatment effects derived from gene expression endpoints.

  16. Elevation of the Yields of Very Long Chain Polyunsaturated Fatty Acids via Minimal Codon Optimization of Two Key Biosynthetic Enzymes

    PubMed Central

    Zheng, Desong; Sun, Quanxi; Liu, Jiang; Li, Yaxiao; Hua, Jinping

    2016-01-01

    Eicosapentaenoic acid (EPA, 20:5Δ5,8,11,14,17) and Docosahexaenoic acid (DHA, 22:6Δ4,7,10,13,16,19) are nutritionally beneficial to human health. Transgenic production of EPA and DHA in oilseed crops by transferring genes originating from lower eukaryotes, such as microalgae and fungi, has been attempted in recent years. However, the low yield of EPA and DHA produced in these transgenic crops is a major hurdle for the commercialization of these transgenics. Many factors can negatively affect transgene expression, leading to a low level of converted fatty acid products. Among these the codon bias between the transgene donor and the host crop is one of the major contributing factors. Therefore, we carried out codon optimization of a fatty acid delta-6 desaturase gene PinD6 from the fungus Phytophthora infestans, and a delta-9 elongase gene, IgASE1 from the microalga Isochrysis galbana for expression in Saccharomyces cerevisiae and Arabidopsis respectively. These are the two key genes encoding enzymes for driving the first catalytic steps in the Δ6 desaturation/Δ6 elongation and the Δ9 elongation/Δ8 desaturation pathways for EPA/DHA biosynthesis. Hence expression levels of these two genes are important in determining the final yield of EPA/DHA. Via PCR-based mutagenesis we optimized the least preferred codons within the first 16 codons at their N-termini, as well as the most biased CGC codons (coding for arginine) within the entire sequences of both genes. An expression study showed that transgenic Arabidopsis plants harbouring the codon-optimized IgASE1 contained 64% more elongated fatty acid products than plants expressing the native IgASE1 sequence, whilst Saccharomyces cerevisiae expressing the codon optimized PinD6 yielded 20 times more desaturated products than yeast expressing wild-type (WT) PinD6. Thus the codon optimization strategy we developed here offers a simple, effective and low-cost alternative to whole gene synthesis for high expression of foreign genes in yeast and Arabidopsis. PMID:27433934

  17. Exploring codon context bias for synthetic gene design of a thermostable invertase in Escherichia coli.

    PubMed

    Pek, Han Bin; Klement, Maximilian; Ang, Kok Siong; Chung, Bevan Kai-Sheng; Ow, Dave Siak-Wei; Lee, Dong-Yup

    2015-01-01

    Various isoforms of invertases from prokaryotes, fungi, and higher plants has been expressed in Escherichia coli, and codon optimisation is a widely-adopted strategy for improvement of heterologous enzyme expression. Successful synthetic gene design for recombinant protein expression can be done by matching its translational elongation rate against heterologous host organisms via codon optimization. Amongst the various design parameters considered for the gene synthesis, codon context bias has been relatively overlooked compared to individual codon usage which is commonly adopted in most of codon optimization tools. In addition, matching the rates of transcription and translation based on secondary structure may lead to enhanced protein folding. In this study, we evaluated codon context fitness as design criterion for improving the expression of thermostable invertase from Thermotoga maritima in Escherichia coli and explored the relevance of secondary structure regions for folding and expression. We designed three coding sequences by using (1) a commercial vendor optimized gene algorithm, (2) codon context for the whole gene, and (3) codon context based on the secondary structure regions. Then, the codon optimized sequences were transformed and expressed in E. coli. From the resultant enzyme activities and protein yield data, codon context fitness proved to have the highest activity as compared to the wild-type control and other criteria while secondary structure-based strategy is comparable to the control. Codon context bias was shown to be a relevant parameter for enhancing enzyme production in Escherichia coli by codon optimization. Thus, we can effectively design synthetic genes within heterologous host organisms using this criterion. Copyright © 2015 Elsevier Inc. All rights reserved.

  18. Cloning, Codon Optimization, and Expression of Yersinia intermedia Phytase Gene in E. coli.

    PubMed

    Mirzaei, Maryam; Saffar, Behnaz; Shareghi, Behzad

    2016-06-01

    Phytate is an anti-nutritional factor in plants, which catches the most phosphorus contents and some vital minerals. Therefore, Phytase is added mainly as an additive to the monogastric animals' foods to hydrolyze phytate and increase absorption of phosphorus. Y. intermedia phytase is a new phytase with special characteristics such as high specific activity, pH stability, and thermostability. Our aim was to clone, express, and characterizea codon optimized Y. intermedia phytase gene in E. coli . The Y. intermedia phytase gene was optimized according to the codon usage in E. coli . The sequence was synthesized and sub-cloned in pET-22b (+) vector and transformed into E. coli Bl21 (DE3). The protein was expressed in the presence of IPTG at a final concentration of 1 mM at 30°C. The purification of recombinant protein was performed by Ni 2+ affinity chromatography. Phytase activity and stability were determined in various pH and temperatures. The codon optimized Y. intermedia phytase gene was sub-cloned successfully.The expression was confirmed by SDS-PAGE and Western blot analysis. The recombinant enzyme (approximately 45 kDa) was purified. Specific activity of enzyme was 3849 (U.mg -1 ) with optimal pH 5 and optimal temperature of 55°C. Thermostability (80°C for 15 min) and pH stability (3-6) of the enzyme were 56 and more than 80%, respectively. The results of the expression and enzyme characterization revealed that the optimized Y. intermedia phytase gene has a good potential to be produced commercially andto be applied in animals' foodsindustry.

  19. Balancing gene expression without library construction via a reusable sRNA pool.

    PubMed

    Ghodasara, Amar; Voigt, Christopher A

    2017-07-27

    Balancing protein expression is critical when optimizing genetic systems. Typically, this requires library construction to vary the genetic parts controlling each gene, which can be expensive and time-consuming. Here, we develop sRNAs corresponding to 15nt 'target' sequences that can be inserted upstream of a gene. The targeted gene can be repressed from 1.6- to 87-fold by controlling sRNA expression using promoters of different strength. A pool is built where six sRNAs are placed under the control of 16 promoters that span a ∼103-fold range of strengths, yielding ∼107 combinations. This pool can simultaneously optimize up to six genes in a system. This requires building only a single system-specific construct by placing a target sequence upstream of each gene and transforming it with the pre-built sRNA pool. The resulting library is screened and the top clone is sequenced to determine the promoter controlling each sRNA, from which the fold-repression of the genes can be inferred. The system is then rebuilt by rationally selecting parts that implement the optimal expression of each gene. We demonstrate the versatility of this approach by using the same pool to optimize a metabolic pathway (β-carotene) and genetic circuit (XNOR logic gate). © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  20. Minimal doses of a sequence-optimized transgene mediate high-level and long-term EPO expression in vivo: challenging CpG-free gene design.

    PubMed

    Kosovac, D; Wild, J; Ludwig, C; Meissner, S; Bauer, A P; Wagner, R

    2011-02-01

    Advanced gene delivery techniques can be combined with rational gene design to further improve the efficiency of plasmid DNA (pDNA)-mediated transgene expression in vivo. Herein, we analyzed the influence of intragenic sequence modifications on transgene expression in vitro and in vivo using murine erythropoietin (mEPO) as a transgene model. A single electro-gene transfer of an RNA- and codon-optimized mEPOopt gene into skeletal muscle resulted in a 3- to 4-fold increase of mEPO production sustained for >1 year and triggered a significant increase in hematocrit and hemoglobin without causing adverse effects. mEPO expression and hematologic levels were significantly lower when using comparable amounts of the wild type (mEPOwt) gene and only marginal effects were induced by mEPOΔCpG lacking intragenic CpG dinucleotides, even at high pDNA amounts. Corresponding with these observations, in vitro analysis of transfected cells revealed a 2- to 3-fold increased (mEPOopt) and 50% decreased (mEPOΔCpG) erythropoietin expression compared with mEPOwt, respectively. RNA analyses demonstrated that the specific design of the transgene sequence influenced expression levels by modulating transcriptional activity and nuclear plus cytoplasmic RNA amounts rather than translation. In sum, whereas CpG depletion negatively interferes with efficient expression in postmitotic tissues, mEPOopt doses <0.5 μg were sufficient to trigger optimal long-term hematologic effects encouraging the use of sequence-optimized transgenes to further reduce effective pDNA amounts.

  1. An enhancement of binary particle swarm optimization for gene selection in classifying cancer classes

    PubMed Central

    2013-01-01

    Background Gene expression data could likely be a momentous help in the progress of proficient cancer diagnoses and classification platforms. Lately, many researchers analyze gene expression data using diverse computational intelligence methods, for selecting a small subset of informative genes from the data for cancer classification. Many computational methods face difficulties in selecting small subsets due to the small number of samples compared to the huge number of genes (high-dimension), irrelevant genes, and noisy genes. Methods We propose an enhanced binary particle swarm optimization to perform the selection of small subsets of informative genes which is significant for cancer classification. Particle speed, rule, and modified sigmoid function are introduced in this proposed method to increase the probability of the bits in a particle’s position to be zero. The method was empirically applied to a suite of ten well-known benchmark gene expression data sets. Results The performance of the proposed method proved to be superior to other previous related works, including the conventional version of binary particle swarm optimization (BPSO) in terms of classification accuracy and the number of selected genes. The proposed method also requires lower computational time compared to BPSO. PMID:23617960

  2. Selection of reference genes for gene expression studies related to intramuscular fat deposition in Capra hircus skeletal muscle.

    PubMed

    Zhu, Wuzheng; Lin, Yaqiu; Liao, Honghai; Wang, Yong

    2015-01-01

    The identification of suitable reference genes is critical for obtaining reliable results from gene expression studies using quantitative real-time PCR (qPCR) because the expression of reference genes may vary considerably under different experimental conditions. In most cases, however, commonly used reference genes are employed in data normalization without proper validation, which may lead to incorrect data interpretation. Here, we aim to select a set of optimal reference genes for the accurate normalization of gene expression associated with intramuscular fat (IMF) deposition during development. In the present study, eight reference genes (PPIB, HMBS, RPLP0, B2M, YWHAZ, 18S, GAPDH and ACTB) were evaluated by three different algorithms (geNorm, NormFinder and BestKeeper) in two types of muscle tissues (longissimus dorsi muscle and biceps femoris muscle) across different developmental stages. All three algorithms gave similar results. PPIB and HMBS were identified as the most stable reference genes, while the commonly used reference genes 18S and GAPDH were the most variably expressed, with expression varying dramatically across different developmental stages. Furthermore, to reveal the crucial role of appropriate reference genes in obtaining a reliable result, analysis of PPARG expression was performed by normalization to the most and the least stable reference genes. The relative expression levels of PPARG normalized to the most stable reference genes greatly differed from those normalized to the least stable one. Therefore, evaluation of reference genes must be performed for a given experimental condition before the reference genes are used. PPIB and HMBS are the optimal reference genes for analysis of gene expression associated with IMF deposition in skeletal muscle during development.

  3. Expression of the Arginine Deiminase Pathway Genes in Lactobacillus sakei Is Strain Dependent and Is Affected by the Environmental pH

    PubMed Central

    Rimaux, T.; Rivière, A.; Illeghems, K.; Weckx, S.; De Vuyst, L.

    2012-01-01

    The adaptation of Lactobacillus sakei to a meat environment is reflected in its metabolic potential. For instance, the ability to utilize arginine through the arginine deiminase (ADI) pathway, resulting in additional ATP, represents a competitive benefit. In L. sakei CTC 494, the arc operon (arcABCTDR) shows the same gene order and organization as that in L. sakei 23K, the genome sequence of which is known. However, differences in relative gene expression were found, and these seemed to be optimal in different growth phases, namely, the highest relative gene expression level was in the end exponential growth phase in the case of L. sakei CTC 494 and in the mid-exponential growth phase of L. sakei 23K. Also, the environmental pH influenced the relative expression level of the arc operon, as shown for L. sakei CTC 494, with the highest relative expression level occurring at the optimal pH for growth (pH 6.0). Deviations from this optimal pH (pH 5.0 and pH 7.0) resulted in an overall decline of the relative expression level of all genes of the arc operon. Furthermore, a differential relative expression of the individual genes of the arc operon was found, with the highest relative gene expression occurring for the first two genes of the arc operon (arcA and arcB). Finally, it was shown that some L. sakei strains were able to convert agmatine into putrescine, suggesting an operational agmatine deiminase pathway in these strains, a metabolic trait that is undesirable in meat fermentations. This study shows that this metabolic trait is most probably encoded by a previously erroneously annotated second putative arc operon. PMID:22544250

  4. Identification of two integration sites in favor of transgene expression in Trichoderma reesei.

    PubMed

    Qin, Lina; Jiang, Xianzhang; Dong, Zhiyang; Huang, Jianzhong; Chen, Xiuzhen

    2018-01-01

    The ascomycete fungus Trichoderma reesei was widely used as a biotechnological workhorse for production of cellulases and recombinant proteins due to its large capacity of protein secretion. Transgenesis by random integration of a gene of interest (GOI) into the genome of T. reesei can generate series of strains that express different levels of the indicated transgene. The insertion site of the GOI plays an important role in the ultimate production of the targeted proteins. However, so far no systematic studies have been made to identify transgene integration loci for optimal expression of the GOI in T. reesei . Currently, only the locus of exocellobiohydrolases I encoding gene ( cbh1) is widely used as a promising integration site to lead to high expression level of the GOI. No additional sites associated with efficient gene expression have been characterized. To search for gene integration sites that benefit for the secreted expression of GOI, the food-and-mouth disease virus 2A protein was applied for co-expression of an Aspergillus niger lipA gene and Discosoma sp. DsRed1 gene in T. reesei, by random integration of the expression cassette into the genome. We demonstrated that the fluorescent intensity of RFP (red fluorescent protein) inside of the cell was well correlated with the secreted lipase yields, based on which, we successfully developed a high-throughput screening method to screen strains with relatively higher secreted expression of the GOI (in this study, lipase). The copy number and the insertion sites of the transgene were investigated among the selected highly expressed strains. Eventually, in addition to cbh1 gene locus, two other genome insertion loci that efficiently facilitate gene expression in T. reesei were identified. We have successfully developed a high-throughput screening method to screen strains with optimal expression of the indicated secreted proteins in T. reesei . Moreover, we identified two optimal genome loci for transgene expression, which could provide new approach to modulate gene expression levels while retaining the indicated promoter and culture conditions.

  5. Optimal Reference Gene Selection for Expression Studies in Human Reticulocytes.

    PubMed

    Aggarwal, Anu; Jamwal, Manu; Viswanathan, Ganesh K; Sharma, Prashant; Sachdeva, ManUpdesh S; Bansal, Deepak; Malhotra, Pankaj; Das, Reena

    2018-05-01

    Reference genes are indispensable for normalizing mRNA levels across samples in real-time quantitative PCR. Their expression levels vary under different experimental conditions and because of several inherent characteristics. Appropriate reference gene selection is thus critical for gene-expression studies. This study aimed at selecting optimal reference genes for gene-expression analysis of reticulocytes and at validating them in hereditary spherocytosis (HS) and β-thalassemia intermedia (βTI) patients. Seven reference genes (PGK1, MPP1, HPRT1, ACTB, GAPDH, RN18S1, and SDHA) were selected because of published reports. Real-time quantitative PCR was performed on reticulocytes in 20 healthy volunteers, 15 HS patients, and 10 βTI patients. Threshold cycle values were compared with fold-change method and RefFinder software. The stable reference genes recommended by RefFinder were validated with SLC4A1 and flow cytometric eosin-5'-maleimide binding assay values in HS patients and HBG2 and high performance liquid chromatography-derived percentage of hemoglobin F in βTI. Comprehensive ranking predicted MPP1 and GAPDH as optimal reference genes for reticulocytes that were not affected in HS and βTI. This was further confirmed on validation with eosin-5'-maleimide results and percentage of hemoglobin F in HS and βTI patients, respectively. Hence, MPP1 and GAPDH are good reference genes for reticulocyte expression studies compared with ACTB and RN18S1, the two most commonly used reference genes. Copyright © 2018 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

  6. Expression of chicken parvovirus VP2 in chicken embryo fibroblasts requires codon optimization for production of naked DNA and vectored meleagrid herpesvirus type 1 vaccines.

    PubMed

    Spatz, Stephen J; Volkening, Jeremy D; Mullis, Robert; Li, Fenglan; Mercado, John; Zsak, Laszlo

    2013-10-01

    Meleagrid herpesvirus type 1 (MeHV-1) is an ideal vector for the expression of antigens from pathogenic avian organisms in order to generate vaccines. Chicken parvovirus (ChPV) is a widespread infectious virus that causes serious disease in chickens. It is one of the etiological agents largely suspected in causing Runting Stunting Syndrome (RSS) in chickens. Initial attempts to express the wild-type gene encoding the capsid protein VP2 of ChPV by insertion into the thymidine kinase gene of MeHV-1 were unsuccessful. However, transient expression of a codon-optimized synthetic VP2 gene cloned into the bicistronic vector pIRES2-Ds-Red2, could be demonstrated by immunocytochemical staining of transfected chicken embryo fibroblasts (CEFs). Red fluorescence could also be detected in these transfected cells since the red fluorescent protein gene is downstream from the internal ribosome entry site (IRES). Strikingly, fluorescence could not be demonstrated in cells transiently transfected with the bicistronic vector containing the wild-type or non-codon-optimized VP2 gene. Immunocytochemical staining of these cells also failed to demonstrate expression of wild-type VP2, indicating that the lack of expression was at the RNA level and the VP2 protein was not toxic to CEFs. Chickens vaccinated with a DNA vaccine consisting of the bicistronic vector containing the codon-optimized VP2 elicited a humoral immune response as measured by a VP2-specific ELISA. This VP2 codon-optimized bicistronic cassette was rescued into the MeHV-1 genome generating a vectored vaccine against ChPV disease.

  7. Cardiac Gene Therapy: Optimization of Gene Delivery Techniques In Vivo

    PubMed Central

    Katz, Michael G.; Swain, JaBaris D.; White, Jennifer D.; Low, David; Stedman, Hansell

    2010-01-01

    Abstract Vector-mediated cardiac gene therapy holds tremendous promise as a translatable platform technology for treating many cardiovascular diseases. The ideal technique is one that is efficient and practical, allowing for global cardiac gene expression, while minimizing collateral expression in other organs. Here we survey the available in vivo vector-mediated cardiac gene delivery methods—including transcutaneous, intravascular, intramuscular, and cardiopulmonary bypass techniques—with consideration of the relative merits and deficiencies of each. Review of available techniques suggests that an optimal method for vector-mediated gene delivery to the large animal myocardium would ideally employ retrograde and/or anterograde transcoronary gene delivery,extended vector residence time in the coronary circulation, an increased myocardial transcapillary gradient using physical methods, increased endothelial permeability with pharmacological agents, minimal collateral gene expression by isolation of the cardiac circulation from the systemic, and have low immunogenicity. PMID:19947886

  8. Putative carotenoid genes expressed under the regulation of Shine-Dalgarno regions in Escherichia coli for efficient lycopene production.

    PubMed

    Jin, Weiyue; Xu, Xian; Jiang, Ling; Zhang, Zhidong; Li, Shuang; Huang, He

    2015-11-01

    Putative genes crtE, crtB, and crtI from Deinococcus wulumiqiensis R12, a novel species, were identified by genome mining and were co-expressed using the optimized Shine-Dalgarno (SD) regions to improve lycopene yield. A lycopene biosynthesis pathway was constructed by co-expressing these three genes in Escherichia coli. After optimizing the upstream SD regions and the culture medium, the recombinant strain EDW11 produced 88 mg lycopene g(-1) dry cell wt (780 mg lycopene l(-1)) after 40 h fermentation without IPTG induction, while the strain EDW without optimized SD regions only produced 49 mg lycopene g(-1) dry cell wt (417 mg lycopene l(-1)). Based on the optimization of the upstream SD regions and culture medium, the yield of the strain EDW11 reached a high level during microbial lycopene production until now.

  9. New and improved tools and methods for enhanced biosynthesis of natural products in microorganisms.

    PubMed

    Wang, Zhiqing; Cirino, Patrick C

    2016-12-01

    Engineering efficient biosynthesis of natural products in microorganisms requires optimizing gene expression levels to balance metabolite flux distributions and to minimize accumulation of toxic intermediates. Such metabolic optimization is challenged with identifying the right gene targets, and then determining and achieving appropriate gene expression levels. After decades of having a relatively limited set of gene regulation tools available, metabolic engineers are recently enjoying an ever-growing repertoire of more precise and tunable gene expression platforms. Here we review recent applications of natural and designed transcriptional and translational regulatory machinery for engineering biosynthesis of natural products in microorganisms. Customized trans-acting RNAs (sgRNA, asRNA and sRNA), along with appropriate accessory proteins, are allowing for unparalleled tuning of gene expression. Meanwhile metabolite-responsive transcription factors and riboswitches have been implemented in strain screening and evolution, and in dynamic gene regulation. Further refinements and expansions on these platform technologies will circumvent many long-term obstacles in natural products biosynthesis. Copyright © 2016 Elsevier Ltd. All rights reserved.

  10. Promoter library-based module combination (PLMC) technology for optimization of threonine biosynthesis in Corynebacterium glutamicum.

    PubMed

    Wei, Liang; Xu, Ning; Wang, Yiran; Zhou, Wei; Han, Guoqiang; Ma, Yanhe; Liu, Jun

    2018-05-01

    Due to the lack of efficient control elements and tools, the fine-tuning of gene expression in the multi-gene metabolic pathways is still a great challenge for engineering microbial cell factories, especially for the important industrial microorganism Corynebacterium glutamicum. In this study, the promoter library-based module combination (PLMC) technology was developed to efficiently optimize the expression of genes in C. glutamicum. A random promoter library was designed to contain the putative - 10 (NNTANANT) and - 35 (NNGNCN) consensus motifs, and refined through a three-step screening procedure to achieve numerous genetic control elements with different strength levels, including fluorescence-activated cell sorting (FACS) screening, agar plate screening, and 96-well plate screening. Multiple conventional strategies were employed for further precise characterizations of the promoter library, such as real-time quantitative PCR, sodium dodecyl sulfate polyacrylamide gel electrophoresis, FACS analysis, and the lacZ reporter system. These results suggested that the established promoter elements effectively regulated gene expression and showed varying strengths over a wide range. Subsequently, a multi-module combination technology was created based on the efficient promoter elements for combination and optimization of modules in the multi-gene pathways. Using this technology, the threonine biosynthesis pathway was reconstructed and optimized by predictable tuning expression of five modules in C. glutamicum. The threonine titer of the optimized strain was significantly improved to 12.8 g/L, an approximate 6.1-fold higher than that of the control strain. Overall, the PLMC technology presented in this study provides a rapid and effective method for combination and optimization of multi-gene pathways in C. glutamicum.

  11. Expression and Activity Analysis of Fructosyltransferase from Aspergillus oryzae.

    PubMed

    Guan, Lihong; Chen, Liping; Chen, Yongsen; Zhang, Nu; Han, Yawei

    2017-08-01

    The fructosyltransferase gene was isolated and cloned from Aspergillus oryzae. The gene was 1368 bp, which encoded a protein of 455 amino acids. To analyze the activity of the expressed fructosyltransferase, the pET32a-fructosyltransferase recombined plasmid was transformed into Escherichia coli BL21. The fructosyltransferase gene was successfully expressed by Isopropyl-β-d-thiogalactoside (IPTG) induction. The molecular weight of the expression protein was about 45 kDa. The optimal conditions of protein expression were 25 °C, 0.1 mM IPTG, and 8 h of inducing time. The optimal concentration of urea dealing with inclusion body was 2.5 M. The expressed protein exhibited a strong fructosyl transfer activity. These results showed that the expressed fructosyltransferas owned transferase activity, and could catalyze the synthesis of sucrose-6-acetate.

  12. Optimization of cDNA microarrays procedures using criteria that do not rely on external standards.

    PubMed

    Bruland, Torunn; Anderssen, Endre; Doseth, Berit; Bergum, Hallgeir; Beisvag, Vidar; Laegreid, Astrid

    2007-10-18

    The measurement of gene expression using microarray technology is a complicated process in which a large number of factors can be varied. Due to the lack of standard calibration samples such as are used in traditional chemical analysis it may be a problem to evaluate whether changes done to the microarray procedure actually improve the identification of truly differentially expressed genes. The purpose of the present work is to report the optimization of several steps in the microarray process both in laboratory practices and in data processing using criteria that do not rely on external standards. We performed a cDNA microarry experiment including RNA from samples with high expected differential gene expression termed "high contrasts" (rat cell lines AR42J and NRK52E) compared to self-self hybridization, and optimized a pipeline to maximize the number of genes found to be differentially expressed in the "high contrasts" RNA samples by estimating the false discovery rate (FDR) using a null distribution obtained from the self-self experiment. The proposed high-contrast versus self-self method (HCSSM) requires only four microarrays per evaluation. The effects of blocking reagent dose, filtering, and background corrections methodologies were investigated. In our experiments a dose of 250 ng LNA (locked nucleic acid) dT blocker, no background correction and weight based filtering gave the largest number of differentially expressed genes. The choice of background correction method had a stronger impact on the estimated number of differentially expressed genes than the choice of filtering method. Cross platform microarray (Illumina) analysis was used to validate that the increase in the number of differentially expressed genes found by HCSSM was real. The results show that HCSSM can be a useful and simple approach to optimize microarray procedures without including external standards. Our optimizing method is highly applicable to both long oligo-probe microarrays which have become commonly used for well characterized organisms such as man, mouse and rat, as well as to cDNA microarrays which are still of importance for organisms with incomplete genome sequence information such as many bacteria, plants and fish.

  13. Optimization of cDNA microarrays procedures using criteria that do not rely on external standards

    PubMed Central

    Bruland, Torunn; Anderssen, Endre; Doseth, Berit; Bergum, Hallgeir; Beisvag, Vidar; Lægreid, Astrid

    2007-01-01

    Background The measurement of gene expression using microarray technology is a complicated process in which a large number of factors can be varied. Due to the lack of standard calibration samples such as are used in traditional chemical analysis it may be a problem to evaluate whether changes done to the microarray procedure actually improve the identification of truly differentially expressed genes. The purpose of the present work is to report the optimization of several steps in the microarray process both in laboratory practices and in data processing using criteria that do not rely on external standards. Results We performed a cDNA microarry experiment including RNA from samples with high expected differential gene expression termed "high contrasts" (rat cell lines AR42J and NRK52E) compared to self-self hybridization, and optimized a pipeline to maximize the number of genes found to be differentially expressed in the "high contrasts" RNA samples by estimating the false discovery rate (FDR) using a null distribution obtained from the self-self experiment. The proposed high-contrast versus self-self method (HCSSM) requires only four microarrays per evaluation. The effects of blocking reagent dose, filtering, and background corrections methodologies were investigated. In our experiments a dose of 250 ng LNA (locked nucleic acid) dT blocker, no background correction and weight based filtering gave the largest number of differentially expressed genes. The choice of background correction method had a stronger impact on the estimated number of differentially expressed genes than the choice of filtering method. Cross platform microarray (Illumina) analysis was used to validate that the increase in the number of differentially expressed genes found by HCSSM was real. Conclusion The results show that HCSSM can be a useful and simple approach to optimize microarray procedures without including external standards. Our optimizing method is highly applicable to both long oligo-probe microarrays which have become commonly used for well characterized organisms such as man, mouse and rat, as well as to cDNA microarrays which are still of importance for organisms with incomplete genome sequence information such as many bacteria, plants and fish. PMID:17949480

  14. Transient gene expression in epidermal cells of plant leaves by biolistic DNA delivery.

    PubMed

    Ueki, Shoko; Magori, Shimpei; Lacroix, Benoît; Citovsky, Vitaly

    2013-01-01

    Transient gene expression is a useful approach for studying the functions of gene products. In the case of plants, Agrobacterium infiltration is a method of choice for transient introduction of genes for many species. However, this technique does not work efficiently in some species, such as Arabidopsis thaliana. Moreover, the infection of Agrobacterium is known to induce dynamic changes in gene expression patterns in the host plants, possibly affecting the function and localization of the proteins to be tested. These problems can be circumvented by biolistic delivery of the genes of interest. Here, we present an optimized protocol for biolistic delivery of plasmid DNA into epidermal cells of plant leaves, which can be easily performed using the Bio-Rad Helios gene gun system. This protocol allows efficient and reproducible transient expression of diverse genes in Arabidopsis, Nicotiana benthamiana and N. tabacum, and is suitable for studies of the biological function and subcellular localization of the gene products directly in planta. The protocol also can be easily adapted to other species by optimizing the delivery gas pressure.

  15. Optimization of conditions for transient Agrobacterium-mediated gene expression assays in Arabidopsis.

    PubMed

    Kim, Mi Jung; Baek, Kon; Park, Chung-Mo

    2009-08-01

    Transient genetic transformation of plant organs is an indispensable way of studying gene function in plants. This study was aimed to develop an optimized system for transient Agrobacterium-mediated transformation of the Arabidopsis leaves. The beta-glucuronidase (GUS) reporter gene was employed to evaluate growth and biochemical parameters that influence the levels of transient expression. The effects of plant culture conditions, Agrobacterial genetic backgrounds, densities of Agrobacterial cell suspensions, and of several detergents were analyzed. We found that optimization of plant culture conditions is the most critical factor among the parameters analyzed. Higher levels of transient expression were observed in plants grown under short day conditions (SDs) than in plants grown under long day conditions (LDs). Furthermore, incubation of the plants under SDs at high relative humidity (85-90%) for 24 h after infiltration greatly improved the levels of transient expression. Under the optimized culture conditions, expression of the reporter gene reached the peak 3 days after infiltration and was rapidly decreased after the peak. Among the five Agrobacterial strains examined, LAB4404 produced the highest levels of expression. We also examined the effects of detergents, including Triton X-100, Tween-20, and Silwet L-77. Supplementation of the infiltration media either with 0.01% Triton X-100 or 0.01% Tween-20 improved the levels of expression by approximately 1.6-fold. Our observations indicate that transient transformation of the Arabidopsis leaves in the infiltration media supplemented with 0.01% Triton X-100 and incubation of the infiltrated plants under SDs at high relative humidity are necessary for maximal levels of expression.

  16. Non-Viral Transfection Methods Optimized for Gene Delivery to a Lung Cancer Cell Line

    PubMed Central

    Salimzadeh, Loghman; Jaberipour, Mansooreh; Hosseini, Ahmad; Ghaderi, Abbas

    2013-01-01

    Background Mehr-80 is a newly established adherent human large cell lung cancer cell line that has not been transfected until now. This study aims to define the optimal transfection conditions and effects of some critical elements for enhancing gene delivery to this cell line by utilizing different non-viral transfection Procedures. Methods In the current study, calcium phosphate (CaP), DEAE-dextran, superfect, electroporation and lipofection transfection methods were used to optimize delivery of a plasmid construct that expressed Green Fluorescent Protein (GFP). Transgene expression was detected by fluorescent microscopy and flowcytometry. Toxicities of the methods were estimated by trypan blue staining. In order to evaluate the density of the transfected gene, we used a plasmid construct that expressed the Stromal cell-Derived Factor-1 (SDF-1) gene and measured its expression by real-time PCR. Results Mean levels of GFP-expressing cells 48 hr after transfection were 8.4% (CaP), 8.2% (DEAE-dextran), 4.9% (superfect), 34.1% (electroporation), and 40.1% (lipofection). Lipofection had the highest intense SDF-1 expression of the analyzed methods. Conclusion This study has shown that the lipofection and electroporation methods were more efficient at gene delivery to Mehr-80 cells. The quantity of DNA per transfection, reagent concentration, and incubation time were identified as essential factors for successful transfection in all of the studied methods. PMID:23799175

  17. Highly efficient mesophyll protoplast isolation and PEG-mediated transient gene expression for rapid and large-scale gene characterization in cassava (Manihot esculenta Crantz).

    PubMed

    Wu, Jun-Zheng; Liu, Qin; Geng, Xiao-Shan; Li, Kai-Mian; Luo, Li-Juan; Liu, Jin-Ping

    2017-03-14

    Cassava (Manihot esculenta Crantz) is a major crop extensively cultivated in the tropics as both an important source of calories and a promising source for biofuel production. Although stable gene expression have been used for transgenic breeding and gene function study, a quick, easy and large-scale transformation platform has been in urgent need for gene functional characterization, especially after the cassava full genome was sequenced. Fully expanded leaves from in vitro plantlets of Manihot esculenta were used to optimize the concentrations of cellulase R-10 and macerozyme R-10 for obtaining protoplasts with the highest yield and viability. Then, the optimum conditions (PEG4000 concentration and transfection time) were determined for cassava protoplast transient gene expression. In addition, the reliability of the established protocol was confirmed for subcellular protein localization. In this work we optimized the main influencing factors and developed an efficient mesophyll protoplast isolation and PEG-mediated transient gene expression in cassava. The suitable enzyme digestion system was established with the combination of 1.6% cellulase R-10 and 0.8% macerozyme R-10 for 16 h of digestion in the dark at 25 °C, resulting in the high yield (4.4 × 10 7 protoplasts/g FW) and vitality (92.6%) of mesophyll protoplasts. The maximum transfection efficiency (70.8%) was obtained with the incubation of the protoplasts/vector DNA mixture with 25% PEG4000 for 10 min. We validated the applicability of the system for studying the subcellular localization of MeSTP7 (an H + /monosaccharide cotransporter) with our transient expression protocol and a heterologous Arabidopsis transient gene expression system. We optimized the main influencing factors and developed an efficient mesophyll protoplast isolation and transient gene expression in cassava, which will facilitate large-scale characterization of genes and pathways in cassava.

  18. Sequential Metabolic Phases as a Means to Optimize Cellular Output in a Constant Environment

    PubMed Central

    Bockmayr, Alexander; Holzhütter, Hermann-Georg

    2015-01-01

    Temporal changes of gene expression are a well-known regulatory feature of all cells, which is commonly perceived as a strategy to adapt the proteome to varying external conditions. However, temporal (rhythmic and non-rhythmic) changes of gene expression are also observed under virtually constant external conditions. Here we hypothesize that such changes are a means to render the synthesis of the metabolic output more efficient than under conditions of constant gene activities. In order to substantiate this hypothesis, we used a flux-balance model of the cellular metabolism. The total time span spent on the production of a given set of target metabolites was split into a series of shorter time intervals (metabolic phases) during which only selected groups of metabolic genes are active. The related flux distributions were calculated under the constraint that genes can be either active or inactive whereby the amount of protein related to an active gene is only controlled by the number of active genes: the lower the number of active genes the more protein can be allocated to the enzymes carrying non-zero fluxes. This concept of a predominantly protein-limited efficiency of gene expression clearly differs from other concepts resting on the assumption of an optimal gene regulation capable of allocating to all enzymes and transporters just that fraction of protein necessary to prevent rate limitation. Applying this concept to a simplified metabolic network of the central carbon metabolism with glucose or lactate as alternative substrates, we demonstrate that switching between optimally chosen stationary flux modes comprising different sets of active genes allows producing a demanded amount of target metabolites in a significantly shorter time than by a single optimal flux mode at fixed gene activities. Our model-based findings suggest that temporal expression of metabolic genes can be advantageous even under conditions of constant external substrate supply. PMID:25786979

  19. Optimal Scaling of Digital Transcriptomes

    PubMed Central

    Glusman, Gustavo; Caballero, Juan; Robinson, Max; Kutlu, Burak; Hood, Leroy

    2013-01-01

    Deep sequencing of transcriptomes has become an indispensable tool for biology, enabling expression levels for thousands of genes to be compared across multiple samples. Since transcript counts scale with sequencing depth, counts from different samples must be normalized to a common scale prior to comparison. We analyzed fifteen existing and novel algorithms for normalizing transcript counts, and evaluated the effectiveness of the resulting normalizations. For this purpose we defined two novel and mutually independent metrics: (1) the number of “uniform” genes (genes whose normalized expression levels have a sufficiently low coefficient of variation), and (2) low Spearman correlation between normalized expression profiles of gene pairs. We also define four novel algorithms, one of which explicitly maximizes the number of uniform genes, and compared the performance of all fifteen algorithms. The two most commonly used methods (scaling to a fixed total value, or equalizing the expression of certain ‘housekeeping’ genes) yielded particularly poor results, surpassed even by normalization based on randomly selected gene sets. Conversely, seven of the algorithms approached what appears to be optimal normalization. Three of these algorithms rely on the identification of “ubiquitous” genes: genes expressed in all the samples studied, but never at very high or very low levels. We demonstrate that these include a “core” of genes expressed in many tissues in a mutually consistent pattern, which is suitable for use as an internal normalization guide. The new methods yield robustly normalized expression values, which is a prerequisite for the identification of differentially expressed and tissue-specific genes as potential biomarkers. PMID:24223126

  20. Development of a Synthetic Oxytetracycline-Inducible Expression System for Streptomycetes Using de Novo Characterized Genetic Parts.

    PubMed

    Wang, Weishan; Yang, Tongjian; Li, Yihong; Li, Shanshan; Yin, Shouliang; Styles, Kathryn; Corre, Christophe; Yang, Keqian

    2016-07-15

    Precise control of gene expression using exogenous factors is of great significance. To develop ideal inducible expression systems for streptomycetes, new genetic parts, oxytetracycline responsive repressor OtrR, operator otrO, and promoter otrBp from Streptomyces rimosus, were selected de novo and characterized in vivo and in vitro. OtrR showed strong affinity to otrO (KD = 1.7 × 10(-10) M) and oxytetracycline induced dissociation of the OtrR/DNA complex in a concentration-dependent manner. On the basis of these genetic parts, a synthetic inducible expression system Potr* was optimized. Induction of Potr* with 0.01-4 μM of oxytetracycline triggered a wide-range expression level of gfp reporter gene in different Streptomyces species. Benchmarking Potr* against the widely used constitutive promoters ermE* and kasOp* revealed greatly enhanced levels of expression when Potr* was fully induced. Finally, Potr* was used as a tool to activate and optimize the expression of the silent jadomycin biosynthetic gene cluster in Streptomyces venezuelae. Altogether, the synthetic Potr* presents a new versatile tool for fine-tuning gene expression in streptomycetes.

  1. Optimizing information flow in small genetic networks. IV. Spatial coupling

    NASA Astrophysics Data System (ADS)

    Sokolowski, Thomas R.; Tkačik, Gašper

    2015-06-01

    We typically think of cells as responding to external signals independently by regulating their gene expression levels, yet they often locally exchange information and coordinate. Can such spatial coupling be of benefit for conveying signals subject to gene regulatory noise? Here we extend our information-theoretic framework for gene regulation to spatially extended systems. As an example, we consider a lattice of nuclei responding to a concentration field of a transcriptional regulator (the input) by expressing a single diffusible target gene. When input concentrations are low, diffusive coupling markedly improves information transmission; optimal gene activation functions also systematically change. A qualitatively different regulatory strategy emerges where individual cells respond to the input in a nearly steplike fashion that is subsequently averaged out by strong diffusion. While motivated by early patterning events in the Drosophila embryo, our framework is generically applicable to spatially coupled stochastic gene expression models.

  2. A Novel Method to Predict Highly Expressed Genes Based on Radius Clustering and Relative Synonymous Codon Usage.

    PubMed

    Tran, Tuan-Anh; Vo, Nam Tri; Nguyen, Hoang Duc; Pham, Bao The

    2015-12-01

    Recombinant proteins play an important role in many aspects of life and have generated a huge income, notably in the industrial enzyme business. A gene is introduced into a vector and expressed in a host organism-for example, E. coli-to obtain a high productivity of target protein. However, transferred genes from particular organisms are not usually compatible with the host's expression system because of various reasons, for example, codon usage bias, GC content, repetitive sequences, and secondary structure. The solution is developing programs to optimize for designing a nucleotide sequence whose origin is from peptide sequences using properties of highly expressed genes (HEGs) of the host organism. Existing data of HEGs determined by practical and computer-based methods do not satisfy for qualifying and quantifying. Therefore, the demand for developing a new HEG prediction method is critical. We proposed a new method for predicting HEGs and criteria to evaluate gene optimization. Codon usage bias was weighted by amplifying the difference between HEGs and non-highly expressed genes (non-HEGs). The number of predicted HEGs is 5% of the genome. In comparison with Puigbò's method, the result is twice as good as Puigbò's one, in kernel ratio and kernel sensitivity. Concerning transcription/translation factor proteins (TF), the proposed method gives low TF sensitivity, while Puigbò's method gives moderate one. In summary, the results indicated that the proposed method can be a good optional applying method to predict optimized genes for particular organisms, and we generated an HEG database for further researches in gene design.

  3. Cloning and expression of codon-optimized recombinant darbepoetin alfa in Leishmania tarentolae T7-TR.

    PubMed

    Kianmehr, Anvarsadat; Golavar, Raziyeh; Rouintan, Mandana; Mahrooz, Abdolkarim; Fard-Esfahani, Pezhman; Oladnabi, Morteza; Khajeniazi, Safoura; Mostafavi, Seyede Samaneh; Omidinia, Eskandar

    2016-02-01

    Darbepoetin alfa is an engineered and hyperglycosylated analog of recombinant human erythropoietin (EPO) which is used as a drug in treating anemia in patients with chronic kidney failure and cancer. This study desribes the secretory expression of a codon-optimized recombinant form of darbepoetin alfa in Leishmania tarentolae T7-TR. Synthetic codon-optimized gene was amplified by PCR and cloned into the pLEXSY-I-blecherry3 vector. The resultant expression vector, pLEXSYDarbo, was purified, digested, and electroporated into the L. tarentolae. Expression of recombinant darbepoetin alfa was evaluated by ELISA, reverse-transcription PCR (RT-PCR), Western blotting, and biological activity. After codon optimization, codon adaptation index (CAI) of the gene raised from 0.50 to 0.99 and its GC% content changed from 56% to 58%. Expression analysis confirmed the presence of a protein band at 40 kDa. Furthermore, reticulocyte experiment results revealed that the activity of expressed darbepoetin alfa was similar to that of its equivalent expressed in Chinese hamster ovary (CHO) cells. These data suggested that the codon optimization and expression in L. tarentolae host provided an efficient approach for high level expression of darbepoetin alfa. Copyright © 2015 Elsevier Inc. All rights reserved.

  4. Evaluation and Selection of Appropriate Reference Genes for Real-Time Quantitative PCR Analysis of Gene Expression in Nile Tilapia (Oreochromis niloticus) during Vaccination and Infection

    PubMed Central

    Wang, Erlong; Wang, Kaiyu; Chen, Defang; Wang, Jun; He, Yang; Long, Bo; Yang, Lei; Yang, Qian; Geng, Yi; Huang, Xiaoli; Ouyang, Ping; Lai, Weimin

    2015-01-01

    qPCR as a powerful and attractive methodology has been widely applied to aquaculture researches for gene expression analyses. However, the suitable reference selection is critical for normalizing target genes expression in qPCR. In the present study, six commonly used endogenous controls were selected as candidate reference genes to evaluate and analyze their expression levels, stabilities and normalization to immune-related gene IgM expression during vaccination and infection in spleen of tilapia with RefFinder and GeNorm programs. The results showed that all of these candidate reference genes exhibited transcriptional variations to some extent at different periods. Among them, EF1A was the most stable reference with RefFinder, followed by 18S rRNA, ACTB, UBCE, TUBA and GAPDH respectively and the optimal number of reference genes for IgM normalization under different experiment sets was two with GeNorm. Meanwhile, combination the Cq (quantification cycle) value and the recommended comprehensive ranking of reference genes, EF1A and ACTB, the two optimal reference genes, were used together as reference genes for accurate analysis of immune-related gene expression during vaccination and infection in Nile tilapia with qPCR. Moreover, the highest IgM expression level was at two weeks post-vaccination when normalized to EF1A, 18S rRNA, ACTB, and EF1A together with ACTB compared to one week post-vaccination before normalizing, which was also consistent with the IgM antibody titers detection by ELISA. PMID:25941937

  5. An Optimal Mean Based Block Robust Feature Extraction Method to Identify Colorectal Cancer Genes with Integrated Data.

    PubMed

    Liu, Jian; Cheng, Yuhu; Wang, Xuesong; Zhang, Lin; Liu, Hui

    2017-08-17

    It is urgent to diagnose colorectal cancer in the early stage. Some feature genes which are important to colorectal cancer development have been identified. However, for the early stage of colorectal cancer, less is known about the identity of specific cancer genes that are associated with advanced clinical stage. In this paper, we conducted a feature extraction method named Optimal Mean based Block Robust Feature Extraction method (OMBRFE) to identify feature genes associated with advanced colorectal cancer in clinical stage by using the integrated colorectal cancer data. Firstly, based on the optimal mean and L 2,1 -norm, a novel feature extraction method called Optimal Mean based Robust Feature Extraction method (OMRFE) is proposed to identify feature genes. Then the OMBRFE method which introduces the block ideology into OMRFE method is put forward to process the colorectal cancer integrated data which includes multiple genomic data: copy number alterations, somatic mutations, methylation expression alteration, as well as gene expression changes. Experimental results demonstrate that the OMBRFE is more effective than previous methods in identifying the feature genes. Moreover, genes identified by OMBRFE are verified to be closely associated with advanced colorectal cancer in clinical stage.

  6. Genes under weaker stabilizing selection increase network evolvability and rapid regulatory adaptation to an environmental shift.

    PubMed

    Laarits, T; Bordalo, P; Lemos, B

    2016-08-01

    Regulatory networks play a central role in the modulation of gene expression, the control of cellular differentiation, and the emergence of complex phenotypes. Regulatory networks could constrain or facilitate evolutionary adaptation in gene expression levels. Here, we model the adaptation of regulatory networks and gene expression levels to a shift in the environment that alters the optimal expression level of a single gene. Our analyses show signatures of natural selection on regulatory networks that both constrain and facilitate rapid evolution of gene expression level towards new optima. The analyses are interpreted from the standpoint of neutral expectations and illustrate the challenge to making inferences about network adaptation. Furthermore, we examine the consequence of variable stabilizing selection across genes on the strength and direction of interactions in regulatory networks and in their subsequent adaptation. We observe that directional selection on a highly constrained gene previously under strong stabilizing selection was more efficient when the gene was embedded within a network of partners under relaxed stabilizing selection pressure. The observation leads to the expectation that evolutionarily resilient regulatory networks will contain optimal ratios of genes whose expression is under weak and strong stabilizing selection. Altogether, our results suggest that the variable strengths of stabilizing selection across genes within regulatory networks might itself contribute to the long-term adaptation of complex phenotypes. © 2016 European Society For Evolutionary Biology. Journal of Evolutionary Biology © 2016 European Society For Evolutionary Biology.

  7. Maximizing RNA yield from archival renal tumors and optimizing gene expression analysis.

    PubMed

    Glenn, Sean T; Head, Karen L; Teh, Bin T; Gross, Kenneth W; Kim, Hyung L

    2010-01-01

    Formalin-fixed, paraffin-embedded tissues are widely available for gene expression analysis using TaqMan PCR. Five methods, including 4 commercial kits, for recovering RNA from paraffin-embedded renal tumor tissue were compared. The MasterPure kit from Epicentre produced the highest RNA yield. However, the difference in RNA yield between the kit from Epicenter and Invitrogen's TRIzol method was not significant. Using the top 3 RNA isolation methods, the manufacturers' protocols were modified to include an overnight Proteinase K digestion. Overnight protein digestion resulted in a significant increase in RNA yield. To optimize the reverse transcription reaction, conventional reverse transcription with random oligonucleotide primers was compared to reverse transcription using primers specific for genes of interest. Reverse transcription using gene-specific primers significantly increased the quantity of cDNA detectable by TaqMan PCR. Therefore, expression profiling of formalin-fixed, paraffin-embedded tissue using TaqMan qPCR can be optimized by using the MasterPure RNA isolation kit modified to include an overnight Proteinase K digestion and gene-specific primers during the reverse transcription.

  8. Codon Optimization to Enhance Expression Yields Insights into Chloroplast Translation1[OPEN

    PubMed Central

    Chan, Hui-Ting; Williams-Carrier, Rosalind; Barkan, Alice

    2016-01-01

    Codon optimization based on psbA genes from 133 plant species eliminated 105 (human clotting factor VIII heavy chain [FVIII HC]) and 59 (polio VIRAL CAPSID PROTEIN1 [VP1]) rare codons; replacement with only the most highly preferred codons decreased transgene expression (77- to 111-fold) when compared with the codon usage hierarchy of the psbA genes. Targeted proteomic quantification by parallel reaction monitoring analysis showed 4.9- to 7.1-fold or 22.5- to 28.1-fold increase in FVIII or VP1 codon-optimized genes when normalized with stable isotope-labeled standard peptides (or housekeeping protein peptides), but quantitation using western blots showed 6.3- to 8-fold or 91- to 125-fold increase of transgene expression from the same batch of materials, due to limitations in quantitative protein transfer, denaturation, solubility, or stability. Parallel reaction monitoring, to our knowledge validated here for the first time for in planta quantitation of biopharmaceuticals, is especially useful for insoluble or multimeric proteins required for oral drug delivery. Northern blots confirmed that the increase of codon-optimized protein synthesis is at the translational level rather than any impact on transcript abundance. Ribosome footprints did not increase proportionately with VP1 translation or even decreased after FVIII codon optimization but is useful in diagnosing additional rate-limiting steps. A major ribosome pause at CTC leucine codons in the native gene of FVIII HC was eliminated upon codon optimization. Ribosome stalls observed at clusters of serine codons in the codon-optimized VP1 gene provide an opportunity for further optimization. In addition to increasing our understanding of chloroplast translation, these new tools should help to advance this concept toward human clinical studies. PMID:27465114

  9. An effective fuzzy kernel clustering analysis approach for gene expression data.

    PubMed

    Sun, Lin; Xu, Jiucheng; Yin, Jiaojiao

    2015-01-01

    Fuzzy clustering is an important tool for analyzing microarray data. A major problem in applying fuzzy clustering method to microarray gene expression data is the choice of parameters with cluster number and centers. This paper proposes a new approach to fuzzy kernel clustering analysis (FKCA) that identifies desired cluster number and obtains more steady results for gene expression data. First of all, to optimize characteristic differences and estimate optimal cluster number, Gaussian kernel function is introduced to improve spectrum analysis method (SAM). By combining subtractive clustering with max-min distance mean, maximum distance method (MDM) is proposed to determine cluster centers. Then, the corresponding steps of improved SAM (ISAM) and MDM are given respectively, whose superiority and stability are illustrated through performing experimental comparisons on gene expression data. Finally, by introducing ISAM and MDM into FKCA, an effective improved FKCA algorithm is proposed. Experimental results from public gene expression data and UCI database show that the proposed algorithms are feasible for cluster analysis, and the clustering accuracy is higher than the other related clustering algorithms.

  10. Gene Architectures that Minimize Cost of Gene Expression.

    PubMed

    Frumkin, Idan; Schirman, Dvir; Rotman, Aviv; Li, Fangfei; Zahavi, Liron; Mordret, Ernest; Asraf, Omer; Wu, Song; Levy, Sasha F; Pilpel, Yitzhak

    2017-01-05

    Gene expression burdens cells by consuming resources and energy. While numerous studies have investigated regulation of expression level, little is known about gene design elements that govern expression costs. Here, we ask how cells minimize production costs while maintaining a given protein expression level and whether there are gene architectures that optimize this process. We measured fitness of ∼14,000 E. coli strains, each expressing a reporter gene with a unique 5' architecture. By comparing cost-effective and ineffective architectures, we found that cost per protein molecule could be minimized by lowering transcription levels, regulating translation speeds, and utilizing amino acids that are cheap to synthesize and that are less hydrophobic. We then examined natural E. coli genes and found that highly expressed genes have evolved more forcefully to minimize costs associated with their expression. Our study thus elucidates gene design elements that improve the economy of protein expression in natural and heterologous systems. Copyright © 2017 Elsevier Inc. All rights reserved.

  11. Expression of a codon-optimized Aspergillus niger pectin methylesterase gene in the methylotrophic yeast Candida boidinii.

    PubMed

    Kawaguchi, Kosuke; Yurimoto, Hiroya; Sakai, Yasuyoshi

    2014-01-01

    A codon-optimized Aspergillus niger pectin methylesterase (PME) gene was expressed in the methylotrophic yeast Canidia boidinii. The PME-producing strains showed better growth on pectin than the wild-type strains, suggesting that the PME-producing strains could efficiently utilize methyl ester moieties of pectin. On the other hand, overproduction of PME negatively affected the proliferation of C. boidinii on leaves of Arabidopsis thaliana.

  12. High-level expression of the Penicillium notatum glucose oxidase gene in Pichia pastoris using codon optimization.

    PubMed

    Gao, Zhaowei; Li, Zhuofu; Zhang, Yuhong; Huang, Huoqing; Li, Mu; Zhou, Liwei; Tang, Yunming; Yao, Bin; Zhang, Wei

    2012-03-01

    The glucose oxidase (GOD) gene from Penicillium notatum was expressed in Pichia pastoris. The 1,815 bp gene, god-w, encodes 604 amino acids. Recombinant GOD-w had optimal activity at 35-40°C and pH 6.2 and was stable, from pH 3 to 7 maintaining >75% maximum activity after incubation at 50°C for 1 h. GOD-w worked as well as commercial GODs to improve bread making. To achieve high-level expression of recombinant GOD in P. pastoris, 272 nucleotides involving 228 residues were mutated, consistent with the codon bias of P. pastoris. The optimized recombinant GOD-m yielded 615 U ml(-1) (2.5 g protein l(-1)) in a 3 l fermentor--410% higher than GOD-w (148 U ml(-1)), and thus is a low-cost alternative for the bread baking industry.

  13. Optimizing antibody expression: The nuts and bolts.

    PubMed

    Ayyar, B Vijayalakshmi; Arora, Sushrut; Ravi, Shiva Shankar

    2017-03-01

    Antibodies are extensively utilized entities in biomedical research, and in the development of diagnostics and therapeutics. Many of these applications require high amounts of antibodies. However, meeting this ever-increasing demand of antibodies in the global market is one of the outstanding challenges. The need to maintain a balance between demand and supply of antibodies has led the researchers to discover better means and methods for optimizing their expression. These strategies aim to increase the volumetric productivity of the antibodies along with the reduction of associated manufacturing costs. Recent years have witnessed major advances in recombinant protein technology, owing to the introduction of novel cloning strategies, gene manipulation techniques, and an array of cell and vector engineering techniques, together with the progress in fermentation technologies. These innovations were also highly beneficial for antibody expression. Antibody expression depends upon the complex interplay of multiple factors that may require fine tuning at diverse levels to achieve maximum yields. However, each antibody is unique and requires individual consideration and customization for optimizing the associated expression parameters. This review provides a comprehensive overview of several state-of-the-art approaches, such as host selection, strain engineering, codon optimization, gene optimization, vector modification and process optimization that are deemed suitable for enhancing antibody expression. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. Production of human interferon alfa 2b in plants of Nicotiana excelsior by Agrobacterium-mediated transient expression.

    PubMed

    Sindarovska, Y R; Gerasymenko, I M; Sheludko, Y V; Olevinskaya, Z M; Spivak, N Y; Kuchuk, N V

    2010-01-01

    Human interferon alpha2b gene was transiently expressed in Nicotiana excelsior plants. Fusion with N. plumbaginifolia calreticulin signal peptide for improved apoplast targeting and carrying out the expression under optimized conditions resulted in maximal interferon activity of 3.2 x 10(3) IU/g fresh weight (FW) with an average of 2.1 +/- 0.8 x 10(3) IU/g FW. It proves that N. excelsior is a suitable host for Agrobacterium-mediated transient expression of genes encoding physiologically active human proteins. The transient expression conditions optimized for GFP marker protein were confirmed to be preferable for hIFN alpha2b.

  15. Transcriptome-wide identification of reference genes for expression analysis of soybean responses to drought stress along the day

    USDA-ARS?s Scientific Manuscript database

    The soybean transcriptome displays strong variation along the day in optimal growth conditions and also in response to adverse circumstances, like drought stress. However, no study conducted to date has presented suitable reference genes, with stable expression along the day, for relative gene expre...

  16. Tailor-made fibroblast-specific and antibiotic-free interleukin 12 plasmid for gene electrotransfer-mediated cancer immunotherapy.

    PubMed

    Kamensek, Urska; Tesic, Natasa; Sersa, Gregor; Kos, Spela; Cemazar, Maja

    2017-01-01

    Electrotransfer mediated delivery of interleukin-12 (IL-12) gene, encoded on a plasmid vector, has already been demonstrated to have a potent antitumor efficacy and great potential for clinical application. In the present study, our aim was to construct an optimized IL-12-encoding plasmid that is safe from the regulatory point of view. In light of previous studies demonstrating that IL-12 should be released in a tumor localized manner for optimal efficacy, the strong ubiquitous promoter was replaced with a weak endogenous promoter of the collagen 2 gene, which is specific for fibroblasts. Next, to comply with increasing regulatory demands for clinically used plasmids, the expression cassette was cloned in a plasmid lacking the antibiotic resistance gene. The constructed fibroblast-specific and antibiotic-free IL-12 plasmid was demonstrated to support low IL-12 expression after gene electrotransfer in selected cell lines. Furthermore, the removal of antibiotic resistance did not affect the plasmid expression profile and lowered its cytotoxicity. With optimal IL-12 expression and minimal transgene non-specific effects, i.e., low cytotoxicity, the constructed plasmid could be especially valuable for different modern immunological approaches to achieve localized boosting of the host's immune system. Copyright © 2016 Elsevier Inc. All rights reserved.

  17. The tunable pReX expression vector enables optimizing the T7-based production of membrane and secretory proteins in E. coli.

    PubMed

    Kuipers, Grietje; Karyolaimos, Alexandros; Zhang, Zhe; Ismail, Nurzian; Trinco, Gianluca; Vikström, David; Slotboom, Dirk Jan; de Gier, Jan-Willem

    2017-12-16

    To optimize the production of membrane and secretory proteins in Escherichia coli, it is critical to harmonize the expression rates of the genes encoding these proteins with the capacity of their biogenesis machineries. Therefore, we engineered the Lemo21(DE3) strain, which is derived from the T7 RNA polymerase-based BL21(DE3) protein production strain. In Lemo21(DE3), the T7 RNA polymerase activity can be modulated by the controlled co-production of its natural inhibitor T7 lysozyme. This setup enables to precisely tune target gene expression rates in Lemo21(DE3). The t7lys gene is expressed from the pLemo plasmid using the titratable rhamnose promoter. A disadvantage of the Lemo21(DE3) setup is that the system is based on two plasmids, a T7 expression vector and pLemo. The aim of this study was to simplify the Lemo21(DE3) setup by incorporating the key elements of pLemo in a standard T7-based expression vector. By incorporating the gene encoding the T7 lysozyme under control of the rhamnose promoter in a standard T7-based expression vector, pReX was created (ReX stands for Regulated gene eXpression). For two model membrane proteins and a model secretory protein we show that the optimized production yields obtained with the pReX expression vector in BL21(DE3) are similar to the ones obtained with Lemo21(DE3) using a standard T7 expression vector. For another secretory protein, a c-type cytochrome, we show that pReX, in contrast to Lemo21(DE3), enables the use of a helper plasmid that is required for the maturation and hence the production of this heme c protein. Here, we created pReX, a T7-based expression vector that contains the gene encoding the T7 lysozyme under control of the rhamnose promoter. pReX enables regulated T7-based target gene expression using only one plasmid. We show that with pReX the production of membrane and secretory proteins can be readily optimized. Importantly, pReX facilitates the use of helper plasmids. Furthermore, the use of pReX is not restricted to BL21(DE3), but it can in principle be used in any T7 RNAP-based strain. Thus, pReX is a versatile alternative to Lemo21(DE3).

  18. Puromycin and Methotrexate Resistance Cassettes and Optimized cre-recombinase Expression Plasmids for use in Yeast

    PubMed Central

    MacDonald, Chris; Piper, Robert C.

    2015-01-01

    Here we expand the set of tools for genetically manipulating Saccharomyces cerevisiae. We show that puromycin-resistance can be achieved in yeast through expression of a bacterial puromycin-resistance gene optimized to the yeast codon bias, which in turn serves as an easy to use dominant genetic marker suitable for gene disruption. We have constructed a similar DNA cassette expressing yeast codon-optimized mutant human dihydrofolate reductase (DHFR) that confers resistance to methotrexate and can also be used as a dominant selectable marker. Both of these drug-resistant marker cassettes are flanked by loxP sites allowing for their excision from the genome following expression of cre-recombinase. Finally, we have created a series of plasmids for low-level constitutive expression of cre-recombinase in yeast that allows for efficient excision of loxP-flanked markers. PMID:25688547

  19. Exploring valid reference genes for quantitative real-time PCR analysis in Sesamia inferens (Lepidoptera: Noctuidae).

    PubMed

    Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou

    2015-01-01

    The pink stem borer, Sesamia inferens, which is endemic in China and other parts of Asia, is a major pest of rice and causes significant yield loss in this host plant. Very few studies have addressed gene expression in S. inferens. Quantitative real-time PCR (qRT-PCR) is currently the most accurate and sensitive method for gene expression analysis. In qRT-PCR, data are normalized using reference genes, which help control for internal differences and reduce error between samples. In this study, seven candidate reference genes, 18S ribosomal RNA (18S rRNA), elongation factor 1 (EF1), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), ribosomal protein S13 (RPS13), ribosomal protein S20 (RPS20), tubulin (TUB), and β-actin (ACTB) were evaluated for their suitability in normalizing gene expression under different experimental conditions. The results indicated that three genes (RPS13, RPS20, and EF1) were optimal for normalizing gene expression in different insect tissues (head, epidermis, fat body, foregut, midgut, hindgut, Malpighian tubules, haemocytes, and salivary glands). 18S rRNA, EF1, and GAPDH were best for normalizing expression with respect to developmental stages and sex (egg masses; first, second, third, fourth, fifth, and sixth instar larvae; male and female pupae; and one-day-old male and female adults). 18S rRNA, RPS20, and TUB were optimal for fifth instars exposed to different temperatures (-8, -6, -4, -2, 0, and 27°C). To validate this recommendation, the expression profile of a target gene heat shock protein 83 gene (hsp83) was investigated, and results showed the selection was necessary and effective. In conclusion, this study describes reference gene sets that can be used to accurately measure gene expression in S. inferens.

  20. Dynamic network reconstruction from gene expression data applied to immune response during bacterial infection.

    PubMed

    Guthke, Reinhard; Möller, Ulrich; Hoffmann, Martin; Thies, Frank; Töpfer, Susanne

    2005-04-15

    The immune response to bacterial infection represents a complex network of dynamic gene and protein interactions. We present an optimized reverse engineering strategy aimed at a reconstruction of this kind of interaction networks. The proposed approach is based on both microarray data and available biological knowledge. The main kinetics of the immune response were identified by fuzzy clustering of gene expression profiles (time series). The number of clusters was optimized using various evaluation criteria. For each cluster a representative gene with a high fuzzy-membership was chosen in accordance with available physiological knowledge. Then hypothetical network structures were identified by seeking systems of ordinary differential equations, whose simulated kinetics could fit the gene expression profiles of the cluster-representative genes. For the construction of hypothetical network structures singular value decomposition (SVD) based methods and a newly introduced heuristic Network Generation Method here were compared. It turned out that the proposed novel method could find sparser networks and gave better fits to the experimental data. Reinhard.Guthke@hki-jena.de.

  1. Optimized expression of prolyl aminopeptidase in Pichia pastoris and its characteristics after glycosylation.

    PubMed

    Yang, Hongyu; Zhu, Qiang; Zhou, Nandi; Tian, Yaping

    2016-11-01

    Prolyl aminopeptidases are specific exopeptidases that catalyze the hydrolysis of the N-terminus proline residue of peptides and proteins. In the present study, the prolyl aminopeptidase gene (pap) from Aspergillus oryzae JN-412 was optimized through the codon usage of Pichia pastoris. Both the native and optimized pap genes were inserted into the expression vector pPIC9 K and were successfully expressed in P. pastoris. Additionally, the activity of the intracellular enzyme expressed by the recombinant optimized pap gene reached 61.26 U mL(-1), an activity that is 2.1-fold higher than that of the native gene. The recombinant enzyme was purified by one-step elution through Ni-affinity chromatography. The optimal temperature and pH of the purified PAP were 60 °C and 7.5, respectively. Additionally, the recombinant PAP was recovered at a yield greater than 65 % at an extremely broad range of pH values from 6 to 10 after treatment at 50 °C for 6 h. The molecular weight of the recombinant PAP decreased from 50 kDa to 48 kDa after treatment with a deglycosylation enzyme, indicating that the recombinant PAP was completely glycosylated. The glycosylated PAP exhibited high thermo-stability. Half of the activity remained after incubation at 50 °C for 50 h, whereas the remaining activity of PAP expressed in E. coli was only 10 % after incubation at 50 °C for 1 h. PAP could be activated by the appropriate salt concentration and exhibited salt tolerance against NaCl at a concentration up to 5 mol L(-1).

  2. Optimal aggregation of binary classifiers for multiclass cancer diagnosis using gene expression profiles.

    PubMed

    Yukinawa, Naoto; Oba, Shigeyuki; Kato, Kikuya; Ishii, Shin

    2009-01-01

    Multiclass classification is one of the fundamental tasks in bioinformatics and typically arises in cancer diagnosis studies by gene expression profiling. There have been many studies of aggregating binary classifiers to construct a multiclass classifier based on one-versus-the-rest (1R), one-versus-one (11), or other coding strategies, as well as some comparison studies between them. However, the studies found that the best coding depends on each situation. Therefore, a new problem, which we call the "optimal coding problem," has arisen: how can we determine which coding is the optimal one in each situation? To approach this optimal coding problem, we propose a novel framework for constructing a multiclass classifier, in which each binary classifier to be aggregated has a weight value to be optimally tuned based on the observed data. Although there is no a priori answer to the optimal coding problem, our weight tuning method can be a consistent answer to the problem. We apply this method to various classification problems including a synthesized data set and some cancer diagnosis data sets from gene expression profiling. The results demonstrate that, in most situations, our method can improve classification accuracy over simple voting heuristics and is better than or comparable to state-of-the-art multiclass predictors.

  3. A tetO Toolkit To Alter Expression of Genes in Saccharomyces cerevisiae.

    PubMed

    Cuperus, Josh T; Lo, Russell S; Shumaker, Lucia; Proctor, Julia; Fields, Stanley

    2015-07-17

    Strategies to optimize a metabolic pathway often involve building a large collection of strains, each containing different versions of sequences that regulate the expression of pathway genes. Here, we develop reagents and methods to carry out this process at high efficiency in the yeast Saccharomyces cerevisiae. We identify variants of the Escherichia coli tet operator (tetO) sequence that bind a TetR-VP16 activator with differential affinity and therefore result in different TetR-VP16 activator-driven expression. By recombining these variants upstream of the genes of a pathway, we generate unique combinations of expression levels. Here, we built a tetO toolkit, which includes the I-OnuI homing endonuclease to create double-strand breaks, which increases homologous recombination by 10(5); a plasmid carrying six variant tetO sequences flanked by I-OnuI sites, uncoupling transformation and recombination steps; an S. cerevisiae-optimized TetR-VP16 activator; and a vector to integrate constructs into the yeast genome. We introduce into the S. cerevisiae genome the three crt genes from Erwinia herbicola required for yeast to synthesize lycopene and carry out the recombination process to produce a population of cells with permutations of tetO variants regulating the three genes. We identify 0.7% of this population as making detectable lycopene, of which the vast majority have undergone recombination at all three crt genes. We estimate a rate of ∼20% recombination per targeted site, much higher than that obtained in other studies. Application of this toolkit to medically or industrially important end products could reduce the time and labor required to optimize the expression of a set of metabolic genes.

  4. Global gene expression analysis by combinatorial optimization.

    PubMed

    Ameur, Adam; Aurell, Erik; Carlsson, Mats; Westholm, Jakub Orzechowski

    2004-01-01

    Generally, there is a trade-off between methods of gene expression analysis that are precise but labor-intensive, e.g. RT-PCR, and methods that scale up to global coverage but are not quite as quantitative, e.g. microarrays. In the present paper, we show how how a known method of gene expression profiling (K. Kato, Nucleic Acids Res. 23, 3685-3690 (1995)), which relies on a fairly small number of steps, can be turned into a global gene expression measurement by advanced data post-processing, with potentially little loss of accuracy. Post-processing here entails solving an ancillary combinatorial optimization problem. Validation is performed on in silico experiments generated from the FANTOM data base of full-length mouse cDNA. We present two variants of the method. One uses state-of-the-art commercial software for solving problems of this kind, the other a code developed by us specifically for this purpose, released in the public domain under GPL license.

  5. Selection of internal control genes for quantitative real-time RT-PCR studies during tomato development process

    PubMed Central

    Expósito-Rodríguez, Marino; Borges, Andrés A; Borges-Pérez, Andrés; Pérez, José A

    2008-01-01

    Background The elucidation of gene expression patterns leads to a better understanding of biological processes. Real-time quantitative RT-PCR has become the standard method for in-depth studies of gene expression. A biologically meaningful reporting of target mRNA quantities requires accurate and reliable normalization in order to identify real gene-specific variation. The purpose of normalization is to control several variables such as different amounts and quality of starting material, variable enzymatic efficiencies of retrotranscription from RNA to cDNA, or differences between tissues or cells in overall transcriptional activity. The validity of a housekeeping gene as endogenous control relies on the stability of its expression level across the sample panel being analysed. In the present report we describe the first systematic evaluation of potential internal controls during tomato development process to identify which are the most reliable for transcript quantification by real-time RT-PCR. Results In this study, we assess the expression stability of 7 traditional and 4 novel housekeeping genes in a set of 27 samples representing different tissues and organs of tomato plants at different developmental stages. First, we designed, tested and optimized amplification primers for real-time RT-PCR. Then, expression data from each candidate gene were evaluated with three complementary approaches based on different statistical procedures. Our analysis suggests that SGN-U314153 (CAC), SGN-U321250 (TIP41), SGN-U346908 ("Expressed") and SGN-U316474 (SAND) genes provide superior transcript normalization in tomato development studies. We recommend different combinations of these exceptionally stable housekeeping genes for suited normalization of different developmental series, including the complete tomato development process. Conclusion This work constitutes the first effort for the selection of optimal endogenous controls for quantitative real-time RT-PCR studies of gene expression during tomato development process. From our study a tool-kit of control genes emerges that outperform the traditional genes in terms of expression stability. PMID:19102748

  6. Design, Construction and Cloning of Truncated ORF2 and tPAsp-PADRE-Truncated ORF2 Gene Cassette From Hepatitis E Virus in the pVAX1 Expression Vector

    PubMed Central

    Farshadpour, Fatemeh; Makvandi, Manoochehr; Taherkhani, Reza

    2015-01-01

    Background: Hepatitis E Virus (HEV) is the causative agent of enterically transmitted acute hepatitis and has high mortality rate of up to 30% among pregnant women. Therefore, development of a novel vaccine is a desirable goal. Objectives: The aim of this study was to construct tPAsp-PADRE-truncated open reading frame 2 (ORF2) and truncated ORF2 DNA plasmid, which can assist future studies with the preparation of an effective vaccine against Hepatitis E Virus. Materials and Methods: A synthetic codon-optimized gene cassette encoding tPAsp-PADRE-truncated ORF2 protein was designed, constructed and analyzed by some bioinformatics software. Furthermore, a codon-optimized truncated ORF2 gene was amplified by the polymerase chain reaction (PCR), with a specific primer from the previous construct. The constructs were sub-cloned in the pVAX1 expression vector and finally expressed in eukaryotic cells. Results: Sequence analysis and bioinformatics studies of the codon-optimized gene cassette revealed that codon adaptation index (CAI), GC content, and frequency of optimal codon usage (Fop) value were improved, and performance of the secretory signal was confirmed. Cloning and sub-cloning of the tPAsp-PADRE-truncated ORF2 gene cassette and truncated ORF2 gene were confirmed by colony PCR, restriction enzymes digestion and DNA sequencing of the recombinant plasmids pVAX-tPAsp-PADRE-truncated ORF2 (aa 112-660) and pVAX-truncated ORF2 (aa 112-660). The expression of truncated ORF2 protein in eukaryotic cells was approved by an Immunofluorescence assay (IFA) and the reverse transcriptase polymerase chain reaction (RT-PCR) method. Conclusions: The results of this study demonstrated that the tPAsp-PADRE-truncated ORF2 gene cassette and the truncated ORF2 gene in recombinant plasmids are successfully expressed in eukaryotic cells. The immunogenicity of the two recombinant plasmids with different formulations will be evaluated as a novel DNA vaccine in future investigations. PMID:26865938

  7. Combinatorial Screening for Transgenic Yeasts with High Cellulase Activities in Combination with a Tunable Expression System

    PubMed Central

    Ito, Yoichiro; Yamanishi, Mamoru; Ikeuchi, Akinori; Imamura, Chie; Matsuyama, Takashi

    2015-01-01

    Combinatorial screening used together with a broad library of gene expression cassettes is expected to produce a powerful tool for the optimization of the simultaneous expression of multiple enzymes. Recently, we proposed a highly tunable protein expression system that utilized multiple genome-integrated target genes to fine-tune enzyme expression in yeast cells. This tunable system included a library of expression cassettes each composed of three gene-expression control elements that in different combinations produced a wide range of protein expression levels. In this study, four gene expression cassettes with graded protein expression levels were applied to the expression of three cellulases: cellobiohydrolase 1, cellobiohydrolase 2, and endoglucanase 2. After combinatorial screening for transgenic yeasts simultaneously secreting these three cellulases, we obtained strains with higher cellulase expressions than a strain harboring three cellulase-expression constructs within one high-performance gene expression cassette. These results show that our method will be of broad use throughout the field of metabolic engineering. PMID:26692026

  8. Dataset of proinflammatory cytokine and cytokine receptor gene expression in rainbow trout (Oncorhynchus mykiss) measured using a novel GeXP multiplex, RT-PCR assay

    USDA-ARS?s Scientific Manuscript database

    A GeXP multiplex, RT-PCR assay was developed and optimized that simultaneously measures expression of a suite of immune-relevant genes in rainbow trout (Oncorhynchus mykiss), concentrating on tumor necrosis factor and interleukin-1 ligand/receptor systems and acute phase response genes. The dataset ...

  9. Gene expression profiling of two distinct neuronal populations in the rodent spinal cord.

    PubMed

    Ryge, Jesper; Westerdahl, Ann-Charlotte; Alstrøm, Preben; Kiehn, Ole

    2008-01-01

    In the field of neuroscience microarray gene expression profiles on anatomically defined brain structures are being used increasingly to study both normal brain functions as well as pathological states. Fluorescent tracing techniques in brain tissue that identifies distinct neuronal populations can in combination with global gene expression profiling potentially increase the resolution and specificity of such studies to shed new light on neuronal functions at the cellular level. We examine the microarray gene expression profiles of two distinct neuronal populations in the spinal cord of the neonatal rat, the principal motor neurons and specific interneurons involved in motor control. The gene expression profiles of the respective cell populations were obtained from amplified mRNA originating from 50-250 fluorescently identified and laser microdissected cells. In the data analysis we combine a new microarray normalization procedure with a conglomerate measure of significant differential gene expression. Using our methodology we find 32 genes to be more expressed in the interneurons compared to the motor neurons that all except one have not previously been associated with this neuronal population. As a validation of our method we find 17 genes to be more expressed in the motor neurons than in the interneurons and of these only one had not previously been described in this population. We provide an optimized experimental protocol that allows isolation of gene transcripts from fluorescent retrogradely labeled cell populations in fresh tissue, which can be used to generate amplified aRNA for microarray hybridization from as few as 50 laser microdissected cells. Using this optimized experimental protocol in combination with our microarray analysis methodology we find 49 differentially expressed genes between the motor neurons and the interneurons that reflect the functional differences between these two cell populations in generating and transmitting the motor output in the rodent spinal cord.

  10. Gene Expression Profiling of Two Distinct Neuronal Populations in the Rodent Spinal Cord

    PubMed Central

    Alstrøm, Preben; Kiehn, Ole

    2008-01-01

    Background In the field of neuroscience microarray gene expression profiles on anatomically defined brain structures are being used increasingly to study both normal brain functions as well as pathological states. Fluorescent tracing techniques in brain tissue that identifies distinct neuronal populations can in combination with global gene expression profiling potentially increase the resolution and specificity of such studies to shed new light on neuronal functions at the cellular level. Methodology/Principal Findings We examine the microarray gene expression profiles of two distinct neuronal populations in the spinal cord of the neonatal rat, the principal motor neurons and specific interneurons involved in motor control. The gene expression profiles of the respective cell populations were obtained from amplified mRNA originating from 50–250 fluorescently identified and laser microdissected cells. In the data analysis we combine a new microarray normalization procedure with a conglomerate measure of significant differential gene expression. Using our methodology we find 32 genes to be more expressed in the interneurons compared to the motor neurons that all except one have not previously been associated with this neuronal population. As a validation of our method we find 17 genes to be more expressed in the motor neurons than in the interneurons and of these only one had not previously been described in this population. Conclusions/Significance We provide an optimized experimental protocol that allows isolation of gene transcripts from fluorescent retrogradely labeled cell populations in fresh tissue, which can be used to generate amplified aRNA for microarray hybridization from as few as 50 laser microdissected cells. Using this optimized experimental protocol in combination with our microarray analysis methodology we find 49 differentially expressed genes between the motor neurons and the interneurons that reflect the functional differences between these two cell populations in generating and transmitting the motor output in the rodent spinal cord. PMID:18923679

  11. A novel harmony search-K means hybrid algorithm for clustering gene expression data

    PubMed Central

    Nazeer, KA Abdul; Sebastian, MP; Kumar, SD Madhu

    2013-01-01

    Recent progress in bioinformatics research has led to the accumulation of huge quantities of biological data at various data sources. The DNA microarray technology makes it possible to simultaneously analyze large number of genes across different samples. Clustering of microarray data can reveal the hidden gene expression patterns from large quantities of expression data that in turn offers tremendous possibilities in functional genomics, comparative genomics, disease diagnosis and drug development. The k- ¬means clustering algorithm is widely used for many practical applications. But the original k-¬means algorithm has several drawbacks. It is computationally expensive and generates locally optimal solutions based on the random choice of the initial centroids. Several methods have been proposed in the literature for improving the performance of the k-¬means algorithm. A meta-heuristic optimization algorithm named harmony search helps find out near-global optimal solutions by searching the entire solution space. Low clustering accuracy of the existing algorithms limits their use in many crucial applications of life sciences. In this paper we propose a novel Harmony Search-K means Hybrid (HSKH) algorithm for clustering the gene expression data. Experimental results show that the proposed algorithm produces clusters with better accuracy in comparison with the existing algorithms. PMID:23390351

  12. A novel harmony search-K means hybrid algorithm for clustering gene expression data.

    PubMed

    Nazeer, Ka Abdul; Sebastian, Mp; Kumar, Sd Madhu

    2013-01-01

    Recent progress in bioinformatics research has led to the accumulation of huge quantities of biological data at various data sources. The DNA microarray technology makes it possible to simultaneously analyze large number of genes across different samples. Clustering of microarray data can reveal the hidden gene expression patterns from large quantities of expression data that in turn offers tremendous possibilities in functional genomics, comparative genomics, disease diagnosis and drug development. The k- ¬means clustering algorithm is widely used for many practical applications. But the original k-¬means algorithm has several drawbacks. It is computationally expensive and generates locally optimal solutions based on the random choice of the initial centroids. Several methods have been proposed in the literature for improving the performance of the k-¬means algorithm. A meta-heuristic optimization algorithm named harmony search helps find out near-global optimal solutions by searching the entire solution space. Low clustering accuracy of the existing algorithms limits their use in many crucial applications of life sciences. In this paper we propose a novel Harmony Search-K means Hybrid (HSKH) algorithm for clustering the gene expression data. Experimental results show that the proposed algorithm produces clusters with better accuracy in comparison with the existing algorithms.

  13. DAILY PATTERNS OF CLOCK AND COGNITION-RELATED FACTORS ARE MODIFIED IN THE HIPPOCAMPUS OF VITAMIN A-DEFICIENT RATS

    PubMed Central

    Golini, Rebeca S.; Delgado, Silvia M.; Navigatore Fonzo, Lorena S.; Ponce, Ivana T.; Lacoste, María G.; Anzulovich, Ana C.

    2012-01-01

    The circadian expression of clock and clock-controlled cognition-related genes in the hippocampus would be essential to achieve an optimal daily cognitive performance. There is some evidence that retinoid nuclear receptors (RARs and RXRs) can regulate circadian gene expression in different tissues. In this study, Holtzman male rats from control and vitamin A-deficient groups were sacrificed throughout a 24-h period and hippocampus samples were isolated every 4 or 5 h. RARα and RXRβ expression level was quantified and daily expression patterns of clock BMAL1, PER1, RORα and REVERB genes, RORα and REVERB proteins, as well as temporal expression of cognition-related RC3 and BDNF genes were determined in the hippocampus of the two groups of rats. Our results show significant daily variations of BMAL1, PER1, RORα and REVERB genes, RORα and REVERB proteins and, consequently, daily oscillating expression of RC3 and BDNF genes in the rat hippocampus. Vitamin A deficiency reduced RXRβ mRNA level as well as the amplitude of PER1, REVERB gene and REVERB protein rhythms, and phase-shifted the daily peaks of BMAL1 and RORα mRNA, RORα protein and RC3 and BDNF mRNA levels. Thus, nutritional factors, such as vitamin A and its derivatives the retinoids, might modulate daily patterns of BDNF and RC3 expression in the hippocampus and they could be essential to maintain an optimal daily performance at molecular level in this learning-and-memory-related brain area. PMID:22434687

  14. Adaptation of video game UVW mapping to 3D visualization of gene expression patterns

    NASA Astrophysics Data System (ADS)

    Vize, Peter D.; Gerth, Victor E.

    2007-01-01

    Analysis of gene expression patterns within an organism plays a critical role in associating genes with biological processes in both health and disease. During embryonic development the analysis and comparison of different gene expression patterns allows biologists to identify candidate genes that may regulate the formation of normal tissues and organs and to search for genes associated with congenital diseases. No two individual embryos, or organs, are exactly the same shape or size so comparing spatial gene expression in one embryo to that in another is difficult. We will present our efforts in comparing gene expression data collected using both volumetric and projection approaches. Volumetric data is highly accurate but difficult to process and compare. Projection methods use UV mapping to align texture maps to standardized spatial frameworks. This approach is less accurate but is very rapid and requires very little processing. We have built a database of over 180 3D models depicting gene expression patterns mapped onto the surface of spline based embryo models. Gene expression data in different models can easily be compared to determine common regions of activity. Visualization software, both Java and OpenGL optimized for viewing 3D gene expression data will also be demonstrated.

  15. Versatile control of Plasmodium falciparum gene expression with an inducible protein-RNA interaction

    PubMed Central

    Goldfless, Stephen J.; Wagner, Jeffrey C.; Niles, Jacquin C.

    2014-01-01

    The available tools for conditional gene expression in Plasmodium falciparum are limited. Here, to enable reliable control of target gene expression, we build a system to efficiently modulate translation. We overcame several problems associated with other approaches for regulating gene expression in P. falciparum. Specifically, our system functions predictably across several native and engineered promoter contexts, and affords control over reporter and native parasite proteins irrespective of their subcellular compartmentalization. Induction and repression of gene expression are rapid, homogeneous, and stable over prolonged periods. To demonstrate practical application of our system, we used it to reveal direct links between antimalarial drugs and their native parasite molecular target. This is an important out come given the rapid spread of resistance, and intensified efforts to efficiently discover and optimize new antimalarial drugs. Overall, the studies presented highlight the utility of our system for broadly controlling gene expression and performing functional genetics in P. falciparum. PMID:25370483

  16. Exploring Valid Reference Genes for Quantitative Real-Time PCR Analysis in Sesamia inferens (Lepidoptera: Noctuidae)

    PubMed Central

    Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou

    2015-01-01

    The pink stem borer, Sesamia inferens, which is endemic in China and other parts of Asia, is a major pest of rice and causes significant yield loss in this host plant. Very few studies have addressed gene expression in S. inferens. Quantitative real-time PCR (qRT-PCR) is currently the most accurate and sensitive method for gene expression analysis. In qRT-PCR, data are normalized using reference genes, which help control for internal differences and reduce error between samples. In this study, seven candidate reference genes, 18S ribosomal RNA (18S rRNA), elongation factor 1 (EF1), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), ribosomal protein S13 (RPS13), ribosomal protein S20 (RPS20), tubulin (TUB), and β-actin (ACTB) were evaluated for their suitability in normalizing gene expression under different experimental conditions. The results indicated that three genes (RPS13, RPS20, and EF1) were optimal for normalizing gene expression in different insect tissues (head, epidermis, fat body, foregut, midgut, hindgut, Malpighian tubules, haemocytes, and salivary glands). 18S rRNA, EF1, and GAPDH were best for normalizing expression with respect to developmental stages and sex (egg masses; first, second, third, fourth, fifth, and sixth instar larvae; male and female pupae; and one-day-old male and female adults). 18S rRNA, RPS20, and TUB were optimal for fifth instars exposed to different temperatures (−8, −6, −4, −2, 0, and 27°C). To validate this recommendation, the expression profile of a target gene heat shock protein 83 gene (hsp83) was investigated, and results showed the selection was necessary and effective. In conclusion, this study describes reference gene sets that can be used to accurately measure gene expression in S. inferens. PMID:25585250

  17. Developmental stage related patterns of codon usage and genomic GC content: searching for evolutionary fingerprints with models of stem cell differentiation

    PubMed Central

    2007-01-01

    Background The usage of synonymous codons shows considerable variation among mammalian genes. How and why this usage is non-random are fundamental biological questions and remain controversial. It is also important to explore whether mammalian genes that are selectively expressed at different developmental stages bear different molecular features. Results In two models of mouse stem cell differentiation, we established correlations between codon usage and the patterns of gene expression. We found that the optimal codons exhibited variation (AT- or GC-ending codons) in different cell types within the developmental hierarchy. We also found that genes that were enriched (developmental-pivotal genes) or specifically expressed (developmental-specific genes) at different developmental stages had different patterns of codon usage and local genomic GC (GCg) content. Moreover, at the same developmental stage, developmental-specific genes generally used more GC-ending codons and had higher GCg content compared with developmental-pivotal genes. Further analyses suggest that the model of translational selection might be consistent with the developmental stage-related patterns of codon usage, especially for the AT-ending optimal codons. In addition, our data show that after human-mouse divergence, the influence of selective constraints is still detectable. Conclusion Our findings suggest that developmental stage-related patterns of gene expression are correlated with codon usage (GC3) and GCg content in stem cell hierarchies. Moreover, this paper provides evidence for the influence of natural selection at synonymous sites in the mouse genome and novel clues for linking the molecular features of genes to their patterns of expression during mammalian ontogenesis. PMID:17349061

  18. Long-term functional adeno-associated virus-microdystrophin expression in the dystrophic CXMDj dog.

    PubMed

    Koo, Taeyoung; Okada, Takashi; Athanasopoulos, Takis; Foster, Helen; Takeda, Shin'ichi; Dickson, George

    2011-09-01

    Duchenne muscular dystrophy (DMD) is a severe, inherited, muscle-wasting disorder caused by mutations in the dystrophin gene. Preclinical studies of adeno-associated virus gene therapy for DMD have been described in mouse and dog models of this disease. However, low and transient expression of microdystrophin in dystrophic dogs and a lack of long-term microdystrophin expression associated with a CD8(+)  T-cell response in DMD patients suggests that the development of improved microdystrophin genes and delivery strategies is essential for successful clinical trials in DMD patients. We have previously shown the efficiency of mRNA sequence optimization of mouse microdystrophin in ameliorating the pathology of dystrophic mdx mice. In the present study, we generated adeno-associated virus (AAV)2/8 vectors expressing an mRNA sequence-optimized canine microdystrophin under the control of a muscle-specific promoter and injected intramuscularly into a single canine X-linked muscular dystrophy (CXMDj) dog. Expression of stable and high levels of microdystrophin was observed along with an association of the dystrophin-associated protein complex in intramuscularly injected muscles of a CXMDj dog for at least 8 weeks without immune responses. Treated muscles were highly protected from dystrophic damage, with reduced levels of myofiber permeability and central nucleation. The data obtained in the present study suggest that the use of canine-specific and mRNA sequence-optimized microdystrophin genes in conjunction with a muscle-specific promoter results in high and stable levels of microdystrophin expression in a canine model of DMD. This approach will potentially allow the reduction of dosage and contribute towards the development of a safe and effective AAV gene therapy clinical trial protocol for DMD. Copyright © 2011 John Wiley & Sons, Ltd.

  19. H-NS Facilitates Sequence Diversification of Horizontally Transferred DNAs during Their Integration in Host Chromosomes

    PubMed Central

    Higashi, Koichi; Tobe, Toru; Kanai, Akinori; Uyar, Ebru; Ishikawa, Shu; Suzuki, Yutaka; Ogasawara, Naotake; Kurokawa, Ken; Oshima, Taku

    2016-01-01

    Bacteria can acquire new traits through horizontal gene transfer. Inappropriate expression of transferred genes, however, can disrupt the physiology of the host bacteria. To reduce this risk, Escherichia coli expresses the nucleoid-associated protein, H-NS, which preferentially binds to horizontally transferred genes to control their expression. Once expression is optimized, the horizontally transferred genes may actually contribute to E. coli survival in new habitats. Therefore, we investigated whether and how H-NS contributes to this optimization process. A comparison of H-NS binding profiles on common chromosomal segments of three E. coli strains belonging to different phylogenetic groups indicated that the positions of H-NS-bound regions have been conserved in E. coli strains. The sequences of the H-NS-bound regions appear to have diverged more so than H-NS-unbound regions only when H-NS-bound regions are located upstream or in coding regions of genes. Because these regions generally contain regulatory elements for gene expression, sequence divergence in these regions may be associated with alteration of gene expression. Indeed, nucleotide substitutions in H-NS-bound regions of the ybdO promoter and coding regions have diversified the potential for H-NS-independent negative regulation among E. coli strains. The ybdO expression in these strains was still negatively regulated by H-NS, which reduced the effect of H-NS-independent regulation under normal growth conditions. Hence, we propose that, during E. coli evolution, the conservation of H-NS binding sites resulted in the diversification of the regulation of horizontally transferred genes, which may have facilitated E. coli adaptation to new ecological niches. PMID:26789284

  20. H-NS Facilitates Sequence Diversification of Horizontally Transferred DNAs during Their Integration in Host Chromosomes.

    PubMed

    Higashi, Koichi; Tobe, Toru; Kanai, Akinori; Uyar, Ebru; Ishikawa, Shu; Suzuki, Yutaka; Ogasawara, Naotake; Kurokawa, Ken; Oshima, Taku

    2016-01-01

    Bacteria can acquire new traits through horizontal gene transfer. Inappropriate expression of transferred genes, however, can disrupt the physiology of the host bacteria. To reduce this risk, Escherichia coli expresses the nucleoid-associated protein, H-NS, which preferentially binds to horizontally transferred genes to control their expression. Once expression is optimized, the horizontally transferred genes may actually contribute to E. coli survival in new habitats. Therefore, we investigated whether and how H-NS contributes to this optimization process. A comparison of H-NS binding profiles on common chromosomal segments of three E. coli strains belonging to different phylogenetic groups indicated that the positions of H-NS-bound regions have been conserved in E. coli strains. The sequences of the H-NS-bound regions appear to have diverged more so than H-NS-unbound regions only when H-NS-bound regions are located upstream or in coding regions of genes. Because these regions generally contain regulatory elements for gene expression, sequence divergence in these regions may be associated with alteration of gene expression. Indeed, nucleotide substitutions in H-NS-bound regions of the ybdO promoter and coding regions have diversified the potential for H-NS-independent negative regulation among E. coli strains. The ybdO expression in these strains was still negatively regulated by H-NS, which reduced the effect of H-NS-independent regulation under normal growth conditions. Hence, we propose that, during E. coli evolution, the conservation of H-NS binding sites resulted in the diversification of the regulation of horizontally transferred genes, which may have facilitated E. coli adaptation to new ecological niches.

  1. Codon Optimization of the Human Papillomavirus E7 Oncogene Induces a CD8+ T Cell Response to a Cryptic Epitope Not Harbored by Wild-Type E7

    PubMed Central

    Lorenz, Felix K. M.; Wilde, Susanne; Voigt, Katrin; Kieback, Elisa; Mosetter, Barbara; Schendel, Dolores J.; Uckert, Wolfgang

    2015-01-01

    Codon optimization of nucleotide sequences is a widely used method to achieve high levels of transgene expression for basic and clinical research. Until now, immunological side effects have not been described. To trigger T cell responses against human papillomavirus, we incubated T cells with dendritic cells that were pulsed with RNA encoding the codon-optimized E7 oncogene. All T cell receptors isolated from responding T cell clones recognized target cells expressing the codon-optimized E7 gene but not the wild type E7 sequence. Epitope mapping revealed recognition of a cryptic epitope from the +3 alternative reading frame of codon-optimized E7, which is not encoded by the wild type E7 sequence. The introduction of a stop codon into the +3 alternative reading frame protected the transgene product from recognition by T cell receptor gene-modified T cells. This is the first experimental study demonstrating that codon optimization can render a transgene artificially immunogenic through generation of a dominant cryptic epitope. This finding may be of great importance for the clinical field of gene therapy to avoid rejection of gene-corrected cells and for the design of DNA- and RNA-based vaccines, where codon optimization may artificially add a strong immunogenic component to the vaccine. PMID:25799237

  2. Reproducibility-optimized test statistic for ranking genes in microarray studies.

    PubMed

    Elo, Laura L; Filén, Sanna; Lahesmaa, Riitta; Aittokallio, Tero

    2008-01-01

    A principal goal of microarray studies is to identify the genes showing differential expression under distinct conditions. In such studies, the selection of an optimal test statistic is a crucial challenge, which depends on the type and amount of data under analysis. While previous studies on simulated or spike-in datasets do not provide practical guidance on how to choose the best method for a given real dataset, we introduce an enhanced reproducibility-optimization procedure, which enables the selection of a suitable gene- anking statistic directly from the data. In comparison with existing ranking methods, the reproducibilityoptimized statistic shows good performance consistently under various simulated conditions and on Affymetrix spike-in dataset. Further, the feasibility of the novel statistic is confirmed in a practical research setting using data from an in-house cDNA microarray study of asthma-related gene expression changes. These results suggest that the procedure facilitates the selection of an appropriate test statistic for a given dataset without relying on a priori assumptions, which may bias the findings and their interpretation. Moreover, the general reproducibilityoptimization procedure is not limited to detecting differential expression only but could be extended to a wide range of other applications as well.

  3. Optimized Assembly of a Multifunctional RNA-Protein Nanostructure in a Cell-Free Gene Expression System.

    PubMed

    Schwarz-Schilling, Matthaeus; Dupin, Aurore; Chizzolini, Fabio; Krishnan, Swati; Mansy, Sheref S; Simmel, Friedrich C

    2018-04-11

    Molecular complexes composed of RNA molecules and proteins are promising multifunctional nanostructures for a wide variety of applications in biological cells or in artificial cellular systems. In this study, we systematically address some of the challenges associated with the expression and assembly of such hybrid structures using cell-free gene expression systems. As a model structure, we investigated a pRNA-derived RNA scaffold functionalized with four distinct aptamers, three of which bind to proteins, streptavidin and two fluorescent proteins, while one binds the small molecule dye malachite green (MG). Using MG fluorescence and Förster resonance energy transfer (FRET) between the RNA-scaffolded proteins, we assess critical assembly parameters such as chemical stability, binding efficiency, and also resource sharing effects within the reaction compartment. We then optimize simultaneous expression and coassembly of the RNA-protein nanostructure within a single-compartment cell-free gene expression system. We demonstrate expression and assembly of the multicomponent nanostructures inside of emulsion droplets and their aptamer-mediated localization onto streptavidin-coated substrates, plus the successful assembly of the hybrid structures inside of bacterial cells.

  4. Development of a gene synthesis platform for the efficient large scale production of small genes encoding animal toxins.

    PubMed

    Sequeira, Ana Filipa; Brás, Joana L A; Guerreiro, Catarina I P D; Vincentelli, Renaud; Fontes, Carlos M G A

    2016-12-01

    Gene synthesis is becoming an important tool in many fields of recombinant DNA technology, including recombinant protein production. De novo gene synthesis is quickly replacing the classical cloning and mutagenesis procedures and allows generating nucleic acids for which no template is available. In addition, when coupled with efficient gene design algorithms that optimize codon usage, it leads to high levels of recombinant protein expression. Here, we describe the development of an optimized gene synthesis platform that was applied to the large scale production of small genes encoding venom peptides. This improved gene synthesis method uses a PCR-based protocol to assemble synthetic DNA from pools of overlapping oligonucleotides and was developed to synthesise multiples genes simultaneously. This technology incorporates an accurate, automated and cost effective ligation independent cloning step to directly integrate the synthetic genes into an effective Escherichia coli expression vector. The robustness of this technology to generate large libraries of dozens to thousands of synthetic nucleic acids was demonstrated through the parallel and simultaneous synthesis of 96 genes encoding animal toxins. An automated platform was developed for the large-scale synthesis of small genes encoding eukaryotic toxins. Large scale recombinant expression of synthetic genes encoding eukaryotic toxins will allow exploring the extraordinary potency and pharmacological diversity of animal venoms, an increasingly valuable but unexplored source of lead molecules for drug discovery.

  5. Enhancement of heterogeneous alkaline xylanase production in Pichia pastoris GS115

    NASA Astrophysics Data System (ADS)

    Zheng, Wei

    2017-08-01

    A series of strategies were applied to improve expression level of the recombinant alkaline xylanase from Bacillus pumilus G1-3 in Pichia pastoris GS115. Codon optimization of xylanase gene xynG1-3 from B. pumilus G1-3 were carried out for its heterogeneous expression in P. pastoris. The activity of xylanase encoded by optimized gene (xynG1-3-opt) was up to 33641 U/mL, which was 37% higher than that by wild-type (xynG1-3) gene. The results will greatly contribute to increasing the production of recombinant proteins in P. pastoris and improving the industrial production of the alkaline xylanase.

  6. Efficient production of antibody Fab fragment by transient gene expression in insect cells.

    PubMed

    Mori, Keita; Hamada, Hirotsugu; Ogawa, Takafumi; Ohmuro-Matsuyama, Yuki; Katsuda, Tomohisa; Yamaji, Hideki

    2017-08-01

    Transient gene expression allows a rapid production of diverse recombinant proteins in early-stage preclinical and clinical developments of biologics. Insect cells have proven to be an excellent platform for the production of functional recombinant proteins. In the present study, the production of an antibody Fab fragment by transient gene expression in lepidopteran insect cells was investigated. The DNA fragments encoding heavy-chain (Hc; Fd fragment) and light-chain (Lc) genes of an Fab fragment were individually cloned into the plasmid vector pIHAneo, which contained the Bombyx mori actin promoter downstream of the B. mori nucleopolyhedrovirus (BmNPV) IE-1 transactivator and the BmNPV HR3 enhancer for high-level expression. Trichoplusia ni BTI-TN-5B1-4 (High Five) cells were co-transfected with the resultant plasmid vectors using linear polyethyleneimine. When the transfection efficiency was evaluated, a plasmid vector encoding an enhanced green fluorescent protein (EGFP) gene was also co-transfected. Transfection and culture conditions were optimized based on both the flow cytometry of the EGFP expression in transfected cells and the yield of the secreted Fab fragments determined by enzyme-linked immunosorbent assay (ELISA). Under optimal conditions, a yield of approximately 120 mg/L of Fab fragments was achieved in 5 days in a shake-flask culture. Transient gene expression in insect cells may offer a promising approach to the high-throughput production of recombinant proteins. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  7. Multilevel Regulation of Bacterial Gene Expression with the Combined STAR and Antisense RNA System.

    PubMed

    Lee, Young Je; Kim, Soo-Jung; Moon, Tae Seok

    2018-03-16

    Synthetic small RNA regulators have emerged as a versatile tool to predictably control bacterial gene expression. Owing to their simple design principles, small size, and highly orthogonal behavior, these engineered genetic parts have been incorporated into genetic circuits. However, efforts to achieve more sophisticated cellular functions using RNA regulators have been hindered by our limited ability to integrate different RNA regulators into complex circuits. Here, we present a combined RNA regulatory system in Escherichia coli that uses small transcription activating RNA (STAR) and antisense RNA (asRNA) to activate or deactivate target gene expression in a programmable manner. Specifically, we demonstrated that the activated target output by the STAR system can be deactivated by expressing two different types of asRNAs: one binds to and sequesters the STAR regulator, affecting the transcription process, while the other binds to the target mRNA, affecting the translation process. We improved deactivation efficiencies (up to 96%) by optimizing each type of asRNA and then integrating the two optimized asRNAs into a single circuit. Furthermore, we demonstrated that the combined STAR and asRNA system can control gene expression in a reversible way and can regulate expression of a gene in the genome. Lastly, we constructed and simultaneously tested two A AND NOT B logic gates in the same cell to show sophisticated multigene regulation by the combined system. Our approach establishes a methodology for integrating multiple RNA regulators to rationally control multiple genes.

  8. Independent and high-level dual-gene expression in adult stem-progenitor cells from a single lentiviral vector.

    PubMed

    Tian, J; Andreadis, S T

    2009-07-01

    Expression of multiple genes from the same target cell is required in several technological and therapeutic applications such as quantitative measurements of promoter activity or in vivo tracking of stem cells. In spite of such need, reaching independent and high-level dual-gene expression cannot be reliably accomplished by current gene transfer vehicles. To address this issue, we designed a lentiviral vector carrying two transcriptional units separated by polyadenylation, terminator and insulator sequences. With this design, the expression level of both genes was as high as that yielded from lentiviral vectors containing only a single transcriptional unit. Similar results were observed with several promoters and cell types including epidermal keratinocytes, bone marrow mesenchymal stem cells and hair follicle stem cells. Notably, we demonstrated quantitative dynamic monitoring of gene expression in primary cells with no need for selection protocols suggesting that this optimized lentivirus may be useful in high-throughput gene expression profiling studies.

  9. A group LASSO-based method for robustly inferring gene regulatory networks from multiple time-course datasets.

    PubMed

    Liu, Li-Zhi; Wu, Fang-Xiang; Zhang, Wen-Jun

    2014-01-01

    As an abstract mapping of the gene regulations in the cell, gene regulatory network is important to both biological research study and practical applications. The reverse engineering of gene regulatory networks from microarray gene expression data is a challenging research problem in systems biology. With the development of biological technologies, multiple time-course gene expression datasets might be collected for a specific gene network under different circumstances. The inference of a gene regulatory network can be improved by integrating these multiple datasets. It is also known that gene expression data may be contaminated with large errors or outliers, which may affect the inference results. A novel method, Huber group LASSO, is proposed to infer the same underlying network topology from multiple time-course gene expression datasets as well as to take the robustness to large error or outliers into account. To solve the optimization problem involved in the proposed method, an efficient algorithm which combines the ideas of auxiliary function minimization and block descent is developed. A stability selection method is adapted to our method to find a network topology consisting of edges with scores. The proposed method is applied to both simulation datasets and real experimental datasets. It shows that Huber group LASSO outperforms the group LASSO in terms of both areas under receiver operating characteristic curves and areas under the precision-recall curves. The convergence analysis of the algorithm theoretically shows that the sequence generated from the algorithm converges to the optimal solution of the problem. The simulation and real data examples demonstrate the effectiveness of the Huber group LASSO in integrating multiple time-course gene expression datasets and improving the resistance to large errors or outliers.

  10. Evaluation of Different Normalization and Analysis Procedures for Illumina Gene Expression Microarray Data Involving Small Changes

    PubMed Central

    Johnstone, Daniel M.; Riveros, Carlos; Heidari, Moones; Graham, Ross M.; Trinder, Debbie; Berretta, Regina; Olynyk, John K.; Scott, Rodney J.; Moscato, Pablo; Milward, Elizabeth A.

    2013-01-01

    While Illumina microarrays can be used successfully for detecting small gene expression changes due to their high degree of technical replicability, there is little information on how different normalization and differential expression analysis strategies affect outcomes. To evaluate this, we assessed concordance across gene lists generated by applying different combinations of normalization strategy and analytical approach to two Illumina datasets with modest expression changes. In addition to using traditional statistical approaches, we also tested an approach based on combinatorial optimization. We found that the choice of both normalization strategy and analytical approach considerably affected outcomes, in some cases leading to substantial differences in gene lists and subsequent pathway analysis results. Our findings suggest that important biological phenomena may be overlooked when there is a routine practice of using only one approach to investigate all microarray datasets. Analytical artefacts of this kind are likely to be especially relevant for datasets involving small fold changes, where inherent technical variation—if not adequately minimized by effective normalization—may overshadow true biological variation. This report provides some basic guidelines for optimizing outcomes when working with Illumina datasets involving small expression changes. PMID:27605185

  11. Optimization of HIV-1 Envelope DNA Vaccine Candidates within Three Different Animal Models, Guinea Pigs, Rabbits and Cynomolgus Macaques.

    PubMed

    Borggren, Marie; Vinner, Lasse; Andresen, Betina Skovgaard; Grevstad, Berit; Repits, Johanna; Melchers, Mark; Elvang, Tara Laura; Sanders, Rogier W; Martinon, Frédéric; Dereuddre-Bosquet, Nathalie; Bowles, Emma Joanne; Stewart-Jones, Guillaume; Biswas, Priscilla; Scarlatti, Gabriella; Jansson, Marianne; Heyndrickx, Leo; Grand, Roger Le; Fomsgaard, Anders

    2013-07-19

    HIV-1 DNA vaccines have many advantageous features. Evaluation of HIV-1 vaccine candidates often starts in small animal models before macaque and human trials. Here, we selected and optimized DNA vaccine candidates through systematic testing in rabbits for the induction of broadly neutralizing antibodies (bNAb). We compared three different animal models: guinea pigs, rabbits and cynomolgus macaques. Envelope genes from the prototype isolate HIV-1 Bx08 and two elite neutralizers were included. Codon-optimized genes, encoded secreted gp140 or membrane bound gp150, were modified for expression of stabilized soluble trimer gene products, and delivered individually or mixed. Specific IgG after repeated i.d. inoculations with electroporation confirmed in vivo expression and immunogenicity. Evaluations of rabbits and guinea pigs displayed similar results. The superior DNA construct in rabbits was a trivalent mix of non-modified codon-optimized gp140 envelope genes. Despite NAb responses with some potency and breadth in guinea pigs and rabbits, the DNA vaccinated macaques displayed less bNAb activity. It was concluded that a trivalent mix of non-modified gp140 genes from rationally selected clinical isolates was, in this study, the best option to induce high and broad NAb in the rabbit model, but this optimization does not directly translate into similar responses in cynomolgus macaques.

  12. Optimization of HIV-1 Envelope DNA Vaccine Candidates within Three Different Animal Models, Guinea Pigs, Rabbits and Cynomolgus Macaques

    PubMed Central

    Borggren, Marie; Vinner, Lasse; Andresen, Betina Skovgaard; Grevstad, Berit; Repits, Johanna; Melchers, Mark; Elvang, Tara Laura; Sanders, Rogier W; Martinon, Frédéric; Dereuddre-Bosquet, Nathalie; Bowles, Emma Joanne; Stewart-Jones, Guillaume; Biswas, Priscilla; Scarlatti, Gabriella; Jansson, Marianne; Heyndrickx, Leo; Le Grand, Roger; Fomsgaard, Anders

    2013-01-01

    HIV-1 DNA vaccines have many advantageous features. Evaluation of HIV-1 vaccine candidates often starts in small animal models before macaque and human trials. Here, we selected and optimized DNA vaccine candidates through systematic testing in rabbits for the induction of broadly neutralizing antibodies (bNAb). We compared three different animal models: guinea pigs, rabbits and cynomolgus macaques. Envelope genes from the prototype isolate HIV-1 Bx08 and two elite neutralizers were included. Codon-optimized genes, encoded secreted gp140 or membrane bound gp150, were modified for expression of stabilized soluble trimer gene products, and delivered individually or mixed. Specific IgG after repeated i.d. inoculations with electroporation confirmed in vivo expression and immunogenicity. Evaluations of rabbits and guinea pigs displayed similar results. The superior DNA construct in rabbits was a trivalent mix of non-modified codon-optimized gp140 envelope genes. Despite NAb responses with some potency and breadth in guinea pigs and rabbits, the DNA vaccinated macaques displayed less bNAb activity. It was concluded that a trivalent mix of non-modified gp140 genes from rationally selected clinical isolates was, in this study, the best option to induce high and broad NAb in the rabbit model, but this optimization does not directly translate into similar responses in cynomolgus macaques. PMID:26344115

  13. Rhesus Monkey Rhadinovirus ORF57 Induces gH and gL Glycoprotein Expression through Posttranscriptional Accumulation of Target mRNAs ▿

    PubMed Central

    Shin, Young C.; Desrosiers, Ronald C.

    2011-01-01

    Open reading frame 57 (ORF57) of gamma-2 herpesviruses is a key regulator of viral gene expression. It has been reported to enhance the expression of viral genes by transcriptional, posttranscriptional, or translational activation mechanisms. Previously we have shown that the expression of gH and gL of rhesus monkey rhadinovirus (RRV), a close relative of the human Kaposi's sarcoma-associated herpesvirus (KSHV), could be dramatically rescued by codon optimization as well as by ORF57 coexpression (J. P. Bilello, J. S. Morgan, and R. C. Desrosiers, J. Virol. 82:7231–7237, 2008). We show here that ORF57 coexpression and codon optimization had similar effects, except that the rescue of expression by codon optimization was temporally delayed relative to that of ORF57 coexpression. The transfection of gL mRNA directly into cells with or without ORF57 coexpression and with or without codon optimization recapitulated the effects of these modes of induction on transfected DNA. These findings suggested an important role for the enhancement of mRNA stability and/or the translation of mRNA for these very different modes of induced expression. This conclusion was confirmed by several different measures of gH and gL mRNA stability and accumulation with or without ORF57 coexpression and with or without codon optimization. Our results indicate that RRV gH and gL expression is severely limited by the stability of the mRNA and that ORF57 coexpression and codon optimization independently induce gH and gL expression principally by allowing accumulation and translation of these mRNAs. PMID:21613403

  14. Tetracycline-inducible system for regulation of skeletal muscle-specific gene expression in transgenic mice

    NASA Technical Reports Server (NTRS)

    Grill, Mischala A.; Bales, Mark A.; Fought, Amber N.; Rosburg, Kristopher C.; Munger, Stephanie J.; Antin, Parker B.

    2003-01-01

    Tightly regulated control of over-expression is often necessary to study one aspect or time point of gene function and, in transgenesis, may help to avoid lethal effects and complications caused by ubiquitous over-expression. We have utilized the benefits of an optimized tet-on system and a modified muscle creatine kinase (MCK) promoter to generate a skeletal muscle-specific, doxycycline (Dox) controlled over-expression system in transgenic mice. A DNA construct was generated in which the codon optimized reverse tetracycline transactivator (rtTA) was placed under control of a skeletal muscle-specific version of the mouse MCK promoter. Transgenic mice containing this construct expressed rtTA almost exclusively in skeletal muscles. These mice were crossed to a second transgenic line containing a bi-directional promoter centered on a tet responder element driving both a luciferase reporter gene and a tagged gene of interest; in this case the calpain inhibitor calpastatin. Compound hemizygous mice showed high level, Dox dependent muscle-specific luciferase activity often exceeding 10,000-fold over non-muscle tissues of the same mouse. Western and immunocytochemical analysis demonstrated similar Dox dependent muscle-specific induction of the tagged calpastatin protein. These findings demonstrate the effectiveness and flexibility of the tet-on system to provide a tightly regulated over-expression system in adult skeletal muscle. The MCKrtTA transgenic lines can be combined with other transgenic responder lines for skeletal muscle-specific over-expression of any target gene of interest.

  15. Optimization of a yeast RNA interference system for controlling gene expression and enabling rapid metabolic engineering.

    PubMed

    Crook, Nathan C; Schmitz, Alexander C; Alper, Hal S

    2014-05-16

    Reduction of endogenous gene expression is a fundamental operation of metabolic engineering, yet current methods for gene knockdown (i.e., genome editing) remain laborious and slow, especially in yeast. In contrast, RNA interference allows facile and tunable gene knockdown via a simple plasmid transformation step, enabling metabolic engineers to rapidly prototype knockdown strategies in multiple strains before expending significant cost to undertake genome editing. Although RNAi is naturally present in a myriad of eukaryotes, it has only been recently implemented in Saccharomyces cerevisiae as a heterologous pathway and so has not yet been optimized as a metabolic engineering tool. In this study, we elucidate a set of design principles for the construction of hairpin RNA expression cassettes in yeast and implement RNA interference to quickly identify routes for improvement of itaconic acid production in this organism. The approach developed here enables rapid prototyping of knockdown strategies and thus accelerates and reduces the cost of the design-build-test cycle in yeast.

  16. Effect of codon optimization and subcellular targeting on Toxoplasma gondii antigen SAG1 expression in tobacco leaves to use in subcutaneous and oral immunization in mice.

    PubMed

    Laguía-Becher, Melina; Martín, Valentina; Kraemer, Mauricio; Corigliano, Mariana; Yacono, María L; Goldman, Alejandra; Clemente, Marina

    2010-07-15

    Codon optimization and subcellular targeting were studied with the aim to increase the expression levels of the SAG178-322 antigen of Toxoplasma gondii in tobacco leaves. The expression of the tobacco-optimized and native versions of the SAG1 gene was explored by transient expression from the Agrobacterium tumefaciens binary expression vector, which allows targeting the recombinant protein to the endoplasmic reticulum (ER) and the apoplast. Finally, mice were subcutaneously and orally immunized with leaf extracts-SAG1 and the strategy of prime boost with rSAG1 expressed in Escherichia coli was used to optimize the oral immunization with leaf extracts-SAG1. Leaves agroinfiltrated with an unmodified SAG1 gene accumulated 5- to 10-fold more than leaves agroinfiltrated with a codon-optimized SAG1 gene. ER localization allowed the accumulation of higher levels of native SAG1. However, no significant differences were observed between the mRNA accumulations of the different versions of SAG1. Subcutaneous immunization with leaf extracts-SAG1 (SAG1) protected mice against an oral challenge with a non-lethal cyst dose, and this effect could be associated with the secretion of significant levels of IFN-gamma. The protection was increased when mice were ID boosted with rSAG1 (SAG1+boost). This group elicited a significant Th1 humoral and cellular immune response characterized by high levels of IFN-gamma. In an oral immunization assay, the SAG1+boost group showed a significantly lower brain cyst burden compared to the rest of the groups. Transient agroinfiltration was useful for the expression of all of the recombinant proteins tested. Our results support the usefulness of endoplasmic reticulum signal peptides in enhancing the production of recombinant proteins meant for use as vaccines. The results showed that this plant-produced protein has potential for use as vaccine and provides a potential means for protecting humans and animals against toxoplasmosis.

  17. Design and testing of regulatory cassettes for optimal activity in skeletal and cardiac muscles.

    PubMed

    Himeda, Charis L; Chen, Xiaolan; Hauschka, Stephen D

    2011-01-01

    Gene therapy for muscular dystrophies requires efficient gene delivery to the striated musculature and specific, high-level expression of the therapeutic gene in a physiologically diverse array of muscles. This can be achieved by the use of recombinant adeno-associated virus vectors in conjunction with muscle-specific regulatory cassettes. We have constructed several generations of regulatory cassettes based on the enhancer and promoter of the muscle creatine kinase gene, some of which include heterologous enhancers and individual elements from other muscle genes. Since the relative importance of many control elements varies among different anatomical muscles, we are aiming to tailor these cassettes for high-level expression in cardiac muscle, and in fast and slow skeletal muscles. With the achievement of efficient intravascular gene delivery to isolated limbs, selected muscle groups, and heart in large animal models, the design of cassettes optimized for activity in different muscle types is now a practical goal. In this protocol, we outline the key steps involved in the design of regulatory cassettes for optimal activity in skeletal and cardiac muscle, and testing in mature muscle fiber cultures. The basic principles described here can also be applied to engineering tissue-specific regulatory cassettes for other cell types.

  18. Influence of intron length on interaction characters between post-spliced intron and its CDS in ribosomal protein genes

    NASA Astrophysics Data System (ADS)

    Zhao, Xiaoqing; Li, Hong; Bao, Tonglaga; Ying, Zhiqiang

    2012-09-01

    Many experiment evidences showed that sequence structures of introns and intron loss/gain can influence gene expression, but current mechanisms did not refer to the functions of post-spliced introns directly. We propose that postspliced introns play their functions in gene expression by interacting with their mRNA sequences and the interaction is characterized by the matched segments between introns and their CDS. In this study, we investigated the interaction characters with length series by improved Smith-Waterman local alignment software for the ribosomal protein genes in C. elegans and D. melanogaster. Our results showed that RF values of five intron groups are significantly high in the central non-conserved region and very low in 5'-end and 3'-end splicing region. It is interesting that the number of the optimal matched regions gradually increases with intron length. Distributions of the optimal matched regions are different for five intron groups. Our study revealed that there are more interaction regions between longer introns and their CDS than shorter, and it provides a positive pattern for regulating the gene expression.

  19. High-level expression of a synthetic gene encoding a sweet protein, monellin, in Escherichia coli.

    PubMed

    Chen, Zhongjun; Cai, Heng; Lu, Fuping; Du, Lianxiang

    2005-11-01

    The expression of a synthetic gene encoding monellin, a sweet protein, in E. coli under the control of T7 promoter from phage is described. The single-chain monellin gene was designed based on the biased codons of E. coli so as to optimize its expression. Monellin was produced and accounted for 45% of total soluble proteins. It was purified to yield 43 mg protein per g dry cell wt. The purity of the recombinant protein was confirmed by SDS-PAGE.

  20. High activity and stability of codon-optimized phosphoenolpyruvate carboxylase from Photobacterium profundum SS9 at low temperatures and its application for in vitro production of oxaloacetate.

    PubMed

    Park, Soohyun; Hong, Soohye; Pack, Seung Pil; Lee, Jinwon

    2014-02-01

    Phosphoenolpyruvate carboxylase (PEPC) of Photobacterium profundum SS9 can be expressed and purified using the Escherichia coli expression system. In this study, a codon-optimized PEPC gene (OPPP) was used to increase expression levels. We confirmed OPPP expression and purified it from extracts of recombinant E. coli SGJS117 harboring the OPPP gene. The purified OPPP showed a specific activity value of 80.3 U/mg protein. The OPPP was stable under low temperature (5-30 °C) and weakly basic conditions (pH 8.5-10). The enzymatic ability of OPPP was investigated for in vitro production of oxaloacetate using phosphoenolpyruvate (PEP) and bicarbonate. Only samples containing the OPPP, PEP, and bicarbonate resulted in oxaloacetate production. OPPP production system using E. coli could be a platform technology to produce high yields of heterogeneous gene and provide the PEPC enzyme, which has high enzyme activity.

  1. Pathway optimization by re-design of untranslated regions for L-tyrosine production in Escherichia coli

    PubMed Central

    Cheol Kim, Seong; Eun Min, Byung; Gyu Hwang, Hyun; Woo Seo, Sang; Yeol Jung, Gyoo

    2015-01-01

    L-tyrosine is a commercially important compound in the food, pharmaceutical, chemical, and cosmetic industries. Although several attempts have been made to improve L-tyrosine production, translation-level expression control and carbon flux rebalancing around phosphoenolpyruvate (PEP) node still remain to be achieved for optimizing the pathway. Here, we demonstrate pathway optimization by altering gene expression levels for L-tyrosine production in Escherichia coli. To optimize the L-tyrosine biosynthetic pathway, a synthetic constitutive promoter and a synthetic 5′-untranslated region (5′-UTR) were introduced for each gene of interest to allow for control at both transcription and translation levels. Carbon flux rebalancing was achieved by controlling the expression level of PEP synthetase using UTR Designer. The L-tyrosine productivity of the engineered E. coli strain was increased through pathway optimization resulting in 3.0 g/L of L-tyrosine titer, 0.0354 g L-tyrosine/h/g DCW of productivity, and 0.102 g L-tyrosine/g glucose yield. Thus, this work demonstrates that pathway optimization by 5′-UTR redesign is an effective strategy for the development of efficient L-tyrosine-producing bacteria. PMID:26346938

  2. AMT1;1 transgenic rice plants with enhanced NH4(+) permeability show superior growth and higher yield under optimal and suboptimal NH4(+) conditions.

    PubMed

    Ranathunge, Kosala; El-Kereamy, Ashraf; Gidda, Satinder; Bi, Yong-Mei; Rothstein, Steven J

    2014-03-01

    The major source of nitrogen for rice (Oryza sativa L.) is ammonium (NH4(+)). The NH4(+) uptake of roots is mainly governed by membrane transporters, with OsAMT1;1 being a prominent member of the OsAMT1 gene family that is known to be involved in NH4(+) transport in rice plants. However, little is known about its involvement in NH4(+) uptake in rice roots and subsequent effects on NH4(+) assimilation. This study shows that OsAMT1;1 is a constitutively expressed, nitrogen-responsive gene, and its protein product is localized in the plasma membrane. Its expression level is under the control of circadian rhythm. Transgenic rice lines (L-2 and L-3) overexpressing the OsAMT1;1 gene had the same root structure as the wild type (WT). However, they had 2-fold greater NH4(+) permeability than the WT, whereas OsAMT1;1 gene expression was 20-fold higher than in the WT. Analogous to the expression, transgenic lines had a higher NH4(+) content in the shoots and roots than the WT. Direct NH4(+) fluxes in the xylem showed that the transgenic lines had significantly greater uptake rates than the WT. Higher NH4(+) contents also promoted higher expression levels of genes in the nitrogen assimilation pathway, resulting in greater nitrogen assimilates, chlorophyll, starch, sugars, and grain yield in transgenic lines than in the WT under suboptimal and optimal nitrogen conditions. OsAMT1;1 also enhanced overall plant growth, especially under suboptimal NH4(+) levels. These results suggest that OsAMT1;1 has the potential for improving nitrogen use efficiency, plant growth, and grain yield under both suboptimal and optimal nitrogen fertilizer conditions.

  3. Optimization and evaluation of T7 based RNA linear amplification protocols for cDNA microarray analysis

    PubMed Central

    Zhao, Hongjuan; Hastie, Trevor; Whitfield, Michael L; Børresen-Dale, Anne-Lise; Jeffrey, Stefanie S

    2002-01-01

    Background T7 based linear amplification of RNA is used to obtain sufficient antisense RNA for microarray expression profiling. We optimized and systematically evaluated the fidelity and reproducibility of different amplification protocols using total RNA obtained from primary human breast carcinomas and high-density cDNA microarrays. Results Using an optimized protocol, the average correlation coefficient of gene expression of 11,123 cDNA clones between amplified and unamplified samples is 0.82 (0.85 when a virtual array was created using repeatedly amplified samples to minimize experimental variation). Less than 4% of genes show changes in expression level by 2-fold or greater after amplification compared to unamplified samples. Most changes due to amplification are not systematic both within one tumor sample and between different tumors. Amplification appears to dampen the variation of gene expression for some genes when compared to unamplified poly(A)+ RNA. The reproducibility between repeatedly amplified samples is 0.97 when performed on the same day, but drops to 0.90 when performed weeks apart. The fidelity and reproducibility of amplification is not affected by decreasing the amount of input total RNA in the 0.3–3 micrograms range. Adding template-switching primer, DNA ligase, or column purification of double-stranded cDNA does not improve the fidelity of amplification. The correlation coefficient between amplified and unamplified samples is higher when total RNA is used as template for both experimental and reference RNA amplification. Conclusion T7 based linear amplification reproducibly generates amplified RNA that closely approximates original sample for gene expression profiling using cDNA microarrays. PMID:12445333

  4. Employing epigenetics to augment the expression of therapeutic proteins in mammalian cells.

    PubMed

    Kwaks, Ted H J; Otte, Arie P

    2006-03-01

    Recombinant proteins form an increasingly large part of the portfolio of biopharmaceutical companies. Production of these often complex transgenic proteins is achieved predominantly in mammalian cell lines but the process is hampered by low yields and unstable expression. Some of these problems are caused by gene silencing at the level of chromatin - so-called epigenetic gene silencing. Here, we describe approaches, which have emerged during the past few years, designed to interfere with epigenetic gene silencing with the aim of enhancing and stabilizing transgene expression. These include targeting histones, the inclusion of specific DNA elements and targeting sites of high gene-expression. We conclude that employing epigenetic gene regulation tools, in combination with further process optimization, might represent the next step forward in the production of therapeutic proteins.

  5. Drug transporter gene expression in human colorectal tissue and cell lines: modulation with antiretrovirals for microbicide optimization.

    PubMed

    Mukhopadhya, Indrani; Murray, Graeme I; Berry, Susan; Thomson, John; Frank, Bruce; Gwozdz, Garry; Ekeruche-Makinde, Julia; Shattock, Robin; Kelly, Charles; Iannelli, Francesco; Pozzi, Gianni; El-Omar, Emad M; Hold, Georgina L; Hijazi, Karolin

    2016-02-01

    The objectives of this study were to comprehensively assess mRNA expression of 84 drug transporters in human colorectal biopsies and six representative cell lines, and to investigate the alteration of drug transporter gene expression after exposure to three candidate microbicidal antiretroviral (ARV) drugs (tenofovir, darunavir and dapivirine) in the colorectal epithelium. The outcome of the objectives informs development of optimal ARV-based microbicidal formulations for prevention of HIV-1 infection. Drug transporter mRNA expression was quantified from colorectal biopsies and cell lines by quantitative real-time PCR. Relative mRNA expression was quantified in Caco-2 cells and colorectal explants after induction with ARVs. Data were analysed using Pearson's product moment correlation (r), hierarchical clustering and principal component analysis (PCA). Expression of 58 of the 84 transporters was documented in colorectal biopsies, with genes for CNT2, P-glycoprotein (P-gp) and MRP3 showing the highest expression. No difference was noted between individual subjects when analysed by age, gender or anatomical site (rectum or recto-sigmoid) (r = 0.95-0.99). High expression of P-gp and CNT2 proteins was confirmed by immunohistochemical staining. Similarity between colorectal tissue and cell-line drug transporter gene expression was variable (r = 0.64-0.84). PCA showed distinct clustering of human colorectal biopsy samples, with the Caco-2 cells defined as the best surrogate system. Induction of Caco-2 cell lines with ARV drugs suggests that darunavir-based microbicides incorporating tenofovir may result in drug-drug interactions likely to affect distribution of individual drugs to sub-epithelial target cells. These findings will help optimize complex formulations of rectal microbicides to realize their full potential as an effective approach for pre-exposure prophylaxis against HIV-1 infection. © The Author 2015. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  6. Proof of Concept Study to Assess Fetal Gene Expression in Amniotic Fluid by NanoArray PCR

    PubMed Central

    Massingham, Lauren J.; Johnson, Kirby L.; Bianchi, Diana W.; Pei, Shermin; Peter, Inga; Cowan, Janet M.; Tantravahi, Umadevi; Morrison, Tom B.

    2011-01-01

    Microarray analysis of cell-free RNA in amniotic fluid (AF) supernatant has revealed differential fetal gene expression as a function of gestational age and karyotype. Once informative genes are identified, research moves to a more focused platform such as quantitative reverse transcriptase-PCR. Standardized NanoArray PCR (SNAP) is a recently developed gene profiling technology that enables the measurement of transcripts from samples containing reduced quantities or degraded nucleic acids. We used a previously developed SNAP gene panel as proof of concept to determine whether fetal functional gene expression could be ascertained from AF supernatant. RNA was extracted and converted to cDNA from 19 AF supernatant samples of euploid fetuses between 15 to 20 weeks of gestation, and transcript abundance of 21 genes was measured. Statistically significant differences in expression, as a function of advancing gestational age, were observed for 5 of 21 genes. ANXA5, GUSB, and PPIA showed decreasing gene expression over time, whereas CASC3 and ZNF264 showed increasing gene expression over time. Statistically significantly increased expression of MTOR and STAT2 was seen in female compared with male fetuses. This study demonstrates the feasibility of focused fetal gene expression analysis using SNAP technology. In the future, this technique could be optimized to examine specific genes instrumental in fetal organ system function, which could be a useful addition to prenatal care. PMID:21827969

  7. High-level accumulation of recombinant miraculin protein in transgenic tomatoes expressing a synthetic miraculin gene with optimized codon usage terminated by the native miraculin terminator.

    PubMed

    Hiwasa-Tanase, Kyoko; Nyarubona, Mpanja; Hirai, Tadayoshi; Kato, Kazuhisa; Ichikawa, Takanari; Ezura, Hiroshi

    2011-01-01

    In our previous study, a transgenic tomato line that expressed the MIR gene under control of the cauliflower mosaic virus 35S promoter and the nopaline synthase terminator (tNOS) produced the taste-modifying protein miraculin (MIR). However, the concentration of MIR in the tomatoes was lower than that in the MIR gene's native miracle fruit. To increase MIR production, the native MIR terminator (tMIR) was used and a synthetic gene encoding MIR protein (sMIR) was designed to optimize its codon usage for tomato. Four different combinations of these genes and terminators (MIR-tNOS, MIR-tMIR, sMIR-tNOS and sMIR-tMIR) were constructed and used for transformation. The average MIR concentrations in MIR-tNOS, MIR-tMIR, sMIR-tNOS and sMIR-tMIR fruits were 131, 197, 128 and 287 μg/g fresh weight, respectively. The MIR concentrations using tMIR were higher than those using tNOS. The highest MIR accumulation was detected in sMIR-tMIR fruits. On the other hand, the MIR concentration was largely unaffected by sMIR-tNOS. The expression levels of both MIR and sMIR mRNAs terminated by tMIR tended to be higher than those terminated by tNOS. Read-through mRNA transcripts terminated by tNOS were much longer than those terminated by tMIR. These results suggest that tMIR enhances mRNA expression and permits the multiplier effect of optimized codon usage.

  8. Automated Protocol for Large-Scale Modeling of Gene Expression Data.

    PubMed

    Hall, Michelle Lynn; Calkins, David; Sherman, Woody

    2016-11-28

    With the continued rise of phenotypic- and genotypic-based screening projects, computational methods to analyze, process, and ultimately make predictions in this field take on growing importance. Here we show how automated machine learning workflows can produce models that are predictive of differential gene expression as a function of a compound structure using data from A673 cells as a proof of principle. In particular, we present predictive models with an average accuracy of greater than 70% across a highly diverse ∼1000 gene expression profile. In contrast to the usual in silico design paradigm, where one interrogates a particular target-based response, this work opens the opportunity for virtual screening and lead optimization for desired multitarget gene expression profiles.

  9. Gene Expression Profile Analysis is Directly Affected by the Selected Reference Gene: The Case of Leaf-Cutting Atta Sexdens

    PubMed Central

    Máximo, Wesley P. F.; Zanetti, Ronald; Paiva, Luciano V.

    2018-01-01

    Although several ant species are important targets for the development of molecular control strategies, only a few studies focus on identifying and validating reference genes for quantitative reverse transcription polymerase chain reaction (RT-qPCR) data normalization. We provide here an extensive study to identify and validate suitable reference genes for gene expression analysis in the ant Atta sexdens, a threatening agricultural pest in South America. The optimal number of reference genes varies according to each sample and the result generated by RefFinder differed about which is the most suitable reference gene. Results suggest that the RPS16, NADH and SDHB genes were the best reference genes in the sample pool according to stability values. The SNF7 gene expression pattern was stable in all evaluated sample set. In contrast, when using less stable reference genes for normalization a large variability in SNF7 gene expression was recorded. There is no universal reference gene suitable for all conditions under analysis, since these genes can also participate in different cellular functions, thus requiring a systematic validation of possible reference genes for each specific condition. The choice of reference genes on SNF7 gene normalization confirmed that unstable reference genes might drastically change the expression profile analysis of target candidate genes. PMID:29419794

  10. Selection of Reliable Reference Genes for Gene Expression Studies of a Promising Oilseed Crop, Plukenetia volubilis, by Real-Time Quantitative PCR.

    PubMed

    Niu, Longjian; Tao, Yan-Bin; Chen, Mao-Sheng; Fu, Qiantang; Li, Chaoqiong; Dong, Yuling; Wang, Xiulan; He, Huiying; Xu, Zeng-Fu

    2015-06-03

    Real-time quantitative PCR (RT-qPCR) is a reliable and widely used method for gene expression analysis. The accuracy of the determination of a target gene expression level by RT-qPCR demands the use of appropriate reference genes to normalize the mRNA levels among different samples. However, suitable reference genes for RT-qPCR have not been identified in Sacha inchi (Plukenetia volubilis), a promising oilseed crop known for its polyunsaturated fatty acid (PUFA)-rich seeds. In this study, using RT-qPCR, twelve candidate reference genes were examined in seedlings and adult plants, during flower and seed development and for the entire growth cycle of Sacha inchi. Four statistical algorithms (delta cycle threshold (ΔCt), BestKeeper, geNorm, and NormFinder) were used to assess the expression stabilities of the candidate genes. The results showed that ubiquitin-conjugating enzyme (UCE), actin (ACT) and phospholipase A22 (PLA) were the most stable genes in Sacha inchi seedlings. For roots, stems, leaves, flowers, and seeds from adult plants, 30S ribosomal protein S13 (RPS13), cyclophilin (CYC) and elongation factor-1alpha (EF1α) were recommended as reference genes for RT-qPCR. During the development of reproductive organs, PLA, ACT and UCE were the optimal reference genes for flower development, whereas UCE, RPS13 and RNA polymerase II subunit (RPII) were optimal for seed development. Considering the entire growth cycle of Sacha inchi, UCE, ACT and EF1α were sufficient for the purpose of normalization. Our results provide useful guidelines for the selection of reliable reference genes for the normalization of RT-qPCR data for seedlings and adult plants, for reproductive organs, and for the entire growth cycle of Sacha inchi.

  11. Simulated maximum likelihood method for estimating kinetic rates in gene expression.

    PubMed

    Tian, Tianhai; Xu, Songlin; Gao, Junbin; Burrage, Kevin

    2007-01-01

    Kinetic rate in gene expression is a key measurement of the stability of gene products and gives important information for the reconstruction of genetic regulatory networks. Recent developments in experimental technologies have made it possible to measure the numbers of transcripts and protein molecules in single cells. Although estimation methods based on deterministic models have been proposed aimed at evaluating kinetic rates from experimental observations, these methods cannot tackle noise in gene expression that may arise from discrete processes of gene expression, small numbers of mRNA transcript, fluctuations in the activity of transcriptional factors and variability in the experimental environment. In this paper, we develop effective methods for estimating kinetic rates in genetic regulatory networks. The simulated maximum likelihood method is used to evaluate parameters in stochastic models described by either stochastic differential equations or discrete biochemical reactions. Different types of non-parametric density functions are used to measure the transitional probability of experimental observations. For stochastic models described by biochemical reactions, we propose to use the simulated frequency distribution to evaluate the transitional density based on the discrete nature of stochastic simulations. The genetic optimization algorithm is used as an efficient tool to search for optimal reaction rates. Numerical results indicate that the proposed methods can give robust estimations of kinetic rates with good accuracy.

  12. With Reference to Reference Genes: A Systematic Review of Endogenous Controls in Gene Expression Studies.

    PubMed

    Chapman, Joanne R; Waldenström, Jonas

    2015-01-01

    The choice of reference genes that are stably expressed amongst treatment groups is a crucial step in real-time quantitative PCR gene expression studies. Recent guidelines have specified that a minimum of two validated reference genes should be used for normalisation. However, a quantitative review of the literature showed that the average number of reference genes used across all studies was 1.2. Thus, the vast majority of studies continue to use a single gene, with β-actin (ACTB) and/or glyceraldehyde 3-phosphate dehydrogenase (GAPDH) being commonly selected in studies of vertebrate gene expression. Few studies (15%) tested a panel of potential reference genes for stability of expression before using them to normalise data. Amongst studies specifically testing reference gene stability, few found ACTB or GAPDH to be optimal, whereby these genes were significantly less likely to be chosen when larger panels of potential reference genes were screened. Fewer reference genes were tested for stability in non-model organisms, presumably owing to a dearth of available primers in less well characterised species. Furthermore, the experimental conditions under which real-time quantitative PCR analyses were conducted had a large influence on the choice of reference genes, whereby different studies of rat brain tissue showed different reference genes to be the most stable. These results highlight the importance of validating the choice of normalising reference genes before conducting gene expression studies.

  13. Formation of friable embryogenic callus in cassava is enhanced under conditions of reduced nitrate, potassium and phosphate

    PubMed Central

    Utsumi, Yoshinori; Utsumi, Chikako; Tanaka, Maho; Ha, Vu The; Matsui, Akihiro; Takahashi, Satoshi; Seki, Motoaki

    2017-01-01

    Agrobacterium-mediated transformation is an important research tool for the genetic improvement of cassava. The induction of friable embryogenic callus (FEC) is considered as a key step in cassava transformation. In the present study, the media composition was optimized for enhancing the FEC induction, and the effect of the optimized medium on gene expression was evaluated. In relative comparison to MS medium, results demonstrated that using a medium with reducing nutrition (a 10-fold less concentration of nitrogen, potassium, and phosphate), the increased amount of vitamin B1 (10 mg/L) and the use of picrolam led to reprogram non-FEC to FEC. Gene expression analyses revealed that FEC on modified media increased the expression of genes related to the regulation of polysaccharide biosynthesis and breakdown of cell wall components in comparison to FEC on normal CIM media, whereas the gene expression associated with energy flux was not dramatically altered. It is hypothesized that we reprogram non-FEC to FEC under low nitrogen, potassium and phosphate and high vitamin B1. These findings were more effective in inducing FEC formation than the previous protocol. It might contribute to development of an efficient transformation strategy in cassava. PMID:28806727

  14. Mechanisms and Evolution of Control Logic in Prokaryotic Transcriptional Regulation

    PubMed Central

    van Hijum, Sacha A. F. T.; Medema, Marnix H.; Kuipers, Oscar P.

    2009-01-01

    Summary: A major part of organismal complexity and versatility of prokaryotes resides in their ability to fine-tune gene expression to adequately respond to internal and external stimuli. Evolution has been very innovative in creating intricate mechanisms by which different regulatory signals operate and interact at promoters to drive gene expression. The regulation of target gene expression by transcription factors (TFs) is governed by control logic brought about by the interaction of regulators with TF binding sites (TFBSs) in cis-regulatory regions. A factor that in large part determines the strength of the response of a target to a given TF is motif stringency, the extent to which the TFBS fits the optimal TFBS sequence for a given TF. Advances in high-throughput technologies and computational genomics allow reconstruction of transcriptional regulatory networks in silico. To optimize the prediction of transcriptional regulatory networks, i.e., to separate direct regulation from indirect regulation, a thorough understanding of the control logic underlying the regulation of gene expression is required. This review summarizes the state of the art of the elements that determine the functionality of TFBSs by focusing on the molecular biological mechanisms and evolutionary origins of cis-regulatory regions. PMID:19721087

  15. Selection and Validation of Reference Genes for Quantitative Real-Time PCR in Buckwheat (Fagopyrum esculentum) Based on Transcriptome Sequence Data

    PubMed Central

    Demidenko, Natalia V.; Logacheva, Maria D.; Penin, Aleksey A.

    2011-01-01

    Quantitative reverse transcription PCR (qRT-PCR) is one of the most precise and widely used methods of gene expression analysis. A necessary prerequisite of exact and reliable data is the accurate choice of reference genes. We studied the expression stability of potential reference genes in common buckwheat (Fagopyrum esculentum) in order to find the optimal reference for gene expression analysis in this economically important crop. Recently sequenced buckwheat floral transcriptome was used as source of sequence information. Expression stability of eight candidate reference genes was assessed in different plant structures (leaves and inflorescences at two stages of development and fruits). These genes are the orthologs of Arabidopsis genes identified as stable in a genome-wide survey gene of expression stability and a traditionally used housekeeping gene GAPDH. Three software applications – geNorm, NormFinder and BestKeeper - were used to estimate expression stability and provided congruent results. The orthologs of AT4G33380 (expressed protein of unknown function, Expressed1), AT2G28390 (SAND family protein, SAND) and AT5G46630 (clathrin adapter complex subunit family protein, CACS) are revealed as the most stable. We recommend using the combination of Expressed1, SAND and CACS for the normalization of gene expression data in studies on buckwheat using qRT-PCR. These genes are listed among five the most stably expressed in Arabidopsis that emphasizes utility of the studies on model plants as a framework for other species. PMID:21589908

  16. Selection and assessment of reference genes for quantitative PCR normalization in migratory locust Locusta migratoria (Orthoptera: Acrididae).

    PubMed

    Yang, Qingpo; Li, Zhen; Cao, Jinjun; Zhang, Songdou; Zhang, Huaijiang; Wu, Xiaoyun; Zhang, Qingwen; Liu, Xiaoxia

    2014-01-01

    Locusta migratoria is a classic hemimetamorphosis insect and has caused widespread economic damage to crops as a migratory pest. Researches on the expression pattern of functional genes in L. migratoria have drawn focus in recent years, especially with the release of genome information. Real-time quantitative PCR is the most reproducible and sensitive approach for detecting transcript expression levels of target genes, but optimal internal standards are key factors for its accuracy and reliability. Therefore, it's necessary to provide a systematic stability assessment of internal control for well-performed tests of target gene expression profile. In this study, twelve candidate genes (Ach, Act, Cht2, EF1α, RPL32, Hsp70, Tub, RP49, SDH, GAPDH, 18S, and His) were analyzed with four statistical methods: the delta Ct approach, geNorm, Bestkeeper and NormFinder. The results from these analyses aimed to choose the best suitable reference gene across different experimental situations for gene profile study in L. migratoria. The result demonstrated that for different developmental stages, EF1α, Hsp70 and RPL32 exhibited the most stable expression status for all samples; EF1α and RPL32 were selected as the best reference genes for studies involving embryo and larvae stages, while SDH and RP49 were identified for adult stage. The best-ranked reference genes across different tissues are RPL32, Hsp70 and RP49. For abiotic treatments, the most appropriate genes we identified were as follows: Act and SDH for larvae subjected to different insecticides; RPL32 and Ach for larvae exposed to different temperature treatments; and Act and Ach for larvae suffering from starvation. The present report should facilitate future researches on gene expression in L. migratoria with accessibly optimal reference genes under different experimental contexts.

  17. Comparative evolutionary genomics of Corynebacterium with special reference to codon and amino acid usage diversities.

    PubMed

    Pal, Shilpee; Sarkar, Indrani; Roy, Ayan; Mohapatra, Pradeep K Das; Mondal, Keshab C; Sen, Arnab

    2018-02-01

    The present study has been aimed to the comparative analysis of high GC composition containing Corynebacterium genomes and their evolutionary study by exploring codon and amino acid usage patterns. Phylogenetic study by MLSA approach, indel analysis and BLAST matrix differentiated Corynebacterium species in pathogenic and non-pathogenic clusters. Correspondence analysis on synonymous codon usage reveals that, gene length, optimal codon frequencies and tRNA abundance affect the gene expression of Corynebacterium. Most of the optimal codons as well as translationally optimal codons are C ending i.e. RNY (R-purine, N-any nucleotide base, and Y-pyrimidine) and reveal translational selection pressure on codon bias of Corynebacterium. Amino acid usage is affected by hydrophobicity, aromaticity, protein energy cost, etc. Highly expressed genes followed the cost minimization hypothesis and are less diverged at their synonymous positions of codons. Functional analysis of core genes shows significant difference in pathogenic and non-pathogenic Corynebacterium. The study reveals close relationship between non-pathogenic and opportunistic pathogenic Corynebaterium as well as between molecular evolution and survival niches of the organism.

  18. Open source machine-learning algorithms for the prediction of optimal cancer drug therapies.

    PubMed

    Huang, Cai; Mezencev, Roman; McDonald, John F; Vannberg, Fredrik

    2017-01-01

    Precision medicine is a rapidly growing area of modern medical science and open source machine-learning codes promise to be a critical component for the successful development of standardized and automated analysis of patient data. One important goal of precision cancer medicine is the accurate prediction of optimal drug therapies from the genomic profiles of individual patient tumors. We introduce here an open source software platform that employs a highly versatile support vector machine (SVM) algorithm combined with a standard recursive feature elimination (RFE) approach to predict personalized drug responses from gene expression profiles. Drug specific models were built using gene expression and drug response data from the National Cancer Institute panel of 60 human cancer cell lines (NCI-60). The models are highly accurate in predicting the drug responsiveness of a variety of cancer cell lines including those comprising the recent NCI-DREAM Challenge. We demonstrate that predictive accuracy is optimized when the learning dataset utilizes all probe-set expression values from a diversity of cancer cell types without pre-filtering for genes generally considered to be "drivers" of cancer onset/progression. Application of our models to publically available ovarian cancer (OC) patient gene expression datasets generated predictions consistent with observed responses previously reported in the literature. By making our algorithm "open source", we hope to facilitate its testing in a variety of cancer types and contexts leading to community-driven improvements and refinements in subsequent applications.

  19. Transcriptome from circulating cells suggests dysregulated pathways associated with long-term recurrent events following first-time myocardial infarction.

    PubMed

    Suresh, Rahul; Li, Xing; Chiriac, Anca; Goel, Kashish; Terzic, Andre; Perez-Terzic, Carmen; Nelson, Timothy J

    2014-09-01

    Whole-genome gene expression analysis has been successfully utilized to diagnose, prognosticate, and identify potential therapeutic targets for high-risk cardiovascular diseases. However, the feasibility of this approach to identify outcome-related genes and dysregulated pathways following first-time myocardial infarction (AMI) remains unknown and may offer a novel strategy to detect affected expressome networks that predict long-term outcome. Whole-genome expression microarray on blood samples from normal cardiac function controls (n=21) and first-time AMI patients (n=31) within 48-hours post-MI revealed expected differential gene expression profiles enriched for inflammation and immune-response pathways. To determine molecular signatures at the time of AMI associated with long-term outcomes, transcriptional profiles from sub-groups of AMI patients with (n=5) or without (n=22) any recurrent events over an 18-month follow-up were compared. This analysis identified 559 differentially-expressed genes. Bioinformatic analysis of this differential gene-set for associated pathways revealed 1) increasing disease severity in AMI patients is associated with a decreased expression of genes involved in the developmental epithelial-to-mesenchymal transition pathway, and 2) modulation of cholesterol transport genes that include ABCA1, CETP, APOA1, and LDLR is associated with clinical outcome. Differentially regulated genes and modulated pathways were identified that were associated with recurrent cardiovascular outcomes in first-time AMI patients. This cell-based approach for risk stratification in AMI could represent a novel, non-invasive platform to anticipate modifiable pathways and therapeutic targets to optimize long-term outcome for AMI patients and warrants further study to determine the role of metabolic remodeling and regenerative processes required for optimal outcomes. Copyright © 2014 Elsevier Ltd. All rights reserved.

  20. Zipf's Law in Gene Expression

    NASA Astrophysics Data System (ADS)

    Furusawa, Chikara; Kaneko, Kunihiko

    2003-02-01

    Using data from gene expression databases on various organisms and tissues, including yeast, nematodes, human normal and cancer tissues, and embryonic stem cells, we found that the abundances of expressed genes exhibit a power-law distribution with an exponent close to -1; i.e., they obey Zipf’s law. Furthermore, by simulations of a simple model with an intracellular reaction network, we found that Zipf’s law of chemical abundance is a universal feature of cells where such a network optimizes the efficiency and faithfulness of self-reproduction. These findings provide novel insights into the nature of the organization of reaction dynamics in living cells.

  1. Generation of a Tet-On Expression System to Study Transactivation Ability of Tax-2.

    PubMed

    Bignami, Fabio; Sozzi, Riccardo Alessio; Pilotti, Elisabetta

    2017-01-01

    HTLV Tax proteins (Tax-1 and Tax-2) are known to be able to transactivate several host cellular genes involved in complex molecular pathways. Here, we describe a stable and regulated high-level expression model based on Tet-On system, to study the capacity of Tax-2 to transactivate host genes. In particular, the Jurkat Tet-On cell line suitable for evaluating the ability of Tax-2 to stimulate transactivation of a specific host gene, CCL3L1 (C-C motif chemokine ligand 3 like 1 gene), was selected. Then, a plasmid expressing tax-2 gene under control of a tetracycline-response element was constructed. To avoid the production of a fusion protein between the report gene and the inserted gene, a bidirectional plasmid was designed. Maximum expression and fast response time were achieved by using nucleofection technology as transfection method. After developing an optimized protocol for efficiently transferring tax-2 gene in Jurkat Tet-On cellular model and exposing transfected cells to Dox (doxycycline, a tetracycline derivate), a kinetics of tax-2 expression through TaqMan Real-time PCR assay was determined.

  2. Cellular reprogramming dynamics follow a simple 1D reaction coordinate

    NASA Astrophysics Data System (ADS)

    Teja Pusuluri, Sai; Lang, Alex H.; Mehta, Pankaj; Castillo, Horacio E.

    2018-01-01

    Cellular reprogramming, the conversion of one cell type to another, induces global changes in gene expression involving thousands of genes, and understanding how cells globally alter their gene expression profile during reprogramming is an ongoing problem. Here we reanalyze time-course data on cellular reprogramming from differentiated cell types to induced pluripotent stem cells (iPSCs) and show that gene expression dynamics during reprogramming follow a simple 1D reaction coordinate. This reaction coordinate is independent of both the time it takes to reach the iPSC state as well as the details of the experimental protocol used. Using Monte-Carlo simulations, we show that such a reaction coordinate emerges from epigenetic landscape models where cellular reprogramming is viewed as a ‘barrier-crossing’ process between cell fates. Overall, our analysis and model suggest that gene expression dynamics during reprogramming follow a canonical trajectory consistent with the idea of an ‘optimal path’ in gene expression space for reprogramming.

  3. A general framework for optimization of probes for gene expression microarray and its application to the fungus Podospora anserina.

    PubMed

    Bidard, Frédérique; Imbeaud, Sandrine; Reymond, Nancie; Lespinet, Olivier; Silar, Philippe; Clavé, Corinne; Delacroix, Hervé; Berteaux-Lecellier, Véronique; Debuchy, Robert

    2010-06-18

    The development of new microarray technologies makes custom long oligonucleotide arrays affordable for many experimental applications, notably gene expression analyses. Reliable results depend on probe design quality and selection. Probe design strategy should cope with the limited accuracy of de novo gene prediction programs, and annotation up-dating. We present a novel in silico procedure which addresses these issues and includes experimental screening, as an empirical approach is the best strategy to identify optimal probes in the in silico outcome. We used four criteria for in silico probe selection: cross-hybridization, hairpin stability, probe location relative to coding sequence end and intron position. This latter criterion is critical when exon-intron gene structure predictions for intron-rich genes are inaccurate. For each coding sequence (CDS), we selected a sub-set of four probes. These probes were included in a test microarray, which was used to evaluate the hybridization behavior of each probe. The best probe for each CDS was selected according to three experimental criteria: signal-to-noise ratio, signal reproducibility, and representative signal intensities. This procedure was applied for the development of a gene expression Agilent platform for the filamentous fungus Podospora anserina and the selection of a single 60-mer probe for each of the 10,556 P. anserina CDS. A reliable gene expression microarray version based on the Agilent 44K platform was developed with four spot replicates of each probe to increase statistical significance of analysis.

  4. Selection of reference genes for qRT-PCR analysis of gene expression in sea cucumber Apostichopus japonicus during aestivation

    NASA Astrophysics Data System (ADS)

    Zhao, Ye; Chen, Muyan; Wang, Tianming; Sun, Lina; Xu, Dongxue; Yang, Hongsheng

    2014-11-01

    Quantitative real-time reverse transcription-polymerase chain reaction (qRT-PCR) is a technique that is widely used for gene expression analysis, and its accuracy depends on the expression stability of the internal reference genes used as normalization factors. However, many applications of qRT-PCR used housekeeping genes as internal controls without validation. In this study, the expression stability of eight candidate reference genes in three tissues (intestine, respiratory tree, and muscle) of the sea cucumber Apostichopus japonicus was assessed during normal growth and aestivation using the geNorm, NormFinder, delta CT, and RefFinder algorithms. The results indicate that the reference genes exhibited significantly different expression patterns among the three tissues during aestivation. In general, the β-tubulin (TUBB) gene was relatively stable in the intestine and respiratory tree tissues. The optimal reference gene combination for intestine was 40S ribosomal protein S18 (RPS18), TUBB, and NADH dehydrogenase (NADH); for respiratory tree, it was β-actin (ACTB), TUBB, and succinate dehydrogenase cytochrome B small subunit (SDHC); and for muscle it was α-tubulin (TUBA) and NADH dehydrogenase [ubiquinone] 1 α subcomplex subunit 13 (NDUFA13). These combinations of internal control genes should be considered for use in further studies of gene expression in A. japonicus during aestivation.

  5. Multiplex titration RT-PCR: rapid determination of gene expression patterns for a large number of genes

    NASA Technical Reports Server (NTRS)

    Nebenfuhr, A.; Lomax, T. L.

    1998-01-01

    We have developed an improved method for determination of gene expression levels with RT-PCR. The procedure is rapid and does not require extensive optimization or densitometric analysis. Since the detection of individual transcripts is PCR-based, small amounts of tissue samples are sufficient for the analysis of expression patterns in large gene families. Using this method, we were able to rapidly screen nine members of the Aux/IAA family of auxin-responsive genes and identify those genes which vary in message abundance in a tissue- and light-specific manner. While not offering the accuracy of conventional semi-quantitative or competitive RT-PCR, our method allows quick screening of large numbers of genes in a wide range of RNA samples with just a thermal cycler and standard gel analysis equipment.

  6. Validation of the β-amy1 transcription profiling assay and selection of reference genes suited for a RT-qPCR assay in developing barley caryopsis.

    PubMed

    Ovesná, Jaroslava; Kučera, Ladislav; Vaculová, Kateřina; Štrymplová, Kamila; Svobodová, Ilona; Milella, Luigi

    2012-01-01

    Reverse transcription coupled with real-time quantitative PCR (RT-qPCR) is a frequently used method for gene expression profiling. Reference genes (RGs) are commonly employed to normalize gene expression data. A limited information exist on the gene expression and profiling in developing barley caryopsis. Expression stability was assessed by measuring the cycle threshold (Ct) range and applying both the GeNorm (pair-wise comparison of geometric means) and Normfinder (model-based approach) principles for the calculation. Here, we have identified a set of four RGs suitable for studying gene expression in the developing barley caryopsis. These encode the proteins GAPDH, HSP90, HSP70 and ubiquitin. We found a correlation between the frequency of occurrence of a transcript in silico and its suitability as an RG. This set of RGs was tested by comparing the normalized level of β-amylase (β-amy1) transcript with directly measured quantities of the BMY1 gene product in the developing barley caryopsis. This panel of genes could be used for other gene expression studies, as well as to optimize β-amy1 analysis for study of the impact of β-amy1 expression upon barley end-use quality.

  7. Fungal and host transcriptome analysis of pH-regulated genes during colonization of apple fruits by Penicillium expansum.

    PubMed

    Barad, Shiri; Sela, Noa; Kumar, Dilip; Kumar-Dubey, Amit; Glam-Matana, Nofar; Sherman, Amir; Prusky, Dov

    2016-05-04

    Penicillium expansum is a destructive phytopathogen that causes decay in deciduous fruits during postharvest handling and storage. During colonization the fungus secretes D-gluconic acid (GLA), which modulates environmental pH and regulates mycotoxin accumulation in colonized tissue. Till now no transcriptomic analysis has addressed the specific contribution of the pathogen's pH regulation to the P. expansum colonization process. For this purpose total RNA from the leading edge of P. expansum-colonized apple tissue of cv. 'Golden Delicious' and from fungal cultures grown under pH 4 or 7 were sequenced and their gene expression patterns were compared. We present a large-scale analysis of the transcriptome data of P. expansum and apple response to fungal colonization. The fungal analysis revealed nine different clusters of gene expression patterns that were divided among three major groups in which the colonized tissue showed, respectively: (i) differing transcript expression patterns between mycelial growth at pH 4 and pH 7; (ii) similar transcript expression patterns of mycelial growth at pH 4; and (iii) similar transcript expression patterns of mycelial growth at pH 7. Each group was functionally characterized in order to decipher genes that are important for pH regulation and also for colonization of apple fruits by Penicillium. Furthermore, comparison of gene expression of healthy apple tissue with that of colonized tissue showed that differentially expressed genes revealed up-regulation of the jasmonic acid and mevalonate pathways, and also down-regulation of the glycogen and starch biosynthesis pathways. Overall, we identified important genes and functionalities of P. expansum that were controlled by the environmental pH. Differential expression patterns of genes belonging to the same gene family suggest that genes were selectively activated according to their optimal environmental conditions (pH, in vitro or in vivo) to enable the fungus to cope with varying conditions and to make optimal use of available enzymes. Comparison between the activation of the colonized host's gene responses by alkalizing Colletotrichum gloeosporioides and acidifying P. expansum pathogens indicated similar gene response patterns, but stronger responses to P. expansum, suggesting the importance of acidification by P. expansum as a factor in its increased aggressiveness.

  8. Oxaloacetate and malate production in engineered Escherichia coli by expression of codon-optimized phosphoenolpyruvate carboxylase2 gene from Dunaliella salina.

    PubMed

    Park, Soohyun; Chang, Kwang Suk; Jin, Eonseon; Pack, Seung Pil; Lee, Jinwon

    2013-01-01

    A new phosphoenolpyruvate carboxylase (PEPC) gene of Dunaliella salina is identified using homology analysis was conducted using PEPC gene of Chlamydomonas reinhardtii and Arabidopsis thaliana. Recombinant E. coli SGJS115 with increased production of malate and oxaloacetate was developed by introducing codon-optimized phosphoenolpyruvate carboxylase2 (OPDSPEPC2) gene of Dunaliella salina. E. coli SGJS115 yielded a 9.9 % increase in malate production. In addition, E. coli SGJS115 exhibited two times increase in the yield of oxaloacetate over the E. coli SGJS114 having identified PEPC2 gene obtained from Dunaliella salina.

  9. Gene expression profiling gut microbiota in different races of humans

    NASA Astrophysics Data System (ADS)

    Chen, Lei; Zhang, Yu-Hang; Huang, Tao; Cai, Yu-Dong

    2016-03-01

    The gut microbiome is shaped and modified by the polymorphisms of microorganisms in the intestinal tract. Its composition shows strong individual specificity and may play a crucial role in the human digestive system and metabolism. Several factors can affect the composition of the gut microbiome, such as eating habits, living environment, and antibiotic usage. Thus, various races are characterized by different gut microbiome characteristics. In this present study, we studied the gut microbiomes of three different races, including individuals of Asian, European and American races. The gut microbiome and the expression levels of gut microbiome genes were analyzed in these individuals. Advanced feature selection methods (minimum redundancy maximum relevance and incremental feature selection) and four machine-learning algorithms (random forest, nearest neighbor algorithm, sequential minimal optimization, Dagging) were employed to capture key differentially expressed genes. As a result, sequential minimal optimization was found to yield the best performance using the 454 genes, which could effectively distinguish the gut microbiomes of different races. Our analyses of extracted genes support the widely accepted hypotheses that eating habits, living environments and metabolic levels in different races can influence the characteristics of the gut microbiome.

  10. Gene expression profiling gut microbiota in different races of humans

    PubMed Central

    Chen, Lei; Zhang, Yu-Hang; Huang, Tao; Cai, Yu-Dong

    2016-01-01

    The gut microbiome is shaped and modified by the polymorphisms of microorganisms in the intestinal tract. Its composition shows strong individual specificity and may play a crucial role in the human digestive system and metabolism. Several factors can affect the composition of the gut microbiome, such as eating habits, living environment, and antibiotic usage. Thus, various races are characterized by different gut microbiome characteristics. In this present study, we studied the gut microbiomes of three different races, including individuals of Asian, European and American races. The gut microbiome and the expression levels of gut microbiome genes were analyzed in these individuals. Advanced feature selection methods (minimum redundancy maximum relevance and incremental feature selection) and four machine-learning algorithms (random forest, nearest neighbor algorithm, sequential minimal optimization, Dagging) were employed to capture key differentially expressed genes. As a result, sequential minimal optimization was found to yield the best performance using the 454 genes, which could effectively distinguish the gut microbiomes of different races. Our analyses of extracted genes support the widely accepted hypotheses that eating habits, living environments and metabolic levels in different races can influence the characteristics of the gut microbiome. PMID:26975620

  11. mRMR-ABC: A Hybrid Gene Selection Algorithm for Cancer Classification Using Microarray Gene Expression Profiling

    PubMed Central

    Alshamlan, Hala; Badr, Ghada; Alohali, Yousef

    2015-01-01

    An artificial bee colony (ABC) is a relatively recent swarm intelligence optimization approach. In this paper, we propose the first attempt at applying ABC algorithm in analyzing a microarray gene expression profile. In addition, we propose an innovative feature selection algorithm, minimum redundancy maximum relevance (mRMR), and combine it with an ABC algorithm, mRMR-ABC, to select informative genes from microarray profile. The new approach is based on a support vector machine (SVM) algorithm to measure the classification accuracy for selected genes. We evaluate the performance of the proposed mRMR-ABC algorithm by conducting extensive experiments on six binary and multiclass gene expression microarray datasets. Furthermore, we compare our proposed mRMR-ABC algorithm with previously known techniques. We reimplemented two of these techniques for the sake of a fair comparison using the same parameters. These two techniques are mRMR when combined with a genetic algorithm (mRMR-GA) and mRMR when combined with a particle swarm optimization algorithm (mRMR-PSO). The experimental results prove that the proposed mRMR-ABC algorithm achieves accurate classification performance using small number of predictive genes when tested using both datasets and compared to previously suggested methods. This shows that mRMR-ABC is a promising approach for solving gene selection and cancer classification problems. PMID:25961028

  12. mRMR-ABC: A Hybrid Gene Selection Algorithm for Cancer Classification Using Microarray Gene Expression Profiling.

    PubMed

    Alshamlan, Hala; Badr, Ghada; Alohali, Yousef

    2015-01-01

    An artificial bee colony (ABC) is a relatively recent swarm intelligence optimization approach. In this paper, we propose the first attempt at applying ABC algorithm in analyzing a microarray gene expression profile. In addition, we propose an innovative feature selection algorithm, minimum redundancy maximum relevance (mRMR), and combine it with an ABC algorithm, mRMR-ABC, to select informative genes from microarray profile. The new approach is based on a support vector machine (SVM) algorithm to measure the classification accuracy for selected genes. We evaluate the performance of the proposed mRMR-ABC algorithm by conducting extensive experiments on six binary and multiclass gene expression microarray datasets. Furthermore, we compare our proposed mRMR-ABC algorithm with previously known techniques. We reimplemented two of these techniques for the sake of a fair comparison using the same parameters. These two techniques are mRMR when combined with a genetic algorithm (mRMR-GA) and mRMR when combined with a particle swarm optimization algorithm (mRMR-PSO). The experimental results prove that the proposed mRMR-ABC algorithm achieves accurate classification performance using small number of predictive genes when tested using both datasets and compared to previously suggested methods. This shows that mRMR-ABC is a promising approach for solving gene selection and cancer classification problems.

  13. Microarray expression profiling in adhesion and normal peritoneal tissues.

    PubMed

    Ambler, Dana R; Golden, Alicia M; Gell, Jennifer S; Saed, Ghassan M; Carey, David J; Diamond, Michael P

    2012-05-01

    To identify molecular markers associated with adhesion and normal peritoneal tissue using microarray expression profiling. Comparative study. University hospital. Five premenopausal women. Adhesion and normal peritoneal tissue samples were obtained from premenopausal women. Ribonucleic acid was extracted using standard protocols and processed for hybridization to Affymetrix Whole Transcript Human Gene Expression Chips. Microarray data were obtained from five different patients, each with adhesion tissue and normal peritoneal samples. Real-time polymerase chain reaction was performed for confirmation using standard protocols. Gene expression in postoperative adhesion and normal peritoneal tissues. A total of 1,263 genes were differentially expressed between adhesion and normal tissues. One hundred seventy-three genes were found to be up-regulated and 56 genes were down-regulated in the adhesion tissues compared with normal peritoneal tissues. The genes were sorted into functional categories according to Gene Ontology annotations. Twenty-six up-regulated genes and 11 down-regulated genes were identified with functions potentially relevant to the pathophysiology of postoperative adhesions. We evaluated and confirmed expression of 12 of these specific genes via polymerase chain reaction. The pathogenesis, natural history, and optimal treatment of postoperative adhesive disease remains unanswered. Microarray analysis of adhesions identified specific genes with increased and decreased expression when compared with normal peritoneum. Knowledge of these genes and ontologic pathways with altered expression provide targets for new therapies to treat patients who have or are at risk for postoperative adhesions. Copyright © 2012 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

  14. Characterization of the yeast copper-inducible promoter system in Arabidopsis thaliana

    NASA Technical Reports Server (NTRS)

    Granger, C. L.; Cyr, R. J.

    2001-01-01

    Inducible promoters or gene-switches are used to both spatially and temporally regulate gene expression. Such regulation can provide information concerning the function of a gene in a developmental context as well as avoid potential harmful effects due to overexpression. A gfp construct under the control of a copper-inducible promoter was introduced into Arabidopsis thaliana (L.) Heynh. and the regulatory parameters of this inducible promoter were determined. Here, we describe the time-course of up- and down-regulation of GFP expression in response to copper level, the optimal regulatory levels of copper, and the tissue specificity of expression in three transgenic lines. We conclude that the copper-inducible promoter system may be useful in regulating the time and location of gene expression in A. thaliana.

  15. Preferential Allele Expression Analysis Identifies Shared Germline and Somatic Driver Genes in Advanced Ovarian Cancer

    PubMed Central

    Halabi, Najeeb M.; Martinez, Alejandra; Al-Farsi, Halema; Mery, Eliane; Puydenus, Laurence; Pujol, Pascal; Khalak, Hanif G.; McLurcan, Cameron; Ferron, Gwenael; Querleu, Denis; Al-Azwani, Iman; Al-Dous, Eman; Mohamoud, Yasmin A.; Malek, Joel A.; Rafii, Arash

    2016-01-01

    Identifying genes where a variant allele is preferentially expressed in tumors could lead to a better understanding of cancer biology and optimization of targeted therapy. However, tumor sample heterogeneity complicates standard approaches for detecting preferential allele expression. We therefore developed a novel approach combining genome and transcriptome sequencing data from the same sample that corrects for sample heterogeneity and identifies significant preferentially expressed alleles. We applied this analysis to epithelial ovarian cancer samples consisting of matched primary ovary and peritoneum and lymph node metastasis. We find that preferentially expressed variant alleles include germline and somatic variants, are shared at a relatively high frequency between patients, and are in gene networks known to be involved in cancer processes. Analysis at a patient level identifies patient-specific preferentially expressed alleles in genes that are targets for known drugs. Analysis at a site level identifies patterns of site specific preferential allele expression with similar pathways being impacted in the primary and metastasis sites. We conclude that genes with preferentially expressed variant alleles can act as cancer drivers and that targeting those genes could lead to new therapeutic strategies. PMID:26735499

  16. Sensitive dual color in vivo bioluminescence imaging using a new red codon optimized firefly luciferase and a green click beetle luciferase.

    PubMed

    Mezzanotte, Laura; Que, Ivo; Kaijzel, Eric; Branchini, Bruce; Roda, Aldo; Löwik, Clemens

    2011-04-22

    Despite a plethora of bioluminescent reporter genes being cloned and used for cell assays and molecular imaging purposes, the simultaneous monitoring of multiple events in small animals is still challenging. This is partly attributable to the lack of optimization of cell reporter gene expression as well as too much spectral overlap of the color-coupled reporter genes. A new red emitting codon-optimized luciferase reporter gene mutant of Photinus pyralis, Ppy RE8, has been developed and used in combination with the green click beetle luciferase, CBG99. Human embryonic kidney cells (HEK293) were transfected with vectors that expressed red Ppy RE8 and green CBG99 luciferases. Populations of red and green emitting cells were mixed in different ratios. After addition of the shared single substrate, D-luciferin, bioluminescent (BL) signals were imaged with an ultrasensitive cooled CCD camera using a series of band pass filters (20 nm). Spectral unmixing algorithms were applied to the images where good separation of signals was observed. Furthermore, HEK293 cells that expressed the two luciferases were injected at different depth in the animals. Spectrally-separate images and quantification of the dual BL signals in a mixed population of cells was achieved when cells were either injected subcutaneously or directly into the prostate. We report here the re-engineering of different luciferase genes for in vitro and in vivo dual color imaging applications to address the technical issues of using dual luciferases for imaging. In respect to previously used dual assays, our study demonstrated enhanced sensitivity combined with spatially separate BL spectral emissions using a suitable spectral unmixing algorithm. This new D-luciferin-dependent reporter gene couplet opens up the possibility in the future for more accurate quantitative gene expression studies in vivo by simultaneously monitoring two events in real time.

  17. Sensitive Dual Color In Vivo Bioluminescence Imaging Using a New Red Codon Optimized Firefly Luciferase and a Green Click Beetle Luciferase

    PubMed Central

    Mezzanotte, Laura; Que, Ivo; Kaijzel, Eric; Branchini, Bruce; Roda, Aldo; Löwik, Clemens

    2011-01-01

    Background Despite a plethora of bioluminescent reporter genes being cloned and used for cell assays and molecular imaging purposes, the simultaneous monitoring of multiple events in small animals is still challenging. This is partly attributable to the lack of optimization of cell reporter gene expression as well as too much spectral overlap of the color-coupled reporter genes. A new red emitting codon-optimized luciferase reporter gene mutant of Photinus pyralis, Ppy RE8, has been developed and used in combination with the green click beetle luciferase, CBG99. Principal Findings Human embryonic kidney cells (HEK293) were transfected with vectors that expressed red Ppy RE8 and green CBG99 luciferases. Populations of red and green emitting cells were mixed in different ratios. After addition of the shared single substrate, D-luciferin, bioluminescent (BL) signals were imaged with an ultrasensitive cooled CCD camera using a series of band pass filters (20 nm). Spectral unmixing algorithms were applied to the images where good separation of signals was observed. Furthermore, HEK293 cells that expressed the two luciferases were injected at different depth in the animals. Spectrally-separate images and quantification of the dual BL signals in a mixed population of cells was achieved when cells were either injected subcutaneously or directly into the prostate. Significance We report here the re-engineering of different luciferase genes for in vitro and in vivo dual color imaging applications to address the technical issues of using dual luciferases for imaging. In respect to previously used dual assays, our study demonstrated enhanced sensitivity combined with spatially separate BL spectral emissions using a suitable spectral unmixing algorithm. This new D-luciferin-dependent reporter gene couplet opens up the possibility in the future for more accurate quantitative gene expression studies in vivo by simultaneously monitoring two events in real time. PMID:21544210

  18. Different gene expressions between cattle and yak provide insights into high-altitude adaptation.

    PubMed

    Wang, K; Yang, Y; Wang, L; Ma, T; Shang, H; Ding, L; Han, J; Qiu, Q

    2016-02-01

    DNA sequence variation has been widely reported as the genetic basis for adaptation, in both humans and other animals, to the hypoxic environment experienced at high altitudes. However, little is known about the patterns of gene expression underlying such hypoxic adaptations. In this study, we examined the differences in the transcriptomes of four organs (heart, kidney, liver and lung) between yak and cattle, a pair of closely related species distributed at high and low altitudes respectively. Of the four organs examined, heart shows the greatest differentiation between the two species in terms of gene expression profiles. Detailed analyses demonstrated that some genes associated with the oxygen supply system and the defense systems that respond to threats of hypoxia are differentially expressed. In addition, genes with significantly differentiated patterns of expression in all organs exhibited an unexpected uniformity of regulation along with an elevated frequency of nonsynonymous substitutions. This co-evolution of protein sequences and gene expression patterns is likely to be correlated with the optimization of the yak metabolic system to resist hypoxia. © 2015 Stichting International Foundation for Animal Genetics.

  19. A Luciferase Reporter Gene System for High-Throughput Screening of γ-Globin Gene Activators.

    PubMed

    Xie, Wensheng; Silvers, Robert; Ouellette, Michael; Wu, Zining; Lu, Quinn; Li, Hu; Gallagher, Kathleen; Johnson, Kathy; Montoute, Monica

    2016-01-01

    Luciferase reporter gene assays have long been used for drug discovery due to their high sensitivity and robust signal. A dual reporter gene system contains a gene of interest and a control gene to monitor non-specific effects on gene expression. In our dual luciferase reporter gene system, a synthetic promoter of γ-globin gene was constructed immediately upstream of the firefly luciferase gene, followed downstream by a synthetic β-globin gene promoter in front of the Renilla luciferase gene. A stable cell line with the dual reporter gene was cloned and used for all assay development and HTS work. Due to the low activity of the control Renilla luciferase, only the firefly luciferase activity was further optimized for HTS. Several critical factors, such as cell density, serum concentration, and miniaturization, were optimized using tool compounds to achieve maximum robustness and sensitivity. Using the optimized reporter assay, the HTS campaign was successfully completed and approximately 1000 hits were identified. In this chapter, we also describe strategies to triage hits that non-specifically interfere with firefly luciferase.

  20. A modular and optimized single marker system for generating Trypanosoma brucei cell lines expressing T7 RNA polymerase and the tetracycline repressor.

    PubMed

    Poon, S K; Peacock, L; Gibson, W; Gull, K; Kelly, S

    2012-02-01

    Here, we present a simple modular extendable vector system for introducing the T7 RNA polymerase and tetracycline repressor genes into Trypanosoma brucei. This novel system exploits developments in our understanding of gene expression and genome organization to produce a streamlined plasmid optimized for high levels of expression of the introduced transgenes. We demonstrate the utility of this novel system in bloodstream and procyclic forms of Trypanosoma brucei, including the genome strain TREU927/4. We validate these cell lines using a variety of inducible experiments that recapture previously published lethal and non-lethal phenotypes. We further demonstrate the utility of the single marker (SmOx) TREU927/4 cell line for in vivo experiments in the tsetse fly and provide a set of plasmids that enable both whole-fly and salivary gland-specific inducible expression of transgenes.

  1. A modular and optimized single marker system for generating Trypanosoma brucei cell lines expressing T7 RNA polymerase and the tetracycline repressor

    PubMed Central

    Poon, S. K.; Peacock, L.; Gibson, W.; Gull, K.; Kelly, S.

    2012-01-01

    Here, we present a simple modular extendable vector system for introducing the T7 RNA polymerase and tetracycline repressor genes into Trypanosoma brucei. This novel system exploits developments in our understanding of gene expression and genome organization to produce a streamlined plasmid optimized for high levels of expression of the introduced transgenes. We demonstrate the utility of this novel system in bloodstream and procyclic forms of Trypanosoma brucei, including the genome strain TREU927/4. We validate these cell lines using a variety of inducible experiments that recapture previously published lethal and non-lethal phenotypes. We further demonstrate the utility of the single marker (SmOx) TREU927/4 cell line for in vivo experiments in the tsetse fly and provide a set of plasmids that enable both whole-fly and salivary gland-specific inducible expression of transgenes. PMID:22645659

  2. Stromal-derived factor 1 directly promotes genes expressed within the ovulatory cascade in feline cumulus oocyte complexes.

    PubMed

    Rojo, Julieta L; Linari, Martina; Young, Kelly A; Peluffo, Marina C

    2018-05-01

    We hypothesized that the chemokine SDF1/CXCR4 system was present in feline cumulus-oocyte complexes (COCs) and that COCs cultured with SDF1 would directly upregulate gene expression in the ovulatory cascade. Ovaries (n = 50) were obtained from adult domestic cats during the breeding season and COCs were recovered from antral follicles. Because IVM media triggers cumulus-oocyte expansion, culture conditions needed to be optimized to study periovulatory genes. After optimization, the effects of 25 ng/ml SDF1 and the CXCR4 inhibitor were examined in a COC culture for 3, 12, and 24 h. MEM-hepes with 1% of charcoal stripped-FBS was the optimized culture medium, assessed by the expansion of COCs at 24 h in the gonadotropin (GNT) group but not in the media with serum alone. The mRNA expression of HAS2, TNFAIP6, PTX3, and AREG peaked at 3 h in GNT group as compared to all other groups (p < 0.05). COCs cultured with SDF1 showed increased HAS2 and TNFAIP6 mRNA expression at 3 h compared to negative controls and to the CXCR4 inhibitor group. CXCR4 and SDF1 immunostaining was present in both cumulus cells and the oocyte. These results demonstrate that GNT stimulation upregulates key periovulatory genes and expansion in feline COCs from antral follicles, and support the use of this culture system to examine molecular processes within the COC. In addition, SDF1 directly promotes key periovulatory genes in feline COCs, suggesting that the SDF1-CXCR4 pathway may extend its function beyond a chemoattractant, and may play a direct role within the COC.

  3. Gene expression patterns during somatic embryo development and germination in maize Hi II callus cultures.

    PubMed

    Che, Ping; Love, Tanzy M; Frame, Bronwyn R; Wang, Kan; Carriquiry, Alicia L; Howell, Stephen H

    2006-09-01

    Gene expression patterns were profiled during somatic embryogenesis in a regeneration-proficient maize hybrid line, Hi II, in an effort to identify genes that might be used as developmental markers or targets to optimize regeneration steps for recovering maize plants from tissue culture. Gene expression profiles were generated from embryogenic calli induced to undergo embryo maturation and germination. Over 1,000 genes in the 12,060 element arrays showed significant time variation during somatic embryo development. A substantial number of genes were downregulated during embryo maturation, largely histone and ribosomal protein genes, which may result from a slowdown in cell proliferation and growth during embryo maturation. The expression of these genes dramatically recovered at germination. Other genes up-regulated during embryo maturation included genes encoding hydrolytic enzymes (nucleases, glucosidases and proteases) and a few storage genes (an alpha-zein and caleosin), which are good candidates for developmental marker genes. Germination is accompanied by the up-regulation of a number of stress response and membrane transporter genes, and, as expected, greening is associated with the up-regulation of many genes encoding photosynthetic and chloroplast components. Thus, some, but not all genes typically associated with zygotic embryogenesis are significantly up or down-regulated during somatic embryogenesis in Hi II maize line regeneration. Although many genes varied in expression throughout somatic embryo development in this study, no statistically significant gene expression changes were detected between total embryogenic callus and callus enriched for transition stage somatic embryos.

  4. ImpulseDE: detection of differentially expressed genes in time series data using impulse models.

    PubMed

    Sander, Jil; Schultze, Joachim L; Yosef, Nir

    2017-03-01

    Perturbations in the environment lead to distinctive gene expression changes within a cell. Observed over time, those variations can be characterized by single impulse-like progression patterns. ImpulseDE is an R package suited to capture these patterns in high throughput time series datasets. By fitting a representative impulse model to each gene, it reports differentially expressed genes across time points from a single or between two time courses from two experiments. To optimize running time, the code uses clustering and multi-threading. By applying ImpulseDE , we demonstrate its power to represent underlying biology of gene expression in microarray and RNA-Seq data. ImpulseDE is available on Bioconductor ( https://bioconductor.org/packages/ImpulseDE/ ). niryosef@berkeley.edu. Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com

  5. Identification of optimal reference genes for RT-qPCR in the rat hypothalamus and intestine for the study of obesity.

    PubMed

    Li, B; Matter, E K; Hoppert, H T; Grayson, B E; Seeley, R J; Sandoval, D A

    2014-02-01

    Obesity has a complicated metabolic pathology, and defining the underlying mechanisms of obesity requires integrative studies with molecular end points. Real-time quantitative PCR (RT-qPCR) is a powerful tool that has been widely utilized. However, the importance of using carefully validated reference genes in RT-qPCR seems to have been overlooked in obesity-related research. The objective of this study was to select a set of reference genes with stable expressions to be used for RT-qPCR normalization in rats under fasted vs re-fed and chow vs high-fat diet (HFD) conditions. Male long-Evans rats were treated under four conditions: chow/fasted, chow/re-fed, HFD/fasted and HFD/re-fed. Expression stabilities of 13 candidate reference genes were evaluated in the rat hypothalamus, duodenum, jejunum and ileum using the ReFinder software program. The optimal number of reference genes needed for RT-qPCR analyses was determined using geNorm. Using geNorm analysis, we found that it was sufficient to use the two most stably expressed genes as references in RT-qPCR analyses for each tissue under specific experimental conditions. B2M and RPLP0 in the hypothalamus, RPS18 and HMBS in the duodenum, RPLP2 and RPLP0 in the jejunum and RPS18 and YWHAZ in the ileum were the most suitable pairs for a normalization study when the four aforementioned experimental conditions were considered. Our study demonstrates that gene expression levels of reference genes commonly used in obesity-related studies, such as ACTB or RPS18, are altered by changes in acute or chronic energy status. These findings underline the importance of using reference genes that are stable in expression across experimental conditions when studying the rat hypothalamus and intestine, because these tissues have an integral role in the regulation of energy homeostasis. It is our hope that this study will raise awareness among obesity researchers on the essential need for reference gene validation in gene expression studies.

  6. Yeast Kluyveromyces lactis as host for expression of the bacterial lipase: cloning and adaptation of the new lipase gene from Serratia sp.

    PubMed

    Šiekštelė, Rimantas; Veteikytė, Aušra; Tvaska, Bronius; Matijošytė, Inga

    2015-10-01

    Many microbial lipases have been successfully expressed in yeasts, but not in industrially attractive Kluyveromyces lactis, which among other benefits can be cultivated on a medium supplemented with whey--cheap and easily available industrial waste. A new bacterial lipase from Serratia sp. was isolated and for the first time expressed into the yeast Kluyveromyces lactis by heterologous protein expression system based on a strong promoter of Kluyveromyces marxianus triosephosphate isomerase gene and signal peptide of Kluyveromyces marxianus endopolygalacturonase gene. In addition, the bacterial lipase gene was synthesized de novo by taking into account a codon usage bias optimal for K. lactis and was expressed into the yeast K. lactis also. Both resulting strains were characterized by high output level of the target protein secreted extracellularly. Secreted lipases were characterized for activity and stability.

  7. Secreted expression of Leuconostoc mesenteroides glucansucrase in Lactococcus lactis for the production of insoluble glucans

    USDA-ARS?s Scientific Manuscript database

    We expressed a glucansucrase, DsrI, from Leuconostoc mesenteroides that catalyzes formation of water-insoluble glucans from sucrose in Lactococcus lactis using a nisin-controlled gene expression system. Production of DsrI was optimized using several different background vectors, signal peptides, str...

  8. [Prokaryotic expression of recombinant prochymosin gene and its antiserum preparation].

    PubMed

    Li, Xin-ping; Liu, Huan-huan; Pu, Yan; Zhang, Fu-chun; Li, Yi-jie

    2012-07-01

    To optimize the prochymosin (pCHY) gene codons and express the gene in Escherichia coli (E.coli), and to prepare its antiserum and detect chymosin protein specifically. According to codon usage bias of E.coli, prochymosin gene sequence was synthesized based on the conserved sequences of prochymosin gene from bovine, lamb and camel, and then cloned into the plasmid pET-30a and pcDNA3-AAT-COMP-C3d3 (pcD-ACC), respectively. pET-30a-pCHY was expressed, as the detected antigen, in E.coli BL21(DE3) after IPTG induction. RT-PCR was used to detect prochymosin mRNA expression in liver from the mice injected pcDNA3-AAT-COMP-pCHY-C3d3(pACCC) by hydrodynamics-based transfection method. To prepare the antiserum of prochymosin, pACCC and GST-pCHY proteins were used to immunize New Zealand rabbits in accordance with DNA prime-protein boost strategy. Antibody levels were tested by ELISA. Western blotting showed the molecular weight of His-pCHY protein was about 55 000, similar to the expected molecular size. ELISA demonstrated that the titer level of prochymosin antiserum was high. Based on the codon optimization, we have obtained high-titer prochymosin antiserum through DNA vaccine vector pcD-ACC combined with DNA prime-protein boost strategy, similar to that by protein vaccine.

  9. Optimization of hCFTR Lung Expression in Mice Using DNA Nanoparticles

    PubMed Central

    Padegimas, Linas; Kowalczyk, Tomasz H; Adams, Sam; Gedeon, Chris R; Oette, Sharon M; Dines, Karla; Hyatt, Susannah L; Sesenoglu-Laird, Ozge; Tyr, Olena; Moen, Robert C; Cooper, Mark J

    2012-01-01

    Efficient and prolonged human cystic fibrosis transmembrane conductance regulator (hCFTR) expression is a major goal for cystic fibrosis (CF) lung therapy. A hCFTR expression plasmid was optimized as a payload for compacted DNA nanoparticles formulated with polyethylene glycol (PEG)-substituted 30-mer lysine peptides. A codon-optimized and CpG-reduced hCFTR synthetic gene (CO-CFTR) was placed in a polyubiquitin C expression plasmid. Compared to hCFTR complementary DNA (cDNA), CO-CFTR produced a ninefold increased level of hCFTR protein in transfected HEK293 cells and, when compacted as DNA nanoparticles, produced a similar improvement in lung mRNA expression in Balb/c and fatty acid binding protein promoter (FABP) CF mice, although expression duration was transient. Various vector modifications were tested to extend duration of CO-CFTR expression. A novel prolonged expression (PE) element derived from the bovine growth hormone (BGH) gene 3′ flanking sequence produced prolonged expression of CO-CFTR mRNA at biologically relevant levels. A time course study in the mouse lung revealed that CO-CFTR mRNA did not change significantly, with CO-CFTR/mCFTR geometric mean ratios of 94% on day 2, 71% on day 14, 53% on day 30, and 14% on day 59. Prolonged CO-CFTR expression is dependent on the orientation of the PE element and its transcription, is not specific to the UbC promoter, and is less dependent on other vector backbone elements. PMID:21952168

  10. HCV T Cell Receptor Chain Modifications to Enhance Expression, Pairing, and Antigen Recognition in T Cells for Adoptive Transfer.

    PubMed

    Foley, Kendra C; Spear, Timothy T; Murray, David C; Nagato, Kaoru; Garrett-Mayer, Elizabeth; Nishimura, Michael I

    2017-06-16

    T cell receptor (TCR)-gene-modified T cells for adoptive cell transfer can mediate objective clinical responses in melanoma and other malignancies. When introducing a second TCR, mispairing between the endogenous and introduced α and β TCR chains limits expression of the introduced TCR, which can result in impaired efficacy or off-target reactivity and autoimmunity. One approach to promote proper TCR chain pairing involves modifications of the introduced TCR genes: introducing a disulfide bridge, substituting murine for human constant regions, codon optimization, TCR chain leucine zipper fusions, and a single-chain TCR. We have introduced these modifications into our hepatitis C virus (HCV) reactive TCR and utilize a marker gene, CD34t, which allows us to directly compare transduction efficiency with TCR expression and T cell function. Our results reveal that of the TCRs tested, T cells expressing the murine Cβ2 TCR or leucine zipper TCR have the highest levels of expression and the highest percentage of lytic and interferon-γ (IFN-γ)-producing T cells. Our studies give us a better understanding of how TCR modifications impact TCR expression and T cell function that may allow for optimization of TCR-modified T cells for adoptive cell transfer to treat patients with malignancies.

  11. Digital gene expression analysis of gene expression differences within Brassica diploids and allopolyploids.

    PubMed

    Jiang, Jinjin; Wang, Yue; Zhu, Bao; Fang, Tingting; Fang, Yujie; Wang, Youping

    2015-01-27

    Brassica includes many successfully cultivated crop species of polyploid origin, either by ancestral genome triplication or by hybridization between two diploid progenitors, displaying complex repetitive sequences and transposons. The U's triangle, which consists of three diploids and three amphidiploids, is optimal for the analysis of complicated genomes after polyploidization. Next-generation sequencing enables the transcriptome profiling of polyploids on a global scale. We examined the gene expression patterns of three diploids (Brassica rapa, B. nigra, and B. oleracea) and three amphidiploids (B. napus, B. juncea, and B. carinata) via digital gene expression analysis. In total, the libraries generated between 5.7 and 6.1 million raw reads, and the clean tags of each library were mapped to 18547-21995 genes of B. rapa genome. The unambiguous tag-mapped genes in the libraries were compared. Moreover, the majority of differentially expressed genes (DEGs) were explored among diploids as well as between diploids and amphidiploids. Gene ontological analysis was performed to functionally categorize these DEGs into different classes. The Kyoto Encyclopedia of Genes and Genomes analysis was performed to assign these DEGs into approximately 120 pathways, among which the metabolic pathway, biosynthesis of secondary metabolites, and peroxisomal pathway were enriched. The non-additive genes in Brassica amphidiploids were analyzed, and the results indicated that orthologous genes in polyploids are frequently expressed in a non-additive pattern. Methyltransferase genes showed differential expression pattern in Brassica species. Our results provided an understanding of the transcriptome complexity of natural Brassica species. The gene expression changes in diploids and allopolyploids may help elucidate the morphological and physiological differences among Brassica species.

  12. The Relation of Codon Bias to Tissue-Specific Gene Expression in Arabidopsis thaliana

    PubMed Central

    Camiolo, Salvatore; Farina, Lorenzo; Porceddu, Andrea

    2012-01-01

    The codon composition of coding sequences plays an important role in the regulation of gene expression. Herein, we report systematic differences in the usage of synonymous codons among Arabidopsis thaliana genes that are expressed specifically in distinct tissues. Although we observed that both regionally and transcriptionally associated mutational biases were associated significantly with codon bias, they could not explain the observed differences fully. Similarly, given that transcript abundances did not account for the differences in codon usage, it is unlikely that selection for translational efficiency can account exclusively for the observed codon bias. Thus, we considered the possible evolution of codon bias as an adaptive response to the different abundances of tRNAs in different tissues. Our analysis demonstrated that in some cases, codon usage in genes that were expressed in a broad range of tissues was influenced primarily by the tissue in which the gene was expressed maximally. On the basis of this finding we propose that genes that are expressed in certain tissues might show a tissue-specific compositional signature in relation to codon usage. These findings might have implications for the design of transgenes in relation to optimizing their expression. PMID:22865738

  13. Transcript Profiling of Common Bean (Phaseolus vulgaris L.) Using the GeneChip(R) Soybean Genome Array: Optimizing Analysis by Masking Biased Probes

    USDA-ARS?s Scientific Manuscript database

    Common bean (Phaseolus vulgaris) and soybean (Glycine max) both belong to the Phaseoleae tribe and share significant coding sequence homology. This suggests that the GeneChip(R) Soybean Genome Array (soybean GeneChip) may be used for gene expression studies using common bean. To evaluate the utility...

  14. AMT1;1 transgenic rice plants with enhanced NH4 + permeability show superior growth and higher yield under optimal and suboptimal NH4 + conditions

    PubMed Central

    Rothstein, Steven J.

    2014-01-01

    The major source of nitrogen for rice (Oryza sativa L.) is ammonium (NH4 +). The NH4 + uptake of roots is mainly governed by membrane transporters, with OsAMT1;1 being a prominent member of the OsAMT1 gene family that is known to be involved in NH4 + transport in rice plants. However, little is known about its involvement in NH4 + uptake in rice roots and subsequent effects on NH4 + assimilation. This study shows that OsAMT1;1 is a constitutively expressed, nitrogen-responsive gene, and its protein product is localized in the plasma membrane. Its expression level is under the control of circadian rhythm. Transgenic rice lines (L-2 and L-3) overexpressing the OsAMT1;1 gene had the same root structure as the wild type (WT). However, they had 2-fold greater NH4 + permeability than the WT, whereas OsAMT1;1 gene expression was 20-fold higher than in the WT. Analogous to the expression, transgenic lines had a higher NH4 + content in the shoots and roots than the WT. Direct NH4 + fluxes in the xylem showed that the transgenic lines had significantly greater uptake rates than the WT. Higher NH4 + contents also promoted higher expression levels of genes in the nitrogen assimilation pathway, resulting in greater nitrogen assimilates, chlorophyll, starch, sugars, and grain yield in transgenic lines than in the WT under suboptimal and optimal nitrogen conditions. OsAMT1;1 also enhanced overall plant growth, especially under suboptimal NH4 + levels. These results suggest that OsAMT1;1 has the potential for improving nitrogen use efficiency, plant growth, and grain yield under both suboptimal and optimal nitrogen fertilizer conditions. PMID:24420570

  15. Pre-amplification in the context of high-throughput qPCR gene expression experiment.

    PubMed

    Korenková, Vlasta; Scott, Justin; Novosadová, Vendula; Jindřichová, Marie; Langerová, Lucie; Švec, David; Šídová, Monika; Sjöback, Robert

    2015-03-11

    With the introduction of the first high-throughput qPCR instrument on the market it became possible to perform thousands of reactions in a single run compared to the previous hundreds. In the high-throughput reaction, only limited volumes of highly concentrated cDNA or DNA samples can be added. This necessity can be solved by pre-amplification, which became a part of the high-throughput experimental workflow. Here, we focused our attention on the limits of the specific target pre-amplification reaction and propose the optimal, general setup for gene expression experiment using BioMark instrument (Fluidigm). For evaluating different pre-amplification factors following conditions were combined: four human blood samples from healthy donors and five transcripts having high to low expression levels; each cDNA sample was pre-amplified at four cycles (15, 18, 21, and 24) and five concentrations (equivalent to 0.078 ng, 0.32 ng, 1.25 ng, 5 ng, and 20 ng of total RNA). Factors identified as critical for a success of cDNA pre-amplification were cycle of pre-amplification, total RNA concentration, and type of gene. The selected pre-amplification reactions were further tested for optimal Cq distribution in a BioMark Array. The following concentrations combined with pre-amplification cycles were optimal for good quality samples: 20 ng of total RNA with 15 cycles of pre-amplification, 20x and 40x diluted; and 5 ng and 20 ng of total RNA with 18 cycles of pre-amplification, both 20x and 40x diluted. We set up upper limits for the bulk gene expression experiment using gene expression Dynamic Array and provided an easy-to-obtain tool for measuring of pre-amplification success. We also showed that variability of the pre-amplification, introduced into the experimental workflow of reverse transcription-qPCR, is lower than variability caused by the reverse transcription step.

  16. Identifying and engineering promoters for high level and sustainable therapeutic recombinant protein production in cultured mammalian cells.

    PubMed

    Ho, Steven C L; Yang, Yuansheng

    2014-08-01

    Promoters are essential on plasmid vectors to initiate transcription of the transgenes when generating therapeutic recombinant proteins expressing mammalian cell lines. High and sustained levels of gene expression are desired during therapeutic protein production while gene expression is useful for cell engineering. As many finely controlled promoters exhibit cell and product specificity, new promoters need to be identified, optimized and carefully evaluated before use. Suitable promoters can be identified using techniques ranging from simple molecular biology methods to modern high-throughput omics screenings. Promoter engineering is often required after identification to either obtain high and sustained expression or to provide a wider range of gene expression. This review discusses some of the available methods to identify and engineer promoters for therapeutic recombinant protein expression in mammalian cells.

  17. Harnessing Diversity towards the Reconstructing of Large Scale Gene Regulatory Networks

    PubMed Central

    Yamanaka, Ryota; Kitano, Hiroaki

    2013-01-01

    Elucidating gene regulatory network (GRN) from large scale experimental data remains a central challenge in systems biology. Recently, numerous techniques, particularly consensus driven approaches combining different algorithms, have become a potentially promising strategy to infer accurate GRNs. Here, we develop a novel consensus inference algorithm, TopkNet that can integrate multiple algorithms to infer GRNs. Comprehensive performance benchmarking on a cloud computing framework demonstrated that (i) a simple strategy to combine many algorithms does not always lead to performance improvement compared to the cost of consensus and (ii) TopkNet integrating only high-performance algorithms provide significant performance improvement compared to the best individual algorithms and community prediction. These results suggest that a priori determination of high-performance algorithms is a key to reconstruct an unknown regulatory network. Similarity among gene-expression datasets can be useful to determine potential optimal algorithms for reconstruction of unknown regulatory networks, i.e., if expression-data associated with known regulatory network is similar to that with unknown regulatory network, optimal algorithms determined for the known regulatory network can be repurposed to infer the unknown regulatory network. Based on this observation, we developed a quantitative measure of similarity among gene-expression datasets and demonstrated that, if similarity between the two expression datasets is high, TopkNet integrating algorithms that are optimal for known dataset perform well on the unknown dataset. The consensus framework, TopkNet, together with the similarity measure proposed in this study provides a powerful strategy towards harnessing the wisdom of the crowds in reconstruction of unknown regulatory networks. PMID:24278007

  18. Dynamic optimization of metabolic networks coupled with gene expression.

    PubMed

    Waldherr, Steffen; Oyarzún, Diego A; Bockmayr, Alexander

    2015-01-21

    The regulation of metabolic activity by tuning enzyme expression levels is crucial to sustain cellular growth in changing environments. Metabolic networks are often studied at steady state using constraint-based models and optimization techniques. However, metabolic adaptations driven by changes in gene expression cannot be analyzed by steady state models, as these do not account for temporal changes in biomass composition. Here we present a dynamic optimization framework that integrates the metabolic network with the dynamics of biomass production and composition. An approximation by a timescale separation leads to a coupled model of quasi-steady state constraints on the metabolic reactions, and differential equations for the substrate concentrations and biomass composition. We propose a dynamic optimization approach to determine reaction fluxes for this model, explicitly taking into account enzyme production costs and enzymatic capacity. In contrast to the established dynamic flux balance analysis, our approach allows predicting dynamic changes in both the metabolic fluxes and the biomass composition during metabolic adaptations. Discretization of the optimization problems leads to a linear program that can be efficiently solved. We applied our algorithm in two case studies: a minimal nutrient uptake network, and an abstraction of core metabolic processes in bacteria. In the minimal model, we show that the optimized uptake rates reproduce the empirical Monod growth for bacterial cultures. For the network of core metabolic processes, the dynamic optimization algorithm predicted commonly observed metabolic adaptations, such as a diauxic switch with a preference ranking for different nutrients, re-utilization of waste products after depletion of the original substrate, and metabolic adaptation to an impending nutrient depletion. These examples illustrate how dynamic adaptations of enzyme expression can be predicted solely from an optimization principle. Copyright © 2014 Elsevier Ltd. All rights reserved.

  19. A general framework for optimization of probes for gene expression microarray and its application to the fungus Podospora anserina

    PubMed Central

    2010-01-01

    Background The development of new microarray technologies makes custom long oligonucleotide arrays affordable for many experimental applications, notably gene expression analyses. Reliable results depend on probe design quality and selection. Probe design strategy should cope with the limited accuracy of de novo gene prediction programs, and annotation up-dating. We present a novel in silico procedure which addresses these issues and includes experimental screening, as an empirical approach is the best strategy to identify optimal probes in the in silico outcome. Findings We used four criteria for in silico probe selection: cross-hybridization, hairpin stability, probe location relative to coding sequence end and intron position. This latter criterion is critical when exon-intron gene structure predictions for intron-rich genes are inaccurate. For each coding sequence (CDS), we selected a sub-set of four probes. These probes were included in a test microarray, which was used to evaluate the hybridization behavior of each probe. The best probe for each CDS was selected according to three experimental criteria: signal-to-noise ratio, signal reproducibility, and representative signal intensities. This procedure was applied for the development of a gene expression Agilent platform for the filamentous fungus Podospora anserina and the selection of a single 60-mer probe for each of the 10,556 P. anserina CDS. Conclusions A reliable gene expression microarray version based on the Agilent 44K platform was developed with four spot replicates of each probe to increase statistical significance of analysis. PMID:20565839

  20. Synthetic versions of firefly luciferase and Renilla luciferase reporter genes that resist transgene silencing in sugarcane

    PubMed Central

    2014-01-01

    Background Down-regulation or silencing of transgene expression can be a major hurdle to both molecular studies and biotechnology applications in many plant species. Sugarcane is particularly effective at silencing introduced transgenes, including reporter genes such as the firefly luciferase gene. Synthesizing transgene coding sequences optimized for usage in the host plant is one method of enhancing transgene expression and stability. Using specified design rules we have synthesised new coding sequences for both the firefly luciferase and Renilla luciferase reporter genes. We have tested these optimized versions for enhanced levels of luciferase activity and for increased steady state luciferase mRNA levels in sugarcane. Results The synthetic firefly luciferase (luc*) and Renilla luciferase (Renluc*) coding sequences have elevated G + C contents in line with sugarcane codon usage, but maintain 75% identity to the native firefly or Renilla luciferase nucleotide sequences and 100% identity to the protein coding sequences. Under the control of the maize pUbi promoter, the synthetic luc* and Renluc* genes yielded 60x and 15x higher luciferase activity respectively, over the native firefly and Renilla luciferase genes in transient assays on sugarcane suspension cell cultures. Using a novel transient assay in sugarcane suspension cells combining co-bombardment and qRT-PCR, we showed that synthetic luc* and Renluc* genes generate increased transcript levels compared to the native firefly and Renilla luciferase genes. In stable transgenic lines, the luc* transgene generated significantly higher levels of expression than the native firefly luciferase transgene. The fold difference in expression was highest in the youngest tissues. Conclusions We developed synthetic versions of both the firefly and Renilla luciferase reporter genes that resist transgene silencing in sugarcane. These transgenes will be particularly useful for evaluating the expression patterns conferred by existing and newly isolated promoters in sugarcane tissues. The strategies used to design the synthetic luciferase transgenes could be applied to other transgenes that are aggressively silenced in sugarcane. PMID:24708613

  1. Synthetic versions of firefly luciferase and Renilla luciferase reporter genes that resist transgene silencing in sugarcane.

    PubMed

    Chou, Ting-Chun; Moyle, Richard L

    2014-04-08

    Down-regulation or silencing of transgene expression can be a major hurdle to both molecular studies and biotechnology applications in many plant species. Sugarcane is particularly effective at silencing introduced transgenes, including reporter genes such as the firefly luciferase gene.Synthesizing transgene coding sequences optimized for usage in the host plant is one method of enhancing transgene expression and stability. Using specified design rules we have synthesised new coding sequences for both the firefly luciferase and Renilla luciferase reporter genes. We have tested these optimized versions for enhanced levels of luciferase activity and for increased steady state luciferase mRNA levels in sugarcane. The synthetic firefly luciferase (luc*) and Renilla luciferase (Renluc*) coding sequences have elevated G + C contents in line with sugarcane codon usage, but maintain 75% identity to the native firefly or Renilla luciferase nucleotide sequences and 100% identity to the protein coding sequences.Under the control of the maize pUbi promoter, the synthetic luc* and Renluc* genes yielded 60x and 15x higher luciferase activity respectively, over the native firefly and Renilla luciferase genes in transient assays on sugarcane suspension cell cultures.Using a novel transient assay in sugarcane suspension cells combining co-bombardment and qRT-PCR, we showed that synthetic luc* and Renluc* genes generate increased transcript levels compared to the native firefly and Renilla luciferase genes.In stable transgenic lines, the luc* transgene generated significantly higher levels of expression than the native firefly luciferase transgene. The fold difference in expression was highest in the youngest tissues. We developed synthetic versions of both the firefly and Renilla luciferase reporter genes that resist transgene silencing in sugarcane. These transgenes will be particularly useful for evaluating the expression patterns conferred by existing and newly isolated promoters in sugarcane tissues. The strategies used to design the synthetic luciferase transgenes could be applied to other transgenes that are aggressively silenced in sugarcane.

  2. Strategies to optimize capsid protein expression and single-stranded DNA formation of adeno-associated virus in Saccharomyces cerevisiae.

    PubMed

    Galli, A; Della Latta, V; Bologna, C; Pucciarelli, D; Cipriani, F; Backovic, A; Cervelli, T

    2017-08-01

    Adeno-associated virus type 2 (AAV) is a nonpathogenic parvovirus that is a promising tool for gene therapy. We aimed to construct plasmids for optimal expression and assembly of capsid proteins and evaluate adenovirus (Ad) protein effect on AAV single-stranded DNA (ssDNA) formation in Saccharomyces cerevisiae. Yeast expression plasmids have been developed in which the transcription of AAV capsid proteins (VP1,2,3) is driven by the constitutive ADH1 promoter or galactose-inducible promoters. Optimal VP1,2,3 expression was obtained from GAL1/10 bidirectional promoter. Moreover, we demonstrated that AAP is expressed in yeast and virus-like particles (VLPs) assembled inside the cell. Finally, the expression of two Ad proteins, E4orf6 and E1b55k, had no effect on AAV ssDNA formation. This study confirms that yeast is able to form AAV VLPs; however, capsid assembly and ssDNA formation are less efficient in yeast than in human cells. Moreover, the expression of Ad proteins did not affect AAV ssDNA formation. New manufacturing strategies for AAV-based gene therapy vectors (rAAV) are needed to reduce costs and time of production. Our study explores the feasibility of yeast as alternative system for rAAV production. © 2017 The Society for Applied Microbiology.

  3. Stem cell gene therapy for fanconi anemia: report from the 1st international Fanconi anemia gene therapy working group meeting.

    PubMed

    Tolar, Jakub; Adair, Jennifer E; Antoniou, Michael; Bartholomae, Cynthia C; Becker, Pamela S; Blazar, Bruce R; Bueren, Juan; Carroll, Thomas; Cavazzana-Calvo, Marina; Clapp, D Wade; Dalgleish, Robert; Galy, Anne; Gaspar, H Bobby; Hanenberg, Helmut; Von Kalle, Christof; Kiem, Hans-Peter; Lindeman, Dirk; Naldini, Luigi; Navarro, Susana; Renella, Raffaele; Rio, Paula; Sevilla, Julián; Schmidt, Manfred; Verhoeyen, Els; Wagner, John E; Williams, David A; Thrasher, Adrian J

    2011-07-01

    Survival rates after allogeneic hematopoietic cell transplantation (HCT) for Fanconi anemia (FA) have increased dramatically since 2000. However, the use of autologous stem cell gene therapy, whereby the patient's own blood stem cells are modified to express the wild-type gene product, could potentially avoid the early and late complications of allogeneic HCT. Over the last decades, gene therapy has experienced a high degree of optimism interrupted by periods of diminished expectation. Optimism stems from recent examples of successful gene correction in several congenital immunodeficiencies, whereas diminished expectations come from the realization that gene therapy will not be free of side effects. The goal of the 1st International Fanconi Anemia Gene Therapy Working Group Meeting was to determine the optimal strategy for moving stem cell gene therapy into clinical trials for individuals with FA. To this end, key investigators examined vector design, transduction method, criteria for large-scale clinical-grade vector manufacture, hematopoietic cell preparation, and eligibility criteria for FA patients most likely to benefit. The report summarizes the roadmap for the development of gene therapy for FA.

  4. Constrained clusters of gene expression profiles with pathological features.

    PubMed

    Sese, Jun; Kurokawa, Yukinori; Monden, Morito; Kato, Kikuya; Morishita, Shinichi

    2004-11-22

    Gene expression profiles should be useful in distinguishing variations in disease, since they reflect accurately the status of cells. The primary clustering of gene expression reveals the genotypes that are responsible for the proximity of members within each cluster, while further clustering elucidates the pathological features of the individual members of each cluster. However, since the first clustering process and the second classification step, in which the features are associated with clusters, are performed independently, the initial set of clusters may omit genes that are associated with pathologically meaningful features. Therefore, it is important to devise a way of identifying gene expression clusters that are associated with pathological features. We present the novel technique of 'itemset constrained clustering' (IC-Clustering), which computes the optimal cluster that maximizes the interclass variance of gene expression between groups, which are divided according to the restriction that only divisions that can be expressed using common features are allowed. This constraint automatically labels each cluster with a set of pathological features which characterize that cluster. When applied to liver cancer datasets, IC-Clustering revealed informative gene expression clusters, which could be annotated with various pathological features, such as 'tumor' and 'man', or 'except tumor' and 'normal liver function'. In contrast, the k-means method overlooked these clusters.

  5. Effect of Mild Acid on Gene Expression in Staphylococcus aureus

    PubMed Central

    Weinrick, Brian; Dunman, Paul M.; McAleese, Fionnuala; Murphy, Ellen; Projan, Steven J.; Fang, Yuan; Novick, Richard P.

    2004-01-01

    During staphylococcal growth in glucose-supplemented medium, the pH of a culture starting near neutrality typically decreases by about 2 units due to the fermentation of glucose. Many species can comfortably tolerate the resulting mildly acidic conditions (pH, ∼5.5) by mounting a cellular response, which serves to defend the intracellular pH and, in principle, to modify gene expression for optimal performance in a mildly acidic infection site. In this report, we show that changes in staphylococcal gene expression formerly thought to represent a glucose effect are largely the result of declining pH. We examine the cellular response to mild acid by microarray analysis and define the affected gene set as the mild acid stimulon. Many of the genes encoding extracellular virulence factors are affected, as are genes involved in regulation of virulence factor gene expression, transport of sugars and peptides, intermediary metabolism, and pH homeostasis. Key results are verified by gene fusion and Northern blot hybridization analyses. The results point to, but do not define, possible regulatory pathways by which the organism senses and responds to a pH stimulus. PMID:15576791

  6. Automation of fluorescent differential display with digital readout.

    PubMed

    Meade, Jonathan D; Cho, Yong-Jig; Fisher, Jeffrey S; Walden, Jamie C; Guo, Zhen; Liang, Peng

    2006-01-01

    Since its invention in 1992, differential display (DD) has become the most commonly used technique for identifying differentially expressed genes because of its many advantages over competing technologies such as DNA microarray, serial analysis of gene expression (SAGE), and subtractive hybridization. Despite the great impact of the method on biomedical research, there has been a lack of automation of DD technology to increase its throughput and accuracy for systematic gene expression analysis. Most of previous DD work has taken a "shot-gun" approach of identifying one gene at a time, with a limited number of polymerase chain reaction (PCR) reactions set up manually, giving DD a low-tech and low-throughput image. We have optimized the DD process with a new platform that incorporates fluorescent digital readout, automated liquid handling, and large-format gels capable of running entire 96-well plates. The resulting streamlined fluorescent DD (FDD) technology offers an unprecedented accuracy, sensitivity, and throughput in comprehensive and quantitative analysis of gene expression. These major improvements will allow researchers to find differentially expressed genes of interest, both known and novel, quickly and easily.

  7. Developing tTA Transgenic Rats for Inducible and Reversible Gene Expression

    PubMed Central

    Zhou, Hongxia; Huang, Cao; Yang, Min; Landel, Carlisle P; Xia, Pedro Yuxing; Liu, Yong-Jian; Xia, Xu Gang

    2009-01-01

    To develop transgenic lines for conditional expression of desired genes in rats, we generated several lines of the transgenic rats carrying the tetracycline-controlled transactivator (tTA) gene. Using a vigorous, ubiquitous promoter to drive the tTA transgene, we obtained widespread expression of tTA in various tissues. Expression of tTA was sufficient to strongly activate its reporter gene, but was below the toxicity threshold. We examined the dynamics of Doxycycline (Dox)-regulated gene expression in transgenic rats. In the two transmittable lines, tTA-mediated activation of the reporter gene was fully subject to regulation by Dox. Dox dose-dependently suppressed tTA-activated gene expression. The washout time for the effects of Dox was dose-dependent. We tested a complex regime of Dox administration to determine the optimal effectiveness and washout duration. Dox was administered at a high dose (500 μg/ml in drinking water) for two days to reach the effective concentration, and then was given at a low dose (20 μg/ml) to maintain effectiveness. This regimen of Dox administration can achieve a quick switch between ON and OFF statuses of tTA-activated gene expression. In addition, administration of Dox to pregnant rats fully suppressed postnatal tTA-activated gene expression in their offspring. Sufficient levels of Dox are present in mother's milk to produce maximal efficacy in nursing neonates. Administration of Dox to pregnant or nursing rats can provide a continual suppression of tTA-dependent gene expression during embryonic and postnatal development. The tTA transgenic rat allows for inducible and reversible gene expression in the rat; this important tool will be valuable in the development of genetic rat models of human diseases. PMID:19214245

  8. GeMS: an advanced software package for designing synthetic genes.

    PubMed

    Jayaraj, Sebastian; Reid, Ralph; Santi, Daniel V

    2005-01-01

    A user-friendly, advanced software package for gene design is described. The software comprises an integrated suite of programs-also provided as stand-alone tools-that automatically performs the following tasks in gene design: restriction site prediction, codon optimization for any expression host, restriction site inclusion and exclusion, separation of long sequences into synthesizable fragments, T(m) and stem-loop determinations, optimal oligonucleotide component design and design verification/error-checking. The output is a complete design report and a list of optimized oligonucleotides to be prepared for subsequent gene synthesis. The user interface accommodates both inexperienced and experienced users. For inexperienced users, explanatory notes are provided such that detailed instructions are not necessary; for experienced users, a streamlined interface is provided without such notes. The software has been extensively tested in the design and successful synthesis of over 400 kb of genes, many of which exceeded 5 kb in length.

  9. Computational Analysis and Low-Scale Constitutive Expression of Laccases Synthetic Genes GlLCC1 from Ganoderma lucidum and POXA 1B from Pleurotus ostreatus in Pichia pastoris

    PubMed Central

    Reyes-Guzmán, Edwin Alfredo; Poutou-Piñales, Raúl A.; Reyes-Montaño, Edgar Antonio; Pedroza-Rodríguez, Aura Marina; Rodríguez-Vázquez, Refugio; Cardozo-Bernal, Ángela M.

    2015-01-01

    Lacasses are multicopper oxidases that can catalyze aromatic and non-aromatic compounds concomitantly with reduction of molecular oxygen to water. Fungal laccases have generated a growing interest due to their biotechnological potential applications, such as lignocellulosic material delignification, biopulping and biobleaching, wastewater treatment, and transformation of toxic organic pollutants. In this work we selected fungal genes encoding for laccase enzymes GlLCC1 in Ganoderma lucidum and POXA 1B in Pleurotus ostreatus. These genes were optimized for codon use, GC content, and regions generating secondary structures. Laccase proposed computational models, and their interaction with ABTS [2, 2′-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid)] substrate was evaluated by molecular docking. Synthetic genes were cloned under the control of Pichia pastoris glyceraldehyde-3-phosphate dehydrogenase (GAP) constitutive promoter. P. pastoris X-33 was transformed with pGAPZαA-LaccGluc-Stop and pGAPZαA-LaccPost-Stop constructs. Optimization reduced GC content by 47 and 49% for LaccGluc-Stop and LaccPost-Stop genes, respectively. A codon adaptation index of 0.84 was obtained for both genes. 3D structure analysis using SuperPose revealed LaccGluc-Stop is similar to the laccase crystallographic structure 1GYC of Trametes versicolor. Interaction analysis of the 3D models validated through ABTS, demonstrated higher substrate affinity for LaccPost-Stop, in agreement with our experimental results with enzymatic activities of 451.08 ± 6.46 UL-1 compared to activities of 0.13 ± 0.028 UL-1 for LaccGluc-Stop. This study demonstrated that G. lucidum GlLCC1 and P. ostreatus POXA 1B gene optimization resulted in constitutive gene expression under GAP promoter and α-factor leader in P. pastoris. These are important findings in light of recombinant enzyme expression system utility for environmentally friendly designed expression systems, because of the wide range of substrates that laccases can transform. This contributes to a great gamut of products in diverse settings: industry, clinical and chemical use, and environmental applications. PMID:25611746

  10. Computational analysis and low-scale constitutive expression of laccases synthetic genes GlLCC1 from Ganoderma lucidum and POXA 1B from Pleurotus ostreatus in Pichia pastoris.

    PubMed

    Rivera-Hoyos, Claudia M; Morales-Álvarez, Edwin David; Poveda-Cuevas, Sergio Alejandro; Reyes-Guzmán, Edwin Alfredo; Poutou-Piñales, Raúl A; Reyes-Montaño, Edgar Antonio; Pedroza-Rodríguez, Aura Marina; Rodríguez-Vázquez, Refugio; Cardozo-Bernal, Ángela M

    2015-01-01

    Lacasses are multicopper oxidases that can catalyze aromatic and non-aromatic compounds concomitantly with reduction of molecular oxygen to water. Fungal laccases have generated a growing interest due to their biotechnological potential applications, such as lignocellulosic material delignification, biopulping and biobleaching, wastewater treatment, and transformation of toxic organic pollutants. In this work we selected fungal genes encoding for laccase enzymes GlLCC1 in Ganoderma lucidum and POXA 1B in Pleurotus ostreatus. These genes were optimized for codon use, GC content, and regions generating secondary structures. Laccase proposed computational models, and their interaction with ABTS [2, 2'-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid)] substrate was evaluated by molecular docking. Synthetic genes were cloned under the control of Pichia pastoris glyceraldehyde-3-phosphate dehydrogenase (GAP) constitutive promoter. P. pastoris X-33 was transformed with pGAPZαA-LaccGluc-Stop and pGAPZαA-LaccPost-Stop constructs. Optimization reduced GC content by 47 and 49% for LaccGluc-Stop and LaccPost-Stop genes, respectively. A codon adaptation index of 0.84 was obtained for both genes. 3D structure analysis using SuperPose revealed LaccGluc-Stop is similar to the laccase crystallographic structure 1GYC of Trametes versicolor. Interaction analysis of the 3D models validated through ABTS, demonstrated higher substrate affinity for LaccPost-Stop, in agreement with our experimental results with enzymatic activities of 451.08 ± 6.46 UL-1 compared to activities of 0.13 ± 0.028 UL-1 for LaccGluc-Stop. This study demonstrated that G. lucidum GlLCC1 and P. ostreatus POXA 1B gene optimization resulted in constitutive gene expression under GAP promoter and α-factor leader in P. pastoris. These are important findings in light of recombinant enzyme expression system utility for environmentally friendly designed expression systems, because of the wide range of substrates that laccases can transform. This contributes to a great gamut of products in diverse settings: industry, clinical and chemical use, and environmental applications.

  11. Identification of expression quantitative trait loci by the interaction analysis using genetic algorithm.

    PubMed

    Namkung, Junghyun; Nam, Jin-Wu; Park, Taesung

    2007-01-01

    Many genes with major effects on quantitative traits have been reported to interact with other genes. However, finding a group of interacting genes from thousands of SNPs is challenging. Hence, an efficient and robust algorithm is needed. The genetic algorithm (GA) is useful in searching for the optimal solution from a very large searchable space. In this study, we show that genome-wide interaction analysis using GA and a statistical interaction model can provide a practical method to detect biologically interacting loci. We focus our search on transcriptional regulators by analyzing gene x gene interactions for cancer-related genes. The expression values of three cancer-related genes were selected from the expression data of the Genetic Analysis Workshop 15 Problem 1 data set. We implemented a GA to identify the expression quantitative trait loci that are significantly associated with expression levels of the cancer-related genes. The time complexity of the GA was compared with that of an exhaustive search algorithm. As a result, our GA, which included heuristic methods, such as archive, elitism, and local search, has greatly reduced computational time in a genome-wide search for gene x gene interactions. In general, the GA took one-fifth the computation time of an exhaustive search for the most significant pair of single-nucleotide polymorphisms.

  12. Identification of expression quantitative trait loci by the interaction analysis using genetic algorithm

    PubMed Central

    Namkung, Junghyun; Nam, Jin-Wu; Park, Taesung

    2007-01-01

    Many genes with major effects on quantitative traits have been reported to interact with other genes. However, finding a group of interacting genes from thousands of SNPs is challenging. Hence, an efficient and robust algorithm is needed. The genetic algorithm (GA) is useful in searching for the optimal solution from a very large searchable space. In this study, we show that genome-wide interaction analysis using GA and a statistical interaction model can provide a practical method to detect biologically interacting loci. We focus our search on transcriptional regulators by analyzing gene × gene interactions for cancer-related genes. The expression values of three cancer-related genes were selected from the expression data of the Genetic Analysis Workshop 15 Problem 1 data set. We implemented a GA to identify the expression quantitative trait loci that are significantly associated with expression levels of the cancer-related genes. The time complexity of the GA was compared with that of an exhaustive search algorithm. As a result, our GA, which included heuristic methods, such as archive, elitism, and local search, has greatly reduced computational time in a genome-wide search for gene × gene interactions. In general, the GA took one-fifth the computation time of an exhaustive search for the most significant pair of single-nucleotide polymorphisms. PMID:18466570

  13. Selection of Reliable Reference Genes for Gene Expression Studies of a Promising Oilseed Crop, Plukenetia volubilis, by Real-Time Quantitative PCR

    PubMed Central

    Niu, Longjian; Tao, Yan-Bin; Chen, Mao-Sheng; Fu, Qiantang; Li, Chaoqiong; Dong, Yuling; Wang, Xiulan; He, Huiying; Xu, Zeng-Fu

    2015-01-01

    Real-time quantitative PCR (RT-qPCR) is a reliable and widely used method for gene expression analysis. The accuracy of the determination of a target gene expression level by RT-qPCR demands the use of appropriate reference genes to normalize the mRNA levels among different samples. However, suitable reference genes for RT-qPCR have not been identified in Sacha inchi (Plukenetia volubilis), a promising oilseed crop known for its polyunsaturated fatty acid (PUFA)-rich seeds. In this study, using RT-qPCR, twelve candidate reference genes were examined in seedlings and adult plants, during flower and seed development and for the entire growth cycle of Sacha inchi. Four statistical algorithms (delta cycle threshold (ΔCt), BestKeeper, geNorm, and NormFinder) were used to assess the expression stabilities of the candidate genes. The results showed that ubiquitin-conjugating enzyme (UCE), actin (ACT) and phospholipase A22 (PLA) were the most stable genes in Sacha inchi seedlings. For roots, stems, leaves, flowers, and seeds from adult plants, 30S ribosomal protein S13 (RPS13), cyclophilin (CYC) and elongation factor-1alpha (EF1α) were recommended as reference genes for RT-qPCR. During the development of reproductive organs, PLA, ACT and UCE were the optimal reference genes for flower development, whereas UCE, RPS13 and RNA polymerase II subunit (RPII) were optimal for seed development. Considering the entire growth cycle of Sacha inchi, UCE, ACT and EF1α were sufficient for the purpose of normalization. Our results provide useful guidelines for the selection of reliable reference genes for the normalization of RT-qPCR data for seedlings and adult plants, for reproductive organs, and for the entire growth cycle of Sacha inchi. PMID:26047338

  14. An Optimized Transient Dual Luciferase Assay for Quantifying MicroRNA Directed Repression of Targeted Sequences

    PubMed Central

    Moyle, Richard L.; Carvalhais, Lilia C.; Pretorius, Lara-Simone; Nowak, Ekaterina; Subramaniam, Gayathery; Dalton-Morgan, Jessica; Schenk, Peer M.

    2017-01-01

    Studies investigating the action of small RNAs on computationally predicted target genes require some form of experimental validation. Classical molecular methods of validating microRNA action on target genes are laborious, while approaches that tag predicted target sequences to qualitative reporter genes encounter technical limitations. The aim of this study was to address the challenge of experimentally validating large numbers of computationally predicted microRNA-target transcript interactions using an optimized, quantitative, cost-effective, and scalable approach. The presented method combines transient expression via agroinfiltration of Nicotiana benthamiana leaves with a quantitative dual luciferase reporter system, where firefly luciferase is used to report the microRNA-target sequence interaction and Renilla luciferase is used as an internal standard to normalize expression between replicates. We report the appropriate concentration of N. benthamiana leaf extracts and dilution factor to apply in order to avoid inhibition of firefly LUC activity. Furthermore, the optimal ratio of microRNA precursor expression construct to reporter construct and duration of the incubation period post-agroinfiltration were determined. The optimized dual luciferase assay provides an efficient, repeatable and scalable method to validate and quantify microRNA action on predicted target sequences. The optimized assay was used to validate five predicted targets of rice microRNA miR529b, with as few as six technical replicates. The assay can be extended to assess other small RNA-target sequence interactions, including assessing the functionality of an artificial miRNA or an RNAi construct on a targeted sequence. PMID:28979287

  15. A multi-Poisson dynamic mixture model to cluster developmental patterns of gene expression by RNA-seq.

    PubMed

    Ye, Meixia; Wang, Zhong; Wang, Yaqun; Wu, Rongling

    2015-03-01

    Dynamic changes of gene expression reflect an intrinsic mechanism of how an organism responds to developmental and environmental signals. With the increasing availability of expression data across a time-space scale by RNA-seq, the classification of genes as per their biological function using RNA-seq data has become one of the most significant challenges in contemporary biology. Here we develop a clustering mixture model to discover distinct groups of genes expressed during a period of organ development. By integrating the density function of multivariate Poisson distribution, the model accommodates the discrete property of read counts characteristic of RNA-seq data. The temporal dependence of gene expression is modeled by the first-order autoregressive process. The model is implemented with the Expectation-Maximization algorithm and model selection to determine the optimal number of gene clusters and obtain the estimates of Poisson parameters that describe the pattern of time-dependent expression of genes from each cluster. The model has been demonstrated by analyzing a real data from an experiment aimed to link the pattern of gene expression to catkin development in white poplar. The usefulness of the model has been validated through computer simulation. The model provides a valuable tool for clustering RNA-seq data, facilitating our global view of expression dynamics and understanding of gene regulation mechanisms. © The Author 2014. Published by Oxford University Press. For Permissions, please email: journals.permissions@oup.com.

  16. Improving Classification of Cancer and Mining Biomarkers from Gene Expression Profiles Using Hybrid Optimization Algorithms and Fuzzy Support Vector Machine

    PubMed Central

    Moteghaed, Niloofar Yousefi; Maghooli, Keivan; Garshasbi, Masoud

    2018-01-01

    Background: Gene expression data are characteristically high dimensional with a small sample size in contrast to the feature size and variability inherent in biological processes that contribute to difficulties in analysis. Selection of highly discriminative features decreases the computational cost and complexity of the classifier and improves its reliability for prediction of a new class of samples. Methods: The present study used hybrid particle swarm optimization and genetic algorithms for gene selection and a fuzzy support vector machine (SVM) as the classifier. Fuzzy logic is used to infer the importance of each sample in the training phase and decrease the outlier sensitivity of the system to increase the ability to generalize the classifier. A decision-tree algorithm was applied to the most frequent genes to develop a set of rules for each type of cancer. This improved the abilities of the algorithm by finding the best parameters for the classifier during the training phase without the need for trial-and-error by the user. The proposed approach was tested on four benchmark gene expression profiles. Results: Good results have been demonstrated for the proposed algorithm. The classification accuracy for leukemia data is 100%, for colon cancer is 96.67% and for breast cancer is 98%. The results show that the best kernel used in training the SVM classifier is the radial basis function. Conclusions: The experimental results show that the proposed algorithm can decrease the dimensionality of the dataset, determine the most informative gene subset, and improve classification accuracy using the optimal parameters of the classifier with no user interface. PMID:29535919

  17. Improved production of a recombinant Rhizomucor miehei lipase expressed in Pichia pastoris and its application for conversion of microalgae oil to biodiesel.

    PubMed

    Huang, Jinjin; Xia, Ji; Yang, Zhen; Guan, Feifei; Cui, Di; Guan, Guohua; Jiang, Wei; Li, Ying

    2014-01-01

    We previously cloned a 1,3-specific lipase gene from the fungus Rhizomucor miehei and expressed it in methylotrophic yeast Pichia pastoris strain GS115. The enzyme produced (termed RML) was able to catalyze methanolysis of soybean oil and showed strong position specificity. However, the enzyme activity and amount of enzyme produced were not adequate for industrial application. Our goal in the present study was to improve the enzyme properties of RML in order to apply it for the conversion of microalgae oil to biofuel. Several new expression plasmids were constructed by adding the propeptide of the target gene, optimizing the signal peptide, and varying the number of target gene copies. Each plasmid was transformed separately into P. pastoris strain X-33. Screening by flask culture showed maximal (21.4-fold increased) enzyme activity for the recombinant strain with two copies of the target gene; the enzyme was termed Lipase GH2. The expressed protein with the propeptide (pRML) was a stable glycosylated protein, because of glycosylation sites in the propeptide. Quantitative real-time RT-PCR analysis revealed two major reasons for the increase in enzyme activity: (1) the modified recombinant expression system gave an increased transcription level of the target gene (rml), and (2) the enzyme was suitable for expression in host cells without causing endoplasmic reticulum (ER) stress. The modified enzyme had improved thermostability and methanol or ethanol tolerance, and was applicable directly as free lipase (fermentation supernatant) in the catalytic esterification and transesterification reaction. After reaction for 24 hours at 30°C, the conversion rate of microalgae oil to biofuel was above 90%. Our experimental results show that signal peptide optimization in the expression plasmid, addition of the gene propeptide, and proper gene dosage significantly increased RML expression level and enhanced the enzymatic properties. The target enzyme was the major component of fermentation supernatant and was stable for over six months at 4°C. The modified free lipase is potentially applicable for industrial-scale conversion of microalgae oil to biodiesel.

  18. Which missing value imputation method to use in expression profiles: a comparative study and two selection schemes.

    PubMed

    Brock, Guy N; Shaffer, John R; Blakesley, Richard E; Lotz, Meredith J; Tseng, George C

    2008-01-10

    Gene expression data frequently contain missing values, however, most down-stream analyses for microarray experiments require complete data. In the literature many methods have been proposed to estimate missing values via information of the correlation patterns within the gene expression matrix. Each method has its own advantages, but the specific conditions for which each method is preferred remains largely unclear. In this report we describe an extensive evaluation of eight current imputation methods on multiple types of microarray experiments, including time series, multiple exposures, and multiple exposures x time series data. We then introduce two complementary selection schemes for determining the most appropriate imputation method for any given data set. We found that the optimal imputation algorithms (LSA, LLS, and BPCA) are all highly competitive with each other, and that no method is uniformly superior in all the data sets we examined. The success of each method can also depend on the underlying "complexity" of the expression data, where we take complexity to indicate the difficulty in mapping the gene expression matrix to a lower-dimensional subspace. We developed an entropy measure to quantify the complexity of expression matrixes and found that, by incorporating this information, the entropy-based selection (EBS) scheme is useful for selecting an appropriate imputation algorithm. We further propose a simulation-based self-training selection (STS) scheme. This technique has been used previously for microarray data imputation, but for different purposes. The scheme selects the optimal or near-optimal method with high accuracy but at an increased computational cost. Our findings provide insight into the problem of which imputation method is optimal for a given data set. Three top-performing methods (LSA, LLS and BPCA) are competitive with each other. Global-based imputation methods (PLS, SVD, BPCA) performed better on mcroarray data with lower complexity, while neighbour-based methods (KNN, OLS, LSA, LLS) performed better in data with higher complexity. We also found that the EBS and STS schemes serve as complementary and effective tools for selecting the optimal imputation algorithm.

  19. Hybrid Binary Imperialist Competition Algorithm and Tabu Search Approach for Feature Selection Using Gene Expression Data.

    PubMed

    Wang, Shuaiqun; Aorigele; Kong, Wei; Zeng, Weiming; Hong, Xiaomin

    2016-01-01

    Gene expression data composed of thousands of genes play an important role in classification platforms and disease diagnosis. Hence, it is vital to select a small subset of salient features over a large number of gene expression data. Lately, many researchers devote themselves to feature selection using diverse computational intelligence methods. However, in the progress of selecting informative genes, many computational methods face difficulties in selecting small subsets for cancer classification due to the huge number of genes (high dimension) compared to the small number of samples, noisy genes, and irrelevant genes. In this paper, we propose a new hybrid algorithm HICATS incorporating imperialist competition algorithm (ICA) which performs global search and tabu search (TS) that conducts fine-tuned search. In order to verify the performance of the proposed algorithm HICATS, we have tested it on 10 well-known benchmark gene expression classification datasets with dimensions varying from 2308 to 12600. The performance of our proposed method proved to be superior to other related works including the conventional version of binary optimization algorithm in terms of classification accuracy and the number of selected genes.

  20. Hybrid Binary Imperialist Competition Algorithm and Tabu Search Approach for Feature Selection Using Gene Expression Data

    PubMed Central

    Aorigele; Zeng, Weiming; Hong, Xiaomin

    2016-01-01

    Gene expression data composed of thousands of genes play an important role in classification platforms and disease diagnosis. Hence, it is vital to select a small subset of salient features over a large number of gene expression data. Lately, many researchers devote themselves to feature selection using diverse computational intelligence methods. However, in the progress of selecting informative genes, many computational methods face difficulties in selecting small subsets for cancer classification due to the huge number of genes (high dimension) compared to the small number of samples, noisy genes, and irrelevant genes. In this paper, we propose a new hybrid algorithm HICATS incorporating imperialist competition algorithm (ICA) which performs global search and tabu search (TS) that conducts fine-tuned search. In order to verify the performance of the proposed algorithm HICATS, we have tested it on 10 well-known benchmark gene expression classification datasets with dimensions varying from 2308 to 12600. The performance of our proposed method proved to be superior to other related works including the conventional version of binary optimization algorithm in terms of classification accuracy and the number of selected genes. PMID:27579323

  1. Validation of reference genes aiming accurate normalization of qRT-PCR data in Dendrocalamus latiflorus Munro.

    PubMed

    Liu, Mingying; Jiang, Jing; Han, Xiaojiao; Qiao, Guirong; Zhuo, Renying

    2014-01-01

    Dendrocalamus latiflorus Munro distributes widely in subtropical areas and plays vital roles as valuable natural resources. The transcriptome sequencing for D. latiflorus Munro has been performed and numerous genes especially those predicted to be unique to D. latiflorus Munro were revealed. qRT-PCR has become a feasible approach to uncover gene expression profiling, and the accuracy and reliability of the results obtained depends upon the proper selection of stable reference genes for accurate normalization. Therefore, a set of suitable internal controls should be validated for D. latiflorus Munro. In this report, twelve candidate reference genes were selected and the assessment of gene expression stability was performed in ten tissue samples and four leaf samples from seedlings and anther-regenerated plants of different ploidy. The PCR amplification efficiency was estimated, and the candidate genes were ranked according to their expression stability using three software packages: geNorm, NormFinder and Bestkeeper. GAPDH and EF1α were characterized to be the most stable genes among different tissues or in all the sample pools, while CYP showed low expression stability. RPL3 had the optimal performance among four leaf samples. The application of verified reference genes was illustrated by analyzing ferritin and laccase expression profiles among different experimental sets. The analysis revealed the biological variation in ferritin and laccase transcript expression among the tissues studied and the individual plants. geNorm, NormFinder, and BestKeeper analyses recommended different suitable reference gene(s) for normalization according to the experimental sets. GAPDH and EF1α had the highest expression stability across different tissues and RPL3 for the other sample set. This study emphasizes the importance of validating superior reference genes for qRT-PCR analysis to accurately normalize gene expression of D. latiflorus Munro.

  2. Co-expression of hepatitis C virus polytope-HBsAg and p19-silencing suppressor protein in tobacco leaves.

    PubMed

    Mohammadzadeh, Sara; Roohvand, Farzin; Memarnejadian, Arash; Jafari, Anis; Ajdary, Soheila; Salmanian, Ali-Hatef; Ehsani, Parastoo

    2016-01-01

    Plants transformed by virus-based vectors have emerged as promising tools to rapidly express large amounts and inexpensive antigens in transient condition. We studied the possibility of transient-expression of an HBsAg-fused polytopic construct (HCVpc) [containing H-2d and HLA-A2-restricted CD8+CTL-epitopic peptides of C (Core; aa 132-142), E6 (Envelope2; aa 614-622), N (NS3; aa 1406-1415), and E4 (Envelope2; aa 405-414) in tandem of CE6NE4] in tobacco (Nicotiana tabacum) leaves for the development of a plant-based HCV vaccine. A codon-optimized gene encoding the Kozak sequence, hexahistidine (6×His)-tag peptide, and HCVpc in tandem was designed, chemically synthesized, fused to HBsAg gene, and inserted into Potato virus X (PVX-GW) vector under the control of duplicated PVX coat protein promoter (CPP). The resulted recombinant plasmids (after confirmation by restriction and sequencing analyses) were transferred into Agrobacterium tumefaciens strain GV3101 and vacuum infiltrated into tobacco leaves. The effect of gene-silencing suppressor, p19 protein from tomato bushy stunt virus, on the expression yield of HCVpc-HBsAg was also evaluated by co-infiltration of a p19 expression vector. Codon-optimized gene increased adaptation index (CAI) value (from 0.61 to 0.92) in tobacco. The expression of the HCVpc-HBsAg was confirmed by western blot and HBsAg-based detection ELISA on total extractable proteins of tobacco leaves. The expression level of the fusion protein was significantly higher in p19 co-agroinfiltrated plants. The results indicated the possibility of expression of HCVpc-HBsAg constructs with proper protein conformations in tobacco for final application as a plant-derived HCV vaccine.

  3. Targeted gene delivery to the synovial pannus in antigen-induced arthritis by ultrasound-targeted microbubble destruction in vivo.

    PubMed

    Xiang, Xi; Tang, Yuanjiao; Leng, Qianying; Zhang, Lingyan; Qiu, Li

    2016-02-01

    The purpose of this study was to optimize an ultrasound-targeted microbubble destruction (UTMD) technique to improve the in vivo transfection efficiency of the gene encoding enhanced green fluorescent protein (EGFP) in the synovial pannus in an antigen-induced arthritis rabbit model. A mixture of microbubbles and plasmids was locally injected into the knee joints of an antigen-induced arthritis (AIA) rabbits. The plasmid concentrations and ultrasound conditions were varied in the experiments. We also tested local articular and intravenous injections. The rabbits were divided into five groups: (1) ultrasound+microbubbles+plasmid; (2) ultrasound+plasmid; (3) microbubble+plasmid; (4) plasmid only; (5) untreated controls. EGFP expression was observed by fluorescent microscope and immunohistochemical staining in the synovial pannus of each group. The optimal plasmid dosage and ultrasound parameter were determined based on the results of EGFP expression and the present and absent of tissue damage under light microscopy. The irradiation procedure was performed to observe the duration of the EGFP expression in the synovial pannus and other tissues and organs, as well as the damage to the normal cells. The optimal condition was determined to be a 1-MHz ultrasound pulse applied for 5 min with a power output of 2 W/cm(2) and a 20% duty cycle along with 300 μg of plasmid. Under these conditions, the synovial pannus showed significant EGFP expression without significant damage to the surrounding normal tissue. The EGFP expression induced by the local intra-articular injection was significantly more increased than that induced by the intravenous injection. The EGFP expression in the synovial pannus of the ultrasound+microbubbles+plasmid group was significantly higher than that of the other four groups (P<0.05). The expression peaked on day 5, remained detectable on day 40 and disappeared on day 60. No EGFP expression was detected in the other tissues and organs. The UTMD technique can significantly enhance the in vivo gene transfection efficiency without significant tissue damage in the synovial pannus of an AIA model. Thus, this could become a safe and effective non-viral gene transfection procedure for arthritis therapy. Copyright © 2015 Elsevier B.V. All rights reserved.

  4. Cancer Detection in Microarray Data Using a Modified Cat Swarm Optimization Clustering Approach

    PubMed

    M, Pandi; R, Balamurugan; N, Sadhasivam

    2017-12-29

    Objective: A better understanding of functional genomics can be obtained by extracting patterns hidden in gene expression data. This could have paramount implications for cancer diagnosis, gene treatments and other domains. Clustering may reveal natural structures and identify interesting patterns in underlying data. The main objective of this research was to derive a heuristic approach to detection of highly co-expressed genes related to cancer from gene expression data with minimum Mean Squared Error (MSE). Methods: A modified CSO algorithm using Harmony Search (MCSO-HS) for clustering cancer gene expression data was applied. Experiment results are analyzed using two cancer gene expression benchmark datasets, namely for leukaemia and for breast cancer. Result: The results indicated MCSO-HS to be better than HS and CSO, 13% and 9% with the leukaemia dataset. For breast cancer dataset improvement was by 22% and 17%, respectively, in terms of MSE. Conclusion: The results showed MCSO-HS to outperform HS and CSO with both benchmark datasets. To validate the clustering results, this work was tested with internal and external cluster validation indices. Also this work points to biological validation of clusters with gene ontology in terms of function, process and component. Creative Commons Attribution License

  5. Titer improvement of iso-migrastatin in selected heterologous Streptomyces hosts and related analysis of mRNA expression by quantitative RT–PCR

    PubMed Central

    Yang, Dong; Zhu, Xiangcheng; Wu, Xueyun; Feng, Zhiyang; Huang, Lei; Shen, Ben; Xu, Zhinan

    2011-01-01

    iso-Migrastatin (iso-MGS) has been actively pursued recently as an outstanding candidate of antimetastasis agents. Having characterized the iso-MGS biosynthetic gene cluster from its native producer Streptomyces platensis NRRL 18993, we have recently succeeded in producing iso-MGS in five selected heterologous Streptomyces hosts, albeit the low titers failed to meet expectations and cast doubt on the utility of this novel technique for large-scale production. To further explore and capitalize on the production capacity of these hosts, a thorough investigation of these five engineered strains with three fermentation media for iso-MGS production was undertaken. Streptomyces albus J1074 and Streptomyces lividans K4-114 were found to be preferred heterologous hosts, and subsequent analysis of carbon and nitrogen sources revealed that sucrose and yeast extract were ideal for iso-MGS production. After the initial optimization, the titers of iso-MGS in all five hosts were considerably improved by 3–18-fold in the optimized R2YE medium. Furthermore, the iso-MGS titer of S. albus J1074 (pBS11001) was significantly improved to 186.7 mg/L by a hybrid medium strategy. Addition of NaHCO3 to the latter finally afforded an optimized iso-MGS titer of 213.8 mg/L, about 5-fold higher than the originally reported system. With S. albus J1074 (pBS11001) as a model host, the expression of iso-MGS gene cluster in four different media was systematically studied via the quantitative RT–PCR technology. The resultant comparison revealed the correlation of gene expression and iso-MGS production for the first time; synchronous expression of the whole gene cluster was crucial for optimal iso-MGS production. These results reveal new insights into the iso-MGS biosynthetic machinery in heterologous hosts and provide the primary data to realize large-scale production of iso-MGS for further preclinical studies. PMID:21132287

  6. Anti-freezing-protein type III strongly influences the expression of relevant genes in cryopreserved potato shoot tips.

    PubMed

    Seo, Ji Hyang; Naing, Aung Htay; Jeon, Su Min; Kim, Chang Kil

    2018-06-04

    AFP improved cryopreservation efficiency of potato (Solanum tuberosum cv. Superior) by regulating transcript levels of CBF1 and DHN1. However, the optimal AFP concentration required for strong induction of the genes was dependent on the type of vitrification solution to which the AFP was added: This finding suggests that AFP increased cryopreservation efficiency by transcriptional regulation of these genes, which might protect plant cell membranes from cold stress during cryopreservation. Despite the availability of many studies reporting the benefits of anti-freeze protein III (AFP III) as a cryoprotectant, the role of AFP III in this process has not been well demonstrated using molecular analysis. In addition, AFP III has not been exploited in the cryopreservation of potato thus far. Therefore, we studied the effects of AFP III on the cryopreservation of potato (Solanum tuberosum cv. Superior). We found that CBF1 and DHN1 genes are low temperature-inducible in potato leaves (S. tuberosum cv. Superior). Transcript levels of these genes expressed in shoot tips cryopreserved with AFP III were higher than those of the controls. However, the optimal AFP III concentration required for strong induction of the genes was dependent on the type of cryoprotection solution to which the AFP III was added: 500 ng/mL worked best for PVS2, while 1500 ng/mL was optimal for LS. Interestingly, the involvement of AFP III in the cryoprotection solutions improved cryopreservation efficiency as compared to the control, and expression levels of the detected genes were associated with cryopreservation efficiency. This finding suggests that AFP III increased cryopreservation efficiency by transcriptional regulation of these genes, which might protect plant cell membranes from cold stress during cryopreservation. Therefore, we expect that our findings will lead to the successful application of AFP III as a potent cryoprotectant in the cryopreservation of rare and commercially important plant germplasms.

  7. Sox17 drives functional engraftment of endothelium converted from non-vascular cells.

    PubMed

    Schachterle, William; Badwe, Chaitanya R; Palikuqi, Brisa; Kunar, Balvir; Ginsberg, Michael; Lis, Raphael; Yokoyama, Masataka; Elemento, Olivier; Scandura, Joseph M; Rafii, Shahin

    2017-01-16

    Transplanting vascular endothelial cells (ECs) to support metabolism and express regenerative paracrine factors is a strategy to treat vasculopathies and to promote tissue regeneration. However, transplantation strategies have been challenging to develop, because ECs are difficult to culture and little is known about how to direct them to stably integrate into vasculature. Here we show that only amniotic cells could convert to cells that maintain EC gene expression. Even so, these converted cells perform sub-optimally in transplantation studies. Constitutive Akt signalling increases expression of EC morphogenesis genes, including Sox17, shifts the genomic targeting of Fli1 to favour nearby Sox consensus sites and enhances the vascular function of converted cells. Enforced expression of Sox17 increases expression of morphogenesis genes and promotes integration of transplanted converted cells into injured vessels. Thus, Ets transcription factors specify non-vascular, amniotic cells to EC-like cells, whereas Sox17 expression is required to confer EC function.

  8. Insertional Mutagenesis for Genes involved in Otic/Vestibular Development and Function in Xenopus Tropicalis

    NASA Technical Reports Server (NTRS)

    Torrejon, Marcela; Li, Erica; Nguyen, Minh; Winfree, Seth; Wang, Esther; Reinsch, Sigrid; Dalton, Bonnie (Technical Monitor)

    2002-01-01

    Sensitivity to gravity is essential for spatial orientation. Consequently, the gravity receptor system is one of the phylogenetically oldest sensory systems, and the special adaptations that enhance sensitivity to gravity are highly conserved. The main goal of this project is to use Xenopus (frog) to identify genes expressed during vestibular and auditory development. These studies will lead a better understanding of the molecular mechanisms involved in vestibular and auditory development and function. We are using a gene-trap approach in Xenopus tropicalis with the green fluorescent protein (GFP) gene as the transgene reporter. GFP expression occurs only when the GFP gene is correctly integrated in actively transcribed genes. Using the GFP as a tag we can easily identify and clone the mutated gene. In addition, we can study the function of the mutated gene by analyzing the defects generated by insertion of the GFP transgene. To date we have tissue specific GFP expression in X. tropicalis including expression in ear, neural tube, kidney, muscle, eyes and nose. Our transgenic animals will soon reach maturity so that we can outcross them and analyze their progeny. Our next goal is to isolate RNA from our transgenics and clone the tagged genes using RACE-PCR. Currently we are optimizing the RACE-PCR method using transgenics with crystallin GFP expression.

  9. Transcriptome-Wide Identification of Reference Genes for Expression Analysis of Soybean Responses to Drought Stress along the Day.

    PubMed

    Marcolino-Gomes, Juliana; Rodrigues, Fabiana Aparecida; Fuganti-Pagliarini, Renata; Nakayama, Thiago Jonas; Ribeiro Reis, Rafaela; Bouças Farias, Jose Renato; Harmon, Frank G; Correa Molinari, Hugo Bruno; Correa Molinari, Mayla Daiane; Nepomuceno, Alexandre

    2015-01-01

    The soybean transcriptome displays strong variation along the day in optimal growth conditions and also in response to adverse circumstances, like drought stress. However, no study conducted to date has presented suitable reference genes, with stable expression along the day, for relative gene expression quantification in combined studies on drought stress and diurnal oscillations. Recently, water deficit responses have been associated with circadian clock oscillations at the transcription level, revealing the existence of hitherto unknown processes and increasing the demand for studies on plant responses to drought stress and its oscillation during the day. We performed data mining from a transcriptome-wide background using microarrays and RNA-seq databases to select an unpublished set of candidate reference genes, specifically chosen for the normalization of gene expression in studies on soybean under both drought stress and diurnal oscillations. Experimental validation and stability analysis in soybean plants submitted to drought stress and sampled during a 24 h timecourse showed that four of these newer reference genes (FYVE, NUDIX, Golgin-84 and CYST) indeed exhibited greater expression stability than the conventionally used housekeeping genes (ELF1-β and β-actin) under these conditions. We also demonstrated the effect of using reference candidate genes with different stability values to normalize the relative expression data from a drought-inducible soybean gene (DREB5) evaluated in different periods of the day.

  10. A highly sensitive and accurate gene expression analysis by sequencing ("bead-seq") for a single cell.

    PubMed

    Matsunaga, Hiroko; Goto, Mari; Arikawa, Koji; Shirai, Masataka; Tsunoda, Hiroyuki; Huang, Huan; Kambara, Hideki

    2015-02-15

    Analyses of gene expressions in single cells are important for understanding detailed biological phenomena. Here, a highly sensitive and accurate method by sequencing (called "bead-seq") to obtain a whole gene expression profile for a single cell is proposed. A key feature of the method is to use a complementary DNA (cDNA) library on magnetic beads, which enables adding washing steps to remove residual reagents in a sample preparation process. By adding the washing steps, the next steps can be carried out under the optimal conditions without losing cDNAs. Error sources were carefully evaluated to conclude that the first several steps were the key steps. It is demonstrated that bead-seq is superior to the conventional methods for single-cell gene expression analyses in terms of reproducibility, quantitative accuracy, and biases caused during sample preparation and sequencing processes. Copyright © 2014 Elsevier Inc. All rights reserved.

  11. Minimum-noise production of translation factor eIF4G maps to a mechanistically determined optimal rate control window for protein synthesis

    PubMed Central

    Meng, Xiang; Firczuk, Helena; Pietroni, Paola; Westbrook, Richard; Dacheux, Estelle; Mendes, Pedro; McCarthy, John E.G.

    2017-01-01

    Gene expression noise influences organism evolution and fitness. The mechanisms determining the relationship between stochasticity and the functional role of translation machinery components are critical to viability. eIF4G is an essential translation factor that exerts strong control over protein synthesis. We observe an asymmetric, approximately bell-shaped, relationship between the average intracellular abundance of eIF4G and rates of cell population growth and global mRNA translation, with peak rates occurring at normal physiological abundance. This relationship fits a computational model in which eIF4G is at the core of a multi-component–complex assembly pathway. This model also correctly predicts a plateau-like response of translation to super-physiological increases in abundance of the other cap-complex factors, eIF4E and eIF4A. Engineered changes in eIF4G abundance amplify noise, demonstrating that minimum stochasticity coincides with physiological abundance of this factor. Noise is not increased when eIF4E is overproduced. Plasmid-mediated synthesis of eIF4G imposes increased global gene expression stochasticity and reduced viability because the intrinsic noise for this factor influences total cellular gene noise. The naturally evolved eIF4G gene expression noise minimum maps within the optimal activity zone dictated by eIF4G's mechanistic role. Rate control and noise are therefore interdependent and have co-evolved to share an optimal physiological abundance point. PMID:27928055

  12. TALE activators regulate gene expression in a position- and strand-dependent manner in mammalian cells.

    PubMed

    Uhde-Stone, Claudia; Cheung, Edna; Lu, Biao

    2014-01-24

    Transcription activator-like effectors (TALEs) are a class of transcription factors that are readily programmable to regulate gene expression. Despite their growing popularity, little is known about binding site parameters that influence TALE-mediated gene activation in mammalian cells. We demonstrate that TALE activators modulate gene expression in mammalian cells in a position- and strand-dependent manner. To study the effects of binding site location, we engineered TALEs customized to recognize specific DNA sequences located in either the promoter or the transcribed region of reporter genes. We found that TALE activators robustly activated reporter genes when their binding sites were located within the promoter region. In contrast, TALE activators inhibited the expression of reporter genes when their binding sites were located on the sense strand of the transcribed region. Notably, this repression was independent of the effector domain utilized, suggesting a simple blockage mechanism. We conclude that TALE activators in mammalian cells regulate genes in a position- and strand-dependent manner that is substantially different from gene activation by native TALEs in plants. These findings have implications for optimizing the design of custom TALEs for genetic manipulation in mammalian cells. Copyright © 2013 Elsevier Inc. All rights reserved.

  13. Modulation of ColE1-like Plasmid Replication for Recombinant Gene Expression

    PubMed Central

    Camps, Manel

    2010-01-01

    ColE1-like plasmids constitute the most popular vectors for recombinant protein expression. ColE1 plasmid replication is tightly controlled by an antisense RNA mechanism that is highly dynamic, tuning plasmid metabolic burden to the physiological state of the host. Plasmid homeostasis is upset upon induction of recombinant protein expression because of non-physiological levels of expression and because of the frequently biased amino acid composition of recombinant proteins. Disregulation of plasmid replication is the main cause of collapse of plasmid-based expression systems because of a simultaneous increase in the metabolic burden (due to increased average copy number) and in the probability of generation of plasmid-free cells (due to increased copy number variation). Interference between regulatory elements of co-resident plasmids causes comparable effects on plasmid stability (plasmid incompatibility). Modulating plasmid copy number for recombinant gene expression aims at achieving a high gene dosage while preserving the stability of the expression system. Here I present strategies targeting plasmid replication for optimizing recombinant gene expression. Specifically, I review approaches aimed at modulating the antisense regulatory system (as well as their implications for plasmid incompatibility) and innovative strategies involving modulation of host factors, of R-loop formation, and of the timing of recombinant gene expression. PMID:20218961

  14. Expression and purification of functional Clostridium perfringens alpha and epsilon toxins in Escherichia coli.

    PubMed

    Zhao, Yao; Kang, Lin; Gao, Shan; Zhou, Yang; Su, Libo; Xin, Wenwen; Su, Yuxin; Wang, Jinglin

    2011-06-01

    The alpha and epsilon toxins are 2 of the 4 major lethal toxins of the pathogen Clostridium perfringens. In this study, the expression of the epsilon toxin (etx) gene of C. perfringens was optimized by replacing rare codons with high-frequency codons, and the optimized gene was synthesized using overlapping PCR. Then, the etx gene or the alpha-toxin gene (cpa) was individually inserted into the pTIG-Trx expression vector with a hexahistidine tag and a thioredoxin (Trx) to facilitate their purification and induce the expression of soluble proteins. The recombinant alpha toxin (rCPA) and epsilon toxin (rETX) were highly expressed as soluble forms in the recipient Escherichia coli BL21 strain, respectively. The rCPA and rETX were purified using Ni(2+)-chelating chromatography and size-exclusion chromatography. And the entire purification process recovered about 40% of each target protein from the starting materials. The purified target toxins formed single band at about 42kDa (rCPA) or 31kDa (rETX) in sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and their functional activity was confirmed by bioactivity assays. We have shown that the production of large amounts of soluble and functional proteins by using the pTIG-Trx vector in E. coli is a good alternative for the production of native alpha and epsilon toxins and could also be useful for the production of other toxic proteins with soluble forms. Copyright © 2011 Elsevier Inc. All rights reserved.

  15. Ribosomal binding site sequences and promoters for expressing glutamate decarboxylase and producing γ-aminobutyrate in Corynebacterium glutamicum.

    PubMed

    Shi, Feng; Luan, Mingyue; Li, Yongfu

    2018-04-18

    Glutamate decarboxylase (GAD) converts L-glutamate (Glu) into γ-aminobutyric acid (GABA). Corynebacterium glutamicum that expresses exogenous GAD gene, gadB2 or gadB1, can synthesize GABA from its own produced Glu. To enhance GABA production in C. glutamicum, ribosomal binding site (RBS) sequence and promoter were searched and optimized for increasing the expression efficiency of gadB2. R4 exhibited the highest strength among RBS sequences tested, with 6 nt the optimal aligned spacing (AS) between RBS and start codon. This combination of RBS sequence and AS contributed to gadB2 expression, increased GAD activity by 156% and GABA production by 82% compared to normal strong RBS and AS combination. Then, a series of native promoters were selected for transcribing gadB2 under optimal RBS and AS combination. P dnaK , P dtsR , P odhI and P clgR expressed gadB2 and produced GABA as effectively as widely applied P tuf and P cspB promoters and more effectively than P sod promoter. However, each native promoter did not work as well as the synthetic strong promoter P tacM , which produced 20.2 ± 0.3 g/L GABA. Even with prolonged length and bicistronic architecture, the strength of P dnaK did not enhance. Finally, gadB2 and mutant gadB1 were co-expressed under the optimal promoter and RBS combination, thus converted Glu into GABA completely and improved GABA production to more than 25 g/L. This study provides useful promoters and RBS sequences for gene expression in C. glutamicum.

  16. Optimization of the expression of a laccase gene from Trametes versicolor in Pichia methanolica.

    PubMed

    Guo, Mei; Lu, Fuping; Du, Lianxiang; Pu, Jun; Bai, Dongqing

    2006-08-01

    A cDNA encoding for laccase (Lcc1) was isolated from the ligninolytic fungus Trametes versicolor by reverse transcriptase polymerase chain reaction. The Lcc1 gene was subcloned into the Pichia methanolica expression vector pMETalphaA and transformed into the P. methanolica strains PMAD11 and PMAD16. The extracellular laccase activity of the PMAD11 recombinants was found to be 1.3-fold higher than that of the PMAD16 recombinants. The identity of the recombinant protein was further confirmed by immunodetection using the Western blot analysis. As expected, the molecular mass of the mature laccase was 64.0 kDa, similar to that of the native form. The effects of copper concentration, cultivation temperature, pH and methanol concentration in the BMMY on laccase expression were investigated. The laccase activity in the PMAD11 recombinant was up to 12.6 U ml(-1) by optimization.

  17. Cancer as quasi-attractor in the gene expression phase space

    NASA Astrophysics Data System (ADS)

    Giuliani, A.

    2017-09-01

    It takes no more than 250 tissue types to build up a metazoan, and each tissue has a specific and largely invariant gene expression signature. This implies the `viable configurations' correspondent to a given activated/inactivated expression pattern over the entire genome are very few. This points to the presence of few `low energy deep valleys' correspondent to the allowed states of the system and is a direct consequence of the fact genes do not work by alone but embedded into genetic expression networks. Statistical thermodynamics formalism focusing on the changes in the degree of correlation of the studied systems allows to detect transition behavior in gene expression phase space resembling the phase transition of physical-chemistry studies. In this realm cancer can be intended as a sort of `parasite' sub-attractor of the corresponding healthy tissue that, in the case of disease, is `kinetically entrapped' into a sub-optimal solution. The consequences of such a state of affair for cancer therapies are potentially huge.

  18. Transcription in space--environmental vs. genetic effects on differential immune gene expression.

    PubMed

    Lenz, Tobias L

    2015-09-01

    Understanding how organisms adapt to their local environment is one of the key goals in molecular ecology. Adaptation can be achieved through qualitative changes in the coding sequence and/or quantitative changes in gene expression, where the optimal dosage of a gene's product in a given environment is being selected for. Differences in gene expression among populations inhabiting distinct environments can be suggestive of locally adapted gene regulation and have thus been studied in different species (Whitehead & Crawford ; Hodgins-Davis & Townsend ). However, in contrast to a gene's coding sequence, its expression level at a given point in time may depend on various factors, including the current environment. Although critical for understanding the extent of local adaptation, it is usually difficult to disentangle the heritable differences in gene regulation from environmental effects. In this issue of Molecular Ecology, Stutz et al. () describe an experiment in which they reciprocally transplanted three-spined sticklebacks (Gasterosteus aculeatus) between independent pairs of small and large lakes. Their experimental design allows them to attribute differences in gene expression among sticklebacks either to lake of origin or destination lake. Interestingly, they find that translocated sticklebacks show a pattern of gene expression more similar to individuals from the destination lake than to individuals from the lake of origin, suggesting that expression of the targeted genes is more strongly regulated by environmental effects than by genetics. The environmental effect by itself is not entirely surprising; however, the relative extent of it is. Especially when put in the context of local adaptation and population differentiation, as done here, these findings cast a new light onto the heritability of differential gene expression and specifically its relative importance during population divergence and ultimately ecological speciation. © 2015 John Wiley & Sons Ltd.

  19. Expression of the Aspergillus terreus itaconic acid biosynthesis cluster in Aspergillus niger

    PubMed Central

    2014-01-01

    Background Aspergillus terreus is a natural producer of itaconic acid and is currently used to produce itaconic acid on an industrial scale. The metabolic process for itaconic acid biosynthesis is very similar to the production of citric acid in Aspergillus niger. However, a key enzyme in A. niger, cis-aconitate decarboxylase, is missing. The introduction of the A. terreus cadA gene in A. niger exploits the high level of citric acid production (over 200 g per liter) and theoretically can lead to production levels of over 135 g per liter of itaconic acid in A. niger. Given the potential for higher production levels in A. niger, production of itaconic acid in this host was investigated. Results Expression of Aspergillus terreus cis-aconitate decarboxylase in Aspergillus niger resulted in the production of a low concentration (0.05 g/L) of itaconic acid. Overexpression of codon-optimized genes for cis-aconitate decarboxylase, a mitochondrial transporter and a plasma membrane transporter in an oxaloacetate hydrolase and glucose oxidase deficient A. niger strain led to highly increased yields and itaconic acid production titers. At these higher production titers, the effect of the mitochondrial and plasma membrane transporters was much more pronounced, with levels being 5–8 times higher than previously described. Conclusions Itaconic acid can be produced in A. niger by the introduction of the A. terreus cis-aconitate decarboxylase encoding cadA gene. This results in a low itaconic acid production level, which can be increased by codon-optimization of the cadA gene for A. niger. A second crucial requirement for efficient production of itaconic acid is the expression of the A. terreus mttA gene, encoding a putative mitochondrial transporter. Expression of this transporter results in a twenty-fold increase in the secretion of itaconic acid. Expression of the A. terreus itaconic acid cluster consisting of the cadA gene, the mttA gene and the mfsA gene results in A. niger strains that produce over twenty five-fold higher levels of itaconic acid and show a twenty-fold increase in yield compared to a strain expressing only CadA. PMID:24438100

  20. Expression of the Aspergillus terreus itaconic acid biosynthesis cluster in Aspergillus niger.

    PubMed

    van der Straat, Laura; Vernooij, Marloes; Lammers, Marieke; van den Berg, Willy; Schonewille, Tom; Cordewener, Jan; van der Meer, Ingrid; Koops, Andries; de Graaff, Leo H

    2014-01-17

    Aspergillus terreus is a natural producer of itaconic acid and is currently used to produce itaconic acid on an industrial scale. The metabolic process for itaconic acid biosynthesis is very similar to the production of citric acid in Aspergillus niger. However, a key enzyme in A. niger, cis-aconitate decarboxylase, is missing. The introduction of the A. terreus cadA gene in A. niger exploits the high level of citric acid production (over 200 g per liter) and theoretically can lead to production levels of over 135 g per liter of itaconic acid in A. niger. Given the potential for higher production levels in A. niger, production of itaconic acid in this host was investigated. Expression of Aspergillus terreus cis-aconitate decarboxylase in Aspergillus niger resulted in the production of a low concentration (0.05 g/L) of itaconic acid. Overexpression of codon-optimized genes for cis-aconitate decarboxylase, a mitochondrial transporter and a plasma membrane transporter in an oxaloacetate hydrolase and glucose oxidase deficient A. niger strain led to highly increased yields and itaconic acid production titers. At these higher production titers, the effect of the mitochondrial and plasma membrane transporters was much more pronounced, with levels being 5-8 times higher than previously described. Itaconic acid can be produced in A. niger by the introduction of the A. terreus cis-aconitate decarboxylase encoding cadA gene. This results in a low itaconic acid production level, which can be increased by codon-optimization of the cadA gene for A. niger. A second crucial requirement for efficient production of itaconic acid is the expression of the A. terreus mttA gene, encoding a putative mitochondrial transporter. Expression of this transporter results in a twenty-fold increase in the secretion of itaconic acid. Expression of the A. terreus itaconic acid cluster consisting of the cadA gene, the mttA gene and the mfsA gene results in A. niger strains that produce over twenty five-fold higher levels of itaconic acid and show a twenty-fold increase in yield compared to a strain expressing only CadA.

  1. Relative gene expression of bile salt hydrolase and surface proteins in two putative indigenous Lactobacillus plantarum strains under in vitro gut conditions.

    PubMed

    Duary, Raj Kumar; Batish, Virender Kumar; Grover, Sunita

    2012-03-01

    Probiotic bacteria must overcome the toxicity of bile salts secreted in the gut and adhere to the epithelial cells to enable their better colonization with extended transit time. Expression of bile salt hydrolase and other proteins on the surface of probiotic bacteria can help in better survivability and optimal functionality in the gut. Two putative Lactobacillus plantarum isolates i.e., Lp9 and Lp91 along with standard strain CSCC5276 were used. A battery of six housekeeping genes viz. gapB, dnaG, gyrA, ldhD, rpoD and 16S rRNA were evaluated by using geNorm 3.4 excel based application for normalizing the expression of bile salt hydrolase (bsh), mucus-binding protein (mub), mucus adhesion promoting protein (mapA), and elongation factor thermo unstable (EF-Tu) in Lp9 and Lp91. The maximal level of relative bsh gene expression was recorded in Lp91 with 2.89 ± 0.14, 4.57 ± 0.37 and 6.38 ± 0.19 fold increase at 2% bile salt concentration after 1, 2 and 3 h, respectively. Similarly, mub and mapA genes were maximally expressed in Lp9 at the level of 20.07 ± 1.28 and 30.92 ± 1.51 fold, when MRS was supplemented with 0.05% mucin and 1% each of bile and pancreatin (pH 6.5). However, in case of EF-Tu, the maximal expression of 42.84 ± 5.64 fold was recorded in Lp91 in the presence of mucin alone (0.05%). Hence, the expression of bsh, mub, mapA and EF-Tu could be considered as prospective biomarkers for screening of novel probiotic lactobacillus strains for optimal functionality in the gut.

  2. Identifying optimal reference genes for the normalization of microRNA expression in cucumber under viral stress

    PubMed Central

    Liang, Chaoqiong; Hao, Jianjun; Meng, Yan; Luo, Laixin; Li, Jianqiang

    2018-01-01

    Cucumber green mottle mosaic virus (CGMMV) is an economically important pathogen and causes significant reduction of both yield and quality of cucumber (Cucumis sativus). Currently, there were no satisfied strategies for controlling the disease. A better understanding of microRNA (miRNA) expression related to the regulation of plant-virus interactions and virus resistance would be of great assistance when developing control strategies for CGMMV. However, accurate expression analysis is highly dependent on robust and reliable reference gene used as an internal control for normalization of miRNA expression. Most commonly used reference genes involved in CGMMV-infected cucumber are not universally expressed depending on tissue types and stages of plant development. It is therefore crucial to identify suitable reference genes in investigating the role of miRNA expression. In this study, seven reference genes, including Actin, Tubulin, EF-1α, 18S rRNA, Ubiquitin, GAPDH and Cyclophilin, were evaluated for the most accurate results in analyses using reverse transcription-quantitative polymerase chain reaction (RT-qPCR). Gene expression was assayed on cucumber leaves, stems and roots that were collected at different days post inoculation with CGMMV. The expression data were analyzed using algorithms including delta-Ct, geNorm, NormFinder, and BestKeeper as well as the comparative tool RefFinder. The reference genes were subsequently validated using miR159. The results showed that EF-1α and GAPDH were the most reliable reference genes for normalizing miRNA expression in leaf, root and stem samples, while Ubiquitin and EF-1α were the most suitable combination overall. PMID:29543906

  3. Stem Cell Gene Therapy for Fanconi Anemia: Report from the 1st International Fanconi Anemia Gene Therapy Working Group Meeting

    PubMed Central

    Tolar, Jakub; Adair, Jennifer E; Antoniou, Michael; Bartholomae, Cynthia C; Becker, Pamela S; Blazar, Bruce R; Bueren, Juan; Carroll, Thomas; Cavazzana-Calvo, Marina; Clapp, D Wade; Dalgleish, Robert; Galy, Anne; Gaspar, H Bobby; Hanenberg, Helmut; Von Kalle, Christof; Kiem, Hans-Peter; Lindeman, Dirk; Naldini, Luigi; Navarro, Susana; Renella, Raffaele; Rio, Paula; Sevilla, Julián; Schmidt, Manfred; Verhoeyen, Els; Wagner, John E; Williams, David A; Thrasher, Adrian J

    2011-01-01

    Survival rates after allogeneic hematopoietic cell transplantation (HCT) for Fanconi anemia (FA) have increased dramatically since 2000. However, the use of autologous stem cell gene therapy, whereby the patient's own blood stem cells are modified to express the wild-type gene product, could potentially avoid the early and late complications of allogeneic HCT. Over the last decades, gene therapy has experienced a high degree of optimism interrupted by periods of diminished expectation. Optimism stems from recent examples of successful gene correction in several congenital immunodeficiencies, whereas diminished expectations come from the realization that gene therapy will not be free of side effects. The goal of the 1st International Fanconi Anemia Gene Therapy Working Group Meeting was to determine the optimal strategy for moving stem cell gene therapy into clinical trials for individuals with FA. To this end, key investigators examined vector design, transduction method, criteria for large-scale clinical-grade vector manufacture, hematopoietic cell preparation, and eligibility criteria for FA patients most likely to benefit. The report summarizes the roadmap for the development of gene therapy for FA. PMID:21540837

  4. Comparison of multiple gene assembly methods for metabolic engineering

    Treesearch

    Chenfeng Lu; Karen Mansoorabadi; Thomas Jeffries

    2007-01-01

    A universal, rapid DNA assembly method for efficient multigene plasmid construction is important for biological research and for optimizing gene expression in industrial microbes. Three different approaches to achieve this goal were evaluated. These included creating long complementary extensions using a uracil-DNA glycosylase technique, overlap extension polymerase...

  5. Optimization of Soft Tissue Management, Spacer Design, and Grafting Strategies for Large Segmental Bone Defects using the Chronic Caprine Tibial Defect Model

    DTIC Science & Technology

    2015-12-01

    found with Tukey’s HSD post hoc analysis. Several target genes such as Oct4, Sox2, TGFB, and Col1A1 were generally up-regulated in all sections. In...expression analysis from the Aim 1 samples presented several upregulated target genes such as Oct4, Sox2, TGFB, and Col1A1 in all sections. No...TGFB, and Col1A1 . • Data from cellular analysis, histology, gene expression analysis and microCT are being assembled for the predictive model

  6. Gene Expression Profiles of Chlamydophila pneumoniae during the Developmental Cycle and Iron Depletion–Mediated Persistence

    PubMed Central

    Mäurer, André P; Mehlitz, Adrian; Mollenkopf, Hans J; Meyer, Thomas F

    2007-01-01

    The obligate intracellular, gram-negative bacterium Chlamydophila pneumoniae (Cpn) has impact as a human pathogen. Little is known about changes in the Cpn transcriptome during its biphasic developmental cycle (the acute infection) and persistence. The latter stage has been linked to chronic diseases. To analyze Cpn CWL029 gene expression, we designed a pathogen-specific oligo microarray and optimized the extraction method for pathogen RNA. Throughout the acute infection, ratio expression profiles for each gene were generated using 48 h post infection as a reference. Based on these profiles, significantly expressed genes were separated into 12 expression clusters using self-organizing map clustering and manual sorting into the “early”, “mid”, “late”, and “tardy” cluster classes. The latter two were differentiated because the “tardy” class showed steadily increasing expression at the end of the cycle. The transcriptome of the Cpn elementary body (EB) and published EB proteomics data were compared to the cluster profile of the acute infection. We found an intriguing association between “late” genes and genes coding for EB proteins, whereas “tardy” genes were mainly associated with genes coding for EB mRNA. It has been published that iron depletion leads to Cpn persistence. We compared the gene expression profiles during iron depletion–mediated persistence with the expression clusters of the acute infection. This led to the finding that establishment of iron depletion–mediated persistence is more likely a mid-cycle arrest in development rather than a completely distinct gene expression pattern. Here, we describe the Cpn transcriptome during the acute infection, differentiating “late” genes, which correlate to EB proteins, and “tardy” genes, which lead to EB mRNA. Expression profiles during iron mediated–persistence led us to propose the hypothesis that the transcriptomic “clock” is arrested during acute mid-cycle. PMID:17590080

  7. Full expression of Bacillus anthracis toxin gene in the presence of bicarbonate requires a 2.7-kb-long atxA mRNA that contains a terminator structure.

    PubMed

    Bertin, Marine; Château, Alice; Fouet, Agnès

    2010-05-01

    Bacillus anthracis toxin gene expression requires AtxA, a virulence regulator that also activates capsule gene transcription and controls expression of more than a hundred genes. Here we report that atxA mRNA is 2.7-kb-long and ends, after a 500 nt-long 3' untranslated region, with a stem loop structure followed by a run of U's. The presence of this structure stabilizes atxA mRNA and is necessary for AtxA maximal accumulation, full expression of the PA toxin gene, pagA and optimal PA accumulation. This structure displays terminator activity independently of its orientation when cloned between an inducible promoter and a reporter gene. The 3.6-kb-long DNA fragment carrying both AtxA promoters and the terminator is sufficient for full expression of pagA in the presence of bicarbonate. No pXO1-encoded element other than the DNA fragment encompassing the 2.7 kb atxA transcript and the pagA promoter is required for bicarbonate induction of pagA transcription. (c) 2010 Elsevier Masson SAS. All rights reserved.

  8. In silico evolution of the hunchback gene indicates redundancy in cis-regulatory organization and spatial gene expression

    PubMed Central

    Zagrijchuk, Elizaveta A.; Sabirov, Marat A.; Holloway, David M.; Spirov, Alexander V.

    2014-01-01

    Biological development depends on the coordinated expression of genes in time and space. Developmental genes have extensive cis-regulatory regions which control their expression. These regions are organized in a modular manner, with different modules controlling expression at different times and locations. Both how modularity evolved and what function it serves are open questions. We present a computational model for the cis-regulation of the hunchback (hb) gene in the fruit fly (Drosophila). We simulate evolution (using an evolutionary computation approach from computer science) to find the optimal cis-regulatory arrangements for fitting experimental hb expression patterns. We find that the cis-regulatory region tends to readily evolve modularity. These cis-regulatory modules (CRMs) do not tend to control single spatial domains, but show a multi-CRM/multi-domain correspondence. We find that the CRM-domain correspondence seen in Drosophila evolves with a high probability in our model, supporting the biological relevance of the approach. The partial redundancy resulting from multi-CRM control may confer some biological robustness against corruption of regulatory sequences. The technique developed on hb could readily be applied to other multi-CRM developmental genes. PMID:24712536

  9. Living colors in the gray mold pathogen Botrytis cinerea: codon-optimized genes encoding green fluorescent protein and mCherry, which exhibit bright fluorescence.

    PubMed

    Leroch, Michaela; Mernke, Dennis; Koppenhoefer, Dieter; Schneider, Prisca; Mosbach, Andreas; Doehlemann, Gunther; Hahn, Matthias

    2011-05-01

    The green fluorescent protein (GFP) and its variants have been widely used in modern biology as reporters that allow a variety of live-cell imaging techniques. So far, GFP has rarely been used in the gray mold fungus Botrytis cinerea because of low fluorescence intensity. The codon usage of B. cinerea genes strongly deviates from that of commonly used GFP-encoding genes and reveals a lower GC content than other fungi. In this study, we report the development and use of a codon-optimized version of the B. cinerea enhanced GFP (eGFP)-encoding gene (Bcgfp) for improved expression in B. cinerea. Both the codon optimization and, to a smaller extent, the insertion of an intron resulted in higher mRNA levels and increased fluorescence. Bcgfp was used for localization of nuclei in germinating spores and for visualizing host penetration. We further demonstrate the use of promoter-Bcgfp fusions for quantitative evaluation of various toxic compounds as inducers of the atrB gene encoding an ABC-type drug efflux transporter of B. cinerea. In addition, a codon-optimized mCherry-encoding gene was constructed which yielded bright red fluorescence in B. cinerea.

  10. DELAY OF GERMINATION 1 mediates a conserved coat-dormancy mechanism for the temperature- and gibberellin-dependent control of seed germination.

    PubMed

    Graeber, Kai; Linkies, Ada; Steinbrecher, Tina; Mummenhoff, Klaus; Tarkowská, Danuše; Turečková, Veronika; Ignatz, Michael; Sperber, Katja; Voegele, Antje; de Jong, Hans; Urbanová, Terezie; Strnad, Miroslav; Leubner-Metzger, Gerhard

    2014-08-26

    Seed germination is an important life-cycle transition because it determines subsequent plant survival and reproductive success. To detect optimal spatiotemporal conditions for germination, seeds act as sophisticated environmental sensors integrating information such as ambient temperature. Here we show that the delay of germination 1 (DOG1) gene, known for providing dormancy adaptation to distinct environments, determines the optimal temperature for seed germination. By reciprocal gene-swapping experiments between Brassicaceae species we show that the DOG1-mediated dormancy mechanism is conserved. Biomechanical analyses show that this mechanism regulates the material properties of the endosperm, a seed tissue layer acting as germination barrier to control coat dormancy. We found that DOG1 inhibits the expression of gibberellin (GA)-regulated genes encoding cell-wall remodeling proteins in a temperature-dependent manner. Furthermore we demonstrate that DOG1 causes temperature-dependent alterations in the seed GA metabolism. These alterations in hormone metabolism are brought about by the temperature-dependent differential expression of genes encoding key enzymes of the GA biosynthetic pathway. These effects of DOG1 lead to a temperature-dependent control of endosperm weakening and determine the optimal temperature for germination. The conserved DOG1-mediated coat-dormancy mechanism provides a highly adaptable temperature-sensing mechanism to control the timing of germination.

  11. SHOX gene is expressed in vertebral body growth plates in idiopathic and congenital scoliosis: implications for the etiology of scoliosis in Turner syndrome.

    PubMed

    Day, Gregory; Szvetko, Attila; Griffiths, Lyn; McPhee, I Bruce; Tuffley, John; LaBrom, Robert; Askin, Geoffrey; Woodland, Peter; McClosky, Eamonn; Torode, Ian; Tomlinson, Francis

    2009-06-01

    Reduced SHOX gene expression has been demonstrated to be associated with all skeletal abnormalities in Turner syndrome, other than scoliosis (and kyphosis). There is evidence to suggest that Turner syndrome scoliosis is clinically and radiologically similar to idiopathic scoliosis, although the phenotypes are dissimilar. This pilot gene expression study used relative quantitative real-time PCR (qRT-PCR) of the SHOX (short stature on X) gene to determine whether it is expressed in vertebral body growth plates in idiopathic and congenital scoliosis. After vertebral growth plate dissection, tissue was examined histologically and RNA was extracted and its integrity was assessed using a Bio-Spec Mini, NanoDrop ND-1000 spectrophotometer and standard denaturing gel electrophoresis. Following cDNA synthesis, gene-specific optimization in a Corbett RotorGene 6000 real-time cycler was followed by qRT-PCR of vertebral tissue. Histological examination of vertebral samples confirmed that only growth plate was analyzed for gene expression. Cycling and melt curves were resolved in triplicate for all samples. SHOX abundance was demonstrated in congenital and idiopathic scoliosis vertebral body growth plates. SHOX expression was 11-fold greater in idiopathic compared to congenital (n = 3) scoliosis (p = 0.027). This study confirmed that SHOX was expressed in vertebral body growth plates, which implies that its expression may also be associated with the scoliosis (and kyphosis) of Turner syndrome. SHOX expression is reduced in Turner syndrome (short stature). In this study, increased SHOX expression was demonstrated in idiopathic scoliosis (tall stature) and congenital scoliosis. Copyright 2008 Orthopaedic Research Society

  12. Gene Suppression of Mouse Testis In Vivo Using Small Interfering RNA Derived from Plasmid Vectors

    PubMed Central

    Takizawa, Takami; Ishikawa, Tomoko; Kosuge, Takuji; Mizuguchi, Yoshiaki; Sato, Yoko; Koji, Takehiko; Araki, Yoshihiko; Takizawa, Toshihiro

    2012-01-01

    We evaluated whether inhibiting gene expression by small interfering RNA (siRNA) can be used for an in vivo model using a germ cell-specific gene (Tex101) as a model target in mouse testis. We generated plasmid-based expression vectors of siRNA targeting the Tex101 gene and transfected them into postnatal day 10 mouse testes by in vivo electroporation. After optimizing the electroporation conditions using a vector transfected into the mouse testis, a combination of high- and low-voltage pulses showed excellent transfection efficiency for the vectors with minimal tissue damage, but gene suppression was transient. Gene suppression by in vivo electroporation may be helpful as an alternative approach when designing experiments to unravel the basic role of testicular molecules. PMID:22489107

  13. Toxicity of algicidal extracts from Mangrovimonas yunxiaonensis strain LY01 on a HAB causing Alexandrium tamarense.

    PubMed

    Li, Yi; Zhu, Hong; Zhang, Huajun; Chen, Zhangran; Tian, Yun; Xu, Hong; Zheng, Tianling; Zheng, Wei

    2014-08-15

    Toxicity of algicidal extracts from Mangrovimonas yunxiaonensis strain LY01 on Alexandrium tamarense were measured through studying the algicidal procedure, nuclear damage and transcription of related genes. Medium components were optimized to improve algicidal activity, and characteristics of algicidal extracts were determined. Transmission electron microscope analysis revealed that the cell structure was broken. Cell membrane integrity destruction and nuclear structure degradation were monitored using confocal laser scanning microscope, and the rbcS, hsp and proliferating cell nuclear antigen (PCNA) gene expressions were studied. Results showed that 1.0% tryptone, 0.4% glucose and 0.8% MgCl2 were the optimal nutrient sources. The algicidal extracts were heat and pH stable, non-protein and less than 1kD. Cell membrane and nuclear structure integrity were lost, and the transcription of the rbcS and PCNA genes were significantly inhibited and there was up-regulation of hsp gene expression during the exposure procedure. The algicidal extracts destroyed the cell membrane and nuclear structure integrity, inhibited related gene expression and, eventually, lead to the inhibition of algal growth. All the results may elaborate firstly the cell death process and nuclear damage in A. tamarense which was induced by algicidal extracts, and the algicidal extracts could be potentially used as bacterial control of HABs in future. Copyright © 2014 Elsevier B.V. All rights reserved.

  14. A mixed incoherent feed-forward loop contributes to the regulation of bacterial photosynthesis genes.

    PubMed

    Mank, Nils N; Berghoff, Bork A; Klug, Gabriele

    2013-03-01

    Living cells use a variety of regulatory network motifs for accurate gene expression in response to changes in their environment or during differentiation processes. In Rhodobacter sphaeroides, a complex regulatory network controls expression of photosynthesis genes to guarantee optimal energy supply on one hand and to avoid photooxidative stress on the other hand. Recently, we identified a mixed incoherent feed-forward loop comprising the transcription factor PrrA, the sRNA PcrZ and photosynthesis target genes as part of this regulatory network. This point-of-view provides a comparison to other described feed-forward loops and discusses the physiological relevance of PcrZ in more detail.

  15. A mixed incoherent feed-forward loop contributes to the regulation of bacterial photosynthesis genes

    PubMed Central

    Mank, Nils N.; Berghoff, Bork A.; Klug, Gabriele

    2013-01-01

    Living cells use a variety of regulatory network motifs for accurate gene expression in response to changes in their environment or during differentiation processes. In Rhodobacter sphaeroides, a complex regulatory network controls expression of photosynthesis genes to guarantee optimal energy supply on one hand and to avoid photooxidative stress on the other hand. Recently, we identified a mixed incoherent feed-forward loop comprising the transcription factor PrrA, the sRNA PcrZ and photosynthesis target genes as part of this regulatory network. This point-of-view provides a comparison to other described feed-forward loops and discusses the physiological relevance of PcrZ in more detail. PMID:23392242

  16. [Construction of high-yield strain by optimizing lycopene cyclase for β-carotene production].

    PubMed

    Jin, Yingfu; Han, Li; Zhang, Shasha; Li, Shizhong; Liu, Weifeng; Tao, Yong

    2017-11-25

    To optimize key enzymes, such as to explore the gene resources and to modify the expression level, can maximize metabolic pathways of target products. β-carotene is a terpenoid compound with important application value. Lycopene cyclase (CrtY) is the key enzyme in β-carotene biosynthesis pathway, catalyzing flavin adenine dinucleotide (FAD)-dependent cyclization reaction and β-carotene synthesis from lycopene precursor. We optimized lycopene cyclase (CrtY) to improve the synthesis of β-carotene and determined the effect of CrtY expression on metabolic pathways. Frist, we developed a β-carotene synthesis module by coexpressing the lycopene β-cyclase gene crtY with crtEBI module in Escherichia coli. Then we simultaneously optimized the ribosome-binding site (RBS) intensity and the species of crtY using oligo-linker mediated DNA assembly method (OLMA). Five strains with high β-carotene production capacity were screened out from the OLMA library. The β-carotene yields of these strains were up to 15.79-18.90 mg/g DCW (Dry cell weight), 65% higher than that of the original strain at shake flask level. The optimal strain CP12 was further identified and evaluated for β-carotene production at 5 L fermentation level. After process optimization, the final β-carotene yield could reach to 1.9 g/L. The results of RBS strength and metabolic intermediate analysis indicated that an appropriate expression level of CrtY could be beneficial for the function of the β-carotene synthesis module. The results of this study provide important insight into the optimization of β-carotene synthesis pathway in metabolic engineering.

  17. Enhanced expression of codon optimized Mycobacterium avium subsp. paratuberculosis antigens in Lactobacillus salivarius

    USDA-ARS?s Scientific Manuscript database

    We have previously identified the mycobacterial high G+C codon usage bias as a limiting factor in heterologous expression of MAP proteins from Lb.salivarius, and demonstrated that codon optimisation of a synthetic coding gene greatly enhances MAP protein production. Here, we effectively demonstrate ...

  18. Genomic biomarkers and heart transplantation.

    PubMed

    Mehra, Mandeep R; Uber, Patricia A

    2007-01-01

    Clinicians have entered into a new paradigm for managing heart transplant patients with use of multimarker gene expression profiling. Early after transplantation, when corticosteroid modification is the main concern, gene expression testing might assist in optimizing the balance of immunosuppression, defraying the occurrence of rejection, and avoiding crisis intervention. Late after transplantation, the reliance on endomyocardial biopsy could be lessened. These advances, if continually validated in practice, could usher in an era of decreased immunosuppression complications, lesser need for invasive surveillance, and more clinical confidence in immunosuppressive strategies.

  19. Microprojectile Bombardment Transformation of Date Palm Using the Insecticidal Cholesterol Oxidase (ChoA) Gene.

    PubMed

    Allam, Mai A; Saker, Mahmoud M

    2017-01-01

    The overall objective of this work is to optimize the transformation system for date palm as a first step toward production of date palm clones resistant to noxious pests. A construct harboring the cholesterol oxidase (ChoA) gene, which renders plant resistance against insect attack, is introduced into embryogenic date palm callus using the PDS-1000/He particle bombardment system. The process involves the establishment of embryogenic callus cultures as well as immature embryo-derived microcalli that are used as target tissues for shooting and optimization of transformation conditions. This chapter in addition explains molecular and histochemical assays conducted to confirm gene integration and expression.

  20. Reliable cloning of functional antibody variable domains from hybridomas and spleen cell repertoires employing a reengineered phage display system.

    PubMed

    Krebber, A; Bornhauser, S; Burmester, J; Honegger, A; Willuda, J; Bosshard, H R; Plückthun, A

    1997-02-14

    A prerequisite for the use of recombinant antibody technologies starting from hybridomas or immune repertoires is the reliable cloning of functional immunoglobulin genes. For this purpose, a standard phage display system was optimized for robustness, vector stability, tight control of scFv-delta geneIII expression, primer usage for PCR amplification of variable region genes, scFv assembly strategy and subsequent directional cloning using a single rare cutting restriction enzyme. This integrated cloning, screening and selection system allowed us to rapidly obtain antigen binding scFvs derived from spleen-cell repertoires of mice immunized with ampicillin as well as from all hybridoma cell lines tested to date. As representative examples, cloning of monoclonal antibodies against a his tag, leucine zippers, the tumor marker EGP-2 and the insecticide DDT is presented. Several hybridomas whose genes could not be cloned in previous experimental setups, but were successfully obtained with the present system, expressed high amounts of aberrant heavy and light chain mRNAs, which were amplified by PCR and greatly exceeded the amount of binding antibody sequences. These contaminating variable region genes were successfully eliminated by employing the optimized phage display system, thus avoiding time consuming sequencing of non-binding scFv genes. To maximize soluble expression of functional scFvs subsequent to cloning, a compatible vector series to simplify modification, detection, multimerization and rapid purification of recombinant antibody fragments was constructed.

  1. Highly efficient gene transfer using a retroviral vector into murine T cells for preclinical chimeric antigen receptor-expressing T cell therapy

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kusabuka, Hotaka; Fujiwara, Kento; Tokunaga, Yusuke

    Adoptive immunotherapy using chimeric antigen receptor-expressing T (CAR-T) cells has attracted attention as an efficacious strategy for cancer treatment. To prove the efficacy and safety of CAR-T cell therapy, the elucidation of immunological mechanisms underlying it in mice is required. Although a retroviral vector (Rv) is mainly used for the introduction of CAR to murine T cells, gene transduction efficiency is generally less than 50%. The low transduction efficiency causes poor precision in the functional analysis of CAR-T cells. We attempted to improve the Rv gene transduction protocol to more efficiently generate functional CAR-T cells by optimizing the period ofmore » pre-cultivation and antibody stimulation. In the improved protocol, gene transduction efficiency to murine T cells was more than 90%. In addition, almost all of the prepared murine T cells expressed CAR after puromycin selection. These CAR-T cells had antigen-specific cytotoxic activity and secreted multiple cytokines by antigen stimulation. We believe that our optimized gene transduction protocol for murine T cells contributes to the advancement of T cell biology and development of immunotherapy using genetically engineered T cells. - Highlights: • We established highly efficient gene transduction protocols for murine T cells. • CD8{sup +} CAR-T cells had antigen-specific cytotoxic activity. • CD4{sup +} CAR-T cells secreted multiple cytokines by antigen stimulation. • This finding can contribute to the development of T-cell biology and immunotherapy.« less

  2. Expression, purification and characterization of a phyAm-phyCs fusion phytase*

    PubMed Central

    Zou, Li-kou; Wang, Hong-ning; Pan, Xin; Tian, Guo-bao; Xie, Zi-wen; Wu, Qi; Chen, Hui; Xie, Tao; Yang, Zhi-rong

    2008-01-01

    The phyAm gene encoding acid phytase and optimized neutral phytase phyCs gene were inserted into expression vector pPIC9K in correct orientation and transformed into Pichia pastoris in order to expand the pH profile of phytase and decrease the cost of production. The fusion phytase phyAm-phyCs gene was successfully overexpressed in P. pastoris as an active and extracellular phytase. The yield of total extracellular fusion phytase activity is (25.4±0.53) U/ml at the flask scale and (159.1±2.92) U/ml for high cell-density fermentation, respectively. Purified fusion phytase exhibits an optimal temperature at 55 °C and an optimal pH at 5.5~6.0 and its relative activity remains at a relatively high level of above 70% in the range of pH 2.0 to 7.0. About 51% to 63% of its original activity remains after incubation at 75 °C to 95 °C for 10 min. Due to heavy glycosylation, the expressed fusion phytase shows a broad and diffuse band in SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis). After deglycosylation by endoglycosidase H (EndoHf), the enzyme has an apparent molecular size of 95 kDa. The characterization of the fusion phytase was compared with those of phyCs and phyAm. PMID:18600783

  3. Optimization of techniques for multiple platform testing in small, precious samples such as human chorionic villus sampling.

    PubMed

    Pisarska, Margareta D; Akhlaghpour, Marzieh; Lee, Bora; Barlow, Gillian M; Xu, Ning; Wang, Erica T; Mackey, Aaron J; Farber, Charles R; Rich, Stephen S; Rotter, Jerome I; Chen, Yii-der I; Goodarzi, Mark O; Guller, Seth; Williams, John

    2016-11-01

    Multiple testing to understand global changes in gene expression based on genetic and epigenetic modifications is evolving. Chorionic villi, obtained for prenatal testing, is limited, but can be used to understand ongoing human pregnancies. However, optimal storage, processing and utilization of CVS for multiple platform testing have not been established. Leftover CVS samples were flash-frozen or preserved in RNAlater. Modifications to standard isolation kits were performed to isolate quality DNA and RNA from samples as small as 2-5 mg. RNAlater samples had significantly higher RNA yields and quality and were successfully used in microarray and RNA-sequencing (RNA-seq). RNA-seq libraries generated using 200 versus 800-ng RNA showed similar biological coefficients of variation. RNAlater samples had lower DNA yields and quality, which improved by heating the elution buffer to 70 °C. Purification of DNA was not necessary for bisulfite-conversion and genome-wide methylation profiling. CVS cells were propagated and continue to express genes found in freshly isolated chorionic villi. CVS samples preserved in RNAlater are superior. Our optimized techniques provide specimens for genetic, epigenetic and gene expression studies from a single small sample which can be used to develop diagnostics and treatments using a systems biology approach in the prenatal period. © 2016 John Wiley & Sons, Ltd. © 2016 John Wiley & Sons, Ltd.

  4. Gene expression of bovine embryos developing at the air-liquid interface on oviductal epithelial cells (ALI-BOEC).

    PubMed

    van der Weijden, Vera A; Chen, Shuai; Bauersachs, Stefan; Ulbrich, Susanne E; Schoen, Jennifer

    2017-11-25

    We recently developed an air-liquid interface long-term culture of differentiated bovine oviductal epithelial cells (ALI-BOEC). This ex vivo oviduct epithelium is capable of supporting embryo development in co-culture up to the blastocyst stage without addition of embryo culture medium. However, blastocyst rates in co-culture were markedly lower than in conventional in vitro embryo production procedures. In the present study, we assessed target gene expression of ALI-BOEC derived embryos to test their similarity to embryos from conventional in vitro embryo culture. We screened previously published data from developing bovine embryos and selected 41 genes which are either differentially expressed during embryo development, or reflect differences between various in vitro culture conditions or in vitro and in vivo embryos. Target gene expression was measured in 8-cell embryos and blastocysts using a 48.48 Dynamic Array™ on a Biomark HD instrument. For comparison with the ALI-BOEC system, we generated embryos by two different standard IVP protocols. The culture conditions lead to differential gene expression in both 8-cell embryos and blastocysts. Across the expression of all target genes the embryos developing on ALI-BOEC did not depart from conventional IVP embryos. These first results prove that gene expression in ALI-BOEC embryos is not largely aberrant. However, there was no clear indication for a more in vivo-like target gene expression of these embryos. This calls for further optimization of the ALI-BOEC system to increase its efficiency both quantitatively and qualitatively.

  5. Suboptimal evolutionary novel environments promote singular altered gravity responses of transcriptome during Drosophila metamorphosis

    PubMed Central

    2013-01-01

    Background Previous experiments have shown that the reduced gravity aboard the International Space Station (ISS) causes important alterations in Drosophila gene expression. These changes were shown to be intimately linked to environmental space-flight related constraints. Results Here, we use an array of different techniques for ground-based simulation of microgravity effects to assess the effect of suboptimal environmental conditions on the gene expression of Drosophila in reduced gravity. A global and integrative analysis, using “gene expression dynamics inspector” (GEDI) self-organizing maps, reveals different degrees in the responses of the transcriptome when using different environmental conditions or microgravity/hypergravity simulation devices. Although the genes that are affected are different in each simulation technique, we find that the same gene ontology groups, including at least one large multigene family related with behavior, stress response or organogenesis, are over represented in each case. Conclusions These results suggest that the transcriptome as a whole can be finely tuned to gravity force. In optimum environmental conditions, the alteration of gravity has only mild effects on gene expression but when environmental conditions are far from optimal, the gene expression must be tuned greatly and effects become more robust, probably linked to the lack of experience of organisms exposed to evolutionary novel environments such as a gravitational free one. PMID:23806134

  6. Network-based differential gene expression analysis suggests cell cycle related genes regulated by E2F1 underlie the molecular difference between smoker and non-smoker lung adenocarcinoma

    PubMed Central

    2013-01-01

    Background Differential gene expression (DGE) analysis is commonly used to reveal the deregulated molecular mechanisms of complex diseases. However, traditional DGE analysis (e.g., the t test or the rank sum test) tests each gene independently without considering interactions between them. Top-ranked differentially regulated genes prioritized by the analysis may not directly relate to the coherent molecular changes underlying complex diseases. Joint analyses of co-expression and DGE have been applied to reveal the deregulated molecular modules underlying complex diseases. Most of these methods consist of separate steps: first to identify gene-gene relationships under the studied phenotype then to integrate them with gene expression changes for prioritizing signature genes, or vice versa. It is warrant a method that can simultaneously consider gene-gene co-expression strength and corresponding expression level changes so that both types of information can be leveraged optimally. Results In this paper, we develop a gene module based method for differential gene expression analysis, named network-based differential gene expression (nDGE) analysis, a one-step integrative process for prioritizing deregulated genes and grouping them into gene modules. We demonstrate that nDGE outperforms existing methods in prioritizing deregulated genes and discovering deregulated gene modules using simulated data sets. When tested on a series of smoker and non-smoker lung adenocarcinoma data sets, we show that top differentially regulated genes identified by the rank sum test in different sets are not consistent while top ranked genes defined by nDGE in different data sets significantly overlap. nDGE results suggest that a differentially regulated gene module, which is enriched for cell cycle related genes and E2F1 targeted genes, plays a role in the molecular differences between smoker and non-smoker lung adenocarcinoma. Conclusions In this paper, we develop nDGE to prioritize deregulated genes and group them into gene modules by simultaneously considering gene expression level changes and gene-gene co-regulations. When applied to both simulated and empirical data, nDGE outperforms the traditional DGE method. More specifically, when applied to smoker and non-smoker lung cancer sets, nDGE results illustrate the molecular differences between smoker and non-smoker lung cancer. PMID:24341432

  7. Cloning and high-level expression of β-xylosidase from Selenomonas ruminantium in Pichia pastoris by optimizing of pH, methanol concentration and temperature conditions.

    PubMed

    Dehnavi, Ehsan; Ranaei Siadat, Seyed Omid; Fathi Roudsari, Mehrnoosh; Khajeh, Khosro

    2016-08-01

    β-xylosidase and several other glycoside hydrolase family members, including xylanase, cooperate together to degrade hemicelluloses, a commonly found xylan polymer of plant-cell wall. β-d-xylosidase/α-l-arabinofuranosidase from the ruminal anaerobic bacterium Selenomonas ruminantium (SXA) has potential utility in industrial processes such as production of fuel ethanol and other bioproducts. The optimized synthetic SXA gene was overexpressed in methylotrophic Pichia pastoris under the control of alcohol oxidase I (AOX1) promoter and secreted into the medium. Recombinant protein showed an optimum pH 4.8 and optimum temperature 50 °C. Furthermore, optimization of growth and induction conditions in shake flask was carried out. Using the optimum expression condition (pH 6, temperature 20 °C and 1% methanol induction), protein production was increased by about three times in comparison to the control. The recombinant SXA we have expressed here showed higher turnover frequency using ρ-nitrophenyl β-xylopyranoside (PNPX) substrate, in contrast to most xylosidase experiments reported previously. This is the first report on the cloning and expression of a β-xylosidase gene from glycoside hydrolase (GH) family 43 in Pichia pastoris. Our results confirm that P. pastoris is an appropriate host for high level expression and production of SXA for industrial applications. Copyright © 2016. Published by Elsevier Inc.

  8. Fine-tuning gene networks using simple sequence repeats

    PubMed Central

    Egbert, Robert G.; Klavins, Eric

    2012-01-01

    The parameters in a complex synthetic gene network must be extensively tuned before the network functions as designed. Here, we introduce a simple and general approach to rapidly tune gene networks in Escherichia coli using hypermutable simple sequence repeats embedded in the spacer region of the ribosome binding site. By varying repeat length, we generated expression libraries that incrementally and predictably sample gene expression levels over a 1,000-fold range. We demonstrate the utility of the approach by creating a bistable switch library that programmatically samples the expression space to balance the two states of the switch, and we illustrate the need for tuning by showing that the switch’s behavior is sensitive to host context. Further, we show that mutation rates of the repeats are controllable in vivo for stability or for targeted mutagenesis—suggesting a new approach to optimizing gene networks via directed evolution. This tuning methodology should accelerate the process of engineering functionally complex gene networks. PMID:22927382

  9. Impact of Collection and Storage of Lung Tumor Tissue on Whole Genome Expression Profiling

    PubMed Central

    Freidin, Maxim B.; Bhudia, Neesa; Lim, Eric; Nicholson, Andrew G.; Cookson, William O.; Moffatt, Miriam F.

    2012-01-01

    Gene expression profiling could assist in revealing biomarkers of lung cancer prognosis and progression. The handling of biological samples may strongly influence global gene expression, a fact that has not been addressed in many studies. We sought to investigate the changes in gene expression that may occur as a result of sample processing time and conditions. Using Illumina Human WG-6 arrays, we quantified gene expression in lung carcinoma samples from six patients obtained at chest opening before and immediately after lung resection with storage in RNAlater [T1a(CO) and T1b(LR)], after receipt of the sample for histopathology, placed in RNAlater [T2a(HP)]; snap frozen [T2b(HP.SF)]; or snap frozen and stored for 1 week [T2c(HP.SFA)], as well as formalin-fixed, paraffin-embedded (FFPE) block samples. Sampling immediately after resection closely represented the tissue obtained in situ, with only 1% of genes differing more than twofold [T1a(CO) versus T1b(LR)]. Delaying tissue harvest for an average of 30 minutes from the operating theater had a significant impact on gene expression, with approximately 25% of genes differing between T1a(CO) and T2a(HP). Many genes previously identified as lung cancer biomarkers were altered during this period. Examination of FFPE specimens showed minimal correlation with fresh samples. This study shows that tissue collection immediately after lung resection with conservation in RNAlater is an optimal strategy for gene expression profiling. PMID:22240448

  10. Evidence for changes in the transcription levels of two putative P-glycoprotein genes in sea lice (Lepeophtheirus salmonis) in response to emamectin benzoate exposure.

    PubMed

    Tribble, Nicholas D; Burka, John F; Kibenge, Frederick S B

    2007-05-01

    Overexpression of P-glycoproteins (Pgps) is assumed to be a principal mechanism of resistance of nematodes and arthropods to macrocyclic lactones. Quantitative RT-PCR (Q-RT-PCR) was used to demonstrate changes in transcription levels of two putative P-glycoprotein genes, designated here as SL0525 and SL-Pgp1, in sea lice (Lepeophtheirus salmonis) following exposure to emamectin benzoate (EMB). Pre-adult L. salmonis were challenged in an EMB bioassay for 24h and gene expression was studied from lice surviving EMB concentrations of 0, 10, and 30ppb. Gene expression was measured using Q-RT-PCR with elongation factor 1 (eEF1alpha) as an internal reference gene. The results show that both target genes, SL0525 and SL-Pgp1, had significantly increased levels of expression with exposure to 10ppb EMB (p=0.11 and p=0.17, respectively) whereas the group exposed to 30ppb was on the verge of being significant (p=0.053) only in the expression of SL-Pgp1. Gene expression for SL0525 and SL-Pgp1 were increased over five-fold at 10ppb EMB. Therefore, the upregulation of these target genes may offer protection by increasing Pgp expression when lice are exposed to EMB. Our optimized Q-RT-PCR can be used to determine if over-expression of these genes could be the basis for development of resistance in sea lice and thus allow suitable alternative chemotherapeutic options to be assessed.

  11. Bacterial Competition Reveals Differential Regulation of the pks Genes by Bacillus subtilis

    PubMed Central

    Vargas-Bautista, Carol; Rahlwes, Kathryn

    2014-01-01

    Bacillus subtilis is adaptable to many environments in part due to its ability to produce a broad range of bioactive compounds. One such compound, bacillaene, is a linear polyketide/nonribosomal peptide. The pks genes encode the enzymatic megacomplex that synthesizes bacillaene. The majority of pks genes appear to be organized as a giant operon (>74 kb from pksC-pksR). In previous work (P. D. Straight, M. A. Fischbach, C. T. Walsh, D. Z. Rudner, and R. Kolter, Proc. Natl. Acad. Sci. U. S. A. 104:305–310, 2007, doi:10.1073/pnas.0609073103), a deletion of the pks operon in B. subtilis was found to induce prodiginine production by Streptomyces coelicolor. Here, colonies of wild-type B. subtilis formed a spreading population that induced prodiginine production from Streptomyces lividans, suggesting differential regulation of pks genes and, as a result, bacillaene. While the parent colony showed widespread induction of pks expression among cells in the population, we found the spreading cells uniformly and transiently repressed the expression of the pks genes. To identify regulators that control pks genes, we first determined the pattern of pks gene expression in liquid culture. We next identified mutations in regulatory genes that disrupted the wild-type pattern of pks gene expression. We found that expression of the pks genes requires the master regulator of development, Spo0A, through its repression of AbrB and the stationary-phase regulator, CodY. Deletions of degU, comA, and scoC had moderate effects, disrupting the timing and level of pks gene expression. The observed patterns of expression suggest that complex regulation of bacillaene and other antibiotics optimizes competitive fitness for B. subtilis. PMID:24187085

  12. Bacterial competition reveals differential regulation of the pks genes by Bacillus subtilis.

    PubMed

    Vargas-Bautista, Carol; Rahlwes, Kathryn; Straight, Paul

    2014-02-01

    Bacillus subtilis is adaptable to many environments in part due to its ability to produce a broad range of bioactive compounds. One such compound, bacillaene, is a linear polyketide/nonribosomal peptide. The pks genes encode the enzymatic megacomplex that synthesizes bacillaene. The majority of pks genes appear to be organized as a giant operon (>74 kb from pksC-pksR). In previous work (P. D. Straight, M. A. Fischbach, C. T. Walsh, D. Z. Rudner, and R. Kolter, Proc. Natl. Acad. Sci. U. S. A. 104:305-310, 2007, doi:10.1073/pnas.0609073103), a deletion of the pks operon in B. subtilis was found to induce prodiginine production by Streptomyces coelicolor. Here, colonies of wild-type B. subtilis formed a spreading population that induced prodiginine production from Streptomyces lividans, suggesting differential regulation of pks genes and, as a result, bacillaene. While the parent colony showed widespread induction of pks expression among cells in the population, we found the spreading cells uniformly and transiently repressed the expression of the pks genes. To identify regulators that control pks genes, we first determined the pattern of pks gene expression in liquid culture. We next identified mutations in regulatory genes that disrupted the wild-type pattern of pks gene expression. We found that expression of the pks genes requires the master regulator of development, Spo0A, through its repression of AbrB and the stationary-phase regulator, CodY. Deletions of degU, comA, and scoC had moderate effects, disrupting the timing and level of pks gene expression. The observed patterns of expression suggest that complex regulation of bacillaene and other antibiotics optimizes competitive fitness for B. subtilis.

  13. aGEM: an integrative system for analyzing spatial-temporal gene-expression information

    PubMed Central

    Jiménez-Lozano, Natalia; Segura, Joan; Macías, José Ramón; Vega, Juanjo; Carazo, José María

    2009-01-01

    Motivation: The work presented here describes the ‘anatomical Gene-Expression Mapping (aGEM)’ Platform, a development conceived to integrate phenotypic information with the spatial and temporal distributions of genes expressed in the mouse. The aGEM Platform has been built by extending the Distributed Annotation System (DAS) protocol, which was originally designed to share genome annotations over the WWW. DAS is a client-server system in which a single client integrates information from multiple distributed servers. Results: The aGEM Platform provides information to answer three main questions. (i) Which genes are expressed in a given mouse anatomical component? (ii) In which mouse anatomical structures are a given gene or set of genes expressed? And (iii) is there any correlation among these findings? Currently, this Platform includes several well-known mouse resources (EMAGE, GXD and GENSAT), hosting gene-expression data mostly obtained from in situ techniques together with a broad set of image-derived annotations. Availability: The Platform is optimized for Firefox 3.0 and it is accessed through a friendly and intuitive display: http://agem.cnb.csic.es Contact: natalia@cnb.csic.es Supplementary information: Supplementary data are available at http://bioweb.cnb.csic.es/VisualOmics/aGEM/home.html and http://bioweb.cnb.csic.es/VisualOmics/index_VO.html and Bioinformatics online. PMID:19592395

  14. Gene transfer strategies in animal transgenesis.

    PubMed

    Montoliu, Lluís

    2002-01-01

    Position effects in animal transgenesis have prevented the reproducible success and limited the initial expectations of this technique in many biotechnological projects. Historically, several strategies have been devised to overcome such position effects, including the progressive addition of regulatory elements belonging to the same or to a heterologous expression domain. An expression domain is thought to contain all regulatory elements that are needed to specifically control the expression of a given gene in time and space. The lack of profound knowledge on the chromatin structure of expression domains of biotechnological interest, such as mammary gland-specific genes, explains why most standard expression vectors have failed to drive high-level, position-independent, and copy-number-dependent expression of transgenes in a reproducible manner. In contrast, the application of artificial chromosome-type constructs to animal transgenesis usually ensures optimal expression levels. YACs, BACs, and PACs have become crucial tools in animal transgenesis, allowing the inclusion of distant key regulatory sequences, previously unknown, that are characteristic for each expression domain. These elements contribute to insulating the artificial chromosome-type constructs from chromosomal position effects and are fundamental in order to guarantee the correct expression of transgenes.

  15. Control of Expression of the RNases J1 and J2 in Bacillus subtilis

    PubMed Central

    Jamalli, Ailar; Hébert, Agnès; Zig, Léna

    2014-01-01

    In Bacillus subtilis, the dual activity 5′ exo- and endoribonucleases J1 and J2 are important players in mRNA and stable RNA maturation and degradation. Recent work has improved our understanding of their structure and mechanism of action and identified numerous RNA substrates. However, almost nothing is known about the expression of these enzymes. Here, we have identified the transcriptional and translational signals that control the expression of the rnjA (RNase J1) and rnjB (RNase J2) genes. While the rnjB gene is transcribed constitutively from a sigma A promoter, optimal expression of RNase J1 requires cotranscription and cotranslation with the upstream ykzG gene, encoding a protein of unknown function. In the absence of coupled translation, RNase J1 expression is decreased more than 5-fold. Transcription of the ykzG operon initiates at a sigma A promoter with a noncanonical −35 box that is required for optimal transcription. Biosynthesis of RNase J1 is autocontrolled within a small range (1.4-fold) and also slightly stimulated (1.4-fold) in the absence of RNase J2. These controls are weak but might be useful to maintain the overall RNase J level and possibly also equimolar amounts of the two nucleases in the cell that primarily act as a heterodimer in vivo. PMID:24187087

  16. Cutoff Finder: A Comprehensive and Straightforward Web Application Enabling Rapid Biomarker Cutoff Optimization

    PubMed Central

    Budczies, Jan; Klauschen, Frederick; Sinn, Bruno V.; Győrffy, Balázs; Schmitt, Wolfgang D.; Darb-Esfahani, Silvia; Denkert, Carsten

    2012-01-01

    Gene or protein expression data are usually represented by metric or at least ordinal variables. In order to translate a continuous variable into a clinical decision, it is necessary to determine a cutoff point and to stratify patients into two groups each requiring a different kind of treatment. Currently, there is no standard method or standard software for biomarker cutoff determination. Therefore, we developed Cutoff Finder, a bundle of optimization and visualization methods for cutoff determination that is accessible online. While one of the methods for cutoff optimization is based solely on the distribution of the marker under investigation, other methods optimize the correlation of the dichotomization with respect to an outcome or survival variable. We illustrate the functionality of Cutoff Finder by the analysis of the gene expression of estrogen receptor (ER) and progesterone receptor (PgR) in breast cancer tissues. This distribution of these important markers is analyzed and correlated with immunohistologically determined ER status and distant metastasis free survival. Cutoff Finder is expected to fill a relevant gap in the available biometric software repertoire and will enable faster optimization of new diagnostic biomarkers. The tool can be accessed at http://molpath.charite.de/cutoff. PMID:23251644

  17. An efficient strategy for producing a stable, replaceable, highly efficient transgene expression system in silkworm, Bombyx mori

    PubMed Central

    Long, Dingpei; Lu, Weijian; Zhang, Yuli; Bi, Lihui; Xiang, Zhonghuai; Zhao, Aichun

    2015-01-01

    We developed an efficient strategy that combines a method for the post-integration elimination of all transposon sequences, a site-specific recombination system, and an optimized fibroin H-chain expression system to produce a stable, replaceable, highly efficient transgene expression system in the silkworm (Bombyx mori) that overcomes the disadvantages of random insertion and post-integration instability of transposons. Here, we generated four different transgenic silkworm strains, and of one the transgenic strains, designated TS1-RgG2, with up to 16% (w/w) of the target protein in the cocoons, was selected. The subsequent elimination of all the transposon sequences from TS1-RgG2 was completed by the heat-shock-induced expression of the transposase in vivo. The resulting transgenic silkworm strain was designated TS3-g2 and contained only the attP-flanked optimized fibroin H-chain expression cassette in its genome. A phiC31/att-system-based recombinase-mediated cassette exchange (RMCE) method could be used to integrate other genes of interest into the same genome locus between the attP sites in TS3-g2. Controlling for position effects with phiC31-mediated RMCE will also allow the optimization of exogenous protein expression and fine gene function analyses in the silkworm. The strategy developed here is also applicable to other lepidopteran insects, to improve the ecological safety of transgenic strains in biocontrol programs. PMID:25739894

  18. Differential gene expression in Varroa jacobsoni mites following a host shift to European honey bees (Apis mellifera).

    PubMed

    Andino, Gladys K; Gribskov, Michael; Anderson, Denis L; Evans, Jay D; Hunt, Greg J

    2016-11-16

    Varroa mites are widely considered the biggest honey bee health problem worldwide. Until recently, Varroa jacobsoni has been found to live and reproduce only in Asian honey bee (Apis cerana) colonies, while V. destructor successfully reproduces in both A. cerana and A. mellifera colonies. However, we have identified an island population of V. jacobsoni that is highly destructive to A. mellifera, the primary species used for pollination and honey production. The ability of these populations of mites to cross the host species boundary potentially represents an enormous threat to apiculture, and is presumably due to genetic variation that exists among populations of V. jacobsoni that influences gene expression and reproductive status. In this work, we investigate differences in gene expression between populations of V. jacobsoni reproducing on A. cerana and those either reproducing or not capable of reproducing on A. mellifera, in order to gain insight into differences that allow V. jacobsoni to overcome its normal species tropism. We sequenced and assembled a de novo transcriptome of V. jacobsoni. We also performed a differential gene expression analysis contrasting biological replicates of V. jacobsoni populations that differ in their ability to reproduce on A. mellifera. Using the edgeR, EBSeq and DESeq R packages for differential gene expression analysis, we found 287 differentially expressed genes (FDR ≤ 0.05), of which 91% were up regulated in mites reproducing on A. mellifera. In addition, mites found reproducing on A. mellifera showed substantially more variation in expression among replicates. We searched for orthologous genes in public databases and were able to associate 100 of these 287 differentially expressed genes with a functional description. There is differential gene expression between the two mite groups, with more variation in gene expression among mites that were able to reproduce on A. mellifera. A small set of genes showed reduced expression in mites on the A. mellifera host, including putative transcription factors and digestive tract developmental genes. The vast majority of differentially expressed genes were up-regulated in this host. This gene set showed enrichment for genes associated with mitochondrial respiratory function and apoptosis, suggesting that mites on this host may be experiencing higher stress, and may be less optimally adapted to parasitize it. Some genes involved in reproduction and oogenesis were also overexpressed, which should be further studied in regards to this host shift.

  19. Establishing a high yielding streptomyces-based cell-free protein synthesis system.

    PubMed

    Li, Jian; Wang, He; Kwon, Yong-Chan; Jewett, Michael C

    2017-06-01

    Cell-free protein synthesis (CFPS) has emerged as a powerful platform for applied biotechnology and synthetic biology, with a range of applications in synthesizing proteins, evolving proteins, and prototyping genetic circuits. To expand the current CFPS repertoire, we report here the development and optimization of a Streptomyces-based CFPS system for the expression of GC-rich genes. By developing a streamlined crude extract preparation protocol and optimizing reaction conditions, we were able to achieve active enhanced green fluorescent protein (EGFP) yields of greater than 50 μg/mL with batch reactions lasting up to 3 h. By adopting a semi-continuous reaction format, the EGFP yield could be increased to 282 ± 8 μg/mL and the reaction time was extended to 48 h. Notably, our extract preparation procedures were robust to multiple Streptomyces lividans and Streptomyces coelicolor strains, although expression yields varied. We show that our optimized Streptomyces lividans system provides benefits when compared to an Escherichia coli-based CFPS system for increasing percent soluble protein expression for four Streptomyces-originated high GC-content genes that are involved in biosynthesis of the nonribosomal peptides tambromycin and valinomycin. Looking forward, we believe that our Streptomyces-based CFPS system will contribute significantly towards efforts to express complex natural product gene clusters (e.g., nonribosomal peptides and polyketides), providing a new avenue for obtaining and studying natural product biosynthesis pathways. Biotechnol. Bioeng. 2017;114: 1343-1353. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  20. Sox17 drives functional engraftment of endothelium converted from non-vascular cells

    PubMed Central

    Schachterle, William; Badwe, Chaitanya R.; Palikuqi, Brisa; Kunar, Balvir; Ginsberg, Michael; Lis, Raphael; Yokoyama, Masataka; Elemento, Olivier; Scandura, Joseph M.; Rafii, Shahin

    2017-01-01

    Transplanting vascular endothelial cells (ECs) to support metabolism and express regenerative paracrine factors is a strategy to treat vasculopathies and to promote tissue regeneration. However, transplantation strategies have been challenging to develop, because ECs are difficult to culture and little is known about how to direct them to stably integrate into vasculature. Here we show that only amniotic cells could convert to cells that maintain EC gene expression. Even so, these converted cells perform sub-optimally in transplantation studies. Constitutive Akt signalling increases expression of EC morphogenesis genes, including Sox17, shifts the genomic targeting of Fli1 to favour nearby Sox consensus sites and enhances the vascular function of converted cells. Enforced expression of Sox17 increases expression of morphogenesis genes and promotes integration of transplanted converted cells into injured vessels. Thus, Ets transcription factors specify non-vascular, amniotic cells to EC-like cells, whereas Sox17 expression is required to confer EC function. PMID:28091527

  1. High-level expression in Escherichia coli, purification and kinetic characterization of Plasmodium falciparum M1-aminopeptidase.

    PubMed

    González-Bacerio, Jorge; Osuna, Joel; Ponce, Amaia; Fando, Rafael; Figarella, Katherine; Méndez, Yanira; Charli, Jean-Louis; Chávez, María de Los Á

    2014-12-01

    Plasmodium falciparum neutral metallo-aminopeptidase (PfAM1), a member of the M1 family of metallo proteases, is a promising target for malaria, a devastating human parasitic disease. We report the high-level expression of PfAM1 in Escherichia coli BL21. An optimized gene, with a codon adaptation index and an average G/C content higher than the native gene, was synthesized and cloned in the pTrcHis2B vector. Optimal expression was achieved by induction with 1mM IPTG at 37°C for 18h. This allowed obtaining 100mg of recombinant PfAM1 (rPfAM1) per L of culture medium; 19% of the E. coli soluble protein mass was from rPFAM1. rPfAM1, fused to an amino-terminal 6×His tag, was purified in a single step by immobilized metal ion affinity chromatography. The protein showed only limited signs of proteolytic degradation, and this step increased purity 27-fold. The kinetic characteristics of rPfAM1, such as a neutral optimal pH, a preference for substrates with basic or hydrophobic amino acids at the P1 position, an inhibition profile typical of metallo-aminopeptidases, and inhibition from Zn(2+) excess, were similar to those of the native PfAM1. We have thus optimized an expression system that should be useful for identifying new PfAM1 inhibitors. Copyright © 2014 Elsevier Inc. All rights reserved.

  2. The p40 Subunit of Interleukin (IL)-12 Promotes Stabilization and Export of the p35 Subunit

    PubMed Central

    Jalah, Rashmi; Rosati, Margherita; Ganneru, Brunda; Pilkington, Guy R.; Valentin, Antonio; Kulkarni, Viraj; Bergamaschi, Cristina; Chowdhury, Bhabadeb; Zhang, Gen-Mu; Beach, Rachel Kelly; Alicea, Candido; Broderick, Kate E.; Sardesai, Niranjan Y.; Pavlakis, George N.; Felber, Barbara K.

    2013-01-01

    IL-12 is a 70-kDa heterodimeric cytokine composed of the p35 and p40 subunits. To maximize cytokine production from plasmid DNA, molecular steps controlling IL-12p70 biosynthesis at the posttranscriptional and posttranslational levels were investigated. We show that the combination of RNA/codon-optimized gene sequences and fine-tuning of the relative expression levels of the two subunits within a cell resulted in increased production of the IL-12p70 heterodimer. We found that the p40 subunit plays a critical role in enhancing the stability, intracellular trafficking, and export of the p35 subunit. This posttranslational regulation mediated by the p40 subunit is conserved in mammals. Based on these findings, dual gene expression vectors were generated, producing an optimal ratio of the two subunits, resulting in a ∼1 log increase in human, rhesus, and murine IL-12p70 production compared with vectors expressing the wild type sequences. Such optimized DNA plasmids also produced significantly higher levels of systemic bioactive IL-12 upon in vivo DNA delivery in mice compared with plasmids expressing the wild type sequences. A single therapeutic injection of an optimized murine IL-12 DNA plasmid showed significantly more potent control of tumor development in the B16 melanoma cancer model in mice. Therefore, the improved IL-12p70 DNA vectors have promising potential for in vivo use as molecular vaccine adjuvants and in cancer immunotherapy. PMID:23297419

  3. Expression of a codon-optimized β-glucosidase from Cellulomonas flavigena PR-22 in Saccharomyces cerevisiae for bioethanol production from cellobiose.

    PubMed

    Ríos-Fránquez, Francisco Javier; González-Bautista, Enrique; Ponce-Noyola, Teresa; Ramos-Valdivia, Ana Carmela; Poggi-Varaldo, Héctor Mario; García-Mena, Jaime; Martinez, Alfredo

    2017-05-01

    Bioethanol is one of the main biofuels produced from the fermentation of saccharified agricultural waste; however, this technology needs to be optimized for profitability. Because the commonly used ethanologenic yeast strains are unable to assimilate cellobiose, several efforts have been made to express cellulose hydrolytic enzymes in these yeasts to produce ethanol from lignocellulose. The C. flavigenabglA gene encoding β-glucosidase catalytic subunit was optimized for preferential codon usage in S. cerevisiae. The optimized gene, cloned into the episomal vector pRGP-1, was expressed, which led to the secretion of an active β-glucosidase in transformants of the S. cerevisiae diploid strain 2-24D. The volumetric and specific extracellular enzymatic activities using pNPG as substrate were 155 IU L -1 and 222 IU g -1 , respectively, as detected in the supernatant of the cultures of the S. cerevisiae RP2-BGL transformant strain growing in cellobiose (20 g L -1 ) as the sole carbon source for 48 h. Ethanol production was 5 g L -1 after 96 h of culture, which represented a yield of 0.41 g g -1 of substrate consumed (12 g L -1 ), equivalent to 76% of the theoretical yield. The S. cerevisiae RP2-BGL strain expressed the β-glucosidase extracellularly and produced ethanol from cellobiose, which makes this microorganism suitable for application in ethanol production processes with saccharified lignocellulose.

  4. Thermal Assisted In Vivo Gene Electrotransfer

    PubMed Central

    Donate, Amy; Bulysheva, Anna; Edelblute, Chelsea; Jung, Derrick; Malik, Mohammad A.; Guo, Siqi; Burcus, Niculina; Schoenbach, Karl; Heller, Richard

    2016-01-01

    Gene electrotransfer is an effective approach for delivering plasmid DNA to a variety of tissues. Delivery of molecules with electric pulses requires control of the electrical parameters to achieve effective delivery. Since discomfort or tissue damage may occur with high applied voltage, the reduction of the applied voltage while achieving the desired expression may be an important improvement. One possible approach is to combine electrotransfer with exogenously applied heat. Previous work performed in vitro demonstrated that increasing temperature before pulsing can enhance gene expres sion and made it possible to reduce electric fields while maintaining expression levels. In the study reported here, this combination was evaluated in vivo using a novel electrode device designed with an inserted laser for application of heat. The results obtained in this study demonstrated that increased temperature during electrotransfer increased expression or maintained expression with a reduction in applied voltage. With further optimization this approach may provide the basis for both a novel method and a novel instrument that may greatly enhance translation of gene electrotransfer. PMID:27029944

  5. Photomodulating Gene Expression by Using Caged siRNAs with Single-Aptamer Modification.

    PubMed

    Zhang, Liangliang; Chen, Changmai; Fan, Xinli; Tang, Xinjing

    2018-06-18

    Caged siRNAs incorporating terminal modification were rationally designed for photochemical regulation of gene silencing induced by RNA interference (RNAi). Through the conjugation of a single oligonucleotide aptamer at the 5' terminus of the antisense RNA strand, enhancement of the blocking effect for RNA-induced silencing complex (RISC) formation/processing was expected, due both/either to the aptamers themselves and/or to their interaction with large binding proteins. Two oligonucleotide aptamers (AS1411 and MUC-1) were chosen for aptamer-siRNA conjugation through a photolabile linker. This caging strategy was successfully used to photoregulate gene expression both of firefly luciferase and of green fluorescent protein (GFP) in cells. Further patterning experiments revealed that spatial regulation of GFP expression was successfully achieved by using the aptamer-modified caged siRNA and light activation. We expect that further optimized caged siRNAs featuring aptamer conjugation will be promising for practical applications to spatiotemporal photoregulation of gene expression in the future. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. A Herpesvirus Protein Selectively Inhibits Cellular mRNA Nuclear Export.

    PubMed

    Gong, Danyang; Kim, Yong Hoon; Xiao, Yuchen; Du, Yushen; Xie, Yafang; Lee, Kevin K; Feng, Jun; Farhat, Nisar; Zhao, Dawei; Shu, Sara; Dai, Xinghong; Chanda, Sumit K; Rana, Tariq M; Krogan, Nevan J; Sun, Ren; Wu, Ting-Ting

    2016-11-09

    Nuclear mRNA export is highly regulated to ensure accurate cellular gene expression. Viral inhibition of cellular mRNA export can enhance viral access to the cellular translation machinery and prevent anti-viral protein production but is generally thought to be nonselective. We report that ORF10 of Kaposi's sarcoma-associated herpesvirus (KSHV), a nuclear DNA virus, inhibits mRNA export in a transcript-selective manner to control cellular gene expression. Nuclear export inhibition by ORF10 requires an interaction with an RNA export factor, Rae1. Genome-wide analysis reveals a subset of cellular mRNAs whose nuclear export is blocked by ORF10 with the 3' UTRs of ORF10-targeted transcripts conferring sensitivity to export inhibition. The ORF10-Rae1 interaction is important for the virus to express viral genes and produce infectious virions. These results suggest that a nuclear DNA virus can selectively interfere with RNA export to restrict host gene expression for optimal replication. Published by Elsevier Inc.

  7. Optimal design of gene knockout experiments for gene regulatory network inference

    PubMed Central

    Ud-Dean, S. M. Minhaz; Gunawan, Rudiyanto

    2016-01-01

    Motivation: We addressed the problem of inferring gene regulatory network (GRN) from gene expression data of knockout (KO) experiments. This inference is known to be underdetermined and the GRN is not identifiable from data. Past studies have shown that suboptimal design of experiments (DOE) contributes significantly to the identifiability issue of biological networks, including GRNs. However, optimizing DOE has received much less attention than developing methods for GRN inference. Results: We developed REDuction of UnCertain Edges (REDUCE) algorithm for finding the optimal gene KO experiment for inferring directed graphs (digraphs) of GRNs. REDUCE employed ensemble inference to define uncertain gene interactions that could not be verified by prior data. The optimal experiment corresponds to the maximum number of uncertain interactions that could be verified by the resulting data. For this purpose, we introduced the concept of edge separatoid which gave a list of nodes (genes) that upon their removal would allow the verification of a particular gene interaction. Finally, we proposed a procedure that iterates over performing KO experiments, ensemble update and optimal DOE. The case studies including the inference of Escherichia coli GRN and DREAM 4 100-gene GRNs, demonstrated the efficacy of the iterative GRN inference. In comparison to systematic KOs, REDUCE could provide much higher information return per gene KO experiment and consequently more accurate GRN estimates. Conclusions: REDUCE represents an enabling tool for tackling the underdetermined GRN inference. Along with advances in gene deletion and automation technology, the iterative procedure brings an efficient and fully automated GRN inference closer to reality. Availability and implementation: MATLAB and Python scripts of REDUCE are available on www.cabsel.ethz.ch/tools/REDUCE. Contact: rudi.gunawan@chem.ethz.ch Supplementary information: Supplementary data are available at Bioinformatics online. PMID:26568633

  8. Optimization of Dendritic Cell-Mediated Cytotoxic T-Cell Activation by Tracking of Dendritic Cell Migration Using Reporter Gene Imaging.

    PubMed

    Lee, Hongje; Lee, Ho Won; La Lee, You; Jeon, Yong Hyun; Jeong, Shin Young; Lee, Sang-Woo; Lee, Jaetae; Ahn, Byeong-Cheol

    2018-06-01

    The aim of this study is to optimize the dendritic cell (DC)-mediated T-cell activation using reporter gene imaging and flow cytometric analysis in living mice. A murine dendritic cell line (DC2.4) co-expressing effluc and Thy1.1 genes were established by transfection with retroviral vectors. Thy1.1 positive cells were sorted by magnetic bead separation system (DC2.4/effluc). Cell proliferation assay and phenotype analysis to determine the effects of gene transduction on the function of dendritic cells between parental DC2.4 and DC2.4/effluc were performed. To optimize the DC-mediated immune response by cell number or frequency, different cell numbers (5 × 10 5 , 1 × 10 6 , and 2 × 10 6  DC2.4/effluc) or different frequencies of DC2.4/effluc (first, second, and third injections) were injected in the right footpad of mice. The migration of the DC2.4/effluc into the draining popliteal lymph node of mice was monitored by bioluminescence imaging (BLI). Flow cytometric analysis was performed with splenocytes to determine the cytotoxic T-cell population after injection of DC2.4/effluc. Parental DC2.4 and DC2.4/effluc exhibit no significant differences in their proliferation and phenotype. BLI signals were observed in the draining popliteal lymph node at day 1 after injection of DC2.4/effluc in 1 × 10 6 and 2 × 10 6 cells-injected groups. The highest BLI signal intensity was detected in 2 × 10 6 cells-injected mice. On day 11, the BLI signal was detected in only 2 × 10 6 cell-injected group but not in other groups. Optimized cell numbers (2 × 10 6 ) were injected in three animal groups with a different frequency (first, second, and third injection groups). The BLI signal was detected at day 1 and maintained until day 7 in the first injection group, but there is low signal intensity in the second and the third injection groups. Although the expression levels of Thy1.1 gene in the first injection group were very high, there reveals no expression of Thy1.1 gene in the second and the third injection groups. The number of tumor-specific CD8 + T-cells in the spleen significantly increased, as the number of DC injections increases. Successful optimization of DC-mediated cytotoxic T-cell activation in living mice using reporter gene imaging and flow cytometric analysis was achieved. The optimization of DC-mediated cytotoxic T-cell activation could be applied for the future DC-based immunotherapy.

  9. Expression of codon optimized genes in microbial systems: current industrial applications and perspectives

    PubMed Central

    Elena, Claudia; Ravasi, Pablo; Castelli, María E.; Peirú, Salvador; Menzella, Hugo G.

    2014-01-01

    The efficient production of functional proteins in heterologous hosts is one of the major bases of modern biotechnology. Unfortunately, many genes are difficult to express outside their original context. Due to their apparent “silent” nature, synonymous codon substitutions have long been thought to be trivial. In recent years, this dogma has been refuted by evidence that codon replacement can have a significant impact on gene expression levels and protein folding. In the past decade, considerable advances in the speed and cost of gene synthesis have facilitated the complete redesign of entire gene sequences, dramatically improving the likelihood of high protein expression. This technology significantly impacts the economic feasibility of microbial-based biotechnological processes by, for example, increasing the volumetric productivities of recombinant proteins or facilitating the redesign of novel biosynthetic routes for the production of metabolites. This review discusses the current applications of this technology, particularly those regarding the production of small molecules and industrially relevant recombinant enzymes. Suggestions for future research and potential uses are provided as well. PMID:24550894

  10. Coordinate changes in gene expression and triacylglycerol composition in the developing seeds of oilseed rape (Brassica napus) and turnip rape (Brassica rapa).

    PubMed

    Vuorinen, Anssi L; Kalpio, Marika; Linderborg, Kaisa M; Kortesniemi, Maaria; Lehto, Kirsi; Niemi, Jarmo; Yang, Baoru; Kallio, Heikki P

    2014-02-15

    Crop production for vegetable oil in the northern latitudes utilises oilseed rape (Brassica napus subsp. oleifera) and turnip rape (B. rapa subsp. oleifera), having similar oil compositions. The oil consists mostly of triacylglycerols, which are synthesised during seed development. In this study, we characterised the oil composition and the expression levels of genes involved in triacylglycerol biosynthesis in the developing seeds in optimal, low temperature (15 °C) and short day (12-h day length) conditions. Gene expression levels of several genes were altered during seed development. Low temperature and short day treatments increased the level of 9,12,15-octadecatrienoic acid (18:3n-3) in turnip rape and short day treatment decreased the total oil content in both species. This study gives a novel view on seed oil biosynthesis under different growth conditions, bringing together gene expression levels of the triacylglycerol biosynthesis pathway and oil composition over a time series in two related oilseed species. Copyright © 2013 Elsevier Ltd. All rights reserved.

  11. A Substance Exchanger-Based Bioreactor Culture of Pig Discs for Studying the Immature Nucleus Pulposus.

    PubMed

    Li, Pei; Gan, Yibo; Wang, Haoming; Xu, Yuan; Song, Lei; Wang, Liyuan; Ouyang, Bin; Zhou, Qiang

    2017-11-01

    Various research models have been developed to study the biology of disc cells. Recently, the adult disc nucleus pulposus (NP) has been well studied. However, the immature NP is underinvestigated due to a lack of a suitable model. This study aimed to establish an organ culture of immature porcine disc by optimizing culture conditions and using a self-developed substance exchanger-based bioreactor. Immature porcine discs were first cultured in the bioreactor for 7 days at various levels of glucose (low, medium, high), osmolarity (hypo-, iso-, hyper-) and serum (5, 10, 20%) to determine the respective optimal level. The porcine discs were then cultured under the optimized conditions in the novel bioreactor, and were compared with fresh discs at day 14. For high-glucose, iso-osmolarity, or 10% serum, cell viability, the gene expression profile (for anabolic genes and catabolic genes), and glycosaminoglycan (GAG) and hydroxyproline (HYP) contents were more favorable than for other levels of glucose, osmolarity, and serum. When the immature discs were cultured under the optimized conditions using the novel bioreactor for 14 days, the viability of the immature NP was maintained based on histology, cell viability, GAG and HYP contents, and matrix molecule expression. In conclusion, the viability of the immature NP in organ culture could be maintained under the optimized culture conditions (high-glucose, iso-osmolarity, and 10% serum) in the substance exchanger-based bioreactor. © 2017 International Center for Artificial Organs and Transplantation and Wiley Periodicals, Inc.

  12. Transcriptome assembly, profiling and differential gene expression analysis of the halophyte Suaeda fruticosa provides insights into salt tolerance.

    PubMed

    Diray-Arce, Joann; Clement, Mark; Gul, Bilquees; Khan, M Ajmal; Nielsen, Brent L

    2015-05-06

    Improvement of crop production is needed to feed the growing world population as the amount and quality of agricultural land decreases and soil salinity increases. This has stimulated research on salt tolerance in plants. Most crops tolerate a limited amount of salt to survive and produce biomass, while halophytes (salt-tolerant plants) have the ability to grow with saline water utilizing specific biochemical mechanisms. However, little is known about the genes involved in salt tolerance. We have characterized the transcriptome of Suaeda fruticosa, a halophyte that has the ability to sequester salts in its leaves. Suaeda fruticosa is an annual shrub in the family Chenopodiaceae found in coastal and inland regions of Pakistan and Mediterranean shores. This plant is an obligate halophyte that grows optimally from 200-400 mM NaCl and can grow at up to 1000 mM NaCl. High throughput sequencing technology was performed to provide understanding of genes involved in the salt tolerance mechanism. De novo assembly of the transcriptome and analysis has allowed identification of differentially expressed and unique genes present in this non-conventional crop. Twelve sequencing libraries prepared from control (0 mM NaCl treated) and optimum (300 mM NaCl treated) plants were sequenced using Illumina Hiseq 2000 to investigate differential gene expression between shoots and roots of Suaeda fruticosa. The transcriptome was assembled de novo using Velvet and Oases k-45 and clustered using CDHIT-EST. There are 54,526 unigenes; among these 475 genes are downregulated and 44 are upregulated when samples from plants grown under optimal salt are compared with those grown without salt. BLAST analysis identified the differentially expressed genes, which were categorized in gene ontology terms and their pathways. This work has identified potential genes involved in salt tolerance in Suaeda fruticosa, and has provided an outline of tools to use for de novo transcriptome analysis. The assemblies that were used provide coverage of a considerable proportion of the transcriptome, which allows analysis of differential gene expression and identification of genes that may be involved in salt tolerance. The transcriptome may serve as a reference sequence for study of other succulent halophytes.

  13. Sample-space-based feature extraction and class preserving projection for gene expression data.

    PubMed

    Wang, Wenjun

    2013-01-01

    In order to overcome the problems of high computational complexity and serious matrix singularity for feature extraction using Principal Component Analysis (PCA) and Fisher's Linear Discrinimant Analysis (LDA) in high-dimensional data, sample-space-based feature extraction is presented, which transforms the computation procedure of feature extraction from gene space to sample space by representing the optimal transformation vector with the weighted sum of samples. The technique is used in the implementation of PCA, LDA, Class Preserving Projection (CPP) which is a new method for discriminant feature extraction proposed, and the experimental results on gene expression data demonstrate the effectiveness of the method.

  14. Identifying differentially expressed genes in cancer patients using a non-parameter Ising model.

    PubMed

    Li, Xumeng; Feltus, Frank A; Sun, Xiaoqian; Wang, James Z; Luo, Feng

    2011-10-01

    Identification of genes and pathways involved in diseases and physiological conditions is a major task in systems biology. In this study, we developed a novel non-parameter Ising model to integrate protein-protein interaction network and microarray data for identifying differentially expressed (DE) genes. We also proposed a simulated annealing algorithm to find the optimal configuration of the Ising model. The Ising model was applied to two breast cancer microarray data sets. The results showed that more cancer-related DE sub-networks and genes were identified by the Ising model than those by the Markov random field model. Furthermore, cross-validation experiments showed that DE genes identified by Ising model can improve classification performance compared with DE genes identified by Markov random field model. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Wheat seed transcriptome reveals genes controlling key traits for human preference and crop adaptation.

    PubMed

    Henry, Robert J; Furtado, Agnelo; Rangan, Parimalan

    2018-05-17

    Analysis of the transcriptome of the developing wheat grain has associated expression of genes with traits involving production (e.g. yield) and quality (e.g. bread quality). Photosynthesis in the grain may be important in retaining carbon that would be lost in respiration during grain filling and may contribute to yield in the late stages of seed formation under warm and dry environments. A small number of genes have been identified as having been selected by humans to optimize the performance of wheat for foods such as bread. Genes determining flour yield in milling have been discovered. Hardness is explained by variations in expression of pin genes. Knowledge of these genes should dramatically improve the efficiency of breeding better climate adapted wheat genotypes. Copyright © 2018. Published by Elsevier Ltd.

  16. An intronless form of the tobacco extensin gene terminator strongly enhances transient gene expression in plant leaves.

    PubMed

    Rosenthal, Sun Hee; Diamos, Andrew G; Mason, Hugh S

    2018-03-01

    We have found interesting features of a plant gene (extensin) 3' flanking region, including extremely efficient polyadenylation which greatly improves transient expression of transgenes when an intron is removed. Its use will greatly benefit studies of gene expression in plants, research in molecular biology, and applications for recombinant proteins. Plants are a promising platform for the production of recombinant proteins. To express high-value proteins in plants efficiently, the optimization of expression cassettes using appropriate regulatory sequences is critical. Here, we characterize the activity of the tobacco extensin (Ext) gene terminator by transient expression in Nicotiana benthamiana, tobacco, and lettuce. Ext is a member of the hydroxyproline-rich glycoprotein (HRGP) superfamily and constitutes the major protein component of cell walls. The present study demonstrates that the Ext terminator with its native intron removed increased transient gene expression up to 13.5-fold compared to previously established terminators. The enhanced transgene expression was correlated with increased mRNA accumulation and reduced levels of read-through transcripts, which could impair gene expression. Analysis of transcript 3'-ends found that the majority of polyadenylated transcripts were cleaved at a YA dinucleotide downstream from a canonical AAUAAA motif and a UG-rich region, both of which were found to be highly conserved among related extensin terminators. Deletion of either of these regions eliminated most of the activity of the terminator. Additionally, a 45 nt polypurine sequence ~ 175 nt upstream from the polyadenylation sites was found to also be necessary for the enhanced expression. We conclude that the use of Ext terminator has great potential to benefit the production of recombinant proteins in plants.

  17. Hepatic circadian clock oscillators and nuclear receptors integrate microbiome-derived signals

    PubMed Central

    Montagner, Alexandra; Korecka, Agata; Polizzi, Arnaud; Lippi, Yannick; Blum, Yuna; Canlet, Cécile; Tremblay-Franco, Marie; Gautier-Stein, Amandine; Burcelin, Rémy; Yen, Yi-Chun; Je, Hyunsoo Shawn; Maha, Al-Asmakh; Mithieux, Gilles; Arulampalam, Velmurugesan; Lagarrigue, Sandrine; Guillou, Hervé; Pettersson, Sven; Wahli, Walter

    2016-01-01

    The liver is a key organ of metabolic homeostasis with functions that oscillate in response to food intake. Although liver and gut microbiome crosstalk has been reported, microbiome-mediated effects on peripheral circadian clocks and their output genes are less well known. Here, we report that germ-free (GF) mice display altered daily oscillation of clock gene expression with a concomitant change in the expression of clock output regulators. Mice exposed to microbes typically exhibit characterized activities of nuclear receptors, some of which (PPARα, LXRβ) regulate specific liver gene expression networks, but these activities are profoundly changed in GF mice. These alterations in microbiome-sensitive gene expression patterns are associated with daily alterations in lipid, glucose, and xenobiotic metabolism, protein turnover, and redox balance, as revealed by hepatic metabolome analyses. Moreover, at the systemic level, daily changes in the abundance of biomarkers such as HDL cholesterol, free fatty acids, FGF21, bilirubin, and lactate depend on the microbiome. Altogether, our results indicate that the microbiome is required for integration of liver clock oscillations that tune output activators and their effectors, thereby regulating metabolic gene expression for optimal liver function. PMID:26879573

  18. Differential gene expression for Curvularia eragrostidis pathogenic incidence in crabgrass (Digitaria sanguinalis) revealed by cDNA-AFLP analysis.

    PubMed

    Wang, Jianshu; Wang, Xuemin; Yuan, Bohua; Qiang, Sheng

    2013-01-01

    Gene expression profiles of Digitaria sanguinalis infected by Curvularia eragrostidis strain QZ-2000 at two concentrations of conidia and two dew durations were analyzed by cDNA amplified fragment length polymorphisms (cDNA-AFLP). Inoculum strength was more determinant of gene expression than dew duration. A total of 256 primer combinations were used for selective amplification and 1214 transcript-derived fragments (TDFs) were selected for their differential expression. Of these, 518 up-regulated differentially expressed TDFs were identified. Forty-six differential cDNA fragments were chosen to be cloned and 35 of them were successfully cloned and sequenced, of which 25 were homologous to genes of known function according to the GenBank database. Only 6 genes were up-regulated in Curvularia eragrostidis-inoculated D. sanguinalis, with functions involved in signal transduction, energy metabolism, cell growth and development, stress responses, abscisic acid biosynthesis and response. It appears that a few pathways may be important parts of the pathogenic strategy of C. eragrostidis strain QZ-2000 on D. sanguinalis. Our study provides the fundamentals to further study the pathogenic mechanism, screen for optimal C. eragrostidis strains as potential mycoherbicide and apply this product to control D. sanguinalis.

  19. Transcriptional analysis of late ripening stages of grapevine berry

    PubMed Central

    2011-01-01

    Background The composition of grapevine berry at harvest is a major determinant of wine quality. Optimal oenological maturity of berries is characterized by a high sugar/acidity ratio, high anthocyanin content in the skin, and low astringency. However, harvest time is still mostly determined empirically, based on crude biochemical composition and berry tasting. In this context, it is interesting to identify genes that are expressed/repressed specifically at the late stages of ripening and which may be used as indicators of maturity. Results Whole bunches and berries sorted by density were collected in vineyard on Chardonnay (white cultivar) grapevines for two consecutive years at three stages of ripening (7-days before harvest (TH-7), harvest (TH), and 10-days after harvest (TH+10)). Microvinification and sensory analysis indicate that the quality of the wines made from the whole bunches collected at TH-7, TH and TH+10 differed, TH providing the highest quality wines. In parallel, gene expression was studied with Qiagen/Operon microarrays using two types of samples, i.e. whole bunches and berries sorted by density. Only 12 genes were consistently up- or down-regulated in whole bunches and density sorted berries for the two years studied in Chardonnay. 52 genes were differentially expressed between the TH-7 and TH samples. In order to determine whether these genes followed a similar pattern of expression during the late stages of berry ripening in a red cultivar, nine genes were selected for RT-PCR analysis with Cabernet Sauvignon grown under two different temperature regimes affecting the precocity of ripening. The expression profiles and their relationship to ripening were confirmed in Cabernet Sauvignon for seven genes, encoding a carotenoid cleavage dioxygenase, a galactinol synthase, a late embryogenesis abundant protein, a dirigent-like protein, a histidine kinase receptor, a valencene synthase and a putative S-adenosyl-L-methionine:salicylic acid carboxyl methyltransferase. Conclusions This set of up- and down-regulated genes characterize the late stages of berry ripening in the two cultivars studied, and are indirectly linked to wine quality. They might be used directly or indirectly to design immunological, biochemical or molecular tools aimed at the determination of optimal ripening in these cultivars. PMID:22098939

  20. Kinetics of expression of genes involved in glucose metabolism after the last meal in overfed mule ducks.

    PubMed

    Annabelle, Tavernier; Karine, Ricaud; Marie-Dominique, Bernadet; Stéphane, Davail; Karine, Gontier

    2017-06-01

    In waterfowls, overfeeding leads to a hepatic steatosis, also called "foie gras." We decided to investigate the role of glucose metabolism in steatosis emergence. For this, we measured the expression of genes during the 12 h following the last meal of the overfeeding period. As expected, it showed that the expression of glucose transporter is more precocious in jejunal mucosa, especially for SGLT1, known to be the major transporter at the apical surface. In the liver, GLUT2 and HK1 are upregulated at the same time and seem to work together to import glucose. In peripherals tissues, such as muscle and subcutaneous adipose tissue (SAT), expression of genes of interest occurs later than the one in jejunum and liver. These results are in accordance with the evolution of glycemia. This study allows us to better understand the kinetic treatment of glucose after a meal in overfed ducks. It also will allow researchers to better target their sampling time knowing the optimal point of expression of each gene.

  1. Multiclass cancer diagnosis using tumor gene expression signatures

    DOE PAGES

    Ramaswamy, S.; Tamayo, P.; Rifkin, R.; ...

    2001-12-11

    The optimal treatment of patients with cancer depends on establishing accurate diagnoses by using a complex combination of clinical and histopathological data. In some instances, this task is difficult or impossible because of atypical clinical presentation or histopathology. To determine whether the diagnosis of multiple common adult malignancies could be achieved purely by molecular classification, we subjected 218 tumor samples, spanning 14 common tumor types, and 90 normal tissue samples to oligonucleotide microarray gene expression analysis. The expression levels of 16,063 genes and expressed sequence tags were used to evaluate the accuracy of a multiclass classifier based on a supportmore » vector machine algorithm. Overall classification accuracy was 78%, far exceeding the accuracy of random classification (9%). Poorly differentiated cancers resulted in low-confidence predictions and could not be accurately classified according to their tissue of origin, indicating that they are molecularly distinct entities with dramatically different gene expression patterns compared with their well differentiated counterparts. Taken together, these results demonstrate the feasibility of accurate, multiclass molecular cancer classification and suggest a strategy for future clinical implementation of molecular cancer diagnostics.« less

  2. The high-level expression of human tissue plasminogen activator in the milk of transgenic mice with hybrid gene locus strategy.

    PubMed

    Zhou, Yanrong; Lin, Yanli; Wu, Xiaojie; Xiong, Fuyin; Lv, Yuemeng; Zheng, Tao; Huang, Peitang; Chen, Hongxing

    2012-02-01

    Transgene expression for the mammary gland bioreactor aimed at producing recombinant proteins requires optimized expression vector construction. Previously we presented a hybrid gene locus strategy, which was originally tested with human lactoferrin (hLF) as target transgene, and an extremely high-level expression of rhLF ever been achieved as to 29.8 g/l in mice milk. Here to demonstrate the broad application of this strategy, another 38.4 kb mWAP-htPA hybrid gene locus was constructed, in which the 3-kb genomic coding sequence in the 24-kb mouse whey acidic protein (mWAP) gene locus was substituted by the 17.4-kb genomic coding sequence of human tissue plasminogen activator (htPA), exactly from the start codon to the end codon. Corresponding five transgenic mice lines were generated and the highest expression level of rhtPA in the milk attained as to 3.3 g/l. Our strategy will provide a universal way for the large-scale production of pharmaceutical proteins in the mammary gland of transgenic animals.

  3. An AlgU-regulated antisense transcript encoded within the Pseudomonas syringae fleQ gene has a positive effect on motility

    USDA-ARS?s Scientific Manuscript database

    Bacterial flagella production is controlled by a multi-tiered regulatory system that coordinates expression of 40-50 subunits and correct assembly of these complicated structures. Flagellar expression is environmentally controlled, presumably to optimize the benefits and liabilities of flagellar ex...

  4. Development of Sendai Virus Vectors and their Potential Applications in Gene Therapy and Regenerative Medicine

    PubMed Central

    Nakanishi, Mahito; Otsu, Makoto

    2012-01-01

    Gene delivery/expression vectors have been used as fundamental technologies in gene therapy since the 1980s. These technologies are also being applied in regenerative medicine as tools to reprogram cell genomes to a pluripotent state and to other cell lineages. Rapid progress in these new research areas and expectations for their translation into clinical applications have facilitated the development of more sophisticated gene delivery/expression technologies. Since its isolation in 1953 in Japan, Sendai virus (SeV) has been widely used as a research tool in cell biology and in industry, but the application of SeV as a recombinant viral vector has been investigated only recently. Recombinant SeV vectors have various unique characteristics, such as low pathogenicity, powerful capacity for gene expression and a wide host range. In addition, the cytoplasmic gene expression mediated by this vector is advantageous for applications, in that chromosomal integration of exogenous genes can be undesirable. In this review, we introduce a brief historical background on the development of recombinant SeV vectors and describe their current applications in gene therapy. We also describe the application of SeV vectors in advanced nuclear reprogramming and introduce a defective and persistent SeV vector (SeVdp) optimized for such reprogramming. PMID:22920683

  5. Isoprene production by Escherichia coli through the exogenous mevalonate pathway with reduced formation of fermentation byproducts.

    PubMed

    Kim, Jung-Hun; Wang, Chonglong; Jang, Hui-Jung; Cha, Myeong-Seok; Park, Ju-Eon; Jo, Seon-Yeong; Choi, Eui-Sung; Kim, Seon-Won

    2016-12-23

    Isoprene, a volatile C5 hydrocarbon, is an important platform chemical used in the manufacturing of synthetic rubber for tires and various other applications, such as elastomers and adhesives. In this study, Escherichia coli MG1655 harboring Populus trichocarpa isoprene synthase (PtispS) and the exogenous mevalonate (MVA) pathway produced 80 mg/L isoprene. Codon optimization and optimal expression of the ispS gene via adjustment of the RBS strength and inducer concentration increased isoprene production to 199 and 337 mg/L, respectively. To augment expression of MVA pathway genes, the MVA pathway was cloned on a high-copy plasmid (pBR322 origin) with a strong promoter (P trc ), which resulted in an additional increase in isoprene production up to 956 mg/L. To reduce the formation of byproducts derived from acetyl-CoA (an initial substrate of the MVA pathway), nine relevant genes were deleted to generate the E. coli AceCo strain (E. coli MG1655 ΔackA-pta, poxB, ldhA, dld, adhE, pps, and atoDA). The AceCo strain harboring the ispS gene and MVA pathway showed enhanced isoprene production of 1832 mg/L in flask culture with reduced accumulation of byproducts. We achieved a 23-fold increase in isoprene production by codon optimization of PtispS, augmentation of the MVA pathway, and deletion of genes involved in byproduct formation.

  6. Genetic Networks and Anticipation of Gene Expression Patterns

    NASA Astrophysics Data System (ADS)

    Gebert, J.; Lätsch, M.; Pickl, S. W.; Radde, N.; Weber, G.-W.; Wünschiers, R.

    2004-08-01

    An interesting problem for computational biology is the analysis of time-series expression data. Here, the application of modern methods from dynamical systems, optimization theory, numerical algorithms and the utilization of implicit discrete information lead to a deeper understanding. In [1], we suggested to represent the behavior of time-series gene expression patterns by a system of ordinary differential equations, which we analytically and algorithmically investigated under the parametrical aspect of stability or instability. Our algorithm strongly exploited combinatorial information. In this paper, we deepen, extend and exemplify this study from the viewpoint of underlying mathematical modelling. This modelling consists in evaluating DNA-microarray measurements as the basis of anticipatory prediction, in the choice of a smooth model given by differential equations, in an approach of the right-hand side with parametric matrices, and in a discrete approximation which is a least squares optimization problem. We give a mathematical and biological discussion, and pay attention to the special case of a linear system, where the matrices do not depend on the state of expressions. Here, we present first numerical examples.

  7. Reporter gene imaging of targeted T cell immunotherapy in recurrent glioma.

    PubMed

    Keu, Khun Visith; Witney, Timothy H; Yaghoubi, Shahriar; Rosenberg, Jarrett; Kurien, Anita; Magnusson, Rachel; Williams, John; Habte, Frezghi; Wagner, Jamie R; Forman, Stephen; Brown, Christine; Allen-Auerbach, Martin; Czernin, Johannes; Tang, Winson; Jensen, Michael C; Badie, Behnam; Gambhir, Sanjiv S

    2017-01-18

    High-grade gliomas are aggressive cancers that often become rapidly fatal. Immunotherapy using CD8 + cytotoxic T lymphocytes (CTLs), engineered to express both herpes simplex virus type 1 thymidine kinase (HSV1-TK) and interleukin-13 (IL-13) zetakine chimeric antigen receptor (CAR), is a treatment strategy with considerable potential. To optimize this and related immunotherapies, it would be helpful to monitor CTL viability and trafficking to glioma cells. We show that noninvasive positron emission tomography (PET) imaging with 9-[4-[ 18 F]fluoro-3-(hydroxymethyl)butyl]guanine ([ 18 F]FHBG) can track HSV1-tk reporter gene expression present in CAR-engineered CTLs. [ 18 F]FHBG imaging was safe and enabled the longitudinal imaging of T cells stably transfected with a PET reporter gene in patients. Further optimization of this imaging approach for monitoring in vivo cell trafficking should greatly benefit various cell-based therapies for cancer. Copyright © 2017, American Association for the Advancement of Science.

  8. SGDB: a database of synthetic genes re-designed for optimizing protein over-expression.

    PubMed

    Wu, Gang; Zheng, Yuanpu; Qureshi, Imran; Zin, Htar Thant; Beck, Tyler; Bulka, Blazej; Freeland, Stephen J

    2007-01-01

    Here we present the Synthetic Gene Database (SGDB): a relational database that houses sequences and associated experimental information on synthetic (artificially engineered) genes from all peer-reviewed studies published to date. At present, the database comprises information from more than 200 published experiments. This resource not only provides reference material to guide experimentalists in designing new genes that improve protein expression, but also offers a dataset for analysis by bioinformaticians who seek to test ideas regarding the underlying factors that influence gene expression. The SGDB was built under MySQL database management system. We also offer an XML schema for standardized data description of synthetic genes. Users can access the database at http://www.evolvingcode.net/codon/sgdb/index.php, or batch downloads all information through XML files. Moreover, users may visually compare the coding sequences of a synthetic gene and its natural counterpart with an integrated web tool at http://www.evolvingcode.net/codon/sgdb/aligner.php, and discuss questions, findings and related information on an associated e-forum at http://www.evolvingcode.net/forum/viewforum.php?f=27.

  9. Optimization of a nonviral transfection system to evaluate Cox-2 controlled interleukin-4 expression for osteoarthritis gene therapy in vitro.

    PubMed

    Lang, Annemarie; Neuhaus, Johannes; Pfeiffenberger, Moritz; Schröder, Erik; Ponomarev, Igor; Weber, Yvonne; Gaber, Timo; Schmidt, Michael F G

    2014-01-01

    Gene therapy appears to have the potential for achieving a long-term remedy for osteoarthritis (OA). However, there is a risk of adverse reactions, especially when using cytomegalovirus-controlled expression. To provide a safe application, we focused on the expression of therapeutic cytokines [e.g. interleukin (IL)-4] in a disease-responsive manner by use of the previously cloned Cox-2 promoter as 'genetic switch'. In the present study, we report the functionality of a controlled gene therapeutic system in an equine osteoarthritic cell model. Different nonviral transfection reagents were tested for their efficiency on equine chondrocytes stimulated with equine IL-1β or lipopolysaccharide to create an inflammatory environment. To optimize the transfection, we successfully redesigned the vector by excluding the internal ribosomal entry site (IRES). The functionality of our Cox-2 promoter construct with respect to expressing IL-4 was proven at the mRNA and protein levels and the anti-inflammatory potential of IL-4 was confirmed by analyzing the expression of IL-1β, IL-6, IL-8, matrix metalloproteinase (MMP)-1, MMP-3 and tumor necrosis factor (TNF)-α using a quantitative polymerase chain reaction. Nonviral transfection reagents yielded transfection rates from 21% to 44% with control vectors with and without IRES, respectively. Stimulation of equine chondrocytes resulted in a 20-fold increase of mRNA expression of IL-1β. Such exogenous stimulation of chondrocytes transfected with pNCox2-IL4 led to an increase of IL-4 mRNA expression, whereas expression of inflammatory mediators decreased. The timely link between these events confirms the anti-inflammatory potential of synthesized IL-4. We consider that this approach has significant potential for translation into a useful anti-inflammation therapy. Molecular tools such as the described therapeutic plasmid pave the way for a local-controlled, self-limiting gene therapy. Copyright © 2014 John Wiley & Sons, Ltd.

  10. Distribution and regulation of stochasticity and plasticity in Saccharomyces cerevisiae

    DOE PAGES

    Dar, R. D.; Karig, D. K.; Cooke, J. F.; ...

    2010-09-01

    Stochasticity is an inherent feature of complex systems with nanoscale structure. In such systems information is represented by small collections of elements (e.g. a few electrons on a quantum dot), and small variations in the populations of these elements may lead to big uncertainties in the information. Unfortunately, little is known about how to work within this inherently noisy environment to design robust functionality into complex nanoscale systems. Here, we look to the biological cell as an intriguing model system where evolution has mediated the trade-offs between fluctuations and function, and in particular we look at the relationships and trade-offsmore » between stochastic and deterministic responses in the gene expression of budding yeast (Saccharomyces cerevisiae). We find gene regulatory arrangements that control the stochastic and deterministic components of expression, and show that genes that have evolved to respond to stimuli (stress) in the most strongly deterministic way exhibit the most noise in the absence of the stimuli. We show that this relationship is consistent with a bursty 2-state model of gene expression, and demonstrate that this regulatory motif generates the most uncertainty in gene expression when there is the greatest uncertainty in the optimal level of gene expression.« less

  11. Molecular Cooperativity Governs Diverse and Monoallelic Olfactory Receptor Expression

    NASA Astrophysics Data System (ADS)

    Xing, Jianhua; Tian, Xiaojun; Zhang, Hang; Sannerud, Jens

    Multiple-objective optimization is common in biological systems. In the mammalian olfactory system, each sensory neuron stochastically expresses only one out of up to thousands of olfactory receptor (OR) gene alleles; at organism level the types of expressed ORs need to be maximized. The molecular mechanism of this Nobel-Prize winning puzzle remains unresolved after decades of extensive studies. Existing models focus only on monoallele activation, and cannot explain recent observations in mutants, especially the reduced global diversity of expressed ORs in G9a/GLP knockouts. In this work we integrated existing information on OR expression, and proposed an evolutionarily optimized three-layer regulation mechanism, which includes zonal segregation, epigenetic and enhancer competition coupled to a negative feedback loop. This model not only recapitulates monoallelic OR expression, but also elucidates how the olfactory system maximizes and maintains the diversity of OR expression. The model is validated by several experimental results, and particularly underscores cooperativity and synergy as a general design principle of multi-objective optimization in biology. The work is supported by the NIGMS/DMS Mathematical Biology program.

  12. The role of TREX in gene expression and disease

    PubMed Central

    Heath, Catherine G.; Viphakone, Nicolas; Wilson, Stuart A.

    2016-01-01

    TRanscription and EXport (TREX) is a conserved multisubunit complex essential for embryogenesis, organogenesis and cellular differentiation throughout life. By linking transcription, mRNA processing and export together, it exerts a physiologically vital role in the gene expression pathway. In addition, this complex prevents DNA damage and regulates the cell cycle by ensuring optimal gene expression. As the extent of TREX activity in viral infections, amyotrophic lateral sclerosis and cancer emerges, the need for a greater understanding of TREX function becomes evident. A complete elucidation of the composition, function and interactions of the complex will provide the framework for understanding the molecular basis for a variety of diseases. This review details the known composition of TREX, how it is regulated and its cellular functions with an emphasis on mammalian systems. PMID:27679854

  13. Lentiviral transduction of rat Sertoli cells as a means to modify gene expression

    PubMed Central

    Nicholls, Peter K.; Stanton, Peter G.; Rainczuk, Katarzyna E.; Qian, Hongwei; Gregorevic, Paul; Harrison, Craig A.

    2012-01-01

    Primary cell culture is an established and widely used technique to study Sertoli cell function in vitro. However, the relative difficulty of stably overexpressing or knocking down genes in Sertoli cell culture has limited progress in the field. In this technical report, we present a method to transduce 20 dpp rat Sertoli cell cultures with VSV-G pseudotyped lentiviral based vectors at a high rate (~80%), with stable reporter gene expression. Although high transgene expression is desirable, it was noted that at transduction rates > 60% inter-Sertoli cell tight junction integrity and, hence, Sertoli cell function, were transiently compromised. We envisage that this optimized procedure has the potential to stimulate Sertoli cell research, and motivate the use of Sertoli cells in various cell therapy applications. PMID:23248769

  14. Temperature effects on gene expression and morphological development of European eel, Anguilla anguilla larvae

    PubMed Central

    Mazurais, David; Servili, Arianna; Zambonino-Infante, Jose-Luis; Miest, Joanna J.; Sørensen, Sune R.; Tomkiewicz, Jonna; Butts, Ian A. E.

    2017-01-01

    Temperature is important for optimization of rearing conditions in aquaculture, especially during the critical early life history stages of fish. Here, we experimentally investigated the impact of temperature (16, 18, 20, 22 and 24°C) on thermally induced phenotypic variability, from larval hatch to first-feeding, and the linked expression of targeted genes [heat shock proteins (hsp), growth hormone (gh) and insulin-like growth factors (igf)] associated to larval performance of European eel, Anguilla anguilla. Temperature effects on larval morphology and gene expression were investigated throughout early larval development (in real time from 0 to 18 days post hatch) and at specific developmental stages (hatch, jaw/teeth formation, and first-feeding). Results showed that hatch success, yolk utilization efficiency, survival, deformities, yolk utilization, and growth rates were all significantly affected by temperature. In real time, increasing temperature from 16 to 22°C accelerated larval development, while larval gene expression patterns (hsp70, hsp90, gh and igf-1) were delayed at cold temperatures (16°C) or accelerated at warm temperatures (20–22°C). All targeted genes (hsp70, hsp90, gh, igf-1, igf-2a, igf-2b) were differentially expressed during larval development. Moreover, expression of gh was highest at 16°C during the jaw/teeth formation, and the first-feeding developmental stages, while expression of hsp90 was highest at 22°C, suggesting thermal stress. Furthermore, 24°C was shown to be deleterious (resulting in 100% mortality), while 16°C and 22°C (~50 and 90% deformities respectively) represent the lower and upper thermal tolerance limits. In conclusion, the high survival, lowest incidence of deformities at hatch, high yolk utilization efficiency, high gh and low hsp expression, suggest 18°C as the optimal temperature for offspring of European eel. Furthermore, our results suggest that the still enigmatic early life history stages of European eel may inhabit the deeper layer of the Sargasso Sea and indicate vulnerability of this critically endangered species to increasing ocean temperature. PMID:28806748

  15. FastGCN: A GPU Accelerated Tool for Fast Gene Co-Expression Networks

    PubMed Central

    Liang, Meimei; Zhang, Futao; Jin, Gulei; Zhu, Jun

    2015-01-01

    Gene co-expression networks comprise one type of valuable biological networks. Many methods and tools have been published to construct gene co-expression networks; however, most of these tools and methods are inconvenient and time consuming for large datasets. We have developed a user-friendly, accelerated and optimized tool for constructing gene co-expression networks that can fully harness the parallel nature of GPU (Graphic Processing Unit) architectures. Genetic entropies were exploited to filter out genes with no or small expression changes in the raw data preprocessing step. Pearson correlation coefficients were then calculated. After that, we normalized these coefficients and employed the False Discovery Rate to control the multiple tests. At last, modules identification was conducted to construct the co-expression networks. All of these calculations were implemented on a GPU. We also compressed the coefficient matrix to save space. We compared the performance of the GPU implementation with those of multi-core CPU implementations with 16 CPU threads, single-thread C/C++ implementation and single-thread R implementation. Our results show that GPU implementation largely outperforms single-thread C/C++ implementation and single-thread R implementation, and GPU implementation outperforms multi-core CPU implementation when the number of genes increases. With the test dataset containing 16,000 genes and 590 individuals, we can achieve greater than 63 times the speed using a GPU implementation compared with a single-thread R implementation when 50 percent of genes were filtered out and about 80 times the speed when no genes were filtered out. PMID:25602758

  16. FastGCN: a GPU accelerated tool for fast gene co-expression networks.

    PubMed

    Liang, Meimei; Zhang, Futao; Jin, Gulei; Zhu, Jun

    2015-01-01

    Gene co-expression networks comprise one type of valuable biological networks. Many methods and tools have been published to construct gene co-expression networks; however, most of these tools and methods are inconvenient and time consuming for large datasets. We have developed a user-friendly, accelerated and optimized tool for constructing gene co-expression networks that can fully harness the parallel nature of GPU (Graphic Processing Unit) architectures. Genetic entropies were exploited to filter out genes with no or small expression changes in the raw data preprocessing step. Pearson correlation coefficients were then calculated. After that, we normalized these coefficients and employed the False Discovery Rate to control the multiple tests. At last, modules identification was conducted to construct the co-expression networks. All of these calculations were implemented on a GPU. We also compressed the coefficient matrix to save space. We compared the performance of the GPU implementation with those of multi-core CPU implementations with 16 CPU threads, single-thread C/C++ implementation and single-thread R implementation. Our results show that GPU implementation largely outperforms single-thread C/C++ implementation and single-thread R implementation, and GPU implementation outperforms multi-core CPU implementation when the number of genes increases. With the test dataset containing 16,000 genes and 590 individuals, we can achieve greater than 63 times the speed using a GPU implementation compared with a single-thread R implementation when 50 percent of genes were filtered out and about 80 times the speed when no genes were filtered out.

  17. An out-of-lab trial: a case example for the effect of intensive exercise on rhythms of human clock gene expression

    PubMed Central

    2013-01-01

    Background Although out-of-lab investigation of the human circadian clock at the clock gene expression level remains difficult, a recent method using hair follicle cells might be useful. While exercise may function as an entrainment cue for circadian rhythms, it remains unclear whether exercise affects human circadian clock gene expression. Methods Efforts to observe apparent effects of exercise on clock gene expression require that several specific conditions be met: intense exercise should be habitually performed at a relatively uncommon time of day over an extended period; and any relative phase shift thereby observed should be validated by comparison of exercise and no-exercise periods. Wake-up and meal times should be kept almost constant over the experimental period. The present study was conducted using a professional fighter who met these strict criteria as subject. Facial hair samples were collected at 4-h intervals around the clock to ascertain rhythms of clock gene expression. Results During a period in which nighttime training (from 20:00 to 22:00) was habitually performed, circadian clock gene expression was phase-delayed by 2 to 4 h compared with that during a no-exercise period. Maximum level and circadian amplitude of clock gene expression were not affected by the nighttime training. Conclusion Our trial observations illustrate the possibility that heavy physical exercise might strongly affect the circadian phase of clock gene expression. Exercise might be therefore effective for the clinical care of circadian disorders. The results also suggest that athletes may require careful scheduling of heavy physical exercise to maintain normal circadian phase and ensure optimal athletic performance. PMID:24004634

  18. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Price, Morgan N.; Arkin, Adam P.; Alm, Eric J.

    Operons are a major feature of all prokaryotic genomes, but how and why operon structures vary is not well understood. To elucidate the life-cycle of operons, we compared gene order between Escherichia coli K12 and its relatives and identified the recently formed and destroyed operons in E. coli. This allowed us to determine how operons form, how they become closely spaced, and how they die. Our findings suggest that operon evolution is driven by selection on gene expression patterns. First, both operon creation and operon destruction lead to large changes in gene expression patterns. For example, the removal of lysAmore » and ruvA from ancestral operons that contained essential genes allowed their expression to respond to lysine levels and DNA damage, respectively. Second, some operons have undergone accelerated evolution, with multiple new genes being added during a brief period. Third, although most operons are closely spaced because of a neutral bias towards deletion and because of selection against large overlaps, highly expressed operons tend to be widely spaced because of regulatory fine-tuning by intervening sequences. Although operon evolution seems to be adaptive, it need not be optimal: new operons often comprise functionally unrelated genes that were already in proximity before the operon formed.« less

  19. Optimization of the production and purification processes of carnobacteriocins Cbn BM1 and Cbn B2 from Carnobacterium maltaromaticum CP5 by heterologous expression in Escherichia coli.

    PubMed

    Jasniewski, Jordane; Cailliez-Grimal, Catherine; Gelhaye, Eric; Revol-Junelles, Anne-Marie

    2008-04-01

    An optimization of the production and purification processes of carnobacteriocins Cbn BM1 and Cbn B2 from Carnobacterium maltaromaticum CP5, by heterologous expression in Escherichia coli is described. The genes encoding mature bacteriocin were cloned into an E. coli expression system and expressed as a fusion protein with a thermostable thioredoxin. Recombinant E. coli were cultivated following a fed-batch fermentation process with pH, temperature and oxygenation regulation. The overexpression of the fusion proteins was improved by replacing IPTG by lactose. The fusion proteins were purified by thermal coagulation followed by affinity chromatography. The thioredoxin fusion protein was removed by using CNBr instead of enterokinase and the carnobacteriocins were recovered by reverse-phase chromatography. These optimizations led us to produce up to 320 mg of pure protein per liter of culture, which is four to ten fold higher than what is described for other heterologous expression systems.

  20. A novel rapid and reproducible flow cytometric method for optimization of transfection efficiency in cells

    PubMed Central

    Homann, Stefanie; Hofmann, Christian; Gorin, Aleksandr M.; Nguyen, Huy Cong Xuan; Huynh, Diana; Hamid, Phillip; Maithel, Neil; Yacoubian, Vahe; Mu, Wenli; Kossyvakis, Athanasios; Sen Roy, Shubhendu; Yang, Otto Orlean

    2017-01-01

    Transfection is one of the most frequently used techniques in molecular biology that is also applicable for gene therapy studies in humans. One of the biggest challenges to investigate the protein function and interaction in gene therapy studies is to have reliable monospecific detection reagents, particularly antibodies, for all human gene products. Thus, a reliable method that can optimize transfection efficiency based on not only expression of the target protein of interest but also the uptake of the nucleic acid plasmid, can be an important tool in molecular biology. Here, we present a simple, rapid and robust flow cytometric method that can be used as a tool to optimize transfection efficiency at the single cell level while overcoming limitations of prior established methods that quantify transfection efficiency. By using optimized ratios of transfection reagent and a nucleic acid (DNA or RNA) vector directly labeled with a fluorochrome, this method can be used as a tool to simultaneously quantify cellular toxicity of different transfection reagents, the amount of nucleic acid plasmid that cells have taken up during transfection as well as the amount of the encoded expressed protein. Finally, we demonstrate that this method is reproducible, can be standardized and can reliably and rapidly quantify transfection efficiency, reducing assay costs and increasing throughput while increasing data robustness. PMID:28863132

  1. [Joint effects of water temperature and salinity on the expression of gill Hsp70 gene in Pinctada martensii (Dunker)].

    PubMed

    Wang, Ya-Nan; Wang, Hui; Zhu, Xiao-Wen; Luo, Ming-Ming; Liu, Zhi-Gang; Du, Xiao-Dong

    2012-12-01

    By using central composite experimental design and response surface method, the joint effects of water temperature (16-40 degrees C) and salinity (10-50) on the expression of gill Hsp70 gene in Pinctada martensii (Dunker) were studied under laboratory conditions. The results showed that the linear and quadratic effects of temperature on the expression of gill Hsp70 gene were significant, the linear effect of salinity was not significant, while the quadratic effect of salinity was significant. The interactive effect of temperature and salinity was not significant, and the effect of temperature was greater than that of salinity. The model equation of the gill Hsp70 gene expression was established, with the R2, Adj. R2, and Pred. R2 as high as 98.7%, 97.4%, and 89.2%, respectively, suggesting that the overarching predictive capability of the model was very satisfactory, and could be practicably applied for prediction. Through the optimization of the model, the expression of the gill Hsp70 gene reached its minimum (0.5276) when the temperature was 26.78 degrees C and the salinity was 29.33, with the desirability value being 98%. These experimental results could offer theoretical reference for the high expression of gill Hsp70 gene in P. martensii, the maintenance of cell internal environment stability, and the enhancement of P. martensii stress resistance.

  2. Development and Optimization of a Fluorescent Differential Display PCR System for Analyzing the Stress Response in Lactobacillus sakei Strains

    PubMed Central

    Bonomo, Maria Grazia; Sico, Maria Anna; Grieco, Simona; Salzano, Giovanni

    2009-01-01

    Lactobacillus sakei is widely used as starter in the production process of Italian fermented sausages and its growth and survival are affected by various factors. We studied the differential expression of genome in response to different stresses by the fluorescent differential display (FDD) technique. This study resulted in the development and optimization of an innovative technique, with a high level of reproducibility and quality, which allows the identification of gene expression changes associated with different microbial behaviours under different growth conditions. PMID:22253979

  3. Iterative algorithm-guided design of massive strain libraries, applied to itaconic acid production in yeast.

    PubMed

    Young, Eric M; Zhao, Zheng; Gielesen, Bianca E M; Wu, Liang; Benjamin Gordon, D; Roubos, Johannes A; Voigt, Christopher A

    2018-05-09

    Metabolic engineering requires multiple rounds of strain construction to evaluate alternative pathways and enzyme concentrations. Optimizing multigene pathways stepwise or by randomly selecting enzymes and expression levels is inefficient. Here, we apply methods from design of experiments (DOE) to guide the construction of strain libraries from which the maximum information can be extracted without sampling every possible combination. We use Saccharomyces cerevisiae as a host for a novel six-gene pathway to itaconic acid, selected by comparing alternative shunt pathways that bypass the mitochondrial TCA cycle. The pathway is distinctive for the use of acetylating acetaldehyde dehydrogenase to increase cytosolic acetyl-CoA pools, a bacterial enzyme to synthesize citrate in the cytosol, and an itaconic acid exporter. Precise control over the expression of each gene is enabled by a set of promoter-terminator pairs that span a 174-fold range. Two large combinatorial libraries (160 variants, 2.4Mb and 32 variants, 0.6Mb) are designed where the expression levels are selected by statistical methods (I-optimal response surface methodology, full factorial, or Plackett-Burman) with the intent of extracting different types of guiding information after the screen. This is applied to the design of a third library (24 variants, 0.5Mb) intended to alleviate a bottleneck in cis-aconitate decarboxylase (CAD) expression. The top strain produces 815mg/l itaconic acid, a 4-fold improvement over the initial strain achieved by iteratively balancing pathway expression. Including a methylated product in the total, the strain produces 1.3g/l combined itaconic acids. Further, a regression analysis of the libraries reveals the optimal expression level of CAD as well as pairwise interdependencies between genes that result in increased titer and purity of itaconic acid. This work demonstrates adapting algorithmic design strategies to guide automated yeast strain construction and learn information after each iteration. Copyright © 2018. Published by Elsevier Inc.

  4. DELAY OF GERMINATION 1 mediates a conserved coat-dormancy mechanism for the temperature- and gibberellin-dependent control of seed germination

    PubMed Central

    Graeber, Kai; Linkies, Ada; Steinbrecher, Tina; Mummenhoff, Klaus; Tarkowská, Danuše; Turečková, Veronika; Ignatz, Michael; Sperber, Katja; Voegele, Antje; de Jong, Hans; Urbanová, Terezie; Strnad, Miroslav; Leubner-Metzger, Gerhard

    2014-01-01

    Seed germination is an important life-cycle transition because it determines subsequent plant survival and reproductive success. To detect optimal spatiotemporal conditions for germination, seeds act as sophisticated environmental sensors integrating information such as ambient temperature. Here we show that the DELAY OF GERMINATION 1 (DOG1) gene, known for providing dormancy adaptation to distinct environments, determines the optimal temperature for seed germination. By reciprocal gene-swapping experiments between Brassicaceae species we show that the DOG1-mediated dormancy mechanism is conserved. Biomechanical analyses show that this mechanism regulates the material properties of the endosperm, a seed tissue layer acting as germination barrier to control coat dormancy. We found that DOG1 inhibits the expression of gibberellin (GA)-regulated genes encoding cell-wall remodeling proteins in a temperature-dependent manner. Furthermore we demonstrate that DOG1 causes temperature-dependent alterations in the seed GA metabolism. These alterations in hormone metabolism are brought about by the temperature-dependent differential expression of genes encoding key enzymes of the GA biosynthetic pathway. These effects of DOG1 lead to a temperature-dependent control of endosperm weakening and determine the optimal temperature for germination. The conserved DOG1-mediated coat-dormancy mechanism provides a highly adaptable temperature-sensing mechanism to control the timing of germination. PMID:25114251

  5. Selection and evaluation of reference genes for expression studies with quantitative PCR in the model fungus Neurospora crassa under different environmental conditions in continuous culture.

    PubMed

    Cusick, Kathleen D; Fitzgerald, Lisa A; Pirlo, Russell K; Cockrell, Allison L; Petersen, Emily R; Biffinger, Justin C

    2014-01-01

    Neurospora crassa has served as a model organism for studying circadian pathways and more recently has gained attention in the biofuel industry due to its enhanced capacity for cellulase production. However, in order to optimize N. crassa for biotechnological applications, metabolic pathways during growth under different environmental conditions must be addressed. Reverse-transcription quantitative PCR (RT-qPCR) is a technique that provides a high-throughput platform from which to measure the expression of a large set of genes over time. The selection of a suitable reference gene is critical for gene expression studies using relative quantification, as this strategy is based on normalization of target gene expression to a reference gene whose expression is stable under the experimental conditions. This study evaluated twelve candidate reference genes for use with N. crassa when grown in continuous culture bioreactors under different light and temperature conditions. Based on combined stability values from NormFinder and Best Keeper software packages, the following are the most appropriate reference genes under conditions of: (1) light/dark cycling: btl, asl, and vma1; (2) all-dark growth: btl, tbp, vma1, and vma2; (3) temperature flux: btl, vma1, act, and asl; (4) all conditions combined: vma1, vma2, tbp, and btl. Since N. crassa exists as different cell types (uni- or multi-nucleated), expression changes in a subset of the candidate genes was further assessed using absolute quantification. A strong negative correlation was found to exist between ratio and threshold cycle (CT) values, demonstrating that CT changes serve as a reliable reflection of transcript, and not gene copy number, fluctuations. The results of this study identified genes that are appropriate for use as reference genes in RT-qPCR studies with N. crassa and demonstrated that even with the presence of different cell types, relative quantification is an acceptable method for measuring gene expression changes during growth in bioreactors.

  6. Selection of Reference Genes for Quantitative Gene Expression in Porcine Mesenchymal Stem Cells Derived from Various Sources along with Differentiation into Multilineages

    PubMed Central

    Lee, Won-Jae; Jeon, Ryoung-Hoon; Jang, Si-Jung; Park, Ji-Sung; Lee, Seung-Chan; Baregundi Subbarao, Raghavendra; Lee, Sung-Lim; Park, Bong-Wook; King, William Allan; Rho, Gyu-Jin

    2015-01-01

    The identification of stable reference genes is a prerequisite for ensuring accurate validation of gene expression, yet too little is known about stable reference genes of porcine MSCs. The present study was, therefore, conducted to assess the stability of reference genes in porcine MSCs derived from bone marrow (BMSCs), adipose (AMSCs), and skin (SMSCs) with their in vitro differentiated cells into mesenchymal lineages such as adipocytes, osteocytes, and chondrocytes. Twelve commonly used reference genes were investigated for their threshold cycle (Ct) values by qRT-PCR. The Ct values of candidate reference genes were analyzed by geNorm software to clarify stable expression regardless of experimental conditions. Thus, Pearson's correlation was applied to determine correlation between the three most stable reference genes (NF3) and optimal number of reference genes (NFopt). In assessment of stability of reference gene across experimental conditions by geNorm analysis, undifferentiated MSCs and each differentiated status into mesenchymal lineages showed slightly different results but similar patterns about more or less stable rankings. Furthermore, Pearson's correlation revealed high correlation (r > 0.9) between NF3 and NFopt. Overall, the present study showed that HMBS, YWHAZ, SDHA, and TBP are suitable reference genes for qRT-PCR in porcine MSCs. PMID:25972899

  7. Fine-grained parallelization of fitness functions in bioinformatics optimization problems: gene selection for cancer classification and biclustering of gene expression data.

    PubMed

    Gomez-Pulido, Juan A; Cerrada-Barrios, Jose L; Trinidad-Amado, Sebastian; Lanza-Gutierrez, Jose M; Fernandez-Diaz, Ramon A; Crawford, Broderick; Soto, Ricardo

    2016-08-31

    Metaheuristics are widely used to solve large combinatorial optimization problems in bioinformatics because of the huge set of possible solutions. Two representative problems are gene selection for cancer classification and biclustering of gene expression data. In most cases, these metaheuristics, as well as other non-linear techniques, apply a fitness function to each possible solution with a size-limited population, and that step involves higher latencies than other parts of the algorithms, which is the reason why the execution time of the applications will mainly depend on the execution time of the fitness function. In addition, it is usual to find floating-point arithmetic formulations for the fitness functions. This way, a careful parallelization of these functions using the reconfigurable hardware technology will accelerate the computation, specially if they are applied in parallel to several solutions of the population. A fine-grained parallelization of two floating-point fitness functions of different complexities and features involved in biclustering of gene expression data and gene selection for cancer classification allowed for obtaining higher speedups and power-reduced computation with regard to usual microprocessors. The results show better performances using reconfigurable hardware technology instead of usual microprocessors, in computing time and power consumption terms, not only because of the parallelization of the arithmetic operations, but also thanks to the concurrent fitness evaluation for several individuals of the population in the metaheuristic. This is a good basis for building accelerated and low-energy solutions for intensive computing scenarios.

  8. Cotransduction with MGMT and Ubiquitous or Erythroid-Specific GFP Lentiviruses Allows Enrichment of Dual-Positive Hematopoietic Progenitor Cells In Vivo

    PubMed Central

    Roth, Justin C.; Ismail, Mourad; Reese, Jane S.; Lingas, Karen T.; Ferrari, Giuliana; Gerson, Stanton L.

    2012-01-01

    The P140K point mutant of MGMT allows robust hematopoietic stem cell (HSC) enrichment in vivo. Thus, dual-gene vectors that couple MGMT and therapeutic gene expression have allowed enrichment of gene-corrected HSCs in animal models. However, expression levels from dual-gene vectors are often reduced for one or both genes. Further, it may be desirable to express selection and therapeutic genes at distinct stages of cell differentiation. In this regard, we evaluated whether hematopoietic cells could be efficiently cotransduced using low MOIs of two separate single-gene lentiviruses, including MGMT for dual-positive cell enrichment. Cotransduction efficiencies were evaluated using a range of MGMT : GFP virus ratios, MOIs, and selection stringencies in vitro. Cotransduction was optimal when equal proportions of each virus were used, but low MGMT : GFP virus ratios resulted in the highest proportion of dual-positive cells after selection. This strategy was then evaluated in murine models for in vivo selection of HSCs cotransduced with a ubiquitous MGMT expression vector and an erythroid-specific GFP vector. Although the MGMT and GFP expression percentages were variable among engrafted recipients, drug selection enriched MGMT-positive leukocyte and GFP-positive erythroid cell populations. These data demonstrate cotransduction as a mean to rapidly enrich and evaluate therapeutic lentivectors in vivo. PMID:22888445

  9. Targeting Neutrophil Protease-Mediated Degradation of Tsp-1 to Induce Metastatic Dormancy

    DTIC Science & Technology

    2017-10-01

    have decided to use CRISPR -Cas9 mediated gene knockout as it results in complete depletion of gene products. The sequences for gRNAs (Fig. 1B) have...express Tsp-1 receptor CD36 Fig. 1. (A) Tsp-1 receptor CD36 is expressed by tumor cells. (B) Design of CRISPR -Cas9 gRNAs for generating biallelic...DWLPK peptide solubility were created and optimized. For Aim 1, Subtask 2.1: We have decided to use CRISPR -Cas9 as they are more potent in

  10. Non-uniqueness of factors constraint on the codon usage in Bombyx mori.

    PubMed

    Jia, Xian; Liu, Shuyu; Zheng, Hao; Li, Bo; Qi, Qi; Wei, Lei; Zhao, Taiyi; He, Jian; Sun, Jingchen

    2015-05-06

    The analysis of codon usage is a good way to understand the genetic and evolutionary characteristics of an organism. However, there are only a few reports related with the codon usage of the domesticated silkworm, Bombyx mori (B. mori). Hence, the codon usage of B. mori was analyzed here to reveal the constraint factors and it could be helpful to improve the bioreactor based on B. mori. A total of 1,097 annotated mRNA sequences from B. mori were analyzed, revealing there is only a weak codon bias. It also shows that the gene expression level is related to the GC content, and the amino acids with higher general average hydropathicity (GRAVY) and aromaticity (Aromo). And the genes on the primary axis are strongly positively correlated with the GC content, and GC3s. Meanwhile, the effective number of codons (ENc) is strongly correlated with codon adaptation index (CAI), gene length, and Aromo values. However, the ENc values are correlated with the second axis, which indicates that the codon usage in B. mori is affected by not only mutation pressure and natural selection, but also nucleotide composition and the gene expression level. It is also associated with Aromo values, and gene length. Additionally, B. mori has a greater relative discrepancy in codon preferences with Drosophila melanogaster (D. melanogaster) or Saccharomyces cerevisiae (S. cerevisiae) than with Arabidopsis thaliana (A. thaliana), Escherichia coli (E. coli), or Caenorhabditis elegans (C. elegans). The codon usage bias in B. mori is relatively weak, and many influence factors are found here, such as nucleotide composition, mutation pressure, natural selection, and expression level. Additionally, it is also associated with Aromo values, and gene length. Among them, natural selection might play a major role. Moreover, the "optimal codons" of B. mori are all encoded by G and C, which provides useful information for enhancing the gene expression in B. mori through codon optimization.

  11. The expression of Longus type 4 pilus of enterotoxigenic Escherichia coli is regulated by LngR and LngS and by H-NS, CpxR and CRP global regulators.

    PubMed

    De la Cruz, Miguel A; Ruiz-Tagle, Alejandro; Ares, Miguel A; Pacheco, Sabino; Yáñez, Jorge A; Cedillo, Lilia; Torres, Javier; Girón, Jorge A

    2017-05-01

    Enterotoxigenic Escherichia coli produces a long type 4 pilus called Longus. The regulatory elements and the environmental signals controlling the expression of Longus-encoding genes are unknown. We identified two genes lngR and lngS in the Longus operon, whose predicted products share homology with transcriptional regulators. Isogenic lngR and lngS mutants were considerably affected in transcription of lngA pilin gene. The expression of lngA, lngR and lngS genes was optimally expressed at 37°C at pH 7.5. The presence of glucose and sodium chloride had a positive effect on Longus expression. The presence of divalent ions, particularly calcium, appears to be an important stimulus for Longus production. In addition, we studied H-NS, CpxR and CRP global regulators, on Longus expression. The response regulator CpxR appears to function as a positive regulator of lng genes as the cpxR mutant showed reduced levels of lngRSA expression. In contrast, H-NS and CRP function as negative regulators since expression of lngA was up-regulated in isogenic hns and crp mutants. H-NS and CRP were required for salt- and glucose-mediated regulation of Longus. Our data suggest the existence of a complex regulatory network controlling Longus expression, involving both local and global regulators in response to different environmental signals. © 2016 Society for Applied Microbiology and John Wiley & Sons Ltd.

  12. PCFT/SLC46A1 promoter methylation and restoration of gene expression in human leukemia cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gonen, Nitzan; Bram, Eran E.; Assaraf, Yehuda G.

    2008-11-28

    The proton-coupled folate transporter (PCFT/SLC46A1) displays optimal and prominent folate and antifolate transport activity at acidic pH in human carcinoma cells but poor activity in leukemia cells. Consistently herein, human leukemia cell lines expressed poor PCFT transcript levels, whereas various carcinoma cell lines showed substantial PCFT gene expression. We identified a CpG island with high density at nucleotides -200 through +100 and explored its role in PCFT promoter silencing. Leukemia cells with barely detectable PCFT transcripts consistently harbored 85-100% methylation of this CpG island, whereas no methylation was found in carcinoma cells. Treatment with 5-Aza-2'-deoxycytidine which induced demethylation but notmore » with the histone deacetylase inhibitor trichostatin A, restored 50-fold PCFT expression only in leukemia cells. These findings constitute the first demonstration of the dominant epigenetic silencing of the PCFT gene in leukemia cells. The potential translational implications of the restoration of PCFT expression in chemotherapy of leukemia are discussed.« less

  13. Optimal 3D culture of primary articular chondrocytes for use in the rotating wall vessel bioreactor.

    PubMed

    Mellor, Liliana F; Baker, Travis L; Brown, Raquel J; Catlin, Lindsey W; Oxford, Julia Thom

    2014-08-01

    Reliable culturing methods for primary articular chondrocytes are essential to study the effects of loading and unloading on joint tissue at the cellular level. Due to the limited proliferation capacity of primary chondrocytes and their tendency to dedifferentiate in conventional culture conditions, long-term culturing conditions of primary chondrocytes can be challenging. The goal of this study was to develop a suspension culturing technique that not only would retain the cellular morphology, but also maintain the gene expression characteristics of primary articular chondrocytes. Three-dimensional culturing methods were compared and optimized for primary articular chondrocytes in the rotating wall vessel bioreactor, which changes the mechanical culture conditions to provide a form of suspension culture optimized for low shear and turbulence. We performed gene expression analysis and morphological characterization of cells cultured in alginate beads, Cytopore-2 microcarriers, primary monolayer culture, and passaged monolayer cultures using reverse transcription-PCR and laser scanning confocal microscopy. Primary chondrocytes grown on Cytopore-2 microcarriers maintained the phenotypical morphology and gene expression pattern observed in primary bovine articular chondrocytes, and retained these characteristics for up to 9 d. Our results provide a novel and alternative culturing technique for primary chondrocytes suitable for studies that require suspension such as those using the rotating wall vessel bioreactor. In addition, we provide an alternative culturing technique for primary chondrocytes that can impact future mechanistic studies of osteoarthritis progression, treatments for cartilage damage and repair, and cartilage tissue engineering.

  14. Classification based upon gene expression data: bias and precision of error rates.

    PubMed

    Wood, Ian A; Visscher, Peter M; Mengersen, Kerrie L

    2007-06-01

    Gene expression data offer a large number of potentially useful predictors for the classification of tissue samples into classes, such as diseased and non-diseased. The predictive error rate of classifiers can be estimated using methods such as cross-validation. We have investigated issues of interpretation and potential bias in the reporting of error rate estimates. The issues considered here are optimization and selection biases, sampling effects, measures of misclassification rate, baseline error rates, two-level external cross-validation and a novel proposal for detection of bias using the permutation mean. Reporting an optimal estimated error rate incurs an optimization bias. Downward bias of 3-5% was found in an existing study of classification based on gene expression data and may be endemic in similar studies. Using a simulated non-informative dataset and two example datasets from existing studies, we show how bias can be detected through the use of label permutations and avoided using two-level external cross-validation. Some studies avoid optimization bias by using single-level cross-validation and a test set, but error rates can be more accurately estimated via two-level cross-validation. In addition to estimating the simple overall error rate, we recommend reporting class error rates plus where possible the conditional risk incorporating prior class probabilities and a misclassification cost matrix. We also describe baseline error rates derived from three trivial classifiers which ignore the predictors. R code which implements two-level external cross-validation with the PAMR package, experiment code, dataset details and additional figures are freely available for non-commercial use from http://www.maths.qut.edu.au/profiles/wood/permr.jsp

  15. Selection and validation of suitable reference genes for miRNA expression normalization by quantitative RT-PCR in citrus somatic embryogenic and adult tissues.

    PubMed

    Kou, Shu-Jun; Wu, Xiao-Meng; Liu, Zheng; Liu, Yuan-Long; Xu, Qiang; Guo, Wen-Wu

    2012-12-01

    miRNAs have recently been reported to modulate somatic embryogenesis (SE), a key pathway of plant regeneration in vitro. For expression level detection and subsequent function dissection of miRNAs in certain biological processes, qRT-PCR is one of the most effective and sensitive techniques, for which suitable reference gene selection is a prerequisite. In this study, three miRNAs and eight non-coding RNAs (ncRNA) were selected as reference candidates, and their expression stability was inspected in developing citrus SE tissues cultured at 20, 25, and 30 °C. Stability of the eight non-miRNA ncRNAs was further validated in five adult tissues without temperature treatment. The best single reference gene for SE tissues was snoR14 or snoRD25, while for the adult tissues the best one was U4; although they were not as stable as the optimal multiple references snoR14 + U6 for SE tissues and snoR14 + U5 for adult tissues. For expression normalization of less abundant miRNAs in SE tissues, miR3954 was assessed as a viable reference. Single reference gene snoR14 outperformed multiple references for the overall SE and adult tissues. As one of the pioneer systematic studies on reference gene identification for plant miRNA normalization, this study benefits future exploration on miRNA function in citrus and provides valuable information for similar studies in other higher plants. Three miRNAs and eight non-coding RNAs were tested as reference candidates on developing citrus SE tissues. Best single references snoR14 or snoRD25 and optimal multiple references snoR14 + U6, snoR14 + U5 were identified.

  16. Identification of appropriate reference genes for human mesenchymal stem cell analysis by quantitative real-time PCR.

    PubMed

    Li, Xiuying; Yang, Qiwei; Bai, Jinping; Xuan, Yali; Wang, Yimin

    2015-01-01

    Normalization to a reference gene is the method of choice for quantitative reverse transcription-PCR (RT-qPCR) analysis. The stability of reference genes is critical for accurate experimental results and conclusions. We have evaluated the expression stability of eight commonly used reference genes found in four different human mesenchymal stem cells (MSC). Using geNorm, NormFinder and BestKeeper algorithms, we show that beta-2-microglobulin and peptidyl-prolylisomerase A were the optimal reference genes for normalizing RT-qPCR data obtained from MSC, whereas the TATA box binding protein was not suitable due to its extensive variability in expression. Our findings emphasize the significance of validating reference genes for qPCR analyses. We offer a short list of reference genes to use for normalization and recommend some commercially-available software programs as a rapid approach to validate reference genes. We also demonstrate that the two reference genes, β-actin and glyceraldehyde-3-phosphate dehydrogenase, are frequently used are not always successful in many cases.

  17. Classification of intramural metastases and lymph node metastases of esophageal cancer from gene expression based on boosting and projective adaptive resonance theory.

    PubMed

    Takahashi, Hiro; Aoyagi, Kazuhiko; Nakanishi, Yukihiro; Sasaki, Hiroki; Yoshida, Teruhiko; Honda, Hiroyuki

    2006-07-01

    Esophageal cancer is a well-known cancer with poorer prognosis than other cancers. An optimal and individualized treatment protocol based on accurate diagnosis is urgently needed to improve the treatment of cancer patients. For this purpose, it is important to develop a sophisticated algorithm that can manage a large amount of data, such as gene expression data from DNA microarrays, for optimal and individualized diagnosis. Marker gene selection is essential in the analysis of gene expression data. We have already developed a combination method of the use of the projective adaptive resonance theory and that of a boosted fuzzy classifier with the SWEEP operator denoted PART-BFCS. This method is superior to other methods, and has four features, namely fast calculation, accurate prediction, reliable prediction, and rule extraction. In this study, we applied this method to analyze microarray data obtained from esophageal cancer patients. A combination method of PART-BFCS and the U-test was also investigated. It was necessary to use a specific type of BFCS, namely, BFCS-1,2, because the esophageal cancer data were very complexity. PART-BFCS and PART-BFCS with the U-test models showed higher performances than two conventional methods, namely, k-nearest neighbor (kNN) and weighted voting (WV). The genes including CDK6 could be found by our methods and excellent IF-THEN rules could be extracted. The genes selected in this study have a high potential as new diagnosis markers for esophageal cancer. These results indicate that the new methods can be used in marker gene selection for the diagnosis of cancer patients.

  18. Transcriptome Profiling of Bovine Milk Oligosaccharide Metabolism Genes Using RNA-Sequencing

    PubMed Central

    Wickramasinghe, Saumya; Hua, Serenus; Rincon, Gonzalo; Islas-Trejo, Alma; German, J. Bruce; Lebrilla, Carlito B.; Medrano, Juan F.

    2011-01-01

    This study examines the genes coding for enzymes involved in bovine milk oligosaccharide metabolism by comparing the oligosaccharide profiles with the expressions of glycosylation-related genes. Fresh milk samples (n = 32) were collected from four Holstein and Jersey cows at days 1, 15, 90 and 250 of lactation and free milk oligosaccharide profiles were analyzed. RNA was extracted from milk somatic cells at days 15 and 250 of lactation (n = 12) and gene expression analysis was conducted by RNA-Sequencing. A list was created of 121 glycosylation-related genes involved in oligosaccharide metabolism pathways in bovine by analyzing the oligosaccharide profiles and performing an extensive literature search. No significant differences were observed in either oligosaccharide profiles or expressions of glycosylation-related genes between Holstein and Jersey cows. The highest concentrations of free oligosaccharides were observed in the colostrum samples and a sharp decrease was observed in the concentration of free oligosaccharides on day 15, followed by progressive decrease on days 90 and 250. Ninety-two glycosylation-related genes were expressed in milk somatic cells. Most of these genes exhibited higher expression in day 250 samples indicating increases in net glycosylation-related metabolism in spite of decreases in free milk oligosaccharides in late lactation milk. Even though fucosylated free oligosaccharides were not identified, gene expression indicated the likely presence of fucosylated oligosaccharides in bovine milk. Fucosidase genes were expressed in milk and a possible explanation for not detecting fucosylated free oligosaccharides is the degradation of large fucosylated free oligosaccharides by the fucosidases. Detailed characterization of enzymes encoded by the 92 glycosylation-related genes identified in this study will provide the basic knowledge for metabolic network analysis of oligosaccharides in mammalian milk. These candidate genes will guide the design of a targeted breeding strategy to optimize the content of beneficial oligosaccharides in bovine milk. PMID:21541029

  19. Selection of appropriate reference genes for RT-qPCR analysis in a streptozotocin-induced Alzheimer's disease model of cynomolgus monkeys (Macaca fascicularis).

    PubMed

    Park, Sang-Je; Kim, Young-Hyun; Lee, Youngjeon; Kim, Kyoung-Min; Kim, Heui-Soo; Lee, Sang-Rae; Kim, Sun-Uk; Kim, Sang-Hyun; Kim, Ji-Su; Jeong, Kang-Jin; Lee, Kyoung-Min; Huh, Jae-Won; Chang, Kyu-Tae

    2013-01-01

    Reverse transcription quantitative real-time polymerase chain reaction (RT-qPCR) has been widely used to quantify relative gene expression because of the specificity, sensitivity, and accuracy of this technique. In order to obtain reliable gene expression data from RT-qPCR experiments, it is important to utilize optimal reference genes for the normalization of target gene expression under varied experimental conditions. Previously, we developed and validated a novel icv-STZ cynomolgus monkey model for Alzheimer's disease (AD) research. However, in order to enhance the reliability of this disease model, appropriate reference genes must be selected to allow meaningful analysis of the gene expression levels in the icv-STZ cynomolgus monkey brain. In this study, we assessed the expression stability of 9 candidate reference genes in 2 matched-pair brain samples (5 regions) of control cynomolgus monkeys and those who had received intracerebroventricular injection of streptozotocin (icv-STZ). Three well-known analytical programs geNorm, NormFinder, and BestKeeper were used to choose the suitable reference genes from the total sample group, control group, and icv-STZ group. Combination analysis of the 3 different programs clearly indicated that the ideal reference genes are RPS19 and YWHAZ in the total sample group, GAPDH and RPS19 in the control group, and ACTB and GAPDH in the icv-STZ group. Additionally, we validated the normalization accuracy of the most appropriate reference genes (RPS19 and YWHAZ) by comparison with the least stable gene (TBP) using quantification of the APP and MAPT genes in the total sample group. To the best of our knowledge, this research is the first study to identify and validate the appropriate reference genes in cynomolgus monkey brains. These findings provide useful information for future studies involving the expression of target genes in the cynomolgus monkey.

  20. Automatic Control of Gene Expression in Mammalian Cells.

    PubMed

    Fracassi, Chiara; Postiglione, Lorena; Fiore, Gianfranco; di Bernardo, Diego

    2016-04-15

    Automatic control of gene expression in living cells is paramount importance to characterize both endogenous gene regulatory networks and synthetic circuits. In addition, such a technology can be used to maintain the expression of synthetic circuit components in an optimal range in order to ensure reliable performance. Here we present a microfluidics-based method to automatically control gene expression from the tetracycline-inducible promoter in mammalian cells in real time. Our approach is based on the negative-feedback control engineering paradigm. We validated our method in a monoclonal population of cells constitutively expressing a fluorescent reporter protein (d2EYFP) downstream of a minimal CMV promoter with seven tet-responsive operator motifs (CMV-TET). These cells also constitutively express the tetracycline transactivator protein (tTA). In cells grown in standard growth medium, tTA is able to bind the CMV-TET promoter, causing d2EYFP to be maximally expressed. Upon addition of tetracycline to the culture medium, tTA detaches from the CMV-TET promoter, thus preventing d2EYFP expression. We tested two different model-independent control algorithms (relay and proportional-integral (PI)) to force a monoclonal population of cells to express an intermediate level of d2EYFP equal to 50% of its maximum expression level for up to 3500 min. The control input is either tetracycline-rich or standard growth medium. We demonstrated that both the relay and PI controllers can regulate gene expression at the desired level, despite oscillations (dampened in the case of the PI controller) around the chosen set point.

  1. Validation of Reference Genes for Robust qRT-PCR Gene Expression Analysis in the Rice Blast Fungus Magnaporthe oryzae.

    PubMed

    Che Omar, Sarena; Bentley, Michael A; Morieri, Giulia; Preston, Gail M; Gurr, Sarah J

    2016-01-01

    The rice blast fungus causes significant annual harvest losses. It also serves as a genetically-tractable model to study fungal ingress. Whilst pathogenicity determinants have been unmasked and changes in global gene expression described, we know little about Magnaporthe oryzae cell wall remodelling. Our interests, in wall remodelling genes expressed during infection, vegetative growth and under exogenous wall stress, demand robust choice of reference genes for quantitative Real Time-PCR (qRT-PCR) data normalisation. We describe the expression stability of nine candidate reference genes profiled by qRT-PCR with cDNAs derived during asexual germling development, from sexual stage perithecia and from vegetative mycelium grown under various exogenous stressors. Our Minimum Information for Publication of qRT-PCR Experiments (MIQE) compliant analysis reveals a set of robust reference genes used to track changes in the expression of the cell wall remodelling gene MGG_Crh2 (MGG_00592). We ranked nine candidate reference genes by their expression stability (M) and report the best gene combination needed for reliable gene expression normalisation, when assayed in three tissue groups (Infective, Vegetative, and Global) frequently used in M. oryzae expression studies. We found that MGG_Actin (MGG_03982) and the 40S 27a ribosomal subunit MGG_40s (MGG_02872) proved to be robust reference genes for the Infection group and MGG_40s and MGG_Ef1 (Elongation Factor1-α) for both Vegetative and Global groups. Using the above validated reference genes, M. oryzae MGG_Crh2 expression was found to be significantly (p<0.05) elevated three-fold during vegetative growth as compared with dormant spores and two fold higher under cell wall stress (Congo Red) compared to growth under optimal conditions. We recommend the combinatorial use of two reference genes, belonging to the cytoskeleton and ribosomal synthesis functional groups, MGG_Actin, MGG_40s, MGG_S8 (Ribosomal subunit 40S S8) or MGG_Ef1, which demonstrated low M values across heterogeneous tissues. By contrast, metabolic pathway genes MGG_Fad (FAD binding domain-containing protein) and MGG_Gapdh (Glyceraldehyde-3-phosphate dehydrogenase) performed poorly, due to their lack of expression stability across samples.

  2. Transcriptomic Analysis of Temperature Responses of Aspergillus kawachii during Barley Koji Production

    PubMed Central

    Futagami, Taiki; Mori, Kazuki; Wada, Shotaro; Ida, Hiroko; Kajiwara, Yasuhiro; Takashita, Hideharu; Tashiro, Kosuke; Yamada, Osamu; Omori, Toshiro; Kuhara, Satoru

    2014-01-01

    The koji mold Aspergillus kawachii is used for making the Japanese distilled spirit shochu. During shochu production, A. kawachii is grown in solid-state culture (koji) on steamed grains, such as rice or barley, to convert the grain starch to glucose and produce citric acid. During this process, the cultivation temperature of A. kawachii is gradually increased to 40°C and is then lowered to 30°C. This temperature modulation is important for stimulating amylase activity and the accumulation of citric acid. However, the effects of temperature on A. kawachii at the gene expression level have not been elucidated. In this study, we investigated the effect of solid-state cultivation temperature on gene expression for A. kawachii grown on barley. The results of DNA microarray and gene ontology analyses showed that the expression of genes involved in the glycerol, trehalose, and pentose phosphate metabolic pathways, which function downstream of glycolysis, was downregulated by shifting the cultivation temperature from 40 to 30°C. In addition, significantly reduced expression of genes related to heat shock responses and increased expression of genes related with amino acid transport were also observed. These results suggest that solid-state cultivation at 40°C is stressful for A. kawachii and that heat adaptation leads to reduced citric acid accumulation through activation of pathways branching from glycolysis. The gene expression profile of A. kawachii elucidated in this study is expected to contribute to the understanding of gene regulation during koji production and optimization of the industrially desirable characteristics of A. kawachii. PMID:25501485

  3. Transcriptomic analysis of temperature responses of Aspergillus kawachii during barley koji production.

    PubMed

    Futagami, Taiki; Mori, Kazuki; Wada, Shotaro; Ida, Hiroko; Kajiwara, Yasuhiro; Takashita, Hideharu; Tashiro, Kosuke; Yamada, Osamu; Omori, Toshiro; Kuhara, Satoru; Goto, Masatoshi

    2015-02-01

    The koji mold Aspergillus kawachii is used for making the Japanese distilled spirit shochu. During shochu production, A. kawachii is grown in solid-state culture (koji) on steamed grains, such as rice or barley, to convert the grain starch to glucose and produce citric acid. During this process, the cultivation temperature of A. kawachii is gradually increased to 40 °C and is then lowered to 30 °C. This temperature modulation is important for stimulating amylase activity and the accumulation of citric acid. However, the effects of temperature on A. kawachii at the gene expression level have not been elucidated. In this study, we investigated the effect of solid-state cultivation temperature on gene expression for A. kawachii grown on barley. The results of DNA microarray and gene ontology analyses showed that the expression of genes involved in the glycerol, trehalose, and pentose phosphate metabolic pathways, which function downstream of glycolysis, was downregulated by shifting the cultivation temperature from 40 to 30 °C. In addition, significantly reduced expression of genes related to heat shock responses and increased expression of genes related with amino acid transport were also observed. These results suggest that solid-state cultivation at 40 °C is stressful for A. kawachii and that heat adaptation leads to reduced citric acid accumulation through activation of pathways branching from glycolysis. The gene expression profile of A. kawachii elucidated in this study is expected to contribute to the understanding of gene regulation during koji production and optimization of the industrially desirable characteristics of A. kawachii.

  4. 5S rRNA Promoter for Guide RNA Expression Enabled Highly Efficient CRISPR/Cas9 Genome Editing in Aspergillus niger.

    PubMed

    Zheng, Xiaomei; Zheng, Ping; Zhang, Kun; Cairns, Timothy C; Meyer, Vera; Sun, Jibin; Ma, Yanhe

    2018-04-30

    The CRISPR/Cas9 system is a revolutionary genome editing tool. However, in eukaryotes, search and optimization of a suitable promoter for guide RNA expression is a significant technical challenge. Here we used the industrially important fungus, Aspergillus niger, to demonstrate that the 5S rRNA gene, which is both highly conserved and efficiently expressed in eukaryotes, can be used as a guide RNA promoter. The gene editing system was established with 100% rates of precision gene modifications among dozens of transformants using short (40-bp) homologous donor DNA. This system was also applicable for generation of designer chromosomes, as evidenced by deletion of a 48 kb gene cluster required for biosynthesis of the mycotoxin fumonisin B1. Moreover, this system also facilitated simultaneous mutagenesis of multiple genes in A. niger. We anticipate that the use of the 5S rRNA gene as guide RNA promoter can broadly be applied for engineering highly efficient eukaryotic CRISPR/Cas9 toolkits. Additionally, the system reported here will enable development of designer chromosomes in model and industrially important fungi.

  5. Metabolic engineering of Escherichia coli for production of valerenadiene.

    PubMed

    Nybo, S Eric; Saunders, Jacqueline; McCormick, Sean P

    2017-11-20

    Valeriana officinalis is a medicinal herb which produces a suite of compounds in its root tissue useful for treatment of anxiety and insomnia. The sesquiterpene components of the root extract, valerenic acid and valerena-1,10-diene, are thought to contribute to most of the observed anxiolytic of Valerian root preparations. However, valerenic acid and its biosynthetic intermediates are only produced in low quantities in the roots of V. officinalis. Thus, in this report, Escherichia coli was metabolically engineered to produce substantial quantities of valerena-1,10-diene in shake flask fermentations with decane overlay. Expression of the wildtype valerenadiene synthase gene (pZE-wvds) resulted in production of 12μg/mL in LB cultures using endogenous FPP metabolism. Expression of a codon-optimized version of the valerenadiene synthase gene (pZE-cvds) resulted in 3-fold higher titers of valerenadiene (32μg/mL). Co-expression of pZE-cvds with an engineered methyl erythritol phosphate (MEP) pathway improved valerenadiene titers 65-fold to 2.09mg/L valerenadiene. Optimization of the fermentation medium to include glycerol supplementation enhanced yields by another 5.5-fold (11.0mg/L valerenadiene). The highest production of valerenadiene resulted from engineering the codon-optimized valerenadiene synthase gene under strong P trc and P T7 promoters and via co-expression of an exogenous mevalonate (MVA) pathway. These efforts resulted in an E. coli production strain that produced 62.0mg/L valerenadiene (19.4mg/L/OD 600 specific productivity). This E. coli production platform will serve as the foundation for the synthesis of novel valerenic acid analogues potentially useful for the treatment of anxiety disorders. Copyright © 2017 Elsevier B.V. All rights reserved.

  6. Development of a codon optimization strategy using the efor RED reporter gene as a test case

    NASA Astrophysics Data System (ADS)

    Yip, Chee-Hoo; Yarkoni, Orr; Ajioka, James; Wan, Kiew-Lian; Nathan, Sheila

    2018-04-01

    Synthetic biology is a platform that enables high-level synthesis of useful products such as pharmaceutically related drugs, bioplastics and green fuels from synthetic DNA constructs. Large-scale expression of these products can be achieved in an industrial compliant host such as Escherichia coli. To maximise the production of recombinant proteins in a heterologous host, the genes of interest are usually codon optimized based on the codon usage of the host. However, the bioinformatics freeware available for standard codon optimization might not be ideal in determining the best sequence for the synthesis of synthetic DNA. Synthesis of incorrect sequences can prove to be a costly error and to avoid this, a codon optimization strategy was developed based on the E. coli codon usage using the efor RED reporter gene as a test case. This strategy replaces codons encoding for serine, leucine, proline and threonine with the most frequently used codons in E. coli. Furthermore, codons encoding for valine and glycine are substituted with the second highly used codons in E. coli. Both the optimized and original efor RED genes were ligated to the pJS209 plasmid backbone using Gibson Assembly and the recombinant DNAs were transformed into E. coli E. cloni 10G strain. The fluorescence intensity per cell density of the optimized sequence was improved by 20% compared to the original sequence. Hence, the developed codon optimization strategy is proposed when designing an optimal sequence for heterologous protein production in E. coli.

  7. Plastids Are Major Regulators of Light Signaling in Arabidopsis1[W][OA

    PubMed Central

    Ruckle, Michael E.; Burgoon, Lyle D.; Lawrence, Lauren A.; Sinkler, Christopher A.; Larkin, Robert M.

    2012-01-01

    We previously provided evidence that plastid signaling regulates the downstream components of a light signaling network and that this signal integration coordinates chloroplast biogenesis with both the light environment and development by regulating gene expression. We tested these ideas by analyzing light- and plastid-regulated transcriptomes in Arabidopsis (Arabidopsis thaliana). We found that the enrichment of Gene Ontology terms in these transcriptomes is consistent with the integration of light and plastid signaling (1) down-regulating photosynthesis and inducing both repair and stress tolerance in dysfunctional chloroplasts and (2) helping coordinate processes such as growth, the circadian rhythm, and stress responses with the degree of chloroplast function. We then tested whether factors that contribute to this signal integration are also regulated by light and plastid signals by characterizing T-DNA insertion alleles of genes that are regulated by light and plastid signaling and that encode proteins that are annotated as contributing to signaling, transcription, or no known function. We found that a high proportion of these mutant alleles induce chloroplast biogenesis during deetiolation. We quantified the expression of four photosynthesis-related genes in seven of these enhanced deetiolation (end) mutants and found that photosynthesis-related gene expression is attenuated. This attenuation is particularly striking for Photosystem II subunit S expression. We conclude that the integration of light and plastid signaling regulates a number of END genes that help optimize chloroplast function and that at least some END genes affect photosynthesis-related gene expression. PMID:22383539

  8. Survey of the Heritability and Sparse Architecture of Gene Expression Traits across Human Tissues.

    PubMed

    Wheeler, Heather E; Shah, Kaanan P; Brenner, Jonathon; Garcia, Tzintzuni; Aquino-Michaels, Keston; Cox, Nancy J; Nicolae, Dan L; Im, Hae Kyung

    2016-11-01

    Understanding the genetic architecture of gene expression traits is key to elucidating the underlying mechanisms of complex traits. Here, for the first time, we perform a systematic survey of the heritability and the distribution of effect sizes across all representative tissues in the human body. We find that local h2 can be relatively well characterized with 59% of expressed genes showing significant h2 (FDR < 0.1) in the DGN whole blood cohort. However, current sample sizes (n ≤ 922) do not allow us to compute distal h2. Bayesian Sparse Linear Mixed Model (BSLMM) analysis provides strong evidence that the genetic contribution to local expression traits is dominated by a handful of genetic variants rather than by the collective contribution of a large number of variants each of modest size. In other words, the local architecture of gene expression traits is sparse rather than polygenic across all 40 tissues (from DGN and GTEx) examined. This result is confirmed by the sparsity of optimal performing gene expression predictors via elastic net modeling. To further explore the tissue context specificity, we decompose the expression traits into cross-tissue and tissue-specific components using a novel Orthogonal Tissue Decomposition (OTD) approach. Through a series of simulations we show that the cross-tissue and tissue-specific components are identifiable via OTD. Heritability and sparsity estimates of these derived expression phenotypes show similar characteristics to the original traits. Consistent properties relative to prior GTEx multi-tissue analysis results suggest that these traits reflect the expected biology. Finally, we apply this knowledge to develop prediction models of gene expression traits for all tissues. The prediction models, heritability, and prediction performance R2 for original and decomposed expression phenotypes are made publicly available (https://github.com/hakyimlab/PrediXcan).

  9. Study on relationship between expression level and molecular conformations of gene drugs targeting to hepatoma cells in vitro

    PubMed Central

    Yang, Dong-Ye; Lu, Fang-Gen; Tang, Xi-Xiang; Zhao, Shui-Ping; Ouyang, Chun-Hui; Wu, Xiao-Ping; Liu, Xiao-Wei; Wu, Xiao-Ying

    2003-01-01

    AIM: To increase exogenous gene expression level by modulating molecular conformations of targeting gene drugs. METHODS: The full length cDNAs of both P40 and P35 subunits of human interleukin 12 were amplified through polymerase chain reaction (PCR) and cloned into eukaryotic expressing vectors pcDNA3.1 (±) to construct plasmids of P (+)/IL-12, P (+)/P40 and P (-)/P35. These plasmids were combined with ASOR-PLL to form two targeting gene drugs [ASOR-PLL-P (+)/IL-12 and ASOR-PLL-P (+)/P40 + ASOR-PLL-P (-)/P35] in optimal ratios. The conformations of these two drugs at various concentrations adjuvant were examined under electron microscope (EM) and the drugs were transfected into HepG2 (ASGr+) cells. Semi-quantitative reverse transcription polymerase chain reaction (RT-PCR) was performed with total RNA extracted from the transfected cells to determine the hIL12 mRNA transcript level. The hIL12 protein in the cultured supernatant was measured with enzyme-linked immunosorbent assay (ELISA) 48 hours after transfection. RESULTS: Targeting gene drugs, whose structures were granular and circle-like and diameters ranged from 25 nm to 150 nm, had the highest hIL-12 expression level. The hIL-12 expression level in the group co-transfected with ASOR-PLL-P (+)/P40 and ASOR-PLL-P (-)/P35 was higher than that of ASOR-PLL-P (+)/IL-12 transfected group. CONCLUSION: The molecular conformations of targeting gene drugs play an important role in exogenous gene expression level, the best structures are granular and circle-like and their diameters range from 25 nm to 150 nm. The sizes and linking styles of exogenous genes also have some effects on their expression level. PMID:12970883

  10. Whole Blood Gene Expression Profile Associated with Spontaneous Preterm Birth in Women with Threatened Preterm Labor

    PubMed Central

    Heng, Yujing Jan; Pennell, Craig Edward; Chua, Hon Nian; Perkins, Jonathan Edward; Lye, Stephen James

    2014-01-01

    Threatened preterm labor (TPTL) is defined as persistent premature uterine contractions between 20 and 37 weeks of gestation and is the most common condition that requires hospitalization during pregnancy. Most of these TPTL women continue their pregnancies to term while only an estimated 5% will deliver a premature baby within ten days. The aim of this work was to study differential whole blood gene expression associated with spontaneous preterm birth (sPTB) within 48 hours of hospital admission. Peripheral blood was collected at point of hospital admission from 154 women with TPTL before any medical treatment. Microarrays were utilized to investigate differential whole blood gene expression between TPTL women who did (n = 48) or did not have a sPTB (n = 106) within 48 hours of admission. Total leukocyte and neutrophil counts were significantly higher (35% and 41% respectively) in women who had sPTB than women who did not deliver within 48 hours (p<0.001). Fetal fibronectin (fFN) test was performed on 62 women. There was no difference in the urine, vaginal and placental microbiology and histopathology reports between the two groups of women. There were 469 significant differentially expressed genes (FDR<0.05); 28 differentially expressed genes were chosen for microarray validation using qRT-PCR and 20 out of 28 genes were successfully validated (p<0.05). An optimal random forest classifier model to predict sPTB was achieved using the top nine differentially expressed genes coupled with peripheral clinical blood data (sensitivity 70.8%, specificity 75.5%). These differentially expressed genes may further elucidate the underlying mechanisms of sPTB and pave the way for future systems biology studies to predict sPTB. PMID:24828675

  11. Evaluation of biolistic gene transfer methods in vivo using non-invasive bioluminescent imaging techniques.

    PubMed

    Xia, Jixiang; Martinez, Angela; Daniell, Henry; Ebert, Steven N

    2011-06-02

    Gene therapy continues to hold great potential for treating many different types of disease and dysfunction. Safe and efficient techniques for gene transfer and expression in vivo are needed to enable gene therapeutic strategies to be effective in patients. Currently, the most commonly used methods employ replication-defective viral vectors for gene transfer, while physical gene transfer methods such as biolistic-mediated ("gene-gun") delivery to target tissues have not been as extensively explored. In the present study, we evaluated the efficacy of biolistic gene transfer techniques in vivo using non-invasive bioluminescent imaging (BLI) methods. Plasmid DNA carrying the firefly luciferase (LUC) reporter gene under the control of the human Cytomegalovirus (CMV) promoter/enhancer was transfected into mouse skin and liver using biolistic methods. The plasmids were coupled to gold microspheres (1 μm diameter) using different DNA Loading Ratios (DLRs), and "shot" into target tissues using a helium-driven gene gun. The optimal DLR was found to be in the range of 4-10. Bioluminescence was measured using an In Vivo Imaging System (IVIS-50) at various time-points following transfer. Biolistic gene transfer to mouse skin produced peak reporter gene expression one day after transfer. Expression remained detectable through four days, but declined to undetectable levels by six days following gene transfer. Maximum depth of tissue penetration following biolistic transfer to abdominal skin was 200-300 μm. Similarly, biolistic gene transfer to mouse liver in vivo also produced peak early expression followed by a decline over time. In contrast to skin, however, liver expression of the reporter gene was relatively stable 4-8 days post-biolistic gene transfer, and remained detectable for nearly two weeks. The use of bioluminescence imaging techniques enabled efficient evaluation of reporter gene expression in vivo. Our results demonstrate that different tissues show different expression kinetics following gene transfer of the same reporter plasmid to different mouse tissues in vivo. We evaluated superficial (skin) and abdominal organ (liver) targets, and found that reporter gene expression peaked within the first two days post-transfer in each case, but declined most rapidly in the skin (3-4 days) compared to liver (10-14 days). This information is essential for designing effective gene therapy strategies in different target tissues.

  12. [Comparison of protective properties of the smallpox DNA-vaccine based on the variola virus A30L gene and its variant with modified codon usage].

    PubMed

    Maksiutov, R A; Shchelkunov, S N

    2011-01-01

    Efficacy of candidate DNA-vaccines based on the variola virus natural gene A30L and artificial gene A30Lopt with modified codon usage, optimized for expression in mammalian cells, was tested. The groups of mice were intracutaneously immunized three times with three-week intervals with candidate DNA-vaccines: pcDNA_A30L or pcDNA_A30Lopt, and in three weeks after the last immunization all mice in the groups were intraperitoneally infected by the ectromelia virus K1 strain in 10 LD50 dose for the estimation of protection. It was shown that the DNA-vaccines based on natural gene A30L and codon-optimized gene A30Lopt elicited virus, thereby neutralizing the antibody response and protected mice from lethal intraperitoneal challenge with the ectromelia virus with lack of statistically significant difference.

  13. Bacterial cell-free expression technology to in vitro systems engineering and optimization.

    PubMed

    Caschera, Filippo

    2017-06-01

    Cell-free expression system is a technology for the synthesis of proteins in vitro . The system is a platform for several bioengineering projects, e.g. cell-free metabolic engineering, evolutionary design of experiments, and synthetic minimal cell construction. Bacterial cell-free protein synthesis system (CFPS) is a robust tool for synthetic biology. The bacteria lysate, the DNA, and the energy module, which are the three optimized sub-systems for in vitro protein synthesis, compose the integrated system. Currently, an optimized E. coli cell-free expression system can produce up to ∼2.3 mg/mL of a fluorescent reporter protein. Herein, I will describe the features of ATP-regeneration systems for in vitro protein synthesis, and I will present a machine-learning experiment for optimizing the protein yield of E. coli cell-free protein synthesis systems. Moreover, I will introduce experiments on the synthesis of a minimal cell using liposomes as dynamic containers, and E. coli cell-free expression system as biochemical platform for metabolism and gene expression. CFPS can be further integrated with other technologies for novel applications in environmental, medical and material science.

  14. eXpression2Kinases (X2K) Web: linking expression signatures to upstream cell signaling networks.

    PubMed

    Clarke, Daniel J B; Kuleshov, Maxim V; Schilder, Brian M; Torre, Denis; Duffy, Mary E; Keenan, Alexandra B; Lachmann, Alexander; Feldmann, Axel S; Gundersen, Gregory W; Silverstein, Moshe C; Wang, Zichen; Ma'ayan, Avi

    2018-05-25

    While gene expression data at the mRNA level can be globally and accurately measured, profiling the activity of cell signaling pathways is currently much more difficult. eXpression2Kinases (X2K) computationally predicts involvement of upstream cell signaling pathways, given a signature of differentially expressed genes. X2K first computes enrichment for transcription factors likely to regulate the expression of the differentially expressed genes. The next step of X2K connects these enriched transcription factors through known protein-protein interactions (PPIs) to construct a subnetwork. The final step performs kinase enrichment analysis on the members of the subnetwork. X2K Web is a new implementation of the original eXpression2Kinases algorithm with important enhancements. X2K Web includes many new transcription factor and kinase libraries, and PPI networks. For demonstration, thousands of gene expression signatures induced by kinase inhibitors, applied to six breast cancer cell lines, are provided for fetching directly into X2K Web. The results are displayed as interactive downloadable vector graphic network images and bar graphs. Benchmarking various settings via random permutations enabled the identification of an optimal set of parameters to be used as the default settings in X2K Web. X2K Web is freely available from http://X2K.cloud.

  15. [Optimization of prokaryotic expression conditions of Leptospira interrogans trigeminy genus-specific protein antigen based on surface response analysis].

    PubMed

    Wang, Jiang; Luo, Dongjiao; Sun, Aihua; Yan, Jie

    2008-07-01

    Lipoproteins LipL32 and LipL21 and transmembrane protein OMPL1 have been confirmed as the superficial genus-specific antigens of Leptospira interrogans, which can be used as antigens for developing a universal genetic engineering vaccine. In order to obtain high expression of an artificial fusion gene lipL32/1-lipL21-ompL1/2, we optimized prokaryotic expression conditions. We used surface response analysis based on the central composite design to optimize culture conditions of a new antigen protein by recombinant Escherichia coli DE3.The culture conditions included initial pH, induction start time, post-induction time, Isopropyl beta-D-thiogalactopyranoside (IPTG) concentration, and temperature. The maximal production of antigen protein was 37.78 mg/l. The optimal culture conditions for high recombinant fusion protein was determined: initial pH 7.9, induction start time 2.5 h, a post-induction time of 5.38 h, 0.20 mM IPTG, and a post-induction temperature of 31 degrees C. Surface response analysis based on CCD increased the target production. This statistical method reduced the number of experiments required for optimization and enabled rapid identification and integration of the key culture condition parameters for optimizing recombinant protein expression.

  16. Synonymous codon choices in the extremely GC-poor genome of Plasmodium falciparum: compositional constraints and translational selection.

    PubMed

    Musto, H; Romero, H; Zavala, A; Jabbari, K; Bernardi, G

    1999-07-01

    We have analyzed the patterns of synonymous codon preferences of the nuclear genes of Plasmodium falciparum, a unicellular parasite characterized by an extremely GC-poor genome. When all genes are considered, codon usage is strongly biased toward A and T in third codon positions, as expected, but multivariate statistical analysis detects a major trend among genes. At one end genes display codon choices determined mainly by the extreme genome composition of this parasite, and very probably their expression level is low. At the other end a few genes exhibit an increased relative usage of a particular subset of codons, many of which are C-ending. Since the majority of these few genes is putatively highly expressed, we postulate that the increased C-ending codons are translationally optimal. In conclusion, while codon usage of the majority of P. falciparum genes is determined mainly by compositional constraints, a small number of genes exhibit translational selection.

  17. Ribozyme-based aminoglycoside switches of gene expression engineered by genetic selection in S. cerevisiae.

    PubMed

    Klauser, Benedikt; Atanasov, Janina; Siewert, Lena K; Hartig, Jörg S

    2015-05-15

    Systems for conditional gene expression are powerful tools in basic research as well as in biotechnology. For future applications, it is of great importance to engineer orthogonal genetic switches that function reliably in diverse contexts. RNA-based switches have the advantage that effector molecules interact immediately with regulatory modules inserted into the target RNAs, getting rid of the need of transcription factors usually mediating genetic control. Artificial riboswitches are characterized by their simplicity and small size accompanied by a high degree of modularity. We have recently reported a series of hammerhead ribozyme-based artificial riboswitches that allow for post-transcriptional regulation of gene expression via switching mRNA, tRNA, or rRNA functions. A more widespread application was so far hampered by moderate switching performances and a limited set of effector molecules available. Here, we report the re-engineering of hammerhead ribozymes in order to respond efficiently to aminoglycoside antibiotics. We first established an in vivo selection protocol in Saccharomyces cerevisiae that enabled us to search large sequence spaces for optimized switches. We then envisioned and characterized a novel strategy of attaching the aptamer to the ribozyme catalytic core, increasing the design options for rendering the ribozyme ligand-dependent. These innovations enabled the development of neomycin-dependent RNA modules that switch gene expression up to 25-fold. The presented aminoglycoside-responsive riboswitches belong to the best-performing RNA-based genetic regulators reported so far. The developed in vivo selection protocol should allow for sampling of large sequence spaces for engineering of further optimized riboswitches.

  18. Gene Expression Biomarkers Provide Sensitive Indicators of in Planta Nitrogen Status in Maize[W][OA

    PubMed Central

    Yang, Xiaofeng S.; Wu, Jingrui; Ziegler, Todd E.; Yang, Xiao; Zayed, Adel; Rajani, M.S.; Zhou, Dafeng; Basra, Amarjit S.; Schachtman, Daniel P.; Peng, Mingsheng; Armstrong, Charles L.; Caldo, Rico A.; Morrell, James A.; Lacy, Michelle; Staub, Jeffrey M.

    2011-01-01

    Over the last several decades, increased agricultural production has been driven by improved agronomic practices and a dramatic increase in the use of nitrogen-containing fertilizers to maximize the yield potential of crops. To reduce input costs and to minimize the potential environmental impacts of nitrogen fertilizer that has been used to optimize yield, an increased understanding of the molecular responses to nitrogen under field conditions is critical for our ability to further improve agricultural sustainability. Using maize (Zea mays) as a model, we have characterized the transcriptional response of plants grown under limiting and sufficient nitrogen conditions and during the recovery of nitrogen-starved plants. We show that a large percentage (approximately 7%) of the maize transcriptome is nitrogen responsive, similar to previous observations in other plant species. Furthermore, we have used statistical approaches to identify a small set of genes whose expression profiles can quantitatively assess the response of plants to varying nitrogen conditions. Using a composite gene expression scoring system, this single set of biomarker genes can accurately assess nitrogen responses independently of genotype, developmental stage, tissue type, or environment, including in plants grown under controlled environments or in the field. Importantly, the biomarker composite expression response is much more rapid and quantitative than phenotypic observations. Consequently, we have successfully used these biomarkers to monitor nitrogen status in real-time assays of field-grown maize plants under typical production conditions. Our results suggest that biomarkers have the potential to be used as agronomic tools to monitor and optimize nitrogen fertilizer usage to help achieve maximal crop yields. PMID:21980173

  19. Gene expression biomarkers provide sensitive indicators of in planta nitrogen status in maize.

    PubMed

    Yang, Xiaofeng S; Wu, Jingrui; Ziegler, Todd E; Yang, Xiao; Zayed, Adel; Rajani, M S; Zhou, Dafeng; Basra, Amarjit S; Schachtman, Daniel P; Peng, Mingsheng; Armstrong, Charles L; Caldo, Rico A; Morrell, James A; Lacy, Michelle; Staub, Jeffrey M

    2011-12-01

    Over the last several decades, increased agricultural production has been driven by improved agronomic practices and a dramatic increase in the use of nitrogen-containing fertilizers to maximize the yield potential of crops. To reduce input costs and to minimize the potential environmental impacts of nitrogen fertilizer that has been used to optimize yield, an increased understanding of the molecular responses to nitrogen under field conditions is critical for our ability to further improve agricultural sustainability. Using maize (Zea mays) as a model, we have characterized the transcriptional response of plants grown under limiting and sufficient nitrogen conditions and during the recovery of nitrogen-starved plants. We show that a large percentage (approximately 7%) of the maize transcriptome is nitrogen responsive, similar to previous observations in other plant species. Furthermore, we have used statistical approaches to identify a small set of genes whose expression profiles can quantitatively assess the response of plants to varying nitrogen conditions. Using a composite gene expression scoring system, this single set of biomarker genes can accurately assess nitrogen responses independently of genotype, developmental stage, tissue type, or environment, including in plants grown under controlled environments or in the field. Importantly, the biomarker composite expression response is much more rapid and quantitative than phenotypic observations. Consequently, we have successfully used these biomarkers to monitor nitrogen status in real-time assays of field-grown maize plants under typical production conditions. Our results suggest that biomarkers have the potential to be used as agronomic tools to monitor and optimize nitrogen fertilizer usage to help achieve maximal crop yields.

  20. Analysis of the 5′ untranslated region (5′UTR) of the alcohol oxidase 1 (AOX1) gene in recombinant protein expression in Pichia pastoris

    PubMed Central

    Staley, Chris A.; Huang, Amy; Nattestad, Maria; Oshiro, Kristin T.; Ray, Laura E.; Mulye, Tejas; Li, Zhiguo Harry; Le, Thu; Stephens, Justin J.; Gomez, Seth R.; Moy, Allison D.; Nguyen, Jackson C.; Franz, Andreas H.; Lin-Cereghino, Joan; Lin-Cereghino, Geoff P.

    2012-01-01

    Pichia pastoris is a methylotrophic yeast that has been genetically engineered to express over one thousand heterologous proteins valued for industrial, pharmaceutical and basic research purposes. In most cases, the 5′ untranslated region (UTR) of the alcohol oxidase 1 (AOX1) gene is fused to the coding sequence of the recombinant gene for protein expression in this yeast. Because the effect of the AOX1 5′UTR on protein expression is not known, site-directed mutagenesis was performed in order to decrease or increase the length of this region. Both of these types of changes were shown to affect translational efficiency, not transcript stability. While increasing the length of the 5′UTR clearly decreased expression of a β-galactosidase reporter in a proportional manner, a deletion analysis demonstrated that the AOX1 5′UTR contains a complex mixture of both positive and negative cis-acting elements, suggesting that the construction of a synthetic 5′UTR optimized for a higher level of expression may be challenging. PMID:22285974

  1. The Proximity of Ribosomal Protein Genes to oriC Enhances Vibrio cholerae Fitness in the Absence of Multifork Replication.

    PubMed

    Soler-Bistué, Alfonso; Timmermans, Michaël; Mazel, Didier

    2017-02-28

    Recent works suggest that bacterial gene order links chromosome structure to cell homeostasis. Comparative genomics showed that, in fast-growing bacteria, ribosomal protein genes (RP) locate near the replication origin ( oriC ). We recently showed that Vibrio cholerae employs this positional bias as a growth optimization strategy: under fast-growth conditions, multifork replication increases RP dosage and expression. However, RP location may provide advantages in a dosage-independent manner: for example, the physical proximity of the many ribosomal components, in the context of a crowded cytoplasm, may favor ribosome biogenesis. To uncover putative dosage-independent effects, we studied isogenic V. cholerae derivatives in which the major RP locus, S10-spc-α (S10), was relocated to alternative genomic positions. When bacteria grew fast, bacterial fitness was reduced according to the S10 relative distance to oriC The growth of wild-type V. cholerae could not be improved by additional copies of the locus, suggesting a physiologically optimized genomic location. Slow growth is expected to uncouple RP position from dosage, since multifork replication does not occur. Under these conditions, we detected a fitness impairment when S10 was far from oriC Deep sequencing followed by marker frequency analysis in the absence of multifork replication revealed an up to 30% S10 dosage reduction associated with its relocation that closely correlated with fitness alterations. Hence, the impact of S10 location goes beyond a growth optimization strategy during feast periods. RP location may be important during the whole life cycle of this pathogen. IMPORTANCE The role of gene order within the bacterial chromosome is poorly understood. In fast growers, the location of genes linked with the expression of genetic information (i.e., transcription and translation) is biased toward oriC It was proposed that the location of these genes helps to maximize their expression by recruiting multifork replication during fast growth. Our results show that such genomic positioning impacts cell fitness beyond fast-growth conditions, probably across the whole life cycle of fast growers. Thus, the genomic position of key highly expressed genes, such as RP, was finely tuned during the evolution of fast-growing bacteria and may also be important in slow growers. In the near future, many more genes whose genomic position impacts bacterial phenotype will be described. These studies will contribute to discovery the rules of genome organization and application of them for the design of synthetic chromosomes and the creation of artificial life forms. Copyright © 2017 Soler-Bistué et al.

  2. Optimization of Streptomyces bacteriophage phi C31 integrase system to prevent post integrative gene silencing in pulmonary type II cells.

    PubMed

    Aneja, Manish Kumar; Geiger, Johannes; Imker, Rabea; Uzgun, Senta; Kormann, Michael; Hasenpusch, Guenther; Maucksch, Christof; Rudolph, Carsten

    2009-12-31

    phi C31 integrase has emerged as a potent tool for achieving long-term gene expression in different tissues. The present study aimed at optimizing elements of phi C31 integrase system for alveolar type II cells. Luciferase and beta-galactosidase activities were measured at different time points post transfection. 5-Aza-2'deoxycytidine (AZA) and trichostatin A (TSA) were used to inhibit DNA methyltransferase and histone deacetylase complex (HDAC) respectively. In A549 cells, expression of the integrase using a CMV promoter resulted in highest integrase activity, whereas in MLE12 cells, both CAG and CMV promoter were equally effective. Effect of polyA site was observed only in A549 cells, where replacement of SV40 polyA by bovine growth hormone (BGH) polyA site resulted in an enhancement of integrase activity. Addition of a C-terminal SV40 nuclear localization signal (NLS) did not result in any significant increase in integrase activity. Long-term expression studies with AZA and TSA, provided evidence for post-integrative gene silencing. In MLE12 cells, both DNA methylases and HDACs played a significant role in silencing, whereas in A549 cells, it could be attributed majorly to HDAC activity. Donor plasmids comprising cellular promoters ubiquitin B (UBB), ubiquitin C (UCC) and elongation factor 1 alpha (EF1 alpha) in an improved backbone prevented post-integrative gene silencing. In contrast to A549 and MLE12 cells, no silencing could be observed in human bronchial epithelial cells, BEAS-2B. Donor plasmid coding for murine erythropoietin under the EF1 alpha promoter when combined with phi C31 integrase resulted in higher long-term erythropoietin expression and subsequently higher hematocrit levels in mice after intravenous delivery to the lungs. These results provide evidence for cell specific post integrative gene silencing with C31 integrase and demonstrate the pivotal role of donor plasmid in long-term expression attained with this system.

  3. Differential Gene Expression of Longan Under Simulated Acid Rain Stress.

    PubMed

    Zheng, Shan; Pan, Tengfei; Ma, Cuilan; Qiu, Dongliang

    2017-05-01

    Differential gene expression profile was studied in Dimocarpus longan Lour. in response to treatments of simulated acid rain with pH 2.5, 3.5, and a control (pH 5.6) using differential display reverse transcription polymerase chain reaction (DDRT-PCR). Results showed that mRNA differential display conditions were optimized to find an expressed sequence tag (EST) related with acid rain stress. The potential encoding products had 80% similarity with a transcription initiation factor IIF of Gossypium raimondii and 81% similarity with a protein product of Theobroma cacao. This fragment is the transcription factor activated by second messenger substances in longan leaves after signal perception of acid rain.

  4. Lung tumor diagnosis and subtype discovery by gene expression profiling.

    PubMed

    Wang, Lu-yong; Tu, Zhuowen

    2006-01-01

    The optimal treatment of patients with complex diseases, such as cancers, depends on the accurate diagnosis by using a combination of clinical and histopathological data. In many scenarios, it becomes tremendously difficult because of the limitations in clinical presentation and histopathology. To accurate diagnose complex diseases, the molecular classification based on gene or protein expression profiles are indispensable for modern medicine. Moreover, many heterogeneous diseases consist of various potential subtypes in molecular basis and differ remarkably in their response to therapies. It is critical to accurate predict subgroup on disease gene expression profiles. More fundamental knowledge of the molecular basis and classification of disease could aid in the prediction of patient outcome, the informed selection of therapies, and identification of novel molecular targets for therapy. In this paper, we propose a new disease diagnostic method, probabilistic boosting tree (PB tree) method, on gene expression profiles of lung tumors. It enables accurate disease classification and subtype discovery in disease. It automatically constructs a tree in which each node combines a number of weak classifiers into a strong classifier. Also, subtype discovery is naturally embedded in the learning process. Our algorithm achieves excellent diagnostic performance, and meanwhile it is capable of detecting the disease subtype based on gene expression profile.

  5. Single-cell transcriptional analysis of taste sensory neuron pair in Caenorhabditis elegans.

    PubMed

    Takayama, Jun; Faumont, Serge; Kunitomo, Hirofumi; Lockery, Shawn R; Iino, Yuichi

    2010-01-01

    The nervous system is composed of a wide variety of neurons. A description of the transcriptional profiles of each neuron would yield enormous information about the molecular mechanisms that define morphological or functional characteristics. Here we show that RNA isolation from single neurons is feasible by using an optimized mRNA tagging method. This method extracts transcripts in the target cells by co-immunoprecipitation of the complexes of RNA and epitope-tagged poly(A) binding protein expressed specifically in the cells. With this method and genome-wide microarray, we compared the transcriptional profiles of two functionally different neurons in the main C. elegans gustatory neuron class ASE. Eight of the 13 known subtype-specific genes were successfully detected. Additionally, we identified nine novel genes including a receptor guanylyl cyclase, secreted proteins, a TRPC channel and uncharacterized genes conserved among nematodes, suggesting the two neurons are substantially different than previously thought. The expression of these novel genes was controlled by the previously known regulatory network for subtype differentiation. We also describe unique motif organization within individual gene groups classified by the expression patterns in ASE. Our study paves the way to the complete catalog of the expression profiles of individual C. elegans neurons.

  6. Microbial expression profiles in the rhizosphere of willows depend on soil contamination

    PubMed Central

    Yergeau, Etienne; Sanschagrin, Sylvie; Maynard, Christine; St-Arnaud, Marc; Greer, Charles W

    2014-01-01

    The goal of phytoremediation is to use plants to immobilize, extract or degrade organic and inorganic pollutants. In the case of organic contaminants, plants essentially act indirectly through the stimulation of rhizosphere microorganisms. A detailed understanding of the effect plants have on the activities of rhizosphere microorganisms could help optimize phytoremediation systems and enhance their use. In this study, willows were planted in contaminated and non-contaminated soils in a greenhouse, and the active microbial communities and the expression of functional genes in the rhizosphere and bulk soil were compared. Ion Torrent sequencing of 16S rRNA and Illumina sequencing of mRNA were performed. Genes related to carbon and amino-acid uptake and utilization were upregulated in the willow rhizosphere, providing indirect evidence of the compositional content of the root exudates. Related to this increased nutrient input, several microbial taxa showed a significant increase in activity in the rhizosphere. The extent of the rhizosphere stimulation varied markedly with soil contamination levels. The combined selective pressure of contaminants and rhizosphere resulted in higher expression of genes related to competition (antibiotic resistance and biofilm formation) in the contaminated rhizosphere. Genes related to hydrocarbon degradation were generally more expressed in contaminated soils, but the exact complement of genes induced was different for bulk and rhizosphere soils. Together, these results provide an unprecedented view of microbial gene expression in the plant rhizosphere during phytoremediation. PMID:24067257

  7. Geometry of the Gene Expression Space of Individual Cells

    PubMed Central

    Korem, Yael; Szekely, Pablo; Hart, Yuval; Sheftel, Hila; Hausser, Jean; Mayo, Avi; Rothenberg, Michael E.; Kalisky, Tomer; Alon, Uri

    2015-01-01

    There is a revolution in the ability to analyze gene expression of single cells in a tissue. To understand this data we must comprehend how cells are distributed in a high-dimensional gene expression space. One open question is whether cell types form discrete clusters or whether gene expression forms a continuum of states. If such a continuum exists, what is its geometry? Recent theory on evolutionary trade-offs suggests that cells that need to perform multiple tasks are arranged in a polygon or polyhedron (line, triangle, tetrahedron and so on, generally called polytopes) in gene expression space, whose vertices are the expression profiles optimal for each task. Here, we analyze single-cell data from human and mouse tissues profiled using a variety of single-cell technologies. We fit the data to shapes with different numbers of vertices, compute their statistical significance, and infer their tasks. We find cases in which single cells fill out a continuum of expression states within a polyhedron. This occurs in intestinal progenitor cells, which fill out a tetrahedron in gene expression space. The four vertices of this tetrahedron are each enriched with genes for a specific task related to stemness and early differentiation. A polyhedral continuum of states is also found in spleen dendritic cells, known to perform multiple immune tasks: cells fill out a tetrahedron whose vertices correspond to key tasks related to maturation, pathogen sensing and communication with lymphocytes. A mixture of continuum-like distributions and discrete clusters is found in other cell types, including bone marrow and differentiated intestinal crypt cells. This approach can be used to understand the geometry and biological tasks of a wide range of single-cell datasets. The present results suggest that the concept of cell type may be expanded. In addition to discreet clusters in gene-expression space, we suggest a new possibility: a continuum of states within a polyhedron, in which the vertices represent specialists at key tasks. PMID:26161936

  8. KIT gene mutations and patterns of protein expression in mucosal and acral melanoma.

    PubMed

    Abu-Abed, Suzan; Pennell, Nancy; Petrella, Teresa; Wright, Frances; Seth, Arun; Hanna, Wedad

    2012-01-01

    Recently characterized KIT (CD117) gene mutations have revealed new pathways involved in melanoma pathogenesis. In particular, certain subtypes harbor mutations similar to those observed in gastrointestinal stromal tumors, which are sensitive to treatment with tyrosine kinase inhibitors. The purpose of this study was to characterize KIT gene mutations and patterns of protein expression in mucosal and acral melanoma. Formalin-fixed, paraffin-embedded tissues were retrieved from our archives. Histologic assessment included routine hematoxylin-eosin stains and immunohistochemical staining for KIT. Genomic DNA was used for polymerase chain reaction-based amplification of exons 11 and 13. We identified 59 acral and mucosal melanoma cases, of which 78% showed variable levels of KIT expression. Sequencing of exons 11 and 13 was completed on all cases, and 4 (6.8%) mutant cases were isolated. We successfully optimized conditions for the detection of KIT mutations and showed that 8.6% of mucosal and 4.2% of acral melanoma cases at our institution harbor KIT mutations; all mutant cases showed strong, diffuse KIT protein expression. Our case series represents the first Canadian study to characterize KIT gene mutations and patterns of protein expression in acral and mucosal melanoma.

  9. Expression of the human hepatitis B virus large surface antigen gene in transgenic tomato plants.

    PubMed

    Lou, Xiao-Ming; Yao, Quan-Hong; Zhang, Zhen; Peng, Ri-He; Xiong, Ai-Sheng; Wang, Hua-Kun

    2007-04-01

    The original hepatitis B virus (HBV) large surface antigen gene was synthesized. In order to optimize the expression of this gene in tomato plants, the tobacco pathogenesis-related protein S signal peptide was fused to the 5' end of the modified gene and the sequence encoding amino acids S, E, K, D, E, and L was placed at the 3' end. The gene encoding the modified HBV large surface antigen under the control of a fruit-specific promoter was constructed and expressed in transgenic tomato plants. The expression of the antigen from transgenic plants was confirmed by PCR and reverse transcriptase PCR. Enzyme-linked immunoassays using a monoclonal antibody directed against human serum-derived HBsAg revealed that the maximal level of HBsAg was about 0.02% of the soluble protein in transgenic tomato fruit. The amount of HBsAg in mature fruits was found to be 65- to 171-fold larger than in small or medium fruits and leaf tissues. Examination of transgenic plant samples by transmission electron microscopy proved that HBsAg had been expressed and had accumulated. The HBsAg protein was capable of assembling into capsomers and virus-like particles. To our knowledge, this is the first time the HBV large surface antigen has been expressed in plants. This work suggests the possibility of producing a new alternative vaccine for human HBV.

  10. Systems genetics: a paradigm to improve discovery of candidate genes and mechanisms underlying complex traits.

    PubMed

    Feltus, F Alex

    2014-06-01

    Understanding the control of any trait optimally requires the detection of causal genes, gene interaction, and mechanism of action to discover and model the biochemical pathways underlying the expressed phenotype. Functional genomics techniques, including RNA expression profiling via microarray and high-throughput DNA sequencing, allow for the precise genome localization of biological information. Powerful genetic approaches, including quantitative trait locus (QTL) and genome-wide association study mapping, link phenotype with genome positions, yet genetics is less precise in localizing the relevant mechanistic information encoded in DNA. The coupling of salient functional genomic signals with genetically mapped positions is an appealing approach to discover meaningful gene-phenotype relationships. Techniques used to define this genetic-genomic convergence comprise the field of systems genetics. This short review will address an application of systems genetics where RNA profiles are associated with genetically mapped genome positions of individual genes (eQTL mapping) or as gene sets (co-expression network modules). Both approaches can be applied for knowledge independent selection of candidate genes (and possible control mechanisms) underlying complex traits where multiple, likely unlinked, genomic regions might control specific complex traits. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  11. Optimization of culturing conditions of recombined Escherichia coli to produce umami octopeptide-containing protein.

    PubMed

    Zhang, Yin; Wei, Xiong; Lu, Zhou; Pan, Zhongli; Gou, Xinhua; Venkitasamy, Chandrasekar; Guo, Siya; Zhao, Liming

    2017-07-15

    Using synthesized peptides to verify the taste of natural peptides was probably the leading cause for tasting disputes regarding umami peptides. A novel method was developed to prepare the natural peptide which could be used to verify the taste of umami peptide. A controversial octopeptide was selected and gene engineering was used to structure its Escherichia coli. expressing vector. A response surface method was adopted to optimize the expression conditions of the recombinant protein. The results of SDS-PAGE for the recombinant protein indicated that the recombinant expression system was successfully structured. The fitting results of the response surface experiment showed that the OD 600 value was the key factor which influenced the expression of the recombinant protein. The optimal culturing process conditions predicted with the fitting model were an OD 600 value of 0.5, an IPTG concentration of 0.6mM, a culturing temperature of 28.75°C and a culturing time of 5h. Copyright © 2017 Elsevier Ltd. All rights reserved.

  12. Bayesian estimation of the discrete coefficient of determination.

    PubMed

    Chen, Ting; Braga-Neto, Ulisses M

    2016-12-01

    The discrete coefficient of determination (CoD) measures the nonlinear interaction between discrete predictor and target variables and has had far-reaching applications in Genomic Signal Processing. Previous work has addressed the inference of the discrete CoD using classical parametric and nonparametric approaches. In this paper, we introduce a Bayesian framework for the inference of the discrete CoD. We derive analytically the optimal minimum mean-square error (MMSE) CoD estimator, as well as a CoD estimator based on the Optimal Bayesian Predictor (OBP). For the latter estimator, exact expressions for its bias, variance, and root-mean-square (RMS) are given. The accuracy of both Bayesian CoD estimators with non-informative and informative priors, under fixed or random parameters, is studied via analytical and numerical approaches. We also demonstrate the application of the proposed Bayesian approach in the inference of gene regulatory networks, using gene-expression data from a previously published study on metastatic melanoma.

  13. Tetracapsuloides bryosalmonae infection affects the expression of genes involved in cellular signal transduction and iron metabolism in the kidney of the brown trout Salmo trutta.

    PubMed

    Kumar, Gokhlesh; Sarker, Subhodeep; Menanteau-Ledouble, Simon; El-Matbouli, Mansour

    2015-06-01

    Tetracapsuloides bryosalmonae is an enigmatic endoparasite which causes proliferative kidney disease in various species of salmonids in Europe and North America. The life cycle of the European strain of T. bryosalmonae generally completes in an invertebrate host freshwater bryozoan and vertebrate host brown trout (Salmo trutta) Linnaeus, 1758. Little is known about the gene expression in the kidney of brown trout during the developmental stages of T. bryosalmonae. In the present study, quantitative real-time PCR was applied to quantify the target genes of interest in the kidney of brown trout at different time points of T. bryosalmonae development. PCR primers specific for target genes were designed and optimized, and their gene expression levels were quantified in the cDNA kidney samples using SYBR Green Supermix. Expression of Rab GDP dissociation inhibitor beta, integral membrane protein 2B, NADH dehydrogenase 1 beta subcomplex subunit 6, and 26S protease regulatory subunit S10B were upregulated significantly in infected brown trout, while the expression of the ferritin M middle subunit was downregulated significantly. These results suggest that host genes involved in cellular signal transduction, proteasomal activities, including membrane transporters and cellular iron storage, are differentially upregulated or downregulated in the kidney of brown trout during parasite development. The gene expression pattern of infected renal tissue may support the development of intraluminal sporogonic stages of T. bryosalmonae in the renal tubular lumen of brown trout which may facilitate the release of viable parasite spores to transmit to the invertebrate host bryozoan.

  14. Changing expression of vertebrate immunity genes in an anthropogenic environment: a controlled experiment.

    PubMed

    Hablützel, Pascal I; Brown, Martha; Friberg, Ida M; Jackson, Joseph A

    2016-09-01

    The effect of anthropogenic environments on the function of the vertebrate immune system is a problem of general importance. For example, it relates to the increasing rates of immunologically-based disease in modern human populations and to the desirability of identifying optimal immune function in domesticated animals. Despite this importance, our present understanding is compromised by a deficit of experimental studies that make adequately matched comparisons between wild and captive vertebrates. We transferred post-larval fishes (three-spined sticklebacks), collected in the wild, to an anthropogenic (captive) environment. We then monitored, over 11 months, how the systemic expression of immunity genes changed in comparison to cohort-matched wild individuals in the originator population (total n = 299). We found that a range of innate (lyz, defbl2, il1r-like, tbk1) and adaptive (cd8a, igmh) immunity genes were up-regulated in captivity, accompanied by an increase in expression of the antioxidant enzyme, gpx4a. For some genes previously known to show seasonality in the wild, this appeared to be reduced in captive fishes. Captive fishes tended to express immunity genes, including igzh, foxp3b, lyz, defbl2, and il1r-like, more variably. Furthermore, although gene co-expression patterns (analyzed through gene-by-gene correlations and mutual information theory based networks) shared common structure in wild and captive fishes, there was also significant divergence. For one gene in particular, defbl2, high expression was associated with adverse health outcomes in captive fishes. Taken together, these results demonstrate widespread regulatory changes in the immune system in captive populations, and that the expression of immunity genes is more constrained in the wild. An increase in constitutive systemic immune activity, such as we observed here, may alter the risk of immunopathology and contribute to variance in health in vertebrate populations exposed to anthropogenic environments.

  15. Combining -Omics to Unravel the Impact of Copper Nutrition on Alfalfa (Medicago sativa) Stem Metabolism.

    PubMed

    Printz, Bruno; Guerriero, Gea; Sergeant, Kjell; Audinot, Jean-Nicolas; Guignard, Cédric; Renaut, Jenny; Lutts, Stanley; Hausman, Jean-Francois

    2016-02-01

    Copper can be found in the environment at concentrations ranging from a shortage up to the threshold of toxicity for plants, with optimal growth conditions situated in between. The plant stem plays a central role in transferring and distributing minerals, water and other solutes throughout the plant. In this study, alfalfa is exposed to different levels of copper availability, from deficiency to slight excess, and the impact on the metabolism of the stem is assessed by a non-targeted proteomics study and by the expression analysis of key genes controlling plant stem development. Under copper deficiency, the plant stem accumulates specific copper chaperones, the expression of genes involved in stem development is decreased and the concentrations of zinc and molybdenum are increased in comparison with the optimum copper level. At the optimal copper level, the expression of cell wall-related genes increases and proteins playing a role in cell wall deposition and in methionine metabolism accumulate, whereas copper excess imposes a reduction in the concentration of iron in the stem and a reduced abundance of ferritins. Secondary ion mass spectrometry (SIMS) analysis suggests a role for the apoplasm as a copper storage site in the case of copper toxicity. © The Author 2016. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists.

  16. Combining -Omics to Unravel the Impact of Copper Nutrition on Alfalfa (Medicago sativa) Stem Metabolism

    PubMed Central

    Printz, Bruno; Guerriero, Gea; Sergeant, Kjell; Audinot, Jean-Nicolas; Guignard, Cédric; Renaut, Jenny; Lutts, Stanley; Hausman, Jean-Francois

    2016-01-01

    Copper can be found in the environment at concentrations ranging from a shortage up to the threshold of toxicity for plants, with optimal growth conditions situated in between. The plant stem plays a central role in transferring and distributing minerals, water and other solutes throughout the plant. In this study, alfalfa is exposed to different levels of copper availability, from deficiency to slight excess, and the impact on the metabolism of the stem is assessed by a non-targeted proteomics study and by the expression analysis of key genes controlling plant stem development. Under copper deficiency, the plant stem accumulates specific copper chaperones, the expression of genes involved in stem development is decreased and the concentrations of zinc and molybdenum are increased in comparison with the optimum copper level. At the optimal copper level, the expression of cell wall-related genes increases and proteins playing a role in cell wall deposition and in methionine metabolism accumulate, whereas copper excess imposes a reduction in the concentration of iron in the stem and a reduced abundance of ferritins. Secondary ion mass spectrometry (SIMS) analysis suggests a role for the apoplasm as a copper storage site in the case of copper toxicity. PMID:26865661

  17. Stringent and reproducible tetracycline-regulated transgene expression by site-specific insertion at chromosomal loci with pre-characterised induction characteristics

    PubMed Central

    Brough, Rachel; Papanastasiou, Antigoni M; Porter, Andrew CG

    2007-01-01

    Background The ability to regulate transgene expression has many applications, mostly concerning the analysis of gene function. Desirable induction characteristics, such as low un-induced expression, high induced expression and limited cellular heterogeneity, can be seriously impaired by chromosomal position effects at the site of transgene integration. Many clones may therefore need to be screened before one with optimal induction characteristics is identified. Furthermore, such screens must be repeated for each new transgene investigated, and comparisons between clones with different transgenes is complicated by their different integration sites. Results To circumvent these problems we have developed a "screen and insert" strategy in which clones carrying a transgene for a fluorescent reporter are first screened for those with optimal induction characteristics. Site-specific recombination (SSR) is then be used repeatedly to insert any new transgene at the reporter transgene locus of such clones so that optimal induction characteristics are conferred upon it. Here we have tested in a human fibrosarcoma cell line (HT1080) two of many possible implementations of this approach. Clones (e.g. Rht14-10) in which a GFP reporter gene is very stringently regulated by the tetracycline (tet) transactivator (tTA) protein were first identified flow-cytometrically. Transgenes encoding luciferase, I-SceI endonuclease or Rad52 were then inserted by SSR at a LoxP site adjacent to the GFP gene resulting stringent tet-regulated transgene expression. In clone Rht14-10, increases in expression from essentially background levels (+tet) to more than 104-fold above background (-tet) were reproducibly detected after Cre-mediated insertion of either the luciferase or the I-SceI transgenes. Conclusion Although previous methods have made use of SSR to integrate transgenes at defined sites, none has effectively combined this with a pre-selection step to identify integration sites that support optimal regulatory characteristics. Rht14-10 and similar HT1080-derived clones can now be used in conjunction with a convenient delivery vector (pIN2-neoMCS), in a simple 3-step protocol leading to stringent and reproducible transgene regulation. This approach will be particularly useful for transgenes whose products are very active at low concentrations and/or for comparisons of multiple related transgenes. PMID:17493262

  18. Supervised group Lasso with applications to microarray data analysis

    PubMed Central

    Ma, Shuangge; Song, Xiao; Huang, Jian

    2007-01-01

    Background A tremendous amount of efforts have been devoted to identifying genes for diagnosis and prognosis of diseases using microarray gene expression data. It has been demonstrated that gene expression data have cluster structure, where the clusters consist of co-regulated genes which tend to have coordinated functions. However, most available statistical methods for gene selection do not take into consideration the cluster structure. Results We propose a supervised group Lasso approach that takes into account the cluster structure in gene expression data for gene selection and predictive model building. For gene expression data without biological cluster information, we first divide genes into clusters using the K-means approach and determine the optimal number of clusters using the Gap method. The supervised group Lasso consists of two steps. In the first step, we identify important genes within each cluster using the Lasso method. In the second step, we select important clusters using the group Lasso. Tuning parameters are determined using V-fold cross validation at both steps to allow for further flexibility. Prediction performance is evaluated using leave-one-out cross validation. We apply the proposed method to disease classification and survival analysis with microarray data. Conclusion We analyze four microarray data sets using the proposed approach: two cancer data sets with binary cancer occurrence as outcomes and two lymphoma data sets with survival outcomes. The results show that the proposed approach is capable of identifying a small number of influential gene clusters and important genes within those clusters, and has better prediction performance than existing methods. PMID:17316436

  19. Construction of a directed hammerhead ribozyme library: towards the identification of optimal target sites for antisense-mediated gene inhibition.

    PubMed Central

    Pierce, M L; Ruffner, D E

    1998-01-01

    Antisense-mediated gene inhibition uses short complementary DNA or RNA oligonucleotides to block expression of any mRNA of interest. A key parameter in the success or failure of an antisense therapy is the identification of a suitable target site on the chosen mRNA. Ultimately, the accessibility of the target to the antisense agent determines target suitability. Since accessibility is a function of many complex factors, it is currently beyond our ability to predict. Consequently, identification of the most effective target(s) requires examination of every site. Towards this goal, we describe a method to construct directed ribozyme libraries against any chosen mRNA. The library contains nearly equal amounts of ribozymes targeting every site on the chosen transcript and the library only contains ribozymes capable of binding to that transcript. Expression of the ribozyme library in cultured cells should allow identification of optimal target sites under natural conditions, subject to the complexities of a fully functional cell. Optimal target sites identified in this manner should be the most effective sites for therapeutic intervention. PMID:9801305

  20. Comparison of gene expression microarray data with count-based RNA measurements informs microarray interpretation.

    PubMed

    Richard, Arianne C; Lyons, Paul A; Peters, James E; Biasci, Daniele; Flint, Shaun M; Lee, James C; McKinney, Eoin F; Siegel, Richard M; Smith, Kenneth G C

    2014-08-04

    Although numerous investigations have compared gene expression microarray platforms, preprocessing methods and batch correction algorithms using constructed spike-in or dilution datasets, there remains a paucity of studies examining the properties of microarray data using diverse biological samples. Most microarray experiments seek to identify subtle differences between samples with variable background noise, a scenario poorly represented by constructed datasets. Thus, microarray users lack important information regarding the complexities introduced in real-world experimental settings. The recent development of a multiplexed, digital technology for nucleic acid measurement enables counting of individual RNA molecules without amplification and, for the first time, permits such a study. Using a set of human leukocyte subset RNA samples, we compared previously acquired microarray expression values with RNA molecule counts determined by the nCounter Analysis System (NanoString Technologies) in selected genes. We found that gene measurements across samples correlated well between the two platforms, particularly for high-variance genes, while genes deemed unexpressed by the nCounter generally had both low expression and low variance on the microarray. Confirming previous findings from spike-in and dilution datasets, this "gold-standard" comparison demonstrated signal compression that varied dramatically by expression level and, to a lesser extent, by dataset. Most importantly, examination of three different cell types revealed that noise levels differed across tissues. Microarray measurements generally correlate with relative RNA molecule counts within optimal ranges but suffer from expression-dependent accuracy bias and precision that varies across datasets. We urge microarray users to consider expression-level effects in signal interpretation and to evaluate noise properties in each dataset independently.

  1. Increased receptor-mediated gene delivery to the liver by protamine-enhanced-asialofetuin-lipoplexes.

    PubMed

    Arangoa, M A; Düzgüneş, N; Tros de Ilarduya, C

    2003-01-01

    A novel lipidic vector composed of DOTAP/Chol liposomes, asialofetuin (AF), protamine sulfate and DNA has been developed. The resulting protamine-AF-lipoplexes improved significantly the levels of gene expression in cultured cells and in the liver upon i.v. administration. Lipoplexes containing the optimal amount of AF (1 microg/microg DNA) showed a 16-fold higher transfection activity in HepG2 cells than non-targeted (plain) complexes. The uptake by cells having asialoglycoprotein receptors (ASGPr) on their plasma membrane was decreased by the addition of free AF, indicating that AF-lipoplexes were taken up specifically by cells via ASGPr-mediated endocytosis. Results from transfections performed in cells defective in ASGPr, ie HeLa cells, confirmed this mechanism. By addition of the condensing peptide, protamine sulfate, smaller complexes were obtained, which enhanced even more the uptake of AF-complexes in HepG2 cells and in the liver. The optimal amount of protamine was 0.4 microg/mcirog DNA, and gene expression was about 5-fold over that obtained with AF-lipoplexes in the absence of the peptide, and 75-fold higher than that with plain conventional lipoplexes. Protamine-AF-lipoplexes increased by a factor of 12 luciferase gene expression in the liver of mice administered systemically via the tail vein, compared to plain complexes. In summary, our findings extend the scope of previous studies where AF-lipoplexes were used to introduce DNA into hepatocytes. The combination of targeting and protamine condensation obviated the need for partial hepatectomy, commonly required to obtain efficient gene delivery in this organ. Since protamine sulfate has been proven to be non-toxic in humans, the novel liver-specific vector described here may be useful for the delivery of clinically important genes to this organ.

  2. Evaluation of endogenous control genes for gene expression studies across multiple tissues and in the specific sets of fat- and muscle-type samples of the pig.

    PubMed

    Gu, Y R; Li, M Z; Zhang, K; Chen, L; Jiang, A A; Wang, J Y; Li, X W

    2011-08-01

    To normalize a set of quantitative real-time PCR (q-PCR) data, it is essential to determine an optimal number/set of housekeeping genes, as the abundance of housekeeping genes can vary across tissues or cells during different developmental stages, or even under certain environmental conditions. In this study, of the 20 commonly used endogenous control genes, 13, 18 and 17 genes exhibited credible stability in 56 different tissues, 10 types of adipose tissue and five types of muscle tissue, respectively. Our analysis clearly showed that three optimal housekeeping genes are adequate for an accurate normalization, which correlated well with the theoretical optimal number (r ≥ 0.94). In terms of economical and experimental feasibility, we recommend the use of the three most stable housekeeping genes for calculating the normalization factor. Based on our results, the three most stable housekeeping genes in all analysed samples (TOP2B, HSPCB and YWHAZ) are recommended for accurate normalization of q-PCR data. We also suggest that two different sets of housekeeping genes are appropriate for 10 types of adipose tissue (the HSPCB, ALDOA and GAPDH genes) and five types of muscle tissue (the TOP2B, HSPCB and YWHAZ genes), respectively. Our report will serve as a valuable reference for other studies aimed at measuring tissue-specific mRNA abundance in porcine samples. © 2011 Blackwell Verlag GmbH.

  3. Identifying Stable Reference Genes for qRT-PCR Normalisation in Gene Expression Studies of Narrow-Leafed Lupin (Lupinus angustifolius L.).

    PubMed

    Taylor, Candy M; Jost, Ricarda; Erskine, William; Nelson, Matthew N

    2016-01-01

    Quantitative Reverse Transcription PCR (qRT-PCR) is currently one of the most popular, high-throughput and sensitive technologies available for quantifying gene expression. Its accurate application depends heavily upon normalisation of gene-of-interest data with reference genes that are uniformly expressed under experimental conditions. The aim of this study was to provide the first validation of reference genes for Lupinus angustifolius (narrow-leafed lupin, a significant grain legume crop) using a selection of seven genes previously trialed as reference genes for the model legume, Medicago truncatula. In a preliminary evaluation, the seven candidate reference genes were assessed on the basis of primer specificity for their respective targeted region, PCR amplification efficiency, and ability to discriminate between cDNA and gDNA. Following this assessment, expression of the three most promising candidates [Ubiquitin C (UBC), Helicase (HEL), and Polypyrimidine tract-binding protein (PTB)] was evaluated using the NormFinder and RefFinder statistical algorithms in two narrow-leafed lupin lines, both with and without vernalisation treatment, and across seven organ types (cotyledons, stem, leaves, shoot apical meristem, flowers, pods and roots) encompassing three developmental stages. UBC was consistently identified as the most stable candidate and has sufficiently uniform expression that it may be used as a sole reference gene under the experimental conditions tested here. However, as organ type and developmental stage were associated with greater variability in relative expression, it is recommended using UBC and HEL as a pair to achieve optimal normalisation. These results highlight the importance of rigorously assessing candidate reference genes for each species across a diverse range of organs and developmental stages. With emerging technologies, such as RNAseq, and the completion of valuable transcriptome data sets, it is possible that other potentially more suitable reference genes will be identified for this species in future.

  4. Identifying Stable Reference Genes for qRT-PCR Normalisation in Gene Expression Studies of Narrow-Leafed Lupin (Lupinus angustifolius L.)

    PubMed Central

    Erskine, William; Nelson, Matthew N.

    2016-01-01

    Quantitative Reverse Transcription PCR (qRT-PCR) is currently one of the most popular, high-throughput and sensitive technologies available for quantifying gene expression. Its accurate application depends heavily upon normalisation of gene-of-interest data with reference genes that are uniformly expressed under experimental conditions. The aim of this study was to provide the first validation of reference genes for Lupinus angustifolius (narrow-leafed lupin, a significant grain legume crop) using a selection of seven genes previously trialed as reference genes for the model legume, Medicago truncatula. In a preliminary evaluation, the seven candidate reference genes were assessed on the basis of primer specificity for their respective targeted region, PCR amplification efficiency, and ability to discriminate between cDNA and gDNA. Following this assessment, expression of the three most promising candidates [Ubiquitin C (UBC), Helicase (HEL), and Polypyrimidine tract-binding protein (PTB)] was evaluated using the NormFinder and RefFinder statistical algorithms in two narrow-leafed lupin lines, both with and without vernalisation treatment, and across seven organ types (cotyledons, stem, leaves, shoot apical meristem, flowers, pods and roots) encompassing three developmental stages. UBC was consistently identified as the most stable candidate and has sufficiently uniform expression that it may be used as a sole reference gene under the experimental conditions tested here. However, as organ type and developmental stage were associated with greater variability in relative expression, it is recommended using UBC and HEL as a pair to achieve optimal normalisation. These results highlight the importance of rigorously assessing candidate reference genes for each species across a diverse range of organs and developmental stages. With emerging technologies, such as RNAseq, and the completion of valuable transcriptome data sets, it is possible that other potentially more suitable reference genes will be identified for this species in future. PMID:26872362

  5. Metabolic engineering of oleaginous yeast Yarrowia lipolytica for limonene overproduction.

    PubMed

    Cao, Xuan; Lv, Yu-Bei; Chen, Jun; Imanaka, Tadayuki; Wei, Liu-Jing; Hua, Qiang

    2016-01-01

    Limonene, a monocyclic monoterpene, is known for its using as an important precursor of many flavoring, pharmaceutical, and biodiesel products. Currently, d-limonene has been produced via fractionation from essential oils or as a byproduct of orange juice production, however, considering the increasing need for limonene and a certain amount of pesticides may exist in the limonene obtained from the citrus industry, some other methods should be explored to produce limonene. To construct the limonene synthetic pathway in Yarrowia lipolytica , two genes encoding neryl diphosphate synthase 1 (NDPS1) and limonene synthase (LS) were codon-optimized and heterologously expressed in Y. lipolytica . Furthermore, to maximize limonene production, several genes involved in the MVA pathway were overexpressed, either in different copies of the same gene or in combination. Finally with the optimized pyruvic acid and dodecane concentration in flask culture, a maximum limonene titer and content of 23.56 mg/L and 1.36 mg/g DCW were achieved in the final engineered strain Po1f-LN-051, showing approximately 226-fold increase compared with the initial yield 0.006 mg/g DCW. This is the first report on limonene biosynthesis in oleaginous yeast Y. lipolytica by heterologous expression of codon-optimized tLS and tNDPS1 genes. To our knowledge, the limonene production 23.56 mg/L, is the highest limonene production level reported in yeast. In short, we demonstrate that Y. lipolytica provides a compelling platform for the overproduction of limonene derivatives, and even other monoterpenes.

  6. Transformation of an edible crop with the pagA gene of Bacillus anthracis.

    PubMed

    Aziz, Mohammad Azhar; Sikriwal, Deepa; Singh, Samer; Jarugula, Sridhar; Kumar, P Anand; Bhatnagar, Rakesh

    2005-09-01

    Vaccination against anthrax is the most important strategy to combat the disease. This study describes a generation of edible transgenic crop expressing, functional protective antigen (PA). In vitro studies showed that the plant-expressed antigen is qualitatively similar to recombinant PA. Immunization studies in mouse animal models indicated the generation of PA-specific neutralizing antibodies and stressed the need for improving expression levels to generate higher antibody titers. Genetic engineering of a plant organelle offers immense scope for increasing levels of antigen expression. An AT-rich PA gene (pagA) coding for the 83-kDa PA molecule was thus cloned and expressed in tobacco chloroplasts. Biolistics was used for the transformation of a chloroplast genome under a set of optimized conditions. The expression of the pagA gene with 69% AT content was highly favored by an AT-rich chloroplast genome. A multifold expression level of functional PA was obtained as compared with the nuclear transgenic tobacco plants. This report describes for the first time a comprehensive study on generating transgenic plants expressing PA, which may serve as a source of an edible vaccine against anthrax. Two important achievements of expressing PA in an edible crop and use of chloroplast technology to enhance the expression levels are discussed here.

  7. Computational Investigation of Environment-Noise Interaction in Single-Cell Organisms: The Merit of Expression Stochasticity Depends on the Quality of Environmental Fluctuations.

    PubMed

    Lück, Anja; Klimmasch, Lukas; Großmann, Peter; Germerodt, Sebastian; Kaleta, Christoph

    2018-01-10

    Organisms need to adapt to changing environments and they do so by using a broad spectrum of strategies. These strategies include finding the right balance between expressing genes before or when they are needed, and adjusting the degree of noise inherent in gene expression. We investigated the interplay between different nutritional environments and the inhabiting organisms' metabolic and genetic adaptations by applying an evolutionary algorithm to an agent-based model of a concise bacterial metabolism. Our results show that constant environments and rapidly fluctuating environments produce similar adaptations in the organisms, making the predictability of the environment a major factor in determining optimal adaptation. We show that exploitation of expression noise occurs only in some types of fluctuating environment and is strongly dependent on the quality and availability of nutrients: stochasticity is generally detrimental in fluctuating environments and beneficial only at equal periods of nutrient availability and above a threshold environmental richness. Moreover, depending on the availability and nutritional value of nutrients, nutrient-dependent and stochastic expression are both strategies used to deal with environmental changes. Overall, we comprehensively characterize the interplay between the quality and periodicity of an environment and the resulting optimal deterministic and stochastic regulation strategies of nutrient-catabolizing pathways.

  8. Genetic engineering with T cell receptors.

    PubMed

    Zhang, Ling; Morgan, Richard A

    2012-06-01

    In the past two decades, human gene transfer research has been translated from a laboratory technology to clinical evaluation. The success of adoptive transfer of tumor-reactive lymphocytes to treat the patients with metastatic melanoma has led to new strategies to redirect normal T cells to recognize tumor antigens by genetic engineering with tumor antigen-specific T cell receptor (TCR) genes. This new strategy can generate large numbers of defined antigen-specific cells for therapeutic application. Much progress has been made to TCR gene transfer systems by optimizing gene expression and gene transfer protocols. Vector and protein modifications have enabled excellent expression of introduced TCR chains in human lymphocytes with reduced mis-pairing between the introduced and endogenous TCR chains. Initial clinical studies have demonstrated that TCR gene-engineered T cells could mediate tumor regression in vivo. In this review, we discuss the progress and prospects of TCR gene-engineered T cells as a therapeutic strategy for treating patients with melanoma and other cancers. Published by Elsevier B.V.

  9. Delivery of gene silencing agents for breast cancer therapy

    PubMed Central

    2013-01-01

    The discovery of RNA interference has opened the door for the development of a new class of cancer therapeutics. Small inhibitory RNA oligos are being designed to specifically suppress expression of proteins that are traditionally considered nondruggable, and microRNAs are being evaluated to exert broad control of gene expression for inhibition of tumor growth. Since most naked molecules are not optimized for in vivo applications, the gene silencing agents need to be packaged into delivery vehicles in order to reach the target tissues as their destinations. Thus, the selection of the right delivery vehicles serves as a crucial step in the development of cancer therapeutics. The current review summarizes the status of gene silencing agents in breast cancer and recent development of candidate cancer drugs in clinical trials. Nanotechnology-based delivery vectors for the formulation and packaging of gene silencing agents are also described. PMID:23659575

  10. Reference gene selection for quantitative gene expression studies during biological invasions: A test on multiple genes and tissues in a model ascidian Ciona savignyi.

    PubMed

    Huang, Xuena; Gao, Yangchun; Jiang, Bei; Zhou, Zunchun; Zhan, Aibin

    2016-01-15

    As invasive species have successfully colonized a wide range of dramatically different local environments, they offer a good opportunity to study interactions between species and rapidly changing environments. Gene expression represents one of the primary and crucial mechanisms for rapid adaptation to local environments. Here, we aim to select reference genes for quantitative gene expression analysis based on quantitative Real-Time PCR (qRT-PCR) for a model invasive ascidian, Ciona savignyi. We analyzed the stability of ten candidate reference genes in three tissues (siphon, pharynx and intestine) under two key environmental stresses (temperature and salinity) in the marine realm based on three programs (geNorm, NormFinder and delta Ct method). Our results demonstrated only minor difference for stability rankings among the three methods. The use of different single reference gene might influence the data interpretation, while multiple reference genes could minimize possible errors. Therefore, reference gene combinations were recommended for different tissues - the optimal reference gene combination for siphon was RPS15 and RPL17 under temperature stress, and RPL17, UBQ and TubA under salinity treatment; for pharynx, TubB, TubA and RPL17 were the most stable genes under temperature stress, while TubB, TubA and UBQ were the best under salinity stress; for intestine, UBQ, RPS15 and RPL17 were the most reliable reference genes under both treatments. Our results suggest that the necessity of selection and test of reference genes for different tissues under varying environmental stresses. The results obtained here are expected to reveal mechanisms of gene expression-mediated invasion success using C. savignyi as a model species. Copyright © 2015 Elsevier B.V. All rights reserved.

  11. Selection of housekeeping genes for gene expression studies in the adult rat submandibular gland under normal, inflamed, atrophic and regenerative states

    PubMed Central

    Silver, Nicholas; Cotroneo, Emanuele; Proctor, Gordon; Osailan, Samira; Paterson, Katherine L; Carpenter, Guy H

    2008-01-01

    Background Real-time PCR is a reliable tool with which to measure mRNA transcripts, and provides valuable information on gene expression profiles. Endogenous controls such as housekeeping genes are used to normalise mRNA levels between samples for sensitive comparisons of mRNA transcription. Selection of the most stable control gene(s) is therefore critical for the reliable interpretation of gene expression data. For the purpose of this study, 7 commonly used housekeeping genes were investigated in salivary submandibular glands under normal, inflamed, atrophic and regenerative states. Results The program NormFinder identified the suitability of HPRT to use as a single gene for normalisation within the normal, inflamed and regenerative states, and GAPDH in the atrophic state. For normalisation to multiple housekeeping genes, for each individual state, the optimal number of housekeeping genes as given by geNorm was: ACTB/UBC in the normal, ACTB/YWHAZ in the inflamed, ACTB/HPRT in the atrophic and ACTB/GAPDH in the regenerative state. The most stable housekeeping gene identified between states (compared to normal) was UBC. However, ACTB, identified as one of the most stably expressed genes within states, was found to be one of the most variable between states. Furthermore we demonstrated that normalising between states to ACTB, rather than UBC, introduced an approximately 3 fold magnitude of error. Conclusion Using NormFinder, our studies demonstrated the suitability of HPRT to use as a single gene for normalisation within the normal, inflamed and regenerative groups and GAPDH in the atrophic group. However, if normalising to multiple housekeeping genes, we recommend normalising to those identified by geNorm. For normalisation across the physiological states, we recommend the use of UBC. PMID:18637167

  12. High content analysis platform for optimization of lipid mediated CRISPR-Cas9 delivery strategies in human cells.

    PubMed

    Steyer, Benjamin; Carlson-Stevermer, Jared; Angenent-Mari, Nicolas; Khalil, Andrew; Harkness, Ty; Saha, Krishanu

    2016-04-01

    Non-viral gene-editing of human cells using the CRISPR-Cas9 system requires optimized delivery of multiple components. Both the Cas9 endonuclease and a single guide RNA, that defines the genomic target, need to be present and co-localized within the nucleus for efficient gene-editing to occur. This work describes a new high-throughput screening platform for the optimization of CRISPR-Cas9 delivery strategies. By exploiting high content image analysis and microcontact printed plates, multi-parametric gene-editing outcome data from hundreds to thousands of isolated cell populations can be screened simultaneously. Employing this platform, we systematically screened four commercially available cationic lipid transfection materials with a range of RNAs encoding the CRISPR-Cas9 system. Analysis of Cas9 expression and editing of a fluorescent mCherry reporter transgene within human embryonic kidney cells was monitored over several days after transfection. Design of experiments analysis enabled rigorous evaluation of delivery materials and RNA concentration conditions. The results of this analysis indicated that the concentration and identity of transfection material have significantly greater effect on gene-editing than ratio or total amount of RNA. Cell subpopulation analysis on microcontact printed plates, further revealed that low cell number and high Cas9 expression, 24h after CRISPR-Cas9 delivery, were strong predictors of gene-editing outcomes. These results suggest design principles for the development of materials and transfection strategies with lipid-based materials. This platform could be applied to rapidly optimize materials for gene-editing in a variety of cell/tissue types in order to advance genomic medicine, regenerative biology and drug discovery. CRISPR-Cas9 is a new gene-editing technology for "genome surgery" that is anticipated to treat genetic diseases. This technology uses multiple components of the Cas9 system to cut out disease-causing mutations in the human genome and precisely suture in therapeutic sequences. Biomaterials based delivery strategies could help transition these technologies to the clinic. The design space for materials based delivery strategies is vast and optimization is essential to ensuring the safety and efficacy of these treatments. Therefore, new methods are required to rapidly and systematically screen gene-editing efficacy in human cells. This work utilizes an innovative platform to generate and screen many formulations of synthetic biomaterials and components of the CRISPR-Cas9 system in parallel. On this platform, we watch genome surgery in action using high content image analysis. These capabilities enabled us to identify formulation parameters for Cas9-material complexes that can optimize gene-editing in a specific human cell type. Copyright © 2015 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.

  13. Comprehensive analysis of transcriptome variation uncovers known and novel driver events in T-cell acute lymphoblastic leukemia.

    PubMed

    Atak, Zeynep Kalender; Gianfelici, Valentina; Hulselmans, Gert; De Keersmaecker, Kim; Devasia, Arun George; Geerdens, Ellen; Mentens, Nicole; Chiaretti, Sabina; Durinck, Kaat; Uyttebroeck, Anne; Vandenberghe, Peter; Wlodarska, Iwona; Cloos, Jacqueline; Foà, Robin; Speleman, Frank; Cools, Jan; Aerts, Stein

    2013-01-01

    RNA-seq is a promising technology to re-sequence protein coding genes for the identification of single nucleotide variants (SNV), while simultaneously obtaining information on structural variations and gene expression perturbations. We asked whether RNA-seq is suitable for the detection of driver mutations in T-cell acute lymphoblastic leukemia (T-ALL). These leukemias are caused by a combination of gene fusions, over-expression of transcription factors and cooperative point mutations in oncogenes and tumor suppressor genes. We analyzed 31 T-ALL patient samples and 18 T-ALL cell lines by high-coverage paired-end RNA-seq. First, we optimized the detection of SNVs in RNA-seq data by comparing the results with exome re-sequencing data. We identified known driver genes with recurrent protein altering variations, as well as several new candidates including H3F3A, PTK2B, and STAT5B. Next, we determined accurate gene expression levels from the RNA-seq data through normalizations and batch effect removal, and used these to classify patients into T-ALL subtypes. Finally, we detected gene fusions, of which several can explain the over-expression of key driver genes such as TLX1, PLAG1, LMO1, or NKX2-1; and others result in novel fusion transcripts encoding activated kinases (SSBP2-FER and TPM3-JAK2) or involving MLLT10. In conclusion, we present novel analysis pipelines for variant calling, variant filtering, and expression normalization on RNA-seq data, and successfully applied these for the detection of translocations, point mutations, INDELs, exon-skipping events, and expression perturbations in T-ALL.

  14. The expression of proinflammatory genes in epidermal keratinocytes is regulated by hydration status.

    PubMed

    Xu, Wei; Jia, Shengxian; Xie, Ping; Zhong, Aimei; Galiano, Robert D; Mustoe, Thomas A; Hong, Seok J

    2014-04-01

    Mucosal wounds heal more rapidly, exhibit less inflammation, and are associated with minimal scarring when compared with equivalent cutaneous wounds. We previously demonstrated that cutaneous epithelium exhibits an exaggerated response to injury compared with mucosal epithelium. We hypothesized that treatment of injured skin with a semiocclusive dressing preserves the hydration of the skin and results in a wound healing phenotype that more closely resembles that of mucosa. Here we explored whether changes in hydration status alter epidermal gene expression patterns in rabbit partial-thickness incisional wounds. Using microarray studies on injured epidermis, we showed that global gene expression patterns in highly occluded versus non-occluded wounds are distinct. Many genes including IL-1β, IL-8, TNF-α (tumor necrosis factor-α), and COX-2 (cyclooxygenase 2) are upregulated in non-occluded wounds compared with highly occluded wounds. In addition, decreased levels of hydration resulted in an increased expression of proinflammatory genes in human ex vivo skin culture (HESC) and stratified keratinocytes. Hierarchical analysis of genes using RNA interference showed that both TNF-α and IL-1β regulate the expression of IL-8 through independent pathways in response to reduced hydration. Furthermore, both gene knockdown and pharmacological inhibition studies showed that COX-2 mediates the TNF-α/IL-8 pathway by increasing the production of prostaglandin E2 (PGE2). IL-8 in turn controls the production of matrix metalloproteinase-9 in keratinocytes. Our data show that hydration status directly affects the expression of inflammatory signaling in the epidermis. The identification of genes involved in the epithelial hydration pathway provides an opportunity to develop strategies to reduce scarring and optimize wound healing.

  15. Preferential expression and immunogenicity of HIV-1 Tat fusion protein expressed in tomato plant.

    PubMed

    Cueno, Marni E; Hibi, Yurina; Karamatsu, Katsuo; Yasutomi, Yasuhiro; Imai, Kenichi; Laurena, Antonio C; Okamoto, Takashi

    2010-10-01

    HIV-1 Tat plays a major role in viral replication and is essential for AIDS development making it an ideal vaccine target providing that both humoral and cellular immune responses are induced. Plant-based antigen production, due to its cheaper cost, appears ideal for vaccine production. In this study, we created a plant-optimized tat and mutant (Cys30Ala/Lys41Ala) tat (mtat) gene and ligated each into a pBI121 expression vector with a stop codon and a gusA gene positioned immediately downstream. The vector construct was bombarded into tomato leaf calli and allowed to develop. We thus generated recombinant tomato plants preferentially expressing a Tat-GUS fusion protein over a Tat-only protein. In addition, plants bombarded with either tat or mtat genes showed no phenotypic difference and produced 2-4 microg Tat-GUS fusion protein per milligram soluble plant protein. Furthermore, tomato extracts intradermally inoculated into mice were found to induce a humoral and, most importantly, cellular immunity.

  16. [Correlation of codon biases and potential secondary structures with mRNA translation efficiency in unicellular organisms].

    PubMed

    Vladimirov, N V; Likhoshvaĭ, V A; Matushkin, Iu G

    2007-01-01

    Gene expression is known to correlate with degree of codon bias in many unicellular organisms. However, such correlation is absent in some organisms. Recently we demonstrated that inverted complementary repeats within coding DNA sequence must be considered for proper estimation of translation efficiency, since they may form secondary structures that obstruct ribosome movement. We have developed a program for estimation of potential coding DNA sequence expression in defined unicellular organism using its genome sequence. The program computes elongation efficiency index. Computation is based on estimation of coding DNA sequence elongation efficiency, taking into account three key factors: codon bias, average number of inverted complementary repeats, and free energy of potential stem-loop structures formed by the repeats. The influence of these factors on translation is numerically estimated. An optimal proportion of these factors is computed for each organism individually. Quantitative translational characteristics of 384 unicellular organisms (351 bacteria, 28 archaea, 5 eukaryota) have been computed using their annotated genomes from NCBI GenBank. Five potential evolutionary strategies of translational optimization have been determined among studied organisms. A considerable difference of preferred translational strategies between Bacteria and Archaea has been revealed. Significant correlations between elongation efficiency index and gene expression levels have been shown for two organisms (S. cerevisiae and H. pylori) using available microarray data. The proposed method allows to estimate numerically the coding DNA sequence translation efficiency and to optimize nucleotide composition of heterologous genes in unicellular organisms. http://www.mgs.bionet.nsc.ru/mgs/programs/eei-calculator/.

  17. Quantitative ‘Omics Analyses of Medium Chain Length Polyhydroxyalkanaote Metabolism in Pseudomonas putida LS46 Cultured with Waste Glycerol and Waste Fatty Acids

    PubMed Central

    Fu, Jilagamazhi; Sharma, Parveen; Spicer, Vic; Krokhin, Oleg V.; Zhang, Xiangli; Fristensky, Brian; Cicek, Nazim; Sparling, Richard; Levin, David. B.

    2015-01-01

    Transcriptomes and proteomes of Pseudomonas putida LS46 cultured with biodiesel-derived waste glycerol or waste free fatty acids, as sole carbon sources, were compared under conditions that were either permissive or non-permissive for synthesis of medium chain length polyhydroxyalkanoates (mcl-PHA). The objectives of this study were to elucidate mechanisms that influence activation of biopolymer synthesis, intra-cellular accumulation, and monomer composition, and determine if these were physiologically specific to the carbon sources used for growth of P. putida LS46. Active mcl-PHA synthesis by P. putida LS46 was associated with high expression levels of key mcl-PHA biosynthesis genes and/or gene products including monomer-supplying proteins, PHA synthases, and granule-associated proteins. ‘Omics data suggested that expression of these genes were regulated by different genetic mechanisms in P. putida LS46 cells in different physiological states, when cultured on the two waste carbon sources. Optimal polymer production by P. putida LS46 was primarily limited by less efficient glycerol metabolism during mcl-PHA synthesis on waste glycerol. Mapping the ‘Omics data to the mcl-PHA biosynthetic pathway revealed significant variations in gene expression, primarily involved in: 1) glycerol transportation; 2) enzymatic reactions that recycle reducing equivalents and produce key mcl-PHA biosynthesis pathway intermediates (e.g. NADH/NADPH, acetyl-CoA). Active synthesis of mcl-PHAs was observed during exponential phase in cultures with waste free fatty acids, and was associated with the fatty acid beta-oxidation pathway. A putative Thioesterase in the beta-oxidation pathway that may regulate the level of fatty acid beta-oxidation intermediates, and thus carbon flux to mcl-PHA biosynthesis, was highly up-regulated. Finally, the data suggested that differences in expression of selected fatty acid metabolism and mcl-PHA monomer-supplying enzymes may play a role in determining the monomer composition of mcl-PHA polymers. Understanding the relationships between genome content, gene and gene product expression, and how these factors influence polymer synthesis, will aid in optimization of mcl-PHA production by P. putida LS46 using biodiesel waste streams. PMID:26544181

  18. Learning Biological Networks via Bootstrapping with Optimized GO-based Gene Similarity

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Taylor, Ronald C.; Sanfilippo, Antonio P.; McDermott, Jason E.

    2010-08-02

    Microarray gene expression data provide a unique information resource for learning biological networks using "reverse engineering" methods. However, there are a variety of cases in which we know which genes are involved in a given pathology of interest, but we do not have enough experimental evidence to support the use of fully-supervised/reverse-engineering learning methods. In this paper, we explore a novel semi-supervised approach in which biological networks are learned from a reference list of genes and a partial set of links for these genes extracted automatically from PubMed abstracts, using a knowledge-driven bootstrapping algorithm. We show how new relevant linksmore » across genes can be iteratively derived using a gene similarity measure based on the Gene Ontology that is optimized on the input network at each iteration. We describe an application of this approach to the TGFB pathway as a case study and show how the ensuing results prove the feasibility of the approach as an alternate or complementary technique to fully supervised methods.« less

  19. Fast and robust group-wise eQTL mapping using sparse graphical models.

    PubMed

    Cheng, Wei; Shi, Yu; Zhang, Xiang; Wang, Wei

    2015-01-16

    Genome-wide expression quantitative trait loci (eQTL) studies have emerged as a powerful tool to understand the genetic basis of gene expression and complex traits. The traditional eQTL methods focus on testing the associations between individual single-nucleotide polymorphisms (SNPs) and gene expression traits. A major drawback of this approach is that it cannot model the joint effect of a set of SNPs on a set of genes, which may correspond to hidden biological pathways. We introduce a new approach to identify novel group-wise associations between sets of SNPs and sets of genes. Such associations are captured by hidden variables connecting SNPs and genes. Our model is a linear-Gaussian model and uses two types of hidden variables. One captures the set associations between SNPs and genes, and the other captures confounders. We develop an efficient optimization procedure which makes this approach suitable for large scale studies. Extensive experimental evaluations on both simulated and real datasets demonstrate that the proposed methods can effectively capture both individual and group-wise signals that cannot be identified by the state-of-the-art eQTL mapping methods. Considering group-wise associations significantly improves the accuracy of eQTL mapping, and the successful multi-layer regression model opens a new approach to understand how multiple SNPs interact with each other to jointly affect the expression level of a group of genes.

  20. paraGSEA: a scalable approach for large-scale gene expression profiling

    PubMed Central

    Peng, Shaoliang; Yang, Shunyun

    2017-01-01

    Abstract More studies have been conducted using gene expression similarity to identify functional connections among genes, diseases and drugs. Gene Set Enrichment Analysis (GSEA) is a powerful analytical method for interpreting gene expression data. However, due to its enormous computational overhead in the estimation of significance level step and multiple hypothesis testing step, the computation scalability and efficiency are poor on large-scale datasets. We proposed paraGSEA for efficient large-scale transcriptome data analysis. By optimization, the overall time complexity of paraGSEA is reduced from O(mn) to O(m+n), where m is the length of the gene sets and n is the length of the gene expression profiles, which contributes more than 100-fold increase in performance compared with other popular GSEA implementations such as GSEA-P, SAM-GS and GSEA2. By further parallelization, a near-linear speed-up is gained on both workstations and clusters in an efficient manner with high scalability and performance on large-scale datasets. The analysis time of whole LINCS phase I dataset (GSE92742) was reduced to nearly half hour on a 1000 node cluster on Tianhe-2, or within 120 hours on a 96-core workstation. The source code of paraGSEA is licensed under the GPLv3 and available at http://github.com/ysycloud/paraGSEA. PMID:28973463

  1. Reconstructing Genetic Regulatory Networks Using Two-Step Algorithms with the Differential Equation Models of Neural Networks.

    PubMed

    Chen, Chi-Kan

    2017-07-26

    The identification of genetic regulatory networks (GRNs) provides insights into complex cellular processes. A class of recurrent neural networks (RNNs) captures the dynamics of GRN. Algorithms combining the RNN and machine learning schemes were proposed to reconstruct small-scale GRNs using gene expression time series. We present new GRN reconstruction methods with neural networks. The RNN is extended to a class of recurrent multilayer perceptrons (RMLPs) with latent nodes. Our methods contain two steps: the edge rank assignment step and the network construction step. The former assigns ranks to all possible edges by a recursive procedure based on the estimated weights of wires of RNN/RMLP (RE RNN /RE RMLP ), and the latter constructs a network consisting of top-ranked edges under which the optimized RNN simulates the gene expression time series. The particle swarm optimization (PSO) is applied to optimize the parameters of RNNs and RMLPs in a two-step algorithm. The proposed RE RNN -RNN and RE RMLP -RNN algorithms are tested on synthetic and experimental gene expression time series of small GRNs of about 10 genes. The experimental time series are from the studies of yeast cell cycle regulated genes and E. coli DNA repair genes. The unstable estimation of RNN using experimental time series having limited data points can lead to fairly arbitrary predicted GRNs. Our methods incorporate RNN and RMLP into a two-step structure learning procedure. Results show that the RE RMLP using the RMLP with a suitable number of latent nodes to reduce the parameter dimension often result in more accurate edge ranks than the RE RNN using the regularized RNN on short simulated time series. Combining by a weighted majority voting rule the networks derived by the RE RMLP -RNN using different numbers of latent nodes in step one to infer the GRN, the method performs consistently and outperforms published algorithms for GRN reconstruction on most benchmark time series. The framework of two-step algorithms can potentially incorporate with different nonlinear differential equation models to reconstruct the GRN.

  2. Two-pass imputation algorithm for missing value estimation in gene expression time series.

    PubMed

    Tsiporkova, Elena; Boeva, Veselka

    2007-10-01

    Gene expression microarray experiments frequently generate datasets with multiple values missing. However, most of the analysis, mining, and classification methods for gene expression data require a complete matrix of gene array values. Therefore, the accurate estimation of missing values in such datasets has been recognized as an important issue, and several imputation algorithms have already been proposed to the biological community. Most of these approaches, however, are not particularly suitable for time series expression profiles. In view of this, we propose a novel imputation algorithm, which is specially suited for the estimation of missing values in gene expression time series data. The algorithm utilizes Dynamic Time Warping (DTW) distance in order to measure the similarity between time expression profiles, and subsequently selects for each gene expression profile with missing values a dedicated set of candidate profiles for estimation. Three different DTW-based imputation (DTWimpute) algorithms have been considered: position-wise, neighborhood-wise, and two-pass imputation. These have initially been prototyped in Perl, and their accuracy has been evaluated on yeast expression time series data using several different parameter settings. The experiments have shown that the two-pass algorithm consistently outperforms, in particular for datasets with a higher level of missing entries, the neighborhood-wise and the position-wise algorithms. The performance of the two-pass DTWimpute algorithm has further been benchmarked against the weighted K-Nearest Neighbors algorithm, which is widely used in the biological community; the former algorithm has appeared superior to the latter one. Motivated by these findings, indicating clearly the added value of the DTW techniques for missing value estimation in time series data, we have built an optimized C++ implementation of the two-pass DTWimpute algorithm. The software also provides for a choice between three different initial rough imputation methods.

  3. Signature pathway expression of xylose utilization in the genetically engineered industrial yeast Saccharomyces cerevisiae.

    PubMed

    Feng, Quanzhou; Liu, Z Lewis; Weber, Scott A; Li, Shizhong

    2018-01-01

    Haploid laboratory strains of Saccharomyces cerevisiae are commonly used for genetic engineering to enable their xylose utilization but little is known about the industrial yeast which is often recognized as diploid and as well as haploid and tetraploid. Here we report three unique signature pathway expression patterns and gene interactions in the centre metabolic pathways that signify xylose utilization of genetically engineered industrial yeast S. cerevisiae NRRL Y-50463, a diploid yeast. Quantitative expression analysis revealed outstanding high levels of constitutive expression of YXI, a synthesized yeast codon-optimized xylose isomerase gene integrated into chromosome XV of strain Y-50463. Comparative expression analysis indicated that the YXI was necessary to initiate the xylose metabolic pathway along with a set of heterologous xylose transporter and utilization facilitating genes including XUT4, XUT6, XKS1 and XYL2. The highly activated transketolase and transaldolase genes TKL1, TKL2, TAL1 and NQM1 as well as their complex interactions in the non-oxidative pentose phosphate pathway branch were critical for the serial of sugar transformation to drive the metabolic flow into glycolysis for increased ethanol production. The significantly increased expression of the entire PRS gene family facilitates functions of the life cycle and biosynthesis superpathway for the yeast. The outstanding higher levels of constitutive expression of YXI and the first insight into the signature pathway expression and the gene interactions in the closely related centre metabolic pathways from the industrial yeast aid continued efforts for development of the next-generation biocatalyst. Our results further suggest the industrial yeast is a desirable delivery vehicle for new strain development for efficient lignocellulose-to-advanced biofuels production.

  4. Signature pathway expression of xylose utilization in the genetically engineered industrial yeast Saccharomyces cerevisiae

    PubMed Central

    Feng, Quanzhou; Weber, Scott A.; Li, Shizhong

    2018-01-01

    Haploid laboratory strains of Saccharomyces cerevisiae are commonly used for genetic engineering to enable their xylose utilization but little is known about the industrial yeast which is often recognized as diploid and as well as haploid and tetraploid. Here we report three unique signature pathway expression patterns and gene interactions in the centre metabolic pathways that signify xylose utilization of genetically engineered industrial yeast S. cerevisiae NRRL Y-50463, a diploid yeast. Quantitative expression analysis revealed outstanding high levels of constitutive expression of YXI, a synthesized yeast codon-optimized xylose isomerase gene integrated into chromosome XV of strain Y-50463. Comparative expression analysis indicated that the YXI was necessary to initiate the xylose metabolic pathway along with a set of heterologous xylose transporter and utilization facilitating genes including XUT4, XUT6, XKS1 and XYL2. The highly activated transketolase and transaldolase genes TKL1, TKL2, TAL1 and NQM1 as well as their complex interactions in the non-oxidative pentose phosphate pathway branch were critical for the serial of sugar transformation to drive the metabolic flow into glycolysis for increased ethanol production. The significantly increased expression of the entire PRS gene family facilitates functions of the life cycle and biosynthesis superpathway for the yeast. The outstanding higher levels of constitutive expression of YXI and the first insight into the signature pathway expression and the gene interactions in the closely related centre metabolic pathways from the industrial yeast aid continued efforts for development of the next-generation biocatalyst. Our results further suggest the industrial yeast is a desirable delivery vehicle for new strain development for efficient lignocellulose-to-advanced biofuels production. PMID:29621349

  5. Identification of normalization factors for quantitative real-time RT-PCR analysis of gene expression in Pacific abalone Haliotis discus hannai

    NASA Astrophysics Data System (ADS)

    Qiu, Reng; Sun, Boguang; Fang, Shasha; Sun, Li; Liu, Xiao

    2013-03-01

    Quantitative real-time reverse transcription-polymerase chain reaction (qRT-PCR) is widely used in studies of gene expression. In most of these studies, housekeeping genes are used as internal references without validation. To identify appropriate reference genes for qRT-PCR in Pacific abalone Haliotis discus hannai, we examined the transcription stability of six housekeeping genes in abalone tissues in the presence and absence of bacterial infection. For this purpose, abalone were infected with the bacterial pathogen Vibrio anguillarum for 12 h and 48 h. The mRNA levels of the housekeeping genes in five tissues (digestive glands, foot muscle, gill, hemocyte, and mantle) were determined by qRT-PCR. The PCR data was subsequently analyzed with the geNorm and NormFinder algorithms. The results show that in the absence of bacterial infection, elongation factor-1-alpha and beta-actin were the most stably expressed genes in all tissues, and thus are suitable as cross-tissue type normalization factors. However, we did not identify any universal reference genes post infection because the most stable genes varied between tissue types. Furthermore, for most tissues, the optimal reference genes identified by both algorithms at 12 h and 48 h post-infection differed. These results indicate that bacterial infection induced significant changes in the expression of abalone housekeeping genes in a manner that is dependent on tissue type and duration of infection. As a result, different normalization factors must be used for different tissues at different infection points.

  6. Using transcriptomics to guide lead optimization in drug discovery projects: Lessons learned from the QSTAR project.

    PubMed

    Verbist, Bie; Klambauer, Günter; Vervoort, Liesbet; Talloen, Willem; Shkedy, Ziv; Thas, Olivier; Bender, Andreas; Göhlmann, Hinrich W H; Hochreiter, Sepp

    2015-05-01

    The pharmaceutical industry is faced with steadily declining R&D efficiency which results in fewer drugs reaching the market despite increased investment. A major cause for this low efficiency is the failure of drug candidates in late-stage development owing to safety issues or previously undiscovered side-effects. We analyzed to what extent gene expression data can help to de-risk drug development in early phases by detecting the biological effects of compounds across disease areas, targets and scaffolds. For eight drug discovery projects within a global pharmaceutical company, gene expression data were informative and able to support go/no-go decisions. Our studies show that gene expression profiling can detect adverse effects of compounds, and is a valuable tool in early-stage drug discovery decision making. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.

  7. Cell-Free Optogenetic Gene Expression System.

    PubMed

    Jayaraman, Premkumar; Yeoh, Jing Wui; Jayaraman, Sudhaghar; Teh, Ai Ying; Zhang, Jingyun; Poh, Chueh Loo

    2018-04-20

    Optogenetic tools provide a new and efficient way to dynamically program gene expression with unmatched spatiotemporal precision. To date, their vast potential remains untapped in the field of cell-free synthetic biology, largely due to the lack of simple and efficient light-switchable systems. Here, to bridge the gap between cell-free systems and optogenetics, we studied our previously engineered one component-based blue light-inducible Escherichia coli promoter in a cell-free environment through experimental characterization and mathematical modeling. We achieved >10-fold dynamic expression and demonstrated rapid and reversible activation of the target gene to generate oscillatory response. The deterministic model developed was able to recapitulate the system behavior and helped to provide quantitative insights to optimize dynamic response. This in vitro optogenetic approach could be a powerful new high-throughput screening technology for rapid prototyping of complex biological networks in both space and time without the need for chemical induction.

  8. Relationship between fumonisin production and FUM gene expression in Fusarium verticillioides under different environmental conditions.

    PubMed

    Fanelli, Francesca; Iversen, Anita; Logrieco, Antonio F; Mulè, Giuseppina

    2013-01-01

    Fusarium verticillioides is the main source of fumonisins, a group of mycotoxins that can contaminate maize-based food and feed and cause diseases in humans and animals. The study of the effect of different environmental conditions on toxin production should provide information that can be used to develop strategies to minimize the risk. This study analysed the effect of temperature (15°C-35°C), water activity (a(w): 0.999-0.93), salinity (0-125 g l(-1) NaCl) and pH (5-8) on the growth and production of fumonisins B(1) (FB1), B(2) (FB2) and B(3) (FB3) and the expression of FUM1 and FUM21 in F. verticillioides. The highest growth rate was measured at 25°C, a(w) of 0.998-0.99 and 0-25 g l(-1) of NaCl. Optimal conditions for fumonisin production were 30°C, a(w) of 0.99, 25 g l(-1) of NaCl and pH 5; nevertheless, the strain showed a good adaptability and was able to produce moderate levels of fumonisins under a wide range of conditions. Gene expression mirrored fumonisin production profile under all conditions with the exception of temperature: FUM1 and FUM21 expression was highest at 15°C, while maximum fumonisin production was at 30°C. These data indicate that a post-transcriptional regulation mechanism could account for the different optimal temperatures for FUM gene expression and fumonisin production.

  9. Optimal consistency in microRNA expression analysis using reference-gene-based normalization.

    PubMed

    Wang, Xi; Gardiner, Erin J; Cairns, Murray J

    2015-05-01

    Normalization of high-throughput molecular expression profiles secures differential expression analysis between samples of different phenotypes or biological conditions, and facilitates comparison between experimental batches. While the same general principles apply to microRNA (miRNA) normalization, there is mounting evidence that global shifts in their expression patterns occur in specific circumstances, which pose a challenge for normalizing miRNA expression data. As an alternative to global normalization, which has the propensity to flatten large trends, normalization against constitutively expressed reference genes presents an advantage through their relative independence. Here we investigated the performance of reference-gene-based (RGB) normalization for differential miRNA expression analysis of microarray expression data, and compared the results with other normalization methods, including: quantile, variance stabilization, robust spline, simple scaling, rank invariant, and Loess regression. The comparative analyses were executed using miRNA expression in tissue samples derived from subjects with schizophrenia and non-psychiatric controls. We proposed a consistency criterion for evaluating methods by examining the overlapping of differentially expressed miRNAs detected using different partitions of the whole data. Based on this criterion, we found that RGB normalization generally outperformed global normalization methods. Thus we recommend the application of RGB normalization for miRNA expression data sets, and believe that this will yield a more consistent and useful readout of differentially expressed miRNAs, particularly in biological conditions characterized by large shifts in miRNA expression.

  10. Detection of MDR1 mRNA expression with optimized gold nanoparticle beacon

    NASA Astrophysics Data System (ADS)

    Zhou, Qiumei; Qian, Zhiyu; Gu, Yueqing

    2016-03-01

    MDR1 (multidrug resistance gene) mRNA expression is a promising biomarker for the prediction of doxorubicin resistance in clinic. However, the traditional technical process in clinic is complicated and cannot perform the real-time detection mRNA in living single cells. In this study, the expression of MDR1 mRNA was analyzed based on optimized gold nanoparticle beacon in tumor cells. Firstly, gold nanoparticle (AuNP) was modified by thiol-PEG, and the MDR1 beacon sequence was screened and optimized using a BLAST bioinformatics strategy. Then, optimized MDR1 molecular beacons were characterized by transmission electron microscope, UV-vis and fluorescence spectroscopies. The cytotoxicity of MDR1 molecular beacon on L-02, K562 and K562/Adr cells were investigated by MTT assay, suggesting that MDR1 molecular beacon was low inherent cytotoxicity. Dark field microscope was used to investigate the cellular uptake of hDAuNP beacon assisted with ultrasound. Finally, laser scanning confocal microscope images showed that there was a significant difference in MDR1 mRNA expression in K562 and K562/Adr cells, which was consistent with the results of q-PCR measurement. In summary, optimized MDR1 molecular beacon designed in this study is a reliable strategy for detection MDR1 mRNA expression in living tumor cells, and will be a promising strategy for in guiding patient treatment and management in individualized medication.

  11. Exploring the potential of the bacterial carotene desaturase CrtI to increase the beta-carotene content in Golden Rice.

    PubMed

    Al-Babili, Salim; Hoa, Tran Thi Cuc; Schaub, Patrick

    2006-01-01

    To increase the beta-carotene (provitamin A) content and thus the nutritional value of Golden Rice, the optimization of the enzymes employed, phytoene synthase (PSY) and the Erwinia uredovora carotene desaturase (CrtI), must be considered. CrtI was chosen for this study because this bacterial enzyme, unlike phytoene synthase, was expressed at barely detectable levels in the endosperm of the Golden Rice events investigated. The low protein amounts observed may be caused by either weak cauliflower mosaic virus 35S promoter activity in the endosperm or by inappropriate codon usage. The protein level of CrtI was increased to explore its potential for enhancing the flux of metabolites through the pathway. For this purpose, a synthetic CrtI gene with a codon usage matching that of rice storage proteins was generated. Rice plants were transformed to express the synthetic gene under the control of the endosperm-specific glutelin B1 promoter. In addition, transgenic plants expressing the original bacterial gene were generated, but the endosperm-specific glutelin B1 promoter was employed instead of the cauliflower mosaic virus 35S promoter. Independent of codon optimization, the use of the endosperm-specific promoter resulted in a large increase in bacterial desaturase production in the T(1) rice grains. However, this did not lead to a significant increase in the carotenoid content, suggesting that the bacterial enzyme is sufficiently active in rice endosperm even at very low levels and is not rate-limiting. The endosperm-specific expression of CrtI did not affect the carotenoid pattern in the leaves, which was observed upon its constitutive expression. Therefore, tissue-specific expression of CrtI represents the better option.

  12. Coherent organization in gene regulation: a study on six networks

    NASA Astrophysics Data System (ADS)

    Aral, Neşe; Kabakçıoğlu, Alkan

    2016-04-01

    Structural and dynamical fingerprints of evolutionary optimization in biological networks are still unclear. Here we analyze the dynamics of genetic regulatory networks responsible for the regulation of cell cycle and cell differentiation in three organisms or cell types each, and show that they follow a version of Hebb's rule which we have termed coherence. More precisely, we find that simultaneously expressed genes with a common target are less likely to act antagonistically at the attractors of the regulatory dynamics. We then investigate the dependence of coherence on structural parameters, such as the mean number of inputs per node and the activatory/repressory interaction ratio, as well as on dynamically determined quantities, such as the basin size and the number of expressed genes.

  13. Gene expression markers in circulating tumor cells may predict bone metastasis and response to hormonal treatment in breast cancer

    PubMed Central

    WANG, HAIYING; MOLINA, JULIAN; JIANG, JOHN; FERBER, MATTHEW; PRUTHI, SANDHYA; JATKOE, TIMOTHY; DERECHO, CARLO; RAJPUROHIT, YASHODA; ZHENG, JIAN; WANG, YIXIN

    2013-01-01

    Circulating tumor cells (CTCs) have recently attracted attention due to their potential as prognostic and predictive markers for the clinical management of metastatic breast cancer patients. The isolation of CTCs from patients may enable the molecular characterization of these cells, which may help establish a minimally invasive assay for the prediction of metastasis and further optimization of treatment. Molecular markers of proven clinical value may therefore be useful in predicting disease aggressiveness and response to treatment. In our earlier study, we identified a gene signature in breast cancer that appears to be significantly associated with bone metastasis. Among the genes that constitute this signature, trefoil factor 1 (TFF1) was identified as the most differentially expressed gene associated with bone metastasis. In this study, we investigated 25 candidate gene markers in the CTCs of metastatic breast cancer patients with different metastatic sites. The panel of the 25 markers was investigated in 80 baseline samples (first blood draw of CTCs) and 30 follow-up samples. In addition, 40 healthy blood donors (HBDs) were analyzed as controls. The assay was performed using quantitative reverse transcriptase polymerase chain reaction (qRT-PCR) with RNA extracted from CTCs captured by the CellSearch system. Our study indicated that 12 of the genes were uniquely expressed in CTCs and 10 were highly expressed in the CTCs obtained from patients compared to those obtained from HBDs. Among these genes, the expression of keratin 19 was highly correlated with the CTC count. The TFF1 expression in CTCs was a strong predictor of bone metastasis and the patients with a high expression of estrogen receptor β in CTCs exhibited a better response to hormonal treatment. Molecular characterization of these genes in CTCs may provide a better understanding of the mechanism underlying tumor metastasis and identify gene markers in CTCs for predicting disease progression and response to treatment. PMID:24649289

  14. Gene expression markers in circulating tumor cells may predict bone metastasis and response to hormonal treatment in breast cancer.

    PubMed

    Wang, Haiying; Molina, Julian; Jiang, John; Ferber, Matthew; Pruthi, Sandhya; Jatkoe, Timothy; Derecho, Carlo; Rajpurohit, Yashoda; Zheng, Jian; Wang, Yixin

    2013-11-01

    Circulating tumor cells (CTCs) have recently attracted attention due to their potential as prognostic and predictive markers for the clinical management of metastatic breast cancer patients. The isolation of CTCs from patients may enable the molecular characterization of these cells, which may help establish a minimally invasive assay for the prediction of metastasis and further optimization of treatment. Molecular markers of proven clinical value may therefore be useful in predicting disease aggressiveness and response to treatment. In our earlier study, we identified a gene signature in breast cancer that appears to be significantly associated with bone metastasis. Among the genes that constitute this signature, trefoil factor 1 (TFF1) was identified as the most differentially expressed gene associated with bone metastasis. In this study, we investigated 25 candidate gene markers in the CTCs of metastatic breast cancer patients with different metastatic sites. The panel of the 25 markers was investigated in 80 baseline samples (first blood draw of CTCs) and 30 follow-up samples. In addition, 40 healthy blood donors (HBDs) were analyzed as controls. The assay was performed using quantitative reverse transcriptase polymerase chain reaction (qRT-PCR) with RNA extracted from CTCs captured by the CellSearch system. Our study indicated that 12 of the genes were uniquely expressed in CTCs and 10 were highly expressed in the CTCs obtained from patients compared to those obtained from HBDs. Among these genes, the expression of keratin 19 was highly correlated with the CTC count. The TFF1 expression in CTCs was a strong predictor of bone metastasis and the patients with a high expression of estrogen receptor β in CTCs exhibited a better response to hormonal treatment. Molecular characterization of these genes in CTCs may provide a better understanding of the mechanism underlying tumor metastasis and identify gene markers in CTCs for predicting disease progression and response to treatment.

  15. Codon optimization of the adenoviral fiber negatively impacts structural protein expression and viral fitness

    NASA Astrophysics Data System (ADS)

    Villanueva, Eneko; Martí-Solano, Maria; Fillat, Cristina

    2016-06-01

    Codon usage adaptation of lytic viruses to their hosts is determinant for viral fitness. In this work, we analyzed the codon usage of adenoviral proteins by principal component analysis and assessed their codon adaptation to the host. We observed a general clustering of adenoviral proteins according to their function. However, there was a significant variation in the codon preference between the host-interacting fiber protein and the rest of structural late phase proteins, with a non-optimal codon usage of the fiber. To understand the impact of codon bias in the fiber, we optimized the Adenovirus-5 fiber to the codon usage of the hexon structural protein. The optimized fiber displayed increased expression in a non-viral context. However, infection with adenoviruses containing the optimized fiber resulted in decreased expression of the fiber and of wild-type structural proteins. Consequently, this led to a drastic reduction in viral release. The insertion of an exogenous optimized protein as a late gene in the adenovirus with the optimized fiber further interfered with viral fitness. These results highlight the importance of balancing codon usage in viral proteins to adequately exploit cellular resources for efficient infection and open new opportunities to regulate viral fitness for virotherapy and vaccine development.

  16. Core element characterization of Rhodococcus promoters and development of a promoter-RBS mini-pool with different activity levels for efficient gene expression.

    PubMed

    Jiao, Song; Yu, Huimin; Shen, Zhongyao

    2018-09-25

    To satisfy the urgent demand for promoter engineering that can accurately regulate the metabolic circuits and expression of specific genes in the Rhodococcus microbial platform, a promoter-ribosome binding site (RBS) coupled mini-pool with fine-tuning of different activity levels was successfully established. Transcriptome analyses of R. ruber TH revealed several representative promoters with different activity levels, e.g., Pami, Pcs, Pnh, P50sl36, PcbiM, PgroE and Pniami. β-Galactosidase (LacZ) reporter measurement demonstrated that different gene expression levels could be obtained with these natural promoters combined with an optimal RBS of ami. Further use of these promoters to overexpress the nitrile hydratase (NHase) gene with RBSami in R. ruber THdAdN produced different expression levels consistent with the transcription analyses. The -35 and -10 core elements of different promoters were further analyzed, and the conserved sequences were revealed to be TTGNNN and (T/C)GNNA(A/C)AAT. By mutating the core elements of the strong promoters, Pnh and Pami, into the above consensus sequence, two even stronger promoters, PnhM and PamiM, were obtained with 2.2-fold and 7.7-fold improvements in transcription, respectively. Integrating several strategies, including transcriptome promoter screening, -35 and -10 core element identification, core element point-mutation, RBS optimization and diverse reporter verification, a fine-tuning promoter-RBS combination mini-pool with different activity levels in Rhodococcus strains was successfully established. This development is significant for broad applications of the Rhodococcus genus as a microbial platform. Copyright © 2018 Elsevier B.V. All rights reserved.

  17. Blood cell gene expression associated with cellular stress defense is modulated by antioxidant-rich food in a randomised controlled clinical trial of male smokers.

    PubMed

    Bøhn, Siv K; Myhrstad, Mari C; Thoresen, Magne; Holden, Marit; Karlsen, Anette; Tunheim, Siv Haugen; Erlund, Iris; Svendsen, Mette; Seljeflot, Ingebjørg; Moskaug, Jan O; Duttaroy, Asim K; Laake, Petter; Arnesen, Harald; Tonstad, Serena; Collins, Andrew; Drevon, Christan A; Blomhoff, Rune

    2010-09-16

    Plant-based diets rich in fruit and vegetables can prevent development of several chronic age-related diseases. However, the mechanisms behind this protective effect are not elucidated. We have tested the hypothesis that intake of antioxidant-rich foods can affect groups of genes associated with cellular stress defence in human blood cells. NCT00520819 http://clinicaltrials.gov. In an 8-week dietary intervention study, 102 healthy male smokers were randomised to either a diet rich in various antioxidant-rich foods, a kiwifruit diet (three kiwifruits/d added to the regular diet) or a control group. Blood cell gene expression profiles were obtained from 10 randomly selected individuals of each group. Diet-induced changes on gene expression were compared to controls using a novel application of the gene set enrichment analysis (GSEA) on transcription profiles obtained using Affymetrix HG-U133-Plus 2.0 whole genome arrays. Changes were observed in the blood cell gene expression profiles in both intervention groups when compared to the control group. Groups of genes involved in regulation of cellular stress defence, such as DNA repair, apoptosis and hypoxia, were significantly upregulated (GSEA, FDR q-values < 5%) by both diets compared to the control group. Genes with common regulatory motifs for aryl hydrocarbon receptor (AhR) and AhR nuclear translocator (AhR/ARNT) were upregulated by both interventions (FDR q-values < 5%). Plasma antioxidant biomarkers (polyphenols/carotenoids) increased in both groups. The observed changes in the blood cell gene expression profiles suggest that the beneficial effects of a plant-based diet on human health may be mediated through optimization of defence processes.

  18. Development of a gene cloning system in a fast-growing and moderately thermophilic Streptomyces species and heterologous expression of Streptomyces antibiotic biosynthetic gene clusters

    PubMed Central

    2011-01-01

    Background Streptomyces species are a major source of antibiotics. They usually grow slowly at their optimal temperature and fermentation of industrial strains in a large scale often takes a long time, consuming more energy and materials than some other bacterial industrial strains (e.g., E. coli and Bacillus). Most thermophilic Streptomyces species grow fast, but no gene cloning systems have been developed in such strains. Results We report here the isolation of 41 fast-growing (about twice the rate of S. coelicolor), moderately thermophilic (growing at both 30°C and 50°C) Streptomyces strains, detection of one linear and three circular plasmids in them, and sequencing of a 6996-bp plasmid, pTSC1, from one of them. pTSC1-derived pCWH1 could replicate in both thermophilic and mesophilic Streptomyces strains. On the other hand, several Streptomyces replicons function in thermophilic Streptomyces species. By examining ten well-sporulating strains, we found two promising cloning hosts, 2C and 4F. A gene cloning system was established by using the two strains. The actinorhodin and anthramycin biosynthetic gene clusters from mesophilic S. coelicolor A3(2) and thermophilic S. refuineus were heterologously expressed in one of the hosts. Conclusions We have developed a gene cloning and expression system in a fast-growing and moderately thermophilic Streptomyces species. Although just a few plasmids and one antibiotic biosynthetic gene cluster from mesophilic Streptomyces were successfully expressed in thermophilic Streptomyces species, we expect that by utilizing thermophilic Streptomyces-specific promoters, more genes and especially antibiotic genes clusters of mesophilic Streptomyces should be heterologously expressed. PMID:22032628

  19. Translation efficiency of heterologous proteins is significantly affected by the genetic context of RBS sequences in engineered cyanobacterium Synechocystis sp. PCC 6803.

    PubMed

    Thiel, Kati; Mulaku, Edita; Dandapani, Hariharan; Nagy, Csaba; Aro, Eva-Mari; Kallio, Pauli

    2018-03-02

    Photosynthetic cyanobacteria have been studied as potential host organisms for direct solar-driven production of different carbon-based chemicals from CO 2 and water, as part of the development of sustainable future biotechnological applications. The engineering approaches, however, are still limited by the lack of comprehensive information on most optimal expression strategies and validated species-specific genetic elements which are essential for increasing the intricacy, predictability and efficiency of the systems. This study focused on the systematic evaluation of the key translational control elements, ribosome binding sites (RBS), in the cyanobacterial host Synechocystis sp. PCC 6803, with the objective of expanding the palette of tools for more rigorous engineering approaches. An expression system was established for the comparison of 13 selected RBS sequences in Synechocystis, using several alternative reporter proteins (sYFP2, codon-optimized GFPmut3 and ethylene forming enzyme) as quantitative indicators of the relative translation efficiencies. The set-up was shown to yield highly reproducible expression patterns in independent analytical series with low variation between biological replicates, thus allowing statistical comparison of the activities of the different RBSs in vivo. While the RBSs covered a relatively broad overall expression level range, the downstream gene sequence was demonstrated in a rigorous manner to have a clear impact on the resulting translational profiles. This was expected to reflect interfering sequence-specific mRNA-level interaction between the RBS and the coding region, yet correlation between potential secondary structure formation and observed translation levels could not be resolved with existing in silico prediction tools. The study expands our current understanding on the potential and limitations associated with the regulation of protein expression at translational level in engineered cyanobacteria. The acquired information can be used for selecting appropriate RBSs for optimizing over-expression constructs or multicistronic pathways in Synechocystis, while underlining the complications in predicting the activity due to gene-specific interactions which may reduce the translational efficiency for a given RBS-gene combination. Ultimately, the findings emphasize the need for additional characterized insulator sequence elements to decouple the interaction between the RBS and the coding region for future engineering approaches.

  20. Genome-wide gene expression and RNA half-life measurements allow predictions of regulation and metabolic behavior in Methanosarcina acetivorans

    DOE PAGES

    Peterson, Joseph R.; Thor, ShengShee; Kohler, Lars; ...

    2016-11-16

    Here, while a few studies on the variations in mRNA expression and half-lives measured under different growth conditions have been used to predict patterns of regulation in bacterial organisms, the extent to which this information can also play a role in defining metabolic phenotypes has yet to be examined systematically. Here we present the first comprehensive study for a model methanogen. As a result, we use expression and half-life data for the methanogen Methanosarcina acetivorans growing on fast- and slow-growth substrates to examine the regulation of its genes. Unlike Escherichia coli where only small shifts in half-lives were observed, wemore » found that most mRNA have significantly longer half-lives for slow growth on acetate compared to fast growth on methanol or trimethylamine. Interestingly, half-life shifts are not uniform across functional classes of enzymes, suggesting the existence of a selective stabilization mechanism for mRNAs. Using the transcriptomics data we determined whether transcription or degradation rate controls the change in transcript abundance. Degradation was found to control abundance for about half of the metabolic genes underscoring its role in regulating metabolism. Genes involved in half of the metabolic reactions were found to be differentially expressed among the substrates suggesting the existence of drastically different metabolic phenotypes that extend beyond just the methanogenesis pathways. By integrating expression data with an updated metabolic model of the organism (iST807) significant differences in pathway flux and production of metabolites were predicted for the three growth substrates. In conclusion, this study provides the first global picture of differential expression and half-lives for a class II methanogen, as well as provides the first evidence in a single organism that drastic genome-wide shifts in RNA half-lives can be modulated by growth substrate. We determined which genes in each metabolic pathway control the flux and classified them as regulated by transcription (e.g. transcription factor) or degradation (e.g. post-transcriptional modification). We found that more than half of genes in metabolism were controlled by degradation. Our results suggest that M. acetivorans employs extensive post-transcriptional regulation to optimize key metabolic steps, and more generally that degradation could play a much greater role in optimizing an organism’s metabolism than previously thought.« less

  1. Genome-wide gene expression and RNA half-life measurements allow predictions of regulation and metabolic behavior in Methanosarcina acetivorans

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Peterson, Joseph R.; Thor, ShengShee; Kohler, Lars

    Here, while a few studies on the variations in mRNA expression and half-lives measured under different growth conditions have been used to predict patterns of regulation in bacterial organisms, the extent to which this information can also play a role in defining metabolic phenotypes has yet to be examined systematically. Here we present the first comprehensive study for a model methanogen. As a result, we use expression and half-life data for the methanogen Methanosarcina acetivorans growing on fast- and slow-growth substrates to examine the regulation of its genes. Unlike Escherichia coli where only small shifts in half-lives were observed, wemore » found that most mRNA have significantly longer half-lives for slow growth on acetate compared to fast growth on methanol or trimethylamine. Interestingly, half-life shifts are not uniform across functional classes of enzymes, suggesting the existence of a selective stabilization mechanism for mRNAs. Using the transcriptomics data we determined whether transcription or degradation rate controls the change in transcript abundance. Degradation was found to control abundance for about half of the metabolic genes underscoring its role in regulating metabolism. Genes involved in half of the metabolic reactions were found to be differentially expressed among the substrates suggesting the existence of drastically different metabolic phenotypes that extend beyond just the methanogenesis pathways. By integrating expression data with an updated metabolic model of the organism (iST807) significant differences in pathway flux and production of metabolites were predicted for the three growth substrates. In conclusion, this study provides the first global picture of differential expression and half-lives for a class II methanogen, as well as provides the first evidence in a single organism that drastic genome-wide shifts in RNA half-lives can be modulated by growth substrate. We determined which genes in each metabolic pathway control the flux and classified them as regulated by transcription (e.g. transcription factor) or degradation (e.g. post-transcriptional modification). We found that more than half of genes in metabolism were controlled by degradation. Our results suggest that M. acetivorans employs extensive post-transcriptional regulation to optimize key metabolic steps, and more generally that degradation could play a much greater role in optimizing an organism’s metabolism than previously thought.« less

  2. Identification and validation of reference genes for normalization of gene expression analysis using qRT-PCR in Helicoverpa armigera (Lepidoptera: Noctuidae).

    PubMed

    Zhang, Songdou; An, Shiheng; Li, Zhen; Wu, Fengming; Yang, Qingpo; Liu, Yichen; Cao, Jinjun; Zhang, Huaijiang; Zhang, Qingwen; Liu, Xiaoxia

    2015-01-25

    Recent studies have focused on determining functional genes and microRNAs in the pest Helicoverpa armigera (Lepidoptera: Noctuidae). Most of these studies used quantitative real-time PCR (qRT-PCR). Suitable reference genes are necessary to normalize gene expression data of qRT-PCR. However, a comprehensive study on the reference genes in H. armigera remains lacking. Twelve candidate reference genes of H. armigera were selected and evaluated for their expression stability under different biotic and abiotic conditions. The comprehensive stability ranking of candidate reference genes was recommended by RefFinder and the optimal number of reference genes was calculated by geNorm. Two target genes, thioredoxin (TRX) and Cu/Zn superoxide dismutase (SOD), were used to validate the selection of reference genes. Results showed that the most suitable candidate combinations of reference genes were as follows: 28S and RPS15 for developmental stages; RPS15 and RPL13 for larvae tissues; EF and RPL27 for adult tissues; GAPDH, RPL27, and β-TUB for nuclear polyhedrosis virus infection; RPS15 and RPL32 for insecticide treatment; RPS15 and RPL27 for temperature treatment; and RPL32, RPS15, and RPL27 for all samples. This study not only establishes an accurate method for normalizing qRT-PCR data in H. armigera but also serve as a reference for further study on gene transcription in H. armigera and other insects. Copyright © 2014 Elsevier B.V. All rights reserved.

  3. Optimal Reference Genes for Gene Expression Normalization in Trichomonas vaginalis.

    PubMed

    dos Santos, Odelta; de Vargas Rigo, Graziela; Frasson, Amanda Piccoli; Macedo, Alexandre José; Tasca, Tiana

    2015-01-01

    Trichomonas vaginalis is the etiologic agent of trichomonosis, the most common non-viral sexually transmitted disease worldwide. This infection is associated with several health consequences, including cervical and prostate cancers and HIV acquisition. Gene expression analysis has been facilitated because of available genome sequences and large-scale transcriptomes in T. vaginalis, particularly using quantitative real-time polymerase chain reaction (qRT-PCR), one of the most used methods for molecular studies. Reference genes for normalization are crucial to ensure the accuracy of this method. However, to the best of our knowledge, a systematic validation of reference genes has not been performed for T. vaginalis. In this study, the transcripts of nine candidate reference genes were quantified using qRT-PCR under different cultivation conditions, and the stability of these genes was compared using the geNorm and NormFinder algorithms. The most stable reference genes were α-tubulin, actin and DNATopII, and, conversely, the widely used T. vaginalis reference genes GAPDH and β-tubulin were less stable. The PFOR gene was used to validate the reliability of the use of these candidate reference genes. As expected, the PFOR gene was upregulated when the trophozoites were cultivated with ferrous ammonium sulfate when the DNATopII, α-tubulin and actin genes were used as normalizing gene. By contrast, the PFOR gene was downregulated when the GAPDH gene was used as an internal control, leading to misinterpretation of the data. These results provide an important starting point for reference gene selection and gene expression analysis with qRT-PCR studies of T. vaginalis.

  4. Optimal Reference Genes for Gene Expression Normalization in Trichomonas vaginalis

    PubMed Central

    dos Santos, Odelta; de Vargas Rigo, Graziela; Frasson, Amanda Piccoli; Macedo, Alexandre José; Tasca, Tiana

    2015-01-01

    Trichomonas vaginalis is the etiologic agent of trichomonosis, the most common non-viral sexually transmitted disease worldwide. This infection is associated with several health consequences, including cervical and prostate cancers and HIV acquisition. Gene expression analysis has been facilitated because of available genome sequences and large-scale transcriptomes in T. vaginalis, particularly using quantitative real-time polymerase chain reaction (qRT-PCR), one of the most used methods for molecular studies. Reference genes for normalization are crucial to ensure the accuracy of this method. However, to the best of our knowledge, a systematic validation of reference genes has not been performed for T. vaginalis. In this study, the transcripts of nine candidate reference genes were quantified using qRT-PCR under different cultivation conditions, and the stability of these genes was compared using the geNorm and NormFinder algorithms. The most stable reference genes were α-tubulin, actin and DNATopII, and, conversely, the widely used T. vaginalis reference genes GAPDH and β-tubulin were less stable. The PFOR gene was used to validate the reliability of the use of these candidate reference genes. As expected, the PFOR gene was upregulated when the trophozoites were cultivated with ferrous ammonium sulfate when the DNATopII, α-tubulin and actin genes were used as normalizing gene. By contrast, the PFOR gene was downregulated when the GAPDH gene was used as an internal control, leading to misinterpretation of the data. These results provide an important starting point for reference gene selection and gene expression analysis with qRT-PCR studies of T. vaginalis. PMID:26393928

  5. Chemical modification: the key to clinical application of RNA interference?

    PubMed Central

    Corey, David R.

    2007-01-01

    RNA interference provides a potent and specific method for controlling gene expression in human cells. To translate this potential into a broad new family of therapeutics, it is necessary to optimize the efficacy of the RNA-based drugs. As discussed in this Review, it might be possible to achieve this optimization using chemical modifications that improve their in vivo stability, cellular delivery, biodistribution, pharmacokinetics, potency, and specificity. PMID:18060019

  6. Dynamic Visualization of Co-expression in Systems Genetics Data

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    New, Joshua Ryan; Huang, Jian; Chesler, Elissa J

    2008-01-01

    Biologists hope to address grand scientific challenges by exploring the abundance of data made available through modern microarray technology and other high-throughput techniques. The impact of this data, however, is limited unless researchers can effectively assimilate such complex information and integrate it into their daily research; interactive visualization tools are called for to support the effort. Specifically, typical studies of gene co-expression require novel visualization tools that enable the dynamic formulation and fine-tuning of hypotheses to aid the process of evaluating sensitivity of key parameters. These tools should allow biologists to develop an intuitive understanding of the structure of biologicalmore » networks and discover genes which reside in critical positions in networks and pathways. By using a graph as a universal data representation of correlation in gene expression data, our novel visualization tool employs several techniques that when used in an integrated manner provide innovative analytical capabilities. Our tool for interacting with gene co-expression data integrates techniques such as: graph layout, qualitative subgraph extraction through a novel 2D user interface, quantitative subgraph extraction using graph-theoretic algorithms or by querying an optimized b-tree, dynamic level-of-detail graph abstraction, and template-based fuzzy classification using neural networks. We demonstrate our system using a real-world workflow from a large-scale, systems genetics study of mammalian gene co-expression.« less

  7. RNA sample preparation applied to gene expression profiling for the horse biological passport.

    PubMed

    Bailly-Chouriberry, Ludovic; Baudoin, Florent; Cormant, Florence; Glavieux, Yohan; Loup, Benoit; Garcia, Patrice; Popot, Marie-Agnès; Bonnaire, Yves

    2017-09-01

    The improvement of doping control is an ongoing race. Techniques to fight doping are usually based on the direct detection of drugs or their metabolites by analytical methods such as chromatography hyphenated to mass spectrometry after ad hoc sample preparation. Nowadays, omic methods constitute an attractive development and advances have been achieved particularly by application of molecular biology tools for detection of anabolic androgenic steroids (AAS), erythropoiesis-stimulating agent (ESA), or to control human growth hormone misuses. These interesting results across different animal species have suggested that modification of gene expression offers promising new methods of improving the window of detection of banned substances by targeting their effects on blood cell gene expression. In this context, the present study describes the possibility of using a modified version of the dedicated Human IVD (in vitro Diagnostics) PAXgene® Blood RNA Kit for horse gene expression analysis in blood collected on PAXgene® tubes applied to the horse biological passport. The commercial kit was only approved for human blood samples and has required an optimization of specific technical requirements for equine blood samples. Improvements and recommendations were achieved for sample collection, storage and RNA extraction procedure. Following these developments, RNA yield and quality were demonstrated to be suitable for downstream gene expression analysis by qPCR techniques. Copyright © 2017 John Wiley & Sons, Ltd. Copyright © 2017 John Wiley & Sons, Ltd.

  8. Scoring clustering solutions by their biological relevance.

    PubMed

    Gat-Viks, I; Sharan, R; Shamir, R

    2003-12-12

    A central step in the analysis of gene expression data is the identification of groups of genes that exhibit similar expression patterns. Clustering gene expression data into homogeneous groups was shown to be instrumental in functional annotation, tissue classification, regulatory motif identification, and other applications. Although there is a rich literature on clustering algorithms for gene expression analysis, very few works addressed the systematic comparison and evaluation of clustering results. Typically, different clustering algorithms yield different clustering solutions on the same data, and there is no agreed upon guideline for choosing among them. We developed a novel statistically based method for assessing a clustering solution according to prior biological knowledge. Our method can be used to compare different clustering solutions or to optimize the parameters of a clustering algorithm. The method is based on projecting vectors of biological attributes of the clustered elements onto the real line, such that the ratio of between-groups and within-group variance estimators is maximized. The projected data are then scored using a non-parametric analysis of variance test, and the score's confidence is evaluated. We validate our approach using simulated data and show that our scoring method outperforms several extant methods, including the separation to homogeneity ratio and the silhouette measure. We apply our method to evaluate results of several clustering methods on yeast cell-cycle gene expression data. The software is available from the authors upon request.

  9. Novel molecular subtypes of serous and endometrioid ovarian cancer linked to clinical outcome.

    PubMed

    Tothill, Richard W; Tinker, Anna V; George, Joshy; Brown, Robert; Fox, Stephen B; Lade, Stephen; Johnson, Daryl S; Trivett, Melanie K; Etemadmoghadam, Dariush; Locandro, Bianca; Traficante, Nadia; Fereday, Sian; Hung, Jillian A; Chiew, Yoke-Eng; Haviv, Izhak; Gertig, Dorota; DeFazio, Anna; Bowtell, David D L

    2008-08-15

    The study aim to identify novel molecular subtypes of ovarian cancer by gene expression profiling with linkage to clinical and pathologic features. Microarray gene expression profiling was done on 285 serous and endometrioid tumors of the ovary, peritoneum, and fallopian tube. K-means clustering was applied to identify robust molecular subtypes. Statistical analysis identified differentially expressed genes, pathways, and gene ontologies. Laser capture microdissection, pathology review, and immunohistochemistry validated the array-based findings. Patient survival within k-means groups was evaluated using Cox proportional hazards models. Class prediction validated k-means groups in an independent dataset. A semisupervised survival analysis of the array data was used to compare against unsupervised clustering results. Optimal clustering of array data identified six molecular subtypes. Two subtypes represented predominantly serous low malignant potential and low-grade endometrioid subtypes, respectively. The remaining four subtypes represented higher grade and advanced stage cancers of serous and endometrioid morphology. A novel subtype of high-grade serous cancers reflected a mesenchymal cell type, characterized by overexpression of N-cadherin and P-cadherin and low expression of differentiation markers, including CA125 and MUC1. A poor prognosis subtype was defined by a reactive stroma gene expression signature, correlating with extensive desmoplasia in such samples. A similar poor prognosis signature could be found using a semisupervised analysis. Each subtype displayed distinct levels and patterns of immune cell infiltration. Class prediction identified similar subtypes in an independent ovarian dataset with similar prognostic trends. Gene expression profiling identified molecular subtypes of ovarian cancer of biological and clinical importance.

  10. Discrete Biogeography Based Optimization for Feature Selection in Molecular Signatures.

    PubMed

    Liu, Bo; Tian, Meihong; Zhang, Chunhua; Li, Xiangtao

    2015-04-01

    Biomarker discovery from high-dimensional data is a complex task in the development of efficient cancer diagnoses and classification. However, these data are usually redundant and noisy, and only a subset of them present distinct profiles for different classes of samples. Thus, selecting high discriminative genes from gene expression data has become increasingly interesting in the field of bioinformatics. In this paper, a discrete biogeography based optimization is proposed to select the good subset of informative gene relevant to the classification. In the proposed algorithm, firstly, the fisher-markov selector is used to choose fixed number of gene data. Secondly, to make biogeography based optimization suitable for the feature selection problem; discrete migration model and discrete mutation model are proposed to balance the exploration and exploitation ability. Then, discrete biogeography based optimization, as we called DBBO, is proposed by integrating discrete migration model and discrete mutation model. Finally, the DBBO method is used for feature selection, and three classifiers are used as the classifier with the 10 fold cross-validation method. In order to show the effective and efficiency of the algorithm, the proposed algorithm is tested on four breast cancer dataset benchmarks. Comparison with genetic algorithm, particle swarm optimization, differential evolution algorithm and hybrid biogeography based optimization, experimental results demonstrate that the proposed method is better or at least comparable with previous method from literature when considering the quality of the solutions obtained. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Effects of temperature acclimation on Pacific bluefin tuna (Thunnus orientalis) cardiac transcriptome.

    PubMed

    Jayasundara, Nishad; Gardner, Luke D; Block, Barbara A

    2013-11-01

    Little is known about the mechanisms underpinning thermal plasticity of vertebrate hearts. Bluefin tuna hearts offer a unique model to investigate processes underlying thermal acclimation. Their hearts, while supporting an endothermic physiology, operate at ambient temperature, and are presented with a thermal challenge when migrating to different thermal regimes. Here, we examined the molecular responses in atrial and ventricular tissues of Pacific bluefin tuna acclimated to 14°C, 20°C, and 25°C. Quantitative PCR studies showed an increase in sarcoplasmic reticulum Ca(2+) ATPase gene expression with cold acclimation and an induction of Na(+)/Ca(2+)-exchanger gene at both cold and warm temperatures. These data provide evidence for thermal plasticity of excitation-contraction coupling gene expression in bluefin tunas and indicate an increased capacity for internal Ca(2+) storage in cardiac myocytes at 14°C. Transcriptomic analysis showed profound changes in cardiac tissues with acclimation. A principal component analysis revealed that temperature effect was greatest on gene expression in warm-acclimated atrium. Overall data showed an increase in cardiac energy metabolism at 14°C, potentially compensating for cold temperature to optimize bluefin tuna performance in colder oceans. In contrast, metabolic enzyme activity and gene expression data suggest a decrease in ATP production at 25°C. Expression of genes involved in protein turnover and molecular chaperones was also decreased at 25°C. Expression of genes involved in oxidative stress response and programmed cell death suggest an increase in oxidative damage and apoptosis at 25°C, particularly in the atrium. These findings provide insights into molecular processes that may characterize cardiac phenotypes at upper thermal limits of teleosts.

  12. Circadian clock regulation of the cell cycle in the zebrafish intestine.

    PubMed

    Peyric, Elodie; Moore, Helen A; Whitmore, David

    2013-01-01

    The circadian clock controls cell proliferation in a number of healthy tissues where cell renewal and regeneration are critical for normal physiological function. The intestine is an organ that typically undergoes regular cycles of cell division, differentiation and apoptosis as part of its role in digestion and nutrient absorption. The aim of this study was to explore circadian clock regulation of cell proliferation and cell cycle gene expression in the zebrafish intestine. Here we show that the zebrafish gut contains a directly light-entrainable circadian pacemaker, which regulates the daily timing of mitosis. Furthermore, this intestinal clock controls the expression of key cell cycle regulators, such as cdc2, wee1, p21, PCNA and cdk2, but only weakly influences cyclin B1, cyclin B2 and cyclin E1 expression. Interestingly, food deprivation has little impact on circadian clock function in the gut, but dramatically reduces cell proliferation, as well as cell cycle gene expression in this tissue. Timed feeding under constant dark conditions is able to drive rhythmic expression not only of circadian clock genes, but also of several cell cycle genes, suggesting that food can entrain the clock, as well as the cell cycle in the intestine. Rather surprisingly, we found that timed feeding is critical for high amplitude rhythms in cell cycle gene expression, even when zebrafish are maintained on a light-dark cycle. Together these results suggest that the intestinal clock integrates multiple rhythmic cues, including light and food, to function optimally.

  13. Circadian Clock Regulation of the Cell Cycle in the Zebrafish Intestine

    PubMed Central

    Peyric, Elodie; Moore, Helen A.; Whitmore, David

    2013-01-01

    The circadian clock controls cell proliferation in a number of healthy tissues where cell renewal and regeneration are critical for normal physiological function. The intestine is an organ that typically undergoes regular cycles of cell division, differentiation and apoptosis as part of its role in digestion and nutrient absorption. The aim of this study was to explore circadian clock regulation of cell proliferation and cell cycle gene expression in the zebrafish intestine. Here we show that the zebrafish gut contains a directly light-entrainable circadian pacemaker, which regulates the daily timing of mitosis. Furthermore, this intestinal clock controls the expression of key cell cycle regulators, such as cdc2, wee1, p21, PCNA and cdk2, but only weakly influences cyclin B1, cyclin B2 and cyclin E1 expression. Interestingly, food deprivation has little impact on circadian clock function in the gut, but dramatically reduces cell proliferation, as well as cell cycle gene expression in this tissue. Timed feeding under constant dark conditions is able to drive rhythmic expression not only of circadian clock genes, but also of several cell cycle genes, suggesting that food can entrain the clock, as well as the cell cycle in the intestine. Rather surprisingly, we found that timed feeding is critical for high amplitude rhythms in cell cycle gene expression, even when zebrafish are maintained on a light-dark cycle. Together these results suggest that the intestinal clock integrates multiple rhythmic cues, including light and food, to function optimally. PMID:24013905

  14. Development of two bacterial artificial chromosome shuttle vectors for a recombination-based cloning and regulated expression of large genes in mammalian cells.

    PubMed

    Hong, Y K; Kim, D H; Beletskii, A; Lee, C; Memili, E; Strauss, W M

    2001-04-01

    Most conditional expression vectors designed for mammalian cells have been valuable systems for studying genes of interest by regulating their expressions. The available vectors, however, are reliable for the short-length cDNA clones and not optimal for relatively long fragments of genomic DNA or long cDNAs. Here, we report the construction of two bacterial artificial chromosome (BAC) vectors, capable of harboring large inserts and shuttling among Escherichia coli, yeast, and mammalian cells. These two vectors, pEYMT and pEYMI, contain conditional expression systems which are designed to be regulated by tetracycline and mouse interferons, respectively. To test the properties of the vectors, we cloned in both vectors the green fluorescence protein (GFP) through an in vitro ligation reaction and the 17.8-kb-long X-inactive-specific transcript (Xist) cDNA through homologous recombination in yeast. Subsequently, we characterized their regulated expression properties using real-time quantitative RT-PCR (TaqMan) and RNA-fluorescent in situ hybridization (FISH). We demonstrate that these two BAC vectors are good systems for recombination-based cloning and regulated expression of large genes in mammalian cells. Copyright 2001 Academic Press.

  15. Selection of Reliable Reference Genes for Gene Expression Studies on Rhododendron molle G. Don.

    PubMed

    Xiao, Zheng; Sun, Xiaobo; Liu, Xiaoqing; Li, Chang; He, Lisi; Chen, Shangping; Su, Jiale

    2016-01-01

    The quantitative real-time polymerase chain reaction (qRT-PCR) approach has become a widely used method to analyze expression patterns of target genes. The selection of an optimal reference gene is a prerequisite for the accurate normalization of gene expression in qRT-PCR. The present study constitutes the first systematic evaluation of potential reference genes in Rhododendron molle G. Don. Eleven candidate reference genes in different tissues and flowers at different developmental stages of R. molle were assessed using the following three software packages: GeNorm, NormFinder, and BestKeeper. The results showed that EF1- α (elongation factor 1-alpha), 18S (18s ribosomal RNA), and RPL3 (ribosomal protein L3) were the most stable reference genes in developing rhododendron flowers and, thus, in all of the tested samples, while tublin ( TUB ) was the least stable. ACT5 (actin), RPL3 , 18S , and EF1- α were found to be the top four choices for different tissues, whereas TUB was not found to favor qRT-PCR normalization in these tissues. Three stable reference genes are recommended for the normalization of qRT-PCR data in R. molle . Furthermore, the expression profiles of RmPSY (phytoene synthase) and RmPDS (phytoene dehydrogenase) were assessed using EF1- α, 18S , ACT5 , RPL3 , and their combination as internals. Similar trends were found, but these trends varied when the least stable reference gene TUB was used. The results further prove that it is necessary to validate the stability of reference genes prior to their use for normalization under different experimental conditions. This study provides useful information for reliable qRT-PCR data normalization in gene studies of R. molle .

  16. Detection of Diurnal Variation of Tomato Transcriptome through the Molecular Timetable Method in a Sunlight-Type Plant Factory.

    PubMed

    Higashi, Takanobu; Tanigaki, Yusuke; Takayama, Kotaro; Nagano, Atsushi J; Honjo, Mie N; Fukuda, Hirokazu

    2016-01-01

    The timing of measurement during plant growth is important because many genes are expressed periodically and orchestrate physiological events. Their periodicity is generated by environmental fluctuations as external factors and the circadian clock as the internal factor. The circadian clock orchestrates physiological events such as photosynthesis or flowering and it enables enhanced growth and herbivory resistance. These characteristics have possible applications for agriculture. In this study, we demonstrated the diurnal variation of the transcriptome in tomato (Solanum lycopersicum) leaves through molecular timetable method in a sunlight-type plant factory. Molecular timetable methods have been developed to detect periodic genes and estimate individual internal body time from these expression profiles in mammals. We sampled tomato leaves every 2 h for 2 days and acquired time-course transcriptome data by RNA-Seq. Many genes were expressed periodically and these expressions were stable across the 1st and 2nd days of measurement. We selected 143 time-indicating genes whose expression indicated periodically, and estimated internal time in the plant from these expression profiles. The estimated internal time was generally the same as the external environment time; however, there was a difference of more than 1 h between the two for some sampling points. Furthermore, the stress-responsive genes also showed weakly periodic expression, implying that they were usually expressed periodically, regulated by light-dark cycles as an external factor or the circadian clock as the internal factor, and could be particularly expressed when the plant experiences some specific stress under agricultural situations. This study suggests that circadian clock mediate the optimization for fluctuating environments in the field and it has possibilities to enhance resistibility to stress and floral induction by controlling circadian clock through light supplement and temperature control.

  17. Detection of Diurnal Variation of Tomato Transcriptome through the Molecular Timetable Method in a Sunlight-Type Plant Factory

    PubMed Central

    Higashi, Takanobu; Tanigaki, Yusuke; Takayama, Kotaro; Nagano, Atsushi J.; Honjo, Mie N.; Fukuda, Hirokazu

    2016-01-01

    The timing of measurement during plant growth is important because many genes are expressed periodically and orchestrate physiological events. Their periodicity is generated by environmental fluctuations as external factors and the circadian clock as the internal factor. The circadian clock orchestrates physiological events such as photosynthesis or flowering and it enables enhanced growth and herbivory resistance. These characteristics have possible applications for agriculture. In this study, we demonstrated the diurnal variation of the transcriptome in tomato (Solanum lycopersicum) leaves through molecular timetable method in a sunlight-type plant factory. Molecular timetable methods have been developed to detect periodic genes and estimate individual internal body time from these expression profiles in mammals. We sampled tomato leaves every 2 h for 2 days and acquired time-course transcriptome data by RNA-Seq. Many genes were expressed periodically and these expressions were stable across the 1st and 2nd days of measurement. We selected 143 time-indicating genes whose expression indicated periodically, and estimated internal time in the plant from these expression profiles. The estimated internal time was generally the same as the external environment time; however, there was a difference of more than 1 h between the two for some sampling points. Furthermore, the stress-responsive genes also showed weakly periodic expression, implying that they were usually expressed periodically, regulated by light–dark cycles as an external factor or the circadian clock as the internal factor, and could be particularly expressed when the plant experiences some specific stress under agricultural situations. This study suggests that circadian clock mediate the optimization for fluctuating environments in the field and it has possibilities to enhance resistibility to stress and floral induction by controlling circadian clock through light supplement and temperature control. PMID:26904059

  18. Re-engineering adenovirus vector systems to enable high-throughput analyses of gene function.

    PubMed

    Stanton, Richard J; McSharry, Brian P; Armstrong, Melanie; Tomasec, Peter; Wilkinson, Gavin W G

    2008-12-01

    With the enhanced capacity of bioinformatics to interrogate extensive banks of sequence data, more efficient technologies are needed to test gene function predictions. Replication-deficient recombinant adenovirus (Ad) vectors are widely used in expression analysis since they provide for extremely efficient expression of transgenes in a wide range of cell types. To facilitate rapid, high-throughput generation of recombinant viruses, we have re-engineered an adenovirus vector (designated AdZ) to allow single-step, directional gene insertion using recombineering technology. Recombineering allows for direct insertion into the Ad vector of PCR products, synthesized sequences, or oligonucleotides encoding shRNAs without requirement for a transfer vector Vectors were optimized for high-throughput applications by making them "self-excising" through incorporating the I-SceI homing endonuclease into the vector removing the need to linearize vectors prior to transfection into packaging cells. AdZ vectors allow genes to be expressed in their native form or with strep, V5, or GFP tags. Insertion of tetracycline operators downstream of the human cytomegalovirus major immediate early (HCMV MIE) promoter permits silencing of transgenes in helper cells expressing the tet repressor thus making the vector compatible with the cloning of toxic gene products. The AdZ vector system is robust, straightforward, and suited to both sporadic and high-throughput applications.

  19. Therapy for Duchenne muscular dystrophy: renewed optimism from genetic approaches.

    PubMed

    Fairclough, Rebecca J; Wood, Matthew J; Davies, Kay E

    2013-06-01

    Duchenne muscular dystrophy (DMD) is a devastating progressive disease for which there is currently no effective treatment except palliative therapy. There are several promising genetic approaches, including viral delivery of the missing dystrophin gene, read-through of translation stop codons, exon skipping to restore the reading frame and increased expression of the compensatory utrophin gene. The lessons learned from these approaches will be applicable to many other disorders.

  20. fabH deletion increases DHA production in Escherichia coli expressing Pfa genes.

    PubMed

    Giner-Robles, Laura; Lázaro, Beatriz; de la Cruz, Fernando; Moncalián, Gabriel

    2018-06-08

    Some marine bacteria, such as Moritella marina, produce the nutraceutical docosahexaenoic acid (DHA) thanks to a specific enzymatic complex called Pfa synthase. Escherichia coli heterologously expressing the pfa gene cluster from M. marina also produces DHA. The aim of this study was to find genetic or metabolic conditions to increase DHA production in E. coli. First, we analysed the effect of the antibiotic cerulenin, showing that DHA production increased twofold. Then, we tested a series of single gene knockout mutations affecting fatty acid biosynthesis, in order to optimize the synthesis of DHA. The most effective mutant, fabH, showed a threefold increase compared to wild type strain. The combination of cerulenin inhibition and fabH deletion rendered a 6.5-fold improvement compared to control strain. Both strategies seem to have the same mechanism of action, in which fatty acid synthesis via the canonical pathway (fab pathway) is affected in its first catalytic step, which allows the substrates to be used by the heterologous pathway to synthesize DHA. DHA-producing E. coli strain that carries a fabH gene deletion boosts DHA production by tuning down the competing canonical biosynthesis pathway. Our approach can be used for optimization of DHA production in different organisms.

  1. Single cell gene expression profiling in Alzheimer's disease.

    PubMed

    Ginsberg, Stephen D; Che, Shaoli; Counts, Scott E; Mufson, Elliott J

    2006-07-01

    Development and implementation of microarray techniques to quantify expression levels of dozens to hundreds to thousands of transcripts simultaneously within select tissue samples from normal control subjects and neurodegenerative diseased brains has enabled scientists to create molecular fingerprints of vulnerable neuronal populations in Alzheimer's disease (AD) and related disorders. A goal is to sample gene expression from homogeneous cell types within a defined region without potential contamination by expression profiles of adjacent neuronal subpopulations and nonneuronal cells. The precise resolution afforded by single cell and population cell RNA analysis in combination with microarrays and real-time quantitative polymerase chain reaction (qPCR)-based analyses allows for relative gene expression level comparisons across cell types under different experimental conditions and disease progression. The ability to analyze single cells is an important distinction from global and regional assessments of mRNA expression and can be applied to optimally prepared tissues from animal models of neurodegeneration as well as postmortem human brain tissues. Gene expression analysis in postmortem AD brain regions including the hippocampal formation and neocortex reveals selectively vulnerable cell types share putative pathogenetic alterations in common classes of transcripts, for example, markers of glutamatergic neurotransmission, synaptic-related markers, protein phosphatases and kinases, and neurotrophins/neurotrophin receptors. Expression profiles of vulnerable regions and neurons may reveal important clues toward the understanding of the molecular pathogenesis of various neurological diseases and aid in identifying rational targets toward pharmacotherapeutic interventions for progressive, late-onset neurodegenerative disorders such as mild cognitive impairment (MCI) and AD.

  2. Comparative Transcriptomic Analysis Reveals Similarities and Dissimilarities in Saccharomyces cerevisiae Wine Strains Response to Nitrogen Availability

    PubMed Central

    Barbosa, Catarina; García-Martínez, José; Pérez-Ortín, José E.; Mendes-Ferreira, Ana

    2015-01-01

    Nitrogen levels in grape-juices are of major importance in winemaking ensuring adequate yeast growth and fermentation performance. Here we used a comparative transcriptome analysis to uncover wine yeasts responses to nitrogen availability during fermentation. Gene expression was assessed in three genetically and phenotypically divergent commercial wine strains (CEG, VL1 and QA23), under low (67 mg/L) and high nitrogen (670 mg/L) regimes, at three time points during fermentation (12h, 24h and 96h). Two-way ANOVA analysis of each fermentation condition led to the identification of genes whose expression was dependent on strain, fermentation stage and on the interaction of both factors. The high fermenter yeast strain QA23 was more clearly distinct from the other two strains, by differential expression of genes involved in flocculation, mitochondrial functions, energy generation and protein folding and stabilization. For all strains, higher transcriptional variability due to fermentation stage was seen in the high nitrogen fermentations. A positive correlation between maximum fermentation rate and the expression of genes involved in stress response was observed. The finding of common genes correlated with both fermentation activity and nitrogen up-take underlies the role of nitrogen on yeast fermentative fitness. The comparative analysis of genes differentially expressed between both fermentation conditions at 12h, where the main difference was the level of nitrogen available, showed the highest variability amongst strains revealing strain-specific responses. Nevertheless, we were able to identify a small set of genes whose expression profiles can quantitatively assess the common response of the yeast strains to varying nitrogen conditions. The use of three contrasting yeast strains in gene expression analysis prompts the identification of more reliable, accurate and reproducible biomarkers that will facilitate the diagnosis of deficiency of this nutrient in the grape-musts and the development of strategies to optimize yeast performance in industrial fermentations. PMID:25884705

  3. Noninvasive imaging of cationic lipid-mediated delivery of optical and PET reporter genes in living mice.

    PubMed

    Iyer, Meera; Berenji, Manijeh; Templeton, Nancy S; Gambhir, Sanjiv S

    2002-10-01

    Gene therapy involves the safe and effective delivery of one or more genes of interest to target cells in vivo. The advantages of using nonviral delivery systems include ease of preparation, low toxicity, and weak immunogenicity. Nonviral delivery methods, when combined with a noninvasive, clinically applicable imaging assay, will greatly aid in the optimization of gene therapy approaches for cancer. We demonstrate cationic lipid-mediated noninvasive monitoring of reporter gene expression of firefly (Photinus pyralis) luciferase (fl) and a mutant herpes simplex virus type I thymidine kinase (HSV1-sr39tk, tk) in living mice using a cooled charge coupled device (CCD) camera and positron emission tomography (PET), respectively. We observe a high level of fl and tk reporter gene expression predominantly in the lungs after a single injection of the extruded DOTAP:cholesterol DNA liposome complexes by way of the tail vein, seen to be time- and dose-dependent. We observe a good correlation between the in vivo bioluminescent signal and the ex vivo firefly luciferase enzyme (FL) activity in different organs. We further demonstrate the feasibility of noninvasively imaging both optical and PET reporter gene expression in the same animal using the CCD camera and microPET, respectively.

  4. Improving the active expression of transglutaminase in Streptomyces lividans by promoter engineering and codon optimization.

    PubMed

    Liu, Song; Wang, Miao; Du, Guocheng; Chen, Jian

    2016-10-28

    Transglutaminases (TGase), which are synthesized as a zymogen (pro-TGase) in Streptomyces sp., are important enzymes in the food industry. Because this pro-peptide is essential for the correct folding of Streptomyces TGase, TGase is usually expressed in an inactive pro-TGase form, which is then converted to active TGase by the addition of activating proteases in vitro. In this study, Streptomyces hygroscopicus TGase was actively produced by Streptomyces lividans through promoter engineering and codon optimization. A gene fragment (tg1, 2.6 kb) that encoded the pro-TGase and its endogenous promoter region, signal peptide and terminator was amplified from S. hygroscopicus WSH03-13 and cloned into plasmid pIJ86, which resulted in pIJ86/tg1. After fermentation for 2 days, S. lividans TK24 that harbored pIJ86/tg1 produced 1.8 U/mL of TGase, and a clear TGase band (38 kDa) was detected in the culture supernatant. These results indicated that the pro-TGase was successfully expressed and correctly processed into active TGase in S. lividans TK24 by using the TGase promoter. Based on deletion analysis, the complete sequence of the TGase promoter is restricted to the region from -693 to -48. We also identified a negative element (-198 to -148) in the TGase promoter, and the deletion of this element increased the TGase production by 81.3 %, in contrast to the method by which S. lividans expresses pIJ86/tg1. Combining the deletion of the negative element of the promoter and optimization of the gene codons, the yield and productivity of TGase reached 5.73 U/mL and 0.14 U/mL/h in the recombinant S. lividans, respectively. We constructed an active TGase-producing strain that had a high yield and productivity, and the optimized TGase promoter could be a good candidate promoter for the expression of other proteins in Streptomyces.

  5. Distributed Function Mining for Gene Expression Programming Based on Fast Reduction.

    PubMed

    Deng, Song; Yue, Dong; Yang, Le-chan; Fu, Xiong; Feng, Ya-zhou

    2016-01-01

    For high-dimensional and massive data sets, traditional centralized gene expression programming (GEP) or improved algorithms lead to increased run-time and decreased prediction accuracy. To solve this problem, this paper proposes a new improved algorithm called distributed function mining for gene expression programming based on fast reduction (DFMGEP-FR). In DFMGEP-FR, fast attribution reduction in binary search algorithms (FAR-BSA) is proposed to quickly find the optimal attribution set, and the function consistency replacement algorithm is given to solve integration of the local function model. Thorough comparative experiments for DFMGEP-FR, centralized GEP and the parallel gene expression programming algorithm based on simulated annealing (parallel GEPSA) are included in this paper. For the waveform, mushroom, connect-4 and musk datasets, the comparative results show that the average time-consumption of DFMGEP-FR drops by 89.09%%, 88.85%, 85.79% and 93.06%, respectively, in contrast to centralized GEP and by 12.5%, 8.42%, 9.62% and 13.75%, respectively, compared with parallel GEPSA. Six well-studied UCI test data sets demonstrate the efficiency and capability of our proposed DFMGEP-FR algorithm for distributed function mining.

  6. Single cell digital polymerase chain reaction on self-priming compartmentalization chip

    PubMed Central

    Zhu, Qiangyuan; Qiu, Lin; Xu, Yanan; Li, Guang; Mu, Ying

    2017-01-01

    Single cell analysis provides a new framework for understanding biology and disease, however, an absolute quantification of single cell gene expression still faces many challenges. Microfluidic digital polymerase chain reaction (PCR) provides a unique method to absolutely quantify the single cell gene expression, but only limited devices are developed to analyze a single cell with detection variation. This paper describes a self-priming compartmentalization (SPC) microfluidic digital polymerase chain reaction chip being capable of performing single molecule amplification from single cell. The chip can be used to detect four single cells simultaneously with 85% of sample digitization. With the optimized protocol for the SPC chip, we first tested the ability, precision, and sensitivity of our SPC digital PCR chip by assessing β-actin DNA gene expression in 1, 10, 100, and 1000 cells. And the reproducibility of the SPC chip is evaluated by testing 18S rRNA of single cells with 1.6%–4.6% of coefficient of variation. At last, by detecting the lung cancer related genes, PLAU gene expression of A549 cells at the single cell level, the single cell heterogeneity was demonstrated. So, with the power-free, valve-free SPC chip, the gene copy number of single cells can be quantified absolutely with higher sensitivity, reduced labor time, and reagent. We expect that this chip will enable new studies for biology and disease. PMID:28191267

  7. Single cell digital polymerase chain reaction on self-priming compartmentalization chip.

    PubMed

    Zhu, Qiangyuan; Qiu, Lin; Xu, Yanan; Li, Guang; Mu, Ying

    2017-01-01

    Single cell analysis provides a new framework for understanding biology and disease, however, an absolute quantification of single cell gene expression still faces many challenges. Microfluidic digital polymerase chain reaction (PCR) provides a unique method to absolutely quantify the single cell gene expression, but only limited devices are developed to analyze a single cell with detection variation. This paper describes a self-priming compartmentalization (SPC) microfluidic digital polymerase chain reaction chip being capable of performing single molecule amplification from single cell. The chip can be used to detect four single cells simultaneously with 85% of sample digitization. With the optimized protocol for the SPC chip, we first tested the ability, precision, and sensitivity of our SPC digital PCR chip by assessing β-actin DNA gene expression in 1, 10, 100, and 1000 cells. And the reproducibility of the SPC chip is evaluated by testing 18S rRNA of single cells with 1.6%-4.6% of coefficient of variation. At last, by detecting the lung cancer related genes, PLAU gene expression of A549 cells at the single cell level, the single cell heterogeneity was demonstrated. So, with the power-free, valve-free SPC chip, the gene copy number of single cells can be quantified absolutely with higher sensitivity, reduced labor time, and reagent. We expect that this chip will enable new studies for biology and disease.

  8. RNA interference: learning gene knock-down from cell physiology

    PubMed Central

    Mocellin, Simone; Provenzano, Maurizio

    2004-01-01

    Over the past decade RNA interference (RNAi) has emerged as a natural mechanism for silencing gene expression. This ancient cellular antiviral response can be exploited to allow specific inhibition of the function of any chosen target gene. RNAi is proving to be an invaluable research tool, allowing much more rapid characterization of the function of known genes. More importantly, RNAi technology considerably bolsters functional genomics to aid in the identification of novel genes involved in disease processes. This review briefly describes the molecular principles underlying the biology of RNAi phenomenon and discuss the main technical issues regarding optimization of RNAi experimental design. PMID:15555080

  9. A novel analysis strategy for integrating methylation and expression data reveals core pathways for thyroid cancer aetiology

    PubMed Central

    2015-01-01

    Background Recently, a wide range of diseases have been associated with changes in DNA methylation levels, which play a vital role in gene expression regulation. With ongoing developments in technology, attempts to understand disease mechanism have benefited greatly from epigenetics and transcriptomics studies. In this work, we have used expression and methylation data of thyroid carcinoma as a case study and explored how to optimally incorporate expression and methylation information into the disease study when both data are available. Moreover, we have also investigated whether there are important post-translational modifiers which could drive critical insights on thyroid cancer genetics. Results In this study, we have conducted a threshold analysis for varying methylation levels to identify whether setting a methylation level threshold increases the performance of functional enrichment. Moreover, in order to decide on best-performing analysis strategy, we have performed data integration analysis including comparison of 10 different analysis strategies. As a result, combining methylation with expression and using genes with more than 15% methylation change led to optimal detection rate of thyroid-cancer associated pathways in top 20 functional enrichment results. Furthermore, pooling the data from different experiments increased analysis confidence by improving the data range. Consequently, we have identified 207 transcription factors and 245 post-translational modifiers with more than 15% methylation change which may be important in understanding underlying mechanisms of thyroid cancer. Conclusion While only expression or only methylation information would not reveal both primary and secondary mechanisms involved in disease state, combining expression and methylation led to a better detection of thyroid cancer-related genes and pathways that are found in the recent literature. Moreover, focusing on genes that have certain level of methylation change improved the functional enrichment results, revealing the core pathways involved in disease development such as; endocytosis, apoptosis, glutamatergic synapse, MAPK, ErbB, TGF-beta and Toll-like receptor pathways. Overall, in addition to novel analysis framework, our study reveals important thyroid-cancer related mechanisms, secondary molecular alterations and contributes to better knowledge of thyroid cancer aetiology. PMID:26678064

  10. Modeling gene expression measurement error: a quasi-likelihood approach

    PubMed Central

    Strimmer, Korbinian

    2003-01-01

    Background Using suitable error models for gene expression measurements is essential in the statistical analysis of microarray data. However, the true probabilistic model underlying gene expression intensity readings is generally not known. Instead, in currently used approaches some simple parametric model is assumed (usually a transformed normal distribution) or the empirical distribution is estimated. However, both these strategies may not be optimal for gene expression data, as the non-parametric approach ignores known structural information whereas the fully parametric models run the risk of misspecification. A further related problem is the choice of a suitable scale for the model (e.g. observed vs. log-scale). Results Here a simple semi-parametric model for gene expression measurement error is presented. In this approach inference is based an approximate likelihood function (the extended quasi-likelihood). Only partial knowledge about the unknown true distribution is required to construct this function. In case of gene expression this information is available in the form of the postulated (e.g. quadratic) variance structure of the data. As the quasi-likelihood behaves (almost) like a proper likelihood, it allows for the estimation of calibration and variance parameters, and it is also straightforward to obtain corresponding approximate confidence intervals. Unlike most other frameworks, it also allows analysis on any preferred scale, i.e. both on the original linear scale as well as on a transformed scale. It can also be employed in regression approaches to model systematic (e.g. array or dye) effects. Conclusions The quasi-likelihood framework provides a simple and versatile approach to analyze gene expression data that does not make any strong distributional assumptions about the underlying error model. For several simulated as well as real data sets it provides a better fit to the data than competing models. In an example it also improved the power of tests to identify differential expression. PMID:12659637

  11. Optimized RNP transfection for highly efficient CRISPR/Cas9-mediated gene knockout in primary T cells.

    PubMed

    Seki, Akiko; Rutz, Sascha

    2018-03-05

    CRISPR (clustered, regularly interspaced, short palindromic repeats)/Cas9 (CRISPR-associated protein 9) has become the tool of choice for generating gene knockouts across a variety of species. The ability for efficient gene editing in primary T cells not only represents a valuable research tool to study gene function but also holds great promise for T cell-based immunotherapies, such as next-generation chimeric antigen receptor (CAR) T cells. Previous attempts to apply CRIPSR/Cas9 for gene editing in primary T cells have resulted in highly variable knockout efficiency and required T cell receptor (TCR) stimulation, thus largely precluding the study of genes involved in T cell activation or differentiation. Here, we describe an optimized approach for Cas9/RNP transfection of primary mouse and human T cells without TCR stimulation that results in near complete loss of target gene expression at the population level, mitigating the need for selection. We believe that this method will greatly extend the feasibly of target gene discovery and validation in primary T cells and simplify the gene editing process for next-generation immunotherapies. © 2018 Genentech.

  12. Adipokinetic hormones control amylase activity in the cockroach (Periplaneta americana) gut.

    PubMed

    Bodláková, Karolina; Jedlička, Pavel; Kodrík, Dalibor

    2017-04-01

    This study examined the biochemical characteristics of α-amylase and hormonal (adipokinetic hormone: AKH) stimulation of α-amylase activity in the cockroach (Periplaneta americana) midgut. We applied two AKHs in vivo and in vitro, then measured resultant amylase activity and gene expression, as well as the expression of AKH receptor (AKHR). The results revealed that optimal amylase activity is characterized by the following: pH: 5.7, temperature: 38.4 °C, K m (Michaelis-Menten constant): 2.54 mg starch/mL, and V max (maximum reaction velocity): 0.185 μmol maltose/mL/min. In vivo application of AKHs resulted in significant increase of amylase activity: by two-fold in the gastric caeca and 4-7 fold in the rest of the midgut. In vitro experiments supported results seen in vivo: a 24-h incubation with the hormones resulted in the increase of amylase activity by 1.4 times in the caeca and 4-9 times in the midgut. Further, gene expression analyses reveal that AKHR is expressed in both the caeca and the rest of the midgut, although expression levels in the former were 23 times higher than levels in the latter. A similar pattern was found for the amylase (AMY) gene. Hormonal treatment did not affect the expression of either gene. This study is the first to provide evidence indicating direct AKH stimulation of digestive enzyme activity in the insect midgut, supported by specific AKHR gene expression in this organ. © 2016 Institute of Zoology, Chinese Academy of Sciences.

  13. Requirement for STAT1 in LPS-induced gene expression in macrophages.

    PubMed

    Ohmori, Y; Hamilton, T A

    2001-04-01

    This study examines the role of the signal transducer and activator of transcription 1 (STAT1) in induction of lipopolysaccharide (LPS)-stimulated gene expression both in vitro and in vivo. LPS-induced expression of an interferon (IFN)-inducible 10-kDa protein (IP-10), IFN regulatory factor-1 (IRF-1), and inducible nitric oxide synthase (iNOS) mRNAs was severely impaired in macrophages prepared from Stat1-/- mice, whereas levels of tumor necrosis factor alpha and KC (a C-X-C chemokine) mRNA in LPS-treated cell cultures were unaffected. A similar deficiency in LPS-induced gene expression was observed in livers and spleens from Stat1-/- mice. The reduced LPS-stimulated gene expression seen in Stat1-/- macrophages was not the result of reduced activation of nuclear factor kappaB. LPS stimulated the delayed activation of both IFN-stimulated response element and IFN-gamma-activated sequence binding activity in macrophages from wild-type mice. Activation of these STAT1-containing transcription factors was mediated by the intermediate induction of type I IFNs, since the LPS-induced IP-10, IRF-1, and iNOS mRNA expression was markedly reduced in macrophages from IFN-alpha/betaR-/- mice and blocked by cotreatment with antibodies against type I IFN. These results indicate that indirect activation of STAT1 by LPS-induced type I IFN participates in promoting optimal expression of LPS-inducible genes, and they suggest that STAT1 may play a critical role in innate immunity against gram-negative bacterial infection.

  14. Overproduction of Fatty Acid Ethyl Esters by the Oleaginous Yeast Yarrowia lipolytica through Metabolic Engineering and Process Optimization.

    PubMed

    Gao, Qi; Cao, Xuan; Huang, Yu-Ying; Yang, Jing-Lin; Chen, Jun; Wei, Liu-Jing; Hua, Qiang

    2018-05-18

    Recent advances in the production of biofuels by microbes have attracted attention due to increasingly limited fossil fuels. Biodiesels, especially fatty acid ethyl esters (FAEEs), are considered a potentially fully sustainable fuel in the near future due to similarities with petrodiesels and compatibility with existing infrastructure. However, biosynthesis of FAEEs is limited by the supply of precursor lipids and acetyl-CoA. In the present study, we explored the production potential of an engineered biosynthetic pathway coupled to the addition of ethanol in the oleaginous yeast Yarrowia lipolytica. This type of yeast is able to supply a greater amount of precursor lipids than species typically used. To construct the FAEEs synthesis pathway, WS genes that encode wax ester synthases (WSs) from different species were codon-optimized and heterologously expressed in Y. lipolytica. The most productive engineered strain was found to express a WS gene from Marinobacter hydrocarbonoclasticus strain DSM 8798. To stepwisely increase FAEEs production, we optimized the promoter of WS overexpression, eliminated β-oxidation by deleting the PEX10 gene in our engineered strains, and redirected metabolic flux toward acetyl-CoA. The new engineered strain, coupled with an optimized ethanol concentration, led to an approximate 5.5-fold increase in extracellular FAEEs levels compared to the wild-type strain and a maximum FAEEs titer of 1.18 g/L in shake flask cultures. In summary, the present study demonstrated that an engineered Y. lipolytica strain possessed a high capacity for FAEEs production and may serve as a platform for more efficient biodiesel production in the future.

  15. Direct head-to-head comparison of cationic liposome-mediated gene delivery to mesenchymal stem/stromal cells of different human sources: a comprehensive study.

    PubMed

    Boura, Joana S; Santos, Francisco Dos; Gimble, Jeffrey M; Cardoso, Carla M P; Madeira, Catarina; Cabral, Joaquim M S; Silva, Cláudia Lobato da

    2013-02-01

    Nonviral gene delivery to human mesenchymal stem/stromal cells (MSC) can be considered a very promising strategy to improve their intrinsic features, amplifying the therapeutic potential of these cells for clinical applications. In this work, we performed a comprehensive comparison of liposome-mediated gene transfer efficiencies to MSC derived from different human sources-bone marrow (BM MSC), adipose tissue-derived cells (ASC), and umbilical cord matrix (UCM MSC). The results obtained using a green fluorescent protein (GFP)-encoding plasmid indicated that MSC isolated from BM and UCM are more amenable to genetic modification when compared to ASC as they exhibited superior levels of viable, GFP(+) cells 48 hr post-transfection, 58 ± 7.1% and 54 ± 3.8%, respectively, versus 33 ± 4.7%. For all cell sources, high cell recoveries (≈50%) and viabilities (>85%) were achieved, and the transgene expression was maintained for 10 days. Levels of plasmid DNA uptake, as well as kinetics of transgene expression and cellular division, were also determined. Importantly, modified cells were found to retain their characteristic immunophenotypic profile and multilineage differentiation capacity. By using the lipofection protocol optimized herein, we were able to maximize transfection efficiencies to human MSC (maximum of 74% total GFP(+) cells) and show that lipofection is a promising transfection strategy for MSC genetic modification, especially when a transient expression of a therapeutic gene is required. Importantly, we also clearly demonstrated that intrinsic features of MSC from different sources should be taken into consideration when developing and optimizing strategies for MSC engineering with a therapeutic gene.

  16. KCNN4 and S100A14 act as predictors of recurrence in optimally debulked patients with serous ovarian cancer

    PubMed Central

    Hu, Ting; Sun, Qian; Wu, Jianli; Lin, Xingguang; Luo, Danfeng; Sun, Chaoyang; Wang, Changyu; Zhou, Bo; Li, Na; Xia, Meng; Lu, Hao; Meng, Li; Xu, Xiaoyan; Hu, Junbo; Ma, Ding; Chen, Gang; Zhu, Tao

    2016-01-01

    Approximately 50-75% of patients with serous ovarian carcinoma (SOC) experience recurrence within 18 months after first-line treatment. Current clinical indicators are inadequate for predicting the risk of recurrence. In this study, we used 7 publicly available microarray datasets to identify gene signatures related to recurrence in optimally debulked SOC patients, and validated their expressions in an independent clinic cohort of 127 patients using immunohistochemistry (IHC). We identified a two-gene signature including KCNN4 and S100A14 which was related to recurrence in optimally debulked SOC patients. Their mRNA expression levels were positively correlated and regulated by DNA copy number alterations (CNA) (KCNN4: p=1.918e-05) and DNA promotermethylation (KCNN4: p=0.0179; S100A14: p=2.787e-13). Recurrence prediction models built in the TCGA dataset based on KCNN4 and S100A14 individually and in combination showed good prediction performance in the other 6 datasets (AUC:0.5442-0.9524). The independent cohort supported the expression difference between SOC recurrences. Also, a KCNN4 and S100A14-centered protein interaction subnetwork was built from the STRING database, and the shortest regulation path between them, called the KCNN4-UBA52-KLF4-S100A14 axis, was identified. This discovery might facilitate individualized treatment of SOC. PMID:27270322

  17. Polyethylene glycol and octa-arginine dual-functionalized nanographene oxide: an optimization for efficient nucleic acid delivery.

    PubMed

    Imani, Rana; Prakash, Satya; Vali, Hojatollah; Faghihi, Shahab

    2018-05-29

    The successful application of nucleic acid-based therapy for the treatment of various cancers is largely dependent on a safe and efficient delivery system. A dual-functionalized graphene oxide (GO)-based nanocarrier with the conjugation of aminated-polyethylene glycol (PEG-diamine) and octa-arginine (R8) for the intracellular delivery of nucleic acids is proposed. The functionalized sites are covalently co-conjugated and the PEG : R8 molar ratio is optimized at 10 : 1 to achieve a hydrocolloidally stable size of 252 ± 2.0 nm with an effective charge of +40.97 ± 1.05 and an amine-rich content of 10.87 ± 0.4 μmol g-1. The uptake of the nanocarrier in breast cancer cell lines, MCF-7 and MDA-MB 231, is investigated. The siRNA and pDNA condensation ability in the presence and absence of enzymes and the endosomal buffering capacity, as well as the intracellular localization of the gene/nanocarrier complex are also evaluated. Furthermore, the delivery of functional genes associated with the nanocarrier is assessed using c-Myc protein knockdown and EGFP gene expression. The effective uptake of the nanocarrier by the cells shows superior cytocompatibility, and protects the siRNA and pDNA against enzyme degradation while inhibiting their migration with N : P ratios of 10 and 5, respectively. The co-conjugation of PEG-diamine and the cationic cell-penetrating peptide (CPP) into the GO nanocarrier also provides a superior internalization efficacy of 85% in comparison with a commercially available transfection reagent. The c-Myc protein knockdown and EGFP expression, which are induced by the nanocarrier, confirm that the optimized PEG-diamine/R8-functionalized GO could effectively deliver pDNA and siRNA into the cells and interfere with gene expression.

  18. Integration event induced changes in recombinant protein productivity in Pichia pastoris discovered by whole genome sequencing and derived vector optimization.

    PubMed

    Schwarzhans, Jan-Philipp; Wibberg, Daniel; Winkler, Anika; Luttermann, Tobias; Kalinowski, Jörn; Friehs, Karl

    2016-05-20

    The classic AOX1 replacement approach is still one of the most often used techniques for expression of recombinant proteins in the methylotrophic yeast Pichia pastoris. Although this approach is largely successful, it frequently delivers clones with unpredicted production characteristics and a work-intense screening process is required to find the strain with desired productivity. In this project 845 P. pastoris clones, transformed with a GFP expression cassette, were analyzed for their methanol-utilization (Mut)-phenotypes, GFP gene expression levels and gene copy numbers. Several groups of strains with irregular features were identified. Such features include GFP expression that is markedly higher or lower than expected based on gene copy number as well as strains that grew under selective conditions but where the GFP gene cassette and its expression could not be detected. From these classes of strains 31 characteristic clones were selected and their genomes sequenced. By correlating the assembled genome data with the experimental phenotypes novel insights were obtained. These comprise a clear connection between productivity and cassette-to-cassette orientation in the genome, the occurrence of false-positive clones due to a secondary recombination event, and lower total productivity due to the presence of untransformed cells within the isolates were discovered. To cope with some of these problems, the original vector was optimized by replacing the AOX1 terminator, preventing the occurrence of false-positive clones due to the secondary recombination event. Standard methods for transformation of P. pastoris led to a multitude of unintended and sometimes detrimental integration events, lowering total productivity. By documenting the connections between productivity and integration event we obtained a deeper understanding of the genetics of mutation in P. pastoris. These findings and the derived improved mutagenesis and transformation procedures and tools will help other scientists working on recombinant protein production in P. pastoris and similar non-conventional yeasts.

  19. Next-generation sequencing facilitates quantitative analysis of wild-type and Nrl−/− retinal transcriptomes

    PubMed Central

    Brooks, Matthew J.; Rajasimha, Harsha K.; Roger, Jerome E.

    2011-01-01

    Purpose Next-generation sequencing (NGS) has revolutionized systems-based analysis of cellular pathways. The goals of this study are to compare NGS-derived retinal transcriptome profiling (RNA-seq) to microarray and quantitative reverse transcription polymerase chain reaction (qRT–PCR) methods and to evaluate protocols for optimal high-throughput data analysis. Methods Retinal mRNA profiles of 21-day-old wild-type (WT) and neural retina leucine zipper knockout (Nrl−/−) mice were generated by deep sequencing, in triplicate, using Illumina GAIIx. The sequence reads that passed quality filters were analyzed at the transcript isoform level with two methods: Burrows–Wheeler Aligner (BWA) followed by ANOVA (ANOVA) and TopHat followed by Cufflinks. qRT–PCR validation was performed using TaqMan and SYBR Green assays. Results Using an optimized data analysis workflow, we mapped about 30 million sequence reads per sample to the mouse genome (build mm9) and identified 16,014 transcripts in the retinas of WT and Nrl−/− mice with BWA workflow and 34,115 transcripts with TopHat workflow. RNA-seq data confirmed stable expression of 25 known housekeeping genes, and 12 of these were validated with qRT–PCR. RNA-seq data had a linear relationship with qRT–PCR for more than four orders of magnitude and a goodness of fit (R2) of 0.8798. Approximately 10% of the transcripts showed differential expression between the WT and Nrl−/− retina, with a fold change ≥1.5 and p value <0.05. Altered expression of 25 genes was confirmed with qRT–PCR, demonstrating the high degree of sensitivity of the RNA-seq method. Hierarchical clustering of differentially expressed genes uncovered several as yet uncharacterized genes that may contribute to retinal function. Data analysis with BWA and TopHat workflows revealed a significant overlap yet provided complementary insights in transcriptome profiling. Conclusions Our study represents the first detailed analysis of retinal transcriptomes, with biologic replicates, generated by RNA-seq technology. The optimized data analysis workflows reported here should provide a framework for comparative investigations of expression profiles. Our results show that NGS offers a comprehensive and more accurate quantitative and qualitative evaluation of mRNA content within a cell or tissue. We conclude that RNA-seq based transcriptome characterization would expedite genetic network analyses and permit the dissection of complex biologic functions. PMID:22162623

  20. Sodium butyrate improves the cloned yak embryo viability and corrects gene expression patterns.

    PubMed

    Xiong, Xian-rong; Lan, Dao-liang; Li, Jian; Wang, Yong; Zhong, Jin-cheng

    2015-02-01

    Interspecies somatic cell nuclear transfer (iSCNT), a powerful tool in basic scientific research, has been used widely to increase and preserve the population of endangered species. Yak (Bos grunniens) is one of these species. Development to term of interspecies cloned yak embryos has not been achieved, possibly due to abnormal epigenetic reprogramming. Previous studies have demonstrated that treatment of intraspecies cloned embryos with (NaBu) significantly improves nuclear-cytoplasmic reprogramming and viability in vitro. Therefore, in this study, we evaluated the effect of optimal NaBu concentration and exposure time on preimplantation development of yak iSCNT embryos and on the expression patterns of developmentally important genes. The results showed that 8-cell rate, blastocyst formation rate and total cell number increased significantly compared with their untreated counterparts when yak iSCNT embryos were treated with 5 nM NaBu for 12 h after activation, but that the 2-cell stage embryo rate was not significantly different. The treatment of NaBu also increased significantly the expression levels of Oct-4 and decreased the expression levels of HDAC-2, Dnmt-1 and IGF-1; the expression patterns of these genes were more similar to that of their bovine-yak in vitro fertilization (BY-IVF) counterparts. The results described above indicated that NaBu treatment improved developmental competence in vitro and 'corrected' the gene expression patterns of yak iSCNT embryos.

  1. Single-cell mRNA sequencing identifies subclonal heterogeneity in anti-cancer drug responses of lung adenocarcinoma cells.

    PubMed

    Kim, Kyu-Tae; Lee, Hye Won; Lee, Hae-Ock; Kim, Sang Cheol; Seo, Yun Jee; Chung, Woosung; Eum, Hye Hyeon; Nam, Do-Hyun; Kim, Junhyong; Joo, Kyeung Min; Park, Woong-Yang

    2015-06-19

    Intra-tumoral genetic and functional heterogeneity correlates with cancer clinical prognoses. However, the mechanisms by which intra-tumoral heterogeneity impacts therapeutic outcome remain poorly understood. RNA sequencing (RNA-seq) of single tumor cells can provide comprehensive information about gene expression and single-nucleotide variations in individual tumor cells, which may allow for the translation of heterogeneous tumor cell functional responses into customized anti-cancer treatments. We isolated 34 patient-derived xenograft (PDX) tumor cells from a lung adenocarcinoma patient tumor xenograft. Individual tumor cells were subjected to single cell RNA-seq for gene expression profiling and expressed mutation profiling. Fifty tumor-specific single-nucleotide variations, including KRAS(G12D), were observed to be heterogeneous in individual PDX cells. Semi-supervised clustering, based on KRAS(G12D) mutant expression and a risk score representing expression of 69 lung adenocarcinoma-prognostic genes, classified PDX cells into four groups. PDX cells that survived in vitro anti-cancer drug treatment displayed transcriptome signatures consistent with the group characterized by KRAS(G12D) and low risk score. Single-cell RNA-seq on viable PDX cells identified a candidate tumor cell subgroup associated with anti-cancer drug resistance. Thus, single-cell RNA-seq is a powerful approach for identifying unique tumor cell-specific gene expression profiles which could facilitate the development of optimized clinical anti-cancer strategies.

  2. Expression of Allene Oxide Synthase Determines Defense Gene Activation in Tomato1

    PubMed Central

    Sivasankar, Sobhana; Sheldrick, Bay; Rothstein, Steven J.

    2000-01-01

    Allene oxide synthase (AOS; hydroperoxide dehydratase; EC 4.2.1.92) catalyzes the first step in the biosynthesis of jasmonic acid from lipoxygenase-derived hydroperoxides of free fatty acids. Using the AOS cDNA from tomato (Lycopersicon esculentum), in which the role of jasmonic acid in wound-induced defense gene activation has been best described, we examined the kinetics of AOS induction in response to wounding and elicitors, in parallel with that of the wound-inducible PIN II (proteinase inhibitor II) gene. AOS was induced in leaves by wounding, systemin, 12-oxophytodienoic acid, and methyl jasmonate. The levels of AOS mRNA started declining by 4 h after induction, whereas the levels of PIN II mRNA continued to increase up to 20 h after induction. Salicylic acid inhibited AOS and PIN II expression, and the addition of 12-oxophytodienoic acid or methyl jasmonate did not prevent the inhibition of PIN II expression in the presence of salicylic acid. Ethylene induced the expression of AOS, but the presence of ethylene alone did not produce an optimal induction of PIN II. The addition of silver thiosulfate, an ethylene action inhibitor, prevented the wound-induced expression of both AOS and PIN II. Products of hydroperoxide lyase affected neither AOS nor PIN II, but induced expression of prosystemin. Based on these results, we propose an updated model for defense gene activation in tomato. PMID:10759530

  3. The Effects of Different Repetitive Transcranial Magnetic Stimulation (rTMS) Protocols on Cortical Gene Expression in a Rat Model of Cerebral Ischemic-Reperfusion Injury

    PubMed Central

    Ljubisavljevic, Milos R.; Javid, Asma; Oommen, Joji; Parekh, Khatija; Nagelkerke, Nico; Shehab, Safa; Adrian, Thomas E.

    2015-01-01

    Although repetitive Transcranial Magnetic Stimulation (rTMS) in treatment of stroke in humans has been explored over the past decade the data remain controversial in terms of optimal stimulation parameters and the mechanisms of rTMS long-term effects. This study aimed to explore the potential of different rTMS protocols to induce changes in gene expression in rat cortices after acute ischemic-reperfusion brain injury. The stroke was induced by middle cerebral artery occlusion (MCAO) with subsequent reperfusion. Changes in the expression of 96 genes were examined using low-density expression arrays after MCAO alone and after MCAO combined with 1Hz, 5Hz, continuous (cTBS) and intermittent (iTBS) theta-burst rTMS. rTMS over the lesioned hemisphere was given for two weeks (with a 2-day pause) in a single daily session and a total of 2400 pulses. MCAO alone induced significant upregulation in the expression of 44 genes and downregulation in 10. Two weeks of iTBS induced significant increase in the expression of 52 genes. There were no downregulated genes. 1Hz and 5Hz had no significant effects on gene expression, while cTBS effects were negligible. Upregulated genes included those involved in angiogenesis, inflammation, injury response and cellular repair, structural remodeling, neuroprotection, neurotransmission and neuronal plasticity. The results show that long-term rTMS in acute ischemic-reperfusion brain injury induces complex changes in gene expression that span multiple pathways, which generally promote the recovery. They also demonstrate that induced changes primarily depend on the rTMS frequency (1Hz and 5Hz vs. iTBS) and pattern (cTBS vs. iTBS). The results further underlines the premise that one of the benefits of rTMS application in stroke may be to prime the brain, enhancing its potential to cope with the injury and to rewire. This could further augment its potential to favorably respond to rehabilitation, and to restore some of the loss functions. PMID:26431529

  4. CEM-designer: design of custom expression microarrays in the post-ENCODE Era.

    PubMed

    Arnold, Christian; Externbrink, Fabian; Hackermüller, Jörg; Reiche, Kristin

    2014-11-10

    Microarrays are widely used in gene expression studies, and custom expression microarrays are popular to monitor expression changes of a customer-defined set of genes. However, the complexity of transcriptomes uncovered recently make custom expression microarray design a non-trivial task. Pervasive transcription and alternative processing of transcripts generate a wealth of interweaved transcripts that requires well-considered probe design strategies and is largely neglected in existing approaches. We developed the web server CEM-Designer that facilitates microarray platform independent design of custom expression microarrays for complex transcriptomes. CEM-Designer covers (i) the collection and generation of a set of unique target sequences from different sources and (ii) the selection of a set of sensitive and specific probes that optimally represents the target sequences. Probe design itself is left to third party software to ensure that probes meet provider-specific constraints. CEM-Designer is available at http://designpipeline.bioinf.uni-leipzig.de. Copyright © 2014 Elsevier B.V. All rights reserved.

  5. The forage type (grazing versus hay pasture) fed to ewes and the lamb sex affect fatty acid profile and lipogenic gene expression in the longissimus muscle of suckling lambs.

    PubMed

    Dervishi, E; Joy, M; Alvarez-Rodriguez, J; Serrano, M; Calvo, J H

    2012-01-01

    Meat intramuscular fat (IMF) contributes to meat quality and consumer acceptance. Molecular events that occur during IMF deposition and the identification of genes that are differentially expressed during this process are important to the design of an optimal nutrition plan for animals. In the present study, we examined the effect of the forage type (grazing vs. hay pasture) fed to ewes and the effect of lamb sex on the LM fatty acid (FA) profile and gene expression of suckling lambs (10 to 12 kg of BW at slaughter); ewes received pasture hay (PH) or grazed pasture (GRE). Forage type had a significant effect on IMF FA profile. Ewes grazing green forage (GRE) promoted the formation and deposition of vaccenic acid (C18:1n-7), CLA, and PUFA n-3 in LM from their suckling lambs (P < 0.05). We found that forage type affected the expression of the sterol regulatory element binding transcription factor 1 (SREBF1) gene in females. However, in males, it modulated stearoyl CoA desaturase (SCD) gene expression (P < 0.05). Moreover, our results showed that females, independent of the diet of the ewes (PH or GRE), are predisposed to develop fat and to upregulate the expression of key genes of transcriptional factors PPARA, CEBPB, SREBF1, and lipoprotein lipase (LPL) and SCD (P < 0.05). The data suggest that SREBF1, SCD, and most likely CEBPB gene expression in young suckling lambs is modulated by both lamb sex and forage type fed to ewes. Fatty acid indicators PUFA, n-6/n-3, CLA, and SFA are closely related to LPL, SCD, PPARA, and CEBPB gene expression depending on animal sex or the diet of ewes. This study suggests that grazing pasture affects FA composition promoting greater vaccenic, CLA, and total PUFA n-3 FA in female and male suckling lambs, and it is mediated through the regulation of lipogenic enzyme expression.

  6. Selenium regulates gene expression of selenoprotein W in chicken skeletal muscle system.

    PubMed

    Ruan, Hongfeng; Zhang, Ziwei; Wu, Qiong; Yao, Haidong; Li, Jinlong; Li, Shu; Xu, Shiwen

    2012-01-01

    Selenoprotein W (SelW) is abundantly expressed in skeletal muscles of mammals and necessary for the metabolism of skeletal muscles. However, its expression pattern in skeletal muscle system of birds is still uncovered. Herein, to investigate the distribution of SelW mRNA in chicken skeletal muscle system and its response to different selenium (Se) status, 1-day-old chickens were exposed to various concentrations of Se as sodium selenite in the feed for 35 days. In addition, myoblasts were treated with different concentrations of Se in the medium for 72 h. Then the levels of SelW mRNA in skeletal muscles (wing muscle, pectoral muscle, thigh muscle) and myoblasts were determined on days 1, 15, 25, and 35 and at 0, 24, 48, and 72 h, respectively. The results showed that SelW was detected in all these muscle components and it increased both along with the growth of organism and the differentiation process of myoblasts. The thigh muscle is more responsive to Se intake than the other two skeletal muscle tissues while the optimal Se supplementation for SelW mRNA expression in chicken myoblasts was 10(-7) M. In summary, Se plays important roles in the development of chicken skeletal muscles. To effect optimal SelW gene expression, Se must be provided in the diet and the media in adequate amounts and neither at excessive nor deficient levels.

  7. Hair growth-promotion effects of different alternating current parameter settings are mediated by the activation of Wnt/β-catenin and MAPK pathway.

    PubMed

    Sohn, Ki Min; Jeong, Kwan Ho; Kim, Jung Eun; Park, Young Min; Kang, Hoon

    2015-12-01

    Electrical stimulation is being used in variable skin therapeutic conditions. There have been clinical studies demonstrating the positive effect of electrical stimuli on hair regrowth. However, the underlying exact mechanism and optimal parameter settings are not clarified yet. To investigate the effects of different parameter settings of electrical stimuli on hair growth by examining changes in human dermal papilla cells (hDPCs) in vitro and by observing molecular changes in animal tissue. In vitro, cultured hDPCs were electrically stimulated with different parameter settings at alternating current (AC). Cell proliferation was measured by MTT assay. The Ki67 expression was measured by immunofluorescence. Hair growth-related gene expressions were measured by RT-PCR. In animal model, different parameter settings of AC were applied to the shaved dorsal skin of rabbit for 8 weeks. Expression of hair-related genes in the skin of rabbit was examined by RT-PCR. At low voltage power (3.5 V) and low frequency (1 or 2 MHz) with AC, in vitro proliferation of hDPCs was successfully induced. A significant increase in Wnt/β-catenin, Ki67, p-ERK and p-AKT expressions was observed under the aforementioned settings. In animal model, hair regrowth was observed in the entire stimulated areas under individual conditions. Expression of hair-related genes in the skin significantly increased on the 6th week of treatment. There are optimal conditions for electrical stimulated hair growth, and they might be different in the cells, animals and human tissues. Electrical stimuli induce mechanisms such as the activation of Wnt/β-catenin and MAPK pathway in hair follicles. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  8. Evaluation of the attenuation, immunogenicity, and efficacy of a live virus vaccine generated by codon-pair bias de-optimization of the 2009 pandemic H1N1 influenza virus, in ferrets

    PubMed Central

    Broadbent, Andrew J.; Santos, Celia P.; Anafu, Amanda; Wimmer, Eckard; Mueller, Steffen; Subbarao, Kanta

    2015-01-01

    Codon-pair bias de-optimization (CPBD) of viruses involves re-writing viral genes using statistically underrepresented codon pairs, without any changes to the amino acid sequence or codon usage. Previously, this technology has been used to attenuate the influenza A/Puerto Rico/8/34 (H1N1) virus. The de-optimized virus was immunogenic and protected inbred mice from challenge. In order to assess whether CPBD could be used to produce a live vaccine against a clinically relevant influenza virus, we generated an influenza A/California/07/2009 pandemic H1N1 (2009 pH1N1) virus with de-optimized HA and NA gene segments (2009 pH1N1-(HA+NA)Min), and evaluated viral replication and protein expression in MDCK cells, and attenuation, immunogenicity, and efficacy in outbred ferrets. The 2009 pH1N1-(HA+NA)Min virus grew to a similar titer as the 2009 pH1N1 wild type (wt) virus in MDCK cells (~106 TCID50/ml), despite reduced HA and NA protein expression on western blot. In ferrets, intranasal inoculation of 2009 pH1N1-(HA+NA)Min virus at doses ranging from 103 to 105 TCID50 led to seroconversion in all animals and protection from challenge with the 2009 pH1N1 wt virus 28 days later. The 2009 pH1N1-(HA+NA)Min virus did not cause clinical illness in ferrets, but replicated to a similar titer as the wt virus in the upper and lower respiratory tract, suggesting that de-optimization of additional gene segments may be warranted for improved attenuation. Taken together, our data demonstrate the potential of using CPBD technology for the development of a live influenza virus vaccine if the level of attenuation is optimized. PMID:26655630

  9. Histone-Targeted Nucleic Acid Delivery for Tissue Regenerative Applications

    NASA Astrophysics Data System (ADS)

    Munsell, Erik V.

    Nucleic acid delivery has garnered significant attention as an innovative therapeutic approach for treating a wide variety of diseases. However, the design of non-viral delivery systems that negotiate efficient intracellular trafficking and nuclear entry represents a significant challenge. Overcoming these hurdles requires a combination of well-controlled materials approaches with techniques to understand and direct cellular delivery. Recent investigations have highlighted the roles histone tail sequences play in directing nuclear delivery and retention, as well as activating DNA transcription. We established the ability to recapitulate these natural histone tail activities within non-viral gene nanocarriers, driving gene transfer/expression by enabling effective navigation to the nucleus via retrograde vesicular trafficking. A unique finding of this histone-targeted approach was that nanocarriers gained enhanced access to the nucleus during mitosis. The work described in this dissertation builds off of these fundamental insights to facilitate the translation of this histone-targeted delivery approach toward regenerative medicine applications. During native tissue repair, actively proliferating mesenchymal stem cells (MSCs) respond to a complex series of growth factor signals that direct their differentiation. Accordingly, the investigations in this work focused on utilizing the histone-targeted nanocarriers to enhance osteogenic growth factor gene transfer in dividing MSCs leading to augmented MSC chondrogenic differentiation, an essential first step in skeletal tissue repair. Concurrently, additional studies focused on optimizing the histone-targeted nanocarrier design strategy to enable improved plasmid DNA (pDNA) binding stability and tunable harnessing of native cellular processing pathways for enhanced gene transfer. Overall, the work presented herein demonstrated substantial increases in growth factor expression following histone-targeted gene transfer. This enhanced expression enabled more robust levels of chondrogenesis in MSCs than treatments with equivalent amounts of recombinant growth factor protein. Additionally, nanocarrier design optimization provided effective pDNA condensation and controllable interactions with native histone effectors. Importantly, these optimized nanocarriers conferred stable nanoplex formation and maintained transfection efficiency under physiologically relevant conditions. Taken together, these advances may help drive the clinical translation of histone-targeted nucleic acid delivery strategies for the regeneration of damaged tissue following traumatic injury.

  10. Enhanced green fluorescent protein (egfp) gene expression in Tetraselmis subcordiformis chloroplast with endogenous regulators.

    PubMed

    Cui, Yulin; Zhao, Jialin; Hou, Shichang; Qin, Song

    2016-05-01

    On the basis of fundamental genetic transformation technologies, the goal of this study was to optimize Tetraselmis subcordiformis chloroplast transformation through the use of endogenous regulators. The genes rrn16S, rbcL, psbA, and psbC are commonly highly expressed in chloroplasts, and the regulators of these genes are often used in chloroplast transformation. For lack of a known chloroplast genome sequence, the genome-walking method was used here to obtain full sequences of T. subcordiformis endogenous regulators. The resulting regulators, including three promoters, two terminators, and a ribosome combination sequence, were inserted into the previously constructed plasmid pPSC-R, with the egfp gene included as a reporter gene, and five chloroplast expression vectors prepared. These vectors were successfully transformed into T. subcordiformis by particle bombardment and the efficiency of each vector tested by assessing EGFP fluorescence via microscopy. The results showed that these vectors exhibited higher efficiency than the former vector pPSC-G carrying exogenous regulators, and the vector pRFA with Prrn, psbA-5'RE, and TpsbA showed the highest efficiency. This research provides a set of effective endogenous regulators for T. subcordiformis and will facilitate future fundamental studies of this alga.

  11. RNA-Seq reveals 10 novel promising candidate genes affecting milk protein concentration in the Chinese Holstein population.

    PubMed

    Li, Cong; Cai, Wentao; Zhou, Chenghao; Yin, Hongwei; Zhang, Ziqi; Loor, Juan J; Sun, Dongxiao; Zhang, Qin; Liu, Jianfeng; Zhang, Shengli

    2016-06-02

    Paired-end RNA sequencing (RNA-Seq) was used to explore the bovine transcriptome from the mammary tissue of 12 Chinese Holstein cows with 6 extremely high and 6 low phenotypic values for milk protein percentage. We defined the differentially expressed transcripts between the two comparison groups, extremely high and low milk protein percentage during the peak lactation (HP vs LP) and during the non-lactating period (HD vs LD), respectively. Within the differentially expressed genes (DEGs), we detected 157 at peak lactation and 497 in the non-lactating period with a highly significant correlation with milk protein concentration. Integrated interpretation of differential gene expression indicated that SERPINA1, CLU, CNTFR, ERBB2, NEDD4L, ANG, GALE, HSPA8, LPAR6 and CD14 are the most promising candidate genes affecting milk protein concentration. Similarly, LTF, FCGR3A, MEGF10, RRM2 and UBE2C are the most promising candidates that in the non-lactating period could help the mammary tissue prevent issues with inflammation and udder disorders. Putative genes will be valuable resources for designing better breeding strategies to optimize the content of milk protein and also to provide new insights into regulation of lactogenesis.

  12. Expression stability and selection of optimal reference genes for gene expression normalization in early life stage rainbow trout exposed to cadmium and copper.

    PubMed

    Shekh, Kamran; Tang, Song; Niyogi, Som; Hecker, Markus

    2017-09-01

    Gene expression analysis represents a powerful approach to characterize the specific mechanisms by which contaminants interact with organisms. One of the key considerations when conducting gene expression analyses using quantitative real-time reverse transcription-polymerase chain reaction (qPCR) is the selection of appropriate reference genes, which is often overlooked. Specifically, to reach meaningful conclusions when using relative quantification approaches, expression levels of reference genes must be highly stable and cannot vary as a function of experimental conditions. However, to date, information on the stability of commonly used reference genes across developmental stages, tissues and after exposure to contaminants such as metals is lacking for many vertebrate species including teleost fish. Therefore, in this study, we assessed the stability of expression of 8 reference gene candidates in the gills and skin of three different early life-stages of rainbow trout after acute exposure (24h) to two metals, cadmium (Cd) and copper (Cu) using qPCR. Candidate housekeeping genes were: beta actin (b-actin), DNA directed RNA polymerase II subunit I (DRP2), elongation factor-1 alpha (EF1a), glyceraldehyde 3-phosphate dehydrogenase (GAPDH), glucose-6-phosphate dehydrogenase (G6PD), hypoxanthine phosphoribosyltransferase (HPRT), ribosomal protein L8 (RPL8), and 18S ribosomal RNA (18S). Four algorithms, geNorm, NormFinder, BestKeeper, and the comparative ΔCt method were employed to systematically evaluate the expression stability of these candidate genes under control and exposed conditions as well as across three different life-stages. Finally, stability of genes was ranked by taking geometric means of the ranks established by the different methods. Stability of reference genes was ranked in the following order (from lower to higher stability): HPRT

  13. Nutrigenomics and nutrigenetics.

    PubMed

    Farhud, Dd; Zarif Yeganeh, M; Zarif Yeganeh, M

    2010-01-01

    The nutrients are able to interact with molecular mechanisms and modulate the physiological functions in the body. The Nutritional Genomics focuses on the interaction between bioactive food components and the genome, which includes Nutrigenetics and Nutrigenomics. The influence of nutrients on f genes expression is called Nutrigenomics, while the heterogeneous response of gene variants to nutrients, dietary components and developing nutraceticals is called Nutrigenetics. Genetic variation is known to affect food tolerances among human subpopulations and may also influence dietary requirements and raising the possibility of individualizing nutritional intake for optimal health and disease prevention on the basis of an individual's genome. Nutrigenomics provides a genetic understanding for how common dietary components affect the balance between health and disease by altering the expression and/or structure of an individual's genetic makeup. Nutrigenetics describes that the genetic profile have impact on the response of body to bioactive food components by influencing their absorption, metabolism, and site of action.In this way, considering different aspects of gene-nutrient interaction and designing appropriate diet for every specific genotype that optimize individual health, diagnosis and nutritional treatment of genome instability, we could prevent and control conversion of healthy phenotype to diseases.

  14. Alpha-amylase from the Hyperthermophilic Archaeon Thermococcus thioreducens

    NASA Technical Reports Server (NTRS)

    Bernhardsdotter, E. C. M. J.; Pusey, M. L.; Ng, M. L.; Garriott, O. K.

    2003-01-01

    Extremophiles are microorganisms that thrive in, from an anthropocentric view, extreme environments such as hot springs. The ability of survival at extreme conditions has rendered enzymes from extremophiles to be of interest in industrial applications. One approach to producing these extremozymes entails the expression of the enzyme-encoding gene in a mesophilic host such as E.coli. This method has been employed in the effort to produce an alpha-amylase from a hyperthermophile (an organism that displays optimal growth above 80 C) isolated from a hydrothermal vent at the Rainbow vent site in the Atlantic Ocean. alpha-amylases catalyze the hydrolysis of starch to produce smaller sugars and constitute a class of industrial enzymes having approximately 25% of the enzyme market. One application for thermostable alpha-amylases is the starch liquefaction process in which starch is converted into fructose and glucose syrups. The a-amylase encoding gene from the hyperthermophile Thermococcus thioreducens was cloned and sequenced, revealing high similarity with other archaeal hyperthermophilic a-amylases. The gene encoding the mature protein was expressed in E.coli. Initial characterization of this enzyme has revealed an optimal amylolytic activity between 85-90 C and around pH 5.3-6.0.

  15. Identification of Suitable Reference Genes for Investigating Gene Expression in Anterior Cruciate Ligament Injury by Using Reverse Transcription-Quantitative PCR.

    PubMed

    Leal, Mariana Ferreira; Astur, Diego Costa; Debieux, Pedro; Arliani, Gustavo Gonçalves; Silveira Franciozi, Carlos Eduardo; Loyola, Leonor Casilla; Andreoli, Carlos Vicente; Smith, Marília Cardoso; Pochini, Alberto de Castro; Ejnisman, Benno; Cohen, Moises

    2015-01-01

    The anterior cruciate ligament (ACL) is one of the most frequently injured structures during high-impact sporting activities. Gene expression analysis may be a useful tool for understanding ACL tears and healing failure. Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) has emerged as an effective method for such studies. However, this technique requires the use of suitable reference genes for data normalization. Here, we evaluated the suitability of six reference genes (18S, ACTB, B2M, GAPDH, HPRT1, and TBP) by using ACL samples of 39 individuals with ACL tears (20 with isolated ACL tears and 19 with ACL tear and combined meniscal injury) and of 13 controls. The stability of the candidate reference genes was determined by using the NormFinder, geNorm, BestKeeper DataAssist, and RefFinder software packages and the comparative ΔCt method. ACTB was the best single reference gene and ACTB+TBP was the best gene pair. The GenEx software showed that the accumulated standard deviation is reduced when a larger number of reference genes is used for gene expression normalization. However, the use of a single reference gene may not be suitable. To identify the optimal combination of reference genes, we evaluated the expression of FN1 and PLOD1. We observed that at least 3 reference genes should be used. ACTB+HPRT1+18S is the best trio for the analyses involving isolated ACL tears and controls. Conversely, ACTB+TBP+18S is the best trio for the analyses involving (1) injured ACL tears and controls, and (2) ACL tears of patients with meniscal tears and controls. Therefore, if the gene expression study aims to compare non-injured ACL, isolated ACL tears and ACL tears from patients with meniscal tear as three independent groups ACTB+TBP+18S+HPRT1 should be used. In conclusion, 3 or more genes should be used as reference genes for analysis of ACL samples of individuals with and without ACL tears.

  16. Steady-state and dynamic gene expression programs in Saccharomyces cerevisiae in response to variation in environmental nitrogen

    PubMed Central

    Airoldi, Edoardo M.; Miller, Darach; Athanasiadou, Rodoniki; Brandt, Nathan; Abdul-Rahman, Farah; Neymotin, Benjamin; Hashimoto, Tatsu; Bahmani, Tayebeh; Gresham, David

    2016-01-01

    Cell growth rate is regulated in response to the abundance and molecular form of essential nutrients. In Saccharomyces cerevisiae (budding yeast), the molecular form of environmental nitrogen is a major determinant of cell growth rate, supporting growth rates that vary at least threefold. Transcriptional control of nitrogen use is mediated in large part by nitrogen catabolite repression (NCR), which results in the repression of specific transcripts in the presence of a preferred nitrogen source that supports a fast growth rate, such as glutamine, that are otherwise expressed in the presence of a nonpreferred nitrogen source, such as proline, which supports a slower growth rate. Differential expression of the NCR regulon and additional nitrogen-responsive genes results in >500 transcripts that are differentially expressed in cells growing in the presence of different nitrogen sources in batch cultures. Here we find that in growth rate–controlled cultures using nitrogen-limited chemostats, gene expression programs are strikingly similar regardless of nitrogen source. NCR expression is derepressed in all nitrogen-limiting chemostat conditions regardless of nitrogen source, and in these conditions, only 34 transcripts exhibit nitrogen source–specific differential gene expression. Addition of either the preferred nitrogen source, glutamine, or the nonpreferred nitrogen source, proline, to cells growing in nitrogen-limited chemostats results in rapid, dose-dependent repression of the NCR regulon. Using a novel means of computational normalization to compare global gene expression programs in steady-state and dynamic conditions, we find evidence that the addition of nitrogen to nitrogen-limited cells results in the transient overproduction of transcripts required for protein translation. Simultaneously, we find that that accelerated mRNA degradation underlies the rapid clearing of a subset of transcripts, which is most pronounced for the highly expressed NCR-regulated permease genes GAP1, MEP2, DAL5, PUT4, and DIP5. Our results reveal novel aspects of nitrogen-regulated gene expression and highlight the need for a quantitative approach to study how the cell coordinates protein translation and nitrogen assimilation to optimize cell growth in different environments. PMID:26941329

  17. Evaluation of Gene Expression Endpoints in the Context of a Xenopus laevis Metamorphosis-based Bioassay to Detect Thyroid Hormone Disruptors

    EPA Science Inventory

    This study accentuates the need to examine multiple tissues and provides critical information required for optimization of exposure regimens and endpoint assessments that focus on the detection of disruption in TH-regulatory systems.

  18. Efficient androst-1,4-diene-3,17-dione production by co-expressing 3-ketosteroid-Δ1 -dehydrogenase and catalase in Bacillus subtilis.

    PubMed

    Shao, M; Sha, Z; Zhang, X; Rao, Z; Xu, M; Yang, T; Xu, Z; Yang, S

    2017-01-01

    3-ketosteroid-Δ 1 -dehydrogenase (KSDD), a flavin adenine dinucleotide (FAD)-dependent enzyme involved in sterol metabolism, specifically catalyses the conversion of androst-4-ene-3,17-dione (AD) to androst-1,4-diene-3,17-dione (ADD). However, the low KSDD activity and the toxic effects of hydrogen peroxide (H 2 O 2 ) generated during the biotransformation of AD to ADD with FAD regeneration hinder its application on AD conversion. The aim of this work was to improve KSDD activity and eliminate the toxic effects of the generated H 2 O 2 to enhance ADD production. The ksdd gene obtained from Mycobacterium neoaurum JC-12 was codon-optimized to increase its expression level in Bacillus subtilis, and the KSDD activity reached 12·3 U mg -1 , which was sevenfold of that of codon-unoptimized gene. To improve AD conversion, catalase was co-expressed with KSDD in B. subtilis 168/pMA5-ksdd opt -katA to eliminate the toxic effects of H 2 O 2 generated during AD conversion. Finally, under optimized bioconversion conditions, fed-batch strategy was carried out and the ADD yield improved to 8·76 g l -1 . This work demonstrates the potential to improve enzyme activity by codon-optimization and eliminate the toxic effects of H 2 O 2 by co-expressing catalase. This study showed the highest ADD productivity ever reported and provides a promising strain for efficient ADD production in the pharmaceutical industry. © 2016 The Society for Applied Microbiology.

  19. Optimization of gene delivery methods in Xenopus laevis kidney (A6) and Chinese hamster ovary (CHO) cell lines for heterologous expression of Xenopus inner ear genes

    PubMed Central

    Ramirez-Gordillo, Daniel; Trujillo-Provencio, Casilda; Knight, V. Bleu; Serrano, Elba E.

    2014-01-01

    The Xenopus inner ear provides a useful model for studies of hearing and balance because it shares features with the mammalian inner ear, and because amphibians are capable of regenerating damaged mechanosensory hair cells. The structure and function of many proteins necessary for inner ear function have yet to be elucidated and require methods for analysis. To this end, we seek to characterize Xenopus inner ear genes outside of the animal model through heterologous expression in cell lines. As part of this effort, we aimed to optimize physical (electroporation), chemical (lipid-mediated; Lipofectamine™ 2000, Metafectene® Pro), and biological (viral-mediated; BacMam virus Cellular Lights™ Tubulin-RFP) gene delivery methods in amphibian (Xenopus; A6) cells and mammalian (Chinese hamster ovary (CHO)) cells. We successfully introduced the commercially available pEGFP-N3, pmCherry-N1, pEYFP-Tubulin, and Cellular Lights™ Tubulin-RFP fluorescent constructs to cells and evaluated their transfection or transduction efficiencies using the three gene delivery methods. In addition, we analyzed the transfection efficiency of a novel construct synthesized in our laboratory by cloning the Xenopus inner ear calcium-activated potassium channel β1 subunit, then subcloning the subunit into the pmCherry-N1 vector. Every gene delivery method was significantly more effective in CHO cells. Although results for the A6 cell line were not statistically significant, both cell lines illustrate a trend towards more efficient gene delivery using viral-mediated methods; however the cost of viral transduction is also much higher. Our findings demonstrate the need to improve gene delivery methods for amphibian cells and underscore the necessity for a greater understanding of amphibian cell biology. PMID:21959846

  20. Expression of recombinant myostatin propeptide pPIC9K-Msp plasmid in Pichia pastoris.

    PubMed

    Du, W; Xia, J; Zhang, Y; Liu, M J; Li, H B; Yan, X M; Zhang, J S; Li, N; Zhou, Z Y; Xie, W Z

    2015-12-28

    Myostatin propeptide can inhibit the biological activity of myostatin protein and promote muscle growth. To express myostatin propeptide in vitro with a higher biological activity, we performed codon optimization on the sheep myostatin propeptide gene sequence, and mutated aspartic acid-76 to alanine based on the codon usage bias of Pichia pastoris and the enhanced biological activity of myostatin propeptide mutant. Modified myostatin propeptide gene was cloned into the pPIC9K plasmid to form the recombinant plasmid pPIC9K-Msp. Recombinant plasmid pPIC9K-Msp was transformed into Pichia pastoris GS115 by electrotransformation. Transformed cells were screened, and methanol was used to induce expression. SDS-PAGE and western blotting were used to verify the successful expression of myostatin propeptide with biological activity in Pichia pastoris, providing the basis for characterization of this protein.

  1. Particle bombardment - mediated gene transfer and GFP transient expression in Seteria viridis.

    PubMed

    Mookkan, Muruganantham

    2018-04-03

    Setaria viridis is one of the most important model grasses in studying monocot plant biology. Transient gene expression study is a very important tool in plant biotechnology, functional genomics, and CRISPR-Cas9 genome editing technology via particle bombardment. In this study, a particle bombardment-mediated protocol was developed to introduce DNA into Setaria viridis in vitro leaf explants. In addition, physical and biological parameters, such as helium pressure, distance from stopping screen to the target tissues, DNA concentration, and number of bombardments, were tested and optimized. Optimum concentration of transient GFP expression was achieved using 1.5 ug plasmid DNA with 0.6 mm gold particles and 6 cm bombardment distance, using 1,100 psi. Doubling the bombardment instances provides the maximum number of foci of transient GFP expression. This simple protocol will be helpful for genomics studies in the S. viridis monocot model.

  2. Development and application of a T7 RNA polymerase-dependent expression system for antibiotic production improvement in Streptomyces.

    PubMed

    Wei, Junhong; Tian, Jinjin; Pan, Guoqing; Xie, Jie; Bao, Jialing; Zhou, Zeyang

    2017-06-01

    To develop a reliable and easy to use expression system for antibiotic production improvement of Streptomyces. A two-compound T7 RNA polymerase-dependent gene expression system was developed to fulfill this demand. In this system, the T7 RNA polymerase coding sequence was optimized based on the codon usage of Streptomyces coelicolor. To evaluate the functionality of this system, we constructed an activator gene overexpression strain for enhancement of actinorhodin production. By overexpression of the positive regulator actII-ORF4 with this system, the maximum actinorhodin yield of engineered strain was 15-fold higher and the fermentation time was decreased by 48 h. The modified two-compound T7 expression system improves both antibiotic production and accelerates the fermentation process in Streptomyces. This provides a general and useful strategy for strain improvement of important antibiotic producing Streptomyces strains.

  3. Characterization of reference genes for qPCR analysis in various tissues of the Fujian oyster Crassostrea angulata

    NASA Astrophysics Data System (ADS)

    Pu, Fei; Yang, Bingye; Ke, Caihuan

    2015-07-01

    Accurate quantification of transcripts using quantitative real-time polymerase chain reaction (qPCR) depends on the identification of reliable reference genes for normalization. This study aimed to identify and validate seven reference genes, including actin-2 ( ACT-2), elongation factor 1 alpha ( EF-1α), elongation factor 1 beta ( EF-1β), glyceraldehyde-3-phosphate dehydrogenase ( GAPDH), ubiquitin ( UBQ), β-tubulin ( β-TUB), and 18S ribosomal RNA, from Crassostrea angulata, a valuable marine bivalve cultured worldwide. Transcript levels of the candidate reference genes were examined using qPCR analysis and showed differential expression patterns in the mantle, gill, adductor muscle, labial palp, visceral mass, hemolymph and gonad tissues. Quantitative data were analyzed using the geNorm software to assess the expression stability of the candidate reference genes, revealing that β-TUB and UBQ were the most stable genes. The commonly used GAPDH and 18S rRNA showed low stability, making them unsuitable candidates in this system. The expression pattern of the G protein β-subunit gene ( Gβ) across tissue types was also examined and normalized to the expression of each or both of UBQ and β-TUB as internal controls. This revealed consistent trends with all three normalization approaches, thus validating the reliability of UBQ and β-TUB as optimal internal controls. The study provides the first validated reference genes for accurate data normalization in transcript profiling in Crassostrea angulata, which will be indispensable for further functional genomics studies in this economically valuable marine bivalve.

  4. Histone Methylation Restrains the Expression of Subtype-Specific Genes during Terminal Neuronal Differentiation in Caenorhabditis elegans

    PubMed Central

    Chiang, Victor; Chalfie, Martin

    2013-01-01

    Although epigenetic control of stem cell fate choice is well established, little is known about epigenetic regulation of terminal neuronal differentiation. We found that some differences among the subtypes of Caenorhabditis elegans VC neurons, particularly the expression of the transcription factor gene unc-4, require histone modification, most likely H3K9 methylation. An EGF signal from the vulva alleviated the epigenetic repression of unc-4 in vulval VC neurons but not the more distant nonvulval VC cells, which kept unc-4 silenced. Loss of the H3K9 methyltransferase MET-2 or H3K9me2/3 binding proteins HPL-2 and LIN-61 or a novel chromodomain protein CEC-3 caused ectopic unc-4 expression in all VC neurons. Downstream of the EGF signaling in vulval VC neurons, the transcription factor LIN-11 and histone demethylases removed the suppressive histone marks and derepressed unc-4. Behaviorally, expression of UNC-4 in all the VC neurons caused an imbalance in the egg-laying circuit. Thus, epigenetic mechanisms help establish subtype-specific gene expression, which are needed for optimal activity of a neural circuit. PMID:24348272

  5. Inferring Gene Regulatory Networks by Singular Value Decomposition and Gravitation Field Algorithm

    PubMed Central

    Zheng, Ming; Wu, Jia-nan; Huang, Yan-xin; Liu, Gui-xia; Zhou, You; Zhou, Chun-guang

    2012-01-01

    Reconstruction of gene regulatory networks (GRNs) is of utmost interest and has become a challenge computational problem in system biology. However, every existing inference algorithm from gene expression profiles has its own advantages and disadvantages. In particular, the effectiveness and efficiency of every previous algorithm is not high enough. In this work, we proposed a novel inference algorithm from gene expression data based on differential equation model. In this algorithm, two methods were included for inferring GRNs. Before reconstructing GRNs, singular value decomposition method was used to decompose gene expression data, determine the algorithm solution space, and get all candidate solutions of GRNs. In these generated family of candidate solutions, gravitation field algorithm was modified to infer GRNs, used to optimize the criteria of differential equation model, and search the best network structure result. The proposed algorithm is validated on both the simulated scale-free network and real benchmark gene regulatory network in networks database. Both the Bayesian method and the traditional differential equation model were also used to infer GRNs, and the results were used to compare with the proposed algorithm in our work. And genetic algorithm and simulated annealing were also used to evaluate gravitation field algorithm. The cross-validation results confirmed the effectiveness of our algorithm, which outperforms significantly other previous algorithms. PMID:23226565

  6. Successful transient expression of Cas9 and single guide RNA genes in Chlamydomonas reinhardtii.

    PubMed

    Jiang, Wenzhi; Brueggeman, Andrew J; Horken, Kempton M; Plucinak, Thomas M; Weeks, Donald P

    2014-11-01

    The clustered regularly interspaced short palindromic repeat (CRISPR)/Cas9 system has become a powerful and precise tool for targeted gene modification (e.g., gene knockout and gene replacement) in numerous eukaryotic organisms. Initial attempts to apply this technology to a model, the single-cell alga, Chlamydomonas reinhardtii, failed to yield cells containing edited genes. To determine if the Cas9 and single guide RNA (sgRNA) genes were functional in C. reinhardtii, we tested the ability of a codon-optimized Cas9 gene along with one of four different sgRNAs to cause targeted gene disruption during a 24-h period immediately following transformation. All three exogenously supplied gene targets as well as the endogenous FKB12 (rapamycin sensitivity) gene of C. reinhardtii displayed distinct Cas9/sgRNA-mediated target site modifications as determined by DNA sequencing of cloned PCR amplicons of the target site region. Success in transient expression of Cas9 and sgRNA genes contrasted with the recovery of only a single rapamycin-resistant colony bearing an appropriately modified FKB12 target site in 16 independent transformation experiments involving >10(9) cells. Failure to recover transformants with intact or expressed Cas9 genes following transformation with the Cas9 gene alone (or even with a gene encoding a Cas9 lacking nuclease activity) provided strong suggestive evidence for Cas9 toxicity when Cas9 is produced constitutively in C. reinhardtii. The present results provide compelling evidence that Cas9 and sgRNA genes function properly in C. reinhardtii to cause targeted gene modifications and point to the need for a focus on development of methods to properly stem Cas9 production and/or activity following gene editing. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  7. Rapid Evolution of Ovarian-Biased Genes in the Yellow Fever Mosquito (Aedes aegypti).

    PubMed

    Whittle, Carrie A; Extavour, Cassandra G

    2017-08-01

    Males and females exhibit highly dimorphic phenotypes, particularly in their gonads, which is believed to be driven largely by differential gene expression. Typically, the protein sequences of genes upregulated in males, or male-biased genes, evolve rapidly as compared to female-biased and unbiased genes. To date, the specific study of gonad-biased genes remains uncommon in metazoans. Here, we identified and studied a total of 2927, 2013, and 4449 coding sequences (CDS) with ovary-biased, testis-biased, and unbiased expression, respectively, in the yellow fever mosquito Aedes aegypti The results showed that ovary-biased and unbiased CDS had higher nonsynonymous to synonymous substitution rates (dN/dS) and lower optimal codon usage (those codons that promote efficient translation) than testis-biased genes. Further, we observed higher dN/dS in ovary-biased genes than in testis-biased genes, even for genes coexpressed in nonsexual (embryo) tissues. Ovary-specific genes evolved exceptionally fast, as compared to testis- or embryo-specific genes, and exhibited higher frequency of positive selection. Genes with ovary expression were preferentially involved in olfactory binding and reception. We hypothesize that at least two potential mechanisms could explain rapid evolution of ovary-biased genes in this mosquito: (1) the evolutionary rate of ovary-biased genes may be accelerated by sexual selection (including female-female competition or male-mate choice) affecting olfactory genes during female swarming by males, and/or by adaptive evolution of olfactory signaling within the female reproductive system ( e.g. , sperm-ovary signaling); and/or (2) testis-biased genes may exhibit decelerated evolutionary rates due to the formation of mating plugs in the female after copulation, which limits male-male sperm competition. Copyright © 2017 by the Genetics Society of America.

  8. An ant colony optimization based algorithm for identifying gene regulatory elements.

    PubMed

    Liu, Wei; Chen, Hanwu; Chen, Ling

    2013-08-01

    It is one of the most important tasks in bioinformatics to identify the regulatory elements in gene sequences. Most of the existing algorithms for identifying regulatory elements are inclined to converge into a local optimum, and have high time complexity. Ant Colony Optimization (ACO) is a meta-heuristic method based on swarm intelligence and is derived from a model inspired by the collective foraging behavior of real ants. Taking advantage of the ACO in traits such as self-organization and robustness, this paper designs and implements an ACO based algorithm named ACRI (ant-colony-regulatory-identification) for identifying all possible binding sites of transcription factor from the upstream of co-expressed genes. To accelerate the ants' searching process, a strategy of local optimization is presented to adjust the ants' start positions on the searched sequences. By exploiting the powerful optimization ability of ACO, the algorithm ACRI can not only improve precision of the results, but also achieve a very high speed. Experimental results on real world datasets show that ACRI can outperform other traditional algorithms in the respects of speed and quality of solutions. Copyright © 2013 Elsevier Ltd. All rights reserved.

  9. Optimization of Light-Harvesting Pigment Improves Photosynthetic Efficiency.

    PubMed

    Jin, Honglei; Li, Mengshu; Duan, Sujuan; Fu, Mei; Dong, Xiaoxiao; Liu, Bing; Feng, Dongru; Wang, Jinfa; Wang, Hong-Bin

    2016-11-01

    Maximizing light capture by light-harvesting pigment optimization represents an attractive but challenging strategy to improve photosynthetic efficiency. Here, we report that loss of a previously uncharacterized gene, HIGH PHOTOSYNTHETIC EFFICIENCY1 (HPE1), optimizes light-harvesting pigments, leading to improved photosynthetic efficiency and biomass production. Arabidopsis (Arabidopsis thaliana) hpe1 mutants show faster electron transport and increased contents of carbohydrates. HPE1 encodes a chloroplast protein containing an RNA recognition motif that directly associates with and regulates the splicing of target RNAs of plastid genes. HPE1 also interacts with other plastid RNA-splicing factors, including CAF1 and OTP51, which share common targets with HPE1. Deficiency of HPE1 alters the expression of nucleus-encoded chlorophyll-related genes, probably through plastid-to-nucleus signaling, causing decreased total content of chlorophyll (a+b) in a limited range but increased chlorophyll a/b ratio. Interestingly, this adjustment of light-harvesting pigment reduces antenna size, improves light capture, decreases energy loss, mitigates photodamage, and enhances photosynthetic quantum yield during photosynthesis. Our findings suggest a novel strategy to optimize light-harvesting pigments that improves photosynthetic efficiency and biomass production in higher plants. © 2016 American Society of Plant Biologists. All Rights Reserved.

  10. Optimization of Light-Harvesting Pigment Improves Photosynthetic Efficiency1[OPEN

    PubMed Central

    Jin, Honglei; Li, Mengshu; Duan, Sujuan; Fu, Mei; Dong, Xiaoxiao; Feng, Dongru; Wang, Jinfa

    2016-01-01

    Maximizing light capture by light-harvesting pigment optimization represents an attractive but challenging strategy to improve photosynthetic efficiency. Here, we report that loss of a previously uncharacterized gene, HIGH PHOTOSYNTHETIC EFFICIENCY1 (HPE1), optimizes light-harvesting pigments, leading to improved photosynthetic efficiency and biomass production. Arabidopsis (Arabidopsis thaliana) hpe1 mutants show faster electron transport and increased contents of carbohydrates. HPE1 encodes a chloroplast protein containing an RNA recognition motif that directly associates with and regulates the splicing of target RNAs of plastid genes. HPE1 also interacts with other plastid RNA-splicing factors, including CAF1 and OTP51, which share common targets with HPE1. Deficiency of HPE1 alters the expression of nucleus-encoded chlorophyll-related genes, probably through plastid-to-nucleus signaling, causing decreased total content of chlorophyll (a+b) in a limited range but increased chlorophyll a/b ratio. Interestingly, this adjustment of light-harvesting pigment reduces antenna size, improves light capture, decreases energy loss, mitigates photodamage, and enhances photosynthetic quantum yield during photosynthesis. Our findings suggest a novel strategy to optimize light-harvesting pigments that improves photosynthetic efficiency and biomass production in higher plants. PMID:27609860

  11. The Essential Role of the Deinococcus radiodurans ssb Gene in Cell Survival and Radiation Tolerance

    PubMed Central

    Lockhart, J. Scott; DeVeaux, Linda C.

    2013-01-01

    Recent evidence has implicated single-stranded DNA-binding protein (SSB) expression level as an important factor in microbial radiation resistance. The genome of the extremely radiation resistant bacterium Deinococcus radiodurans contains genes for two SSB homologs: the homodimeric, canonical Ssb, encoded by the gene ssb, and a novel pentameric protein encoded by the gene ddrB. ddrB is highly induced upon exposure to radiation, and deletions result in decreased radiation-resistance, suggesting an integral role of the protein in the extreme resistance exhibited by this organism. Although expression of ssb is also induced after irradiation, Ssb is thought to be involved primarily in replication. In this study, we demonstrate that Ssb in D. radiodurans is essential for cell survival. The lethality of an ssb deletion cannot be complemented by providing ddrB in trans. In addition, the radiation-sensitive phenotype conferred by a ddrB deletion is not alleviated by providing ssb in trans. By altering expression of the ssb gene, we also show that lower levels of transcription are required for optimal growth than are necessary for high radiation resistance. When expression is reduced to that of E. coli, ionizing radiation resistance is similarly reduced. UV resistance is also decreased under low ssb transcript levels where growth is unimpaired. These results indicate that the expression of ssb is a key component of both normal cellular metabolism as well as pathways responsible for the high radiation tolerance of D. radiodurans. PMID:23951213

  12. Pathway activity inference for multiclass disease classification through a mathematical programming optimisation framework.

    PubMed

    Yang, Lingjian; Ainali, Chrysanthi; Tsoka, Sophia; Papageorgiou, Lazaros G

    2014-12-05

    Applying machine learning methods on microarray gene expression profiles for disease classification problems is a popular method to derive biomarkers, i.e. sets of genes that can predict disease state or outcome. Traditional approaches where expression of genes were treated independently suffer from low prediction accuracy and difficulty of biological interpretation. Current research efforts focus on integrating information on protein interactions through biochemical pathway datasets with expression profiles to propose pathway-based classifiers that can enhance disease diagnosis and prognosis. As most of the pathway activity inference methods in literature are either unsupervised or applied on two-class datasets, there is good scope to address such limitations by proposing novel methodologies. A supervised multiclass pathway activity inference method using optimisation techniques is reported. For each pathway expression dataset, patterns of its constituent genes are summarised into one composite feature, termed pathway activity, and a novel mathematical programming model is proposed to infer this feature as a weighted linear summation of expression of its constituent genes. Gene weights are determined by the optimisation model, in a way that the resulting pathway activity has the optimal discriminative power with regards to disease phenotypes. Classification is then performed on the resulting low-dimensional pathway activity profile. The model was evaluated through a variety of published gene expression profiles that cover different types of disease. We show that not only does it improve classification accuracy, but it can also perform well in multiclass disease datasets, a limitation of other approaches from the literature. Desirable features of the model include the ability to control the maximum number of genes that may participate in determining pathway activity, which may be pre-specified by the user. Overall, this work highlights the potential of building pathway-based multi-phenotype classifiers for accurate disease diagnosis and prognosis problems.

  13. Tabu search and binary particle swarm optimization for feature selection using microarray data.

    PubMed

    Chuang, Li-Yeh; Yang, Cheng-Huei; Yang, Cheng-Hong

    2009-12-01

    Gene expression profiles have great potential as a medical diagnosis tool because they represent the state of a cell at the molecular level. In the classification of cancer type research, available training datasets generally have a fairly small sample size compared to the number of genes involved. This fact poses an unprecedented challenge to some classification methodologies due to training data limitations. Therefore, a good selection method for genes relevant for sample classification is needed to improve the predictive accuracy, and to avoid incomprehensibility due to the large number of genes investigated. In this article, we propose to combine tabu search (TS) and binary particle swarm optimization (BPSO) for feature selection. BPSO acts as a local optimizer each time the TS has been run for a single generation. The K-nearest neighbor method with leave-one-out cross-validation and support vector machine with one-versus-rest serve as evaluators of the TS and BPSO. The proposed method is applied and compared to the 11 classification problems taken from the literature. Experimental results show that our method simplifies features effectively and either obtains higher classification accuracy or uses fewer features compared to other feature selection methods.

  14. Genetical Toxicogenomics in Drosophila Identifies Master Modulatory Loci that are Regulated by Developmental Exposure to Lead

    PubMed Central

    Ruden, Douglas M.; Chen, Lang; Possidente, Debra; Possidente, Bernard; Rasouli, Parsa; Wang, Luan; Lu, Xiangyi; Garfinkel, Mark D.; Hirsch, Helmut V. B.; Page, Grier P.

    2009-01-01

    The genetics of gene expression in recombinant inbred lines (RILs) can be mapped as expression quantitative trait loci (eQTLs). So-called “genetical genomics” studies have identified locally-acting eQTLs (cis-eQTLs) for genes that show differences in steady state RNA levels. These studies have also identified distantly-acting master-modulatory trans-eQTLs that regulate tens or hundreds of transcripts (hotspots or transbands). We expand on these studies by performing genetical genomics experiments in two environments in order to identify trans-eQTL that might be regulated by developmental exposure to the neurotoxin lead. Flies from each of 75 RIL were raised from eggs to adults on either control food (made with 250 µM sodium acetate), or lead-treated food (made with 250 µM lead acetate, PbAc). RNA expression analyses of whole adult male flies (5–10 days old) were performed with Affymetrix DrosII whole genome arrays (18,952 probesets). Among the 1,389 genes with cis-eQTL, there were 405 genes unique to control flies and 544 genes unique to lead-treated ones (440 genes had the same cis-eQTLs in both samples). There are 2,396 genes with trans-eQTL which mapped to 12 major transbands with greater than 95 genes. Permutation analyses of the strain labels but not the expression data suggests that the total number of eQTL and the number of transbands are more important criteria for validation than the size of the transband. Two transbands, one located on the 2nd chromosome and one on the 3rd chromosome, co-regulate 33 lead-induced genes, many of which are involved in neurodevelopmental processes. For these 33 genes, rather than allelic variation at one locus exerting differential effects in two environments, we found that variation at two different loci are required for optimal effects on lead-induced expression. PMID:19737576

  15. A targeted gene expression platform allows for rapid analysis of chemical-induced antioxidant mRNA expression in zebrafish larvae.

    PubMed

    Mills, Margaret G; Gallagher, Evan P

    2017-01-01

    Chemical-induced oxidative stress and the biochemical pathways that protect against oxidative damage are of particular interest in the field of toxicology. To rapidly identify oxidative stress-responsive gene expression changes in zebrafish, we developed a targeted panel of antioxidant genes using the Affymetrix QuantiGene Plex (QGP) platform. The genes contained in our panel include eight putative Nrf2 (Nfe2l2a)-dependent antioxidant genes (hmox1a, gstp1, gclc, nqo1, prdx1, gpx1a, sod1, sod2), a stress response gene (hsp70), an inducible DNA damage repair gene (gadd45bb), and three reference genes (actb1, gapdh, hprt1). We tested this platform on larval zebrafish exposed to tert-butyl hydroperoxide (tBHP) and cadmium (Cd), two model oxidative stressors with different modes of action, and compared our results with those obtained using the more common quantitative PCR (qPCR) method. Both methods showed that exposure to tBHP and Cd induced expression of prdx1, gstp1, and hmox1a (2- to 12-fold increase via QGP), indicative of an activated Nrf2 response in larval zebrafish. Both compounds also elicited a general stress response as reflected by elevation of hsp70 and gadd45bb, with Cd being the more potent inducer. Transient changes were observed in sod2 and gpx1a expression, whereas nqo1, an Nrf2-responsive gene in mammalian cells, was minimally affected by either tBHP or Cd chemical exposures. Developmental expression analysis of the target genes by QGP revealed marked upregulation of sod2 between 0-96hpf, and to a lesser extent, of sod1 and gstp1. Once optimized, QGP analysis of these experiments was accomplished more rapidly, using far less tissue, and at lower total costs than qPCR analysis. In summary, the QGP platform as applied to higher-throughput zebrafish studies provides a reasonable cost-effective alternative to qPCR or more comprehensive transcriptomics approaches to rapidly assess the potential for chemicals to elicit oxidative stress as a mechanism of chemical toxicity.

  16. Dehydrogenase GRD1 Represents a Novel Component of the Cellulase Regulon in Trichoderma reesei (Hypocrea jecorina) ▿ † §

    PubMed Central

    Schuster, André; Kubicek, Christian P.; Schmoll, Monika

    2011-01-01

    Trichoderma reesei (Hypocrea jecorina) is nowadays the most important industrial producer of cellulase and hemicellulase enzymes, which are used for pretreatment of cellulosic biomass for biofuel production. In this study, we introduce a novel component, GRD1 (glucose-ribitol dehydrogenase 1), which shows enzymatic activity on cellobiose and positively influences cellulase gene transcription, expression, and extracellular endo-1,4-β-d-glucanase activity. grd1 is differentially transcribed upon growth on cellulose and the induction of cellulase gene expression by sophorose. The transcription of grd1 is coregulated with that of cel7a (cbh1) under inducing conditions. GRD1 is further involved in carbon source utilization on several carbon sources, such as those involved in lactose and d-galactose catabolism, in several cases in a light-dependent manner. We conclude that GRD1 represents a novel enhancer of cellulase gene expression, which by coregulation with the major cellulase may act via optimization of inducing mechanisms. PMID:21602376

  17. Csf2 null mutation alters placental gene expression and trophoblast glycogen cell and giant cell abundance in mice.

    PubMed

    Sferruzzi-Perri, Amanda N; Macpherson, Anne M; Roberts, Claire T; Robertson, Sarah A

    2009-07-01

    Genetic deficiency in granulocyte-macrophage colony-stimulating factor (CSF2, GM-CSF) results in altered placental structure in mice. To investigate the mechanism of action of CSF2 in placental morphogenesis, the placental gene expression and cell composition were examined in Csf2 null mutant and wild-type mice. Microarray and quantitative RT-PCR analyses on Embryonic Day (E) 13 placentae revealed that the Csf2 null mutation caused altered expression of 17 genes not previously known to be associated with placental development, including Mid1, Cd24a, Tnfrsf11b, and Wdfy1. Genes controlling trophoblast differentiation (Ascl2, Tcfeb, Itgav, and Socs3) were also differentially expressed. The CSF2 ligand and the CSF2 receptor alpha subunit were predominantly synthesized in the placental junctional zone. Altered placental structure in Csf2 null mice at E15 was characterized by an expanded junctional zone and by increased Cx31(+) glycogen cells and cyclin-dependent kinase inhibitor 1C (CDKN1C(+), P57(Kip2+)) giant cells, accompanied by elevated junctional zone transcription of genes controlling spongiotrophoblast and giant cell differentiation and secretory function (Ascl2, Hand1, Prl3d1, and Prl2c2). Granzyme genes implicated in tissue remodeling and potentially in trophoblast invasion (Gzmc, Gzme, and Gzmf) were downregulated in the junctional zone of Csf2 null mutant placentae. These data demonstrate aberrant placental gene expression in Csf2 null mutant mice that is associated with altered differentiation and/or functional maturation of junctional zone trophoblast lineages, glycogen cells, and giant cells. We conclude that CSF2 is a regulator of trophoblast differentiation and placental development, which potentially influences the functional capacity of the placenta to support optimal fetal growth in pregnancy.

  18. Dynamic modelling of microRNA regulation during mesenchymal stem cell differentiation.

    PubMed

    Weber, Michael; Sotoca, Ana M; Kupfer, Peter; Guthke, Reinhard; van Zoelen, Everardus J

    2013-11-12

    Network inference from gene expression data is a typical approach to reconstruct gene regulatory networks. During chondrogenic differentiation of human mesenchymal stem cells (hMSCs), a complex transcriptional network is active and regulates the temporal differentiation progress. As modulators of transcriptional regulation, microRNAs (miRNAs) play a critical role in stem cell differentiation. Integrated network inference aimes at determining interrelations between miRNAs and mRNAs on the basis of expression data as well as miRNA target predictions. We applied the NetGenerator tool in order to infer an integrated gene regulatory network. Time series experiments were performed to measure mRNA and miRNA abundances of TGF-beta1+BMP2 stimulated hMSCs. Network nodes were identified by analysing temporal expression changes, miRNA target gene predictions, time series correlation and literature knowledge. Network inference was performed using NetGenerator to reconstruct a dynamical regulatory model based on the measured data and prior knowledge. The resulting model is robust against noise and shows an optimal trade-off between fitting precision and inclusion of prior knowledge. It predicts the influence of miRNAs on the expression of chondrogenic marker genes and therefore proposes novel regulatory relations in differentiation control. By analysing the inferred network, we identified a previously unknown regulatory effect of miR-524-5p on the expression of the transcription factor SOX9 and the chondrogenic marker genes COL2A1, ACAN and COL10A1. Genome-wide exploration of miRNA-mRNA regulatory relationships is a reasonable approach to identify miRNAs which have so far not been associated with the investigated differentiation process. The NetGenerator tool is able to identify valid gene regulatory networks on the basis of miRNA and mRNA time series data.

  19. Sleeping Beauty-baculovirus hybrid vectors for long-term gene expression in the eye.

    PubMed

    Turunen, Tytteli Anni Kaarina; Laakkonen, Johanna Päivikki; Alasaarela, Laura; Airenne, Kari Juhani; Ylä-Herttuala, Seppo

    2014-01-01

    A baculovirus vector is capable of efficiently transducing many nondiving and diving cell types. However, the potential of baculovirus is restricted for many gene delivery applications as a result of the transient gene expression that it mediates. The plasmid-based Sleeping Beauty (SB) transposon system integrates transgenes into target cell genome efficiently with a genomic integration pattern that is generally considered safer than the integration of many other integrating vectors; yet efficient delivery of therapeutic genes into cells of target tissues in vivo is a major challenge for nonviral gene therapy. In the present study, SB was introduced into baculovirus to obtain novel hybrid vectors that would combine the best features of the two vector systems (i.e. effective gene delivery and efficient integration into the genome), thus circumventing the major limitations of these vectors. We constructed and optimized SB-baculovirus hybrid vectors that bear either SB100x transposase or SB transposon in the forward or reverse orientations with respect to the viral backbone The functionality of the novel hybrid vectors was investigated in cell cultures and in a proof-of-concept study in the mouse eye. The hybrid vectors showed high and sustained transgene expression that remained stable and demonstrated no signs of decline during the 2 months follow-up in vitro. These results were verified in the mouse eye where persistent transgene expression was detected two months after intravitreal injection. Our results confirm that (i) SB-baculovirus hybrid vectors mediate long-term gene expression in vitro and in vivo, and (ii) the hybrid vectors are potential new tools for the treatment of ocular diseases. Copyright © 2014 John Wiley & Sons, Ltd.

  20. Avian Paramyxovirus Type-3 as a Vaccine Vector: Identification of a Genome Location for High Level Expression of a Foreign Gene

    PubMed Central

    Yoshida, Asuka; Samal, Siba K.

    2017-01-01

    Avian paramyxovirus serotype 3 (APMV-3) causes infection in a wide variety of avian species, but it does not cause apparent diseases in chickens. On the contrary, APMV-1, also known as Newcastle disease virus (NDV), can cause severe disease in chickens. Currently, natural low virulence strains of NDV are used as live-attenuated vaccines throughout the world. NDV is also being evaluated as a vaccine vector against poultry pathogens. However, due to routine vaccination programs, chickens often possess pre-existing antibodies against NDV, which may cause the chickens to be less sensitive to recombinant NDV vaccines expressing antigens of other avian pathogens. Therefore, it may be possible for an APMV-3 vector vaccine to circumvent this issue. In this study, we determined the optimal insertion site in the genome of APMV-3 for high level expression of a foreign gene. We generated recombinant APMV-3 viruses expressing the green fluorescent protein (GFP) by inserting the GFP gene at five different intergenic regions in the genome. The levels of GFP transcription and translation were evaluated. Interestingly, the levels of GFP transcription and translation did not follow the 3′-to-5′ attenuation mechanism of non-segmented, negative-sense RNA viruses. The insertion of GFP gene into the P-M gene junction resulted in higher level of expression of GFP than when the gene was inserted into the upstream N-P gene junction. Unlike NDV, insertion of GFP did not attenuate the growth efficiency of AMPV-3. Thus, APMV-3 could be a more useful vaccine vector for avian pathogens than NDV. PMID:28473820

  1. Avian Paramyxovirus Type-3 as a Vaccine Vector: Identification of a Genome Location for High Level Expression of a Foreign Gene.

    PubMed

    Yoshida, Asuka; Samal, Siba K

    2017-01-01

    Avian paramyxovirus serotype 3 (APMV-3) causes infection in a wide variety of avian species, but it does not cause apparent diseases in chickens. On the contrary, APMV-1, also known as Newcastle disease virus (NDV), can cause severe disease in chickens. Currently, natural low virulence strains of NDV are used as live-attenuated vaccines throughout the world. NDV is also being evaluated as a vaccine vector against poultry pathogens. However, due to routine vaccination programs, chickens often possess pre-existing antibodies against NDV, which may cause the chickens to be less sensitive to recombinant NDV vaccines expressing antigens of other avian pathogens. Therefore, it may be possible for an APMV-3 vector vaccine to circumvent this issue. In this study, we determined the optimal insertion site in the genome of APMV-3 for high level expression of a foreign gene. We generated recombinant APMV-3 viruses expressing the green fluorescent protein (GFP) by inserting the GFP gene at five different intergenic regions in the genome. The levels of GFP transcription and translation were evaluated. Interestingly, the levels of GFP transcription and translation did not follow the 3'-to-5' attenuation mechanism of non-segmented, negative-sense RNA viruses. The insertion of GFP gene into the P-M gene junction resulted in higher level of expression of GFP than when the gene was inserted into the upstream N-P gene junction. Unlike NDV, insertion of GFP did not attenuate the growth efficiency of AMPV-3. Thus, APMV-3 could be a more useful vaccine vector for avian pathogens than NDV.

  2. Validation of reference genes for quantitative real-time PCR during leaf and flower development in Petunia hybrida

    PubMed Central

    2010-01-01

    Background Identification of genes with invariant levels of gene expression is a prerequisite for validating transcriptomic changes accompanying development. Ideally expression of these genes should be independent of the morphogenetic process or environmental condition tested as well as the methods used for RNA purification and analysis. Results In an effort to identify endogenous genes meeting these criteria nine reference genes (RG) were tested in two Petunia lines (Mitchell and V30). Growth conditions differed in Mitchell and V30, and different methods were used for RNA isolation and analysis. Four different software tools were employed to analyze the data. We merged the four outputs by means of a non-weighted unsupervised rank aggregation method. The genes identified as optimal for transcriptomic analysis of Mitchell and V30 were EF1α in Mitchell and CYP in V30, whereas the least suitable gene was GAPDH in both lines. Conclusions The least adequate gene turned out to be GAPDH indicating that it should be rejected as reference gene in Petunia. The absence of correspondence of the best-suited genes suggests that assessing reference gene stability is needed when performing normalization of data from transcriptomic analysis of flower and leaf development. PMID:20056000

  3. Optimization of Retinal Gene Therapy for X-Linked Retinitis Pigmentosa Due to RPGR Mutations.

    PubMed

    Beltran, William A; Cideciyan, Artur V; Boye, Shannon E; Ye, Guo-Jie; Iwabe, Simone; Dufour, Valerie L; Marinho, Luis Felipe; Swider, Malgorzata; Kosyk, Mychajlo S; Sha, Jin; Boye, Sanford L; Peterson, James J; Witherspoon, C Douglas; Alexander, John J; Ying, Gui-Shuang; Shearman, Mark S; Chulay, Jeffrey D; Hauswirth, William W; Gamlin, Paul D; Jacobson, Samuel G; Aguirre, Gustavo D

    2017-08-02

    X-linked retinitis pigmentosa (XLRP) caused by mutations in the RPGR gene is an early onset and severe cause of blindness. Successful proof-of-concept studies in a canine model have recently shown that development of a corrective gene therapy for RPGR-XLRP may now be an attainable goal. In preparation for a future clinical trial, we have here optimized the therapeutic AAV vector construct by showing that GRK1 (rather than IRBP) is a more efficient promoter for targeting gene expression to both rods and cones in non-human primates. Two transgenes were used in RPGR mutant (XLPRA2) dogs under the control of the GRK1 promoter. First was the previously developed stabilized human RPGR (hRPGRstb). Second was a new full-length stabilized and codon-optimized human RPGR (hRPGRco). Long-term (>2 years) studies with an AAV2/5 vector carrying hRPGRstb under control of the GRK1 promoter showed rescue of rods and cones from degeneration and retention of vision. Shorter term (3 months) studies demonstrated comparable preservation of photoreceptors in canine eyes treated with an AAV2/5 vector carrying either transgene under the control of the GRK1 promoter. These results provide the critical molecular components (GRK1 promoter, hRPGRco transgene) to now construct a therapeutic viral vector optimized for RPGR-XLRP patients. Copyright © 2017 The American Society of Gene and Cell Therapy. Published by Elsevier Inc. All rights reserved.

  4. Expression of six peptidases from Lactobacillus helveticus in Lactococcus lactis.

    PubMed

    Luoma, S; Peltoniemi, K; Joutsjoki, V; Rantanen, T; Tamminen, M; Heikkinen, I; Palva, A

    2001-03-01

    For development of novel starter strains with improved proteolytic properties, the ability of Lactococcus lactis to produce Lactobacillus helveticus aminopeptidase N (PepN), aminopeptidase C (PepC), X-prolyl dipeptidyl aminopeptidase (PepX), proline iminopeptidase (PepI), prolinase (PepR), and dipeptidase (PepD) was studied by introducing the genes encoding these enzymes into L. lactis MG1363 and its derivatives. According to Northern analyses and enzyme activity measurements, the L. helveticus aminopeptidase genes pepN, pepC, and pepX are expressed under the control of their own promoters in L. lactis. The highest expression level, using a low-copy-number vector, was obtained with the L. helveticus pepN gene, which resulted in a 25-fold increase in PepN activity compared to that of wild-type L. lactis. The L. helveticus pepI gene, residing as a third gene in an operon in its host, was expressed in L. lactis under the control of the L. helveticus pepX promoter. The genetic background of the L. lactis derivatives tested did not affect the expression level of any of the L. helveticus peptidases studied. However, the growth medium used affected both the recombinant peptidase profiles in transformant strains and the resident peptidase activities. The levels of expression of the L. helveticus pepD and pepR clones under the control of their own promoters were below the detection limit in L. lactis. However, substantial amounts of recombinant pepD and PepR activities were obtained in L. lactis when pepD and pepR were expressed under the control of the inducible lactococcal nisA promoter at an optimized nisin concentration.

  5. Expression of Six Peptidases from Lactobacillus helveticus in Lactococcus lactis

    PubMed Central

    Luoma, Susanna; Peltoniemi, Kirsi; Joutsjoki, Vesa; Rantanen, Terhi; Tamminen, Marja; Heikkinen, Inka; Palva, Airi

    2001-01-01

    For development of novel starter strains with improved proteolytic properties, the ability of Lactococcus lactis to produce Lactobacillus helveticus aminopeptidase N (PepN), aminopeptidase C (PepC), X-prolyl dipeptidyl aminopeptidase (PepX), proline iminopeptidase (PepI), prolinase (PepR), and dipeptidase (PepD) was studied by introducing the genes encoding these enzymes into L. lactis MG1363 and its derivatives. According to Northern analyses and enzyme activity measurements, the L. helveticus aminopeptidase genes pepN, pepC, and pepX are expressed under the control of their own promoters in L. lactis. The highest expression level, using a low-copy-number vector, was obtained with the L. helveticus pepN gene, which resulted in a 25-fold increase in PepN activity compared to that of wild-type L. lactis. The L. helveticus pepI gene, residing as a third gene in an operon in its host, was expressed in L. lactis under the control of the L. helveticus pepX promoter. The genetic background of the L. lactis derivatives tested did not affect the expression level of any of the L. helveticus peptidases studied. However, the growth medium used affected both the recombinant peptidase profiles in transformant strains and the resident peptidase activities. The levels of expression of the L. helveticus pepD and pepR clones under the control of their own promoters were below the detection limit in L. lactis. However, substantial amounts of recombinant pepD and PepR activities were obtained in L. lactis when pepD and pepR were expressed under the control of the inducible lactococcal nisA promoter at an optimized nisin concentration. PMID:11229915

  6. Expression of the enzymatically active legumain-like cysteine proteinase TvLEGU-1 of Trichomonas vaginalis in Pichia pastoris.

    PubMed

    Reséndiz-Cardiel, Gerardo; Arroyo, Rossana; Ortega-López, Jaime

    2017-06-01

    The legumain-like cysteine proteinase TvLEGU-1 from Trichomonas vaginalis plays a major role in trichomonal cytoadherence. However, its structure-function characterization has been limited by the lack of a reliable recombinant expression platform to produce this protein in its native folded conformation. TvLEGU-1 has been expressed in Escherichia coli as inclusion bodies and all efforts to refold it have failed. Here, we describe the expression of the synthetic codon-optimized tvlegu-1 (tvlegu-1-opt) gene in Pichia pastoris strain X-33 (Mut+) under the inducible AOX1 promoter. The active TvLEGU-1 recombinant protein (rTvLEGU-1) was secreted into the medium when tvlegu-1-opt was fused to the Aspergillus niger alpha-amylase signal peptide. The rTvLEGU-1 secretion was influenced by the gene copy number and induction temperature. Data indicate that increasing tvlegu-1-opt gene copy number was detrimental for heterologous expression of the enzymatically active TvLEGU-1. Indeed, expression of TvLEGU-1 had a greater impact on cell viability for those clones with 26 or 29 gene copy number, and cell lysis was observed when the induction was carried out at 30 °C. The enzyme activity in the medium was higher when the induction was carried out at 16 °C and in P. pastoris clones with lower gene copy number. The results presented here suggest that both copy number and induction temperature affect the rTvLEGU-1 expression in its native-like and active conformation. Copyright © 2017 Elsevier Inc. All rights reserved.

  7. A method to facilitate and monitor expression of exogenous genes in the rat kidney using plasmid and viral vectors

    PubMed Central

    Corridon, Peter R.; Rhodes, George J.; Leonard, Ellen C.; Basile, David P.; Gattone, Vincent H.; Bacallao, Robert L.

    2013-01-01

    Gene therapy has been proposed as a novel alternative to treat kidney disease. This goal has been hindered by the inability to reliably deliver transgenes to target cells throughout the kidney, while minimizing injury. Since hydrodynamic forces have previously shown promising results, we optimized this approach and designed a method that utilizes retrograde renal vein injections to facilitate transgene expression in rat kidneys. We show, using intravital fluorescence two-photon microscopy, that fluorescent albumin and dextrans injected into the renal vein under defined conditions of hydrodynamic pressure distribute broadly throughout the kidney in live animals. We found injection parameters that result in no kidney injury as determined by intravital microscopy, histology, and serum creatinine measurements. Plasmids, baculovirus, and adenovirus vectors, designed to express EGFP, EGFP-actin, EGFP-occludin, EGFP-tubulin, tdTomato-H2B, or RFP-actin fusion proteins, were introduced into live kidneys in a similar fashion. Gene expression was then observed in live and ex vivo kidneys using two-photon imaging and confocal laser scanning microscopy. We recorded widespread fluorescent protein expression lasting more than 1 mo after introduction of transgenes. Plasmid and adenovirus vectors provided gene transfer efficiencies ranging from 50 to 90%, compared with 10–50% using baculovirus. Using plasmids and adenovirus, fluorescent protein expression was observed 1) in proximal and distal tubule epithelial cells; 2) within glomeruli; and 3) within the peritubular interstitium. In isolated kidneys, fluorescent protein expression was observed from the cortex to the papilla. These results provide a robust approach for gene delivery and the study of protein function in live mammal kidneys. PMID:23467422

  8. Machine-learning approach identifies a pattern of gene expression in peripheral blood that can accurately detect ischaemic stroke

    PubMed Central

    O’Connell, Grant C; Petrone, Ashley B; Treadway, Madison B; Tennant, Connie S; Lucke-Wold, Noelle; Chantler, Paul D; Barr, Taura L

    2016-01-01

    Early and accurate diagnosis of stroke improves the probability of positive outcome. The objective of this study was to identify a pattern of gene expression in peripheral blood that could potentially be optimised to expedite the diagnosis of acute ischaemic stroke (AIS). A discovery cohort was recruited consisting of 39 AIS patients and 24 neurologically asymptomatic controls. Peripheral blood was sampled at emergency department admission, and genome-wide expression profiling was performed via microarray. A machine-learning technique known as genetic algorithm k-nearest neighbours (GA/kNN) was then used to identify a pattern of gene expression that could optimally discriminate between groups. This pattern of expression was then assessed via qRT-PCR in an independent validation cohort, where it was evaluated for its ability to discriminate between an additional 39 AIS patients and 30 neurologically asymptomatic controls, as well as 20 acute stroke mimics. GA/kNN identified 10 genes (ANTXR2, STK3, PDK4, CD163, MAL, GRAP, ID3, CTSZ, KIF1B and PLXDC2) whose coordinate pattern of expression was able to identify 98.4% of discovery cohort subjects correctly (97.4% sensitive, 100% specific). In the validation cohort, the expression levels of the same 10 genes were able to identify 95.6% of subjects correctly when comparing AIS patients to asymptomatic controls (92.3% sensitive, 100% specific), and 94.9% of subjects correctly when comparing AIS patients with stroke mimics (97.4% sensitive, 90.0% specific). The transcriptional pattern identified in this study shows strong diagnostic potential, and warrants further evaluation to determine its true clinical efficacy. PMID:29263821

  9. Optimized AAV rh.10 Vectors That Partially Evade Neutralizing Antibodies during Hepatic Gene Transfer

    PubMed Central

    Selot, Ruchita; Arumugam, Sathyathithan; Mary, Bertin; Cheemadan, Sabna; Jayandharan, Giridhara R.

    2017-01-01

    Of the 12 common serotypes used for gene delivery applications, Adeno-associated virus (AAV)rh.10 serotype has shown sustained hepatic transduction and has the lowest seropositivity in humans. We have evaluated if further modifications to AAVrh.10 at its phosphodegron like regions or predicted immunogenic epitopes could improve its hepatic gene transfer and immune evasion potential. Mutant AAVrh.10 vectors were generated by site directed mutagenesis of the predicted targets. These mutant vectors were first tested for their transduction efficiency in HeLa and HEK293T cells. The optimal vector was further evaluated for their cellular uptake, entry, and intracellular trafficking by quantitative PCR and time-lapse confocal microscopy. To evaluate their potential during hepatic gene therapy, C57BL/6 mice were administered with wild-type or optimal mutant AAVrh.10 and the luciferase transgene expression was documented by serial bioluminescence imaging at 14, 30, 45, and 72 days post-gene transfer. Their hepatic transduction was further verified by a quantitative PCR analysis of AAV copy number in the liver tissue. The optimal AAVrh.10 vector was further evaluated for their immune escape potential, in animals pre-immunized with human intravenous immunoglobulin. Our results demonstrate that a modified AAVrh.10 S671A vector had enhanced cellular entry (3.6 fold), migrate rapidly to the perinuclear region (1 vs. >2 h for wild type vectors) in vitro, which further translates to modest increase in hepatic gene transfer efficiency in vivo. More importantly, the mutant AAVrh.10 vector was able to partially evade neutralizing antibodies (~27–64 fold) in pre-immunized animals. The development of an AAV vector system that can escape the circulating neutralizing antibodies in the host will substantially widen the scope of gene therapy applications in humans. PMID:28769791

  10. The food additive vanillic acid controls transgene expression in mammalian cells and mice.

    PubMed

    Gitzinger, Marc; Kemmer, Christian; Fluri, David A; El-Baba, Marie Daoud; Weber, Wilfried; Fussenegger, Martin

    2012-03-01

    Trigger-inducible transcription-control devices that reversibly fine-tune transgene expression in response to molecular cues have significantly advanced the rational reprogramming of mammalian cells. When designed for use in future gene- and cell-based therapies the trigger molecules have to be carefully chosen in order to provide maximum specificity, minimal side-effects and optimal pharmacokinetics in a mammalian organism. Capitalizing on control components that enable Caulobacter crescentus to metabolize vanillic acid originating from lignin degradation that occurs in its oligotrophic freshwater habitat, we have designed synthetic devices that specifically adjust transgene expression in mammalian cells when exposed to vanillic acid. Even in mice transgene expression was robust, precise and tunable in response to vanillic acid. As a licensed food additive that is regularly consumed by humans via flavoured convenience food and specific fresh vegetable and fruits, vanillic acid can be considered as a safe trigger molecule that could be used for diet-controlled transgene expression in future gene- and cell-based therapies.

  11. Heat shock protein 90{beta}: A novel mediator of vitamin D action

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Angelo, Giana; Mineral Bioavailability Laboratory, 711 Washington Street, Boston, MA 02111; Lamon-Fava, Stefania

    2008-03-14

    We investigated the role of Heat shock protein 90 (Hsp90) in vitamin D action in Caco-2 cells using geldanamycin (GA) to block Hsp90 function and RNA interference to reduce Hsp90{beta} expression. When cells were exposed to GA, vitamin D-mediated gene expression and transcriptional activity were inhibited by 69% and 54%, respectively. Gel shift analysis indicated that GA reduced vitamin D-mediated DNA binding activity of the vitamin D receptor (VDR). We tested the specific role of Hsp90{beta} by knocking down its expression with stably expressed short hairpin RNA. Vitamin D-induced gene expression and transcriptional activity were reduced by 90% and 80%,more » respectively, in Hsp90{beta}-deficient cells. Nuclear protein for VDR and RXR{alpha}, its heterodimer partner, were not reduced in Hsp90{beta}-deficient cells. These findings indicate that Hsp90{beta} is needed for optimal vitamin D responsiveness in the enterocyte and demonstrate a specific role for Hsp90{beta} in VDR signaling.« less

  12. An siRNA-based method for efficient silencing of gene expression in mature brown adipocytes.

    PubMed

    Isidor, Marie S; Winther, Sally; Basse, Astrid L; Petersen, M Christine H; Cannon, Barbara; Nedergaard, Jan; Hansen, Jacob B

    2016-01-01

    Brown adipose tissue is a promising therapeutic target for opposing obesity, glucose intolerance and insulin resistance. The ability to modulate gene expression in mature brown adipocytes is important to understand brown adipocyte function and delineate novel regulatory mechanisms of non-shivering thermogenesis. The aim of this study was to optimize a lipofection-based small interfering RNA (siRNA) transfection protocol for efficient silencing of gene expression in mature brown adipocytes. We determined that a critical parameter was to deliver the siRNA to mature adipocytes by reverse transfection, i.e. transfection of non-adherent cells. Using this protocol, we effectively knocked down both high- and low-abundance transcripts in a model of mature brown adipocytes (WT-1) as well as in primary mature mouse brown adipocytes. A functional consequence of the knockdown was confirmed by an attenuated increase in uncoupled respiration (thermogenesis) in response to β-adrenergic stimulation of mature WT-1 brown adipocytes transfected with uncoupling protein 1 siRNA. Efficient gene silencing was also obtained in various mouse and human white adipocyte models (3T3-L1, primary mouse white adipocytes, hMADS) with the ability to undergo "browning." In summary, we report an easy and versatile reverse siRNA transfection protocol to achieve specific silencing of gene expression in various models of mature brown and browning-competent white adipocytes, including primary cells.

  13. A Tightly Regulated Genetic Selection System with Signaling-Active Alleles of Phytochrome B.

    PubMed

    Hu, Wei; Lagarias, J Clark

    2017-01-01

    Selectable markers derived from plant genes circumvent the potential risk of antibiotic/herbicide-resistance gene transfer into neighboring plant species, endophytic bacteria, and mycorrhizal fungi. Toward this goal, we have engineered and validated signaling-active alleles of phytochrome B (eYHB) as plant-derived selection marker genes in the model plant Arabidopsis (Arabidopsis thaliana). By probing the relationship of construct size and induction conditions to optimal phenotypic selection, we show that eYHB-based alleles are robust substitutes for antibiotic/herbicide-dependent marker genes as well as surprisingly sensitive reporters of off-target transgene expression. © 2017 American Society of Plant Biologists. All Rights Reserved.

  14. A Tightly Regulated Genetic Selection System with Signaling-Active Alleles of Phytochrome B1[OPEN

    PubMed Central

    2017-01-01

    Selectable markers derived from plant genes circumvent the potential risk of antibiotic/herbicide-resistance gene transfer into neighboring plant species, endophytic bacteria, and mycorrhizal fungi. Toward this goal, we have engineered and validated signaling-active alleles of phytochrome B (eYHB) as plant-derived selection marker genes in the model plant Arabidopsis (Arabidopsis thaliana). By probing the relationship of construct size and induction conditions to optimal phenotypic selection, we show that eYHB-based alleles are robust substitutes for antibiotic/herbicide-dependent marker genes as well as surprisingly sensitive reporters of off-target transgene expression. PMID:27881727

  15. Combining lipophilic dye, in situ hybridization, immunohistochemistry, and histology.

    PubMed

    Duncan, Jeremy; Kersigo, Jennifer; Gray, Brian; Fritzsch, Bernd

    2011-03-17

    Going beyond single gene function to cut deeper into gene regulatory networks requires multiple mutations combined in a single animal. Such analysis of two or more genes needs to be complemented with in situ hybridization of other genes, or immunohistochemistry of their proteins, both in whole mounted developing organs or sections for detailed resolution of the cellular and tissue expression alterations. Combining multiple gene alterations requires the use of cre or flipase to conditionally delete genes and avoid embryonic lethality. Required breeding schemes dramatically enhance effort and cost proportional to the number of genes mutated, with an outcome of very few animals with the full repertoire of genetic modifications desired. Amortizing the vast amount of effort and time to obtain these few precious specimens that are carrying multiple mutations necessitates tissue optimization. Moreover, investigating a single animal with multiple techniques makes it easier to correlate gene deletion defects with expression profiles. We have developed a technique to obtain a more thorough analysis of a given animal; with the ability to analyze several different histologically recognizable structures as well as gene and protein expression all from the same specimen in both whole mounted organs and sections. Although mice have been utilized to demonstrate the effectiveness of this technique it can be applied to a wide array of animals. To do this we combine lipophilic dye tracing, whole mount in situ hybridization, immunohistochemistry, and histology to extract the maximal possible amount of data.

  16. Complex modulation of androgen responsive gene expression by methoxyacetic acid

    PubMed Central

    2011-01-01

    Background Optimal androgen signaling is critical for testicular development and spermatogenesis. Methoxyacetic acid (MAA), the primary active metabolite of the industrial chemical ethylene glycol monomethyl ether, disrupts spermatogenesis and causes testicular atrophy. Transcriptional trans-activation studies have indicated that MAA can enhance androgen receptor activity, however, whether MAA actually impacts the expression of androgen-responsive genes in vivo, and which genes might be affected is not known. Methods A mouse TM3 Leydig cell line that stably expresses androgen receptor (TM3-AR) was prepared and analyzed by transcriptional profiling to identify target gene interactions between MAA and testosterone on a global scale. Results MAA is shown to have widespread effects on androgen-responsive genes, affecting processes ranging from apoptosis to ion transport, cell adhesion, phosphorylation and transcription, with MAA able to enhance, as well as antagonize, androgenic responses. Moreover, testosterone is shown to exert both positive and negative effects on MAA gene responses. Motif analysis indicated that binding sites for FOX, HOX, LEF/TCF, STAT5 and MEF2 family transcription factors are among the most highly enriched in genes regulated by testosterone and MAA. Notably, 65 FOXO targets were repressed by testosterone or showed repression enhanced by MAA with testosterone; these include 16 genes associated with developmental processes, six of which are Hox genes. Conclusions These findings highlight the complex interactions between testosterone and MAA, and provide insight into the effects of MAA exposure on androgen-dependent processes in a Leydig cell model. PMID:21453523

  17. Combining Lipophilic dye, in situ Hybridization, Immunohistochemistry, and Histology

    PubMed Central

    Duncan, Jeremy; Kersigo, Jennifer; Gray, Brian; Fritzsch, Bernd

    2011-01-01

    Going beyond single gene function to cut deeper into gene regulatory networks requires multiple mutations combined in a single animal. Such analysis of two or more genes needs to be complemented with in situ hybridization of other genes, or immunohistochemistry of their proteins, both in whole mounted developing organs or sections for detailed resolution of the cellular and tissue expression alterations. Combining multiple gene alterations requires the use of cre or flipase to conditionally delete genes and avoid embryonic lethality. Required breeding schemes dramatically enhance effort and cost proportional to the number of genes mutated, with an outcome of very few animals with the full repertoire of genetic modifications desired. Amortizing the vast amount of effort and time to obtain these few precious specimens that are carrying multiple mutations necessitates tissue optimization. Moreover, investigating a single animal with multiple techniques makes it easier to correlate gene deletion defects with expression profiles. We have developed a technique to obtain a more thorough analysis of a given animal; with the ability to analyze several different histologically recognizable structures as well as gene and protein expression all from the same specimen in both whole mounted organs and sections. Although mice have been utilized to demonstrate the effectiveness of this technique it can be applied to a wide array of animals. To do this we combine lipophilic dye tracing, whole mount in situ hybridization, immunohistochemistry, and histology to extract the maximal possible amount of data. PMID:21445047

  18. Cone-Specific Promoters for Gene Therapy of Achromatopsia and Other Retinal Diseases

    PubMed Central

    Ye, Guo-Jie; Budzynski, Ewa; Sonnentag, Peter; Nork, T. Michael; Sheibani, Nader; Gurel, Zafer; Boye, Sanford L.; Peterson, James J.; Boye, Shannon E.; Hauswirth, William W.; Chulay, Jeffrey D.

    2016-01-01

    Adeno-associated viral (AAV) vectors containing cone-specific promoters have rescued cone photoreceptor function in mouse and dog models of achromatopsia, but cone-specific promoters have not been optimized for use in primates. Using AAV vectors administered by subretinal injection, we evaluated a series of promoters based on the human L-opsin promoter, or a chimeric human cone transducin promoter, for their ability to drive gene expression of green fluorescent protein (GFP) in mice and nonhuman primates. Each of these promoters directed high-level GFP expression in mouse photoreceptors. In primates, subretinal injection of an AAV-GFP vector containing a 1.7-kb L-opsin promoter (PR1.7) achieved strong and specific GFP expression in all cone photoreceptors and was more efficient than a vector containing the 2.1-kb L-opsin promoter that was used in AAV vectors that rescued cone function in mouse and dog models of achromatopsia. A chimeric cone transducin promoter that directed strong GFP expression in mouse and dog cone photoreceptors was unable to drive GFP expression in primate cones. An AAV vector expressing a human CNGB3 gene driven by the PR1.7 promoter rescued cone function in the mouse model of achromatopsia. These results have informed the design of an AAV vector for treatment of patients with achromatopsia. PMID:26603570

  19. Cone-Specific Promoters for Gene Therapy of Achromatopsia and Other Retinal Diseases.

    PubMed

    Ye, Guo-Jie; Budzynski, Ewa; Sonnentag, Peter; Nork, T Michael; Sheibani, Nader; Gurel, Zafer; Boye, Sanford L; Peterson, James J; Boye, Shannon E; Hauswirth, William W; Chulay, Jeffrey D

    2016-01-01

    Adeno-associated viral (AAV) vectors containing cone-specific promoters have rescued cone photoreceptor function in mouse and dog models of achromatopsia, but cone-specific promoters have not been optimized for use in primates. Using AAV vectors administered by subretinal injection, we evaluated a series of promoters based on the human L-opsin promoter, or a chimeric human cone transducin promoter, for their ability to drive gene expression of green fluorescent protein (GFP) in mice and nonhuman primates. Each of these promoters directed high-level GFP expression in mouse photoreceptors. In primates, subretinal injection of an AAV-GFP vector containing a 1.7-kb L-opsin promoter (PR1.7) achieved strong and specific GFP expression in all cone photoreceptors and was more efficient than a vector containing the 2.1-kb L-opsin promoter that was used in AAV vectors that rescued cone function in mouse and dog models of achromatopsia. A chimeric cone transducin promoter that directed strong GFP expression in mouse and dog cone photoreceptors was unable to drive GFP expression in primate cones. An AAV vector expressing a human CNGB3 gene driven by the PR1.7 promoter rescued cone function in the mouse model of achromatopsia. These results have informed the design of an AAV vector for treatment of patients with achromatopsia.

  20. Gelam honey potentiates ex vivo corneal keratocytes proliferation with desirable phenotype expression.

    PubMed

    Yusof, Alia Md; Abd Ghafar, Norzana; Kamarudin, Taty Anna; Hui, Chua Kien; Yusof, Yasmin Anum Mohd

    2016-02-24

    This study aimed to evaluate the effects of Gelam honey on corneal keratocytes proliferative capacity and phenotypic characterization via MTT assay, gene expression and immunocytochemistry. Corneal keratocytes from New Zealand white rabbits were cultured in basal medium (BM) and serum enriched medium (BMS). Serial dilutions of Gelam honey (GH) were added to both media and cells were cultured until passage 1. MTT assay was performed on corneal keratocytes in both media to ascertain the optimal dose of GH that produced maximum proliferation. Gelam honey at the concentration of 0.0015% in both media showed the highest proliferative capacity with no morphological changes compared to their respective controls. The gene expression of aldehyde dehydrogenase (ALDH), a marker for quiescent keratocytes and vimentin, a marker for fibroblast, were higher in the GH enriched groups. The alpha smooth muscle actin (α-SMA) expression, marker for myofibroblast, was lower in GH treated groups compared to the controls. Immunocytochemistry results were in accordance to the gene expression analyses. Gelam honey at a concentration of 0.0015% promotes ex vivo corneal keratocytes proliferation while retaining desirable phenotype expression. The results serve as a basis for the development of Gelam honey as a potential natural product in promoting corneal wound healing.

  1. The Arabidopsis WRINKLED1 transcription factor affects auxin homeostasis in roots

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kong, Que; Ma, Wei; Yang, Haibing

    WRINKLED1 (WRI1) is a key transcriptional regulator of fatty acid biosynthesis genes in diverse oil-containing tissues. Loss of function of Arabidopsis WRI1 leads to a reduction in the expression of genes for fatty acid biosynthesis and glycolysis, and concomitant strong reduction of seed oil content. The wri1-1 loss-of-function mutant shows reduced primary root growth and decreased acidification of the growth medium. The content of a conjugated form of the plant growth hormone auxin, indole-3-acetic acid (IAA)-Asp, was higher in wri1-1 plants compared with the wild-type. GH3.3, a gene encoding an enzyme involved in auxin degradation, displayed higher expression in themore » wri1-1 mutant. EMSAs demonstrated that AtWRI1 bound to the promoter of GH3.3. Specific AtWRI1-binding motifs were identified in the promoter of GH3.3. In addition, wri1-1 displayed decreased auxin transport. Expression of some PIN genes, which encode IAA carrier proteins, was reduced in wri1-1 plants as well. Correspondingly, AtWRI1 bound to the promoter regions of some PIN genes. It is well known that auxin exerts its maximum effects at a specific, optimal concentration in roots requiring a finely balanced auxin homeostasis. This process appears to be disrupted when the expression of WRI1 and in turn a subset of its target genes are misregulated, highlighting a role for WRI1 in root auxin homeostasis.« less

  2. The Myxococcus xanthus two-component system CorSR regulates expression of a gene cluster involved in maintaining copper tolerance during growth and development.

    PubMed

    Sánchez-Sutil, María Celestina; Pérez, Juana; Gómez-Santos, Nuria; Shimkets, Lawrence J; Moraleda-Muñoz, Aurelio; Muñoz-Dorado, José

    2013-01-01

    Myxococcus xanthus is a soil-dwelling member of the δ-Proteobacteria that exhibits a complex developmental cycle upon starvation. Development comprises aggregation and differentiation into environmentally resistant myxospores in an environment that includes fluctuations in metal ion concentrations. While copper is essential for M. xanthus cells because several housekeeping enzymes use it as a cofactor, high copper concentrations are toxic. These opposing effects force cells to maintain a tight copper homeostasis. A plethora of paralogous genes involved in copper detoxification, all of which are differentially regulated, have been reported in M. xanthus. The use of in-frame deletion mutants and fusions with the reporter gene lacZ has allowed the identification of a two-component system, CorSR, that modulates the expression of an operon termed curA consisting of nine genes whose expression slowly increases after metal addition, reaching a plateau. Transcriptional regulation of this operon is complex because transcription can be initiated at different promoters and by different types of regulators. These genes confer copper tolerance during growth and development. Copper induces carotenoid production in a ΔcorSR mutant at lower concentrations than with the wild-type strain due to lack of expression of a gene product resembling subunit III of cbb3-type cytochrome c oxidase. This data may explain why copper induces carotenoid biosynthesis at suboptimal rather than optimal growth conditions in wild-type strains.

  3. The Myxococcus xanthus Two-Component System CorSR Regulates Expression of a Gene Cluster Involved in Maintaining Copper Tolerance during Growth and Development

    PubMed Central

    Sánchez-Sutil, María Celestina; Pérez, Juana; Gómez-Santos, Nuria; Shimkets, Lawrence J.; Moraleda-Muñoz, Aurelio; Muñoz-Dorado, José

    2013-01-01

    Myxococcus xanthus is a soil-dwelling member of the δ–Proteobacteria that exhibits a complex developmental cycle upon starvation. Development comprises aggregation and differentiation into environmentally resistant myxospores in an environment that includes fluctuations in metal ion concentrations. While copper is essential for M. xanthus cells because several housekeeping enzymes use it as a cofactor, high copper concentrations are toxic. These opposing effects force cells to maintain a tight copper homeostasis. A plethora of paralogous genes involved in copper detoxification, all of which are differentially regulated, have been reported in M. xanthus. The use of in-frame deletion mutants and fusions with the reporter gene lacZ has allowed the identification of a two-component system, CorSR, that modulates the expression of an operon termed curA consisting of nine genes whose expression slowly increases after metal addition, reaching a plateau. Transcriptional regulation of this operon is complex because transcription can be initiated at different promoters and by different types of regulators. These genes confer copper tolerance during growth and development. Copper induces carotenoid production in a ΔcorSR mutant at lower concentrations than with the wild-type strain due to lack of expression of a gene product resembling subunit III of cbb3-type cytochrome c oxidase. This data may explain why copper induces carotenoid biosynthesis at suboptimal rather than optimal growth conditions in wild-type strains. PMID:23874560

  4. The Arabidopsis WRINKLED1 transcription factor affects auxin homeostasis in roots

    DOE PAGES

    Kong, Que; Ma, Wei; Yang, Haibing; ...

    2017-08-26

    WRINKLED1 (WRI1) is a key transcriptional regulator of fatty acid biosynthesis genes in diverse oil-containing tissues. Loss of function of Arabidopsis WRI1 leads to a reduction in the expression of genes for fatty acid biosynthesis and glycolysis, and concomitant strong reduction of seed oil content. The wri1-1 loss-of-function mutant shows reduced primary root growth and decreased acidification of the growth medium. The content of a conjugated form of the plant growth hormone auxin, indole-3-acetic acid (IAA)-Asp, was higher in wri1-1 plants compared with the wild-type. GH3.3, a gene encoding an enzyme involved in auxin degradation, displayed higher expression in themore » wri1-1 mutant. EMSAs demonstrated that AtWRI1 bound to the promoter of GH3.3. Specific AtWRI1-binding motifs were identified in the promoter of GH3.3. In addition, wri1-1 displayed decreased auxin transport. Expression of some PIN genes, which encode IAA carrier proteins, was reduced in wri1-1 plants as well. Correspondingly, AtWRI1 bound to the promoter regions of some PIN genes. It is well known that auxin exerts its maximum effects at a specific, optimal concentration in roots requiring a finely balanced auxin homeostasis. This process appears to be disrupted when the expression of WRI1 and in turn a subset of its target genes are misregulated, highlighting a role for WRI1 in root auxin homeostasis.« less

  5. Rapid protein production from stable CHO cell pools using plasmid vector and the cumate gene-switch.

    PubMed

    Poulain, Adeline; Perret, Sylvie; Malenfant, Félix; Mullick, Alaka; Massie, Bernard; Durocher, Yves

    2017-08-10

    To rapidly produce large amounts of recombinant proteins, the generation of stable Chinese Hamster Ovary (CHO) cell pools represents a useful alternative to large-scale transient gene expression (TGE). We have developed a cell line (CHO BRI/rcTA ) allowing the inducible expression of recombinant proteins, based on the cumate gene switch. After the identification of optimal plasmid DNA topology (supercoiled vs linearized plasmid) for PEIpro™ mediated transfection and of optimal conditions for methionine sulfoximine (MSX) selection, we were able to generate CHO BRI/rcTA pools producing high levels of recombinant proteins. Volumetric productivities of up to 900mg/L were reproducibly achieved for a Fc fusion protein and up to 350mg/L for an antibody after 14days post-induction in non-optimized fed-batch cultures. In addition, we show that CHO pool volumetric productivities are not affected by a freeze-thaw cycle or following maintenance in culture for over one month in the presence of MSX. Finally, we demonstrate that volumetric protein production with the CR5 cumate-inducible promoter is three- to four-fold higher than with the human CMV or hybrid EF1α-HTLV constitutive promoters. These results suggest that the cumate-inducible CHO BRI/rcTA stable pool platform is a powerful and robust system for the rapid production of gram amounts of recombinant proteins. Crown Copyright © 2017. Published by Elsevier B.V. All rights reserved.

  6. RNAi Mediated curcin precursor gene silencing in Jatropha (Jatropha curcas L.).

    PubMed

    Patade, Vikas Yadav; Khatri, Deepti; Kumar, Kamal; Grover, Atul; Kumari, Maya; Gupta, Sanjay Mohan; Kumar, Devender; Nasim, Mohammed

    2014-07-01

    Curcin, a type I ribosomal inhibiting protein-RIP, encoded by curcin precursor gene, is a phytotoxin present in Jatropha (Jatropha curcas L.). Here, we report designing of RNAi construct for the curcin precursor gene and further its genetic transformation of Jatropha to reduce its transcript expression. Curcin precursor gene was first cloned from Jatropha strain DARL-2 and part of the gene sequence was cloned in sense and antisense orientation separated by an intron sequence in plant expression binary vector pRI101 AN. The construction of the RNAi vector was confirmed by double digestion and nucleotide sequencing. The vector was then mobilized into Agrobacterium tumefaciens strain GV 3101 and used for tissue culture independent in planta transformation protocol optimized for Jatropha. Germinating seeds were injured with a needle before infection with Agrobacterium and then transferred to sterilized sand medium. The seedlings were grown for 90 days and genomic DNA was isolated from leaves for transgenic confirmation based on real time PCR with NPT II specific dual labeled probe. Result of the transgenic confirmation analysis revealed presence of the gene silencing construct in ten out of 30 tested seedlings. Further, quantitative transcript expression analysis of the curcin precursor gene revealed reduction in the transcript abundance by more than 98% to undetectable level. The transgenic plants are being grown in containment for further studies on reduction in curcin protein content in Jatropha seeds.

  7. Characterisation of the willow phenylalanine ammonia-lyase (PAL) gene family reveals expression differences compared with poplar

    PubMed Central

    de Jong, Femke; Hanley, Steven J.; Beale, Michael H.; Karp, Angela

    2015-01-01

    Willow is an important biomass crop for the bioenergy industry, and therefore optimal growth with minimal effects of biotic and abiotic stress is essential. The phenylpropanoid pathway is responsible for the biosynthesis of not only lignin but also of flavonoids, condensed tannins, benzenoids and phenolic glycosides which all have a role in protecting the plant against biotic and abiotic stress. All products of the phenylpropanoid pathway are important for the healthy growth of short rotation cropping species such as willow. However, the phenylpropanoid pathway in willow remains largely uncharacterised. In the current study we identified and characterised five willow phenylalanine ammonia-lyase (PAL) genes, which encode enzymes that catalyse the deamination of l-phenylalanine to form trans-cinnamic acid, the entry point into the phenylpropanoid pathway. Willow PAL1, PAL2, PAL3 and PAL4 genes were orthologous to the poplar genes. However no orthologue of PAL5 appears to be present in willow. Moreover, two tandemly repeated PAL2 orthologues were identified in a single contig. Willow PALs show similar sub-cellular localisation to the poplar genes. However, the enzyme kinetics and gene expression of the willow PAL genes differed slightly, with willow PAL2 being more widely expressed than its poplar orthologues implying a wider role for PALs in the production of flavonoids, condensed tannins, benzenoids, and phenolic glycosides, in willow. PMID:26070140

  8. A multicolor panel of novel lentiviral "gene ontology" (LeGO) vectors for functional gene analysis.

    PubMed

    Weber, Kristoffer; Bartsch, Udo; Stocking, Carol; Fehse, Boris

    2008-04-01

    Functional gene analysis requires the possibility of overexpression, as well as downregulation of one, or ideally several, potentially interacting genes. Lentiviral vectors are well suited for this purpose as they ensure stable expression of complementary DNAs (cDNAs), as well as short-hairpin RNAs (shRNAs), and can efficiently transduce a wide spectrum of cell targets when packaged within the coat proteins of other viruses. Here we introduce a multicolor panel of novel lentiviral "gene ontology" (LeGO) vectors designed according to the "building blocks" principle. Using a wide spectrum of different fluorescent markers, including drug-selectable enhanced green fluorescent protein (eGFP)- and dTomato-blasticidin-S resistance fusion proteins, LeGO vectors allow simultaneous analysis of multiple genes and shRNAs of interest within single, easily identifiable cells. Furthermore, each functional module is flanked by unique cloning sites, ensuring flexibility and individual optimization. The efficacy of these vectors for analyzing multiple genes in a single cell was demonstrated in several different cell types, including hematopoietic, endothelial, and neural stem and progenitor cells, as well as hepatocytes. LeGO vectors thus represent a valuable tool for investigating gene networks using conditional ectopic expression and knock-down approaches simultaneously.

  9. Generation of recombinant rotaviruses expressing fluorescent proteins using an optimized reverse genetics system.

    PubMed

    Komoto, Satoshi; Fukuda, Saori; Ide, Tomihiko; Ito, Naoto; Sugiyama, Makoto; Yoshikawa, Tetsushi; Murata, Takayuki; Taniguchi, Koki

    2018-04-18

    An entirely plasmid-based reverse genetics system for rotaviruses was established very recently. We improved the reverse genetics system to generate recombinant rotavirus by transfecting only 11 cDNA plasmids for its 11 gene segments under the condition of increasing the ratio of the cDNA plasmids for NSP2 and NSP5 genes. Utilizing this highly efficient system, we then engineered infectious recombinant rotaviruses expressing bioluminescent (NanoLuc luciferase) and fluorescent (EGFP and mCherry) reporters. These recombinant rotaviruses expressing reporters remained genetically stable during serial passages. Our reverse genetics approach and recombinant rotaviruses carrying reporter genes will be great additions to the tool kit for studying the molecular virology of rotavirus, and for developing future next-generation vaccines and expression vectors. IMPORTANCE Rotavirus is one of the most important pathogens causing severe gastroenteritis in young children worldwide. In this paper, we describe a robust and simple reverse genetics system based on only rotavirus cDNAs, and its application for engineering infectious recombinant rotaviruses harboring bioluminescent (NanoLuc) and fluorescent (EGFP and mCherry) protein genes. This highly efficient reverse genetics system and recombinant RVAs expressing reporters could be powerful tools for the study of different aspects of rotavirus replication. Furthermore, they may be useful for next-generation vaccine production for this medically important virus. Copyright © 2018 American Society for Microbiology.

  10. Melibiose permease and alpha-galactosidase of Escherichia coli: Identification by selective labeling using a T7 RNA polymerase/promoter expression system

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pourcher, T.; Bassilana, M.; Sarkar, H.K.

    1990-01-23

    Identification and selective labeling of the melibiose permease and alpha-galactosidase in Escherichia coli, which are encoded by the melB and melA genes, respectively, have been accomplished by selectively labeling the two gene products with a T7 RNA polymerase expression system. Following generation of a novel EcoRI restriction site in the intergenic sequence between the two genes of the mel operon by oligonucleotide-directed, site-specific mutagenesis, melA and melB were separately inserted into plasmid pT7-6 of the T7 expression system. Expression of melB was markedly enhanced by placing a strong, synthetic ribosome binding site at an optimal distance upstream from the initiationmore » codon of melB. Expression of cloned gene products was characterized functionally and by performing autoradiographic analysis on total cell, inner membrane, and cytoplasmic proteins from cells pulse labeled with (35S)methionine in the presence of rifampicin and resolved by sodium dodecyl sulfate/polyacrylamide gel electrophoresis. The results first confirm that alpha-galactosidase is a cytoplasmic protein with an Mr of 50K; in contrast, the membrane-bound melibiose permease is identified as a protein with an apparent Mr of 39K, a value significantly higher than that of 30K previously suggested.« less

  11. Validation of Reference Genes for Relative Quantitative Gene Expression Studies in Cassava (Manihot esculenta Crantz) by Using Quantitative Real-Time PCR

    PubMed Central

    Hu, Meizhen; Hu, Wenbin; Xia, Zhiqiang; Zhou, Xincheng; Wang, Wenquan

    2016-01-01

    Reverse transcription quantitative real-time polymerase chain reaction (real-time PCR, also referred to as quantitative RT-PCR or RT-qPCR) is a highly sensitive and high-throughput method used to study gene expression. Despite the numerous advantages of RT-qPCR, its accuracy is strongly influenced by the stability of internal reference genes used for normalizations. To date, few studies on the identification of reference genes have been performed on cassava (Manihot esculenta Crantz). Therefore, we selected 26 candidate reference genes mainly via the three following channels: reference genes used in previous studies on cassava, the orthologs of the most stable Arabidopsis genes, and the sequences obtained from 32 cassava transcriptome sequence data. Then, we employed ABI 7900 HT and SYBR Green PCR mix to assess the expression of these genes in 21 materials obtained from various cassava samples under different developmental and environmental conditions. The stability of gene expression was analyzed using two statistical algorithms, namely geNorm and NormFinder. geNorm software suggests the combination of cassava4.1_017977 and cassava4.1_006391 as sufficient reference genes for major cassava samples, the union of cassava4.1_014335 and cassava4.1_006884 as best choice for drought stressed samples, and the association of cassava4.1_012496 and cassava4.1_006391 as optimal choice for normally grown samples. NormFinder software recommends cassava4.1_006884 or cassava4.1_006776 as superior reference for qPCR analysis of different materials and organs of drought stressed or normally grown cassava, respectively. Results provide an important resource for cassava reference genes under specific conditions. The limitations of these findings were also discussed. Furthermore, we suggested some strategies that may be used to select candidate reference genes. PMID:27242878

  12. Application of RT-PCR in formalin-fixed and paraffin-embedded lung cancer tissues.

    PubMed

    Zhang, Fan; Wang, Zhuo-min; Liu, Hong-yu; Bai, Yun; Wei, Sen; Li, Ying; Wang, Min; Chen, Jun; Zhou, Qing-hua

    2010-01-01

    To analyze gene expression in formalin-fixed, paraffin-embedded lung cancer tissues using modified method. Total RNA from frozen tissues was extracted using TRIZOL reagent. RNA was extracted from formalin-fixed, paraffin-embedded tissues by digestion with proteinase K before the acid-phenol:chloroform extraction and carrier precipitation. We modified this method by using a higher concentration of proteinase K and a longer digestion time, optimized to 16 hours. RT-PCR and real-time RT-PCR were used to check reproducibility and the concordance between frozen and paraffin-embedded samples. The results showed that the RNA extracted from the paraffin-embedded lung tissues had high quality with the most fragment length between 28S and 18S bands (about 1000 to 2000 bases). The housekeeping gene GUSB exhibited low variation of expression in frozen and paraffin-embedded lung tissues, whereas PGK1 had the lowest variation in lymphoma tissues. Furthermore, real-time PCR analysis of the expression of known prognostic genes in non-small cell lung carcinoma (NSCLC) demonstrated an extremely high correlation (r>0.880) between the paired frozen and formalin-fixed, paraffin-embedded specimens. This improved method of RNA extraction is suitable for real-time quantitative RT-PCR, and may be used for global gene expression profiling of paraffin-embedded tissues.

  13. Optimized Sleeping Beauty transposons rapidly generate stable transgenic cell lines.

    PubMed

    Kowarz, Eric; Löscher, Denise; Marschalek, Rolf

    2015-04-01

    Stable gene expression in mammalian cells is a prerequisite for many in vitro and in vivo experiments. However, either the integration of plasmids into mammalian genomes or the use of retro-/lentiviral systems have intrinsic limitations. The use of transposable elements, e.g. the Sleeping Beauty system (SB), circumvents most of these drawbacks (integration sites, size limitations) and allows the quick generation of stable cell lines. The integration process of SB is catalyzed by a transposase and the handling of this gene transfer system is easy, fast and safe. Here, we report our improvements made to the existing SB vector system and present two new vector types for robust constitutive or inducible expression of any gene of interest. Both types are available in 16 variants with different selection marker (puromycin, hygromycin, blasticidin, neomycin) and fluorescent protein expression (GFP, RFP, BFP) to fit most experimental requirements. With this system it is possible to generate cell lines from stable transfected cells quickly and reliably in a medium-throughput setting (three to five days). Cell lines robustly express any gene-of-interest, either constitutively or tightly regulated by doxycycline. This allows many laboratory experiments to speed up generation of data in a rapid and robust manner. Copyright © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. Effect of DNA sequence of Fab fragment on yield characteristics and cell growth of E. coli.

    PubMed

    Kulmala, Antti; Huovinen, Tuomas; Lamminmäki, Urpo

    2017-06-19

    Codon usage is one of the factors influencing recombinant protein expression. We were interested in the codon usage of an antibody Fab fragment gene exhibiting extreme toxicity in the E. coli host. The toxic synthetic human Fab gene contained domains optimized by the "one amino acid-one codon" method. We redesigned five segments of the Fab gene with a "codon harmonization" method described by Angov et al. and studied the effects of these changes on cell viability, Fab yield and display on filamentous phage using different vectors and bacterial strains. The harmonization considerably reduced toxicity, increased Fab expression from negligible levels to 10 mg/l, and restored the display on phage. Testing the impact of the individual redesigned segments revealed that the most significant effects were conferred by changes in the constant domain of the light chain. For some of the Fab gene variants, we also observed striking differences in protein yields when cloned from a chloramphenicol resistant vector into an identical vector, except with ampicillin resistance. In conclusion, our results show that the expression of a heterodimeric secretory protein can be improved by harmonizing selected DNA segments by synonymous codons and reveal additional complexity involved in heterologous protein expression.

  15. Nonviral Vectors for Gene Delivery

    NASA Astrophysics Data System (ADS)

    Baoum, Abdulgader Ahmed

    2011-12-01

    The development of nonviral vectors for safe and efficient gene delivery has been gaining considerable attention recently. An ideal nonviral vector must protect the gene against degradation by nuclease in the extracellular matrix, internalize the plasma membrane, escape from the endosomal compartment, unpackage the gene at some point and have no detrimental effects. In comparison to viruses, nonviral vectors are relatively easy to synthesize, less immunogenic, low in cost, and have no limitation in the size of a gene that can be delivered. Significant progress has been made in the basic science and applications of various nonviral gene delivery vectors; however, the majority of nonviral approaches are still inefficient and often toxic. To this end, two nonviral gene delivery systems using either biodegradable poly(D,L-lactide- co-glycolide) (PLG) nanoparticles or cell penetrating peptide (CPP) complexes have been designed and studied using A549 human lung epithelial cells. PLG nanoparticles were optimized for gene delivery by varying particle surface chemistry using different coating materials that adsorb to the particle surface during formation. A variety of cationic coating materials were studied and compared to more conventional surfactants used for PLG nanoparticle fabrication. Nanoparticles (˜200 nm) efficiently encapsulated plasmids encoding for luciferase (80-90%) and slowly released the same for two weeks. After a delay, moderate levels of gene expression appeared at day 5 for certain positively charged PLG particles and gene expression was maintained for at least two weeks. In contrast, gene expression mediated by polyethyleneimine (PEI) ended at day 5. PLG particles were also significantly less cytotoxic than PEI suggesting the use of these vehicles for localized, sustained gene delivery to the pulmonary epithelium. On the other hand, a more simple method to synthesize 50-200 nm complexes capable of high transfection efficiency or high gene knockdown was also explored. Positively charged CPPs were complexed with pDNA or siRNA, which resulted in 'loose' (˜1 micron) particles. These were then condensed into small nanoparticles by using calcium, which formed "soft" crosslinks by interacting with both phosphates on nucleic acids and amines on CPPs. An optimal amount of CaCl2 produced stable, ˜100 nm complexes that exhibited higher transfection efficiency and gene silencing than PEI polyplexes. CPPs also displayed negligible cytotoxicity up to 5 mg/mL. Biophysical studies of the pDNA structure within complexes suggested that pDNA within CPP complexes (condensed with calcium) had similar structure, but enhanced thermal stability compared to PEI complexes. Thus, CPP complexes emerged as simple, attractive candidates for future studies on nonviral gene delivery in vivo.

  16. Knockdown of the bovine prion gene PRNP by RNA interference (RNAi) technology.

    PubMed

    Sutou, Shizuyo; Kunishi, Miho; Kudo, Toshiyuki; Wongsrikeao, Pimprapar; Miyagishi, Makoto; Otoi, Takeshige

    2007-07-26

    Since prion gene-knockout mice do not contract prion diseases and animals in which production of prion protein (PrP) is reduced by half are resistant to the disease, we hypothesized that bovine animals with reduced PrP would be tolerant to BSE. Hence, attempts were made to produce bovine PRNP (bPRNP) that could be knocked down by RNA interference (RNAi) technology. Before an in vivo study, optimal conditions for knocking down bPRNP were determined in cultured mammalian cell systems. Factors examined included siRNA (short interfering RNA) expression plasmid vectors, target sites of PRNP, and lengths of siRNAs. Four siRNA expression plasmid vectors were used: three harboring different cloning sites were driven by the human U6 promoter (hU6), and one by the human tRNAVal promoter. Six target sites of bovine PRNP were designed using an algorithm. From 1 (22 mer) to 9 (19, 20, 21, 22, 23, 24, 25, 27, and 29 mer) siRNA expression vectors were constructed for each target site. As targets of siRNA, the entire bPRNP coding sequence was connected to the reporter gene of the fluorescent EGFP, or of firefly luciferase or Renilla luciferase. Target plasmid DNA was co-transfected with siRNA expression vector DNA into HeLaS3 cells, and fluorescence or luminescence was measured. The activities of siRNAs varied widely depending on the target sites, length of the siRNAs, and vectors used. Longer siRNAs were less effective, and 19 mer or 21 mer was generally optimal. Although 21 mer GGGGAGAACTTCACCGAAACT expressed by a hU6-driven plasmid with a Bsp MI cloning site was best under the present experimental conditions, the corresponding tRNA promoter-driven plasmid was almost equally useful. The effectiveness of this siRNA was confirmed by immunostaining and Western blotting. Four siRNA expression plasmid vectors, six target sites of bPRNP, and various lengths of siRNAs from 19 mer to 29 mer were examined to establish optimal conditions for knocking down of bPRNP in vitro. The most effective siRNA so far tested was 21 mer GGGGAGAACTTCACCGAAACT driven either by a hU6 or tRNA promoter, a finding that provides a basis for further studies in vivo.

  17. Parameter optimization for constructing competing endogenous RNA regulatory network in glioblastoma multiforme and other cancers.

    PubMed

    Chiu, Yu-Chiao; Hsiao, Tzu-Hung; Chen, Yidong; Chuang, Eric Y

    2015-01-01

    In addition to direct targeting and repressing mRNAs, recent studies reported that microRNAs (miRNAs) can bridge up an alternative layer of post-transcriptional gene regulatory networks. The competing endogenous RNA (ceRNA) regulation depicts the scenario where pairs of genes (ceRNAs) sharing, fully or partially, common binding miRNAs (miRNA program) can establish coexpression through competition for a limited pool of the miRNA program. While the dynamics of ceRNA regulation among cellular conditions have been verified based on in silico and in vitro experiments, comprehensive investigation into the strength of ceRNA regulation in human datasets remains largely unexplored. Furthermore, pan-cancer analysis of ceRNA regulation, to our knowledge, has not been systematically investigated. In the present study we explored optimal conditions for ceRNA regulation, investigated functions governed by ceRNA regulation, and evaluated pan-cancer effects. We started by investigating how essential factors, such as the size of miRNA programs, the number of miRNA program binding sites, and expression levels of miRNA programs and ceRNAs affect the ceRNA regulation capacity in tumors derived from glioblastoma multiforme patients captured by The Cancer Genome Atlas (TCGA). We demonstrated that increased numbers of common targeting miRNAs as well as the abundance of binding sites enhance ceRNA regulation and strengthen coexpression of ceRNA pairs. Also, our investigation revealed that the strength of ceRNA regulation is dependent on expression levels of both miRNA programs and ceRNAs. Through functional annotation analysis, our results indicated that ceRNA regulation is highly associated with essential cellular functions and diseases including cancer. Furthermore, the highly intertwined ceRNA regulatory relationship enables constitutive and effective intra-function regulation of genes in diverse types of cancer. Using gene and microRNA expression datasets from TCGA, we successfully quantified the optimal conditions for ceRNA regulation, which hinge on four essential parameters of ceRNAs. Our analysis suggests optimized ceRNA regulation is related to disease pathways and essential cellular functions. Furthermore, although the strength of ceRNA regulation is dynamic among cancers, its governing functions are stably maintained. The findings of this report contribute to better understanding of ceRNA dynamics and its crucial roles in cancers.

  18. Molecular cloning and expression analysis of KIN10 and cold-acclimation related genes in wild banana 'Huanxi' (Musa itinerans).

    PubMed

    Liu, Weihua; Cheng, Chunzhen; Lai, Gongti; Lin, Yuling; Lai, Zhongxiong

    2015-01-01

    Banana cultivars may experience chilling or freezing injury in some of their cultivated regions, where wild banana can still grow very well. The clarification of the cold-resistant mechanism of wild banana is vital for cold-resistant banana breeding. In this study, the central stress integrator gene KIN10 and some cold-acclimation related genes (HOS1 and ICE1s) from the cold-resistant wild banana 'Huanxi' (Musa itinerans) were cloned and their expression patterns under different temperature treatments were analyzed. Thirteen full-length cDNA transcripts including 6 KIN10s, 1 HOS1 and 6 ICE1s were successfully cloned. Quantitative real-time PCR (qRT-PCR) results showed that all these genes had the highest expression levels at the critical temperature of banana (13 °C). Under chilling temperature (4 °C), the expression level of KIN10 reduced significantly but the expression of HOS1 was still higher than that at the optimal temperature (28 °C, control). Both KIN10 and HOS1 showed the lowest expression levels at 0 °C, the expression level of ICE1, however, was higher than control. As sucrose plays role in plant cold-acclimation and in regulation of KIN10 and HOS1 bioactivities, the sucrose contents of wild banana under different temperatures were detected. Results showed that the sucrose content increased as temperature lowered. Our result suggested that KIN10 may participate in cold stress response via regulating sucrose biosynthesis, which is helpful in regulating cold acclimation pathway in wild banana.

  19. Enhancement of Recombinant Protein Production in Transgenic Nicotiana benthamiana Plant Cell Suspension Cultures with Co-Cultivation of Agrobacterium Containing Silencing Suppressors.

    PubMed

    Huang, Ting-Kuo; Falk, Bryce W; Dandekar, Abhaya M; McDonald, Karen A

    2018-05-24

    We have previously demonstrated that the inducible plant viral vector (CMViva) in transgenic plant cell cultures can significantly improve the productivity of extracellular functional recombinant human alpha-1-antiryspin (rAAT) compared with either a common plant constitutive promoter ( Cauliflower mosaic virus (CaMV) 35S) or a chemically inducible promoter (estrogen receptor-based XVE) system. For a transgenic plant host system, however, viral or transgene-induced post-transcriptional gene silencing (PTGS) has been identified as a host response mechanism that may dramatically reduce the expression of a foreign gene. Previous studies have suggested that viral gene silencing suppressors encoded by a virus can block or interfere with the pathways of transgene-induced PTGS in plant cells. In this study, the capability of nine different viral gene silencing suppressors were evaluated for improving the production of rAAT protein in transgenic plant cell cultures (CMViva, XVE or 35S system) using an Agrobacterium -mediated transient expression co-cultivation process in which transgenic plant cells and recombinant Agrobacterium carrying the viral gene silencing suppressor were grown together in suspension cultures. Through the co-cultivation process, the impacts of gene silencing suppressors on the rAAT production were elucidated, and promising gene silencing suppressors were identified. Furthermore, the combinations of gene silencing suppressors were optimized using design of experiments methodology. The results have shown that in transgenic CMViva cell cultures, the functional rAAT as a percentage of total soluble protein is increased 5.7 fold with the expression of P19, and 17.2 fold with the co-expression of CP, P19 and P24.

  20. Parallel evolution of auditory genes for echolocation in bats and toothed whales.

    PubMed

    Shen, Yong-Yi; Liang, Lu; Li, Gui-Sheng; Murphy, Robert W; Zhang, Ya-Ping

    2012-06-01

    The ability of bats and toothed whales to echolocate is a remarkable case of convergent evolution. Previous genetic studies have documented parallel evolution of nucleotide sequences in Prestin and KCNQ4, both of which are associated with voltage motility during the cochlear amplification of signals. Echolocation involves complex mechanisms. The most important factors include cochlear amplification, nerve transmission, and signal re-coding. Herein, we screen three genes that play different roles in this auditory system. Cadherin 23 (Cdh23) and its ligand, protocadherin 15 (Pcdh15), are essential for bundling motility in the sensory hair. Otoferlin (Otof) responds to nerve signal transmission in the auditory inner hair cell. Signals of parallel evolution occur in all three genes in the three groups of echolocators--two groups of bats (Yangochiroptera and Rhinolophoidea) plus the dolphin. Significant signals of positive selection also occur in Cdh23 in the Rhinolophoidea and dolphin, and Pcdh15 in Yangochiroptera. In addition, adult echolocating bats have higher levels of Otof expression in the auditory cortex than do their embryos and non-echolocation bats. Cdh23 and Pcdh15 encode the upper and lower parts of tip-links, and both genes show signals of convergent evolution and positive selection in echolocators, implying that they may co-evolve to optimize cochlear amplification. Convergent evolution and expression patterns of Otof suggest the potential role of nerve and brain in echolocation. Our synthesis of gene sequence and gene expression analyses reveals that positive selection, parallel evolution, and perhaps co-evolution and gene expression affect multiple hearing genes that play different roles in audition, including voltage and bundle motility in cochlear amplification, nerve transmission, and brain function.

Top