Sample records for optimal target vector

  1. SU-E-T-422: Fast Analytical Beamlet Optimization for Volumetric Intensity-Modulated Arc Therapy

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chan, Kenny S K; Lee, Louis K Y; Xing, L

    2015-06-15

    Purpose: To implement a fast optimization algorithm on CPU/GPU heterogeneous computing platform and to obtain an optimal fluence for a given target dose distribution from the pre-calculated beamlets in an analytical approach. Methods: The 2D target dose distribution was modeled as an n-dimensional vector and estimated by a linear combination of independent basis vectors. The basis set was composed of the pre-calculated beamlet dose distributions at every 6 degrees of gantry angle and the cost function was set as the magnitude square of the vector difference between the target and the estimated dose distribution. The optimal weighting of the basis,more » which corresponds to the optimal fluence, was obtained analytically by the least square method. Those basis vectors with a positive weighting were selected for entering into the next level of optimization. Totally, 7 levels of optimization were implemented in the study.Ten head-and-neck and ten prostate carcinoma cases were selected for the study and mapped to a round water phantom with a diameter of 20cm. The Matlab computation was performed in a heterogeneous programming environment with Intel i7 CPU and NVIDIA Geforce 840M GPU. Results: In all selected cases, the estimated dose distribution was in a good agreement with the given target dose distribution and their correlation coefficients were found to be in the range of 0.9992 to 0.9997. Their root-mean-square error was monotonically decreasing and converging after 7 cycles of optimization. The computation took only about 10 seconds and the optimal fluence maps at each gantry angle throughout an arc were quickly obtained. Conclusion: An analytical approach is derived for finding the optimal fluence for a given target dose distribution and a fast optimization algorithm implemented on the CPU/GPU heterogeneous computing environment greatly reduces the optimization time.« less

  2. Identification and characterization of highly versatile peptide-vectors that bind non-competitively to the low-density lipoprotein receptor for in vivo targeting and delivery of small molecules and protein cargos

    PubMed Central

    David, Marion; Lécorché, Pascaline; Masse, Maxime; Faucon, Aude; Abouzid, Karima; Gaudin, Nicolas; Varini, Karine; Gassiot, Fanny; Ferracci, Géraldine; Jacquot, Guillaume; Vlieghe, Patrick

    2018-01-01

    Insufficient membrane penetration of drugs, in particular biotherapeutics and/or low target specificity remain a major drawback in their efficacy. We propose here the rational characterization and optimization of peptides to be developed as vectors that target cells expressing specific receptors involved in endocytosis or transcytosis. Among receptors involved in receptor-mediated transport is the LDL receptor. Screening complex phage-displayed peptide libraries on the human LDLR (hLDLR) stably expressed in cell lines led to the characterization of a family of cyclic and linear peptides that specifically bind the hLDLR. The VH411 lead cyclic peptide allowed endocytosis of payloads such as the S-Tag peptide or antibodies into cells expressing the hLDLR. Size reduction and chemical optimization of this lead peptide-vector led to improved receptor affinity. The optimized peptide-vectors were successfully conjugated to cargos of different nature and size including small organic molecules, siRNAs, peptides or a protein moiety such as an Fc fragment. We show that in all cases, the peptide-vectors retain their binding affinity to the hLDLR and potential for endocytosis. Following i.v. administration in wild type or ldlr-/- mice, an Fc fragment chemically conjugated or fused in C-terminal to peptide-vectors showed significant biodistribution in LDLR-enriched organs. We have thus developed highly versatile peptide-vectors endowed with good affinity for the LDLR as a target receptor. These peptide-vectors have the potential to be further developed for efficient transport of therapeutic or imaging agents into cells -including pathological cells—or organs that express the LDLR. PMID:29485998

  3. Support Vector Data Description Model to Map Specific Land Cover with Optimal Parameters Determined from a Window-Based Validation Set.

    PubMed

    Zhang, Jinshui; Yuan, Zhoumiqi; Shuai, Guanyuan; Pan, Yaozhong; Zhu, Xiufang

    2017-04-26

    This paper developed an approach, the window-based validation set for support vector data description (WVS-SVDD), to determine optimal parameters for support vector data description (SVDD) model to map specific land cover by integrating training and window-based validation sets. Compared to the conventional approach where the validation set included target and outlier pixels selected visually and randomly, the validation set derived from WVS-SVDD constructed a tightened hypersphere because of the compact constraint by the outlier pixels which were located neighboring to the target class in the spectral feature space. The overall accuracies for wheat and bare land achieved were as high as 89.25% and 83.65%, respectively. However, target class was underestimated because the validation set covers only a small fraction of the heterogeneous spectra of the target class. The different window sizes were then tested to acquire more wheat pixels for validation set. The results showed that classification accuracy increased with the increasing window size and the overall accuracies were higher than 88% at all window size scales. Moreover, WVS-SVDD showed much less sensitivity to the untrained classes than the multi-class support vector machine (SVM) method. Therefore, the developed method showed its merits using the optimal parameters, tradeoff coefficient ( C ) and kernel width ( s ), in mapping homogeneous specific land cover.

  4. Antibody-mediated targeting of replication-competent retroviral vectors.

    PubMed

    Tai, Chien-Kuo; Logg, Christopher R; Park, Jinha M; Anderson, W French; Press, Michael F; Kasahara, Noriyuki

    2003-05-20

    Replication-competent murine leukemia virus (MLV) vectors can be engineered to achieve high efficiency gene transfer to solid tumors in vivo and tumor-restricted replication, however their safety can be further enhanced by redirecting tropism of the virus envelope. We have therefore tested the targeting capability and replicative stability of ecotropic and amphotropic replication-competent retrovirus (RCR) vectors containing two tandem repeats from the immunoglobulin G-binding domain of Staphylococcal protein A inserted into the proline-rich "hinge" region of the envelope, which enables modular use of antibodies of various specificities for vector targeting. The modified envelopes were efficiently expressed and incorporated into virions, were capable of capturing monoclonal anti-HER2 antibodies, and mediated efficient binding of the virus-antibody complex to HER2-positive target cells. While infectivity was markedly reduced by pseudotyping with targeted envelopes alone, coexpression of wild-type envelope rescued efficient cellular entry. Both ecotropic and amphotropic RCR vector/anti-HER2 antibody complexes achieved significant enhancement of transduction on murine target cells overexpressing HER2, which could be competed by preincubation with excess free antibodies. Interestingly, HER2-expressing human breast cancer cells did not show enhancement of transduction despite efficient antibody-mediated cell surface binding, suggesting that target cell-specific parameters markedly affect the efficiency of post-binding entry processes. Serial replication of targeted vectors resulted in selection of Z domain deletion variants, but reduction of the overall size of the vector genome enhanced its stability. Application of antibody-mediated targeting to the initial localization of replication-competent virus vectors to tumor sites will thus require optimized target selection and vector design.

  5. Optimization of Support Vector Machine (SVM) for Object Classification

    NASA Technical Reports Server (NTRS)

    Scholten, Matthew; Dhingra, Neil; Lu, Thomas T.; Chao, Tien-Hsin

    2012-01-01

    The Support Vector Machine (SVM) is a powerful algorithm, useful in classifying data into species. The SVMs implemented in this research were used as classifiers for the final stage in a Multistage Automatic Target Recognition (ATR) system. A single kernel SVM known as SVMlight, and a modified version known as a SVM with K-Means Clustering were used. These SVM algorithms were tested as classifiers under varying conditions. Image noise levels varied, and the orientation of the targets changed. The classifiers were then optimized to demonstrate their maximum potential as classifiers. Results demonstrate the reliability of SVM as a method for classification. From trial to trial, SVM produces consistent results.

  6. Optimization of the transductional efficiency of lentiviral vectors: effect of sera and polycations

    PubMed Central

    Denning, Warren; Das, Suvendu; Guo, Siqi; Xu, Jun; Kappes, John C.; Hel, Zdenek

    2012-01-01

    Lentiviral vectors are widely used as effective gene-delivery vehicles. Optimization of the conditions for efficient lentiviral transduction is of a high importance for a variety of research applications. Presence of positively-charged polycations reduces the electrostatic repulsion forces between a negatively-charged cell and an approaching enveloped lentiviral particle resulting in an increase in the transduction efficiency. Although a variety of polycations are commonly used to enhance the transduction with retroviruses, the relative effect of various types of polycations on the efficiency of transduction and on the potential bias in the determination of titer of lentiviral vectors is not fully understood. Here we present data suggesting that DEAE-dextran provides superior results in enhancing lentiviral transduction of most tested cell lines and primary cell cultures. Specific type and source of serum affects the efficiency of transduction of target cell populations. Non-specific binding of enhanced green fluorescent protein (EGFP)-containing membrane aggregates in the presence of DEAE-dextran does not significantly affect the determination of the titer of EGFP-expressing lentiviral vectors. In conclusion, various polycations and types of sera should be tested when optimizing lentiviral transduction of target cell populations. PMID:22407723

  7. Optimization of the transductional efficiency of lentiviral vectors: effect of sera and polycations.

    PubMed

    Denning, Warren; Das, Suvendu; Guo, Siqi; Xu, Jun; Kappes, John C; Hel, Zdenek

    2013-03-01

    Lentiviral vectors are widely used as effective gene-delivery vehicles. Optimization of the conditions for efficient lentiviral transduction is of a high importance for a variety of research applications. Presence of positively charged polycations reduces the electrostatic repulsion forces between a negatively charged cell and an approaching enveloped lentiviral particle resulting in an increase in the transduction efficiency. Although a variety of polycations are commonly used to enhance the transduction with retroviruses, the relative effect of various types of polycations on the efficiency of transduction and on the potential bias in the determination of titer of lentiviral vectors is not fully understood. Here, we present data suggesting that DEAE-dextran provides superior results in enhancing lentiviral transduction of most tested cell lines and primary cell cultures. Specific type and source of serum affects the efficiency of transduction of target cell populations. Non-specific binding of enhanced green fluorescent protein (EGFP)-containing membrane aggregates in the presence of DEAE-dextran does not significantly affect the determination of the titer of EGFP-expressing lentiviral vectors. In conclusion, various polycations and types of sera should be tested when optimizing lentiviral transduction of target cell populations.

  8. Knockdown of the bovine prion gene PRNP by RNA interference (RNAi) technology.

    PubMed

    Sutou, Shizuyo; Kunishi, Miho; Kudo, Toshiyuki; Wongsrikeao, Pimprapar; Miyagishi, Makoto; Otoi, Takeshige

    2007-07-26

    Since prion gene-knockout mice do not contract prion diseases and animals in which production of prion protein (PrP) is reduced by half are resistant to the disease, we hypothesized that bovine animals with reduced PrP would be tolerant to BSE. Hence, attempts were made to produce bovine PRNP (bPRNP) that could be knocked down by RNA interference (RNAi) technology. Before an in vivo study, optimal conditions for knocking down bPRNP were determined in cultured mammalian cell systems. Factors examined included siRNA (short interfering RNA) expression plasmid vectors, target sites of PRNP, and lengths of siRNAs. Four siRNA expression plasmid vectors were used: three harboring different cloning sites were driven by the human U6 promoter (hU6), and one by the human tRNAVal promoter. Six target sites of bovine PRNP were designed using an algorithm. From 1 (22 mer) to 9 (19, 20, 21, 22, 23, 24, 25, 27, and 29 mer) siRNA expression vectors were constructed for each target site. As targets of siRNA, the entire bPRNP coding sequence was connected to the reporter gene of the fluorescent EGFP, or of firefly luciferase or Renilla luciferase. Target plasmid DNA was co-transfected with siRNA expression vector DNA into HeLaS3 cells, and fluorescence or luminescence was measured. The activities of siRNAs varied widely depending on the target sites, length of the siRNAs, and vectors used. Longer siRNAs were less effective, and 19 mer or 21 mer was generally optimal. Although 21 mer GGGGAGAACTTCACCGAAACT expressed by a hU6-driven plasmid with a Bsp MI cloning site was best under the present experimental conditions, the corresponding tRNA promoter-driven plasmid was almost equally useful. The effectiveness of this siRNA was confirmed by immunostaining and Western blotting. Four siRNA expression plasmid vectors, six target sites of bPRNP, and various lengths of siRNAs from 19 mer to 29 mer were examined to establish optimal conditions for knocking down of bPRNP in vitro. The most effective siRNA so far tested was 21 mer GGGGAGAACTTCACCGAAACT driven either by a hU6 or tRNA promoter, a finding that provides a basis for further studies in vivo.

  9. The magnetofection method: using magnetic force to enhance gene delivery.

    PubMed

    Plank, Christian; Schillinger, Ulrike; Scherer, Franz; Bergemann, Christian; Rémy, Jean-Serge; Krötz, Florian; Anton, Martina; Lausier, Jim; Rosenecker, Joseph

    2003-05-01

    In order to enhance and target gene delivery we have previously established a novel method, termed magnetofection, which uses magnetic force acting on gene vectors that are associated with magnetic particles. Here we review the benefits, the mechanism and the potential of the method with regard to overcoming physical limitations to gene delivery. Magnetic particle chemistry and physics are discussed, followed by a detailed presentation of vector formulation and optimization work. While magnetofection does not necessarily improve the overall performance of any given standard gene transfer method in vitro, its major potential lies in the extraordinarily rapid and efficient transfection at low vector doses and the possibility of remotely controlled vector targeting in vivo.

  10. Testing of the Support Vector Machine for Binary-Class Classification

    NASA Technical Reports Server (NTRS)

    Scholten, Matthew

    2011-01-01

    The Support Vector Machine is a powerful algorithm, useful in classifying data in to species. The Support Vector Machines implemented in this research were used as classifiers for the final stage in a Multistage Autonomous Target Recognition system. A single kernel SVM known as SVMlight, and a modified version known as a Support Vector Machine with K-Means Clustering were used. These SVM algorithms were tested as classifiers under varying conditions. Image noise levels varied, and the orientation of the targets changed. The classifiers were then optimized to demonstrate their maximum potential as classifiers. Results demonstrate the reliability of SMV as a method for classification. From trial to trial, SVM produces consistent results

  11. Singular vector-based targeted observations of chemical constituents: description and first application of the EURAD-IM-SVA v1.0

    NASA Astrophysics Data System (ADS)

    Goris, N.; Elbern, H.

    2015-12-01

    Measurements of the large-dimensional chemical state of the atmosphere provide only sparse snapshots of the state of the system due to their typically insufficient temporal and spatial density. In order to optimize the measurement configurations despite those limitations, the present work describes the identification of sensitive states of the chemical system as optimal target areas for adaptive observations. For this purpose, the technique of singular vector analysis (SVA), which has proven effective for targeted observations in numerical weather prediction, is implemented in the EURAD-IM (EURopean Air pollution and Dispersion - Inverse Model) chemical transport model, yielding the EURAD-IM-SVA v1.0. Besides initial values, emissions are investigated as critical simulation controlling targeting variables. For both variants, singular vectors are applied to determine the optimal placement for observations and moreover to quantify which chemical compounds have to be observed with preference. Based on measurements of the airship based ZEPTER-2 campaign, the EURAD-IM-SVA v1.0 has been evaluated by conducting a comprehensive set of model runs involving different initial states and simulation lengths. For the sake of brevity, we concentrate our attention on the following chemical compounds, O3, NO, NO2, HCHO, CO, HONO, and OH, and focus on their influence on selected O3 profiles. Our analysis shows that the optimal placement for observations of chemical species is not entirely determined by mere transport and mixing processes. Rather, a combination of initial chemical concentrations, chemical conversions, and meteorological processes determines the influence of chemical compounds and regions. We furthermore demonstrate that the optimal placement of observations of emission strengths is highly dependent on the location of emission sources and that the benefit of including emissions as target variables outperforms the value of initial value optimization with growing simulation length. The obtained results confirm the benefit of considering both initial values and emission strengths as target variables and of applying the EURAD-IM-SVA v1.0 for measurement decision guidance with respect to chemical compounds.

  12. A model for predicting field-directed particle transport in the magnetofection process.

    PubMed

    Furlani, Edward P; Xue, Xiaozheng

    2012-05-01

    To analyze the magnetofection process in which magnetic carrier particles with surface-bound gene vectors are attracted to target cells for transfection using an external magnetic field and to obtain a fundamental understanding of the impact of key factors such as particle size and field strength on the gene delivery process. A numerical model is used to study the field-directed transport of the carrier particle-gene vector complex to target cells in a conventional multiwell culture plate system. The model predicts the transport dynamics and the distribution of particle accumulation at the target cells. The impact of several factors that strongly influence gene vector delivery is assessed including the properties of the carrier particles, the strength of the field source, and its extent and proximity relative to the target cells. The study demonstrates that modeling can be used to predict and optimize gene vector delivery in the magnetofection process for novel and conventional in vitro systems.

  13. Using species distribution models to optimize vector control in the framework of the tsetse eradication campaign in Senegal

    PubMed Central

    Dicko, Ahmadou H.; Lancelot, Renaud; Seck, Momar T.; Guerrini, Laure; Sall, Baba; Lo, Mbargou; Vreysen, Marc J. B.; Lefrançois, Thierry; Fonta, William M.; Peck, Steven L.; Bouyer, Jérémy

    2014-01-01

    Tsetse flies are vectors of human and animal trypanosomoses in sub-Saharan Africa and are the target of the Pan African Tsetse and Trypanosomiasis Eradication Campaign (PATTEC). Glossina palpalis gambiensis (Diptera: Glossinidae) is a riverine species that is still present as an isolated metapopulation in the Niayes area of Senegal. It is targeted by a national eradication campaign combining a population reduction phase based on insecticide-treated targets (ITTs) and cattle and an eradication phase based on the sterile insect technique. In this study, we used species distribution models to optimize control operations. We compared the probability of the presence of G. p. gambiensis and habitat suitability using a regularized logistic regression and Maxent, respectively. Both models performed well, with an area under the curve of 0.89 and 0.92, respectively. Only the Maxent model predicted an expert-based classification of landscapes correctly. Maxent predictions were therefore used throughout the eradication campaign in the Niayes to make control operations more efficient in terms of deployment of ITTs, release density of sterile males, and location of monitoring traps used to assess program progress. We discuss how the models’ results informed about the particular ecology of tsetse in the target area. Maxent predictions allowed optimizing efficiency and cost within our project, and might be useful for other tsetse control campaigns in the framework of the PATTEC and, more generally, other vector or insect pest control programs. PMID:24982143

  14. Using species distribution models to optimize vector control in the framework of the tsetse eradication campaign in Senegal.

    PubMed

    Dicko, Ahmadou H; Lancelot, Renaud; Seck, Momar T; Guerrini, Laure; Sall, Baba; Lo, Mbargou; Vreysen, Marc J B; Lefrançois, Thierry; Fonta, William M; Peck, Steven L; Bouyer, Jérémy

    2014-07-15

    Tsetse flies are vectors of human and animal trypanosomoses in sub-Saharan Africa and are the target of the Pan African Tsetse and Trypanosomiasis Eradication Campaign (PATTEC). Glossina palpalis gambiensis (Diptera: Glossinidae) is a riverine species that is still present as an isolated metapopulation in the Niayes area of Senegal. It is targeted by a national eradication campaign combining a population reduction phase based on insecticide-treated targets (ITTs) and cattle and an eradication phase based on the sterile insect technique. In this study, we used species distribution models to optimize control operations. We compared the probability of the presence of G. p. gambiensis and habitat suitability using a regularized logistic regression and Maxent, respectively. Both models performed well, with an area under the curve of 0.89 and 0.92, respectively. Only the Maxent model predicted an expert-based classification of landscapes correctly. Maxent predictions were therefore used throughout the eradication campaign in the Niayes to make control operations more efficient in terms of deployment of ITTs, release density of sterile males, and location of monitoring traps used to assess program progress. We discuss how the models' results informed about the particular ecology of tsetse in the target area. Maxent predictions allowed optimizing efficiency and cost within our project, and might be useful for other tsetse control campaigns in the framework of the PATTEC and, more generally, other vector or insect pest control programs.

  15. Gene Suppression of Mouse Testis In Vivo Using Small Interfering RNA Derived from Plasmid Vectors

    PubMed Central

    Takizawa, Takami; Ishikawa, Tomoko; Kosuge, Takuji; Mizuguchi, Yoshiaki; Sato, Yoko; Koji, Takehiko; Araki, Yoshihiko; Takizawa, Toshihiro

    2012-01-01

    We evaluated whether inhibiting gene expression by small interfering RNA (siRNA) can be used for an in vivo model using a germ cell-specific gene (Tex101) as a model target in mouse testis. We generated plasmid-based expression vectors of siRNA targeting the Tex101 gene and transfected them into postnatal day 10 mouse testes by in vivo electroporation. After optimizing the electroporation conditions using a vector transfected into the mouse testis, a combination of high- and low-voltage pulses showed excellent transfection efficiency for the vectors with minimal tissue damage, but gene suppression was transient. Gene suppression by in vivo electroporation may be helpful as an alternative approach when designing experiments to unravel the basic role of testicular molecules. PMID:22489107

  16. Overcoming preexisting humoral immunity to AAV using capsid decoys.

    PubMed

    Mingozzi, Federico; Anguela, Xavier M; Pavani, Giulia; Chen, Yifeng; Davidson, Robert J; Hui, Daniel J; Yazicioglu, Mustafa; Elkouby, Liron; Hinderer, Christian J; Faella, Armida; Howard, Carolann; Tai, Alex; Podsakoff, Gregory M; Zhou, Shangzhen; Basner-Tschakarjan, Etiena; Wright, John Fraser; High, Katherine A

    2013-07-17

    Adeno-associated virus (AAV) vectors delivered through the systemic circulation successfully transduce various target tissues in animal models. However, similar attempts in humans have been hampered by the high prevalence of neutralizing antibodies to AAV, which completely block vector transduction. We show in both mouse and nonhuman primate models that addition of empty capsid to the final vector formulation can, in a dose-dependent manner, adsorb these antibodies, even at high titers, thus overcoming their inhibitory effect. To further enhance the safety of the approach, we mutated the receptor binding site of AAV2 to generate an empty capsid mutant that can adsorb antibodies but cannot enter a target cell. Our work suggests that optimizing the ratio of full/empty capsids in the final formulation of vector, based on a patient's anti-AAV titers, will maximize the efficacy of gene transfer after systemic vector delivery.

  17. Overcoming Preexisting Humoral Immunity to AAV Using Capsid Decoys

    PubMed Central

    Anguela, Xavier M.; Pavani, Giulia; Chen, Yifeng; Davidson, Robert J.; Hui, Daniel J.; Yazicioglu, Mustafa; Elkouby, Liron; Hinderer, Christian J.; Faella, Armida; Howard, Carolann; Tai, Alex; Podsakoff, Gregory M.; Zhou, Shangzhen; Basner-Tschakarjan, Etiena; Wright, John Fraser

    2014-01-01

    Adeno-associated virus (AAV) vectors delivered through the systemic circulation successfully transduce various target tissues in animal models. However, similar attempts in humans have been hampered by the high prevalence of neutralizing antibodies to AAV, which completely block vector transduction. We show in both mouse and nonhuman primate models that addition of empty capsid to the final vector formulation can, in a dose-dependent manner, adsorb these antibodies, even at high titers, thus overcoming their inhibitory effect. To further enhance the safety of the approach, we mutated the receptor binding site of AAV2 to generate an empty capsid mutant that can adsorb antibodies but cannot enter a target cell. Our work suggests that optimizing the ratio of full/empty capsids in the final formulation of vector, based on a patient's anti-AAV titers, will maximize the efficacy of gene transfer after systemic vector delivery. PMID:23863832

  18. Optimized AAV rh.10 Vectors That Partially Evade Neutralizing Antibodies during Hepatic Gene Transfer

    PubMed Central

    Selot, Ruchita; Arumugam, Sathyathithan; Mary, Bertin; Cheemadan, Sabna; Jayandharan, Giridhara R.

    2017-01-01

    Of the 12 common serotypes used for gene delivery applications, Adeno-associated virus (AAV)rh.10 serotype has shown sustained hepatic transduction and has the lowest seropositivity in humans. We have evaluated if further modifications to AAVrh.10 at its phosphodegron like regions or predicted immunogenic epitopes could improve its hepatic gene transfer and immune evasion potential. Mutant AAVrh.10 vectors were generated by site directed mutagenesis of the predicted targets. These mutant vectors were first tested for their transduction efficiency in HeLa and HEK293T cells. The optimal vector was further evaluated for their cellular uptake, entry, and intracellular trafficking by quantitative PCR and time-lapse confocal microscopy. To evaluate their potential during hepatic gene therapy, C57BL/6 mice were administered with wild-type or optimal mutant AAVrh.10 and the luciferase transgene expression was documented by serial bioluminescence imaging at 14, 30, 45, and 72 days post-gene transfer. Their hepatic transduction was further verified by a quantitative PCR analysis of AAV copy number in the liver tissue. The optimal AAVrh.10 vector was further evaluated for their immune escape potential, in animals pre-immunized with human intravenous immunoglobulin. Our results demonstrate that a modified AAVrh.10 S671A vector had enhanced cellular entry (3.6 fold), migrate rapidly to the perinuclear region (1 vs. >2 h for wild type vectors) in vitro, which further translates to modest increase in hepatic gene transfer efficiency in vivo. More importantly, the mutant AAVrh.10 vector was able to partially evade neutralizing antibodies (~27–64 fold) in pre-immunized animals. The development of an AAV vector system that can escape the circulating neutralizing antibodies in the host will substantially widen the scope of gene therapy applications in humans. PMID:28769791

  19. Minimum Variance Distortionless Response Beamformer with Enhanced Nulling Level Control via Dynamic Mutated Artificial Immune System

    PubMed Central

    Kiong, Tiong Sieh; Salem, S. Balasem; Paw, Johnny Koh Siaw; Sankar, K. Prajindra

    2014-01-01

    In smart antenna applications, the adaptive beamforming technique is used to cancel interfering signals (placing nulls) and produce or steer a strong beam toward the target signal according to the calculated weight vectors. Minimum variance distortionless response (MVDR) beamforming is capable of determining the weight vectors for beam steering; however, its nulling level on the interference sources remains unsatisfactory. Beamforming can be considered as an optimization problem, such that optimal weight vector should be obtained through computation. Hence, in this paper, a new dynamic mutated artificial immune system (DM-AIS) is proposed to enhance MVDR beamforming for controlling the null steering of interference and increase the signal to interference noise ratio (SINR) for wanted signals. PMID:25003136

  20. Minimum variance distortionless response beamformer with enhanced nulling level control via dynamic mutated artificial immune system.

    PubMed

    Kiong, Tiong Sieh; Salem, S Balasem; Paw, Johnny Koh Siaw; Sankar, K Prajindra; Darzi, Soodabeh

    2014-01-01

    In smart antenna applications, the adaptive beamforming technique is used to cancel interfering signals (placing nulls) and produce or steer a strong beam toward the target signal according to the calculated weight vectors. Minimum variance distortionless response (MVDR) beamforming is capable of determining the weight vectors for beam steering; however, its nulling level on the interference sources remains unsatisfactory. Beamforming can be considered as an optimization problem, such that optimal weight vector should be obtained through computation. Hence, in this paper, a new dynamic mutated artificial immune system (DM-AIS) is proposed to enhance MVDR beamforming for controlling the null steering of interference and increase the signal to interference noise ratio (SINR) for wanted signals.

  1. Genetic transformation of Fusarium avenaceum by Agrobacterium tumefaciens mediated transformation and the development of a USER-Brick vector construction system

    PubMed Central

    2014-01-01

    Background The plant pathogenic and saprophytic fungus Fusarium avenaceum causes considerable in-field and post-field losses worldwide due to its infections of a wide range of different crops. Despite its significant impact on the profitability of agriculture production and a desire to characterize the infection process at the molecular biological level, no genetic transformation protocol has yet been established for F. avenaceum. In the current study, it is shown that F. avenaceum can be efficiently transformed by Agrobacterium tumefaciens mediated transformation. In addition, an efficient and versatile single step vector construction strategy relying on Uracil Specific Excision Reagent (USER) Fusion cloning, is developed. Results The new vector construction system, termed USER-Brick, is based on a limited number of PCR amplified vector fragments (core USER-Bricks) which are combined with PCR generated fragments from the gene of interest. The system was found to have an assembly efficiency of 97% with up to six DNA fragments, based on the construction of 55 vectors targeting different polyketide synthase (PKS) and PKS associated transcription factor encoding genes in F. avenaceum. Subsequently, the ΔFaPKS3 vector was used for optimizing A. tumefaciens mediated transformation (ATMT) of F. avenaceum with respect to six variables. Acetosyringone concentration, co-culturing time, co-culturing temperature and fungal inoculum were found to significantly impact the transformation frequency. Following optimization, an average of 140 transformants per 106 macroconidia was obtained in experiments aimed at introducing targeted genome modifications. Targeted deletion of FaPKS6 (FA08709.2) in F. avenaceum showed that this gene is essential for biosynthesis of the polyketide/nonribosomal compound fusaristatin A. Conclusion The new USER-Brick system is highly versatile by allowing for the reuse of a common set of building blocks to accommodate seven different types of genome modifications. New USER-Bricks with additional functionality can easily be added to the system by future users. The optimized protocol for ATMT of F. avenaceum represents the first reported targeted genome modification by double homologous recombination of this plant pathogen and will allow for future characterization of this fungus. Functional linkage of FaPKS6 to the production of the mycotoxin fusaristatin A serves as a first testimony to this. PMID:25048842

  2. Targeted Gene Knock Out Using Nuclease-Assisted Vector Integration: Hemi- and Homozygous Deletion of JAG1.

    PubMed

    Gapinske, Michael; Tague, Nathan; Winter, Jackson; Underhill, Gregory H; Perez-Pinera, Pablo

    2018-01-01

    Gene editing technologies are revolutionizing fields such as biomedicine and biotechnology by providing a simple means to manipulate the genetic makeup of essentially any organism. Gene editing tools function by introducing double-stranded breaks at targeted sites within the genome, which the host cells repair preferentially by Non-Homologous End Joining. While the technologies to introduce double-stranded breaks have been extensively optimized, this progress has not been matched by the development of methods to integrate heterologous DNA at the target sites or techniques to detect and isolate cells that harbor the desired modification. We present here a technique for rapid introduction of vectors at target sites in the genome that enables efficient isolation of successfully edited cells.

  3. Atlas IIAS ascent trajectory design for the SOHO mission

    NASA Technical Reports Server (NTRS)

    Willen, Robert E.; Rude, Bradley J.

    1993-01-01

    In 1995, an Atlas IIAS launch vehicle will loft the Solar and Heliospheric Observatory (SOHO) as part of the International Solar and Terrestrial Physics program. The operational phase of the SOHO mission will be conducted from a `halo orbit' about the Sun-Earth interior libration point. Depending on the time of the year of launch, the optimal transfer requires a parking orbit of variable duration to satisfy widely varying inertial targets. A simulation capability has been developed that optimizes the launch vehicle ascent and spacecraft transfer phases of flight together, subject to both launch vehicle and spacecraft constraints. It will be shown that this `ground-up' simulation removes the need for an intermediate target vector at Centaur upper stage/spacecraft separation. Although providing only a modest gain in deliverable satellite mass, this capability substantially improves the mission integration process by removing the strict reliance on near-Earth target vectors. Trajectory data from several cases are presented and future applications of this capability are also discussed.

  4. Theater-Level Gaming and Analysis Workshop for Force Planning. Volume II. Summary, Discussion of Issues and Requirements for Research. September 27- 29, 1977, Held at Xerox International Center for Training and Management Development, Leesburg, Virginia

    DTIC Science & Technology

    1981-05-01

    be allocated to targets on the battlefield and in the rear area. The speaker describes the VECTOR I/NUCLEAR model, a combination of the UNICORN target...outlined. UNICORN is compatible with VECTOR 1 in level of detail. It is an expected value damage model and uses linear programming to optimize the...and a growing appreciation for the power of simulation in addressing large, complex problems, it was only a few short years before these games had

  5. AAV viral vector delivery to the brain by shape-conforming MR-guided infusions.

    PubMed

    Bankiewicz, Krystof S; Sudhakar, Vivek; Samaranch, Lluis; San Sebastian, Waldy; Bringas, John; Forsayeth, John

    2016-10-28

    Gene transfer technology offers great promise as a potential therapeutic approach to the brain but has to be viewed as a very complex technology. Success of ongoing clinical gene therapy trials depends on many factors such as selection of the correct genetic and anatomical target in the brain. In addition, selection of the viral vector capable of transfer of therapeutic gene into target cells, along with long-term expression that avoids immunotoxicity has to be established. As with any drug development strategy, delivery of gene therapy has to be consistent and predictable in each study subject. Failed drug and vector delivery will lead to failed clinical trials. In this article, we describe our experience with AAV viral vector delivery system, that allows us to optimize and monitor in real time viral vector administration into affected regions of the brain. In addition to discussing MRI-guided technology for administration of AAV vectors we have developed and now employ in current clinical trials, we also describe ways in which infusion cannula design and stereotactic trajectory may be used to maximize the anatomical coverage by using fluid backflow. This innovative approach enables more precise coverage by fitting the shape of the infusion to the shape of the anatomical target. Copyright © 2016 Elsevier B.V. All rights reserved.

  6. Management of arthropod pathogen vectors in North America: Minimizing adverse effects on pollinators

    USGS Publications Warehouse

    Ginsberg, Howard; Bargar, Timothy A.; Hladik, Michelle L.; Lubelczyk, Charles

    2017-01-01

    Tick and mosquito management is important to public health protection. At the same time, growing concerns about declines of pollinator species raise the question of whether vector control practices might affect pollinator populations. We report the results of a task force of the North American Pollinator Protection Campaign (NAPPC) that examined potential effects of vector management practices on pollinators, and how these programs could be adjusted to minimize negative effects on pollinating species. The main types of vector control practices that might affect pollinators are landscape manipulation, biocontrol, and pesticide applications. Some current practices already minimize effects of vector control on pollinators (e.g., short-lived pesticides and application-targeting technologies). Nontarget effects can be further diminished by taking pollinator protection into account in the planning stages of vector management programs. Effects of vector control on pollinator species often depend on specific local conditions (e.g., proximity of locations with abundant vectors to concentrations of floral resources), so planning is most effective when it includes collaborations of local vector management professionals with local experts on pollinators. Interventions can then be designed to avoid pollinators (e.g., targeting applications to avoid blooming times and pollinator nesting habitats), while still optimizing public health protection. Research on efficient targeting of interventions, and on effects on pollinators of emerging technologies, will help mitigate potential deleterious effects on pollinators in future management programs. In particular, models that can predict effects of integrated pest management on vector-borne pathogen transmission, along with effects on pollinator populations, would be useful for collaborative decision-making.

  7. Quantitative evaluation of first, second, and third generation hairpin systems reveals the limit of mammalian vector-based RNAi

    PubMed Central

    Watanabe, Colin; Cuellar, Trinna L.; Haley, Benjamin

    2016-01-01

    ABSTRACT Incorporating miRNA-like features into vector-based hairpin scaffolds has been shown to augment small RNA processing and RNAi efficiency. Therefore, defining an optimal, native hairpin context may obviate a need for hairpin-specific targeting design schemes, which confound the movement of functional siRNAs into shRNA/artificial miRNA backbones, or large-scale screens to identify efficacious sequences. Thus, we used quantitative cell-based assays to compare separate third generation artificial miRNA systems, miR-E (based on miR-30a) and miR-3G (based on miR-16-2 and first described in this study) to widely-adopted, first and second generation formats in both Pol-II and Pol-III expression vector contexts. Despite their unique structures and strandedness, and in contrast to first and second-generation RNAi triggers, the third generation formats operated with remarkable similarity to one another, and strong silencing was observed with a significant fraction of the evaluated target sequences within either promoter context. By pairing an established siRNA design algorithm with the third generation vectors we could readily identify targeting sequences that matched or exceeded the potency of those discovered through large-scale sensor-based assays. We find that third generation hairpin systems enable the maximal level of siRNA function, likely through enhanced processing and accumulation of precisely-defined guide RNAs. Therefore, we predict future gains in RNAi potency will come from improved hairpin expression and identification of optimal siRNA-intrinsic silencing properties rather than further modification of these scaffolds. Consequently, third generation systems should be the primary format for vector-based RNAi studies; miR-3G is advantageous due to its small expression cassette and simplified, cost-efficient cloning scheme. PMID:26786363

  8. Implementing Scientific Simulation Codes Highly Tailored for Vector Architectures Using Custom Configurable Computing Machines

    NASA Technical Reports Server (NTRS)

    Rutishauser, David

    2006-01-01

    The motivation for this work comes from an observation that amidst the push for Massively Parallel (MP) solutions to high-end computing problems such as numerical physical simulations, large amounts of legacy code exist that are highly optimized for vector supercomputers. Because re-hosting legacy code often requires a complete re-write of the original code, which can be a very long and expensive effort, this work examines the potential to exploit reconfigurable computing machines in place of a vector supercomputer to implement an essentially unmodified legacy source code. Custom and reconfigurable computing resources could be used to emulate an original application's target platform to the extent required to achieve high performance. To arrive at an architecture that delivers the desired performance subject to limited resources involves solving a multi-variable optimization problem with constraints. Prior research in the area of reconfigurable computing has demonstrated that designing an optimum hardware implementation of a given application under hardware resource constraints is an NP-complete problem. The premise of the approach is that the general issue of applying reconfigurable computing resources to the implementation of an application, maximizing the performance of the computation subject to physical resource constraints, can be made a tractable problem by assuming a computational paradigm, such as vector processing. This research contributes a formulation of the problem and a methodology to design a reconfigurable vector processing implementation of a given application that satisfies a performance metric. A generic, parametric, architectural framework for vector processing implemented in reconfigurable logic is developed as a target for a scheduling/mapping algorithm that maps an input computation to a given instance of the architecture. This algorithm is integrated with an optimization framework to arrive at a specification of the architecture parameters that attempts to minimize execution time, while staying within resource constraints. The flexibility of using a custom reconfigurable implementation is exploited in a unique manner to leverage the lessons learned in vector supercomputer development. The vector processing framework is tailored to the application, with variable parameters that are fixed in traditional vector processing. Benchmark data that demonstrates the functionality and utility of the approach is presented. The benchmark data includes an identified bottleneck in a real case study example vector code, the NASA Langley Terminal Area Simulation System (TASS) application.

  9. Optimized Pan-species and Speciation Duplex Real-time PCR Assays for Plasmodium Parasites Detection in Malaria Vectors

    PubMed Central

    Sandeu, Maurice Marcel; Moussiliou, Azizath; Moiroux, Nicolas; Padonou, Gilles G.; Massougbodji, Achille; Corbel, Vincent; Tuikue Ndam, Nicaise

    2012-01-01

    Background An accurate method for detecting malaria parasites in the mosquito’s vector remains an essential component in the vector control. The Enzyme linked immunosorbent assay specific for circumsporozoite protein (ELISA-CSP) is the gold standard method for the detection of malaria parasites in the vector even if it presents some limitations. Here, we optimized multiplex real-time PCR assays to accurately detect minor populations in mixed infection with multiple Plasmodium species in the African malaria vectors Anopheles gambiae and Anopheles funestus. Methods Complementary TaqMan-based real-time PCR assays that detect Plasmodium species using specific primers and probes were first evaluated on artificial mixtures of different targets inserted in plasmid constructs. The assays were further validated in comparison with the ELISA-CSP on 200 field caught Anopheles gambiae and Anopheles funestus mosquitoes collected in two localities in southern Benin. Results The validation of the duplex real-time PCR assays on the plasmid mixtures demonstrated robust specificity and sensitivity for detecting distinct targets. Using a panel of mosquito specimen, the real-time PCR showed a relatively high sensitivity (88.6%) and specificity (98%), compared to ELISA-CSP as the referent standard. The agreement between both methods was “excellent” (κ = 0.8, P<0.05). The relative quantification of Plasmodium DNA between the two Anopheles species analyzed showed no significant difference (P = 0, 2). All infected mosquito samples contained Plasmodium falciparum DNA and mixed infections with P. malariae and/or P. ovale were observed in 18.6% and 13.6% of An. gambiae and An. funestus respectively. Plasmodium vivax was found in none of the mosquito samples analyzed. Conclusion This study presents an optimized method for detecting the four Plasmodium species in the African malaria vectors. The study highlights substantial discordance with traditional ELISA-CSP pointing out the utility of employing an accurate molecular diagnostic tool for detecting malaria parasites in field mosquito populations. PMID:23285168

  10. Expanding integrated vector management to promote healthy environments

    PubMed Central

    Lizzi, Karina M.; Qualls, Whitney A.; Brown, Scott C.; Beier, John C.

    2014-01-01

    Integrated Vector Management (IVM) strategies are intended to protect communities from pathogen transmission by arthropods. These strategies target multiple vectors and different ecological and socioeconomic settings, but the aggregate benefits of IVM are limited by the narrow focus of its approach; IVM strategies only aim to control arthropod vectors. We argue that IVM should encompass environmental modifications at early stages, for instance, infrastructural development and sanitation services, to regulate not only vectors but also nuisance-biting arthropods. An additional focus on nuisance-biting arthropods will improve public health, quality of life, and minimize social disparity issues fostered by pests. Optimally, IVM could incorporate environmental awareness and promotion of control methods in order to proactively reduce threats of serious pest situations. PMID:25028090

  11. Disclosing the Parameters Leading to High Productivity of Retroviral Producer Cells Lines: Evaluating Random Versus Targeted Integration.

    PubMed

    Bandeira, Vanessa S; Tomás, Hélio A; Alici, Evren; Carrondo, Manuel J T; Coroadinha, Ana S

    2017-04-01

    Gammaretrovirus and lentivirus are the preferred viral vectors to genetically modify T and natural killer cells to be used in immune cell therapies. The transduction efficiency of hematopoietic and T cells is more efficient using gibbon ape leukemia virus (GaLV) pseudotyping. In this context gammaretroviral vector producer cells offer competitive higher titers than transient lentiviral vectors productions. The main aim of this work was to identify the key parameters governing GaLV-pseudotyped gammaretroviral vector productivity in stable producer cells, using a retroviral vector expression cassette enabling positive (facilitating cell enrichment) and negative cell selection (allowing cell elimination). The retroviral vector contains a thymidine kinase suicide gene fused with a ouabain-resistant Na + ,K + -ATPase gene, a potential safer and faster marker. The establishment of retroviral vector producer cells is traditionally performed by randomly integrating the retroviral vector expression cassette codifying the transgene. More recently, recombinase-mediated cassette exchange methodologies have been introduced to achieve targeted integration. Herein we compared random and targeted integration of the retroviral vector transgene construct. Two retroviral producer cell lines, 293 OuaS and 293 FlexOuaS, were generated by random and targeted integration, respectively, producing high titers (on the order of 10 7 infectious particles·ml -1 ). Results showed that the retroviral vector transgene cassette is the key retroviral vector component determining the viral titers notwithstanding, single-copy integration is sufficient to provide high titers. The expression levels of the three retroviral constructs (gag-pol, GaLV env, and retroviral vector transgene) were analyzed. Although gag-pol and GaLV env gene expression levels should surpass a minimal threshold, we found that relatively modest expression levels of these two expression cassettes are required. Their levels of expression should not be maximized. We concluded, to establish a high producer retroviral vector cell line only the expression level of the genomic retroviral RNA, that is, the retroviral vector transgene cassette, should be maximized, both through (1) the optimization of its design (i.e., genetic elements composition) and (2) the selection of high expressing chromosomal locus for its integration. The use of methodologies identifying and promoting integration into high-expression loci, as targeted integration or high-throughput screening are in this perspective highly valuable.

  12. Optimal Low Energy Earth-Moon Transfers

    NASA Technical Reports Server (NTRS)

    Griesemer, Paul Ricord; Ocampo, Cesar; Cooley, D. S.

    2010-01-01

    The optimality of a low-energy Earth-Moon transfer is examined for the first time using primer vector theory. An optimal control problem is formed with the following free variables: the location, time, and magnitude of the transfer insertion burn, and the transfer time. A constraint is placed on the initial state of the spacecraft to bind it to a given initial orbit around a first body, and on the final state of the spacecraft to limit its Keplerian energy with respect to a second body. Optimal transfers in the system are shown to meet certain conditions placed on the primer vector and its time derivative. A two point boundary value problem containing these necessary conditions is created for use in targeting optimal transfers. The two point boundary value problem is then applied to the ballistic lunar capture problem, and an optimal trajectory is shown. Additionally, the ballistic lunar capture trajectory is examined to determine whether one or more additional impulses may improve on the cost of the transfer.

  13. Design of an optimal preview controller for linear discrete-time descriptor systems with state delay

    NASA Astrophysics Data System (ADS)

    Cao, Mengjuan; Liao, Fucheng

    2015-04-01

    In this paper, the linear discrete-time descriptor system with state delay is studied, and a design method for an optimal preview controller is proposed. First, by using the discrete lifting technique, the original system is transformed into a general descriptor system without state delay in form. Then, taking advantage of the first-order forward difference operator, we construct a descriptor augmented error system, including the state vectors of the lifted system, error vectors, and desired target signals. Rigorous mathematical proofs are given for the regularity, stabilisability, causal controllability, and causal observability of the descriptor augmented error system. Based on these, the optimal preview controller with preview feedforward compensation for the original system is obtained by using the standard optimal regulator theory of the descriptor system. The effectiveness of the proposed method is shown by numerical simulation.

  14. Gammaretroviral Vectors: Biology, Technology and Application

    PubMed Central

    Maetzig, Tobias; Galla, Melanie; Baum, Christopher; Schambach, Axel

    2011-01-01

    Retroviruses are evolutionary optimized gene carriers that have naturally adapted to their hosts to efficiently deliver their nucleic acids into the target cell chromatin, thereby overcoming natural cellular barriers. Here we will review—starting with a deeper look into retroviral biology—how Murine Leukemia Virus (MLV), a simple gammaretrovirus, can be converted into an efficient vehicle of genetic therapeutics. Furthermore, we will describe how more rational vector backbones can be designed and how these so-called self-inactivating vectors can be pseudotyped and produced. Finally, we will provide an overview on existing clinical trials and how biosafety can be improved. PMID:21994751

  15. Evolutionary programming-based univector field navigation method for past mobile robots.

    PubMed

    Kim, Y J; Kim, J H; Kwon, D S

    2001-01-01

    Most of navigation techniques with obstacle avoidance do not consider the robot orientation at the target position. These techniques deal with the robot position only and are independent of its orientation and velocity. To solve these problems this paper proposes a novel univector field method for fast mobile robot navigation which introduces a normalized two dimensional vector field. The method provides fast moving robots with the desired posture at the target position and obstacle avoidance. To obtain the sub-optimal vector field, a function approximator is used and trained by evolutionary programming. Two kinds of vector fields are trained, one for the final posture acquisition and the other for obstacle avoidance. Computer simulations and real experiments are carried out for a fast moving mobile robot to demonstrate the effectiveness of the proposed scheme.

  16. Homologous Recombination-Independent Large Gene Cassette Knock-in in CHO Cells Using TALEN and MMEJ-Directed Donor Plasmids

    PubMed Central

    Sakuma, Tetsushi; Takenaga, Mitsumasa; Kawabe, Yoshinori; Nakamura, Takahiro; Kamihira, Masamichi; Yamamoto, Takashi

    2015-01-01

    Gene knock-in techniques have rapidly evolved in recent years, along with the development and maturation of genome editing technology using programmable nucleases. We recently reported a novel strategy for microhomology-mediated end-joining-dependent integration of donor DNA by using TALEN or CRISPR/Cas9 and optimized targeting vectors, named PITCh (Precise Integration into Target Chromosome) vectors. Here we describe TALEN and PITCh vector-mediated integration of long gene cassettes, including a single-chain Fv-Fc (scFv-Fc) gene, in Chinese hamster ovary (CHO) cells, with comparison of targeting and cloning efficiency among several donor design and culture conditions. We achieved 9.6-kb whole plasmid integration and 7.6-kb backbone-free integration into a defined genomic locus in CHO cells. Furthermore, we confirmed the reasonable productivity of recombinant scFv-Fc protein of the knock-in cells. Using our protocol, the knock-in cell clones could be obtained by a single transfection and a single limiting dilution using a 96-well plate, without constructing targeting vectors containing long homology arms. Thus, the study described herein provides a highly practical strategy for gene knock-in of large DNA in CHO cells, which accelerates high-throughput generation of cell lines stably producing any desired biopharmaceuticals, including huge antibody proteins. PMID:26473830

  17. Homologous Recombination-Independent Large Gene Cassette Knock-in in CHO Cells Using TALEN and MMEJ-Directed Donor Plasmids.

    PubMed

    Sakuma, Tetsushi; Takenaga, Mitsumasa; Kawabe, Yoshinori; Nakamura, Takahiro; Kamihira, Masamichi; Yamamoto, Takashi

    2015-10-09

    Gene knock-in techniques have rapidly evolved in recent years, along with the development and maturation of genome editing technology using programmable nucleases. We recently reported a novel strategy for microhomology-mediated end-joining-dependent integration of donor DNA by using TALEN or CRISPR/Cas9 and optimized targeting vectors, named PITCh (Precise Integration into Target Chromosome) vectors. Here we describe TALEN and PITCh vector-mediated integration of long gene cassettes, including a single-chain Fv-Fc (scFv-Fc) gene, in Chinese hamster ovary (CHO) cells, with comparison of targeting and cloning efficiency among several donor design and culture conditions. We achieved 9.6-kb whole plasmid integration and 7.6-kb backbone-free integration into a defined genomic locus in CHO cells. Furthermore, we confirmed the reasonable productivity of recombinant scFv-Fc protein of the knock-in cells. Using our protocol, the knock-in cell clones could be obtained by a single transfection and a single limiting dilution using a 96-well plate, without constructing targeting vectors containing long homology arms. Thus, the study described herein provides a highly practical strategy for gene knock-in of large DNA in CHO cells, which accelerates high-throughput generation of cell lines stably producing any desired biopharmaceuticals, including huge antibody proteins.

  18. HYBRID NEURAL NETWORK AND SUPPORT VECTOR MACHINE METHOD FOR OPTIMIZATION

    NASA Technical Reports Server (NTRS)

    Rai, Man Mohan (Inventor)

    2005-01-01

    System and method for optimization of a design associated with a response function, using a hybrid neural net and support vector machine (NN/SVM) analysis to minimize or maximize an objective function, optionally subject to one or more constraints. As a first example, the NN/SVM analysis is applied iteratively to design of an aerodynamic component, such as an airfoil shape, where the objective function measures deviation from a target pressure distribution on the perimeter of the aerodynamic component. As a second example, the NN/SVM analysis is applied to data classification of a sequence of data points in a multidimensional space. The NN/SVM analysis is also applied to data regression.

  19. Hybrid Neural Network and Support Vector Machine Method for Optimization

    NASA Technical Reports Server (NTRS)

    Rai, Man Mohan (Inventor)

    2007-01-01

    System and method for optimization of a design associated with a response function, using a hybrid neural net and support vector machine (NN/SVM) analysis to minimize or maximize an objective function, optionally subject to one or more constraints. As a first example, the NN/SVM analysis is applied iteratively to design of an aerodynamic component, such as an airfoil shape, where the objective function measures deviation from a target pressure distribution on the perimeter of the aerodynamic component. As a second example, the NN/SVM analysis is applied to data classification of a sequence of data points in a multidimensional space. The NN/SVM analysis is also applied to data regression.

  20. Optimal ballistically captured Earth-Moon transfers

    NASA Astrophysics Data System (ADS)

    Ricord Griesemer, Paul; Ocampo, Cesar; Cooley, D. S.

    2012-07-01

    The optimality of a low-energy Earth-Moon transfer terminating in ballistic capture is examined for the first time using primer vector theory. An optimal control problem is formed with the following free variables: the location, time, and magnitude of the transfer insertion burn, and the transfer time. A constraint is placed on the initial state of the spacecraft to bind it to a given initial orbit around a first body, and on the final state of the spacecraft to limit its Keplerian energy with respect to a second body. Optimal transfers in the system are shown to meet certain conditions placed on the primer vector and its time derivative. A two point boundary value problem containing these necessary conditions is created for use in targeting optimal transfers. The two point boundary value problem is then applied to the ballistic lunar capture problem, and an optimal trajectory is shown. Additionally, the problem is then modified to fix the time of transfer, allowing for optimal multi-impulse transfers. The tradeoff between transfer time and fuel cost is shown for Earth-Moon ballistic lunar capture transfers.

  1. Multi-kilobase homozygous targeted gene replacement in human induced pluripotent stem cells.

    PubMed

    Byrne, Susan M; Ortiz, Luis; Mali, Prashant; Aach, John; Church, George M

    2015-02-18

    Sequence-specific nucleases such as TALEN and the CRISPR/Cas9 system have so far been used to disrupt, correct or insert transgenes at precise locations in mammalian genomes. We demonstrate efficient 'knock-in' targeted replacement of multi-kilobase genes in human induced pluripotent stem cells (iPSC). Using a model system replacing endogenous human genes with their mouse counterpart, we performed a comprehensive study of targeting vector design parameters for homologous recombination. A 2.7 kilobase (kb) homozygous gene replacement was achieved in up to 11% of iPSC without selection. The optimal homology arm length was around 2 kb, with homology length being especially critical on the arm not adjacent to the cut site. Homologous sequence inside the cut sites was detrimental to targeting efficiency, consistent with a synthesis-dependent strand annealing (SDSA) mechanism. Using two nuclease sites, we observed a high degree of gene excisions and inversions, which sometimes occurred more frequently than indel mutations. While homozygous deletions of 86 kb were achieved with up to 8% frequency, deletion frequencies were not solely a function of nuclease activity and deletion size. Our results analyzing the optimal parameters for targeting vector design will inform future gene targeting efforts involving multi-kilobase gene segments, particularly in human iPSC. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  2. An integrated vector system for cellular studies of phage display-derived peptides.

    PubMed

    Voss, Stephan D; DeGrand, Alec M; Romeo, Giulio R; Cantley, Lewis C; Frangioni, John V

    2002-09-15

    Peptide phage display is a method by which large numbers of diverse peptides can be screened for binding to a target of interest. Even when successful, the rate-limiting step is usually validation of peptide bioactivity using living cells. In this paper, we describe an integrated system of vectors that expedites both the screening and the characterization processes. Library construction and screening is performed using an optimized type 3 phage display vector, mJ(1), which is shown to accept peptide libraries of at least 23 amino acids in length. Peptide coding sequences are shuttled from mJ(1) into one of three families of mammalian expression vectors for cell physiological studies. The vector pAL(1) expresses phage display-derived peptides as Gal4 DNA binding domain fusion proteins for transcriptional activation studies. The vectors pG(1), pG(1)N, and pG(1)C express phage display-derived peptides as green fluorescent protein fusions targeted to the entire cell, nucleus, or cytoplasm, respectively. The vector pAP(1) expresses phage display-derived peptides as fusions to secreted placental alkaline phosphatase. Such enzyme fusions can be used as highly sensitive affinity reagents for high-throughput assays and for cloning of peptide-binding cell surface receptors. Taken together, this system of vectors should facilitate the development of phage display-derived peptides into useful biomolecules.

  3. The tunable pReX expression vector enables optimizing the T7-based production of membrane and secretory proteins in E. coli.

    PubMed

    Kuipers, Grietje; Karyolaimos, Alexandros; Zhang, Zhe; Ismail, Nurzian; Trinco, Gianluca; Vikström, David; Slotboom, Dirk Jan; de Gier, Jan-Willem

    2017-12-16

    To optimize the production of membrane and secretory proteins in Escherichia coli, it is critical to harmonize the expression rates of the genes encoding these proteins with the capacity of their biogenesis machineries. Therefore, we engineered the Lemo21(DE3) strain, which is derived from the T7 RNA polymerase-based BL21(DE3) protein production strain. In Lemo21(DE3), the T7 RNA polymerase activity can be modulated by the controlled co-production of its natural inhibitor T7 lysozyme. This setup enables to precisely tune target gene expression rates in Lemo21(DE3). The t7lys gene is expressed from the pLemo plasmid using the titratable rhamnose promoter. A disadvantage of the Lemo21(DE3) setup is that the system is based on two plasmids, a T7 expression vector and pLemo. The aim of this study was to simplify the Lemo21(DE3) setup by incorporating the key elements of pLemo in a standard T7-based expression vector. By incorporating the gene encoding the T7 lysozyme under control of the rhamnose promoter in a standard T7-based expression vector, pReX was created (ReX stands for Regulated gene eXpression). For two model membrane proteins and a model secretory protein we show that the optimized production yields obtained with the pReX expression vector in BL21(DE3) are similar to the ones obtained with Lemo21(DE3) using a standard T7 expression vector. For another secretory protein, a c-type cytochrome, we show that pReX, in contrast to Lemo21(DE3), enables the use of a helper plasmid that is required for the maturation and hence the production of this heme c protein. Here, we created pReX, a T7-based expression vector that contains the gene encoding the T7 lysozyme under control of the rhamnose promoter. pReX enables regulated T7-based target gene expression using only one plasmid. We show that with pReX the production of membrane and secretory proteins can be readily optimized. Importantly, pReX facilitates the use of helper plasmids. Furthermore, the use of pReX is not restricted to BL21(DE3), but it can in principle be used in any T7 RNAP-based strain. Thus, pReX is a versatile alternative to Lemo21(DE3).

  4. A receptor-targeted nanocomplex vector system optimized for respiratory gene transfer.

    PubMed

    Tagalakis, Aristides D; McAnulty, Robin J; Devaney, James; Bottoms, Stephen E; Wong, John B; Elbs, Martin; Writer, Michele J; Hailes, Helen C; Tabor, Alethea B; O'Callaghan, Christopher; Jaffe, Adam; Hart, Stephen L

    2008-05-01

    Synthetic vectors for cystic fibrosis (CF) gene therapy are required that efficiently and safely transfect airway epithelial cells, rather than alveolar epithelial cells or macrophages, and that are nonimmunogenic, thus allowing for repeated delivery. We have compared several vector systems against these criteria including GL67, polyethylenimine (PEI) 22 and 25 kd and two new, synthetic vector formulations, comprising a cationic, receptor-targeting peptide K(16)GACSERSMNFCG (E), and the cationic liposomes (L) DHDTMA/DOPE or DOSEP3/DOPE. The lipid and peptide formulations self assemble into receptor-targeted nanocomplexes (RTNs) LED-1 and LED-2, respectively, on mixing with plasmid (D). LED-1 transfected airway epithelium efficiently, while LED-2 and GL67 preferentially transfected alveolar cells. PEI transfected airway epithelial cells with high efficiency, but was more toxic to the mice than the other formulations. On repeat dosing, LED-1 was equally as effective as the single dose, while GL67 was 30% less effective and PEI 22 kd displayed a 90% reduction of efficiency on repeated delivery. LED-1 thus was the only formulation that fulfilled the criteria for a CF gene therapy vector while GL67 and LED-2 may be appropriate for other respiratory diseases. Opportunities for PEI depend on a solution to its toxicity problems. LED-1 formulations were stable to nebulization, the most appropriate delivery method for CF.

  5. Spectral sensitivity of the nocturnal mosquito, Culex quinquefasciatus

    USDA-ARS?s Scientific Manuscript database

    The nocturnal mosquito, Culex quinquefasciatus,as a vector of West Nile virus is the target of many surveillance and control efforts. Surveillance of this species primarily consists of light traps baited with a variety of chemical lures. While much research has focused on optimization of the olfa...

  6. Optimization of Retinal Gene Therapy for X-Linked Retinitis Pigmentosa Due to RPGR Mutations.

    PubMed

    Beltran, William A; Cideciyan, Artur V; Boye, Shannon E; Ye, Guo-Jie; Iwabe, Simone; Dufour, Valerie L; Marinho, Luis Felipe; Swider, Malgorzata; Kosyk, Mychajlo S; Sha, Jin; Boye, Sanford L; Peterson, James J; Witherspoon, C Douglas; Alexander, John J; Ying, Gui-Shuang; Shearman, Mark S; Chulay, Jeffrey D; Hauswirth, William W; Gamlin, Paul D; Jacobson, Samuel G; Aguirre, Gustavo D

    2017-08-02

    X-linked retinitis pigmentosa (XLRP) caused by mutations in the RPGR gene is an early onset and severe cause of blindness. Successful proof-of-concept studies in a canine model have recently shown that development of a corrective gene therapy for RPGR-XLRP may now be an attainable goal. In preparation for a future clinical trial, we have here optimized the therapeutic AAV vector construct by showing that GRK1 (rather than IRBP) is a more efficient promoter for targeting gene expression to both rods and cones in non-human primates. Two transgenes were used in RPGR mutant (XLPRA2) dogs under the control of the GRK1 promoter. First was the previously developed stabilized human RPGR (hRPGRstb). Second was a new full-length stabilized and codon-optimized human RPGR (hRPGRco). Long-term (>2 years) studies with an AAV2/5 vector carrying hRPGRstb under control of the GRK1 promoter showed rescue of rods and cones from degeneration and retention of vision. Shorter term (3 months) studies demonstrated comparable preservation of photoreceptors in canine eyes treated with an AAV2/5 vector carrying either transgene under the control of the GRK1 promoter. These results provide the critical molecular components (GRK1 promoter, hRPGRco transgene) to now construct a therapeutic viral vector optimized for RPGR-XLRP patients. Copyright © 2017 The American Society of Gene and Cell Therapy. Published by Elsevier Inc. All rights reserved.

  7. A modular toolset for recombination transgenesis and neurogenetic analysis of Drosophila.

    PubMed

    Wang, Ji-Wu; Beck, Erin S; McCabe, Brian D

    2012-01-01

    Transgenic Drosophila have contributed extensively to our understanding of nervous system development, physiology and behavior in addition to being valuable models of human neurological disease. Here, we have generated a novel series of modular transgenic vectors designed to optimize and accelerate the production and analysis of transgenes in Drosophila. We constructed a novel vector backbone, pBID, that allows both phiC31 targeted transgene integration and incorporates insulator sequences to ensure specific and uniform transgene expression. Upon this framework, we have built a series of constructs that are either backwards compatible with existing restriction enzyme based vectors or utilize Gateway recombination technology for high-throughput cloning. These vectors allow for endogenous promoter or Gal4 targeted expression of transgenic proteins with or without fluorescent protein or epitope tags. In addition, we have generated constructs that facilitate transgenic splice isoform specific RNA inhibition of gene expression. We demonstrate the utility of these constructs to analyze proteins involved in nervous system development, physiology and neurodegenerative disease. We expect that these reagents will facilitate the proficiency and sophistication of Drosophila genetic analysis in both the nervous system and other tissues.

  8. TargetM6A: Identifying N6-Methyladenosine Sites From RNA Sequences via Position-Specific Nucleotide Propensities and a Support Vector Machine.

    PubMed

    Li, Guang-Qing; Liu, Zi; Shen, Hong-Bin; Yu, Dong-Jun

    2016-10-01

    As one of the most ubiquitous post-transcriptional modifications of RNA, N 6 -methyladenosine ( [Formula: see text]) plays an essential role in many vital biological processes. The identification of [Formula: see text] sites in RNAs is significantly important for both basic biomedical research and practical drug development. In this study, we designed a computational-based method, called TargetM6A, to rapidly and accurately target [Formula: see text] sites solely from the primary RNA sequences. Two new features, i.e., position-specific nucleotide/dinucleotide propensities (PSNP/PSDP), are introduced and combined with the traditional nucleotide composition (NC) feature to formulate RNA sequences. The extracted features are further optimized to obtain a much more compact and discriminative feature subset by applying an incremental feature selection (IFS) procedure. Based on the optimized feature subset, we trained TargetM6A on the training dataset with a support vector machine (SVM) as the prediction engine. We compared the proposed TargetM6A method with existing methods for predicting [Formula: see text] sites by performing stringent jackknife tests and independent validation tests on benchmark datasets. The experimental results show that the proposed TargetM6A method outperformed the existing methods for predicting [Formula: see text] sites and remarkably improved the prediction performances, with MCC = 0.526 and AUC = 0.818. We also provided a user-friendly web server for TargetM6A, which is publicly accessible for academic use at http://csbio.njust.edu.cn/bioinf/TargetM6A.

  9. A simple method to determine IgG light chain to heavy chain polypeptide ratios expressed by CHO cells.

    PubMed

    Gerster, Anja; Wodarczyk, Claas; Reichenbächer, Britta; Köhler, Janet; Schulze, Andreas; Krause, Felix; Müller, Dethardt

    2016-12-01

    To establish a high-throughput method for determination of antibodies intra- and extracellular light chain (LC) to heavy chain (HC) polypeptide ratio as screening parameter during cell line development. Chinese Hamster Ovary (CHO) TurboCell pools containing different designed vectors supposed to result in different LC:HC polypeptide ratios were generated by targeted integration. Cell culture supernatants and cell lysates of a fed batch experiment were purified by combined Protein A and anti-kappa affinity batch purification in 96-well format. Capture of all antibodies and their fragments allowed the determination of the intra- and extracellular LC:HC peptide ratios by reduced SDS capillary electrophoresis. Results demonstrate that the method is suitable to show the significant impact of the vector design on the intra- and extracellular LC:HC polypeptide ratios. Determination of LC:HC polypeptide ratios can give important information in vector design optimization leading to CHO cell lines with optimized antibody assembly and preferred product quality.

  10. Construction and Characterization of an in-vivo Linear Covalently Closed DNA Vector Production System

    PubMed Central

    2012-01-01

    Background While safer than their viral counterparts, conventional non-viral gene delivery DNA vectors offer a limited safety profile. They often result in the delivery of unwanted prokaryotic sequences, antibiotic resistance genes, and the bacterial origins of replication to the target, which may lead to the stimulation of unwanted immunological responses due to their chimeric DNA composition. Such vectors may also impart the potential for chromosomal integration, thus potentiating oncogenesis. We sought to engineer an in vivo system for the quick and simple production of safer DNA vector alternatives that were devoid of non-transgene bacterial sequences and would lethally disrupt the host chromosome in the event of an unwanted vector integration event. Results We constructed a parent eukaryotic expression vector possessing a specialized manufactured multi-target site called “Super Sequence”, and engineered E. coli cells (R-cell) that conditionally produce phage-derived recombinase Tel (PY54), TelN (N15), or Cre (P1). Passage of the parent plasmid vector through R-cells under optimized conditions, resulted in rapid, efficient, and one step in vivo generation of mini lcc—linear covalently closed (Tel/TelN-cell), or mini ccc—circular covalently closed (Cre-cell), DNA constructs, separated from the backbone plasmid DNA. Site-specific integration of lcc plasmids into the host chromosome resulted in chromosomal disruption and 105 fold lower viability than that seen with the ccc counterpart. Conclusion We offer a high efficiency mini DNA vector production system that confers simple, rapid and scalable in vivo production of mini lcc DNA vectors that possess all the benefits of “minicircle” DNA vectors and virtually eliminate the potential for undesirable vector integration events. PMID:23216697

  11. Construction and characterization of an in-vivo linear covalently closed DNA vector production system.

    PubMed

    Nafissi, Nafiseh; Slavcev, Roderick

    2012-12-06

    While safer than their viral counterparts, conventional non-viral gene delivery DNA vectors offer a limited safety profile. They often result in the delivery of unwanted prokaryotic sequences, antibiotic resistance genes, and the bacterial origins of replication to the target, which may lead to the stimulation of unwanted immunological responses due to their chimeric DNA composition. Such vectors may also impart the potential for chromosomal integration, thus potentiating oncogenesis. We sought to engineer an in vivo system for the quick and simple production of safer DNA vector alternatives that were devoid of non-transgene bacterial sequences and would lethally disrupt the host chromosome in the event of an unwanted vector integration event. We constructed a parent eukaryotic expression vector possessing a specialized manufactured multi-target site called "Super Sequence", and engineered E. coli cells (R-cell) that conditionally produce phage-derived recombinase Tel (PY54), TelN (N15), or Cre (P1). Passage of the parent plasmid vector through R-cells under optimized conditions, resulted in rapid, efficient, and one step in vivo generation of mini lcc--linear covalently closed (Tel/TelN-cell), or mini ccc--circular covalently closed (Cre-cell), DNA constructs, separated from the backbone plasmid DNA. Site-specific integration of lcc plasmids into the host chromosome resulted in chromosomal disruption and 10(5) fold lower viability than that seen with the ccc counterpart. We offer a high efficiency mini DNA vector production system that confers simple, rapid and scalable in vivo production of mini lcc DNA vectors that possess all the benefits of "minicircle" DNA vectors and virtually eliminate the potential for undesirable vector integration events.

  12. Sleeping Beauty-baculovirus hybrid vectors for long-term gene expression in the eye.

    PubMed

    Turunen, Tytteli Anni Kaarina; Laakkonen, Johanna Päivikki; Alasaarela, Laura; Airenne, Kari Juhani; Ylä-Herttuala, Seppo

    2014-01-01

    A baculovirus vector is capable of efficiently transducing many nondiving and diving cell types. However, the potential of baculovirus is restricted for many gene delivery applications as a result of the transient gene expression that it mediates. The plasmid-based Sleeping Beauty (SB) transposon system integrates transgenes into target cell genome efficiently with a genomic integration pattern that is generally considered safer than the integration of many other integrating vectors; yet efficient delivery of therapeutic genes into cells of target tissues in vivo is a major challenge for nonviral gene therapy. In the present study, SB was introduced into baculovirus to obtain novel hybrid vectors that would combine the best features of the two vector systems (i.e. effective gene delivery and efficient integration into the genome), thus circumventing the major limitations of these vectors. We constructed and optimized SB-baculovirus hybrid vectors that bear either SB100x transposase or SB transposon in the forward or reverse orientations with respect to the viral backbone The functionality of the novel hybrid vectors was investigated in cell cultures and in a proof-of-concept study in the mouse eye. The hybrid vectors showed high and sustained transgene expression that remained stable and demonstrated no signs of decline during the 2 months follow-up in vitro. These results were verified in the mouse eye where persistent transgene expression was detected two months after intravitreal injection. Our results confirm that (i) SB-baculovirus hybrid vectors mediate long-term gene expression in vitro and in vivo, and (ii) the hybrid vectors are potential new tools for the treatment of ocular diseases. Copyright © 2014 John Wiley & Sons, Ltd.

  13. Reversal of blindness in animal models of leber congenital amaurosis using optimized AAV2-mediated gene transfer.

    PubMed

    Bennicelli, Jeannette; Wright, John Fraser; Komaromy, Andras; Jacobs, Jonathan B; Hauck, Bernd; Zelenaia, Olga; Mingozzi, Federico; Hui, Daniel; Chung, Daniel; Rex, Tonia S; Wei, Zhangyong; Qu, Guang; Zhou, Shangzhen; Zeiss, Caroline; Arruda, Valder R; Acland, Gregory M; Dell'Osso, Lou F; High, Katherine A; Maguire, Albert M; Bennett, Jean

    2008-03-01

    We evaluated the safety and efficacy of an optimized adeno-associated virus (AAV; AAV2.RPE65) in animal models of the RPE65 form of Leber congenital amaurosis (LCA). Protein expression was optimized by addition of a modified Kozak sequence at the translational start site of hRPE65. Modifications in AAV production and delivery included use of a long stuffer sequence to prevent reverse packaging from the AAV inverted-terminal repeats, and co-injection with a surfactant. The latter allows consistent and predictable delivery of a given dose of vector. We observed improved electroretinograms (ERGs) and visual acuity in Rpe65 mutant mice. This has not been reported previously using AAV2 vectors. Subretinal delivery of 8.25 x 10(10) vector genomes in affected dogs was well tolerated both locally and systemically, and treated animals showed improved visual behavior and pupillary responses, and reduced nystagmus within 2 weeks of injection. ERG responses confirmed the reversal of visual deficit. Immunohistochemistry confirmed transduction of retinal pigment epithelium cells and there was minimal toxicity to the retina as judged by histopathologic analysis. The data demonstrate that AAV2.RPE65 delivers the RPE65 transgene efficiently and quickly to the appropriate target cells in vivo in animal models. This vector holds great promise for treatment of LCA due to RPE65 mutations.

  14. Reversal of Blindness in Animal Models of Leber Congenital Amaurosis Using Optimized AAV2-mediated Gene Transfer

    PubMed Central

    Bennicelli, Jeannette; Wright, John Fraser; Komaromy, Andras; Jacobs, Jonathan B; Hauck, Bernd; Zelenaia, Olga; Mingozzi, Federico; Hui, Daniel; Chung, Daniel; Rex, Tonia S; Wei, Zhangyong; Qu, Guang; Zhou, Shangzhen; Zeiss, Caroline; Arruda, Valder R; Acland, Gregory M; Dell’Osso, Lou F; High, Katherine A; Maguire, Albert M; Bennett, Jean

    2010-01-01

    We evaluated the safety and efficacy of an optimized adeno-associated virus (AAV; AAV2.RPE65) in animal models of the RPE65 form of Leber congenital amaurosis (LCA). Protein expression was optimized by addition of a modified Kozak sequence at the translational start site of hRPE65. Modifications in AAV production and delivery included use of a long stuffer sequence to prevent reverse packaging from the AAV inverted-terminal repeats, and co-injection with a surfactant. The latter allows consistent and predictable delivery of a given dose of vector. We observed improved electroretinograms (ERGs) and visual acuity in Rpe65 mutant mice. This has not been reported previously using AAV2 vectors. Subretinal delivery of 8.25 × 1010 vector genomes in affected dogs was well tolerated both locally and systemically, and treated animals showed improved visual behavior and pupillary responses, and reduced nystagmus within 2 weeks of injection. ERG responses confirmed the reversal of visual deficit. Immunohistochemistry confirmed transduction of retinal pigment epithelium cells and there was minimal toxicity to the retina as judged by histopathologic analysis. The data demonstrate that AAV2.RPE65 delivers the RPE65 transgene efficiently and quickly to the appropriate target cells in vivo in animal models. This vector holds great promise for treatment of LCA due to RPE65 mutations. PMID:18209734

  15. Deep kernel learning method for SAR image target recognition

    NASA Astrophysics Data System (ADS)

    Chen, Xiuyuan; Peng, Xiyuan; Duan, Ran; Li, Junbao

    2017-10-01

    With the development of deep learning, research on image target recognition has made great progress in recent years. Remote sensing detection urgently requires target recognition for military, geographic, and other scientific research. This paper aims to solve the synthetic aperture radar image target recognition problem by combining deep and kernel learning. The model, which has a multilayer multiple kernel structure, is optimized layer by layer with the parameters of Support Vector Machine and a gradient descent algorithm. This new deep kernel learning method improves accuracy and achieves competitive recognition results compared with other learning methods.

  16. Clever eye algorithm for target detection of remote sensing imagery

    NASA Astrophysics Data System (ADS)

    Geng, Xiurui; Ji, Luyan; Sun, Kang

    2016-04-01

    Target detection algorithms for hyperspectral remote sensing imagery, such as the two most commonly used remote sensing detection algorithms, the constrained energy minimization (CEM) and matched filter (MF), can usually be attributed to the inner product between a weight filter (or detector) and a pixel vector. CEM and MF have the same expression except that MF requires data centralization first. However, this difference leads to a difference in the target detection results. That is to say, the selection of the data origin could directly affect the performance of the detector. Therefore, does there exist another data origin other than the zero and mean-vector points for a better target detection performance? This is a very meaningful issue in the field of target detection, but it has not been paid enough attention yet. In this study, we propose a novel objective function by introducing the data origin as another variable, and the solution of the function is corresponding to the data origin with the minimal output energy. The process of finding the optimal solution can be vividly regarded as a clever eye automatically searching the best observing position and direction in the feature space, which corresponds to the largest separation between the target and background. Therefore, this new algorithm is referred to as the clever eye algorithm (CE). Based on the Sherman-Morrison formula and the gradient ascent method, CE could derive the optimal target detection result in terms of energy. Experiments with both synthetic and real hyperspectral data have verified the effectiveness of our method.

  17. Neural Network Target Identification System for False Alarm Reduction

    NASA Technical Reports Server (NTRS)

    Ye, David; Edens, Weston; Lu, Thomas T.; Chao, Tien-Hsin

    2009-01-01

    A multi-stage automated target recognition (ATR) system has been designed to perform computer vision tasks with adequate proficiency in mimicking human vision. The system is able to detect, identify, and track targets of interest. Potential regions of interest (ROIs) are first identified by the detection stage using an Optimum Trade-off Maximum Average Correlation Height (OT-MACH) filter combined with a wavelet transform. False positives are then eliminated by the verification stage using feature extraction methods in conjunction with neural networks. Feature extraction transforms the ROIs using filtering and binning algorithms to create feature vectors. A feed forward back propagation neural network (NN) is then trained to classify each feature vector and remove false positives. This paper discusses the test of the system performance and parameter optimizations process which adapts the system to various targets and datasets. The test results show that the system was successful in substantially reducing the false positive rate when tested on a sonar image dataset.

  18. Method for Household Refrigerators Efficiency Increasing

    NASA Astrophysics Data System (ADS)

    Lebedev, V. V.; Sumzina, L. V.; Maksimov, A. V.

    2017-11-01

    The relevance of working processes parameters optimization in air conditioning systems is proved in the work. The research is performed with the use of the simulation modeling method. The parameters optimization criteria are considered, the analysis of target functions is given while the key factors of technical and economic optimization are considered in the article. The search for the optimal solution at multi-purpose optimization of the system is made by finding out the minimum of the dual-target vector created by the Pareto method of linear and weight compromises from target functions of the total capital costs and total operating costs. The tasks are solved in the MathCAD environment. The research results show that the values of technical and economic parameters of air conditioning systems in the areas relating to the optimum solutions’ areas manifest considerable deviations from the minimum values. At the same time, the tendencies for significant growth in deviations take place at removal of technical parameters from the optimal values of both the capital investments and operating costs. The production and operation of conditioners with the parameters which are considerably deviating from the optimal values will lead to the increase of material and power costs. The research allows one to establish the borders of the area of the optimal values for technical and economic parameters at air conditioning systems’ design.

  19. Attacking the mosquito on multiple fronts: Insights from the Vector Control Optimization Model (VCOM) for malaria elimination.

    PubMed

    Kiware, Samson S; Chitnis, Nakul; Tatarsky, Allison; Wu, Sean; Castellanos, Héctor Manuel Sánchez; Gosling, Roly; Smith, David; Marshall, John M

    2017-01-01

    Despite great achievements by insecticide-treated nets (ITNs) and indoor residual spraying (IRS) in reducing malaria transmission, it is unlikely these tools will be sufficient to eliminate malaria transmission on their own in many settings today. Fortunately, field experiments indicate that there are many promising vector control interventions that can be used to complement ITNs and/or IRS by targeting a wide range of biological and environmental mosquito resources. The majority of these experiments were performed to test a single vector control intervention in isolation; however, there is growing evidence and consensus that effective vector control with the goal of malaria elimination will require a combination of interventions. We have developed a model of mosquito population dynamic to describe the mosquito life and feeding cycles and to optimize the impact of vector control intervention combinations at suppressing mosquito populations. The model simulations were performed for the main three malaria vectors in sub-Saharan Africa, Anopheles gambiae s.s, An. arabiensis and An. funestus. We considered areas having low, moderate and high malaria transmission, corresponding to entomological inoculation rates of 10, 50 and 100 infective bites per person per year, respectively. In all settings, we considered baseline ITN coverage of 50% or 80% in addition to a range of other vector control tools to interrupt malaria transmission. The model was used to sweep through parameters space to select the best optimal intervention packages. Sample model simulations indicate that, starting with ITNs at a coverage of 50% (An. gambiae s.s. and An. funestus) or 80% (An. arabiensis) and adding interventions that do not require human participation (e.g. larviciding at 80% coverage, endectocide treated cattle at 50% coverage and attractive toxic sugar baits at 50% coverage) may be sufficient to suppress all the three species to an extent required to achieve local malaria elimination. The Vector Control Optimization Model (VCOM) is a computational tool to predict the impact of combined vector control interventions at the mosquito population level in a range of eco-epidemiological settings. The model predicts specific combinations of vector control tools to achieve local malaria elimination in a range of eco-epidemiological settings and can assist researchers and program decision-makers on the design of experimental or operational research to test vector control interventions. A corresponding graphical user interface is available for national malaria control programs and other end users.

  20. Enhancing magnetic nanoparticle-based DNA transfection: Intracellular-active cassette features

    NASA Astrophysics Data System (ADS)

    Vernon, Matthew Martin

    Efficient plasmid DNA transfection of embryonic stem cells, mesenchymal stem cells, neural cell lines and the majority of primary cell lines is a current challenge in gene therapy research. Magnetic nanoparticle-based DNA transfection is a gene vectoring technique that is promising because it is capable of outperforming most other non-viral transfection methods in terms of both transfection efficiency and cell viability. The nature of the DNA vector implemented depends on the target cell phenotype, where the particle surface chemistry and DNA binding/unbinding kinetics of the DNA carrier molecule play a critical role in the many steps required for successful gene transfection. Accordingly, Neuromag, an iron oxide/polymer nanoparticle optimized for transfection of neural phenotypes, outperforms many other nanoparticles and lipidbased DNA carriers. Up to now, improvements to nanomagnetic transfection techniques have focused mostly on particle functionalization and transfection parameter optimization (cell confluence, growth media, serum starvation, magnet oscillation parameters, etc.). None of these parameters are capable of assisting the nuclear translocation of delivered plasmid DNA once the particle-DNA complex is released from the endosome and dissociates in the cell's cytoplasm. In this study, incorporation of a DNA targeting sequence (DTS) feature in the transfecting plasmid DNA confers improved nuclear translocation, demonstrating significant improvement in nanomagnetic transfection efficiency in differentiated SH-SY5Y neuroblastoma cells. Other parameters, such as days in vitro, are also found to play a role and represent potential targets for further optimization.

  1. Co-occurrence of viruses and mosquitoes at the vectors' optimal climate range: An underestimated risk to temperate regions?

    PubMed

    Blagrove, Marcus S C; Caminade, Cyril; Waldmann, Elisabeth; Sutton, Elizabeth R; Wardeh, Maya; Baylis, Matthew

    2017-06-01

    Mosquito-borne viruses have been estimated to cause over 100 million cases of human disease annually. Many methodologies have been developed to help identify areas most at risk from transmission of these viruses. However, generally, these methodologies focus predominantly on the effects of climate on either the vectors or the pathogens they spread, and do not consider the dynamic interaction between the optimal conditions for both vector and virus. Here, we use a new approach that considers the complex interplay between the optimal temperature for virus transmission, and the optimal climate for the mosquito vectors. Using published geolocated data we identified temperature and rainfall ranges in which a number of mosquito vectors have been observed to co-occur with West Nile virus, dengue virus or chikungunya virus. We then investigated whether the optimal climate for co-occurrence of vector and virus varies between "warmer" and "cooler" adapted vectors for the same virus. We found that different mosquito vectors co-occur with the same virus at different temperatures, despite significant overlap in vector temperature ranges. Specifically, we found that co-occurrence correlates with the optimal climatic conditions for the respective vector; cooler-adapted mosquitoes tend to co-occur with the same virus in cooler conditions than their warmer-adapted counterparts. We conclude that mosquitoes appear to be most able to transmit virus in the mosquitoes' optimal climate range, and hypothesise that this may be due to proportionally over-extended vector longevity, and other increased fitness attributes, within this optimal range. These results suggest that the threat posed by vector-competent mosquito species indigenous to temperate regions may have been underestimated, whilst the threat arising from invasive tropical vectors moving to cooler temperate regions may be overestimated.

  2. A Modular Toolset for Recombination Transgenesis and Neurogenetic Analysis of Drosophila

    PubMed Central

    Wang, Ji-Wu; Beck, Erin S.; McCabe, Brian D.

    2012-01-01

    Transgenic Drosophila have contributed extensively to our understanding of nervous system development, physiology and behavior in addition to being valuable models of human neurological disease. Here, we have generated a novel series of modular transgenic vectors designed to optimize and accelerate the production and analysis of transgenes in Drosophila. We constructed a novel vector backbone, pBID, that allows both phiC31 targeted transgene integration and incorporates insulator sequences to ensure specific and uniform transgene expression. Upon this framework, we have built a series of constructs that are either backwards compatible with existing restriction enzyme based vectors or utilize Gateway recombination technology for high-throughput cloning. These vectors allow for endogenous promoter or Gal4 targeted expression of transgenic proteins with or without fluorescent protein or epitope tags. In addition, we have generated constructs that facilitate transgenic splice isoform specific RNA inhibition of gene expression. We demonstrate the utility of these constructs to analyze proteins involved in nervous system development, physiology and neurodegenerative disease. We expect that these reagents will facilitate the proficiency and sophistication of Drosophila genetic analysis in both the nervous system and other tissues. PMID:22848718

  3. Crispr-mediated Gene Targeting of Human Induced Pluripotent Stem Cells.

    PubMed

    Byrne, Susan M; Church, George M

    2015-01-01

    CRISPR/Cas9 nuclease systems can create double-stranded DNA breaks at specific sequences to efficiently and precisely disrupt, excise, mutate, insert, or replace genes. However, human embryonic stem or induced pluripotent stem cells (iPSCs) are more difficult to transfect and less resilient to DNA damage than immortalized tumor cell lines. Here, we describe an optimized protocol for genome engineering of human iPSCs using a simple transient transfection of plasmids and/or single-stranded oligonucleotides. With this protocol, we achieve transfection efficiencies greater than 60%, with gene disruption efficiencies from 1-25% and gene insertion/replacement efficiencies from 0.5-10% without any further selection or enrichment steps. We also describe how to design and assess optimal sgRNA target sites and donor targeting vectors; cloning individual iPSC by single cell FACS sorting, and genotyping successfully edited cells.

  4. Developing a de novo targeted knock-in method based on in utero electroporation into the mammalian brain.

    PubMed

    Tsunekawa, Yuji; Terhune, Raymond Kunikane; Fujita, Ikumi; Shitamukai, Atsunori; Suetsugu, Taeko; Matsuzaki, Fumio

    2016-09-01

    Genome-editing technology has revolutionized the field of biology. Here, we report a novel de novo gene-targeting method mediated by in utero electroporation into the developing mammalian brain. Electroporation of donor DNA with the CRISPR/Cas9 system vectors successfully leads to knock-in of the donor sequence, such as EGFP, to the target site via the homology-directed repair mechanism. We developed a targeting vector system optimized to prevent anomalous leaky expression of the donor gene from the plasmid, which otherwise often occurs depending on the donor sequence. The knock-in efficiency of the electroporated progenitors reached up to 40% in the early stage and 20% in the late stage of the developing mouse brain. Furthermore, we inserted different fluorescent markers into the target gene in each homologous chromosome, successfully distinguishing homozygous knock-in cells by color. We also applied this de novo gene targeting to the ferret model for the study of complex mammalian brains. Our results demonstrate that this technique is widely applicable for monitoring gene expression, visualizing protein localization, lineage analysis and gene knockout, all at the single-cell level, in developmental tissues. © 2016. Published by The Company of Biologists Ltd.

  5. Viral Vectors for Gene Delivery to the Central Nervous System

    PubMed Central

    Lentz, Thomas B.; Gray, Steven J.; Samulski, R. Jude

    2011-01-01

    The potential benefits of gene therapy for neurological diseases such as Parkinson’s, Amyotrophic Lateral Sclerosis (ALS), Epilepsy, and Alzheimer’s are enormous. Even a delay in the onset of severe symptoms would be invaluable to patients suffering from these and other diseases. Significant effort has been placed in developing vectors capable of delivering therapeutic genes to the CNS in order to treat neurological disorders. At the forefront of potential vectors, viral systems have evolved to efficiently deliver their genetic material to a cell. The biology of different viruses offers unique solutions to the challenges of gene therapy, such as cell targeting, transgene expression and vector production. It is important to consider the natural biology of a vector when deciding whether it will be the most effective for a specific therapeutic function. In this review, we outline desired features of the ideal vector for gene delivery to the CNS and discuss how well available viral vectors compare to this model. Adeno-associated virus, retrovirus, adenovirus and herpesvirus vectors are covered. Focus is placed on features of the natural biology that have made these viruses effective tools for gene delivery with emphasis on their application in the CNS. Our goal is to provide insight into features of the optimal vector and which viral vectors can provide these features. PMID:22001604

  6. Optimization of a CRISPR/Cas9-mediated Knock-in Strategy at the Porcine Rosa26 Locus in Porcine Foetal Fibroblasts.

    PubMed

    Xie, Zicong; Pang, Daxin; Wang, Kankan; Li, Mengjing; Guo, Nannan; Yuan, Hongming; Li, Jianing; Zou, Xiaodong; Jiao, Huping; Ouyang, Hongsheng; Li, Zhanjun; Tang, Xiaochun

    2017-06-08

    Genetically modified pigs have important roles in agriculture and biomedicine. However, genome-specific knock-in techniques in pigs are still in their infancy and optimal strategies have not been extensively investigated. In this study, we performed electroporation to introduce a targeting donor vector (a non-linearized vector that did not contain a promoter or selectable marker) into Porcine Foetal Fibroblasts (PFFs) along with a CRISPR/Cas9 vector. After optimization, the efficiency of the EGFP site-specific knock-in could reach up to 29.6% at the pRosa26 locus in PFFs. Next, we used the EGFP reporter PFFs to address two key conditions in the process of achieving transgenic pigs, the limiting dilution method and the strategy to evaluate the safety and feasibility of the knock-in locus. This study demonstrates that we establish an efficient procedures for the exogenous gene knock-in technique and creates a platform to efficiently generate promoter-less and selectable marker-free transgenic PFFs through the CRISPR/Cas9 system. This study should contribute to the generation of promoter-less and selectable marker-free transgenic pigs and it may provide insights into sophisticated site-specific genome engineering techniques for additional species.

  7. Multi-Stage System for Automatic Target Recognition

    NASA Technical Reports Server (NTRS)

    Chao, Tien-Hsin; Lu, Thomas T.; Ye, David; Edens, Weston; Johnson, Oliver

    2010-01-01

    A multi-stage automated target recognition (ATR) system has been designed to perform computer vision tasks with adequate proficiency in mimicking human vision. The system is able to detect, identify, and track targets of interest. Potential regions of interest (ROIs) are first identified by the detection stage using an Optimum Trade-off Maximum Average Correlation Height (OT-MACH) filter combined with a wavelet transform. False positives are then eliminated by the verification stage using feature extraction methods in conjunction with neural networks. Feature extraction transforms the ROIs using filtering and binning algorithms to create feature vectors. A feedforward back-propagation neural network (NN) is then trained to classify each feature vector and to remove false positives. The system parameter optimizations process has been developed to adapt to various targets and datasets. The objective was to design an efficient computer vision system that can learn to detect multiple targets in large images with unknown backgrounds. Because the target size is small relative to the image size in this problem, there are many regions of the image that could potentially contain the target. A cursory analysis of every region can be computationally efficient, but may yield too many false positives. On the other hand, a detailed analysis of every region can yield better results, but may be computationally inefficient. The multi-stage ATR system was designed to achieve an optimal balance between accuracy and computational efficiency by incorporating both models. The detection stage first identifies potential ROIs where the target may be present by performing a fast Fourier domain OT-MACH filter-based correlation. Because threshold for this stage is chosen with the goal of detecting all true positives, a number of false positives are also detected as ROIs. The verification stage then transforms the regions of interest into feature space, and eliminates false positives using an artificial neural network classifier. The multi-stage system allows tuning the detection sensitivity and the identification specificity individually in each stage. It is easier to achieve optimized ATR operation based on its specific goal. The test results show that the system was successful in substantially reducing the false positive rate when tested on a sonar and video image datasets.

  8. Methods and materials for deconstruction of biomass for biofuels production

    DOEpatents

    Schoeniger, Joseph S; Hadi, Masood Zia

    2015-05-05

    The present invention relates to nucleic acids, peptides, vectors, cells, and plants useful in the production of biofuels. In certain embodiments, the invention relates to nucleic acid sequences and peptides from extremophile organisms, such as SSO1949 and Ce1A, that are useful for hydrolyzing plant cell wall materials. In further embodiments, the invention relates to modified versions of such sequences that have been optimized for production in one or both of monocot and dicot plants. In other embodiments, the invention provides for targeting peptide production or activity to a certain location within the cell or organism, such as the apoplast. In further embodiments, the invention relates to transformed cells or plants. In additional embodiments, the invention relates to methods of producing biofuel utilizing such nucleic acids, peptides, targeting sequences, vectors, cells, and/or plants.

  9. UAV formation control design with obstacle avoidance in dynamic three-dimensional environment.

    PubMed

    Chang, Kai; Xia, Yuanqing; Huang, Kaoli

    2016-01-01

    This paper considers the artificial potential field method combined with rotational vectors for a general problem of multi-unmanned aerial vehicle (UAV) systems tracking a moving target in dynamic three-dimensional environment. An attractive potential field is generated between the leader and the target. It drives the leader to track the target based on the relative position of them. The other UAVs in the formation are controlled to follow the leader by the attractive control force. The repulsive force affects among the UAVs to avoid collisions and distribute the UAVs evenly on the spherical surface whose center is the leader-UAV. Specific orders or positions of the UAVs are not required. The trajectories of avoidance obstacle can be obtained through two kinds of potential field with rotation vectors. Every UAV can choose the optimal trajectory to avoid the obstacle and reconfigure the formation after passing the obstacle. Simulations study on UAV are presented to demonstrate the effectiveness of proposed method.

  10. Polyamidoamine nanoparticles as nanocarriers for the drug delivery to malaria parasite stages in the mosquito vector.

    PubMed

    Urbán, Patricia; Ranucci, Elisabetta; Fernàndez-Busquets, Xavier

    2015-11-01

    Malaria is arguably one of the main medical concerns worldwide because of the numbers of people affected, the severity of the disease and the complexity of the life cycle of its causative agent, the protist Plasmodium spp. With the advent of nanoscience, renewed hopes have appeared of finally obtaining the long sought-after magic bullet against malaria in the form of a nanovector for the targeted delivery of antimalarial compounds exclusively to Plasmodium-infected cells, thus increasing drug efficacy and minimizing the induction of resistance to newly developed therapeutic agents. Polyamidoamine-derived nanovectors combine into a single chemical structure drug encapsulating capacity, antimalarial activity, low unspecific toxicity, specific targeting to Plasmodium, optimal in vivo activity and affordable synthesis cost. After having shown their efficacy in targeting drugs to intraerythrocytic parasites, now polyamidoamines face the challenge of spearheading a new generation of nanocarriers aiming at the malaria parasite stages in the mosquito vector.

  11. Effective 2D-3D medical image registration using Support Vector Machine.

    PubMed

    Qi, Wenyuan; Gu, Lixu; Zhao, Qiang

    2008-01-01

    Registration of pre-operative 3D volume dataset and intra-operative 2D images gradually becomes an important technique to assist radiologists in diagnosing complicated diseases easily and quickly. In this paper, we proposed a novel 2D/3D registration framework based on Support Vector Machine (SVM) to compensate the disadvantages of generating large number of DRR images in the stage of intra-operation. Estimated similarity metric distribution could be built up from the relationship between parameters of transform and prior sparse target metric values by means of SVR method. Based on which, global optimal parameters of transform are finally searched out by an optimizer in order to guide 3D volume dataset to match intra-operative 2D image. Experiments reveal that our proposed registration method improved performance compared to conventional registration method and also provided a precise registration result efficiently.

  12. Satellite scheduling considering maximum observation coverage time and minimum orbital transfer fuel cost

    NASA Astrophysics Data System (ADS)

    Zhu, Kai-Jian; Li, Jun-Feng; Baoyin, He-Xi

    2010-01-01

    In case of an emergency like the Wenchuan earthquake, it is impossible to observe a given target on earth by immediately launching new satellites. There is an urgent need for efficient satellite scheduling within a limited time period, so we must find a way to reasonably utilize the existing satellites to rapidly image the affected area during a short time period. Generally, the main consideration in orbit design is satellite coverage with the subsatellite nadir point as a standard of reference. Two factors must be taken into consideration simultaneously in orbit design, i.e., the maximum observation coverage time and the minimum orbital transfer fuel cost. The local time of visiting the given observation sites must satisfy the solar radiation requirement. When calculating the operational orbit elements as optimal parameters to be evaluated, we obtain the minimum objective function by comparing the results derived from the primer vector theory with those derived from the Hohmann transfer because the operational orbit for observing the disaster area with impulse maneuvers is considered in this paper. The primer vector theory is utilized to optimize the transfer trajectory with three impulses and the Hohmann transfer is utilized for coplanar and small inclination of non-coplanar cases. Finally, we applied this method in a simulation of the rescue mission at Wenchuan city. The results of optimizing orbit design with a hybrid PSO and DE algorithm show that the primer vector and Hohmann transfer theory proved to be effective methods for multi-object orbit optimization.

  13. Application of Droplet Digital PCR for Estimating Vector Copy Number States in Stem Cell Gene Therapy.

    PubMed

    Lin, Huan-Ting; Okumura, Takashi; Yatsuda, Yukinori; Ito, Satoru; Nakauchi, Hiromitsu; Otsu, Makoto

    2016-10-01

    Stable gene transfer into target cell populations via integrating viral vectors is widely used in stem cell gene therapy (SCGT). Accurate vector copy number (VCN) estimation has become increasingly important. However, existing methods of estimation such as real-time quantitative PCR are more restricted in practicality, especially during clinical trials, given the limited availability of sample materials from patients. This study demonstrates the application of an emerging technology called droplet digital PCR (ddPCR) in estimating VCN states in the context of SCGT. Induced pluripotent stem cells (iPSCs) derived from a patient with X-linked chronic granulomatous disease were used as clonable target cells for transduction with alpharetroviral vectors harboring codon-optimized CYBB cDNA. Precise primer-probe design followed by multiplex analysis conferred assay specificity. Accurate estimation of per-cell VCN values was possible without reliance on a reference standard curve. Sensitivity was high and the dynamic range of detection was wide. Assay reliability was validated by observation of consistent, reproducible, and distinct VCN clustering patterns for clones of transduced iPSCs with varying numbers of transgene copies. Taken together, use of ddPCR appears to offer a practical and robust approach to VCN estimation with a wide range of clinical and research applications.

  14. Application of Droplet Digital PCR for Estimating Vector Copy Number States in Stem Cell Gene Therapy

    PubMed Central

    Lin, Huan-Ting; Okumura, Takashi; Yatsuda, Yukinori; Ito, Satoru; Nakauchi, Hiromitsu; Otsu, Makoto

    2016-01-01

    Stable gene transfer into target cell populations via integrating viral vectors is widely used in stem cell gene therapy (SCGT). Accurate vector copy number (VCN) estimation has become increasingly important. However, existing methods of estimation such as real-time quantitative PCR are more restricted in practicality, especially during clinical trials, given the limited availability of sample materials from patients. This study demonstrates the application of an emerging technology called droplet digital PCR (ddPCR) in estimating VCN states in the context of SCGT. Induced pluripotent stem cells (iPSCs) derived from a patient with X-linked chronic granulomatous disease were used as clonable target cells for transduction with alpharetroviral vectors harboring codon-optimized CYBB cDNA. Precise primer–probe design followed by multiplex analysis conferred assay specificity. Accurate estimation of per-cell VCN values was possible without reliance on a reference standard curve. Sensitivity was high and the dynamic range of detection was wide. Assay reliability was validated by observation of consistent, reproducible, and distinct VCN clustering patterns for clones of transduced iPSCs with varying numbers of transgene copies. Taken together, use of ddPCR appears to offer a practical and robust approach to VCN estimation with a wide range of clinical and research applications. PMID:27763786

  15. Development of Peritoneal Tumor-Targeting Vector by In Vivo Screening with a Random Peptide-Displaying Adenovirus Library

    PubMed Central

    Yoshida, Kimiko; Goto, Naoko; Ohnami, Shumpei; Aoki, Kazunori

    2012-01-01

    The targeting of gene transfer at the cell-entry level is one of the most attractive challenges in vector development. However, attempts to redirect adenovirus vectors to alternative receptors by engineering the capsid-coding region have shown limited success, because the proper targeting ligands on the cells of interest are generally unknown. To overcome this limitation, we have constructed a random peptide library displayed on the adenoviral fiber knob, and have successfully selected targeted vectors by screening the library on cancer cell lines in vitro. The infection of targeted vectors was considered to be mediated by specific receptors on target cells. However, the expression levels and kinds of cell surface receptors may be substantially different between in vitro culture and in vivo tumor tissue. Here, we screened the peptide display-adenovirus library in the peritoneal dissemination model of AsPC-1 pancreatic cancer cells. The vector displaying a selected peptide (PFWSGAV) showed higher infectivity in the AsPC-1 peritoneal tumors but not in organs and other peritoneal tumors as compared with a non-targeted vector. Furthermore, the infectivity of the PFWSGAV-displaying vector for AsPC-1 peritoneal tumors was significantly higher than that of a vector displaying a peptide selected by in vitro screening, indicating the usefulness of in vivo screening in exploring the targeting vectors. This vector-screening system can facilitate the development of targeted adenovirus vectors for a variety of applications in medicine. PMID:23029088

  16. Point-based warping with optimized weighting factors of displacement vectors

    NASA Astrophysics Data System (ADS)

    Pielot, Ranier; Scholz, Michael; Obermayer, Klaus; Gundelfinger, Eckart D.; Hess, Andreas

    2000-06-01

    The accurate comparison of inter-individual 3D image brain datasets requires non-affine transformation techniques (warping) to reduce geometric variations. Constrained by the biological prerequisites we use in this study a landmark-based warping method with weighted sums of displacement vectors, which is enhanced by an optimization process. Furthermore, we investigate fast automatic procedures for determining landmarks to improve the practicability of 3D warping. This combined approach was tested on 3D autoradiographs of Gerbil brains. The autoradiographs were obtained after injecting a non-metabolized radioactive glucose derivative into the Gerbil thereby visualizing neuronal activity in the brain. Afterwards the brain was processed with standard autoradiographical methods. The landmark-generator computes corresponding reference points simultaneously within a given number of datasets by Monte-Carlo-techniques. The warping function is a distance weighted exponential function with a landmark- specific weighting factor. These weighting factors are optimized by a computational evolution strategy. The warping quality is quantified by several coefficients (correlation coefficient, overlap-index, and registration error). The described approach combines a highly suitable procedure to automatically detect landmarks in autoradiographical brain images and an enhanced point-based warping technique, optimizing the local weighting factors. This optimization process significantly improves the similarity between the warped and the target dataset.

  17. Complex matrix multiplication operations with data pre-conditioning in a high performance computing architecture

    DOEpatents

    Eichenberger, Alexandre E; Gschwind, Michael K; Gunnels, John A

    2014-02-11

    Mechanisms for performing a complex matrix multiplication operation are provided. A vector load operation is performed to load a first vector operand of the complex matrix multiplication operation to a first target vector register. The first vector operand comprises a real and imaginary part of a first complex vector value. A complex load and splat operation is performed to load a second complex vector value of a second vector operand and replicate the second complex vector value within a second target vector register. The second complex vector value has a real and imaginary part. A cross multiply add operation is performed on elements of the first target vector register and elements of the second target vector register to generate a partial product of the complex matrix multiplication operation. The partial product is accumulated with other partial products and a resulting accumulated partial product is stored in a result vector register.

  18. Zinc-finger nuclease-mediated gene correction using single AAV vector transduction and enhancement by Food and Drug Administration-approved drugs

    PubMed Central

    Ellis, BL; Hirsch, ML; Porter, SN; Samulski, RJ; Porteus, MH

    2016-01-01

    An emerging strategy for the treatment of monogenic diseases uses genetic engineering to precisely correct the mutation(s) at the genome level. Recent advancements in this technology have demonstrated therapeutic levels of gene correction using a zinc-finger nuclease (ZFN)-induced DNA double-strand break in conjunction with an exogenous DNA donor substrate. This strategy requires efficient nucleic acid delivery and among viral vectors, recombinant adeno-associated virus (rAAV) has demonstrated clinical success without pathology. However, a major limitation of rAAV is the small DNA packaging capacity and to date, the use of rAAV for ZFN gene delivery has yet to be reported. Theoretically, an ideal situation is to deliver both ZFNs and the repair substrate in a single vector to avoid inefficient gene targeting and unwanted mutagenesis, both complications of a rAAV co-transduction strategy. Therefore, a rAAV format was generated in which a single polypeptide encodes the ZFN monomers connected by a ribosome skipping 2A peptide and furin cleavage sequence. On the basis of this arrangement, a DNA repair substrate of 750 nucleotides was also included in this vector. Efficient polypeptide processing to discrete ZFNs is demonstrated, as well as the ability of this single vector format to stimulate efficient gene targeting in a human cell line and mouse model derived fibroblasts. Additionally, we increased rAAV-mediated gene correction up to sixfold using a combination of Food and Drug Administration-approved drugs, which act at the level of AAV vector transduction. Collectively, these experiments demonstrate the ability to deliver ZFNs and a repair substrate by a single AAV vector and offer insights for the optimization of rAAV-mediated gene correction using drug therapy. PMID:22257934

  19. A multicolor panel of novel lentiviral "gene ontology" (LeGO) vectors for functional gene analysis.

    PubMed

    Weber, Kristoffer; Bartsch, Udo; Stocking, Carol; Fehse, Boris

    2008-04-01

    Functional gene analysis requires the possibility of overexpression, as well as downregulation of one, or ideally several, potentially interacting genes. Lentiviral vectors are well suited for this purpose as they ensure stable expression of complementary DNAs (cDNAs), as well as short-hairpin RNAs (shRNAs), and can efficiently transduce a wide spectrum of cell targets when packaged within the coat proteins of other viruses. Here we introduce a multicolor panel of novel lentiviral "gene ontology" (LeGO) vectors designed according to the "building blocks" principle. Using a wide spectrum of different fluorescent markers, including drug-selectable enhanced green fluorescent protein (eGFP)- and dTomato-blasticidin-S resistance fusion proteins, LeGO vectors allow simultaneous analysis of multiple genes and shRNAs of interest within single, easily identifiable cells. Furthermore, each functional module is flanked by unique cloning sites, ensuring flexibility and individual optimization. The efficacy of these vectors for analyzing multiple genes in a single cell was demonstrated in several different cell types, including hematopoietic, endothelial, and neural stem and progenitor cells, as well as hepatocytes. LeGO vectors thus represent a valuable tool for investigating gene networks using conditional ectopic expression and knock-down approaches simultaneously.

  20. General Quantum Meet-in-the-Middle Search Algorithm Based on Target Solution of Fixed Weight

    NASA Astrophysics Data System (ADS)

    Fu, Xiang-Qun; Bao, Wan-Su; Wang, Xiang; Shi, Jian-Hong

    2016-10-01

    Similar to the classical meet-in-the-middle algorithm, the storage and computation complexity are the key factors that decide the efficiency of the quantum meet-in-the-middle algorithm. Aiming at the target vector of fixed weight, based on the quantum meet-in-the-middle algorithm, the algorithm for searching all n-product vectors with the same weight is presented, whose complexity is better than the exhaustive search algorithm. And the algorithm can reduce the storage complexity of the quantum meet-in-the-middle search algorithm. Then based on the algorithm and the knapsack vector of the Chor-Rivest public-key crypto of fixed weight d, we present a general quantum meet-in-the-middle search algorithm based on the target solution of fixed weight, whose computational complexity is \\sumj = 0d {(O(\\sqrt {Cn - k + 1d - j }) + O(C_kj log C_k^j))} with Σd i =0 Ck i memory cost. And the optimal value of k is given. Compared to the quantum meet-in-the-middle search algorithm for knapsack problem and the quantum algorithm for searching a target solution of fixed weight, the computational complexity of the algorithm is lower. And its storage complexity is smaller than the quantum meet-in-the-middle-algorithm. Supported by the National Basic Research Program of China under Grant No. 2013CB338002 and the National Natural Science Foundation of China under Grant No. 61502526

  1. Fast Quaternion Attitude Estimation from Two Vector Measurements

    NASA Technical Reports Server (NTRS)

    Markley, F. Landis; Bauer, Frank H. (Technical Monitor)

    2001-01-01

    Many spacecraft attitude determination methods use exactly two vector measurements. The two vectors are typically the unit vector to the Sun and the Earth's magnetic field vector for coarse "sun-mag" attitude determination or unit vectors to two stars tracked by two star trackers for fine attitude determination. Existing closed-form attitude estimates based on Wahba's optimality criterion for two arbitrarily weighted observations are somewhat slow to evaluate. This paper presents two new fast quaternion attitude estimation algorithms using two vector observations, one optimal and one suboptimal. The suboptimal method gives the same estimate as the TRIAD algorithm, at reduced computational cost. Simulations show that the TRIAD estimate is almost as accurate as the optimal estimate in representative test scenarios.

  2. Specific markers, micro-environmental anomalies and tropism: opportunities for gold nanorods targeting of tumors in laser-induced hyperthermia

    NASA Astrophysics Data System (ADS)

    Tatini, Francesca; Ratto, Fulvio; Centi, Sonia; Landini, Ida; Nobili, Stefania; Witort, Ewa; Fusi, Franco; Capaccioli, Sergio; Mini, Enrico; Pini, Roberto

    2014-03-01

    Gold nanorods (GNRs) are optimal contrast agents for near-infrared (NIR) laser-induced photothermal ablation of cancer. Selective targeting of cancer cells can be pursued by attaching specific molecules on the particles surface or by the use of cellular vectors loaded with GNRs. We performed and tested various targeting approaches by means of GNRs functionalization with (i) antibodies against Cancer-Antigen-125 (CA-125), (ii) inhibitors of the carbonic anhydrase 9 (CA9) and (iii) by the use of macrophages as cellular vectors. GNRs with a NIR absorption band at 810 nm were synthesized and PEGylated. For GNRs functionalization the targets of choice were CA-125, the most widely used biomarker for ovarian cancer, and CA9, overexpressed by hypoxic cells which are often located within the tumor mass. In the case of cellular vectors, to be used as Trojan horses naturally able to reach tumor areas, the surface of PEG-GNRs was modified to achieve unspecific interactions with macrophage membranes. In all cases the cellular uptake was evaluated by silver staining and cell viability was assessed by MTT test. Then tests of laser-induced GNRs-mediated hyperthermia were performed in various cell cultures illuminating with an 810 nm diode laser (CW, 0,5-4 W/cm2 power density, 1-10 min exposure time) and cell death was evaluated. Each targeting strategy we tested may be used alone or in combination, to maximize the tumor loading and therefore the efficiency of the laser treatment. Moreover, a multiple approach could help when the tumor variability interferes with the targeting directed to a single marker.

  3. The mean-square error optimal linear discriminant function and its application to incomplete data vectors

    NASA Technical Reports Server (NTRS)

    Walker, H. F.

    1979-01-01

    In many pattern recognition problems, data vectors are classified although one or more of the data vector elements are missing. This problem occurs in remote sensing when the ground is obscured by clouds. Optimal linear discrimination procedures for classifying imcomplete data vectors are discussed.

  4. Optimal four-impulse rendezvous between coplanar elliptical orbits

    NASA Astrophysics Data System (ADS)

    Wang, JianXia; Baoyin, HeXi; Li, JunFeng; Sun, FuChun

    2011-04-01

    Rendezvous in circular or near circular orbits has been investigated in great detail, while rendezvous in arbitrary eccentricity elliptical orbits is not sufficiently explored. Among the various optimization methods proposed for fuel optimal orbital rendezvous, Lawden's primer vector theory is favored by many researchers with its clear physical concept and simplicity in solution. Prussing has applied the primer vector optimization theory to minimum-fuel, multiple-impulse, time-fixed orbital rendezvous in a near circular orbit and achieved great success. Extending Prussing's work, this paper will employ the primer vector theory to study trajectory optimization problems of arbitrary eccentricity elliptical orbit rendezvous. Based on linearized equations of relative motion on elliptical reference orbit (referred to as T-H equations), the primer vector theory is used to deal with time-fixed multiple-impulse optimal rendezvous between two coplanar, coaxial elliptical orbits with arbitrary large eccentricity. A parameter adjustment method is developed for the prime vector to satisfy the Lawden's necessary condition for the optimal solution. Finally, the optimal multiple-impulse rendezvous solution including the time, direction and magnitudes of the impulse is obtained by solving the two-point boundary value problem. The rendezvous error of the linearized equation is also analyzed. The simulation results confirmed the analyzed results that the rendezvous error is small for the small eccentricity case and is large for the higher eccentricity. For better rendezvous accuracy of high eccentricity orbits, a combined method of multiplier penalty function with the simplex search method is used for local optimization. The simplex search method is sensitive to the initial values of optimization variables, but the simulation results show that initial values with the primer vector theory, and the local optimization algorithm can improve the rendezvous accuracy effectively with fast convergence, because the optimal results obtained by the primer vector theory are already very close to the actual optimal solution. If the initial values are taken randomly, it is difficult to converge to the optimal solution.

  5. Vector-model-supported approach in prostate plan optimization

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Liu, Eva Sau Fan; Department of Health Technology and Informatics, The Hong Kong Polytechnic University; Wu, Vincent Wing Cheung

    Lengthy time consumed in traditional manual plan optimization can limit the use of step-and-shoot intensity-modulated radiotherapy/volumetric-modulated radiotherapy (S&S IMRT/VMAT). A vector model base, retrieving similar radiotherapy cases, was developed with respect to the structural and physiologic features extracted from the Digital Imaging and Communications in Medicine (DICOM) files. Planning parameters were retrieved from the selected similar reference case and applied to the test case to bypass the gradual adjustment of planning parameters. Therefore, the planning time spent on the traditional trial-and-error manual optimization approach in the beginning of optimization could be reduced. Each S&S IMRT/VMAT prostate reference database comprised 100more » previously treated cases. Prostate cases were replanned with both traditional optimization and vector-model-supported optimization based on the oncologists' clinical dose prescriptions. A total of 360 plans, which consisted of 30 cases of S&S IMRT, 30 cases of 1-arc VMAT, and 30 cases of 2-arc VMAT plans including first optimization and final optimization with/without vector-model-supported optimization, were compared using the 2-sided t-test and paired Wilcoxon signed rank test, with a significance level of 0.05 and a false discovery rate of less than 0.05. For S&S IMRT, 1-arc VMAT, and 2-arc VMAT prostate plans, there was a significant reduction in the planning time and iteration with vector-model-supported optimization by almost 50%. When the first optimization plans were compared, 2-arc VMAT prostate plans had better plan quality than 1-arc VMAT plans. The volume receiving 35 Gy in the femoral head for 2-arc VMAT plans was reduced with the vector-model-supported optimization compared with the traditional manual optimization approach. Otherwise, the quality of plans from both approaches was comparable. Vector-model-supported optimization was shown to offer much shortened planning time and iteration number without compromising the plan quality.« less

  6. Supercomputers for engineering analysis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Goudreau, G.L.; Benson, D.J.; Hallquist, J.O.

    1986-07-01

    The Cray-1 and Cray X-MP/48 experience in engineering computations at the Lawrence Livermore National Laboratory is surveyed. The fully vectorized explicit DYNA and implicit NIKE finite element codes are discussed with respect to solid and structural mechanics. The main efficiencies for production analyses are currently obtained by simple CFT compiler exploitation of pipeline architecture for inner do-loop optimization. Current developmet of outer-loop multitasking is also discussed. Applications emphasis will be on 3D examples spanning earth penetrator loads analysis, target lethality assessment, and crashworthiness. The use of a vectorized large deformation shell element in both DYNA and NIKE has substantially expandedmore » 3D nonlinear capability. 25 refs., 7 figs.« less

  7. A Power Transformers Fault Diagnosis Model Based on Three DGA Ratios and PSO Optimization SVM

    NASA Astrophysics Data System (ADS)

    Ma, Hongzhe; Zhang, Wei; Wu, Rongrong; Yang, Chunyan

    2018-03-01

    In order to make up for the shortcomings of existing transformer fault diagnosis methods in dissolved gas-in-oil analysis (DGA) feature selection and parameter optimization, a transformer fault diagnosis model based on the three DGA ratios and particle swarm optimization (PSO) optimize support vector machine (SVM) is proposed. Using transforming support vector machine to the nonlinear and multi-classification SVM, establishing the particle swarm optimization to optimize the SVM multi classification model, and conducting transformer fault diagnosis combined with the cross validation principle. The fault diagnosis results show that the average accuracy of test method is better than the standard support vector machine and genetic algorithm support vector machine, and the proposed method can effectively improve the accuracy of transformer fault diagnosis is proved.

  8. Slotted rotatable target assembly and systematic error analysis for a search for long range spin dependent interactions from exotic vector boson exchange using neutron spin rotation

    NASA Astrophysics Data System (ADS)

    Haddock, C.; Crawford, B.; Fox, W.; Francis, I.; Holley, A.; Magers, S.; Sarsour, M.; Snow, W. M.; Vanderwerp, J.

    2018-03-01

    We discuss the design and construction of a novel target array of nonmagnetic test masses used in a neutron polarimetry measurement made in search for new possible exotic spin dependent neutron-atominteractions of Nature at sub-mm length scales. This target was designed to accept and efficiently transmit a transversely polarized slow neutron beam through a series of long open parallel slots bounded by flat rectangular plates. These openings possessed equal atom density gradients normal to the slots from the flat test masses with dimensions optimized to achieve maximum sensitivity to an exotic spin-dependent interaction from vector boson exchanges with ranges in the mm - μm regime. The parallel slots were oriented differently in four quadrants that can be rotated about the neutron beam axis in discrete 90°increments using a Geneva drive. The spin rotation signals from the 4 quadrants were measured using a segmented neutron ion chamber to suppress possible systematic errors from stray magnetic fields in the target region. We discuss the per-neutron sensitivity of the target to the exotic interaction, the design constraints, the potential sources of systematic errors which could be present in this design, and our estimate of the achievable sensitivity using this method.

  9. Evolving phage vectors for cell targeted gene delivery.

    PubMed

    Larocca, David; Burg, Michael A; Jensen-Pergakes, Kristen; Ravey, Edward Prenn; Gonzalez, Ana Maria; Baird, Andrew

    2002-03-01

    We adapted filamentous phage vectors for targeted gene delivery to mammalian cells by inserting a mammalian reporter gene expression cassette (GFP) into the vector backbone and fusing the pIII coat protein to a cell targeting ligand (i.e. FGF2, EGF). Like transfection with animal viral vectors, targeted phage gene delivery is concentration, time, and ligand dependent. Importantly, targeted phage particles are specific for the appropriate target cell surface receptor. Phage have distinct advantages over existing gene therapy vectors because they are simple, economical to produce at high titer, have no intrinsic tropism for mammalian cells, and are relatively simple to genetically modify and evolve. Initially transduction by targeted phage particles was low resulting in foreign gene expression in 1-2% of transfected cells. We increased transduction efficiency by modifying both the transfection protocol and vector design. For example, we stabilized the display of the targeting ligand to create multivalent phagemid-based vectors with transduction efficiencies of up to 45% in certain cell lines when combined with genotoxic treatment. Taken together, these studies establish that the efficiency of phage-mediated gene transfer can be significantly improved through genetic modification. We are currently evolving phage vectors with enhanced cell targeting, increased stability, reduced immunogenicity and other properties suitable for gene therapy.

  10. A novel non-toxic combined CTA1-DD and ISCOMS adjuvant vector for effective mucosal immunization against influenza virus.

    PubMed

    Eliasson, Dubravka Grdic; Helgeby, Anja; Schön, Karin; Nygren, Caroline; El-Bakkouri, Karim; Fiers, Walter; Saelens, Xavier; Lövgren, Karin Bengtsson; Nyström, Ida; Lycke, Nils Y

    2011-05-23

    Here we demonstrate that by using non-toxic fractions of saponin combined with CTA1-DD we can achieve a safe and above all highly efficacious mucosal adjuvant vector. We optimized the construction, tested the requirements for function and evaluated proof-of-concept in an influenza A virus challenge model. We demonstrated that the CTA1-3M2e-DD/ISCOMS vector provided 100% protection against mortality and greatly reduced morbidity in the mouse model. The immunogenicity of the vector was superior to other vaccine formulations using the ISCOM or CTA1-DD adjuvants alone. The versatility of the vector was best exemplified by the many options to insert, incorporate or admix vaccine antigens with the vector. Furthermore, the CTA1-3M2e-DD/ISCOMS could be kept 1 year at 4°C or as a freeze-dried powder without affecting immunogenicity or adjuvanticity of the vector. Strong serum IgG and mucosal IgA responses were elicited and CD4 T cell responses were greatly enhanced after intranasal administration of the combined vector. Together these findings hold promise for the combined vector as a mucosal vaccine against influenza virus infections including pandemic influenza. The CTA1-DD/ISCOMS technology represents a breakthrough in mucosal vaccine vector design which successfully combines immunomodulation and targeting in a safe and stable particulate formation. Copyright © 2011 Elsevier Ltd. All rights reserved.

  11. Optimizing cardiovascular gene therapy: increased vascular gene transfer with modified adenoviral vectors.

    PubMed

    Kibbe, M R; Murdock, A; Wickham, T; Lizonova, A; Kovesdi, I; Nie, S; Shears, L; Billiar, T R; Tzeng, E

    2000-02-01

    Adenovirus is widely used as a vector for gene transfer to the vasculature. However, the efficiency of these vectors can be limited by ineffective viral-target cell interactions. Viral attachment, which largely determines adenoviral tropism, is mediated through binding of the adenoviral fiber coat protein to the Coxsackievirus and adenovirus receptor, while internalization follows binding of the adenoviral RGD motif to alpha(v)-integrin receptors. Modifications of the fiber coat protein sequence have been successful for targeting the adenovirus to more prevalent receptors in the vasculature, including heparan sulfate-containing receptors and alpha(v)-integrin receptors. Modified adenoviral vectors targeted to receptors more prevalent in the vasculature result in an increased transfer efficiency of the virus in vitro and in vivo even in the presence of clinically relevant doses of heparin. We tested 2 modified E1- and E3-deleted Ad5 type adenoviral vectors containing the beta-galactosidase gene. AdZ.F(pK7) contains multiple positively charged lysines in the fiber coat protein that target the adenovirus to heparan sulfate receptors, while AdZ.F(RGD) contains an RGD integrin-binding sequence in the fiber coat protein that allows binding to alpha(v)-integrin receptors. The gene transfer efficiency of these modified viruses was compared in rat aortic smooth muscle cells in vitro and in an in vivo porcine model of balloon-induced arterial injury. Because of the use of heparin during most vascular surgical procedures and the concern that heparin might interfere with the binding of AdZ.F(pK7) to heparan sulfate receptors, the effect of heparin on the in vitro and in vivo transfer efficiency of these 2 modified adenoviruses was evaluated. In vitro infection of rat aortic smooth muscle cells with AdZ.F(pK7) and AdZ.F(RGD) resulted in significantly higher levels of beta-galactosidase expression compared with the unmodified adenovirus (mean +/- SEM, 1766.3 +/- 89.1 and 44.8 +/- 3.4 vs 10.1 +/- 0.7 mU per milligram of protein; P<.001). Following heparin administration, the gene transfer efficiency achieved with AdZ.F(pK7) diminished slightly in a concentration-dependent manner. However, the transfer efficiency was still greater than with the unmodified virus (mean +/- SEM, 1342.3 +/- 101.8 vs 4.8 +/- 0.4 mU per milligram of protein; P<.001). In vivo, following injury to the pig iliac artery with a 4F Fogarty balloon catheter, we found that AdZ.F(pK7) transduced the artery approximately 35-fold more efficiently than AdZ.F and 3-fold more efficiently than AdZ.F(RGD) following the administration of intravenous heparin, 100 U/kg body weight, and heparinized saline irrigation. Modifications of the adenovirus that lead to receptor targeting resulted in significantly improved gene transfer efficiencies. These improvements in transfer efficiencies observed with the modified vectors decreased slightly in the presence of heparin. However, AdZ.F(pK7) was still superior to AdZ.F(RGD) and AdZ.F despite heparin administration. These data demonstrate that modifications of adenoviral vectors that enhance binding to heparan sulfate receptors significantly improve gene transfer efficiency even in the presence of heparin and suggest an approach to optimize gene transfer into blood vessels.

  12. Voyager 1 Saturn targeting strategy

    NASA Technical Reports Server (NTRS)

    Cesarone, R. J.

    1980-01-01

    A trajectory targeting strategy for the Voyager 1 Saturn encounter has been designed to accomodate predicted uncertainties in Titan's ephemeris while maximizing spacecraft safety and science return. The encounter is characterized by a close Titan flyby 18 hours prior to Saturn periapse. Retargeting of the nominal trajectory to account for late updates in Titan's estimated position can disperse the ascending node location, which is nominally situated at a radius of low expected particle density in Saturn's ring plane. The strategy utilizes a floating Titan impact vector magnitude to minimize this dispersion. Encounter trajectory characteristics and optimal tradeoffs are presented.

  13. Engineered Salmonella enterica serovar Typhimurium overcomes limitations of anti-bacterial immunity in bacteria-mediated tumor therapy

    PubMed Central

    Felgner, Sebastian; Kocijancic, Dino; Frahm, Michael; Heise, Ulrike; Rohde, Manfred; Zimmermann, Kurt; Falk, Christine; Weiss, Siegfried

    2018-01-01

    ABSTRACT Cancer is one of the leading causes of death in the industrialized world and represents a tremendous social and economic burden. As conventional therapies fail to provide a sustainable cure for most cancer patients, the emerging unique immune therapeutic approach of bacteria-mediated tumor therapy (BMTT) is marching towards a feasible solution. Although promising results have been obtained with BMTT using various preclinical tumor models, for advancement a major concern is immunity against the bacterial vector itself. Pre-exposure to the therapeutic agent under field conditions is a reasonable expectation and may limit the therapeutic efficacy of BMTT. In the present study, we investigated the therapeutic potential of Salmonella and E. coli vector strains in naïve and immunized tumor bearing mice. Pre-exposure to the therapeutic agent caused a significant aberrant phenotype of the microenvironment of colonized tumors and limited the in vivo efficacy of established BMTT vector strains Salmonella SL7207 and E. coli Symbioflor-2. Using targeted genetic engineering, we generated the optimized auxotrophic Salmonella vector strain SF200 (ΔlpxR9 ΔpagL7 ΔpagP8 ΔaroA ΔydiV ΔfliF) harboring modifications in Lipid A and flagella synthesis. This combination of mutations resulted in an increased immune-stimulatory capacity and as such the strain was able to overcome the efficacy-limiting effects of pre-exposure. Thus, we conclude that any limitations of BMTT concerning anti-bacterial immunity may be countered by strategies that optimize the immune-stimulatory capacity of the attenuated vector strains. PMID:29308303

  14. Improved methods of AAV-mediated gene targeting for human cell lines using ribosome-skipping 2A peptide

    PubMed Central

    Karnan, Sivasundaram; Ota, Akinobu; Konishi, Yuko; Wahiduzzaman, Md; Hosokawa, Yoshitaka; Konishi, Hiroyuki

    2016-01-01

    The adeno-associated virus (AAV)-based targeting vector has been one of the tools commonly used for genome modification in human cell lines. It allows for relatively efficient gene targeting associated with 1–4-log higher ratios of homologous-to-random integration of targeting vectors (H/R ratios) than plasmid-based targeting vectors, without actively introducing DNA double-strand breaks. In this study, we sought to improve the efficiency of AAV-mediated gene targeting by introducing a 2A-based promoter-trap system into targeting constructs. We generated three distinct AAV-based targeting vectors carrying 2A for promoter trapping, each targeting a GFP-based reporter module incorporated into the genome, PIGA exon 6 or PIGA intron 5. The absolute gene targeting efficiencies and H/R ratios attained using these vectors were assessed in multiple human cell lines and compared with those attained using targeting vectors carrying internal ribosome entry site (IRES) for promoter trapping. We found that the use of 2A for promoter trapping increased absolute gene targeting efficiencies by 3.4–28-fold and H/R ratios by 2–5-fold compared to values obtained with IRES. In CRISPR-Cas9-assisted gene targeting using plasmid-based targeting vectors, the use of 2A did not enhance the H/R ratios but did upregulate the absolute gene targeting efficiencies compared to the use of IRES. PMID:26657635

  15. Targeted drug delivery and enhanced intracellular release using functionalized liposomes

    NASA Astrophysics Data System (ADS)

    Garg, Ashish

    The ability to target cancer cells using an appropriate drug delivery system can significantly reduce the associated side effects from cancer therapies and can help in improving the overall quality of life, post cancer survival. Integrin alpha5beta1 is expressed on several types of cancer cells, including colon cancer and plays an important role in tumor growth and metastasis. Thus, the ability to target the integrin alpha 5beta1 using an appropriate drug delivery nano-vector can significantly help in inhibiting tumor growth and reducing tumor metastasis. The work in this thesis focuses on designing and optimizing, functionalized stealth liposomes (liposomes covered with polyethylene glycol (PEG)) that specifically target the integrin alpha5beta1. The PEG provides a steric barrier allowing the liposomes to circulate in the blood for longer duration and the functionalizing moiety, PR_b peptide specifically recognizes and binds to integrin alpha5beta1 expressing cells. The work demonstrates that by optimizing the amount of PEG and PR_b on the liposomal interface, nano-vectors can be engineered that bind to CT26.WT colon cancer cells in a specific manner and internalize through alpha 5beta1-mediated endocytosis. To further improve the efficacy of the system, PR_b functionalized pH-sensitive stealth liposomes that exhibit triggered release under mild acidic conditions present in endocytotic vesicles were designed. The study showed that PR_b functionalized pH-sensitive stealth liposomes, undergo destabilization under mildly acidic conditions and incorporation of the PR_b peptide does not significantly affect the pH-sensitivity of the liposomes. PR_b functionalized pH-sensitive stealth liposomes bind to CT26.WT colon carcinoma cells that express integrin alpha5beta 1, undergo cellular internalization, and release their load intracellularly in a short period of time as compared to other formulations. PR_b-targeted pH-sensitive stealth liposomes encapsulating 5-fluorouracil (5-FU) show significantly higher cytotoxicity than the PR_b-targeted inert stealth liposomes and the non-targeted stealth liposomes (both pH-sensitive and inert). The studies demonstrated that optimized PR_b functionalized pH sensitive liposomes have the potential to deliver a payload, such as chemotherapeutic agents, directly to colon cancer cells in an efficient and specific manner.

  16. Practical method for targeted disruption of cilia-related genes by using CRISPR/Cas9-mediated, homology-independent knock-in system.

    PubMed

    Katoh, Yohei; Michisaka, Saki; Nozaki, Shohei; Funabashi, Teruki; Hirano, Tomoaki; Takei, Ryota; Nakayama, Kazuhisa

    2017-04-01

    The CRISPR/Cas9 system has revolutionized genome editing in virtually all organisms. Although the CRISPR/Cas9 system enables the targeted cleavage of genomic DNA, its use for gene knock-in remains challenging because levels of homologous recombination activity vary among various cells. In contrast, the efficiency of homology-independent DNA repair is relatively high in most cell types. Therefore the use of a homology-independent repair mechanism is a possible alternative for efficient genome editing. Here we constructed a donor knock-in vector optimized for the CRISPR/Cas9 system and developed a practical system that enables efficient disruption of target genes by exploiting homology-independent repair. Using this practical knock-in system, we successfully disrupted genes encoding proteins involved in ciliary protein trafficking, including IFT88 and IFT20, in hTERT-RPE1 cells, which have low homologous recombination activity. The most critical concern using the CRISPR/Cas9 system is off-target cleavage. To reduce the off-target cleavage frequency and increase the versatility of our knock-in system, we constructed a universal donor vector and an expression vector containing Cas9 with enhanced specificity and tandem sgRNA expression cassettes. We demonstrated that the second version of our system has improved usability. © 2017 Katoh et al. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).

  17. Matrix multiplication operations using pair-wise load and splat operations

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Eichenberger, Alexandre E.; Gschwind, Michael K.; Gunnels, John A.

    Mechanisms for performing a matrix multiplication operation are provided. A vector load operation is performed to load a first vector operand of the matrix multiplication operation to a first target vector register. A pair-wise load and splat operation is performed to load a pair of scalar values of a second vector operand and replicate the pair of scalar values within a second target vector register. An operation is performed on elements of the first target vector register and elements of the second target vector register to generate a partial product of the matrix multiplication operation. The partial product is accumulatedmore » with other partial products and a resulting accumulated partial product is stored. This operation may be repeated for a second pair of scalar values of the second vector operand.« less

  18. Registration algorithm of point clouds based on multiscale normal features

    NASA Astrophysics Data System (ADS)

    Lu, Jun; Peng, Zhongtao; Su, Hang; Xia, GuiHua

    2015-01-01

    The point cloud registration technology for obtaining a three-dimensional digital model is widely applied in many areas. To improve the accuracy and speed of point cloud registration, a registration method based on multiscale normal vectors is proposed. The proposed registration method mainly includes three parts: the selection of key points, the calculation of feature descriptors, and the determining and optimization of correspondences. First, key points are selected from the point cloud based on the changes of magnitude of multiscale curvatures obtained by using principal components analysis. Then the feature descriptor of each key point is proposed, which consists of 21 elements based on multiscale normal vectors and curvatures. The correspondences in a pair of two point clouds are determined according to the descriptor's similarity of key points in the source point cloud and target point cloud. Correspondences are optimized by using a random sampling consistency algorithm and clustering technology. Finally, singular value decomposition is applied to optimized correspondences so that the rigid transformation matrix between two point clouds is obtained. Experimental results show that the proposed point cloud registration algorithm has a faster calculation speed, higher registration accuracy, and better antinoise performance.

  19. Integrated optimization of unmanned aerial vehicle task allocation and path planning under steady wind.

    PubMed

    Luo, He; Liang, Zhengzheng; Zhu, Moning; Hu, Xiaoxuan; Wang, Guoqiang

    2018-01-01

    Wind has a significant effect on the control of fixed-wing unmanned aerial vehicles (UAVs), resulting in changes in their ground speed and direction, which has an important influence on the results of integrated optimization of UAV task allocation and path planning. The objective of this integrated optimization problem changes from minimizing flight distance to minimizing flight time. In this study, the Euclidean distance between any two targets is expanded to the Dubins path length, considering the minimum turning radius of fixed-wing UAVs. According to the vector relationship between wind speed, UAV airspeed, and UAV ground speed, a method is proposed to calculate the flight time of UAV between targets. On this basis, a variable-speed Dubins path vehicle routing problem (VS-DP-VRP) model is established with the purpose of minimizing the time required for UAVs to visit all the targets and return to the starting point. By designing a crossover operator and mutation operator, the genetic algorithm is used to solve the model, the results of which show that an effective UAV task allocation and path planning solution under steady wind can be provided.

  20. Integrated optimization of unmanned aerial vehicle task allocation and path planning under steady wind

    PubMed Central

    Liang, Zhengzheng; Zhu, Moning; Hu, Xiaoxuan; Wang, Guoqiang

    2018-01-01

    Wind has a significant effect on the control of fixed-wing unmanned aerial vehicles (UAVs), resulting in changes in their ground speed and direction, which has an important influence on the results of integrated optimization of UAV task allocation and path planning. The objective of this integrated optimization problem changes from minimizing flight distance to minimizing flight time. In this study, the Euclidean distance between any two targets is expanded to the Dubins path length, considering the minimum turning radius of fixed-wing UAVs. According to the vector relationship between wind speed, UAV airspeed, and UAV ground speed, a method is proposed to calculate the flight time of UAV between targets. On this basis, a variable-speed Dubins path vehicle routing problem (VS-DP-VRP) model is established with the purpose of minimizing the time required for UAVs to visit all the targets and return to the starting point. By designing a crossover operator and mutation operator, the genetic algorithm is used to solve the model, the results of which show that an effective UAV task allocation and path planning solution under steady wind can be provided. PMID:29561888

  1. Interactive optimization approach for optimal impulsive rendezvous using primer vector and evolutionary algorithms

    NASA Astrophysics Data System (ADS)

    Luo, Ya-Zhong; Zhang, Jin; Li, Hai-yang; Tang, Guo-Jin

    2010-08-01

    In this paper, a new optimization approach combining primer vector theory and evolutionary algorithms for fuel-optimal non-linear impulsive rendezvous is proposed. The optimization approach is designed to seek the optimal number of impulses as well as the optimal impulse vectors. In this optimization approach, adding a midcourse impulse is determined by an interactive method, i.e. observing the primer-magnitude time history. An improved version of simulated annealing is employed to optimize the rendezvous trajectory with the fixed-number of impulses. This interactive approach is evaluated by three test cases: coplanar circle-to-circle rendezvous, same-circle rendezvous and non-coplanar rendezvous. The results show that the interactive approach is effective and efficient in fuel-optimal non-linear rendezvous design. It can guarantee solutions, which satisfy the Lawden's necessary optimality conditions.

  2. Mucosal vaccination by adenoviruses displaying reovirus sigma 1

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Weaver, Eric A.; Camacho, Zenaido T.; Hillestad, Matthew L.

    We developed adenovirus serotype 5 (Ad5) vectors displaying the sigma 1 protein from reovirus as mucosal vaccines. Ad5-sigma retargets to JAM-1 and sialic acid, but has 40-fold reduced gene delivery when compared to Ad5. While weaker at transduction, Ad5-sigma generates stronger T cell responses than Ad5 when used for mucosal immunization. In this work, new Ad5-fiber-sigma vectors were generated by varying the number of fiber β-spiral shaft repeats (R) between the fiber tail and sigma. Increasing chimera length led to decreasing insertion of these proteinsAd5 virions. Ad-R3 and R14 vectors effectively targeted JAM-1 in vitro while R20 did not. Whenmore » wereused to immunize mice by the intranasal route, Ad5-R3-sigma produced higher serum and vaginal antibody responses than Ad5. These data suggest optimized Ad-sigma vectors may be useful vectors for mucosal vaccination. - Highlights: • Constructed adenoviruses (Ads) displaying different reovirus sigma 1 fusion proteins. • Progressively longer chimeras were more poorly encapsidated onto Ad virions. • Ad5-R3-sigma mediated better systemic and mucosal immune responses than Ad5.« less

  3. Lightweight filter architecture for energy efficient mobile vehicle localization based on a distributed acoustic sensor network.

    PubMed

    Kim, Keonwook

    2013-08-23

    The generic properties of an acoustic signal provide numerous benefits for localization by applying energy-based methods over a deployed wireless sensor network (WSN). However, the signal generated by a stationary target utilizes a significant amount of bandwidth and power in the system without providing further position information. For vehicle localization, this paper proposes a novel proximity velocity vector estimator (PVVE) node architecture in order to capture the energy from a moving vehicle and reject the signal from motionless automobiles around the WSN node. A cascade structure between analog envelope detector and digital exponential smoothing filter presents the velocity vector-sensitive output with low analog circuit and digital computation complexity. The optimal parameters in the exponential smoothing filter are obtained by analytical and mathematical methods for maximum variation over the vehicle speed. For stationary targets, the derived simulation based on the acoustic field parameters demonstrates that the system significantly reduces the communication requirements with low complexity and can be expected to extend the operation time considerably.

  4. An optimal control strategies using vaccination and fogging in dengue fever transmission model

    NASA Astrophysics Data System (ADS)

    Fitria, Irma; Winarni, Pancahayani, Sigit; Subchan

    2017-08-01

    This paper discussed regarding a model and an optimal control problem of dengue fever transmission. We classified the model as human and vector (mosquito) population classes. For the human population, there are three subclasses, such as susceptible, infected, and resistant classes. Then, for the vector population, we divided it into wiggler, susceptible, and infected vector classes. Thus, the model consists of six dynamic equations. To minimize the number of dengue fever cases, we designed two optimal control variables in the model, the giving of fogging and vaccination. The objective function of this optimal control problem is to minimize the number of infected human population, the number of vector, and the cost of the controlling efforts. By giving the fogging optimally, the number of vector can be minimized. In this case, we considered the giving of vaccination as a control variable because it is one of the efforts that are being developed to reduce the spreading of dengue fever. We used Pontryagin Minimum Principle to solve the optimal control problem. Furthermore, the numerical simulation results are given to show the effect of the optimal control strategies in order to minimize the epidemic of dengue fever.

  5. Matrix multiplication operations with data pre-conditioning in a high performance computing architecture

    DOEpatents

    Eichenberger, Alexandre E; Gschwind, Michael K; Gunnels, John A

    2013-11-05

    Mechanisms for performing matrix multiplication operations with data pre-conditioning in a high performance computing architecture are provided. A vector load operation is performed to load a first vector operand of the matrix multiplication operation to a first target vector register. A load and splat operation is performed to load an element of a second vector operand and replicating the element to each of a plurality of elements of a second target vector register. A multiply add operation is performed on elements of the first target vector register and elements of the second target vector register to generate a partial product of the matrix multiplication operation. The partial product of the matrix multiplication operation is accumulated with other partial products of the matrix multiplication operation.

  6. Parallel-vector computation for linear structural analysis and non-linear unconstrained optimization problems

    NASA Technical Reports Server (NTRS)

    Nguyen, D. T.; Al-Nasra, M.; Zhang, Y.; Baddourah, M. A.; Agarwal, T. K.; Storaasli, O. O.; Carmona, E. A.

    1991-01-01

    Several parallel-vector computational improvements to the unconstrained optimization procedure are described which speed up the structural analysis-synthesis process. A fast parallel-vector Choleski-based equation solver, pvsolve, is incorporated into the well-known SAP-4 general-purpose finite-element code. The new code, denoted PV-SAP, is tested for static structural analysis. Initial results on a four processor CRAY 2 show that using pvsolve reduces the equation solution time by a factor of 14-16 over the original SAP-4 code. In addition, parallel-vector procedures for the Golden Block Search technique and the BFGS method are developed and tested for nonlinear unconstrained optimization. A parallel version of an iterative solver and the pvsolve direct solver are incorporated into the BFGS method. Preliminary results on nonlinear unconstrained optimization test problems, using pvsolve in the analysis, show excellent parallel-vector performance indicating that these parallel-vector algorithms can be used in a new generation of finite-element based structural design/analysis-synthesis codes.

  7. Systemic administration of a PEGylated adenovirus vector with a cancer-specific promoter is effective in a mouse model of metastasis.

    PubMed

    Yao, X; Yoshioka, Y; Morishige, T; Eto, Y; Watanabe, H; Okada, Y; Mizuguchi, H; Mukai, Y; Okada, N; Nakagawa, S

    2009-12-01

    Cancer gene therapy by adenovirus vectors (Advs) for metastatic cancer is limited because systemic administration of Adv produces low therapeutic effect and severe side effects. In this study, we generated a dual cancer-specific targeting vector system by using PEGylation and the telomere reverse transcriptase (TERT) promoter and attempted to treat experimental metastases through systemic administration of the vectors. We first optimized the molecular size of PEG and modification ratios used to create PEG-Ads. Systemic administration of PEG-Ad with 20-kDa PEG at a 45% modification ratio (PEG[20K/45%]-Ad) resulted in higher tumor-selective transgene expression than unmodified Adv. Next, we examined the effectiveness against metastases and side effects of a TERT promoter-driven PEG[20K/45%]-Ad containing the herpes simplex virus thymidine kinase (HSVtk) gene (PEG-Ad-TERT/HSVtk). Systemic administration of PEG-Ad-TERT/HSVtk showed superior antitumor effects against metastases with negligible side effects. A cytomegalovirus (CMV) promoter-driven PEG[20K/45%]-Ad also produced antimetastatic effects, but these were accompanied by side effects. Combining PEG-Ad-TERT/HSVtk with etoposide or 5-fluorouracil enhanced the therapeutic effects with negligible side effects. These results suggest that modification with 20-kDa PEG at a 45% modification ratio is the optimal condition for PEGylation of Adv, and PEG-Ad-TERT/HSVtk is a prototype Adv for systemic cancer gene therapy against metastases.

  8. Analytical Approach to the Fuel Optimal Impulsive Transfer Problem Using Primer Vector Method

    NASA Astrophysics Data System (ADS)

    Fitrianingsih, E.; Armellin, R.

    2018-04-01

    One of the objectives of mission design is selecting an optimum orbital transfer which often translated as a transfer which requires minimum propellant consumption. In order to assure the selected trajectory meets the requirement, the optimality of transfer should first be analyzed either by directly calculating the ΔV of the candidate trajectories and select the one that gives a minimum value or by evaluating the trajectory according to certain criteria of optimality. The second method is performed by analyzing the profile of the modulus of the thrust direction vector which is known as primer vector. Both methods come with their own advantages and disadvantages. However, it is possible to use the primer vector method to verify if the result from the direct method is truly optimal or if the ΔV can be reduced further by implementing correction maneuver to the reference trajectory. In addition to its capability to evaluate the transfer optimality without the need to calculate the transfer ΔV, primer vector also enables us to identify the time and position to apply correction maneuver in order to optimize a non-optimum transfer. This paper will present the analytical approach to the fuel optimal impulsive transfer using primer vector method. The validity of the method is confirmed by comparing the result to those from the numerical method. The investigation of the optimality of direct transfer is used to give an example of the application of the method. The case under study is the prograde elliptic transfers from Earth to Mars. The study enables us to identify the optimality of all the possible transfers.

  9. Construction and applications of exon-trapping gene-targeting vectors with a novel strategy for negative selection.

    PubMed

    Saito, Shinta; Ura, Kiyoe; Kodama, Miho; Adachi, Noritaka

    2015-06-30

    Targeted gene modification by homologous recombination provides a powerful tool for studying gene function in cells and animals. In higher eukaryotes, non-homologous integration of targeting vectors occurs several orders of magnitude more frequently than does targeted integration, making the gene-targeting technology highly inefficient. For this reason, negative-selection strategies have been employed to reduce the number of drug-resistant clones associated with non-homologous vector integration, particularly when artificial nucleases to introduce a DNA break at the target site are unavailable or undesirable. As such, an exon-trap strategy using a promoterless drug-resistance marker gene provides an effective way to counterselect non-homologous integrants. However, constructing exon-trapping targeting vectors has been a time-consuming and complicated process. By virtue of highly efficient att-mediated recombination, we successfully developed a simple and rapid method to construct plasmid-based vectors that allow for exon-trapping gene targeting. These exon-trap vectors were useful in obtaining correctly targeted clones in mouse embryonic stem cells and human HT1080 cells. Most importantly, with the use of a conditionally cytotoxic gene, we further developed a novel strategy for negative selection, thereby enhancing the efficiency of counterselection for non-homologous integration of exon-trap vectors. Our methods will greatly facilitate exon-trapping gene-targeting technologies in mammalian cells, particularly when combined with the novel negative selection strategy.

  10. An Efficient Visual Screen for CRISPR/Cas9 Activity in Arabidopsis thaliana.

    PubMed

    Hahn, Florian; Mantegazza, Otho; Greiner, André; Hegemann, Peter; Eisenhut, Marion; Weber, Andreas P M

    2017-01-01

    The CRISPR/Cas9 system enables precision editing of the genome of the model plant Arabidopsis thaliana and likely of any other organism. Tools and methods for further developing and optimizing this widespread and versatile system in Arabidopsis would hence be welcomed. Here, we designed a generic vector system that can be used to clone any sgRNA sequence in a plant T-DNA vector containing an ubiquitously expressed Cas9 gene. With this vector, we explored two alternative marker systems for tracking Cas9-mediated gene-editing in vivo : BIALAPHOS RESISTANCE ( BAR ) and GLABROUS1 ( GL1 ). BAR confers resistance to glufosinate and is widely used as a positive selection marker; GL1 is required for the formation of trichomes. Reversion of a frameshift null BAR allele to a functional one by Cas9-mediated gene editing yielded a higher than expected number of plants that are resistant to glufosinate. Surprisingly, many of those plants did not display reversion of the BAR gene through the germline. We hypothesize that few BAR revertant cells in a highly chimeric plant likely provide system-wide resistance to glufosinate and thus we suggest that BAR is not suitable as marker for tracking Cas9-mediated gene-editing. Targeting the GL1 gene for disruption with Cas9 provided clearly visible phenotypes of partially and completely glabrous plants. 50% of the analyzed T1 plants produced descendants with a chimeric phenotype and we could recover fully homozygous plants in the T3 generation with high efficiency. We propose that targeting of GL1 is suitable for assessing and optimizing Cas9-mediated gene-editing in Arabidopsis .

  11. Breaking the polar-nonpolar division in solvation free energy prediction.

    PubMed

    Wang, Bao; Wang, Chengzhang; Wu, Kedi; Wei, Guo-Wei

    2018-02-05

    Implicit solvent models divide solvation free energies into polar and nonpolar additive contributions, whereas polar and nonpolar interactions are inseparable and nonadditive. We present a feature functional theory (FFT) framework to break this ad hoc division. The essential ideas of FFT are as follows: (i) representability assumption: there exists a microscopic feature vector that can uniquely characterize and distinguish one molecule from another; (ii) feature-function relationship assumption: the macroscopic features, including solvation free energy, of a molecule is a functional of microscopic feature vectors; and (iii) similarity assumption: molecules with similar microscopic features have similar macroscopic properties, such as solvation free energies. Based on these assumptions, solvation free energy prediction is carried out in the following protocol. First, we construct a molecular microscopic feature vector that is efficient in characterizing the solvation process using quantum mechanics and Poisson-Boltzmann theory. Microscopic feature vectors are combined with macroscopic features, that is, physical observable, to form extended feature vectors. Additionally, we partition a solvation dataset into queries according to molecular compositions. Moreover, for each target molecule, we adopt a machine learning algorithm for its nearest neighbor search, based on the selected microscopic feature vectors. Finally, from the extended feature vectors of obtained nearest neighbors, we construct a functional of solvation free energy, which is employed to predict the solvation free energy of the target molecule. The proposed FFT model has been extensively validated via a large dataset of 668 molecules. The leave-one-out test gives an optimal root-mean-square error (RMSE) of 1.05 kcal/mol. FFT predictions of SAMPL0, SAMPL1, SAMPL2, SAMPL3, and SAMPL4 challenge sets deliver the RMSEs of 0.61, 1.86, 1.64, 0.86, and 1.14 kcal/mol, respectively. Using a test set of 94 molecules and its associated training set, the present approach was carefully compared with a classic solvation model based on weighted solvent accessible surface area. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  12. High-order graph matching based feature selection for Alzheimer's disease identification.

    PubMed

    Liu, Feng; Suk, Heung-Il; Wee, Chong-Yaw; Chen, Huafu; Shen, Dinggang

    2013-01-01

    One of the main limitations of l1-norm feature selection is that it focuses on estimating the target vector for each sample individually without considering relations with other samples. However, it's believed that the geometrical relation among target vectors in the training set may provide useful information, and it would be natural to expect that the predicted vectors have similar geometric relations as the target vectors. To overcome these limitations, we formulate this as a graph-matching feature selection problem between a predicted graph and a target graph. In the predicted graph a node is represented by predicted vector that may describe regional gray matter volume or cortical thickness features, and in the target graph a node is represented by target vector that include class label and clinical scores. In particular, we devise new regularization terms in sparse representation to impose high-order graph matching between the target vectors and the predicted ones. Finally, the selected regional gray matter volume and cortical thickness features are fused in kernel space for classification. Using the ADNI dataset, we evaluate the effectiveness of the proposed method and obtain the accuracies of 92.17% and 81.57% in AD and MCI classification, respectively.

  13. Avidin-Based Targeting and Purification of a Protein IX-Modified, Metabolically Biotinylated Adenoviral Vector

    PubMed Central

    Campos, Samuel K.; Parrott, M. Brandon; Barry, Michael A.

    2014-01-01

    While genetic modification of adenoviral vectors can produce vectors with modified tropism, incorporation of targeting peptides/proteins into the structural context of the virion can also result in destruction of ligand targeting or virion integrity. To combat this problem, we have developed a versatile targeting system using metabolically biotinylated adenoviral vectors bearing biotinylated fiber proteins. These vectors have been demonstrated to be useful as a platform for avidin-based ligand screening and vector targeting by conjugating biotinylated ligands to the virus using high-affinity tetrameric avidin (Kd = 10−15 M). The biotinylated vector could also be purified by biotin-reversible binding on monomeric avidin (Kd = 10−7 M). In this report, a second metabolically biotinylated adenovirus vector, Ad-IX-BAP, has been engineered by fusing a biotin acceptor peptide (BAP) to the C-terminus of the adenovirus pIX protein. This biotinylated vector displays twice as many biotins and was markedly superior for single-step affinity purification on monomeric avidin resin. However, unlike the fiber-biotinylated vector, Ad-IX-BAP failed to retarget to cells with biotinylated antibodies including anti-CD71 against the transferrin receptor. In contrast, Ad-IX-BAP was retargeted if transferrin, the cognate ligand for CD71, was used as a ligand rather than the anti-CD71. This work demonstrates the utility of metabolic biotinylation as a molecular screening tool to assess the utility of different viral capsid proteins for ligand display and the biology and compatibility of different ligands and receptors for vector targeting applications. These results also demonstrate the utility of the pIX-biotinylated vector as a platform for gentle single-step affinity purification of adenoviral vectors. PMID:15194061

  14. Current Advances and Future Challenges in Adenoviral Vector Biology and Targeting

    PubMed Central

    Campos, Samuel K.; Barry, Michael A.

    2008-01-01

    Gene delivery vectors based on Adenoviral (Ad) vectors have enormous potential for the treatment of both hereditary and acquired disease. Detailed structural analysis of the Ad virion, combined with functional studies has broadened our knowledge of the structure/function relationships between Ad vectors and host cells/tissues and substantial achievement has been made towards a thorough understanding of the biology of Ad vectors. The widespread use of Ad vectors for clinical gene therapy is compromised by their inherent immunogenicity. The generation of safer and more effective Ad vectors, targeted to the site of disease, has therefore become a great ambition in the field of Ad vector development. This review provides a synopsis of the structure/function relationships between Ad vectors and host systems and summarizes the many innovative approaches towards achieving Ad vector targeting. PMID:17584037

  15. Characterization of the Dispersal of Non-Domiciliated Triatoma dimidiata through the Selection of Spatially Explicit Models

    PubMed Central

    Barbu, Corentin; Dumonteil, Eric; Gourbière, Sébastien

    2010-01-01

    Background Chagas disease is a major parasitic disease in Latin America, prevented in part by vector control programs that reduce domestic populations of triatomines. However, the design of control strategies adapted to non-domiciliated vectors, such as Triatoma dimidiata, remains a challenge because it requires an accurate description of their spatio-temporal distributions, and a proper understanding of the underlying dispersal processes. Methodology/Principal Findings We combined extensive spatio-temporal data sets describing house infestation dynamics by T. dimidiata within a village, and spatially explicit population dynamics models in a selection model approach. Several models were implemented to provide theoretical predictions under different hypotheses on the origin of the dispersers and their dispersal characteristics, which we compared with the spatio-temporal pattern of infestation observed in the field. The best models fitted the dynamic of infestation described by a one year time-series, and also predicted with a very good accuracy the infestation process observed during a second replicate one year time-series. The parameterized models gave key insights into the dispersal of these vectors. i) About 55% of the triatomines infesting houses came from the peridomestic habitat, the rest corresponding to immigration from the sylvatic habitat, ii) dispersing triatomines were 5–15 times more attracted by houses than by peridomestic area, and iii) the moving individuals spread on average over rather small distances, typically 40–60 m/15 days. Conclusion/Significance Since these dispersal characteristics are associated with much higher abundance of insects in the periphery of the village, we discuss the possibility that spatially targeted interventions allow for optimizing the efficacy of vector control activities within villages. Such optimization could prove very useful in the context of limited resources devoted to vector control. PMID:20689823

  16. Interpreting linear support vector machine models with heat map molecule coloring

    PubMed Central

    2011-01-01

    Background Model-based virtual screening plays an important role in the early drug discovery stage. The outcomes of high-throughput screenings are a valuable source for machine learning algorithms to infer such models. Besides a strong performance, the interpretability of a machine learning model is a desired property to guide the optimization of a compound in later drug discovery stages. Linear support vector machines showed to have a convincing performance on large-scale data sets. The goal of this study is to present a heat map molecule coloring technique to interpret linear support vector machine models. Based on the weights of a linear model, the visualization approach colors each atom and bond of a compound according to its importance for activity. Results We evaluated our approach on a toxicity data set, a chromosome aberration data set, and the maximum unbiased validation data sets. The experiments show that our method sensibly visualizes structure-property and structure-activity relationships of a linear support vector machine model. The coloring of ligands in the binding pocket of several crystal structures of a maximum unbiased validation data set target indicates that our approach assists to determine the correct ligand orientation in the binding pocket. Additionally, the heat map coloring enables the identification of substructures important for the binding of an inhibitor. Conclusions In combination with heat map coloring, linear support vector machine models can help to guide the modification of a compound in later stages of drug discovery. Particularly substructures identified as important by our method might be a starting point for optimization of a lead compound. The heat map coloring should be considered as complementary to structure based modeling approaches. As such, it helps to get a better understanding of the binding mode of an inhibitor. PMID:21439031

  17. A Multipurpose Toolkit to Enable Advanced Genome Engineering in Plants[OPEN

    PubMed Central

    Gil-Humanes, Javier; Čegan, Radim; Kono, Thomas J.Y.; Konečná, Eva; Belanto, Joseph J.; Starker, Colby G.

    2017-01-01

    We report a comprehensive toolkit that enables targeted, specific modification of monocot and dicot genomes using a variety of genome engineering approaches. Our reagents, based on transcription activator-like effector nucleases (TALENs) and the clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 system, are systematized for fast, modular cloning and accommodate diverse regulatory sequences to drive reagent expression. Vectors are optimized to create either single or multiple gene knockouts and large chromosomal deletions. Moreover, integration of geminivirus-based vectors enables precise gene editing through homologous recombination. Regulation of transcription is also possible. A Web-based tool streamlines vector selection and construction. One advantage of our platform is the use of the Csy-type (CRISPR system yersinia) ribonuclease 4 (Csy4) and tRNA processing enzymes to simultaneously express multiple guide RNAs (gRNAs). For example, we demonstrate targeted deletions in up to six genes by expressing 12 gRNAs from a single transcript. Csy4 and tRNA expression systems are almost twice as effective in inducing mutations as gRNAs expressed from individual RNA polymerase III promoters. Mutagenesis can be further enhanced 2.5-fold by incorporating the Trex2 exonuclease. Finally, we demonstrate that Cas9 nickases induce gene targeting at frequencies comparable to native Cas9 when they are delivered on geminivirus replicons. The reagents have been successfully validated in tomato (Solanum lycopersicum), tobacco (Nicotiana tabacum), Medicago truncatula, wheat (Triticum aestivum), and barley (Hordeum vulgare). PMID:28522548

  18. A multi-purpose toolkit to enable advanced genome engineering in plants

    DOE PAGES

    Cermak, Tomas; Curtin, Shaun J.; Gil-Humanes, Javier; ...

    2017-05-18

    Here, we report a comprehensive toolkit that enables targeted, specific modification of monocot and dicot genomes using a variety of genome engineering approaches. Our reagents, based on Transcription Activator-Like Effector Nucleases TALENs and the Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)/Cas9 system, are systematized for fast, modular cloning and accommodate diverse regulatory sequences to drive reagent expression. Vectors are optimized to create either single or multiple gene knockouts and large chromosomal deletions. Moreover, integration of geminivirus-based vectors enables precise gene editing through homologous recombination. Regulation of transcription is also possible. A web-based tool streamlines vector selection and construction. One advantagemore » of our platform is the use of the Csy-type (CRISPR system yersinia) ribonuclease 4 Csy4 and tRNA processing enzymes to simultaneously express multiple guide RNAs (gRNAs). For example, we demonstrate targeted deletions in up to six genes by expressing twelve gRNAs from a single transcript. Csy4 and tRNA expression systems are almost twice as effective in inducing mutations as gRNAs expressed from individual RNA polymerase III promoters. Mutagenesis can be further enhanced 2.5-fold by incorporating the Trex2 exonuclease. Finally, we demonstrate that Cas9 nickases induce gene targeting at frequencies comparable to native Cas9 when they are delivered on geminivirus replicons. The reagents have been successfully validated in tomato (Solanum lycopersicum), tobacco (Nicotiana tabacum), Medicago truncatula, wheat (Triticum aestivum), and barley (Hordeum vulgare).« less

  19. A multi-purpose toolkit to enable advanced genome engineering in plants

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cermak, Tomas; Curtin, Shaun J.; Gil-Humanes, Javier

    Here, we report a comprehensive toolkit that enables targeted, specific modification of monocot and dicot genomes using a variety of genome engineering approaches. Our reagents, based on Transcription Activator-Like Effector Nucleases TALENs and the Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)/Cas9 system, are systematized for fast, modular cloning and accommodate diverse regulatory sequences to drive reagent expression. Vectors are optimized to create either single or multiple gene knockouts and large chromosomal deletions. Moreover, integration of geminivirus-based vectors enables precise gene editing through homologous recombination. Regulation of transcription is also possible. A web-based tool streamlines vector selection and construction. One advantagemore » of our platform is the use of the Csy-type (CRISPR system yersinia) ribonuclease 4 Csy4 and tRNA processing enzymes to simultaneously express multiple guide RNAs (gRNAs). For example, we demonstrate targeted deletions in up to six genes by expressing twelve gRNAs from a single transcript. Csy4 and tRNA expression systems are almost twice as effective in inducing mutations as gRNAs expressed from individual RNA polymerase III promoters. Mutagenesis can be further enhanced 2.5-fold by incorporating the Trex2 exonuclease. Finally, we demonstrate that Cas9 nickases induce gene targeting at frequencies comparable to native Cas9 when they are delivered on geminivirus replicons. The reagents have been successfully validated in tomato (Solanum lycopersicum), tobacco (Nicotiana tabacum), Medicago truncatula, wheat (Triticum aestivum), and barley (Hordeum vulgare).« less

  20. Exploring the role of peptides in polymer-based gene delivery.

    PubMed

    Sun, Yanping; Yang, Zhen; Wang, Chunxi; Yang, Tianzhi; Cai, Cuifang; Zhao, Xiaoyun; Yang, Li; Ding, Pingtian

    2017-09-15

    Polymers are widely studied as non-viral gene vectors because of their strong DNA binding ability, capacity to carry large payload, flexibility of chemical modifications, low immunogenicity, and facile processes for manufacturing. However, high cytotoxicity and low transfection efficiency substantially restrict their application in clinical trials. Incorporating functional peptides is a promising approach to address these issues. Peptides demonstrate various functions in polymer-based gene delivery systems, such as targeting to specific cells, breaching membrane barriers, facilitating DNA condensation and release, and lowering cytotoxicity. In this review, we systematically summarize the role of peptides in polymer-based gene delivery, and elaborate how to rationally design polymer-peptide based gene delivery vectors. Polymers are widely studied as non-viral gene vectors, but suffer from high cytotoxicity and low transfection efficiency. Incorporating short, bioactive peptides into polymer-based gene delivery systems can address this issue. Peptides demonstrate various functions in polymer-based gene delivery systems, such as targeting to specific cells, breaching membrane barriers, facilitating DNA condensation and release, and lowering cytotoxicity. In this review, we highlight the peptides' roles in polymer-based gene delivery, and elaborate how to utilize various functional peptides to enhance the transfection efficiency of polymers. The optimized peptide-polymer vectors should be able to alter their structures and functions according to biological microenvironments and utilize inherent intracellular pathways of cells, and consequently overcome the barriers during gene delivery to enhance transfection efficiency. Copyright © 2017 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.

  1. Strategies for targeting primate neural circuits with viral vectors

    PubMed Central

    El-Shamayleh, Yasmine; Ni, Amy M.

    2016-01-01

    Understanding how the brain works requires understanding how different types of neurons contribute to circuit function and organism behavior. Progress on this front has been accelerated by optogenetics and chemogenetics, which provide an unprecedented level of control over distinct neuronal types in small animals. In primates, however, targeting specific types of neurons with these tools remains challenging. In this review, we discuss existing and emerging strategies for directing genetic manipulations to targeted neurons in the adult primate central nervous system. We review the literature on viral vectors for gene delivery to neurons, focusing on adeno-associated viral vectors and lentiviral vectors, their tropism for different cell types, and prospects for new variants with improved efficacy and selectivity. We discuss two projection targeting approaches for probing neural circuits: anterograde projection targeting and retrograde transport of viral vectors. We conclude with an analysis of cell type-specific promoters and other nucleotide sequences that can be used in viral vectors to target neuronal types at the transcriptional level. PMID:27052579

  2. Optimal control of malaria: combining vector interventions and drug therapies.

    PubMed

    Khamis, Doran; El Mouden, Claire; Kura, Klodeta; Bonsall, Michael B

    2018-04-24

    The sterile insect technique and transgenic equivalents are considered promising tools for controlling vector-borne disease in an age of increasing insecticide and drug-resistance. Combining vector interventions with artemisinin-based therapies may achieve the twin goals of suppressing malaria endemicity while managing artemisinin resistance. While the cost-effectiveness of these controls has been investigated independently, their combined usage has not been dynamically optimized in response to ecological and epidemiological processes. An optimal control framework based on coupled models of mosquito population dynamics and malaria epidemiology is used to investigate the cost-effectiveness of combining vector control with drug therapies in homogeneous environments with and without vector migration. The costs of endemic malaria are weighed against the costs of administering artemisinin therapies and releasing modified mosquitoes using various cost structures. Larval density dependence is shown to reduce the cost-effectiveness of conventional sterile insect releases compared with transgenic mosquitoes with a late-acting lethal gene. Using drug treatments can reduce the critical vector control release ratio necessary to cause disease fadeout. Combining vector control and drug therapies is the most effective and efficient use of resources, and using optimized implementation strategies can substantially reduce costs.

  3. Vector-model-supported optimization in volumetric-modulated arc stereotactic radiotherapy planning for brain metastasis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Liu, Eva Sau Fan; Department of Health Technology and Informatics, The Hong Kong Polytechnic University; Wu, Vincent Wing Cheung

    Long planning time in volumetric-modulated arc stereotactic radiotherapy (VMA-SRT) cases can limit its clinical efficiency and use. A vector model could retrieve previously successful radiotherapy cases that share various common anatomic features with the current case. The prsent study aimed to develop a vector model that could reduce planning time by applying the optimization parameters from those retrieved reference cases. Thirty-six VMA-SRT cases of brain metastasis (gender, male [n = 23], female [n = 13]; age range, 32 to 81 years old) were collected and used as a reference database. Another 10 VMA-SRT cases were planned with both conventional optimization and vector-model-supported optimization, followingmore » the oncologists' clinical dose prescriptions. Planning time and plan quality measures were compared using the 2-sided paired Wilcoxon signed rank test with a significance level of 0.05, with positive false discovery rate (pFDR) of less than 0.05. With vector-model-supported optimization, there was a significant reduction in the median planning time, a 40% reduction from 3.7 to 2.2 hours (p = 0.002, pFDR = 0.032), and for the number of iterations, a 30% reduction from 8.5 to 6.0 (p = 0.006, pFDR = 0.047). The quality of plans from both approaches was comparable. From these preliminary results, vector-model-supported optimization can expedite the optimization of VMA-SRT for brain metastasis while maintaining plan quality.« less

  4. A versatile targeting system with lentiviral vectors bearing the biotin-adaptor peptide

    PubMed Central

    Morizono, Kouki; Xie, Yiming; Helguera, Gustavo; Daniels, Tracy R.; Lane, Timothy F.; Penichet, Manuel L.; Chen, Irvin S. Y.

    2010-01-01

    Background Targeted gene transduction in vivo is the ultimate preferred method for gene delivery. We previously developed targeting lentiviral vectors that specifically recognize cell surface molecules with conjugated antibodies and mediate targeted gene transduction both in vitro and in vivo. Although effective in some experimental settings, the conjugation of virus with antibodies is mediated by the interaction between protein A and the Fc region of antibodies, which is not as stable as covalent conjugation. We have now developed a more stable conjugation strategy utilizing the interaction between avidin and biotin. Methods We inserted the biotin-adaptor-peptide, which was biotinylated by secretory biotin ligase at specific sites, into our targeting envelope proteins, enabling conjugation of the pseudotyped virus with avidin, streptavidin or neutravidin. Results When conjugated with avidin-antibody fusion proteins or the complex of avidin and biotinylated targeting molecules, the vectors could mediate specific transduction to targeted cells recognized by the targeting molecules. When conjugated with streptavidin-coated magnetic beads, transduction by the vectors was targeted to the locations of magnets. Conclusions This targeting vector system can be used for broad applications of targeted gene transduction using biotinylated targeting molecules or targeting molecules fused with avidin. PMID:19455593

  5. Determination of foodborne pathogenic bacteria by multiplex PCR-microchip capillary electrophoresis with genetic algorithm-support vector regression optimization.

    PubMed

    Li, Yongxin; Li, Yuanqian; Zheng, Bo; Qu, Lingli; Li, Can

    2009-06-08

    A rapid and sensitive method based on microchip capillary electrophoresis with condition optimization of genetic algorithm-support vector regression (GA-SVR) was developed and applied to simultaneous analysis of multiplex PCR products of four foodborne pathogenic bacteria. Four pairs of oligonucleotide primers were designed to exclusively amplify the targeted gene of Vibrio parahemolyticus, Salmonella, Escherichia coli (E. coli) O157:H7, Shigella and the quadruplex PCR parameters were optimized. At the same time, GA-SVR was employed to optimize the separation conditions of DNA fragments in microchip capillary electrophoresis. The proposed method was applied to simultaneously detect the multiplex PCR products of four foodborne pathogenic bacteria under the optimal conditions within 8 min. The levels of detection were as low as 1.2 x 10(2) CFU mL(-1) of Vibrio parahemolyticus, 2.9 x 10(2) CFU mL(-1) of Salmonella, 8.7 x 10(1) CFU mL(-1) of E. coli O157:H7 and 5.2 x 10(1) CFU mL(-1) of Shigella, respectively. The relative standard deviation of migration time was in the range of 0.74-2.09%. The results demonstrated that the good resolution and less analytical time were achieved due to the application of the multivariate strategy. This study offers an efficient alternative to routine foodborne pathogenic bacteria detection in a fast, reliable, and sensitive way.

  6. Peptide-Based Technologies to Alter Adenoviral Vector Tropism: Ways and Means for Systemic Treatment of Cancer

    PubMed Central

    Reetz, Julia; Herchenröder, Ottmar; Pützer, Brigitte M.

    2014-01-01

    Due to the fundamental progress in elucidating the molecular mechanisms of human diseases and the arrival of the post-genomic era, increasing numbers of therapeutic genes and cellular targets are available for gene therapy. Meanwhile, the most important challenge is to develop gene delivery vectors with high efficiency through target cell selectivity, in particular under in situ conditions. The most widely used vector system to transduce cells is based on adenovirus (Ad). Recent endeavors in the development of selective Ad vectors that target cells or tissues of interest and spare the alteration of all others have focused on the modification of the virus broad natural tropism. A popular way of Ad targeting is achieved by directing the vector towards distinct cellular receptors. Redirecting can be accomplished by linking custom-made peptides with specific affinity to cellular surface proteins via genetic integration, chemical coupling or bridging with dual-specific adapter molecules. Ideally, targeted vectors are incapable of entering cells via their native receptors. Such altered vectors offer new opportunities to delineate functional genomics in a natural environment and may enable efficient systemic therapeutic approaches. This review provides a summary of current state-of-the-art techniques to specifically target adenovirus-based gene delivery vectors. PMID:24699364

  7. Phenotyping of VIGS-mediated gene silencing in rice using a vector derived from a DNA virus.

    PubMed

    Kant, Ravi; Dasgupta, Indranil

    2017-07-01

    Target genes in rice can be optimally silenced if inserted in antisense or hairpin orientation in the RTBV-derived VIGS vector and plants grown at 28 °C and 80% humidity after inoculation. Virus induced gene silencing (VIGS) is a method used to transiently silence genes in dicot as well as monocot plants. For the important monocot species rice, the Rice tungro bacilliform virus (RTBV)-derived VIGS system (RTBV-VIGS), which uses agroinoculation to initiate silencing, has not been standardized for optimal use. Here, using RTBV-VIGS, three sets of conditions were tested to achieve optimal silencing of the rice marker gene phytoene desaturase (pds). The effect of orientation of the insert in the RTBV-VIGS plasmid (sense, antisense and hairpin) on the silencing of the target gene was then evaluated using rice magnesium chelatase subunit H (chlH). Finally, the rice Xa21 gene, conferring resistance against bacterial leaf blight disease (BLB) was silenced using RTBV-VIGS system. In each case, real-time PCR-based assessment indicated approximately 40-80% fall in the accumulation levels of the transcripts of pds, chlH and Xa21. In the case of pds, the appearance of white streaks in the emerging leaves, and for chlH, chlorophyll levels and F v /F m ratio were assessed as phenotypes for silencing. For Xa21, the resistance levels to BLB were assessed by measuring the lesion length and the percent diseased areas of leaves, following challenge inoculation with Xanthomonas oryzae. In each case, the RTBV-MVIGS system gave rise to a discernible phenotype indicating the silencing of the respective target gene using condition III (temperature 28 °C, humidity 80% and 1 mM MES and 20 µM acetosyringone in secondary agrobacterium culture), which revealed the robustness of this gene silencing system for rice.

  8. Bacteriophage-Derived Vectors for Targeted Cancer Gene Therapy

    PubMed Central

    Pranjol, Md Zahidul Islam; Hajitou, Amin

    2015-01-01

    Cancer gene therapy expanded and reached its pinnacle in research in the last decade. Both viral and non-viral vectors have entered clinical trials, and significant successes have been achieved. However, a systemic administration of a vector, illustrating safe, efficient, and targeted gene delivery to solid tumors has proven to be a major challenge. In this review, we summarize the current progress and challenges in the targeted gene therapy of cancer. Moreover, we highlight the recent developments of bacteriophage-derived vectors and their contributions in targeting cancer with therapeutic genes following systemic administration. PMID:25606974

  9. Bacteriophage-derived vectors for targeted cancer gene therapy.

    PubMed

    Pranjol, Md Zahidul Islam; Hajitou, Amin

    2015-01-19

    Cancer gene therapy expanded and reached its pinnacle in research in the last decade. Both viral and non-viral vectors have entered clinical trials, and significant successes have been achieved. However, a systemic administration of a vector, illustrating safe, efficient, and targeted gene delivery to solid tumors has proven to be a major challenge. In this review, we summarize the current progress and challenges in the targeted gene therapy of cancer. Moreover, we highlight the recent developments of bacteriophage-derived vectors and their contributions in targeting cancer with therapeutic genes following systemic administration.

  10. Insertion of targeting domains into the envelope glycoprotein of Moloney murine leukemia virus (MoMLV)-based vectors modulates the route of mCAT-1-mediated viral entry.

    PubMed

    Viejo-Borbolla, A; Pizzato, M; Blair, E D; Schulz, T F

    2005-03-01

    Several groups have inserted targeting domains into the envelope glycoprotein (Env) of Moloney murine leukemia virus (MoMLV) in an attempt to produce targeted retroviral vectors for human gene therapy. While binding of these modified Envs to the target molecule expressed on the surface of human cells was observed, specific high-titer infection of human cells expressing the target molecule was not achieved. Here we investigate the initial steps in the entry process of targeted MoMLV vectors both in murine and human cells expressing the MoMLV receptor, the mouse cationic amino acid transporter-1 (mCAT-1). We show that insertion of a small ligand targeted to E-selectin and of a single chain antibody (scFv) targeted to folate-binding protein (FBP) into the N-terminus of MoMLV Env results in the reduction of the infectivity and the kinetics of entry of the MoMLV vectors. The use of soluble receptor-binding domain (sRBD), bafilomycin A1 (BafA1) and methyl-beta-cyclodextrin (MbetaC) increase the infectivity of the MoMLV vectors targeted to FBP (MoMLV-FBP) suggesting that the scFv targeted to FBP increases the threshold for fusion and might re-route entry of the targeted MoMLV-FBP vector towards an endocytic, non-productive pathway.

  11. Evaluation of the concentration and bioactivity of adenovirus vectors for gene therapy.

    PubMed Central

    Mittereder, N; March, K L; Trapnell, B C

    1996-01-01

    Development of adenovirus vectors as potential therapeutic agents for multiple applications of in vivo human gene therapy has resulted in numerous preclinical and clinical studies. However, lack of standardization of the methods for quantifying the physical concentration and functionally active fraction of virions in these studies has often made comparison between various studies difficult or impossible. This study was therefore carried out to define the variables for quantification of the concentration of adenovirus vectors. The methods for evaluation of total virion concentration included electron microscopy and optical absorbance. The methods for evaluation of the concentration of functional virions included detection of gene transfer (transgene transfer and expression) and the plaque assay on 293 cells. Enumeration of total virion concentration by optical absorbance was found to be a precise procedure, but accuracy was dependent on physical disruption of the virion to eliminate artifacts from light scattering and also on a correct value for the extinction coefficient. Both biological assays for enumerating functional virions were highly dependent on the assay conditions and in particular the time of virion adsorption and adsorption volume. Under optimal conditions, the bioactivity of the vector, defined as the fraction of total virions which leads to detected target cell infection, was determined to be 0.10 in the plaque assay and 0.29 in the gene transfer assay. This difference is most likely due to the fact that detection by gene transfer requires only measurement of levels of transgene expression in the infected cell whereas plaque formation is dependent on a series of biological events of much greater complexity. These results show that the exact conditions for determination of infectious virion concentration and bioactivity of recombinant adenovirus vectors are critical and must be standardized for comparability. These observations may be very useful in comparison of data from different preclinical and clinical studies and may also have important implications for how adenovirus vectors can optimally be used in human gene therapy. PMID:8892868

  12. Adenoviral Vector Immunity: Its Implications and circumvention strategies

    PubMed Central

    Ahi, Yadvinder S.; Bangari, Dinesh S.; Mittal, Suresh K.

    2014-01-01

    Adenoviral (Ad) vectors have emerged as a promising gene delivery platform for a variety of therapeutic and vaccine purposes during last two decades. However, the presence of preexisting Ad immunity and the rapid development of Ad vector immunity still pose significant challenges to the clinical use of these vectors. Innate inflammatory response following Ad vector administration may lead to systemic toxicity, drastically limit vector transduction efficiency and significantly abbreviate the duration of transgene expression. Currently, a number of approaches are being extensively pursued to overcome these drawbacks by strategies that target either the host or the Ad vector. In addition, significant progress has been made in the development of novel Ad vectors based on less prevalent human Ad serotypes and nonhuman Ad. This review provides an update on our current understanding of immune responses to Ad vectors and delineates various approaches for eluding Ad vector immunity. Approaches targeting the host and those targeting the vector are discussed in light of their promises and limitations. PMID:21453277

  13. Self-focusing therapeutic gene delivery with intelligent gene vector swarms: intra-swarm signalling through receptor transgene expression in targeted cells.

    PubMed

    Tolmachov, Oleg E

    2015-01-01

    Gene delivery in vivo that is tightly focused on the intended target cells is essential to maximize the benefits of gene therapy and to reduce unwanted side-effects. Cell surface markers are immediately available for probing by therapeutic gene vectors and are often used to direct gene transfer with these vectors to specific target cell populations. However, it is not unusual for the choice of available extra-cellular markers to be too scarce to provide a reliable definition of the desired therapeutically relevant set of target cells. Therefore, interrogation of intra-cellular determinants of cell-specificity, such as tissue-specific transcription factors, can be vital in order to provide detailed cell-guiding information to gene vector particles. An important improvement in cell-specific gene delivery can be achieved through auto-buildup in vector homing efficiency using intelligent 'self-focusing' of swarms of vector particles on target cells. Vector self-focusing was previously suggested to rely on the release of diffusible chemo-attractants after a successful target-specific hit by 'scout' vector particles. I hypothesize that intelligent self-focusing behaviour of swarms of cell-targeted therapeutic gene vectors can be accomplished without the employment of difficult-to-use diffusible chemo-attractants, instead relying on the intra-swarm signalling through cells expressing a non-diffusible extra-cellular receptor for the gene vectors. In the proposed model, cell-guiding information is gathered by the 'scout' gene vector particles, which: (1) attach to a variety of cells via a weakly binding (low affinity) receptor; (2) successfully facilitate gene transfer into these cells; (3) query intra-cellular determinants of cell-specificity with their transgene expression control elements and (4) direct the cell-specific biosynthesis of a vector-encoded strongly binding (high affinity) cell-surface receptor. Free members of the vector swarm loaded with therapeutic cargo are then attracted to and internalized into the intended target cells via the expressed cognate strongly binding extra-cellular receptor, causing escalation of gene transfer into these cells and increasing the copy number of the therapeutic gene expression modules. Such self-focusing swarms of gene vectors can be either homogeneous, with 'scout' and 'therapeutic' members of the swarm being structurally identical, or, alternatively, heterogeneous (split), with 'scout' and 'therapeutic' members of the swarm being structurally specialized. It is hoped that the proposed self-focusing cell-targeted gene vector swarms with receptor-mediated intra-swarm signalling could be particularly effective in 'top-up' gene delivery scenarios, achieving high-level and sustained expression of therapeutic transgenes that are prone to shut-down through degradation and silencing. Crucially, in contrast to low-precision 'general location' vector guidance by diffusible chemo-attractants, ear-marking non-diffusible receptors can provide high-accuracy targeting of therapeutic vector particles to the specific cell, which has undergone a 'successful cell-specific hit' by a 'scout' vector particle. Opportunities for cell targeting could be expanded, since in the proposed model of self-focusing it could be possible to probe a broad selection of intra-cellular determinants of cell-specificity and not just to rely exclusively on extra-cellular markers of cell-specificity. By employing such self-focusing gene vectors for the improvement of cell-targeted delivery of therapeutic genes, e.g., in cancer therapy or gene addition therapy of recessive genetic diseases, it could be possible to broaden a leeway for the reduction of the vector load and, consequently, to minimize undesired vector cytotoxicity, immune reactions, and the risk of inadvertent genetic modification of germline cells in genetic treatment in vivo. Copyright © 2014 Elsevier B.V. All rights reserved.

  14. Independent and high-level dual-gene expression in adult stem-progenitor cells from a single lentiviral vector.

    PubMed

    Tian, J; Andreadis, S T

    2009-07-01

    Expression of multiple genes from the same target cell is required in several technological and therapeutic applications such as quantitative measurements of promoter activity or in vivo tracking of stem cells. In spite of such need, reaching independent and high-level dual-gene expression cannot be reliably accomplished by current gene transfer vehicles. To address this issue, we designed a lentiviral vector carrying two transcriptional units separated by polyadenylation, terminator and insulator sequences. With this design, the expression level of both genes was as high as that yielded from lentiviral vectors containing only a single transcriptional unit. Similar results were observed with several promoters and cell types including epidermal keratinocytes, bone marrow mesenchymal stem cells and hair follicle stem cells. Notably, we demonstrated quantitative dynamic monitoring of gene expression in primary cells with no need for selection protocols suggesting that this optimized lentivirus may be useful in high-throughput gene expression profiling studies.

  15. Vector-borne disease intelligence: strategies to deal with disease burden and threats.

    PubMed

    Braks, Marieta; Medlock, Jolyon M; Hubalek, Zdenek; Hjertqvist, Marika; Perrin, Yvon; Lancelot, Renaud; Duchyene, Els; Hendrickx, Guy; Stroo, Arjan; Heyman, Paul; Sprong, Hein

    2014-01-01

    Owing to the complex nature of vector-borne diseases (VBDs), whereby monitoring of human case patients does not suffice, public health authorities experience challenges in surveillance and control of VBDs. Knowledge on the presence and distribution of vectors and the pathogens that they transmit is vital to the risk assessment process to permit effective early warning, surveillance, and control of VBDs. Upon accepting this reality, public health authorities face an ever-increasing range of possible surveillance targets and an associated prioritization process. Here, we propose a comprehensive approach that integrates three surveillance strategies: population-based surveillance, disease-based surveillance, and context-based surveillance for EU member states to tailor the best surveillance strategy for control of VBDs in their geographic region. By classifying the surveillance structure into five different contexts, we hope to provide guidance in optimizing surveillance efforts. Contextual surveillance strategies for VBDs entail combining organization and data collection approaches that result in disease intelligence rather than a preset static structure.

  16. Vector-Borne Disease Intelligence: Strategies to Deal with Disease Burden and Threats

    PubMed Central

    Braks, Marieta; Medlock, Jolyon M.; Hubalek, Zdenek; Hjertqvist, Marika; Perrin, Yvon; Lancelot, Renaud; Duchyene, Els; Hendrickx, Guy; Stroo, Arjan; Heyman, Paul; Sprong, Hein

    2014-01-01

    Owing to the complex nature of vector-borne diseases (VBDs), whereby monitoring of human case patients does not suffice, public health authorities experience challenges in surveillance and control of VBDs. Knowledge on the presence and distribution of vectors and the pathogens that they transmit is vital to the risk assessment process to permit effective early warning, surveillance, and control of VBDs. Upon accepting this reality, public health authorities face an ever-increasing range of possible surveillance targets and an associated prioritization process. Here, we propose a comprehensive approach that integrates three surveillance strategies: population-based surveillance, disease-based surveillance, and context-based surveillance for EU member states to tailor the best surveillance strategy for control of VBDs in their geographic region. By classifying the surveillance structure into five different contexts, we hope to provide guidance in optimizing surveillance efforts. Contextual surveillance strategies for VBDs entail combining organization and data collection approaches that result in disease intelligence rather than a preset static structure. PMID:25566522

  17. Effective reduction of the interleukin-1β transcript in osteoarthritis-prone guinea pig chondrocytes via short hairpin RNA mediated RNA interference influences gene expression of mediators implicated in disease pathogenesis

    PubMed Central

    Santangeloyz, K.S.; Bertoneyz, A.L.

    2011-01-01

    summary Objective To ascertain a viral vector-based short hairpin RNA (shRNA) capable of reducing the interleukin-1β (IL-1β) transcript in osteoarthritis (OA)-prone chondrocytes and detect corresponding changes in the expression patterns of several critical disease mediators. Methods Cultured chondrocytes from 2-month-old Hartley guinea pigs were screened for reduction of the IL-1β transcript following plasmid-based delivery of U6-driven shRNA sequences. A successful plasmid/shRNA knockdown combination was identified and used to construct an adeno-associated virus serotype 5 (AAV5) vector for further evaluation. Relative real-time reverse transcription polymerase chain reaction (RTPCR) was used to quantify in vitro transcript changes of IL-1β and an additional nine genes following transduction with this targeting knockdown vector. To validate in vitro findings, this AAV5 vector was injected into one knee, while either an equivalent volume of saline vehicle (three animals) or non-targeting control vector (three animals) were injected into opposite knees. Fold differences and subsequent percent gene expression levels relative to control groups were calculated using the comparative CT (2−ΔΔCT) method. Results Statistically significant decreases in IL-1β expression were achieved by the targeting knockdown vector relative to both the mock-transduced control and non-targeting vector control groups in vitro. Transcript levels of anabolic transforming growth factor-β (TGF-β) were significantly increased by use of this targeting knockdown vector. Transduction with this targeting AAV5 vector also significantly decreased the transcript levels of key inflammatory cytokines [tumor necrosis factor-α (TNF-α), IL-2, IL-8, and IL-12] and catabolic agents [matrix metalloproteinase (MMP)13, MMP2, interferon-γ (IFN-γ), and inducible nitrous oxide synthase (iNOS)] relative to both mock-transduced and non-targeting vector control groups. In vivo application of this targeting knockdown vector resulted in a >50% reduction (P= 0.0045) or >90% (P= 0.0001) of the IL-1β transcript relative to vehicle-only or non-targeting vector control exposed cartilage, respectively. Conclusions Successful reduction of the IL-1β transcript was achieved via RNA interference (RNAi) techniques. Importantly, this alteration significantly influenced the transcript levels of several major players involved in OA pathogenesis in the direction of disease modification. Investigations to characterize additional gene expression changes influenced by targeting knockdown AAV5 vector-based diminution of the IL-1β transcript in vivo are warranted. PMID:21945742

  18. Stochastic optimal control as non-equilibrium statistical mechanics: calculus of variations over density and current

    NASA Astrophysics Data System (ADS)

    Chernyak, Vladimir Y.; Chertkov, Michael; Bierkens, Joris; Kappen, Hilbert J.

    2014-01-01

    In stochastic optimal control (SOC) one minimizes the average cost-to-go, that consists of the cost-of-control (amount of efforts), cost-of-space (where one wants the system to be) and the target cost (where one wants the system to arrive), for a system participating in forced and controlled Langevin dynamics. We extend the SOC problem by introducing an additional cost-of-dynamics, characterized by a vector potential. We propose derivation of the generalized gauge-invariant Hamilton-Jacobi-Bellman equation as a variation over density and current, suggest hydrodynamic interpretation and discuss examples, e.g., ergodic control of a particle-within-a-circle, illustrating non-equilibrium space-time complexity.

  19. Effect of handling characteristics on minimum time cornering with torque vectoring

    NASA Astrophysics Data System (ADS)

    Smith, E. N.; Velenis, E.; Tavernini, D.; Cao, D.

    2018-02-01

    In this paper, the effect of both passive and actively-modified vehicle handling characteristics on minimum time manoeuvring for vehicles with 4-wheel torque vectoring (TV) capability is studied. First, a baseline optimal TV strategy is sought, independent of any causal control law. An optimal control problem (OCP) is initially formulated considering 4 independent wheel torque inputs, together with the steering angle rate, as the control variables. Using this formulation, the performance benefit using TV against an electric drive train with a fixed torque distribution, is demonstrated. The sensitivity of TV-controlled manoeuvre time to the passive understeer gradient of the vehicle is then studied. A second formulation of the OCP is introduced where a closed-loop TV controller is incorporated into the system dynamics of the OCP. This formulation allows the effect of actively modifying a vehicle's handling characteristic via TV on its minimum time cornering performance of the vehicle to be assessed. In particular, the effect of the target understeer gradient as the key tuning parameter of the literature-standard steady-state linear single-track model yaw rate reference is analysed.

  20. Targeted Knock-Down of miR21 Primary Transcripts Using snoMEN Vectors Induces Apoptosis in Human Cancer Cell Lines.

    PubMed

    Ono, Motoharu; Yamada, Kayo; Avolio, Fabio; Afzal, Vackar; Bensaddek, Dalila; Lamond, Angus I

    2015-01-01

    We have previously reported an antisense technology, 'snoMEN vectors', for targeted knock-down of protein coding mRNAs using human snoRNAs manipulated to contain short regions of sequence complementarity with the mRNA target. Here we characterise the use of snoMEN vectors to target the knock-down of micro RNA primary transcripts. We document the specific knock-down of miR21 in HeLa cells using plasmid vectors expressing miR21-targeted snoMEN RNAs and show this induces apoptosis. Knock-down is dependent on the presence of complementary sequences in the snoMEN vector and the induction of apoptosis can be suppressed by over-expression of miR21. Furthermore, we have also developed lentiviral vectors for delivery of snoMEN RNAs and show this increases the efficiency of vector transduction in many human cell lines that are difficult to transfect with plasmid vectors. Transduction of lentiviral vectors expressing snoMEN targeted to pri-miR21 induces apoptosis in human lung adenocarcinoma cells, which express high levels of miR21, but not in human primary cells. We show that snoMEN-mediated suppression of miRNA expression is prevented by siRNA knock-down of Ago2, but not by knock-down of Ago1 or Upf1. snoMEN RNAs colocalise with Ago2 in cell nuclei and nucleoli and can be co-immunoprecipitated from nuclear extracts by antibodies specific for Ago2.

  1. More complete gene silencing by fewer siRNAs: transparent optimized design and biophysical signature

    PubMed Central

    Ladunga, Istvan

    2007-01-01

    Highly accurate knockdown functional analyses based on RNA interference (RNAi) require the possible most complete hydrolysis of the targeted mRNA while avoiding the degradation of untargeted genes (off-target effects). This in turn requires significant improvements to target selection for two reasons. First, the average silencing activity of randomly selected siRNAs is as low as 62%. Second, applying more than five different siRNAs may lead to saturation of the RNA-induced silencing complex (RISC) and to the degradation of untargeted genes. Therefore, selecting a small number of highly active siRNAs is critical for maximizing knockdown and minimizing off-target effects. To satisfy these needs, a publicly available and transparent machine learning tool is presented that ranks all possible siRNAs for each targeted gene. Support vector machines (SVMs) with polynomial kernels and constrained optimization models select and utilize the most predictive effective combinations from 572 sequence, thermodynamic, accessibility and self-hairpin features over 2200 published siRNAs. This tool reaches an accuracy of 92.3% in cross-validation experiments. We fully present the underlying biophysical signature that involves free energy, accessibility and dinucleotide characteristics. We show that while complete silencing is possible at certain structured target sites, accessibility information improves the prediction of the 90% active siRNA target sites. Fast siRNA activity predictions can be performed on our web server at . PMID:17169992

  2. Determining on-fault earthquake magnitude distributions from integer programming

    NASA Astrophysics Data System (ADS)

    Geist, Eric L.; Parsons, Tom

    2018-02-01

    Earthquake magnitude distributions among faults within a fault system are determined from regional seismicity and fault slip rates using binary integer programming. A synthetic earthquake catalog (i.e., list of randomly sampled magnitudes) that spans millennia is first formed, assuming that regional seismicity follows a Gutenberg-Richter relation. Each earthquake in the synthetic catalog can occur on any fault and at any location. The objective is to minimize misfits in the target slip rate for each fault, where slip for each earthquake is scaled from its magnitude. The decision vector consists of binary variables indicating which locations are optimal among all possibilities. Uncertainty estimates in fault slip rates provide explicit upper and lower bounding constraints to the problem. An implicit constraint is that an earthquake can only be located on a fault if it is long enough to contain that earthquake. A general mixed-integer programming solver, consisting of a number of different algorithms, is used to determine the optimal decision vector. A case study is presented for the State of California, where a 4 kyr synthetic earthquake catalog is created and faults with slip ≥3 mm/yr are considered, resulting in >106 variables. The optimal magnitude distributions for each of the faults in the system span a rich diversity of shapes, ranging from characteristic to power-law distributions.

  3. Lentiviral gene ontology (LeGO) vectors equipped with novel drug-selectable fluorescent proteins: new building blocks for cell marking and multi-gene analysis.

    PubMed

    Weber, K; Mock, U; Petrowitz, B; Bartsch, U; Fehse, B

    2010-04-01

    Vector-encoded fluorescent proteins (FPs) facilitate unambiguous identification or sorting of gene-modified cells by fluorescence-activated cell sorting (FACS). Exploiting this feature, we have recently developed lentiviral gene ontology (LeGO) vectors (www.LentiGO-Vectors.de) for multi-gene analysis in different target cells. In this study, we extend the LeGO principle by introducing 10 different drug-selectable FPs created by fusing one of the five selection marker (protecting against blasticidin, hygromycin, neomycin, puromycin and zeocin) and one of the five FP genes (Cerulean, eGFP, Venus, dTomato and mCherry). All tested fusion proteins allowed both fluorescence-mediated detection and drug-mediated selection of LeGO-transduced cells. Newly generated codon-optimized hygromycin- and neomycin-resistance genes showed improved expression as compared with their ancestors. New LeGO constructs were produced at titers >10(6) per ml (for non-concentrated supernatants). We show efficient combinatorial marking and selection of various cells, including mesenchymal stem cells, simultaneously transduced with different LeGO constructs. Inclusion of the cytomegalovirus early enhancer/chicken beta-actin promoter into LeGO vectors facilitated robust transgene expression in and selection of neural stem cells and their differentiated progeny. We suppose that the new drug-selectable markers combining advantages of FACS and drug selection are well suited for numerous applications and vector systems. Their inclusion into LeGO vectors opens new possibilities for (stem) cell tracking and functional multi-gene analysis.

  4. Crysalis: an integrated server for computational analysis and design of protein crystallization.

    PubMed

    Wang, Huilin; Feng, Liubin; Zhang, Ziding; Webb, Geoffrey I; Lin, Donghai; Song, Jiangning

    2016-02-24

    The failure of multi-step experimental procedures to yield diffraction-quality crystals is a major bottleneck in protein structure determination. Accordingly, several bioinformatics methods have been successfully developed and employed to select crystallizable proteins. Unfortunately, the majority of existing in silico methods only allow the prediction of crystallization propensity, seldom enabling computational design of protein mutants that can be targeted for enhancing protein crystallizability. Here, we present Crysalis, an integrated crystallization analysis tool that builds on support-vector regression (SVR) models to facilitate computational protein crystallization prediction, analysis, and design. More specifically, the functionality of this new tool includes: (1) rapid selection of target crystallizable proteins at the proteome level, (2) identification of site non-optimality for protein crystallization and systematic analysis of all potential single-point mutations that might enhance protein crystallization propensity, and (3) annotation of target protein based on predicted structural properties. We applied the design mode of Crysalis to identify site non-optimality for protein crystallization on a proteome-scale, focusing on proteins currently classified as non-crystallizable. Our results revealed that site non-optimality is based on biases related to residues, predicted structures, physicochemical properties, and sequence loci, which provides in-depth understanding of the features influencing protein crystallization. Crysalis is freely available at http://nmrcen.xmu.edu.cn/crysalis/.

  5. Crysalis: an integrated server for computational analysis and design of protein crystallization

    PubMed Central

    Wang, Huilin; Feng, Liubin; Zhang, Ziding; Webb, Geoffrey I.; Lin, Donghai; Song, Jiangning

    2016-01-01

    The failure of multi-step experimental procedures to yield diffraction-quality crystals is a major bottleneck in protein structure determination. Accordingly, several bioinformatics methods have been successfully developed and employed to select crystallizable proteins. Unfortunately, the majority of existing in silico methods only allow the prediction of crystallization propensity, seldom enabling computational design of protein mutants that can be targeted for enhancing protein crystallizability. Here, we present Crysalis, an integrated crystallization analysis tool that builds on support-vector regression (SVR) models to facilitate computational protein crystallization prediction, analysis, and design. More specifically, the functionality of this new tool includes: (1) rapid selection of target crystallizable proteins at the proteome level, (2) identification of site non-optimality for protein crystallization and systematic analysis of all potential single-point mutations that might enhance protein crystallization propensity, and (3) annotation of target protein based on predicted structural properties. We applied the design mode of Crysalis to identify site non-optimality for protein crystallization on a proteome-scale, focusing on proteins currently classified as non-crystallizable. Our results revealed that site non-optimality is based on biases related to residues, predicted structures, physicochemical properties, and sequence loci, which provides in-depth understanding of the features influencing protein crystallization. Crysalis is freely available at http://nmrcen.xmu.edu.cn/crysalis/. PMID:26906024

  6. Optimal Orbital Coverage of Theater Operations and Targets

    DTIC Science & Technology

    2007-03-01

    3.18). (3.18) 1.000140612 .016708617cos( ) .000139589cos(2 )r M= − − M The obliquity of the ecliptic (ε ) was determined using equation (3.19...estimated using equation (3.16). UT1357.5277233 35999.05034M T= + o (3.16) The ecliptic longitude ( eclipticλ ) was determined using equation (3.17...1.914666471 sin( ) .019994643sin(2 ) ecliptic M Mλ λ= + + o M (3.17) The magnitude of the position vector to the sun was solved for using equation

  7. Optimization of a one-step heat-inducible in vivo mini DNA vector production system.

    PubMed

    Nafissi, Nafiseh; Sum, Chi Hong; Wettig, Shawn; Slavcev, Roderick A

    2014-01-01

    While safer than their viral counterparts, conventional circular covalently closed (CCC) plasmid DNA vectors offer a limited safety profile. They often result in the transfer of unwanted prokaryotic sequences, antibiotic resistance genes, and bacterial origins of replication that may lead to unwanted immunostimulatory responses. Furthermore, such vectors may impart the potential for chromosomal integration, thus potentiating oncogenesis. Linear covalently closed (LCC), bacterial sequence free DNA vectors have shown promising clinical improvements in vitro and in vivo. However, the generation of such minivectors has been limited by in vitro enzymatic reactions hindering their downstream application in clinical trials. We previously characterized an in vivo temperature-inducible expression system, governed by the phage λ pL promoter and regulated by the thermolabile λ CI[Ts]857 repressor to produce recombinant protelomerase enzymes in E. coli. In this expression system, induction of recombinant protelomerase was achieved by increasing culture temperature above the 37°C threshold temperature. Overexpression of protelomerase led to enzymatic reactions, acting on genetically engineered multi-target sites called "Super Sequences" that serve to convert conventional CCC plasmid DNA into LCC DNA minivectors. Temperature up-shift, however, can result in intracellular stress responses and may alter plasmid replication rates; both of which may be detrimental to LCC minivector production. We sought to optimize our one-step in vivo DNA minivector production system under various induction schedules in combination with genetic modifications influencing plasmid replication, processing rates, and cellular heat stress responses. We assessed different culture growth techniques, growth media compositions, heat induction scheduling and temperature, induction duration, post-induction temperature, and E. coli genetic background to improve the productivity and scalability of our system, achieving an overall LCC DNA minivector production efficiency of ∼ 90%.We optimized a robust technology conferring rapid, scalable, one-step in vivo production of LCC DNA minivectors with potential application to gene transfer-mediated therapeutics.

  8. Optimization of a One-Step Heat-Inducible In Vivo Mini DNA Vector Production System

    PubMed Central

    Wettig, Shawn; Slavcev, Roderick A.

    2014-01-01

    While safer than their viral counterparts, conventional circular covalently closed (CCC) plasmid DNA vectors offer a limited safety profile. They often result in the transfer of unwanted prokaryotic sequences, antibiotic resistance genes, and bacterial origins of replication that may lead to unwanted immunostimulatory responses. Furthermore, such vectors may impart the potential for chromosomal integration, thus potentiating oncogenesis. Linear covalently closed (LCC), bacterial sequence free DNA vectors have shown promising clinical improvements in vitro and in vivo. However, the generation of such minivectors has been limited by in vitro enzymatic reactions hindering their downstream application in clinical trials. We previously characterized an in vivo temperature-inducible expression system, governed by the phage λ pL promoter and regulated by the thermolabile λ CI[Ts]857 repressor to produce recombinant protelomerase enzymes in E. coli. In this expression system, induction of recombinant protelomerase was achieved by increasing culture temperature above the 37°C threshold temperature. Overexpression of protelomerase led to enzymatic reactions, acting on genetically engineered multi-target sites called “Super Sequences” that serve to convert conventional CCC plasmid DNA into LCC DNA minivectors. Temperature up-shift, however, can result in intracellular stress responses and may alter plasmid replication rates; both of which may be detrimental to LCC minivector production. We sought to optimize our one-step in vivo DNA minivector production system under various induction schedules in combination with genetic modifications influencing plasmid replication, processing rates, and cellular heat stress responses. We assessed different culture growth techniques, growth media compositions, heat induction scheduling and temperature, induction duration, post-induction temperature, and E. coli genetic background to improve the productivity and scalability of our system, achieving an overall LCC DNA minivector production efficiency of ∼90%.We optimized a robust technology conferring rapid, scalable, one-step in vivo production of LCC DNA minivectors with potential application to gene transfer-mediated therapeutics. PMID:24586704

  9. Development of renal-targeted vectors through combined in vivo phage display and capsid engineering of adenoviral fibers from serotype 19p.

    PubMed

    Denby, Laura; Work, Lorraine M; Seggern, Dan J Von; Wu, Eugene; McVey, John H; Nicklin, Stuart A; Baker, Andrew H

    2007-09-01

    The potential efficacy of gene delivery is dictated by the infectivity profile of existing vectors, which is often restrictive. In order to target cells and organs for which no efficient vector is currently available, a promising approach would be to engineer vectors with novel transduction profiles. Applications that involve injecting adenovirus (Ad) vectors into the bloodstream require that native tropism for the liver be removed, and that targeting moieties be engineered into the capsid. We previously reported that pseudotyping the Ad serotype 5 fiber for that of Ad19p results in reduced hepatic transduction. In this study we show that this may be caused, at least in part, by a reduction in the capacity of the Ad19p-based virus to bind blood coagulation factors. It is therefore a potential candidate for vector retargeting, focusing on the kidney as a therapeutic target. We used in vivo phage display in rats, and identified peptides HTTHREP and HITSLLS that homed to the kidneys following intravenous injection. We engineered the HI loop of Ad19p to accommodate peptide insertions and clones. Intravenous delivery of each peptide-modified virus resulted in selective renal targeting, with HTTHREP and HITSLLS-targeted viruses selectively transducing tubular epithelium and glomeruli, respectively. Our study has important implications for the use of genetic engineering of Ad fibers to produce targeted gene delivery vectors.

  10. Estimating dengue vector abundance in the wet and dry season: implications for targeted vector control in urban and peri-urban Asia

    PubMed Central

    Wai, Khin Thet; Arunachalam, Natarajan; Tana, Susilowati; Espino, Fe; Kittayapong, Pattamaporn; Abeyewickreme, W; Hapangama, Dilini; Tyagi, Brij Kishore; Htun, Pe Than; Koyadun, Surachart; Kroeger, Axel; Sommerfeld, Johannes; Petzold, Max

    2012-01-01

    Background Research has shown that the classical Stegomyia indices (or “larval indices”) of the dengue vector Aedes aegypti reflect the absence or presence of the vector but do not provide accurate measures of adult mosquito density. In contrast, pupal indices as collected in pupal productivity surveys are a much better proxy indicator for adult vector abundance. However, it is unknown when it is most optimal to conduct pupal productivity surveys, in the wet or in the dry season or in both, to inform control services about the most productive water container types and if this pattern varies among different ecological settings. Methods A multi-country study in randomly selected twelve to twenty urban and peri-urban neighborhoods (“clusters”) of six Asian countries, in which all water holding containers were examined for larvae and pupae of Aedes aegypti during the dry season and the wet season and their productivity was characterized by water container types. In addition, meteorological data and information on reported dengue cases were collected. Findings The study reconfirmed the association between rainfall and dengue cases (“dengue season”) and underlined the importance of determining through pupal productivity surveys the “most productive containers types”, responsible for the majority (>70%) of adult dengue vectors. The variety of productive container types was greater during the wet than during the dry season, but included practically all container types productive in the dry season. Container types producing pupae were usually different from those infested by larvae indicating that containers with larval infestations do not necessarily foster pupal development and thus the production of adult Aedes mosquitoes. Conclusion Pupal productivity surveys conducted during the wet season will identify almost all of the most productive container types for both the dry and wet seasons and will therefore facilitate cost-effective targeted interventions. PMID:23318235

  11. Reducing vector-borne disease by empowering farmers in integrated vector management.

    PubMed

    van den Berg, Henk; von Hildebrand, Alexander; Ragunathan, Vaithilingam; Das, Pradeep K

    2007-07-01

    Irrigated agriculture exposes rural people to health risks associated with vector-borne diseases and pesticides used in agriculture and for public health protection. Most developing countries lack collaboration between the agricultural and health sectors to jointly address these problems. We present an evaluation of a project that uses the "farmer field school" method to teach farmers how to manage vector-borne diseases and how to improve rice yields. Teaching farmers about these two concepts together is known as "integrated pest and vector management". An intersectoral project targeting rice irrigation systems in Sri Lanka. Project partners developed a new curriculum for the field school that included a component on vector-borne diseases. Rice farmers in intervention villages who graduated from the field school took vector-control actions as well as improving environmental sanitation and their personal protection measures against disease transmission. They also reduced their use of agricultural pesticides, especially insecticides. The intervention motivated and enabled rural people to take part in vector-management activities and to reduce several environmental health risks. There is scope for expanding the curriculum to include information on the harmful effects of pesticides on human health and to address other public health concerns. Benefits of this approach for community-based health programmes have not yet been optimally assessed. Also, the institutional basis of the integrated management approach needs to be broadened so that people from a wider range of organizations take part. A monitoring and evaluation system needs to be established to measure the performance of integrated management initiatives.

  12. Effective Clipart Image Vectorization through Direct Optimization of Bezigons.

    PubMed

    Yang, Ming; Chao, Hongyang; Zhang, Chi; Guo, Jun; Yuan, Lu; Sun, Jian

    2016-02-01

    Bezigons, i.e., closed paths composed of Bézier curves, have been widely employed to describe shapes in image vectorization results. However, most existing vectorization techniques infer the bezigons by simply approximating an intermediate vector representation (such as polygons). Consequently, the resultant bezigons are sometimes imperfect due to accumulated errors, fitting ambiguities, and a lack of curve priors, especially for low-resolution images. In this paper, we describe a novel method for vectorizing clipart images. In contrast to previous methods, we directly optimize the bezigons rather than using other intermediate representations; therefore, the resultant bezigons are not only of higher fidelity compared with the original raster image but also more reasonable because they were traced by a proficient expert. To enable such optimization, we have overcome several challenges and have devised a differentiable data energy as well as several curve-based prior terms. To improve the efficiency of the optimization, we also take advantage of the local control property of bezigons and adopt an overlapped piecewise optimization strategy. The experimental results show that our method outperforms both the current state-of-the-art method and commonly used commercial software in terms of bezigon quality.

  13. Targeted systemic gene therapy and molecular imaging of cancer contribution of the vascular-targeted AAVP vector.

    PubMed

    Hajitou, Amin

    2010-01-01

    Gene therapy and molecular-genetic imaging have faced a major problem: the lack of an efficient systemic gene delivery vector. Unquestionably, eukaryotic viruses have been the vectors of choice for gene delivery to mammalian cells; however, they have had limited success in systemic gene therapy. This is mainly due to undesired uptake by the liver and reticuloendothelial system, broad tropism for mammalian cells causing toxicity, and their immunogenicity. On the other hand, prokaryotic viruses such as bacteriophage (phage) have no tropism for mammalian cells, but can be engineered to deliver genes to these cells. However, phage-based vectors have inherently been considered poor vectors for mammalian cells. We have reported a new generation of vascular-targeted systemic hybrid prokaryotic-eukaryotic vectors as chimeras between an adeno-associated virus (AAV) and targeted bacteriophage (termed AAV/phage; AAVP). In this hybrid vector, the targeted bacteriophage serves as a shuttle to deliver the AAV transgene cassette inserted in an intergenomic region of the phage DNA genome. As a proof of concept, we assessed the in vivo efficacy of vector in animal models of cancer by displaying on the phage capsid the cyclic Arg-Gly-Asp (RGD-4C) ligand that binds to alphav integrin receptors specifically expressed on the angiogenic blood vessels of tumors. The ligand-directed vector was able to specifically deliver imaging and therapeutic transgenes to tumors in mice, rats, and dogs while sparing the normal organs. This chapter reviews some gene transfer strategies and the potential of the vascular-targeted AAVP vector for enhancing the effectiveness of existing systemic gene delivery and genetic-imaging technologies. Copyright (c) 2010 Elsevier Inc. All rights reserved.

  14. Lightweight Filter Architecture for Energy Efficient Mobile Vehicle Localization Based on a Distributed Acoustic Sensor Network

    PubMed Central

    Kim, Keonwook

    2013-01-01

    The generic properties of an acoustic signal provide numerous benefits for localization by applying energy-based methods over a deployed wireless sensor network (WSN). However, the signal generated by a stationary target utilizes a significant amount of bandwidth and power in the system without providing further position information. For vehicle localization, this paper proposes a novel proximity velocity vector estimator (PVVE) node architecture in order to capture the energy from a moving vehicle and reject the signal from motionless automobiles around the WSN node. A cascade structure between analog envelope detector and digital exponential smoothing filter presents the velocity vector-sensitive output with low analog circuit and digital computation complexity. The optimal parameters in the exponential smoothing filter are obtained by analytical and mathematical methods for maximum variation over the vehicle speed. For stationary targets, the derived simulation based on the acoustic field parameters demonstrates that the system significantly reduces the communication requirements with low complexity and can be expected to extend the operation time considerably. PMID:23979482

  15. Adaptive track scheduling to optimize concurrency and vectorization in GeantV

    DOE PAGES

    Apostolakis, J.; Bandieramonte, M.; Bitzes, G.; ...

    2015-05-22

    The GeantV project is focused on the R&D of new particle transport techniques to maximize parallelism on multiple levels, profiting from the use of both SIMD instructions and co-processors for the CPU-intensive calculations specific to this type of applications. In our approach, vectors of tracks belonging to multiple events and matching different locality criteria must be gathered and dispatched to algorithms having vector signatures. While the transport propagates tracks and changes their individual states, data locality becomes harder to maintain. The scheduling policy has to be changed to maintain efficient vectors while keeping an optimal level of concurrency. The modelmore » has complex dynamics requiring tuning the thresholds to switch between the normal regime and special modes, i.e. prioritizing events to allow flushing memory, adding new events in the transport pipeline to boost locality, dynamically adjusting the particle vector size or switching between vector to single track mode when vectorization causes only overhead. Lastly, this work requires a comprehensive study for optimizing these parameters to make the behaviour of the scheduler self-adapting, presenting here its initial results.« less

  16. Effective reduction of the interleukin-1β transcript in osteoarthritis-prone guinea pig chondrocytes via short hairpin RNA mediated RNA interference influences gene expression of mediators implicated in disease pathogenesis.

    PubMed

    Santangelo, K S; Bertone, A L

    2011-12-01

    To ascertain a viral vector-based short hairpin RNA (shRNA) capable of reducing the interleukin-1β (IL-1β) transcript in osteoarthritis (OA)-prone chondrocytes and detect corresponding changes in the expression patterns of several critical disease mediators. Cultured chondrocytes from 2-month-old Hartley guinea pigs were screened for reduction of the IL-1β transcript following plasmid-based delivery of U6-driven shRNA sequences. A successful plasmid/shRNA knockdown combination was identified and used to construct an adeno-associated virus serotype 5 (AAV5) vector for further evaluation. Relative real-time reverse transcription polymerase chain reaction (RT-PCR) was used to quantify in vitro transcript changes of IL-1β and an additional nine genes following transduction with this targeting knockdown vector. To validate in vitro findings, this AAV5 vector was injected into one knee, while either an equivalent volume of saline vehicle (three animals) or non-targeting control vector (three animals) were injected into opposite knees. Fold differences and subsequent percent gene expression levels relative to control groups were calculated using the comparative CT (2(-ΔΔCT)) method. Statistically significant decreases in IL-1β expression were achieved by the targeting knockdown vector relative to both the mock-transduced control and non-targeting vector control groups in vitro. Transcript levels of anabolic transforming growth factor-β (TGF-β) were significantly increased by use of this targeting knockdown vector. Transduction with this targeting AAV5 vector also significantly decreased the transcript levels of key inflammatory cytokines [tumor necrosis factor-α (TNF-α), IL-2, IL-8, and IL-12] and catabolic agents [matrix metalloproteinase (MMP)13, MMP2, interferon-γ (IFN-γ), and inducible nitrous oxide synthase (iNOS)] relative to both mock-transduced and non-targeting vector control groups. In vivo application of this targeting knockdown vector resulted in a >50% reduction (P=0.0045) or >90% (P=0.0001) of the IL-1β transcript relative to vehicle-only or non-targeting vector control exposed cartilage, respectively. Successful reduction of the IL-1β transcript was achieved via RNA interference (RNAi) techniques. Importantly, this alteration significantly influenced the transcript levels of several major players involved in OA pathogenesis in the direction of disease modification. Investigations to characterize additional gene expression changes influenced by targeting knockdown AAV5 vector-based diminution of the IL-1β transcript in vivo are warranted. Copyright © 2011 Osteoarthritis Research Society International. Published by Elsevier Ltd. All rights reserved.

  17. Design and construction of targeted AAVP vectors for mammalian cell transduction.

    PubMed

    Hajitou, Amin; Rangel, Roberto; Trepel, Martin; Soghomonyan, Suren; Gelovani, Juri G; Alauddin, Mian M; Pasqualini, Renata; Arap, Wadih

    2007-01-01

    Bacteriophage (phage) evolved as bacterial viruses, but can be adapted to transduce mammalian cells through ligand-directed targeting to a specific receptor. We have recently reported a new generation of hybrid prokaryotic-eukaryotic vectors, which are chimeras of genetic cis-elements of recombinant adeno-associated virus and phage (termed AAVP). This protocol describes the design and construction of ligand-directed AAVP vectors, production of AAVP particles and the methodology to transduce mammalian cells in vitro and to target tissues in vivo after systemic administration. Targeted AAVP particles are made in a two-step process. First, a ligand peptide of choice is displayed on the coat protein to generate a targeted backbone phage vector. Then, a recombinant AAV carrying a mammalian transgene cassette is inserted into an intergenomic region. High-titer suspensions (approximately 10(10)-10(11) transducing units per microl) can be produced within 3 days after vector construction. Transgene expression by targeted AAVP usually reaches maximum levels within 1 week.

  18. Image-based tracking and sensor resource management for UAVs in an urban environment

    NASA Astrophysics Data System (ADS)

    Samant, Ashwin; Chang, K. C.

    2010-04-01

    Coordination and deployment of multiple unmanned air vehicles (UAVs) requires a lot of human resources in order to carry out a successful mission. The complexity of such a surveillance mission is significantly increased in the case of an urban environment where targets can easily escape from the UAV's field of view (FOV) due to intervening building and line-of-sight obstruction. In the proposed methodology, we focus on the control and coordination of multiple UAVs having gimbaled video sensor onboard for tracking multiple targets in an urban environment. We developed optimal path planning algorithms with emphasis on dynamic target prioritizations and persistent target updates. The command center is responsible for target prioritization and autonomous control of multiple UAVs, enabling a single operator to monitor and control a team of UAVs from a remote location. The results are obtained using extensive 3D simulations in Google Earth using Tangent plus Lyapunov vector field guidance for target tracking.

  19. Explicit time integration of finite element models on a vectorized, concurrent computer with shared memory

    NASA Technical Reports Server (NTRS)

    Gilbertsen, Noreen D.; Belytschko, Ted

    1990-01-01

    The implementation of a nonlinear explicit program on a vectorized, concurrent computer with shared memory is described and studied. The conflict between vectorization and concurrency is described and some guidelines are given for optimal block sizes. Several example problems are summarized to illustrate the types of speed-ups which can be achieved by reprogramming as compared to compiler optimization.

  20. Robust RNAi enhancement via human Argonaute-2 overexpression from plasmids, viral vectors and cell lines

    PubMed Central

    Börner, Kathleen; Niopek, Dominik; Cotugno, Gabriella; Kaldenbach, Michaela; Pankert, Teresa; Willemsen, Joschka; Zhang, Xian; Schürmann, Nina; Mockenhaupt, Stefan; Serva, Andrius; Hiet, Marie-Sophie; Wiedtke, Ellen; Castoldi, Mirco; Starkuviene, Vytaute; Erfle, Holger; Gilbert, Daniel F.; Bartenschlager, Ralf; Boutros, Michael; Binder, Marco; Streetz, Konrad; Kräusslich, Hans-Georg; Grimm, Dirk

    2013-01-01

    As the only mammalian Argonaute protein capable of directly cleaving mRNAs in a small RNA-guided manner, Argonaute-2 (Ago2) is a keyplayer in RNA interference (RNAi) silencing via small interfering (si) or short hairpin (sh) RNAs. It is also a rate-limiting factor whose saturation by si/shRNAs limits RNAi efficiency and causes numerous adverse side effects. Here, we report a set of versatile tools and widely applicable strategies for transient or stable Ago2 co-expression, which overcome these concerns. Specifically, we engineered plasmids and viral vectors to co-encode a codon-optimized human Ago2 cDNA along with custom shRNAs. Furthermore, we stably integrated this Ago2 cDNA into a panel of standard human cell lines via plasmid transfection or lentiviral transduction. Using various endo- or exogenous targets, we demonstrate the potential of all three strategies to boost mRNA silencing efficiencies in cell culture by up to 10-fold, and to facilitate combinatorial knockdowns. Importantly, these robust improvements were reflected by augmented RNAi phenotypes and accompanied by reduced off-targeting effects. We moreover show that Ago2/shRNA-co-encoding vectors can enhance and prolong transgene silencing in livers of adult mice, while concurrently alleviating hepatotoxicity. Our customizable reagents and avenues should broadly improve future in vitro and in vivo RNAi experiments in mammalian systems. PMID:24049077

  1. Creating the New from the Old: Combinatorial Libraries Generation with Machine-Learning-Based Compound Structure Optimization.

    PubMed

    Podlewska, Sabina; Czarnecki, Wojciech M; Kafel, Rafał; Bojarski, Andrzej J

    2017-02-27

    The growing computational abilities of various tools that are applied in the broadly understood field of computer-aided drug design have led to the extreme popularity of virtual screening in the search for new biologically active compounds. Most often, the source of such molecules consists of commercially available compound databases, but they can also be searched for within the libraries of structures generated in silico from existing ligands. Various computational combinatorial approaches are based solely on the chemical structure of compounds, using different types of substitutions for new molecules formation. In this study, the starting point for combinatorial library generation was the fingerprint referring to the optimal substructural composition in terms of the activity toward a considered target, which was obtained using a machine learning-based optimization procedure. The systematic enumeration of all possible connections between preferred substructures resulted in the formation of target-focused libraries of new potential ligands. The compounds were initially assessed by machine learning methods using a hashed fingerprint to represent molecules; the distribution of their physicochemical properties was also investigated, as well as their synthetic accessibility. The examination of various fingerprints and machine learning algorithms indicated that the Klekota-Roth fingerprint and support vector machine were an optimal combination for such experiments. This study was performed for 8 protein targets, and the obtained compound sets and their characterization are publically available at http://skandal.if-pan.krakow.pl/comb_lib/ .

  2. Research on intrusion detection based on Kohonen network and support vector machine

    NASA Astrophysics Data System (ADS)

    Shuai, Chunyan; Yang, Hengcheng; Gong, Zeweiyi

    2018-05-01

    In view of the problem of low detection accuracy and the long detection time of support vector machine, which directly applied to the network intrusion detection system. Optimization of SVM parameters can greatly improve the detection accuracy, but it can not be applied to high-speed network because of the long detection time. a method based on Kohonen neural network feature selection is proposed to reduce the optimization time of support vector machine parameters. Firstly, this paper is to calculate the weights of the KDD99 network intrusion data by Kohonen network and select feature by weight. Then, after the feature selection is completed, genetic algorithm (GA) and grid search method are used for parameter optimization to find the appropriate parameters and classify them by support vector machines. By comparing experiments, it is concluded that feature selection can reduce the time of parameter optimization, which has little influence on the accuracy of classification. The experiments suggest that the support vector machine can be used in the network intrusion detection system and reduce the missing rate.

  3. Dose-dependent Toxicity of Humanized Renilla reniformis GFP (hrGFP) Limits Its Utility as a Reporter Gene in Mouse Muscle

    PubMed Central

    Wallace, Lindsay M; Moreo, Andrew; Clark, K Reed; Harper, Scott Q

    2013-01-01

    Gene therapy has historically focused on delivering protein-coding genes to target cells or tissues using a variety of vectors. In recent years, the field has expanded to include gene-silencing strategies involving delivery of noncoding inhibitory RNAs, such as short hairpin RNAs or microRNAs (miRNAs). Often called RNA interference (RNAi) triggers, these small inhibitory RNAs are difficult or impossible to visualize in living cells or tissues. To circumvent this detection problem and ensure efficient delivery in preclinical studies, vectors can be engineered to coexpress a fluorescent reporter gene to serve as a marker of transduction. In this study, we set out to optimize adeno-associated viral (AAV) vectors capable of delivering engineered miRNAs and green fluorescent protein (GFP) reporter genes to skeletal muscle. Although the more broadly utilized enhanced GFP (eGFP) gene derived from the jellyfish, Aequorea victoria was a conventional choice, we were concerned about some previous studies suggesting this protein was myotoxic. We thus opted to test vectors carrying the humanized Renilla reniformis-derived GFP (hrGFP) gene, which has not seen as extensive usage as eGFP but was purported to be a safer and less cytotoxic alternative. Employing AAV6 vector dosages typically used in preclinical gene transfer studies (3×1010 –1 × 1011 particles), we found that hrGFP caused dose-dependent myopathy when delivered to wild-type (wt) mouse muscle, whereas identical titers of AAV6 carrying eGFP were relatively benign. Dose de-escalation at or below 8 × 109 AAV particles effectively reduced or eliminated hrGFP-associated myotoxicity, but also had dampening effects on green fluorescence and miRNA-mediated gene silencing in whole muscles. We conclude that hrGFP is impractical for use as a transduction marker in preclinical, AAV-based RNA interference therapy studies where adult mouse muscle is the target organ. Moreover, our data support that eGFP is superior to hrGFP as a reporter gene in mouse muscle. These results may impact the design of future preclinical gene therapy studies targeting muscles and non-muscle tissues alike. PMID:23591809

  4. Expression and purification of functional Clostridium perfringens alpha and epsilon toxins in Escherichia coli.

    PubMed

    Zhao, Yao; Kang, Lin; Gao, Shan; Zhou, Yang; Su, Libo; Xin, Wenwen; Su, Yuxin; Wang, Jinglin

    2011-06-01

    The alpha and epsilon toxins are 2 of the 4 major lethal toxins of the pathogen Clostridium perfringens. In this study, the expression of the epsilon toxin (etx) gene of C. perfringens was optimized by replacing rare codons with high-frequency codons, and the optimized gene was synthesized using overlapping PCR. Then, the etx gene or the alpha-toxin gene (cpa) was individually inserted into the pTIG-Trx expression vector with a hexahistidine tag and a thioredoxin (Trx) to facilitate their purification and induce the expression of soluble proteins. The recombinant alpha toxin (rCPA) and epsilon toxin (rETX) were highly expressed as soluble forms in the recipient Escherichia coli BL21 strain, respectively. The rCPA and rETX were purified using Ni(2+)-chelating chromatography and size-exclusion chromatography. And the entire purification process recovered about 40% of each target protein from the starting materials. The purified target toxins formed single band at about 42kDa (rCPA) or 31kDa (rETX) in sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and their functional activity was confirmed by bioactivity assays. We have shown that the production of large amounts of soluble and functional proteins by using the pTIG-Trx vector in E. coli is a good alternative for the production of native alpha and epsilon toxins and could also be useful for the production of other toxic proteins with soluble forms. Copyright © 2011 Elsevier Inc. All rights reserved.

  5. Detection of ferromagnetic target based on mobile magnetic gradient tensor system

    NASA Astrophysics Data System (ADS)

    Gang, Y. I. N.; Yingtang, Zhang; Zhining, Li; Hongbo, Fan; Guoquan, Ren

    2016-03-01

    Attitude change of mobile magnetic gradient tensor system critically affects the precision of gradient measurements, thereby increasing ambiguity in target detection. This paper presents a rotational invariant-based method for locating and identifying ferromagnetic targets. Firstly, unit magnetic moment vector was derived based on the geometrical invariant, such that the intermediate eigenvector of the magnetic gradient tensor is perpendicular to the magnetic moment vector and the source-sensor displacement vector. Secondly, unit source-sensor displacement vector was derived based on the characteristic that the angle between magnetic moment vector and source-sensor displacement is a rotational invariant. By introducing a displacement vector between two measurement points, the magnetic moment vector and the source-sensor displacement vector were theoretically derived. To resolve the problem of measurement noises existing in the realistic detection applications, linear equations were formulated using invariants corresponding to several distinct measurement points and least square solution of magnetic moment vector and source-sensor displacement vector were obtained. Results of simulation and principal verification experiment showed the correctness of the analytical method, along with the practicability of the least square method.

  6. Optimum instantaneous impulsive orbital injection to attain a specified asymptotic velocity vector.

    NASA Technical Reports Server (NTRS)

    Bean, W. C.

    1971-01-01

    A nalysis of the necessary conditions of Battin for instantaneous orbital injection, with consideration of the uniqueness of his solution, and of the further problem which arises in the degenerate case when radius vector and asymptotic vector are separated by 180 deg. It is shown that when the angular separation between radius vector and asymptotic velocity vector satisfies theta not equal to 180 deg, there are precisely two insertion-velocity vectors which permit attainment of the target asymptotic velocity vector, one yielding posigrade, the other retrograde motion. When theta equals to 180 deg, there is a family of insertion-velocity vectors which permit attainment of a specified asymptotic velocity vector with a unique insertion-velocity vector for every arbitrary orientation of a target unit angular momentum vector.

  7. Fast temporal neural learning using teacher forcing

    NASA Technical Reports Server (NTRS)

    Toomarian, Nikzad (Inventor); Bahren, Jacob (Inventor)

    1992-01-01

    A neural network is trained to output a time dependent target vector defined over a predetermined time interval in response to a time dependent input vector defined over the same time interval by applying corresponding elements of the error vector, or difference between the target vector and the actual neuron output vector, to the inputs of corresponding output neurons of the network as corrective feedback. This feedback decreases the error and quickens the learning process, so that a much smaller number of training cycles are required to complete the learning process. A conventional gradient descent algorithm is employed to update the neural network parameters at the end of the predetermined time interval. The foregoing process is repeated in repetitive cycles until the actual output vector corresponds to the target vector. In the preferred embodiment, as the overall error of the neural network output decreasing during successive training cycles, the portion of the error fed back to the output neurons is decreased accordingly, allowing the network to learn with greater freedom from teacher forcing as the network parameters converge to their optimum values. The invention may also be used to train a neural network with stationary training and target vectors.

  8. Fast temporal neural learning using teacher forcing

    NASA Technical Reports Server (NTRS)

    Toomarian, Nikzad (Inventor); Bahren, Jacob (Inventor)

    1995-01-01

    A neural network is trained to output a time dependent target vector defined over a predetermined time interval in response to a time dependent input vector defined over the same time interval by applying corresponding elements of the error vector, or difference between the target vector and the actual neuron output vector, to the inputs of corresponding output neurons of the network as corrective feedback. This feedback decreases the error and quickens the learning process, so that a much smaller number of training cycles are required to complete the learning process. A conventional gradient descent algorithm is employed to update the neural network parameters at the end of the predetermined time interval. The foregoing process is repeated in repetitive cycles until the actual output vector corresponds to the target vector. In the preferred embodiment, as the overall error of the neural network output decreasing during successive training cycles, the portion of the error fed back to the output neurons is decreased accordingly, allowing the network to learn with greater freedom from teacher forcing as the network parameters converge to their optimum values. The invention may also be used to train a neural network with stationary training and target vectors.

  9. Combing VFH with bezier for motion planning of an autonomous vehicle

    NASA Astrophysics Data System (ADS)

    Ye, Feng; Yang, Jing; Ma, Chao; Rong, Haijun

    2017-08-01

    Vector Field Histogram (VFH) is a method for mobile robot obstacle avoidance. However, due to the nonholonomic constraints of the vehicle, the algorithm is seldom applied to autonomous vehicles. Especially when we expect the vehicle to reach target location in a certain direction, the algorithm is often unsatisfactory. Fortunately, the Bezier Curve is defined by the states of the starting point and the target point. We can use this feature to make the vehicle in the expected direction. Therefore, we propose an algorithm to combine the Bezier Curve with the VFH algorithm, to search for the collision-free states with the VFH search method, and to select the optimal trajectory point with the Bezier Curve as the reference line. This means that we will improve the cost function in the VFH algorithm by comparing the distance between candidate directions and reference line. Finally, select the closest direction to the reference line to be the optimal motion direction.

  10. Rapid, parallel path planning by propagating wavefronts of spiking neural activity

    PubMed Central

    Ponulak, Filip; Hopfield, John J.

    2013-01-01

    Efficient path planning and navigation is critical for animals, robotics, logistics and transportation. We study a model in which spatial navigation problems can rapidly be solved in the brain by parallel mental exploration of alternative routes using propagating waves of neural activity. A wave of spiking activity propagates through a hippocampus-like network, altering the synaptic connectivity. The resulting vector field of synaptic change then guides a simulated animal to the appropriate selected target locations. We demonstrate that the navigation problem can be solved using realistic, local synaptic plasticity rules during a single passage of a wavefront. Our model can find optimal solutions for competing possible targets or learn and navigate in multiple environments. The model provides a hypothesis on the possible computational mechanisms for optimal path planning in the brain, at the same time it is useful for neuromorphic implementations, where the parallelism of information processing proposed here can fully be harnessed in hardware. PMID:23882213

  11. High-performance computing — an overview

    NASA Astrophysics Data System (ADS)

    Marksteiner, Peter

    1996-08-01

    An overview of high-performance computing (HPC) is given. Different types of computer architectures used in HPC are discussed: vector supercomputers, high-performance RISC processors, various parallel computers like symmetric multiprocessors, workstation clusters, massively parallel processors. Software tools and programming techniques used in HPC are reviewed: vectorizing compilers, optimization and vector tuning, optimization for RISC processors; parallel programming techniques like shared-memory parallelism, message passing and data parallelism; and numerical libraries.

  12. Potential high-frequency off-target mutagenesis induced by CRISPR/Cas9 in Arabidopsis and its prevention.

    PubMed

    Zhang, Qiang; Xing, Hui-Li; Wang, Zhi-Ping; Zhang, Hai-Yan; Yang, Fang; Wang, Xue-Chen; Chen, Qi-Jun

    2018-03-01

    We present novel observations of high-specificity SpCas9 variants, sgRNA expression strategies based on mutant sgRNA scaffold and tRNA processing system, and CRISPR/Cas9-mediated T-DNA integrations. Specificity of CRISPR/Cas9 tools has been a major concern along with the reports of their successful applications. We report unexpected observations of high frequency off-target mutagenesis induced by CRISPR/Cas9 in T1 Arabidopsis mutants although the sgRNA was predicted to have a high specificity score. We also present evidence that the off-target effects were further exacerbated in the T2 progeny. To prevent the off-target effects, we tested and optimized two strategies in Arabidopsis, including introduction of a mCherry cassette for a simple and reliable isolation of Cas9-free mutants and the use of highly specific mutant SpCas9 variants. Optimization of the mCherry vectors and subsequent validation found that fusion of tRNA with the mutant rather than the original sgRNA scaffold significantly improves editing efficiency. We then examined the editing efficiency of eight high-specificity SpCas9 variants in combination with the improved tRNA-sgRNA fusion strategy. Our results suggest that highly specific SpCas9 variants require a higher level of expression than their wild-type counterpart to maintain high editing efficiency. Additionally, we demonstrate that T-DNA can be inserted into the cleavage sites of CRISPR/Cas9 targets with high frequency. Altogether, our results suggest that in plants, continuous attention should be paid to off-target effects induced by CRISPR/Cas9 in current and subsequent generations, and that the tools optimized in this report will be useful in improving genome editing efficiency and specificity in plants and other organisms.

  13. Modeling of Mean-VaR portfolio optimization by risk tolerance when the utility function is quadratic

    NASA Astrophysics Data System (ADS)

    Sukono, Sidi, Pramono; Bon, Abdul Talib bin; Supian, Sudradjat

    2017-03-01

    The problems of investing in financial assets are to choose a combination of weighting a portfolio can be maximized return expectations and minimizing the risk. This paper discusses the modeling of Mean-VaR portfolio optimization by risk tolerance, when square-shaped utility functions. It is assumed that the asset return has a certain distribution, and the risk of the portfolio is measured using the Value-at-Risk (VaR). So, the process of optimization of the portfolio is done based on the model of Mean-VaR portfolio optimization model for the Mean-VaR done using matrix algebra approach, and the Lagrange multiplier method, as well as Khun-Tucker. The results of the modeling portfolio optimization is in the form of a weighting vector equations depends on the vector mean return vector assets, identities, and matrix covariance between return of assets, as well as a factor in risk tolerance. As an illustration of numeric, analyzed five shares traded on the stock market in Indonesia. Based on analysis of five stocks return data gained the vector of weight composition and graphics of efficient surface of portfolio. Vector composition weighting weights and efficient surface charts can be used as a guide for investors in decisions to invest.

  14. Combination therapy utilizing shRNA knockdown and an optimized resistant transgene for rescue of diseases caused by misfolded proteins.

    PubMed

    Li, Chengwen; Xiao, Pingjie; Gray, Steven James; Weinberg, Marc Scott; Samulski, R Jude

    2011-08-23

    Molecular knockdown of disease proteins and restoration of wild-type activity represent a promising but challenging strategy for the treatment of diseases that result from the accumulation of misfolded proteins (i.e., Huntington disease, amyotrophic lateral sclerosis, and α-1 antitrypsin deficiency). In this study we used alpha-1 antitrypsin (AAT) deficiency with the piZZ mutant phenotype as a model system to evaluate the efficiency of gene-delivery approaches that both silence the piZZ transcript (e.g., shRNA) and restore circulating wild-type AAT expression from resistant codon-optimized AAT (AAT-opt) transgene cassette using adeno-associated virus (AAV) vector delivery. After systemic injection of a self-complimentary AAV serotype 8 (scAAV8) vector encoding shRNA in piZZ transgenic mice, both mutant AAT mRNA in the liver and defected serum protein level were inhibited by 95%, whereas liver pathology, as monitored by dPAS and fibrosis staining, reversed. To restore blood AAT levels in AAV8/shRNA-treated mice, several strategies to restore functional AAT levels were tested, including using AAV AAT-opt transgene cassettes targeted to muscle and liver, or combination vectors carrying piZZ shRNA and AAT-opt transgenes separately, or a single bicistronic AAV vector. With these molecular approaches, we observed over 90% knockdown of mutant AAT with a 13- to 30-fold increase of circulating wild-type AAT protein from the shRNA-resistant AAT-opt cassette. The molecular approaches applied in this study can simultaneously prevent liver pathology and restore blood AAT concentration in AAT deficiencies. Based on these observations, similar gene-therapy strategies could be considered for any diseases caused by accumulation of misfolded proteins.

  15. Bioengineering a non-genotoxic vector for genetic modification of mesenchymal stem cells.

    PubMed

    Chen, Xuguang; Nomani, Alireza; Patel, Niket; Nouri, Faranak S; Hatefi, Arash

    2018-01-01

    Vectors used for stem cell transfection must be non-genotoxic, in addition to possessing high efficiency, because they could potentially transform normal stem cells into cancer-initiating cells. The objective of this research was to bioengineer an efficient vector that can be used for genetic modification of stem cells without any negative somatic or genetic impact. Two types of multifunctional vectors, namely targeted and non-targeted were genetically engineered and purified from E. coli. The targeted vectors were designed to enter stem cells via overexpressed receptors. The non-targeted vectors were equipped with MPG and Pep1 cell penetrating peptides. A series of commercial synthetic non-viral vectors and an adenoviral vector were used as controls. All vectors were evaluated for their efficiency and impact on metabolic activity, cell membrane integrity, chromosomal aberrations (micronuclei formation), gene dysregulation, and differentiation ability of stem cells. The results of this study showed that the bioengineered vector utilizing VEGFR-1 receptors for cellular entry could transfect mesenchymal stem cells with high efficiency without inducing genotoxicity, negative impact on gene function, or ability to differentiate. Overall, the vectors that utilized receptors as ports for cellular entry (viral and non-viral) showed considerably better somato- and genosafety profiles in comparison to those that entered through electrostatic interaction with cellular membrane. The genetically engineered vector in this study demonstrated that it can be safely and efficiently used to genetically modify stem cells with potential applications in tissue engineering and cancer therapy. Copyright © 2017 Elsevier Ltd. All rights reserved.

  16. Innate Functions of Immunoglobulin M Lessen Liver Gene Transfer with Helper-Dependent Adenovirus

    PubMed Central

    Unzu, Carmen; Morales-Kastresana, Aizea; Sampedro, Ana; Serrano-Mendioroz, Irantzu; Azpilikueta, Arantza; Ochoa, María Carmen; Dubrot, Juan; Martínez-Ansó, Eduardo

    2014-01-01

    The immune system poses obstacles to viral vectors, even in the first administration to preimmunized hosts. We have observed that the livers of B cell-deficient mice were more effectively transduced by a helper-dependent adenovirus serotype-5 (HDA) vector than those of WT mice. This effect was T-cell independent as shown in athymic mice. Passive transfer of the serum from adenovirus-naïve WT to Rag1KO mice resulted in a reduction in gene transfer that was traced to IgM purified from serum of adenovirus-naïve mice. To ascribe the gene transfer inhibition activity to either adenoviral antigen-specific or antigen-unspecific functions of IgM, we used a monoclonal IgM antibody of unrelated specificity. Both the polyclonal and the irrelevant monoclonal IgM inhibited gene transfer by the HDA vector to either cultured hepatocellular carcinoma cells or to the liver of mice in vivo. Adsorption of polyclonal or monoclonal IgMs to viral capsids was revealed by ELISAs on adenovirus-coated plates. These observations indicate the existence of an inborn IgM mechanism deployed against a prevalent virus to reduce early post-infection viremia. In conclusion, innate IgM binding to adenovirus serotype-5 capsids restrains gene-transfer and offers a mechanism to be targeted for optimization of vector dosage in gene therapy with HDA vectors. PMID:24465560

  17. Targeted delivery of non-viral vectors to cartilage in vivo using a chondrocyte-homing peptide identified by phage display.

    PubMed

    Pi, Yanbin; Zhang, Xin; Shi, Junjun; Zhu, Jinxian; Chen, Wenqing; Zhang, Chenguang; Gao, Weiwei; Zhou, Chunyan; Ao, Yingfang

    2011-09-01

    Gene therapy is a promising method for osteoarthritis and cartilage injury. However, specifically delivering target genes into chondrocytes is a great challenge because of their non-vascularity and the dense extracellular matrix of cartilage. In our study, we identified a chondrocyte-affinity peptide (CAP, DWRVIIPPRPSA) by phage display technology. Subsequent analysis suggests that the peptide can efficiently interact specifically with chondrocytes without any species specificity. Polyethylenimine (PEI) was covalently modified with CAP to construct a non-viral vector for cartilage-targeted therapy. To investigate the cartilage-targeting property of the CAP-modified vector, FITC-labeled CAP conjugated PEI/DNA particles were injected into rabbit knee joints, and visualized under confocal microscope. Higher concentrations of CAP-modified vector were detected in the cartilage and specifically taken up by chondrocytes compared with a randomly scrambled peptide (SP)-modified vector. To evaluate cartilage-targeting transfection efficiency, the GFP and luciferase genes were delivered into knee joints using CAP- and SP-modified PEI. Cartilage transfections mediated by CAP-modified PEI were much more efficient and specific than those by SP-modified PEI. This result suggests that CAP-modified PEI could be used as a specific cartilage-targeting vector for cartilage disorders. Copyright © 2011 Elsevier Ltd. All rights reserved.

  18. Adeno-associated virus Rep-mediated targeting of integrase-defective retroviral vector DNA circles into human chromosome 19

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Huang, Shuohao; Kawabe, Yoshinori; Ito, Akira

    2012-01-06

    Highlights: Black-Right-Pointing-Pointer Adeno-associated virus (AAV) is capable of targeted integration in human cells. Black-Right-Pointing-Pointer Integrase-defective retroviral vector (IDRV) enables a circular DNA delivery. Black-Right-Pointing-Pointer A targeted integration system of IDRV DNA using the AAV integration mechanism. Black-Right-Pointing-Pointer Targeted IDRV integration ameliorates the safety concerns for retroviral vectors. -- Abstract: Retroviral vectors have been employed in clinical trials for gene therapy owing to their relative large packaging capacity, alterable cell tropism, and chromosomal integration for stable transgene expression. However, uncontrollable integrations of transgenes are likely to cause safety issues, such as insertional mutagenesis. A targeted transgene integration system for retroviral vectors,more » therefore, is a straightforward way to address the insertional mutagenesis issue. Adeno-associated virus (AAV) is the only known virus capable of targeted integration in human cells. In the presence of AAV Rep proteins, plasmids possessing the p5 integration efficiency element (p5IEE) can be integrated into the AAV integration site (AAVS1) in the human genome. In this report, we describe a system that can target the circular DNA derived from non-integrating retroviral vectors to the AAVS1 site by utilizing the Rep/p5IEE integration mechanism. Our results showed that after G418 selection 30% of collected clones had retroviral DNA targeted at the AAVS1 site.« less

  19. Selection and trajectory design to mission secondary targets

    NASA Astrophysics Data System (ADS)

    Victorino Sarli, Bruno; Kawakatsu, Yasuhiro

    2017-02-01

    Recently, with new trajectory design techniques and use of low-thrust propulsion systems, missions have become more efficient and cheaper with respect to propellant. As a way to increase the mission's value and scientific return, secondary targets close to the main trajectory are often added with a small change in the transfer trajectory. As a result of their large number, importance and facility to perform a flyby, asteroids are commonly used as such targets. This work uses the Primer Vector theory to define the direction and magnitude of the thrust for a minimum fuel consumption problem. The design of a low-thrust trajectory with a midcourse asteroid flyby is not only challenging for the low-thrust problem solution, but also with respect to the selection of a target and its flyby point. Currently more than 700,000 minor bodies have been identified, which generates a very large number of possible flyby points. This work uses a combination of reachability, reference orbit, and linear theory to select appropriate candidates, drastically reducing the simulation time, to be later included in the main trajectory and optimized. Two test cases are presented using the aforementioned selection process and optimization to add and design a secondary flyby to a mission with the primary objective of 3200 Phaethon flyby and 25143 Itokawa rendezvous.

  20. Vector processing efficiency of plasma MHD codes by use of the FACOM 230-75 APU

    NASA Astrophysics Data System (ADS)

    Matsuura, T.; Tanaka, Y.; Naraoka, K.; Takizuka, T.; Tsunematsu, T.; Tokuda, S.; Azumi, M.; Kurita, G.; Takeda, T.

    1982-06-01

    In the framework of pipelined vector architecture, the efficiency of vector processing is assessed with respect to plasma MHD codes in nuclear fusion research. By using a vector processor, the FACOM 230-75 APU, the limit of the enhancement factor due to parallelism of current vector machines is examined for three numerical codes based on a fluid model. Reasonable speed-up factors of approximately 6,6 and 4 times faster than the highly optimized scalar version are obtained for ERATO (linear stability code), AEOLUS-R1 (nonlinear stability code) and APOLLO (1-1/2D transport code), respectively. Problems of the pipelined vector processors are discussed from the viewpoint of restructuring, optimization and choice of algorithms. In conclusion, the important concept of "concurrency within pipelined parallelism" is emphasized.

  1. Exploring the capabilities of support vector machines in detecting silent data corruptions

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Subasi, Omer; Di, Sheng; Bautista-Gomez, Leonardo

    As the exascale era approaches, the increasing capacity of high-performance computing (HPC) systems with targeted power and energy budget goals introduces significant challenges in reliability. Silent data corruptions (SDCs), or silent errors, are one of the major sources that corrupt the execution results of HPC applications without being detected. Here in this paper, we explore a set of novel SDC detectors – by leveraging epsilon-insensitive support vector machine regression – to detect SDCs that occur in HPC applications. The key contributions are threefold. (1) Our exploration takes temporal, spatial, and spatiotemporal features into account and analyzes different detectors based onmore » different features. (2) We provide an in-depth study on the detection ability and performance with different parameters, and we optimize the detection range carefully. (3) Experiments with eight real-world HPC applications show that support-vector-machine-based detectors can achieve detection sensitivity (i.e., recall) up to 99% yet suffer a less than 1% false positive rate for most cases. Our detectors incur low performance overhead, 5% on average, for all benchmarks studied in this work.« less

  2. Exploring the capabilities of support vector machines in detecting silent data corruptions

    DOE PAGES

    Subasi, Omer; Di, Sheng; Bautista-Gomez, Leonardo; ...

    2018-02-01

    As the exascale era approaches, the increasing capacity of high-performance computing (HPC) systems with targeted power and energy budget goals introduces significant challenges in reliability. Silent data corruptions (SDCs), or silent errors, are one of the major sources that corrupt the execution results of HPC applications without being detected. Here in this paper, we explore a set of novel SDC detectors – by leveraging epsilon-insensitive support vector machine regression – to detect SDCs that occur in HPC applications. The key contributions are threefold. (1) Our exploration takes temporal, spatial, and spatiotemporal features into account and analyzes different detectors based onmore » different features. (2) We provide an in-depth study on the detection ability and performance with different parameters, and we optimize the detection range carefully. (3) Experiments with eight real-world HPC applications show that support-vector-machine-based detectors can achieve detection sensitivity (i.e., recall) up to 99% yet suffer a less than 1% false positive rate for most cases. Our detectors incur low performance overhead, 5% on average, for all benchmarks studied in this work.« less

  3. Molecular Cardiac Surgery with Recirculating Delivery (MCARD): Procedure and Vector Transfer.

    PubMed

    Katz, Michael G; Fargnoli, Anthony S; Kendle, Andrew P; Bridges, Charles R

    2017-01-01

    Despite progress in clinical treatment, cardiovascular diseases are still the leading cause of morbidity and mortality worldwide. Therefore, novel therapeutic approaches are needed, targeting the underlying molecular mechanisms of disease with improved outcomes for patients. Gene therapy is one of the most promising fields for the development of new treatments for the advanced stages of cardiovascular diseases. The establishment of clinically relevant methods of gene transfer remains one of the principal limitations on the effectiveness of gene therapy. Recently, there have been significant advances in direct and transvascular gene delivery methods. The ideal gene transfer method should be explored in clinically relevant large animal models of heart disease to evaluate the roles of specific molecular pathways in disease pathogenesis. Characteristics of the optimal technique for gene delivery include low morbidity, an increased myocardial transcapillary gradient, esxtended vector residence time in the myocytes, and the exclusion of residual vector from the systemic circulation after delivery to minimize collateral expression and immune response. Here we describe myocardial gene transfer techniques with molecular cardiac surgery with recirculating delivery in a large animal model of post ischemic heart failure.

  4. Determining on-fault earthquake magnitude distributions from integer programming

    USGS Publications Warehouse

    Geist, Eric L.; Parsons, Thomas E.

    2018-01-01

    Earthquake magnitude distributions among faults within a fault system are determined from regional seismicity and fault slip rates using binary integer programming. A synthetic earthquake catalog (i.e., list of randomly sampled magnitudes) that spans millennia is first formed, assuming that regional seismicity follows a Gutenberg-Richter relation. Each earthquake in the synthetic catalog can occur on any fault and at any location. The objective is to minimize misfits in the target slip rate for each fault, where slip for each earthquake is scaled from its magnitude. The decision vector consists of binary variables indicating which locations are optimal among all possibilities. Uncertainty estimates in fault slip rates provide explicit upper and lower bounding constraints to the problem. An implicit constraint is that an earthquake can only be located on a fault if it is long enough to contain that earthquake. A general mixed-integer programming solver, consisting of a number of different algorithms, is used to determine the optimal decision vector. A case study is presented for the State of California, where a 4 kyr synthetic earthquake catalog is created and faults with slip ≥3 mm/yr are considered, resulting in >106  variables. The optimal magnitude distributions for each of the faults in the system span a rich diversity of shapes, ranging from characteristic to power-law distributions. 

  5. Specific Retrograde Transduction of Spinal Motor Neurons Using Lentiviral Vectors Targeted to Presynaptic NMJ Receptors

    PubMed Central

    Eleftheriadou, I; Trabalza, A; Ellison, SM; Gharun, K; Mazarakis, ND

    2014-01-01

    To understand how receptors are involved in neuronal trafficking and to be able to utilize them for specific targeting via the peripheral route would be of great benefit. Here, we describe the generation of novel lentiviral vectors with tropism to motor neurons that were made by coexpressing onto the lentiviral surface a fusogenic glycoprotein (mutated sindbis G) and an antibody against a cell-surface receptor (Thy1.1, p75NTR, or coxsackievirus and adenovirus receptor) on the presynaptic terminal of the neuromuscular junction. These vectors exhibit binding specificity and efficient transduction of receptor positive cell lines and primary motor neurons in vitro. Targeting of each of these receptors conferred to these vectors the capability of being transported retrogradely from the axonal tip, leading to transduction of motor neurons in vitro in compartmented microfluidic cultures. In vivo delivery of coxsackievirus and adenovirus receptor-targeted vectors in leg muscles of mice resulted in predicted patterns of motor neuron labeling in lumbar spinal cord. This opens up the clinical potential of these vectors for minimally invasive administration of central nervous system-targeted therapeutics in motor neuron diseases. PMID:24670531

  6. Vector design for liver specific expression of multiple interfering RNAs that target hepatitis B virus transcripts

    PubMed Central

    Snyder, Lindsey L.; Esser, Jonathan M.; Pachuk, Catherine J.; Steel, Laura F.

    2008-01-01

    RNA interference (RNAi) is a process that can target intracellular RNAs for degradation in a highly sequence specific manner, making it a powerful tool that is being pursued in both research and therapeutic applications. Hepatitis B virus (HBV) is a serious public health problem in need of better treatment options, and aspects of its life cycle make it an excellent target for RNAi-based therapeutics. We have designed a vector that expresses interfering RNAs that target HBV transcripts, including both viral RNA replicative intermediates and mRNAs encoding viral proteins. Our vector design incorporates many features of endogenous microRNA (miRNA) gene organization that are proving useful for the development of reagents for RNAi. In particular, our vector contains an RNA pol II driven gene cassette that leads to tissue specific expression and efficient processing of multiple interfering RNAs from a single transcript, without the co-expression of any protein product. This vector shows potent silencing of HBV targets in cell culture models of HBV infection. The vector design will be applicable to silencing of additional cellular or disease-related genes. PMID:18499277

  7. In Vivo Zinc Finger Nuclease-mediated Targeted Integration of a Glucose-6-phosphatase Transgene Promotes Survival in Mice With Glycogen Storage Disease Type IA

    PubMed Central

    Landau, Dustin J; Brooks, Elizabeth Drake; Perez-Pinera, Pablo; Amarasekara, Hiruni; Mefferd, Adam; Li, Songtao; Bird, Andrew; Gersbach, Charles A; Koeberl, Dwight D

    2016-01-01

    Glycogen storage disease type Ia (GSD Ia) is caused by glucose-6-phosphatase (G6Pase) deficiency in association with severe, life-threatening hypoglycemia that necessitates lifelong dietary therapy. Here we show that use of a zinc-finger nuclease (ZFN) targeted to the ROSA26 safe harbor locus and a ROSA26-targeting vector containing a G6PC donor transgene, both delivered with adeno-associated virus (AAV) vectors, markedly improved survival of G6Pase knockout (G6Pase-KO) mice compared with mice receiving the donor vector alone (P < 0.04). Furthermore, transgene integration has been confirmed by sequencing in the majority of the mice treated with both vectors. Targeted alleles were 4.6-fold more common in livers of mice with GSD Ia, as compared with normal littermates, at 8 months following vector administration (P < 0.02). This suggests a selective advantage for vector-transduced hepatocytes following ZFN-mediated integration of the G6Pase vector. A short-term experiment also showed that 3-month-old mice receiving the ZFN had significantly-improved biochemical correction, in comparison with mice that received the donor vector alone. These data suggest that the use of ZFNs to drive integration of G6Pase at a safe harbor locus might improve vector persistence and efficacy, and lower mortality in GSD Ia. PMID:26865405

  8. Enhancing and targeting nucleic acid delivery by magnetic force.

    PubMed

    Plank, Christian; Anton, Martina; Rudolph, Carsten; Rosenecker, Joseph; Krötz, Florian

    2003-08-01

    Insufficient contact of inherently highly active nucleic acid delivery systems with target cells is a primary reason for their often observed limited efficacy. Physical methods of targeting can overcome this limitation and reduce the risk of undesired side effects due to non-target site delivery. The authors and others have developed a novel means of physical targeting, exploiting magnetic force acting on nucleic acid vectors associated with magnetic particles in order to mediate the rapid contact of vectors with target cells. Here, the principles of magnetic drug and nucleic acid delivery are reviewed, and the facts and potentials of the technique for research and therapeutic applications are discussed. Magnetically enhanced nucleic acid delivery - magnetofection - is universally applicable to viral and non-viral vectors, is extraordinarily rapid, simple and yields saturation level transfection at low dose in vitro. The method is useful for site-specific vector targeting in vivo. Exploiting the full potential of the technique requires an interdisciplinary research effort in magnetic field physics, magnetic particle chemistry, pharmaceutical formulation and medical application.

  9. Acceleration of GPU-based Krylov solvers via data transfer reduction

    DOE PAGES

    Anzt, Hartwig; Tomov, Stanimire; Luszczek, Piotr; ...

    2015-04-08

    Krylov subspace iterative solvers are often the method of choice when solving large sparse linear systems. At the same time, hardware accelerators such as graphics processing units continue to offer significant floating point performance gains for matrix and vector computations through easy-to-use libraries of computational kernels. However, as these libraries are usually composed of a well optimized but limited set of linear algebra operations, applications that use them often fail to reduce certain data communications, and hence fail to leverage the full potential of the accelerator. In this study, we target the acceleration of Krylov subspace iterative methods for graphicsmore » processing units, and in particular the Biconjugate Gradient Stabilized solver that significant improvement can be achieved by reformulating the method to reduce data-communications through application-specific kernels instead of using the generic BLAS kernels, e.g. as provided by NVIDIA’s cuBLAS library, and by designing a graphics processing unit specific sparse matrix-vector product kernel that is able to more efficiently use the graphics processing unit’s computing power. Furthermore, we derive a model estimating the performance improvement, and use experimental data to validate the expected runtime savings. Finally, considering that the derived implementation achieves significantly higher performance, we assert that similar optimizations addressing algorithm structure, as well as sparse matrix-vector, are crucial for the subsequent development of high-performance graphics processing units accelerated Krylov subspace iterative methods.« less

  10. Hypergraph-Based Combinatorial Optimization of Matrix-Vector Multiplication

    ERIC Educational Resources Information Center

    Wolf, Michael Maclean

    2009-01-01

    Combinatorial scientific computing plays an important enabling role in computational science, particularly in high performance scientific computing. In this thesis, we will describe our work on optimizing matrix-vector multiplication using combinatorial techniques. Our research has focused on two different problems in combinatorial scientific…

  11. Current vector control challenges in the fight against malaria.

    PubMed

    Benelli, Giovanni; Beier, John C

    2017-10-01

    The effective and eco-friendly control of Anopheles vectors plays a key role in any malaria management program. Integrated Vector Management (IVM) suggests making use of the full range of vector control tools available. The strategies for IVM require novel technologies to control outdoor transmission of malaria. Despite the wide number of promising control tools tested against mosquitoes, current strategies for malaria vector control used in most African countries are not sufficient to achieve successful malaria control. The majority of National Malaria Control Programs in Africa still rely on indoor residual spraying (IRS) and long-lasting insecticidal nets (LLINs). These methods reduce malaria incidence but generally have little impact on malaria prevalence. In addition to outdoor transmission, growing levels of insecticide resistance in targeted vectors threaten the efficacy of LLINs and IRS. Larvicidal treatments can be useful, but are not recommended for rural areas. The research needed to improve the quality and delivery of mosquito vector control should focus on (i) optimization of processes and methods for vector control delivery; (ii) monitoring of vector populations and biting activity with reliable techniques; (iii) the development of effective and eco-friendly tools to reduce the burden or locally eliminate malaria and other mosquito-borne diseases; (iv) the careful evaluation of field suitability and efficacy of new mosquito control tools to prove their epidemiological impact; (v) the continuous monitoring of environmental changes which potentially affect malaria vector populations; (vi) the cooperation among different disciplines, with main emphasis on parasitology, tropical medicine, ecology, entomology, and ecotoxicology. A better understanding of behavioral ecology of malaria vectors is required. Key ecological obstacles that limit the effectiveness of vector control include the variation in mosquito behavior, development of insecticide resistance, presence of behavioral avoidance, high vector biodiversity, competitive and food web interactions, lack of insights on mosquito dispersal and mating behavior, and the impact of environmental changes on mosquito ecological traits. Overall, the trans-disciplinary cooperation among parasitologists and entomologists is crucial to ensure proper evaluation of the epidemiological impact triggered by novel mosquito vector control strategies. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. Targeted adenoviral vectors

    NASA Astrophysics Data System (ADS)

    Douglas, Joanne T.

    The practical implementation of gene therapy in the clinical setting mandates gene delivery vehicles, or vectors, capable of efficient gene delivery selectively to the target disease cells. The utility of adenoviral vectors for gene therapy is restricted by their dependence on the native adenoviral primary cellular receptor for cell entry. Therefore, a number of strategies have been developed to allow CAR-independent infection of specific cell types, including the use of bispecific conjugates and genetic modifications to the adenoviral capsid proteins, in particular the fibre protein. These targeted adenoviral vectors have demonstrated efficient gene transfer in vitro , correlating with a therapeutic benefit in preclinical animal models. Such vectors are predicted to possess enhanced efficacy in human clinical studies, although anatomical barriers to their use must be circumvented.

  13. Vector-transmitted disease vaccines: targeting salivary proteins in transmission (SPIT).

    PubMed

    McDowell, Mary Ann

    2015-08-01

    More than half the population of the world is at risk for morbidity and mortality from vector-transmitted diseases, and emerging vector-transmitted infections are threatening new populations. Rising insecticide resistance and lack of efficacious vaccines highlight the need for novel control measures. One such approach is targeting the vector-host interface by incorporating vector salivary proteins in anti-pathogen vaccines. Debate remains about whether vector saliva exposure exacerbates or protects against more severe clinical manifestations, induces immunity through natural exposure or extends to all vector species and associated pathogens. Nevertheless, exploiting this unique biology holds promise as a viable strategy for the development of vaccines against vector-transmitted diseases. Copyright © 2015 Elsevier Ltd. All rights reserved.

  14. E-RNAi: a web application for the multi-species design of RNAi reagents—2010 update

    PubMed Central

    Horn, Thomas; Boutros, Michael

    2010-01-01

    The design of RNA interference (RNAi) reagents is an essential step for performing loss-of-function studies in many experimental systems. The availability of sequenced and annotated genomes greatly facilitates RNAi experiments in an increasing number of organisms that were previously not genetically tractable. The E-RNAi web-service, accessible at http://www.e-rnai.org/, provides a computational resource for the optimized design and evaluation of RNAi reagents. The 2010 update of E-RNAi now covers 12 genomes, including Drosophila, Caenorhabditis elegans, human, emerging model organisms such as Schmidtea mediterranea and Acyrthosiphon pisum, as well as the medically relevant vectors Anopheles gambiae and Aedes aegypti. The web service calculates RNAi reagents based on the input of target sequences, sequence identifiers or by visual selection of target regions through a genome browser interface. It identifies optimized RNAi target-sites by ranking sequences according to their predicted specificity, efficiency and complexity. E-RNAi also facilitates the design of secondary RNAi reagents for validation experiments, evaluation of pooled siRNA reagents and batch design. Results are presented online, as a downloadable HTML report and as tab-delimited files. PMID:20444868

  15. A Hamiltonian approach to the planar optimization of mid-course corrections

    NASA Astrophysics Data System (ADS)

    Iorfida, E.; Palmer, P. L.; Roberts, M.

    2016-04-01

    Lawden's primer vector theory gives a set of necessary conditions that characterize the optimality of a transfer orbit, defined accordingly to the possibility of adding mid-course corrections. In this paper a novel approach is proposed where, through a polar coordinates transformation, the primer vector components decouple. Furthermore, the case when transfer, departure and arrival orbits are coplanar is analyzed using a Hamiltonian approach. This procedure leads to approximate analytic solutions for the in-plane components of the primer vector. Moreover, the solution for the circular transfer case is proven to be the Hill's solution. The novel procedure reduces the mathematical and computational complexity of the original case study. It is shown that the primer vector is independent of the semi-major axis of the transfer orbit. The case with a fixed transfer trajectory and variable initial and final thrust impulses is studied. The acquired related optimality maps are presented and analyzed and they express the likelihood of a set of trajectories to be optimal. Furthermore, it is presented which kind of requirements have to be fulfilled by a set of departure and arrival orbits to have the same profile of primer vector.

  16. Two novel motion-based algorithms for surveillance video analysis on embedded platforms

    NASA Astrophysics Data System (ADS)

    Vijverberg, Julien A.; Loomans, Marijn J. H.; Koeleman, Cornelis J.; de With, Peter H. N.

    2010-05-01

    This paper proposes two novel motion-vector based techniques for target detection and target tracking in surveillance videos. The algorithms are designed to operate on a resource-constrained device, such as a surveillance camera, and to reuse the motion vectors generated by the video encoder. The first novel algorithm for target detection uses motion vectors to construct a consistent motion mask, which is combined with a simple background segmentation technique to obtain a segmentation mask. The second proposed algorithm aims at multi-target tracking and uses motion vectors to assign blocks to targets employing five features. The weights of these features are adapted based on the interaction between targets. These algorithms are combined in one complete analysis application. The performance of this application for target detection has been evaluated for the i-LIDS sterile zone dataset and achieves an F1-score of 0.40-0.69. The performance of the analysis algorithm for multi-target tracking has been evaluated using the CAVIAR dataset and achieves an MOTP of around 9.7 and MOTA of 0.17-0.25. On a selection of targets in videos from other datasets, the achieved MOTP and MOTA are 8.8-10.5 and 0.32-0.49 respectively. The execution time on a PC-based platform is 36 ms. This includes the 20 ms for generating motion vectors, which are also required by the video encoder.

  17. Improved Dual-Luciferase Reporter Assays for Nuclear Receptors

    PubMed Central

    Paguio, Aileen; Stecha, Pete; Wood, Keith V; Fan, Frank

    2010-01-01

    Nuclear receptors play important roles in many cellular functions through control of gene transcription. It is also a large target class for drug discovery. Luciferase reporter assays are frequently used to study nuclear receptor function because of their wide dynamic range, low endogenous activity, and ease of use. Recent improvements of luciferase genes and vectors have further enhanced their utilities. Here we applied these improvements to two reporter formats for studying nuclear receptors. The first assay contains a Murine Mammary Tumor Virus promoter upstream of a destabilized luciferase. The presence of response elements for nuclear hormone receptor in this promoter allows the studies of endogenous and/or exogenous full length receptors. The second assay contains a ligand binding domain (LBD) of a nuclear receptor fused to the GAL4 DNA binding domain (DBD) on one vector and multiple Gal4 Upstream Activator Sequences (UAS) upstream of luciferase reporter on another vector. We showed that codon optimization of luciferase reporter genes increased expression levels in conjunction with the incorporation of protein destabilizing sequences into luciferase led to a larger assay dynamic range in both formats. The optimum number of UAS to generate the best response was determined. The expression vector for nuclear receptor LBD/GAL4 DBD fusion also constitutively expresses a Renilla luciferase-neoR fusion protein, which provides selection capability (G418 resistance, neoR) as well as an internal control (Renilla luciferase). This dual-luciferase format allowed detecting compound cytotoxicity or off-target change in expression during drug screening, therefore improved data quality. These luciferase reporter assays provided better research and drug discovery tools for studying the functions of full length nuclear receptors and ligand binding domains. PMID:21687560

  18. Fault Detection of Bearing Systems through EEMD and Optimization Algorithm

    PubMed Central

    Lee, Dong-Han; Ahn, Jong-Hyo; Koh, Bong-Hwan

    2017-01-01

    This study proposes a fault detection and diagnosis method for bearing systems using ensemble empirical mode decomposition (EEMD) based feature extraction, in conjunction with particle swarm optimization (PSO), principal component analysis (PCA), and Isomap. First, a mathematical model is assumed to generate vibration signals from damaged bearing components, such as the inner-race, outer-race, and rolling elements. The process of decomposing vibration signals into intrinsic mode functions (IMFs) and extracting statistical features is introduced to develop a damage-sensitive parameter vector. Finally, PCA and Isomap algorithm are used to classify and visualize this parameter vector, to separate damage characteristics from healthy bearing components. Moreover, the PSO-based optimization algorithm improves the classification performance by selecting proper weightings for the parameter vector, to maximize the visualization effect of separating and grouping of parameter vectors in three-dimensional space. PMID:29143772

  19. A Robust CRISPR/Cas9 System for Convenient, High-Efficiency Multiplex Genome Editing in Monocot and Dicot Plants.

    PubMed

    Ma, Xingliang; Zhang, Qunyu; Zhu, Qinlong; Liu, Wei; Chen, Yan; Qiu, Rong; Wang, Bin; Yang, Zhongfang; Li, Heying; Lin, Yuru; Xie, Yongyao; Shen, Rongxin; Chen, Shuifu; Wang, Zhi; Chen, Yuanling; Guo, Jingxin; Chen, Letian; Zhao, Xiucai; Dong, Zhicheng; Liu, Yao-Guang

    2015-08-01

    CRISPR/Cas9 genome targeting systems have been applied to a variety of species. However, most CRISPR/Cas9 systems reported for plants can only modify one or a few target sites. Here, we report a robust CRISPR/Cas9 vector system, utilizing a plant codon optimized Cas9 gene, for convenient and high-efficiency multiplex genome editing in monocot and dicot plants. We designed PCR-based procedures to rapidly generate multiple sgRNA expression cassettes, which can be assembled into the binary CRISPR/Cas9 vectors in one round of cloning by Golden Gate ligation or Gibson Assembly. With this system, we edited 46 target sites in rice with an average 85.4% rate of mutation, mostly in biallelic and homozygous status. We reasoned that about 16% of the homozygous mutations in rice were generated through the non-homologous end-joining mechanism followed by homologous recombination-based repair. We also obtained uniform biallelic, heterozygous, homozygous, and chimeric mutations in Arabidopsis T1 plants. The targeted mutations in both rice and Arabidopsis were heritable. We provide examples of loss-of-function gene mutations in T0 rice and T1 Arabidopsis plants by simultaneous targeting of multiple (up to eight) members of a gene family, multiple genes in a biosynthetic pathway, or multiple sites in a single gene. This system has provided a versatile toolbox for studying functions of multiple genes and gene families in plants for basic research and genetic improvement. Copyright © 2015 The Author. Published by Elsevier Inc. All rights reserved.

  20. Direct cloning of isogenic murine DNA in yeast and relevance of isogenicity for targeting in embryonic stem cells.

    PubMed

    Andréasson, Claes; Schick, Anna J; Pfeiffer, Susanne M; Sarov, Mihail; Stewart, Francis; Wurst, Wolfgang; Schick, Joel A

    2013-01-01

    Efficient gene targeting in embryonic stem cells requires that modifying DNA sequences are identical to those in the targeted chromosomal locus. Yet, there is a paucity of isogenic genomic clones for human cell lines and PCR amplification cannot be used in many mutation-sensitive applications. Here, we describe a novel method for the direct cloning of genomic DNA into a targeting vector, pRTVIR, using oligonucleotide-directed homologous recombination in yeast. We demonstrate the applicability of the method by constructing functional targeting vectors for mammalian genes Uhrf1 and Gfap. Whereas the isogenic targeting of the gene Uhrf1 showed a substantial increase in targeting efficiency compared to non-isogenic DNA in mouse E14 cells, E14-derived DNA performed better than the isogenic DNA in JM8 cells for both Uhrf1 and Gfap. Analysis of 70 C57BL/6-derived targeting vectors electroporated in JM8 and E14 cell lines in parallel showed a clear dependence on isogenicity for targeting, but for three genes isogenic DNA was found to be inhibitory. In summary, this study provides a straightforward methodological approach for the direct generation of isogenic gene targeting vectors.

  1. An Improved Co-evolutionary Particle Swarm Optimization for Wireless Sensor Networks with Dynamic Deployment

    PubMed Central

    Wang, Xue; Wang, Sheng; Ma, Jun-Jie

    2007-01-01

    The effectiveness of wireless sensor networks (WSNs) depends on the coverage and target detection probability provided by dynamic deployment, which is usually supported by the virtual force (VF) algorithm. However, in the VF algorithm, the virtual force exerted by stationary sensor nodes will hinder the movement of mobile sensor nodes. Particle swarm optimization (PSO) is introduced as another dynamic deployment algorithm, but in this case the computation time required is the big bottleneck. This paper proposes a dynamic deployment algorithm which is named “virtual force directed co-evolutionary particle swarm optimization” (VFCPSO), since this algorithm combines the co-evolutionary particle swarm optimization (CPSO) with the VF algorithm, whereby the CPSO uses multiple swarms to optimize different components of the solution vectors for dynamic deployment cooperatively and the velocity of each particle is updated according to not only the historical local and global optimal solutions, but also the virtual forces of sensor nodes. Simulation results demonstrate that the proposed VFCPSO is competent for dynamic deployment in WSNs and has better performance with respect to computation time and effectiveness than the VF, PSO and VFPSO algorithms.

  2. Costs and Cost-Effectiveness of Plasmodium vivax Control.

    PubMed

    White, Michael T; Yeung, Shunmay; Patouillard, Edith; Cibulskis, Richard

    2016-12-28

    The continued success of efforts to reduce the global malaria burden will require sustained funding for interventions specifically targeting Plasmodium vivax The optimal use of limited financial resources necessitates cost and cost-effectiveness analyses of strategies for diagnosing and treating P. vivax and vector control tools. Herein, we review the existing published evidence on the costs and cost-effectiveness of interventions for controlling P. vivax, identifying nine studies focused on diagnosis and treatment and seven studies focused on vector control. Although many of the results from the much more extensive P. falciparum literature can be applied to P. vivax, it is not always possible to extrapolate results from P. falciparum-specific cost-effectiveness analyses. Notably, there is a need for additional studies to evaluate the potential cost-effectiveness of radical cure with primaquine for the prevention of P. vivax relapses with glucose-6-phosphate dehydrogenase testing. © The American Society of Tropical Medicine and Hygiene.

  3. Costs and Cost-Effectiveness of Plasmodium vivax Control

    PubMed Central

    White, Michael T.; Yeung, Shunmay; Patouillard, Edith; Cibulskis, Richard

    2016-01-01

    The continued success of efforts to reduce the global malaria burden will require sustained funding for interventions specifically targeting Plasmodium vivax. The optimal use of limited financial resources necessitates cost and cost-effectiveness analyses of strategies for diagnosing and treating P. vivax and vector control tools. Herein, we review the existing published evidence on the costs and cost-effectiveness of interventions for controlling P. vivax, identifying nine studies focused on diagnosis and treatment and seven studies focused on vector control. Although many of the results from the much more extensive P. falciparum literature can be applied to P. vivax, it is not always possible to extrapolate results from P. falciparum–specific cost-effectiveness analyses. Notably, there is a need for additional studies to evaluate the potential cost-effectiveness of radical cure with primaquine for the prevention of P. vivax relapses with glucose-6-phosphate dehydrogenase testing. PMID:28025283

  4. Genetic Targeting of an Adenovirus Vector via Replacement of the Fiber Protein with the Phage T4 Fibritin

    PubMed Central

    Krasnykh, Victor; Belousova, Natalya; Korokhov, Nikolay; Mikheeva, Galina; Curiel, David T.

    2001-01-01

    The utility of adenovirus (Ad) vectors for gene therapy is restricted by their inability to selectively transduce disease-affected tissues. This limitation may be overcome by the derivation of vectors capable of interacting with receptors specifically expressed in the target tissue. Previous attempts to alter Ad tropism by genetic modification of the Ad fiber have had limited success due to structural conflicts between the fiber and the targeting ligand. Here we present a strategy to derive an Ad vector with enhanced targeting potential by a radical replacement of the fiber protein in the Ad capsid with a chimeric molecule containing a heterologous trimerization motif and a receptor-binding ligand. Our approach, which capitalized upon the overall structural similarity between the human Ad type 5 (Ad5) fiber and bacteriophage T4 fibritin proteins, has resulted in the generation of a genetically modified Ad5 incorporating chimeric fiber-fibritin proteins targeted to artificial receptor molecules. Gene transfer studies employing this novel viral vector have demonstrated its capacity to efficiently deliver a transgene payload to the target cells in a receptor-specific manner. PMID:11287567

  5. Local ensemble transform Kalman filter for ionospheric data assimilation: Observation influence analysis during a geomagnetic storm event

    NASA Astrophysics Data System (ADS)

    Durazo, Juan A.; Kostelich, Eric J.; Mahalov, Alex

    2017-09-01

    We propose a targeted observation strategy, based on the influence matrix diagnostic, that optimally selects where additional observations may be placed to improve ionospheric forecasts. This strategy is applied in data assimilation observing system experiments, where synthetic electron density vertical profiles, which represent those of Constellation Observing System for Meteorology, Ionosphere, and Climate/Formosa satellite 3, are assimilated into the Thermosphere-Ionosphere-Electrodynamics General Circulation Model using the local ensemble transform Kalman filter during the 26 September 2011 geomagnetic storm. During each analysis step, the observation vector is augmented with five synthetic vertical profiles optimally placed to target electron density errors, using our targeted observation strategy. Forecast improvement due to assimilation of augmented vertical profiles is measured with the root-mean-square error (RMSE) of analyzed electron density, averaged over 600 km regions centered around the augmented vertical profile locations. Assimilating vertical profiles with targeted locations yields about 60%-80% reduction in electron density RMSE, compared to a 15% average reduction when assimilating randomly placed vertical profiles. Assimilating vertical profiles whose locations target the zonal component of neutral winds (Un) yields on average a 25% RMSE reduction in Un estimates, compared to a 2% average improvement obtained with randomly placed vertical profiles. These results demonstrate that our targeted strategy can improve data assimilation efforts during extreme events by detecting regions where additional observations would provide the largest benefit to the forecast.

  6. Application of optimal control theory to the design of the NASA/JPL 70-meter antenna servos

    NASA Technical Reports Server (NTRS)

    Alvarez, L. S.; Nickerson, J.

    1989-01-01

    The application of Linear Quadratic Gaussian (LQG) techniques to the design of the 70-m axis servos is described. Linear quadratic optimal control and Kalman filter theory are reviewed, and model development and verification are discussed. Families of optimal controller and Kalman filter gain vectors were generated by varying weight parameters. Performance specifications were used to select final gain vectors.

  7. Support vector machine firefly algorithm based optimization of lens system.

    PubMed

    Shamshirband, Shahaboddin; Petković, Dalibor; Pavlović, Nenad T; Ch, Sudheer; Altameem, Torki A; Gani, Abdullah

    2015-01-01

    Lens system design is an important factor in image quality. The main aspect of the lens system design methodology is the optimization procedure. Since optimization is a complex, nonlinear task, soft computing optimization algorithms can be used. There are many tools that can be employed to measure optical performance, but the spot diagram is the most useful. The spot diagram gives an indication of the image of a point object. In this paper, the spot size radius is considered an optimization criterion. Intelligent soft computing scheme support vector machines (SVMs) coupled with the firefly algorithm (FFA) are implemented. The performance of the proposed estimators is confirmed with the simulation results. The result of the proposed SVM-FFA model has been compared with support vector regression (SVR), artificial neural networks, and generic programming methods. The results show that the SVM-FFA model performs more accurately than the other methodologies. Therefore, SVM-FFA can be used as an efficient soft computing technique in the optimization of lens system designs.

  8. Two-UAV Intersection Localization System Based on the Airborne Optoelectronic Platform

    PubMed Central

    Bai, Guanbing; Liu, Jinghong; Song, Yueming; Zuo, Yujia

    2017-01-01

    To address the limitation of the existing UAV (unmanned aerial vehicles) photoelectric localization method used for moving objects, this paper proposes an improved two-UAV intersection localization system based on airborne optoelectronic platforms by using the crossed-angle localization method of photoelectric theodolites for reference. This paper introduces the makeup and operating principle of intersection localization system, creates auxiliary coordinate systems, transforms the LOS (line of sight, from the UAV to the target) vectors into homogeneous coordinates, and establishes a two-UAV intersection localization model. In this paper, the influence of the positional relationship between UAVs and the target on localization accuracy has been studied in detail to obtain an ideal measuring position and the optimal localization position where the optimal intersection angle is 72.6318°. The result shows that, given the optimal position, the localization root mean square error (RMS) will be 25.0235 m when the target is 5 km away from UAV baselines. Finally, the influence of modified adaptive Kalman filtering on localization results is analyzed, and an appropriate filtering model is established to reduce the localization RMS error to 15.7983 m. Finally, An outfield experiment was carried out and obtained the optimal results: σB=1.63×10−4 (°), σL=1.35×10−4 (°), σH=15.8 (m), σsum=27.6 (m), where σB represents the longitude error, σL represents the latitude error, σH represents the altitude error, and σsum represents the error radius. PMID:28067814

  9. Two-UAV Intersection Localization System Based on the Airborne Optoelectronic Platform.

    PubMed

    Bai, Guanbing; Liu, Jinghong; Song, Yueming; Zuo, Yujia

    2017-01-06

    To address the limitation of the existing UAV (unmanned aerial vehicles) photoelectric localization method used for moving objects, this paper proposes an improved two-UAV intersection localization system based on airborne optoelectronic platforms by using the crossed-angle localization method of photoelectric theodolites for reference. This paper introduces the makeup and operating principle of intersection localization system, creates auxiliary coordinate systems, transforms the LOS (line of sight, from the UAV to the target) vectors into homogeneous coordinates, and establishes a two-UAV intersection localization model. In this paper, the influence of the positional relationship between UAVs and the target on localization accuracy has been studied in detail to obtain an ideal measuring position and the optimal localization position where the optimal intersection angle is 72.6318°. The result shows that, given the optimal position, the localization root mean square error (RMS) will be 25.0235 m when the target is 5 km away from UAV baselines. Finally, the influence of modified adaptive Kalman filtering on localization results is analyzed, and an appropriate filtering model is established to reduce the localization RMS error to 15.7983 m. Finally, An outfield experiment was carried out and obtained the optimal results: σ B = 1.63 × 10 - 4 ( ° ) , σ L = 1.35 × 10 - 4 ( ° ) , σ H = 15.8 ( m ) , σ s u m = 27.6 ( m ) , where σ B represents the longitude error, σ L represents the latitude error, σ H represents the altitude error, and σ s u m represents the error radius.

  10. Tensor Fukunaga-Koontz transform for small target detection in infrared images

    NASA Astrophysics Data System (ADS)

    Liu, Ruiming; Wang, Jingzhuo; Yang, Huizhen; Gong, Chenglong; Zhou, Yuanshen; Liu, Lipeng; Zhang, Zhen; Shen, Shuli

    2016-09-01

    Infrared small targets detection plays a crucial role in warning and tracking systems. Some novel methods based on pattern recognition technology catch much attention from researchers. However, those classic methods must reshape images into vectors with the high dimensionality. Moreover, vectorizing breaks the natural structure and correlations in the image data. Image representation based on tensor treats images as matrices and can hold the natural structure and correlation information. So tensor algorithms have better classification performance than vector algorithms. Fukunaga-Koontz transform is one of classification algorithms and it is a vector version method with the disadvantage of all vector algorithms. In this paper, we first extended the Fukunaga-Koontz transform into its tensor version, tensor Fukunaga-Koontz transform. Then we designed a method based on tensor Fukunaga-Koontz transform for detecting targets and used it to detect small targets in infrared images. The experimental results, comparison through signal-to-clutter, signal-to-clutter gain and background suppression factor, have validated the advantage of the target detection based on the tensor Fukunaga-Koontz transform over that based on the Fukunaga-Koontz transform.

  11. Robust resolution enhancement optimization methods to process variations based on vector imaging model

    NASA Astrophysics Data System (ADS)

    Ma, Xu; Li, Yanqiu; Guo, Xuejia; Dong, Lisong

    2012-03-01

    Optical proximity correction (OPC) and phase shifting mask (PSM) are the most widely used resolution enhancement techniques (RET) in the semiconductor industry. Recently, a set of OPC and PSM optimization algorithms have been developed to solve for the inverse lithography problem, which are only designed for the nominal imaging parameters without giving sufficient attention to the process variations due to the aberrations, defocus and dose variation. However, the effects of process variations existing in the practical optical lithography systems become more pronounced as the critical dimension (CD) continuously shrinks. On the other hand, the lithography systems with larger NA (NA>0.6) are now extensively used, rendering the scalar imaging models inadequate to describe the vector nature of the electromagnetic field in the current optical lithography systems. In order to tackle the above problems, this paper focuses on developing robust gradient-based OPC and PSM optimization algorithms to the process variations under a vector imaging model. To achieve this goal, an integrative and analytic vector imaging model is applied to formulate the optimization problem, where the effects of process variations are explicitly incorporated in the optimization framework. The steepest descent algorithm is used to optimize the mask iteratively. In order to improve the efficiency of the proposed algorithms, a set of algorithm acceleration techniques (AAT) are exploited during the optimization procedure.

  12. Fabric wrinkle characterization and classification using modified wavelet coefficients and optimized support-vector-machine classifier

    USDA-ARS?s Scientific Manuscript database

    This paper presents a novel wrinkle evaluation method that uses modified wavelet coefficients and an optimized support-vector-machine (SVM) classification scheme to characterize and classify wrinkle appearance of fabric. Fabric images were decomposed with the wavelet transform (WT), and five parame...

  13. Game-theoretic approach to joint transmitter adaptation and power control in wireless systems.

    PubMed

    Popescu, Dimitrie C; Rawat, Danda B; Popescu, Otilia; Saquib, Mohamad

    2010-06-01

    Game theory has emerged as a new mathematical tool in the analysis and design of wireless communication systems, being particularly useful in studying the interactions among adaptive transmitters that attempt to achieve specific objectives without cooperation. In this paper, we present a game-theoretic approach to the problem of joint transmitter adaptation and power control in wireless systems, where users' transmissions are subject to quality-of-service requirements specified in terms of target signal-to-interference-plus-noise ratios (SINRs) and nonideal vector channels between transmitters and receivers are explicitly considered. Our approach is based on application of separable games, which are a specific class of noncooperative games where the players' cost is a separable function of their strategic choices. We formally state a joint codeword and power adaptation game, which is separable, and we study its properties in terms of its subgames, namely, the codeword adaptation subgame and the power adaptation subgame. We investigate the necessary conditions for an optimal Nash equilibrium and show that this corresponds to an ensemble of user codewords and powers, which maximizes the sum capacity of the corresponding multiaccess vector channel model, and for which the specified target SINRs are achieved with minimum transmitted power.

  14. Gene therapy: advances, challenges and perspectives

    PubMed Central

    Gonçalves, Giulliana Augusta Rangel; Paiva, Raquel de Melo Alves

    2017-01-01

    ABSTRACT The ability to make site-specific modifications to the human genome has been an objective in medicine since the recognition of the gene as the basic unit of heredity. Thus, gene therapy is understood as the ability of genetic improvement through the correction of altered (mutated) genes or site-specific modifications that target therapeutic treatment. This therapy became possible through the advances of genetics and bioengineering that enabled manipulating vectors for delivery of extrachromosomal material to target cells. One of the main focuses of this technique is the optimization of delivery vehicles (vectors) that are mostly plasmids, nanostructured or viruses. The viruses are more often investigated due to their excellence of invading cells and inserting their genetic material. However, there is great concern regarding exacerbated immune responses and genome manipulation, especially in germ line cells. In vivo studies in in somatic cell showed satisfactory results with approved protocols in clinical trials. These trials have been conducted in the United States, Europe, Australia and China. Recent biotechnological advances, such as induced pluripotent stem cells in patients with liver diseases, chimeric antigen receptor T-cell immunotherapy, and genomic editing by CRISPR/Cas9, are addressed in this review. PMID:29091160

  15. Feature Extraction and Selection Strategies for Automated Target Recognition

    NASA Technical Reports Server (NTRS)

    Greene, W. Nicholas; Zhang, Yuhan; Lu, Thomas T.; Chao, Tien-Hsin

    2010-01-01

    Several feature extraction and selection methods for an existing automatic target recognition (ATR) system using JPLs Grayscale Optical Correlator (GOC) and Optimal Trade-Off Maximum Average Correlation Height (OT-MACH) filter were tested using MATLAB. The ATR system is composed of three stages: a cursory region of-interest (ROI) search using the GOC and OT-MACH filter, a feature extraction and selection stage, and a final classification stage. Feature extraction and selection concerns transforming potential target data into more useful forms as well as selecting important subsets of that data which may aide in detection and classification. The strategies tested were built around two popular extraction methods: Principal Component Analysis (PCA) and Independent Component Analysis (ICA). Performance was measured based on the classification accuracy and free-response receiver operating characteristic (FROC) output of a support vector machine(SVM) and a neural net (NN) classifier.

  16. Feature extraction and selection strategies for automated target recognition

    NASA Astrophysics Data System (ADS)

    Greene, W. Nicholas; Zhang, Yuhan; Lu, Thomas T.; Chao, Tien-Hsin

    2010-04-01

    Several feature extraction and selection methods for an existing automatic target recognition (ATR) system using JPLs Grayscale Optical Correlator (GOC) and Optimal Trade-Off Maximum Average Correlation Height (OT-MACH) filter were tested using MATLAB. The ATR system is composed of three stages: a cursory regionof- interest (ROI) search using the GOC and OT-MACH filter, a feature extraction and selection stage, and a final classification stage. Feature extraction and selection concerns transforming potential target data into more useful forms as well as selecting important subsets of that data which may aide in detection and classification. The strategies tested were built around two popular extraction methods: Principal Component Analysis (PCA) and Independent Component Analysis (ICA). Performance was measured based on the classification accuracy and free-response receiver operating characteristic (FROC) output of a support vector machine(SVM) and a neural net (NN) classifier.

  17. Vectorial mask optimization methods for robust optical lithography

    NASA Astrophysics Data System (ADS)

    Ma, Xu; Li, Yanqiu; Guo, Xuejia; Dong, Lisong; Arce, Gonzalo R.

    2012-10-01

    Continuous shrinkage of critical dimension in an integrated circuit impels the development of resolution enhancement techniques for low k1 lithography. Recently, several pixelated optical proximity correction (OPC) and phase-shifting mask (PSM) approaches were developed under scalar imaging models to account for the process variations. However, the lithography systems with larger-NA (NA>0.6) are predominant for current technology nodes, rendering the scalar models inadequate to describe the vector nature of the electromagnetic field that propagates through the optical lithography system. In addition, OPC and PSM algorithms based on scalar models can compensate for wavefront aberrations, but are incapable of mitigating polarization aberrations in practical lithography systems, which can only be dealt with under the vector model. To this end, we focus on developing robust pixelated gradient-based OPC and PSM optimization algorithms aimed at canceling defocus, dose variation, wavefront and polarization aberrations under a vector model. First, an integrative and analytic vector imaging model is applied to formulate the optimization problem, where the effects of process variations are explicitly incorporated in the optimization framework. A steepest descent algorithm is then used to iteratively optimize the mask patterns. Simulations show that the proposed algorithms can effectively improve the process windows of the optical lithography systems.

  18. Efficient Optimization of Low-Thrust Spacecraft Trajectories

    NASA Technical Reports Server (NTRS)

    Lee, Seungwon; Fink, Wolfgang; Russell, Ryan; Terrile, Richard; Petropoulos, Anastassios; vonAllmen, Paul

    2007-01-01

    A paper describes a computationally efficient method of optimizing trajectories of spacecraft driven by propulsion systems that generate low thrusts and, hence, must be operated for long times. A common goal in trajectory-optimization problems is to find minimum-time, minimum-fuel, or Pareto-optimal trajectories (here, Pareto-optimality signifies that no other solutions are superior with respect to both flight time and fuel consumption). The present method utilizes genetic and simulated-annealing algorithms to search for globally Pareto-optimal solutions. These algorithms are implemented in parallel form to reduce computation time. These algorithms are coupled with either of two traditional trajectory- design approaches called "direct" and "indirect." In the direct approach, thrust control is discretized in either arc time or arc length, and the resulting discrete thrust vectors are optimized. The indirect approach involves the primer-vector theory (introduced in 1963), in which the thrust control problem is transformed into a co-state control problem and the initial values of the co-state vector are optimized. In application to two example orbit-transfer problems, this method was found to generate solutions comparable to those of other state-of-the-art trajectory-optimization methods while requiring much less computation time.

  19. Optimization and in Vivo Validation of Peptide Vectors Targeting the LDL Receptor.

    PubMed

    Jacquot, Guillaume; Lécorché, Pascaline; Malcor, Jean-Daniel; Laurencin, Mathieu; Smirnova, Maria; Varini, Karine; Malicet, Cédric; Gassiot, Fanny; Abouzid, Karima; Faucon, Aude; David, Marion; Gaudin, Nicolas; Masse, Maxime; Ferracci, Géraldine; Dive, Vincent; Cisternino, Salvatore; Khrestchatisky, Michel

    2016-12-05

    Active targeting and delivery to pathophysiological organs of interest is of paramount importance to increase specific accumulation of therapeutic drugs or imaging agents while avoiding systemic side effects. We recently developed a family of new peptide ligands of the human and rodent LDL receptor (LDLR), an attractive cell-surface receptor with high uptake activity and local enrichment in several normal or pathological tissues (Malcor et al., J. Med. Chem. 2012, 55 (5), 2227). Initial chemical optimization of the 15-mer, all natural amino acid compound 1/VH411 (DSGL[CMPRLRGC] c DPR) and structure-activity relationship (SAR) investigation led to the cyclic 8 amino acid analogue compound 22/VH445 ([cMPRLRGC] c ) which specifically binds hLDLR with a K D of 76 nM and has an in vitro blood half-life of ∼3 h. Further introduction of non-natural amino acids led to the identification of compound 60/VH4106 ([(d)-"Pen"M"Thz"RLRGC] c ), which showed the highest K D value of 9 nM. However, this latter analogue displayed the lowest in vitro blood half-life (∼1.9 h). In the present study, we designed a new set of peptide analogues, namely, VH4127 to VH4131, with further improved biological properties. Detailed analysis of the hLDLR-binding kinetics of previous and new analogues showed that the latter all displayed very high on-rates, in the 10 6 s -1. M -1 range, and off-rates varying from the low 10 -2 s -1 to the 10 -1 s -1 range. Furthermore, all these new analogues showed increased blood half-lives in vitro, reaching ∼7 and 10 h for VH4129 and VH4131, respectively. Interestingly, we demonstrate in cell-based assays using both VH445 and the most balanced optimized analogue VH4127 ([cM"Thz"RLRG"Pen"] c ), showing a K D of 18 nM and a blood half-life of ∼4.3 h, that its higher on-rate correlated with a significant increase in both the extent of cell-surface binding to hLDLR and the endocytosis potential. Finally, intravenous injection of tritium-radiolabeled 3 H-VH4127 in wild-type or ldlr -/- mice confirmed their active LDLR targeting in vivo. Overall, this study extends our previous work toward a diversified portfolio of LDLR-targeted peptide vectors with validated LDLR-targeting potential in vivo.

  20. Applicability of initial optimal maternal and fetal electrocardiogram combination vectors to subsequent recordings

    NASA Astrophysics Data System (ADS)

    Yan, Hua-Wen; Huang, Xiao-Lin; Zhao, Ying; Si, Jun-Feng; Liu, Tie-Bing; Liu, Hong-Xing

    2014-11-01

    A series of experiments are conducted to confirm whether the vectors calculated for an early section of a continuous non-invasive fetal electrocardiogram (fECG) recording can be directly applied to subsequent sections in order to reduce the computation required for real-time monitoring. Our results suggest that it is generally feasible to apply the initial optimal maternal and fetal ECG combination vectors to extract the fECG and maternal ECG in subsequent recorded sections.

  1. Regolith-geology mapping with support vector machine: A case study over weathered Ni-bearing peridotites, New Caledonia

    NASA Astrophysics Data System (ADS)

    De Boissieu, Florian; Sevin, Brice; Cudahy, Thomas; Mangeas, Morgan; Chevrel, Stéphane; Ong, Cindy; Rodger, Andrew; Maurizot, Pierre; Laukamp, Carsten; Lau, Ian; Touraivane, Touraivane; Cluzel, Dominique; Despinoy, Marc

    2018-02-01

    Accurate maps of Earth's geology, especially its regolith, are required for managing the sustainable exploration and development of mineral resources. This paper shows how airborne imaging hyperspectral data collected over weathered peridotite rocks in vegetated, mountainous terrane in New Caledonia were processed using a combination of methods to generate a regolith-geology map that could be used for more efficiently targeting Ni exploration. The image processing combined two usual methods, which are spectral feature extraction and support vector machine (SVM). This rationale being the spectral features extraction can rapidly reduce data complexity by both targeting only the diagnostic mineral absorptions and masking those pixels complicated by vegetation, cloud and deep shade. SVM is a supervised classification method able to generate an optimal non-linear classifier with these features that generalises well even with limited training data. Key minerals targeted are serpentine, which is considered as an indicator for hydrolysed peridotitic rock, and iron oxy-hydroxides (hematite and goethite), which are considered as diagnostic of laterite development. The final classified regolith map was assessed against interpreted regolith field sites, which yielded approximately 70% similarity for all unit types, as well as against a regolith-geology map interpreted using traditional datasets (not hyperspectral imagery). Importantly, the hyperspectral derived mineral map provided much greater detail enabling a more precise understanding of the regolith-geological architecture where there are exposed soils and rocks.

  2. Gene-carried hepatoma targeting complex induced high gene transfection efficiency with low toxicity and significant antitumor activity.

    PubMed

    Zhao, Qing-Qing; Hu, Yu-Lan; Zhou, Yang; Li, Ni; Han, Min; Tang, Gu-Ping; Qiu, Feng; Tabata, Yasuhiko; Gao, Jian-Qing

    2012-01-01

    The success of gene transfection is largely dependent on the development of a vehicle or vector that can efficiently deliver a gene to cells with minimal toxicity. A liver cancer-targeted specific peptide (FQHPSF sequence) was successfully synthesized and linked with chitosan-linked polyethylenimine (CP) to form a new targeted gene delivery vector called CPT (CP/peptide). The structure of CPT was confirmed by (1)H nuclear magnetic resonance spectroscopy and ultraviolet spectrophotometry. The particle size of CPT/ DNA complexes was measured using laser diffraction spectrometry and the cytotoxicity of the copolymer was evaluated by methylthiazol tetrazolium method. The transfection efficiency evaluation of the CP copolymer was performed using luciferase activity assay. Cellular internalization of the CP/DNA complex was observed under confocal laser scanning microscopy. The targeting specificity of the polymer coupled to peptide was measured by competitive inhibition transfection study. The liver targeting specificity of the CPT copolymer in vivo was demonstrated by combining the copolymer with a therapeutic gene, interleukin-12, and assessed by its abilities in suppressing the growth of ascites tumor in mouse model. The results showed that the liver cancer-targeted specific peptide was successfully synthesized and linked with CP to form a new targeted gene delivery vector called CPT. The composition of CPT was confirmed and the vector showed low cytotoxicity and strong targeting specificity to liver tumors in vitro. The in vivo study results showed that interleukin-12 delivered by the new gene vector CPT/DNA significantly enhanced the antitumor effect on ascites tumor-bearing imprinting control region mice as compared with polyethylenimine (25 kDa), CP, and other controls, which further demonstrate the targeting specificity of the new synthesized polymer. The synthesized CPT copolymer was proven to be an effective liver cancer-targeted vector for therapeutic gene delivery, which could be a potential candidate for targeted cancer gene therapy.

  3. Optimal distribution of integration time for intensity measurements in Stokes polarimetry.

    PubMed

    Li, Xiaobo; Liu, Tiegen; Huang, Bingjing; Song, Zhanjie; Hu, Haofeng

    2015-10-19

    We consider the typical Stokes polarimetry system, which performs four intensity measurements to estimate a Stokes vector. We show that if the total integration time of intensity measurements is fixed, the variance of the Stokes vector estimator depends on the distribution of the integration time at four intensity measurements. Therefore, by optimizing the distribution of integration time, the variance of the Stokes vector estimator can be decreased. In this paper, we obtain the closed-form solution of the optimal distribution of integration time by employing Lagrange multiplier method. According to the theoretical analysis and real-world experiment, it is shown that the total variance of the Stokes vector estimator can be significantly decreased about 40% in the case discussed in this paper. The method proposed in this paper can effectively decrease the measurement variance and thus statistically improves the measurement accuracy of the polarimetric system.

  4. Null steering of adaptive beamforming using linear constraint minimum variance assisted by particle swarm optimization, dynamic mutated artificial immune system, and gravitational search algorithm.

    PubMed

    Darzi, Soodabeh; Kiong, Tiong Sieh; Islam, Mohammad Tariqul; Ismail, Mahamod; Kibria, Salehin; Salem, Balasem

    2014-01-01

    Linear constraint minimum variance (LCMV) is one of the adaptive beamforming techniques that is commonly applied to cancel interfering signals and steer or produce a strong beam to the desired signal through its computed weight vectors. However, weights computed by LCMV usually are not able to form the radiation beam towards the target user precisely and not good enough to reduce the interference by placing null at the interference sources. It is difficult to improve and optimize the LCMV beamforming technique through conventional empirical approach. To provide a solution to this problem, artificial intelligence (AI) technique is explored in order to enhance the LCMV beamforming ability. In this paper, particle swarm optimization (PSO), dynamic mutated artificial immune system (DM-AIS), and gravitational search algorithm (GSA) are incorporated into the existing LCMV technique in order to improve the weights of LCMV. The simulation result demonstrates that received signal to interference and noise ratio (SINR) of target user can be significantly improved by the integration of PSO, DM-AIS, and GSA in LCMV through the suppression of interference in undesired direction. Furthermore, the proposed GSA can be applied as a more effective technique in LCMV beamforming optimization as compared to the PSO technique. The algorithms were implemented using Matlab program.

  5. Null Steering of Adaptive Beamforming Using Linear Constraint Minimum Variance Assisted by Particle Swarm Optimization, Dynamic Mutated Artificial Immune System, and Gravitational Search Algorithm

    PubMed Central

    Sieh Kiong, Tiong; Tariqul Islam, Mohammad; Ismail, Mahamod; Salem, Balasem

    2014-01-01

    Linear constraint minimum variance (LCMV) is one of the adaptive beamforming techniques that is commonly applied to cancel interfering signals and steer or produce a strong beam to the desired signal through its computed weight vectors. However, weights computed by LCMV usually are not able to form the radiation beam towards the target user precisely and not good enough to reduce the interference by placing null at the interference sources. It is difficult to improve and optimize the LCMV beamforming technique through conventional empirical approach. To provide a solution to this problem, artificial intelligence (AI) technique is explored in order to enhance the LCMV beamforming ability. In this paper, particle swarm optimization (PSO), dynamic mutated artificial immune system (DM-AIS), and gravitational search algorithm (GSA) are incorporated into the existing LCMV technique in order to improve the weights of LCMV. The simulation result demonstrates that received signal to interference and noise ratio (SINR) of target user can be significantly improved by the integration of PSO, DM-AIS, and GSA in LCMV through the suppression of interference in undesired direction. Furthermore, the proposed GSA can be applied as a more effective technique in LCMV beamforming optimization as compared to the PSO technique. The algorithms were implemented using Matlab program. PMID:25147859

  6. Optimal Pitch Thrust-Vector Angle and Benefits for all Flight Regimes

    NASA Technical Reports Server (NTRS)

    Gilyard, Glenn B.; Bolonkin, Alexander

    2000-01-01

    The NASA Dryden Flight Research Center is exploring the optimum thrust-vector angle on aircraft. Simple aerodynamic performance models for various phases of aircraft flight are developed and optimization equations and algorithms are presented in this report. Results of optimal angles of thrust vectors and associated benefits for various flight regimes of aircraft (takeoff, climb, cruise, descent, final approach, and landing) are given. Results for a typical wide-body transport aircraft are also given. The benefits accruable for this class of aircraft are small, but the technique can be applied to other conventionally configured aircraft. The lower L/D aerodynamic characteristics of fighters generally would produce larger benefits than those produced for transport aircraft.

  7. Study on the influence factors of camouflage target polarization detection

    NASA Astrophysics Data System (ADS)

    Huang, Yanhua; Chen, Lei; Li, Xia; Wu, Wenyuan

    2016-10-01

    The degree of linear polarization (DOLP) expressions at any polarizer direction (PD) was deduced based on the Stokes vector and Mueller matrix. The outdoors experiments were carried out to demonstrate the expressions. This paper mainly explored the DOLP-image-Contrast (DOLPC) between the target image and the background image, and the PD and RGB waveband that be considered two important influence factors were studied for camouflage target polarization detection. It was found that the DOLPC of target and background was obviously higher than intensity image. When setting the reference direction that polarizer was perpendicular to the incident face, the DOLP image of interval angle 60 degree between PD and reference direction had relatively high DOLPC, the interval angle 45 degree was the second, and the interval angle 35 degree was the third. The outdoors polarization detection experiment of controlling waveband showed that the DOLPC results was significantly different to use 650nm, 550nm and 450nm waveband, and the polarization detection performance by using 650nm band was an optimization method.

  8. Nonlinear dynamics support a linear population code in a retinal target-tracking circuit.

    PubMed

    Leonardo, Anthony; Meister, Markus

    2013-10-23

    A basic task faced by the visual system of many organisms is to accurately track the position of moving prey. The retina is the first stage in the processing of such stimuli; the nature of the transformation here, from photons to spike trains, constrains not only the ultimate fidelity of the tracking signal but also the ease with which it can be extracted by other brain regions. Here we demonstrate that a population of fast-OFF ganglion cells in the salamander retina, whose dynamics are governed by a nonlinear circuit, serve to compute the future position of the target over hundreds of milliseconds. The extrapolated position of the target is not found by stimulus reconstruction but is instead computed by a weighted sum of ganglion cell outputs, the population vector average (PVA). The magnitude of PVA extrapolation varies systematically with target size, speed, and acceleration, such that large targets are tracked most accurately at high speeds, and small targets at low speeds, just as is seen in the motion of real prey. Tracking precision reaches the resolution of single photoreceptors, and the PVA algorithm performs more robustly than several alternative algorithms. If the salamander brain uses the fast-OFF cell circuit for target extrapolation as we suggest, the circuit dynamics should leave a microstructure on the behavior that may be measured in future experiments. Our analysis highlights the utility of simple computations that, while not globally optimal, are efficiently implemented and have close to optimal performance over a limited but ethologically relevant range of stimuli.

  9. Attitude Determination Using Two Vector Measurements

    NASA Technical Reports Server (NTRS)

    Markley, F. Landis

    1998-01-01

    Many spacecraft attitude determination methods use exactly two vector measurements. The two vectors are typically the unit vector to the Sun and the Earth's magnetic field vector for coarse "sun-mag" attitude determination or unit vectors to two stars tracked by two star trackers for fine attitude determination. TRIAD, the earliest published algorithm for determining spacecraft attitude from two vector measurements, has been widely used in both ground-based and onboard attitude determination. Later attitude determination methods have been based on Wahba's optimality criterion for n arbitrarily weighted observations. The solution of Wahba's problem is somewhat difficult in the general case, but there is a simple closed-form solution in the two-observation case. This solution reduces to the TRIAD solution for certain choices of measurement weights. This paper presents and compares these algorithms as well as sub-optimal algorithms proposed by Bar-Itzhack, Harman, and Reynolds. Some new results will be presented, but the paper is primarily a review and tutorial.

  10. Expression of chicken parvovirus VP2 in chicken embryo fibroblasts requires codon optimization for production of naked DNA and vectored meleagrid herpesvirus type 1 vaccines.

    PubMed

    Spatz, Stephen J; Volkening, Jeremy D; Mullis, Robert; Li, Fenglan; Mercado, John; Zsak, Laszlo

    2013-10-01

    Meleagrid herpesvirus type 1 (MeHV-1) is an ideal vector for the expression of antigens from pathogenic avian organisms in order to generate vaccines. Chicken parvovirus (ChPV) is a widespread infectious virus that causes serious disease in chickens. It is one of the etiological agents largely suspected in causing Runting Stunting Syndrome (RSS) in chickens. Initial attempts to express the wild-type gene encoding the capsid protein VP2 of ChPV by insertion into the thymidine kinase gene of MeHV-1 were unsuccessful. However, transient expression of a codon-optimized synthetic VP2 gene cloned into the bicistronic vector pIRES2-Ds-Red2, could be demonstrated by immunocytochemical staining of transfected chicken embryo fibroblasts (CEFs). Red fluorescence could also be detected in these transfected cells since the red fluorescent protein gene is downstream from the internal ribosome entry site (IRES). Strikingly, fluorescence could not be demonstrated in cells transiently transfected with the bicistronic vector containing the wild-type or non-codon-optimized VP2 gene. Immunocytochemical staining of these cells also failed to demonstrate expression of wild-type VP2, indicating that the lack of expression was at the RNA level and the VP2 protein was not toxic to CEFs. Chickens vaccinated with a DNA vaccine consisting of the bicistronic vector containing the codon-optimized VP2 elicited a humoral immune response as measured by a VP2-specific ELISA. This VP2 codon-optimized bicistronic cassette was rescued into the MeHV-1 genome generating a vectored vaccine against ChPV disease.

  11. The primer vector in linear, relative-motion equations. [spacecraft trajectory optimization

    NASA Technical Reports Server (NTRS)

    1980-01-01

    Primer vector theory is used in analyzing a set of linear, relative-motion equations - the Clohessy-Wiltshire equations - to determine the criteria and necessary conditions for an optimal, N-impulse trajectory. Since the state vector for these equations is defined in terms of a linear system of ordinary differential equations, all fundamental relations defining the solution of the state and costate equations, and the necessary conditions for optimality, can be expressed in terms of elementary functions. The analysis develops the analytical criteria for improving a solution by (1) moving any dependent or independent variable in the initial and/or final orbit, and (2) adding intermediate impulses. If these criteria are violated, the theory establishes a sufficient number of analytical equations. The subsequent satisfaction of these equations will result in the optimal position vectors and times of an N-impulse trajectory. The solution is examined for the specific boundary conditions of (1) fixed-end conditions, two-impulse, and time-open transfer; (2) an orbit-to-orbit transfer; and (3) a generalized rendezvous problem. A sequence of rendezvous problems is solved to illustrate the analysis and the computational procedure.

  12. Optimizing the method for generation of integration-free induced pluripotent stem cells from human peripheral blood.

    PubMed

    Gu, Haihui; Huang, Xia; Xu, Jing; Song, Lili; Liu, Shuping; Zhang, Xiao-Bing; Yuan, Weiping; Li, Yanxin

    2018-06-15

    Generation of induced pluripotent stem cells (iPSCs) from human peripheral blood provides a convenient and low-invasive way to obtain patient-specific iPSCs. The episomal vector is one of the best approaches for reprogramming somatic cells to pluripotent status because of its simplicity and affordability. However, the efficiency of episomal vector reprogramming of adult peripheral blood cells is relatively low compared with cord blood and bone marrow cells. In the present study, integration-free human iPSCs derived from peripheral blood were established via episomal technology. We optimized mononuclear cell isolation and cultivation, episomal vector promoters, and a combination of transcriptional factors to improve reprogramming efficiency. Here, we improved the generation efficiency of integration-free iPSCs from human peripheral blood mononuclear cells by optimizing the method of isolating mononuclear cells from peripheral blood, by modifying the integration of culture medium, and by adjusting the duration of culture time and the combination of different episomal vectors. With this optimized protocol, a valuable asset for banking patient-specific iPSCs has been established.

  13. Supervised non-negative tensor factorization for automatic hyperspectral feature extraction and target discrimination

    NASA Astrophysics Data System (ADS)

    Anderson, Dylan; Bapst, Aleksander; Coon, Joshua; Pung, Aaron; Kudenov, Michael

    2017-05-01

    Hyperspectral imaging provides a highly discriminative and powerful signature for target detection and discrimination. Recent literature has shown that considering additional target characteristics, such as spatial or temporal profiles, simultaneously with spectral content can greatly increase classifier performance. Considering these additional characteristics in a traditional discriminative algorithm requires a feature extraction step be performed first. An example of such a pipeline is computing a filter bank response to extract spatial features followed by a support vector machine (SVM) to discriminate between targets. This decoupling between feature extraction and target discrimination yields features that are suboptimal for discrimination, reducing performance. This performance reduction is especially pronounced when the number of features or available data is limited. In this paper, we propose the use of Supervised Nonnegative Tensor Factorization (SNTF) to jointly perform feature extraction and target discrimination over hyperspectral data products. SNTF learns a tensor factorization and a classification boundary from labeled training data simultaneously. This ensures that the features learned via tensor factorization are optimal for both summarizing the input data and separating the targets of interest. Practical considerations for applying SNTF to hyperspectral data are presented, and results from this framework are compared to decoupled feature extraction/target discrimination pipelines.

  14. Estimation of Target Angular Position Under Mainbeam Jamming Conditions,

    DTIC Science & Technology

    1995-12-01

    technique, Multiple Signal Classification ( MUSIC ), is used to estimate the target Direction Of Arrival (DOA) from the processed data vectors. The model...used in the MUSIC technique takes into account the fact that the jammer has been cancelled in the target data vector. The performance of this algorithm

  15. An improved Red/ET recombineering system and mouse ES cells culture conditions for the generation of targeted mutant mice.

    PubMed

    Kumagai, Katsuyoshi; Takanashi, Masakatsu; Ohno, Shin-Ichiro; Kuroda, Masahiko; Sudo, Katsuko

    2017-05-03

    Targeted mutant mice generated on a C57BL/6 background are powerful tools for analysis of the biological functions of genes, and gene targeting technologies using mouse embryonic stem (ES) cells have been used to generate such mice. Recently, a bacterial artificial chromosome (BAC) recombineering system was established for the construction of targeting vectors. However, gene retrieval from BACs for the generation of gene targeting vectors using this system remains difficult. Even when construction of a gene targeting vector is successful, the efficiency of production of targeted mutant mice from ES cells derived from C57BL/6 mice are poor. Therefore, in this study, we first improved the strategy for the retrieval of genes from BACs and their transfer into a DT-A plasmid, for the generation of gene targeting vectors using the BAC recombineering system. Then, we attempted to generate targeted mutant mice from ES cell lines derived from C57BL/6 mice, by culturing in serum-free medium. In conclusion, we established an improved strategy for the efficient generation of targeted mutant mice on a C57BL/6 background, which are useful for the in vivo analysis of gene functions and regulation.

  16. [The preparation of recombinant adenovirus Ad-Rad50-GFP and detection of the optimal multiplicity of infection in CNE1 transfected hv Ad-Rad50-GFP].

    PubMed

    Yan, Ruicheng; Huang, Jiancong; Zhu, Ling; Chang, Lihong; Li, Jingjia; Wu, Xifu; Ye, Jin; Zhang, Gehua

    2015-12-01

    The optimal multiplicity of infection (MOI) of the recombinant adenovirus Ad-Rad50-GFP carrying a mutant Rad50 gene expression region on the cell growth of nasopharyngeal carcinoma and the viral amplification efficiency of CNE1 cell infected by this adenovirus were studied. The biological titer of Ad-Rad50-GFP was measured by end point dilution method. The impact of recombinant adenoviral vector transfection on the growth of CNE1 cells was observed by cell growth curve. Transfection efficacy of recombinant adenoviral vector was observed and calculated through fluorescence microscope. The expression f mutant Rad50 in the Ad-Rad50-GFP transfected CNE1 cells with optimal MOI was detected by Western Blot after transfection. The biological titer of Ad-Rad50-GFP was 1.26 x 10¹¹ pfu/ml. CNE1 cell growth was not influenced significantly as they were transfected by recombinant adenoviral vector with MOI less than 50. Transfection efficacy of recombinant adenoviral vector was most salient at 24 hours after transfection, with the high expression of mutant Rad50, and the efficiency still remained about 70% after 72 hours. Recombinant adenoviral vector Ad-Rad50-GFP could transfect CNE1 cells as well as result in the expression of mutant Rad50 in CNE1 cells effectively. MOI = 50 was the optimal multiplicity of infection of CNE1 cells transfected by recombinant adenoviral vector Ad-Rad50-GFP.

  17. Dose-dependent Toxicity of Humanized Renilla reniformis GFP (hrGFP) Limits Its Utility as a Reporter Gene in Mouse Muscle.

    PubMed

    Wallace, Lindsay M; Moreo, Andrew; Clark, K Reed; Harper, Scott Q

    2013-04-16

    Gene therapy has historically focused on delivering protein-coding genes to target cells or tissues using a variety of vectors. In recent years, the field has expanded to include gene-silencing strategies involving delivery of noncoding inhibitory RNAs, such as short hairpin RNAs or microRNAs (miRNAs). Often called RNA interference (RNAi) triggers, these small inhibitory RNAs are difficult or impossible to visualize in living cells or tissues. To circumvent this detection problem and ensure efficient delivery in preclinical studies, vectors can be engineered to coexpress a fluorescent reporter gene to serve as a marker of transduction. In this study, we set out to optimize adeno-associated viral (AAV) vectors capable of delivering engineered miRNAs and green fluorescent protein (GFP) reporter genes to skeletal muscle. Although the more broadly utilized enhanced GFP (eGFP) gene derived from the jellyfish, Aequorea victoria was a conventional choice, we were concerned about some previous studies suggesting this protein was myotoxic. We thus opted to test vectors carrying the humanized Renilla reniformis-derived GFP (hrGFP) gene, which has not seen as extensive usage as eGFP but was purported to be a safer and less cytotoxic alternative. Employing AAV6 vector dosages typically used in preclinical gene transfer studies (3×10(10) -1 × 10(11) particles), we found that hrGFP caused dose-dependent myopathy when delivered to wild-type (wt) mouse muscle, whereas identical titers of AAV6 carrying eGFP were relatively benign. Dose de-escalation at or below 8 × 10(9) AAV particles effectively reduced or eliminated hrGFP-associated myotoxicity, but also had dampening effects on green fluorescence and miRNA-mediated gene silencing in whole muscles. We conclude that hrGFP is impractical for use as a transduction marker in preclinical, AAV-based RNA interference therapy studies where adult mouse muscle is the target organ. Moreover, our data support that eGFP is superior to hrGFP as a reporter gene in mouse muscle. These results may impact the design of future preclinical gene therapy studies targeting muscles and non-muscle tissues alike.Molecular Therapy - Nucleic Acids (2013) 2, e86; doi:10.1038/mtna.2013.16; published online 16 April 2013.

  18. Balancing aggregation and smoothing errors in inverse models

    DOE PAGES

    Turner, A. J.; Jacob, D. J.

    2015-06-30

    Inverse models use observations of a system (observation vector) to quantify the variables driving that system (state vector) by statistical optimization. When the observation vector is large, such as with satellite data, selecting a suitable dimension for the state vector is a challenge. A state vector that is too large cannot be effectively constrained by the observations, leading to smoothing error. However, reducing the dimension of the state vector leads to aggregation error as prior relationships between state vector elements are imposed rather than optimized. Here we present a method for quantifying aggregation and smoothing errors as a function ofmore » state vector dimension, so that a suitable dimension can be selected by minimizing the combined error. Reducing the state vector within the aggregation error constraints can have the added advantage of enabling analytical solution to the inverse problem with full error characterization. We compare three methods for reducing the dimension of the state vector from its native resolution: (1) merging adjacent elements (grid coarsening), (2) clustering with principal component analysis (PCA), and (3) applying a Gaussian mixture model (GMM) with Gaussian pdfs as state vector elements on which the native-resolution state vector elements are projected using radial basis functions (RBFs). The GMM method leads to somewhat lower aggregation error than the other methods, but more importantly it retains resolution of major local features in the state vector while smoothing weak and broad features.« less

  19. Balancing aggregation and smoothing errors in inverse models

    NASA Astrophysics Data System (ADS)

    Turner, A. J.; Jacob, D. J.

    2015-01-01

    Inverse models use observations of a system (observation vector) to quantify the variables driving that system (state vector) by statistical optimization. When the observation vector is large, such as with satellite data, selecting a suitable dimension for the state vector is a challenge. A state vector that is too large cannot be effectively constrained by the observations, leading to smoothing error. However, reducing the dimension of the state vector leads to aggregation error as prior relationships between state vector elements are imposed rather than optimized. Here we present a method for quantifying aggregation and smoothing errors as a function of state vector dimension, so that a suitable dimension can be selected by minimizing the combined error. Reducing the state vector within the aggregation error constraints can have the added advantage of enabling analytical solution to the inverse problem with full error characterization. We compare three methods for reducing the dimension of the state vector from its native resolution: (1) merging adjacent elements (grid coarsening), (2) clustering with principal component analysis (PCA), and (3) applying a Gaussian mixture model (GMM) with Gaussian pdfs as state vector elements on which the native-resolution state vector elements are projected using radial basis functions (RBFs). The GMM method leads to somewhat lower aggregation error than the other methods, but more importantly it retains resolution of major local features in the state vector while smoothing weak and broad features.

  20. Balancing aggregation and smoothing errors in inverse models

    NASA Astrophysics Data System (ADS)

    Turner, A. J.; Jacob, D. J.

    2015-06-01

    Inverse models use observations of a system (observation vector) to quantify the variables driving that system (state vector) by statistical optimization. When the observation vector is large, such as with satellite data, selecting a suitable dimension for the state vector is a challenge. A state vector that is too large cannot be effectively constrained by the observations, leading to smoothing error. However, reducing the dimension of the state vector leads to aggregation error as prior relationships between state vector elements are imposed rather than optimized. Here we present a method for quantifying aggregation and smoothing errors as a function of state vector dimension, so that a suitable dimension can be selected by minimizing the combined error. Reducing the state vector within the aggregation error constraints can have the added advantage of enabling analytical solution to the inverse problem with full error characterization. We compare three methods for reducing the dimension of the state vector from its native resolution: (1) merging adjacent elements (grid coarsening), (2) clustering with principal component analysis (PCA), and (3) applying a Gaussian mixture model (GMM) with Gaussian pdfs as state vector elements on which the native-resolution state vector elements are projected using radial basis functions (RBFs). The GMM method leads to somewhat lower aggregation error than the other methods, but more importantly it retains resolution of major local features in the state vector while smoothing weak and broad features.

  1. Oncolytic Adenovirus: Strategies and Insights for Vector Design and Immuno-Oncolytic Applications

    PubMed Central

    Uusi-Kerttula, Hanni; Hulin-Curtis, Sarah; Davies, James; Parker, Alan L.

    2015-01-01

    Adenoviruses (Ad) are commonly used both experimentally and clinically, including oncolytic virotherapy applications. In the clinical area, efficacy is frequently hampered by the high rates of neutralizing immunity, estimated as high as 90% in some populations that promote vector clearance and limit bioavailability for tumor targeting following systemic delivery. Active tumor targeting is also hampered by the ubiquitous nature of the Ad5 receptor, hCAR, as well as the lack of highly tumor-selective targeting ligands and suitable targeting strategies. Furthermore, significant off-target interactions between the viral vector and cellular and proteinaceous components of the bloodstream have been documented that promote uptake into non-target cells and determine dose-limiting toxicities. Novel strategies are therefore needed to overcome the obstacles that prevent efficacious Ad deployment for wider clinical applications. The use of less seroprevalent Ad serotypes, non-human serotypes, capsid pseudotyping, chemical shielding and genetic masking by heterologous peptide incorporation are all potential strategies to achieve efficient vector escape from humoral immune recognition. Conversely, selective vector arming with immunostimulatory agents can be utilized to enhance their oncolytic potential by activation of cancer-specific immune responses against the malignant tissues. This review presents recent advantages and pitfalls occurring in the field of adenoviral oncolytic therapies. PMID:26610547

  2. Genetic stability of gene targeted immunoglobulin loci. I. Heavy chain isotype exchange induced by a universal gene replacement vector.

    PubMed Central

    Kardinal, C; Selmayr, M; Mocikat, R

    1996-01-01

    Gene targeting at the immunoglobulin loci of B cells is an efficient tool for studying immunoglobulin expression or generating chimeric antibodies. We have shown that vector integration induced by human immunoglobulin G1 (IgG1) insertion vectors results in subsequent vector excision mediated by the duplicated target sequence, whereas replacement events which could be induced by the same constructs remain stable. We could demonstrate that the distribution of the vector homology strongly influences the genetic stability obtained. To this end we developed a novel type of a heavy chain replacement vector making use of the heavy chain class switch recombination sequence. Despite the presence of a two-sided homology this construct is universally applicable irrespective of the constant gene region utilized by the B cell. In comparison to an integration vector the frequency of stable incorporation was strongly increased, but we still observed vector excision, although at a markedly reduced rate. The latter events even occurred with circular constructs. Linearization of the construct at various sites and the comparison with an integration vector that carries the identical homology sequence, but differs in the distribution of homology, revealed the following features of homologous recombination of immunoglobulin genes: (i) the integration frequency is only determined by the length of the homology flank where the cross-over takes place; (ii) a 5' flank that does not meet the minimum requirement of homology length cannot be complemented by a sufficient 3' flank; (iii) free vector ends play a role for integration as well as for replacement targeting; (iv) truncating recombination events are suppressed in the presence of two flanks. Furthermore, we show that the switch region that was used as 3' flank is non-functional in an inverted orientation. Images Figure 2 PMID:8958041

  3. Genetic stability of gene targeted immunoglobulin loci. I. Heavy chain isotype exchange induced by a universal gene replacement vector.

    PubMed

    Kardinal, C; Selmayr, M; Mocikat, R

    1996-11-01

    Gene targeting at the immunoglobulin loci of B cells is an efficient tool for studying immunoglobulin expression or generating chimeric antibodies. We have shown that vector integration induced by human immunoglobulin G1 (IgG1) insertion vectors results in subsequent vector excision mediated by the duplicated target sequence, whereas replacement events which could be induced by the same constructs remain stable. We could demonstrate that the distribution of the vector homology strongly influences the genetic stability obtained. To this end we developed a novel type of a heavy chain replacement vector making use of the heavy chain class switch recombination sequence. Despite the presence of a two-sided homology this construct is universally applicable irrespective of the constant gene region utilized by the B cell. In comparison to an integration vector the frequency of stable incorporation was strongly increased, but we still observed vector excision, although at a markedly reduced rate. The latter events even occurred with circular constructs. Linearization of the construct at various sites and the comparison with an integration vector that carries the identical homology sequence, but differs in the distribution of homology, revealed the following features of homologous recombination of immunoglobulin genes: (i) the integration frequency is only determined by the length of the homology flank where the cross-over takes place; (ii) a 5' flank that does not meet the minimum requirement of homology length cannot be complemented by a sufficient 3' flank; (iii) free vector ends play a role for integration as well as for replacement targeting; (iv) truncating recombination events are suppressed in the presence of two flanks. Furthermore, we show that the switch region that was used as 3' flank is non-functional in an inverted orientation.

  4. Recent Advances in Non-viral Vectors for Gene Delivery

    PubMed Central

    Guo, Xia; Huang, Leaf

    2011-01-01

    CONSPECTUS Non-viral vectors, typically based on cationic lipids or polymers, are preferred due to safety concerns with viral vectors. So far, non-viral vectors can proficiently transfect cells in culture, but obtaining efficient nanomedicines is far from evident. To overcome the hurdles associated with non-viral vectors is significant for improving delivery efficiency and therapeutic effect of nucleic acid. The drawbacks include the strong interaction of cationic delivery vehicles with blood components, uptake by the reticuloendothelial system (RES), toxicity, targeting ability of the carriers to the cells of interest, and so on. PEGylation is the predominant method used to reduce the binding of plasma proteins with non-viral vectors and minimize the clearance by RES after intravenous administration. The nanoparticles that are not rapidly cleared from the circulation accumulate in the tumors due to the enhanced permeability and retention effect, and the targeting ligands attached to the distal end of the PEGylated components allow binding to the receptors on the target cell surface. Neutral or anionic liposomes have been also developed for systemic delivery of nucleic acids in experimental animal model. Designing and synthesizing novel cationic lipids and polymers, and binding nucleic acid with peptides, targeting ligands, polymers, or environmentally sensitive moieties also attract many attentions for resolving the problems encountered by non-viral vectors. The application of inorganic nanoparticles in nucleic acid delivery is an emerging field, too. Recently, different classes of non-viral vectors appear to be converging and the features of different classes of non-viral vectors could be combined in one strategy. More hurdles associated with efficient nucleic acid delivery therefore might be expected to be overcome. In this account, we will focus on these novel non-viral vectors, which are classified into multifunctional hybrid nucleic acid vectors, novel membrane/core nanoparticles for nucleic acid delivery and ultrasound-responsive nucleic acid vectors. The systemic delivery studies are highlighted. Finally, we bring forward the prospect for nucleic acid delivery. We think a better understandings of the fate of the nanoparticles inside the cell and of the interactions between the parts of hybrid particles will lead to a delivery system suitable for clinical use. We also underscore the value of sustained release of nucleic acid and presume making vectors targeted to cells with sustained release in vivo should be an interesting research challenge. PMID:21870813

  5. [Progress in application of targeting viral vector regulated by microRNA in gene therapy: a review].

    PubMed

    Zhang, Guohai; Wang, Qizhao; Zhang, Jinghong; Xu, Ruian

    2010-06-01

    A safe and effective targeting viral vector is the key factor for successful clinical gene therapy. microRNA, a class of small, single-stranded endogenous RNAs, act as post-transcriptional regulators of gene expression. The discovery of these kind regulatory elements provides a new approach to regulate gene expression more accurately. In this review, we elucidated the principle of microRNA in regulation of targeting viral vector. The applications of microRNA in the fields of elimination contamination from replication competent virus, reduction of transgene-specific immunity, promotion of cancer-targeted gene therapy and development of live attenuated vaccines were also discussed.

  6. A biologically inspired neural net for trajectory formation and obstacle avoidance.

    PubMed

    Glasius, R; Komoda, A; Gielen, S C

    1996-06-01

    In this paper we present a biologically inspired two-layered neural network for trajectory formation and obstacle avoidance. The two topographically ordered neural maps consist of analog neurons having continuous dynamics. The first layer, the sensory map, receives sensory information and builds up an activity pattern which contains the optimal solution (i.e. shortest path without collisions) for any given set of current position, target positions and obstacle positions. Targets and obstacles are allowed to move, in which case the activity pattern in the sensory map will change accordingly. The time evolution of the neural activity in the second layer, the motor map, results in a moving cluster of activity, which can be interpreted as a population vector. Through the feedforward connections between the two layers, input of the sensory map directs the movement of the cluster along the optimal path from the current position of the cluster to the target position. The smooth trajectory is the result of the intrinsic dynamics of the network only. No supervisor is required. The output of the motor map can be used for direct control of an autonomous system in a cluttered environment or for control of the actuators of a biological limb or robot manipulator. The system is able to reach a target even in the presence of an external perturbation. Computer simulations of a point robot and a multi-joint manipulator illustrate the theory.

  7. Comparison of three different detectors applied to synthetic aperture radar data

    NASA Astrophysics Data System (ADS)

    Ranney, Kenneth I.; Khatri, Hiralal; Nguyen, Lam H.

    2002-08-01

    The U.S. Army Research Laboratory has investigated the relative performance of three different target detection paradigms applied to foliage penetration (FOPEN) synthetic aperture radar (SAR) data. The three detectors - a quadratic polynomial discriminator (QPD), Bayesian neural network (BNN) and a support vector machine (SVM) - utilize a common collection of statistics (feature values) calculated from the fully polarimetric FOPEN data. We describe the parametric variations required as part of the algorithm optimizations, and we present the relative performance of the detectors in terms of probability of false alarm (Pfa) and probability of detection (Pd).

  8. Recent advances in genetic modification of adenovirus vectors for cancer treatment.

    PubMed

    Yamamoto, Yuki; Nagasato, Masaki; Yoshida, Teruhiko; Aoki, Kazunori

    2017-05-01

    Adenoviruses are widely used to deliver genes to a variety of cell types and have been used in a number of clinical trials for gene therapy and oncolytic virotherapy. However, several concerns must be addressed for the clinical use of adenovirus vectors. Selective delivery of a therapeutic gene by adenovirus vectors to target cancer is precluded by the widespread distribution of the primary cellular receptors. The systemic administration of adenoviruses results in hepatic tropism independent of the primary receptors. Adenoviruses induce strong innate and acquired immunity in vivo. Furthermore, several modifications to these vectors are necessary to enhance their oncolytic activity and ensure patient safety. As such, the adenovirus genome has been engineered to overcome these problems. The first part of the present review outlines recent progress in the genetic modification of adenovirus vectors for cancer treatment. In addition, several groups have recently developed cancer-targeting adenovirus vectors by using libraries that display random peptides on a fiber knob. Pancreatic cancer-targeting sequences have been isolated, and these oncolytic vectors have been shown by our group to be associated with a higher gene transduction efficiency and more potent oncolytic activity in cell lines, murine models, and surgical specimens of pancreatic cancer. In the second part of this review, we explain that combining cancer-targeting strategies can be a promising approach to increase the clinical usefulness of oncolytic adenovirus vectors. © 2017 The Authors. Cancer Science published by John Wiley & Sons Australia, Ltd on behalf of Japanese Cancer Association.

  9. Optimization of a Diaphragm for a Micro-Shock Tube-Based Drug Delivery Method

    PubMed Central

    Rathod, Vivek T.; Mahapatra, Debiprosad Roy

    2017-01-01

    This paper presents the design optimization of diaphragms for a micro-shock tube-based drug delivery device. The function of the diaphragm is to impart the required velocity and direction to the loosely held drug particles on the diaphragm through van der Waals interaction. The finite element model-based studies involved diaphragms made up of copper, brass and aluminium. The study of the influence of material and geometric parameters serves as a vital tool in optimizing the magnitude and direction of velocity distribution on the diaphragm surface. Experiments carried out using a micro-shock tube validate the final deformed shape of the diaphragms determined from the finite element simulation. The diaphragm yields a maximum velocity of 335 m/s for which the maximum deviation of the velocity vector is 0.62°. Drug particles that travel to the destination target tissue are simulated using the estimated velocity distribution and angular deviation. Further, a theoretical model of penetration helps in the prediction of the drug particle penetration in the skin tissue like a target, which is found to be 0.126 mm. The design and calibration procedure of a micro-shock tube device to alter drug particle penetration considering the skin thickness and property are presented. PMID:28952503

  10. Modified spin-wave theory with ordering vector optimization: spatially anisotropic triangular lattice and J1J2J3 model with Heisenberg interactions

    NASA Astrophysics Data System (ADS)

    Hauke, Philipp; Roscilde, Tommaso; Murg, Valentin; Cirac, J. Ignacio; Schmied, Roman

    2011-07-01

    We study the ground-state phases of the S=1/2 Heisenberg quantum antiferromagnet on the spatially anisotropic triangular lattice (SATL) and on the square lattice with up to next-next-nearest-neighbor coupling (the J1J2J3 model), making use of Takahashi's modified spin-wave (MSW) theory supplemented by ordering vector optimization. We compare the MSW results with exact diagonalization and projected-entangled-pair-states calculations, demonstrating their qualitative and quantitative reliability. We find that the MSW theory correctly accounts for strong quantum effects on the ordering vector of the magnetic phases of the models under investigation: in particular, collinear magnetic order is promoted at the expense of non-collinear (spiral) order, and several spiral states that are stable at the classical level disappear from the quantum phase diagram. Moreover, collinear states and non-collinear ones are never connected continuously, but they are separated by parameter regions in which the MSW theory breaks down, signaling the possible appearance of a non-magnetic ground state. In the case of the SATL, a large breakdown region appears also for weak couplings between the chains composing the lattice, suggesting the possible occurrence of a large non-magnetic region continuously connected with the spin-liquid state of the uncoupled chains. This shows that the MSW theory is—despite its apparent simplicity—a versatile tool for finding candidate regions in the case of spin-liquid phases, which are among prime targets for relevant quantum simulations.

  11. SSE-based Thomas algorithm for quasi-block-tridiagonal linear equation systems, optimized for small dense blocks

    NASA Astrophysics Data System (ADS)

    Barnaś, Dawid; Bieniasz, Lesław K.

    2017-07-01

    We have recently developed a vectorized Thomas solver for quasi-block tridiagonal linear algebraic equation systems using Streaming SIMD Extensions (SSE) and Advanced Vector Extensions (AVX) in operations on dense blocks [D. Barnaś and L. K. Bieniasz, Int. J. Comput. Meth., accepted]. The acceleration caused by vectorization was observed for large block sizes, but was less satisfactory for small blocks. In this communication we report on another version of the solver, optimized for small blocks of size up to four rows and/or columns.

  12. Genetic modification of hematopoietic cells using retroviral and lentiviral vectors: safety considerations for vector design and delivery into target cells.

    PubMed

    Dropulic, Boro

    2005-07-01

    The recent development of leukemia in three patients following retroviral vector gene transfer in hematopoietic stem cells, resulting in the death of one patient, has raised safety concerns for the use of integrating gene transfer vectors for human gene therapy. This review discusses these serious adverse events from the perspective of whether restrictions on vector design and vector-modified target cells are warranted at this time. A case is made against presently establishing specific restrictions for vector design and transduced cells; rather, their safety should be ascertained by empiric evaluation in appropriate preclinical models on a case-by-case basis. Such preclinical data, coupled with proper informed patient consent and a risk-benefit ratio analysis, provide the best available prospective evaluation of gene transfer vectors prior to their translation into the clinic.

  13. P and M gene junction is the optimal insertion site in Newcastle disease virus vaccine vector for foreign gene expression

    USDA-ARS?s Scientific Manuscript database

    Newcastle disease virus (NDV) has been developed as a vector for vaccine and gene therapy purposes. However, the optimal insertion site for foreign gene expression remained to be determined. In the present study, we inserted the green fluorescence protein (GFP) gene into five different intergenic ...

  14. "RCL-Pooling Assay": A Simplified Method for the Detection of Replication-Competent Lentiviruses in Vector Batches Using Sequential Pooling.

    PubMed

    Corre, Guillaume; Dessainte, Michel; Marteau, Jean-Brice; Dalle, Bruno; Fenard, David; Galy, Anne

    2016-02-01

    Nonreplicative recombinant HIV-1-derived lentiviral vectors (LV) are increasingly used in gene therapy of various genetic diseases, infectious diseases, and cancer. Before they are used in humans, preparations of LV must undergo extensive quality control testing. In particular, testing of LV must demonstrate the absence of replication-competent lentiviruses (RCL) with suitable methods, on representative fractions of vector batches. Current methods based on cell culture are challenging because high titers of vector batches translate into high volumes of cell culture to be tested in RCL assays. As vector batch size and titers are continuously increasing because of the improvement of production and purification methods, it became necessary for us to modify the current RCL assay based on the detection of p24 in cultures of indicator cells. Here, we propose a practical optimization of this method using a pairwise pooling strategy enabling easier testing of higher vector inoculum volumes. These modifications significantly decrease material handling and operator time, leading to a cost-effective method, while maintaining optimal sensibility of the RCL testing. This optimized "RCL-pooling assay" ameliorates the feasibility of the quality control of large-scale batches of clinical-grade LV while maintaining the same sensitivity.

  15. Confidence level estimation in multi-target classification problems

    NASA Astrophysics Data System (ADS)

    Chang, Shi; Isaacs, Jason; Fu, Bo; Shin, Jaejeong; Zhu, Pingping; Ferrari, Silvia

    2018-04-01

    This paper presents an approach for estimating the confidence level in automatic multi-target classification performed by an imaging sensor on an unmanned vehicle. An automatic target recognition algorithm comprised of a deep convolutional neural network in series with a support vector machine classifier detects and classifies targets based on the image matrix. The joint posterior probability mass function of target class, features, and classification estimates is learned from labeled data, and recursively updated as additional images become available. Based on the learned joint probability mass function, the approach presented in this paper predicts the expected confidence level of future target classifications, prior to obtaining new images. The proposed approach is tested with a set of simulated sonar image data. The numerical results show that the estimated confidence level provides a close approximation to the actual confidence level value determined a posteriori, i.e. after the new image is obtained by the on-board sensor. Therefore, the expected confidence level function presented in this paper can be used to adaptively plan the path of the unmanned vehicle so as to optimize the expected confidence levels and ensure that all targets are classified with satisfactory confidence after the path is executed.

  16. Ontology Sparse Vector Learning Algorithm for Ontology Similarity Measuring and Ontology Mapping via ADAL Technology

    NASA Astrophysics Data System (ADS)

    Gao, Wei; Zhu, Linli; Wang, Kaiyun

    2015-12-01

    Ontology, a model of knowledge representation and storage, has had extensive applications in pharmaceutics, social science, chemistry and biology. In the age of “big data”, the constructed concepts are often represented as higher-dimensional data by scholars, and thus the sparse learning techniques are introduced into ontology algorithms. In this paper, based on the alternating direction augmented Lagrangian method, we present an ontology optimization algorithm for ontological sparse vector learning, and a fast version of such ontology technologies. The optimal sparse vector is obtained by an iterative procedure, and the ontology function is then obtained from the sparse vector. Four simulation experiments show that our ontological sparse vector learning model has a higher precision ratio on plant ontology, humanoid robotics ontology, biology ontology and physics education ontology data for similarity measuring and ontology mapping applications.

  17. Targeted Adenoviral Vector Demonstrates Enhanced Efficacy for In Vivo Gene Therapy of Uterine Leiomyoma

    PubMed Central

    Abdelaziz, Mohamed; Sherif, Lotfy; ElKhiary, Mostafa; Nair, Sanjeeta; Shalaby, Shahinaz; Mohamed, Sara; Eziba, Noura; El-Lakany, Mohamed; Curiel, David; Ismail, Nahed; Diamond, Michael P.; Al-Hendy, Ayman

    2016-01-01

    Background: Gene therapy is a potentially effective non-surgical approach for the treatment of uterine leiomyoma. We demonstrated that targeted adenovirus vector, Ad-SSTR-RGD-TK/GCV, was highly effective in selectively inducing apoptosis and inhibiting proliferation of human leiomyoma cells in vitro while sparing normal myometrial cells. Study design: An in-vivo study, to compare efficacy and safety of modified adenovirus vector Ad-SSTR-RGD-TK/GCV versus untargeted vector for treatment of leiomyoma. Materials and methods: Female nude mice were implanted with rat leiomyoma cells subcutaneously. Then mice were randomized into three groups. Group 1 received Ad-LacZ (marker gene), Group 2 received untargeted Ad-TK, and Group 3 received the targeted Ad-SSTR-RGD-TK. Tumors were measured weekly for 4 weeks. Then mice were sacrificed and tissue samples were collected. Evaluation of markers of apoptosis, proliferation, extracellular matrix, and angiogenesis was performed using Western Blot & Immunohistochemistry. Statistical analysis was done using ANOVA. Dissemination of adenovirus was assessed by PCR. Results: In comparison with the untargeted vector, the targeted adenoviral vector significantly shrank leiomyoma size (P < 0.05), reduced expression of proliferation marker (PCNA) (P < 0.05), induced expression of apoptotic protein, c-PARP-1, (P < 0.05) and inhibited expression of extracellular matrix-related genes (TGF beta 3) and angiogenesis-related genes (VEGF & IGF-1) (P < 0.01). There were no detectable adenovirus in tested tissues other than leiomyoma lesions with both targeted and untargeted adenovirus. Conclusion: Targeted adenovirus, effectively reduces tumor size in leiomyoma without dissemination to other organs. Further evaluation of this localized targeted strategy for gene therapy is needed in appropriate preclinical humanoid animal models in preparation for a future pilot human trial. PMID:26884457

  18. Targeted Adenoviral Vector Demonstrates Enhanced Efficacy for In Vivo Gene Therapy of Uterine Leiomyoma.

    PubMed

    Abdelaziz, Mohamed; Sherif, Lotfy; ElKhiary, Mostafa; Nair, Sanjeeta; Shalaby, Shahinaz; Mohamed, Sara; Eziba, Noura; El-Lakany, Mohamed; Curiel, David; Ismail, Nahed; Diamond, Michael P; Al-Hendy, Ayman

    2016-04-01

    Gene therapy is a potentially effective non-surgical approach for the treatment of uterine leiomyoma. We demonstrated that targeted adenovirus vector, Ad-SSTR-RGD-TK/GCV, was highly effective in selectively inducing apoptosis and inhibiting proliferation of human leiomyoma cells in vitro while sparing normal myometrial cells. An in-vivo study, to compare efficacy and safety of modified adenovirus vector Ad-SSTR-RGD-TK/GCV versus untargeted vector for treatment of leiomyoma. Female nude mice were implanted with rat leiomyoma cells subcutaneously. Then mice were randomized into three groups. Group 1 received Ad-LacZ (marker gene), Group 2 received untargeted Ad-TK, and Group 3 received the targeted Ad-SSTR-RGD-TK. Tumors were measured weekly for 4 weeks. Then mice were sacrificed and tissue samples were collected. Evaluation of markers of apoptosis, proliferation, extracellular matrix, and angiogenesis was performed using Western Blot & Immunohistochemistry. Statistical analysis was done using ANOVA. Dissemination of adenovirus was assessed by PCR. In comparison with the untargeted vector, the targeted adenoviral vector significantly shrank leiomyoma size (P < 0.05), reduced expression of proliferation marker (PCNA) (P < 0.05), induced expression of apoptotic protein, c-PARP-1, (P < 0.05) and inhibited expression of extracellular matrix-related genes (TGF beta 3) and angiogenesis-related genes (VEGF & IGF-1) (P < 0.01). There were no detectable adenovirus in tested tissues other than leiomyoma lesions with both targeted and untargeted adenovirus. Targeted adenovirus, effectively reduces tumor size in leiomyoma without dissemination to other organs. Further evaluation of this localized targeted strategy for gene therapy is needed in appropriate preclinical humanoid animal models in preparation for a future pilot human trial. © The Author(s) 2016.

  19. The prospect of gene therapy for prostate cancer: update on theory and status.

    PubMed

    Koeneman, K S; Hsieh, J T

    2001-09-01

    Molecularly based novel therapeutic agents are needed to address the problem of locally recurrent, or metastatic, advanced hormone-refractory prostate cancer. Recent basic science advances in mechanisms of gene expression, vector delivery, and targeting have rendered clinically relevant gene therapy to the prostatic fossa and distant sites feasible in the near future. Current research and clinical investigative efforts involving methods for more effective vector delivery and targeting, with enhanced gene expression to selected (specific) sites, are reviewed. These areas of research involve tissue-specific promoters, transgene exploration, vector design and delivery, and selective vector targeting. The 'vectorology' involved mainly addresses selective tissue homing with ligands, mechanisms of innate immune system evasion for durable transgene expression, and the possibility of repeat administration.

  20. Object recognition of real targets using modelled SAR images

    NASA Astrophysics Data System (ADS)

    Zherdev, D. A.

    2017-12-01

    In this work the problem of recognition is studied using SAR images. The algorithm of recognition is based on the computation of conjugation indices with vectors of class. The support subspaces for each class are constructed by exception of the most and the less correlated vectors in a class. In the study we examine the ability of a significant feature vector size reduce that leads to recognition time decrease. The images of targets form the feature vectors that are transformed using pre-trained convolutional neural network (CNN).

  1. Robust Visual Tracking via Online Discriminative and Low-Rank Dictionary Learning.

    PubMed

    Zhou, Tao; Liu, Fanghui; Bhaskar, Harish; Yang, Jie

    2017-09-12

    In this paper, we propose a novel and robust tracking framework based on online discriminative and low-rank dictionary learning. The primary aim of this paper is to obtain compact and low-rank dictionaries that can provide good discriminative representations of both target and background. We accomplish this by exploiting the recovery ability of low-rank matrices. That is if we assume that the data from the same class are linearly correlated, then the corresponding basis vectors learned from the training set of each class shall render the dictionary to become approximately low-rank. The proposed dictionary learning technique incorporates a reconstruction error that improves the reliability of classification. Also, a multiconstraint objective function is designed to enable active learning of a discriminative and robust dictionary. Further, an optimal solution is obtained by iteratively computing the dictionary, coefficients, and by simultaneously learning the classifier parameters. Finally, a simple yet effective likelihood function is implemented to estimate the optimal state of the target during tracking. Moreover, to make the dictionary adaptive to the variations of the target and background during tracking, an online update criterion is employed while learning the new dictionary. Experimental results on a publicly available benchmark dataset have demonstrated that the proposed tracking algorithm performs better than other state-of-the-art trackers.

  2. Optimal impulsive manoeuvres and aerodynamic braking

    NASA Technical Reports Server (NTRS)

    Jezewski, D. J.

    1985-01-01

    A method developed for obtaining solutions to the aerodynamic braking problem, using impulses in the exoatmospheric phases is discussed. The solution combines primer vector theory and the results of a suboptimal atmospheric guidance program. For a specified initial and final orbit, the solution determines: (1) the minimum impulsive cost using a maximum of four impulses, (2) the optimal atmospheric entry and exit-state vectors subject to equality and inequality constraints, and (3) the optimal coast times. Numerical solutions which illustrate the characteristics of the solution are presented.

  3. The Preventive Control of a Dengue Disease Using Pontryagin Minimum Principal

    NASA Astrophysics Data System (ADS)

    Ratna Sari, Eminugroho; Insani, Nur; Lestari, Dwi

    2017-06-01

    Behaviour analysis for host-vector model without control of dengue disease is based on the value of basic reproduction number obtained using next generation matrices. Furthermore, the model is further developed involving a preventive control to minimize the contact between host and vector. The purpose is to obtain an optimal preventive strategy with minimal cost. The Pontryagin Minimum Principal is used to find the optimal control analytically. The derived optimality model is then solved numerically to investigate control effort to reduce infected class.

  4. Targeting multiple heterogeneous hardware platforms with OpenCL

    NASA Astrophysics Data System (ADS)

    Fox, Paul A.; Kozacik, Stephen T.; Humphrey, John R.; Paolini, Aaron; Kuller, Aryeh; Kelmelis, Eric J.

    2014-06-01

    The OpenCL API allows for the abstract expression of parallel, heterogeneous computing, but hardware implementations have substantial implementation differences. The abstractions provided by the OpenCL API are often insufficiently high-level to conceal differences in hardware architecture. Additionally, implementations often do not take advantage of potential performance gains from certain features due to hardware limitations and other factors. These factors make it challenging to produce code that is portable in practice, resulting in much OpenCL code being duplicated for each hardware platform being targeted. This duplication of effort offsets the principal advantage of OpenCL: portability. The use of certain coding practices can mitigate this problem, allowing a common code base to be adapted to perform well across a wide range of hardware platforms. To this end, we explore some general practices for producing performant code that are effective across platforms. Additionally, we explore some ways of modularizing code to enable optional optimizations that take advantage of hardware-specific characteristics. The minimum requirement for portability implies avoiding the use of OpenCL features that are optional, not widely implemented, poorly implemented, or missing in major implementations. Exposing multiple levels of parallelism allows hardware to take advantage of the types of parallelism it supports, from the task level down to explicit vector operations. Static optimizations and branch elimination in device code help the platform compiler to effectively optimize programs. Modularization of some code is important to allow operations to be chosen for performance on target hardware. Optional subroutines exploiting explicit memory locality allow for different memory hierarchies to be exploited for maximum performance. The C preprocessor and JIT compilation using the OpenCL runtime can be used to enable some of these techniques, as well as to factor in hardware-specific optimizations as necessary.

  5. Optimal multiguidance integration in insect navigation.

    PubMed

    Hoinville, Thierry; Wehner, Rüdiger

    2018-03-13

    In the last decades, desert ants have become model organisms for the study of insect navigation. In finding their way, they use two major navigational routines: path integration using a celestial compass and landmark guidance based on sets of panoramic views of the terrestrial environment. It has been claimed that this information would enable the insect to acquire and use a centralized cognitive map of its foraging terrain. Here, we present a decentralized architecture, in which the concurrently operating path integration and landmark guidance routines contribute optimally to the directions to be steered, with "optimal" meaning maximizing the certainty (reliability) of the combined information. At any one time during its journey, the animal computes a path integration (global) vector and landmark guidance (local) vector, in which the length of each vector is proportional to the certainty of the individual estimates. Hence, these vectors represent the limited knowledge that the navigator has at any one place about the direction of the goal. The sum of the global and local vectors indicates the navigator's optimal directional estimate. Wherever applied, this decentralized model architecture is sufficient to simulate the results of quite a number of diverse cue-conflict experiments, which have recently been performed in various behavioral contexts by different authors in both desert ants and honeybees. They include even those experiments that have deliberately been designed by former authors to strengthen the evidence for a metric cognitive map in bees.

  6. Broad patterns in domestic vector-borne Trypanosoma cruzi transmission dynamics: synanthropic animals and vector control.

    PubMed

    Peterson, Jennifer K; Bartsch, Sarah M; Lee, Bruce Y; Dobson, Andrew P

    2015-10-22

    Chagas disease (caused by Trypanosoma cruzi) is the most important neglected tropical disease (NTD) in Latin America, infecting an estimated 5.7 million people in the 21 countries where it is endemic. It is one of the NTDs targeted for control and elimination by the 2020 London Declaration goals, with the first goal being to interrupt intra-domiciliary vector-borne T. cruzi transmission. A key question in domestic T. cruzi transmission is the role that synanthropic animals play in T. cruzi transmission to humans. Here, we ask, (1) do synanthropic animals need to be targeted in Chagas disease prevention policies?, and (2) how does the presence of animals affect the efficacy of vector control? We developed a simple mathematical model to simulate domestic vector-borne T. cruzi transmission and to specifically examine the interaction between the presence of synanthropic animals and effects of vector control. We used the model to explore how the interactions between triatomine bugs, humans and animals impact the number and proportion of T. cruzi-infected bugs and humans. We then examined how T. cruzi dynamics change when control measures targeting vector abundance are introduced into the system. We found that the presence of synanthropic animals slows the speed of T. cruzi transmission to humans, and increases the sensitivity of T. cruzi transmission dynamics to vector control measures at comparable triatomine carrying capacities. However, T. cruzi transmission is amplified when triatomine carrying capacity increases with the abundance of syntathoropic hosts. Our results suggest that in domestic T. cruzi transmission scenarios where no vector control measures are in place, a reduction in synanthropic animals may slow T. cruzi transmission to humans, but it would not completely eliminate transmission. To reach the 2020 goal of interrupting intra-domiciliary T. cruzi transmission, it is critical to target vector populations. Additionally, where vector control measures are in place, synanthropic animals may be beneficial.

  7. Surface modification via strain-promoted click reaction facilitates targeted lentiviral transduction.

    PubMed

    Chu, Yanjie; Oum, Yoon Hyeun; Carrico, Isaac S

    2016-01-01

    As a result of their ability to integrate into the genome of both dividing and non-dividing cells, lentiviruses have emerged as a promising vector for gene delivery. Targeted gene transduction of specific cells and tissues by lentiviral vectors has been a major goal, which has proven difficult to achieve. We report a novel targeting protocol that relies on the chemoselective attachment of cancer specific ligands to unnatural glycans on lentiviral surfaces. This strategy exhibits minimal perturbation on virus physiology and demonstrates remarkable flexibility. It allows for targeting but can be more broadly useful with applications such as vector purification and immunomodulation. Copyright © 2015 Elsevier Inc. All rights reserved.

  8. Rabies Virus Envelope Glycoprotein Targets Lentiviral Vectors to the Axonal Retrograde Pathway in Motor Neurons*

    PubMed Central

    Hislop, James N.; Islam, Tarin A.; Eleftheriadou, Ioanna; Carpentier, David C. J.; Trabalza, Antonio; Parkinson, Michael; Schiavo, Giampietro; Mazarakis, Nicholas D.

    2014-01-01

    Rabies pseudotyped lentiviral vectors have great potential in gene therapy, not least because of their ability to transduce neurons following their distal axonal application. However, very little is known about the molecular processes that underlie their retrograde transport and cell transduction. Using multiple labeling techniques and confocal microscopy, we demonstrated that pseudotyping with rabies virus envelope glycoprotein (RV-G) enabled the axonal retrograde transport of two distinct subtypes of lentiviral vector in motor neuron cultures. Analysis of this process revealed that these vectors trafficked through Rab5-positive endosomes and accumulated within a non-acidic Rab7 compartment. RV-G pseudotyped vectors were co-transported with both the tetanus neurotoxin-binding fragment and the membrane proteins thought to mediate rabies virus endocytosis (neural cell adhesion molecule, nicotinic acetylcholine receptor, and p75 neurotrophin receptor), thus demonstrating that pseudotyping with RV-G targets lentiviral vectors for transport along the same pathway exploited by several toxins and viruses. Using motor neurons cultured in compartmentalized chambers, we demonstrated that axonal retrograde transport of these vectors was rapid and efficient; however, it was not able to transduce the targeted neurons efficiently, suggesting that impairment in processes occurring after arrival of the viral vector in the soma is responsible for the low transduction efficiency seen in vivo, which suggests a novel area for improvement of gene therapy vectors. PMID:24753246

  9. A method to predict different mechanisms for blood-brain barrier permeability of CNS activity compounds in Chinese herbs using support vector machine.

    PubMed

    Jiang, Ludi; Chen, Jiahua; He, Yusu; Zhang, Yanling; Li, Gongyu

    2016-02-01

    The blood-brain barrier (BBB), a highly selective barrier between central nervous system (CNS) and the blood stream, restricts and regulates the penetration of compounds from the blood into the brain. Drugs that affect the CNS interact with the BBB prior to their target site, so the prediction research on BBB permeability is a fundamental and significant research direction in neuropharmacology. In this study, we combed through the available data and then with the help of support vector machine (SVM), we established an experiment process for discovering potential CNS compounds and investigating the mechanisms of BBB permeability of them to advance the research in this field four types of prediction models, referring to CNS activity, BBB permeability, passive diffusion and efflux transport, were obtained in the experiment process. The first two models were used to discover compounds which may have CNS activity and also cross the BBB at the same time; the latter two were used to elucidate the mechanism of BBB permeability of those compounds. Three optimization parameter methods, Grid Search, Genetic Algorithm (GA), and Particle Swarm Optimization (PSO), were used to optimize the SVM models. Then, four optimal models were selected with excellent evaluation indexes (the accuracy, sensitivity and specificity of each model were all above 85%). Furthermore, discrimination models were utilized to study the BBB properties of the known CNS activity compounds in Chinese herbs and this may guide the CNS drug development. With the relatively systematic and quick approach, the application rationality of traditional Chinese medicines for treating nervous system disease in the clinical practice will be improved.

  10. Quality by design approach for developing chitosan-Ca-alginate microspheres for colon delivery of celecoxib-hydroxypropyl-β-cyclodextrin-PVP complex.

    PubMed

    Mennini, N; Furlanetto, S; Cirri, M; Mura, P

    2012-01-01

    The aim of the present work was to develop a new multiparticulate system, designed for colon-specific delivery of celecoxib for both systemic (in chronotherapic treatment of arthritis) and local (in prophylaxis of colon carcinogenesis) therapy. The system simultaneously benefits from ternary complexation with hydroxypropyl-β-cyclodextrin and PVP (polyvinylpyrrolidone), to increase drug solubility, and vectorization in chitosan-Ca-alginate microspheres, to exploit the colon-specific carrier properties of these polymers. Statistical experimental design was employed to investigate the combined effect of four formulation variables, i.e., % of alginate, CaCl₂, and chitosan and time of cross-linking on microsphere entrapment efficiency (EE%) and drug amount released after 4h in colonic medium, considered as the responses to be optimized. Design of experiment was used in the context of Quality by Design, which requires a multivariate approach for understanding the multifactorial relationships among formulation parameters. Doehlert design allowed for defining a design space, which revealed that variations of the considered factors had in most cases an opposite influence on the responses. Desirability function was used to attain simultaneous optimization of both responses. The desired goals were achieved for both systemic and local use of celecoxib. Experimental values obtained from the optimized formulations were in both cases very close to the predicted values, thus confirming the validity of the generated mathematical model. These results demonstrated the effectiveness of the proposed jointed use of drug cyclodextrin complexation and chitosan-Ca-alginate microsphere vectorization, as well as the usefulness of the multivariate approach for the preparation of colon-targeted celecoxib microspheres with optimized properties. Copyright © 2011 Elsevier B.V. All rights reserved.

  11. Optimal cue integration in ants.

    PubMed

    Wystrach, Antoine; Mangan, Michael; Webb, Barbara

    2015-10-07

    In situations with redundant or competing sensory information, humans have been shown to perform cue integration, weighting different cues according to their certainty in a quantifiably optimal manner. Ants have been shown to merge the directional information available from their path integration (PI) and visual memory, but as yet it is not clear that they do so in a way that reflects the relative certainty of the cues. In this study, we manipulate the variance of the PI home vector by allowing ants (Cataglyphis velox) to run different distances and testing their directional choice when the PI vector direction is put in competition with visual memory. Ants show progressively stronger weighting of their PI direction as PI length increases. The weighting is quantitatively predicted by modelling the expected directional variance of home vectors of different lengths and assuming optimal cue integration. However, a subsequent experiment suggests ants may not actually compute an internal estimate of the PI certainty, but are using the PI home vector length as a proxy. © 2015 The Author(s).

  12. An efficient procedure for marker-free mutagenesis of S. coelicolor by site-specific recombination for secondary metabolite overproduction.

    PubMed

    Zhang, Bo; Zhang, Lin; Dai, Ruixue; Yu, Meiying; Zhao, Guoping; Ding, Xiaoming

    2013-01-01

    Streptomyces bacteria are known for producing important natural compounds by secondary metabolism, especially antibiotics with novel biological activities. Functional studies of antibiotic-biosynthesizing gene clusters are generally through homologous genomic recombination by gene-targeting vectors. Here, we present a rapid and efficient method for construction of gene-targeting vectors. This approach is based on Streptomyces phage φBT1 integrase-mediated multisite in vitro site-specific recombination. Four 'entry clones' were assembled into a circular plasmid to generate the destination gene-targeting vector by a one-step reaction. The four 'entry clones' contained two clones of the upstream and downstream flanks of the target gene, a selectable marker and an E. coli-Streptomyces shuttle vector. After targeted modification of the genome, the selectable markers were removed by φC31 integrase-mediated in vivo site-specific recombination between pre-placed attB and attP sites. Using this method, part of the calcium-dependent antibiotic (CDA) and actinorhodin (Act) biosynthetic gene clusters were deleted, and the rrdA encoding RrdA, a negative regulator of Red production, was also deleted. The final prodiginine production of the engineered strain was over five times that of the wild-type strain. This straightforward φBT1 and φC31 integrase-based strategy provides an alternative approach for rapid gene-targeting vector construction and marker removal in streptomycetes.

  13. Influenza virus-specific TCR-transduced T cells as a model for adoptive immunotherapy

    PubMed Central

    Berdien, Belinda; Reinhard, Henrike; Meyer, Sabrina; Spöck, Stefanie; Kröger, Nicolaus; Atanackovic, Djordje; Fehse, Boris

    2013-01-01

    Adoptive transfer of T lymphocytes equipped with tumor-antigen specific T-cell receptors (TCRs) represents a promising strategy in cancer immunotherapy, but the approach remains technically demanding. Using influenza virus (Flu)-specific T-cell responses as a model system we compared different methods for the generation of T-cell clones and isolation of antigen-specific TCRs. Altogether, we generated 12 CD8+ T-cell clones reacting to the Flu matrix protein (Flu-M) and 6 CD4+ T-cell clones reacting to the Flu nucleoprotein (Flu-NP) from 4 healthy donors. IFN-γ-secretion-based enrichment of antigen-specific cells, optionally combined with tetramer staining, was the most efficient way for generating T-cell clones. In contrast, the commonly used limiting dilution approach was least efficient. TCR genes were isolated from T-cell clones and cloned into both a previously used gammaretroviral LTR-vector, MP91 and the novel lentiviral self-inactivating vector LeGO-MP that contains MP91-derived promotor and regulatory elements. To directly compare their functional efficiencies, we in parallel transduced T-cell lines and primary T cells with the two vectors encoding identical TCRs. Transduction efficiencies were approximately twice higher with the gammaretroviral vector. Secretion of high amounts of IFN-γ, IL-2 and TNF-α by transduced cells after exposure to the respective influenza target epitope proved efficient specificity transfer of the isolated TCRs to primary T-cells for both vectors, at the same time indicating superior functionality of MP91-transduced cells. In conclusion, we have developed optimized strategies to obtain and transfer antigen-specific TCRs as well as designed a novel lentiviral vector for TCR-gene transfer. Our data may help to improve adoptive T-cell therapies. PMID:23428899

  14. Adenovirus Vectors Target Several Cell Subtypes of Mammalian Inner Ear In Vivo

    PubMed Central

    Li, Wenyan; Shen, Jun

    2016-01-01

    Mammalian inner ear harbors diverse cell types that are essential for hearing and balance. Adenovirus is one of the major vectors to deliver genes into the inner ear for functional studies and hair cell regeneration. To identify adenovirus vectors that target specific cell subtypes in the inner ear, we studied three adenovirus vectors, carrying a reporter gene encoding green fluorescent protein (GFP) from two vendors or with a genome editing gene Cre recombinase (Cre), by injection into postnatal days 0 (P0) and 4 (P4) mouse cochlea through scala media by cochleostomy in vivo. We found three adenovirus vectors transduced mouse inner ear cells with different specificities and expression levels, depending on the type of adenoviral vectors and the age of mice. The most frequently targeted region was the cochlear sensory epithelium, including auditory hair cells and supporting cells. Adenovirus with GFP transduced utricular supporting cells as well. This study shows that adenovirus vectors are capable of efficiently and specifically transducing different cell types in the mammalian inner ear and provides useful tools to study inner ear gene function and to evaluate gene therapy to treat hearing loss and vestibular dysfunction. PMID:28116172

  15. Feature Vector Construction Method for IRIS Recognition

    NASA Astrophysics Data System (ADS)

    Odinokikh, G.; Fartukov, A.; Korobkin, M.; Yoo, J.

    2017-05-01

    One of the basic stages of iris recognition pipeline is iris feature vector construction procedure. The procedure represents the extraction of iris texture information relevant to its subsequent comparison. Thorough investigation of feature vectors obtained from iris showed that not all the vector elements are equally relevant. There are two characteristics which determine the vector element utility: fragility and discriminability. Conventional iris feature extraction methods consider the concept of fragility as the feature vector instability without respect to the nature of such instability appearance. This work separates sources of the instability into natural and encodinginduced which helps deeply investigate each source of instability independently. According to the separation concept, a novel approach of iris feature vector construction is proposed. The approach consists of two steps: iris feature extraction using Gabor filtering with optimal parameters and quantization with separated preliminary optimized fragility thresholds. The proposed method has been tested on two different datasets of iris images captured under changing environmental conditions. The testing results show that the proposed method surpasses all the methods considered as a prior art by recognition accuracy on both datasets.

  16. Low molecular weight polyethylenimine cross-linked by 2-hydroxypropyl-gamma-cyclodextrin coupled to peptide targeting HER2 as a gene delivery vector.

    PubMed

    Huang, Hongliang; Yu, Hai; Tang, Guping; Wang, Qingqing; Li, Jun

    2010-03-01

    Gene delivery is one of the critical steps for gene therapy. Non-viral vectors have many advantages but suffered from low gene transfection efficiency. Here, in order to develop new polymeric gene vectors with low cytotoxicity and high gene transfection efficiency, we synthesized a cationic polymer composed of low molecular weight polyethylenimine (PEI) of molecular weight of 600 Da cross-linked by 2-hydroxypropyl-gamma-cyclodextrin (HP gamma-CD) and then coupled to MC-10 oligopeptide containing a sequence of Met-Ala-Arg-Ala-Lys-Glu. The oligopeptide can target to HER2, the human epidermal growth factor receptor 2, which is often over expressed in many breast and ovary cancers. The new gene vector was expected to be able to target delivery of genes to HER2 positive cancer cells for gene therapy. The new gene vector was composed of chemically bonded HP gamma-CD, PEI (600 Da), and MC-10 peptide at a molar ratio of 1:3.3:1.2. The gene vector could condense plasmid DNA at an N/P ratio of 6 or above. The particle size of HP gamma-CD-PEI-P/DNA complexes at N/P ratios 40 was around 170-200 nm, with zeta potential of about 20 mV. The gene vector showed very low cytotoxicity, strong targeting specificity to HER2 receptor, and high efficiency of delivering DNA to target cells in vitro and in vivo with the reporter genes. The delivery of therapeutic IFN-alpha gene mediated by the new gene vector and the therapeutic efficiency were also studied in mice animal model. The animal study results showed that the new gene vector HP gamma-CD-PEI-P significantly enhanced the anti-tumor effect on tumor-bearing nude mice as compared to PEI (25 kDa), HP gamma-CD-PEI, and other controls, indicating that this new polymeric gene vector is a potential candidate for cancer gene therapy. (c) 2009 Elsevier Ltd. All rights reserved.

  17. Initialization of Formation Flying Using Primer Vector Theory

    NASA Technical Reports Server (NTRS)

    Mailhe, Laurie; Schiff, Conrad; Folta, David

    2002-01-01

    In this paper, we extend primer vector analysis to formation flying. Optimization of the classical rendezvous or free-time transfer problem between two orbits using primer vector theory has been extensively studied for one spacecraft. However, an increasing number of missions are now considering flying a set of spacecraft in close formation. Missions such as the Magnetospheric MultiScale (MMS) and Leonardo-BRDF (Bidirectional Reflectance Distribution Function) need to determine strategies to transfer each spacecraft from the common launch orbit to their respective operational orbit. In addition, all the spacecraft must synchronize their states so that they achieve the same desired formation geometry over each orbit. This periodicity requirement imposes constraints on the boundary conditions that can be used for the primer vector algorithm. In this work we explore the impact of the periodicity requirement in optimizing each spacecraft transfer trajectory using primer vector theory. We first present our adaptation of primer vector theory to formation flying. Using this method, we then compute the AV budget for each spacecraft subject to different formation endpoint constraints.

  18. Attitude determination using vector observations: A fast optimal matrix algorithm

    NASA Technical Reports Server (NTRS)

    Markley, F. Landis

    1993-01-01

    The attitude matrix minimizing Wahba's loss function is computed directly by a method that is competitive with the fastest known algorithm for finding this optimal estimate. The method also provides an estimate of the attitude error covariance matrix. Analysis of the special case of two vector observations identifies those cases for which the TRIAD or algebraic method minimizes Wahba's loss function.

  19. Calibration of Predictor Models Using Multiple Validation Experiments

    NASA Technical Reports Server (NTRS)

    Crespo, Luis G.; Kenny, Sean P.; Giesy, Daniel P.

    2015-01-01

    This paper presents a framework for calibrating computational models using data from several and possibly dissimilar validation experiments. The offset between model predictions and observations, which might be caused by measurement noise, model-form uncertainty, and numerical error, drives the process by which uncertainty in the models parameters is characterized. The resulting description of uncertainty along with the computational model constitute a predictor model. Two types of predictor models are studied: Interval Predictor Models (IPMs) and Random Predictor Models (RPMs). IPMs use sets to characterize uncertainty, whereas RPMs use random vectors. The propagation of a set through a model makes the response an interval valued function of the state, whereas the propagation of a random vector yields a random process. Optimization-based strategies for calculating both types of predictor models are proposed. Whereas the formulations used to calculate IPMs target solutions leading to the interval value function of minimal spread containing all observations, those for RPMs seek to maximize the models' ability to reproduce the distribution of observations. Regarding RPMs, we choose a structure for the random vector (i.e., the assignment of probability to points in the parameter space) solely dependent on the prediction error. As such, the probabilistic description of uncertainty is not a subjective assignment of belief, nor is it expected to asymptotically converge to a fixed value, but instead it casts the model's ability to reproduce the experimental data. This framework enables evaluating the spread and distribution of the predicted response of target applications depending on the same parameters beyond the validation domain.

  20. The myeloid-binding peptide adenoviral vector enables multi-organ vascular endothelial gene targeting.

    PubMed

    Lu, Zhi Hong; Kaliberov, Sergey; Zhang, Jingzhu; Muz, Barbara; Azab, Abdel K; Sohn, Rebecca E; Kaliberova, Lyudmila; Du, Yingqiu; Curiel, David T; Arbeit, Jeffrey M

    2014-08-01

    Vascular endothelial cells (ECs) are ideal gene therapy targets as they provide widespread tissue access and are the first contact surfaces following intravenous vector administration. Human recombinant adenovirus serotype 5 (Ad5) is the most frequently used gene transfer system because of its appreciable transgene payload capacity and lack of somatic mutation risk. However, standard Ad5 vectors predominantly transduce liver but not the vasculature following intravenous administration. We recently developed an Ad5 vector with a myeloid cell-binding peptide (MBP) incorporated into the knob-deleted, T4 fibritin chimeric fiber (Ad.MBP). This vector was shown to transduce pulmonary ECs presumably via a vector handoff mechanism. Here we tested the body-wide tropism of the Ad.MBP vector, its myeloid cell necessity, and vector-EC expression dose response. Using comprehensive multi-organ co-immunofluorescence analysis, we discovered that Ad.MBP produced widespread EC transduction in the lung, heart, kidney, skeletal muscle, pancreas, small bowel, and brain. Surprisingly, Ad.MBP retained hepatocyte tropism albeit at a reduced frequency compared with the standard Ad5. While binding specifically to myeloid cells ex vivo, multi-organ Ad.MBP expression was not dependent on circulating monocytes or macrophages. Ad.MBP dose de-escalation maintained full lung-targeting capacity but drastically reduced transgene expression in other organs. Swapping the EC-specific ROBO4 for the CMV promoter/enhancer abrogated hepatocyte expression but also reduced gene expression in other organs. Collectively, our multilevel targeting strategy could enable therapeutic biological production in previously inaccessible organs that pertain to the most debilitating or lethal human diseases.

  1. Automated vector selection of SIVQ and parallel computing integration MATLAB™: Innovations supporting large-scale and high-throughput image analysis studies.

    PubMed

    Cheng, Jerome; Hipp, Jason; Monaco, James; Lucas, David R; Madabhushi, Anant; Balis, Ulysses J

    2011-01-01

    Spatially invariant vector quantization (SIVQ) is a texture and color-based image matching algorithm that queries the image space through the use of ring vectors. In prior studies, the selection of one or more optimal vectors for a particular feature of interest required a manual process, with the user initially stochastically selecting candidate vectors and subsequently testing them upon other regions of the image to verify the vector's sensitivity and specificity properties (typically by reviewing a resultant heat map). In carrying out the prior efforts, the SIVQ algorithm was noted to exhibit highly scalable computational properties, where each region of analysis can take place independently of others, making a compelling case for the exploration of its deployment on high-throughput computing platforms, with the hypothesis that such an exercise will result in performance gains that scale linearly with increasing processor count. An automated process was developed for the selection of optimal ring vectors to serve as the predicate matching operator in defining histopathological features of interest. Briefly, candidate vectors were generated from every possible coordinate origin within a user-defined vector selection area (VSA) and subsequently compared against user-identified positive and negative "ground truth" regions on the same image. Each vector from the VSA was assessed for its goodness-of-fit to both the positive and negative areas via the use of the receiver operating characteristic (ROC) transfer function, with each assessment resulting in an associated area-under-the-curve (AUC) figure of merit. Use of the above-mentioned automated vector selection process was demonstrated in two cases of use: First, to identify malignant colonic epithelium, and second, to identify soft tissue sarcoma. For both examples, a very satisfactory optimized vector was identified, as defined by the AUC metric. Finally, as an additional effort directed towards attaining high-throughput capability for the SIVQ algorithm, we demonstrated the successful incorporation of it with the MATrix LABoratory (MATLAB™) application interface. The SIVQ algorithm is suitable for automated vector selection settings and high throughput computation.

  2. Increased receptor-mediated gene delivery to the liver by protamine-enhanced-asialofetuin-lipoplexes.

    PubMed

    Arangoa, M A; Düzgüneş, N; Tros de Ilarduya, C

    2003-01-01

    A novel lipidic vector composed of DOTAP/Chol liposomes, asialofetuin (AF), protamine sulfate and DNA has been developed. The resulting protamine-AF-lipoplexes improved significantly the levels of gene expression in cultured cells and in the liver upon i.v. administration. Lipoplexes containing the optimal amount of AF (1 microg/microg DNA) showed a 16-fold higher transfection activity in HepG2 cells than non-targeted (plain) complexes. The uptake by cells having asialoglycoprotein receptors (ASGPr) on their plasma membrane was decreased by the addition of free AF, indicating that AF-lipoplexes were taken up specifically by cells via ASGPr-mediated endocytosis. Results from transfections performed in cells defective in ASGPr, ie HeLa cells, confirmed this mechanism. By addition of the condensing peptide, protamine sulfate, smaller complexes were obtained, which enhanced even more the uptake of AF-complexes in HepG2 cells and in the liver. The optimal amount of protamine was 0.4 microg/mcirog DNA, and gene expression was about 5-fold over that obtained with AF-lipoplexes in the absence of the peptide, and 75-fold higher than that with plain conventional lipoplexes. Protamine-AF-lipoplexes increased by a factor of 12 luciferase gene expression in the liver of mice administered systemically via the tail vein, compared to plain complexes. In summary, our findings extend the scope of previous studies where AF-lipoplexes were used to introduce DNA into hepatocytes. The combination of targeting and protamine condensation obviated the need for partial hepatectomy, commonly required to obtain efficient gene delivery in this organ. Since protamine sulfate has been proven to be non-toxic in humans, the novel liver-specific vector described here may be useful for the delivery of clinically important genes to this organ.

  3. Supercomputer optimizations for stochastic optimal control applications

    NASA Technical Reports Server (NTRS)

    Chung, Siu-Leung; Hanson, Floyd B.; Xu, Huihuang

    1991-01-01

    Supercomputer optimizations for a computational method of solving stochastic, multibody, dynamic programming problems are presented. The computational method is valid for a general class of optimal control problems that are nonlinear, multibody dynamical systems, perturbed by general Markov noise in continuous time, i.e., nonsmooth Gaussian as well as jump Poisson random white noise. Optimization techniques for vector multiprocessors or vectorizing supercomputers include advanced data structures, loop restructuring, loop collapsing, blocking, and compiler directives. These advanced computing techniques and superconducting hardware help alleviate Bellman's curse of dimensionality in dynamic programming computations, by permitting the solution of large multibody problems. Possible applications include lumped flight dynamics models for uncertain environments, such as large scale and background random aerospace fluctuations.

  4. Medical Image Compression Based on Vector Quantization with Variable Block Sizes in Wavelet Domain

    PubMed Central

    Jiang, Huiyan; Ma, Zhiyuan; Hu, Yang; Yang, Benqiang; Zhang, Libo

    2012-01-01

    An optimized medical image compression algorithm based on wavelet transform and improved vector quantization is introduced. The goal of the proposed method is to maintain the diagnostic-related information of the medical image at a high compression ratio. Wavelet transformation was first applied to the image. For the lowest-frequency subband of wavelet coefficients, a lossless compression method was exploited; for each of the high-frequency subbands, an optimized vector quantization with variable block size was implemented. In the novel vector quantization method, local fractal dimension (LFD) was used to analyze the local complexity of each wavelet coefficients, subband. Then an optimal quadtree method was employed to partition each wavelet coefficients, subband into several sizes of subblocks. After that, a modified K-means approach which is based on energy function was used in the codebook training phase. At last, vector quantization coding was implemented in different types of sub-blocks. In order to verify the effectiveness of the proposed algorithm, JPEG, JPEG2000, and fractal coding approach were chosen as contrast algorithms. Experimental results show that the proposed method can improve the compression performance and can achieve a balance between the compression ratio and the image visual quality. PMID:23049544

  5. Medical image compression based on vector quantization with variable block sizes in wavelet domain.

    PubMed

    Jiang, Huiyan; Ma, Zhiyuan; Hu, Yang; Yang, Benqiang; Zhang, Libo

    2012-01-01

    An optimized medical image compression algorithm based on wavelet transform and improved vector quantization is introduced. The goal of the proposed method is to maintain the diagnostic-related information of the medical image at a high compression ratio. Wavelet transformation was first applied to the image. For the lowest-frequency subband of wavelet coefficients, a lossless compression method was exploited; for each of the high-frequency subbands, an optimized vector quantization with variable block size was implemented. In the novel vector quantization method, local fractal dimension (LFD) was used to analyze the local complexity of each wavelet coefficients, subband. Then an optimal quadtree method was employed to partition each wavelet coefficients, subband into several sizes of subblocks. After that, a modified K-means approach which is based on energy function was used in the codebook training phase. At last, vector quantization coding was implemented in different types of sub-blocks. In order to verify the effectiveness of the proposed algorithm, JPEG, JPEG2000, and fractal coding approach were chosen as contrast algorithms. Experimental results show that the proposed method can improve the compression performance and can achieve a balance between the compression ratio and the image visual quality.

  6. Pulmonary Nodule Recognition Based on Multiple Kernel Learning Support Vector Machine-PSO

    PubMed Central

    Zhu, Zhichuan; Zhao, Qingdong; Liu, Liwei; Zhang, Lijuan

    2018-01-01

    Pulmonary nodule recognition is the core module of lung CAD. The Support Vector Machine (SVM) algorithm has been widely used in pulmonary nodule recognition, and the algorithm of Multiple Kernel Learning Support Vector Machine (MKL-SVM) has achieved good results therein. Based on grid search, however, the MKL-SVM algorithm needs long optimization time in course of parameter optimization; also its identification accuracy depends on the fineness of grid. In the paper, swarm intelligence is introduced and the Particle Swarm Optimization (PSO) is combined with MKL-SVM algorithm to be MKL-SVM-PSO algorithm so as to realize global optimization of parameters rapidly. In order to obtain the global optimal solution, different inertia weights such as constant inertia weight, linear inertia weight, and nonlinear inertia weight are applied to pulmonary nodules recognition. The experimental results show that the model training time of the proposed MKL-SVM-PSO algorithm is only 1/7 of the training time of the MKL-SVM grid search algorithm, achieving better recognition effect. Moreover, Euclidean norm of normalized error vector is proposed to measure the proximity between the average fitness curve and the optimal fitness curve after convergence. Through statistical analysis of the average of 20 times operation results with different inertial weights, it can be seen that the dynamic inertial weight is superior to the constant inertia weight in the MKL-SVM-PSO algorithm. In the dynamic inertial weight algorithm, the parameter optimization time of nonlinear inertia weight is shorter; the average fitness value after convergence is much closer to the optimal fitness value, which is better than the linear inertial weight. Besides, a better nonlinear inertial weight is verified. PMID:29853983

  7. Pulmonary Nodule Recognition Based on Multiple Kernel Learning Support Vector Machine-PSO.

    PubMed

    Li, Yang; Zhu, Zhichuan; Hou, Alin; Zhao, Qingdong; Liu, Liwei; Zhang, Lijuan

    2018-01-01

    Pulmonary nodule recognition is the core module of lung CAD. The Support Vector Machine (SVM) algorithm has been widely used in pulmonary nodule recognition, and the algorithm of Multiple Kernel Learning Support Vector Machine (MKL-SVM) has achieved good results therein. Based on grid search, however, the MKL-SVM algorithm needs long optimization time in course of parameter optimization; also its identification accuracy depends on the fineness of grid. In the paper, swarm intelligence is introduced and the Particle Swarm Optimization (PSO) is combined with MKL-SVM algorithm to be MKL-SVM-PSO algorithm so as to realize global optimization of parameters rapidly. In order to obtain the global optimal solution, different inertia weights such as constant inertia weight, linear inertia weight, and nonlinear inertia weight are applied to pulmonary nodules recognition. The experimental results show that the model training time of the proposed MKL-SVM-PSO algorithm is only 1/7 of the training time of the MKL-SVM grid search algorithm, achieving better recognition effect. Moreover, Euclidean norm of normalized error vector is proposed to measure the proximity between the average fitness curve and the optimal fitness curve after convergence. Through statistical analysis of the average of 20 times operation results with different inertial weights, it can be seen that the dynamic inertial weight is superior to the constant inertia weight in the MKL-SVM-PSO algorithm. In the dynamic inertial weight algorithm, the parameter optimization time of nonlinear inertia weight is shorter; the average fitness value after convergence is much closer to the optimal fitness value, which is better than the linear inertial weight. Besides, a better nonlinear inertial weight is verified.

  8. A New Unified Analysis of Estimate Errors by Model-Matching Phase-Estimation Methods for Sensorless Drive of Permanent-Magnet Synchronous Motors and New Trajectory-Oriented Vector Control, Part II

    NASA Astrophysics Data System (ADS)

    Shinnaka, Shinji

    This paper presents a new unified analysis of estimate errors by model-matching extended-back-EMF estimation methods for sensorless drive of permanent-magnet synchronous motors. Analytical solutions about estimate errors, whose validity is confirmed by numerical experiments, are rich in universality and applicability. As an example of universality and applicability, a new trajectory-oriented vector control method is proposed, which can realize directly quasi-optimal strategy minimizing total losses with no additional computational loads by simply orienting one of vector-control coordinates to the associated quasi-optimal trajectory. The coordinate orientation rule, which is analytically derived, is surprisingly simple. Consequently the trajectory-oriented vector control method can be applied to a number of conventional vector control systems using model-matching extended-back-EMF estimation methods.

  9. Radar target classification method with high accuracy and decision speed performance using MUSIC spectrum vectors and PCA projection

    NASA Astrophysics Data System (ADS)

    Secmen, Mustafa

    2011-10-01

    This paper introduces the performance of an electromagnetic target recognition method in resonance scattering region, which includes pseudo spectrum Multiple Signal Classification (MUSIC) algorithm and principal component analysis (PCA) technique. The aim of this method is to classify an "unknown" target as one of the "known" targets in an aspect-independent manner. The suggested method initially collects the late-time portion of noise-free time-scattered signals obtained from different reference aspect angles of known targets. Afterward, these signals are used to obtain MUSIC spectrums in real frequency domain having super-resolution ability and noise resistant feature. In the final step, PCA technique is applied to these spectrums in order to reduce dimensionality and obtain only one feature vector per known target. In the decision stage, noise-free or noisy scattered signal of an unknown (test) target from an unknown aspect angle is initially obtained. Subsequently, MUSIC algorithm is processed for this test signal and resulting test vector is compared with feature vectors of known targets one by one. Finally, the highest correlation gives the type of test target. The method is applied to wire models of airplane targets, and it is shown that it can tolerate considerable noise levels although it has a few different reference aspect angles. Besides, the runtime of the method for a test target is sufficiently low, which makes the method suitable for real-time applications.

  10. Evolving lessons on nanomaterial-coated viral vectors for local and systemic gene therapy

    PubMed Central

    Kasala, Dayananda; Yoon, A-Rum; Hong, Jinwoo; Kim, Sung Wan; Yun, Chae-Ok

    2016-01-01

    Viral vectors are promising gene carriers for cancer therapy. However, virus-mediated gene therapies have demonstrated insufficient therapeutic efficacy in clinical trials due to rapid dissemination to nontarget tissues and to the immunogenicity of viral vectors, resulting in poor retention at the disease locus and induction of adverse inflammatory responses in patients. Further, the limited tropism of viral vectors prevents efficient gene delivery to target tissues. In this regard, modification of the viral surface with nanomaterials is a promising strategy to augment vector accumulation at the target tissue, circumvent the host immune response, and avoid nonspecific interactions with the reticuloendothelial system or serum complement. In the present review, we discuss various chemical modification strategies to enhance the therapeutic efficacy of viral vectors delivered either locally or systemically. We conclude by highlighting the salient features of various nanomaterial-coated viral vectors and their prospects and directions for future research. PMID:27348247

  11. Primer Vector Optimization: Survey of Theory, New Analysis and Applications

    NASA Technical Reports Server (NTRS)

    Guzman, J. J.; Mailhe, L. M.; Schiff, C.; Hughes, S. P.; Folta, D. C.

    2002-01-01

    In this paper, a summary of primer vector theory is presented. The applicability of primer vector theory is examined in an effort to understand when and why the theory can fail. For example, since the Calculus of Variations is based on "small" variations, singularities in the linearized (variational) equations of motion along the arcs must be taken into account. These singularities are a recurring problem in analyse that employ small variations. Two examples, the initialization of an orbit and a line of apsides rotation, are presented. Recommendations, future work, and the possible addition of other optimization techniques are also discussed.

  12. Optimal source coding, removable noise elimination, and natural coordinate system construction for general vector sources using replicator neural networks

    NASA Astrophysics Data System (ADS)

    Hecht-Nielsen, Robert

    1997-04-01

    A new universal one-chart smooth manifold model for vector information sources is introduced. Natural coordinates (a particular type of chart) for such data manifolds are then defined. Uniformly quantized natural coordinates form an optimal vector quantization code for a general vector source. Replicator neural networks (a specialized type of multilayer perceptron with three hidden layers) are the introduced. As properly configured examples of replicator networks approach minimum mean squared error (e.g., via training and architecture adjustment using randomly chosen vectors from the source), these networks automatically develop a mapping which, in the limit, produces natural coordinates for arbitrary source vectors. The new concept of removable noise (a noise model applicable to a wide variety of real-world noise processes) is then discussed. Replicator neural networks, when configured to approach minimum mean squared reconstruction error (e.g., via training and architecture adjustment on randomly chosen examples from a vector source, each with randomly chosen additive removable noise contamination), in the limit eliminate removable noise and produce natural coordinates for the data vector portions of the noise-corrupted source vectors. Consideration regarding selection of the dimension of a data manifold source model and the training/configuration of replicator neural networks are discussed.

  13. Improving geolocation and spatial accuracies with the modular integrated avionics group (MIAG)

    NASA Astrophysics Data System (ADS)

    Johnson, Einar; Souter, Keith

    1996-05-01

    The modular integrated avionics group (MIAG) is a single unit approach to combining position, inertial and baro-altitude/air data sensors to provide optimized navigation, guidance and control performance. Lear Astronics Corporation is currently working within the navigation community to upgrade existing MIAG performance with precise GPS positioning mechanization tightly integrated with inertial, baro and other sensors. Among the immediate benefits are the following: (1) accurate target location in dynamic conditions; (2) autonomous launch and recovery using airborne avionics only; (3) precise flight path guidance; and (4) improved aircraft and payload stability information. This paper will focus on the impact of using the MIAG with its multimode navigation accuracies on the UAV targeting mission. Gimbaled electro-optical sensors mounted on a UAV can be used to determine ground coordinates of a target at the center of the field of view by a series of vector rotation and scaling computations. The accuracy of the computed target coordinates is dependent on knowing the UAV position and the UAV-to-target offset computation. Astronics performed a series of simulations to evaluate the effects that the improved angular and position data available from the MIAG have on target coordinate accuracy.

  14. Development and Evaluation of an Optimal Human Single-Chain Variable Fragment-Derived BCMA-Targeted CAR T Cell Vector.

    PubMed

    Smith, Eric L; Staehr, Mette; Masakayan, Reed; Tatake, Ishan J; Purdon, Terence J; Wang, Xiuyan; Wang, Pei; Liu, Hong; Xu, Yiyang; Garrett-Thomson, Sarah C; Almo, Steven C; Riviere, Isabelle; Liu, Cheng; Brentjens, Renier J

    2018-06-06

    B cell maturation antigen (BCMA) has recently been identified as an important multiple myeloma (MM)-specific target for chimeric antigen receptor (CAR) T cell therapy. In CAR T cell therapy targeting CD19 for lymphoma, host immune anti-murine CAR responses limited the efficacy of repeat dosing and possibly long-term persistence. This clinically relevant concern can be addressed by generating a CAR incorporating a human single-chain variable fragment (scFv). We screened a human B cell-derived scFv phage display library and identified a panel of BCMA-specific clones from which human CARs were engineered. Despite a narrow range of affinity for BCMA, dramatic differences in CAR T cell expansion were observed between unique scFvs in a repeat antigen stimulation assay. These results were confirmed by screening in a MM xenograft model, where only the top preforming CARs from the repeat antigen stimulation assay eradicated disease and prolonged survival. The results of this screening identified a highly effective CAR T cell therapy with properties, including rapid in vivo expansion (>10,000-fold, day 6), eradication of large tumor burden, and durable protection to tumor re-challenge. We generated a bicistronic construct including a second-generation CAR and a truncated-epithelial growth factor receptor marker. CAR T cell vectors stemming from this work are under clinical investigation. Copyright © 2018 The American Society of Gene and Cell Therapy. Published by Elsevier Inc. All rights reserved.

  15. Optimal reduced-rank quadratic classifiers using the Fukunaga-Koontz transform with applications to automated target recognition

    NASA Astrophysics Data System (ADS)

    Huo, Xiaoming; Elad, Michael; Flesia, Ana G.; Muise, Robert R.; Stanfill, S. Robert; Friedman, Jerome; Popescu, Bogdan; Chen, Jihong; Mahalanobis, Abhijit; Donoho, David L.

    2003-09-01

    In target recognition applications of discriminant of classification analysis, each 'feature' is a result of a convolution of an imagery with a filter, which may be derived from a feature vector. It is important to use relatively few features. We analyze an optimal reduced-rank classifier under the two-class situation. Assuming each population is Gaussian and has zero mean, and the classes differ through the covariance matrices: ∑1 and ∑2. The following matrix is considered: Λ=(∑1+∑2)-1/2∑1(∑1+∑2)-1/2. We show that the k eigenvectors of this matrix whose eigenvalues are most different from 1/2 offer the best rank k approximation to the maximum likelihood classifier. The matrix Λ and its eigenvectors have been introduced by Fukunaga and Koontz; hence this analysis gives a new interpretation of the well known Fukunaga-Koontz transform. The optimality that is promised in this method hold if the two populations are exactly Guassian with the same means. To check the applicability of this approach to real data, an experiment is performed, in which several 'modern' classifiers were used on an Infrared ATR data. In these experiments, a reduced-rank classifier-Tuned Basis Functions-outperforms others. The competitive performance of the optimal reduced-rank quadratic classifier suggests that, at least for classification purposes, the imagery data behaves in a nearly-Gaussian fashion.

  16. Development of a Recombinant Multifunctional Biomacromolecule for Targeted Gene Transfer to Prostate Cancer Cells.

    PubMed

    Hatefi, Arash; Karjoo, Zahra; Nomani, Alireza

    2017-09-11

    The objective of this study was to genetically engineer a fully functional single chain fusion peptide composed of motifs from diverse biological and synthetic origins that can perform multiple tasks including DNA condensation, cell targeting, cell transfection, particle shielding from immune system and effective gene transfer to prostate tumors. To achieve the objective, a single chain biomacromolecule (vector) consisted of four repeatative units of histone H2A peptide, fusogenic peptide GALA, short elastin-like peptide, and PC-3 cell targeting peptide was designed. To examine the functionality of each motif in the vector sequence, it was characterized in terms of size and zeta potential by Zetasizer, PC-3 cell targeting and transfection by flowcytometry, IgG induction by immunogenicity assay, and PC-3 tumor transfection by quantitative live animal imaging. Overall, the results of this study showed the possibility of using genetic engineering techniques to program various functionalities into one single chain vector and create a multifunctional nonimmunogenic biomacromolecule for targeted gene transfer to prostate cancer cells. This proof-of-concept study is a significant step forward toward creating a library of vectors for targeted gene transfer to any cancer cell type at both in vitro and in vivo levels.

  17. Gene therapy for heart disease: molecular targets, vectors and modes of delivery to myocardium.

    PubMed

    Scimia, Maria Cecilia; Cannavo, Alessandro; Koch, Walter J

    2013-08-01

    Despite the numerous hurdles that gene therapy has encountered along the way, clinical trials over the last few years are showing promising results in many fields of medicine, including cardiology, where many targets are moving toward clinical development. In this review, the authors discuss the current state of the art in terms of clinical and preclinical development. They also examine vector technology and available vector-delivery strategies.

  18. Loa loa vectors Chrysops spp.: perspectives on research, distribution, bionomics, and implications for elimination of lymphatic filariasis and onchocerciasis.

    PubMed

    Kelly-Hope, Louise; Paulo, Rossely; Thomas, Brent; Brito, Miguel; Unnasch, Thomas R; Molyneux, David

    2017-04-05

    Loiasis is a filarial disease caused Loa loa. The main vectors are Chrysops silacea and C. dimidiata which are confined to the tropical rainforests of Central and West Africa. Loiasis is a mild disease, but individuals with high microfilaria loads may suffer from severe adverse events if treated with ivermectin during mass drug administration campaigns for the elimination of lymphatic filariasis and onchocerciasis. This poses significant challenges for elimination programmes and alternative interventions are required in L. loa co-endemic areas. The control of Chrysops has not been considered as a viable cost-effective intervention; we reviewed the current knowledge of Chrysops vectors to assess the potential for control as well as identified areas for future research. We identified 89 primary published documents on the two main L. loa vectors C. silacea and C dimidiata. These were collated into a database summarising the publication, field and laboratory procedures, species distributions, ecology, habitats and methods of vector control. The majority of articles were from the 1950-1960s. Field studies conducted in Cameroon, Democratic Republic of Congo, Equatorial Guinea, Nigeria and Sudan highlighted that C. silacea is the most important and widespread vector. This species breeds in muddy streams or swampy areas of forests or plantations, descends from forest canopies to feed on humans during the day, is more readily adapted to human dwellings and attracted to wood fires. Main vector targeted measures proposed to impact on L. loa transmission included personal repellents, household screening, indoor residual spraying, community-based environmental management, adulticiding and larviciding. This is the first comprehensive review of the major L. loa vectors for several decades. It highlights key vector transmission characteristics that may be targeted for vector control providing insights into the potential for integrated vector management, with multiple diseases being targeted simultaneously, with shared human and financial resources and multiple impact. Integrated vector management programmes for filarial infections, especially in low transmission areas of onchocerciasis, require innovative approaches and alternative strategies if the elimination targets established by the World Health Organization are to be achieved.

  19. Ecological, biological and social dimensions of dengue vector breeding in five urban settings of Latin America: a multi-country study.

    PubMed

    Quintero, Juliana; Brochero, Helena; Manrique-Saide, Pablo; Barrera-Pérez, Mario; Basso, César; Romero, Sonnia; Caprara, Andrea; De Lima Cunha, Jane Cris; Beltrán-Ayala, Efraín; Mitchell-Foster, Kendra; Kroeger, Axel; Sommerfeld, Johannnes; Petzold, Max

    2014-01-21

    Dengue is an increasingly important public health problem in most Latin American countries and more cost-effective ways of reducing dengue vector densities to prevent transmission are in demand by vector control programs. This multi-centre study attempted to identify key factors associated with vector breeding and development as a basis for improving targeted intervention strategies. In each of 5 participant cities in Mexico, Colombia, Ecuador, Brazil and Uruguay, 20 clusters were randomly selected by grid sampling to incorporate 100 contiguous households, non-residential private buildings (businesses) and public spaces. Standardized household surveys, cluster background surveys and entomological surveys specifically targeted to obtain pupal indices for Aedes aegypti, were conducted in the dry and wet seasons. The study clusters included mainly urban low-middle class populations with satisfactory infrastructure and -except for Uruguay- favourable climatic conditions for dengue vector development. Household knowledge about dengue and "dengue mosquitoes" was widespread, mainly through mass media, but there was less awareness around interventions to reduce vector densities. Vector production (measured through pupal indices) was favoured when water containers were outdoor, uncovered, unused (even in Colombia and Ecuador where the large tanks used for household water storage and washing were predominantly productive) and -particularly during the dry season- rainwater filled. Larval infestation did not reflect productive container types. All productive container types, including those important in the dry season, were identified by pupal surveys executed during the rainy season. A number of findings are relevant for improving vector control: 1) there is a need for complementing larval surveys with occasional pupal surveys (to be conducted during the wet season) for identifying and subsequently targeting productive container types; 2) the need to raise public awareness about useful and effective interventions in productive container types specific to their area; and 3) the motivation for control services that-according to this and similar studies in Asia- dedicated, targeted vector management can make a difference in terms of reducing vector abundance.

  20. The loss-of-allele assay for ES cell screening and mouse genotyping.

    PubMed

    Frendewey, David; Chernomorsky, Rostislav; Esau, Lakeisha; Om, Jinsop; Xue, Yingzi; Murphy, Andrew J; Yancopoulos, George D; Valenzuela, David M

    2010-01-01

    Targeting vectors used to create directed mutations in mouse embryonic stem (ES) cells consist, in their simplest form, of a gene for drug selection flanked by mouse genomic sequences, the so-called homology arms that promote site-directed homologous recombination between the vector and the target gene. The VelociGene method for the creation of targeted mutations in ES cells employs targeting vectors, called BACVecs, that are based on bacterial artificial chromosomes. Compared with conventional short targeting vectors, BacVecs provide two major advantages: (1) their much larger homology arms promote high targeting efficiencies without the need for isogenicity or negative selection strategies; and (2) they enable deletions and insertions of up to 100kb in a single targeting event, making possible gene-ablating definitive null alleles and other large-scale genomic modifications. Because of their large arm sizes, however, BACVecs do not permit screening by conventional assays, such as long-range PCR or Southern blotting, that link the inserted targeting vector to the targeted locus. To exploit the advantages of BACVecs for gene targeting, we inverted the conventional screening logic in developing the loss-of-allele (LOA) assay, which quantifies the number of copies of the native locus to which the mutation was directed. In a correctly targeted ES cell clone, the LOA assay detects one of the two native alleles (for genes not on the X or Y chromosome), the other allele being disrupted by the targeted modification. We apply the same principle in reverse as a gain-of-allele assay to quantify the copy number of the inserted targeting vector. The LOA assay reveals a correctly targeted clone as having lost one copy of the native target gene and gained one copy of the drug resistance gene or other inserted marker. The combination of these quantitative assays makes LOA genotyping unequivocal and amenable to automated scoring. We use the quantitative polymerase chain reaction (qPCR) as our method of allele quantification, but any method that can reliably distinguish the difference between one and two copies of the target gene can be used to develop an LOA assay. We have designed qPCR LOA assays for deletions, insertions, point mutations, domain swaps, conditional, and humanized alleles and have used the insert assays to quantify the copy number of random insertion BAC transgenics. Because of its quantitative precision, specificity, and compatibility with high throughput robotic operations, the LOA assay eliminates bottlenecks in ES cell screening and mouse genotyping and facilitates maximal speed and throughput for knockout mouse production. Copyright (c) 2010 Elsevier Inc. All rights reserved.

  1. Preferential expression and immunogenicity of HIV-1 Tat fusion protein expressed in tomato plant.

    PubMed

    Cueno, Marni E; Hibi, Yurina; Karamatsu, Katsuo; Yasutomi, Yasuhiro; Imai, Kenichi; Laurena, Antonio C; Okamoto, Takashi

    2010-10-01

    HIV-1 Tat plays a major role in viral replication and is essential for AIDS development making it an ideal vaccine target providing that both humoral and cellular immune responses are induced. Plant-based antigen production, due to its cheaper cost, appears ideal for vaccine production. In this study, we created a plant-optimized tat and mutant (Cys30Ala/Lys41Ala) tat (mtat) gene and ligated each into a pBI121 expression vector with a stop codon and a gusA gene positioned immediately downstream. The vector construct was bombarded into tomato leaf calli and allowed to develop. We thus generated recombinant tomato plants preferentially expressing a Tat-GUS fusion protein over a Tat-only protein. In addition, plants bombarded with either tat or mtat genes showed no phenotypic difference and produced 2-4 microg Tat-GUS fusion protein per milligram soluble plant protein. Furthermore, tomato extracts intradermally inoculated into mice were found to induce a humoral and, most importantly, cellular immunity.

  2. A global airport-based risk model for the spread of dengue infection via the air transport network.

    PubMed

    Gardner, Lauren; Sarkar, Sahotra

    2013-01-01

    The number of travel-acquired dengue infections has seen a consistent global rise over the past decade. An increased volume of international passenger air traffic originating from regions with endemic dengue has contributed to a rise in the number of dengue cases in both areas of endemicity and elsewhere. This paper reports results from a network-based risk assessment model which uses international passenger travel volumes, travel routes, travel distances, regional populations, and predictive species distribution models (for the two vector species, Aedes aegypti and Aedes albopictus) to quantify the relative risk posed by each airport in importing passengers with travel-acquired dengue infections. Two risk attributes are evaluated: (i) the risk posed by through traffic at each stopover airport and (ii) the risk posed by incoming travelers to each destination airport. The model results prioritize optimal locations (i.e., airports) for targeted dengue surveillance. The model is easily extendible to other vector-borne diseases.

  3. A Global Airport-Based Risk Model for the Spread of Dengue Infection via the Air Transport Network

    PubMed Central

    Gardner, Lauren; Sarkar, Sahotra

    2013-01-01

    The number of travel-acquired dengue infections has seen a consistent global rise over the past decade. An increased volume of international passenger air traffic originating from regions with endemic dengue has contributed to a rise in the number of dengue cases in both areas of endemicity and elsewhere. This paper reports results from a network-based risk assessment model which uses international passenger travel volumes, travel routes, travel distances, regional populations, and predictive species distribution models (for the two vector species, Aedes aegypti and Aedes albopictus) to quantify the relative risk posed by each airport in importing passengers with travel-acquired dengue infections. Two risk attributes are evaluated: (i) the risk posed by through traffic at each stopover airport and (ii) the risk posed by incoming travelers to each destination airport. The model results prioritize optimal locations (i.e., airports) for targeted dengue surveillance. The model is easily extendible to other vector-borne diseases. PMID:24009672

  4. A novel non-uniform control vector parameterization approach with time grid refinement for flight level tracking optimal control problems.

    PubMed

    Liu, Ping; Li, Guodong; Liu, Xinggao; Xiao, Long; Wang, Yalin; Yang, Chunhua; Gui, Weihua

    2018-02-01

    High quality control method is essential for the implementation of aircraft autopilot system. An optimal control problem model considering the safe aerodynamic envelop is therefore established to improve the control quality of aircraft flight level tracking. A novel non-uniform control vector parameterization (CVP) method with time grid refinement is then proposed for solving the optimal control problem. By introducing the Hilbert-Huang transform (HHT) analysis, an efficient time grid refinement approach is presented and an adaptive time grid is automatically obtained. With this refinement, the proposed method needs fewer optimization parameters to achieve better control quality when compared with uniform refinement CVP method, whereas the computational cost is lower. Two well-known flight level altitude tracking problems and one minimum time cost problem are tested as illustrations and the uniform refinement control vector parameterization method is adopted as the comparative base. Numerical results show that the proposed method achieves better performances in terms of optimization accuracy and computation cost; meanwhile, the control quality is efficiently improved. Copyright © 2017 ISA. Published by Elsevier Ltd. All rights reserved.

  5. Aircraft Engine Thrust Estimator Design Based on GSA-LSSVM

    NASA Astrophysics Data System (ADS)

    Sheng, Hanlin; Zhang, Tianhong

    2017-08-01

    In view of the necessity of highly precise and reliable thrust estimator to achieve direct thrust control of aircraft engine, based on support vector regression (SVR), as well as least square support vector machine (LSSVM) and a new optimization algorithm - gravitational search algorithm (GSA), by performing integrated modelling and parameter optimization, a GSA-LSSVM-based thrust estimator design solution is proposed. The results show that compared to particle swarm optimization (PSO) algorithm, GSA can find unknown optimization parameter better and enables the model developed with better prediction and generalization ability. The model can better predict aircraft engine thrust and thus fulfills the need of direct thrust control of aircraft engine.

  6. Minimum impulse three-body trajectories.

    NASA Technical Reports Server (NTRS)

    D'Amario, L.; Edelbaum, T. N.

    1973-01-01

    A rapid and accurate method of calculating optimal impulsive transfers in the restricted problem of three bodies has been developed. The technique combines a multi-conic method of trajectory integration with primer vector theory and an accelerated gradient method of trajectory optimization. A unique feature is that the state transition matrix and the primer vector are found analytical without additional integrations or differentiations. The method has been applied to the determination of optimal two and three impulse transfers between the L2 libration point and circular orbits about both the earth and the moon.

  7. Effect of codon optimization and subcellular targeting on Toxoplasma gondii antigen SAG1 expression in tobacco leaves to use in subcutaneous and oral immunization in mice.

    PubMed

    Laguía-Becher, Melina; Martín, Valentina; Kraemer, Mauricio; Corigliano, Mariana; Yacono, María L; Goldman, Alejandra; Clemente, Marina

    2010-07-15

    Codon optimization and subcellular targeting were studied with the aim to increase the expression levels of the SAG178-322 antigen of Toxoplasma gondii in tobacco leaves. The expression of the tobacco-optimized and native versions of the SAG1 gene was explored by transient expression from the Agrobacterium tumefaciens binary expression vector, which allows targeting the recombinant protein to the endoplasmic reticulum (ER) and the apoplast. Finally, mice were subcutaneously and orally immunized with leaf extracts-SAG1 and the strategy of prime boost with rSAG1 expressed in Escherichia coli was used to optimize the oral immunization with leaf extracts-SAG1. Leaves agroinfiltrated with an unmodified SAG1 gene accumulated 5- to 10-fold more than leaves agroinfiltrated with a codon-optimized SAG1 gene. ER localization allowed the accumulation of higher levels of native SAG1. However, no significant differences were observed between the mRNA accumulations of the different versions of SAG1. Subcutaneous immunization with leaf extracts-SAG1 (SAG1) protected mice against an oral challenge with a non-lethal cyst dose, and this effect could be associated with the secretion of significant levels of IFN-gamma. The protection was increased when mice were ID boosted with rSAG1 (SAG1+boost). This group elicited a significant Th1 humoral and cellular immune response characterized by high levels of IFN-gamma. In an oral immunization assay, the SAG1+boost group showed a significantly lower brain cyst burden compared to the rest of the groups. Transient agroinfiltration was useful for the expression of all of the recombinant proteins tested. Our results support the usefulness of endoplasmic reticulum signal peptides in enhancing the production of recombinant proteins meant for use as vaccines. The results showed that this plant-produced protein has potential for use as vaccine and provides a potential means for protecting humans and animals against toxoplasmosis.

  8. Characterization of a 3rd Generation Lentiviral Vector Pseudotyped With Nipah Virus Envelope Proteins For Endothelial Cell Transduction

    PubMed Central

    Witting, Scott R.; Vallanda, Priya; Gamble, Aisha L.

    2013-01-01

    Lentiviruses are becoming progressively more popular as gene therapy vectors due to their ability to integrate into quiescent cells and recent clinical trial successes. Directing these vectors to specific cell types and limiting off-target transduction in vivo remains a challenge. Replacing the viral envelope proteins responsible for cellular binding, or pseudotyping, remains a common method to improve lentiviral targeting. Here, we describe the development of a high titer, 3rd generation lentiviral vector pseudotyped with Nipah virus fusion protein (NiV-F) and attachment protein (NiV-G). Critical to high titers was truncation of the cytoplasmic domains of both NiV-F and NiV-G. As known targets of wild-type Nipah virus, primary endothelial cells are shown to be effectively transduced by the Nipah pseudotype. In contrast, human CD34+ hematopoietic progenitors were not significantly transduced. Additionally, the Nipah pseudotype has increased stability in human serum compared to VSV pseudotyped lentivirus. These findings suggest that the use of Nipah virus envelope proteins in 3rd generation lentiviral vectors would be a valuable tool for gene delivery targeted to endothelial cells. PMID:23698741

  9. Characterization of a third generation lentiviral vector pseudotyped with Nipah virus envelope proteins for endothelial cell transduction.

    PubMed

    Witting, S R; Vallanda, P; Gamble, A L

    2013-10-01

    Lentiviruses are becoming progressively more popular as gene therapy vectors due to their ability to integrate into quiescent cells and recent clinical trial successes. Directing these vectors to specific cell types and limiting off-target transduction in vivo remains a challenge. Replacing the viral envelope proteins responsible for cellular binding, or pseudotyping, remains a common method to improve lentiviral targeting. Here, we describe the development of a high titer, third generation lentiviral vector pseudotyped with Nipah virus fusion protein (NiV-F) and attachment protein (NiV-G). Critical to high titers was truncation of the cytoplasmic domains of both NiV-F and NiV-G. As known targets of wild-type Nipah virus, primary endothelial cells are shown to be effectively transduced by the Nipah pseudotype. In contrast, human CD34+ hematopoietic progenitors were not significantly transduced. Additionally, the Nipah pseudotype has increased stability in human serum compared with vesicular stomatitis virus pseudotyped lentivirus. These findings suggest that the use of Nipah virus envelope proteins in third generation lentiviral vectors would be a valuable tool for gene delivery targeted to endothelial cells.

  10. Rabies virus envelope glycoprotein targets lentiviral vectors to the axonal retrograde pathway in motor neurons.

    PubMed

    Hislop, James N; Islam, Tarin A; Eleftheriadou, Ioanna; Carpentier, David C J; Trabalza, Antonio; Parkinson, Michael; Schiavo, Giampietro; Mazarakis, Nicholas D

    2014-06-06

    Rabies pseudotyped lentiviral vectors have great potential in gene therapy, not least because of their ability to transduce neurons following their distal axonal application. However, very little is known about the molecular processes that underlie their retrograde transport and cell transduction. Using multiple labeling techniques and confocal microscopy, we demonstrated that pseudotyping with rabies virus envelope glycoprotein (RV-G) enabled the axonal retrograde transport of two distinct subtypes of lentiviral vector in motor neuron cultures. Analysis of this process revealed that these vectors trafficked through Rab5-positive endosomes and accumulated within a non-acidic Rab7 compartment. RV-G pseudotyped vectors were co-transported with both the tetanus neurotoxin-binding fragment and the membrane proteins thought to mediate rabies virus endocytosis (neural cell adhesion molecule, nicotinic acetylcholine receptor, and p75 neurotrophin receptor), thus demonstrating that pseudotyping with RV-G targets lentiviral vectors for transport along the same pathway exploited by several toxins and viruses. Using motor neurons cultured in compartmentalized chambers, we demonstrated that axonal retrograde transport of these vectors was rapid and efficient; however, it was not able to transduce the targeted neurons efficiently, suggesting that impairment in processes occurring after arrival of the viral vector in the soma is responsible for the low transduction efficiency seen in vivo, which suggests a novel area for improvement of gene therapy vectors. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  11. Synthesis and biological evaluation of copper-64 radiolabeled [DUPA-6-Ahx-(NODAGA)-5-Ava-BBN(7-14)NH2], a novel bivalent targeting vector having affinity for two distinct biomarkers (GRPr/PSMA) of prostate cancer.

    PubMed

    Bandari, Rajendra Prasad; Jiang, Zongrun; Reynolds, Tamila Stott; Bernskoetter, Nicole E; Szczodroski, Ashley F; Bassuner, Kurt J; Kirkpatrick, Daniel L; Rold, Tammy L; Sieckman, Gary L; Hoffman, Timothy J; Connors, James P; Smith, Charles J

    2014-04-01

    Gastrin-releasing peptide receptors (GRPr) and prostate-specific membrane antigen (PSMA) are two identifying biomarkers expressed in very high numbers on prostate cancer cells and could serve as a useful tool for molecular targeting and diagnosis of disease via positron-emission tomography (PET). The aim of this study was to produce the multipurpose, bivalent [DUPA-6-Ahx-((64)Cu-NODAGA)-5-Ava-BBN(7-14)NH2] radioligand for prostate cancer imaging, where DUPA = (2-[3-(1,3-dicarboxypropyl)-ureido]pentanedioic acid), a small-molecule, PSMA-targeting probe, 6Ahx = 6-aminohexanoic acid, 5-Ava = 5-aminovaleric acid, NODAGA = [2-(4,7-biscarboxymethyl)-1,4,7-(triazonan-1-yl)pentanedioic acid] (a derivative of NOTA (1,4,7-triazacyclononane-1,4,7-triacetic acid)), and BBN(7-14)NH2 = bombesin, a GRPr-specific peptide targeting probe. The PSMA/GRPr dual targeting ligand precursor [DUPA-6-Ahx-K-5-Ava-BBN(7-14)NH2], was synthesized by solid-phase and manual peptide synthesis, after which NODAGA was added via manual conjugation to the ε-amine of lysine (K). The new bivalent GRPr/PSMA targeting vector was purified by reversed-phase high performance liquid chromatography (RP-HPLC), characterized by electrospray-ionization mass spectrometry (ESI-MS), and metallated with (64)CuCl2 and (nat)CuCl2. The receptor binding affinity was evaluated in human, prostate, PC-3 (GRPr-positive) and LNCaP (PSMA-positive) cells and the tumor-targeting efficacy determined in severe combined immunodeficient (SCID) and athymic nude mice bearing PC-3 and LNCaP tumors. Whole-body maximum intensity microPET/CT images of PC-3/LNCaP tumor-bearing mice were obtained 18 h post-injection (p.i.). Competitive binding assays in PC-3 and LNCaP cells indicated high receptor binding affinity for the [DUPA-6-Ahx-((nat)Cu-NODAGA)-5-Ava-BBN(7-14)NH2] conjugate. MicroPET scintigraphy in PC-3/LNCaP tumor-bearing mice indicated that xenografted tumors were visible at 18h p.i. with collateral, background radiation also being observed in non-target tissue. DUPA-6-Ahx-((64)Cu-NODAGA)-5-Ava-BBN(7-14)NH2] targeting vector, as described herein, is the first example of a dual GRPr-/PSMA-targeting radioligand for molecular of imaging prostate tumors. Detailed in vitro studies and microPET molecular imaging investigations of [DUPA-6-Ahx-((64)Cu-NODAGA)-5-Ava-BBN(7-14)NH2 in tumor-bearing mice indicate that further studies are necessary to optimize uptake and retention of tracer in GRPr- and PSMA-positive tissues. Published by Elsevier Inc.

  12. Synthesis and Biological Evaluation of Copper-64 Radiolabeled [DUPA-6-Ahx-(NODAGA)-5-Ava-BBN(7-14)NH2], a Novel Bivalent Targeting Vector Having Affinity for Two Distinct Biomarkers (GRPr/PSMA) of Prostate Cancer

    PubMed Central

    Bandari, Rajendra Prasad; Jiang, Zongrun; Reynolds, Tamila Stott; Bernskoetter, Nicole E.; Szczodroski, Ashley F.; Bassuner, Kurt J.; Kirkpatrick, Daniel L.; Rold, Tammy L.; Sieckman, Gary L.; Hoffman, Timothy J.; Connors, James P.; Smith, Charles J.

    2014-01-01

    Gastrin-releasing peptide receptors (GRPr) and prostate-specific membrane antigen (PSMA) are two identifying biomarkers expressed in very high numbers on prostate cancer cells and could serve as a useful tool for molecular targeting and diagnosis of disease via positron-emission tomography (PET). The aim of this study was to produce the multipurpose, bivalent [DUPA-6-Ahx-(64Cu-NODAGA)-5-Ava-BBN(7-14)NH2] radioligand for prostate cancer imaging, where DUPA = 2-[3-(1,3-Bis-tertbutoxycarbonylpropyl)-ureido]pentanedioic acid, a small-molecule, PSMA-targeting probe, 6Ahx = 6-aminohexanoic acid, 5-Ava = 5-aminovaleric acid, NODAGA = [2-(4,7-biscarboxymethyl)-1,4,7-(triazonan-1-yl)pentanedioic acid] (a derivative of NOTA (1,4,7-triazacyclononane-1,4,7-triacetic acid)), and BBN(7-14)NH2 = bombesin or BBN, a GRPr-specific peptide targeting probe. Methods The PSMA/GRPr dual targeting ligand precursor [DUPA-6-Ahx-K-5-Ava-BBN(7-14)NH2], was synthesized by solid-phase and manual peptide synthesis, after which NODAGA was added via manual conjugation to the ε-amine of lysine (K). The new bivalent GRPr/PSMA targeting vector was purified by reversed-phase high performance liquid chromatography (RP-HPLC), characterized by electrospray-ionization mass spectrometry (ESI-MS), and metallated with 64CuCl2 and natCuCl2. The receptor binding affinity was evaluated in human, prostate, PC-3 (GRPr-positive) and LNCaP (PSMA-positive) cells and the tumor-targeting efficacy determined in severe combined immunodeficient (SCID) and athymic nude mice bearing PC-3 and LNCaP tumors. Whole-body maximum intensity microPET/CT images of PC-3/LNCaP tumor-bearing mice were obtained 18 h post-injection (p.i.). Results Competitive binding assays in PC-3 and LNCaP cells indicated high receptor binding affinity for the [DUPA-6-Ahx-(natCu-NODAGA)-5-Ava-BBN(7-14)NH2] conjugate. MicroPET scintigraphy in PC-3/LNCaP tumor-bearing mice indicated that xenografted tumors were visible at 18 h p.i. with collateral, background radiation also being observed in non-target tissue. Conclusions [DUPA-6-Ahx-(64Cu-NODAGA)-5-Ava-BBN(7-14)NH2] targeting vector, as described herein, is the first example of a dual GRPr-/PSMA-targeting radioligand for molecular imaging prostate tumors. Detailed in vitro studies and microPET molecular imaging investigations of [DUPA-6-Ahx-(64Cu-NODAGA)-5-Ava-BBN(7-14)NH2] in tumor-bearing mice indicates that further studies are necessary to optimize uptake and retention of tracer in GRPr- and PSMA-positive tissues. PMID:24508213

  13. Sequential cloning of chromosomes

    DOEpatents

    Lacks, Sanford A.

    1995-07-18

    A method for sequential cloning of chromosomal DNA of a target organism is disclosed. A first DNA segment homologous to the chromosomal DNA to be sequentially cloned is isolated. The first segment has a first restriction enzyme site on either side. A first vector product is formed by ligating the homologous segment into a suitably designed vector. The first vector product is circularly integrated into the target organism's chromosomal DNA. The resulting integrated chromosomal DNA segment includes the homologous DNA segment at either end of the integrated vector segment. The integrated chromosomal DNA is cleaved with a second restriction enzyme and ligated to form a vector-containing plasmid, which is replicated in a host organism. The replicated plasmid is then cleaved with the first restriction enzyme. Next, a DNA segment containing the vector and a segment of DNA homologous to a distal portion of the previously isolated DNA segment is isolated. This segment is then ligated to form a plasmid which is replicated within a suitable host. This plasmid is then circularly integrated into the target chromosomal DNA. The chromosomal DNA containing the circularly integrated vector is treated with a third, retrorestriction (class IIS) enzyme. The cleaved DNA is ligated to give a plasmid that is used to transform a host permissive for replication of its vector. The sequential cloning process continues by repeated cycles of circular integration and excision. The excision is carried out alternately with the second and third enzymes.

  14. Thyra Abstract Interface Package

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bartlett, Roscoe A.

    2005-09-01

    Thrya primarily defines a set of abstract C++ class interfaces needed for the development of abstract numerical atgorithms (ANAs) such as iterative linear solvers, transient solvers all the way up to optimization. At the foundation of these interfaces are abstract C++ classes for vectors, vector spaces, linear operators and multi-vectors. Also included in the Thyra package is C++ code for creating concrete vector, vector space, linear operator, and multi-vector subclasses as well as other utilities to aid in the development of ANAs. Currently, very general and efficient concrete subclass implementations exist for serial and SPMD in-core vectors and multi-vectors. Codemore » also currently exists for testing objects and providing composite objects such as product vectors.« less

  15. Lentiviral vectors encoding shRNAs efficiently transduce and knockdown LINGO-1 but induce an interferon response and cytotoxicity in CNS neurons

    PubMed Central

    Hutson, Thomas H.; Foster, Edmund; Dawes, John M.; Hindges, Robert; Yáñez-Muñoz, Rafael J.; Moon, Lawrence D.F.

    2017-01-01

    Background Knocking down neuronal LINGO-1 using short hairpin RNAs (shRNAs) might enhance axon regeneration in the CNS. Integration-deficient lentiviral vectors have great potential as a therapeutic delivery system for CNS injuries. However, recent studies have revealed that shRNAs can induce an interferon response resulting in off-target effects and cytotoxicity. Methods CNS neurons were transduced with integration-deficient lentiviral vectors in vitro. The transcriptional effect of shRNA expression was analysed using qRT-PCR and northern blots were used to assess shRNA production. Results Integration-deficient lentiviral vectors efficiently transduced CNS neurons and knocked down LINGO-1 mRNA in vitro. However, an increase in cell death was observed when lentiviral vectors encoding an shRNA were applied or when high vector concentrations were used. We demonstrate that high doses of vector or the use of vectors encoding shRNAs can induce an up-regulation of interferon stimulated genes (OAS1 and PKR) and a down-regulation of off- target genes (including p75NTR and NgR1). Furthermore, the northern blot demonstrated that these negative consequences occur even when lentiviral vectors express low levels of shRNAs. Together, these results may explain why neurite outgrowth was not enhanced on an inhibitory substrate after transduction with lentiviral vectors encoding an shRNA targeting LINGO-1. Conclusions These findings highlight the importance of including appropriate controls to verify silencing specificity and the requirement to check for an interferon response when conducting RNA interference experiments. However, the potential benefits that RNA interference and viral vectors offer to gene-based therapies to CNS injuries cannot be overlooked and demand further investigation. PMID:22499506

  16. Interaction between shock wave and single inertial bubbles near an elastic boundary.

    PubMed

    Sankin, G N; Zhong, P

    2006-10-01

    The interaction of laser-generated single inertial bubbles (collapse time = 121 mus) near a silicon rubber membrane with a shock wave (55 MPa in peak pressure and 1.7 mus in compressive pulse duration) is investigated. The interaction leads to directional, forced asymmetric collapse of the bubble with microjet formation toward the surface. Maximum jet penetration into the membrane is produced during the bubble collapse phase with optimal shock wave arrival time and stand-off distance. Such interaction may provide a unique acoustic means for in vivo microinjection, applicable to targeted delivery of macromolecules and gene vectors to biological tissues.

  17. Performance improvements of symmetry-breaking reflector structures in nonimaging devices

    DOEpatents

    Winston, Roland

    2004-01-13

    A structure and method for providing a broken symmetry reflector structure for a solar concentrator device. The component of the optical direction vector along the symmetry axis is conserved for all rays propagated through a translationally symmetric optical device. This quantity, referred to as the translational skew invariant, is conserved in rotationally symmetric optical systems. Performance limits for translationally symmetric nonimaging optical devices are derived from the distributions of the translational skew invariant for the optical source and for the target to which flux is to be transferred. A numerically optimized non-tracking solar concentrator utilizing symmetry-breaking reflector structures can overcome the performance limits associated with translational symmetry.

  18. Gene Delivery to Adipose Tissue Using Transcriptionally Targeted rAAV8 Vectors

    PubMed Central

    Uhrig-Schmidt, Silke; Geiger, Matthias; Luippold, Gerd; Birk, Gerald; Mennerich, Detlev; Neubauer, Heike; Grimm, Dirk; Wolfrum, Christian; Kreuz, Sebastian

    2014-01-01

    In recent years, the increasing prevalence of obesity and obesity-related co-morbidities fostered intensive research in the field of adipose tissue biology. To further unravel molecular mechanisms of adipose tissue function, genetic tools enabling functional studies in vitro and in vivo are essential. While the use of transgenic animals is well established, attempts using viral and non-viral vectors to genetically modify adipocytes in vivo are rare. Therefore, we here characterized recombinant Adeno-associated virus (rAAV) vectors regarding their potency as gene transfer vehicles for adipose tissue. Our results demonstrate that a single dose of systemically applied rAAV8-CMV-eGFP can give rise to remarkable transgene expression in murine adipose tissues. Upon transcriptional targeting of the rAAV8 vector to adipocytes using a 2.2 kb fragment of the murine adiponectin (mAP2.2) promoter, eGFP expression was significantly decreased in off-target tissues while efficient transduction was maintained in subcutaneous and visceral fat depots. Moreover, rAAV8-mAP2.2-mediated expression of perilipin A – a lipid-droplet-associated protein – resulted in significant changes in metabolic parameters only three weeks post vector administration. Taken together, our findings indicate that rAAV vector technology is applicable as a flexible tool to genetically modify adipocytes for functional proof-of-concept studies and the assessment of putative therapeutic targets in vivo. PMID:25551639

  19. Towards β-globin gene-targeting with integrase-defective lentiviral vectors.

    PubMed

    Inanlou, Davoud Nouri; Yakhchali, Bagher; Khanahmad, Hossein; Gardaneh, Mossa; Movassagh, Hesam; Cohan, Reza Ahangari; Ardestani, Mehdi Shafiee; Mahdian, Reza; Zeinali, Sirous

    2010-11-01

    We have developed an integrase-defective lentiviral (LV) vector in combination with a gene-targeting approach for gene therapy of β-thalassemia. The β-globin gene-targeting construct has two homologous stems including sequence upstream and downstream of the β-globin gene, a β-globin gene positioned between hygromycin and neomycin resistant genes and a herpes simplex virus type 1 thymidine kinase (HSVtk) suicide gene. Utilization of integrase-defective LV as a vector for the β-globin gene increased the number of selected clones relative to non-viral methods. This method represents an important step toward the ultimate goal of a clinical gene therapy for β-thalassemia.

  20. Primer vector theory applied to the linear relative-motion equations. [for N-impulse space trajectory optimization

    NASA Technical Reports Server (NTRS)

    Jezewski, D.

    1980-01-01

    Prime vector theory is used in analyzing a set of linear relative-motion equations - the Clohessy-Wiltshire (C/W) equations - to determine the criteria and necessary conditions for an optimal N-impulse trajectory. The analysis develops the analytical criteria for improving a solution by: (1) moving any dependent or independent variable in the initial and/or final orbit, and (2) adding intermediate impulses. If these criteria are violated, the theory establishes a sufficient number of analytical equations. The subsequent satisfaction of these equations will result in the optimal position vectors and times of an N-impulse trajectory. The solution is examined for the specific boundary conditions of: (1) fixed-end conditions, two impulse, and time-open transfer; (2) an orbit-to-orbit transfer; and (3) a generalized renezvous problem.

  1. Performance limitations of translationally symmetric nonimaging devices

    NASA Astrophysics Data System (ADS)

    Bortz, John C.; Shatz, Narkis E.; Winston, Roland

    2001-11-01

    The component of the optical direction vector along the symmetry axis is conserved for all rays propagated through a translationally symmetric optical device. This quality, referred to herein as the translational skew invariant, is analogous to the conventional skew invariant, which is conserved in rotationally symmetric optical systems. The invariance of both of these quantities is a consequence of Noether's theorem. We show how performance limits for translationally symmetric nonimaging optical devices can be derived from the distributions of the translational skew invariant for the optical source and for the target to which flux is to be transferred. Examples of computed performance limits are provided. In addition, we show that a numerically optimized non-tracking solar concentrator utilizing symmetry-breaking surface microstructure can overcome the performance limits associated with translational symmetry. The optimized design provides a 47.4% increase in efficiency and concentration relative to an ideal translationally symmetric concentrator.

  2. Habitat suitability and ecological niche profile of major malaria vectors in Cameroon

    PubMed Central

    2009-01-01

    Background Suitability of environmental conditions determines a species distribution in space and time. Understanding and modelling the ecological niche of mosquito disease vectors can, therefore, be a powerful predictor of the risk of exposure to the pathogens they transmit. In Africa, five anophelines are responsible for over 95% of total malaria transmission. However, detailed knowledge of the geographic distribution and ecological requirements of these species is to date still inadequate. Methods Indoor-resting mosquitoes were sampled from 386 villages covering the full range of ecological settings available in Cameroon, Central Africa. Using a predictive species distribution modeling approach based only on presence records, habitat suitability maps were constructed for the five major malaria vectors Anopheles gambiae, Anopheles funestus, Anopheles arabiensis, Anopheles nili and Anopheles moucheti. The influence of 17 climatic, topographic, and land use variables on mosquito geographic distribution was assessed by multivariate regression and ordination techniques. Results Twenty-four anopheline species were collected, of which 17 are known to transmit malaria in Africa. Ecological Niche Factor Analysis, Habitat Suitability modeling and Canonical Correspondence Analysis revealed marked differences among the five major malaria vector species, both in terms of ecological requirements and niche breadth. Eco-geographical variables (EGVs) related to human activity had the highest impact on habitat suitability for the five major malaria vectors, with areas of low population density being of marginal or unsuitable habitat quality. Sunlight exposure, rainfall, evapo-transpiration, relative humidity, and wind speed were among the most discriminative EGVs separating "forest" from "savanna" species. Conclusions The distribution of major malaria vectors in Cameroon is strongly affected by the impact of humans on the environment, with variables related to proximity to human settings being among the best predictors of habitat suitability. The ecologically more tolerant species An. gambiae and An. funestus were recorded in a wide range of eco-climatic settings. The other three major vectors, An. arabiensis, An. moucheti, and An. nili, were more specialized. Ecological niche and species distribution modelling should help improve malaria vector control interventions by targeting places and times where the impact on vector populations and disease transmission can be optimized. PMID:20028559

  3. Habitat suitability and ecological niche profile of major malaria vectors in Cameroon.

    PubMed

    Ayala, Diego; Costantini, Carlo; Ose, Kenji; Kamdem, Guy C; Antonio-Nkondjio, Christophe; Agbor, Jean-Pierre; Awono-Ambene, Parfait; Fontenille, Didier; Simard, Frédéric

    2009-12-23

    Suitability of environmental conditions determines a species distribution in space and time. Understanding and modelling the ecological niche of mosquito disease vectors can, therefore, be a powerful predictor of the risk of exposure to the pathogens they transmit. In Africa, five anophelines are responsible for over 95% of total malaria transmission. However, detailed knowledge of the geographic distribution and ecological requirements of these species is to date still inadequate. Indoor-resting mosquitoes were sampled from 386 villages covering the full range of ecological settings available in Cameroon, Central Africa. Using a predictive species distribution modeling approach based only on presence records, habitat suitability maps were constructed for the five major malaria vectors Anopheles gambiae, Anopheles funestus, Anopheles arabiensis, Anopheles nili and Anopheles moucheti. The influence of 17 climatic, topographic, and land use variables on mosquito geographic distribution was assessed by multivariate regression and ordination techniques. Twenty-four anopheline species were collected, of which 17 are known to transmit malaria in Africa. Ecological Niche Factor Analysis, Habitat Suitability modeling and Canonical Correspondence Analysis revealed marked differences among the five major malaria vector species, both in terms of ecological requirements and niche breadth. Eco-geographical variables (EGVs) related to human activity had the highest impact on habitat suitability for the five major malaria vectors, with areas of low population density being of marginal or unsuitable habitat quality. Sunlight exposure, rainfall, evapo-transpiration, relative humidity, and wind speed were among the most discriminative EGVs separating "forest" from "savanna" species. The distribution of major malaria vectors in Cameroon is strongly affected by the impact of humans on the environment, with variables related to proximity to human settings being among the best predictors of habitat suitability. The ecologically more tolerant species An. gambiae and An. funestus were recorded in a wide range of eco-climatic settings. The other three major vectors, An. arabiensis, An. moucheti, and An. nili, were more specialized. Ecological niche and species distribution modelling should help improve malaria vector control interventions by targeting places and times where the impact on vector populations and disease transmission can be optimized.

  4. Deletion of Specific Immune-Modulatory Genes from Modified Vaccinia Virus Ankara-Based HIV Vaccines Engenders Improved Immunogenicity in Rhesus Macaques

    PubMed Central

    O'Mara, Leigh A.; Gangadhara, Sailaja; McQuoid, Monica; Zhang, Xiugen; Zheng, Rui; Gill, Kiran; Verma, Meena; Yu, Tianwei; Johnson, Brent; Li, Bing; Derdeyn, Cynthia A.; Ibegbu, Chris; Altman, John D.; Hunter, Eric; Feinberg, Mark B.

    2012-01-01

    Modified vaccinia virus Ankara (MVA) is a safe, attenuated orthopoxvirus that is being developed as a vaccine vector but has demonstrated limited immunogenicity in several early-phase clinical trials. Our objective was to rationally improve the immunogenicity of MVA-based HIV/AIDS vaccines via the targeted deletion of specific poxvirus immune-modulatory genes. Vaccines expressing codon-optimized HIV subtype C consensus Env and Gag antigens were generated from MVA vector backbones that (i) harbor simultaneous deletions of four viral immune-modulatory genes, encoding an interleukin-18 (IL-18) binding protein, an IL-1β receptor, a dominant negative Toll/IL-1 signaling adapter, and CC-chemokine binding protein (MVAΔ4-HIV); (ii) harbor a deletion of an additional (fifth) viral gene, encoding uracil-DNA glycosylase (MVAΔ5-HIV); or (iii) represent the parental MVA backbone as a control (MVA-HIV). We performed head-to-head comparisons of the cellular and humoral immune responses that were elicited by these vectors during homologous prime-boost immunization regimens utilizing either high-dose (2 × 108 PFU) or low-dose (1 × 107 PFU) intramuscular immunization of rhesus macaques. At all time points, a majority of the HIV-specific T cell responses, elicited by all vectors, were directed against Env, rather than Gag, determinants, as previously observed with other vector systems. Both modified vectors elicited up to 6-fold-higher frequencies of HIV-specific CD8 and CD4 T cell responses and up to 25-fold-higher titers of Env (gp120)-specific binding (nonneutralizing) antibody responses that were relatively transient in nature. While the correlates of protection against HIV infection remain incompletely defined, our results indicate that the rational deletion of specific genes from MVA vectors can positively alter their cellular and humoral immunogenicity profiles in nonhuman primates. PMID:22973033

  5. Modular protein expression by RNA trans-splicing enables flexible expression of antibody formats in mammalian cells from a dual-host phage display vector.

    PubMed

    Shang, Yonglei; Tesar, Devin; Hötzel, Isidro

    2015-10-01

    A recently described dual-host phage display vector that allows expression of immunoglobulin G (IgG) in mammalian cells bypasses the need for subcloning of phage display clone inserts to mammalian vectors for IgG expression in large antibody discovery and optimization campaigns. However, antibody discovery and optimization campaigns usually need different antibody formats for screening, requiring reformatting of the clones in the dual-host phage display vector to an alternative vector. We developed a modular protein expression system mediated by RNA trans-splicing to enable the expression of different antibody formats from the same phage display vector. The heavy-chain region encoded by the phage display vector is directly and precisely fused to different downstream heavy-chain sequences encoded by complementing plasmids simply by joining exons in different pre-mRNAs by trans-splicing. The modular expression system can be used to efficiently express structurally correct IgG and Fab fragments or other antibody formats from the same phage display clone in mammalian cells without clone reformatting. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  6. Methods, systems and apparatus for optimization of third harmonic current injection in a multi-phase machine

    DOEpatents

    Gallegos-Lopez, Gabriel

    2012-10-02

    Methods, system and apparatus are provided for increasing voltage utilization in a five-phase vector controlled machine drive system that employs third harmonic current injection to increase torque and power output by a five-phase machine. To do so, a fundamental current angle of a fundamental current vector is optimized for each particular torque-speed of operating point of the five-phase machine.

  7. Direct model-based predictive control scheme without cost function for voltage source inverters with reduced common-mode voltage

    NASA Astrophysics Data System (ADS)

    Kim, Jae-Chang; Moon, Sung-Ki; Kwak, Sangshin

    2018-04-01

    This paper presents a direct model-based predictive control scheme for voltage source inverters (VSIs) with reduced common-mode voltages (CMVs). The developed method directly finds optimal vectors without using repetitive calculation of a cost function. To adjust output currents with the CMVs in the range of -Vdc/6 to +Vdc/6, the developed method uses voltage vectors, as finite control resources, excluding zero voltage vectors which produce the CMVs in the VSI within ±Vdc/2. In a model-based predictive control (MPC), not using zero voltage vectors increases the output current ripples and the current errors. To alleviate these problems, the developed method uses two non-zero voltage vectors in one sampling step. In addition, the voltage vectors scheduled to be used are directly selected at every sampling step once the developed method calculates the future reference voltage vector, saving the efforts of repeatedly calculating the cost function. And the two non-zero voltage vectors are optimally allocated to make the output current approach the reference current as close as possible. Thus, low CMV, rapid current-following capability and sufficient output current ripple performance are attained by the developed method. The results of a simulation and an experiment verify the effectiveness of the developed method.

  8. Developing the Second Generation CMORPH: A Prototype

    NASA Astrophysics Data System (ADS)

    Xie, Pingping; Joyce, Robert

    2014-05-01

    A prototype system of the second generation CMORPH is being developed at NOAA Climate Prediction Center (CPC) to produce global analyses of 30-min precipitation on a 0.05deg lat/lon grid over the entire globe from pole to pole through integration of information from satellite observations as well as numerical model simulations. The second generation CMORPH is built upon the Kalman Filter based CMORPH algorithm of Joyce and Xie (2011). Inputs to the system include rainfall and snowfall rate retrievals from passive microwave (PMW) measurements aboard all available low earth orbit (LEO) satellites, estimates derived from infrared (IR) observations of geostationary (GEO) as well as LEO platforms, and precipitation simulations from numerical global models. First, precipitation estimation / retrievals from various sources are mapped onto a global grid of 0.05deg lat/lon and calibrated against a common reference field to ensure consistency in their precipitation rate PDF structures. The motion vectors for the precipitating cloud systems are then defined using information from both satellite IR observations and precipitation fields generated by the NCEP Climate Forecast System Reanalysis (CFSR). To this end, motion vectors are first computed from CFSR hourly precipitation fields through cross-correlation analysis of consecutive hourly precipitation fields on the global T382 (~35 km) grid. In a similar manner, separate processing is also performed on satellite IR-based precipitation estimates to derive motion vectors from observations. A blended analysis of precipitating cloud motion vectors is then constructed through the combination of CFSR and satellite-derived vectors with an objective analysis technique. Fine resolution mapped PMW precipitation retrievals are then separately propagated along the motion vectors from their respective observation times to the target analysis time from both forward and backward directions. The CMORPH high resolution precipitation analyses are finally constructed through the combination of propagated PMW retrievals with the IR based estimates for the target analysis time. This Kalman Filter based CMORPH processing is performed for rainfall and snowfall fields separately with the same motion vectors. Experiments have been conducted for two periods of two months each, July - August 2009, and January - February 2010, to explore the development of an optimal algorithm that generates global precipitation for summer and winter situations. Preliminary results demonstrated technical feasibility to construct global rainfall and snowfall analyses through the integration of information from multiple sources. More work is underway to refine various technical components of the system for operational applications of the system. Detailed results will be reported at the EGU meeting.

  9. Application of three controls optimally in a vector-borne disease - a mathematical study

    NASA Astrophysics Data System (ADS)

    Kar, T. K.; Jana, Soovoojeet

    2013-10-01

    We have proposed and analyzed a vector-borne disease model with three types of controls for the eradication of the disease. Four different classes for the human population namely susceptible, infected, recovered and vaccinated and two different classes for the vector populations namely susceptible and infected are considered. In the first part of our analysis the disease dynamics are described for fixed controls and some inferences have been drawn regarding the spread of the disease. Next the optimal control problem is formulated and solved considering control parameters as time dependent. Different possible combination of controls are used and their effectiveness are compared by numerical simulation.

  10. Optimal integer resolution for attitude determination using global positioning system signals

    NASA Technical Reports Server (NTRS)

    Crassidis, John L.; Markley, F. Landis; Lightsey, E. Glenn

    1998-01-01

    In this paper, a new motion-based algorithm for GPS integer ambiguity resolution is derived. The first step of this algorithm converts the reference sightline vectors into body frame vectors. This is accomplished by an optimal vectorized transformation of the phase difference measurements. The result of this transformation leads to the conversion of the integer ambiguities to vectorized biases. This essentially converts the problem to the familiar magnetometer-bias determination problem, for which an optimal and efficient solution exists. Also, the formulation in this paper is re-derived to provide a sequential estimate, so that a suitable stopping condition can be found during the vehicle motion. The advantages of the new algorithm include: it does not require an a-priori estimate of the vehicle's attitude; it provides an inherent integrity check using a covariance-type expression; and it can sequentially estimate the ambiguities during the vehicle motion. The only disadvantage of the new algorithm is that it requires at least three non-coplanar baselines. The performance of the new algorithm is tested on a dynamic hardware simulator.

  11. Modifications of adenovirus hexon allow for either hepatocyte detargeting or targeting with potential evasion from Kupffer cells.

    PubMed

    Prill, Jan-Michael; Espenlaub, Sigrid; Samen, Ulrike; Engler, Tatjana; Schmidt, Erika; Vetrini, Francesco; Rosewell, Amanda; Grove, Nathan; Palmer, Donna; Ng, Philip; Kochanek, Stefan; Kreppel, Florian

    2011-01-01

    In vivo gene transfer with adenovirus vectors would significantly benefit from a tight control of the adenovirus-inherent liver tropism. For efficient hepatocyte transduction, adenovirus vectors need to evade from Kupffer cell scavenging while delivery to peripheral tissues or tumors could be improved if both scavenging by Kupffer cells and uptake by hepatocytes were blocked. Here, we provide evidence that a single point mutation in the hexon capsomere designed to enable defined chemical capsid modifications may permit both detargeting from and targeting to hepatocytes with evasion from Kupffer cell scavenging. Vector particles modified with small polyethylene glycol (PEG) moieties specifically on hexon exhibited decreased transduction of hepatocytes by shielding from blood coagulation factor binding. Vector particles modified with transferrin or, surprisingly, 5,000 Da PEG or dextran increased hepatocyte transduction up to 18-fold independent of the presence of Kupffer cells. We further show that our strategy can be used to target high-capacity adenovirus vectors to hepatocytes emphasizing the potential for therapeutic liver-directed gene transfer. Our approach may lead to a detailed understanding of the interactions between adenovirus vectors and Kupffer cells, one of the most important barriers for adenovirus-mediated gene delivery.

  12. Engineered Lentivector Targeting of Dendritic Cells for In Vivo Immunization

    PubMed Central

    Yang, Lili; Yang, Haiguang; Rideout, Kendra; Cho, Taehoon; Joo, Kye il; Ziegler, Leslie; Elliot, Abigail; Walls, Anthony; Yu, Dongzi; Baltimore, David; Wang, Pin

    2008-01-01

    We report a method of inducing antigen production in dendritic cells (DCs) by in vivo targeting with lentiviral vectors that specifically bind to the DC surface protein, DC-SIGN. To target the DCs, the lentivector was enveloped with a viral glycoprotein from Sindbis virus, engineered to be DC-SIGN-specific. In vitro, this lentivector specifically transduced DCs and induced DC maturation. A remarkable frequency (up to 12%) of ovalbumin (OVA)-specific CD8+ T cells and a significant antibody response were observed 2 weeks following injection of a targeted lentiviral vector encoding an OVA transgene into naïve mice. These mice were solidly protected against the growth of the OVA-expressing E.G7 tumor and this methodology could even induce regression of an established tumor. Thus, lentiviral vectors targeting DCs provide a simple method of producing effective immunity and may provide an alternative route for immunization with protein antigens. PMID:18297056

  13. The influence of diet on the use of near-infrared spectroscopy to determine the age of female Aedes aegypti mosquitoes

    USDA-ARS?s Scientific Manuscript database

    Interventions targeting adult mosquitoes are used to combat transmission of vector-borne diseases, including dengue. Without available vaccines, targeting the primary vector, Aedes aegypti, is essential to prevent transmission. Older mosquitoes (>/='7 days) are of greatest epidemiological significan...

  14. Application of a haematopoetic progenitor cell-targeted adeno-associated viral (AAV) vector established by selection of an AAV random peptide library on a leukaemia cell line

    PubMed Central

    Stiefelhagen, Marius; Sellner, Leopold; Kleinschmidt, Jürgen A; Jauch, Anna; Laufs, Stephanie; Wenz, Frederik; Zeller, W Jens; Fruehauf, Stefan; Veldwijk, Marlon R

    2008-01-01

    Background For many promising target cells (e.g.: haematopoeitic progenitors), the susceptibility to standard adeno-associated viral (AAV) vectors is low. Advancements in vector development now allows the generation of target cell-selected AAV capsid mutants. Methods To determine its suitability, the method was applied on a chronic myelogenous leukaemia (CML) cell line (K562) to obtain a CML-targeted vector and the resulting vectors tested on leukaemia, non-leukaemia, primary human CML and CD34+ peripheral blood progenitor cells (PBPC); standard AAV2 and a random capsid mutant vector served as controls. Results Transduction of CML (BV173, EM3, K562 and Lama84) and AML (HL60 and KG1a) cell lines with the capsid mutants resulted in an up to 36-fold increase in CML transduction efficiency (K562: 2-fold, 60% ± 2% green fluorescent protein (GFP)+ cells; BV173: 9-fold, 37% ± 2% GFP+ cells; Lama84: 36-fold, 29% ± 2% GFP+ cells) compared to controls. For AML (KG1a, HL60) and one CML cell line (EM3), no significant transduction (<1% GFP+ cells) was observed for any vector. Although the capsid mutant clone was established on a cell line, proof-of-principle experiments using primary human cells were performed. For CML (3.2-fold, mutant: 1.75% ± 0.45% GFP+ cells, p = 0.03) and PBPC (3.5-fold, mutant: 4.21% ± 3.40% GFP+ cells) a moderate increase in gene transfer of the capsid mutant compared to control vectors was observed. Conclusion Using an AAV random peptide library on a CML cell line, we were able to generate a capsid mutant, which transduced CML cell lines and primary human haematopoietic progenitor cells with higher efficiency than standard recombinant AAV vectors. PMID:18789140

  15. Molecular and biochemical characterization of a sand fly population from Sri Lanka: evidence for insecticide resistance due to altered esterases and insensitive acetylcholinesterase.

    PubMed

    Surendran, S N; Karunaratne, S H P P; Adams, Z; Hemingway, J; Hawkes, N J

    2005-08-01

    With an increasing incidence of cutaneous leishmaniasis in Sri Lanka, particularly in northern provinces, insecticide-mediated vector control is under consideration. Optimizing such a strategy requires the characterization of sand fly populations in target areas with regard to species composition and extant resistance, among other parameters. Sand flies were collected by human bait and cattle-baited net traps on Delft Island, used as an illegal transit location by many refugees returning to the north of Sri Lanka from southern India where leishmaniasis is endemic. For species identification, genomic DNA was extracted and a fragment of the ribosomal 18S gene amplified. The sequence from all flies analysed matched that of Phlebotomus argentipes Annandale & Brunetti, the primary vector in India and the most likely vector in Sri Lanka. Independent morphological analysis also identified P. argentipes. To establish the current susceptibility status of vector species, data were obtained at the biochemical level, from which potential cross-resistance to alternative insecticides can be predicted. The Delft Island collection was assayed for the activities of four enzyme systems involved in insecticide resistance (acetylcholinesterase, non-specific carboxylesterases, glutathione-S-transferases and cytochrome p450 monooxygenases), establishing baselines against which subsequent collections can be evaluated. There was preliminary evidence for elevated esterases and altered acetylcholinesterase in this population, the first report of these resistance mechanisms in sand flies to our knowledge, which probably arose from the malathion-based spraying regimes of the Anti-Malarial Campaign.

  16. AAV-mediated RLBP1 gene therapy improves the rate of dark adaptation in Rlbp1 knockout mice

    PubMed Central

    Choi, Vivian W; Bigelow, Chad E; McGee, Terri L; Gujar, Akshata N; Li, Hui; Hanks, Shawn M; Vrouvlianis, Joanna; Maker, Michael; Leehy, Barrett; Zhang, Yiqin; Aranda, Jorge; Bounoutas, George; Demirs, John T; Yang, Junzheng; Ornberg, Richard; Wang, Yu; Martin, Wendy; Stout, Kelly R; Argentieri, Gregory; Grosenstein, Paul; Diaz, Danielle; Turner, Oliver; Jaffee, Bruce D; Police, Seshidhar R; Dryja, Thaddeus P

    2015-01-01

    Recessive mutations in RLBP1 cause a form of retinitis pigmentosa in which the retina, before its degeneration leads to blindness, abnormally slowly recovers sensitivity after exposure to light. To develop a potential gene therapy for this condition, we tested multiple recombinant adeno-associated vectors (rAAVs) composed of different promoters, capsid serotypes, and genome conformations. We generated rAAVs in which sequences from the promoters of the human RLBP1, RPE65, or BEST1 genes drove the expression of a reporter gene (green fluorescent protein). A promoter derived from the RLBP1 gene mediated expression in the retinal pigment epithelium and Müller cells (the intended target cell types) at qualitatively higher levels than in other retinal cell types in wild-type mice and monkeys. With this promoter upstream of the coding sequence of the human RLBP1 gene, we compared the potencies of vectors with an AAV2 versus an AAV8 capsid in transducing mouse retinas, and we compared vectors with a self-complementary versus a single-stranded genome. The optimal vector (scAAV8-pRLBP1-hRLBP1) had serotype 8 capsid and a self-complementary genome. Subretinal injection of scAAV8-pRLBP1-hRLBP1 in Rlbp1 nullizygous mice improved the rate of dark adaptation based on scotopic (rod-plus-cone) and photopic (cone) electroretinograms (ERGs). The effect was still present after 1 year. PMID:26199951

  17. Design of 2D time-varying vector fields.

    PubMed

    Chen, Guoning; Kwatra, Vivek; Wei, Li-Yi; Hansen, Charles D; Zhang, Eugene

    2012-10-01

    Design of time-varying vector fields, i.e., vector fields that can change over time, has a wide variety of important applications in computer graphics. Existing vector field design techniques do not address time-varying vector fields. In this paper, we present a framework for the design of time-varying vector fields, both for planar domains as well as manifold surfaces. Our system supports the creation and modification of various time-varying vector fields with desired spatial and temporal characteristics through several design metaphors, including streamlines, pathlines, singularity paths, and bifurcations. These design metaphors are integrated into an element-based design to generate the time-varying vector fields via a sequence of basis field summations or spatial constrained optimizations at the sampled times. The key-frame design and field deformation are also introduced to support other user design scenarios. Accordingly, a spatial-temporal constrained optimization and the time-varying transformation are employed to generate the desired fields for these two design scenarios, respectively. We apply the time-varying vector fields generated using our design system to a number of important computer graphics applications that require controllable dynamic effects, such as evolving surface appearance, dynamic scene design, steerable crowd movement, and painterly animation. Many of these are difficult or impossible to achieve via prior simulation-based methods. In these applications, the time-varying vector fields have been applied as either orientation fields or advection fields to control the instantaneous appearance or evolving trajectories of the dynamic effects.

  18. nanos-Driven expression of piggyBac transposase induces mobilization of a synthetic autonomous transposon in the malaria vector mosquito, Anopheles stephensi.

    PubMed

    Macias, Vanessa M; Jimenez, Alyssa J; Burini-Kojin, Bianca; Pledger, David; Jasinskiene, Nijole; Phong, Celine Hien; Chu, Karen; Fazekas, Aniko; Martin, Kelcie; Marinotti, Osvaldo; James, Anthony A

    2017-08-01

    Transposons are a class of selfish DNA elements that can mobilize within a genome. If mobilization is accompanied by an increase in copy number (replicative transposition), the transposon may sweep through a population until it is fixed in all of its interbreeding members. This introgression has been proposed as the basis for drive systems to move genes with desirable phenotypes into target species. One such application would be to use them to move a gene conferring resistance to malaria parasites throughout a population of vector mosquitos. We assessed the feasibility of using the piggyBac transposon as a gene-drive mechanism to distribute anti-malarial transgenes in populations of the malaria vector, Anopheles stephensi. We designed synthetic gene constructs that express the piggyBac transposase in the female germline using the control DNA of the An. stephensi nanos orthologous gene linked to marker genes to monitor inheritance. Two remobilization events were observed with a frequency of one every 23 generations, a rate far below what would be useful to drive anti-pathogen transgenes into wild mosquito populations. We discuss the possibility of optimizing this system and the impetus to do so. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

  19. Ant Navigation: Fractional Use of the Home Vector

    PubMed Central

    Cheung, Allen; Hiby, Lex; Narendra, Ajay

    2012-01-01

    Home is a special location for many animals, offering shelter from the elements, protection from predation, and a common place for gathering of the same species. Not surprisingly, many species have evolved efficient, robust homing strategies, which are used as part of each and every foraging journey. A basic strategy used by most animals is to take the shortest possible route home by accruing the net distances and directions travelled during foraging, a strategy well known as path integration. This strategy is part of the navigation toolbox of ants occupying different landscapes. However, when there is a visual discrepancy between test and training conditions, the distance travelled by animals relying on the path integrator varies dramatically between species: from 90% of the home vector to an absolute distance of only 50 cm. We here ask what the theoretically optimal balance between PI-driven and landmark-driven navigation should be. In combination with well-established results from optimal search theory, we show analytically that this fractional use of the home vector is an optimal homing strategy under a variety of circumstances. Assuming there is a familiar route that an ant recognizes, theoretically optimal search should always begin at some fraction of the home vector, depending on the region of familiarity. These results are shown to be largely independent of the search algorithm used. Ant species from different habitats appear to have optimized their navigation strategy based on the availability and nature of navigational information content in their environment. PMID:23209744

  20. Gain-adaptive vector quantization for medium-rate speech coding

    NASA Technical Reports Server (NTRS)

    Chen, J.-H.; Gersho, A.

    1985-01-01

    A class of adaptive vector quantizers (VQs) that can dynamically adjust the 'gain' of codevectors according to the input signal level is introduced. The encoder uses a gain estimator to determine a suitable normalization of each input vector prior to VQ coding. The normalized vectors have reduced dynamic range and can then be more efficiently coded. At the receiver, the VQ decoder output is multiplied by the estimated gain. Both forward and backward adaptation are considered and several different gain estimators are compared and evaluated. An approach to optimizing the design of gain estimators is introduced. Some of the more obvious techniques for achieving gain adaptation are substantially less effective than the use of optimized gain estimators. A novel design technique that is needed to generate the appropriate gain-normalized codebook for the vector quantizer is introduced. Experimental results show that a significant gain in segmental SNR can be obtained over nonadaptive VQ with a negligible increase in complexity.

  1. A New Unified Analysis of Estimate Errors by Model-Matching Phase-Estimation Methods for Sensorless Drive of Permanent-Magnet Synchronous Motors and New Trajectory-Oriented Vector Control, Part I

    NASA Astrophysics Data System (ADS)

    Shinnaka, Shinji; Sano, Kousuke

    This paper presents a new unified analysis of estimate errors by model-matching phase-estimation methods such as rotor-flux state-observers, back EMF state-observers, and back EMF disturbance-observers, for sensorless drive of permanent-magnet synchronous motors. Analytical solutions about estimate errors, whose validity is confirmed by numerical experiments, are rich in universality and applicability. As an example of universality and applicability, a new trajectory-oriented vector control method is proposed, which can realize directly quasi-optimal strategy minimizing total losses with no additional computational loads by simply orienting one of vector-control coordinates to the associated quasi-optimal trajectory. The coordinate orientation rule, which is analytically derived, is surprisingly simple. Consequently the trajectory-oriented vector control method can be applied to a number of conventional vector control systems using one of the model-matching phase-estimation methods.

  2. Receptor-Targeted Nipah Virus Glycoproteins Improve Cell-Type Selective Gene Delivery and Reveal a Preference for Membrane-Proximal Cell Attachment.

    PubMed

    Bender, Ruben R; Muth, Anke; Schneider, Irene C; Friedel, Thorsten; Hartmann, Jessica; Plückthun, Andreas; Maisner, Andrea; Buchholz, Christian J

    2016-06-01

    Receptor-targeted lentiviral vectors (LVs) can be an effective tool for selective transfer of genes into distinct cell types of choice. Moreover, they can be used to determine the molecular properties that cell surface proteins must fulfill to act as receptors for viral glycoproteins. Here we show that LVs pseudotyped with receptor-targeted Nipah virus (NiV) glycoproteins effectively enter into cells when they use cell surface proteins as receptors that bring them closely enough to the cell membrane (less than 100 Å distance). Then, they were flexible in receptor usage as demonstrated by successful targeting of EpCAM, CD20, and CD8, and as selective as LVs pseudotyped with receptor-targeted measles virus (MV) glycoproteins, the current standard for cell-type specific gene delivery. Remarkably, NiV-LVs could be produced at up to two orders of magnitude higher titers compared to their MV-based counterparts and were at least 10,000-fold less effectively neutralized than MV glycoprotein pseudotyped LVs by pooled human intravenous immunoglobulin. An important finding for NiV-LVs targeted to Her2/neu was an about 100-fold higher gene transfer activity when particles were targeted to membrane-proximal regions as compared to particles binding to a more membrane-distal epitope. Likewise, the low gene transfer activity mediated by NiV-LV particles bound to the membrane distal domains of CD117 or the glutamate receptor subunit 4 (GluA4) was substantially enhanced by reducing receptor size to below 100 Å. Overall, the data suggest that the NiV glycoproteins are optimally suited for cell-type specific gene delivery with LVs and, in addition, for the first time define which parts of a cell surface protein should be targeted to achieve optimal gene transfer rates with receptor-targeted LVs.

  3. To be targeted: is the magic bullet concept a viable option for synthetic nucleic acid therapeutics?

    PubMed

    Ogris, Manfred; Wagner, Ernst

    2011-07-01

    Nucleic acids offer the possibility of tailor-made, individualized treatments for genetic disorders, infectious diseases, and cancer. As an alternative to viral vectors, synthetic delivery systems have a potentially improved safety profile, but often lack sufficient efficiency especially when applied in vivo. Receptor targeting of synthetic vectors can improve the specificity of the vector and increase the efficiency of nucleic acid delivery to the target site. This review covers recent concepts for targeted DNA and RNA delivery to organs like liver and lung, and also to solid cancers. Syntheses and applications of delivery systems targeted with proteins, peptides, and small molecules as ligands coupled to polymeric or lipidic nucleic acid carriers are reviewed. Therapeutic concepts for treatment of genetic and infectious diseases are explained. Systemic treatment regimens of metastasized malignancies in combination with chemotherapy and radiation have already been successfully applied in preclinical studies. In addition, a first clinical study in the human application of a targeted synthetic carrier has been performed.

  4. Constructing and Validating High-Performance MIEC-SVM Models in Virtual Screening for Kinases: A Better Way for Actives Discovery

    PubMed Central

    Sun, Huiyong; Pan, Peichen; Tian, Sheng; Xu, Lei; Kong, Xiaotian; Li, Youyong; Dan Li; Hou, Tingjun

    2016-01-01

    The MIEC-SVM approach, which combines molecular interaction energy components (MIEC) derived from free energy decomposition and support vector machine (SVM), has been found effective in capturing the energetic patterns of protein-peptide recognition. However, the performance of this approach in identifying small molecule inhibitors of drug targets has not been well assessed and validated by experiments. Thereafter, by combining different model construction protocols, the issues related to developing best MIEC-SVM models were firstly discussed upon three kinase targets (ABL, ALK, and BRAF). As for the investigated targets, the optimized MIEC-SVM models performed much better than the models based on the default SVM parameters and Autodock for the tested datasets. Then, the proposed strategy was utilized to screen the Specs database for discovering potential inhibitors of the ALK kinase. The experimental results showed that the optimized MIEC-SVM model, which identified 7 actives with IC50 < 10 μM from 50 purchased compounds (namely hit rate of 14%, and 4 in nM level) and performed much better than Autodock (3 actives with IC50 < 10 μM from 50 purchased compounds, namely hit rate of 6%, and 2 in nM level), suggesting that the proposed strategy is a powerful tool in structure-based virtual screening. PMID:27102549

  5. Constructing and Validating High-Performance MIEC-SVM Models in Virtual Screening for Kinases: A Better Way for Actives Discovery.

    PubMed

    Sun, Huiyong; Pan, Peichen; Tian, Sheng; Xu, Lei; Kong, Xiaotian; Li, Youyong; Dan Li; Hou, Tingjun

    2016-04-22

    The MIEC-SVM approach, which combines molecular interaction energy components (MIEC) derived from free energy decomposition and support vector machine (SVM), has been found effective in capturing the energetic patterns of protein-peptide recognition. However, the performance of this approach in identifying small molecule inhibitors of drug targets has not been well assessed and validated by experiments. Thereafter, by combining different model construction protocols, the issues related to developing best MIEC-SVM models were firstly discussed upon three kinase targets (ABL, ALK, and BRAF). As for the investigated targets, the optimized MIEC-SVM models performed much better than the models based on the default SVM parameters and Autodock for the tested datasets. Then, the proposed strategy was utilized to screen the Specs database for discovering potential inhibitors of the ALK kinase. The experimental results showed that the optimized MIEC-SVM model, which identified 7 actives with IC50 < 10 μM from 50 purchased compounds (namely hit rate of 14%, and 4 in nM level) and performed much better than Autodock (3 actives with IC50 < 10 μM from 50 purchased compounds, namely hit rate of 6%, and 2 in nM level), suggesting that the proposed strategy is a powerful tool in structure-based virtual screening.

  6. Optimization of the Brillouin operator on the KNL architecture

    NASA Astrophysics Data System (ADS)

    Dürr, Stephan

    2018-03-01

    Experiences with optimizing the matrix-times-vector application of the Brillouin operator on the Intel KNL processor are reported. Without adjustments to the memory layout, performance figures of 360 Gflop/s in single and 270 Gflop/s in double precision are observed. This is with Nc = 3 colors, Nv = 12 right-hand-sides, Nthr = 256 threads, on lattices of size 323 × 64, using exclusively OMP pragmas. Interestingly, the same routine performs quite well on Intel Core i7 architectures, too. Some observations on the much harderWilson fermion matrix-times-vector optimization problem are added.

  7. Sequential cloning of chromosomes

    DOEpatents

    Lacks, S.A.

    1995-07-18

    A method for sequential cloning of chromosomal DNA of a target organism is disclosed. A first DNA segment homologous to the chromosomal DNA to be sequentially cloned is isolated. The first segment has a first restriction enzyme site on either side. A first vector product is formed by ligating the homologous segment into a suitably designed vector. The first vector product is circularly integrated into the target organism`s chromosomal DNA. The resulting integrated chromosomal DNA segment includes the homologous DNA segment at either end of the integrated vector segment. The integrated chromosomal DNA is cleaved with a second restriction enzyme and ligated to form a vector-containing plasmid, which is replicated in a host organism. The replicated plasmid is then cleaved with the first restriction enzyme. Next, a DNA segment containing the vector and a segment of DNA homologous to a distal portion of the previously isolated DNA segment is isolated. This segment is then ligated to form a plasmid which is replicated within a suitable host. This plasmid is then circularly integrated into the target chromosomal DNA. The chromosomal DNA containing the circularly integrated vector is treated with a third, retrorestriction (class IIS) enzyme. The cleaved DNA is ligated to give a plasmid that is used to transform a host permissive for replication of its vector. The sequential cloning process continues by repeated cycles of circular integration and excision. The excision is carried out alternately with the second and third enzymes. 9 figs.

  8. Evaluation of Spatially Targeted Strategies to Control Non-Domiciliated Triatoma dimidiata Vector of Chagas Disease

    PubMed Central

    Barbu, Corentin; Dumonteil, Eric; Gourbière, Sébastien

    2011-01-01

    Background Chagas disease is a major neglected tropical disease with deep socio-economical effects throughout Central and South America. Vector control programs have consistently reduced domestic populations of triatomine vectors, but non-domiciliated vectors still have to be controlled efficiently. Designing control strategies targeting these vectors is challenging, as it requires a quantitative description of the spatio-temporal dynamics of village infestation, which can only be gained from combinations of extensive field studies and spatial population dynamic modelling. Methodology/Principal Findings A spatially explicit population dynamic model was combined with a two-year field study of T. dimidiata infestation dynamics in the village of Teya, Mexico. The parameterized model fitted and predicted accurately both intra-annual variation and the spatial gradient in vector abundance. Five different control strategies were then applied in concentric rings to mimic spatial design targeting the periphery of the village, where vectors were most abundant. Indoor insecticide spraying and insect screens reduced vector abundance by up to 80% (when applied to the whole village), and half of this effect was obtained when control was applied only to the 33% of households closest to the village periphery. Peri-domicile cleaning was able to eliminate up to 60% of the vectors, but at the periphery of the village it has a low effect, as it is ineffective against sylvatic insects. The use of lethal traps and the management of house attractiveness provided similar levels of control. However this required either house attractiveness to be null, or ≥5 lethal traps, at least as attractive as houses, to be installed in each household. Conclusion/Significance Insecticide and insect screens used in houses at the periphery of the village can contribute to reduce house infestation in more central untreated zones. However, this beneficial effect remains insufficient to allow for a unique spatially targeted strategy to offer protection to all households. Most efficiently, control should combine the use of insect screens in outer zones to reduce infestation by both sylvatic and peri-domiciliated vectors, and cleaning of peri-domicile in the centre of the village where sylvatic vectors are absent. The design of such spatially mixed strategies of control offers a promising avenue to reduce the economic cost associated with the control of non-domiciliated vectors. PMID:21610862

  9. Interactive orbital proximity operations planning system instruction and training guide

    NASA Technical Reports Server (NTRS)

    Grunwald, Arthur J.; Ellis, Stephen R.

    1994-01-01

    This guide instructs users in the operation of a Proximity Operations Planning System. This system uses an interactive graphical method for planning fuel-efficient rendezvous trajectories in the multi-spacecraft environment of the space station and allows the operator to compose a multi-burn transfer trajectory between orbit initial chaser and target trajectories. The available task time (window) of the mission is predetermined and the maneuver is subject to various operational constraints, such as departure, arrival, spatial, plume impingement, and en route passage constraints. The maneuvers are described in terms of the relative motion experienced in a space station centered coordinate system. Both in-orbital plane as well as out-of-orbital plane maneuvering is considered. A number of visual optimization aids are used for assisting the operator in reaching fuel-efficient solutions. These optimization aids are based on the Primer Vector theory. The visual feedback of trajectory shapes, operational constraints, and optimization functions, provided by user-transparent and continuously active background computations, allows the operator to make fast, iterative design changes that rapidly converge to fuel-efficient solutions. The planning tool is an example of operator-assisted optimization of nonlinear cost functions.

  10. The natural dietary genistein boosts bacteriophage-mediated cancer cell killing by improving phage-targeted tumor cell transduction.

    PubMed

    Tsafa, Effrosyni; Al-Bahrani, Mariam; Bentayebi, Kaoutar; Przystal, Justyna; Suwan, Keittisak; Hajitou, Amin

    2016-08-09

    Gene therapy has long been regarded as a promising treatment for cancer. However, cancer gene therapy is still facing the challenge of targeting gene delivery vectors specifically to tumors when administered via clinically acceptable non-invasive systemic routes (i.e. intravenous). The bacteria virus, bacteriophage (phage), represents a new generation of promising vectors in systemic gene delivery since their targeting can be achieved through phage capsid display ligands, which enable them to home to specific tumor receptors without the need to ablate any native eukaryotic tropism. We have previously reported a tumor specific bacteriophage vector named adeno-associated virus/phage, or AAVP, in which gene expression is under a recombinant human rAAV2 virus genome targeted to tumors via a ligand-directed phage capsid. However, cancer gene therapy with this tumor-targeted vector achieved variable outcomes ranging from tumor regression to no effect in both experimental and natural preclinical models. Herein, we hypothesized that combining the natural dietary genistein, with proven anticancer activity, would improve bacteriophage anticancer safe therapy. We show that combination treatment with genistein and AAVP increased targeted cancer cell killing by AAVP carrying the gene for Herpes simplex virus thymidine kinase (HSVtk) in 2D tissue cultures and 3D tumor spheroids. We found this increased tumor cell killing was associated with enhanced AAVP-mediated gene expression. Next, we established that genistein protects AAVP against proteasome degradation and enhances vector genome accumulation in the nucleus. Combination of genistein and phage-guided virotherapy is a safe and promising strategy that should be considered in anticancer therapy with AAVP.

  11. Targeted Entry via Somatostatin Receptors Using a Novel Modified Retrovirus Glycoprotein That Delivers Genes at Levels Comparable to Those of Wild-Type Viral Glycoproteins

    PubMed Central

    Li, Fang; Ryu, Byoung Y.; Krueger, Robin L.; Heldt, Scott A.

    2012-01-01

    Here we report a novel viral glycoprotein created by replacing a natural receptor-binding sequence of the ecotropic Moloney murine leukemia virus envelope glycoprotein with the peptide ligand somatostatin. This new chimeric glycoprotein, which has been named the Sst receptor binding site (Sst-RBS), gives targeted transduction based on three criteria: (i) a gain of the use of a new entry receptor not used by any known virus; (ii) targeted entry at levels comparable to gene delivery by wild-type ecotropic Moloney murine leukemia virus and vesicular stomatitis virus (VSV) G glycoproteins; and (iii) a loss of the use of the natural ecotropic virus receptor. Retroviral vectors coated with Sst-RBS gained the ability to bind and transduce human 293 cells expressing somatostatin receptors. Their infection was specific to target somatostatin receptors, since a synthetic somatostatin peptide inhibited infection in a dose-dependent manner and the ability to transduce mouse cells bearing the natural ecotropic receptor was effectively lost. Importantly, vectors coated with the Sst-RBS glycoprotein gave targeted entry of up to 1 × 106 transducing U/ml, a level comparable to that seen with infection of vectors coated with the parental wild-type ecotropic Moloney murine leukemia virus glycoprotein through the ecotropic receptor and approaching that of infection of VSV G-coated vectors through the VSV receptor. To our knowledge, this is the first example of a glycoprotein that gives targeted entry of retroviral vectors at levels comparable to the natural capacity of viral envelope glycoproteins. PMID:22013043

  12. Necessary conditions for the optimality of variable rate residual vector quantizers

    NASA Technical Reports Server (NTRS)

    Kossentini, Faouzi; Smith, Mark J. T.; Barnes, Christopher F.

    1993-01-01

    Residual vector quantization (RVQ), or multistage VQ, as it is also called, has recently been shown to be a competitive technique for data compression. The competitive performance of RVQ reported in results from the joint optimization of variable rate encoding and RVQ direct-sum code books. In this paper, necessary conditions for the optimality of variable rate RVQ's are derived, and an iterative descent algorithm based on a Lagrangian formulation is introduced for designing RVQ's having minimum average distortion subject to an entropy constraint. Simulation results for these entropy-constrained RVQ's (EC-RVQ's) are presented for memory less Gaussian, Laplacian, and uniform sources. A Gauss-Markov source is also considered. The performance is superior to that of entropy-constrained scalar quantizers (EC-SQ's) and practical entropy-constrained vector quantizers (EC-VQ's), and is competitive with that of some of the best source coding techniques that have appeared in the literature.

  13. Tomo3D 2.0--exploitation of advanced vector extensions (AVX) for 3D reconstruction.

    PubMed

    Agulleiro, Jose-Ignacio; Fernandez, Jose-Jesus

    2015-02-01

    Tomo3D is a program for fast tomographic reconstruction on multicore computers. Its high speed stems from code optimization, vectorization with Streaming SIMD Extensions (SSE), multithreading and optimization of disk access. Recently, Advanced Vector eXtensions (AVX) have been introduced in the x86 processor architecture. Compared to SSE, AVX double the number of simultaneous operations, thus pointing to a potential twofold gain in speed. However, in practice, achieving this potential is extremely difficult. Here, we provide a technical description and an assessment of the optimizations included in Tomo3D to take advantage of AVX instructions. Tomo3D 2.0 allows huge reconstructions to be calculated in standard computers in a matter of minutes. Thus, it will be a valuable tool for electron tomography studies with increasing resolution needs. Copyright © 2014 Elsevier Inc. All rights reserved.

  14. A Tupaia paramyxovirus vector system for targeting and transgene expression.

    PubMed

    Engeland, Christine E; Bossow, Sascha; Hudacek, Andrew W; Hoyler, Birgit; Förster, Judith; Veinalde, Rūta; Jäger, Dirk; Cattaneo, Roberto; Ungerechts, Guy; Springfeld, Christoph

    2017-09-01

    Viruses from the diverse family of Paramyxoviridae include important pathogens and are applied in gene therapy and for cancer treatment. The Tupaia paramyxovirus (TPMV), isolated from the kidney of a tree shrew, does not infect human cells and neutralizing antibodies against other Paramyxoviridae do not cross-react with TPMV. Here, we present a vector system for de novo generation of infectious TPMV that allows for insertion of additional genes as well as targeting using antibody single-chain variable fragments. We show that the recombinant TPMV specifically infect cells expressing the targeted receptor and replicate in human cells. This vector system provides a valuable tool for both basic research and therapeutic applications.

  15. Engineering adeno-associated virus 2 vectors for targeted gene delivery to atherosclerotic lesions.

    PubMed

    White, K; Büning, H; Kritz, A; Janicki, H; McVey, J; Perabo, L; Murphy, G; Odenthal, M; Work, L M; Hallek, M; Nicklin, S A; Baker, A H

    2008-03-01

    Targeted delivery of biological agents to atherosclerotic plaques may provide a novel treatment and/or useful tool for imaging of atherosclerosis in vivo. However, there are no known viral vectors that possess the desired tropism. Two plaque-targeting peptides, CAPGPSKSC (CAP) and CNHRYMQMC (CNH) were inserted into the capsid of adeno-associated virus 2 (AAV2) to assess vector retargeting. AAV2-CNH produced significantly higher levels of transduction than unmodified AAV2 in human, murine and rat endothelial cells, whereas transduction of nontarget HeLa cells was unaltered. Transduction studies and surface plasmon resonance suggest that AAV2-CNH uses membrane type 1 matrix metalloproteinase as a surface receptor. AAV2-CAP only produced higher levels of transduction in rat endothelial cells, possibly because the virus was found to be affected by proteasomal degradation. In vivo substantially higher levels of both peptide-modified AAV2 vectors was detected in the brachiocephalic artery (site of advanced atherosclerotic plaques) and aorta, whereas reduced levels were detected in all other organs examined. These results suggest that in the AAV2 platform the peptides are exposed on the capsid surface in a way that enables efficient receptor binding and so creates effective atherosclerotic plaque targeted vectors.

  16. Specific gene delivery to liver sinusoidal and artery endothelial cells.

    PubMed

    Abel, Tobias; El Filali, Ebtisam; Waern, Johan; Schneider, Irene C; Yuan, Qinggong; Münch, Robert C; Hick, Meike; Warnecke, Gregor; Madrahimov, Nodir; Kontermann, Roland E; Schüttrumpf, Jörg; Müller, Ulrike C; Seppen, Jurgen; Ott, Michael; Buchholz, Christian J

    2013-09-19

    Different types of endothelial cells (EC) fulfill distinct tasks depending on their microenvironment. ECs are therefore difficult to genetically manipulate ex vivo for functional studies or gene therapy. We assessed lentiviral vectors (LVs) targeted to the EC surface marker CD105 for in vivo gene delivery. The mouse CD105-specific vector, mCD105-LV, transduced only CD105-positive cells in primary liver cell cultures. Upon systemic injection, strong reporter gene expression was detected in liver where mCD105-LV specifically transduced liver sinusoidal ECs (LSECs) but not Kupffer cells, which were mainly transduced by nontargeted LVs. Tumor ECs were specifically targeted upon intratumoral vector injection. Delivery of the erythropoietin gene with mCD105-LV resulted in substantially increased erythropoietin and hematocrit levels. The human CD105-specific vector (huCD105-LV) transduced exclusively human LSECs in mice transplanted with human liver ECs. Interestingly, when applied at higher dose and in absence of target cells in the liver, huCD105-LV transduced ECs of a human artery transplanted into the descending mouse aorta. The data demonstrate for the first time targeted gene delivery to specialized ECs upon systemic vector administration. This strategy offers novel options to better understand the physiological functions of ECs and to treat genetic diseases such as those affecting blood factors.

  17. Cre/lox-Recombinase-Mediated Cassette Exchange for Reversible Site-Specific Genomic Targeting of the Disease Vector, Aedes aegypti.

    PubMed

    Häcker, Irina; Harrell Ii, Robert A; Eichner, Gerrit; Pilitt, Kristina L; O'Brochta, David A; Handler, Alfred M; Schetelig, Marc F

    2017-03-07

    Site-specific genome modification (SSM) is an important tool for mosquito functional genomics and comparative gene expression studies, which contribute to a better understanding of mosquito biology and are thus a key to finding new strategies to eliminate vector-borne diseases. Moreover, it allows for the creation of advanced transgenic strains for vector control programs. SSM circumvents the drawbacks of transposon-mediated transgenesis, where random transgene integration into the host genome results in insertional mutagenesis and variable position effects. We applied the Cre/lox recombinase-mediated cassette exchange (RMCE) system to Aedes aegypti, the vector of dengue, chikungunya, and Zika viruses. In this context we created four target site lines for RMCE and evaluated their fitness costs. Cre-RMCE is functional in a two-step mechanism and with good efficiency in Ae. aegypti. The advantages of Cre-RMCE over existing site-specific modification systems for Ae. aegypti, phiC31-RMCE and CRISPR, originate in the preservation of the recombination sites, which 1) allows successive modifications and rapid expansion or adaptation of existing systems by repeated targeting of the same site; and 2) provides reversibility, thus allowing the excision of undesired sequences. Thereby, Cre-RMCE complements existing genomic modification tools, adding flexibility and versatility to vector genome targeting.

  18. Unique Safety Issues Associated with Virus Vectored Vaccines: Potential for and Theoretical Consequences of Recombination with Wild Type Virus Strains

    PubMed Central

    Condit, Richard C.; Williamson, Anna-Lise; Sheets, Rebecca; Seligman, Stephen J.; Monath, Thomas P.; Excler, Jean-Louis; Gurwith, Marc; Bok, Karin; Robertson, James S.; Kim, Denny; Hendry, Michael; Singh, Vidisha; Mac, Lisa M.; Chen, Robert T.

    2016-01-01

    In 2003 and 2013, the World Health Organization convened informal consultations on characterization and quality aspects of vaccines based on live virus vectors. In the resulting reports, one of several issues raised for future study was the potential for recombination of virus-vectored vaccines with wild type pathogenic virus strains. This paper presents an assessment of this issue formulated by the Brighton Collaboration. To provide an appropriate context for understanding the potential for recombination of virus-vectored vaccines, we review briefly the current status of virus vectored vaccines, mechanisms of recombination between viruses, experience with recombination involving live attenuated vaccines in the field, and concerns raised previously in the literature regarding recombination of virus-vectored vaccines with wild type virus strains. We then present a discussion of the major variables that could influence recombination between a virus-vectored vaccine and circulating wild type virus and the consequences of such recombination, including intrinsic recombination properties of the parent virus used as a vector; sequence relatedness of vector and wild virus; virus host range, pathogenesis and transmission; replication competency of vector in target host; mechanism of vector attenuation; additional factors potentially affecting virulence; and circulation of multiple recombinant vectors in the same target population. Finally, we present some guiding principles for vector design and testing intended to anticipate and mitigate the potential for and consequences of recombination of virus-vectored vaccines with wild type pathogenic virus strains. PMID:27346303

  19. Effect of temperature post viral vector inoculation on the amount of hemagglutinin transiently expressed in Nicotiana benthamiana leaves.

    PubMed

    Matsuda, Ryo; Abe, Tatsuki; Fujiuchi, Naomichi; Matoba, Nobuyuki; Fujiwara, Kazuhiro

    2017-09-01

    Transient gene expression in whole plants by using viral vectors is promising as a rapid, mass production system for biopharmaceutical proteins. Recent studies have indicated that plant growth conditions such as air temperature markedly influence the accumulation levels of target proteins. Here, we investigated time course of the amount of recombinant hemagglutinin (HA), a vaccine antigen of influenza virus, in leaves of Nicotiana benthamiana plants grown at 20°C or 25°C post viral vector inoculation. The HA content per unit of leaf biomass increased and decreased from 4 to 6 days post inoculation at 20°C and 25°C, respectively, irrespective of the subcellular localization of HA. The overall HA contents were higher when HA was targeted to the endoplasmic reticulum (ER) rather than the apoplast. Necrosis of leaf tissues was specifically observed in plants inoculated with the ER-targeting vector and grown at 25°C. With the ER-targeting vector, the maximum HA contents at 20°C and 25°C were recorded at 6 and 4 days post inoculation, respectively, and were comparable to each other. HA contents thereafter decreased at both temperatures; the rate of reduction appeared faster at 25°C than at 20°C. From a practical point of view, our results indicate that the strategy of targeting HA to the ER, growing plants at a lower temperature of 20°C, and harvesting leaves at around a week after vector inoculation should be implemented to obtain a high HA yield stably and efficiently. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  20. Enhancers Are Major Targets for Murine Leukemia Virus Vector Integration

    PubMed Central

    De Ravin, Suk See; Su, Ling; Theobald, Narda; Choi, Uimook; Macpherson, Janet L.; Poidinger, Michael; Symonds, Geoff; Pond, Susan M.; Ferris, Andrea L.; Hughes, Stephen H.

    2014-01-01

    ABSTRACT Retroviral vectors have been used in successful gene therapies. However, in some patients, insertional mutagenesis led to leukemia or myelodysplasia. Both the strong promoter/enhancer elements in the long terminal repeats (LTRs) of murine leukemia virus (MLV)-based vectors and the vector-specific integration site preferences played an important role in these adverse clinical events. MLV integration is known to prefer regions in or near transcription start sites (TSS). Recently, BET family proteins were shown to be the major cellular proteins responsible for targeting MLV integration. Although MLV integration sites are significantly enriched at TSS, only a small fraction of the MLV integration sites (<15%) occur in this region. To resolve this apparent discrepancy, we created a high-resolution genome-wide integration map of more than one million integration sites from CD34+ hematopoietic stem cells transduced with a clinically relevant MLV-based vector. The integration sites form ∼60,000 tight clusters. These clusters comprise ∼1.9% of the genome. The vast majority (87%) of the integration sites are located within histone H3K4me1 islands, a hallmark of enhancers. The majority of these clusters also have H3K27ac histone modifications, which mark active enhancers. The enhancers of some oncogenes, including LMO2, are highly preferred targets for integration without in vivo selection. IMPORTANCE We show that active enhancer regions are the major targets for MLV integration; this means that MLV preferentially integrates in regions that are favorable for viral gene expression in a variety of cell types. The results provide insights for MLV integration target site selection and also explain the high risk of insertional mutagenesis that is associated with gene therapy trials using MLV vectors. PMID:24501411

  1. Ecological, biological and social dimensions of dengue vector breeding in five urban settings of Latin America: a multi-country study

    PubMed Central

    2014-01-01

    Background Dengue is an increasingly important public health problem in most Latin American countries and more cost-effective ways of reducing dengue vector densities to prevent transmission are in demand by vector control programs. This multi-centre study attempted to identify key factors associated with vector breeding and development as a basis for improving targeted intervention strategies. Methods In each of 5 participant cities in Mexico, Colombia, Ecuador, Brazil and Uruguay, 20 clusters were randomly selected by grid sampling to incorporate 100 contiguous households, non-residential private buildings (businesses) and public spaces. Standardized household surveys, cluster background surveys and entomological surveys specifically targeted to obtain pupal indices for Aedes aegypti, were conducted in the dry and wet seasons. Results The study clusters included mainly urban low-middle class populations with satisfactory infrastructure and –except for Uruguay- favourable climatic conditions for dengue vector development. Household knowledge about dengue and “dengue mosquitoes” was widespread, mainly through mass media, but there was less awareness around interventions to reduce vector densities. Vector production (measured through pupal indices) was favoured when water containers were outdoor, uncovered, unused (even in Colombia and Ecuador where the large tanks used for household water storage and washing were predominantly productive) and –particularly during the dry season- rainwater filled. Larval infestation did not reflect productive container types. All productive container types, including those important in the dry season, were identified by pupal surveys executed during the rainy season. Conclusions A number of findings are relevant for improving vector control: 1) there is a need for complementing larval surveys with occasional pupal surveys (to be conducted during the wet season) for identifying and subsequently targeting productive container types; 2) the need to raise public awareness about useful and effective interventions in productive container types specific to their area; and 3) the motivation for control services that-according to this and similar studies in Asia- dedicated, targeted vector management can make a difference in terms of reducing vector abundance. PMID:24447796

  2. A multicolor panel of TALE-KRAB based transcriptional repressor vectors enabling knockdown of multiple gene targets

    PubMed Central

    Zhang, Zhonghui; Wu, Elise; Qian, Zhijian; Wu, Wen-Shu

    2014-01-01

    Stable and efficient knockdown of multiple gene targets is highly desirable for dissection of molecular pathways. Because it allows sequence-specific DNA binding, transcription activator-like effector (TALE) offers a new genetic perturbation technique that allows for gene-specific repression. Here, we constructed a multicolor lentiviral TALE-Kruppel-associated box (KRAB) expression vector platform that enables knockdown of multiple gene targets. This platform is fully compatible with the Golden Gate TALEN and TAL Effector Kit 2.0, a widely used and efficient method for TALE assembly. We showed that this multicolor TALE-KRAB vector system when combined together with bone marrow transplantation could quickly knock down c-kit and PU.1 genes in hematopoietic stem and progenitor cells of recipient mice. Furthermore, our data demonstrated that this platform simultaneously knocked down both c-Kit and PU.1 genes in the same primary cell populations. Together, our results suggest that this multicolor TALE-KRAB vector platform is a promising and versatile tool for knockdown of multiple gene targets and could greatly facilitate dissection of molecular pathways. PMID:25475013

  3. A multicolor panel of TALE-KRAB based transcriptional repressor vectors enabling knockdown of multiple gene targets.

    PubMed

    Zhang, Zhonghui; Wu, Elise; Qian, Zhijian; Wu, Wen-Shu

    2014-12-05

    Stable and efficient knockdown of multiple gene targets is highly desirable for dissection of molecular pathways. Because it allows sequence-specific DNA binding, transcription activator-like effector (TALE) offers a new genetic perturbation technique that allows for gene-specific repression. Here, we constructed a multicolor lentiviral TALE-Kruppel-associated box (KRAB) expression vector platform that enables knockdown of multiple gene targets. This platform is fully compatible with the Golden Gate TALEN and TAL Effector Kit 2.0, a widely used and efficient method for TALE assembly. We showed that this multicolor TALE-KRAB vector system when combined together with bone marrow transplantation could quickly knock down c-kit and PU.1 genes in hematopoietic stem and progenitor cells of recipient mice. Furthermore, our data demonstrated that this platform simultaneously knocked down both c-Kit and PU.1 genes in the same primary cell populations. Together, our results suggest that this multicolor TALE-KRAB vector platform is a promising and versatile tool for knockdown of multiple gene targets and could greatly facilitate dissection of molecular pathways.

  4. Detection of Accelerating Targets in Clutter Using a De-Chirping Technique

    DTIC Science & Technology

    2014-06-01

    Academy, also in Canberra, working on the the- ory and simulation of spatial optical solitons and light-induced optical switching in nonlinear...signal gain in the receiver. UNCLASSIFIED 1 DSTO–RR–0399 UNCLASSIFIED target along the velocity vector , or equivalently by radar platform. The change of...the tracker uses range rate in its track initiation logic. (2) Lateral acceleration perpendicular to the velocity vector - the target is turning and

  5. SU-E-J-115: Correlation of Displacement Vector Fields Calculated by Deformable Image Registration Algorithms with Motion Parameters of CT Images with Well-Defined Targets and Controlled-Motion

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jaskowiak, J; Ahmad, S; Ali, I

    Purpose: To investigate correlation of displacement vector fields (DVF) calculated by deformable image registration algorithms with motion parameters in helical axial and cone-beam CT images with motion artifacts. Methods: A mobile thorax phantom with well-known targets with different sizes that were made from water-equivalent material and inserted in foam to simulate lung lesions. The thorax phantom was imaged with helical, axial and cone-beam CT. The phantom was moved with a cyclic motion with different motion amplitudes and frequencies along the superior-inferior direction. Different deformable image registration algorithms including demons, fast demons, Horn-Shunck and iterative-optical-flow from the DIRART software were usedmore » to deform CT images for the phantom with different motion patterns. The CT images of the mobile phantom were deformed to CT images of the stationary phantom. Results: The values of displacement vectors calculated by deformable image registration algorithm correlated strongly with motion amplitude where large displacement vectors were calculated for CT images with large motion amplitudes. For example, the maximal displacement vectors were nearly equal to the motion amplitudes (5mm, 10mm or 20mm) at interfaces between the mobile targets lung tissue, while the minimal displacement vectors were nearly equal to negative the motion amplitudes. The maximal and minimal displacement vectors matched with edges of the blurred targets along the Z-axis (motion-direction), while DVF’s were small in the other directions. This indicates that the blurred edges by phantom motion were shifted largely to match with the actual target edge. These shifts were nearly equal to the motion amplitude. Conclusions: The DVF from deformable-image registration algorithms correlated well with motion amplitude of well-defined mobile targets. This can be used to extract motion parameters such as amplitude. However, as motion amplitudes increased, image artifacts increased significantly and that limited image quality and poor correlation between the motion amplitude and DVF was obtained.« less

  6. Identification of candidate transmission-blocking antigen genes in Theileria annulata and related vector-borne apicomplexan parasites.

    PubMed

    Lempereur, Laetitia; Larcombe, Stephen D; Durrani, Zeeshan; Karagenc, Tulin; Bilgic, Huseyin Bilgin; Bakirci, Serkan; Hacilarlioglu, Selin; Kinnaird, Jane; Thompson, Joanne; Weir, William; Shiels, Brian

    2017-06-05

    Vector-borne apicomplexan parasites are a major cause of mortality and morbidity to humans and livestock globally. The most important disease syndromes caused by these parasites are malaria, babesiosis and theileriosis. Strategies for control often target parasite stages in the mammalian host that cause disease, but this can result in reservoir infections that promote pathogen transmission and generate economic loss. Optimal control strategies should protect against clinical disease, block transmission and be applicable across related genera of parasites. We have used bioinformatics and transcriptomics to screen for transmission-blocking candidate antigens in the tick-borne apicomplexan parasite, Theileria annulata. A number of candidate antigen genes were identified which encoded amino acid domains that are conserved across vector-borne Apicomplexa (Babesia, Plasmodium and Theileria), including the Pfs48/45 6-cys domain and a novel cysteine-rich domain. Expression profiling confirmed that selected candidate genes are expressed by life cycle stages within infected ticks. Additionally, putative B cell epitopes were identified in the T. annulata gene sequences encoding the 6-cys and cysteine rich domains, in a gene encoding a putative papain-family cysteine peptidase, with similarity to the Plasmodium SERA family, and the gene encoding the T. annulata major merozoite/piroplasm surface antigen, Tams1. Candidate genes were identified that encode proteins with similarity to known transmission blocking candidates in related parasites, while one is a novel candidate conserved across vector-borne apicomplexans and has a potential role in the sexual phase of the life cycle. The results indicate that a 'One Health' approach could be utilised to develop a transmission-blocking strategy effective against vector-borne apicomplexan parasites of animals and humans.

  7. Gene Transfer to Chicks Using Lentiviral Vectors Administered via the Embryonic Chorioallantoic Membrane

    PubMed Central

    Hen, Gideon; Yosefi, Sara; Shinder, Dmitry; Or, Adi; Mygdal, Sivan; Condiotti, Reba; Galun, Eithan; Bor, Amir; Sela-Donenfeld, Dalit; Friedman-Einat, Miriam

    2012-01-01

    The lack of affordable techniques for gene transfer in birds has inhibited the advancement of molecular studies in avian species. Here we demonstrate a new approach for introducing genes into chicken somatic tissues by administration of a lentiviral vector, derived from the feline immunodeficiency virus (FIV), into the chorioallantoic membrane (CAM) of chick embryos on embryonic day 11. The FIV-derived vectors carried yellow fluorescent protein (YFP) or recombinant alpha-melanocyte-stimulating hormone (α-MSH) genes, driven by the cytomegalovirus (CMV) promoter. Transgene expression, detected in chicks 2 days after hatch by quantitative real-time PCR, was mostly observed in the liver and spleen. Lower expression levels were also detected in the brain, kidney, heart and breast muscle. Immunofluorescence and flow cytometry analyses confirmed transgene expression in chick tissues at the protein level, demonstrating a transduction efficiency of ∼0.46% of liver cells. Integration of the viral vector into the chicken genome was demonstrated using genomic repetitive (CR1)-PCR amplification. Viability and stability of the transduced cells was confirmed using terminal deoxynucleotidyl transferase (dUTP) nick end labeling (TUNEL) assay, immunostaining with anti-proliferating cell nuclear antigen (anti-PCNA), and detection of transgene expression 51 days post transduction. Our approach led to only 9% drop in hatching efficiency compared to non-injected embryos, and all of the hatched chicks expressed the transgenes. We suggest that the transduction efficiency of FIV vectors combined with the accessibility of the CAM vasculature as a delivery route comprise a new powerful and practical approach for gene delivery into somatic tissues of chickens. Most relevant is the efficient transduction of the liver, which specializes in the production and secretion of proteins, thereby providing an optimal target for prolonged study of secreted hormones and peptides. PMID:22606269

  8. Highly efficient gene transfer in naive human T cells with a murine leukemia virus-based vector.

    PubMed

    Dardalhon, V; Jaleco, S; Rebouissou, C; Ferrand, C; Skander, N; Swainson, L; Tiberghien, P; Spits, H; Noraz, N; Taylor, N

    2000-08-01

    Retroviral vectors based on the Moloney murine leukemia virus (MuLV) have become the primary tool for gene delivery into hematopoietic cells, but clinical trials have been hampered by low transduction efficiencies. Recently, we and others have shown that gene transfer of MuLV-based vectors into T cells can be significantly augmented using a fibronectin-facilitated protocol. Nevertheless, the relative abilities of naive (CD45RA(+)) and memory (CD45RO(+)) lymphocyte subsets to be transduced has not been assessed. Although naive T cells demonstrate a restricted cytokine profile following antigen stimulation and a decreased susceptibility to infection with human immunodeficiency virus, it was not clear whether they could be efficiently infected with a MuLV vector. This study describes conditions that permitted gene transfer of an enhanced green fluorescent protein-expressing retroviral vector in more than 50% of naive umbilical cord (UC) blood and peripheral blood (PB) T cells following CD3/CD28 ligation. Moreover, treatment of naive T cells with interleukin-7 resulted in the maintenance of a CD45RA phenotype and gene transfer levels approached 20%. Finally, it was determined that parameters for optimal transduction of CD45RA(+) T cells isolated from PB and UC blood differed: transduction of the UC cells was significantly increased by the presence of autologous mononuclear cells (24.5% versus 56.5%). Because naive T cells harbor a receptor repertoire that allows them to respond to novel antigens, the development of protocols targeting their transduction is crucial for gene therapy applications. This approach will also allow the functions of exogenous genes to be evaluated in primary nontransformed naive T cells.

  9. Particle-in-Cell laser-plasma simulation on Xeon Phi coprocessors

    NASA Astrophysics Data System (ADS)

    Surmin, I. A.; Bastrakov, S. I.; Efimenko, E. S.; Gonoskov, A. A.; Korzhimanov, A. V.; Meyerov, I. B.

    2016-05-01

    This paper concerns the development of a high-performance implementation of the Particle-in-Cell method for plasma simulation on Intel Xeon Phi coprocessors. We discuss the suitability of the method for Xeon Phi architecture and present our experience in the porting and optimization of the existing parallel Particle-in-Cell code PICADOR. Direct porting without code modification gives performance on Xeon Phi close to that of an 8-core CPU on a benchmark problem with 50 particles per cell. We demonstrate step-by-step optimization techniques, such as improving data locality, enhancing parallelization efficiency and vectorization leading to an overall 4.2 × speedup on CPU and 7.5 × on Xeon Phi compared to the baseline version. The optimized version achieves 16.9 ns per particle update on an Intel Xeon E5-2660 CPU and 9.3 ns per particle update on an Intel Xeon Phi 5110P. For a real problem of laser ion acceleration in targets with surface grating, where a large number of macroparticles per cell is required, the speedup of Xeon Phi compared to CPU is 1.6 ×.

  10. [Extraction Optimization of Rhizome of Curcuma longa by Response Surface Methodology and Support Vector Regression].

    PubMed

    Zhou, Pei-pei; Shan, Jin-feng; Jiang, Jian-lan

    2015-12-01

    To optimize the optimal microwave-assisted extraction method of curcuminoids from Curcuma longa. On the base of single factor experiment, the ethanol concentration, the ratio of liquid to solid and the microwave time were selected for further optimization. Support Vector Regression (SVR) and Central Composite Design-Response Surface Methodology (CCD) algorithm were utilized to design and establish models respectively, while Particle Swarm Optimization (PSO) was introduced to optimize the parameters of SVR models and to search optimal points of models. The evaluation indicator, the sum of curcumin, demethoxycurcumin and bisdemethoxycurcumin by HPLC, were used. The optimal parameters of microwave-assisted extraction were as follows: ethanol concentration of 69%, ratio of liquid to solid of 21 : 1, microwave time of 55 s. On those conditions, the sum of three curcuminoids was 28.97 mg/g (per gram of rhizomes powder). Both the CCD model and the SVR model were credible, for they have predicted the similar process condition and the deviation of yield were less than 1.2%.

  11. Mechanisms of double-strand-break repair during gene targeting in mammalian cells.

    PubMed Central

    Ng, P; Baker, M D

    1999-01-01

    In the present study, the mechanism of double-strand-break (DSB) repair during gene targeting at the chromosomal immunoglobulin mu-locus in a murine hybridoma was examined. The gene-targeting assay utilized specially designed insertion vectors genetically marked in the region of homology to the chromosomal mu-locus by six diagnostic restriction enzyme site markers. The restriction enzyme markers permitted the contribution of vector-borne and chromosomal mu-sequences in the recombinant product to be determined. The use of the insertion vectors in conjunction with a plating procedure in which individual integrative homologous recombination events were retained for analysis revealed several important features about the mammalian DSB repair process:The presence of the markers within the region of shared homology did not affect the efficiency of gene targeting.In the majority of recombinants, the vector-borne marker proximal to the DSB was absent, being replaced with the corresponding chromosomal restriction enzyme site. This result is consistent with either formation and repair of a vector-borne gap or an "end" bias in mismatch repair of heteroduplex DNA (hDNA) that favored the chromosomal sequence. Formation of hDNA was frequently associated with gene targeting and, in most cases, began approximately 645 bp from the DSB and could encompass a distance of at least 1469 bp.The hDNA was efficiently repaired prior to DNA replication.The repair of adjacent mismatches in hDNA occurred predominantly on the same strand, suggesting the involvement of a long-patch repair mechanism. PMID:10049929

  12. ℓ(p)-Norm multikernel learning approach for stock market price forecasting.

    PubMed

    Shao, Xigao; Wu, Kun; Liao, Bifeng

    2012-01-01

    Linear multiple kernel learning model has been used for predicting financial time series. However, ℓ(1)-norm multiple support vector regression is rarely observed to outperform trivial baselines in practical applications. To allow for robust kernel mixtures that generalize well, we adopt ℓ(p)-norm multiple kernel support vector regression (1 ≤ p < ∞) as a stock price prediction model. The optimization problem is decomposed into smaller subproblems, and the interleaved optimization strategy is employed to solve the regression model. The model is evaluated on forecasting the daily stock closing prices of Shanghai Stock Index in China. Experimental results show that our proposed model performs better than ℓ(1)-norm multiple support vector regression model.

  13. Experiences in using the CYBER 203 for three-dimensional transonic flow calculations

    NASA Technical Reports Server (NTRS)

    Melson, N. D.; Keller, J. D.

    1982-01-01

    In this paper, the authors report on some of their experiences modifying two three-dimensional transonic flow programs (FLO22 and FLO27) for use on the NASA Langley Research Center CYBER 203. Both of the programs discussed were originally written for use on serial machines. Several methods were attempted to optimize the execution of the two programs on the vector machine, including: (1) leaving the program in a scalar form (i.e., serial computation) with compiler software used to optimize and vectorize the program, (2) vectorizing parts of the existing algorithm in the program, and (3) incorporating a new vectorizable algorithm (ZEBRA I or ZEBRA II) in the program.

  14. Optimization of large matrix calculations for execution on the Cray X-MP vector supercomputer

    NASA Technical Reports Server (NTRS)

    Hornfeck, William A.

    1988-01-01

    A considerable volume of large computational computer codes were developed for NASA over the past twenty-five years. This code represents algorithms developed for machines of earlier generation. With the emergence of the vector supercomputer as a viable, commercially available machine, an opportunity exists to evaluate optimization strategies to improve the efficiency of existing software. This result is primarily due to architectural differences in the latest generation of large-scale machines and the earlier, mostly uniprocessor, machines. A sofware package being used by NASA to perform computations on large matrices is described, and a strategy for conversion to the Cray X-MP vector supercomputer is also described.

  15. Prevalence of Vector-Borne Pathogens in Southern California Dogs With Clinical and Laboratory Abnormalities Consistent With Immune-Mediated Disease.

    PubMed

    Kidd, L; Qurollo, B; Lappin, M; Richter, K; Hart, J R; Hill, S; Osmond, C; Breitschwerdt, E B

    2017-07-01

    Studies investigating the prevalence of vector-borne pathogens in southern California dogs are limited. Occult infections might be misdiagnosed as idiopathic immune-mediated disease. (1) To determine the prevalence of vector-borne pathogens in southern California dogs with compatible clinical findings using PCR and serologic panels and (2) to determine whether testing convalescent samples and repeating PCR on acute samples using the same and different gene targets enhance detection. Forty-two client-owned dogs with clinical signs of vector-borne disease presenting to specialty practices in San Diego County. Combined prospective and retrospective observational study. Forty-two acute and 27 convalescent samples were collected. Acute samples were prospectively tested for antibodies to Rickettsia, Ehrlichia, Bartonella, Babesia, Borrelia, and Anaplasma species. PCR targeting Ehrlichia, Babesia, Anaplasma, hemotropic Mycoplasma, and Bartonella species was also performed. Retrospectively, convalescent samples were tested for the same organisms using serology, and for Ehrlichia, Babesia, Anaplasma, and Bartonella species using PCR. Acute samples were retested using PCR targeting Ehrlichia and Babesia species. Evidence of exposure to or infection with a vector-borne pathogen was detected in 33% (14/42) of dogs. Ehrlichia and Babesia species were most common; each was identified in 5 dogs. Convalescent serologic testing, repeating PCR, and using novel PCR gene targets increased detection by 30%. Repeated testing using serology and PCR enhances detection of infection by vector-borne pathogens in dogs with clinical signs of immune-mediated disease. Larger prevalence studies of emerging vector-borne pathogens in southern California dogs are warranted. Copyright © 2017 The Authors. Journal of Veterinary Internal Medicine published by Wiley Periodicals, Inc. on behalf of the American College of Veterinary Internal Medicine.

  16. [Effects of plant viruses on vector and non-vector herbivorous arthropods and their natural enemies: a mini review].

    PubMed

    He, Xiao-Chan; Xu, Hong-Xing; Zhou, Xiao-Jun; Zheng, Xu-Song; Sun, Yu-Jian; Yang, Ya-Jun; Tian, Jun-Ce; Lü, Zhong-Xian

    2014-05-01

    Plant viruses transmitted by arthropods, as an important biotic factor, may not only directly affect the yield and quality of host plants, and development, physiological characteristics and ecological performances of their vector arthropods, but also directly or indirectly affect the non-vector herbivorous arthropods and their natural enemies in the same ecosystem, thereby causing influences to the whole agro-ecosystem. This paper reviewed the progress on the effects of plant viruses on herbivorous arthropods, including vector and non-vector, and their natural enemies, and on their ecological mechanisms to provide a reference for optimizing the management of vector and non-vector arthropod populations and sustainable control of plant viruses in agro-ecosystem.

  17. Predictability of a Coupled Model of ENSO Using Singular Vector Analysis: Optimal Growth and Forecast Skill.

    NASA Astrophysics Data System (ADS)

    Xue, Yan

    The optimal growth and its relationship with the forecast skill of the Zebiak and Cane model are studied using a simple statistical model best fit to the original nonlinear model and local linear tangent models about idealized climatic states (the mean background and ENSO cycles in a long model run), and the actual forecast states, including two sets of runs using two different initialization procedures. The seasonally varying Markov model best fit to a suite of 3-year forecasts in a reduced EOF space (18 EOFs) fits the original nonlinear model reasonably well and has comparable or better forecast skill. The initial error growth in a linear evolution operator A is governed by the eigenvalues of A^{T}A, and the square roots of eigenvalues and eigenvectors of A^{T}A are named singular values and singular vectors. One dominant growing singular vector is found, and the optimal 6 month growth rate is largest for a (boreal) spring start and smallest for a fall start. Most of the variation in the optimal growth rate of the two forecasts is seasonal, attributable to the seasonal variations in the mean background, except that in the cold events it is substantially suppressed. It is found that the mean background (zero anomaly) is the most unstable state, and the "forecast IC states" are more unstable than the "coupled model states". One dominant growing singular vector is found, characterized by north-south and east -west dipoles, convergent winds on the equator in the eastern Pacific and a deepened thermocline in the whole equatorial belt. This singular vector is insensitive to initial time and optimization time, but its final pattern is a strong function of initial states. The ENSO system is inherently unpredictable for the dominant singular vector can amplify 5-fold to 24-fold in 6 months and evolve into the large scales characteristic of ENSO. However, the inherent ENSO predictability is only a secondary factor, while the mismatches between the model and data is a primary factor controlling the current forecast skill.

  18. An adaptive evolutionary multi-objective approach based on simulated annealing.

    PubMed

    Li, H; Landa-Silva, D

    2011-01-01

    A multi-objective optimization problem can be solved by decomposing it into one or more single objective subproblems in some multi-objective metaheuristic algorithms. Each subproblem corresponds to one weighted aggregation function. For example, MOEA/D is an evolutionary multi-objective optimization (EMO) algorithm that attempts to optimize multiple subproblems simultaneously by evolving a population of solutions. However, the performance of MOEA/D highly depends on the initial setting and diversity of the weight vectors. In this paper, we present an improved version of MOEA/D, called EMOSA, which incorporates an advanced local search technique (simulated annealing) and adapts the search directions (weight vectors) corresponding to various subproblems. In EMOSA, the weight vector of each subproblem is adaptively modified at the lowest temperature in order to diversify the search toward the unexplored parts of the Pareto-optimal front. Our computational results show that EMOSA outperforms six other well established multi-objective metaheuristic algorithms on both the (constrained) multi-objective knapsack problem and the (unconstrained) multi-objective traveling salesman problem. Moreover, the effects of the main algorithmic components and parameter sensitivities on the search performance of EMOSA are experimentally investigated.

  19. On the Improvement of Convergence Performance for Integrated Design of Wind Turbine Blade Using a Vector Dominating Multi-objective Evolution Algorithm

    NASA Astrophysics Data System (ADS)

    Wang, L.; Wang, T. G.; Wu, J. H.; Cheng, G. P.

    2016-09-01

    A novel multi-objective optimization algorithm incorporating evolution strategies and vector mechanisms, referred as VD-MOEA, is proposed and applied in aerodynamic- structural integrated design of wind turbine blade. In the algorithm, a set of uniformly distributed vectors is constructed to guide population in moving forward to the Pareto front rapidly and maintain population diversity with high efficiency. For example, two- and three- objective designs of 1.5MW wind turbine blade are subsequently carried out for the optimization objectives of maximum annual energy production, minimum blade mass, and minimum extreme root thrust. The results show that the Pareto optimal solutions can be obtained in one single simulation run and uniformly distributed in the objective space, maximally maintaining the population diversity. In comparison to conventional evolution algorithms, VD-MOEA displays dramatic improvement of algorithm performance in both convergence and diversity preservation for handling complex problems of multi-variables, multi-objectives and multi-constraints. This provides a reliable high-performance optimization approach for the aerodynamic-structural integrated design of wind turbine blade.

  20. Vector systems for prenatal gene therapy: principles of retrovirus vector design and production.

    PubMed

    Howe, Steven J; Chandrashekran, Anil

    2012-01-01

    Vectors derived from the Retroviridae family have several attributes required for successful gene delivery. Retroviral vectors have an adequate payload size for the coding regions of most genes; they are safe to handle and simple to produce. These vectors can be manipulated to target different cell types with low immunogenicity and can permanently insert genetic information into the host cells' genome. Retroviral vectors have been used in gene therapy clinical trials and successfully applied experimentally in vitro, in vivo, and in utero.

  1. Roofline Analysis in the Intel® Advisor to Deliver Optimized Performance for applications on Intel® Xeon Phi™ Processor

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Koskela, Tuomas S.; Lobet, Mathieu; Deslippe, Jack

    In this session we show, in two case studies, how the roofline feature of Intel Advisor has been utilized to optimize the performance of kernels of the XGC1 and PICSAR codes in preparation for Intel Knights Landing architecture. The impact of the implemented optimizations and the benefits of using the automatic roofline feature of Intel Advisor to study performance of large applications will be presented. This demonstrates an effective optimization strategy that has enabled these science applications to achieve up to 4.6 times speed-up and prepare for future exascale architectures. # Goal/Relevance of Session The roofline model [1,2] is amore » powerful tool for analyzing the performance of applications with respect to the theoretical peak achievable on a given computer architecture. It allows one to graphically represent the performance of an application in terms of operational intensity, i.e. the ratio of flops performed and bytes moved from memory in order to guide optimization efforts. Given the scale and complexity of modern science applications, it can often be a tedious task for the user to perform the analysis on the level of functions or loops to identify where performance gains can be made. With new Intel tools, it is now possible to automate this task, as well as base the estimates of peak performance on measurements rather than vendor specifications. The goal of this session is to demonstrate how the roofline feature of Intel Advisor can be used to balance memory vs. computation related optimization efforts and effectively identify performance bottlenecks. A series of typical optimization techniques: cache blocking, structure refactoring, data alignment, and vectorization illustrated by the kernel cases will be addressed. # Description of the codes ## XGC1 The XGC1 code [3] is a magnetic fusion Particle-In-Cell code that uses an unstructured mesh for its Poisson solver that allows it to accurately resolve the edge plasma of a magnetic fusion device. After recent optimizations to its collision kernel [4], most of the computing time is spent in the electron push (pushe) kernel, where these optimization efforts have been focused. The kernel code scaled well with MPI+OpenMP but had almost no automatic compiler vectorization, in part due to indirect memory addresses and in part due to low trip counts of low-level loops that would be candidates for vectorization. Particle blocking and sorting have been implemented to increase trip counts of low-level loops and improve memory locality, and OpenMP directives have been added to vectorize compute-intensive loops that were identified by Advisor. The optimizations have improved the performance of the pushe kernel 2x on Haswell processors and 1.7x on KNL. The KNL node-for-node performance has been brought to within 30% of a NERSC Cori phase I Haswell node and we expect to bridge this gap by reducing the memory footprint of compute intensive routines to improve cache reuse. ## PICSAR is a Fortran/Python high-performance Particle-In-Cell library targeting at MIC architectures first designed to be coupled with the PIC code WARP for the simulation of laser-matter interaction and particle accelerators. PICSAR also contains a FORTRAN stand-alone kernel for performance studies and benchmarks. A MPI domain decomposition is used between NUMA domains and a tile decomposition (cache-blocking) handled by OpenMP has been added for shared-memory parallelism and better cache management. The so-called current deposition and field gathering steps that compose the PIC time loop constitute major hotspots that have been rewritten to enable more efficient vectorization. Particle communications between tiles and MPI domain has been merged and parallelized. All considered, these improvements provide speedups of 3.1 for order 1 and 4.6 for order 3 interpolation shape factors on KNL configured in SNC4 quadrant flat mode. Performance is similar between a node of cori phase 1 and KNL at order 1 and better on KNL by a factor 1.6 at order 3 with the considered test case (homogeneous thermal plasma).« less

  2. Optimal control in a model of malaria with differential susceptibility

    NASA Astrophysics Data System (ADS)

    Hincapié, Doracelly; Ospina, Juan

    2014-06-01

    A malaria model with differential susceptibility is analyzed using the optimal control technique. In the model the human population is classified as susceptible, infected and recovered. Susceptibility is assumed dependent on genetic, physiological, or social characteristics that vary between individuals. The model is described by a system of differential equations that relate the human and vector populations, so that the infection is transmitted to humans by vectors, and the infection is transmitted to vectors by humans. The model considered is analyzed using the optimal control method when the control consists in using of insecticide-treated nets and educational campaigns; and the optimality criterion is to minimize the number of infected humans, while keeping the cost as low as is possible. One first goal is to determine the effects of differential susceptibility in the proposed control mechanism; and the second goal is to determine the algebraic form of the basic reproductive number of the model. All computations are performed using computer algebra, specifically Maple. It is claimed that the analytical results obtained are important for the design and implementation of control measures for malaria. It is suggested some future investigations such as the application of the method to other vector-borne diseases such as dengue or yellow fever; and also it is suggested the possible application of free software of computer algebra like Maxima.

  3. Application of support vector regression for optimization of vibration flow field of high-density polyethylene melts characterized by small angle light scattering

    NASA Astrophysics Data System (ADS)

    Xian, Guangming

    2018-03-01

    In this paper, the vibration flow field parameters of polymer melts in a visual slit die are optimized by using intelligent algorithm. Experimental small angle light scattering (SALS) patterns are shown to characterize the processing process. In order to capture the scattered light, a polarizer and an analyzer are placed before and after the polymer melts. The results reported in this study are obtained using high-density polyethylene (HDPE) with rotation speed at 28 rpm. In addition, support vector regression (SVR) analytical method is introduced for optimization the parameters of vibration flow field. This work establishes the general applicability of SVR for predicting the optimal parameters of vibration flow field.

  4. Cardiac Gene Therapy: Optimization of Gene Delivery Techniques In Vivo

    PubMed Central

    Katz, Michael G.; Swain, JaBaris D.; White, Jennifer D.; Low, David; Stedman, Hansell

    2010-01-01

    Abstract Vector-mediated cardiac gene therapy holds tremendous promise as a translatable platform technology for treating many cardiovascular diseases. The ideal technique is one that is efficient and practical, allowing for global cardiac gene expression, while minimizing collateral expression in other organs. Here we survey the available in vivo vector-mediated cardiac gene delivery methods—including transcutaneous, intravascular, intramuscular, and cardiopulmonary bypass techniques—with consideration of the relative merits and deficiencies of each. Review of available techniques suggests that an optimal method for vector-mediated gene delivery to the large animal myocardium would ideally employ retrograde and/or anterograde transcoronary gene delivery,extended vector residence time in the coronary circulation, an increased myocardial transcapillary gradient using physical methods, increased endothelial permeability with pharmacological agents, minimal collateral gene expression by isolation of the cardiac circulation from the systemic, and have low immunogenicity. PMID:19947886

  5. Rank-Optimized Logistic Matrix Regression toward Improved Matrix Data Classification.

    PubMed

    Zhang, Jianguang; Jiang, Jianmin

    2018-02-01

    While existing logistic regression suffers from overfitting and often fails in considering structural information, we propose a novel matrix-based logistic regression to overcome the weakness. In the proposed method, 2D matrices are directly used to learn two groups of parameter vectors along each dimension without vectorization, which allows the proposed method to fully exploit the underlying structural information embedded inside the 2D matrices. Further, we add a joint [Formula: see text]-norm on two parameter matrices, which are organized by aligning each group of parameter vectors in columns. This added co-regularization term has two roles-enhancing the effect of regularization and optimizing the rank during the learning process. With our proposed fast iterative solution, we carried out extensive experiments. The results show that in comparison to both the traditional tensor-based methods and the vector-based regression methods, our proposed solution achieves better performance for matrix data classifications.

  6. Deformable 3D-2D registration for CT and its application to low dose tomographic fluoroscopy

    NASA Astrophysics Data System (ADS)

    Flach, Barbara; Brehm, Marcus; Sawall, Stefan; Kachelrieß, Marc

    2014-12-01

    Many applications in medical imaging include image registration for matching of images from the same or different modalities. In the case of full data sampling, the respective reconstructed images are usually of such a good image quality that standard deformable volume-to-volume (3D-3D) registration approaches can be applied. But research in temporal-correlated image reconstruction and dose reductions increases the number of cases where rawdata are available from only few projection angles. Here, deteriorated image quality leads to non-acceptable deformable volume-to-volume registration results. Therefore a registration approach is required that is robust against a decreasing number of projections defining the target position. We propose a deformable volume-to-rawdata (3D-2D) registration method that aims at finding a displacement vector field maximizing the alignment of a CT volume and the acquired rawdata based on the sum of squared differences in rawdata domain. The registration is constrained by a regularization term in accordance with a fluid-based diffusion. Both cost function components, the rawdata fidelity and the regularization term, are optimized in an alternating manner. The matching criterion is optimized by a conjugate gradient descent for nonlinear functions, while the regularization is realized by convolution of the vector fields with Gaussian kernels. We validate the proposed method and compare it to the demons algorithm, a well-known 3D-3D registration method. The comparison is done for a range of 4-60 target projections using datasets from low dose tomographic fluoroscopy as an application example. The results show a high correlation to the ground truth target position without introducing artifacts even in the case of very few projections. In particular the matching in the rawdata domain is improved compared to the 3D-3D registration for the investigated range. The proposed volume-to-rawdata registration increases the robustness regarding sparse rawdata and provides more stable results than volume-to-volume approaches. By applying the proposed registration approach to low dose tomographic fluoroscopy it is possible to improve the temporal resolution and thus to increase the robustness of low dose tomographic fluoroscopy.

  7. Progress in navigation filter estimate fusion and its application to spacecraft rendezvous

    NASA Technical Reports Server (NTRS)

    Carpenter, J. Russell

    1994-01-01

    A new derivation of an algorithm which fuses the outputs of two Kalman filters is presented within the context of previous research in this field. Unlike other works, this derivation clearly shows the combination of estimates to be optimal, minimizing the trace of the fused covariance matrix. The algorithm assumes that the filters use identical models, and are stable and operating optimally with respect to their own local measurements. Evidence is presented which indicates that the error ellipsoid derived from the covariance of the optimally fused estimate is contained within the intersections of the error ellipsoids of the two filters being fused. Modifications which reduce the algorithm's data transmission requirements are also presented, including a scalar gain approximation, a cross-covariance update formula which employs only the two contributing filters' autocovariances, and a form of the algorithm which can be used to reinitialize the two Kalman filters. A sufficient condition for using the optimally fused estimates to periodically reinitialize the Kalman filters in this fashion is presented and proved as a theorem. When these results are applied to an optimal spacecraft rendezvous problem, simulated performance results indicate that the use of optimally fused data leads to significantly improved robustness to initial target vehicle state errors. The following applications of estimate fusion methods to spacecraft rendezvous are also described: state vector differencing, and redundancy management.

  8. An Agrobacterium-delivered CRISPR/Cas9 system for high-frequency targeted mutagenesis in maize.

    PubMed

    Char, Si Nian; Neelakandan, Anjanasree K; Nahampun, Hartinio; Frame, Bronwyn; Main, Marcy; Spalding, Martin H; Becraft, Philip W; Meyers, Blake C; Walbot, Virginia; Wang, Kan; Yang, Bing

    2017-02-01

    CRISPR/Cas9 is a powerful genome editing tool in many organisms, including a number of monocots and dicots. Although the design and application of CRISPR/Cas9 is simpler compared to other nuclease-based genome editing tools, optimization requires the consideration of the DNA delivery and tissue regeneration methods for a particular species to achieve accuracy and efficiency. Here, we describe a public sector system, ISU Maize CRISPR, utilizing Agrobacterium-delivered CRISPR/Cas9 for high-frequency targeted mutagenesis in maize. This system consists of an Escherichia coli cloning vector and an Agrobacterium binary vector. It can be used to clone up to four guide RNAs for single or multiplex gene targeting. We evaluated this system for its mutagenesis frequency and heritability using four maize genes in two duplicated pairs: Argonaute 18 (ZmAgo18a and ZmAgo18b) and dihydroflavonol 4-reductase or anthocyaninless genes (a1 and a4). T 0 transgenic events carrying mono- or diallelic mutations of one locus and various combinations of allelic mutations of two loci occurred at rates over 70% mutants per transgenic events in both Hi-II and B104 genotypes. Through genetic segregation, null segregants carrying only the desired mutant alleles without the CRISPR transgene could be generated in T 1 progeny. Inheritance of an active CRISPR/Cas9 transgene leads to additional target-specific mutations in subsequent generations. Duplex infection of immature embryos by mixing two individual Agrobacterium strains harbouring different Cas9/gRNA modules can be performed for improved cost efficiency. Together, the findings demonstrate that the ISU Maize CRISPR platform is an effective and robust tool to targeted mutagenesis in maize. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  9. Optimal Interception of a Maneuvering Long-range Missile

    NASA Astrophysics Data System (ADS)

    X. Vinh, Nguyen; T. Kabamba, Pierre; Takehira, Tetsuya

    2001-01-01

    In a Newtonian central force field, the minimum-fuel interception of a satellite, or a ballistic missile, in elliptic trajectory can be obtained via Lawden's theory of primer vector. To secure interception when the target performs evasive maneuvers, a new control law, with explicit solutions, is implemented. It is shown that by a rotation of coordinate system, the problem of three-dimensional interception is reduced to a planar problem. The general case of planar interception of a long-range ballistic missile is then studied. Examples of interception at a specified time, head-on interception and minimum-fuel interception are presented. In each case, the requirement for the thrust acceleration is expressed explicitly as a function of time.

  10. A parallel Jacobson-Oksman optimization algorithm. [parallel processing (computers)

    NASA Technical Reports Server (NTRS)

    Straeter, T. A.; Markos, A. T.

    1975-01-01

    A gradient-dependent optimization technique which exploits the vector-streaming or parallel-computing capabilities of some modern computers is presented. The algorithm, derived by assuming that the function to be minimized is homogeneous, is a modification of the Jacobson-Oksman serial minimization method. In addition to describing the algorithm, conditions insuring the convergence of the iterates of the algorithm and the results of numerical experiments on a group of sample test functions are presented. The results of these experiments indicate that this algorithm will solve optimization problems in less computing time than conventional serial methods on machines having vector-streaming or parallel-computing capabilities.

  11. Transfers between libration-point orbits in the elliptic restricted problem

    NASA Astrophysics Data System (ADS)

    Hiday, L. A.; Howell, K. C.

    The present time-fixed impulsive transfers between 3D libration point orbits in the vicinity of the interior L(1) libration point of the sun-earth-moon barycenter system are 'optimal' in that the total characteristic velocity required for implementation of the transfer exhibits a local minimum. The conditions necessary for a time-fixed, two-impulse transfer trajectory to be optimal are stated in terms of the primer vector, and the conditions necessary for satisfying the local optimality of a transfer trajectory containing additional impulses are addressed by requiring continuity of the Hamiltonian and the derivative of the primer vector at all interior impulses.

  12. The natural dietary genistein boosts bacteriophage-mediated cancer cell killing by improving phage-targeted tumor cell transduction

    PubMed Central

    Tsafa, Effrosyni; Al-Bahrani, Mariam; Bentayebi, Kaoutar; Przystal, Justyna; Suwan, Keittisak; Hajitou, Amin

    2016-01-01

    Gene therapy has long been regarded as a promising treatment for cancer. However, cancer gene therapy is still facing the challenge of targeting gene delivery vectors specifically to tumors when administered via clinically acceptable non-invasive systemic routes (i.e. intravenous). The bacteria virus, bacteriophage (phage), represents a new generation of promising vectors in systemic gene delivery since their targeting can be achieved through phage capsid display ligands, which enable them to home to specific tumor receptors without the need to ablate any native eukaryotic tropism. We have previously reported a tumor specific bacteriophage vector named adeno-associated virus/phage, or AAVP, in which gene expression is under a recombinant human rAAV2 virus genome targeted to tumors via a ligand-directed phage capsid. However, cancer gene therapy with this tumor-targeted vector achieved variable outcomes ranging from tumor regression to no effect in both experimental and natural preclinical models. Herein, we hypothesized that combining the natural dietary genistein, with proven anticancer activity, would improve bacteriophage anticancer safe therapy. We show that combination treatment with genistein and AAVP increased targeted cancer cell killing by AAVP carrying the gene for Herpes simplex virus thymidine kinase (HSVtk) in 2D tissue cultures and 3D tumor spheroids. We found this increased tumor cell killing was associated with enhanced AAVP-mediated gene expression. Next, we established that genistein protects AAVP against proteasome degradation and enhances vector genome accumulation in the nucleus. Combination of genistein and phage-guided virotherapy is a safe and promising strategy that should be considered in anticancer therapy with AAVP. PMID:27437775

  13. Modelling strategies to break transmission of lymphatic filariasis--aggregation, adherence and vector competence greatly alter elimination.

    PubMed

    Irvine, M A; Reimer, L J; Njenga, S M; Gunawardena, S; Kelly-Hope, L; Bockarie, M; Hollingsworth, T D

    2015-10-22

    With ambitious targets to eliminate lymphatic filariasis over the coming years, there is a need to identify optimal strategies to achieve them in areas with different baseline prevalence and stages of control. Modelling can assist in identifying what data should be collected and what strategies are best for which scenarios. We develop a new individual-based, stochastic mathematical model of the transmission of lymphatic filariasis. We validate the model by fitting to a first time point and predicting future timepoints from surveillance data in Kenya and Sri Lanka, which have different vectors and different stages of the control programme. We then simulate different treatment scenarios in low, medium and high transmission settings, comparing once yearly mass drug administration (MDA) with more frequent MDA and higher coverage. We investigate the potential impact that vector control, systematic non-compliance and different levels of aggregation have on the dynamics of transmission and control. In all settings, increasing coverage from 65 to 80 % has a similar impact on control to treating twice a year at 65 % coverage, for fewer drug treatments being distributed. Vector control has a large impact, even at moderate levels. The extent of aggregation of parasite loads amongst a small portion of the population, which has been estimated to be highly variable in different settings, can undermine the success of a programme, particularly if high risk sub-communities are not accessing interventions. Even moderate levels of vector control have a large impact both on the reduction in prevalence and the maintenance of gains made during MDA, even when parasite loads are highly aggregated, and use of vector control is at moderate levels. For the same prevalence, differences in aggregation and adherence can result in very different dynamics. The novel analysis of a small amount of surveillance data and resulting simulations highlight the need for more individual level data to be analysed to effectively tailor programmes in the drive for elimination.

  14. Improving virtual screening predictive accuracy of Human kallikrein 5 inhibitors using machine learning models.

    PubMed

    Fang, Xingang; Bagui, Sikha; Bagui, Subhash

    2017-08-01

    The readily available high throughput screening (HTS) data from the PubChem database provides an opportunity for mining of small molecules in a variety of biological systems using machine learning techniques. From the thousands of available molecular descriptors developed to encode useful chemical information representing the characteristics of molecules, descriptor selection is an essential step in building an optimal quantitative structural-activity relationship (QSAR) model. For the development of a systematic descriptor selection strategy, we need the understanding of the relationship between: (i) the descriptor selection; (ii) the choice of the machine learning model; and (iii) the characteristics of the target bio-molecule. In this work, we employed the Signature descriptor to generate a dataset on the Human kallikrein 5 (hK 5) inhibition confirmatory assay data and compared multiple classification models including logistic regression, support vector machine, random forest and k-nearest neighbor. Under optimal conditions, the logistic regression model provided extremely high overall accuracy (98%) and precision (90%), with good sensitivity (65%) in the cross validation test. In testing the primary HTS screening data with more than 200K molecular structures, the logistic regression model exhibited the capability of eliminating more than 99.9% of the inactive structures. As part of our exploration of the descriptor-model-target relationship, the excellent predictive performance of the combination of the Signature descriptor and the logistic regression model on the assay data of the Human kallikrein 5 (hK 5) target suggested a feasible descriptor/model selection strategy on similar targets. Copyright © 2017 Elsevier Ltd. All rights reserved.

  15. Method and apparatus for optimized processing of sparse matrices

    DOEpatents

    Taylor, Valerie E.

    1993-01-01

    A computer architecture for processing a sparse matrix is disclosed. The apparatus stores a value-row vector corresponding to nonzero values of a sparse matrix. Each of the nonzero values is located at a defined row and column position in the matrix. The value-row vector includes a first vector including nonzero values and delimiting characters indicating a transition from one column to another. The value-row vector also includes a second vector which defines row position values in the matrix corresponding to the nonzero values in the first vector and column position values in the matrix corresponding to the column position of the nonzero values in the first vector. The architecture also includes a circuit for detecting a special character within the value-row vector. Matrix-vector multiplication is executed on the value-row vector. This multiplication is performed by multiplying an index value of the first vector value by a column value from a second matrix to form a matrix-vector product which is added to a previous matrix-vector product.

  16. AAV Vectorization of DSB-mediated Gene Editing Technologies.

    PubMed

    Moser, Rachel J; Hirsch, Matthew L

    2016-01-01

    Recent work both at the bench and the bedside demonstrate zinc-finger nucleases (ZFNs), CRISPR/Cas9, and other programmable site-specific endonuclease technologies are being successfully utilized within and alongside AAV vectors to induce therapeutically relevant levels of directed gene editing within the human chromosome. Studies from past decades acknowledge that AAV vector genomes are enhanced substrates for homology-directed repair in the presence or absence of targeted DNA damage within the host genome. Additionally, AAV vectors are currently the most efficient format for in vivo gene delivery with no vector related complications in >100 clinical trials for diverse diseases. At the same time, advancements in the design of custom-engineered site-specific endonucleases and the utilization of elucidated endonuclease formats have resulted in efficient and facile genetic engineering for basic science and for clinical therapies. AAV vectors and gene editing technologies are an obvious marriage, using AAV for the delivery of repair substrate and/or a gene encoding a designer endonuclease; however, while efficient delivery and enhanced gene targeting by vector genomes are advantageous, other attributes of AAV vectors are less desirable for gene editing technologies. This review summarizes the various roles that AAV vectors play in gene editing technologies and provides insight into its trending applications for the treatment of genetic diseases.

  17. [Herpes simplex virus-mediated RNA interference targeting vesicular glutamate transporter 3 attenuates tactile allodynia in mice].

    PubMed

    Liu, Jie-Qiong; Li, Chen-Hong; Luo, Qiong; Yin, Ping-Ping; Lei, Tao; Luo, Fang

    2016-11-20

    To construct a replication-deficient herpes simplex virus (HSV-1) for delivering a short hairpin RNA (shRNA) targeting vesicular glutamate transporter 3 (VGLUT3) and observe its effect in alleviating allodynia in mice. The recombinant HSV-1 vector carrying the shRNA targeting Vglut3 (HSV-1-shvglut3) was constructed and inoculated in the sciatic nerve in a mouse model of mechanical allodynia to test its analgesia effect. Mechanical allodynia and heat hypersensitivity of the mice were tested by von Frey filaments and Hargreaves' test, respectively. VGLUT3 expression in the dorsal root ganglion (DRG) was evaluated by immunohistochemistry and Western blotting. Following inoculation in the sciatic nerve, the HSV vector HSV-1-shvglut3 was retrogradely transported to the DRG. Mechanical withdraw thresholds of the mouse models receiving HSV-1-shvglut3 inoculation were reversed to nearly the baseline level, and VGLUT3 expression in the DRG was down-regulated 2 weeks after vector inoculation. The analgesic effect lasted for over 2 weeks in these mice without obvious systematic side effects or changes in heat hypersensitivity threshold. Vglut3 in the DRG is a promising therapeutic target for alleviating mechanical allodynia, and HSV-1 vector-mediated RNA interference is safe and efficient for inducing long-lasting analgesia after peripheral inoculation of the vector.

  18. [Construction and expression of the targeting super-antigen EGF-SEA fusion gene].

    PubMed

    Xie, Yang; Peng, Shaoping; Liao, Zhiying; Liu, Jiafeng; Liu, Xuemei; Chen, Weifeng

    2014-05-01

    To construct expression vector for the SEA-EGF fusion gene. Clone the SEA gene and the EGF gene segment with PCR and RT-PCR independently, and connect this two genes by the bridge PCR. Insert the fusion gene EGF-SEA into the expression vector PET-44. Induced the secretion of the fusion protein SEA-EGF by the antileptic. The gene fragment encoding EGF and SEA mature peptide was successfully cloned. The fusion gene EGF-SEA was successfully constructed and was inserted into expression vector. The new recombinant expression vector for fusion gene EGF-SEA is specific for head and neck cancer, laid the foundation for the further study of fusion protein SEA-EGF targeting immune therapy in head and neck tumors.

  19. pHg/pSILBAγ vector system for efficient gene silencing in homobasidiomycetes: optimization of ihpRNA – triggering in the mycorrhizal fungus Laccaria bicolor

    PubMed Central

    Kemppainen, Minna J.; Pardo, Alejandro G.

    2010-01-01

    Summary pSILBAγ silencing vector was constructed for efficient RNA silencing triggering in the model mycorrhizal fungus Laccaria bicolor. This cloning vector carries the Agaricus bisporus gpdII promoter, two multiple cloning sites separated by a L. bicolor nitrate reductase intron and the Aspergillus nidulans trpC terminator. pSILBAγ allows an easy oriented two‐step PCR cloning of hairpin sequences to be expressed in basidiomycetes. With one further cloning step into pHg, a pCAMBIA1300‐based binary vector carrying a hygromycin resistance cassette, the pHg/pSILBAγ plasmid is used for Agrobacterium‐mediated transformation. The pHg/pSILBAγ system results in predominantly single integrations of RNA silencing triggering T‐DNAs in the fungal genome and the integration sites of the transgenes can be resolved by plasmid rescue. pSILBAγ construct and two other pSILBA plasmid variants (pSILBA and pSILBAα) were evaluated for their capacity to silence Laccaria nitrate reductase gene. While all pSILBA variants tested resulted in up to 65–76% of transformants with reduced growth on nitrate, pSILBAγ produced the highest number (65%) of strongly affected fungal strains. The strongly silenced phenotype was shown to correlate with T‐DNA integration in transcriptionally active genomic sites. pHg/pSILBAγ was shown to produce T‐DNAs with minimum CpG methylation in transgene promoter regions which assures the maximum silencing trigger production in Laccaria. Methylation of the target endogene was only slight in RNA silencing triggered with constructs carrying an intronic spacer hairpin sequence. The silencing capacity of the pHg/pSILBAγ was further tested with Laccaria inositol‐1,4,5‐triphosphate 5‐phosphatase gene. Besides its use in silencing triggering, the herein described plasmid system can also be used for transgene expression in Laccaria. pHg/pSILBAγ silencing system is optimized for L. bicolor but it should be highly useful also for other homobasidiomycetes, group of fungi currently lacking molecular tools for RNA silencing. PMID:21255319

  20. A vectorization of the Jameson-Caughey NYU transonic swept-wing computer program FLO-22-V1 for the STAR-100 computer

    NASA Technical Reports Server (NTRS)

    Smith, R. E.; Pitts, J. I.; Lambiotte, J. J., Jr.

    1978-01-01

    The computer program FLO-22 for analyzing inviscid transonic flow past 3-D swept-wing configurations was modified to use vector operations and run on the STAR-100 computer. The vectorized version described herein was called FLO-22-V1. Vector operations were incorporated into Successive Line Over-Relaxation in the transformed horizontal direction. Vector relational operations and control vectors were used to implement upwind differencing at supersonic points. A high speed of computation and extended grid domain were characteristics of FLO-22-V1. The new program was not the optimal vectorization of Successive Line Over-Relaxation applied to transonic flow; however, it proved that vector operations can readily be implemented to increase the computation rate of the algorithm.

  1. Unrestricted Hepatocyte Transduction with Adeno-Associated Virus Serotype 8 Vectors in Mice

    PubMed Central

    Nakai, Hiroyuki; Fuess, Sally; Storm, Theresa A.; Muramatsu, Shin-ichi; Nara, Yuko; Kay, Mark A.

    2005-01-01

    Recombinant adeno-associated virus (rAAV) vectors can mediate long-term stable transduction in various target tissues. However, with rAAV serotype 2 (rAAV2) vectors, liver transduction is confined to only a small portion of hepatocytes even after administration of extremely high vector doses. In order to investigate whether rAAV vectors of other serotypes exhibit similar restricted liver transduction, we performed a dose-response study by injecting mice with β-galactosidase-expressing rAAV1 and rAAV8 vectors via the portal vein. The rAAV1 vector showed a blunted dose-response similar to that of rAAV2 at high doses, while the rAAV8 vector dose-response remained unchanged at any dose and ultimately could transduce all the hepatocytes at a dose of 7.2 × 1012 vector genomes/mouse without toxicity. This indicates that all hepatocytes have the ability to process incoming single-stranded vector genomes into duplex DNA. A single tail vein injection of the rAAV8 vector was as efficient as portal vein injection at any dose. In addition, intravascular administration of the rAAV8 vector at a high dose transduced all the skeletal muscles throughout the body, including the diaphragm, the entire cardiac muscle, and substantial numbers of cells in the pancreas, smooth muscles, and brain. Thus, rAAV8 is a robust vector for gene transfer to the liver and provides a promising research tool for delivering genes to various target organs. In addition, the rAAV8 vector may offer a potential therapeutic agent for various diseases affecting nonhepatic tissues, but great caution is required for vector spillover and tight control of tissue-specific gene expression. PMID:15596817

  2. Transient Expression of Lumbrokinase (PI239) in Tobacco (Nicotiana tabacum) Using a Geminivirus-Based Single Replicon System Dissolves Fibrin and Blood Clots.

    PubMed

    Dickey, Alexia; Wang, Nan; Cooper, Edwin; Tull, Lauren; Breedlove, Drew; Mason, Hugh; Liu, Dehu; Wang, Kevin Yueju

    2017-01-01

    Lumbrokinases, a group of fibrinolytic enzymes extracted from earthworm, have been widely used to prevent and treat various cardiovascular diseases. They specifically target fibrin to effectively degrade thrombi without major side effects. Plant expression systems are becoming potential alternative expression platforms for producing pharmaceutical proteins. In this work, a lumbrokinase (PI239) was produced from a plant system. Both wild-type (WT) and plant codon-optimized (OP) PI239 gene sequences were synthesized and cloned into a geminivirus-based single-vector DNA replicon system. Both vectors were independently expressed in tobacco (Nicotiana tabacum) leaves transiently by agroinfiltration. Overexpressed PI239 resulted in sudden tissue necrosis 3 days after infiltration. Remaining proteins were purified through His-tag affinity chromatography and analyzed with SDS-PAGE and Western blot methods. Purified PI239 successfully degraded artificial fibrin with relative activity of 13,400 U/mg when compared with commercial lumbrokinase product. In vitro tests demonstrated that plant-derived PI239 dissolved human blood clots and that the plant expression system is capable of producing functional PI239.

  3. Monoclonal antibodies expression improvement in CHO cells by PiggyBac transposition regarding vectors ratios and design.

    PubMed

    Ahmadi, Samira; Davami, Fatemeh; Davoudi, Noushin; Nematpour, Fatemeh; Ahmadi, Maryam; Ebadat, Saeedeh; Azadmanesh, Kayhan; Barkhordari, Farzaneh; Mahboudi, Fereidoun

    2017-01-01

    Establishing stable Chinese Hamster Ovary (CHO) cells producing monoclonal antibodies (mAbs) usually pass through the random integration of vectors to the cell genome, which is sensitive to gene silencing. One approach to overcome this issue is to target a highly transcribed region in the genome. Transposons are useful devices to target active parts of genomes, and PiggyBac (PB) transposon can be considered as a good option. In the present study, three PB transposon donor vectors containing both heavy and light chains were constructed, one contained independent expression cassettes while the others utilized either an Internal Ribosome Entry Site (IRES) or 2A element to express mAb. Conventional cell pools were created by transferring donor vectors into the CHO cells, whereas transposon-based cells were generated by transfecting the cells with donor vectors with a companion of a transposase-encoding helper vector, with 1:2.5 helper/donor vectors ratio. To evaluate the influence of helper/donor vectors ratio on expression, the second transposon-based cell pools were generated with 1:5 helper/donor ratio. Expression levels in the transposon-based cells were two to five -folds more than those created by conventional method except for the IRES-mediated ones, in which the observed difference increased more than 100-fold. The results were dependent on both donor vector design and vectors ratios.

  4. Monoclonal antibodies expression improvement in CHO cells by PiggyBac transposition regarding vectors ratios and design

    PubMed Central

    Ahmadi, Samira; Davami, Fatemeh; Davoudi, Noushin; Nematpour, Fatemeh; Ahmadi, Maryam; Ebadat, Saeedeh; Azadmanesh, Kayhan; Barkhordari, Farzaneh

    2017-01-01

    Establishing stable Chinese Hamster Ovary (CHO) cells producing monoclonal antibodies (mAbs) usually pass through the random integration of vectors to the cell genome, which is sensitive to gene silencing. One approach to overcome this issue is to target a highly transcribed region in the genome. Transposons are useful devices to target active parts of genomes, and PiggyBac (PB) transposon can be considered as a good option. In the present study, three PB transposon donor vectors containing both heavy and light chains were constructed, one contained independent expression cassettes while the others utilized either an Internal Ribosome Entry Site (IRES) or 2A element to express mAb. Conventional cell pools were created by transferring donor vectors into the CHO cells, whereas transposon-based cells were generated by transfecting the cells with donor vectors with a companion of a transposase-encoding helper vector, with 1:2.5 helper/donor vectors ratio. To evaluate the influence of helper/donor vectors ratio on expression, the second transposon-based cell pools were generated with 1:5 helper/donor ratio. Expression levels in the transposon-based cells were two to five -folds more than those created by conventional method except for the IRES-mediated ones, in which the observed difference increased more than 100-fold. The results were dependent on both donor vector design and vectors ratios. PMID:28662065

  5. Power line identification of millimeter wave radar based on PCA-GS-SVM

    NASA Astrophysics Data System (ADS)

    Fang, Fang; Zhang, Guifeng; Cheng, Yansheng

    2017-12-01

    Aiming at the problem that the existing detection method can not effectively solve the security of UAV's ultra low altitude flight caused by power line, a power line recognition method based on grid search (GS) and the principal component analysis and support vector machine (PCA-SVM) is proposed. Firstly, the candidate line of Hough transform is reduced by PCA, and the main feature of candidate line is extracted. Then, upport vector machine (SVM is) optimized by grid search method (GS). Finally, using support vector machine classifier optimized parameters to classify the candidate line. MATLAB simulation results show that this method can effectively identify the power line and noise, and has high recognition accuracy and algorithm efficiency.

  6. ℓ p-Norm Multikernel Learning Approach for Stock Market Price Forecasting

    PubMed Central

    Shao, Xigao; Wu, Kun; Liao, Bifeng

    2012-01-01

    Linear multiple kernel learning model has been used for predicting financial time series. However, ℓ 1-norm multiple support vector regression is rarely observed to outperform trivial baselines in practical applications. To allow for robust kernel mixtures that generalize well, we adopt ℓ p-norm multiple kernel support vector regression (1 ≤ p < ∞) as a stock price prediction model. The optimization problem is decomposed into smaller subproblems, and the interleaved optimization strategy is employed to solve the regression model. The model is evaluated on forecasting the daily stock closing prices of Shanghai Stock Index in China. Experimental results show that our proposed model performs better than ℓ 1-norm multiple support vector regression model. PMID:23365561

  7. Use of CYBER 203 and CYBER 205 computers for three-dimensional transonic flow calculations

    NASA Technical Reports Server (NTRS)

    Melson, N. D.; Keller, J. D.

    1983-01-01

    Experiences are discussed for modifying two three-dimensional transonic flow computer programs (FLO 22 and FLO 27) for use on the CDC CYBER 203 computer system. Both programs were originally written for use on serial machines. Several methods were attempted to optimize the execution of the two programs on the vector machine: leaving the program in a scalar form (i.e., serial computation) with compiler software used to optimize and vectorize the program, vectorizing parts of the existing algorithm in the program, and incorporating a vectorizable algorithm (ZEBRA I or ZEBRA II) in the program. Comparison runs of the programs were made on CDC CYBER 175. CYBER 203, and two pipe CDC CYBER 205 computer systems.

  8. Optimal run-and-tumble-based transportation of a Janus particle with active steering

    NASA Astrophysics Data System (ADS)

    Mano, Tomoyuki; Delfau, Jean-Baptiste; Iwasawa, Junichiro; Sano, Masaki

    2017-03-01

    Although making artificial micrometric swimmers has been made possible by using various propulsion mechanisms, guiding their motion in the presence of thermal fluctuations still remains a great challenge. Such a task is essential in biological systems, which present a number of intriguing solutions that are robust against noisy environmental conditions as well as variability in individual genetic makeup. Using synthetic Janus particles driven by an electric field, we present a feedback-based particle-guiding method quite analogous to the “run-and-tumbling” behavior of Escherichia coli but with a deterministic steering in the tumbling phase: the particle is set to the run state when its orientation vector aligns with the target, whereas the transition to the “steering” state is triggered when it exceeds a tolerance angle αα. The active and deterministic reorientation of the particle is achieved by a characteristic rotational motion that can be switched on and off by modulating the ac frequency of the electric field, which is reported in this work. Relying on numerical simulations and analytical results, we show that this feedback algorithm can be optimized by tuning the tolerance angle αα. The optimal resetting angle depends on signal to noise ratio in the steering state, and it is shown in the experiment. The proposed method is simple and robust for targeting, despite variability in self-propelling speeds and angular velocities of individual particles.

  9. Biophysical characterization of an integrin-targeted lipopolyplex gene delivery vector.

    PubMed

    Mustapa, M Firouz Mohd; Bell, Paul C; Hurley, Christopher A; Nicol, Alastair; Guénin, Erwann; Sarkar, Supti; Writer, Michele J; Barker, Susie E; Wong, John B; Pilkington-Miksa, Michael A; Papahadjopoulos-Sternberg, Brigitte; Shamlou, Parviz Ayazi; Hailes, Helen C; Hart, Stephen L; Zicha, Daniel; Tabor, Alethea B

    2007-11-13

    Nonviral gene delivery vectors now show good therapeutic potential: however, detailed characterization of the composition and macromolecular organization of such particles remains a challenge. This paper describes experiments to elucidate the structure of a ternary, targeted, lipopolyplex synthetic vector, the LID complex. This consists of a lipid component, Lipofectin (L) (1:1 DOTMA:DOPE), plasmid DNA (D), and a dual-function, cationic peptide component (I) containing DNA condensation and integrin-targeting sequences. Fluorophore-labeled lipid, peptide, and DNA components were used to formulate the vector, and the stoichiometry of the particles was established by fluorescence correlation spectroscopy (FCS). The size of the complex was measured by FCS, and the sizes of LID, L, LD, and ID complexes were measured by dynamic light scattering (DLS). Fluorescence quenching experiments and freeze-fracture electron microscopy were then used to demonstrate the arrangement of the lipid, peptide, and DNA components within the complex. These experiments showed that the cationic portion of the peptide, I, interacts with the plasmid DNA, resulting in a tightly condensed DNA-peptide inner core; this is surrounded by a disordered lipid layer, from which the integrin-targeting sequence of the peptide partially protrudes.

  10. Managing the resilience space of the German energy system - A vector analysis.

    PubMed

    Schlör, Holger; Venghaus, Sandra; Märker, Carolin; Hake, Jürgen-Friedrich

    2018-07-15

    The UN Sustainable Development Goals formulated in 2016 confirmed the sustainability concept of the Earth Summit of 1992 and supported UNEP's green economy transition concept. The transformation of the energy system (Energiewende) is the keystone of Germany's sustainability strategy and of the German green economy concept. We use ten updated energy-related indicators of the German sustainability strategy to analyse the German energy system. The development of the sustainable indicators is examined in the monitoring process by a vector analysis performed in two-dimensional Euclidean space (Euclidean plane). The aim of the novel vector analysis is to measure the current status of the Energiewende in Germany and thereby provide decision makers with information about the strains for the specific remaining pathway of the single indicators and of the total system in order to meet the sustainability targets of the Energiewende. Within this vector model, three vectors (the normative sustainable development vector, the real development vector, and the green economy vector) define the resilience space of our analysis. The resilience space encloses a number of vectors representing different pathways with different technological and socio-economic strains to achieve a sustainable development of the green economy. In this space, the decision will be made as to whether the government measures will lead to a resilient energy system or whether a readjustment of indicator targets or political measures is necessary. The vector analysis enables us to analyse both the government's ambitiousness, which is expressed in the sustainability target for the indicators at the start of the sustainability strategy representing the starting preference order of the German government (SPO) and, secondly, the current preference order of German society in order to bridge the remaining distance to reach the specific sustainability goals of the strategy summarized in the current preference order (CPO). Copyright © 2018 Elsevier Ltd. All rights reserved.

  11. A self-contained, automated methodology for optimal flow control validated for transition delay

    NASA Technical Reports Server (NTRS)

    Joslin, Ronald D.; Gunzburger, Max D.; Nicolaides, R. A.; Erlebacher, Gordon; Hussaini, M. Yousuff

    1995-01-01

    This paper describes a self-contained, automated methodology for flow control along with a validation of the methodology for the problem of boundary layer instability suppression. The objective of control is to match the stress vector along a portion of the boundary to a given vector; instability suppression is achieved by choosing the given vector to be that of a steady base flow, e.g., Blasius boundary layer. Control is effected through the injection or suction of fluid through a single orifice on the boundary. The present approach couples the time-dependent Navier-Stokes system with an adjoint Navier-Stokes system and optimality conditions from which optimal states, i.e., unsteady flow fields, and control, e.g., actuators, may be determined. The results demonstrate that instability suppression can be achieved without any a priori knowledge of the disturbance, which is significant because other control techniques have required some knowledge of the flow unsteadiness such as frequencies, instability type, etc.

  12. Lanczos eigensolution method for high-performance computers

    NASA Technical Reports Server (NTRS)

    Bostic, Susan W.

    1991-01-01

    The theory, computational analysis, and applications are presented of a Lanczos algorithm on high performance computers. The computationally intensive steps of the algorithm are identified as: the matrix factorization, the forward/backward equation solution, and the matrix vector multiples. These computational steps are optimized to exploit the vector and parallel capabilities of high performance computers. The savings in computational time from applying optimization techniques such as: variable band and sparse data storage and access, loop unrolling, use of local memory, and compiler directives are presented. Two large scale structural analysis applications are described: the buckling of a composite blade stiffened panel with a cutout, and the vibration analysis of a high speed civil transport. The sequential computational time for the panel problem executed on a CONVEX computer of 181.6 seconds was decreased to 14.1 seconds with the optimized vector algorithm. The best computational time of 23 seconds for the transport problem with 17,000 degs of freedom was on the the Cray-YMP using an average of 3.63 processors.

  13. Sparse Solutions for Single Class SVMs: A Bi-Criterion Approach

    NASA Technical Reports Server (NTRS)

    Das, Santanu; Oza, Nikunj C.

    2011-01-01

    In this paper we propose an innovative learning algorithm - a variation of One-class nu Support Vector Machines (SVMs) learning algorithm to produce sparser solutions with much reduced computational complexities. The proposed technique returns an approximate solution, nearly as good as the solution set obtained by the classical approach, by minimizing the original risk function along with a regularization term. We introduce a bi-criterion optimization that helps guide the search towards the optimal set in much reduced time. The outcome of the proposed learning technique was compared with the benchmark one-class Support Vector machines algorithm which more often leads to solutions with redundant support vectors. Through out the analysis, the problem size for both optimization routines was kept consistent. We have tested the proposed algorithm on a variety of data sources under different conditions to demonstrate the effectiveness. In all cases the proposed algorithm closely preserves the accuracy of standard one-class nu SVMs while reducing both training time and test time by several factors.

  14. Customer demand prediction of service-oriented manufacturing using the least square support vector machine optimized by particle swarm optimization algorithm

    NASA Astrophysics Data System (ADS)

    Cao, Jin; Jiang, Zhibin; Wang, Kangzhou

    2017-07-01

    Many nonlinear customer satisfaction-related factors significantly influence the future customer demand for service-oriented manufacturing (SOM). To address this issue and enhance the prediction accuracy, this article develops a novel customer demand prediction approach for SOM. The approach combines the phase space reconstruction (PSR) technique with the optimized least square support vector machine (LSSVM). First, the prediction sample space is reconstructed by the PSR to enrich the time-series dynamics of the limited data sample. Then, the generalization and learning ability of the LSSVM are improved by the hybrid polynomial and radial basis function kernel. Finally, the key parameters of the LSSVM are optimized by the particle swarm optimization algorithm. In a real case study, the customer demand prediction of an air conditioner compressor is implemented. Furthermore, the effectiveness and validity of the proposed approach are demonstrated by comparison with other classical predication approaches.

  15. Feed-Forward Neural Network Soft-Sensor Modeling of Flotation Process Based on Particle Swarm Optimization and Gravitational Search Algorithm

    PubMed Central

    Wang, Jie-Sheng; Han, Shuang

    2015-01-01

    For predicting the key technology indicators (concentrate grade and tailings recovery rate) of flotation process, a feed-forward neural network (FNN) based soft-sensor model optimized by the hybrid algorithm combining particle swarm optimization (PSO) algorithm and gravitational search algorithm (GSA) is proposed. Although GSA has better optimization capability, it has slow convergence velocity and is easy to fall into local optimum. So in this paper, the velocity vector and position vector of GSA are adjusted by PSO algorithm in order to improve its convergence speed and prediction accuracy. Finally, the proposed hybrid algorithm is adopted to optimize the parameters of FNN soft-sensor model. Simulation results show that the model has better generalization and prediction accuracy for the concentrate grade and tailings recovery rate to meet the online soft-sensor requirements of the real-time control in the flotation process. PMID:26583034

  16. Weighted optimization of irradiance for photodynamic therapy of port wine stains

    NASA Astrophysics Data System (ADS)

    He, Linhuan; Zhou, Ya; Hu, Xiaoming

    2016-10-01

    Planning of irradiance distribution (PID) is one of the foremost factors for on-demand treatment of port wine stains (PWS) with photodynamic therapy (PDT). A weighted optimization method for PID was proposed according to the grading of PWS with a three dimensional digital illumination instrument. Firstly, the point clouds of lesions were filtered to remove the error or redundant points, the triangulation was carried out and the lesion was divided into small triangular patches. Secondly, the parameters such as area, normal vector and orthocenter for optimization of each triangular patch were calculated, and the weighted coefficients were determined by the erythema indexes and areas of patches. Then, the optimization initial point was calculated based on the normal vectors and orthocenters to optimize the light direction. In the end, the irradiation can be optimized according to cosine values of irradiance angles and weighted coefficients. Comparing the irradiance distribution before and after optimization, the proposed weighted optimization method can make the irradiance distribution match better with the characteristics of lesions, and has the potential to improve the therapeutic efficacy.

  17. Lentiviral Protein Transfer Vectors Are an Efficient Vaccine Platform and Induce a Strong Antigen-Specific Cytotoxic T Cell Response

    PubMed Central

    Uhlig, Katharina M.; Schülke, Stefan; Scheuplein, Vivian A. M.; Malczyk, Anna H.; Reusch, Johannes; Kugelmann, Stefanie; Muth, Anke; Koch, Vivian; Hutzler, Stefan; Bodmer, Bianca S.; Schambach, Axel; Buchholz, Christian J.; Waibler, Zoe; Scheurer, Stephan

    2015-01-01

    ABSTRACT To induce and trigger innate and adaptive immune responses, antigen-presenting cells (APCs) take up and process antigens. Retroviral particles are capable of transferring not only genetic information but also foreign cargo proteins when they are genetically fused to viral structural proteins. Here, we demonstrate the capacity of lentiviral protein transfer vectors (PTVs) for targeted antigen transfer directly into APCs and thereby induction of cytotoxic T cell responses. Targeting of lentiviral PTVs to APCs can be achieved analogously to gene transfer vectors by pseudotyping the particles with truncated wild-type measles virus (MV) glycoproteins (GPs), which use human SLAM (signaling lymphocyte activation molecule) as a main entry receptor. SLAM is expressed on stimulated lymphocytes and APCs, including dendritic cells. SLAM-targeted PTVs transferred the reporter protein green fluorescent protein (GFP) or Cre recombinase with strict receptor specificity into SLAM-expressing CHO and B cell lines, in contrast to broadly transducing vesicular stomatitis virus G protein (VSV-G) pseudotyped PTVs. Primary myeloid dendritic cells (mDCs) incubated with targeted or nontargeted ovalbumin (Ova)-transferring PTVs stimulated Ova-specific T lymphocytes, especially CD8+ T cells. Administration of Ova-PTVs into SLAM-transgenic and control mice confirmed the observed predominant induction of antigen-specific CD8+ T cells and demonstrated the capacity of protein transfer vectors as suitable vaccines for the induction of antigen-specific immune responses. IMPORTANCE This study demonstrates the specificity and efficacy of antigen transfer by SLAM-targeted and nontargeted lentiviral protein transfer vectors into antigen-presenting cells to trigger antigen-specific immune responses in vitro and in vivo. The observed predominant activation of antigen-specific CD8+ T cells indicates the suitability of SLAM-targeted and also nontargeted PTVs as a vaccine for the induction of cytotoxic immune responses. Since cytotoxic CD8+ T lymphocytes are a mainstay of antitumoral immune responses, PTVs could be engineered for the transfer of specific tumor antigens provoking tailored antitumoral immunity. Therefore, PTVs can be used as safe and efficient alternatives to gene transfer vectors or live attenuated replicating vector platforms, avoiding genotoxicity or general toxicity in highly immunocompromised patients, respectively. Thereby, the potential for easy envelope exchange allows the circumventing of neutralizing antibodies, e.g., during repeated boost immunizations. PMID:26085166

  18. Construction of a star-shaped copolymer as a vector for FGF receptor-mediated gene delivery in vitro and in vivo.

    PubMed

    Li, Da; Ping, Yuan; Xu, Fujian; Yu, Hai; Pan, Hongming; Huang, Hongliang; Wang, Qingqing; Tang, Guping; Li, Jun

    2010-09-13

    The success of cancer gene therapy highly relies on the gene delivery vector with high transfection activity and low toxicity. In the present study, eight-armed polyethylene glycol (EAP) and low molecular weight (LMW) polyethylenimine (PEI) were used as basic units to construct the architecture of a new star-shaped EAP-PEI copolymer (EAPP). MC11, a peptide capable of selectively binding fibroblast growth factor receptor (FGFR) on tumor cell membranes, was further conjugated to EAPP to produce the vector EAPP-MC11 (EAPPM) to enhance tumor targetability. This tumor-targeting vector EAPPM was observed to retard the plasmids mobility at a nitrogen/phosphorus (N/P) ratio of 3. The vector could efficiently condense plasmids within 300 nm nanoparticles with a positive zeta potential at the N/P ratio of 20 or above. While the cytotoxicity of EAPPM polyplexes was similar to that of LMW PEI, it was significantly lower than that of PEI (25 kDa) in HepG2 and PC3 cell lines. In vitro gene transfection with pDNA mediated by EAPPM showed that the transfection efficiency increased 15 times in HepG2 cells but remained at a similar level in PC3 cells in comparison with that of EAPP. By systemic injection of EAPPM/pDNA complexes into a HepG2-bearing mice model, luciferase expression detected in lung, liver, and tumor tissues demonstrated EAPPM could deliver in a targeted manner a reporter gene into tumor tissues, where the luciferase expression of EAPPM was 4 times higher than that of EAPP and even 23 times higher than that of PEI (25 kDa). Furthermore, it was found that the systemic delivery of EAPPM/pCSK-α-interferon complexes in vivo were much more effective in inhibiting tumor growth than EAPP or PEI (25 kDa). These results clearly show that EAPPM is an efficient and safe vector for FGFR-mediated targeted gene delivery both in vitro and in vivo. With low cytotoxicity and high targetability, EAPPM may have great potential as a delivery vector for future cancer gene therapy applications.

  19. Anti-CD22–chimeric antigen receptors targeting B-cell precursor acute lymphoblastic leukemia

    PubMed Central

    Haso, Waleed; Lee, Daniel W.; Shah, Nirali N.; Stetler-Stevenson, Maryalice; Yuan, Constance M.; Pastan, Ira H.; Dimitrov, Dimiter S.; Morgan, Richard A.; FitzGerald, David J.; Barrett, David M.; Wayne, Alan S.; Mackall, Crystal L.

    2013-01-01

    Immune targeting of B-cell malignancies using chimeric antigen receptors (CARs) is a promising new approach, but critical factors impacting CAR efficacy remain unclear. To test the suitability of targeting CD22 on precursor B-cell acute lymphoblastic leukemia (BCP-ALL), lymphoblasts from 111 patients with BCP-ALL were assayed for CD22 expression and all were found to be CD22-positive, with median CD22 expression levels of 3500 sites/cell. Three distinct binding domains targeting CD22 were fused to various TCR signaling domains ± an IgG heavy chain constant domain (CH2CH3) to create a series of vector constructs suitable to delineate optimal CAR configuration. CARs derived from the m971 anti-CD22 mAb, which targets a proximal CD22 epitope demonstrated superior antileukemic activity compared with those incorporating other binding domains, and addition of a 4-1BB signaling domain to CD28.CD3ζ constructs diminished potency, whereas increasing affinity of the anti-CD22 binding motif, and extending the CD22 binding domain away from the membrane via CH2CH3 had no effect. We conclude that second-generation m971 mAb-derived anti-CD22 CARs are promising novel therapeutics that should be tested in BCP-ALL. PMID:23243285

  20. Anti-CD22-chimeric antigen receptors targeting B-cell precursor acute lymphoblastic leukemia.

    PubMed

    Haso, Waleed; Lee, Daniel W; Shah, Nirali N; Stetler-Stevenson, Maryalice; Yuan, Constance M; Pastan, Ira H; Dimitrov, Dimiter S; Morgan, Richard A; FitzGerald, David J; Barrett, David M; Wayne, Alan S; Mackall, Crystal L; Orentas, Rimas J

    2013-02-14

    Immune targeting of B-cell malignancies using chimeric antigen receptors (CARs) is a promising new approach, but critical factors impacting CAR efficacy remain unclear. To test the suitability of targeting CD22 on precursor B-cell acute lymphoblastic leukemia (BCP-ALL), lymphoblasts from 111 patients with BCP-ALL were assayed for CD22 expression and all were found to be CD22-positive, with median CD22 expression levels of 3500 sites/cell. Three distinct binding domains targeting CD22 were fused to various TCR signaling domains ± an IgG heavy chain constant domain (CH2CH3) to create a series of vector constructs suitable to delineate optimal CAR configuration. CARs derived from the m971 anti-CD22 mAb, which targets a proximal CD22 epitope demonstrated superior antileukemic activity compared with those incorporating other binding domains, and addition of a 4-1BB signaling domain to CD28.CD3 constructs diminished potency, whereas increasing affinity of the anti-CD22 binding motif, and extending the CD22 binding domain away from the membrane via CH2CH3 had no effect. We conclude that second-generation m971 mAb-derived anti-CD22 CARs are promising novel therapeutics that should be tested in BCP-ALL.

  1. A Family of LIC Vectors for High-Throughput Cloning and Purification of Proteins1

    PubMed Central

    Eschenfeldt, William H.; Stols, Lucy; Millard, Cynthia Sanville; Joachimiak, Andrzej; Donnelly, Mark I.

    2009-01-01

    Summary Fifteen related ligation-independent cloning vectors were constructed for high-throughput cloning and purification of proteins. The vectors encode a TEV protease site for removal of tags that facilitate protein purification (his-tag) or improve solubility (MBP, GST). Specialized vectors allow coexpression and copurification of interacting proteins, or in vivo removal of MBP by TVMV protease to improve screening and purification. All target genes and vectors are processed by the same protocols, which we describe here. PMID:18988021

  2. G119S ace-1 mutation conferring insecticide resistance detected in the Culex pipiens complex in Morocco.

    PubMed

    Bkhache, Meriem; Tmimi, Fatim-Zohra; Charafeddine, Omar; Benabdelkrim Filali, Oumama; Lemrani, Meryem; Labbé, Pierrick; Sarih, M'hammed

    2018-06-09

    Arboviruses are controlled through insecticide control of their mosquito vector. However, inconsiderate use of insecticides often results in the selection of resistance in treated populations, so that monitoring is required to optimize their usage. Here, Culex pipiens (West Nile and Rift Valley Fever virus vector) specimens were collected from four Moroccan cities. Levels of susceptibility to the organophosphate (OP) insecticide malathion were assessed using WHO-recommended bioassays. Individual mosquitoes were tested for the presence of the G119S mutation in the ace-1 gene, the main OP-target resistance mutation. Bioassays showed that mosquitoes from Mohammedia were significantly more resistant to malathion than those from Marrakech. Analyzing the ace-1 genotypes in dead and surviving individuals suggested that other resistance mechanisms may be present in Mohammedia. The ace-1 resistance allele frequencies were relatively moderate (<0.4). Their analyses in three Moroccan cities (Tangier, Casablanca and Marrakech) however showed disparities between two coexisting Cx. pipiens forms and revealed that the G119S mutation tends to be more frequent in urban than in rural collections sites. These findings provide a reference assessment of OP resistance in Morocco and should help the health authorities to develop informed and sustainable vector control programs. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  3. An RGD-Modified MRI-Visible Polymeric Vector for Targeted siRNA Delivery to Hepatocellular Carcinoma in Nude Mice

    PubMed Central

    Shen, Min; Zhu, Kangshun; Cheng, Du; Liu, Zhihao; Shan, Hong

    2013-01-01

    RNA interference (RNAi) has significant therapeutic promise for the genetic treatment of hepatocellular carcinoma (HCC). Targeted vectors are able to deliver small interfering RNA (siRNA) into HCC cells with high transfection efficiency and stability. The tripeptide arginine glycine aspartic acid (RGD)-modified non-viral vector, polyethylene glycol-grafted polyethylenimine functionalized with superparamagnetic iron oxide nanoparticles (RGD-PEG-g-PEI-SPION), was constructed as a magnetic resonance imaging (MRI)-visible nanocarrier for the delivery of Survivin siRNA targeting the human HCC cell line Bel-7402. The biophysical characterization of the RGD-PEG-g-PEI-SPION was performed. The RGD-modified complexes exhibited a higher transfection efficiency in transferring Survivin siRNA into Bel-7402 cells compared with a non-targeted delivery system, which resulted in more significant gene suppression at both the Survivin mRNA and protein expression levels. Then, the level of caspase-3 activation was significantly elevated, and a remarkable level of tumor cell apoptosis was induced. As a result, the tumor growth in the nude mice Bel-7402 hepatoma model was significantly inhibited. The targeting ability of the RGD-PEG-g-PEI-SPION was successfully imaged by MRI scans performed in vitro and in vivo. Our results strongly indicated that the RGD-PEG-g-PEI-SPION can potentially be used as a targeted non-viral vector for altering gene expression in the treatment of hepatocellular carcinoma and for detecting the tumor in vivo as an effective MRI probe. PMID:23922634

  4. Protein structure modeling and refinement by global optimization in CASP12.

    PubMed

    Hong, Seung Hwan; Joung, InSuk; Flores-Canales, Jose C; Manavalan, Balachandran; Cheng, Qianyi; Heo, Seungryong; Kim, Jong Yun; Lee, Sun Young; Nam, Mikyung; Joo, Keehyoung; Lee, In-Ho; Lee, Sung Jong; Lee, Jooyoung

    2018-03-01

    For protein structure modeling in the CASP12 experiment, we have developed a new protocol based on our previous CASP11 approach. The global optimization method of conformational space annealing (CSA) was applied to 3 stages of modeling: multiple sequence-structure alignment, three-dimensional (3D) chain building, and side-chain re-modeling. For better template selection and model selection, we updated our model quality assessment (QA) method with the newly developed SVMQA (support vector machine for quality assessment). For 3D chain building, we updated our energy function by including restraints generated from predicted residue-residue contacts. New energy terms for the predicted secondary structure and predicted solvent accessible surface area were also introduced. For difficult targets, we proposed a new method, LEEab, where the template term played a less significant role than it did in LEE, complemented by increased contributions from other terms such as the predicted contact term. For TBM (template-based modeling) targets, LEE performed better than LEEab, but for FM targets, LEEab was better. For model refinement, we modified our CASP11 molecular dynamics (MD) based protocol by using explicit solvents and tuning down restraint weights. Refinement results from MD simulations that used a new augmented statistical energy term in the force field were quite promising. Finally, when using inaccurate information (such as the predicted contacts), it was important to use the Lorentzian function for which the maximal penalty arising from wrong information is always bounded. © 2017 Wiley Periodicals, Inc.

  5. An Improved Brome mosaic virus Silencing Vector: Greater Insert Stability and More Extensive VIGS1[OPEN

    PubMed Central

    2018-01-01

    Virus-induced gene silencing (VIGS) is used extensively for gene function studies in plants. VIGS is inexpensive and rapid compared with silencing conducted through stable transformation, but many virus-silencing vectors, especially in grasses, induce only transient silencing phenotypes. A major reason for transient phenotypes is the instability of the foreign gene fragment (insert) in the vector during VIGS. Here, we report the development of a Brome mosaic virus (BMV)-based vector that better maintains inserts through modification of the original BMV vector RNA sequence. Modification of the BMV RNA3 sequence yielded a vector, BMVCP5, that better maintained phytoene desaturase and heat shock protein70-1 (HSP70-1) inserts in Nicotiana benthamiana and maize (Zea mays). Longer maintenance of inserts was correlated with greater target gene silencing and more extensive visible silencing phenotypes displaying greater tissue penetration and involving more leaves. The modified vector accumulated similarly to the original vector in N. benthamiana after agroinfiltration, thus maintaining a high titer of virus in this intermediate host used to produce virus inoculum for grass hosts. For HSP70, silencing one family member led to a large increase in the expression of another family member, an increase likely related to the target gene knockdown and not a general effect of virus infection. The cause of the increased insert stability in the modified vector is discussed in relationship to its recombination and accumulation potential. The modified vector will improve functional genomic studies in grasses, and the conceptual methods used to improve the vector may be applied to other VIGS vectors. PMID:29127260

  6. The research and application of visual saliency and adaptive support vector machine in target tracking field.

    PubMed

    Chen, Yuantao; Xu, Weihong; Kuang, Fangjun; Gao, Shangbing

    2013-01-01

    The efficient target tracking algorithm researches have become current research focus of intelligent robots. The main problems of target tracking process in mobile robot face environmental uncertainty. They are very difficult to estimate the target states, illumination change, target shape changes, complex backgrounds, and other factors and all affect the occlusion in tracking robustness. To further improve the target tracking's accuracy and reliability, we present a novel target tracking algorithm to use visual saliency and adaptive support vector machine (ASVM). Furthermore, the paper's algorithm has been based on the mixture saliency of image features. These features include color, brightness, and sport feature. The execution process used visual saliency features and those common characteristics have been expressed as the target's saliency. Numerous experiments demonstrate the effectiveness and timeliness of the proposed target tracking algorithm in video sequences where the target objects undergo large changes in pose, scale, and illumination.

  7. Research on bearing fault diagnosis of large machinery based on mathematical morphology

    NASA Astrophysics Data System (ADS)

    Wang, Yu

    2018-04-01

    To study the automatic diagnosis of large machinery fault based on support vector machine, combining the four common faults of the large machinery, the support vector machine is used to classify and identify the fault. The extracted feature vectors are entered. The feature vector is trained and identified by multi - classification method. The optimal parameters of the support vector machine are searched by trial and error method and cross validation method. Then, the support vector machine is compared with BP neural network. The results show that the support vector machines are short in time and high in classification accuracy. It is more suitable for the research of fault diagnosis in large machinery. Therefore, it can be concluded that the training speed of support vector machines (SVM) is fast and the performance is good.

  8. Genetic Engineering of Trypanosoma (Dutonella) vivax and In Vitro Differentiation under Axenic Conditions

    PubMed Central

    D'Archivio, Simon; Medina, Mathieu; Cosson, Alain; Chamond, Nathalie; Rotureau, Brice; Minoprio, Paola; Goyard, Sophie

    2011-01-01

    Trypanosoma vivax is one of the most common parasites responsible for animal trypanosomosis, and although this disease is widespread in Africa and Latin America, very few studies have been conducted on the parasite's biology. This is in part due to the fact that no reproducible experimental methods had been developed to maintain the different evolutive forms of this trypanosome under laboratory conditions. Appropriate protocols were developed in the 1990s for the axenic maintenance of three major animal Trypanosoma species: T. b. brucei, T. congolense and T. vivax. These pioneer studies rapidly led to the successful genetic manipulation of T. b. brucei and T. congolense. Advances were made in the understanding of these parasites' biology and virulence, and new drug targets were identified. By contrast, challenging in vitro conditions have been developed for T. vivax in the past, and this per se has contributed to defer both its genetic manipulation and subsequent gene function studies. Here we report on the optimization of non-infective T. vivax epimastigote axenic cultures and on the process of parasite in vitro differentiation into metacyclic infective forms. We have also constructed the first T. vivax specific expression vector that drives constitutive expression of the luciferase reporter gene. This vector was then used to establish and optimize epimastigote transfection. We then developed highly reproducible conditions that can be used to obtain and select stably transfected mutants that continue metacyclogenesis and are infectious in immunocompetent rodents. PMID:22216367

  9. Constrained spacecraft reorientation using mixed integer convex programming

    NASA Astrophysics Data System (ADS)

    Tam, Margaret; Glenn Lightsey, E.

    2016-10-01

    A constrained attitude guidance (CAG) system is developed using convex optimization to autonomously achieve spacecraft pointing objectives while meeting the constraints imposed by on-board hardware. These constraints include bounds on the control input and slew rate, as well as pointing constraints imposed by the sensors. The pointing constraints consist of inclusion and exclusion cones that dictate permissible orientations of the spacecraft in order to keep objects in or out of the field of view of the sensors. The optimization scheme drives a body vector towards a target inertial vector along a trajectory that consists solely of permissible orientations in order to achieve the desired attitude for a given mission mode. The non-convex rotational kinematics are handled by discretization, which also ensures that the quaternion stays unity norm. In order to guarantee an admissible path, the pointing constraints are relaxed. Depending on how strict the pointing constraints are, the degree of relaxation is tuneable. The use of binary variables permits the inclusion of logical expressions in the pointing constraints in the case that a set of sensors has redundancies. The resulting mixed integer convex programming (MICP) formulation generates a steering law that can be easily integrated into an attitude determination and control (ADC) system. A sample simulation of the system is performed for the Bevo-2 satellite, including disturbance torques and actuator dynamics which are not modeled by the controller. Simulation results demonstrate the robustness of the system to disturbances while meeting the mission requirements with desirable performance characteristics.

  10. Serendipity in dark photon searches

    NASA Astrophysics Data System (ADS)

    Ilten, Philip; Soreq, Yotam; Williams, Mike; Xue, Wei

    2018-06-01

    Searches for dark photons provide serendipitous discovery potential for other types of vector particles. We develop a framework for recasting dark photon searches to obtain constraints on more general theories, which includes a data-driven method for determining hadronic decay rates. We demonstrate our approach by deriving constraints on a vector that couples to the B-L current, a leptophobic B boson that couples directly to baryon number and to leptons via B- γ kinetic mixing, and on a vector that mediates a protophobic force. Our approach can easily be generalized to any massive gauge boson with vector couplings to the Standard Model fermions, and software to perform any such recasting is provided at https://gitlab.com/philten/darkcast .

  11. Liver-Directed Lentiviral Gene Therapy in a Dog Model of Hemophilia B

    PubMed Central

    Bartholomae, Cynthia C.; Volpin, Monica; Della Valle, Patrizia; Sanvito, Francesca; Sergi Sergi, Lucia; Gallina, Pierangela; Benedicenti, Fabrizio; Bellinger, Dwight; Raymer, Robin; Merricks, Elizabeth; Bellintani, Francesca; Martin, Samia; Doglioni, Claudio; D’Angelo, Armando; VandenDriessche, Thierry; Chuah, Marinee K.; Schmidt, Manfred; Nichols, Timothy; Montini, Eugenio; Naldini, Luigi

    2017-01-01

    We investigated the safety and efficacy of liver-directed gene therapy using lentiviral vectors in a large animal model of hemophilia B, and evaluated the risk of insertional mutagenesis in tumor-prone mouse models. We show that gene therapy using lentiviral vectors targeting expression of a canine factor IX transgene to hepatocytes was well-tolerated and provided stable long-term production of coagulation factor IX in dogs with hemophilia B. By exploiting three different mouse models designed to amplify the consequences of insertional mutagenesis, we show that no genotoxicity was detected with these lentiviral vectors. Our findings suggest that lentiviral vectors may be an attractive candidate for gene therapy targeted to the liver and may be useful for the treatment of hemophilia. PMID:25739762

  12. Rotman Lens Sidewall Design and Optimization with Hybrid Hardware/Software Based Programming

    DTIC Science & Technology

    2015-01-09

    conventional MoM and stored in memory. The components of Zfar are computed as needed through a fast matrix vector multiplication ( MVM ), which...V vector. Iterative methods, e.g. BiCGSTAB, are employed for solving the linear equation. The matrix-vector multiplications ( MVMs ), which dominate...most of the computation in the solving phase, consists of calculating near and far MVMs . The far MVM comprises aggregation, translation, and

  13. Invariant-feature-based adaptive automatic target recognition in obscured 3D point clouds

    NASA Astrophysics Data System (ADS)

    Khuon, Timothy; Kershner, Charles; Mattei, Enrico; Alverio, Arnel; Rand, Robert

    2014-06-01

    Target recognition and classification in a 3D point cloud is a non-trivial process due to the nature of the data collected from a sensor system. The signal can be corrupted by noise from the environment, electronic system, A/D converter, etc. Therefore, an adaptive system with a desired tolerance is required to perform classification and recognition optimally. The feature-based pattern recognition algorithm architecture as described below is particularly devised for solving a single-sensor classification non-parametrically. Feature set is extracted from an input point cloud, normalized, and classifier a neural network classifier. For instance, automatic target recognition in an urban area would require different feature sets from one in a dense foliage area. The figure above (see manuscript) illustrates the architecture of the feature based adaptive signature extraction of 3D point cloud including LIDAR, RADAR, and electro-optical data. This network takes a 3D cluster and classifies it into a specific class. The algorithm is a supervised and adaptive classifier with two modes: the training mode and the performing mode. For the training mode, a number of novel patterns are selected from actual or artificial data. A particular 3D cluster is input to the network as shown above for the decision class output. The network consists of three sequential functional modules. The first module is for feature extraction that extracts the input cluster into a set of singular value features or feature vector. Then the feature vector is input into the feature normalization module to normalize and balance it before being fed to the neural net classifier for the classification. The neural net can be trained by actual or artificial novel data until each trained output reaches the declared output within the defined tolerance. In case new novel data is added after the neural net has been learned, the training is then resumed until the neural net has incrementally learned with the new novel data. The associative memory capability of the neural net enables the incremental learning. The back propagation algorithm or support vector machine can be utilized for the classification and recognition.

  14. [Prokaryotic expression and immunological activity of human neutrophil gelatinase associated lipocalin].

    PubMed

    Wu, Jianwei; Cai, Lei; Qian, Wei; Jiao, Liyuan; Li, Jiangfeng; Song, Xiaoli; Wang, Jihua

    2015-07-01

    To construct a prokaryotic expression vector of human neutrophil gelatinase associated lipocalin (NGAL) and identify the bioactivity of the fusion protein. The cDNA of human NGAL obtained from GenBank was linked to a cloning vector to construct the prokaryotic expression vector pCold-NGAL. Then the vector was transformed into E.coli BL21(DE3) plysS. Under the optimal induction condition, the recombinant NGAL (rNGAL) was expressed and purified by Ni Sepharose 6 Fast Flow affinity chromatography. The purity and activity of the rNGAL were respectively identified by SDS-PAGE and Western blotting combined with NGAL reagent (Latex enhanced immunoturbidimetry). Restriction enzyme digestion and nucleotide sequencing proved that the expression vector pCold-NGAL was successfully constructed. Under the optimal induction condition that we determined, the rNGAL was expressed in soluble form in E.coli BL21(DE3) plysS. The relative molecular mass of the rNGAL was 25 000, and its purity was more than 98.0%. Furthermore, Western blotting and immunoturbidimetry indicated that the rNGAL reacted with NGAL mAb specifically. Human rNGAL of high purity and bioactivity was successfully constructed in E.coli BL21(DE3) plysS using the expression vector pCold-NGAL.

  15. Enhanced gene disruption by programmable nucleases delivered by a minicircle vector.

    PubMed

    Dad, A-B K; Ramakrishna, S; Song, M; Kim, H

    2014-11-01

    Targeted genetic modification using programmable nucleases such as zinc finger nucleases (ZFNs) and transcription activator-like effector nucleases (TALENs) is of great value in biomedical research, medicine and biotechnology. Minicircle vectors, which lack extraneous bacterial sequences, have several advantages over conventional plasmids for transgene delivery. Here, for the first time, we delivered programmable nucleases into human cells using transient transfection of a minicircle vector and compared the results with those obtained using a conventional plasmid. Surrogate reporter assays and T7 endonuclease analyses revealed that cells in the minicircle vector group displayed significantly higher mutation frequencies at the target sites than those in the conventional plasmid group. Quantitative PCR and reverse transcription-PCR showed higher vector copy number and programmable nuclease transcript levels, respectively, in 293T cells after minicircle versus conventional plasmid vector transfection. In addition, tryphan blue staining and flow cytometry after annexin V and propidium iodide staining showed that cell viability was also significantly higher in the minicircle group than in the conventional plasmid group. Taken together, our results show that gene disruption using minicircle vector-mediated delivery of ZFNs and TALENs is a more efficient, safer and less toxic method than using a conventional plasmid, and indicate that the minicircle vector could serve as an advanced delivery method for programmable nucleases.

  16. Use of LDL receptor-targeting peptide vectors for in vitro and in vivo cargo transport across the blood-brain barrier.

    PubMed

    Molino, Yves; David, Marion; Varini, Karine; Jabès, Françoise; Gaudin, Nicolas; Fortoul, Aude; Bakloul, Karima; Masse, Maxime; Bernard, Anne; Drobecq, Lucile; Lécorché, Pascaline; Temsamani, Jamal; Jacquot, Guillaume; Khrestchatisky, Michel

    2017-05-01

    The blood-brain barrier (BBB) prevents the entry of many drugs into the brain and, thus, is a major obstacle in the treatment of CNS diseases. There is some evidence that the LDL receptor (LDLR) is expressed at the BBB and may participate in the transport of endogenous ligands from blood to brain, a process referred to as receptor-mediated transcytosis. We previously described a family of peptide vectors that were developed to target the LDLR. In the present study, in vitro BBB models that were derived from wild-type and LDLR-knockout animals ( ldlr -/- ) were used to validate the specific LDLR-dependent transcytosis of LDL via a nondegradative route. We next showed that LDLR-targeting peptide vectors, whether in fusion or chemically conjugated to an Ab Fc fragment, promote binding to apical LDLR and transendothelial transfer of the Fc fragment across BBB monolayers via the same route as LDL. Finally, we demonstrated in vivo that LDLR significantly contributes to the brain uptake of vectorized Fc. We thus provide further evidence that LDLR is a relevant receptor for CNS drug delivery via receptor-mediated transcytosis and that the peptide vectors we developed have the potential to transport drugs, including proteins or Ab based, across the BBB.-Molino, Y., David, M., Varini, K., Jabès, F., Gaudin, N., Fortoul, A., Bakloul, K., Masse, M., Bernard, A., Drobecq, L., Lécorché, P., Temsamani, J., Jacquot, G., Khrestchatisky, M. Use of LDL receptor-targeting peptide vectors for in vitro and in vivo cargo transport across the blood-brain barrier. © FASEB.

  17. Identification of Adeno-Associated Viral Vectors That Target Neonatal and Adult Mammalian Inner Ear Cell Subtypes

    PubMed Central

    Shu, Yilai; Tao, Yong; Wang, Zhengmin; Tang, Yong; Li, Huawei; Dai, Pu; Gao, Guangping; Chen, Zheng-Yi

    2016-01-01

    The mammalian inner ear consists of diverse cell types with important functions. Gene mutations in these diverse cell types have been found to underlie different forms of genetic hearing loss. Targeting these mutations for gene therapy development represents a future therapeutic strategy to treat hearing loss. Adeno-associated viral (AAV) vectors have become the vector of choice for gene delivery in animal models in vivo. To identify AAV vectors that target inner ear cell subtypes, we systemically screened 12 AAV vectors with different serotypes (AAV1, 2, 5, 6, 6.2, 7, 8, 9, rh.8, rh.10, rh.39, and rh.43) that carry a reporter gene GFP in neonatal and adult mice by microinjection in vivo. We found that most AAVs infect both neonatal and adult inner ear, with different specificities and expression levels. The inner ear cochlear sensory epithelial region, which includes auditory hair cells and supporting cells, is most frequently targeted for gene delivery. Expression of the transgene is sustained, and neonatal inner ear delivery does not adversely affect hearing. Adult inner ear injection of AAV has a similar infection pattern as the younger inner ear, with the exception that outer hair cell death caused by the injection procedure can lead to hearing loss. In the adult, more so than in the neonatal mice, cell types infected and efficiency of infection are correlated with the site of injection. Most infected cells survive in neonatal and adult inner ears. The study adds to the list of AAV vectors that transduce the mammalian inner ear efficiently, providing the tools that are important to study inner ear gene function and for the development of gene therapy to treat hearing loss. PMID:27342665

  18. Targeted genome editing in a quail cell line using a customized CRISPR/Cas9 system.

    PubMed

    Ahn, Jinsoo; Lee, Joonbum; Park, Ju Yeon; Oh, Keon Bong; Hwang, Seongsoo; Lee, Chang-Won; Lee, Kichoon

    2017-05-01

    Soon after RNA-guided Cas9 (CRISPR-associated protein 9) endonuclease opened a new era of targeted genome editing, the CRISPR/Cas9 platform began to be extensively used to modify genes in various types of cells and organisms. However, successful CRISPR/Cas9-mediated insertion/deletion (indel) mutation remains to be demonstrated in avian cell lines. The objective of this study was to design a poultry-specific CRISPR/Cas9 system to efficiently introduce targeted deletion mutation in chromosomes of the quail muscle clone 7 (QM7) cell line using a customized quail CRISPR vector. In this study, two avian-specific promoters, quail 7SK (q7SK) promoter and CBh promoter, the hybrid form of cytomegalovirus and chicken β-actin promoters, were cloned into a CRISPR vector for the expression of guide RNA and Cas9 protein, respectively. Then, guide RNA, which was designed to target 20-base pair (bp) nucleotides in the quail melanophilin (MLPH) locus, was ligated to the modified CRISPR vector and transfected to QM7 cells. Our results showed multiple indel mutations in the quail MLPH locus in nearly half of the alleles being tested, suggesting the high efficiency of the system for targeted gene modification. The new CRISPR vector developed from this study has the potential application to generate knockout avian cell lines and knockout poultry. © 2016 Poultry Science Association Inc.

  19. Rational design and optimization of downstream processes of virus particles for biopharmaceutical applications: current advances.

    PubMed

    Vicente, Tiago; Mota, José P B; Peixoto, Cristina; Alves, Paula M; Carrondo, Manuel J T

    2011-01-01

    The advent of advanced therapies in the pharmaceutical industry has moved the spotlight into virus-like particles and viral vectors produced in cell culture holding great promise in a myriad of clinical targets, including cancer prophylaxis and treatment. Even though a couple of cases have reached the clinic, these products have yet to overcome a number of biological and technological challenges before broad utilization. Concerning the manufacturing processes, there is significant research focusing on the optimization of current cell culture systems and, more recently, on developing scalable downstream processes to generate material for pre-clinical and clinical trials. We review the current options for downstream processing of these complex biopharmaceuticals and underline current advances on knowledge-based toolboxes proposed for rational optimization of their processing. Rational tools developed to increase the yet scarce knowledge on the purification processes of complex biologicals are discussed as alternative to empirical, "black-boxed" based strategies classically used for process development. Innovative methodologies based on surface plasmon resonance, dynamic light scattering, scale-down high-throughput screening and mathematical modeling for supporting ion-exchange chromatography show great potential for a more efficient and cost-effective process design, optimization and equipment prototyping. Copyright © 2011 Elsevier Inc. All rights reserved.

  20. Pseudotyped Lentiviral Vectors for Retrograde Gene Delivery into Target Brain Regions

    PubMed Central

    Kobayashi, Kenta; Inoue, Ken-ichi; Tanabe, Soshi; Kato, Shigeki; Takada, Masahiko; Kobayashi, Kazuto

    2017-01-01

    Gene transfer through retrograde axonal transport of viral vectors offers a substantial advantage for analyzing roles of specific neuronal pathways or cell types forming complex neural networks. This genetic approach may also be useful in gene therapy trials by enabling delivery of transgenes into a target brain region distant from the injection site of the vectors. Pseudotyping of a lentiviral vector based on human immunodeficiency virus type 1 (HIV-1) with various fusion envelope glycoproteins composed of different combinations of rabies virus glycoprotein (RV-G) and vesicular stomatitis virus glycoprotein (VSV-G) enhances the efficiency of retrograde gene transfer in both rodent and nonhuman primate brains. The most recently developed lentiviral vector is a pseudotype with fusion glycoprotein type E (FuG-E), which demonstrates highly efficient retrograde gene transfer in the brain. The FuG-E–pseudotyped vector permits powerful experimental strategies for more precisely investigating the mechanisms underlying various brain functions. It also contributes to the development of new gene therapy approaches for neurodegenerative disorders, such as Parkinson’s disease, by delivering genes required for survival and protection into specific neuronal populations. In this review article, we report the properties of the FuG-E–pseudotyped vector, and we describe the application of the vector to neural circuit analysis and the potential use of the FuG-E vector in gene therapy for Parkinson’s disease. PMID:28824385

  1. Vector Acoustics, Vector Sensors, and 3D Underwater Imaging

    NASA Astrophysics Data System (ADS)

    Lindwall, D.

    2007-12-01

    Vector acoustic data has two more dimensions of information than pressure data and may allow for 3D underwater imaging with much less data than with hydrophone data. The vector acoustic sensors measures the particle motions due to passing sound waves and, in conjunction with a collocated hydrophone, the direction of travel of the sound waves. When using a controlled source with known source and sensor locations, the reflection points of the sound field can be determined with a simple trigonometric calculation. I demonstrate this concept with an experiment that used an accelerometer based vector acoustic sensor in a water tank with a short-pulse source and passive scattering targets. The sensor consists of a three-axis accelerometer and a matched hydrophone. The sound source was a standard transducer driven by a short 7 kHz pulse. The sensor was suspended in a fixed location and the hydrophone was moved about the tank by a robotic arm to insonify the tank from many locations. Several floats were placed in the tank as acoustic targets at diagonal ranges of approximately one meter. The accelerometer data show the direct source wave as well as the target scattered waves and reflections from the nearby water surface, tank bottom and sides. Without resorting to the usual methods of seismic imaging, which in this case is only two dimensional and relied entirely on the use of a synthetic source aperture, the two targets, the tank walls, the tank bottom, and the water surface were imaged. A directional ambiguity inherent to vector sensors is removed by using collocated hydrophone data. Although this experiment was in a very simple environment, it suggests that 3-D seismic surveys may be achieved with vector sensors using the same logistics as a 2-D survey that uses conventional hydrophones. This work was supported by the Office of Naval Research, program element 61153N.

  2. Adapter-directed display: a modular design for shuttling display on phage surfaces.

    PubMed

    Wang, Kevin Caili; Wang, Xinwei; Zhong, Pingyu; Luo, Peter Peizhi

    2010-02-05

    A novel adapter-directed phage display system was developed with modular features. In this system, the target protein is expressed as a fusion protein consisting of adapter GR1 from the phagemid vector, while the recombinant phage coat protein is expressed as a fusion protein consisting of adapter GR2 in the helper phage vector. Surface display of the target protein is accomplished through specific heterodimerization of GR1 and GR2 adapters, followed by incorporation of the heterodimers into phage particles. A series of engineered helper phages were constructed to facilitate both display valency and formats, based on various phage coat proteins. As the target protein is independent of a specific phage coat protein, this modular system allows the target protein to be displayed on any given phage coat protein and allows various display formats from the same vector without the need for reengineering. Here, we demonstrate the shuttling display of a single-chain Fv antibody on phage surfaces between multivalent and monovalent formats, as well as the shuttling display of an antigen-binding fragment molecule on phage coat proteins pIII, pVII, and pVIII using the same phagemid vectors combined with different helper phage vectors. This adapter-directed display concept has been applied to eukaryotic yeast surface display and to a novel cross-species display that can shuttle between prokaryotic phage and eukaryotic yeast systems. Copyright 2009 Elsevier Ltd. All rights reserved.

  3. Automated generation and optimization of ballistic lunar capture transfer trajectories

    NASA Astrophysics Data System (ADS)

    Griesemer, Paul Ricord

    The successful completion of the Hiten mission in 1991 provided real-world validation of a class of trajectories defined as ballistic lunar capture transfers. This class of transfers is often considered for missions to the Moon and for tours of the moons of other planets. In this study, the dynamics of the three and four body problems are examined to better explain the mechanisms of low energy transfers in the Earth-Moon system, and to determine their optimality. Families of periodic orbits in the restricted Earth-Sun-spacecraft three body problem are shown to be generating families for low energy transfers between orbits of the Earth. The low energy orbit-to-orbit transfers are shown to require less fuel than optimal direct transfers between the same orbits in the Earth-Sun-spacecraft circular restricted three body problem. The low energy transfers are categorized based on their generating family and the number of flybys in the reference three body trajectory. The practical application of these generating families to spacecraft mission design is demonstrated through a robust nonlinear targeting algorithm for finding Sun-Earth-Moon-spacecraft four body transfers based on startup transfers indentified in the Earth-Sun three body problem. The local optimality of the transfers is examined through use of Lawden's primer vector theory, and new conditions of optimality for single-impulse-to-capture lunar transfers are established.

  4. Enhancing speech recognition using improved particle swarm optimization based hidden Markov model.

    PubMed

    Selvaraj, Lokesh; Ganesan, Balakrishnan

    2014-01-01

    Enhancing speech recognition is the primary intention of this work. In this paper a novel speech recognition method based on vector quantization and improved particle swarm optimization (IPSO) is suggested. The suggested methodology contains four stages, namely, (i) denoising, (ii) feature mining (iii), vector quantization, and (iv) IPSO based hidden Markov model (HMM) technique (IP-HMM). At first, the speech signals are denoised using median filter. Next, characteristics such as peak, pitch spectrum, Mel frequency Cepstral coefficients (MFCC), mean, standard deviation, and minimum and maximum of the signal are extorted from the denoised signal. Following that, to accomplish the training process, the extracted characteristics are given to genetic algorithm based codebook generation in vector quantization. The initial populations are created by selecting random code vectors from the training set for the codebooks for the genetic algorithm process and IP-HMM helps in doing the recognition. At this point the creativeness will be done in terms of one of the genetic operation crossovers. The proposed speech recognition technique offers 97.14% accuracy.

  5. An economic evaluation of vector control in the age of a dengue vaccine.

    PubMed

    Fitzpatrick, Christopher; Haines, Alexander; Bangert, Mathieu; Farlow, Andrew; Hemingway, Janet; Velayudhan, Raman

    2017-08-01

    Dengue is a rapidly emerging vector-borne Neglected Tropical Disease, with a 30-fold increase in the number of cases reported since 1960. The economic cost of the illness is measured in the billions of dollars annually. Environmental change and unplanned urbanization are conspiring to raise the health and economic cost even further beyond the reach of health systems and households. The health-sector response has depended in large part on control of the Aedes aegypti and Ae. albopictus (mosquito) vectors. The cost-effectiveness of the first-ever dengue vaccine remains to be evaluated in the field. In this paper, we examine how it might affect the cost-effectiveness of sustained vector control. We employ a dynamic Markov model of the effects of vector control on dengue in both vectors and humans over a 15-year period, in six countries: Brazil, Columbia, Malaysia, Mexico, the Philippines, and Thailand. We evaluate the cost (direct medical costs and control programme costs) and cost-effectiveness of sustained vector control, outbreak response and/or medical case management, in the presence of a (hypothetical) highly targeted and low cost immunization strategy using a (non-hypothetical) medium-efficacy vaccine. Sustained vector control using existing technologies would cost little more than outbreak response, given the associated costs of medical case management. If sustained use of existing or upcoming technologies (of similar price) reduce vector populations by 70-90%, the cost per disability-adjusted life year averted is 2013 US$ 679-1331 (best estimates) relative to no intervention. Sustained vector control could be highly cost-effective even with less effective technologies (50-70% reduction in vector populations) and in the presence of a highly targeted and low cost immunization strategy using a medium-efficacy vaccine. Economic evaluation of the first-ever dengue vaccine is ongoing. However, even under very optimistic assumptions about a highly targeted and low cost immunization strategy, our results suggest that sustained vector control will continue to play an important role in mitigating the impact of environmental change and urbanization on human health. If additional benefits for the control of other Aedes borne diseases, such as Chikungunya, yellow fever and Zika fever are taken into account, the investment case is even stronger. High-burden endemic countries should proceed to map populations to be covered by sustained vector control.

  6. An economic evaluation of vector control in the age of a dengue vaccine

    PubMed Central

    Haines, Alexander; Bangert, Mathieu; Farlow, Andrew; Hemingway, Janet; Velayudhan, Raman

    2017-01-01

    Introduction Dengue is a rapidly emerging vector-borne Neglected Tropical Disease, with a 30-fold increase in the number of cases reported since 1960. The economic cost of the illness is measured in the billions of dollars annually. Environmental change and unplanned urbanization are conspiring to raise the health and economic cost even further beyond the reach of health systems and households. The health-sector response has depended in large part on control of the Aedes aegypti and Ae. albopictus (mosquito) vectors. The cost-effectiveness of the first-ever dengue vaccine remains to be evaluated in the field. In this paper, we examine how it might affect the cost-effectiveness of sustained vector control. Methods We employ a dynamic Markov model of the effects of vector control on dengue in both vectors and humans over a 15-year period, in six countries: Brazil, Columbia, Malaysia, Mexico, the Philippines, and Thailand. We evaluate the cost (direct medical costs and control programme costs) and cost-effectiveness of sustained vector control, outbreak response and/or medical case management, in the presence of a (hypothetical) highly targeted and low cost immunization strategy using a (non-hypothetical) medium-efficacy vaccine. Results Sustained vector control using existing technologies would cost little more than outbreak response, given the associated costs of medical case management. If sustained use of existing or upcoming technologies (of similar price) reduce vector populations by 70–90%, the cost per disability-adjusted life year averted is 2013 US$ 679–1331 (best estimates) relative to no intervention. Sustained vector control could be highly cost-effective even with less effective technologies (50–70% reduction in vector populations) and in the presence of a highly targeted and low cost immunization strategy using a medium-efficacy vaccine. Discussion Economic evaluation of the first-ever dengue vaccine is ongoing. However, even under very optimistic assumptions about a highly targeted and low cost immunization strategy, our results suggest that sustained vector control will continue to play an important role in mitigating the impact of environmental change and urbanization on human health. If additional benefits for the control of other Aedes borne diseases, such as Chikungunya, yellow fever and Zika fever are taken into account, the investment case is even stronger. High-burden endemic countries should proceed to map populations to be covered by sustained vector control. PMID:28806786

  7. Receptor-mediated gene transfer vectors: progress towards genetic pharmaceuticals.

    PubMed

    Molas, M; Gómez-Valadés, A G; Vidal-Alabró, A; Miguel-Turu, M; Bermudez, J; Bartrons, R; Perales, J C

    2003-10-01

    Although specific delivery to tissues and unique cell types in vivo has been demonstrated for many non-viral vectors, current methods are still inadequate for human applications, mainly because of limitations on their efficiencies. All the steps required for an efficient receptor-mediated gene transfer process may in principle be exploited to enhance targeted gene delivery. These steps are: DNA/vector binding, internalization, subcellular trafficking, vesicular escape, nuclear import, and unpacking either for transcription or other functions (i.e., antisense, RNA interference, etc.). The large variety of vector designs that are currently available, usually aimed at improving the efficiency of these steps, has complicated the evaluation of data obtained from specific derivatives of such vectors. The importance of the structure of the final vector and the consequences of design decisions at specific steps on the overall efficiency of the vector will be discussed in detail. We emphasize in this review that stability in serum and thus, proper bioavailability of vectors to their specific receptors may be the single greatest limiting factor on the overall gene transfer efficiency in vivo. We discuss current approaches to overcome the intrinsic instability of synthetic vectors in the blood. In this regard, a summary of the structural features of the vectors obtained from current protocols will be presented and their functional characteristics evaluated. Dissecting information on molecular conjugates obtained by such methodologies, when carefully evaluated, should provide important guidelines for the creation of effective, targeted and safe DNA therapeutics.

  8. Combined targeting of lentiviral vectors and positioning of transduced cells by magnetic nanoparticles.

    PubMed

    Hofmann, Andreas; Wenzel, Daniela; Becher, Ulrich M; Freitag, Daniel F; Klein, Alexandra M; Eberbeck, Dietmar; Schulte, Maike; Zimmermann, Katrin; Bergemann, Christian; Gleich, Bernhard; Roell, Wilhelm; Weyh, Thomas; Trahms, Lutz; Nickenig, Georg; Fleischmann, Bernd K; Pfeifer, Alexander

    2009-01-06

    Targeting of viral vectors is a major challenge for in vivo gene delivery, especially after intravascular application. In addition, targeting of the endothelium itself would be of importance for gene-based therapies of vascular disease. Here, we used magnetic nanoparticles (MNPs) to combine cell transduction and positioning in the vascular system under clinically relevant, nonpermissive conditions, including hydrodynamic forces and hypothermia. The use of MNPs enhanced transduction efficiency of endothelial cells and enabled direct endothelial targeting of lentiviral vectors (LVs) by magnetic force, even in perfused vessels. In addition, application of external magnetic fields to mice significantly changed LV/MNP biodistribution in vivo. LV/MNP-transduced cells exhibited superparamagnetic behavior as measured by magnetorelaxometry, and they were efficiently retained by magnetic fields. The magnetic interactions were strong enough to position MNP-containing endothelial cells at the intima of vessels under physiological flow conditions. Importantly, magnetic positioning of MNP-labeled cells was also achieved in vivo in an injury model of the mouse carotid artery. Intravascular gene targeting can be combined with positioning of the transduced cells via nanomagnetic particles, thereby combining gene- and cell-based therapies.

  9. SapTrap, a Toolkit for High-Throughput CRISPR/Cas9 Gene Modification in Caenorhabditis elegans.

    PubMed

    Schwartz, Matthew L; Jorgensen, Erik M

    2016-04-01

    In principle, clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 allows genetic tags to be inserted at any locus. However, throughput is limited by the laborious construction of repair templates and guide RNA constructs and by the identification of modified strains. We have developed a reagent toolkit and plasmid assembly pipeline, called "SapTrap," that streamlines the production of targeting vectors for tag insertion, as well as the selection of modified Caenorhabditis elegans strains. SapTrap is a high-efficiency modular plasmid assembly pipeline that produces single plasmid targeting vectors, each of which encodes both a guide RNA transcript and a repair template for a particular tagging event. The plasmid is generated in a single tube by cutting modular components with the restriction enzyme SapI, which are then "trapped" in a fixed order by ligation to generate the targeting vector. A library of donor plasmids supplies a variety of protein tags, a selectable marker, and regulatory sequences that allow cell-specific tagging at either the N or the C termini. All site-specific sequences, such as guide RNA targeting sequences and homology arms, are supplied as annealed synthetic oligonucleotides, eliminating the need for PCR or molecular cloning during plasmid assembly. Each tag includes an embedded Cbr-unc-119 selectable marker that is positioned to allow concurrent expression of both the tag and the marker. We demonstrate that SapTrap targeting vectors direct insertion of 3- to 4-kb tags at six different loci in 10-37% of injected animals. Thus SapTrap vectors introduce the possibility for high-throughput generation of CRISPR/Cas9 genome modifications. Copyright © 2016 by the Genetics Society of America.

  10. Vector boson fusion in the inert doublet model

    NASA Astrophysics Data System (ADS)

    Dutta, Bhaskar; Palacio, Guillermo; Restrepo, Diego; Ruiz-Álvarez, José D.

    2018-03-01

    In this paper we probe the inert Higgs doublet model at the LHC using vector boson fusion (VBF) search strategy. We optimize the selection cuts and investigate the parameter space of the model and we show that the VBF search has a better reach when compared with the monojet searches. We also investigate the Drell-Yan type cuts and show that they can be important for smaller charged Higgs masses. We determine the 3 σ reach for the parameter space using these optimized cuts for a luminosity of 3000 fb-1 .

  11. Optimum Multi-Impulse Rendezvous Program

    NASA Technical Reports Server (NTRS)

    Glandorf, D. R.; Onley, A. G.; Rozendaal, H. L.

    1970-01-01

    OMIRPROGRAM determines optimal n-impulse rendezvous trajectories under the restrictions of two-body motion in free space. Lawden's primer vector theory is applied to determine optimum number of midcourse impulse applications. Global optimality is not guaranteed.

  12. Optimizing fusion PIC code performance at scale on Cori Phase 2

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Koskela, T. S.; Deslippe, J.

    In this paper we present the results of optimizing the performance of the gyrokinetic full-f fusion PIC code XGC1 on the Cori Phase Two Knights Landing system. The code has undergone substantial development to enable the use of vector instructions in its most expensive kernels within the NERSC Exascale Science Applications Program. We study the single-node performance of the code on an absolute scale using the roofline methodology to guide optimization efforts. We have obtained 2x speedups in single node performance due to enabling vectorization and performing memory layout optimizations. On multiple nodes, the code is shown to scale wellmore » up to 4000 nodes, near half the size of the machine. We discuss some communication bottlenecks that were identified and resolved during the work.« less

  13. Application of high-performance computing to numerical simulation of human movement

    NASA Technical Reports Server (NTRS)

    Anderson, F. C.; Ziegler, J. M.; Pandy, M. G.; Whalen, R. T.

    1995-01-01

    We have examined the feasibility of using massively-parallel and vector-processing supercomputers to solve large-scale optimization problems for human movement. Specifically, we compared the computational expense of determining the optimal controls for the single support phase of gait using a conventional serial machine (SGI Iris 4D25), a MIMD parallel machine (Intel iPSC/860), and a parallel-vector-processing machine (Cray Y-MP 8/864). With the human body modeled as a 14 degree-of-freedom linkage actuated by 46 musculotendinous units, computation of the optimal controls for gait could take up to 3 months of CPU time on the Iris. Both the Cray and the Intel are able to reduce this time to practical levels. The optimal solution for gait can be found with about 77 hours of CPU on the Cray and with about 88 hours of CPU on the Intel. Although the overall speeds of the Cray and the Intel were found to be similar, the unique capabilities of each machine are better suited to different portions of the computational algorithm used. The Intel was best suited to computing the derivatives of the performance criterion and the constraints whereas the Cray was best suited to parameter optimization of the controls. These results suggest that the ideal computer architecture for solving very large-scale optimal control problems is a hybrid system in which a vector-processing machine is integrated into the communication network of a MIMD parallel machine.

  14. Targeted Modifications in Adeno-Associated Virus Serotype 8 Capsid Improves Its Hepatic Gene Transfer Efficiency In Vivo

    PubMed Central

    Sen, Dwaipayan; Gadkari, Rupali A; Sudha, Govindarajan; Gabriel, Nishanth; Kumar, Yesupatham Sathish; Selot, Ruchita; Samuel, Rekha; Rajalingam, Sumathi; Ramya, V.; Nair, Sukesh C.; Srinivasan, Narayanaswamy; Srivastava, Alok

    2013-01-01

    Abstract Recombinant adeno-associated virus vectors based on serotype 8 (AAV8) have shown significant promise for liver-directed gene therapy. However, to overcome the vector dose dependent immunotoxicity seen with AAV8 vectors, it is important to develop better AAV8 vectors that provide enhanced gene expression at significantly low vector doses. Since it is known that AAV vectors during intracellular trafficking are targeted for destruction in the cytoplasm by the host–cellular kinase/ubiquitination/proteasomal machinery, we modified specific serine/threonine kinase or ubiquitination targets on the AAV8 capsid to augment its transduction efficiency. Point mutations at specific serine (S)/threonine (T)/lysine (K) residues were introduced in the AAV8 capsid at the positions equivalent to that of the effective AAV2 mutants, generated successfully earlier. Extensive structure analysis was carried out subsequently to evaluate the structural equivalence between the two serotypes. scAAV8 vectors with the wild-type (WT) and each one of the S/T→Alanine (A) or K-Arginine (R) mutant capsids were evaluated for their liver transduction efficiency in C57BL/6 mice in vivo. Two of the AAV8-S→A mutants (S279A and S671A), and a K137R mutant vector, demonstrated significantly higher enhanced green fluorescent protein (EGFP) transcript levels (∼9- to 46-fold) in the liver compared to animals that received WT-AAV8 vectors alone. The best performing AAV8 mutant (K137R) vector also had significantly reduced ubiquitination of the viral capsid, reduced activation of markers of innate immune response, and a concomitant two-fold reduction in the levels of neutralizing antibody formation in comparison to WT-AAV8 vectors. Vector biodistribution studies revealed that the K137R mutant had a significantly higher and preferential transduction of the liver (106 vs. 7.7 vector copies/mouse diploid genome) when compared to WT-AAV8 vectors. To further study the utility of the K137R-AAV8 mutant in therapeutic gene transfer, we delivered human coagulation factor IX (h.FIX) under the control of liver-specific promoters (LP1 or hAAT) into C57BL/6 mice. The circulating levels of h.FIX:Ag were higher in all the K137R-AAV8 treated groups up to 8 weeks post-hepatic gene transfer. These studies demonstrate the feasibility of the use of this novel AAV8 vectors for potential gene therapy of hemophilia B. PMID:23442071

  15. Comparison of CRISPR/Cas9 expression constructs for efficient targeted mutagenesis in rice.

    PubMed

    Mikami, Masafumi; Toki, Seiichi; Endo, Masaki

    2015-08-01

    The CRISPR/Cas9 system is an efficient tool used for genome editing in a variety of organisms. Despite several recent reports of successful targeted mutagenesis using the CRISPR/Cas9 system in plants, in each case the target gene of interest, the Cas9 expression system and guide-RNA (gRNA) used, and the tissues used for transformation and subsequent mutagenesis differed, hence the reported frequencies of targeted mutagenesis cannot be compared directly. Here, we evaluated mutation frequency in rice using different Cas9 and/or gRNA expression cassettes under standardized experimental conditions. We introduced Cas9 and gRNA expression cassettes separately or sequentially into rice calli, and assessed the frequency of mutagenesis at the same endogenous targeted sequences. Mutation frequencies differed significantly depending on the Cas9 expression cassette used. In addition, a gRNA driven by the OsU6 promoter was superior to one driven by the OsU3 promoter. Using an all-in-one expression vector harboring the best combined Cas9/gRNA expression cassette resulted in a much improved frequency of targeted mutagenesis in rice calli, and bi-allelic mutant plants were produced in the T0 generation. The approach presented here could be adapted to optimize the construction of Cas9/gRNA cassettes for genome editing in a variety of plants.

  16. Introduction to the ultrasound targeted microbubble destruction technique.

    PubMed

    Walton, Chad B; Anderson, Cynthia D; Boulay, Rachel; Shohet, Ralph V

    2011-06-12

    In UTMD, bioactive molecules, such as negatively charged plasmid DNA vectors encoding a gene of interest, are added to the cationic shells of lipid microbubble contrast agents. In mice these vector-carrying microbubbles can be administered intravenously or directly to the left ventricle of the heart. In larger animals they can also be infused through an intracoronary catheter. The subsequent delivery from the circulation to a target organ occurs by acoustic cavitation at a resonant frequency of the microbubbles. It seems likely that the mechanical energy generated by the microbubble destruction results in transient pore formation in or between the endothelial cells of the microvasculature of the targeted region. As a result of this sonoporation effect, the transfection efficiency into and across the endothelial cells is enhanced, and transgene-encoding vectors are deposited into the surrounding tissue. Plasmid DNA remaining in the circulation is rapidly degraded by nucleases in the blood, which further reduces the likelihood of delivery to non-sonicated tissues and leads to highly specific target-organ transfection.

  17. Parallel-vector computation for structural analysis and nonlinear unconstrained optimization problems

    NASA Technical Reports Server (NTRS)

    Nguyen, Duc T.

    1990-01-01

    Practical engineering application can often be formulated in the form of a constrained optimization problem. There are several solution algorithms for solving a constrained optimization problem. One approach is to convert a constrained problem into a series of unconstrained problems. Furthermore, unconstrained solution algorithms can be used as part of the constrained solution algorithms. Structural optimization is an iterative process where one starts with an initial design, a finite element structure analysis is then performed to calculate the response of the system (such as displacements, stresses, eigenvalues, etc.). Based upon the sensitivity information on the objective and constraint functions, an optimizer such as ADS or IDESIGN, can be used to find the new, improved design. For the structural analysis phase, the equation solver for the system of simultaneous, linear equations plays a key role since it is needed for either static, or eigenvalue, or dynamic analysis. For practical, large-scale structural analysis-synthesis applications, computational time can be excessively large. Thus, it is necessary to have a new structural analysis-synthesis code which employs new solution algorithms to exploit both parallel and vector capabilities offered by modern, high performance computers such as the Convex, Cray-2 and Cray-YMP computers. The objective of this research project is, therefore, to incorporate the latest development in the parallel-vector equation solver, PVSOLVE into the widely popular finite-element production code, such as the SAP-4. Furthermore, several nonlinear unconstrained optimization subroutines have also been developed and tested under a parallel computer environment. The unconstrained optimization subroutines are not only useful in their own right, but they can also be incorporated into a more popular constrained optimization code, such as ADS.

  18. RNA Interference in Infectious Tropical Diseases

    PubMed Central

    Hong, Young S.

    2008-01-01

    Introduction of double-stranded RNA (dsRNA) into some cells or organisms results in degradation of its homologous mRNA, a process called RNA interference (RNAi). The dsRNAs are processed into short interfering RNAs (siRNAs) that subsequently bind to the RNA-induced silencing complex (RISC), causing degradation of target mRNAs. Because of this sequence-specific ability to silence target genes, RNAi has been extensively used to study gene functions and has the potential to control disease pathogens or vectors. With this promise of RNAi to control pathogens and vectors, this paper reviews the current status of RNAi in protozoans, animal parasitic helminths and disease-transmitting vectors, such as insects. Many pathogens and vectors cause severe parasitic diseases in tropical regions and it is difficult to control once the host has been invaded. Intracellularly, RNAi can be highly effective in impeding parasitic development and proliferation within the host. To fully realize its potential as a means to control tropical diseases, appropriate delivery methods for RNAi should be developed, and possible off-target effects should be minimized for specific gene suppression. RNAi can also be utilized to reduce vector competence to interfere with disease transmission, as genes critical for pathogenesis of tropical diseases are knockdowned via RNAi. PMID:18344671

  19. Spatial Epidemic Modelling in Social Networks

    NASA Astrophysics Data System (ADS)

    Simoes, Joana Margarida

    2005-06-01

    The spread of infectious diseases is highly influenced by the structure of the underlying social network. The target of this study is not the network of acquaintances, but the social mobility network: the daily movement of people between locations, in regions. It was already shown that this kind of network exhibits small world characteristics. The model developed is agent based (ABM) and comprehends a movement model and a infection model. In the movement model, some assumptions are made about its structure and the daily movement is decomposed into four types: neighborhood, intra region, inter region and random. The model is Geographical Information Systems (GIS) based, and uses real data to define its geometry. Because it is a vector model, some optimization techniques were used to increase its efficiency.

  20. A targeted change-detection procedure by combining change vector analysis and post-classification approach

    NASA Astrophysics Data System (ADS)

    Ye, Su; Chen, Dongmei; Yu, Jie

    2016-04-01

    In remote sensing, conventional supervised change-detection methods usually require effective training data for multiple change types. This paper introduces a more flexible and efficient procedure that seeks to identify only the changes that users are interested in, here after referred to as "targeted change detection". Based on a one-class classifier "Support Vector Domain Description (SVDD)", a novel algorithm named "Three-layer SVDD Fusion (TLSF)" is developed specially for targeted change detection. The proposed algorithm combines one-class classification generated from change vector maps, as well as before- and after-change images in order to get a more reliable detecting result. In addition, this paper introduces a detailed workflow for implementing this algorithm. This workflow has been applied to two case studies with different practical monitoring objectives: urban expansion and forest fire assessment. The experiment results of these two case studies show that the overall accuracy of our proposed algorithm is superior (Kappa statistics are 86.3% and 87.8% for Case 1 and 2, respectively), compared to applying SVDD to change vector analysis and post-classification comparison.

  1. Gene therapy decreases seizures in a model of Incontinentia pigmenti.

    PubMed

    Dogbevia, Godwin K; Töllner, Kathrin; Körbelin, Jakob; Bröer, Sonja; Ridder, Dirk A; Grasshoff, Hanna; Brandt, Claudia; Wenzel, Jan; Straub, Beate K; Trepel, Martin; Löscher, Wolfgang; Schwaninger, Markus

    2017-07-01

    Incontinentia pigmenti (IP) is a genetic disease leading to severe neurological symptoms, such as epileptic seizures, but no specific treatment is available. IP is caused by pathogenic variants that inactivate the Nemo gene. Replacing Nemo through gene therapy might provide therapeutic benefits. In a mouse model of IP, we administered a single intravenous dose of the adeno-associated virus (AAV) vector, AAV-BR1-CAG-NEMO, delivering the Nemo gene to the brain endothelium. Spontaneous epileptic seizures and the integrity of the blood-brain barrier (BBB) were monitored. The endothelium-targeted gene therapy improved the integrity of the BBB. In parallel, it reduced the incidence of seizures and delayed their occurrence. Neonate mice intravenously injected with the AAV-BR1-CAG-NEMO vector developed no hepatocellular carcinoma or other major adverse effects 11 months after vector injection, demonstrating that the vector has a favorable safety profile. The data show that the BBB is a target of antiepileptic treatment and, more specifically, provide evidence for the therapeutic benefit of a brain endothelial-targeted gene therapy in IP. Ann Neurol 2017;82:93-104. © 2017 American Neurological Association.

  2. Sparse representation based SAR vehicle recognition along with aspect angle.

    PubMed

    Xing, Xiangwei; Ji, Kefeng; Zou, Huanxin; Sun, Jixiang

    2014-01-01

    As a method of representing the test sample with few training samples from an overcomplete dictionary, sparse representation classification (SRC) has attracted much attention in synthetic aperture radar (SAR) automatic target recognition (ATR) recently. In this paper, we develop a novel SAR vehicle recognition method based on sparse representation classification along with aspect information (SRCA), in which the correlation between the vehicle's aspect angle and the sparse representation vector is exploited. The detailed procedure presented in this paper can be summarized as follows. Initially, the sparse representation vector of a test sample is solved by sparse representation algorithm with a principle component analysis (PCA) feature-based dictionary. Then, the coefficient vector is projected onto a sparser one within a certain range of the vehicle's aspect angle. Finally, the vehicle is classified into a certain category that minimizes the reconstruction error with the novel sparse representation vector. Extensive experiments are conducted on the moving and stationary target acquisition and recognition (MSTAR) dataset and the results demonstrate that the proposed method performs robustly under the variations of depression angle and target configurations, as well as incomplete observation.

  3. Light scattering of rectangular slot antennas: parallel magnetic vector vs perpendicular electric vector

    NASA Astrophysics Data System (ADS)

    Lee, Dukhyung; Kim, Dai-Sik

    2016-01-01

    We study light scattering off rectangular slot nano antennas on a metal film varying incident polarization and incident angle, to examine which field vector of light is more important: electric vector perpendicular to, versus magnetic vector parallel to the long axis of the rectangle. While vector Babinet’s principle would prefer magnetic field along the long axis for optimizing slot antenna function, convention and intuition most often refer to the electric field perpendicular to it. Here, we demonstrate experimentally that in accordance with vector Babinet’s principle, the incident magnetic vector parallel to the long axis is the dominant component, with the perpendicular incident electric field making a small contribution of the factor of 1/|ε|, the reciprocal of the absolute value of the dielectric constant of the metal, owing to the non-perfectness of metals at optical frequencies.

  4. Frozen orbit realization using LQR analogy

    NASA Astrophysics Data System (ADS)

    Nagarajan, N.; Rayan, H. Reno

    In the case of remote sensing orbits, the Frozen Orbit concept minimizes altitude variations over a given region using passive means. This is achieved by establishing the mean eccentricity vector at the orbital poles i.e., by fixing the mean argument of perigee at 90 deg with an appropriate eccentricity to balance the perturbations due to zonal harmonics J2 and J3 of the Earth's potential. Eccentricity vector is a vector whose magnitude is the eccentricity and direction is the argument of perigee. The launcher dispersions result in an eccentricity vector which is away from the frozen orbit values. The objective is then to formulate an orbit maneuver strategy to optimize the fuel required to achieve the frozen orbit in the presence of visibility and impulse constraints. It is shown that the motion of the eccentricity vector around the frozen perigee can be approximated as a circle. Combining the circular motion of the eccentricity vector around the frozen point and the maneuver equation, the following discrete equation is obtained. X(k+1) = AX(k) + Bu(k), where X is the state (i.e. eccentricity vector components), A the state transition matrix, u the scalar control force (i.e. dV in this case) and B the control matrix which transforms dV into eccentricity vector change. Based on this, it is shown that the problem of optimizing the fuel can be treated as a Linear Quadratic Regulator (LQR) problem in which the maneuver can be solved by using control system design tools like MATLAB by deriving an analogy LQR design.

  5. Intramuscular injection of AAV8 in mice and macaques is associated with substantial hepatic targeting and transgene expression.

    PubMed

    Greig, Jenny A; Peng, Hui; Ohlstein, Jason; Medina-Jaszek, C Angelica; Ahonkhai, Omua; Mentzinger, Anne; Grant, Rebecca L; Roy, Soumitra; Chen, Shu-Jen; Bell, Peter; Tretiakova, Anna P; Wilson, James M

    2014-01-01

    Intramuscular (IM) administration of adeno-associated viral (AAV) vectors has entered the early stages of clinical development with some success, including the first approved gene therapy product in the West called Glybera. In preparation for broader clinical development of IM AAV vector gene therapy, we conducted detailed pre-clinical studies in mice and macaques evaluating aspects of delivery that could affect performance. We found that following IM administration of AAV8 vectors in mice, a portion of the vector reached the liver and hepatic gene expression contributed significantly to total expression of secreted transgenes. The contribution from liver could be controlled by altering injection volume and by the use of traditional (promoter) and non-traditional (tissue-specific microRNA target sites) expression control elements. Hepatic distribution of vector following IM injection was also noted in rhesus macaques. These pre-clinical data on AAV delivery should inform safe and efficient development of future AAV products.

  6. Reservoir targeted vaccine for lyme borreliosis induces a yearlong, neutralizing antibody response to OspA in white-footed mice.

    PubMed

    Meirelles Richer, Luciana; Aroso, Miguel; Contente-Cuomo, Tania; Ivanova, Larisa; Gomes-Solecki, Maria

    2011-11-01

    Lyme disease is caused by the spirochete Borrelia burgdorferi. The enzootic cycle of this pathogen requires that Ixodes spp. acquire B. burgdorferi from infected wildlife reservoirs and transmit it to other uninfected wildlife. At present, there are no effective measures to control B. burgdorferi; there is no human vaccine available, and existing vector control measures are generally not acceptable to the public. However, if B. burgdorferi could be eliminated from its reservoir hosts or from the ticks that feed on them, the enzootic cycle would be broken, and the incidence of Lyme disease would decrease. We developed OspA-RTV, a reservoir targeted bait vaccine (RTV) based on the immunogenic outer surface protein A (OspA) of B. burgdorferi aimed at breaking the natural cycle of this spirochete. White-footed mice, the major reservoir species for this spirochete in nature developed a systemic OspA-specific IgG response as a result of ingestion of the bait formulation. This immune response protected white-footed mice against B. burgdorferi infection upon tick challenge and cleared B. burgdorferi from the tick vector. In performing extensive studies to optimize the OspA-RTV for field deployment, we determined that mice that consumed the vaccine over periods of 1 or 4 months developed a yearlong, neutralizing anti-OspA systemic IgG response. Furthermore, we defined the minimum number of OspA-RTV units needed to induce a protective immune response.

  7. A Matter of Time: Faster Percolator Analysis via Efficient SVM Learning for Large-Scale Proteomics.

    PubMed

    Halloran, John T; Rocke, David M

    2018-05-04

    Percolator is an important tool for greatly improving the results of a database search and subsequent downstream analysis. Using support vector machines (SVMs), Percolator recalibrates peptide-spectrum matches based on the learned decision boundary between targets and decoys. To improve analysis time for large-scale data sets, we update Percolator's SVM learning engine through software and algorithmic optimizations rather than heuristic approaches that necessitate the careful study of their impact on learned parameters across different search settings and data sets. We show that by optimizing Percolator's original learning algorithm, l 2 -SVM-MFN, large-scale SVM learning requires nearly only a third of the original runtime. Furthermore, we show that by employing the widely used Trust Region Newton (TRON) algorithm instead of l 2 -SVM-MFN, large-scale Percolator SVM learning is reduced to nearly only a fifth of the original runtime. Importantly, these speedups only affect the speed at which Percolator converges to a global solution and do not alter recalibration performance. The upgraded versions of both l 2 -SVM-MFN and TRON are optimized within the Percolator codebase for multithreaded and single-thread use and are available under Apache license at bitbucket.org/jthalloran/percolator_upgrade .

  8. Using evolutionary computation to optimize an SVM used in detecting buried objects in FLIR imagery

    NASA Astrophysics Data System (ADS)

    Paino, Alex; Popescu, Mihail; Keller, James M.; Stone, Kevin

    2013-06-01

    In this paper we describe an approach for optimizing the parameters of a Support Vector Machine (SVM) as part of an algorithm used to detect buried objects in forward looking infrared (FLIR) imagery captured by a camera installed on a moving vehicle. The overall algorithm consists of a spot-finding procedure (to look for potential targets) followed by the extraction of several features from the neighborhood of each spot. The features include local binary pattern (LBP) and histogram of oriented gradients (HOG) as these are good at detecting texture classes. Finally, we project and sum each hit into UTM space along with its confidence value (obtained from the SVM), producing a confidence map for ROC analysis. In this work, we use an Evolutionary Computation Algorithm (ECA) to optimize various parameters involved in the system, such as the combination of features used, parameters on the Canny edge detector, the SVM kernel, and various HOG and LBP parameters. To validate our approach, we compare results obtained from an SVM using parameters obtained through our ECA technique with those previously selected by hand through several iterations of "guess and check".

  9. From nonlinear optimization to convex optimization through firefly algorithm and indirect approach with applications to CAD/CAM.

    PubMed

    Gálvez, Akemi; Iglesias, Andrés

    2013-01-01

    Fitting spline curves to data points is a very important issue in many applied fields. It is also challenging, because these curves typically depend on many continuous variables in a highly interrelated nonlinear way. In general, it is not possible to compute these parameters analytically, so the problem is formulated as a continuous nonlinear optimization problem, for which traditional optimization techniques usually fail. This paper presents a new bioinspired method to tackle this issue. In this method, optimization is performed through a combination of two techniques. Firstly, we apply the indirect approach to the knots, in which they are not initially the subject of optimization but precomputed with a coarse approximation scheme. Secondly, a powerful bioinspired metaheuristic technique, the firefly algorithm, is applied to optimization of data parameterization; then, the knot vector is refined by using De Boor's method, thus yielding a better approximation to the optimal knot vector. This scheme converts the original nonlinear continuous optimization problem into a convex optimization problem, solved by singular value decomposition. Our method is applied to some illustrative real-world examples from the CAD/CAM field. Our experimental results show that the proposed scheme can solve the original continuous nonlinear optimization problem very efficiently.

  10. From Nonlinear Optimization to Convex Optimization through Firefly Algorithm and Indirect Approach with Applications to CAD/CAM

    PubMed Central

    Gálvez, Akemi; Iglesias, Andrés

    2013-01-01

    Fitting spline curves to data points is a very important issue in many applied fields. It is also challenging, because these curves typically depend on many continuous variables in a highly interrelated nonlinear way. In general, it is not possible to compute these parameters analytically, so the problem is formulated as a continuous nonlinear optimization problem, for which traditional optimization techniques usually fail. This paper presents a new bioinspired method to tackle this issue. In this method, optimization is performed through a combination of two techniques. Firstly, we apply the indirect approach to the knots, in which they are not initially the subject of optimization but precomputed with a coarse approximation scheme. Secondly, a powerful bioinspired metaheuristic technique, the firefly algorithm, is applied to optimization of data parameterization; then, the knot vector is refined by using De Boor's method, thus yielding a better approximation to the optimal knot vector. This scheme converts the original nonlinear continuous optimization problem into a convex optimization problem, solved by singular value decomposition. Our method is applied to some illustrative real-world examples from the CAD/CAM field. Our experimental results show that the proposed scheme can solve the original continuous nonlinear optimization problem very efficiently. PMID:24376380

  11. An Improved Brome mosaic virus Silencing Vector: Greater Insert Stability and More Extensive VIGS.

    PubMed

    Ding, Xin Shun; Mannas, Stephen W; Bishop, Bethany A; Rao, Xiaolan; Lecoultre, Mitchell; Kwon, Soonil; Nelson, Richard S

    2018-01-01

    Virus-induced gene silencing (VIGS) is used extensively for gene function studies in plants. VIGS is inexpensive and rapid compared with silencing conducted through stable transformation, but many virus-silencing vectors, especially in grasses, induce only transient silencing phenotypes. A major reason for transient phenotypes is the instability of the foreign gene fragment (insert) in the vector during VIGS. Here, we report the development of a Brome mosaic virus (BMV)-based vector that better maintains inserts through modification of the original BMV vector RNA sequence. Modification of the BMV RNA3 sequence yielded a vector, BMVCP5, that better maintained phytoene desaturase and heat shock protein70-1 ( HSP70-1 ) inserts in Nicotiana benthamiana and maize ( Zea mays ). Longer maintenance of inserts was correlated with greater target gene silencing and more extensive visible silencing phenotypes displaying greater tissue penetration and involving more leaves. The modified vector accumulated similarly to the original vector in N. benthamiana after agroinfiltration, thus maintaining a high titer of virus in this intermediate host used to produce virus inoculum for grass hosts. For HSP70 , silencing one family member led to a large increase in the expression of another family member, an increase likely related to the target gene knockdown and not a general effect of virus infection. The cause of the increased insert stability in the modified vector is discussed in relationship to its recombination and accumulation potential. The modified vector will improve functional genomic studies in grasses, and the conceptual methods used to improve the vector may be applied to other VIGS vectors. © 2018 American Society of Plant Biologists. All Rights Reserved.

  12. Structure Based Drug Design of Crizotinib (PF-02341066), a Potent and Selective Dual Inhibitor of Mesenchymal-Epithelial Transition Factor (c-MET) Kinase and Anaplastic Lymphoma Kinase (ALK)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cui, J Jean; Tran-Dube,; #769

    2011-08-03

    Because of the critical roles of aberrant signaling in cancer, both c-MET and ALK receptor tyrosine kinases are attractive oncology targets for therapeutic intervention. The cocrystal structure of 3 (PHA-665752), bound to c-MET kinase domain, revealed a novel ATP site environment, which served as the target to guide parallel, multiattribute drug design. A novel 2-amino-5-aryl-3-benzyloxypyridine series was created to more effectively make the key interactions achieved with 3. In the novel series, the 2-aminopyridine core allowed a 3-benzyloxy group to reach into the same pocket as the 2,6-dichlorophenyl group of 3 via a more direct vector and thus with amore » better ligand efficiency (LE). Further optimization of the lead series generated the clinical candidate crizotinib (PF-02341066), which demonstrated potent in vitro and in vivo c-MET kinase and ALK inhibition, effective tumor growth inhibition, and good pharmaceutical properties.« less

  13. Barriers to Liposomal Gene Delivery: from Application Site to the Target.

    PubMed

    Saffari, Mostafa; Moghimi, Hamid Reza; Dass, Crispin R

    2016-01-01

    Gene therapy is a therapeutic approach to deliver genetic material into cells to alter their function in entire organism. One promising form of gene delivery system (DDS) is liposomes. The success of liposome-mediated gene delivery is a multifactorial issue and well-designed liposomal systems might lead to optimized gene transfection particularly in vivo. Liposomal gene delivery systems face different barriers from their site of application to their target, which is inside the cells. These barriers include presystemic obstacles (epithelial barriers), systemic barriers in blood circulation and cellular barriers. Epithelial barriers differ depending on the route of administration. Systemic barriers include enzymatic degradation, binding and opsonisation. Both of these barriers can act as limiting hurdles that genetic material and their vector should overcome before reaching the cells. Finally liposomes should overcome cellular barriers that include cell entrance, endosomal escape and nuclear uptake. These barriers and their impact on liposomal gene delivery will be discussed in this review.

  14. Design of a Low-Energy FARAD Thruster

    NASA Technical Reports Server (NTRS)

    Polzin, K. A.; Rose, M. F.; Miller, R.; Best, S.; Owens, T.; Dankanich, J.

    2007-01-01

    The design of an electrodeless thruster that relies on a pulsed, rf-assisted discharge and electromagnetic acceleration using an inductive coil is presented. The thruster design is optimized using known performance,scaling parameters, and experimentally-determined design rules, with design targets for discharge energy, plasma exhaust velocity; and thrust efficiency of 100 J/pulse, 25 km/s, and 50%, respectively. Propellant is injected using a high-speed gas valve and preionized by a pulsed-RF signal supplied by a vector inversion generator, allowing for current sheet formation at lower discharge voltages and energies relative to pulsed inductive accelerators that do not employ preionization. The acceleration coil is designed to possess an inductance of at least 700 nH while the target stray (non-coil) inductance in the circuit is 70 nH. A Bernardes and Merryman pulsed power train or a pulse compression power train provide current to the acceleration coil and solid-state components are used to switch both powertrains.

  15. Liver-directed lentiviral gene therapy in a dog model of hemophilia B.

    PubMed

    Cantore, Alessio; Ranzani, Marco; Bartholomae, Cynthia C; Volpin, Monica; Valle, Patrizia Della; Sanvito, Francesca; Sergi, Lucia Sergi; Gallina, Pierangela; Benedicenti, Fabrizio; Bellinger, Dwight; Raymer, Robin; Merricks, Elizabeth; Bellintani, Francesca; Martin, Samia; Doglioni, Claudio; D'Angelo, Armando; VandenDriessche, Thierry; Chuah, Marinee K; Schmidt, Manfred; Nichols, Timothy; Montini, Eugenio; Naldini, Luigi

    2015-03-04

    We investigated the efficacy of liver-directed gene therapy using lentiviral vectors in a large animal model of hemophilia B and evaluated the risk of insertional mutagenesis in tumor-prone mouse models. We showed that gene therapy using lentiviral vectors targeting the expression of a canine factor IX transgene in hepatocytes was well tolerated and provided a stable long-term production of coagulation factor IX in dogs with hemophilia B. By exploiting three different mouse models designed to amplify the consequences of insertional mutagenesis, we showed that no genotoxicity was detected with these lentiviral vectors. Our findings suggest that lentiviral vectors may be an attractive candidate for gene therapy targeted to the liver and may be potentially useful for the treatment of hemophilia. Copyright © 2015, American Association for the Advancement of Science.

  16. Self-assembled pentablock copolymers for selective and sustained gene delivery

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhang, Bingqi

    2011-05-15

    The poly(diethylaminoethyl methacrylate) (PDEAEM) - Pluronic F127 - PDEAEM pentablock copolymer (PB) gene delivery vector system has been found to possess an inherent selectivity in transfecting cancer cells over non-cancer cells in vitro, without attaching any targeting ligands. In order to understand the mechanism of this selective transfection, three possible intracellular barriers to transfection were investigated in both cancer and non-cancer cells. We concluded that escape from the endocytic pathway served as the primary intracellular barrier for PB-mediated transfection. Most likely, PB vectors were entrapped and rendered non-functional in acidic lysosomes of non-cancer cells, but survived in less acidic lysosomesmore » of cancer cells. The work highlights the importance of identifying intracellular barriers for different gene delivery systems and provides a new paradigm for designing targeting vectors based on intracellular differences between cell types, rather than through the use of targeting ligands. The PB vector was further developed to simultaneously deliver anticancer drugs and genes, which showed a synergistic effect demonstrated by significantly enhanced gene expression in vitro. Due to the thermosensitive gelation behavior, the PB vector packaging both drug and gene was also investigated for its in vitro sustained release properties by using polyethylene glycol diacrylate as a barrier gel to mimic the tumor matrix in vivo. Overall, this work resulted in the development of a gene delivery vector for sustained and selective gene delivery to tumor cells for cancer therapy.« less

  17. Synergistic inhibition of PARP-1 and NF-κB signaling downregulates immune response against recombinant AAV2 vectors during hepatic gene therapy.

    PubMed

    Hareendran, Sangeetha; Ramakrishna, Banumathi; Jayandharan, Giridhara R

    2016-01-01

    Host immune response remains a key obstacle to widespread application of adeno-associated virus (AAV) based gene therapy. Thus, targeted inhibition of the signaling pathways that trigger such immune responses will be beneficial. Previous studies have reported that DNA damage response proteins such as poly(ADP-ribose) polymerase-1 (PARP-1) negatively affect the integration of AAV in the host genome. However, the role of PARP-1 in regulating AAV transduction and the immune response against these vectors has not been elucidated. In this study, we demonstrate that repression of PARP-1 improves the transduction of single-stranded AAV vectors both in vitro (∼174%) and in vivo (two- to 3.4-fold). Inhibition of PARP-1, also significantly downregulated the expression of several proinflammatory and cytokine markers such as TLRs, ILs, NF-κB subunit proteins associated with the host innate response against self-complementary AAV2 vectors. The suppression of the inflammatory response targeted against these vectors was more effective upon combined inhibition of PARP-1 and NF-κB signaling. This strategy also effectively attenuated the AAV capsid-specific cytotoxic T-cell response, with minimal effect on vector transduction, as demonstrated in normal C57BL/6 and hemophilia B mice. These data suggest that targeting specific host cellular proteins could be useful to attenuate the immune barriers to AAV-mediated gene therapy. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Characterization of intravitreally delivered capsid mutant AAV2-Cre vector to induce tissue-specific mutations in murine retinal ganglion cells.

    PubMed

    Langouet-Astrie, Christophe J; Yang, Zhiyong; Polisetti, Sraavya M; Welsbie, Derek S; Hauswirth, William W; Zack, Donald J; Merbs, Shannath L; Enke, Raymond A

    2016-10-01

    Targeted expression of Cre recombinase in murine retinal ganglion cells (RGCs) by viral vector is an effective strategy for creating tissue-specific gene knockouts for investigation of genetic contribution to RGC degeneration associated with optic neuropathies. Here we characterize dosage, efficacy and toxicity for sufficient intravitreal delivery of a capsid mutant Adeno-associated virus 2 (AAV2) vector encoding Cre recombinase. Wild type and Rosa26 (R26) LacZ mice were intravitreally injected with capsid mutant AAV2 viral vectors. Murine eyes were harvested at intervals ranging from 2 weeks to 15 weeks post-injection and were assayed for viral transduction, transgene expression and RGC survival. 10(9) vector genomes (vg) were sufficient for effective in vivo targeting of murine ganglion cell layer (GCL) retinal neurons. Transgene expression was observed as early as 2 weeks post-injection of viral vectors and persisted to 11 weeks. Early expression of Cre had no significant effect on RGC survival, while significant RGC loss was detected beginning 5 weeks post-injection. Early expression of viral Cre recombinase was robust, well-tolerated and predominantly found in GCL neurons suggesting this strategy can be effective in short-term RGC-specific mutation studies in experimental glaucoma models such as optic nerve crush and transection experiments. RGC degeneration with Cre expression for more than 4 weeks suggests that Cre toxicity is a limiting factor for targeted mutation strategies in RGCs. Copyright © 2016 Elsevier Ltd. All rights reserved.

  19. First Experiments with the Polarized Internal Gas Target (PIT) at ANKE/COSY

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Engels, R.; Lorentz, B.; Prasuhn, D.

    2008-02-06

    For future few-nucleon interaction studies with polarized beams and targets at COSY-Juelich, a polarized internal storage-cell gas target was implemented at the magnet spectrometer ANKE in summer 2005. First commissioning of the polarized Atomic Beam Source (ABS) at ANKE was carried out and some improvements of the system have been done. Storage-cell tests to determine the COSY beam dimensions have been performed. Electron cooling combined with stacking and stochastic cooling have been studied. Experiments with N{sub 2} gas in the storage cell to simulate the background produced by beam interaction with the aluminum cell walls were performed to investigate themore » beam heating by the target gas. The analysis of the d-vector p-vector {yields}dp and d-vector p-vector{yields}(dp{sub sp}){pi}{sup 0} reactions showed that events from the extended target can be clearly identified in the ANKE detector system.The polarization of the atomic beam of the ABS, positioned close to the strong dipole magnet D2 of ANKE, was tuned with a Lamb-shift polarimeter (LSP) beneath the target chamber. With use of the known analyzing powers of the quasi-free np{yields}d{pi}{sup 0} reaction, the polarization in the storage cell was measured to be Q{sub y} = 0.79{+-}0.07 in the vertical stray field of the D2 magnet acting as a holding field. The achieved target thickness was 2x10{sup 13} atoms/cm{sup 2} for one hyperfine state populated in the ABS beam only. With a COSY beam intensity of 6x10{sup 9} stored polarized deuterons in the ring, the luminosity for double polarized experiments was 1x10{sup 29} cm{sup -2} s{sup -1}.« less

  20. Efficient mouse airway transduction following recombination between AAV vectors carrying parts of a larger gene.

    PubMed

    Halbert, Christine L; Allen, James M; Miller, A Dusty

    2002-07-01

    The small packaging capacity of adeno-associated virus (AAV) vectors limits the utility of this promising vector system for transfer of large genes. We explored the possibility that larger genes could be reconstituted following homologous recombination between AAV vectors carrying overlapping gene fragments. An alkaline phosphatase (AP) gene was split between two such AAV vectors (rec vectors) and packaged using AAV2 or AAV6 capsid proteins. Rec vectors having either capsid protein recombined to express AP in cultured cells at about 1-2% of the rate observed for an intact vector. Surprisingly, the AAV6 rec vectors transduced lung cells in mice almost as efficiently as did an intact vector, with 10% of airway epithelial cells, the target for treatment of cystic fibrosis (CF), being positive. Thus AAV rec vectors may be useful for diseases such as CF that require transfer of large genes.

  1. Selective targeting of human cells by a chimeric adenovirus vector containing a modified fiber protein.

    PubMed Central

    Stevenson, S C; Rollence, M; Marshall-Neff, J; McClelland, A

    1997-01-01

    The adenovirus fiber protein is responsible for attachment of the virion to unidentified cell surface receptors. There are at least two distinct adenovirus fiber receptors which interact with the group B (Ad3) and group C (Ad5) adenoviruses. We have previously shown by using expressed adenovirus fiber proteins that it is possible to change the specificity of the fiber protein by exchanging the head domain with another serotype which recognizes a different receptor (S. C. Stevenson et al., J. Virol. 69:2850-2857, 1995). A chimeric fiber cDNA containing the Ad3 fiber head domain fused to the Ad5 fiber tail and shaft was incorporated into the genome of an adenovirus vector with E1 and E3 deleted encoding beta-galactosidase to generate Av9LacZ4, an adenovirus particle which contains a chimeric fiber protein. Western blot analysis of the chimeric fiber vector confirmed expression of the chimeric fiber protein and its association with the adenovirus capsid. Transduction experiments with fiber protein competitors demonstrated the altered receptor tropism of the chimeric fiber vector compared to that of the parental Av1LacZ4 vector. Transduction of a panel of human cell lines with the chimeric and parental vectors provided evidence for a different cellular distribution of the Ad5 and Ad3 receptors. Three cell lines (THP-1, MRC-5, and FaDu) were more efficiently transduced by the vector containing the Ad3 fiber head than by the Ad5 fiber vector. In contrast, human coronary artery endothelial cells were transduced more readily with the vector containing the Ad5 fiber than with the chimeric fiber vector. HeLa and human umbilical vein endothelial cells were transduced at equivalent levels compared with human diploid fibroblasts, which were refractory to transduction with both vectors. These results provide evidence for the differential expression of the Ad5 and Ad3 receptors on human cell lines derived from clinically relevant target tissues. Furthermore, we show that exchange of the fiber head domain is a viable approach to the production of adenovirus vectors with cell-type-selective transduction properties. It may be possible to extend this approach to the use of ligands for a range of different cellular receptors in order to target gene transfer to specific cell types at the level of transduction. PMID:9151872

  2. Improved Prefusion Stability, Optimized Codon Usage, and Augmented Virion Packaging Enhance the Immunogenicity of Respiratory Syncytial Virus Fusion Protein in a Vectored-Vaccine Candidate

    PubMed Central

    Liang, Bo; Ngwuta, Joan O.; Surman, Sonja; Kabatova, Barbora; Liu, Xiang; Lingemann, Matthias; Liu, Xueqiao; Yang, Lijuan; Herbert, Richard; Swerczek, Joanna; Chen, Man; Moin, Syed M.; Kumar, Azad; McLellan, Jason S.; Kwong, Peter D.; Graham, Barney S.; Collins, Peter L.

    2017-01-01

    ABSTRACT Respiratory syncytial virus (RSV) is the most important viral agent of severe pediatric respiratory tract disease worldwide, but it lacks a licensed vaccine or suitable antiviral drug. A live attenuated chimeric bovine/human parainfluenza virus type 3 (rB/HPIV3) was developed previously as a vector expressing RSV fusion (F) protein to confer bivalent protection against RSV and HPIV3. In a previous clinical trial in virus-naive children, rB/HPIV3 was well tolerated but the immunogenicity of wild-type RSV F was unsatisfactory. We previously modified RSV F with a designed disulfide bond (DS) to increase stability in the prefusion (pre-F) conformation and to be efficiently packaged in the vector virion. Here, we further stabilized pre-F by adding both disulfide and cavity-filling mutations (DS-Cav1), and we also modified RSV F codon usage to have a lower CpG content and a higher level of expression. This RSV F open reading frame was evaluated in rB/HPIV3 in three forms: (i) pre-F without vector-packaging signal, (ii) pre-F with vector-packaging signal, and (iii) secreted pre-F ectodomain trimer. Despite being efficiently expressed, the secreted pre-F was poorly immunogenic. DS-Cav1 stabilized pre-F, with or without packaging, induced higher titers of pre-F specific antibodies in hamsters, and improved the quality of RSV-neutralizing serum antibodies. Codon-optimized RSV F containing fewer CpG dinucleotides had higher F expression, replicated more efficiently in vivo, and was more immunogenic. The combination of DS-Cav1 pre-F stabilization, optimized codon usage, reduced CpG content, and vector packaging significantly improved vector immunogenicity and protective efficacy against RSV. This provides an improved vectored RSV vaccine candidate suitable for pediatric clinical evaluation. IMPORTANCE RSV and HPIV3 are the first and second leading viral causes of severe pediatric respiratory disease worldwide. Licensed vaccines or suitable antiviral drugs are not available. We are developing a chimeric rB/HPIV3 vector expressing RSV F as a bivalent RSV/HPIV3 vaccine and have been evaluating means to increase RSV F immunogenicity. In this study, we evaluated the effects of improved stabilization of F in the pre-F conformation and of codon optimization resulting in reduced CpG content and greater pre-F expression. Reduced CpG content dampened the interferon response to infection, promoting higher replication and increased F expression. We demonstrate that improved pre-F stabilization and strategic manipulation of codon usage, together with efficient pre-F packaging into vector virions, significantly increased F immunogenicity in the bivalent RSV/HPIV3 vaccine. The improved immunogenicity included induction of increased titers of high-quality complement-independent antibodies with greater pre-F site Ø binding and greater protection against RSV challenge. PMID:28539444

  3. A system for the measurement of gene targeting efficiency in human cell lines using an antibiotic resistance-GFP fusion gene.

    PubMed

    Konishi, Yuko; Karnan, Sivasundaram; Takahashi, Miyuki; Ota, Akinobu; Damdindorj, Lkhagvasuren; Hosokawa, Yoshitaka; Konishi, Hiroyuki

    2012-09-01

    Gene targeting in a broad range of human somatic cell lines has been hampered by inefficient homologous recombination. To improve this technology and facilitate its widespread application, it is critical to first have a robust and efficient research system for measuring gene targeting efficiency. Here, using a fusion gene consisting of hygromycin B phosphotransferase and 3'-truncated enhanced GFP (HygR-5' EGFP) as a reporter gene, we created a molecular system monitoring the ratio of homologous to random integration (H/R ratio) of targeting vectors into the genome. Cell clones transduced with a reporter vector containing HygR-5' EGFP were efficiently established from two human somatic cell lines. Established HygR-5' EGFP reporter clones retained their capacity to monitor gene targeting efficiency for a longer duration than a conventional reporter system using an unfused 5' EGFP gene. With the HygR-5' EGFP reporter system, we reproduced previous findings of gene targeting frequency being up-regulated by the use of an adeno-associated viral (AAV) backbone, a promoter-trap system, or a longer homology arm in a targeting vector, suggesting that this system accurately monitors H/R ratio. Thus, our HygR-5' EGFP reporter system will assist in the development of an efficient AAV-based gene targeting technology.

  4. Tailor-made gene silencing of Staphylococcus aureus clinical isolates by CRISPR interference

    PubMed Central

    Sato’o, Yusuke; Hisatsune, Junzo; Yu, Liansheng; Sakuma, Tetsushi; Yamamoto, Takashi

    2018-01-01

    Preparing the genetically modified organisms have required much time and labor, making it the rate-limiting step but CRISPR/Cas9 technology appearance has changed this difficulty. Although reports on CRISPR/Cas9 technology such as genome editing and CRISPR interference (CRISPRi) in eukaryotes increased, those in prokaryotes especially in Staphylococci were limited. Thus, its potential in the bacteriology remains unexplored. This is attributed to ecological difference between eukaryotes and prokaryotes. Here, we constructed a novel CRISPRi plasmid vector, pBACi for Staphylococcus aureus. The transformation efficiency of S. aureus was ~104 CFU/μg DNA using a vector extracted from dcm negative, which encoded one of DNA modification genes, E. coli. Further, pBACi was introduced into various clinical isolates including that not accepting the conventional temperature-sensitive vector. dcas9 in the vector was expressed throughout the growth phases of S. aureus and this vector decreased various gene mRNA expressions based on the crRNA targeting sequences and altered the knockdown strains’ phenotypes. The targeted genes included various virulence and antibiotic resistant genes. Bioinformatics suggest this vector can be introduced into wide range of low-GC Gram-positive bacteria. Because this new CRISPR/Cas9-based vector can easily prepare knockdown strains, we believe the novel vector will facilitate the characterization of the function of genes from S. aureus and other Gram-positive bacteria. PMID:29377933

  5. Self-Contained Automated Methodology for Optimal Flow Control

    NASA Technical Reports Server (NTRS)

    Joslin, Ronald D.; Gunzburger, Max D.; Nicolaides, Roy A.; Erlebacherl, Gordon; Hussaini, M. Yousuff

    1997-01-01

    This paper describes a self-contained, automated methodology for active flow control which couples the time-dependent Navier-Stokes system with an adjoint Navier-Stokes system and optimality conditions from which optimal states, i.e., unsteady flow fields and controls (e.g., actuators), may be determined. The problem of boundary layer instability suppression through wave cancellation is used as the initial validation case to test the methodology. Here, the objective of control is to match the stress vector along a portion of the boundary to a given vector; instability suppression is achieved by choosing the given vector to be that of a steady base flow. Control is effected through the injection or suction of fluid through a single orifice on the boundary. The results demonstrate that instability suppression can be achieved without any a priori knowledge of the disturbance, which is significant because other control techniques have required some knowledge of the flow unsteadiness such as frequencies, instability type, etc. The present methodology has been extended to three dimensions and may potentially be applied to separation control, re-laminarization, and turbulence control applications using one to many sensors and actuators.

  6. The q-G method : A q-version of the Steepest Descent method for global optimization.

    PubMed

    Soterroni, Aline C; Galski, Roberto L; Scarabello, Marluce C; Ramos, Fernando M

    2015-01-01

    In this work, the q-Gradient (q-G) method, a q-version of the Steepest Descent method, is presented. The main idea behind the q-G method is the use of the negative of the q-gradient vector of the objective function as the search direction. The q-gradient vector, or simply the q-gradient, is a generalization of the classical gradient vector based on the concept of Jackson's derivative from the q-calculus. Its use provides the algorithm an effective mechanism for escaping from local minima. The q-G method reduces to the Steepest Descent method when the parameter q tends to 1. The algorithm has three free parameters and it is implemented so that the search process gradually shifts from global exploration in the beginning to local exploitation in the end. We evaluated the q-G method on 34 test functions, and compared its performance with 34 optimization algorithms, including derivative-free algorithms and the Steepest Descent method. Our results show that the q-G method is competitive and has a great potential for solving multimodal optimization problems.

  7. Adenovirus Vector Pseudotyping in Fiber-Expressing Cell Lines: Improved Transduction of Epstein-Barr Virus-Transformed B Cells

    PubMed Central

    Von Seggern, Dan J.; Huang, Shuang; Fleck, Shonna Kaye; Stevenson, Susan C.; Nemerow, Glen R.

    2000-01-01

    While adenovirus (Ad) gene delivery vectors are useful in many gene therapy applications, their broad tropism means that they cannot be directed to a specific target cell. There are also a number of cell types involved in human disease which are not transducible with standard Ad vectors, such as Epstein-Barr virus (EBV)-transformed B lymphocytes. Adenovirus binds to host cells via the viral fiber protein, and Ad vectors have previously been retargeted by modifying the fiber gene on the viral chromosome. This requires that the modified fiber be able to bind to the cell in which the vector is grown, which prevents truly specific vector targeting. We previously reported a gene delivery system based on a fiber gene-deleted Ad type 5 (Ad5) vector (Ad5.βgal.ΔF) and packaging cells that express the viral fiber protein. Expression of different fibers in packaging cells will allow Ad retargeting without modifying the viral chromosome. Importantly, fiber proteins which can no longer bind to the producer cells can also be used. Using this approach, we generated for the first time pseudotyped Ad5.βgal.ΔF particles containing either the wild-type Ad5 fiber protein or a chimeric fiber with the receptor-binding knob domain of the Ad3 fiber. Particles equipped with the chimeric fiber bound to the Ad3 receptor rather than the coxsackievirus-adenovirus receptor protein used by Ad5. EBV-transformed B lymphocytes were infected efficiently by the Ad3-pseudotyped particles but poorly by virus containing the Ad5 fiber protein. The strategy described here represents a broadly applicable method for targeting gene delivery to specific cell types. PMID:10590124

  8. Construction of Various γ34.5 Deleted Fluorescent-Expressing Oncolytic herpes Simplex type 1 (oHSV) for Generation and Isolation of HSV-Based Vectors

    PubMed

    Abdoli, Shahriyar; Roohvand, Farzin; Teimoori-Toolabi, Ladan; Shokrgozar, Mohammad Ali; Bahrololoumi, Mina; Azadmanesh, Kayhan

    2017-07-01

    Oncolytic herpes simplex virus (oHSV)-based vectors lacking γ34.5 gene, are considered as ideal templates to construct efficient vectors for (targeted) cancer gene therapy. Herein, we reported the construction of three single/dually-flourescence labeled and γ34.5-deleted, recombinant HSV-1 vectors for rapid generation and easy selection/isolation of different HSV-Based vectors. Generation of recombinant viruses was performed with conventional homologous recombination methods using green fluorescent protein (GFP) and BleCherry harboring shuttle vectors. Viruses were isolated by direct fluorescence observation and standard plaque purifying methods and confirmed by PCR and sequencing and flow cytometry. XTT and plaque assay titration were performed on Vero, U87MG, and T98 GBM cell lines. We generated three recombinant viruses, HSV-GFP, HSV-GR (Green-Red), and HSV-Red. The HSV-GFP showed two log higher titer (1010 PFU) than wild type (108 PFU). In contrast, HSV-GR and HSV-Red showed one log lower titer (107 PFU) than parental HSV. Cytotoxicity analysis showed that HSV-GR and HSV-Red can lyse target tumor cells at multiplicity of infection of 10 and 1 (P<0.001). Moreover, HSV-GFP showed higher infection potency (98%) in comparison with HSV-GR (82%). Our oHSVs provide a simple and an efficient platform for construction and rapid isolation of 2nd and 3rd generation oHSVs by replacing the inserted dyes with transgenes and also for rapid identification via fluorescence activated cell sorting. These vectors can also be used for tracing the efficacy of therapeutic agents on target cells, imaging of neural or tumoral cells in vitro/in vivo and as oncolytic agents in cancer therapy.

  9. Optimized scalar promotion with load and splat SIMD instructions

    DOEpatents

    Eichenberger, Alexander E; Gschwind, Michael K; Gunnels, John A

    2013-10-29

    Mechanisms for optimizing scalar code executed on a single instruction multiple data (SIMD) engine are provided. Placement of vector operation-splat operations may be determined based on an identification of scalar and SIMD operations in an original code representation. The original code representation may be modified to insert the vector operation-splat operations based on the determined placement of vector operation-splat operations to generate a first modified code representation. Placement of separate splat operations may be determined based on identification of scalar and SIMD operations in the first modified code representation. The first modified code representation may be modified to insert or delete separate splat operations based on the determined placement of the separate splat operations to generate a second modified code representation. SIMD code may be output based on the second modified code representation for execution by the SIMD engine.

  10. Optimized scalar promotion with load and splat SIMD instructions

    DOEpatents

    Eichenberger, Alexandre E [Chappaqua, NY; Gschwind, Michael K [Chappaqua, NY; Gunnels, John A [Yorktown Heights, NY

    2012-08-28

    Mechanisms for optimizing scalar code executed on a single instruction multiple data (SIMD) engine are provided. Placement of vector operation-splat operations may be determined based on an identification of scalar and SIMD operations in an original code representation. The original code representation may be modified to insert the vector operation-splat operations based on the determined placement of vector operation-splat operations to generate a first modified code representation. Placement of separate splat operations may be determined based on identification of scalar and SIMD operations in the first modified code representation. The first modified code representation may be modified to insert or delete separate splat operations based on the determined placement of the separate splat operations to generate a second modified code representation. SIMD code may be output based on the second modified code representation for execution by the SIMD engine.

  11. Integrative image segmentation optimization and machine learning approach for high quality land-use and land-cover mapping using multisource remote sensing data

    NASA Astrophysics Data System (ADS)

    Gibril, Mohamed Barakat A.; Idrees, Mohammed Oludare; Yao, Kouame; Shafri, Helmi Zulhaidi Mohd

    2018-01-01

    The growing use of optimization for geographic object-based image analysis and the possibility to derive a wide range of information about the image in textual form makes machine learning (data mining) a versatile tool for information extraction from multiple data sources. This paper presents application of data mining for land-cover classification by fusing SPOT-6, RADARSAT-2, and derived dataset. First, the images and other derived indices (normalized difference vegetation index, normalized difference water index, and soil adjusted vegetation index) were combined and subjected to segmentation process with optimal segmentation parameters obtained using combination of spatial and Taguchi statistical optimization. The image objects, which carry all the attributes of the input datasets, were extracted and related to the target land-cover classes through data mining algorithms (decision tree) for classification. To evaluate the performance, the result was compared with two nonparametric classifiers: support vector machine (SVM) and random forest (RF). Furthermore, the decision tree classification result was evaluated against six unoptimized trials segmented using arbitrary parameter combinations. The result shows that the optimized process produces better land-use land-cover classification with overall classification accuracy of 91.79%, 87.25%, and 88.69% for SVM and RF, respectively, while the results of the six unoptimized classifications yield overall accuracy between 84.44% and 88.08%. Higher accuracy of the optimized data mining classification approach compared to the unoptimized results indicates that the optimization process has significant impact on the classification quality.

  12. Improved animal models for testing gene therapy for atherosclerosis.

    PubMed

    Du, Liang; Zhang, Jingwan; De Meyer, Guido R Y; Flynn, Rowan; Dichek, David A

    2014-04-01

    Gene therapy delivered to the blood vessel wall could augment current therapies for atherosclerosis, including systemic drug therapy and stenting. However, identification of clinically useful vectors and effective therapeutic transgenes remains at the preclinical stage. Identification of effective vectors and transgenes would be accelerated by availability of animal models that allow practical and expeditious testing of vessel-wall-directed gene therapy. Such models would include humanlike lesions that develop rapidly in vessels that are amenable to efficient gene delivery. Moreover, because human atherosclerosis develops in normal vessels, gene therapy that prevents atherosclerosis is most logically tested in relatively normal arteries. Similarly, gene therapy that causes atherosclerosis regression requires gene delivery to an existing lesion. Here we report development of three new rabbit models for testing vessel-wall-directed gene therapy that either prevents or reverses atherosclerosis. Carotid artery intimal lesions in these new models develop within 2-7 months after initiation of a high-fat diet and are 20-80 times larger than lesions in a model we described previously. Individual models allow generation of lesions that are relatively rich in either macrophages or smooth muscle cells, permitting testing of gene therapy strategies targeted at either cell type. Two of the models include gene delivery to essentially normal arteries and will be useful for identifying strategies that prevent lesion development. The third model generates lesions rapidly in vector-naïve animals and can be used for testing gene therapy that promotes lesion regression. These models are optimized for testing helper-dependent adenovirus (HDAd)-mediated gene therapy; however, they could be easily adapted for testing of other vectors or of different types of molecular therapies, delivered directly to the blood vessel wall. Our data also supports the promise of HDAd to deliver long-term therapy from vascular endothelium without accelerating atherosclerotic disease.

  13. Germinal Center B Cell and T Follicular Helper Cell Responses to Viral Vector and Protein-in-Adjuvant Vaccines

    PubMed Central

    Wang, Chuan; Hart, Matthew; Chui, Cecilia; Ajuogu, Augustine; Brian, Iona J.; de Cassan, Simone C.; Borrow, Persephone; Draper, Simon J.

    2016-01-01

    There is great interest in the development of Ab-inducing subunit vaccines targeting infections, including HIV, malaria, and Ebola. We previously reported that adenovirus vectored vaccines are potent in priming Ab responses, but uncertainty remains regarding the optimal approach for induction of humoral immune responses. In this study, using OVA as a model Ag, we assessed the magnitude of the primary and anamnestic Ag–specific IgG responses of mice to four clinically relevant vaccine formulations: replication-deficient adenovirus; modified vaccinia Ankara (a poxvirus); protein with alum; and protein in the squalene oil-in-water adjuvant Addavax. We then used flow cytometric assays capable of measuring total and Ag-specific germinal center (GC) B cell and follicular Th cell responses to compare the induction of these responses by the different formulations. We report that adenovirus vectored vaccines induce Ag insert–specific GC B cell and Ab responses of a magnitude comparable to those induced by a potent protein/squalene oil-in-water formulation whereas—despite a robust overall GC response—the insert-specific GC B cell and Ab responses induced by modified vaccinia Ankara were extremely weak. Ag-specific follicular Th cell responses to adenovirus vectored vaccines exceeded those induced by other platforms at day 7 after immunization. We found little evidence that innate immune activation by adenovirus may act as an adjuvant in such a manner that the humoral response to a recombinant protein may be enhanced by coadministering with an adenovirus lacking a transgene of interest. Overall, these studies provide further support for the use of replication-deficient adenoviruses to induce humoral responses. PMID:27412417

  14. Optimal preview control for a linear continuous-time stochastic control system in finite-time horizon

    NASA Astrophysics Data System (ADS)

    Wu, Jiang; Liao, Fucheng; Tomizuka, Masayoshi

    2017-01-01

    This paper discusses the design of the optimal preview controller for a linear continuous-time stochastic control system in finite-time horizon, using the method of augmented error system. First, an assistant system is introduced for state shifting. Then, in order to overcome the difficulty of the state equation of the stochastic control system being unable to be differentiated because of Brownian motion, the integrator is introduced. Thus, the augmented error system which contains the integrator vector, control input, reference signal, error vector and state of the system is reconstructed. This leads to the tracking problem of the optimal preview control of the linear stochastic control system being transformed into the optimal output tracking problem of the augmented error system. With the method of dynamic programming in the theory of stochastic control, the optimal controller with previewable signals of the augmented error system being equal to the controller of the original system is obtained. Finally, numerical simulations show the effectiveness of the controller.

  15. A split ubiquitin system to reveal topology and released peptides of membrane proteins.

    PubMed

    Li, Qiu-Ping; Wang, Shuai; Gou, Jin-Ying

    2017-09-02

    Membrane proteins define biological functions of membranes in cells. Extracellular peptides of transmembrane proteins receive signals from pathogens or environments, and are the major targets of drug developments. Despite of their essential roles, membrane proteins remain elusive in topological studies due to technique difficulties in their expressions and purifications. First, the target gene is cloned into a destination vector to fuse with C terminal ubiquitin at the N or C terminus. Then, Cub vector with target gene and Nub WT or Nub G vectors are transformed into AP4 or AP5 yeast cells, respectively. After mating, the diploid cells are dipped onto selection medium to check the growth. Topology of the target protein is determined according to Table 1. We present a split ubiquitin topology (SUT) analysis system to study the topology and truncation peptide of membrane proteins in a simple yeast experiment. In the SUT system, transcription activator (TA) fused with a nucleo-cytoplasmic protein shows strong auto-activation with both positive and negative control vectors. TA fused with the cytoplasmic end of membrane proteins activates reporter genes only with positive control vector with a wild type N terminal ubiquitin (Nub WT ). However, TA fused with the extracellular termini of membrane proteins can't activate reporter genes even with Nub WT . Interestingly,TA fused with the released peptide of a membrane protein shows autoactivation in the SUT system. The SUT system is a simple and fast experimental procedure complementary to computational predictions and large scale proteomic techniques. The preliminary data from SUT are valuable for pathogen recognitions and new drug developments.

  16. A dual host vector for Fab phage display and expression of native IgG in mammalian cells.

    PubMed

    Tesar, Devin; Hötzel, Isidro

    2013-10-01

    A significant bottleneck in antibody discovery by phage display is the transfer of immunoglobulin variable regions from phage clones to vectors that express immunoglobulin G (IgG) in mammalian cells for screening. Here, we describe a novel phagemid vector for Fab phage display that allows expression of native IgG in mammalian cells without sub-cloning. The vector uses an optimized mammalian signal sequence that drives robust expression of Fab fragments fused to an M13 phage coat protein in Escherichia coli and IgG expression in mammalian cells. To allow the expression of Fab fragments fused to a phage coat protein in E.coli and full-length IgG in mammalian cells from the same vector without sub-cloning, the sequence encoding the phage coat protein was embedded in an optimized synthetic intron within the immunoglobulin heavy chain gene. This intron is removed from transcripts in mammalian cells by RNA splicing. Using this vector, we constructed a synthetic Fab phage display library with diversity in the heavy chain only and selected for clones binding different antigens. Co-transfection of mammalian cells with DNA from individual phage clones and a plasmid expressing the invariant light chain resulted in the expression of native IgG that was used to assay affinity, ligand blocking activity and specificity.

  17. Attitude Control for an Aero-Vehicle Using Vector Thrusting and Variable Speed Control Moment Gyros

    NASA Technical Reports Server (NTRS)

    Shin, Jong-Yeob; Lim, K. B.; Moerder, D. D.

    2005-01-01

    Stabilization of passively unstable thrust-levitated vehicles can require significant control inputs. Although thrust vectoring is a straightforward choice for realizing these inputs, this may lead to difficulties discussed in the paper. This paper examines supplementing thrust vectoring with Variable-Speed Control Moment Gyroscopes (VSCMGs). The paper describes how to allocate VSCMGs and the vectored thrust mechanism for attitude stabilization in frequency domain and also shows trade-off between vectored thrust and VSCMGs. Using an H2 control synthesis methodology in LMI optimization, a feedback control law is designed for a thrust-levitated research vehicle and is simulated with the full nonlinear model. It is demonstrated that VSCMGs can reduce the use of vectored thrust variation for stabilizing the hovering platform in the presence of strong wind gusts.

  18. Data-Driven Sampling Matrix Boolean Optimization for Energy-Efficient Biomedical Signal Acquisition by Compressive Sensing.

    PubMed

    Wang, Yuhao; Li, Xin; Xu, Kai; Ren, Fengbo; Yu, Hao

    2017-04-01

    Compressive sensing is widely used in biomedical applications, and the sampling matrix plays a critical role on both quality and power consumption of signal acquisition. It projects a high-dimensional vector of data into a low-dimensional subspace by matrix-vector multiplication. An optimal sampling matrix can ensure accurate data reconstruction and/or high compression ratio. Most existing optimization methods can only produce real-valued embedding matrices that result in large energy consumption during data acquisition. In this paper, we propose an efficient method that finds an optimal Boolean sampling matrix in order to reduce the energy consumption. Compared to random Boolean embedding, our data-driven Boolean sampling matrix can improve the image recovery quality by 9 dB. Moreover, in terms of sampling hardware complexity, it reduces the energy consumption by 4.6× and the silicon area by 1.9× over the data-driven real-valued embedding.

  19. Intelligent control for PMSM based on online PSO considering parameters change

    NASA Astrophysics Data System (ADS)

    Song, Zhengqiang; Yang, Huiling

    2018-03-01

    A novel online particle swarm optimization method is proposed to design speed and current controllers of vector controlled interior permanent magnet synchronous motor drives considering stator resistance variation. In the proposed drive system, the space vector modulation technique is employed to generate the switching signals for a two-level voltage-source inverter. The nonlinearity of the inverter is also taken into account due to the dead-time, threshold and voltage drop of the switching devices in order to simulate the system in the practical condition. Speed and PI current controller gains are optimized with PSO online, and the fitness function is changed according to the system dynamic and steady states. The proposed optimization algorithm is compared with conventional PI control method in the condition of step speed change and stator resistance variation, showing that the proposed online optimization method has better robustness and dynamic characteristics compared with conventional PI controller design.

  20. Insecticide Resistance and Malaria Vector Control: The Importance of Fitness Cost Mechanisms in Determining Economically Optimal Control Trajectories

    PubMed Central

    Brown, Zachary S.; Dickinson, Katherine L.; Kramer, Randall A.

    2014-01-01

    The evolutionary dynamics of insecticide resistance in harmful arthropods has economic implications, not only for the control of agricultural pests (as has been well studied), but also for the control of disease vectors, such as malaria-transmitting Anopheles mosquitoes. Previous economic work on insecticide resistance illustrates the policy relevance of knowing whether insecticide resistance mutations involve fitness costs. Using a theoretical model, this article investigates economically optimal strategies for controlling malaria-transmitting mosquitoes when there is the potential for mosquitoes to evolve resistance to insecticides. Consistent with previous literature, we find that fitness costs are a key element in the computation of economically optimal resistance management strategies. Additionally, our models indicate that different biological mechanisms underlying these fitness costs (e.g., increased adult mortality and/or decreased fecundity) can significantly alter economically optimal resistance management strategies. PMID:23448053

Top