Generalized bipartite quantum state discrimination problems with sequential measurements

NASA Astrophysics Data System (ADS)

Nakahira, Kenji; Kato, Kentaro; Usuda, Tsuyoshi Sasaki

2018-02-01

We investigate an optimization problem of finding quantum sequential measurements, which forms a wide class of state discrimination problems with the restriction that only local operations and one-way classical communication are allowed. Sequential measurements from Alice to Bob on a bipartite system are considered. Using the fact that the optimization problem can be formulated as a problem with only Alice's measurement and is convex programming, we derive its dual problem and necessary and sufficient conditions for an optimal solution. Our results are applicable to various practical optimization criteria, including the Bayes criterion, the Neyman-Pearson criterion, and the minimax criterion. In the setting of the problem of finding an optimal global measurement, its dual problem and necessary and sufficient conditions for an optimal solution have been widely used to obtain analytical and numerical expressions for optimal solutions. Similarly, our results are useful to obtain analytical and numerical expressions for optimal sequential measurements. Examples in which our results can be used to obtain an analytical expression for an optimal sequential measurement are provided.

Isolation, characterization and optimization of culture parameters for production of an alkaline protease isolated from Aspergillus tamarii.

PubMed

Anandan, Dayanandan; Marmer, William N; Dudley, Robert L

2007-05-01

Aspergillus tamarii expresses an extracellular alkaline protease that we show to be effective in removing hair from cattle hide. Large quantities of the enzyme will be required for the optimization of the enzymatic dehairing process so the growth conditions for maximum protease expression by A. tamarii were optimized for both solid-state culture on wheat bran and for broth culture. Optimal protease expression occurred, for both cultural media, at initial pH 9; the culture was incubated at 30 degrees C for 96 h using a 5% inoculum. The crude enzyme was isolated, purified and characterized using MALDI TOF TOF. The alkaline protease was homologous to the alkaline protease expressed by Aspergillus viridinutans.

Efficient search, mapping, and optimization of multi-protein genetic systems in diverse bacteria

PubMed Central

Farasat, Iman; Kushwaha, Manish; Collens, Jason; Easterbrook, Michael; Guido, Matthew; Salis, Howard M

2014-01-01

Developing predictive models of multi-protein genetic systems to understand and optimize their behavior remains a combinatorial challenge, particularly when measurement throughput is limited. We developed a computational approach to build predictive models and identify optimal sequences and expression levels, while circumventing combinatorial explosion. Maximally informative genetic system variants were first designed by the RBS Library Calculator, an algorithm to design sequences for efficiently searching a multi-protein expression space across a > 10,000-fold range with tailored search parameters and well-predicted translation rates. We validated the algorithm's predictions by characterizing 646 genetic system variants, encoded in plasmids and genomes, expressed in six gram-positive and gram-negative bacterial hosts. We then combined the search algorithm with system-level kinetic modeling, requiring the construction and characterization of 73 variants to build a sequence-expression-activity map (SEAMAP) for a biosynthesis pathway. Using model predictions, we designed and characterized 47 additional pathway variants to navigate its activity space, find optimal expression regions with desired activity response curves, and relieve rate-limiting steps in metabolism. Creating sequence-expression-activity maps accelerates the optimization of many protein systems and allows previous measurements to quantitatively inform future designs. PMID:24952589

A stepwise approach for the reproducible optimization of PAMO expression in Escherichia coli for whole-cell biocatalysis

PubMed Central

2012-01-01

Background Baeyer-Villiger monooxygenases (BVMOs) represent a group of enzymes of considerable biotechnological relevance as illustrated by their growing use as biocatalyst in a variety of synthetic applications. However, due to their increased use the reproducible expression of BVMOs and other biotechnologically relevant enzymes has become a pressing matter while knowledge about the factors governing their reproducible expression is scattered. Results Here, we have used phenylacetone monooxygenase (PAMO) from Thermobifida fusca, a prototype Type I BVMO, as a model enzyme to develop a stepwise strategy to optimize the biotransformation performance of recombinant E. coli expressing PAMO in 96-well microtiter plates in a reproducible fashion. Using this system, the best expression conditions of PAMO were investigated first, including different host strains, temperature as well as time and induction period for PAMO expression. This optimized system was used next to improve biotransformation conditions, the PAMO-catalyzed conversion of phenylacetone, by evaluating the best electron donor, substrate concentration, and the temperature and length of biotransformation. Combining all optimized parameters resulted in a more than four-fold enhancement of the biocatalytic performance and, importantly, this was highly reproducible as indicated by the relative standard deviation of 1% for non-washed cells and 3% for washed cells. Furthermore, the optimized procedure was successfully adapted for activity-based mutant screening. Conclusions Our optimized procedure, which provides a comprehensive overview of the key factors influencing the reproducible expression and performance of a biocatalyst, is expected to form a rational basis for the optimization of miniaturized biotransformations and for the design of novel activity-based screening procedures suitable for BVMOs and other NAD(P)H-dependent enzymes as well. PMID:22720747

Rhesus Monkey Rhadinovirus ORF57 Induces gH and gL Glycoprotein Expression through Posttranscriptional Accumulation of Target mRNAs ▿

PubMed Central

Shin, Young C.; Desrosiers, Ronald C.

2011-01-01

Open reading frame 57 (ORF57) of gamma-2 herpesviruses is a key regulator of viral gene expression. It has been reported to enhance the expression of viral genes by transcriptional, posttranscriptional, or translational activation mechanisms. Previously we have shown that the expression of gH and gL of rhesus monkey rhadinovirus (RRV), a close relative of the human Kaposi's sarcoma-associated herpesvirus (KSHV), could be dramatically rescued by codon optimization as well as by ORF57 coexpression (J. P. Bilello, J. S. Morgan, and R. C. Desrosiers, J. Virol. 82:7231–7237, 2008). We show here that ORF57 coexpression and codon optimization had similar effects, except that the rescue of expression by codon optimization was temporally delayed relative to that of ORF57 coexpression. The transfection of gL mRNA directly into cells with or without ORF57 coexpression and with or without codon optimization recapitulated the effects of these modes of induction on transfected DNA. These findings suggested an important role for the enhancement of mRNA stability and/or the translation of mRNA for these very different modes of induced expression. This conclusion was confirmed by several different measures of gH and gL mRNA stability and accumulation with or without ORF57 coexpression and with or without codon optimization. Our results indicate that RRV gH and gL expression is severely limited by the stability of the mRNA and that ORF57 coexpression and codon optimization independently induce gH and gL expression principally by allowing accumulation and translation of these mRNAs. PMID:21613403

Simulation Modeling to Compare High-Throughput, Low-Iteration Optimization Strategies for Metabolic Engineering

PubMed Central

Heinsch, Stephen C.; Das, Siba R.; Smanski, Michael J.

2018-01-01

Increasing the final titer of a multi-gene metabolic pathway can be viewed as a multivariate optimization problem. While numerous multivariate optimization algorithms exist, few are specifically designed to accommodate the constraints posed by genetic engineering workflows. We present a strategy for optimizing expression levels across an arbitrary number of genes that requires few design-build-test iterations. We compare the performance of several optimization algorithms on a series of simulated expression landscapes. We show that optimal experimental design parameters depend on the degree of landscape ruggedness. This work provides a theoretical framework for designing and executing numerical optimization on multi-gene systems. PMID:29535690

Systematic optimization of expression and refolding of the Plasmodium falciparum cysteine protease falcipain-2.

PubMed

Sijwali, P S; Brinen, L S; Rosenthal, P J

2001-06-01

The Plasmodium falciparum cysteine protease falcipain-2 is a potential new target for antimalarial chemotherapy. In order to obtain large quantities of active falcipain-2 for biochemical and structural analysis, a systematic assessment of optimal parameters for the expression and refolding of the protease was carried out. High-yield expression was achieved using M15(pREP4) Escherichia coli transformed with the pQE-30 plasmid containing a truncated profalcipain-2 construct. Recombinant falcipain-2 was expressed as inclusion bodies, solubilized, and purified by nickel affinity chromatography. A systematic approach was then used to optimize refolding parameters. This approach utilized 100-fold dilutions of reduced and denatured falcipain-2 into 203 different buffers in a microtiter plate format. Refolding efficiency varied markedly. Optimal refolding was obtained in an alkaline buffer containing glycerol or sucrose and equal concentrations of reduced and oxidized glutathione. After optimization of the expression and refolding protocols and additional purification with anion-exchange chromatography, 12 mg of falcipain-2 was obtained from 5 liters of E. coli, and crystals of the protease were grown. The systematic approach described here allowed the rapid evaluation of a large number of expression and refolding conditions and provided milligram quantities of recombinant falcipain-2. Copyright 2001 Academic Press.

Optimization of the Expression Conditions of CGA-N46 in Bacillus subtilis DB1342(p-3N46) by Response Surface Methodology.

PubMed

Li, Rui-Fang; Wang, Bin; Liu, Shuai; Chen, Shi-Hua; Yu, Guang-Hai; Yang, Shuo-Ye; Huang, Liang; Yin, Yan-Li; Lu, Zhi-Fang

2016-09-01

CGA-N46 is a small antifungal-derived peptide and consists of the 31st-76th amino acids of the N-terminus of human chromogranin A. Polycistronic expression of recombinant CGA-N46 in Bacillus subtilis DB1342 was used to improve its production, but the yield of CGA-N46 was still low. In the present study, response surface methodology (RSM) was used to optimize culture medium composition and growth conditions of the engineered strain B. subtilis DB1342(p-3N46) for the further increase in CGA-N46 yield. The results of two-level factorial experiments indicated that dextrin and tryptone were significant factors affecting CGA-N46 expression. Central composite design (CCD) was used to determine the ideal conditions of each significant factors. From the results of CCD, the optimal medium composition was predicted to be dextrin 16.6 g/L, tryptone 19.2 g/L, KH2PO4·H2O 6 g/L, pH 6.5. And the optimal culture process indicated inoculation of B. subtilis DB1342(p-3N46) seed culture into fresh culture medium at 5 % (v/v), followed by expression of CGA-N46 for 56 hours at 30 °C induced by 2 % (v/v) sucrose after one hour of shaking culture. To test optimal CGA-N46 peptide expression, the yeast growth inhibition assay was employed and it was found that under optimal culture conditions, CGA-N46 inhibited the growth of Candida albican by 42.17, 30.86 % more than that in the pre-optimization conditions. In summary, RSM can be used to optimize expression conditions of CGA-N46 in engineered strains B. subtilis DB1342(p-3N46).

An Automated Pipeline for Engineering Many-Enzyme Pathways: Computational Sequence Design, Pathway Expression-Flux Mapping, and Scalable Pathway Optimization.

PubMed

Halper, Sean M; Cetnar, Daniel P; Salis, Howard M

2018-01-01

Engineering many-enzyme metabolic pathways suffers from the design curse of dimensionality. There are an astronomical number of synonymous DNA sequence choices, though relatively few will express an evolutionary robust, maximally productive pathway without metabolic bottlenecks. To solve this challenge, we have developed an integrated, automated computational-experimental pipeline that identifies a pathway's optimal DNA sequence without high-throughput screening or many cycles of design-build-test. The first step applies our Operon Calculator algorithm to design a host-specific evolutionary robust bacterial operon sequence with maximally tunable enzyme expression levels. The second step applies our RBS Library Calculator algorithm to systematically vary enzyme expression levels with the smallest-sized library. After characterizing a small number of constructed pathway variants, measurements are supplied to our Pathway Map Calculator algorithm, which then parameterizes a kinetic metabolic model that ultimately predicts the pathway's optimal enzyme expression levels and DNA sequences. Altogether, our algorithms provide the ability to efficiently map the pathway's sequence-expression-activity space and predict DNA sequences with desired metabolic fluxes. Here, we provide a step-by-step guide to applying the Pathway Optimization Pipeline on a desired multi-enzyme pathway in a bacterial host.

Verification and Optimal Control of Context-Sensitive Probabilistic Boolean Networks Using Model Checking and Polynomial Optimization

PubMed Central

Hiraishi, Kunihiko

2014-01-01

One of the significant topics in systems biology is to develop control theory of gene regulatory networks (GRNs). In typical control of GRNs, expression of some genes is inhibited (activated) by manipulating external stimuli and expression of other genes. It is expected to apply control theory of GRNs to gene therapy technologies in the future. In this paper, a control method using a Boolean network (BN) is studied. A BN is widely used as a model of GRNs, and gene expression is expressed by a binary value (ON or OFF). In particular, a context-sensitive probabilistic Boolean network (CS-PBN), which is one of the extended models of BNs, is used. For CS-PBNs, the verification problem and the optimal control problem are considered. For the verification problem, a solution method using the probabilistic model checker PRISM is proposed. For the optimal control problem, a solution method using polynomial optimization is proposed. Finally, a numerical example on the WNT5A network, which is related to melanoma, is presented. The proposed methods provide us useful tools in control theory of GRNs. PMID:24587766

Cloning, Codon Optimization, and Expression of Yersinia intermedia Phytase Gene in E. coli.

PubMed

Mirzaei, Maryam; Saffar, Behnaz; Shareghi, Behzad

2016-06-01

Phytate is an anti-nutritional factor in plants, which catches the most phosphorus contents and some vital minerals. Therefore, Phytase is added mainly as an additive to the monogastric animals' foods to hydrolyze phytate and increase absorption of phosphorus. Y. intermedia phytase is a new phytase with special characteristics such as high specific activity, pH stability, and thermostability. Our aim was to clone, express, and characterizea codon optimized Y. intermedia phytase gene in E. coli . The Y. intermedia phytase gene was optimized according to the codon usage in E. coli . The sequence was synthesized and sub-cloned in pET-22b (+) vector and transformed into E. coli Bl21 (DE3). The protein was expressed in the presence of IPTG at a final concentration of 1 mM at 30°C. The purification of recombinant protein was performed by Ni 2+ affinity chromatography. Phytase activity and stability were determined in various pH and temperatures. The codon optimized Y. intermedia phytase gene was sub-cloned successfully.The expression was confirmed by SDS-PAGE and Western blot analysis. The recombinant enzyme (approximately 45 kDa) was purified. Specific activity of enzyme was 3849 (U.mg -1 ) with optimal pH 5 and optimal temperature of 55°C. Thermostability (80°C for 15 min) and pH stability (3-6) of the enzyme were 56 and more than 80%, respectively. The results of the expression and enzyme characterization revealed that the optimized Y. intermedia phytase gene has a good potential to be produced commercially andto be applied in animals' foodsindustry.

Efficient Coproduction of Mannanase and Cellulase by the Transformation of a Codon-Optimized Endomannanase Gene from Aspergillus niger into Trichoderma reesei.

PubMed

Sun, Xianhua; Xue, Xianli; Li, Mengzhu; Gao, Fei; Hao, Zhenzhen; Huang, Huoqing; Luo, Huiying; Qin, Lina; Yao, Bin; Su, Xiaoyun

2017-12-20

Cellulase and mannanase are both important enzyme additives in animal feeds. Expressing the two enzymes simultaneously within one microbial host could potentially lead to cost reductions in the feeding of animals. For this purpose, we codon-optimized the Aspergillus niger Man5A gene to the codon-usage bias of Trichoderma reesei. By comparing the free energies and the local structures of the nucleotide sequences, one optimized sequence was finally selected and transformed into the T. reesei pyridine-auxotrophic strain TU-6. The codon-optimized gene was expressed to a higher level than the original one. Further expressing the codon-optimized gene in a mutated T. reesei strain through fed-batch cultivation resulted in coproduction of cellulase and mannanase up to 1376 U·mL -1 and 1204 U·mL -1 , respectively.

[Optimization of prokaryotic expression conditions of Leptospira interrogans trigeminy genus-specific protein antigen based on surface response analysis].

PubMed

Wang, Jiang; Luo, Dongjiao; Sun, Aihua; Yan, Jie

2008-07-01

Lipoproteins LipL32 and LipL21 and transmembrane protein OMPL1 have been confirmed as the superficial genus-specific antigens of Leptospira interrogans, which can be used as antigens for developing a universal genetic engineering vaccine. In order to obtain high expression of an artificial fusion gene lipL32/1-lipL21-ompL1/2, we optimized prokaryotic expression conditions. We used surface response analysis based on the central composite design to optimize culture conditions of a new antigen protein by recombinant Escherichia coli DE3.The culture conditions included initial pH, induction start time, post-induction time, Isopropyl beta-D-thiogalactopyranoside (IPTG) concentration, and temperature. The maximal production of antigen protein was 37.78 mg/l. The optimal culture conditions for high recombinant fusion protein was determined: initial pH 7.9, induction start time 2.5 h, a post-induction time of 5.38 h, 0.20 mM IPTG, and a post-induction temperature of 31 degrees C. Surface response analysis based on CCD increased the target production. This statistical method reduced the number of experiments required for optimization and enabled rapid identification and integration of the key culture condition parameters for optimizing recombinant protein expression.

Analysis of temporal gene expression profiles: clustering by simulated annealing and determining the optimal number of clusters.

PubMed

Lukashin, A V; Fuchs, R

2001-05-01

Cluster analysis of genome-wide expression data from DNA microarray hybridization studies has proved to be a useful tool for identifying biologically relevant groupings of genes and samples. In the present paper, we focus on several important issues related to clustering algorithms that have not yet been fully studied. We describe a simple and robust algorithm for the clustering of temporal gene expression profiles that is based on the simulated annealing procedure. In general, this algorithm guarantees to eventually find the globally optimal distribution of genes over clusters. We introduce an iterative scheme that serves to evaluate quantitatively the optimal number of clusters for each specific data set. The scheme is based on standard approaches used in regular statistical tests. The basic idea is to organize the search of the optimal number of clusters simultaneously with the optimization of the distribution of genes over clusters. The efficiency of the proposed algorithm has been evaluated by means of a reverse engineering experiment, that is, a situation in which the correct distribution of genes over clusters is known a priori. The employment of this statistically rigorous test has shown that our algorithm places greater than 90% genes into correct clusters. Finally, the algorithm has been tested on real gene expression data (expression changes during yeast cell cycle) for which the fundamental patterns of gene expression and the assignment of genes to clusters are well understood from numerous previous studies.

Puromycin and Methotrexate Resistance Cassettes and Optimized cre-recombinase Expression Plasmids for use in Yeast

PubMed Central

MacDonald, Chris; Piper, Robert C.

2015-01-01

Here we expand the set of tools for genetically manipulating Saccharomyces cerevisiae. We show that puromycin-resistance can be achieved in yeast through expression of a bacterial puromycin-resistance gene optimized to the yeast codon bias, which in turn serves as an easy to use dominant genetic marker suitable for gene disruption. We have constructed a similar DNA cassette expressing yeast codon-optimized mutant human dihydrofolate reductase (DHFR) that confers resistance to methotrexate and can also be used as a dominant selectable marker. Both of these drug-resistant marker cassettes are flanked by loxP sites allowing for their excision from the genome following expression of cre-recombinase. Finally, we have created a series of plasmids for low-level constitutive expression of cre-recombinase in yeast that allows for efficient excision of loxP-flanked markers. PMID:25688547

An optimized expression vector for improving the yield of dengue virus-like particles from transfected insect cells.

PubMed

Charoensri, Nicha; Suphatrakul, Amporn; Sriburi, Rungtawan; Yasanga, Thippawan; Junjhon, Jiraphan; Keelapang, Poonsook; Utaipat, Utaiwan; Puttikhunt, Chunya; Kasinrerk, Watchara; Malasit, Prida; Sittisombut, Nopporn

2014-09-01

Recombinant virus-like particles (rVLPs) of flaviviruses are non-infectious particles released from cells expressing the envelope glycoproteins prM and E. Dengue virus rVLPs are recognized as a potential vaccine candidate, but large scale production of these particles is hindered by low yields and the occurrence of cytopathic effects. In an approach to improve the yield of rVLPs from transfected insect cells, several components of a dengue serotype 2 virus prM+E expression cassette were modified and the effect of these modifications was assessed during transient expression. Enhancement of extracellular rVLP levels by simultaneous substitutions of the prM signal peptide and the stem-anchor region of E with homologous cellular and viral counterparts, respectively, was further augmented by codon optimization. Extensive formation of multinucleated cells following transfection with the codon-optimized expression cassette was abrogated by introducing an E fusion loop mutation. This mutation also helped restore the extracellular E levels affected negatively by alteration of a charged residue at the pr-M junction, which was intended to promote maturation of rVLPs during export. Optimized expression cassettes generated in this multiple add-on modification approach should be useful in the generation of stably expressing clones and production of dengue virus rVLPs for immunogenicity studies. Copyright © 2014 Elsevier B.V. All rights reserved.

Evolution of Synonymous Codon Usage in Neurospora tetrasperma and Neurospora discreta

PubMed Central

Whittle, C. A.; Sun, Y.; Johannesson, H.

2011-01-01

Neurospora comprises a primary model system for the study of fungal genetics and biology. In spite of this, little is known about genome evolution in Neurospora. For example, the evolution of synonymous codon usage is largely unknown in this genus. In the present investigation, we conducted a comprehensive analysis of synonymous codon usage and its relationship to gene expression and gene length (GL) in Neurospora tetrasperma and Neurospora discreta. For our analysis, we examined codon usage among 2,079 genes per organism and assessed gene expression using large-scale expressed sequenced tag (EST) data sets (279,323 and 453,559 ESTs for N. tetrasperma and N. discreta, respectively). Data on relative synonymous codon usage revealed 24 codons (and two putative codons) that are more frequently used in genes with high than with low expression and thus were defined as optimal codons. Although codon-usage bias was highly correlated with gene expression, it was independent of selectively neutral base composition (introns); thus demonstrating that translational selection drives synonymous codon usage in these genomes. We also report that GL (coding sequences [CDS]) was inversely associated with optimal codon usage at each gene expression level, with highly expressed short genes having the greatest frequency of optimal codons. Optimal codon frequency was moderately higher in N. tetrasperma than in N. discreta, which might be due to variation in selective pressures and/or mating systems. PMID:21402862

Molecular Cooperativity Governs Diverse and Monoallelic Olfactory Receptor Expression

NASA Astrophysics Data System (ADS)

Xing, Jianhua; Tian, Xiaojun; Zhang, Hang; Sannerud, Jens

Multiple-objective optimization is common in biological systems. In the mammalian olfactory system, each sensory neuron stochastically expresses only one out of up to thousands of olfactory receptor (OR) gene alleles; at organism level the types of expressed ORs need to be maximized. The molecular mechanism of this Nobel-Prize winning puzzle remains unresolved after decades of extensive studies. Existing models focus only on monoallele activation, and cannot explain recent observations in mutants, especially the reduced global diversity of expressed ORs in G9a/GLP knockouts. In this work we integrated existing information on OR expression, and proposed an evolutionarily optimized three-layer regulation mechanism, which includes zonal segregation, epigenetic and enhancer competition coupled to a negative feedback loop. This model not only recapitulates monoallelic OR expression, but also elucidates how the olfactory system maximizes and maintains the diversity of OR expression. The model is validated by several experimental results, and particularly underscores cooperativity and synergy as a general design principle of multi-objective optimization in biology. The work is supported by the NIGMS/DMS Mathematical Biology program.

Optimal tumor sampling for immunostaining of biomarkers in breast carcinoma

PubMed Central

2011-01-01

Introduction Biomarkers, such as Estrogen Receptor, are used to determine therapy and prognosis in breast carcinoma. Immunostaining assays of biomarker expression have a high rate of inaccuracy; for example, estimates are as high as 20% for Estrogen Receptor. Biomarkers have been shown to be heterogeneously expressed in breast tumors and this heterogeneity may contribute to the inaccuracy of immunostaining assays. Currently, no evidence-based standards exist for the amount of tumor that must be sampled in order to correct for biomarker heterogeneity. The aim of this study was to determine the optimal number of 20X fields that are necessary to estimate a representative measurement of expression in a whole tissue section for selected biomarkers: ER, HER-2, AKT, ERK, S6K1, GAPDH, Cytokeratin, and MAP-Tau. Methods Two collections of whole tissue sections of breast carcinoma were immunostained for biomarkers. Expression was quantified using the Automated Quantitative Analysis (AQUA) method of quantitative immunofluorescence. Simulated sampling of various numbers of fields (ranging from one to thirty five) was performed for each marker. The optimal number was selected for each marker via resampling techniques and minimization of prediction error over an independent test set. Results The optimal number of 20X fields varied by biomarker, ranging between three to fourteen fields. More heterogeneous markers, such as MAP-Tau protein, required a larger sample of 20X fields to produce representative measurement. Conclusions The optimal number of 20X fields that must be sampled to produce a representative measurement of biomarker expression varies by marker with more heterogeneous markers requiring a larger number. The clinical implication of these findings is that breast biopsies consisting of a small number of fields may be inadequate to represent whole tumor biomarker expression for many markers. Additionally, for biomarkers newly introduced into clinical use, especially if therapeutic response is dictated by level of expression, the optimal size of tissue sample must be determined on a marker-by-marker basis. PMID:21592345

Detection of MDR1 mRNA expression with optimized gold nanoparticle beacon

NASA Astrophysics Data System (ADS)

Zhou, Qiumei; Qian, Zhiyu; Gu, Yueqing

2016-03-01

MDR1 (multidrug resistance gene) mRNA expression is a promising biomarker for the prediction of doxorubicin resistance in clinic. However, the traditional technical process in clinic is complicated and cannot perform the real-time detection mRNA in living single cells. In this study, the expression of MDR1 mRNA was analyzed based on optimized gold nanoparticle beacon in tumor cells. Firstly, gold nanoparticle (AuNP) was modified by thiol-PEG, and the MDR1 beacon sequence was screened and optimized using a BLAST bioinformatics strategy. Then, optimized MDR1 molecular beacons were characterized by transmission electron microscope, UV-vis and fluorescence spectroscopies. The cytotoxicity of MDR1 molecular beacon on L-02, K562 and K562/Adr cells were investigated by MTT assay, suggesting that MDR1 molecular beacon was low inherent cytotoxicity. Dark field microscope was used to investigate the cellular uptake of hDAuNP beacon assisted with ultrasound. Finally, laser scanning confocal microscope images showed that there was a significant difference in MDR1 mRNA expression in K562 and K562/Adr cells, which was consistent with the results of q-PCR measurement. In summary, optimized MDR1 molecular beacon designed in this study is a reliable strategy for detection MDR1 mRNA expression in living tumor cells, and will be a promising strategy for in guiding patient treatment and management in individualized medication.

Bacterial cell-free expression technology to in vitro systems engineering and optimization.

PubMed

Caschera, Filippo

2017-06-01

Cell-free expression system is a technology for the synthesis of proteins in vitro . The system is a platform for several bioengineering projects, e.g. cell-free metabolic engineering, evolutionary design of experiments, and synthetic minimal cell construction. Bacterial cell-free protein synthesis system (CFPS) is a robust tool for synthetic biology. The bacteria lysate, the DNA, and the energy module, which are the three optimized sub-systems for in vitro protein synthesis, compose the integrated system. Currently, an optimized E. coli cell-free expression system can produce up to ∼2.3 mg/mL of a fluorescent reporter protein. Herein, I will describe the features of ATP-regeneration systems for in vitro protein synthesis, and I will present a machine-learning experiment for optimizing the protein yield of E. coli cell-free protein synthesis systems. Moreover, I will introduce experiments on the synthesis of a minimal cell using liposomes as dynamic containers, and E. coli cell-free expression system as biochemical platform for metabolism and gene expression. CFPS can be further integrated with other technologies for novel applications in environmental, medical and material science.

Elevation of the Yields of Very Long Chain Polyunsaturated Fatty Acids via Minimal Codon Optimization of Two Key Biosynthetic Enzymes

PubMed Central

Zheng, Desong; Sun, Quanxi; Liu, Jiang; Li, Yaxiao; Hua, Jinping

2016-01-01

Eicosapentaenoic acid (EPA, 20:5Δ5,8,11,14,17) and Docosahexaenoic acid (DHA, 22:6Δ4,7,10,13,16,19) are nutritionally beneficial to human health. Transgenic production of EPA and DHA in oilseed crops by transferring genes originating from lower eukaryotes, such as microalgae and fungi, has been attempted in recent years. However, the low yield of EPA and DHA produced in these transgenic crops is a major hurdle for the commercialization of these transgenics. Many factors can negatively affect transgene expression, leading to a low level of converted fatty acid products. Among these the codon bias between the transgene donor and the host crop is one of the major contributing factors. Therefore, we carried out codon optimization of a fatty acid delta-6 desaturase gene PinD6 from the fungus Phytophthora infestans, and a delta-9 elongase gene, IgASE1 from the microalga Isochrysis galbana for expression in Saccharomyces cerevisiae and Arabidopsis respectively. These are the two key genes encoding enzymes for driving the first catalytic steps in the Δ6 desaturation/Δ6 elongation and the Δ9 elongation/Δ8 desaturation pathways for EPA/DHA biosynthesis. Hence expression levels of these two genes are important in determining the final yield of EPA/DHA. Via PCR-based mutagenesis we optimized the least preferred codons within the first 16 codons at their N-termini, as well as the most biased CGC codons (coding for arginine) within the entire sequences of both genes. An expression study showed that transgenic Arabidopsis plants harbouring the codon-optimized IgASE1 contained 64% more elongated fatty acid products than plants expressing the native IgASE1 sequence, whilst Saccharomyces cerevisiae expressing the codon optimized PinD6 yielded 20 times more desaturated products than yeast expressing wild-type (WT) PinD6. Thus the codon optimization strategy we developed here offers a simple, effective and low-cost alternative to whole gene synthesis for high expression of foreign genes in yeast and Arabidopsis. PMID:27433934

Optimization of digital designs

NASA Technical Reports Server (NTRS)

Miles, Lowell H. (Inventor); Whitaker, Sterling R. (Inventor)

2009-01-01

An application specific integrated circuit is optimized by translating a first representation of its digital design to a second representation. The second representation includes multiple syntactic expressions that admit a representation of a higher-order function of base Boolean values. The syntactic expressions are manipulated to form a third representation of the digital design.

Exploring codon context bias for synthetic gene design of a thermostable invertase in Escherichia coli.

PubMed

Pek, Han Bin; Klement, Maximilian; Ang, Kok Siong; Chung, Bevan Kai-Sheng; Ow, Dave Siak-Wei; Lee, Dong-Yup

2015-01-01

Various isoforms of invertases from prokaryotes, fungi, and higher plants has been expressed in Escherichia coli, and codon optimisation is a widely-adopted strategy for improvement of heterologous enzyme expression. Successful synthetic gene design for recombinant protein expression can be done by matching its translational elongation rate against heterologous host organisms via codon optimization. Amongst the various design parameters considered for the gene synthesis, codon context bias has been relatively overlooked compared to individual codon usage which is commonly adopted in most of codon optimization tools. In addition, matching the rates of transcription and translation based on secondary structure may lead to enhanced protein folding. In this study, we evaluated codon context fitness as design criterion for improving the expression of thermostable invertase from Thermotoga maritima in Escherichia coli and explored the relevance of secondary structure regions for folding and expression. We designed three coding sequences by using (1) a commercial vendor optimized gene algorithm, (2) codon context for the whole gene, and (3) codon context based on the secondary structure regions. Then, the codon optimized sequences were transformed and expressed in E. coli. From the resultant enzyme activities and protein yield data, codon context fitness proved to have the highest activity as compared to the wild-type control and other criteria while secondary structure-based strategy is comparable to the control. Codon context bias was shown to be a relevant parameter for enhancing enzyme production in Escherichia coli by codon optimization. Thus, we can effectively design synthetic genes within heterologous host organisms using this criterion. Copyright © 2015 Elsevier Inc. All rights reserved.

A stochastic model for optimizing composite predictors based on gene expression profiles.

PubMed

Ramanathan, Murali

2003-07-01

This project was done to develop a mathematical model for optimizing composite predictors based on gene expression profiles from DNA arrays and proteomics. The problem was amenable to a formulation and solution analogous to the portfolio optimization problem in mathematical finance: it requires the optimization of a quadratic function subject to linear constraints. The performance of the approach was compared to that of neighborhood analysis using a data set containing cDNA array-derived gene expression profiles from 14 multiple sclerosis patients receiving intramuscular inteferon-beta1a. The Markowitz portfolio model predicts that the covariance between genes can be exploited to construct an efficient composite. The model predicts that a composite is not needed for maximizing the mean value of a treatment effect: only a single gene is needed, but the usefulness of the effect measure may be compromised by high variability. The model optimized the composite to yield the highest mean for a given level of variability or the least variability for a given mean level. The choices that meet this optimization criteria lie on a curve of composite mean vs. composite variability plot referred to as the "efficient frontier." When a composite is constructed using the model, it outperforms the composite constructed using the neighborhood analysis method. The Markowitz portfolio model may find potential applications in constructing composite biomarkers and in the pharmacogenomic modeling of treatment effects derived from gene expression endpoints.

Optimization of conditions for transient Agrobacterium-mediated gene expression assays in Arabidopsis.

PubMed

Kim, Mi Jung; Baek, Kon; Park, Chung-Mo

2009-08-01

Transient genetic transformation of plant organs is an indispensable way of studying gene function in plants. This study was aimed to develop an optimized system for transient Agrobacterium-mediated transformation of the Arabidopsis leaves. The beta-glucuronidase (GUS) reporter gene was employed to evaluate growth and biochemical parameters that influence the levels of transient expression. The effects of plant culture conditions, Agrobacterial genetic backgrounds, densities of Agrobacterial cell suspensions, and of several detergents were analyzed. We found that optimization of plant culture conditions is the most critical factor among the parameters analyzed. Higher levels of transient expression were observed in plants grown under short day conditions (SDs) than in plants grown under long day conditions (LDs). Furthermore, incubation of the plants under SDs at high relative humidity (85-90%) for 24 h after infiltration greatly improved the levels of transient expression. Under the optimized culture conditions, expression of the reporter gene reached the peak 3 days after infiltration and was rapidly decreased after the peak. Among the five Agrobacterial strains examined, LAB4404 produced the highest levels of expression. We also examined the effects of detergents, including Triton X-100, Tween-20, and Silwet L-77. Supplementation of the infiltration media either with 0.01% Triton X-100 or 0.01% Tween-20 improved the levels of expression by approximately 1.6-fold. Our observations indicate that transient transformation of the Arabidopsis leaves in the infiltration media supplemented with 0.01% Triton X-100 and incubation of the infiltrated plants under SDs at high relative humidity are necessary for maximal levels of expression.

A Language for Specifying Compiler Optimizations for Generic Software

DOE Office of Scientific and Technical Information (OSTI.GOV)

Willcock, Jeremiah J.

2007-01-01

Compiler optimization is important to software performance, and modern processor architectures make optimization even more critical. However, many modern software applications use libraries providing high levels of abstraction. Such libraries often hinder effective optimization — the libraries are difficult to analyze using current compiler technology. For example, high-level libraries often use dynamic memory allocation and indirectly expressed control structures, such as iteratorbased loops. Programs using these libraries often cannot achieve an optimal level of performance. On the other hand, software libraries have also been recognized as potentially aiding in program optimization. One proposed implementation of library-based optimization is to allowmore » the library author, or a library user, to define custom analyses and optimizations. Only limited systems have been created to take advantage of this potential, however. One problem in creating a framework for defining new optimizations and analyses is how users are to specify them: implementing them by hand inside a compiler is difficult and prone to errors. Thus, a domain-specific language for librarybased compiler optimizations would be beneficial. Many optimization specification languages have appeared in the literature, but they tend to be either limited in power or unnecessarily difficult to use. Therefore, I have designed, implemented, and evaluated the Pavilion language for specifying program analyses and optimizations, designed for library authors and users. These analyses and optimizations can be based on the implementation of a particular library, its use in a specific program, or on the properties of a broad range of types, expressed through concepts. The new system is intended to provide a high level of expressiveness, even though the intended users are unlikely to be compiler experts.« less

Engineering low-temperature expression systems for heterologous production of cold-adapted enzymes.

PubMed

Bjerga, Gro Elin Kjæreng; Lale, Rahmi; Williamson, Adele Kim

2016-01-01

Production of psychrophilic enzymes in the commonly used mesophilic expression systems is hampered by low intrinsic stability of the recombinant enzymes at the optimal host growth temperatures. Unless strategies for low-temperature expression are advanced, research on psychrophilic enzymes may end up being biased toward those that can be stably produced in commonly used mesophilic host systems. Two main strategies are currently being explored for the development of low-temperature expression in bacterial hosts: (i) low-temperature adaption of existing mesophilic expression systems, and (ii) development of new psychrophilic hosts. These developments include genetic engineering of the expression cassettes to optimize the promoter/operator systems that regulate heterologous expression. In this addendum we present our efforts in the development of such low-temperature expression systems, and speculate about future advancements in the field and potential applications.

Dynamic optimization of metabolic networks coupled with gene expression.

PubMed

Waldherr, Steffen; Oyarzún, Diego A; Bockmayr, Alexander

2015-01-21

The regulation of metabolic activity by tuning enzyme expression levels is crucial to sustain cellular growth in changing environments. Metabolic networks are often studied at steady state using constraint-based models and optimization techniques. However, metabolic adaptations driven by changes in gene expression cannot be analyzed by steady state models, as these do not account for temporal changes in biomass composition. Here we present a dynamic optimization framework that integrates the metabolic network with the dynamics of biomass production and composition. An approximation by a timescale separation leads to a coupled model of quasi-steady state constraints on the metabolic reactions, and differential equations for the substrate concentrations and biomass composition. We propose a dynamic optimization approach to determine reaction fluxes for this model, explicitly taking into account enzyme production costs and enzymatic capacity. In contrast to the established dynamic flux balance analysis, our approach allows predicting dynamic changes in both the metabolic fluxes and the biomass composition during metabolic adaptations. Discretization of the optimization problems leads to a linear program that can be efficiently solved. We applied our algorithm in two case studies: a minimal nutrient uptake network, and an abstraction of core metabolic processes in bacteria. In the minimal model, we show that the optimized uptake rates reproduce the empirical Monod growth for bacterial cultures. For the network of core metabolic processes, the dynamic optimization algorithm predicted commonly observed metabolic adaptations, such as a diauxic switch with a preference ranking for different nutrients, re-utilization of waste products after depletion of the original substrate, and metabolic adaptation to an impending nutrient depletion. These examples illustrate how dynamic adaptations of enzyme expression can be predicted solely from an optimization principle. Copyright © 2014 Elsevier Ltd. All rights reserved.

Protein expression of preferred human codon-optimized Gaussia luciferase genes with an artificial open-reading frame in mammalian and bacterial cells.

PubMed

Inouye, Satoshi; Suzuki, Takahiro

2016-12-01

The protein expressions of three preferred human codon-optimized Gaussia luciferase genes (pGLuc, EpGLuc, and KpGLuc) were characterized in mammalian and bacterial cells by comparing them with those of wild-type Gaussia luciferase gene (wGLuc) and human codon-optimized Gaussia luciferase gene (hGLuc). Two synthetic genes of EpGLuc and KpGLuc containing the complete preferred human codons have an artificial open-reading frame; however, they had the similar protein expression levels to those of pGLuc and hGLuc in mammalian cells. In bacterial cells, the protein expressions of pGLuc, EpGLuc, and KpGLuc with approximately 65% GC content were the same and showed approximately 60% activities of wGLuc and hGLuc. The artificial open-reading frame in EpGLuc and KpGLuc did not affect the protein expression in mammalian and bacterial cells. Copyright © 2016 Elsevier Inc. All rights reserved.

Optimization of the production and purification processes of carnobacteriocins Cbn BM1 and Cbn B2 from Carnobacterium maltaromaticum CP5 by heterologous expression in Escherichia coli.

PubMed

Jasniewski, Jordane; Cailliez-Grimal, Catherine; Gelhaye, Eric; Revol-Junelles, Anne-Marie

2008-04-01

An optimization of the production and purification processes of carnobacteriocins Cbn BM1 and Cbn B2 from Carnobacterium maltaromaticum CP5, by heterologous expression in Escherichia coli is described. The genes encoding mature bacteriocin were cloned into an E. coli expression system and expressed as a fusion protein with a thermostable thioredoxin. Recombinant E. coli were cultivated following a fed-batch fermentation process with pH, temperature and oxygenation regulation. The overexpression of the fusion proteins was improved by replacing IPTG by lactose. The fusion proteins were purified by thermal coagulation followed by affinity chromatography. The thioredoxin fusion protein was removed by using CNBr instead of enterokinase and the carnobacteriocins were recovered by reverse-phase chromatography. These optimizations led us to produce up to 320 mg of pure protein per liter of culture, which is four to ten fold higher than what is described for other heterologous expression systems.

On the Probabilistic Deployment of Smart Grid Networks in TV White Space.

PubMed

Cacciapuoti, Angela Sara; Caleffi, Marcello; Paura, Luigi

2016-05-10

To accommodate the rapidly increasing demand for wireless broadband communications in Smart Grid (SG) networks, research efforts are currently ongoing to enable the SG networks to utilize the TV spectrum according to the Cognitive Radio paradigm. To this aim, in this letter, we develop an analytical framework for the optimal deployment of multiple closely-located SG Neighborhood Area Networks (NANs) concurrently using the same TV spectrum. The objective is to derive the optimal values for both the number of NANs and their coverage. More specifically, regarding the number of NANs, we derive the optimal closed-form expression, i.e., the closed-form expression that assures the deployment of the maximum number of NANs in the considered region satisfying a given collision constraint on the transmissions of the NANs. Regarding the NAN coverage, we derive the optimal closed-form expression, i.e., the closed-form expression of the NAN transmission range that assures the maximum coverage of each NAN in the considered region satisfying the given collision constraint. All the theoretical results are derived by adopting a stochastic approach. Finally, numerical results validate the theoretical analysis.

Converging Towards the Optimal Path to Extinction

DTIC Science & Technology

2011-01-01

the reproductive rate R0 should be greater than but very close to 1. However, most real diseases have R0 larger than 1.5, which translates into a...can analytically find an expression for the action along the optimal path. The expression for the action is a function of k and the reproductive number...the optimal path for a range of values of the reproductive number R0. In contrast to the prior two examples, here the action must be computed

Putative carotenoid genes expressed under the regulation of Shine-Dalgarno regions in Escherichia coli for efficient lycopene production.

PubMed

Jin, Weiyue; Xu, Xian; Jiang, Ling; Zhang, Zhidong; Li, Shuang; Huang, He

2015-11-01

Putative genes crtE, crtB, and crtI from Deinococcus wulumiqiensis R12, a novel species, were identified by genome mining and were co-expressed using the optimized Shine-Dalgarno (SD) regions to improve lycopene yield. A lycopene biosynthesis pathway was constructed by co-expressing these three genes in Escherichia coli. After optimizing the upstream SD regions and the culture medium, the recombinant strain EDW11 produced 88 mg lycopene g(-1) dry cell wt (780 mg lycopene l(-1)) after 40 h fermentation without IPTG induction, while the strain EDW without optimized SD regions only produced 49 mg lycopene g(-1) dry cell wt (417 mg lycopene l(-1)). Based on the optimization of the upstream SD regions and culture medium, the yield of the strain EDW11 reached a high level during microbial lycopene production until now.

Codon optimization of the adenoviral fiber negatively impacts structural protein expression and viral fitness

NASA Astrophysics Data System (ADS)

Villanueva, Eneko; Martí-Solano, Maria; Fillat, Cristina

2016-06-01

Codon usage adaptation of lytic viruses to their hosts is determinant for viral fitness. In this work, we analyzed the codon usage of adenoviral proteins by principal component analysis and assessed their codon adaptation to the host. We observed a general clustering of adenoviral proteins according to their function. However, there was a significant variation in the codon preference between the host-interacting fiber protein and the rest of structural late phase proteins, with a non-optimal codon usage of the fiber. To understand the impact of codon bias in the fiber, we optimized the Adenovirus-5 fiber to the codon usage of the hexon structural protein. The optimized fiber displayed increased expression in a non-viral context. However, infection with adenoviruses containing the optimized fiber resulted in decreased expression of the fiber and of wild-type structural proteins. Consequently, this led to a drastic reduction in viral release. The insertion of an exogenous optimized protein as a late gene in the adenovirus with the optimized fiber further interfered with viral fitness. These results highlight the importance of balancing codon usage in viral proteins to adequately exploit cellular resources for efficient infection and open new opportunities to regulate viral fitness for virotherapy and vaccine development.

Pathway optimization by re-design of untranslated regions for L-tyrosine production in Escherichia coli

PubMed Central

Cheol Kim, Seong; Eun Min, Byung; Gyu Hwang, Hyun; Woo Seo, Sang; Yeol Jung, Gyoo

2015-01-01

L-tyrosine is a commercially important compound in the food, pharmaceutical, chemical, and cosmetic industries. Although several attempts have been made to improve L-tyrosine production, translation-level expression control and carbon flux rebalancing around phosphoenolpyruvate (PEP) node still remain to be achieved for optimizing the pathway. Here, we demonstrate pathway optimization by altering gene expression levels for L-tyrosine production in Escherichia coli. To optimize the L-tyrosine biosynthetic pathway, a synthetic constitutive promoter and a synthetic 5′-untranslated region (5′-UTR) were introduced for each gene of interest to allow for control at both transcription and translation levels. Carbon flux rebalancing was achieved by controlling the expression level of PEP synthetase using UTR Designer. The L-tyrosine productivity of the engineered E. coli strain was increased through pathway optimization resulting in 3.0 g/L of L-tyrosine titer, 0.0354 g L-tyrosine/h/g DCW of productivity, and 0.102 g L-tyrosine/g glucose yield. Thus, this work demonstrates that pathway optimization by 5′-UTR redesign is an effective strategy for the development of efficient L-tyrosine-producing bacteria. PMID:26346938

Production of human interferon alfa 2b in plants of Nicotiana excelsior by Agrobacterium-mediated transient expression.

PubMed

Sindarovska, Y R; Gerasymenko, I M; Sheludko, Y V; Olevinskaya, Z M; Spivak, N Y; Kuchuk, N V

2010-01-01

Human interferon alpha2b gene was transiently expressed in Nicotiana excelsior plants. Fusion with N. plumbaginifolia calreticulin signal peptide for improved apoplast targeting and carrying out the expression under optimized conditions resulted in maximal interferon activity of 3.2 x 10(3) IU/g fresh weight (FW) with an average of 2.1 +/- 0.8 x 10(3) IU/g FW. It proves that N. excelsior is a suitable host for Agrobacterium-mediated transient expression of genes encoding physiologically active human proteins. The transient expression conditions optimized for GFP marker protein were confirmed to be preferable for hIFN alpha2b.

Optimal control, optimization and asymptotic analysis of Purcell's microswimmer model

NASA Astrophysics Data System (ADS)

Wiezel, Oren; Or, Yizhar

2016-11-01

Purcell's swimmer (1977) is a classic model of a three-link microswimmer that moves by performing periodic shape changes. Becker et al. (2003) showed that the swimmer's direction of net motion is reversed upon increasing the stroke amplitude of joint angles. Tam and Hosoi (2007) used numerical optimization in order to find optimal gaits for maximizing either net displacement or Lighthill's energetic efficiency. In our work, we analytically derive leading-order expressions as well as next-order corrections for both net displacement and energetic efficiency of Purcell's microswimmer. Using these expressions enables us to explicitly show the reversal in direction of motion, as well as obtaining an estimate for the optimal stroke amplitude. We also find the optimal swimmer's geometry for maximizing either displacement or energetic efficiency. Additionally, the gait optimization problem is revisited and analytically formulated as an optimal control system with only two state variables, which can be solved using Pontryagin's maximum principle. It can be shown that the optimal solution must follow a "singular arc". Numerical solution of the boundary value problem is obtained, which exactly reproduces Tam and Hosoi's optimal gait.

PD-1 or PD-L1 Blockade Restores Antitumor Efficacy Following SSX2 Epitope-Modified DNA Vaccine Immunization.

PubMed

Rekoske, Brian T; Smith, Heath A; Olson, Brian M; Maricque, Brett B; McNeel, Douglas G

2015-08-01

DNA vaccines have demonstrated antitumor efficacy in multiple preclinical models, but low immunogenicity has been observed in several human clinical trials. This has led to many approaches seeking to improve the immunogenicity of DNA vaccines. We previously reported that a DNA vaccine encoding the cancer-testis antigen SSX2, modified to encode altered epitopes with increased MHC class I affinity, elicited a greater frequency of cytolytic, multifunctional CD8(+) T cells in non-tumor-bearing mice. We sought to test whether this optimized vaccine resulted in increased antitumor activity in mice bearing an HLA-A2-expressing tumor engineered to express SSX2. We found that immunization of tumor-bearing mice with the optimized vaccine elicited a surprisingly inferior antitumor effect relative to the native vaccine. Both native and optimized vaccines led to increased expression of PD-L1 on tumor cells, but antigen-specific CD8(+) T cells from mice immunized with the optimized construct expressed higher PD-1. Splenocytes from immunized animals induced PD-L1 expression on tumor cells in vitro. Antitumor activity of the optimized vaccine could be increased when combined with antibodies blocking PD-1 or PD-L1, or by targeting a tumor line not expressing PD-L1. These findings suggest that vaccines aimed at eliciting effector CD8(+) T cells, and DNA vaccines in particular, might best be combined with PD-1 pathway inhibitors in clinical trials. This strategy may be particularly advantageous for vaccines targeting prostate cancer, a disease for which antitumor vaccines have demonstrated clinical benefit and yet PD-1 pathway inhibitors alone have shown little efficacy to date. ©2015 American Association for Cancer Research.

Expression of chicken parvovirus VP2 in chicken embryo fibroblasts requires codon optimization for production of naked DNA and vectored meleagrid herpesvirus type 1 vaccines.

PubMed

Spatz, Stephen J; Volkening, Jeremy D; Mullis, Robert; Li, Fenglan; Mercado, John; Zsak, Laszlo

2013-10-01

Meleagrid herpesvirus type 1 (MeHV-1) is an ideal vector for the expression of antigens from pathogenic avian organisms in order to generate vaccines. Chicken parvovirus (ChPV) is a widespread infectious virus that causes serious disease in chickens. It is one of the etiological agents largely suspected in causing Runting Stunting Syndrome (RSS) in chickens. Initial attempts to express the wild-type gene encoding the capsid protein VP2 of ChPV by insertion into the thymidine kinase gene of MeHV-1 were unsuccessful. However, transient expression of a codon-optimized synthetic VP2 gene cloned into the bicistronic vector pIRES2-Ds-Red2, could be demonstrated by immunocytochemical staining of transfected chicken embryo fibroblasts (CEFs). Red fluorescence could also be detected in these transfected cells since the red fluorescent protein gene is downstream from the internal ribosome entry site (IRES). Strikingly, fluorescence could not be demonstrated in cells transiently transfected with the bicistronic vector containing the wild-type or non-codon-optimized VP2 gene. Immunocytochemical staining of these cells also failed to demonstrate expression of wild-type VP2, indicating that the lack of expression was at the RNA level and the VP2 protein was not toxic to CEFs. Chickens vaccinated with a DNA vaccine consisting of the bicistronic vector containing the codon-optimized VP2 elicited a humoral immune response as measured by a VP2-specific ELISA. This VP2 codon-optimized bicistronic cassette was rescued into the MeHV-1 genome generating a vectored vaccine against ChPV disease.

Expression and Activity Analysis of Fructosyltransferase from Aspergillus oryzae.

PubMed

Guan, Lihong; Chen, Liping; Chen, Yongsen; Zhang, Nu; Han, Yawei

2017-08-01

The fructosyltransferase gene was isolated and cloned from Aspergillus oryzae. The gene was 1368 bp, which encoded a protein of 455 amino acids. To analyze the activity of the expressed fructosyltransferase, the pET32a-fructosyltransferase recombined plasmid was transformed into Escherichia coli BL21. The fructosyltransferase gene was successfully expressed by Isopropyl-β-d-thiogalactoside (IPTG) induction. The molecular weight of the expression protein was about 45 kDa. The optimal conditions of protein expression were 25 °C, 0.1 mM IPTG, and 8 h of inducing time. The optimal concentration of urea dealing with inclusion body was 2.5 M. The expressed protein exhibited a strong fructosyl transfer activity. These results showed that the expressed fructosyltransferas owned transferase activity, and could catalyze the synthesis of sucrose-6-acetate.

P and M gene junction is the optimal insertion site in Newcastle disease virus vaccine vector for foreign gene expression

USDA-ARS?s Scientific Manuscript database

Newcastle disease virus (NDV) has been developed as a vector for vaccine and gene therapy purposes. However, the optimal insertion site for foreign gene expression remained to be determined. In the present study, we inserted the green fluorescence protein (GFP) gene into five different intergenic ...

Minimal doses of a sequence-optimized transgene mediate high-level and long-term EPO expression in vivo: challenging CpG-free gene design.

PubMed

Kosovac, D; Wild, J; Ludwig, C; Meissner, S; Bauer, A P; Wagner, R

2011-02-01

Advanced gene delivery techniques can be combined with rational gene design to further improve the efficiency of plasmid DNA (pDNA)-mediated transgene expression in vivo. Herein, we analyzed the influence of intragenic sequence modifications on transgene expression in vitro and in vivo using murine erythropoietin (mEPO) as a transgene model. A single electro-gene transfer of an RNA- and codon-optimized mEPOopt gene into skeletal muscle resulted in a 3- to 4-fold increase of mEPO production sustained for >1 year and triggered a significant increase in hematocrit and hemoglobin without causing adverse effects. mEPO expression and hematologic levels were significantly lower when using comparable amounts of the wild type (mEPOwt) gene and only marginal effects were induced by mEPOΔCpG lacking intragenic CpG dinucleotides, even at high pDNA amounts. Corresponding with these observations, in vitro analysis of transfected cells revealed a 2- to 3-fold increased (mEPOopt) and 50% decreased (mEPOΔCpG) erythropoietin expression compared with mEPOwt, respectively. RNA analyses demonstrated that the specific design of the transgene sequence influenced expression levels by modulating transcriptional activity and nuclear plus cytoplasmic RNA amounts rather than translation. In sum, whereas CpG depletion negatively interferes with efficient expression in postmitotic tissues, mEPOopt doses <0.5 μg were sufficient to trigger optimal long-term hematologic effects encouraging the use of sequence-optimized transgenes to further reduce effective pDNA amounts.

Effect of codon optimization and subcellular targeting on Toxoplasma gondii antigen SAG1 expression in tobacco leaves to use in subcutaneous and oral immunization in mice.

PubMed

Laguía-Becher, Melina; Martín, Valentina; Kraemer, Mauricio; Corigliano, Mariana; Yacono, María L; Goldman, Alejandra; Clemente, Marina

2010-07-15

Codon optimization and subcellular targeting were studied with the aim to increase the expression levels of the SAG178-322 antigen of Toxoplasma gondii in tobacco leaves. The expression of the tobacco-optimized and native versions of the SAG1 gene was explored by transient expression from the Agrobacterium tumefaciens binary expression vector, which allows targeting the recombinant protein to the endoplasmic reticulum (ER) and the apoplast. Finally, mice were subcutaneously and orally immunized with leaf extracts-SAG1 and the strategy of prime boost with rSAG1 expressed in Escherichia coli was used to optimize the oral immunization with leaf extracts-SAG1. Leaves agroinfiltrated with an unmodified SAG1 gene accumulated 5- to 10-fold more than leaves agroinfiltrated with a codon-optimized SAG1 gene. ER localization allowed the accumulation of higher levels of native SAG1. However, no significant differences were observed between the mRNA accumulations of the different versions of SAG1. Subcutaneous immunization with leaf extracts-SAG1 (SAG1) protected mice against an oral challenge with a non-lethal cyst dose, and this effect could be associated with the secretion of significant levels of IFN-gamma. The protection was increased when mice were ID boosted with rSAG1 (SAG1+boost). This group elicited a significant Th1 humoral and cellular immune response characterized by high levels of IFN-gamma. In an oral immunization assay, the SAG1+boost group showed a significantly lower brain cyst burden compared to the rest of the groups. Transient agroinfiltration was useful for the expression of all of the recombinant proteins tested. Our results support the usefulness of endoplasmic reticulum signal peptides in enhancing the production of recombinant proteins meant for use as vaccines. The results showed that this plant-produced protein has potential for use as vaccine and provides a potential means for protecting humans and animals against toxoplasmosis.

Optimization of hCFTR Lung Expression in Mice Using DNA Nanoparticles

PubMed Central

Padegimas, Linas; Kowalczyk, Tomasz H; Adams, Sam; Gedeon, Chris R; Oette, Sharon M; Dines, Karla; Hyatt, Susannah L; Sesenoglu-Laird, Ozge; Tyr, Olena; Moen, Robert C; Cooper, Mark J

2012-01-01

Efficient and prolonged human cystic fibrosis transmembrane conductance regulator (hCFTR) expression is a major goal for cystic fibrosis (CF) lung therapy. A hCFTR expression plasmid was optimized as a payload for compacted DNA nanoparticles formulated with polyethylene glycol (PEG)-substituted 30-mer lysine peptides. A codon-optimized and CpG-reduced hCFTR synthetic gene (CO-CFTR) was placed in a polyubiquitin C expression plasmid. Compared to hCFTR complementary DNA (cDNA), CO-CFTR produced a ninefold increased level of hCFTR protein in transfected HEK293 cells and, when compacted as DNA nanoparticles, produced a similar improvement in lung mRNA expression in Balb/c and fatty acid binding protein promoter (FABP) CF mice, although expression duration was transient. Various vector modifications were tested to extend duration of CO-CFTR expression. A novel prolonged expression (PE) element derived from the bovine growth hormone (BGH) gene 3′ flanking sequence produced prolonged expression of CO-CFTR mRNA at biologically relevant levels. A time course study in the mouse lung revealed that CO-CFTR mRNA did not change significantly, with CO-CFTR/mCFTR geometric mean ratios of 94% on day 2, 71% on day 14, 53% on day 30, and 14% on day 59. Prolonged CO-CFTR expression is dependent on the orientation of the PE element and its transcription, is not specific to the UbC promoter, and is less dependent on other vector backbone elements. PMID:21952168

On optimal infinite impulse response edge detection filters

NASA Technical Reports Server (NTRS)

Sarkar, Sudeep; Boyer, Kim L.

1991-01-01

The authors outline the design of an optimal, computationally efficient, infinite impulse response edge detection filter. The optimal filter is computed based on Canny's high signal to noise ratio, good localization criteria, and a criterion on the spurious response of the filter to noise. An expression for the width of the filter, which is appropriate for infinite-length filters, is incorporated directly in the expression for spurious responses. The three criteria are maximized using the variational method and nonlinear constrained optimization. The optimal filter parameters are tabulated for various values of the filter performance criteria. A complete methodology for implementing the optimal filter using approximating recursive digital filtering is presented. The approximating recursive digital filter is separable into two linear filters operating in two orthogonal directions. The implementation is very simple and computationally efficient, has a constant time of execution for different sizes of the operator, and is readily amenable to real-time hardware implementation.

Optimizing heat shock protein expression induced by prostate cancer laser therapy through predictive computational models

NASA Astrophysics Data System (ADS)

Rylander, Marissa N.; Feng, Yusheng; Zhang, Yongjie; Bass, Jon; Stafford, Roger J.; Hazle, John D.; Diller, Kenneth R.

2006-07-01

Thermal therapy efficacy can be diminished due to heat shock protein (HSP) induction in regions of a tumor where temperatures are insufficient to coagulate proteins. HSP expression enhances tumor cell viability and imparts resistance to chemotherapy and radiation treatments, which are generally employed in conjunction with hyperthermia. Therefore, an understanding of the thermally induced HSP expression within the targeted tumor must be incorporated into the treatment plan to optimize the thermal dose delivery and permit prediction of the overall tissue response. A treatment planning computational model capable of predicting the temperature, HSP27 and HSP70 expression, and damage fraction distributions associated with laser heating in healthy prostate tissue and tumors is presented. Measured thermally induced HSP27 and HSP70 expression kinetics and injury data for normal and cancerous prostate cells and prostate tumors are employed to create the first HSP expression predictive model and formulate an Arrhenius damage model. The correlation coefficients between measured and model predicted temperature, HSP27, and HSP70 were 0.98, 0.99, and 0.99, respectively, confirming the accuracy of the model. Utilization of the treatment planning model in the design of prostate cancer thermal therapies can enable optimization of the treatment outcome by controlling HSP expression and injury.

Genome-wide characterization and selection of expressed sequence tag simple sequence repeat primers for optimized marker distribution and reliability in peach

USDA-ARS?s Scientific Manuscript database

Expressed sequence tag (EST) simple sequence repeats (SSRs) in Prunus were mined, and flanking primers designed and used for genome-wide characterization and selection of primers to optimize marker distribution and reliability. A total of 12,618 contigs were assembled from 84,727 ESTs, along with 34...

Framework for the rapid optimization of soluble protein expression in Escherichia coli combining microscale experiments and statistical experimental design.

PubMed

Islam, R S; Tisi, D; Levy, M S; Lye, G J

2007-01-01

A major bottleneck in drug discovery is the production of soluble human recombinant protein in sufficient quantities for analysis. This problem is compounded by the complex relationship between protein yield and the large number of variables which affect it. Here, we describe a generic framework for the rapid identification and optimization of factors affecting soluble protein yield in microwell plate fermentations as a prelude to the predictive and reliable scaleup of optimized culture conditions. Recombinant expression of firefly luciferase in Escherichia coli was used as a model system. Two rounds of statistical design of experiments (DoE) were employed to first screen (D-optimal design) and then optimize (central composite face design) the yield of soluble protein. Biological variables from the initial screening experiments included medium type and growth and induction conditions. To provide insight into the impact of the engineering environment on cell growth and expression, plate geometry, shaking speed, and liquid fill volume were included as factors since these strongly influence oxygen transfer into the wells. Compared to standard reference conditions, both the screening and optimization designs gave up to 3-fold increases in the soluble protein yield, i.e., a 9-fold increase overall. In general the highest protein yields were obtained when cells were induced at a relatively low biomass concentration and then allowed to grow slowly up to a high final biomass concentration, >8 g.L-1. Consideration and analysis of the model results showed 6 of the original 10 variables to be important at the screening stage and 3 after optimization. The latter included the microwell plate shaking speeds pre- and postinduction, indicating the importance of oxygen transfer into the microwells and identifying this as a critical parameter for subsequent scale translation studies. The optimization process, also known as response surface methodology (RSM), predicted there to be a distinct optimum set of conditions for protein expression which could be verified experimentally. This work provides a generic approach to protein expression optimization in which both biological and engineering variables are investigated from the initial screening stage. The application of DoE reduces the total number of experiments needed to be performed, while experimentation at the microwell scale increases experimental throughput and reduces cost.

Optimization of thermophilic trans-isoprenyl diphosphate synthase expression in Escherichia coli by response surface methodology.

PubMed

Piccolomini, Angelica A; Fiabon, Alex; Borrotti, Matteo; De Lucrezia, Davide

2017-01-01

We optimized the heterologous expression of trans-isoprenyl diphosphate synthase (IDS), the key enzyme involved in the biosynthesis of trans-polyisoprene. trans-Polyisoprene is a particularly valuable compound due to its superior stiffness, excellent insulation, and low thermal expansion coefficient. Currently, trans-polyisoprene is mainly produced through chemical synthesis and no biotechnological processes have been established so far for its large-scale production. In this work, we employed D-optimal design and response surface methodology to optimize the expression of thermophilic enzymes IDS from Thermococcus kodakaraensis. The design of experiment took into account of six factors (preinduction cell density, inducer concentration, postinduction temperature, salt concentration, alternative carbon source, and protein inhibitor) and seven culture media (LB, NZCYM, TB, M9, Ec, Ac, and EDAVIS) at five different pH points. By screening only 109 experimental points, we were able to improve IDS production by 48% in close-batch fermentation. © 2015 International Union of Biochemistry and Molecular Biology, Inc.

Optimal aggregation of binary classifiers for multiclass cancer diagnosis using gene expression profiles.

PubMed

Yukinawa, Naoto; Oba, Shigeyuki; Kato, Kikuya; Ishii, Shin

2009-01-01

Multiclass classification is one of the fundamental tasks in bioinformatics and typically arises in cancer diagnosis studies by gene expression profiling. There have been many studies of aggregating binary classifiers to construct a multiclass classifier based on one-versus-the-rest (1R), one-versus-one (11), or other coding strategies, as well as some comparison studies between them. However, the studies found that the best coding depends on each situation. Therefore, a new problem, which we call the "optimal coding problem," has arisen: how can we determine which coding is the optimal one in each situation? To approach this optimal coding problem, we propose a novel framework for constructing a multiclass classifier, in which each binary classifier to be aggregated has a weight value to be optimally tuned based on the observed data. Although there is no a priori answer to the optimal coding problem, our weight tuning method can be a consistent answer to the problem. We apply this method to various classification problems including a synthesized data set and some cancer diagnosis data sets from gene expression profiling. The results demonstrate that, in most situations, our method can improve classification accuracy over simple voting heuristics and is better than or comparable to state-of-the-art multiclass predictors.

Optimality of cycle time and inventory decisions in a two echelon inventory system with exponential price dependent demand under credit period

NASA Astrophysics Data System (ADS)

Krugon, Seelam; Nagaraju, Dega

2017-05-01

This work describes and proposes an two echelon inventory system under supply chain, where the manufacturer offers credit period to the retailer with exponential price dependent demand. The model is framed as demand is expressed as exponential function of retailer’s unit selling price. Mathematical model is framed to demonstrate the optimality of cycle time, retailer replenishment quantity, number of shipments, and total relevant cost of the supply chain. The major objective of the paper is to provide trade credit concept from the manufacturer to the retailer with exponential price dependent demand. The retailer would like to delay the payments of the manufacturer. At the first stage retailer and manufacturer expressions are expressed with the functions of ordering cost, carrying cost, transportation cost. In second stage combining of the manufacturer and retailer expressions are expressed. A MATLAB program is written to derive the optimality of cycle time, retailer replenishment quantity, number of shipments, and total relevant cost of the supply chain. From the optimality criteria derived managerial insights can be made. From the research findings, it is evident that the total cost of the supply chain is decreased with the increase in credit period under exponential price dependent demand. To analyse the influence of the model parameters, parametric analysis is also done by taking with help of numerical example.

Structural optimization of large structural systems by optimality criteria methods

NASA Technical Reports Server (NTRS)

Berke, Laszlo

1992-01-01

The fundamental concepts of the optimality criteria method of structural optimization are presented. The effect of the separability properties of the objective and constraint functions on the optimality criteria expressions is emphasized. The single constraint case is treated first, followed by the multiple constraint case with a more complex evaluation of the Lagrange multipliers. Examples illustrate the efficiency of the method.

Optimization of multi-epitopic HIV-1 recombinant protein expression in prokaryote system and conjugation to mouse DEC-205 monoclonal antibody: implication for in-vivo targeted delivery of dendritic cells

PubMed Central

Rahimi, Roghayeh; Ebtekar, Massoumeh; Moazzeni, Seyed Mohammad; Mostafaie, Ali; Mahdavi, Mehdi

2015-01-01

Objective(s): Multi-epitopic protein vaccines and direction of vaccine delivery to dendritic cells (DCs) are promising approaches for enhancing immune responses against mutable pathogens. Escherichia coli is current host for expression of recombinant proteins, and it is important to optimize expression condition. The aim of this study was the optimization of multi-epitopic HIV-1 tat/pol/gag/env recombinant protein (HIVtop4) expression by E. coli and conjugation of purified protein to anti DEC-205 monoclonal antibody as candidate vaccine. Materials and Methods: In this study, expression was induced in BL21 (DE3) E. coli cells by optimization of induction condition, post induction incubation time, temperature and culture medium formula. Some culture mediums were used for cell culture, and isopropyl-beta-D-thiogalactopyranoside was used for induction of expression. Protein was purified by Ni-NTA column chromatography and confirmed against anti-His antibody in western-blotting. To exploit DCs properties for immunization purposes, recombinant protein chemically coupled to αDEC-205 monoclonal antibody and confirmed against anti-His antibody in western-blotting. Results: The optimum condition for expression was 1 mM IPTG during 4 hr cultures in 2XYT medium, and final protein produced in soluble form. Conjugation of purified protein to αDEC-205 antibody resulted in smears of protein: antibodies conjugate in different molecular weights. Conclusion: The best cultivation condition for production of HIVtop4 protein is induction by 1 mM IPTG during 4 hr in 2XYT medium. The final concentration of purified protein was 500 µg/ml. PMID:25810888

Ribosomal binding site sequences and promoters for expressing glutamate decarboxylase and producing γ-aminobutyrate in Corynebacterium glutamicum.

PubMed

Shi, Feng; Luan, Mingyue; Li, Yongfu

2018-04-18

Glutamate decarboxylase (GAD) converts L-glutamate (Glu) into γ-aminobutyric acid (GABA). Corynebacterium glutamicum that expresses exogenous GAD gene, gadB2 or gadB1, can synthesize GABA from its own produced Glu. To enhance GABA production in C. glutamicum, ribosomal binding site (RBS) sequence and promoter were searched and optimized for increasing the expression efficiency of gadB2. R4 exhibited the highest strength among RBS sequences tested, with 6 nt the optimal aligned spacing (AS) between RBS and start codon. This combination of RBS sequence and AS contributed to gadB2 expression, increased GAD activity by 156% and GABA production by 82% compared to normal strong RBS and AS combination. Then, a series of native promoters were selected for transcribing gadB2 under optimal RBS and AS combination. P dnaK , P dtsR , P odhI and P clgR expressed gadB2 and produced GABA as effectively as widely applied P tuf and P cspB promoters and more effectively than P sod promoter. However, each native promoter did not work as well as the synthetic strong promoter P tacM , which produced 20.2 ± 0.3 g/L GABA. Even with prolonged length and bicistronic architecture, the strength of P dnaK did not enhance. Finally, gadB2 and mutant gadB1 were co-expressed under the optimal promoter and RBS combination, thus converted Glu into GABA completely and improved GABA production to more than 25 g/L. This study provides useful promoters and RBS sequences for gene expression in C. glutamicum.

[Modulating expression of key genes within β-carotene synthetic pathway in recombinant Escherichia coli with RBS library to improve β-carotene production].

PubMed

Dai, Guanping; Sun, Tao; Miao, Liangtian; Li, Qingyan; Xiao, Dongguang; Zhang, Xueli

2014-08-01

β-carotene belongs to carotenoids family, widely applied in pharmaceuticals, neutraceuticals, cosmetics and food industries. In this study, three key genes (dxs, idi, and crt operon) within β-carotene synthetic pathway in recombinant Escherichia coli strain CAR005 were modulated with RBS Library to improve β-carotene production. There were 7%, 11% and 17% increase of β-carotene yield respectively after modulating dxs, idi and crt operon genes with RBS Library, demonstrating that modulating gene expression with regulatory parts libraries would have more opportunities to obtain optimal production of target compound. Combined modulation of crt operon, dxs and idi genes led to 35% increase of β-carotene yield compared to parent strain CAR005. The optimal gene expression strength identified in single gene modulation would not be the optimal strength when used in combined modulation. Our study provides a new strategy for improving production of target compound through modulation of gene expression.

Optimization of culturing conditions of recombined Escherichia coli to produce umami octopeptide-containing protein.

PubMed

Zhang, Yin; Wei, Xiong; Lu, Zhou; Pan, Zhongli; Gou, Xinhua; Venkitasamy, Chandrasekar; Guo, Siya; Zhao, Liming

2017-07-15

Using synthesized peptides to verify the taste of natural peptides was probably the leading cause for tasting disputes regarding umami peptides. A novel method was developed to prepare the natural peptide which could be used to verify the taste of umami peptide. A controversial octopeptide was selected and gene engineering was used to structure its Escherichia coli. expressing vector. A response surface method was adopted to optimize the expression conditions of the recombinant protein. The results of SDS-PAGE for the recombinant protein indicated that the recombinant expression system was successfully structured. The fitting results of the response surface experiment showed that the OD 600 value was the key factor which influenced the expression of the recombinant protein. The optimal culturing process conditions predicted with the fitting model were an OD 600 value of 0.5, an IPTG concentration of 0.6mM, a culturing temperature of 28.75°C and a culturing time of 5h. Copyright © 2017 Elsevier Ltd. All rights reserved.

Optimized expression of prolyl aminopeptidase in Pichia pastoris and its characteristics after glycosylation.

PubMed

Yang, Hongyu; Zhu, Qiang; Zhou, Nandi; Tian, Yaping

2016-11-01

Prolyl aminopeptidases are specific exopeptidases that catalyze the hydrolysis of the N-terminus proline residue of peptides and proteins. In the present study, the prolyl aminopeptidase gene (pap) from Aspergillus oryzae JN-412 was optimized through the codon usage of Pichia pastoris. Both the native and optimized pap genes were inserted into the expression vector pPIC9 K and were successfully expressed in P. pastoris. Additionally, the activity of the intracellular enzyme expressed by the recombinant optimized pap gene reached 61.26 U mL(-1), an activity that is 2.1-fold higher than that of the native gene. The recombinant enzyme was purified by one-step elution through Ni-affinity chromatography. The optimal temperature and pH of the purified PAP were 60 °C and 7.5, respectively. Additionally, the recombinant PAP was recovered at a yield greater than 65 % at an extremely broad range of pH values from 6 to 10 after treatment at 50 °C for 6 h. The molecular weight of the recombinant PAP decreased from 50 kDa to 48 kDa after treatment with a deglycosylation enzyme, indicating that the recombinant PAP was completely glycosylated. The glycosylated PAP exhibited high thermo-stability. Half of the activity remained after incubation at 50 °C for 50 h, whereas the remaining activity of PAP expressed in E. coli was only 10 % after incubation at 50 °C for 1 h. PAP could be activated by the appropriate salt concentration and exhibited salt tolerance against NaCl at a concentration up to 5 mol L(-1).

Strategies to optimize capsid protein expression and single-stranded DNA formation of adeno-associated virus in Saccharomyces cerevisiae.

PubMed

Galli, A; Della Latta, V; Bologna, C; Pucciarelli, D; Cipriani, F; Backovic, A; Cervelli, T

2017-08-01

Adeno-associated virus type 2 (AAV) is a nonpathogenic parvovirus that is a promising tool for gene therapy. We aimed to construct plasmids for optimal expression and assembly of capsid proteins and evaluate adenovirus (Ad) protein effect on AAV single-stranded DNA (ssDNA) formation in Saccharomyces cerevisiae. Yeast expression plasmids have been developed in which the transcription of AAV capsid proteins (VP1,2,3) is driven by the constitutive ADH1 promoter or galactose-inducible promoters. Optimal VP1,2,3 expression was obtained from GAL1/10 bidirectional promoter. Moreover, we demonstrated that AAP is expressed in yeast and virus-like particles (VLPs) assembled inside the cell. Finally, the expression of two Ad proteins, E4orf6 and E1b55k, had no effect on AAV ssDNA formation. This study confirms that yeast is able to form AAV VLPs; however, capsid assembly and ssDNA formation are less efficient in yeast than in human cells. Moreover, the expression of Ad proteins did not affect AAV ssDNA formation. New manufacturing strategies for AAV-based gene therapy vectors (rAAV) are needed to reduce costs and time of production. Our study explores the feasibility of yeast as alternative system for rAAV production. © 2017 The Society for Applied Microbiology.

Optimal faces for gender and expression: a new technique for measuring dynamic templates used in face perception.

PubMed

Poirier, Frédéric J A M; Faubert, Jocelyn

2012-06-22

Facial expressions are important for human communications. Face perception studies often measure the impact of major degradation (e.g., noise, inversion, short presentations, masking, alterations) on natural expression recognition performance. Here, we introduce a novel face perception technique using rich and undegraded stimuli. Participants modified faces to create optimal representations of given expressions. Using sliders, participants adjusted 53 face components (including 37 dynamic) including head, eye, eyebrows, mouth, and nose shape and position. Data was collected from six participants and 10 conditions (six emotions + pain + gender + neutral). Some expressions had unique features (e.g., frown for anger, upward-curved mouth for happiness), whereas others had shared features (e.g., open eyes and mouth for surprise and fear). Happiness was different from other emotions. Surprise was different from other emotions except fear. Weighted sum morphing provides acceptable stimuli for gender-neutral and dynamic stimuli. Many features were correlated, including (1) head size with internal feature sizes as related to gender, (2) internal feature scaling, and (3) eyebrow height and eye openness as related to surprise and fear. These findings demonstrate the method's validity for measuring the optimal facial expressions, which we argue is a more direct measure of their internal representations.

Optimization of cDNA microarrays procedures using criteria that do not rely on external standards.

PubMed

Bruland, Torunn; Anderssen, Endre; Doseth, Berit; Bergum, Hallgeir; Beisvag, Vidar; Laegreid, Astrid

2007-10-18

The measurement of gene expression using microarray technology is a complicated process in which a large number of factors can be varied. Due to the lack of standard calibration samples such as are used in traditional chemical analysis it may be a problem to evaluate whether changes done to the microarray procedure actually improve the identification of truly differentially expressed genes. The purpose of the present work is to report the optimization of several steps in the microarray process both in laboratory practices and in data processing using criteria that do not rely on external standards. We performed a cDNA microarry experiment including RNA from samples with high expected differential gene expression termed "high contrasts" (rat cell lines AR42J and NRK52E) compared to self-self hybridization, and optimized a pipeline to maximize the number of genes found to be differentially expressed in the "high contrasts" RNA samples by estimating the false discovery rate (FDR) using a null distribution obtained from the self-self experiment. The proposed high-contrast versus self-self method (HCSSM) requires only four microarrays per evaluation. The effects of blocking reagent dose, filtering, and background corrections methodologies were investigated. In our experiments a dose of 250 ng LNA (locked nucleic acid) dT blocker, no background correction and weight based filtering gave the largest number of differentially expressed genes. The choice of background correction method had a stronger impact on the estimated number of differentially expressed genes than the choice of filtering method. Cross platform microarray (Illumina) analysis was used to validate that the increase in the number of differentially expressed genes found by HCSSM was real. The results show that HCSSM can be a useful and simple approach to optimize microarray procedures without including external standards. Our optimizing method is highly applicable to both long oligo-probe microarrays which have become commonly used for well characterized organisms such as man, mouse and rat, as well as to cDNA microarrays which are still of importance for organisms with incomplete genome sequence information such as many bacteria, plants and fish.

Optimization of cDNA microarrays procedures using criteria that do not rely on external standards

PubMed Central

Bruland, Torunn; Anderssen, Endre; Doseth, Berit; Bergum, Hallgeir; Beisvag, Vidar; Lægreid, Astrid

2007-01-01

Background The measurement of gene expression using microarray technology is a complicated process in which a large number of factors can be varied. Due to the lack of standard calibration samples such as are used in traditional chemical analysis it may be a problem to evaluate whether changes done to the microarray procedure actually improve the identification of truly differentially expressed genes. The purpose of the present work is to report the optimization of several steps in the microarray process both in laboratory practices and in data processing using criteria that do not rely on external standards. Results We performed a cDNA microarry experiment including RNA from samples with high expected differential gene expression termed "high contrasts" (rat cell lines AR42J and NRK52E) compared to self-self hybridization, and optimized a pipeline to maximize the number of genes found to be differentially expressed in the "high contrasts" RNA samples by estimating the false discovery rate (FDR) using a null distribution obtained from the self-self experiment. The proposed high-contrast versus self-self method (HCSSM) requires only four microarrays per evaluation. The effects of blocking reagent dose, filtering, and background corrections methodologies were investigated. In our experiments a dose of 250 ng LNA (locked nucleic acid) dT blocker, no background correction and weight based filtering gave the largest number of differentially expressed genes. The choice of background correction method had a stronger impact on the estimated number of differentially expressed genes than the choice of filtering method. Cross platform microarray (Illumina) analysis was used to validate that the increase in the number of differentially expressed genes found by HCSSM was real. Conclusion The results show that HCSSM can be a useful and simple approach to optimize microarray procedures without including external standards. Our optimizing method is highly applicable to both long oligo-probe microarrays which have become commonly used for well characterized organisms such as man, mouse and rat, as well as to cDNA microarrays which are still of importance for organisms with incomplete genome sequence information such as many bacteria, plants and fish. PMID:17949480

Promoter library-based module combination (PLMC) technology for optimization of threonine biosynthesis in Corynebacterium glutamicum.

PubMed

Wei, Liang; Xu, Ning; Wang, Yiran; Zhou, Wei; Han, Guoqiang; Ma, Yanhe; Liu, Jun

2018-05-01

Due to the lack of efficient control elements and tools, the fine-tuning of gene expression in the multi-gene metabolic pathways is still a great challenge for engineering microbial cell factories, especially for the important industrial microorganism Corynebacterium glutamicum. In this study, the promoter library-based module combination (PLMC) technology was developed to efficiently optimize the expression of genes in C. glutamicum. A random promoter library was designed to contain the putative - 10 (NNTANANT) and - 35 (NNGNCN) consensus motifs, and refined through a three-step screening procedure to achieve numerous genetic control elements with different strength levels, including fluorescence-activated cell sorting (FACS) screening, agar plate screening, and 96-well plate screening. Multiple conventional strategies were employed for further precise characterizations of the promoter library, such as real-time quantitative PCR, sodium dodecyl sulfate polyacrylamide gel electrophoresis, FACS analysis, and the lacZ reporter system. These results suggested that the established promoter elements effectively regulated gene expression and showed varying strengths over a wide range. Subsequently, a multi-module combination technology was created based on the efficient promoter elements for combination and optimization of modules in the multi-gene pathways. Using this technology, the threonine biosynthesis pathway was reconstructed and optimized by predictable tuning expression of five modules in C. glutamicum. The threonine titer of the optimized strain was significantly improved to 12.8 g/L, an approximate 6.1-fold higher than that of the control strain. Overall, the PLMC technology presented in this study provides a rapid and effective method for combination and optimization of multi-gene pathways in C. glutamicum.

The hubris hypothesis: The downside of comparative optimism displays.

PubMed

Hoorens, Vera; Van Damme, Carolien; Helweg-Larsen, Marie; Sedikides, Constantine

2017-04-01

According to the hubris hypothesis, observers respond more unfavorably to individuals who express their positive self-views comparatively than to those who express their positive self-views non-comparatively, because observers infer that the former hold a more disparaging view of others and particularly of observers. Two experiments extended the hubris hypothesis in the domain of optimism. Observers attributed less warmth (but not less competence) to, and showed less interest in affiliating with, an individual displaying comparative optimism (the belief that one's future will be better than others' future) than with an individual displaying absolute optimism (the belief that one's future will be good). Observers responded differently to individuals displaying comparative versus absolute optimism, because they inferred that the former held a gloomier view of the observers' future. Consistent with previous research, observers still attributed more positive traits to a comparative or absolute optimist than to a comparative or absolute pessimist. Copyright © 2016. Published by Elsevier Inc.

Evolutionary conservation of codon optimality reveals hidden signatures of cotranslational folding.

PubMed

Pechmann, Sebastian; Frydman, Judith

2013-02-01

The choice of codons can influence local translation kinetics during protein synthesis. Whether codon preference is linked to cotranslational regulation of polypeptide folding remains unclear. Here, we derive a revised translational efficiency scale that incorporates the competition between tRNA supply and demand. Applying this scale to ten closely related yeast species, we uncover the evolutionary conservation of codon optimality in eukaryotes. This analysis reveals universal patterns of conserved optimal and nonoptimal codons, often in clusters, which associate with the secondary structure of the translated polypeptides independent of the levels of expression. Our analysis suggests an evolved function for codon optimality in regulating the rhythm of elongation to facilitate cotranslational polypeptide folding, beyond its previously proposed role of adapting to the cost of expression. These findings establish how mRNA sequences are generally under selection to optimize the cotranslational folding of corresponding polypeptides.

Optimization of Soluble Expression and Purification of Recombinant Human Rhinovirus Type-14 3C Protease Using Statistically Designed Experiments: Isolation and Characterization of the Enzyme.

PubMed

Antoniou, Georgia; Papakyriacou, Irineos; Papaneophytou, Christos

2017-10-01

Human rhinovirus (HRV) 3C protease is widely used in recombinant protein production for various applications such as biochemical characterization and structural biology projects to separate recombinant fusion proteins from their affinity tags in order to prevent interference between these tags and the target proteins. Herein, we report the optimization of expression and purification conditions of glutathione S-transferase (GST)-tagged HRV 3C protease by statistically designed experiments. Soluble expression of GST-HRV 3C protease was initially optimized by response surface methodology (RSM), and a 5.5-fold increase in enzyme yield was achieved. Subsequently, we developed a new incomplete factorial (IF) design that examines four variables (bacterial strain, expression temperature, induction time, and inducer concentration) in a single experiment. The new design called Incomplete Factorial-Strain/Temperature/Time/Inducer (IF-STTI) was validated using three GST-tagged proteins. In all cases, IF-STTI resulted in only 10% lower expression yields than those obtained by RSM. Purification of GST-HRV 3C was optimized by an IF design that examines simultaneously the effect of the amount of resin, incubation time of cell lysate with resin, and glycerol and DTT concentration in buffers, and a further 15% increase in protease recovery was achieved. Purified GST-HRV 3C protease was active at both 4 and 25 °C in a variety of buffers.

On the Run-Time Optimization of the Boolean Logic of a Program.

ERIC Educational Resources Information Center

Cadolino, C.; Guazzo, M.

1982-01-01

Considers problem of optimal scheduling of Boolean expression (each Boolean variable represents binary outcome of program module) on single-processor system. Optimization discussed consists of finding operand arrangement that minimizes average execution costs representing consumption of resources (elapsed time, main memory, number of…

A Simplified GCS-DCSK Modulation and Its Performance Optimization

NASA Astrophysics Data System (ADS)

Xu, Weikai; Wang, Lin; Chi, Chong-Yung

2016-12-01

In this paper, a simplified Generalized Code-Shifted Differential Chaos Shift Keying (GCS-DCSK) whose transmitter never needs any delay circuits, is proposed. However, its performance is deteriorated because the orthogonality between substreams cannot be guaranteed. In order to optimize its performance, the system model of the proposed GCS-DCSK with power allocations on substreams is presented. An approximate bit error rate (BER) expression of the proposed model, which is a function of substreams’ power, is derived using Gaussian Approximation. Based on the BER expression, an optimal power allocation strategy between information substreams and reference substream is obtained. Simulation results show that the BER performance of the proposed GCS-DCSK with the optimal power allocation can be significantly improved when the number of substreams M is large.

Optimal power and efficiency of quantum Stirling heat engines

NASA Astrophysics Data System (ADS)

Yin, Yong; Chen, Lingen; Wu, Feng

2017-01-01

A quantum Stirling heat engine model is established in this paper in which imperfect regeneration and heat leakage are considered. A single particle which contained in a one-dimensional infinite potential well is studied, and the system consists of countless replicas. Each particle is confined in its own potential well, whose occupation probabilities can be expressed by the thermal equilibrium Gibbs distributions. Based on the Schrödinger equation, the expressions of power output and efficiency for the engine are obtained. Effects of imperfect regeneration and heat leakage on the optimal performance are discussed. The optimal performance region and the optimal values of important parameters of the engine cycle are obtained. The results obtained can provide some guidelines for the design of a quantum Stirling heat engine.

Expression of a codon-optimized Aspergillus niger pectin methylesterase gene in the methylotrophic yeast Candida boidinii.

PubMed

Kawaguchi, Kosuke; Yurimoto, Hiroya; Sakai, Yasuyoshi

2014-01-01

A codon-optimized Aspergillus niger pectin methylesterase (PME) gene was expressed in the methylotrophic yeast Canidia boidinii. The PME-producing strains showed better growth on pectin than the wild-type strains, suggesting that the PME-producing strains could efficiently utilize methyl ester moieties of pectin. On the other hand, overproduction of PME negatively affected the proliferation of C. boidinii on leaves of Arabidopsis thaliana.

High-level expression of the Penicillium notatum glucose oxidase gene in Pichia pastoris using codon optimization.

PubMed

Gao, Zhaowei; Li, Zhuofu; Zhang, Yuhong; Huang, Huoqing; Li, Mu; Zhou, Liwei; Tang, Yunming; Yao, Bin; Zhang, Wei

2012-03-01

The glucose oxidase (GOD) gene from Penicillium notatum was expressed in Pichia pastoris. The 1,815 bp gene, god-w, encodes 604 amino acids. Recombinant GOD-w had optimal activity at 35-40°C and pH 6.2 and was stable, from pH 3 to 7 maintaining >75% maximum activity after incubation at 50°C for 1 h. GOD-w worked as well as commercial GODs to improve bread making. To achieve high-level expression of recombinant GOD in P. pastoris, 272 nucleotides involving 228 residues were mutated, consistent with the codon bias of P. pastoris. The optimized recombinant GOD-m yielded 615 U ml(-1) (2.5 g protein l(-1)) in a 3 l fermentor--410% higher than GOD-w (148 U ml(-1)), and thus is a low-cost alternative for the bread baking industry.

Codon Optimization to Enhance Expression Yields Insights into Chloroplast Translation1[OPEN

PubMed Central

Chan, Hui-Ting; Williams-Carrier, Rosalind; Barkan, Alice

2016-01-01

Codon optimization based on psbA genes from 133 plant species eliminated 105 (human clotting factor VIII heavy chain [FVIII HC]) and 59 (polio VIRAL CAPSID PROTEIN1 [VP1]) rare codons; replacement with only the most highly preferred codons decreased transgene expression (77- to 111-fold) when compared with the codon usage hierarchy of the psbA genes. Targeted proteomic quantification by parallel reaction monitoring analysis showed 4.9- to 7.1-fold or 22.5- to 28.1-fold increase in FVIII or VP1 codon-optimized genes when normalized with stable isotope-labeled standard peptides (or housekeeping protein peptides), but quantitation using western blots showed 6.3- to 8-fold or 91- to 125-fold increase of transgene expression from the same batch of materials, due to limitations in quantitative protein transfer, denaturation, solubility, or stability. Parallel reaction monitoring, to our knowledge validated here for the first time for in planta quantitation of biopharmaceuticals, is especially useful for insoluble or multimeric proteins required for oral drug delivery. Northern blots confirmed that the increase of codon-optimized protein synthesis is at the translational level rather than any impact on transcript abundance. Ribosome footprints did not increase proportionately with VP1 translation or even decreased after FVIII codon optimization but is useful in diagnosing additional rate-limiting steps. A major ribosome pause at CTC leucine codons in the native gene of FVIII HC was eliminated upon codon optimization. Ribosome stalls observed at clusters of serine codons in the codon-optimized VP1 gene provide an opportunity for further optimization. In addition to increasing our understanding of chloroplast translation, these new tools should help to advance this concept toward human clinical studies. PMID:27465114

Development of a Synthetic Oxytetracycline-Inducible Expression System for Streptomycetes Using de Novo Characterized Genetic Parts.

PubMed

Wang, Weishan; Yang, Tongjian; Li, Yihong; Li, Shanshan; Yin, Shouliang; Styles, Kathryn; Corre, Christophe; Yang, Keqian

2016-07-15

Precise control of gene expression using exogenous factors is of great significance. To develop ideal inducible expression systems for streptomycetes, new genetic parts, oxytetracycline responsive repressor OtrR, operator otrO, and promoter otrBp from Streptomyces rimosus, were selected de novo and characterized in vivo and in vitro. OtrR showed strong affinity to otrO (KD = 1.7 × 10(-10) M) and oxytetracycline induced dissociation of the OtrR/DNA complex in a concentration-dependent manner. On the basis of these genetic parts, a synthetic inducible expression system Potr* was optimized. Induction of Potr* with 0.01-4 μM of oxytetracycline triggered a wide-range expression level of gfp reporter gene in different Streptomyces species. Benchmarking Potr* against the widely used constitutive promoters ermE* and kasOp* revealed greatly enhanced levels of expression when Potr* was fully induced. Finally, Potr* was used as a tool to activate and optimize the expression of the silent jadomycin biosynthetic gene cluster in Streptomyces venezuelae. Altogether, the synthetic Potr* presents a new versatile tool for fine-tuning gene expression in streptomycetes.

The Center for Optimized Structural Studies (COSS) platform for automation in cloning, expression, and purification of single proteins and protein-protein complexes.

PubMed

Mlynek, Georg; Lehner, Anita; Neuhold, Jana; Leeb, Sarah; Kostan, Julius; Charnagalov, Alexej; Stolt-Bergner, Peggy; Djinović-Carugo, Kristina; Pinotsis, Nikos

2014-06-01

Expression in Escherichia coli represents the simplest and most cost effective means for the production of recombinant proteins. This is a routine task in structural biology and biochemistry where milligrams of the target protein are required in high purity and monodispersity. To achieve these criteria, the user often needs to screen several constructs in different expression and purification conditions in parallel. We describe a pipeline, implemented in the Center for Optimized Structural Studies, that enables the systematic screening of expression and purification conditions for recombinant proteins and relies on a series of logical decisions. We first use bioinformatics tools to design a series of protein fragments, which we clone in parallel, and subsequently screen in small scale for optimal expression and purification conditions. Based on a scoring system that assesses soluble expression, we then select the top ranking targets for large-scale purification. In the establishment of our pipeline, emphasis was put on streamlining the processes such that it can be easily but not necessarily automatized. In a typical run of about 2 weeks, we are able to prepare and perform small-scale expression screens for 20-100 different constructs followed by large-scale purification of at least 4-6 proteins. The major advantage of our approach is its flexibility, which allows for easy adoption, either partially or entirely, by any average hypothesis driven laboratory in a manual or robot-assisted manner.

Intracellular response to process optimization and impact on productivity and product aggregates for a high-titer CHO cell process.

PubMed

Handlogten, Michael W; Lee-O'Brien, Allison; Roy, Gargi; Levitskaya, Sophia V; Venkat, Raghavan; Singh, Shailendra; Ahuja, Sanjeev

2018-01-01

A key goal in process development for antibodies is to increase productivity while maintaining or improving product quality. During process development of an antibody, titers were increased from 4 to 10 g/L while simultaneously decreasing aggregates. Process development involved optimization of media and feed formulations, feed strategy, and process parameters including pH and temperature. To better understand how CHO cells respond to process changes, the changes were implemented in a stepwise manner. The first change was an optimization of the feed formulation, the second was an optimization of the medium, and the third was an optimization of process parameters. Multiple process outputs were evaluated including cell growth, osmolality, lactate production, ammonium concentration, antibody production, and aggregate levels. Additionally, detailed assessment of oxygen uptake, nutrient and amino acid consumption, extracellular and intracellular redox environment, oxidative stress, activation of the unfolded protein response (UPR) pathway, protein disulfide isomerase (PDI) expression, and heavy and light chain mRNA expression provided an in-depth understanding of the cellular response to process changes. The results demonstrate that mRNA expression and UPR activation were unaffected by process changes, and that increased PDI expression and optimized nutrient supplementation are required for higher productivity processes. Furthermore, our findings demonstrate the role of extra- and intracellular redox environment on productivity and antibody aggregation. Processes using the optimized medium, with increased concentrations of redox modifying agents, had the highest overall specific productivity, reduced aggregate levels, and helped cells better withstand the high levels of oxidative stress associated with increased productivity. Specific productivities of different processes positively correlated to average intracellular values of total glutathione. Additionally, processes with the optimized media maintained an oxidizing intracellular environment, important for correct disulfide bond pairing, which likely contributed to reduced aggregate formation. These findings shed important understanding into how cells respond to process changes and can be useful to guide future development efforts to enhance productivity and improve product quality. © 2017 Wiley Periodicals, Inc.

[Construction of high-yield strain by optimizing lycopene cyclase for β-carotene production].

PubMed

Jin, Yingfu; Han, Li; Zhang, Shasha; Li, Shizhong; Liu, Weifeng; Tao, Yong

2017-11-25

To optimize key enzymes, such as to explore the gene resources and to modify the expression level, can maximize metabolic pathways of target products. β-carotene is a terpenoid compound with important application value. Lycopene cyclase (CrtY) is the key enzyme in β-carotene biosynthesis pathway, catalyzing flavin adenine dinucleotide (FAD)-dependent cyclization reaction and β-carotene synthesis from lycopene precursor. We optimized lycopene cyclase (CrtY) to improve the synthesis of β-carotene and determined the effect of CrtY expression on metabolic pathways. Frist, we developed a β-carotene synthesis module by coexpressing the lycopene β-cyclase gene crtY with crtEBI module in Escherichia coli. Then we simultaneously optimized the ribosome-binding site (RBS) intensity and the species of crtY using oligo-linker mediated DNA assembly method (OLMA). Five strains with high β-carotene production capacity were screened out from the OLMA library. The β-carotene yields of these strains were up to 15.79-18.90 mg/g DCW (Dry cell weight), 65% higher than that of the original strain at shake flask level. The optimal strain CP12 was further identified and evaluated for β-carotene production at 5 L fermentation level. After process optimization, the final β-carotene yield could reach to 1.9 g/L. The results of RBS strength and metabolic intermediate analysis indicated that an appropriate expression level of CrtY could be beneficial for the function of the β-carotene synthesis module. The results of this study provide important insight into the optimization of β-carotene synthesis pathway in metabolic engineering.

Design of optimal hyperthermia protocols for prostate cancer by controlling HSP expression through computer modeling (Invited Paper)

NASA Astrophysics Data System (ADS)

Rylander, Marissa N.; Feng, Yusheng; Diller, Kenneth; Bass, J.

2005-04-01

Heat shock proteins (HSP) are critical components of a complex defense mechanism essential for preserving cell survival under adverse environmental conditions. It is inevitable that hyperthermia will enhance tumor tissue viability, due to HSP expression in regions where temperatures are insufficient to coagulate proteins, and would likely increase the probability of cancer recurrence. Although hyperthermia therapy is commonly used in conjunction with radiotherapy, chemotherapy, and gene therapy to increase therapeutic effectiveness, the efficacy of these therapies can be substantially hindered due to HSP expression when hyperthermia is applied prior to these procedures. Therefore, in planning hyperthermia protocols, prediction of the HSP response of the tumor must be incorporated into the treatment plan to optimize the thermal dose delivery and permit prediction of overall tissue response. In this paper, we present a highly accurate, adaptive, finite element tumor model capable of predicting the HSP expression distribution and tissue damage region based on measured cellular data when hyperthermia protocols are specified. Cubic spline representations of HSP27 and HSP70, and Arrhenius damage models were integrated into the finite element model to enable prediction of the HSP expression and damage distribution in the tissue following laser heating. Application of the model can enable optimized treatment planning by controlling of the tissue response to therapy based on accurate prediction of the HSP expression and cell damage distribution.

Non-Viral Transfection Methods Optimized for Gene Delivery to a Lung Cancer Cell Line

PubMed Central

Salimzadeh, Loghman; Jaberipour, Mansooreh; Hosseini, Ahmad; Ghaderi, Abbas

2013-01-01

Background Mehr-80 is a newly established adherent human large cell lung cancer cell line that has not been transfected until now. This study aims to define the optimal transfection conditions and effects of some critical elements for enhancing gene delivery to this cell line by utilizing different non-viral transfection Procedures. Methods In the current study, calcium phosphate (CaP), DEAE-dextran, superfect, electroporation and lipofection transfection methods were used to optimize delivery of a plasmid construct that expressed Green Fluorescent Protein (GFP). Transgene expression was detected by fluorescent microscopy and flowcytometry. Toxicities of the methods were estimated by trypan blue staining. In order to evaluate the density of the transfected gene, we used a plasmid construct that expressed the Stromal cell-Derived Factor-1 (SDF-1) gene and measured its expression by real-time PCR. Results Mean levels of GFP-expressing cells 48 hr after transfection were 8.4% (CaP), 8.2% (DEAE-dextran), 4.9% (superfect), 34.1% (electroporation), and 40.1% (lipofection). Lipofection had the highest intense SDF-1 expression of the analyzed methods. Conclusion This study has shown that the lipofection and electroporation methods were more efficient at gene delivery to Mehr-80 cells. The quantity of DNA per transfection, reagent concentration, and incubation time were identified as essential factors for successful transfection in all of the studied methods. PMID:23799175

Concept locator: a client-server application for retrieval of UMLS metathesaurus concepts through complex boolean query.

PubMed

Nadkarni, P M

1997-08-01

Concept Locator (CL) is a client-server application that accesses a Sybase relational database server containing a subset of the UMLS Metathesaurus for the purpose of retrieval of concepts corresponding to one or more query expressions supplied to it. CL's query grammar permits complex Boolean expressions, wildcard patterns, and parenthesized (nested) subexpressions. CL translates the query expressions supplied to it into one or more SQL statements that actually perform the retrieval. The generated SQL is optimized by the client to take advantage of the strengths of the server's query optimizer, and sidesteps its weaknesses, so that execution is reasonably efficient.

Production of Self-Purifying Proteins in a Variety of Expression Hosts with Focus on Organophosphorus Hydrolase

DTIC Science & Technology

2012-08-17

cell-density fermentation at laboratory scale, and have provided evidence of their effectiveness. Our most recent work has been on the optimization...of the fermentation process itself, as well as a more biochemical optimization of the expression system. Overall, the ARO support on this project...large scale in high-density fermentation in microbial hosts, which is a critical gap in its appeal. The overall goals of our first renewal proposal

Balancing gene expression without library construction via a reusable sRNA pool.

PubMed

Ghodasara, Amar; Voigt, Christopher A

2017-07-27

Balancing protein expression is critical when optimizing genetic systems. Typically, this requires library construction to vary the genetic parts controlling each gene, which can be expensive and time-consuming. Here, we develop sRNAs corresponding to 15nt 'target' sequences that can be inserted upstream of a gene. The targeted gene can be repressed from 1.6- to 87-fold by controlling sRNA expression using promoters of different strength. A pool is built where six sRNAs are placed under the control of 16 promoters that span a ∼103-fold range of strengths, yielding ∼107 combinations. This pool can simultaneously optimize up to six genes in a system. This requires building only a single system-specific construct by placing a target sequence upstream of each gene and transforming it with the pre-built sRNA pool. The resulting library is screened and the top clone is sequenced to determine the promoter controlling each sRNA, from which the fold-repression of the genes can be inferred. The system is then rebuilt by rationally selecting parts that implement the optimal expression of each gene. We demonstrate the versatility of this approach by using the same pool to optimize a metabolic pathway (β-carotene) and genetic circuit (XNOR logic gate). © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Optimized transitory ectopic expression of promastigote surface antigen protein in Nicotiana benthamiana, a potential anti-leishmaniasis vaccine candidate.

PubMed

Lacombe, Séverine; Bangratz, Martine; Brizard, Jean-Paul; Petitdidier, Elodie; Pagniez, Julie; Sérémé, Drissa; Lemesre, Jean-Loup; Brugidou, Christophe

2018-01-01

In recent years, plants have been shown to be an efficient alternative expression system for high-value pharmaceuticals such as vaccines. However, constitutive expression of recombinant protein remains uncertain on their level of production and biological activity. To overcome these problems, transitory expression systems have been developed. Here, a series of experiments were performed to determine the most effective conditions to enhance vaccine antigen transient accumulation in Nicotiana benthamiana leaves using the promastigote surface antigen (PSA) from the parasitic protozoan Leishmania infantum. This protein has been previously identified as the major antigen of a licensed canine anti-leishmaniasis vaccine. The classical prokaryote Escherichia coli biosystem failed in accumulating PSA. Consequently, the standard plant system based on N. benthamiana has been optimized for the production of putatively active PSA. First, the RNA silencing defense mechanism set up by the plant against PSA ectopic expression was abolished by using three viral suppressors acting at different steps of the RNA silencing pathway. Then, we demonstrated that the signal peptide at the N-terminal side of the PSA is required for its accumulation. The PSA ER signaling and retention with the PSA signal peptide and the KDEL motif, respectively were optimized to significantly increase its accumulation. Finally, we demonstrate that the production of recombinant PSA in N. benthamiana leaves allows the conservation of its immunogenic property. These approaches demonstrate that based on these optimizations, plant based systems can be used to effectively produce the biological active PSA protein. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Optimizing solar-cell grid geometry

NASA Technical Reports Server (NTRS)

Crossley, A. P.

1969-01-01

Trade-off analysis and mathematical expressions calculate optimum grid geometry in terms of various cell parameters. Determination of the grid geometry provides proper balance between grid resistance and cell output to optimize the energy conversion process.

Empirical Performance Model-Driven Data Layout Optimization and Library Call Selection for Tensor Contraction Expressions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lu, Qingda; Gao, Xiaoyang; Krishnamoorthy, Sriram

Empirical optimizers like ATLAS have been very effective in optimizing computational kernels in libraries. The best choice of parameters such as tile size and degree of loop unrolling is determined by executing different versions of the computation. In contrast, optimizing compilers use a model-driven approach to program transformation. While the model-driven approach of optimizing compilers is generally orders of magnitude faster than ATLAS-like library generators, its effectiveness can be limited by the accuracy of the performance models used. In this paper, we describe an approach where a class of computations is modeled in terms of constituent operations that are empiricallymore » measured, thereby allowing modeling of the overall execution time. The performance model with empirically determined cost components is used to perform data layout optimization together with the selection of library calls and layout transformations in the context of the Tensor Contraction Engine, a compiler for a high-level domain-specific language for expressing computational models in quantum chemistry. The effectiveness of the approach is demonstrated through experimental measurements on representative computations from quantum chemistry.« less

Which missing value imputation method to use in expression profiles: a comparative study and two selection schemes.

PubMed

Brock, Guy N; Shaffer, John R; Blakesley, Richard E; Lotz, Meredith J; Tseng, George C

2008-01-10

Gene expression data frequently contain missing values, however, most down-stream analyses for microarray experiments require complete data. In the literature many methods have been proposed to estimate missing values via information of the correlation patterns within the gene expression matrix. Each method has its own advantages, but the specific conditions for which each method is preferred remains largely unclear. In this report we describe an extensive evaluation of eight current imputation methods on multiple types of microarray experiments, including time series, multiple exposures, and multiple exposures x time series data. We then introduce two complementary selection schemes for determining the most appropriate imputation method for any given data set. We found that the optimal imputation algorithms (LSA, LLS, and BPCA) are all highly competitive with each other, and that no method is uniformly superior in all the data sets we examined. The success of each method can also depend on the underlying "complexity" of the expression data, where we take complexity to indicate the difficulty in mapping the gene expression matrix to a lower-dimensional subspace. We developed an entropy measure to quantify the complexity of expression matrixes and found that, by incorporating this information, the entropy-based selection (EBS) scheme is useful for selecting an appropriate imputation algorithm. We further propose a simulation-based self-training selection (STS) scheme. This technique has been used previously for microarray data imputation, but for different purposes. The scheme selects the optimal or near-optimal method with high accuracy but at an increased computational cost. Our findings provide insight into the problem of which imputation method is optimal for a given data set. Three top-performing methods (LSA, LLS and BPCA) are competitive with each other. Global-based imputation methods (PLS, SVD, BPCA) performed better on mcroarray data with lower complexity, while neighbour-based methods (KNN, OLS, LSA, LLS) performed better in data with higher complexity. We also found that the EBS and STS schemes serve as complementary and effective tools for selecting the optimal imputation algorithm.

Optimization and analysis of large chemical kinetic mechanisms using the solution mapping method - Combustion of methane

NASA Technical Reports Server (NTRS)

Frenklach, Michael; Wang, Hai; Rabinowitz, Martin J.

1992-01-01

A method of systematic optimization, solution mapping, as applied to a large-scale dynamic model is presented. The basis of the technique is parameterization of model responses in terms of model parameters by simple algebraic expressions. These expressions are obtained by computer experiments arranged in a factorial design. The developed parameterized responses are then used in a joint multiparameter multidata-set optimization. A brief review of the mathematical background of the technique is given. The concept of active parameters is discussed. The technique is applied to determine an optimum set of parameters for a methane combustion mechanism. Five independent responses - comprising ignition delay times, pre-ignition methyl radical concentration profiles, and laminar premixed flame velocities - were optimized with respect to thirteen reaction rate parameters. The numerical predictions of the optimized model are compared to those computed with several recent literature mechanisms. The utility of the solution mapping technique in situations where the optimum is not unique is also demonstrated.

Variational Trajectory Optimization Tool Set: Technical description and user's manual

NASA Technical Reports Server (NTRS)

Bless, Robert R.; Queen, Eric M.; Cavanaugh, Michael D.; Wetzel, Todd A.; Moerder, Daniel D.

1993-01-01

The algorithms that comprise the Variational Trajectory Optimization Tool Set (VTOTS) package are briefly described. The VTOTS is a software package for solving nonlinear constrained optimal control problems from a wide range of engineering and scientific disciplines. The VTOTS package was specifically designed to minimize the amount of user programming; in fact, for problems that may be expressed in terms of analytical functions, the user needs only to define the problem in terms of symbolic variables. This version of the VTOTS does not support tabular data; thus, problems must be expressed in terms of analytical functions. The VTOTS package consists of two methods for solving nonlinear optimal control problems: a time-domain finite-element algorithm and a multiple shooting algorithm. These two algorithms, under the VTOTS package, may be run independently or jointly. The finite-element algorithm generates approximate solutions, whereas the shooting algorithm provides a more accurate solution to the optimization problem. A user's manual, some examples with results, and a brief description of the individual subroutines are included.

Analytical Optimization of the Net Residual Dispersion in SPM-Limited Dispersion-Managed Systems

NASA Astrophysics Data System (ADS)

Xiao, Xiaosheng; Gao, Shiming; Tian, Yu; Yang, Changxi

2006-05-01

Dispersion management is an effective technique to suppress the nonlinear impairment in fiber transmission systems, which includes tuning the amounts of precompensation, residual dispersion per span (RDPS), and net residual dispersion (NRD) of the systems. For self-phase modulation (SPM)-limited systems, optimizing the NRD is necessary because it can greatly improve the system performance. In this paper, an analytical method is presented to optimize NRD for SPM-limited dispersion-managed systems. The method is based on the correlation between the nonlinear impairment and the output pulse broadening of SPM-limited systems; therefore, dispersion-managed systems can be optimized through minimizing the output single-pulse broadening. A set of expressions is derived to calculate the output pulse broadening of the SPM-limited dispersion-managed system, from which the analytical result of optimal NRD is obtained. Furthermore, with the expressions of pulse broadening, how the nonlinear impairment depends on the amounts of precompensation and RDPS can be revealed conveniently.

Establishment of an immortalized mouse dermal papilla cell strain with optimized culture strategy.

PubMed

Guo, Haiying; Xing, Yizhan; Zhang, Yiming; He, Long; Deng, Fang; Ma, Xiaogen; Li, Yuhong

2018-01-01

Dermal papilla (DP) plays important roles in hair follicle regeneration. Long-term culture of mouse DP cells can provide enough cells for research and application of DP cells. We optimized the culture strategy for DP cells from three dimensions: stepwise dissection, collagen I coating, and optimized culture medium. Based on the optimized culture strategy, we immortalized primary DP cells with SV40 large T antigen, and established several immortalized DP cell strains. By comparing molecular expression and morphologic characteristics with primary DP cells, we found one cell strain named iDP6 was similar with primary DP cells. Further identifications illustrate that iDP6 expresses FGF7 and α-SMA, and has activity of alkaline phosphatase. During the process of characterization of immortalized DP cell strains, we also found that cells in DP were heterogeneous. We successfully optimized culture strategy for DP cells, and established an immortalized DP cell strain suitable for research and application of DP cells.

Establishment of an immortalized mouse dermal papilla cell strain with optimized culture strategy

PubMed Central

Zhang, Yiming; He, Long; Deng, Fang; Ma, Xiaogen

2018-01-01

Dermal papilla (DP) plays important roles in hair follicle regeneration. Long-term culture of mouse DP cells can provide enough cells for research and application of DP cells. We optimized the culture strategy for DP cells from three dimensions: stepwise dissection, collagen I coating, and optimized culture medium. Based on the optimized culture strategy, we immortalized primary DP cells with SV40 large T antigen, and established several immortalized DP cell strains. By comparing molecular expression and morphologic characteristics with primary DP cells, we found one cell strain named iDP6 was similar with primary DP cells. Further identifications illustrate that iDP6 expresses FGF7 and α-SMA, and has activity of alkaline phosphatase. During the process of characterization of immortalized DP cell strains, we also found that cells in DP were heterogeneous. We successfully optimized culture strategy for DP cells, and established an immortalized DP cell strain suitable for research and application of DP cells. PMID:29383288

The tunable pReX expression vector enables optimizing the T7-based production of membrane and secretory proteins in E. coli.

PubMed

Kuipers, Grietje; Karyolaimos, Alexandros; Zhang, Zhe; Ismail, Nurzian; Trinco, Gianluca; Vikström, David; Slotboom, Dirk Jan; de Gier, Jan-Willem

2017-12-16

To optimize the production of membrane and secretory proteins in Escherichia coli, it is critical to harmonize the expression rates of the genes encoding these proteins with the capacity of their biogenesis machineries. Therefore, we engineered the Lemo21(DE3) strain, which is derived from the T7 RNA polymerase-based BL21(DE3) protein production strain. In Lemo21(DE3), the T7 RNA polymerase activity can be modulated by the controlled co-production of its natural inhibitor T7 lysozyme. This setup enables to precisely tune target gene expression rates in Lemo21(DE3). The t7lys gene is expressed from the pLemo plasmid using the titratable rhamnose promoter. A disadvantage of the Lemo21(DE3) setup is that the system is based on two plasmids, a T7 expression vector and pLemo. The aim of this study was to simplify the Lemo21(DE3) setup by incorporating the key elements of pLemo in a standard T7-based expression vector. By incorporating the gene encoding the T7 lysozyme under control of the rhamnose promoter in a standard T7-based expression vector, pReX was created (ReX stands for Regulated gene eXpression). For two model membrane proteins and a model secretory protein we show that the optimized production yields obtained with the pReX expression vector in BL21(DE3) are similar to the ones obtained with Lemo21(DE3) using a standard T7 expression vector. For another secretory protein, a c-type cytochrome, we show that pReX, in contrast to Lemo21(DE3), enables the use of a helper plasmid that is required for the maturation and hence the production of this heme c protein. Here, we created pReX, a T7-based expression vector that contains the gene encoding the T7 lysozyme under control of the rhamnose promoter. pReX enables regulated T7-based target gene expression using only one plasmid. We show that with pReX the production of membrane and secretory proteins can be readily optimized. Importantly, pReX facilitates the use of helper plasmids. Furthermore, the use of pReX is not restricted to BL21(DE3), but it can in principle be used in any T7 RNAP-based strain. Thus, pReX is a versatile alternative to Lemo21(DE3).

An express method for optimally tuning an analog controller with respect to integral quality criteria

NASA Astrophysics Data System (ADS)

Golinko, I. M.; Kovrigo, Yu. M.; Kubrak, A. I.

2014-03-01

An express method for optimally tuning analog PI and PID controllers is considered. An integral quality criterion with minimizing the control output is proposed for optimizing control systems. The suggested criterion differs from existing ones in that the control output applied to the technological process is taken into account in a correct manner, due to which it becomes possible to maximally reduce the expenditure of material and/or energy resources in performing control of industrial equipment sets. With control organized in such manner, smaller wear and longer service life of control devices are achieved. A unimodal nature of the proposed criterion for optimally tuning a controller is numerically demonstrated using the methods of optimization theory. A functional interrelation between the optimal controller parameters and dynamic properties of a controlled plant is numerically determined for a single-loop control system. The results obtained from simulation of transients in a control system carried out using the proposed and existing functional dependences are compared with each other. The proposed calculation formulas differ from the existing ones by a simple structure and highly accurate search for the optimal controller tuning parameters. The obtained calculation formulas are recommended for being used by specialists in automation for design and optimization of control systems.

Precision of Sensitivity in the Design Optimization of Indeterminate Structures

NASA Technical Reports Server (NTRS)

Patnaik, Surya N.; Pai, Shantaram S.; Hopkins, Dale A.

2006-01-01

Design sensitivity is central to most optimization methods. The analytical sensitivity expression for an indeterminate structural design optimization problem can be factored into a simple determinate term and a complicated indeterminate component. Sensitivity can be approximated by retaining only the determinate term and setting the indeterminate factor to zero. The optimum solution is reached with the approximate sensitivity. The central processing unit (CPU) time to solution is substantially reduced. The benefit that accrues from using the approximate sensitivity is quantified by solving a set of problems in a controlled environment. Each problem is solved twice: first using the closed-form sensitivity expression, then using the approximation. The problem solutions use the CometBoards testbed as the optimization tool with the integrated force method as the analyzer. The modification that may be required, to use the stiffener method as the analysis tool in optimization, is discussed. The design optimization problem of an indeterminate structure contains many dependent constraints because of the implicit relationship between stresses, as well as the relationship between the stresses and displacements. The design optimization process can become problematic because the implicit relationship reduces the rank of the sensitivity matrix. The proposed approximation restores the full rank and enhances the robustness of the design optimization method.

Identification of two integration sites in favor of transgene expression in Trichoderma reesei.

PubMed

Qin, Lina; Jiang, Xianzhang; Dong, Zhiyang; Huang, Jianzhong; Chen, Xiuzhen

2018-01-01

The ascomycete fungus Trichoderma reesei was widely used as a biotechnological workhorse for production of cellulases and recombinant proteins due to its large capacity of protein secretion. Transgenesis by random integration of a gene of interest (GOI) into the genome of T. reesei can generate series of strains that express different levels of the indicated transgene. The insertion site of the GOI plays an important role in the ultimate production of the targeted proteins. However, so far no systematic studies have been made to identify transgene integration loci for optimal expression of the GOI in T. reesei . Currently, only the locus of exocellobiohydrolases I encoding gene ( cbh1) is widely used as a promising integration site to lead to high expression level of the GOI. No additional sites associated with efficient gene expression have been characterized. To search for gene integration sites that benefit for the secreted expression of GOI, the food-and-mouth disease virus 2A protein was applied for co-expression of an Aspergillus niger lipA gene and Discosoma sp. DsRed1 gene in T. reesei, by random integration of the expression cassette into the genome. We demonstrated that the fluorescent intensity of RFP (red fluorescent protein) inside of the cell was well correlated with the secreted lipase yields, based on which, we successfully developed a high-throughput screening method to screen strains with relatively higher secreted expression of the GOI (in this study, lipase). The copy number and the insertion sites of the transgene were investigated among the selected highly expressed strains. Eventually, in addition to cbh1 gene locus, two other genome insertion loci that efficiently facilitate gene expression in T. reesei were identified. We have successfully developed a high-throughput screening method to screen strains with optimal expression of the indicated secreted proteins in T. reesei . Moreover, we identified two optimal genome loci for transgene expression, which could provide new approach to modulate gene expression levels while retaining the indicated promoter and culture conditions.

Enhanced recombinant factor VII expression in Chinese hamster ovary cells by optimizing signal peptides and fed-batch medium.

PubMed

Peng, Lin; Yu, Xiao; Li, Chengyuan; Cai, Yanfei; Chen, Yun; He, Yang; Yang, Jianfeng; Jin, Jian; Li, Huazhong

2016-04-01

Signal peptides play an important role in directing and efficiently transporting secretory proteins to their proper locations in the endoplasmic reticulum of mammalian cells. The aim of this study was to enhance the expression of recombinant coagulation factor VII (rFVII) in CHO cells by optimizing the signal peptides and type of fed-batch culture medium used. Five sub-clones (O2, I3, H3, G2 and M3) with different signal peptide were selected by western blot (WB) analysis and used for suspension culture. We compared rFVII expression levels of 5 sub-clones and found that the highest rFVII expression level was obtained with the IgK signal peptide instead of Ori, the native signal peptide of rFVII. The high protein expression of rFVII with signal peptide IgK was mirrored by a high transcription level during suspension culture. After analyzing culture and feed media, the combination of M4 and F4 media yielded the highest rFVII expression of 20 mg/L during a 10-day suspension culture. After analyzing cell density and cell cycle, CHO cells feeding by F4 had a similar percentage of cells in G0/G1 and a higher cell density compared to F2 and F3. This may be the reason for high rFVII expression in M4+F4. In summary, rFVII expression was successfully enhanced by optimizing the signal peptide and fed-batch medium used in CHO suspension culture. Our data may be used to improve the production of other therapeutic proteins in fed-batch culture.

Expression of the Arginine Deiminase Pathway Genes in Lactobacillus sakei Is Strain Dependent and Is Affected by the Environmental pH

PubMed Central

Rimaux, T.; Rivière, A.; Illeghems, K.; Weckx, S.; De Vuyst, L.

2012-01-01

The adaptation of Lactobacillus sakei to a meat environment is reflected in its metabolic potential. For instance, the ability to utilize arginine through the arginine deiminase (ADI) pathway, resulting in additional ATP, represents a competitive benefit. In L. sakei CTC 494, the arc operon (arcABCTDR) shows the same gene order and organization as that in L. sakei 23K, the genome sequence of which is known. However, differences in relative gene expression were found, and these seemed to be optimal in different growth phases, namely, the highest relative gene expression level was in the end exponential growth phase in the case of L. sakei CTC 494 and in the mid-exponential growth phase of L. sakei 23K. Also, the environmental pH influenced the relative expression level of the arc operon, as shown for L. sakei CTC 494, with the highest relative expression level occurring at the optimal pH for growth (pH 6.0). Deviations from this optimal pH (pH 5.0 and pH 7.0) resulted in an overall decline of the relative expression level of all genes of the arc operon. Furthermore, a differential relative expression of the individual genes of the arc operon was found, with the highest relative gene expression occurring for the first two genes of the arc operon (arcA and arcB). Finally, it was shown that some L. sakei strains were able to convert agmatine into putrescine, suggesting an operational agmatine deiminase pathway in these strains, a metabolic trait that is undesirable in meat fermentations. This study shows that this metabolic trait is most probably encoded by a previously erroneously annotated second putative arc operon. PMID:22544250

Selectivity and Efficiency of Late Transgene Expression by Transcriptionally Targeted Oncolytic Adenoviruses Are Dependent on the Transgene Insertion Strategy

PubMed Central

Quirin, Christina; Rohmer, Stanimira; Fernández-Ulibarri, Inés; Behr, Michael; Hesse, Andrea; Engelhardt, Sarah; Erbs, Philippe; Enk, Alexander H.

2011-01-01

Abstract Key challenges facing cancer therapy are the development of tumor-specific drugs and potent multimodal regimens. Oncolytic adenoviruses possess the potential to realize both aims by restricting virus replication to tumors and inserting therapeutic genes into the virus genome, respectively. A major effort in this regard is to express transgenes in a tumor-specific manner without affecting virus replication. Using both luciferase as a sensitive reporter and genetic prodrug activation, we show that promoter control of E1A facilitates highly selective expression of transgenes inserted into the late transcription unit. This, however, required multistep optimization of late transgene expression. Transgene insertion via internal ribosome entry site (IRES), splice acceptor (SA), or viral 2A sequences resulted in replication-dependent expression. Unexpectedly, analyses in appropriate substrates and with matching control viruses revealed that IRES and SA, but not 2A, facilitated indirect transgene targeting via tyrosinase promoter control of E1A. Transgene expression via SA was more selective (up to 1,500-fold) but less effective than via IRES. Notably, we also revealed transgene-dependent interference with splicing. Hence, the prodrug convertase FCU1 (a cytosine deaminase–uracil phosphoribosyltransferase fusion protein) was expressed only after optimizing the sequence surrounding the SA site and mutating a cryptic splice site within the transgene. The resulting tyrosinase promoter-regulated and FCU1-encoding adenovirus combined effective oncolysis with targeted prodrug activation therapy of melanoma. Thus, prodrug activation showed potent bystander killing and increased cytotoxicity of the virus up to 10-fold. We conclude that armed oncolytic viruses can be improved substantially by comparing and optimizing strategies for targeted transgene expression, thereby implementing selective and multimodal cancer therapies. PMID:20939692

Optimization of ELISA Conditions to Quantify Colorectal Cancer Antigen-Antibody Complex Protein (GA733-FcK) Expressed in Transgenic Plant

PubMed Central

Ahn, Junsik; Lee, Kyung Jin

2014-01-01

The purpose of this study is to optimize ELISA conditions to quantify the colorectal cancer antigen GA733 linked to the Fc antibody fragment fused to KDEL, an ER retention motif (GA733-FcK) expressed in transgenic plant. Variable conditions of capture antibody, blocking buffer, and detection antibody for ELISA were optimized with application of leaf extracts from transgenic plant expressing GA733-FcK. In detection antibody, anti-EpCAM/CD362 IgG recognizing the GA733 did not detect any GA733-FcK whereas anti-human Fc IgG recognizing the human Fc existed in plant leaf extracts. For blocking buffer conditions, 3% BSA buffer clearly blocked the plate, compared to the 5% skim-milk buffer. For capture antibody, monoclonal antibody (MAb) CO17-1A was applied to coat the plate with different amounts (1, 0.5, and 0.25 μg/well). Among the amounts of the capture antibody, 1 and 0.5 μg/well (capture antibody) showed similar absorbance, whereas 0.25 μg/well of the capture antibody showed significantly less absorbance. Taken together, the optimized conditions to quantify plant-derived GA733-FcK were 0.5 μg/well of MAb CO17-1A per well for the capture antibody, 3% BSA for blocking buffer, and anti-human Fc conjugated HRP. To confirm the optimized ELISA conditions, correlation analysis was conducted between the quantified amount of GA733-FcK in ELISA and its protein density values of different leaf samples in Western blot. The co-efficient value R2 between the ELISA quantified value and protein density was 0.85 (p<0.01), which indicates that the optimized ELISA conditions feasibly provides quantitative information of GA733-FcK expression in transgenic plant. PMID:24555929

Secreted expression of Leuconostoc mesenteroides glucansucrase in Lactococcus lactis for the production of insoluble glucans

USDA-ARS?s Scientific Manuscript database

We expressed a glucansucrase, DsrI, from Leuconostoc mesenteroides that catalyzes formation of water-insoluble glucans from sucrose in Lactococcus lactis using a nisin-controlled gene expression system. Production of DsrI was optimized using several different background vectors, signal peptides, str...

Modular protein expression by RNA trans-splicing enables flexible expression of antibody formats in mammalian cells from a dual-host phage display vector.

PubMed

Shang, Yonglei; Tesar, Devin; Hötzel, Isidro

2015-10-01

A recently described dual-host phage display vector that allows expression of immunoglobulin G (IgG) in mammalian cells bypasses the need for subcloning of phage display clone inserts to mammalian vectors for IgG expression in large antibody discovery and optimization campaigns. However, antibody discovery and optimization campaigns usually need different antibody formats for screening, requiring reformatting of the clones in the dual-host phage display vector to an alternative vector. We developed a modular protein expression system mediated by RNA trans-splicing to enable the expression of different antibody formats from the same phage display vector. The heavy-chain region encoded by the phage display vector is directly and precisely fused to different downstream heavy-chain sequences encoded by complementing plasmids simply by joining exons in different pre-mRNAs by trans-splicing. The modular expression system can be used to efficiently express structurally correct IgG and Fab fragments or other antibody formats from the same phage display clone in mammalian cells without clone reformatting. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

An efficient strategy for producing a stable, replaceable, highly efficient transgene expression system in silkworm, Bombyx mori

PubMed Central

Long, Dingpei; Lu, Weijian; Zhang, Yuli; Bi, Lihui; Xiang, Zhonghuai; Zhao, Aichun

2015-01-01

We developed an efficient strategy that combines a method for the post-integration elimination of all transposon sequences, a site-specific recombination system, and an optimized fibroin H-chain expression system to produce a stable, replaceable, highly efficient transgene expression system in the silkworm (Bombyx mori) that overcomes the disadvantages of random insertion and post-integration instability of transposons. Here, we generated four different transgenic silkworm strains, and of one the transgenic strains, designated TS1-RgG2, with up to 16% (w/w) of the target protein in the cocoons, was selected. The subsequent elimination of all the transposon sequences from TS1-RgG2 was completed by the heat-shock-induced expression of the transposase in vivo. The resulting transgenic silkworm strain was designated TS3-g2 and contained only the attP-flanked optimized fibroin H-chain expression cassette in its genome. A phiC31/att-system-based recombinase-mediated cassette exchange (RMCE) method could be used to integrate other genes of interest into the same genome locus between the attP sites in TS3-g2. Controlling for position effects with phiC31-mediated RMCE will also allow the optimization of exogenous protein expression and fine gene function analyses in the silkworm. The strategy developed here is also applicable to other lepidopteran insects, to improve the ecological safety of transgenic strains in biocontrol programs. PMID:25739894

[A preliminary study on the autophagy level of human periodontal ligament cells regulated by nicotine].

PubMed

Yang, Du; Shuai, Yuan; Zhifei, Zhou; Lizheng, Wu; Lulu, Wang; Xing'an, Wu; Xiaojing, Wang

2017-04-01

To explore the effect of nicotine on the autophagy level of human periodontal ligament cells (hPDLCs). Periodontal tissues collected from premolars for orthodontic treatment reasons were used to culture hPDLCs. Western blot analysis was performed to test the most optimal time and concentration of nicotine on the autophagy level of the hPDLCs. Transmission electron microscope and immunofluorescence observation were carried out to detect the form of autophagosomes and expression of autophagy related protein LC3 in hPDLCs under this optimal condition. Protein expression of LC3Ⅱ was up regulated with the 12 h nicotine stimulating. Besides that, the up regulation of the protein expression of LC3Ⅱ was concentration dependent and nicotine with a concentration of 1×10⁻⁵ mol·L⁻¹ was the most optimal condition. Transmission electron microscope and immunofluorescence observations indicated that nicotine would activate the autophagy level of hPDLCs by increasing the number of autophagosomes and up regulating the expression of autophagy related protein LC3. Nicotine could increase autophagy level of hPDLCs, thus affecting the occurrence and development of smoking related periodontitis.

The Quantum Approximation Optimization Algorithm for MaxCut: A Fermionic View

NASA Technical Reports Server (NTRS)

Wang, Zhihui; Hadfield, Stuart; Jiang, Zhang; Rieffel, Eleanor G.

2017-01-01

Farhi et al. recently proposed a class of quantum algorithms, the Quantum Approximate Optimization Algorithm (QAOA), for approximately solving combinatorial optimization problems. A level-p QAOA circuit consists of steps in which a classical Hamiltonian, derived from the cost function, is applied followed by a mixing Hamiltonian. The 2p times for which these two Hamiltonians are applied are the parameters of the algorithm. As p increases, however, the parameter search space grows quickly. The success of the QAOA approach will depend, in part, on finding effective parameter-setting strategies. Here, we analytically and numerically study parameter setting for QAOA applied to MAXCUT. For level-1 QAOA, we derive an analytical expression for a general graph. In principle, expressions for higher p could be derived, but the number of terms quickly becomes prohibitive. For a special case of MAXCUT, the Ring of Disagrees, or the 1D antiferromagnetic ring, we provide an analysis for arbitrarily high level. Using a Fermionic representation, the evolution of the system under QAOA translates into quantum optimal control of an ensemble of independent spins. This treatment enables us to obtain analytical expressions for the performance of QAOA for any p. It also greatly simplifies numerical search for the optimal values of the parameters. By exploring symmetries, we identify a lower-dimensional sub-manifold of interest; the search effort can be accordingly reduced. This analysis also explains an observed symmetry in the optimal parameter values. Further, we numerically investigate the parameter landscape and show that it is a simple one in the sense of having no local optima.

High-level expression in Escherichia coli, purification and kinetic characterization of Plasmodium falciparum M1-aminopeptidase.

PubMed

González-Bacerio, Jorge; Osuna, Joel; Ponce, Amaia; Fando, Rafael; Figarella, Katherine; Méndez, Yanira; Charli, Jean-Louis; Chávez, María de Los Á

2014-12-01

Plasmodium falciparum neutral metallo-aminopeptidase (PfAM1), a member of the M1 family of metallo proteases, is a promising target for malaria, a devastating human parasitic disease. We report the high-level expression of PfAM1 in Escherichia coli BL21. An optimized gene, with a codon adaptation index and an average G/C content higher than the native gene, was synthesized and cloned in the pTrcHis2B vector. Optimal expression was achieved by induction with 1mM IPTG at 37°C for 18h. This allowed obtaining 100mg of recombinant PfAM1 (rPfAM1) per L of culture medium; 19% of the E. coli soluble protein mass was from rPFAM1. rPfAM1, fused to an amino-terminal 6×His tag, was purified in a single step by immobilized metal ion affinity chromatography. The protein showed only limited signs of proteolytic degradation, and this step increased purity 27-fold. The kinetic characteristics of rPfAM1, such as a neutral optimal pH, a preference for substrates with basic or hydrophobic amino acids at the P1 position, an inhibition profile typical of metallo-aminopeptidases, and inhibition from Zn(2+) excess, were similar to those of the native PfAM1. We have thus optimized an expression system that should be useful for identifying new PfAM1 inhibitors. Copyright © 2014 Elsevier Inc. All rights reserved.

The p40 Subunit of Interleukin (IL)-12 Promotes Stabilization and Export of the p35 Subunit

PubMed Central

Jalah, Rashmi; Rosati, Margherita; Ganneru, Brunda; Pilkington, Guy R.; Valentin, Antonio; Kulkarni, Viraj; Bergamaschi, Cristina; Chowdhury, Bhabadeb; Zhang, Gen-Mu; Beach, Rachel Kelly; Alicea, Candido; Broderick, Kate E.; Sardesai, Niranjan Y.; Pavlakis, George N.; Felber, Barbara K.

2013-01-01

IL-12 is a 70-kDa heterodimeric cytokine composed of the p35 and p40 subunits. To maximize cytokine production from plasmid DNA, molecular steps controlling IL-12p70 biosynthesis at the posttranscriptional and posttranslational levels were investigated. We show that the combination of RNA/codon-optimized gene sequences and fine-tuning of the relative expression levels of the two subunits within a cell resulted in increased production of the IL-12p70 heterodimer. We found that the p40 subunit plays a critical role in enhancing the stability, intracellular trafficking, and export of the p35 subunit. This posttranslational regulation mediated by the p40 subunit is conserved in mammals. Based on these findings, dual gene expression vectors were generated, producing an optimal ratio of the two subunits, resulting in a ∼1 log increase in human, rhesus, and murine IL-12p70 production compared with vectors expressing the wild type sequences. Such optimized DNA plasmids also produced significantly higher levels of systemic bioactive IL-12 upon in vivo DNA delivery in mice compared with plasmids expressing the wild type sequences. A single therapeutic injection of an optimized murine IL-12 DNA plasmid showed significantly more potent control of tumor development in the B16 melanoma cancer model in mice. Therefore, the improved IL-12p70 DNA vectors have promising potential for in vivo use as molecular vaccine adjuvants and in cancer immunotherapy. PMID:23297419

Expression of a codon-optimized β-glucosidase from Cellulomonas flavigena PR-22 in Saccharomyces cerevisiae for bioethanol production from cellobiose.

PubMed

Ríos-Fránquez, Francisco Javier; González-Bautista, Enrique; Ponce-Noyola, Teresa; Ramos-Valdivia, Ana Carmela; Poggi-Varaldo, Héctor Mario; García-Mena, Jaime; Martinez, Alfredo

2017-05-01

Bioethanol is one of the main biofuels produced from the fermentation of saccharified agricultural waste; however, this technology needs to be optimized for profitability. Because the commonly used ethanologenic yeast strains are unable to assimilate cellobiose, several efforts have been made to express cellulose hydrolytic enzymes in these yeasts to produce ethanol from lignocellulose. The C. flavigenabglA gene encoding β-glucosidase catalytic subunit was optimized for preferential codon usage in S. cerevisiae. The optimized gene, cloned into the episomal vector pRGP-1, was expressed, which led to the secretion of an active β-glucosidase in transformants of the S. cerevisiae diploid strain 2-24D. The volumetric and specific extracellular enzymatic activities using pNPG as substrate were 155 IU L -1 and 222 IU g -1 , respectively, as detected in the supernatant of the cultures of the S. cerevisiae RP2-BGL transformant strain growing in cellobiose (20 g L -1 ) as the sole carbon source for 48 h. Ethanol production was 5 g L -1 after 96 h of culture, which represented a yield of 0.41 g g -1 of substrate consumed (12 g L -1 ), equivalent to 76% of the theoretical yield. The S. cerevisiae RP2-BGL strain expressed the β-glucosidase extracellularly and produced ethanol from cellobiose, which makes this microorganism suitable for application in ethanol production processes with saccharified lignocellulose.

Production of 13S-hydroxy-9(Z)-octadecenoic acid from linoleic acid by whole recombinant cells expressing linoleate 13-hydratase from Lactobacillus acidophilus.

PubMed

Park, Ji-Young; Lee, Seon-Hwa; Kim, Kyoung-Rok; Park, Jin-Byung; Oh, Deok-Kun

2015-08-20

Linoleate 13-hydratase from Lactobacillus acidophilus LMG 11470 converted linoleic acid to hydroxyl fatty acid, which was identified as 13S-hydroxy-9(Z)-octadecenoic acid (13-HOD) by GC-MS and NMR. The expression of linoleate 13-hydratase gene in Escherichia coli was maximized by using pACYC plasmid and super optimal broth with catabolite repression (SOC) medium containing 40mM Mg(2+). To optimize induction conditions, recombinant cells were cultivated at 37°C, 1mM isopropyl-β-d-thiogalactopyranoside was added at 2h, and the culture was further incubated at 16°C for 18h. Recombinant cells expressing linoleate 13-hydratase from L. acidophilus were obtained under the optimized expression conditions and used for 13-HOD production from linoleic acid. The optimal reaction conditions were pH 6.0, 40°C, 0.25% (v/v) Tween 40, 25gl(-1) cells, and 100gl(-1) linoleic acid, and under these conditions, whole recombinant cells produced 79gl(-1) 13-HOD for 3h with a conversion yield of 79% (w/w), a volumetric productivity of 26.3gl(-1)h(-1), and a specific productivity of 1.05g g-cells(-1)h(-1). To the best of our knowledge, the recombinant cells produced hydroxy fatty acid with the highest concentration and productivity reported so far. Crown Copyright © 2015. Published by Elsevier B.V. All rights reserved.

[The preparation of recombinant adenovirus Ad-Rad50-GFP and detection of the optimal multiplicity of infection in CNE1 transfected hv Ad-Rad50-GFP].

PubMed

Yan, Ruicheng; Huang, Jiancong; Zhu, Ling; Chang, Lihong; Li, Jingjia; Wu, Xifu; Ye, Jin; Zhang, Gehua

2015-12-01

The optimal multiplicity of infection (MOI) of the recombinant adenovirus Ad-Rad50-GFP carrying a mutant Rad50 gene expression region on the cell growth of nasopharyngeal carcinoma and the viral amplification efficiency of CNE1 cell infected by this adenovirus were studied. The biological titer of Ad-Rad50-GFP was measured by end point dilution method. The impact of recombinant adenoviral vector transfection on the growth of CNE1 cells was observed by cell growth curve. Transfection efficacy of recombinant adenoviral vector was observed and calculated through fluorescence microscope. The expression f mutant Rad50 in the Ad-Rad50-GFP transfected CNE1 cells with optimal MOI was detected by Western Blot after transfection. The biological titer of Ad-Rad50-GFP was 1.26 x 10¹¹ pfu/ml. CNE1 cell growth was not influenced significantly as they were transfected by recombinant adenoviral vector with MOI less than 50. Transfection efficacy of recombinant adenoviral vector was most salient at 24 hours after transfection, with the high expression of mutant Rad50, and the efficiency still remained about 70% after 72 hours. Recombinant adenoviral vector Ad-Rad50-GFP could transfect CNE1 cells as well as result in the expression of mutant Rad50 in CNE1 cells effectively. MOI = 50 was the optimal multiplicity of infection of CNE1 cells transfected by recombinant adenoviral vector Ad-Rad50-GFP.

Cloning and high-level expression of β-xylosidase from Selenomonas ruminantium in Pichia pastoris by optimizing of pH, methanol concentration and temperature conditions.

PubMed

Dehnavi, Ehsan; Ranaei Siadat, Seyed Omid; Fathi Roudsari, Mehrnoosh; Khajeh, Khosro

2016-08-01

β-xylosidase and several other glycoside hydrolase family members, including xylanase, cooperate together to degrade hemicelluloses, a commonly found xylan polymer of plant-cell wall. β-d-xylosidase/α-l-arabinofuranosidase from the ruminal anaerobic bacterium Selenomonas ruminantium (SXA) has potential utility in industrial processes such as production of fuel ethanol and other bioproducts. The optimized synthetic SXA gene was overexpressed in methylotrophic Pichia pastoris under the control of alcohol oxidase I (AOX1) promoter and secreted into the medium. Recombinant protein showed an optimum pH 4.8 and optimum temperature 50 °C. Furthermore, optimization of growth and induction conditions in shake flask was carried out. Using the optimum expression condition (pH 6, temperature 20 °C and 1% methanol induction), protein production was increased by about three times in comparison to the control. The recombinant SXA we have expressed here showed higher turnover frequency using ρ-nitrophenyl β-xylopyranoside (PNPX) substrate, in contrast to most xylosidase experiments reported previously. This is the first report on the cloning and expression of a β-xylosidase gene from glycoside hydrolase (GH) family 43 in Pichia pastoris. Our results confirm that P. pastoris is an appropriate host for high level expression and production of SXA for industrial applications. Copyright © 2016. Published by Elsevier Inc.

Synaptic Transmission Optimization Predicts Expression Loci of Long-Term Plasticity.

PubMed

Costa, Rui Ponte; Padamsey, Zahid; D'Amour, James A; Emptage, Nigel J; Froemke, Robert C; Vogels, Tim P

2017-09-27

Long-term modifications of neuronal connections are critical for reliable memory storage in the brain. However, their locus of expression-pre- or postsynaptic-is highly variable. Here we introduce a theoretical framework in which long-term plasticity performs an optimization of the postsynaptic response statistics toward a given mean with minimal variance. Consequently, the state of the synapse at the time of plasticity induction determines the ratio of pre- and postsynaptic modifications. Our theory explains the experimentally observed expression loci of the hippocampal and neocortical synaptic potentiation studies we examined. Moreover, the theory predicts presynaptic expression of long-term depression, consistent with experimental observations. At inhibitory synapses, the theory suggests a statistically efficient excitatory-inhibitory balance in which changes in inhibitory postsynaptic response statistics specifically target the mean excitation. Our results provide a unifying theory for understanding the expression mechanisms and functions of long-term synaptic transmission plasticity. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

Global linear-irreversible principle for optimization in finite-time thermodynamics

NASA Astrophysics Data System (ADS)

Johal, Ramandeep S.

2018-03-01

There is intense effort into understanding the universal properties of finite-time models of thermal machines —at optimal performance— such as efficiency at maximum power, coefficient of performance at maximum cooling power, and other such criteria. In this letter, a global principle consistent with linear irreversible thermodynamics is proposed for the whole cycle —without considering details of irreversibilities in the individual steps of the cycle. This helps to express the total duration of the cycle as τ \\propto {\\bar{Q}^2}/{Δ_\\text{tot}S} , where \\bar{Q} models the effective heat transferred through the machine during the cycle, and Δ_ \\text{tot} S is the total entropy generated. By taking \\bar{Q} in the form of simple algebraic means (such as arithmetic and geometric means) over the heats exchanged by the reservoirs, the present approach is able to predict various standard expressions for figures of merit at optimal performance, as well as the bounds respected by them. It simplifies the optimization procedure to a one-parameter optimization, and provides a fresh perspective on the issue of universality at optimal performance, for small difference in reservoir temperatures. As an illustration, we compare the performance of a partially optimized four-step endoreversible cycle with the present approach.

Optimized Assembly of a Multifunctional RNA-Protein Nanostructure in a Cell-Free Gene Expression System.

PubMed

Schwarz-Schilling, Matthaeus; Dupin, Aurore; Chizzolini, Fabio; Krishnan, Swati; Mansy, Sheref S; Simmel, Friedrich C

2018-04-11

Molecular complexes composed of RNA molecules and proteins are promising multifunctional nanostructures for a wide variety of applications in biological cells or in artificial cellular systems. In this study, we systematically address some of the challenges associated with the expression and assembly of such hybrid structures using cell-free gene expression systems. As a model structure, we investigated a pRNA-derived RNA scaffold functionalized with four distinct aptamers, three of which bind to proteins, streptavidin and two fluorescent proteins, while one binds the small molecule dye malachite green (MG). Using MG fluorescence and Förster resonance energy transfer (FRET) between the RNA-scaffolded proteins, we assess critical assembly parameters such as chemical stability, binding efficiency, and also resource sharing effects within the reaction compartment. We then optimize simultaneous expression and coassembly of the RNA-protein nanostructure within a single-compartment cell-free gene expression system. We demonstrate expression and assembly of the multicomponent nanostructures inside of emulsion droplets and their aptamer-mediated localization onto streptavidin-coated substrates, plus the successful assembly of the hybrid structures inside of bacterial cells.

Manufacture of TATB and TNT from Biosynthesized Phloroglucinols

DTIC Science & Technology

2010-07-01

the microbial synthesis of mono-O-methylphloroglucinols, phloroglucinol O-methyl transferase (POMT) from Rosa chinensis var. spontanea has been...successfully de novo synthesized in codon-optimized form for expression in E. coli, which is the host currently used for microbial synthesis of...efforts had been made in both strain development and optimizing fermentation conditions for microbial phloroglucinol synthesis . Under optimized resin

Improvement of LOD in Fluorescence Detection with Spectrally Nonuniform Background by Optimization of Emission Filtering.

PubMed

Galievsky, Victor A; Stasheuski, Alexander S; Krylov, Sergey N

2017-10-17

The limit-of-detection (LOD) in analytical instruments with fluorescence detection can be improved by reducing noise of optical background. Efficiently reducing optical background noise in systems with spectrally nonuniform background requires complex optimization of an emission filter-the main element of spectral filtration. Here, we introduce a filter-optimization method, which utilizes an expression for the signal-to-noise ratio (SNR) as a function of (i) all noise components (dark, shot, and flicker), (ii) emission spectrum of the analyte, (iii) emission spectrum of the optical background, and (iv) transmittance spectrum of the emission filter. In essence, the noise components and the emission spectra are determined experimentally and substituted into the expression. This leaves a single variable-the transmittance spectrum of the filter-which is optimized numerically by maximizing SNR. Maximizing SNR provides an accurate way of filter optimization, while a previously used approach based on maximizing a signal-to-background ratio (SBR) is the approximation that can lead to much poorer LOD specifically in detection of fluorescently labeled biomolecules. The proposed filter-optimization method will be an indispensable tool for developing new and improving existing fluorescence-detection systems aiming at ultimately low LOD.

CVXPY: A Python-Embedded Modeling Language for Convex Optimization.

PubMed

Diamond, Steven; Boyd, Stephen

2016-04-01

CVXPY is a domain-specific language for convex optimization embedded in Python. It allows the user to express convex optimization problems in a natural syntax that follows the math, rather than in the restrictive standard form required by solvers. CVXPY makes it easy to combine convex optimization with high-level features of Python such as parallelism and object-oriented design. CVXPY is available at http://www.cvxpy.org/ under the GPL license, along with documentation and examples.

Dynamic facial expressions of emotion transmit an evolving hierarchy of signals over time.

PubMed

Jack, Rachael E; Garrod, Oliver G B; Schyns, Philippe G

2014-01-20

Designed by biological and social evolutionary pressures, facial expressions of emotion comprise specific facial movements to support a near-optimal system of signaling and decoding. Although highly dynamical, little is known about the form and function of facial expression temporal dynamics. Do facial expressions transmit diagnostic signals simultaneously to optimize categorization of the six classic emotions, or sequentially to support a more complex communication system of successive categorizations over time? Our data support the latter. Using a combination of perceptual expectation modeling, information theory, and Bayesian classifiers, we show that dynamic facial expressions of emotion transmit an evolving hierarchy of "biologically basic to socially specific" information over time. Early in the signaling dynamics, facial expressions systematically transmit few, biologically rooted face signals supporting the categorization of fewer elementary categories (e.g., approach/avoidance). Later transmissions comprise more complex signals that support categorization of a larger number of socially specific categories (i.e., the six classic emotions). Here, we show that dynamic facial expressions of emotion provide a sophisticated signaling system, questioning the widely accepted notion that emotion communication is comprised of six basic (i.e., psychologically irreducible) categories, and instead suggesting four. Copyright © 2014 Elsevier Ltd. All rights reserved.

Drug transporter gene expression in human colorectal tissue and cell lines: modulation with antiretrovirals for microbicide optimization.

PubMed

Mukhopadhya, Indrani; Murray, Graeme I; Berry, Susan; Thomson, John; Frank, Bruce; Gwozdz, Garry; Ekeruche-Makinde, Julia; Shattock, Robin; Kelly, Charles; Iannelli, Francesco; Pozzi, Gianni; El-Omar, Emad M; Hold, Georgina L; Hijazi, Karolin

2016-02-01

The objectives of this study were to comprehensively assess mRNA expression of 84 drug transporters in human colorectal biopsies and six representative cell lines, and to investigate the alteration of drug transporter gene expression after exposure to three candidate microbicidal antiretroviral (ARV) drugs (tenofovir, darunavir and dapivirine) in the colorectal epithelium. The outcome of the objectives informs development of optimal ARV-based microbicidal formulations for prevention of HIV-1 infection. Drug transporter mRNA expression was quantified from colorectal biopsies and cell lines by quantitative real-time PCR. Relative mRNA expression was quantified in Caco-2 cells and colorectal explants after induction with ARVs. Data were analysed using Pearson's product moment correlation (r), hierarchical clustering and principal component analysis (PCA). Expression of 58 of the 84 transporters was documented in colorectal biopsies, with genes for CNT2, P-glycoprotein (P-gp) and MRP3 showing the highest expression. No difference was noted between individual subjects when analysed by age, gender or anatomical site (rectum or recto-sigmoid) (r = 0.95-0.99). High expression of P-gp and CNT2 proteins was confirmed by immunohistochemical staining. Similarity between colorectal tissue and cell-line drug transporter gene expression was variable (r = 0.64-0.84). PCA showed distinct clustering of human colorectal biopsy samples, with the Caco-2 cells defined as the best surrogate system. Induction of Caco-2 cell lines with ARV drugs suggests that darunavir-based microbicides incorporating tenofovir may result in drug-drug interactions likely to affect distribution of individual drugs to sub-epithelial target cells. These findings will help optimize complex formulations of rectal microbicides to realize their full potential as an effective approach for pre-exposure prophylaxis against HIV-1 infection. © The Author 2015. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Development and Optimization of a Fluorescent Differential Display PCR System for Analyzing the Stress Response in Lactobacillus sakei Strains

PubMed Central

Bonomo, Maria Grazia; Sico, Maria Anna; Grieco, Simona; Salzano, Giovanni

2009-01-01

Lactobacillus sakei is widely used as starter in the production process of Italian fermented sausages and its growth and survival are affected by various factors. We studied the differential expression of genome in response to different stresses by the fluorescent differential display (FDD) technique. This study resulted in the development and optimization of an innovative technique, with a high level of reproducibility and quality, which allows the identification of gene expression changes associated with different microbial behaviours under different growth conditions. PMID:22253979

Optimization of Statistical Methods Impact on Quantitative Proteomics Data.

PubMed

Pursiheimo, Anna; Vehmas, Anni P; Afzal, Saira; Suomi, Tomi; Chand, Thaman; Strauss, Leena; Poutanen, Matti; Rokka, Anne; Corthals, Garry L; Elo, Laura L

2015-10-02

As tools for quantitative label-free mass spectrometry (MS) rapidly develop, a consensus about the best practices is not apparent. In the work described here we compared popular statistical methods for detecting differential protein expression from quantitative MS data using both controlled experiments with known quantitative differences for specific proteins used as standards as well as "real" experiments where differences in protein abundance are not known a priori. Our results suggest that data-driven reproducibility-optimization can consistently produce reliable differential expression rankings for label-free proteome tools and are straightforward in their application.

A modular and optimized single marker system for generating Trypanosoma brucei cell lines expressing T7 RNA polymerase and the tetracycline repressor.

PubMed

Poon, S K; Peacock, L; Gibson, W; Gull, K; Kelly, S

2012-02-01

Here, we present a simple modular extendable vector system for introducing the T7 RNA polymerase and tetracycline repressor genes into Trypanosoma brucei. This novel system exploits developments in our understanding of gene expression and genome organization to produce a streamlined plasmid optimized for high levels of expression of the introduced transgenes. We demonstrate the utility of this novel system in bloodstream and procyclic forms of Trypanosoma brucei, including the genome strain TREU927/4. We validate these cell lines using a variety of inducible experiments that recapture previously published lethal and non-lethal phenotypes. We further demonstrate the utility of the single marker (SmOx) TREU927/4 cell line for in vivo experiments in the tsetse fly and provide a set of plasmids that enable both whole-fly and salivary gland-specific inducible expression of transgenes.

A modular and optimized single marker system for generating Trypanosoma brucei cell lines expressing T7 RNA polymerase and the tetracycline repressor

PubMed Central

Poon, S. K.; Peacock, L.; Gibson, W.; Gull, K.; Kelly, S.

2012-01-01

Here, we present a simple modular extendable vector system for introducing the T7 RNA polymerase and tetracycline repressor genes into Trypanosoma brucei. This novel system exploits developments in our understanding of gene expression and genome organization to produce a streamlined plasmid optimized for high levels of expression of the introduced transgenes. We demonstrate the utility of this novel system in bloodstream and procyclic forms of Trypanosoma brucei, including the genome strain TREU927/4. We validate these cell lines using a variety of inducible experiments that recapture previously published lethal and non-lethal phenotypes. We further demonstrate the utility of the single marker (SmOx) TREU927/4 cell line for in vivo experiments in the tsetse fly and provide a set of plasmids that enable both whole-fly and salivary gland-specific inducible expression of transgenes. PMID:22645659

A reverse engineering approach to optimize experiments for the construction of biological regulatory networks.

PubMed

Zhang, Xiaomeng; Shao, Bin; Wu, Yangle; Qi, Ouyang

2013-01-01

One of the major objectives in systems biology is to understand the relation between the topological structures and the dynamics of biological regulatory networks. In this context, various mathematical tools have been developed to deduct structures of regulatory networks from microarray expression data. In general, from a single data set, one cannot deduct the whole network structure; additional expression data are usually needed. Thus how to design a microarray expression experiment in order to get the most information is a practical problem in systems biology. Here we propose three methods, namely, maximum distance method, trajectory entropy method, and sampling method, to derive the optimal initial conditions for experiments. The performance of these methods is tested and evaluated in three well-known regulatory networks (budding yeast cell cycle, fission yeast cell cycle, and E. coli. SOS network). Based on the evaluation, we propose an efficient strategy for the design of microarray expression experiments.

Kinematics and constraints associated with swashplate blade pitch control

NASA Technical Reports Server (NTRS)

Leyland, Jane A.

1993-01-01

An important class of techniques to reduce helicopter vibration is based on using a Higher Harmonic controller to optimally define the Higher Harmonic blade pitch. These techniques typically require solution of a general optimization problem requiring the determination of a control vector which minimizes a performance index where functions of the control vector are subject to inequality constraints. Six possible constraint functions associated with swashplate blade pitch control were identified and defined. These functions constrain: (1) blade pitch Fourier Coefficients expressed in the Rotating System, (2) blade pitch Fourier Coefficients expressed in the Nonrotating System, (3) stroke of the individual actuators expressed in the Nonrotating System, (4) blade pitch expressed as a function of blade azimuth and actuator stroke, (5) time rate-of-change of the aforementioned parameters, and (6) required actuator power. The aforementioned constraints and the associated kinematics of swashplate blade pitch control by means of the strokes of the individual actuators are documented.

Heterologous expression of Trametes versicolor laccase in Saccharomyces cerevisiae.

PubMed

Iimura, Yosuke; Sonoki, Tomonori; Habe, Hiroshi

2018-01-01

Laccase is used in various industrial fields, and it has been the subject of numerous studies. Trametes versicolor laccase has one of the highest redox potentials among the various forms of this enzyme. In this study, we optimized the expression of laccase in Saccharomyces cerevisiae. Optimizing the culture conditions resulted in an improvement in the expression level, and approximately 45 U/L of laccase was functionally secreted in the culture. The recombinant laccase was found to be a heavily hypermannosylated glycoprotein, and the molecular weight of the carbohydrate chain was approximately 60 kDa. These hypermannosylated glycans lowered the substrate affinity, but the optimum pH and thermo-stability were not changed by these hypermannosylated glycans. This functional expression system described here will aid in molecular evolutionary studies conducted to generate new variants of laccase. Copyright © 2017 Elsevier Inc. All rights reserved.

Generation of Human Adult Mesenchymal Stromal/Stem Cells Expressing Defined Xenogenic Vascular Endothelial Growth Factor Levels by Optimized Transduction and Flow Cytometry Purification

PubMed Central

Helmrich, Uta; Marsano, Anna; Melly, Ludovic; Wolff, Thomas; Christ, Liliane; Heberer, Michael; Scherberich, Arnaud; Martin, Ivan

2012-01-01

Adult mesenchymal stromal/stem cells (MSCs) are a valuable source of multipotent progenitors for tissue engineering and regenerative medicine, but may require to be genetically modified to widen their efficacy in therapeutic applications. For example, overexpression of the angiogenic factor vascular endothelial growth factor (VEGF) at controlled levels is an attractive strategy to overcome the crucial bottleneck of graft vascularization and to avoid aberrant vascular growth. Since the regenerative potential of MSCs is rapidly lost during in vitro expansion, we sought to develop an optimized technique to achieve high-efficiency retroviral vector transduction of MSCs derived from both adipose tissue (adipose stromal cells, ASCs) or bone marrow (BMSCs) and rapidly select cells expressing desired levels of VEGF with minimal in vitro expansion. The proliferative peak of freshly isolated human ASCs and BMSCs was reached 4 and 6 days after plating, respectively. By performing retroviral vector transduction at this time point, >90% efficiency was routinely achieved before the first passage. MSCs were transduced with vectors expressing rat VEGF164 quantitatively linked to a syngenic cell surface marker (truncated rat CD8). Retroviral transduction and VEGF expression did not affect MSC phenotype nor impair their in vitro proliferation and differentiation potential. Transgene expression was also maintained during in vitro differentiation. Furthermore, three subpopulations of transduced BMSCs homogeneously producing specific low, medium, and high VEGF doses could be prospectively isolated by flow cytometry based on the intensity of their CD8 expression already at the first passage. In conclusion, this optimized platform allowed the generation of populations of genetically modified MSCs, expressing specific levels of a therapeutic transgene, already at the first passage, thereby minimizing in vitro expansion and loss of regenerative potential. PMID:22070632

Designing a fully automated multi-bioreactor plant for fast DoE optimization of pharmaceutical protein production.

PubMed

Fricke, Jens; Pohlmann, Kristof; Jonescheit, Nils A; Ellert, Andree; Joksch, Burkhard; Luttmann, Reiner

2013-06-01

The identification of optimal expression conditions for state-of-the-art production of pharmaceutical proteins is a very time-consuming and expensive process. In this report a method for rapid and reproducible optimization of protein expression in an in-house designed small-scale BIOSTAT® multi-bioreactor plant is described. A newly developed BioPAT® MFCS/win Design of Experiments (DoE) module (Sartorius Stedim Systems, Germany) connects the process control system MFCS/win and the DoE software MODDE® (Umetrics AB, Sweden) and enables therefore the implementation of fully automated optimization procedures. As a proof of concept, a commercial Pichia pastoris strain KM71H has been transformed for the expression of potential malaria vaccines. This approach has allowed a doubling of intact protein secretion productivity due to the DoE optimization procedure compared to initial cultivation results. In a next step, robustness regarding the sensitivity to process parameter variability has been proven around the determined optimum. Thereby, a pharmaceutical production process that is significantly improved within seven 24-hour cultivation cycles was established. Specifically, regarding the regulatory demands pointed out in the process analytical technology (PAT) initiative of the United States Food and Drug Administration (FDA), the combination of a highly instrumented, fully automated multi-bioreactor platform with proper cultivation strategies and extended DoE software solutions opens up promising benefits and opportunities for pharmaceutical protein production. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Expression and Secretion of Endostar Protein by Escherichia Coli: Optimization of Culture Conditions Using the Response Surface Methodology.

PubMed

Mohajeri, Abbas; Abdolalizadeh, Jalal; Pilehvar-Soltanahmadi, Younes; Kiafar, Farhad; Zarghami, Nosratollah

2016-10-01

Endostar as a specific drug in treatment of the nonsmall cell lung cancer is produced using Escherichia coli expression system. Plackett-Burman design (PBD) and response surface methodology (RSM) are statistical tools for experimental design and optimization of biotechnological processes. This investigation aimed to predict and develop the optimal culture condition and its components for expression and secretion of endostar into the culture medium of E. coli. The synthetic endostar coding sequence was fused with PhoA signal peptide. The nine factors involved in the production of recombinant protein-postinduction temperature, cell density, rotation speed, postinduction time, concentration of glycerol, IPTG, peptone, glycine, and triton X-100-were evaluated using PBD. Four significant factors were selected based on PBD results for optimizing culture condition using RSM. Endostar was purified using cation exchange chromatography and size exclusion chromatography. The maximum level of endostar was obtained under the following condition: 13.57-h postinduction time, 0.76 % glycine, 0.7 % triton X-100, and 4.87 % glycerol. The predicted levels of endostar was significantly correlated with experimental levels (R 2 = 0.982, P = 0.00). The obtained results indicated that PBD and RSM are effective tools for optimization of culture condition and its components for endostar production in E. coli. The most important factors in the enhancement of the protein production are glycerol, glycine, and postinduction time.

Utilizing high-throughput experimentation to enhance specific productivity of an E.coli T7 expression system by phosphate limitation.

PubMed

Huber, Robert; Roth, Simon; Rahmen, Natalie; Büchs, Jochen

2011-03-17

The specific productivity of cultivation processes can be optimized, amongst others, by using genetic engineering of strains, choice of suitable host/vector systems or process optimization (e.g. choosing the right induction time). A further possibility is to reduce biomass buildup in favor of an enhanced product formation, e.g. by limiting secondary substrates in the medium, such as phosphate. However, with conventional techniques (e.g. small scale cultivations in shake flasks), it is very tedious to establish optimal conditions for cell growth and protein expression, as the start of protein expression (induction time) and the degree of phosphate limitation have to be determined in numerous concerted, manually conducted experiments. We investigated the effect of different induction times and a concurrent phosphate limitation on the specific productivity of the T7 expression system E.coli BL21(DE3) pRhotHi-2-EcFbFP, which produces the model fluorescence protein EcFbFP upon induction. Therefore, specific online-monitoring tools for small scale cultivations (RAMOS, BioLector) as well as a novel cultivation platform (Robo-Lector) were used for rapid process optimization. The RAMOS system monitored the oxygen transfer rate in shake flasks, whereas the BioLector device allowed to monitor microbial growth and the production of EcFbFP in microtiter plates. The Robo-Lector is a combination of a BioLector and a pipetting robot and can conduct high-throughput experiments fully automated. By using these tools, it was possible to determine the optimal induction time and to increase the specific productivity for EcFbFP from 22% (for unlimited conditions) to 31% of total protein content of the E.coli cells via a phosphate limitation. The results revealed that a phosphate limitation at the right induction time was suitable to redirect the available cellular resources during cultivation to protein expression rather than in biomass production. To our knowledge, such an effect was shown for the first time for an IPTG-inducible expression system. Finally, this finding and the utilization of the introduced high-throughput experimentation approach could help to find new targets to further enhance the production capacity of recombinant E.coli-strains.

CVXPY: A Python-Embedded Modeling Language for Convex Optimization

PubMed Central

Diamond, Steven; Boyd, Stephen

2016-01-01

CVXPY is a domain-specific language for convex optimization embedded in Python. It allows the user to express convex optimization problems in a natural syntax that follows the math, rather than in the restrictive standard form required by solvers. CVXPY makes it easy to combine convex optimization with high-level features of Python such as parallelism and object-oriented design. CVXPY is available at http://www.cvxpy.org/ under the GPL license, along with documentation and examples. PMID:27375369

A Kind of Nonlinear Programming Problem Based on Mixed Fuzzy Relation Equations Constraints

NASA Astrophysics Data System (ADS)

Li, Jinquan; Feng, Shuang; Mi, Honghai

In this work, a kind of nonlinear programming problem with non-differential objective function and under the constraints expressed by a system of mixed fuzzy relation equations is investigated. First, some properties of this kind of optimization problem are obtained. Then, a polynomial-time algorithm for this kind of optimization problem is proposed based on these properties. Furthermore, we show that this algorithm is optimal for the considered optimization problem in this paper. Finally, numerical examples are provided to illustrate our algorithms.

Aerospace applications of integer and combinatorial optimization

NASA Technical Reports Server (NTRS)

Padula, S. L.; Kincaid, R. K.

1995-01-01

Research supported by NASA Langley Research Center includes many applications of aerospace design optimization and is conducted by teams of applied mathematicians and aerospace engineers. This paper investigates the benefits from this combined expertise in solving combinatorial optimization problems. Applications range from the design of large space antennas to interior noise control. A typical problem, for example, seeks the optimal locations for vibration-damping devices on a large space structure and is expressed as a mixed/integer linear programming problem with more than 1500 design variables.

Clinically Relevant Changes in Emotional Expression in Children with ADHD Treated with Lisdexamfetamine Dimesylate

ERIC Educational Resources Information Center

Katic, Alain; Ginsberg, Lawrence; Jain, Rakesh; Adeyi, Ben; Dirks, Bryan; Babcock, Thomas; Scheckner, Brian; Richards, Cynthia; Lasser, Robert; Turgay, Atilla; Findling, Robert L.

2012-01-01

Objective: To describe clinically relevant effects of lisdexamfetamine dimesylate (LDX) on emotional expression (EE) in children with ADHD. Method: Children with ADHD participated in a 7-week, open-label, LDX dose-optimization study. Expression and Emotion Scale for Children (EESC) change scores were analyzed post hoc using two methods to…

An engineering optimization method with application to STOL-aircraft approach and landing trajectories

NASA Technical Reports Server (NTRS)

Jacob, H. G.

1972-01-01

An optimization method has been developed that computes the optimal open loop inputs for a dynamical system by observing only its output. The method reduces to static optimization by expressing the inputs as series of functions with parameters to be optimized. Since the method is not concerned with the details of the dynamical system to be optimized, it works for both linear and nonlinear systems. The method and the application to optimizing longitudinal landing paths for a STOL aircraft with an augmented wing are discussed. Noise, fuel, time, and path deviation minimizations are considered with and without angle of attack, acceleration excursion, flight path, endpoint, and other constraints.

Tailor-made fibroblast-specific and antibiotic-free interleukin 12 plasmid for gene electrotransfer-mediated cancer immunotherapy.

PubMed

Kamensek, Urska; Tesic, Natasa; Sersa, Gregor; Kos, Spela; Cemazar, Maja

2017-01-01

Electrotransfer mediated delivery of interleukin-12 (IL-12) gene, encoded on a plasmid vector, has already been demonstrated to have a potent antitumor efficacy and great potential for clinical application. In the present study, our aim was to construct an optimized IL-12-encoding plasmid that is safe from the regulatory point of view. In light of previous studies demonstrating that IL-12 should be released in a tumor localized manner for optimal efficacy, the strong ubiquitous promoter was replaced with a weak endogenous promoter of the collagen 2 gene, which is specific for fibroblasts. Next, to comply with increasing regulatory demands for clinically used plasmids, the expression cassette was cloned in a plasmid lacking the antibiotic resistance gene. The constructed fibroblast-specific and antibiotic-free IL-12 plasmid was demonstrated to support low IL-12 expression after gene electrotransfer in selected cell lines. Furthermore, the removal of antibiotic resistance did not affect the plasmid expression profile and lowered its cytotoxicity. With optimal IL-12 expression and minimal transgene non-specific effects, i.e., low cytotoxicity, the constructed plasmid could be especially valuable for different modern immunological approaches to achieve localized boosting of the host's immune system. Copyright © 2016 Elsevier Inc. All rights reserved.

A novel harmony search-K means hybrid algorithm for clustering gene expression data

PubMed Central

Nazeer, KA Abdul; Sebastian, MP; Kumar, SD Madhu

2013-01-01

Recent progress in bioinformatics research has led to the accumulation of huge quantities of biological data at various data sources. The DNA microarray technology makes it possible to simultaneously analyze large number of genes across different samples. Clustering of microarray data can reveal the hidden gene expression patterns from large quantities of expression data that in turn offers tremendous possibilities in functional genomics, comparative genomics, disease diagnosis and drug development. The k- ¬means clustering algorithm is widely used for many practical applications. But the original k-¬means algorithm has several drawbacks. It is computationally expensive and generates locally optimal solutions based on the random choice of the initial centroids. Several methods have been proposed in the literature for improving the performance of the k-¬means algorithm. A meta-heuristic optimization algorithm named harmony search helps find out near-global optimal solutions by searching the entire solution space. Low clustering accuracy of the existing algorithms limits their use in many crucial applications of life sciences. In this paper we propose a novel Harmony Search-K means Hybrid (HSKH) algorithm for clustering the gene expression data. Experimental results show that the proposed algorithm produces clusters with better accuracy in comparison with the existing algorithms. PMID:23390351

A novel harmony search-K means hybrid algorithm for clustering gene expression data.

PubMed

Nazeer, Ka Abdul; Sebastian, Mp; Kumar, Sd Madhu

2013-01-01

Recent progress in bioinformatics research has led to the accumulation of huge quantities of biological data at various data sources. The DNA microarray technology makes it possible to simultaneously analyze large number of genes across different samples. Clustering of microarray data can reveal the hidden gene expression patterns from large quantities of expression data that in turn offers tremendous possibilities in functional genomics, comparative genomics, disease diagnosis and drug development. The k- ¬means clustering algorithm is widely used for many practical applications. But the original k-¬means algorithm has several drawbacks. It is computationally expensive and generates locally optimal solutions based on the random choice of the initial centroids. Several methods have been proposed in the literature for improving the performance of the k-¬means algorithm. A meta-heuristic optimization algorithm named harmony search helps find out near-global optimal solutions by searching the entire solution space. Low clustering accuracy of the existing algorithms limits their use in many crucial applications of life sciences. In this paper we propose a novel Harmony Search-K means Hybrid (HSKH) algorithm for clustering the gene expression data. Experimental results show that the proposed algorithm produces clusters with better accuracy in comparison with the existing algorithms.

Improvement of levan production in Bacillus amyloliquefaciens through metabolic optimization of regulatory elements.

PubMed

Gu, Yanyan; Zheng, Jiayi; Feng, Jun; Cao, Mingfeng; Gao, Weixia; Quan, Yufen; Dang, Yulei; Wang, Yi; Wang, Shufang; Song, Cunjiang

2017-05-01

Levan is a functional homopolymer of fructose with considerable applications in food, pharmaceutical and cosmetic industries. To improve the levan production in Bacillus amyloliquefaciens, the regulatory elements of sacB (encoding levansucrase) expression and levansucrase secretion were optimized. Four heterologous promoters were evaluated for sacB expression, and the Pgrac promoter led to the highest level for both sacB transcription and levansucrase enzyme activity. The levan production in the corresponding recombinant strain ΔLP-pHTPgrac reached 30.5 g/L, which was 114% higher than that of the control strain NK-ΔLP. In a further step, eight signal peptides were investigated (with Pgrac as the promoter for sacB expression) for their effects on the levansucrase secretion and levan production. The signal peptide yncM was identified as the optimal one, with a secretion efficiency of approximately 90%, and the levan production in the corresponding recombinant strain ΔLP-Y reached 37.4 g/L, which was 161% higher when compared with the control strains NK-ΔLP. Finally, fed-batch fermentation was carried out in 5-L bioreactors for levan production using the recombinant strain ΔLP-Y. A final levan concentration of 102 g/L was achieved, which is very close to the ever reported highest levan production level from the literature. To our best knowledge, this is the first report of the improvement of levan production through metabolic optimization for sacB expression and levansucrase secretion. The results from this study provided essential insights for systematically metabolic engineering of microbial cell factories for enhanced biochemical production.

The Culture of Faith and Hope: Patients’ Justifications for Their High Estimations of Expected Therapeutic Benefit When Enrolling in Early-Phase Oncology Trials

PubMed Central

Sulmasy, Daniel P.; Astrow, Alan B.; He, M. Kai; Seils, Damon M.; Meropol, Neal J.; Micco, Ellyn; Weinfurt, Kevin P.

2013-01-01

Purpose Patients’ estimates of their chances of therapeutic benefit from participation in early-phase trials greatly exceed historical data. Ethicists worry that this “therapeutic misestimation” undermines the validity of informed consent. Patients and Methods We interviewed 45 patients enrolled in phase I or II oncology trials about their expectations of therapeutic benefit and their reasons for those expectations. We employed a phenomenological, qualitative approach with one primary coder to identify emergent themes, verified by 2 independent coders. Results Median expectations of therapeutic benefit varied from 50% to 80%, depending on how the question was asked. Justifications universally invoked hope and optimism, and 27/45 participants used one of these words. Three major themes emerged: (1) optimism as performative, that is, the notion that positive thoughts and expressions improve chances of benefit; (2) fighting cancer as a battle; and (3) faith in God, science, or both. Many participants described a culture in which optimism was encouraged and expected, such that trial enrollment became a way of reflecting this expectation. Many reported they had been told few patients would benefit and appeared to understand the uncertainties of clinical research, yet expressed high expected personal therapeutic benefit. More distressed participants were less likely to invoke performative justifications for their expectations (50% vs 84%; P = .04). Conclusion Expressions of high expected therapeutic benefit had little to do with reporting knowledge and more to do with expressing optimism. These results have implications for understanding how to obtain valid consent from participants in early-phase clinical trials. PMID:20564120

Optimized theory for simple and molecular fluids.

PubMed

Marucho, M; Montgomery Pettitt, B

2007-03-28

An optimized closure approximation for both simple and molecular fluids is presented. A smooth interpolation between Perkus-Yevick and hypernetted chain closures is optimized by minimizing the free energy self-consistently with respect to the interpolation parameter(s). The molecular version is derived from a refinement of the method for simple fluids. In doing so, a method is proposed which appropriately couples an optimized closure with the variant of the diagrammatically proper integral equation recently introduced by this laboratory [K. M. Dyer et al., J. Chem. Phys. 123, 204512 (2005)]. The simplicity of the expressions involved in this proposed theory has allowed the authors to obtain an analytic expression for the approximate excess chemical potential. This is shown to be an efficient tool to estimate, from first principles, the numerical value of the interpolation parameters defining the aforementioned closure. As a preliminary test, representative models for simple fluids and homonuclear diatomic Lennard-Jones fluids were analyzed, obtaining site-site correlation functions in excellent agreement with simulation data.

Maximizing RNA yield from archival renal tumors and optimizing gene expression analysis.

PubMed

Glenn, Sean T; Head, Karen L; Teh, Bin T; Gross, Kenneth W; Kim, Hyung L

2010-01-01

Formalin-fixed, paraffin-embedded tissues are widely available for gene expression analysis using TaqMan PCR. Five methods, including 4 commercial kits, for recovering RNA from paraffin-embedded renal tumor tissue were compared. The MasterPure kit from Epicentre produced the highest RNA yield. However, the difference in RNA yield between the kit from Epicenter and Invitrogen's TRIzol method was not significant. Using the top 3 RNA isolation methods, the manufacturers' protocols were modified to include an overnight Proteinase K digestion. Overnight protein digestion resulted in a significant increase in RNA yield. To optimize the reverse transcription reaction, conventional reverse transcription with random oligonucleotide primers was compared to reverse transcription using primers specific for genes of interest. Reverse transcription using gene-specific primers significantly increased the quantity of cDNA detectable by TaqMan PCR. Therefore, expression profiling of formalin-fixed, paraffin-embedded tissue using TaqMan qPCR can be optimized by using the MasterPure RNA isolation kit modified to include an overnight Proteinase K digestion and gene-specific primers during the reverse transcription.

Dynamic imaging model and parameter optimization for a star tracker.

PubMed

Yan, Jinyun; Jiang, Jie; Zhang, Guangjun

2016-03-21

Under dynamic conditions, star spots move across the image plane of a star tracker and form a smeared star image. This smearing effect increases errors in star position estimation and degrades attitude accuracy. First, an analytical energy distribution model of a smeared star spot is established based on a line segment spread function because the dynamic imaging process of a star tracker is equivalent to the static imaging process of linear light sources. The proposed model, which has a clear physical meaning, explicitly reflects the key parameters of the imaging process, including incident flux, exposure time, velocity of a star spot in an image plane, and Gaussian radius. Furthermore, an analytical expression of the centroiding error of the smeared star spot is derived using the proposed model. An accurate and comprehensive evaluation of centroiding accuracy is obtained based on the expression. Moreover, analytical solutions of the optimal parameters are derived to achieve the best performance in centroid estimation. Finally, we perform numerical simulations and a night sky experiment to validate the correctness of the dynamic imaging model, the centroiding error expression, and the optimal parameters.

Codon Optimization of the Human Papillomavirus E7 Oncogene Induces a CD8+ T Cell Response to a Cryptic Epitope Not Harbored by Wild-Type E7

PubMed Central

Lorenz, Felix K. M.; Wilde, Susanne; Voigt, Katrin; Kieback, Elisa; Mosetter, Barbara; Schendel, Dolores J.; Uckert, Wolfgang

2015-01-01

Codon optimization of nucleotide sequences is a widely used method to achieve high levels of transgene expression for basic and clinical research. Until now, immunological side effects have not been described. To trigger T cell responses against human papillomavirus, we incubated T cells with dendritic cells that were pulsed with RNA encoding the codon-optimized E7 oncogene. All T cell receptors isolated from responding T cell clones recognized target cells expressing the codon-optimized E7 gene but not the wild type E7 sequence. Epitope mapping revealed recognition of a cryptic epitope from the +3 alternative reading frame of codon-optimized E7, which is not encoded by the wild type E7 sequence. The introduction of a stop codon into the +3 alternative reading frame protected the transgene product from recognition by T cell receptor gene-modified T cells. This is the first experimental study demonstrating that codon optimization can render a transgene artificially immunogenic through generation of a dominant cryptic epitope. This finding may be of great importance for the clinical field of gene therapy to avoid rejection of gene-corrected cells and for the design of DNA- and RNA-based vaccines, where codon optimization may artificially add a strong immunogenic component to the vaccine. PMID:25799237

Quantum approximate optimization algorithm for MaxCut: A fermionic view

NASA Astrophysics Data System (ADS)

Wang, Zhihui; Hadfield, Stuart; Jiang, Zhang; Rieffel, Eleanor G.

2018-02-01

Farhi et al. recently proposed a class of quantum algorithms, the quantum approximate optimization algorithm (QAOA), for approximately solving combinatorial optimization problems (E. Farhi et al., arXiv:1411.4028; arXiv:1412.6062; arXiv:1602.07674). A level-p QAOA circuit consists of p steps; in each step a classical Hamiltonian, derived from the cost function, is applied followed by a mixing Hamiltonian. The 2 p times for which these two Hamiltonians are applied are the parameters of the algorithm, which are to be optimized classically for the best performance. As p increases, parameter optimization becomes inefficient due to the curse of dimensionality. The success of the QAOA approach will depend, in part, on finding effective parameter-setting strategies. Here we analytically and numerically study parameter setting for the QAOA applied to MaxCut. For the level-1 QAOA, we derive an analytical expression for a general graph. In principle, expressions for higher p could be derived, but the number of terms quickly becomes prohibitive. For a special case of MaxCut, the "ring of disagrees," or the one-dimensional antiferromagnetic ring, we provide an analysis for an arbitrarily high level. Using a fermionic representation, the evolution of the system under the QAOA translates into quantum control of an ensemble of independent spins. This treatment enables us to obtain analytical expressions for the performance of the QAOA for any p . It also greatly simplifies the numerical search for the optimal values of the parameters. By exploring symmetries, we identify a lower-dimensional submanifold of interest; the search effort can be accordingly reduced. This analysis also explains an observed symmetry in the optimal parameter values. Further, we numerically investigate the parameter landscape and show that it is a simple one in the sense of having no local optima.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hart, William E.; Siirola, John Daniel

We describe new capabilities for modeling MPEC problems within the Pyomo modeling software. These capabilities include new modeling components that represent complementar- ity conditions, modeling transformations for re-expressing models with complementarity con- ditions in other forms, and meta-solvers that apply transformations and numeric optimization solvers to optimize MPEC problems. We illustrate the breadth of Pyomo's modeling capabil- ities for MPEC problems, and we describe how Pyomo's meta-solvers can perform local and global optimization of MPEC problems.

Model-Based Optimal Experimental Design for Complex Physical Systems

DTIC Science & Technology

2015-12-03

for public release. magnitude reduction in estimator error required to make solving the exact optimal design problem tractable. Instead of using a naive...for designing a sequence of experiments uses suboptimal approaches: batch design that has no feedback, or greedy ( myopic ) design that optimally...approved for public release. Equation 1 is difficult to solve directly, but can be expressed in an equivalent form using the principle of dynamic programming

[Development of an optimal scheme for calculating results of the use of an immunoenzyme test-system for determining the antigenic activity of a cultured antirabies vaccine].

PubMed

Tsetlin, E M; Volkova, R A

1996-01-01

Ninety-eight lots of commercial antirabies vaccine manufactured by Immunopreparat Research and Production Amalgamation have been tested using enzyme immunoassay system for the detection of rabies virus antigens. Comparison of different variants of interpreting and expressing the results helped define the optimal method for assessment of vaccine titer and reference values: optical density value equal to 0.2 is taken as the cut-off. Antigenic activity of the vaccine may be expressed in international units, similarly as immunogenic activity.

A Recessive Pollination Control System for Wheat Based on Intein-Mediated Protein Splicing.

PubMed

Gils, Mario

2017-01-01

A transgene-expression system for wheat that relies on the complementation of inactive precursor protein fragments through a split-intein system is described. The N- and C-terminal fragments of a barnase gene from Bacillus amyloliquifaciens were fused to intein sequences from Synechocystis sp. and transformed into wheat plants. Upon translation, both barnase fragments are assembled by an autocatalytic intein-mediated trans-splicing reaction, thus forming a cytotoxic enzyme. This chapter focuses on the use of introns and flexible polypeptide linkers to foster the expression of a split-barnase expression system in plants. The methods and protocols that were employed with the objective to test the effects of such genetic elements on transgene expression and to find the optimal design of expression vectors for use in wheat are provided. Split-inteins can be used to form an agriculturally important trait (male sterility) in wheat plants. The use of this principle for the production of hybrid wheat seed is described. The suggested toolbox will hopefully be a valuable contribution to future optimization strategies in this commercially important crop.

An effective fuzzy kernel clustering analysis approach for gene expression data.

PubMed

Sun, Lin; Xu, Jiucheng; Yin, Jiaojiao

2015-01-01

Fuzzy clustering is an important tool for analyzing microarray data. A major problem in applying fuzzy clustering method to microarray gene expression data is the choice of parameters with cluster number and centers. This paper proposes a new approach to fuzzy kernel clustering analysis (FKCA) that identifies desired cluster number and obtains more steady results for gene expression data. First of all, to optimize characteristic differences and estimate optimal cluster number, Gaussian kernel function is introduced to improve spectrum analysis method (SAM). By combining subtractive clustering with max-min distance mean, maximum distance method (MDM) is proposed to determine cluster centers. Then, the corresponding steps of improved SAM (ISAM) and MDM are given respectively, whose superiority and stability are illustrated through performing experimental comparisons on gene expression data. Finally, by introducing ISAM and MDM into FKCA, an effective improved FKCA algorithm is proposed. Experimental results from public gene expression data and UCI database show that the proposed algorithms are feasible for cluster analysis, and the clustering accuracy is higher than the other related clustering algorithms.

Dose-dependent modulation of CD8 and functional avidity as a result of peptide encounter

PubMed Central

Kroger, Charles J; Alexander-Miller, Martha A

2007-01-01

The generation of an optimal CD8+ cytotoxic T lymphocyte (CTL) response is critical for the clearance of many intracellular pathogens. Previous studies suggest that one contributor to an optimal immune response is the presence of CD8+ cells exhibiting high functional avidity. In this regard, CD8 expression has been shown to contribute to peptide sensitivity. Here, we investigated the ability of naive splenocytes to modulate CD8 expression according to the concentration of stimulatory peptide antigen. Our results showed that the level of CD8 expressed was inversely correlated with the amount of peptide used for the primary stimulation, with higher concentrations of antigen resulting in lower expression of both CD8α and CD8β. Importantly the ensuing CD8low and CD8high CTL populations were not the result of the selective outgrowth of naive CD8+ T-cell subpopulations expressing distinct levels of CD8. Subsequent encounter with peptide antigen resulted in continued modulation of both the absolute level and the isoform of CD8 expressed and in the functional avidity of the responding cells. We propose that CD8 cell surface expression is not a static property, but can be modulated to ‘fine tune’ the sensitivity of responding CTL to a defined concentration of antigen. PMID:17484768

[Prokaryotic expression and immunological activity of human neutrophil gelatinase associated lipocalin].

PubMed

Wu, Jianwei; Cai, Lei; Qian, Wei; Jiao, Liyuan; Li, Jiangfeng; Song, Xiaoli; Wang, Jihua

2015-07-01

To construct a prokaryotic expression vector of human neutrophil gelatinase associated lipocalin (NGAL) and identify the bioactivity of the fusion protein. The cDNA of human NGAL obtained from GenBank was linked to a cloning vector to construct the prokaryotic expression vector pCold-NGAL. Then the vector was transformed into E.coli BL21(DE3) plysS. Under the optimal induction condition, the recombinant NGAL (rNGAL) was expressed and purified by Ni Sepharose 6 Fast Flow affinity chromatography. The purity and activity of the rNGAL were respectively identified by SDS-PAGE and Western blotting combined with NGAL reagent (Latex enhanced immunoturbidimetry). Restriction enzyme digestion and nucleotide sequencing proved that the expression vector pCold-NGAL was successfully constructed. Under the optimal induction condition that we determined, the rNGAL was expressed in soluble form in E.coli BL21(DE3) plysS. The relative molecular mass of the rNGAL was 25 000, and its purity was more than 98.0%. Furthermore, Western blotting and immunoturbidimetry indicated that the rNGAL reacted with NGAL mAb specifically. Human rNGAL of high purity and bioactivity was successfully constructed in E.coli BL21(DE3) plysS using the expression vector pCold-NGAL.

Investigation on the use of optimization techniques for helicopter airframe vibrations design studies

NASA Technical Reports Server (NTRS)

Sreekanta Murthy, T.

1992-01-01

Results of the investigation of formal nonlinear programming-based numerical optimization techniques of helicopter airframe vibration reduction are summarized. The objective and constraint function and the sensitivity expressions used in the formulation of airframe vibration optimization problems are presented and discussed. Implementation of a new computational procedure based on MSC/NASTRAN and CONMIN in a computer program system called DYNOPT for optimizing airframes subject to strength, frequency, dynamic response, and dynamic stress constraints is described. An optimization methodology is proposed which is thought to provide a new way of applying formal optimization techniques during the various phases of the airframe design process. Numerical results obtained from the application of the DYNOPT optimization code to a helicopter airframe are discussed.

Parametric optimal control of uncertain systems under an optimistic value criterion

NASA Astrophysics Data System (ADS)

Li, Bo; Zhu, Yuanguo

2018-01-01

It is well known that the optimal control of a linear quadratic model is characterized by the solution of a Riccati differential equation. In many cases, the corresponding Riccati differential equation cannot be solved exactly such that the optimal feedback control may be a complex time-oriented function. In this article, a parametric optimal control problem of an uncertain linear quadratic model under an optimistic value criterion is considered for simplifying the expression of optimal control. Based on the equation of optimality for the uncertain optimal control problem, an approximation method is presented to solve it. As an application, a two-spool turbofan engine optimal control problem is given to show the utility of the proposed model and the efficiency of the presented approximation method.

An Optimized Transient Dual Luciferase Assay for Quantifying MicroRNA Directed Repression of Targeted Sequences

PubMed Central

Moyle, Richard L.; Carvalhais, Lilia C.; Pretorius, Lara-Simone; Nowak, Ekaterina; Subramaniam, Gayathery; Dalton-Morgan, Jessica; Schenk, Peer M.

2017-01-01

Studies investigating the action of small RNAs on computationally predicted target genes require some form of experimental validation. Classical molecular methods of validating microRNA action on target genes are laborious, while approaches that tag predicted target sequences to qualitative reporter genes encounter technical limitations. The aim of this study was to address the challenge of experimentally validating large numbers of computationally predicted microRNA-target transcript interactions using an optimized, quantitative, cost-effective, and scalable approach. The presented method combines transient expression via agroinfiltration of Nicotiana benthamiana leaves with a quantitative dual luciferase reporter system, where firefly luciferase is used to report the microRNA-target sequence interaction and Renilla luciferase is used as an internal standard to normalize expression between replicates. We report the appropriate concentration of N. benthamiana leaf extracts and dilution factor to apply in order to avoid inhibition of firefly LUC activity. Furthermore, the optimal ratio of microRNA precursor expression construct to reporter construct and duration of the incubation period post-agroinfiltration were determined. The optimized dual luciferase assay provides an efficient, repeatable and scalable method to validate and quantify microRNA action on predicted target sequences. The optimized assay was used to validate five predicted targets of rice microRNA miR529b, with as few as six technical replicates. The assay can be extended to assess other small RNA-target sequence interactions, including assessing the functionality of an artificial miRNA or an RNAi construct on a targeted sequence. PMID:28979287

Long-term functional adeno-associated virus-microdystrophin expression in the dystrophic CXMDj dog.

PubMed

Koo, Taeyoung; Okada, Takashi; Athanasopoulos, Takis; Foster, Helen; Takeda, Shin'ichi; Dickson, George

2011-09-01

Duchenne muscular dystrophy (DMD) is a severe, inherited, muscle-wasting disorder caused by mutations in the dystrophin gene. Preclinical studies of adeno-associated virus gene therapy for DMD have been described in mouse and dog models of this disease. However, low and transient expression of microdystrophin in dystrophic dogs and a lack of long-term microdystrophin expression associated with a CD8(+)  T-cell response in DMD patients suggests that the development of improved microdystrophin genes and delivery strategies is essential for successful clinical trials in DMD patients. We have previously shown the efficiency of mRNA sequence optimization of mouse microdystrophin in ameliorating the pathology of dystrophic mdx mice. In the present study, we generated adeno-associated virus (AAV)2/8 vectors expressing an mRNA sequence-optimized canine microdystrophin under the control of a muscle-specific promoter and injected intramuscularly into a single canine X-linked muscular dystrophy (CXMDj) dog. Expression of stable and high levels of microdystrophin was observed along with an association of the dystrophin-associated protein complex in intramuscularly injected muscles of a CXMDj dog for at least 8 weeks without immune responses. Treated muscles were highly protected from dystrophic damage, with reduced levels of myofiber permeability and central nucleation. The data obtained in the present study suggest that the use of canine-specific and mRNA sequence-optimized microdystrophin genes in conjunction with a muscle-specific promoter results in high and stable levels of microdystrophin expression in a canine model of DMD. This approach will potentially allow the reduction of dosage and contribute towards the development of a safe and effective AAV gene therapy clinical trial protocol for DMD. Copyright © 2011 John Wiley & Sons, Ltd.

Optimal expression of a Fab-effector fusion protein in Escherichia coli by removing the cysteine residues responsible for an interchain disulfide bond of a Fab molecule.

PubMed

Kang, Hyeon-Ju; Kim, Hye-Jin; Jung, Mun-Sik; Han, Jae-Kyu; Cha, Sang-Hoon

2017-04-01

Development of novel bi-functional or even tri-functional Fab-effector fusion proteins would have a great potential in the biomedical sciences. However, the expression of Fab-effector fusion proteins in Escherichia coli is problematic especially when a eukaryotic effector moiety is genetically linked to a Fab due to the lack of proper chaperone proteins and an inappropriate physicochemical environment intrinsic to the microbial hosts. We previously reported that a human Fab molecule, referred to as SL335, reactive to human serum albumin has a prolonged in vivo serum half-life in rats. We, herein, tested six discrete SL335-human growth hormone (hGH) fusion constructs as a model system to define an optimal Fab-effector fusion format for E. coli expression. We found that one variant, referred to as HserG/Lser, outperformed the others in terms of a soluble expression yield and functionality in that HserG/Lser has a functional hGH bioactivity and possesses an serum albumin-binding affinity comparable to SL335. Our results clearly demonstrated that the genetic linkage of an effector domain to the C-terminus of Fd (V H +C H1 ) and the removal of cysteine (Cys) residues responsible for an interchain disulfide bond (IDB) ina Fab molecule optimize the periplasmic expression of a Fab-effector fusion protein in E. coli. We believe that our approach can contribute the development of diverse bi-functional Fab-effector fusion proteins by providing a simple strategy that enables the reliable expression of a functional fusion proteins in E. coli. Copyright © 2017 European Federation of Immunological Societies. Published by Elsevier B.V. All rights reserved.

Improving the active expression of transglutaminase in Streptomyces lividans by promoter engineering and codon optimization.

PubMed

Liu, Song; Wang, Miao; Du, Guocheng; Chen, Jian

2016-10-28

Transglutaminases (TGase), which are synthesized as a zymogen (pro-TGase) in Streptomyces sp., are important enzymes in the food industry. Because this pro-peptide is essential for the correct folding of Streptomyces TGase, TGase is usually expressed in an inactive pro-TGase form, which is then converted to active TGase by the addition of activating proteases in vitro. In this study, Streptomyces hygroscopicus TGase was actively produced by Streptomyces lividans through promoter engineering and codon optimization. A gene fragment (tg1, 2.6 kb) that encoded the pro-TGase and its endogenous promoter region, signal peptide and terminator was amplified from S. hygroscopicus WSH03-13 and cloned into plasmid pIJ86, which resulted in pIJ86/tg1. After fermentation for 2 days, S. lividans TK24 that harbored pIJ86/tg1 produced 1.8 U/mL of TGase, and a clear TGase band (38 kDa) was detected in the culture supernatant. These results indicated that the pro-TGase was successfully expressed and correctly processed into active TGase in S. lividans TK24 by using the TGase promoter. Based on deletion analysis, the complete sequence of the TGase promoter is restricted to the region from -693 to -48. We also identified a negative element (-198 to -148) in the TGase promoter, and the deletion of this element increased the TGase production by 81.3 %, in contrast to the method by which S. lividans expresses pIJ86/tg1. Combining the deletion of the negative element of the promoter and optimization of the gene codons, the yield and productivity of TGase reached 5.73 U/mL and 0.14 U/mL/h in the recombinant S. lividans, respectively. We constructed an active TGase-producing strain that had a high yield and productivity, and the optimized TGase promoter could be a good candidate promoter for the expression of other proteins in Streptomyces.

Cloning, optimization of induction conditions and purification of Mycobacterium tuberculosis Rv1733c protein expressed in Escherichia coli

PubMed Central

Ashayeri-Panah, Mitra; Eftekhar, Fereshteh; Kazemi, Bahram; Joseph, Joan

2017-01-01

Background and Objectives: Rv1733c is a latency antigen from Mycobacterium tuberculosis, a probable integral-membrane protein with promiscuous T-cell and B-cell epitopes, making it a potential vaccine candidate against tuberculosis. This study aimed to clone and optimize the expression of recombinant Rv1733c in Escherichia coli for purification. Materials and Methods: Chemically synthesized rv1733c coding sequence was cloned in pET-23a(+) followed by transforming E. coli BL21 (DE3) cells. To evaluate the induction conditions for optimized expression, factorial design of experiments was employed using four different media as well as four levels of isopropyl-b-D-thiogalactopyranosid [IPTG] concentration and duration of induction. The recombinant protein was then purified using a His-tag purification kit and detected through western blotting. Results: Recombinant Rv1733c (> 24 kDa) was expressed and accumulated in the cytoplasm of the E. coli cells. Medium composition showed the most significant effect on the yield of the recombinant protein (P = 0.000). The highest yield of recombinant Rv1733c occurred in the presence of 0.4 mM of IPTG in Terrific Broth medium (containing 1.2% tryptone, 2.4% yeast extract, 72 mM K 2 HPO 4 , 17 mM KH 2 PO 4 and 0.4% glycerol) after 10 h at 37°C. Under these conditions, the expression level was around 0.5 g/L of culture medium. Purified Rv1733c was detected by an anti-polyhistidine antibody and a tuberculosis patient’s serum. Systematic optimization of induction conditions gave us high yield of recombinant polyhistidine-tagged Rv1733c in E. coli which was successfuly purified. Conclusion: We believe that the purified Rv1733c recombinant protein from M. tuberculosis might be a good candidate for vaccine production against tuberculosis. PMID:29213997

Optimization of helicopter airframe structures for vibration reduction considerations, formulations and applications

NASA Technical Reports Server (NTRS)

Murthy, T. Sreekanta

1988-01-01

Several key issues involved in the application of formal optimization technique to helicopter airframe structures for vibration reduction are addressed. Considerations which are important in the optimization of real airframe structures are discussed. Considerations necessary to establish relevant set of design variables, constraints and objectives which are appropriate to conceptual, preliminary, detailed design, ground and flight test phases of airframe design are discussed. A methodology is suggested for optimization of airframes in various phases of design. Optimization formulations that are unique to helicopter airframes are described and expressions for vibration related functions are derived. Using a recently developed computer code, the optimization of a Bell AH-1G helicopter airframe is demonstrated.

Cutoff Finder: A Comprehensive and Straightforward Web Application Enabling Rapid Biomarker Cutoff Optimization

PubMed Central

Budczies, Jan; Klauschen, Frederick; Sinn, Bruno V.; Győrffy, Balázs; Schmitt, Wolfgang D.; Darb-Esfahani, Silvia; Denkert, Carsten

2012-01-01

Gene or protein expression data are usually represented by metric or at least ordinal variables. In order to translate a continuous variable into a clinical decision, it is necessary to determine a cutoff point and to stratify patients into two groups each requiring a different kind of treatment. Currently, there is no standard method or standard software for biomarker cutoff determination. Therefore, we developed Cutoff Finder, a bundle of optimization and visualization methods for cutoff determination that is accessible online. While one of the methods for cutoff optimization is based solely on the distribution of the marker under investigation, other methods optimize the correlation of the dichotomization with respect to an outcome or survival variable. We illustrate the functionality of Cutoff Finder by the analysis of the gene expression of estrogen receptor (ER) and progesterone receptor (PgR) in breast cancer tissues. This distribution of these important markers is analyzed and correlated with immunohistologically determined ER status and distant metastasis free survival. Cutoff Finder is expected to fill a relevant gap in the available biometric software repertoire and will enable faster optimization of new diagnostic biomarkers. The tool can be accessed at http://molpath.charite.de/cutoff. PMID:23251644

Nomenclature and guideline to express the amount of a membrane protein synthesized in animal cells in view of bioprocess optimization and production monitoring.

PubMed

Augusto, Elisabeth F P; Moraes, Angela M; Piccoli, Rosane A M; Barral, Manuel F; Suazo, Cláudio A T; Tonso, Aldo; Pereira, Carlos A

2010-01-01

Studies of a bioprocess optimization and monitoring for protein synthesis in animal cells face a challenge on how to express in quantitative terms the system performance. It is possible to have a panel of calculated variables that fits more or less appropriately the intended goal. Each mathematical expression approach translates different quantitative aspects. We can basically separate them into two categories: those used for the evaluation of cell physiology in terms of product synthesis, which can be for bioprocess improvement or optimization, and those used for production unit sizing and for bioprocess operation. With these perspectives and based on our own data of kinetic S2 cells growth and metabolism, as well as on their synthesis of the transmembrane recombinant rabies virus glycoprotein, here indicated as P, we show and discuss the main characteristics of calculated variables and their recommended use. Mainly applied to a bioprocess improvement/optimization and that mainly used for operation definition and to design the production unit, we expect these definitions/recommendations would improve the quality of data produced in this field and lead to more standardized procedures. In turn, it would allow a better and easier comprehension of scientific and technological communications for specialized readers. Copyright 2009 The International Association for Biologicals. Published by Elsevier Ltd. All rights reserved.

A parallel optimization method for product configuration and supplier selection based on interval

NASA Astrophysics Data System (ADS)

Zheng, Jian; Zhang, Meng; Li, Guoxi

2017-06-01

In the process of design and manufacturing, product configuration is an important way of product development, and supplier selection is an essential component of supply chain management. To reduce the risk of procurement and maximize the profits of enterprises, this study proposes to combine the product configuration and supplier selection, and express the multiple uncertainties as interval numbers. An integrated optimization model of interval product configuration and supplier selection was established, and NSGA-II was put forward to locate the Pareto-optimal solutions to the interval multiobjective optimization model.

Optimal harvesting of a stochastic delay logistic model with Lévy jumps

NASA Astrophysics Data System (ADS)

Qiu, Hong; Deng, Wenmin

2016-10-01

The optimal harvesting problem of a stochastic time delay logistic model with Lévy jumps is considered in this article. We first show that the model has a unique global positive solution and discuss the uniform boundedness of its pth moment with harvesting. Then we prove that the system is globally attractive and asymptotically stable in distribution under our assumptions. Furthermore, we obtain the existence of the optimal harvesting effort by the ergodic method, and then we give the explicit expression of the optimal harvesting policy and maximum yield.

Low Complexity Models to improve Incomplete Sensitivities for Shape Optimization

NASA Astrophysics Data System (ADS)

Stanciu, Mugurel; Mohammadi, Bijan; Moreau, Stéphane

2003-01-01

The present global platform for simulation and design of multi-model configurations treat shape optimization problems in aerodynamics. Flow solvers are coupled with optimization algorithms based on CAD-free and CAD-connected frameworks. Newton methods together with incomplete expressions of gradients are used. Such incomplete sensitivities are improved using reduced models based on physical assumptions. The validity and the application of this approach in real-life problems are presented. The numerical examples concern shape optimization for an airfoil, a business jet and a car engine cooling axial fan.

Aerospace Applications of Integer and Combinatorial Optimization

NASA Technical Reports Server (NTRS)

Padula, S. L.; Kincaid, R. K.

1995-01-01

Research supported by NASA Langley Research Center includes many applications of aerospace design optimization and is conducted by teams of applied mathematicians and aerospace engineers. This paper investigates the benefits from this combined expertise in formulating and solving integer and combinatorial optimization problems. Applications range from the design of large space antennas to interior noise control. A typical problem, for example, seeks the optimal locations for vibration-damping devices on an orbiting platform and is expressed as a mixed/integer linear programming problem with more than 1500 design variables.

Aerospace applications on integer and combinatorial optimization

NASA Technical Reports Server (NTRS)

Padula, S. L.; Kincaid, R. K.

1995-01-01

Research supported by NASA Langley Research Center includes many applications of aerospace design optimization and is conducted by teams of applied mathematicians and aerospace engineers. This paper investigates the benefits from this combined expertise in formulating and solving integer and combinatorial optimization problems. Applications range from the design of large space antennas to interior noise control. A typical problem. for example, seeks the optimal locations for vibration-damping devices on an orbiting platform and is expressed as a mixed/integer linear programming problem with more than 1500 design variables.

A dual host vector for Fab phage display and expression of native IgG in mammalian cells.

PubMed

Tesar, Devin; Hötzel, Isidro

2013-10-01

A significant bottleneck in antibody discovery by phage display is the transfer of immunoglobulin variable regions from phage clones to vectors that express immunoglobulin G (IgG) in mammalian cells for screening. Here, we describe a novel phagemid vector for Fab phage display that allows expression of native IgG in mammalian cells without sub-cloning. The vector uses an optimized mammalian signal sequence that drives robust expression of Fab fragments fused to an M13 phage coat protein in Escherichia coli and IgG expression in mammalian cells. To allow the expression of Fab fragments fused to a phage coat protein in E.coli and full-length IgG in mammalian cells from the same vector without sub-cloning, the sequence encoding the phage coat protein was embedded in an optimized synthetic intron within the immunoglobulin heavy chain gene. This intron is removed from transcripts in mammalian cells by RNA splicing. Using this vector, we constructed a synthetic Fab phage display library with diversity in the heavy chain only and selected for clones binding different antigens. Co-transfection of mammalian cells with DNA from individual phage clones and a plasmid expressing the invariant light chain resulted in the expression of native IgG that was used to assay affinity, ligand blocking activity and specificity.

SIMD Optimization of Linear Expressions for Programmable Graphics Hardware

PubMed Central

Bajaj, Chandrajit; Ihm, Insung; Min, Jungki; Oh, Jinsang

2009-01-01

The increased programmability of graphics hardware allows efficient graphical processing unit (GPU) implementations of a wide range of general computations on commodity PCs. An important factor in such implementations is how to fully exploit the SIMD computing capacities offered by modern graphics processors. Linear expressions in the form of ȳ = Ax̄ + b̄, where A is a matrix, and x̄, ȳ and b̄ are vectors, constitute one of the most basic operations in many scientific computations. In this paper, we propose a SIMD code optimization technique that enables efficient shader codes to be generated for evaluating linear expressions. It is shown that performance can be improved considerably by efficiently packing arithmetic operations into four-wide SIMD instructions through reordering of the operations in linear expressions. We demonstrate that the presented technique can be used effectively for programming both vertex and pixel shaders for a variety of mathematical applications, including integrating differential equations and solving a sparse linear system of equations using iterative methods. PMID:19946569

Baculovirus-mediated expression of GPCRs in insect cells.

PubMed

Saarenpää, Tuulia; Jaakola, Veli-Pekka; Goldman, Adrian

2015-01-01

G-protein-coupled receptors (GPCRs) are a large family of seven transmembrane proteins that influence a considerable number of cellular events. For this reason, they are one of the most studied receptor types for their pharmacological and structural properties. Solving the structure of several GPCR receptor types has been possible using almost all expression systems, including Escherichia coli, yeast, mammalian, and insect cells. So far, however, most of the GPCR structures solved have been done using the baculovirus insect cell expression system. The reason for this is mainly due to cost-effectiveness, posttranslational modification efficiency, and overall effortless maintenance. The system has evolved so much that variables starting from vector type, purification tags, cell line, and growth conditions can be varied and optimized countless ways to suit the needs of new constructs. Here, we present the array of techniques that enable the rapid and efficient optimization of expression steps for maximal protein quality and quantity, including our emendations. © 2015 Elsevier Inc. All rights reserved.

Global gene expression analysis by combinatorial optimization.

PubMed

Ameur, Adam; Aurell, Erik; Carlsson, Mats; Westholm, Jakub Orzechowski

2004-01-01

Generally, there is a trade-off between methods of gene expression analysis that are precise but labor-intensive, e.g. RT-PCR, and methods that scale up to global coverage but are not quite as quantitative, e.g. microarrays. In the present paper, we show how how a known method of gene expression profiling (K. Kato, Nucleic Acids Res. 23, 3685-3690 (1995)), which relies on a fairly small number of steps, can be turned into a global gene expression measurement by advanced data post-processing, with potentially little loss of accuracy. Post-processing here entails solving an ancillary combinatorial optimization problem. Validation is performed on in silico experiments generated from the FANTOM data base of full-length mouse cDNA. We present two variants of the method. One uses state-of-the-art commercial software for solving problems of this kind, the other a code developed by us specifically for this purpose, released in the public domain under GPL license.

High activity and stability of codon-optimized phosphoenolpyruvate carboxylase from Photobacterium profundum SS9 at low temperatures and its application for in vitro production of oxaloacetate.

PubMed

Park, Soohyun; Hong, Soohye; Pack, Seung Pil; Lee, Jinwon

2014-02-01

Phosphoenolpyruvate carboxylase (PEPC) of Photobacterium profundum SS9 can be expressed and purified using the Escherichia coli expression system. In this study, a codon-optimized PEPC gene (OPPP) was used to increase expression levels. We confirmed OPPP expression and purified it from extracts of recombinant E. coli SGJS117 harboring the OPPP gene. The purified OPPP showed a specific activity value of 80.3 U/mg protein. The OPPP was stable under low temperature (5-30 °C) and weakly basic conditions (pH 8.5-10). The enzymatic ability of OPPP was investigated for in vitro production of oxaloacetate using phosphoenolpyruvate (PEP) and bicarbonate. Only samples containing the OPPP, PEP, and bicarbonate resulted in oxaloacetate production. OPPP production system using E. coli could be a platform technology to produce high yields of heterogeneous gene and provide the PEPC enzyme, which has high enzyme activity.

New and improved tools and methods for enhanced biosynthesis of natural products in microorganisms.

PubMed

Wang, Zhiqing; Cirino, Patrick C

2016-12-01

Engineering efficient biosynthesis of natural products in microorganisms requires optimizing gene expression levels to balance metabolite flux distributions and to minimize accumulation of toxic intermediates. Such metabolic optimization is challenged with identifying the right gene targets, and then determining and achieving appropriate gene expression levels. After decades of having a relatively limited set of gene regulation tools available, metabolic engineers are recently enjoying an ever-growing repertoire of more precise and tunable gene expression platforms. Here we review recent applications of natural and designed transcriptional and translational regulatory machinery for engineering biosynthesis of natural products in microorganisms. Customized trans-acting RNAs (sgRNA, asRNA and sRNA), along with appropriate accessory proteins, are allowing for unparalleled tuning of gene expression. Meanwhile metabolite-responsive transcription factors and riboswitches have been implemented in strain screening and evolution, and in dynamic gene regulation. Further refinements and expansions on these platform technologies will circumvent many long-term obstacles in natural products biosynthesis. Copyright © 2016 Elsevier Ltd. All rights reserved.

Human leucocyte antigen class I-redirected anti-tumour CD4+ T cells require a higher T cell receptor binding affinity for optimal activity than CD8+ T cells.

PubMed

Tan, M P; Dolton, G M; Gerry, A B; Brewer, J E; Bennett, A D; Pumphrey, N J; Jakobsen, B K; Sewell, A K

2017-01-01

CD4 + T helper cells are a valuable component of the immune response towards cancer. Unfortunately, natural tumour-specific CD4 + T cells occur in low frequency, express relatively low-affinity T cell receptors (TCRs) and show poor reactivity towards cognate antigen. In addition, the lack of human leucocyte antigen (HLA) class II expression on most cancers dictates that these cells are often unable to respond to tumour cells directly. These deficiencies can be overcome by transducing primary CD4 + T cells with tumour-specific HLA class I-restricted TCRs prior to adoptive transfer. The lack of help from the co-receptor CD8 glycoprotein in CD4 + cells might result in these cells requiring a different optimal TCR binding affinity. Here we compared primary CD4 + and CD8 + T cells expressing wild-type and a range of affinity-enhanced TCRs specific for the HLA A*0201-restricted NY-ESO-1- and gp100 tumour antigens. Our major findings are: (i) redirected primary CD4 + T cells expressing TCRs of sufficiently high affinity exhibit a wide range of effector functions, including cytotoxicity, in response to cognate peptide; and (ii) optimal TCR binding affinity is higher in CD4 + T cells than CD8 + T cells. These results indicate that the CD4 + T cell component of current adoptive therapies using TCRs optimized for CD8 + T cells is below par and that there is room for substantial improvement. © 2016 The Authors. Clinical & Experimental Immunology published by John Wiley & Sons Ltd on behalf of British Society for Immunology.

Efficient production of soluble recombinant single chain Fv fragments by a Pseudomonas putida strain KT2440 cell factory.

PubMed

Dammeyer, Thorben; Steinwand, Miriam; Krüger, Sarah-C; Dübel, Stefan; Hust, Michael; Timmis, Kenneth N

2011-02-21

Recombinant antibody fragments have a wide range of applications in research, diagnostics and therapy. For many of these, small fragments like single chain fragment variables (scFv) function well and can be produced inexpensively in bacterial expression systems. Although Escherichia coli K-12 production systems are convenient, yields of different fragments, even those produced from codon-optimized expression systems, vary significantly. Where yields are inadequate, alternative production systems are needed. Pseudomonas putida strain KT2440 is a versatile biosafety strain known for good expression of heterologous genes, so we have explored its utility as a cell factory for production of scFvs. We have generated new broad host range scFv expression constructs and assessed their production in the Pseudomonas putida KT2440 host. Two scFvs bind either to human C-reactive protein or to mucin1, proteins of significant medical diagnostic and therapeutic interest, whereas a third is a model anti-lysozyme scFv. The KT2440 antibody expression systems produce scFvs targeted to the periplasmic space that were processed precisely and were easily recovered and purified by single-step or tandem affinity chromatography. The influence of promoter system, codon optimization for P. putida, and medium on scFv yield was examined. Yields of up to 3.5 mg/l of pure, soluble, active scFv fragments were obtained from shake flask cultures of constructs based on the original codon usage and expressed from the Ptac expression system, yields that were 2.5-4 times higher than those from equivalent cultures of an E. coli K-12 expression host. Pseudomonas putida KT2440 is a good cell factory for the production of scFvs, and the broad host range constructs we have produced allow yield assessment in a number of different expression hosts when yields in one initially selected are insufficient. High cell density cultivation and further optimization and refinement of the KT2440 cell factory will achieve additional increases in the yields of scFvs.

An Improved Syringe Agroinfiltration Protocol to Enhance Transformation Efficiency by Combinative Use of 5-Azacytidine, Ascorbate Acid and Tween-20.

PubMed

Zhao, Huimin; Tan, Zilong; Wen, Xuejing; Wang, Yucheng

2017-02-14

Syringe infiltration is an important transient transformation method that is widely used in many molecular studies. Owing to the wide use of syringe agroinfiltration, it is important and necessary to improve its transformation efficiency. Here, we studied the factors influencing the transformation efficiency of syringe agroinfiltration. The pCAMBIA1301 was transformed into Nicotiana benthamiana leaves for investigation. The effects of 5-azacytidine (AzaC), Ascorbate acid (ASC) and Tween-20 on transformation were studied. The β-glucuronidase ( GUS ) expression and GUS activity were respectively measured to determine the transformation efficiency. AzaC, ASC and Tween-20 all significantly affected the transformation efficiency of agroinfiltration, and the optimal concentrations of AzaC, ASC and Tween-20 for the transgene expression were identified. Our results showed that 20 μM AzaC, 0.56 mM ASC and 0.03% ( v / v ) Tween-20 is the optimal concentration that could significantly improve the transformation efficiency of agroinfiltration. Furthermore, a combined supplement of 20 μM AzaC, 0.56 mM ASC and 0.03% Tween-20 improves the expression of transgene better than any one factor alone, increasing the transgene expression by more than 6-fold. Thus, an optimized syringe agroinfiltration was developed here, which might be a powerful method in transient transformation analysis.

Efficient Production of γ-GABA Using Recombinant E. coli Expressing Glutamate Decarboxylase (GAD) Derived from Eukaryote Saccharomyces cerevisiae.

PubMed

Xiong, Qiang; Xu, Zheng; Xu, Lu; Yao, Zhong; Li, Sha; Xu, Hong

2017-12-01

γ-Aminobutyric acid (γ-GABA) is a non-proteinogenic amino acid, which acts as a major regulator in the central nervous system. Glutamate decarboxylase (namely GAD, EC 4.1.1.15) is known to be an ideal enzyme for γ-GABA production using L-glutamic acid as substrate. In this study, we cloned and expressed GAD gene from eukaryote Saccharomyces cerevisiae (ScGAD) in E. coli BL21(DE3). This enzyme was further purified and its optimal reaction temperature and pH were 37 °C and pH 4.2, respectively. The cofactor of ScGAD was verified to be either pyridoxal 5'-phosphate (PLP) or pyridoxal hydrochloride. The optimal concentration of either cofactor was 50 mg/L. The optimal medium for E. coli-ScGAD cultivation and expression were 10 g/L lactose, 5 g/L glycerol, 20 g/L yeast extract, and 10 g/L sodium chloride, resulting in an activity of 55 U/mL medium, three times higher than that of using Luria-Bertani (LB) medium. The maximal concentration of γ-GABA was 245 g/L whereas L-glutamic acid was near completely converted. These findings provided us a good example for bio-production of γ-GABA using recombinant E. coli expressing a GAD enzyme derived from eukaryote.

Facial Affect Recognition Using Regularized Discriminant Analysis-Based Algorithms

NASA Astrophysics Data System (ADS)

Lee, Chien-Cheng; Huang, Shin-Sheng; Shih, Cheng-Yuan

2010-12-01

This paper presents a novel and effective method for facial expression recognition including happiness, disgust, fear, anger, sadness, surprise, and neutral state. The proposed method utilizes a regularized discriminant analysis-based boosting algorithm (RDAB) with effective Gabor features to recognize the facial expressions. Entropy criterion is applied to select the effective Gabor feature which is a subset of informative and nonredundant Gabor features. The proposed RDAB algorithm uses RDA as a learner in the boosting algorithm. The RDA combines strengths of linear discriminant analysis (LDA) and quadratic discriminant analysis (QDA). It solves the small sample size and ill-posed problems suffered from QDA and LDA through a regularization technique. Additionally, this study uses the particle swarm optimization (PSO) algorithm to estimate optimal parameters in RDA. Experiment results demonstrate that our approach can accurately and robustly recognize facial expressions.

Optimal Reference Gene Selection for Expression Studies in Human Reticulocytes.

PubMed

Aggarwal, Anu; Jamwal, Manu; Viswanathan, Ganesh K; Sharma, Prashant; Sachdeva, ManUpdesh S; Bansal, Deepak; Malhotra, Pankaj; Das, Reena

2018-05-01

Reference genes are indispensable for normalizing mRNA levels across samples in real-time quantitative PCR. Their expression levels vary under different experimental conditions and because of several inherent characteristics. Appropriate reference gene selection is thus critical for gene-expression studies. This study aimed at selecting optimal reference genes for gene-expression analysis of reticulocytes and at validating them in hereditary spherocytosis (HS) and β-thalassemia intermedia (βTI) patients. Seven reference genes (PGK1, MPP1, HPRT1, ACTB, GAPDH, RN18S1, and SDHA) were selected because of published reports. Real-time quantitative PCR was performed on reticulocytes in 20 healthy volunteers, 15 HS patients, and 10 βTI patients. Threshold cycle values were compared with fold-change method and RefFinder software. The stable reference genes recommended by RefFinder were validated with SLC4A1 and flow cytometric eosin-5'-maleimide binding assay values in HS patients and HBG2 and high performance liquid chromatography-derived percentage of hemoglobin F in βTI. Comprehensive ranking predicted MPP1 and GAPDH as optimal reference genes for reticulocytes that were not affected in HS and βTI. This was further confirmed on validation with eosin-5'-maleimide results and percentage of hemoglobin F in HS and βTI patients, respectively. Hence, MPP1 and GAPDH are good reference genes for reticulocyte expression studies compared with ACTB and RN18S1, the two most commonly used reference genes. Copyright © 2018 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

A Novel Method to Predict Highly Expressed Genes Based on Radius Clustering and Relative Synonymous Codon Usage.

PubMed

Tran, Tuan-Anh; Vo, Nam Tri; Nguyen, Hoang Duc; Pham, Bao The

2015-12-01

Recombinant proteins play an important role in many aspects of life and have generated a huge income, notably in the industrial enzyme business. A gene is introduced into a vector and expressed in a host organism-for example, E. coli-to obtain a high productivity of target protein. However, transferred genes from particular organisms are not usually compatible with the host's expression system because of various reasons, for example, codon usage bias, GC content, repetitive sequences, and secondary structure. The solution is developing programs to optimize for designing a nucleotide sequence whose origin is from peptide sequences using properties of highly expressed genes (HEGs) of the host organism. Existing data of HEGs determined by practical and computer-based methods do not satisfy for qualifying and quantifying. Therefore, the demand for developing a new HEG prediction method is critical. We proposed a new method for predicting HEGs and criteria to evaluate gene optimization. Codon usage bias was weighted by amplifying the difference between HEGs and non-highly expressed genes (non-HEGs). The number of predicted HEGs is 5% of the genome. In comparison with Puigbò's method, the result is twice as good as Puigbò's one, in kernel ratio and kernel sensitivity. Concerning transcription/translation factor proteins (TF), the proposed method gives low TF sensitivity, while Puigbò's method gives moderate one. In summary, the results indicated that the proposed method can be a good optional applying method to predict optimized genes for particular organisms, and we generated an HEG database for further researches in gene design.

Recombinant expression, purification, and crystallization of the glutaminyl-tRNA synthetase from Toxoplasma gondii.

PubMed

van Rooyen, Jason M; Hakimi, Mohamed-Ali; Belrhali, Hassan

2015-06-01

Aminoacyl tRNA synthetases play a critical role in protein synthesis by providing precursor transfer-RNA molecules correctly charged with their cognate amino-acids. The essential nature of these enzymes make them attractive targets for designing new drugs against important pathogenic protozoans like Toxoplasma. Because no structural data currently exists for a protozoan glutaminyl-tRNA synthetase (QRS), an understanding of its potential as a drug target and its function in the assembly of the Toxoplasma multi-aminoacyl tRNA (MARS) complex is therefore lacking. Here we describe the optimization of expression and purification conditions that permitted the recovery and crystallization of both domains of the Toxoplasma QRS enzyme from a heterologous Escherichia coli expression system. Expression of full-length QRS was only achieved after the addition of an N-terminal histidine affinity tag and the isolated protein was active on both cellular and in vitro produced Toxoplasma tRNA. Taking advantage of the proteolytic susceptibility of QRS to cleavage into component domains, N-terminal glutathione S-transferase (GST) motif-containing domain fragments were isolated and crystallization conditions discovered. Isolation of the C-terminal catalytic domain was accomplished after subcloning the domain and optimizing expression conditions. Purified catalytic domain survived cryogenic storage and yielded large diffraction-quality crystals over-night after optimization of screening conditions. This work will form the basis of future structural studies into structural-functional relationships of both domains including potential targeted drug-design studies and investigations into the assembly of the Toxoplasma MARS complex. Copyright © 2015 Elsevier Inc. All rights reserved.

Highly efficient mesophyll protoplast isolation and PEG-mediated transient gene expression for rapid and large-scale gene characterization in cassava (Manihot esculenta Crantz).

PubMed

Wu, Jun-Zheng; Liu, Qin; Geng, Xiao-Shan; Li, Kai-Mian; Luo, Li-Juan; Liu, Jin-Ping

2017-03-14

Cassava (Manihot esculenta Crantz) is a major crop extensively cultivated in the tropics as both an important source of calories and a promising source for biofuel production. Although stable gene expression have been used for transgenic breeding and gene function study, a quick, easy and large-scale transformation platform has been in urgent need for gene functional characterization, especially after the cassava full genome was sequenced. Fully expanded leaves from in vitro plantlets of Manihot esculenta were used to optimize the concentrations of cellulase R-10 and macerozyme R-10 for obtaining protoplasts with the highest yield and viability. Then, the optimum conditions (PEG4000 concentration and transfection time) were determined for cassava protoplast transient gene expression. In addition, the reliability of the established protocol was confirmed for subcellular protein localization. In this work we optimized the main influencing factors and developed an efficient mesophyll protoplast isolation and PEG-mediated transient gene expression in cassava. The suitable enzyme digestion system was established with the combination of 1.6% cellulase R-10 and 0.8% macerozyme R-10 for 16 h of digestion in the dark at 25 °C, resulting in the high yield (4.4 × 10 7 protoplasts/g FW) and vitality (92.6%) of mesophyll protoplasts. The maximum transfection efficiency (70.8%) was obtained with the incubation of the protoplasts/vector DNA mixture with 25% PEG4000 for 10 min. We validated the applicability of the system for studying the subcellular localization of MeSTP7 (an H + /monosaccharide cotransporter) with our transient expression protocol and a heterologous Arabidopsis transient gene expression system. We optimized the main influencing factors and developed an efficient mesophyll protoplast isolation and transient gene expression in cassava, which will facilitate large-scale characterization of genes and pathways in cassava.

Optimization of extraction conditions for osthol, a melanogenesis inhibitor from Cnidium monnieri fruits.

PubMed

Beom Kim, Seon; Kim, CheongTaek; Liu, Qing; Hee Jo, Yang; Joo Choi, Hak; Hwang, Bang Yeon; Kyum Kim, Sang; Kyeong Lee, Mi

2016-08-01

Coumarin derivatives have been reported to inhibit melanin biosynthesis. The melanogenesis inhibitory activity of osthol, a major coumarin of the fruits of Cnidium monnieri Cusson (Umbelliferae), and optimized extraction conditions for the maximum yield from the isolation of osthol from C. monnieri fruits were investigated. B16F10 melanomas were treated with osthol at concentration of 1, 3, and 10 μM for 72 h. The expression of melanogenesis genes, such as tyrosinase, TRP-1, and TRP-2 was also assessed. For optimization, extraction factors such as extraction solvent, extraction time, and sample/solvent ratio were tested and optimized for maximum yield of osthol using response surface methodology with the Box-Behnken design (BBD). Osthol inhibits melanin content in B16F10 melanoma cells with an IC50 value of 4.9 μM. The melanogenesis inhibitory activity of osthol was achieved not by direct inhibition of tyrosinase activity but by inhibiting melanogenic enzyme expressions, such as tyrosinase, TRP-1, and TRP-2. The optimal condition was obtained as a sample/solvent ratio, 1500 mg/10 ml; an extraction time 30.3 min; and a methanol concentration of 97.7%. The osthol yield under optimal conditions was found to be 15.0 mg/g dried samples, which were well matched with the predicted value of 14.9 mg/g dried samples. These results will provide useful information about optimized extraction conditions for the development of osthol as cosmetic therapeutics to reduce skin hyperpigmentation.

Homotopy method for optimization of variable-specific-impulse low-thrust trajectories

NASA Astrophysics Data System (ADS)

Chi, Zhemin; Yang, Hongwei; Chen, Shiyu; Li, Junfeng

2017-11-01

The homotopy method has been used as a useful tool in solving fuel-optimal trajectories with constant-specific-impulse low thrust. However, the specific impulse is often variable for many practical solar electric power-limited thrusters. This paper investigates the application of the homotopy method for optimization of variable-specific-impulse low-thrust trajectories. Difficulties arise when the two commonly-used homotopy functions are employed for trajectory optimization. The optimal power throttle level and the optimal specific impulse are coupled with the commonly-used quadratic and logarithmic homotopy functions. To overcome these difficulties, a modified logarithmic homotopy function is proposed to serve as a gateway for trajectory optimization, leading to decoupled expressions of both the optimal power throttle level and the optimal specific impulse. The homotopy method based on this homotopy function is proposed. Numerical simulations validate the feasibility and high efficiency of the proposed method.

Optimizing piezoelectric receivers for acoustic power transfer applications

NASA Astrophysics Data System (ADS)

Gorostiaga, M.; Wapler, M. C.; Wallrabe, U.

2018-07-01

In this paper, we aim to optimize piezoelectric plate receivers for acoustic power transfer applications by analyzing the influence of the losses and of the acoustic boundary conditions. We derive the analytic expressions of the efficiency of the receiver with the optimal electric loads attached, and analyze the maximum efficiency value and its frequency with different loss and acoustic boundary conditions. To validate the analytical expressions that we have derived, we perform experiments in water with composite transducers of different filling fractions, and see that a lower acoustic impedance mismatch can compensate the influence of large dielectric and acoustic losses to achieve a good performance. Finally, we briefly compare the advantages and drawbacks of composite transducers and pure PZT (lead zirconate titanate) plates as acoustic power receivers, and conclude that 1–3 composites can achieve similar efficiency values in low power applications due to their adjustable acoustic impedance.

Symmetric tridiagonal structure preserving finite element model updating problem for the quadratic model

NASA Astrophysics Data System (ADS)

Rakshit, Suman; Khare, Swanand R.; Datta, Biswa Nath

2018-07-01

One of the most important yet difficult aspect of the Finite Element Model Updating Problem is to preserve the finite element inherited structures in the updated model. Finite element matrices are in general symmetric, positive definite (or semi-definite) and banded (tridiagonal, diagonal, penta-diagonal, etc.). Though a large number of papers have been published in recent years on various aspects of solutions of this problem, papers dealing with structure preservation almost do not exist. A novel optimization based approach that preserves the symmetric tridiagonal structures of the stiffness and damping matrices is proposed in this paper. An analytical expression for the global minimum solution of the associated optimization problem along with the results of numerical experiments obtained by both the analytical expressions and by an appropriate numerical optimization algorithm are presented. The results of numerical experiments support the validity of the proposed method.

An enhancement of binary particle swarm optimization for gene selection in classifying cancer classes

PubMed Central

2013-01-01

Background Gene expression data could likely be a momentous help in the progress of proficient cancer diagnoses and classification platforms. Lately, many researchers analyze gene expression data using diverse computational intelligence methods, for selecting a small subset of informative genes from the data for cancer classification. Many computational methods face difficulties in selecting small subsets due to the small number of samples compared to the huge number of genes (high-dimension), irrelevant genes, and noisy genes. Methods We propose an enhanced binary particle swarm optimization to perform the selection of small subsets of informative genes which is significant for cancer classification. Particle speed, rule, and modified sigmoid function are introduced in this proposed method to increase the probability of the bits in a particle’s position to be zero. The method was empirically applied to a suite of ten well-known benchmark gene expression data sets. Results The performance of the proposed method proved to be superior to other previous related works, including the conventional version of binary particle swarm optimization (BPSO) in terms of classification accuracy and the number of selected genes. The proposed method also requires lower computational time compared to BPSO. PMID:23617960

A codon-optimized green fluorescent protein for live cell imaging in Zymoseptoria tritici☆

PubMed Central

Kilaru, S.; Schuster, M.; Studholme, D.; Soanes, D.; Lin, C.; Talbot, N.J.; Steinberg, G.

2015-01-01

Fluorescent proteins (FPs) are powerful tools to investigate intracellular dynamics and protein localization. Cytoplasmic expression of FPs in fungal pathogens allows greater insight into invasion strategies and the host-pathogen interaction. Detection of their fluorescent signal depends on the right combination of microscopic setup and signal brightness. Slow rates of photo-bleaching are pivotal for in vivo observation of FPs over longer periods of time. Here, we test green-fluorescent proteins, including Aequorea coerulescens GFP (AcGFP), enhanced GFP (eGFP) from Aequorea victoria and a novel Zymoseptoria tritici codon-optimized eGFP (ZtGFP), for their usage in conventional and laser-enhanced epi-fluorescence, and confocal laser-scanning microscopy. We show that eGFP, expressed cytoplasmically in Z. tritici, is significantly brighter and more photo-stable than AcGFP. The codon-optimized ZtGFP performed even better than eGFP, showing significantly slower bleaching and a 20–30% further increase in signal intensity. Heterologous expression of all GFP variants did not affect pathogenicity of Z. tritici. Our data establish ZtGFP as the GFP of choice to investigate intracellular protein dynamics in Z. tritici, but also infection stages of this wheat pathogen inside host tissue. PMID:26092799

Reproducibility-optimized test statistic for ranking genes in microarray studies.

PubMed

Elo, Laura L; Filén, Sanna; Lahesmaa, Riitta; Aittokallio, Tero

2008-01-01

A principal goal of microarray studies is to identify the genes showing differential expression under distinct conditions. In such studies, the selection of an optimal test statistic is a crucial challenge, which depends on the type and amount of data under analysis. While previous studies on simulated or spike-in datasets do not provide practical guidance on how to choose the best method for a given real dataset, we introduce an enhanced reproducibility-optimization procedure, which enables the selection of a suitable gene- anking statistic directly from the data. In comparison with existing ranking methods, the reproducibilityoptimized statistic shows good performance consistently under various simulated conditions and on Affymetrix spike-in dataset. Further, the feasibility of the novel statistic is confirmed in a practical research setting using data from an in-house cDNA microarray study of asthma-related gene expression changes. These results suggest that the procedure facilitates the selection of an appropriate test statistic for a given dataset without relying on a priori assumptions, which may bias the findings and their interpretation. Moreover, the general reproducibilityoptimization procedure is not limited to detecting differential expression only but could be extended to a wide range of other applications as well.

Ly49H signaling through DAP10 is essential for optimal natural killer cell responses to mouse cytomegalovirus infection

PubMed Central

Orr, Mark T.; Sun, Joseph C.; Hesslein, David G.T.; Arase, Hisashi; Phillips, Joseph H.; Takai, Toshiyuki

2009-01-01

The activating natural killer (NK) cell receptor Ly49H recognizes the mouse cytomegalovirus (MCMV) m157 glycoprotein expressed on the surface of infected cells and is required for protection against MCMV. Although Ly49H has previously been shown to signal via DAP12, we now show that Ly49H must also associate with and signal via DAP10 for optimal function. In the absence of DAP12, DAP10 enables Ly49H-mediated killing of m157-bearing target cells, proliferation in response to MCMV infection, and partial protection against MCMV. DAP10-deficient Ly49H+ NK cells, expressing only Ly49H–DAP12 receptor complexes, are partially impaired in their ability to proliferate during MCMV infection, display diminished ERK1/2 activation, produce less IFN-γ upon Ly49H engagement, and demonstrate reduced control of MCMV infection. Deletion of both DAP10 and DAP12 completely abrogates Ly49H surface expression and control of MCMV infection. Thus, optimal NK cell–mediated immunity to MCMV depends on Ly49H signaling through both DAP10 and DAP12. PMID:19332875

Vibrational self-consistent field theory using optimized curvilinear coordinates.

PubMed

Bulik, Ireneusz W; Frisch, Michael J; Vaccaro, Patrick H

2017-07-28

A vibrational SCF model is presented in which the functions forming the single-mode functions in the product wavefunction are expressed in terms of internal coordinates and the coordinates used for each mode are optimized variationally. This model involves no approximations to the kinetic energy operator and does not require a Taylor-series expansion of the potential. The non-linear optimization of coordinates is found to give much better product wavefunctions than the limited variations considered in most previous applications of SCF methods to vibrational problems. The approach is tested using published potential energy surfaces for water, ammonia, and formaldehyde. Variational flexibility allowed in the current ansätze results in excellent zero-point energies expressed through single-product states and accurate fundamental transition frequencies realized by short configuration-interaction expansions. Fully variational optimization of single-product states for excited vibrational levels also is discussed. The highlighted methodology constitutes an excellent starting point for more sophisticated treatments, as the bulk characteristics of many-mode coupling are accounted for efficiently in terms of compact wavefunctions (as evident from the accurate prediction of transition frequencies).

Computation of optimal output-feedback compensators for linear time-invariant systems

NASA Technical Reports Server (NTRS)

Platzman, L. K.

1972-01-01

The control of linear time-invariant systems with respect to a quadratic performance criterion was considered, subject to the constraint that the control vector be a constant linear transformation of the output vector. The optimal feedback matrix, f*, was selected to optimize the expected performance, given the covariance of the initial state. It is first shown that the expected performance criterion can be expressed as the ratio of two multinomials in the element of f. This expression provides the basis for a feasible method of determining f* in the case of single-input single-output systems. A number of iterative algorithms are then proposed for the calculation of f* for multiple input-output systems. For two of these, monotone convergence is proved, but they involve the solution of nonlinear matrix equations at each iteration. Another is proposed involving the solution of Lyapunov equations at each iteration, and the gradual increase of the magnitude of a penalty function. Experience with this algorithm will be needed to determine whether or not it does, indeed, possess desirable convergence properties, and whether it can be used to determine the globally optimal f*.

Execution of Multidisciplinary Design Optimization Approaches on Common Test Problems

NASA Technical Reports Server (NTRS)

Balling, R. J.; Wilkinson, C. A.

1997-01-01

A class of synthetic problems for testing multidisciplinary design optimization (MDO) approaches is presented. These test problems are easy to reproduce because all functions are given as closed-form mathematical expressions. They are constructed in such a way that the optimal value of all variables and the objective is unity. The test problems involve three disciplines and allow the user to specify the number of design variables, state variables, coupling functions, design constraints, controlling design constraints, and the strength of coupling. Several MDO approaches were executed on two sample synthetic test problems. These approaches included single-level optimization approaches, collaborative optimization approaches, and concurrent subspace optimization approaches. Execution results are presented, and the robustness and efficiency of these approaches an evaluated for these sample problems.

Optimized Kernel Entropy Components.

PubMed

Izquierdo-Verdiguier, Emma; Laparra, Valero; Jenssen, Robert; Gomez-Chova, Luis; Camps-Valls, Gustau

2017-06-01

This brief addresses two main issues of the standard kernel entropy component analysis (KECA) algorithm: the optimization of the kernel decomposition and the optimization of the Gaussian kernel parameter. KECA roughly reduces to a sorting of the importance of kernel eigenvectors by entropy instead of variance, as in the kernel principal components analysis. In this brief, we propose an extension of the KECA method, named optimized KECA (OKECA), that directly extracts the optimal features retaining most of the data entropy by means of compacting the information in very few features (often in just one or two). The proposed method produces features which have higher expressive power. In particular, it is based on the independent component analysis framework, and introduces an extra rotation to the eigen decomposition, which is optimized via gradient-ascent search. This maximum entropy preservation suggests that OKECA features are more efficient than KECA features for density estimation. In addition, a critical issue in both the methods is the selection of the kernel parameter, since it critically affects the resulting performance. Here, we analyze the most common kernel length-scale selection criteria. The results of both the methods are illustrated in different synthetic and real problems. Results show that OKECA returns projections with more expressive power than KECA, the most successful rule for estimating the kernel parameter is based on maximum likelihood, and OKECA is more robust to the selection of the length-scale parameter in kernel density estimation.

The Role of ABC Proteins in Drug-Resistant Breast Cancer Cells

DTIC Science & Technology

2007-04-01

and a biotin acceptor domain) under control of the alcohol oxidase promoter (Figure 2). Upon methanol induction, the yeast expressed high levels of...as native cDNA. Therefore, we backtranslated the protein into a nucleotide sequence codon-optimized for expression in Pichia pastoris yeast. Yeast

Enhanced expression of codon optimized Mycobacterium avium subsp. paratuberculosis antigens in Lactobacillus salivarius

USDA-ARS?s Scientific Manuscript database

We have previously identified the mycobacterial high G+C codon usage bias as a limiting factor in heterologous expression of MAP proteins from Lb.salivarius, and demonstrated that codon optimisation of a synthetic coding gene greatly enhances MAP protein production. Here, we effectively demonstrate ...

A randomized controlled trial of expressive writing in breast cancer survivors with lymphedema.

PubMed

Sohl, Stephanie J; Dietrich, Mary S; Wallston, Kenneth A; Ridner, Sheila H

2017-07-01

Breast cancer survivors who develop lymphedema report poorer quality of life (QoL) than those without lymphedema. Expressive writing is a potential intervention to address QoL. Adult women (N = 107) with breast cancer and chronic Stage II lymphedema were randomised to writing about thoughts and feelings specific to lymphedema and its treatment (intervention) or about daily activities (control) for four, 20-min sessions. Outcome measures were several indicators of QoL assessed at baseline, one, three, and six months post-intervention (total scores and subscales of Upper Limb Lymphedema 27 and Functional Assessment of Cancer Therapy-Breast). Hypothesised moderators of change in QoL were dispositional optimism, avoidant behaviours, and time since lymphedema diagnosis. There was no statistically significant intent-to-treat main effects of expressive writing on QoL. Statistically significant moderating effects on change in different indicators of QoL were observed for all three moderators. Expressive writing was more effective for improving QoL in women who were higher on optimism, lower on avoidance and had less time since a lymphedema diagnosis. These results provide further evidence that there are subsets of individuals for whom expressive writing is more effective. Future research may investigate targeting expressive writing based on identified moderators.

HCV T Cell Receptor Chain Modifications to Enhance Expression, Pairing, and Antigen Recognition in T Cells for Adoptive Transfer.

PubMed

Foley, Kendra C; Spear, Timothy T; Murray, David C; Nagato, Kaoru; Garrett-Mayer, Elizabeth; Nishimura, Michael I

2017-06-16

T cell receptor (TCR)-gene-modified T cells for adoptive cell transfer can mediate objective clinical responses in melanoma and other malignancies. When introducing a second TCR, mispairing between the endogenous and introduced α and β TCR chains limits expression of the introduced TCR, which can result in impaired efficacy or off-target reactivity and autoimmunity. One approach to promote proper TCR chain pairing involves modifications of the introduced TCR genes: introducing a disulfide bridge, substituting murine for human constant regions, codon optimization, TCR chain leucine zipper fusions, and a single-chain TCR. We have introduced these modifications into our hepatitis C virus (HCV) reactive TCR and utilize a marker gene, CD34t, which allows us to directly compare transduction efficiency with TCR expression and T cell function. Our results reveal that of the TCRs tested, T cells expressing the murine Cβ2 TCR or leucine zipper TCR have the highest levels of expression and the highest percentage of lytic and interferon-γ (IFN-γ)-producing T cells. Our studies give us a better understanding of how TCR modifications impact TCR expression and T cell function that may allow for optimization of TCR-modified T cells for adoptive cell transfer to treat patients with malignancies.

Application of the method of steepest descent to laminated shield weight optimization with several constraints: Theory

NASA Technical Reports Server (NTRS)

Lahti, G. P.

1971-01-01

The method of steepest descent used in optimizing one-dimensional layered radiation shields is extended to multidimensional, multiconstraint situations. The multidimensional optimization algorithm and equations are developed for the case of a dose constraint in any one direction being dependent only on the shield thicknesses in that direction and independent of shield thicknesses in other directions. Expressions are derived for one-, two-, and three-dimensional cases (one, two, and three constraints). The precedure is applicable to the optimization of shields where there are different dose constraints and layering arrangements in the principal directions.

Evaluation of Different Normalization and Analysis Procedures for Illumina Gene Expression Microarray Data Involving Small Changes

PubMed Central

Johnstone, Daniel M.; Riveros, Carlos; Heidari, Moones; Graham, Ross M.; Trinder, Debbie; Berretta, Regina; Olynyk, John K.; Scott, Rodney J.; Moscato, Pablo; Milward, Elizabeth A.

2013-01-01

While Illumina microarrays can be used successfully for detecting small gene expression changes due to their high degree of technical replicability, there is little information on how different normalization and differential expression analysis strategies affect outcomes. To evaluate this, we assessed concordance across gene lists generated by applying different combinations of normalization strategy and analytical approach to two Illumina datasets with modest expression changes. In addition to using traditional statistical approaches, we also tested an approach based on combinatorial optimization. We found that the choice of both normalization strategy and analytical approach considerably affected outcomes, in some cases leading to substantial differences in gene lists and subsequent pathway analysis results. Our findings suggest that important biological phenomena may be overlooked when there is a routine practice of using only one approach to investigate all microarray datasets. Analytical artefacts of this kind are likely to be especially relevant for datasets involving small fold changes, where inherent technical variation—if not adequately minimized by effective normalization—may overshadow true biological variation. This report provides some basic guidelines for optimizing outcomes when working with Illumina datasets involving small expression changes. PMID:27605185

Norovirus Narita 104 Virus-Like Particles Expressed in Nicotiana benthamiana Induce Serum and Mucosal Immune Responses

PubMed Central

Mathew, Lolita George; Herbst-Kralovetz, Melissa M.; Mason, Hugh S.

2014-01-01

Narita 104 virus is a human pathogen belonging to the norovirus (family Caliciviridae) genogroup II. Noroviruses cause epidemic gastroenteritis worldwide. To explore the potential of developing a plant-based vaccine, a plant optimized gene encoding Narita 104 virus capsid protein (NaVCP) was expressed transiently in Nicotiana benthamiana using a tobacco mosaic virus expression system. NaVCP accumulated up to approximately 0.3 mg/g fresh weight of leaf at 4 days postinfection. Initiation of hypersensitive response-like symptoms followed by tissue necrosis necessitated a brief infection time and was a significant factor limiting expression. Transmission electron microscopy of plant-derived NaVCP confirmed the presence of fully assembled virus-like particles (VLPs). In this study, an optimized method to express and partially purify NaVCP is described. Further, partially purified NaVCP was used to immunize mice by intranasal delivery and generated significant mucosal and serum antibody responses. Thus, plant-derived Narita 104 VLPs have potential for use as a candidate subunit vaccine or as a component of a multivalent subunit vaccine, along with other genotype-specific plant-derived VLPs. PMID:24949472

Nonlatching positive feedback enables robust bimodality by decoupling expression noise from the mean

DOE Office of Scientific and Technical Information (OSTI.GOV)

Razooky, Brandon S.; Cao, Youfang; Hansen, Maike M. K.

Fundamental to biological decision-making is the ability to generate bimodal expression patterns where two alternate expression states simultaneously exist. Here in this study, we use a combination of single-cell analysis and mathematical modeling to examine the sources of bimodality in the transcriptional program controlling HIV’s fate decision between active replication and viral latency. We find that the HIV Tat protein manipulates the intrinsic toggling of HIV’s promoter, the LTR, to generate bimodal ON-OFF expression, and that transcriptional positive feedback from Tat shifts and expands the regime of LTR bimodality. This result holds for both minimal synthetic viral circuits and full-lengthmore » virus. Strikingly, computational analysis indicates that the Tat circuit’s non-cooperative ‘non-latching’ feedback architecture is optimized to slow the promoter’s toggling and generate bimodality by stochastic extinction of Tat. In contrast to the standard Poisson model, theory and experiment show that non-latching positive feedback substantially dampens the inverse noise-mean relationship to maintain stochastic bimodality despite increasing mean-expression levels. Given the rapid evolution of HIV, the presence of a circuit optimized to robustly generate bimodal expression appears consistent with the hypothesis that HIV’s decision between active replication and latency provides a viral fitness advantage. More broadly, the results suggest that positive-feedback circuits may have evolved not only for signal amplification but also for robustly generating bimodality by decoupling expression fluctuations (noise) from mean expression levels.« less

Optimality of profit-including prices under ideal planning.

PubMed

Samuelson, P A

1973-07-01

Although prices calculated by a constant percentage markup on all costs (nonlabor as well as direct-labor) are usually admitted to be more realistic for a competitive capitalistic model, the view is often expressed that, for optimal planning purposes, the "values" model of Marx's Capital, Volume I, is to be preferred. It is shown here that an optimal-control model that maximizes discounted social utility of consumption per capita and that ultimately approaches a steady state must ultimately have optimal pricing that involves equal rates of steady-state profit in all industries; and such optimal pricing will necessarily deviate from Marx's model of equal rates of surplus value (markups on direct-labor only) in all industries.

Optimality of Profit-Including Prices Under Ideal Planning

PubMed Central

Samuelson, Paul A.

1973-01-01

Although prices calculated by a constant percentage markup on all costs (nonlabor as well as direct-labor) are usually admitted to be more realistic for a competitive capitalistic model, the view is often expressed that, for optimal planning purposes, the “values” model of Marx's Capital, Volume I, is to be preferred. It is shown here that an optimal-control model that maximizes discounted social utility of consumption per capita and that ultimately approaches a steady state must ultimately have optimal pricing that involves equal rates of steady-state profit in all industries; and such optimal pricing will necessarily deviate from Marx's model of equal rates of surplus value (markups on direct-labor only) in all industries. PMID:16592102

Cardiac Gene Therapy: Optimization of Gene Delivery Techniques In Vivo

PubMed Central

Katz, Michael G.; Swain, JaBaris D.; White, Jennifer D.; Low, David; Stedman, Hansell

2010-01-01

Abstract Vector-mediated cardiac gene therapy holds tremendous promise as a translatable platform technology for treating many cardiovascular diseases. The ideal technique is one that is efficient and practical, allowing for global cardiac gene expression, while minimizing collateral expression in other organs. Here we survey the available in vivo vector-mediated cardiac gene delivery methods—including transcutaneous, intravascular, intramuscular, and cardiopulmonary bypass techniques—with consideration of the relative merits and deficiencies of each. Review of available techniques suggests that an optimal method for vector-mediated gene delivery to the large animal myocardium would ideally employ retrograde and/or anterograde transcoronary gene delivery,extended vector residence time in the coronary circulation, an increased myocardial transcapillary gradient using physical methods, increased endothelial permeability with pharmacological agents, minimal collateral gene expression by isolation of the cardiac circulation from the systemic, and have low immunogenicity. PMID:19947886

Optimized expression in Pichia pastoris eliminates common protein contaminants from subsequent His-tag purification.

PubMed

Chen, Yong; Li, Yang; Liu, Peng; Sun, Qun; Liu, Zhu

2014-04-01

A weakness of using immobilized metal affinity chromatography (IMAC) to purify recombinant proteins expressed in Pichia pastoris is the co-purification of native proteins that exhibit high affinities for Ni-IMAC. We have determined the elution profiles of P. pastoris proteins and have examined the native proteins that co-purify when eluting with 100 mM imidazole. Four major contaminants were identified: mitochondrial alcohol dehydrogenase isozyme III (mADH), nucleotide excision repair endonuclease, and the hypothetical proteins TPHA_0L01390 and TDEL_0B02190 which are homologous proteins derived from Tetrapisispora phaffii and Torulaspora delbrueckii, respectively. A new P. pastoris expression strain was engineered that eliminated the predominant contaminant, mADH, by gene disruption. The total amount of protein contaminants was reduced by 55 % without effecting cell growth. The present study demonstrates the feasibility of using a proteomic approach to facilitate bioprocess optimization.

Complete characterization of the spasing (L-L) curve of a three-level quantum coherence enhanced spaser for design optimization

NASA Astrophysics Data System (ADS)

Kumarapperuma, Lakshitha; Premaratne, Malin; Jha, Pankaj K.; Stockman, Mark I.; Agrawal, Govind P.

2018-05-01

We demonstrate that it is possible to derive an approximate analytical expression to characterize the spasing (L-L) curve of a coherently enhanced spaser with 3-level gain-medium chromophores. The utility of this solution stems from the fact that it enables optimization of the large parameter space associated with spaser designing, a functionality not offered by the methods currently available in the literature. This is vital for the advancement of spaser technology towards the level of device realization. Owing to the compact nature of the analytical expressions, our solution also facilitates the grouping and identification of key processes responsible for the spasing action, whilst providing significant physical insights. Furthermore, we show that our expression generates results within 0.1% error compared to numerically obtained results for pumping rates higher than the spasing threshold, thereby drastically reducing the computational cost associated with spaser designing.

Optimized expression and purification of NavAb provide the structural insight into the voltage dependence.

PubMed

Irie, Katsumasa; Haga, Yukari; Shimomura, Takushi; Fujiyoshi, Yoshinori

2018-01-01

Voltage-gated sodium channels are crucial for electro-signalling in living systems. Analysis of the molecular mechanism requires both fine electrophysiological evaluation and high-resolution channel structures. Here, we optimized a dual expression system of NavAb, which is a well-established standard of prokaryotic voltage-gated sodium channels, for E. coli and insect cells using a single plasmid vector to analyse high-resolution protein structures and measure large ionic currents. Using this expression system, we evaluated the voltage dependence and determined the crystal structures of NavAb wild-type and two mutants, E32Q and N49K, whose voltage dependence were positively shifted and essential interactions were lost in voltage sensor domain. The structural and functional comparison elucidated the molecular mechanisms of the voltage dependence of prokaryotic voltage-gated sodium channels. © 2017 Federation of European Biochemical Societies.

Optimizing information flow in small genetic networks. IV. Spatial coupling

NASA Astrophysics Data System (ADS)

Sokolowski, Thomas R.; Tkačik, Gašper

2015-06-01

We typically think of cells as responding to external signals independently by regulating their gene expression levels, yet they often locally exchange information and coordinate. Can such spatial coupling be of benefit for conveying signals subject to gene regulatory noise? Here we extend our information-theoretic framework for gene regulation to spatially extended systems. As an example, we consider a lattice of nuclei responding to a concentration field of a transcriptional regulator (the input) by expressing a single diffusible target gene. When input concentrations are low, diffusive coupling markedly improves information transmission; optimal gene activation functions also systematically change. A qualitatively different regulatory strategy emerges where individual cells respond to the input in a nearly steplike fashion that is subsequently averaged out by strong diffusion. While motivated by early patterning events in the Drosophila embryo, our framework is generically applicable to spatially coupled stochastic gene expression models.

Optimization of the expression of a laccase gene from Trametes versicolor in Pichia methanolica.

PubMed

Guo, Mei; Lu, Fuping; Du, Lianxiang; Pu, Jun; Bai, Dongqing

2006-08-01

A cDNA encoding for laccase (Lcc1) was isolated from the ligninolytic fungus Trametes versicolor by reverse transcriptase polymerase chain reaction. The Lcc1 gene was subcloned into the Pichia methanolica expression vector pMETalphaA and transformed into the P. methanolica strains PMAD11 and PMAD16. The extracellular laccase activity of the PMAD11 recombinants was found to be 1.3-fold higher than that of the PMAD16 recombinants. The identity of the recombinant protein was further confirmed by immunodetection using the Western blot analysis. As expected, the molecular mass of the mature laccase was 64.0 kDa, similar to that of the native form. The effects of copper concentration, cultivation temperature, pH and methanol concentration in the BMMY on laccase expression were investigated. The laccase activity in the PMAD11 recombinant was up to 12.6 U ml(-1) by optimization.

Protein stability: a crystallographer’s perspective

DOE Office of Scientific and Technical Information (OSTI.GOV)

Deller, Marc C., E-mail: mdeller@stanford.edu; Kong, Leopold; Rupp, Bernhard

An understanding of protein stability is essential for optimizing the expression, purification and crystallization of proteins. In this review, discussion will focus on factors affecting protein stability on a somewhat practical level, particularly from the view of a protein crystallographer. Protein stability is a topic of major interest for the biotechnology, pharmaceutical and food industries, in addition to being a daily consideration for academic researchers studying proteins. An understanding of protein stability is essential for optimizing the expression, purification, formulation, storage and structural studies of proteins. In this review, discussion will focus on factors affecting protein stability, on a somewhatmore » practical level, particularly from the view of a protein crystallographer. The differences between protein conformational stability and protein compositional stability will be discussed, along with a brief introduction to key methods useful for analyzing protein stability. Finally, tactics for addressing protein-stability issues during protein expression, purification and crystallization will be discussed.« less

Targeted gene delivery to the synovial pannus in antigen-induced arthritis by ultrasound-targeted microbubble destruction in vivo.

PubMed

Xiang, Xi; Tang, Yuanjiao; Leng, Qianying; Zhang, Lingyan; Qiu, Li

2016-02-01

The purpose of this study was to optimize an ultrasound-targeted microbubble destruction (UTMD) technique to improve the in vivo transfection efficiency of the gene encoding enhanced green fluorescent protein (EGFP) in the synovial pannus in an antigen-induced arthritis rabbit model. A mixture of microbubbles and plasmids was locally injected into the knee joints of an antigen-induced arthritis (AIA) rabbits. The plasmid concentrations and ultrasound conditions were varied in the experiments. We also tested local articular and intravenous injections. The rabbits were divided into five groups: (1) ultrasound+microbubbles+plasmid; (2) ultrasound+plasmid; (3) microbubble+plasmid; (4) plasmid only; (5) untreated controls. EGFP expression was observed by fluorescent microscope and immunohistochemical staining in the synovial pannus of each group. The optimal plasmid dosage and ultrasound parameter were determined based on the results of EGFP expression and the present and absent of tissue damage under light microscopy. The irradiation procedure was performed to observe the duration of the EGFP expression in the synovial pannus and other tissues and organs, as well as the damage to the normal cells. The optimal condition was determined to be a 1-MHz ultrasound pulse applied for 5 min with a power output of 2 W/cm(2) and a 20% duty cycle along with 300 μg of plasmid. Under these conditions, the synovial pannus showed significant EGFP expression without significant damage to the surrounding normal tissue. The EGFP expression induced by the local intra-articular injection was significantly more increased than that induced by the intravenous injection. The EGFP expression in the synovial pannus of the ultrasound+microbubbles+plasmid group was significantly higher than that of the other four groups (P<0.05). The expression peaked on day 5, remained detectable on day 40 and disappeared on day 60. No EGFP expression was detected in the other tissues and organs. The UTMD technique can significantly enhance the in vivo gene transfection efficiency without significant tissue damage in the synovial pannus of an AIA model. Thus, this could become a safe and effective non-viral gene transfection procedure for arthritis therapy. Copyright © 2015 Elsevier B.V. All rights reserved.

Optimal placement of tuning masses for vibration reduction in helicopter rotor blades

NASA Technical Reports Server (NTRS)

Pritchard, Jocelyn I.; Adelman, Howard M.

1988-01-01

Described are methods for reducing vibration in helicopter rotor blades by determining optimum sizes and locations of tuning masses through formal mathematical optimization techniques. An optimization procedure is developed which employs the tuning masses and corresponding locations as design variables which are systematically changed to achieve low values of shear without a large mass penalty. The finite-element structural analysis of the blade and the optimization formulation require development of discretized expressions for two performance parameters: modal shaping parameter and modal shear amplitude. Matrix expressions for both quantities and their sensitivity derivatives are developed. Three optimization strategies are developed and tested. The first is based on minimizing the modal shaping parameter which indirectly reduces the modal shear amplitudes corresponding to each harmonic of airload. The second strategy reduces these amplitudes directly, and the third strategy reduces the shear as a function of time during a revolution of the blade. The first strategy works well for reducing the shear for one mode responding to a single harmonic of the airload, but has been found in some cases to be ineffective for more than one mode. The second and third strategies give similar results and show excellent reduction of the shear with a low mass penalty.

Solving the optimal attention allocation problem in manual control

NASA Technical Reports Server (NTRS)

Kleinman, D. L.

1976-01-01

Within the context of the optimal control model of human response, analytic expressions for the gradients of closed-loop performance metrics with respect to human operator attention allocation are derived. These derivatives serve as the basis for a gradient algorithm that determines the optimal attention that a human should allocate among several display indicators in a steady-state manual control task. Application of the human modeling techniques are made to study the hover control task for a CH-46 VTOL flight tested by NASA.

Asymptotic Linearity of Optimal Control Modification Adaptive Law with Analytical Stability Margins

NASA Technical Reports Server (NTRS)

Nguyen, Nhan T.

2010-01-01

Optimal control modification has been developed to improve robustness to model-reference adaptive control. For systems with linear matched uncertainty, optimal control modification adaptive law can be shown by a singular perturbation argument to possess an outer solution that exhibits a linear asymptotic property. Analytical expressions of phase and time delay margins for the outer solution can be obtained. Using the gradient projection operator, a free design parameter of the adaptive law can be selected to satisfy stability margins.

Differential relationships between D1 and D2 dopamine receptor expression in the medial preoptic nucleus and sexually-motivated song in male European starlings (Sturnus vulgaris)

PubMed Central

DeVries, M. S.; Cordes, M.A.; Stevenson, S.A.; Riters, L.V.

2015-01-01

Converging data in songbirds support a central role for the medial preoptic nucleus (POM) in motivational aspects of vocal production. Recent data suggest that dopamine in the POM plays a complex modulatory role in the production of sexually-motivated song and that an optimal level of dopamine D1 receptor stimulation is required to facilitate singing behavior. To further explore this possibility, we used quantitative real time PCR to examine relationships between mRNA expression of D1 as well as D2 receptors in the POM (and also the lateral septum and Area X) and sexually-motivated singing behavior in male European starlings. Results showed that both males with the highest and lowest D1 expression in the POM sang significantly less than males with intermediate levels of expression. Furthermore, singing behavior rose linearly in association with increasing levels of D1 expression in POM but dropped abruptly, such that individuals with D1 expression values higher than the mean sang very little. Analysis of birds with low and intermediate levels of D1 expression in POM revealed strong positive correlations between D1 expression and song but negative relationships between D2 receptor expression and song. These findings support prior work suggesting an optimal level of POM D1 receptor stimulation best facilitates sexually-motivated singing behavior. Results also suggest that D2 receptors may work in opposition to D1 receptors in POM to modify vocal production. PMID:26079111

Final report: Compiled MPI. Cost-Effective Exascale Application Development

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gropp, William Douglas

2015-12-21

This is the final report on Compiled MPI: Cost-Effective Exascale Application Development, and summarizes the results under this project. The project investigated runtime enviroments that improve the performance of MPI (Message-Passing Interface) programs; work at Illinois in the last period of this project looked at optimizing data access optimizations expressed with MPI datatypes.

Optimization of human granulocyte macrophage-colony stimulating factor (hGM-CSF) expression using asparaginase and xylanase gene's signal sequences in Escherichia coli.

PubMed

Khasa, Yogender Pal; Khushoo, Amardeep; Tapryal, Suman; Mukherjee, K J

2011-09-01

The toxicity of the recombinant protein towards the expression host remains a significant deterrent for bioprocess development. In this study, the expression of human granulocyte macrophage-colony stimulating factor (hGM-CSF), which is known to be toxic to its host, was enhanced many folds using a combination of genetic and bioprocess strategies in Escherichia coli. The N terminus attachment of endoxylanase and asparaginase signal sequences from Bacillus subtilis and E. coli, respectively, in combination with and without His-tag, considerably improved expression levels. Induction and media optimization studies in shake flask cultures resulted in a maximal hGM-CSF concentration of 365 mg/L in the form of inclusion bodies (IBs) with a specific product yield (Y (P/X)) of 120 mg/g dry cell weight in case of the asparaginase signal. Culturing the cells in nutrient rich Terrific broth maintained the specific product yields (Y (P/X)) while a 6.6-fold higher volumetric concentration of both product and biomass was obtained. The purification and refolding steps were optimized resulting in a 95% pure protein with a fairly high refolding yield of 45%. The biological activity of the refolded protein was confirmed by a cell proliferation assay on hGM-CSF dependent human erythroleukemia TF-1 cells. This study demonstrated that this indeed is a viable route for the efficient production of hGM-CSF.

Open source machine-learning algorithms for the prediction of optimal cancer drug therapies.

PubMed

Huang, Cai; Mezencev, Roman; McDonald, John F; Vannberg, Fredrik

2017-01-01

Precision medicine is a rapidly growing area of modern medical science and open source machine-learning codes promise to be a critical component for the successful development of standardized and automated analysis of patient data. One important goal of precision cancer medicine is the accurate prediction of optimal drug therapies from the genomic profiles of individual patient tumors. We introduce here an open source software platform that employs a highly versatile support vector machine (SVM) algorithm combined with a standard recursive feature elimination (RFE) approach to predict personalized drug responses from gene expression profiles. Drug specific models were built using gene expression and drug response data from the National Cancer Institute panel of 60 human cancer cell lines (NCI-60). The models are highly accurate in predicting the drug responsiveness of a variety of cancer cell lines including those comprising the recent NCI-DREAM Challenge. We demonstrate that predictive accuracy is optimized when the learning dataset utilizes all probe-set expression values from a diversity of cancer cell types without pre-filtering for genes generally considered to be "drivers" of cancer onset/progression. Application of our models to publically available ovarian cancer (OC) patient gene expression datasets generated predictions consistent with observed responses previously reported in the literature. By making our algorithm "open source", we hope to facilitate its testing in a variety of cancer types and contexts leading to community-driven improvements and refinements in subsequent applications.

GCaMP expression in retinal ganglion cells characterized using a low-cost fundus imaging system

NASA Astrophysics Data System (ADS)

Chang, Yao-Chuan; Walston, Steven T.; Chow, Robert H.; Weiland, James D.

2017-10-01

Objective. Virus-transduced, intracellular-calcium indicators are effective reporters of neural activity, offering the advantage of cell-specific labeling. Due to the existence of an optimal time window for the expression of calcium indicators, a suitable tool for tracking GECI expression in vivo following transduction is highly desirable. Approach. We developed a noninvasive imaging approach based on a custom-modified, low-cost fundus viewing system that allowed us to monitor and characterize in vivo bright-field and fluorescence images of the mouse retina. AAV2-CAG-GCaMP6f was injected into a mouse eye. The fundus imaging system was used to measure fluorescence at several time points post injection. At defined time points, we prepared wholemount retina mounted on a transparent multielectrode array and used calcium imaging to evaluate the responsiveness of retinal ganglion cells (RGCs) to external electrical stimulation. Main results. The noninvasive fundus imaging system clearly resolves individual (RGCs and axons. RGC fluorescence intensity and the number of observable fluorescent cells show a similar rising trend from week 1 to week 3 after viral injection, indicating a consistent increase of GCaMP6f expression. Analysis of the in vivo fluorescence intensity trend and in vitro neurophysiological responsiveness shows that the slope of intensity versus days post injection can be used to estimate the optimal time for calcium imaging of RGCs in response to external electrical stimulation. Significance. The proposed fundus imaging system enables high-resolution digital fundus imaging in the mouse eye, based on off-the-shelf components. The long-term tracking experiment with in vitro calcium imaging validation demonstrates the system can serve as a powerful tool monitoring the level of genetically-encoded calcium indicator expression, further determining the optimal time window for following experiment.

A bio-inspired structural health monitoring system based on ambient vibration

NASA Astrophysics Data System (ADS)

Lin, Tzu-Kang; Kiremidjian, Anne; Lei, Chi-Yang

2010-11-01

A structural health monitoring (SHM) system based on naïve Bayesian (NB) damage classification and DNA-like expression data was developed in this research. Adapted from the deoxyribonucleic acid (DNA) array concept in molecular biology, the proposed structural health monitoring system is constructed utilizing a double-tier regression process to extract the expression array from the structural time history recorded during external excitations. The extracted array is symbolized as the various genes of the structure from the viewpoint of molecular biology and reflects the possible damage conditions prevalent in the structure. A scaled down, six-story steel building mounted on the shaking table of the National Center for Research on Earthquake Engineering (NCREE) was used as the benchmark. The structural response at different damage levels and locations under ambient vibration was collected to support the database for the proposed SHM system. To improve the precision of detection in practical applications, the system was enhanced by an optimization process using the likelihood selection method. The obtained array representing the DNA array of the health condition of the structure was first evaluated and ranked. A total of 12 groups of expression arrays were regenerated from a combination of four damage conditions. To keep the length of the array unchanged, the best 16 coefficients from every expression array were selected to form the optimized SHM system. Test results from the ambient vibrations showed that the detection accuracy of the structural damage could be greatly enhanced by the optimized expression array, when compared to the original system. Practical verification also demonstrated that a rapid and reliable result could be given by the final system within 1 min. The proposed system implements the idea of transplanting the DNA array concept from molecular biology into the field of SHM.

A tetO Toolkit To Alter Expression of Genes in Saccharomyces cerevisiae.

PubMed

Cuperus, Josh T; Lo, Russell S; Shumaker, Lucia; Proctor, Julia; Fields, Stanley

2015-07-17

Strategies to optimize a metabolic pathway often involve building a large collection of strains, each containing different versions of sequences that regulate the expression of pathway genes. Here, we develop reagents and methods to carry out this process at high efficiency in the yeast Saccharomyces cerevisiae. We identify variants of the Escherichia coli tet operator (tetO) sequence that bind a TetR-VP16 activator with differential affinity and therefore result in different TetR-VP16 activator-driven expression. By recombining these variants upstream of the genes of a pathway, we generate unique combinations of expression levels. Here, we built a tetO toolkit, which includes the I-OnuI homing endonuclease to create double-strand breaks, which increases homologous recombination by 10(5); a plasmid carrying six variant tetO sequences flanked by I-OnuI sites, uncoupling transformation and recombination steps; an S. cerevisiae-optimized TetR-VP16 activator; and a vector to integrate constructs into the yeast genome. We introduce into the S. cerevisiae genome the three crt genes from Erwinia herbicola required for yeast to synthesize lycopene and carry out the recombination process to produce a population of cells with permutations of tetO variants regulating the three genes. We identify 0.7% of this population as making detectable lycopene, of which the vast majority have undergone recombination at all three crt genes. We estimate a rate of ∼20% recombination per targeted site, much higher than that obtained in other studies. Application of this toolkit to medically or industrially important end products could reduce the time and labor required to optimize the expression of a set of metabolic genes.

AMT1;1 transgenic rice plants with enhanced NH4(+) permeability show superior growth and higher yield under optimal and suboptimal NH4(+) conditions.

PubMed

Ranathunge, Kosala; El-Kereamy, Ashraf; Gidda, Satinder; Bi, Yong-Mei; Rothstein, Steven J

2014-03-01

The major source of nitrogen for rice (Oryza sativa L.) is ammonium (NH4(+)). The NH4(+) uptake of roots is mainly governed by membrane transporters, with OsAMT1;1 being a prominent member of the OsAMT1 gene family that is known to be involved in NH4(+) transport in rice plants. However, little is known about its involvement in NH4(+) uptake in rice roots and subsequent effects on NH4(+) assimilation. This study shows that OsAMT1;1 is a constitutively expressed, nitrogen-responsive gene, and its protein product is localized in the plasma membrane. Its expression level is under the control of circadian rhythm. Transgenic rice lines (L-2 and L-3) overexpressing the OsAMT1;1 gene had the same root structure as the wild type (WT). However, they had 2-fold greater NH4(+) permeability than the WT, whereas OsAMT1;1 gene expression was 20-fold higher than in the WT. Analogous to the expression, transgenic lines had a higher NH4(+) content in the shoots and roots than the WT. Direct NH4(+) fluxes in the xylem showed that the transgenic lines had significantly greater uptake rates than the WT. Higher NH4(+) contents also promoted higher expression levels of genes in the nitrogen assimilation pathway, resulting in greater nitrogen assimilates, chlorophyll, starch, sugars, and grain yield in transgenic lines than in the WT under suboptimal and optimal nitrogen conditions. OsAMT1;1 also enhanced overall plant growth, especially under suboptimal NH4(+) levels. These results suggest that OsAMT1;1 has the potential for improving nitrogen use efficiency, plant growth, and grain yield under both suboptimal and optimal nitrogen fertilizer conditions.

Optimization and evaluation of T7 based RNA linear amplification protocols for cDNA microarray analysis

PubMed Central

Zhao, Hongjuan; Hastie, Trevor; Whitfield, Michael L; Børresen-Dale, Anne-Lise; Jeffrey, Stefanie S

2002-01-01

Background T7 based linear amplification of RNA is used to obtain sufficient antisense RNA for microarray expression profiling. We optimized and systematically evaluated the fidelity and reproducibility of different amplification protocols using total RNA obtained from primary human breast carcinomas and high-density cDNA microarrays. Results Using an optimized protocol, the average correlation coefficient of gene expression of 11,123 cDNA clones between amplified and unamplified samples is 0.82 (0.85 when a virtual array was created using repeatedly amplified samples to minimize experimental variation). Less than 4% of genes show changes in expression level by 2-fold or greater after amplification compared to unamplified samples. Most changes due to amplification are not systematic both within one tumor sample and between different tumors. Amplification appears to dampen the variation of gene expression for some genes when compared to unamplified poly(A)+ RNA. The reproducibility between repeatedly amplified samples is 0.97 when performed on the same day, but drops to 0.90 when performed weeks apart. The fidelity and reproducibility of amplification is not affected by decreasing the amount of input total RNA in the 0.3–3 micrograms range. Adding template-switching primer, DNA ligase, or column purification of double-stranded cDNA does not improve the fidelity of amplification. The correlation coefficient between amplified and unamplified samples is higher when total RNA is used as template for both experimental and reference RNA amplification. Conclusion T7 based linear amplification reproducibly generates amplified RNA that closely approximates original sample for gene expression profiling using cDNA microarrays. PMID:12445333

Animal component-free Agrobacterium tumefaciens cultivation media for better GMP-compliance increases biomass yield and pharmaceutical protein expression in Nicotiana benthamiana.

PubMed

Houdelet, Marcel; Galinski, Anna; Holland, Tanja; Wenzel, Kathrin; Schillberg, Stefan; Buyel, Johannes Felix

2017-04-01

Transient expression systems allow the rapid production of recombinant proteins in plants. Such systems can be scaled up to several hundred kilograms of biomass, making them suitable for the production of pharmaceutical proteins required at short notice, such as emergency vaccines. However, large-scale transient expression requires the production of recombinant Agrobacterium tumefaciens strains with the capacity for efficient gene transfer to plant cells. The complex media often used for the cultivation of this species typically include animal-derived ingredients that can contain human pathogens, thus conflicting with the requirements of good manufacturing practice (GMP). We replaced all the animal-derived components in yeast extract broth (YEB) cultivation medium with soybean peptone, and then used a design-of-experiments approach to optimize the medium composition, increasing the biomass yield while maintaining high levels of transient expression in subsequent infiltration experiments. The resulting plant peptone Agrobacterium medium (PAM) achieved a two-fold increase in OD 600 compared to YEB medium during a 4-L batch fermentation lasting 18 h. Furthermore, the yields of the monoclonal antibody 2G12 and the fluorescent protein DsRed were maintained when the cells were cultivated in PAM rather than YEB. We have thus demonstrated a simple, efficient and scalable method for medium optimization that reduces process time and costs. The final optimized medium for the cultivation of A. tumefaciens completely lacks animal-derived components, thus facilitating the GMP-compliant large-scale transient expression of recombinant proteins in plants. © 2017 The Authors. Biotechnology Journal published by WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Transcriptome-wide identification of reference genes for expression analysis of soybean responses to drought stress along the day

USDA-ARS?s Scientific Manuscript database

The soybean transcriptome displays strong variation along the day in optimal growth conditions and also in response to adverse circumstances, like drought stress. However, no study conducted to date has presented suitable reference genes, with stable expression along the day, for relative gene expre...

Optimal Levels of Emotional Arousal in Experiential Therapy of Depression

ERIC Educational Resources Information Center

Carryer, Jonathan R.; Greenberg, Leslie S.

2010-01-01

Objective: To determine the relationship between length of time spent expressing highly aroused emotion and therapeutic outcome. Method: Thirty-eight clients (14 male, 24 female) between the ages of 22 and 60 years (M = 39.5, SD = 9.71), treated for depression with experiential therapy, were rated on working alliance and expressed emotional…

An AlgU-regulated antisense transcript encoded within the Pseudomonas syringae fleQ gene has a positive effect on motility

USDA-ARS?s Scientific Manuscript database

Bacterial flagella production is controlled by a multi-tiered regulatory system that coordinates expression of 40-50 subunits and correct assembly of these complicated structures. Flagellar expression is environmentally controlled, presumably to optimize the benefits and liabilities of flagellar ex...

Patterns of Optimism and Pessimism in Perceptions of Changing Sex Roles.

ERIC Educational Resources Information Center

Marrone, Joseph G.; Rutnik, Carron M.

The utility of a design measuring actual, ideal, and expected sex-role attitudes was demonstrated with a 25-item survey administered to 155 undergraduate men and women under different instructional sets. Although relatively liberal attitudes were expressed overall, men generally expressed less egalitarian attitudes than did women. Moreover,…

Musical Understanding, Musical Works, and Emotional Expression: Implications for Education

ERIC Educational Resources Information Center

Elliott, David J.

2005-01-01

What do musicians, critics, and listeners mean when they use emotion-words to describe a piece of instrumental music? How can "pure" musical sounds "express" emotions such as joyfulness, sadness, anguish, optimism, and anger? Sounds are not living organisms; sounds cannot feel emotions. Yet many people around the world believe they hear emotions…

Similarities and Differences in the Perceptual Structure of Facial Expressions of Children and Adults

ERIC Educational Resources Information Center

Gao, Xiaoqing; Maurer, Daphne; Nishimura, Mayu

2010-01-01

We explored the perceptual structure of facial expressions of six basic emotions, varying systematically in intensity, in adults and children aged 7 and 14 years. Multidimensional scaling suggested that three- or four-dimensional structures were optimal for all groups. Two groups of adults demonstrated nearly identical structure, which had…

Genetic Networks and Anticipation of Gene Expression Patterns

NASA Astrophysics Data System (ADS)

Gebert, J.; Lätsch, M.; Pickl, S. W.; Radde, N.; Weber, G.-W.; Wünschiers, R.

2004-08-01

An interesting problem for computational biology is the analysis of time-series expression data. Here, the application of modern methods from dynamical systems, optimization theory, numerical algorithms and the utilization of implicit discrete information lead to a deeper understanding. In [1], we suggested to represent the behavior of time-series gene expression patterns by a system of ordinary differential equations, which we analytically and algorithmically investigated under the parametrical aspect of stability or instability. Our algorithm strongly exploited combinatorial information. In this paper, we deepen, extend and exemplify this study from the viewpoint of underlying mathematical modelling. This modelling consists in evaluating DNA-microarray measurements as the basis of anticipatory prediction, in the choice of a smooth model given by differential equations, in an approach of the right-hand side with parametric matrices, and in a discrete approximation which is a least squares optimization problem. We give a mathematical and biological discussion, and pay attention to the special case of a linear system, where the matrices do not depend on the state of expressions. Here, we present first numerical examples.

Transient gene expression in epidermal cells of plant leaves by biolistic DNA delivery.

PubMed

Ueki, Shoko; Magori, Shimpei; Lacroix, Benoît; Citovsky, Vitaly

2013-01-01

Transient gene expression is a useful approach for studying the functions of gene products. In the case of plants, Agrobacterium infiltration is a method of choice for transient introduction of genes for many species. However, this technique does not work efficiently in some species, such as Arabidopsis thaliana. Moreover, the infection of Agrobacterium is known to induce dynamic changes in gene expression patterns in the host plants, possibly affecting the function and localization of the proteins to be tested. These problems can be circumvented by biolistic delivery of the genes of interest. Here, we present an optimized protocol for biolistic delivery of plasmid DNA into epidermal cells of plant leaves, which can be easily performed using the Bio-Rad Helios gene gun system. This protocol allows efficient and reproducible transient expression of diverse genes in Arabidopsis, Nicotiana benthamiana and N. tabacum, and is suitable for studies of the biological function and subcellular localization of the gene products directly in planta. The protocol also can be easily adapted to other species by optimizing the delivery gas pressure.

Stringent and reproducible tetracycline-regulated transgene expression by site-specific insertion at chromosomal loci with pre-characterised induction characteristics

PubMed Central

Brough, Rachel; Papanastasiou, Antigoni M; Porter, Andrew CG

2007-01-01

Background The ability to regulate transgene expression has many applications, mostly concerning the analysis of gene function. Desirable induction characteristics, such as low un-induced expression, high induced expression and limited cellular heterogeneity, can be seriously impaired by chromosomal position effects at the site of transgene integration. Many clones may therefore need to be screened before one with optimal induction characteristics is identified. Furthermore, such screens must be repeated for each new transgene investigated, and comparisons between clones with different transgenes is complicated by their different integration sites. Results To circumvent these problems we have developed a "screen and insert" strategy in which clones carrying a transgene for a fluorescent reporter are first screened for those with optimal induction characteristics. Site-specific recombination (SSR) is then be used repeatedly to insert any new transgene at the reporter transgene locus of such clones so that optimal induction characteristics are conferred upon it. Here we have tested in a human fibrosarcoma cell line (HT1080) two of many possible implementations of this approach. Clones (e.g. Rht14-10) in which a GFP reporter gene is very stringently regulated by the tetracycline (tet) transactivator (tTA) protein were first identified flow-cytometrically. Transgenes encoding luciferase, I-SceI endonuclease or Rad52 were then inserted by SSR at a LoxP site adjacent to the GFP gene resulting stringent tet-regulated transgene expression. In clone Rht14-10, increases in expression from essentially background levels (+tet) to more than 104-fold above background (-tet) were reproducibly detected after Cre-mediated insertion of either the luciferase or the I-SceI transgenes. Conclusion Although previous methods have made use of SSR to integrate transgenes at defined sites, none has effectively combined this with a pre-selection step to identify integration sites that support optimal regulatory characteristics. Rht14-10 and similar HT1080-derived clones can now be used in conjunction with a convenient delivery vector (pIN2-neoMCS), in a simple 3-step protocol leading to stringent and reproducible transgene regulation. This approach will be particularly useful for transgenes whose products are very active at low concentrations and/or for comparisons of multiple related transgenes. PMID:17493262

Enhancement of heterogeneous alkaline xylanase production in Pichia pastoris GS115

NASA Astrophysics Data System (ADS)

Zheng, Wei

2017-08-01

A series of strategies were applied to improve expression level of the recombinant alkaline xylanase from Bacillus pumilus G1-3 in Pichia pastoris GS115. Codon optimization of xylanase gene xynG1-3 from B. pumilus G1-3 were carried out for its heterogeneous expression in P. pastoris. The activity of xylanase encoded by optimized gene (xynG1-3-opt) was up to 33641 U/mL, which was 37% higher than that by wild-type (xynG1-3) gene. The results will greatly contribute to increasing the production of recombinant proteins in P. pastoris and improving the industrial production of the alkaline xylanase.

Theory and design of interferometric synthetic aperture radars

NASA Technical Reports Server (NTRS)

Rodriguez, E.; Martin, J. M.

1992-01-01

A derivation of the signal statistics, an optimal estimator of the interferometric phase, and the expression necessary to calculate the height-error budget are presented. These expressions are used to derive methods of optimizing the parameters of the interferometric synthetic aperture radar system (InSAR), and are then employed in a specific design example for a system to perform high-resolution global topographic mapping with a one-year mission lifetime, subject to current technological constraints. A Monte Carlo simulation of this InSAR system is performed to evaluate its performance for realistic topography. The results indicate that this system has the potential to satisfy the stringent accuracy and resolution requirements for geophysical use of global topographic data.

Design, Construction and Cloning of Truncated ORF2 and tPAsp-PADRE-Truncated ORF2 Gene Cassette From Hepatitis E Virus in the pVAX1 Expression Vector

PubMed Central

Farshadpour, Fatemeh; Makvandi, Manoochehr; Taherkhani, Reza

2015-01-01

Background: Hepatitis E Virus (HEV) is the causative agent of enterically transmitted acute hepatitis and has high mortality rate of up to 30% among pregnant women. Therefore, development of a novel vaccine is a desirable goal. Objectives: The aim of this study was to construct tPAsp-PADRE-truncated open reading frame 2 (ORF2) and truncated ORF2 DNA plasmid, which can assist future studies with the preparation of an effective vaccine against Hepatitis E Virus. Materials and Methods: A synthetic codon-optimized gene cassette encoding tPAsp-PADRE-truncated ORF2 protein was designed, constructed and analyzed by some bioinformatics software. Furthermore, a codon-optimized truncated ORF2 gene was amplified by the polymerase chain reaction (PCR), with a specific primer from the previous construct. The constructs were sub-cloned in the pVAX1 expression vector and finally expressed in eukaryotic cells. Results: Sequence analysis and bioinformatics studies of the codon-optimized gene cassette revealed that codon adaptation index (CAI), GC content, and frequency of optimal codon usage (Fop) value were improved, and performance of the secretory signal was confirmed. Cloning and sub-cloning of the tPAsp-PADRE-truncated ORF2 gene cassette and truncated ORF2 gene were confirmed by colony PCR, restriction enzymes digestion and DNA sequencing of the recombinant plasmids pVAX-tPAsp-PADRE-truncated ORF2 (aa 112-660) and pVAX-truncated ORF2 (aa 112-660). The expression of truncated ORF2 protein in eukaryotic cells was approved by an Immunofluorescence assay (IFA) and the reverse transcriptase polymerase chain reaction (RT-PCR) method. Conclusions: The results of this study demonstrated that the tPAsp-PADRE-truncated ORF2 gene cassette and the truncated ORF2 gene in recombinant plasmids are successfully expressed in eukaryotic cells. The immunogenicity of the two recombinant plasmids with different formulations will be evaluated as a novel DNA vaccine in future investigations. PMID:26865938

Integrated cell and process engineering for improved transient production of a "difficult-to-express" fusion protein by CHO cells.

PubMed

Johari, Yusuf B; Estes, Scott D; Alves, Christina S; Sinacore, Marty S; James, David C

2015-12-01

Based on an optimized electroporation protocol, we designed a rapid, milliliter-scale diagnostic transient production assay to identify limitations in the ability of Chinese hamster ovary (CHO) cells to produce a model "difficult-to-express" homodimeric Fc-fusion protein, Sp35Fc, that exhibited very low volumetric titer and intracellular formation of disulfide-bonded oligomeric aggregates post-transfection. As expression of Sp35Fc induced an unfolded protein response in transfected host cells, we utilized the transient assay to compare, in parallel, multiple functionally diverse strategies to engineer intracellular processing of Sp35Fc in order to increase production and reduce aggregation as two discrete design objectives. Specifically, we compared the effect of (i) co-expression of ER-resident molecular chaperones (BiP, PDI, CypB) or active forms of UPR transactivators (ATF6c, XBP1s) at varying recombinant gene load, (ii) addition of small molecules known to act as chemical chaperones (PBA, DMSO, glycerol, betaine, TMAO) or modulate UPR signaling (PERK inhibitor GSK2606414) at varying concentration, (iii) a reduction in culture temperature to 32°C. Using this information, we designed a biphasic, Sp35Fc-specific transient manufacturing process mediated by lipofection that utilized CypB co-expression at an optimal Sp35Fc:CypB gene ratio of 5:1 to initially maximize transfected cell proliferation, followed by addition of a combination of PBA (0.5 mM) and glycerol (1% v/v) at the onset of stationary phase to maximize cell specific production and eliminate Sp35Fc aggregation. Using this optimal, engineered process transient Sp35Fc production was significantly increased sixfold over a 12 day production process with no evidence of disulfide-bonded aggregates. Finally, transient production in clonally derived sub-populations (derived from parental CHO host) screened for a heritably improved capability to produce Sp35Fc was also significantly improved by the optimized process, showing that protein-specific cell/process engineering can provide a solution that exceeds the limits of genetic/functional diversity within heterogeneous host cell populations. . © 2015 Wiley Periodicals, Inc.

Developing a new production host from a blueprint: Bacillus pumilus as an industrial enzyme producer.

PubMed

Küppers, Tobias; Steffen, Victoria; Hellmuth, Hendrik; O'Connell, Timothy; Bongaerts, Johannes; Maurer, Karl-Heinz; Wiechert, Wolfgang

2014-03-24

Since volatile and rising cost factors such as energy, raw materials and market competitiveness have a significant impact on the economic efficiency of biotechnological bulk productions, industrial processes need to be steadily improved and optimized. Thereby the current production hosts can undergo various limitations. To overcome those limitations and in addition increase the diversity of available production hosts for future applications, we suggest a Production Strain Blueprinting (PSB) strategy to develop new production systems in a reduced time lapse in contrast to a development from scratch.To demonstrate this approach, Bacillus pumilus has been developed as an alternative expression platform for the production of alkaline enzymes in reference to the established industrial production host Bacillus licheniformis. To develop the selected B. pumilus as an alternative production host the suggested PSB strategy was applied proceeding in the following steps (dedicated product titers are scaled to the protease titer of Henkel's industrial production strain B. licheniformis at lab scale): Introduction of a protease production plasmid, adaptation of a protease production process (44%), process optimization (92%) and expression optimization (114%). To further evaluate the production capability of the developed B. pumilus platform, the target protease was substituted by an α-amylase. The expression performance was tested under the previously optimized protease process conditions and under subsequently adapted process conditions resulting in a maximum product titer of 65% in reference to B. licheniformis protease titer. In this contribution the applied PSB strategy performed very well for the development of B. pumilus as an alternative production strain. Thereby the engineered B. pumilus expression platform even exceeded the protease titer of the industrial production host B. licheniformis by 14%. This result exhibits a remarkable potential of B. pumilus to be the basis for a next generation production host, since the strain has still a large potential for further genetic engineering. The final amylase titer of 65% in reference to B. licheniformis protease titer suggests that the developed B. pumilus expression platform is also suitable for an efficient production of non-proteolytic enzymes reaching a final titer of several grams per liter without complex process modifications.

Plant cell wall glycosyltransferases: High-throughput recombinant expression screening and general requirements for these challenging enzymes

DOE PAGES

Welner, Ditte Hededam; Shin, David; Tomaleri, Giovani P.; ...

2017-06-09

Molecular characterization of plant cell wall glycosyltransferases is a critical step towards understanding the biosynthesis of the complex plant cell wall, and ultimately for efficient engineering of biofuel and agricultural crops. The majority of these enzymes have proven very difficult to obtain in the needed amount and purity for such molecular studies, and recombinant cell wall glycosyltransferase production efforts have largely failed. A daunting number of strategies can be employed to overcome this challenge, including optimization of DNA and protein sequences, choice of expression organism, expression conditions, coexpression partners, purification methods, and optimization of protein solubility and stability. Hence researchersmore » are presented with thousands of potential conditions to test. Ultimately, the subset of conditions that will be sampled depends on practical considerations and prior knowledge of the enzyme(s) being studied. We have developed a rational approach to this process. We devise a pipeline comprising in silico selection of targets and construct design, and high-throughput expression screening, target enrichment, and hit identification. We have applied this pipeline to a test set of Arabidopsis thaliana cell wall glycosyltransferases known to be challenging to obtain in soluble form, as well as to a library of cell wall glycosyltransferases from other plants including agricultural and biofuel crops. The screening results suggest that recombinant cell wall glycosyltransferases in general have a very low soluble: Insoluble ratio in lysates from heterologous expression cultures, and that co-expression of chaperones as well as lysis buffer optimization can increase this ratio. We have applied the identified preferred conditions to Reversibly Glycosylated Polypeptide 1 from Arabidopsis thaliana, and processed this enzyme to near-purity in unprecedented milligram amounts. The obtained preparation of Reversibly Glycosylated Polypeptide 1 has the expected arabinopyranose mutase and autoglycosylation activities.This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.« less

Optimized paired-sgRNA/Cas9 cloning and expression cassette triggers high-efficiency multiplex genome editing in kiwifruit.

PubMed

Wang, Zupeng; Wang, Shuaibin; Li, Dawei; Zhang, Qiong; Li, Li; Zhong, Caihong; Liu, Yifei; Huang, Hongwen

2018-01-13

Kiwifruit is an important fruit crop; however, technologies for its functional genomic and molecular improvement are limited. The clustered regulatory interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein (Cas) system has been successfully applied to genetic improvement in many crops, but its editing capability is variable depending on the different combinations of the synthetic guide RNA (sgRNA) and Cas9 protein expression devices. Optimizing conditions for its use within a particular species is therefore needed to achieve highly efficient genome editing. In this study, we developed a new cloning strategy for generating paired-sgRNA/Cas9 vectors containing four sgRNAs targeting the kiwifruit phytoene desaturase gene (AcPDS). Comparing to the previous method of paired-sgRNA cloning, our strategy only requires the synthesis of two gRNA-containing primers which largely reduces the cost. We further compared efficiencies of paired-sgRNA/Cas9 vectors containing different sgRNA expression devices, including both the polycistronic tRNA-sgRNA cassette (PTG) and the traditional CRISPR expression cassette. We found the mutagenesis frequency of the PTG/Cas9 system was 10-fold higher than that of the CRISPR/Cas9 system, coinciding with the relative expressions of sgRNAs in two different expression cassettes. In particular, we identified large chromosomal fragment deletions induced by the paired-sgRNAs of the PTG/Cas9 system. Finally, as expected, we found both systems can successfully induce the albino phenotype of kiwifruit plantlets regenerated from the G418-resistance callus lines. We conclude that the PTG/Cas9 system is a more powerful system than the traditional CRISPR/Cas9 system for kiwifruit genome editing, which provides valuable clues for optimizing CRISPR/Cas9 editing system in other plants. © 2018 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

Iterative algorithm-guided design of massive strain libraries, applied to itaconic acid production in yeast.

PubMed

Young, Eric M; Zhao, Zheng; Gielesen, Bianca E M; Wu, Liang; Benjamin Gordon, D; Roubos, Johannes A; Voigt, Christopher A

2018-05-09

Metabolic engineering requires multiple rounds of strain construction to evaluate alternative pathways and enzyme concentrations. Optimizing multigene pathways stepwise or by randomly selecting enzymes and expression levels is inefficient. Here, we apply methods from design of experiments (DOE) to guide the construction of strain libraries from which the maximum information can be extracted without sampling every possible combination. We use Saccharomyces cerevisiae as a host for a novel six-gene pathway to itaconic acid, selected by comparing alternative shunt pathways that bypass the mitochondrial TCA cycle. The pathway is distinctive for the use of acetylating acetaldehyde dehydrogenase to increase cytosolic acetyl-CoA pools, a bacterial enzyme to synthesize citrate in the cytosol, and an itaconic acid exporter. Precise control over the expression of each gene is enabled by a set of promoter-terminator pairs that span a 174-fold range. Two large combinatorial libraries (160 variants, 2.4Mb and 32 variants, 0.6Mb) are designed where the expression levels are selected by statistical methods (I-optimal response surface methodology, full factorial, or Plackett-Burman) with the intent of extracting different types of guiding information after the screen. This is applied to the design of a third library (24 variants, 0.5Mb) intended to alleviate a bottleneck in cis-aconitate decarboxylase (CAD) expression. The top strain produces 815mg/l itaconic acid, a 4-fold improvement over the initial strain achieved by iteratively balancing pathway expression. Including a methylated product in the total, the strain produces 1.3g/l combined itaconic acids. Further, a regression analysis of the libraries reveals the optimal expression level of CAD as well as pairwise interdependencies between genes that result in increased titer and purity of itaconic acid. This work demonstrates adapting algorithmic design strategies to guide automated yeast strain construction and learn information after each iteration. Copyright © 2018. Published by Elsevier Inc.

Plant cell wall glycosyltransferases: High-throughput recombinant expression screening and general requirements for these challenging enzymes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Welner, Ditte Hededam; Shin, David; Tomaleri, Giovani P.

Molecular characterization of plant cell wall glycosyltransferases is a critical step towards understanding the biosynthesis of the complex plant cell wall, and ultimately for efficient engineering of biofuel and agricultural crops. The majority of these enzymes have proven very difficult to obtain in the needed amount and purity for such molecular studies, and recombinant cell wall glycosyltransferase production efforts have largely failed. A daunting number of strategies can be employed to overcome this challenge, including optimization of DNA and protein sequences, choice of expression organism, expression conditions, coexpression partners, purification methods, and optimization of protein solubility and stability. Hence researchersmore » are presented with thousands of potential conditions to test. Ultimately, the subset of conditions that will be sampled depends on practical considerations and prior knowledge of the enzyme(s) being studied. We have developed a rational approach to this process. We devise a pipeline comprising in silico selection of targets and construct design, and high-throughput expression screening, target enrichment, and hit identification. We have applied this pipeline to a test set of Arabidopsis thaliana cell wall glycosyltransferases known to be challenging to obtain in soluble form, as well as to a library of cell wall glycosyltransferases from other plants including agricultural and biofuel crops. The screening results suggest that recombinant cell wall glycosyltransferases in general have a very low soluble: Insoluble ratio in lysates from heterologous expression cultures, and that co-expression of chaperones as well as lysis buffer optimization can increase this ratio. We have applied the identified preferred conditions to Reversibly Glycosylated Polypeptide 1 from Arabidopsis thaliana, and processed this enzyme to near-purity in unprecedented milligram amounts. The obtained preparation of Reversibly Glycosylated Polypeptide 1 has the expected arabinopyranose mutase and autoglycosylation activities.This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.« less

Optimality study of a gust alleviation system for light wing-loading STOL aircraft

NASA Technical Reports Server (NTRS)

Komoda, M.

1976-01-01

An analytical study was made of an optimal gust alleviation system that employs a vertical gust sensor mounted forward of an aircraft's center of gravity. Frequency domain optimization techniques were employed to synthesize the optimal filters that process the corrective signals to the flaps and elevator actuators. Special attention was given to evaluating the effectiveness of lead time, that is, the time by which relative wind sensor information should lead the actual encounter of the gust. The resulting filter is expressed as an implicit function of the prescribed control cost. A numerical example for a light wing loading STOL aircraft is included in which the optimal trade-off between performance and control cost is systematically studied.

Fluorescence-based optimization of human bitter taste receptor expression in Saccharomyces cerevisiae

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sugawara, Taishi; Ito, Keisuke; Shiroishi, Mitsunori

2009-05-15

Human TAS2 receptors (hTAS2Rs) perceive bitter tastants, but few studies have explored the structure-function relationships of these receptors. In this paper, we report our trials on the large-scale preparations of hTAS2Rs for structural analysis. Twenty-five hTAS2Rs were expressed using a GFP-fusion yeast system in which the constructs and the culture conditions (e.g., the signal sequence, incubation time and temperature after induction) were optimized by measuring GFP fluorescence. After optimization, five hTAS2Rs (hTAS2R7, hTAS2R8, hTAS2R16, hTAS2R41, and hTAS2R48) were expressed at levels greater than 1 mg protein/L of culture, which is a preferable level for purification and crystallization. Among these fivemore » bitter taste receptors, hTAS2R41 exhibited the highest detergent solubilization efficiency of 87.1% in n-dodecyl-{beta}-D-maltopyranoside (DDM)/cholesteryl hemisuccinate (CHS). Fluorescence size-exclusion chromatography showed that hTAS2R41 exhibited monodispersity in DDM/CHS without aggregates, suggesting that hTAS2R41 is a good target for future crystallization trials.« less

Efficient Expression of Maltohexaose-Forming α-Amylase from Bacillus stearothermophilus in Brevibacillus choshinensis SP3 and Its Use in Maltose Production

PubMed Central

Duan, Xuguo

2017-01-01

The maltohexaose-forming, Ca2+-independent α-amylase gene from Bacillus stearothermophilus (AmyMH) was efficiently expressed in Brevibacillus choshinensis SP3. To improve the production of AmyMH in B. choshinensis SP3, the temperature and initial pH of culture medium were optimized. In addition, single-factor and response surface methodologies were pursued to optimize culture medium. Addition of proline to the culture medium significantly improved the production of recombinant α-amylase in B. choshinensis SP3. This improvement may result from improved cellular integrity of recombinant B. choshinensis SP3 in existence of proline. Culture medium optimization resulted in an 8-fold improvement in α-amylase yield, which reached 1.72 × 104 U·mL−1. The recombinant α-amylase was applied to the production of maltose on a laboratory scale. A maltose content of 90.72%, which could be classified as an extremely high maltose syrup, could be achieved using 15% (m/v) corn starch as the substrate. This study demonstrated that the B. choshinensis SP3 expression system was able to produce substantial quantities of recombinant α-amylase that has potential application in the starch industry. PMID:29250543

Tetracycline-inducible system for regulation of skeletal muscle-specific gene expression in transgenic mice

NASA Technical Reports Server (NTRS)

Grill, Mischala A.; Bales, Mark A.; Fought, Amber N.; Rosburg, Kristopher C.; Munger, Stephanie J.; Antin, Parker B.

2003-01-01

Tightly regulated control of over-expression is often necessary to study one aspect or time point of gene function and, in transgenesis, may help to avoid lethal effects and complications caused by ubiquitous over-expression. We have utilized the benefits of an optimized tet-on system and a modified muscle creatine kinase (MCK) promoter to generate a skeletal muscle-specific, doxycycline (Dox) controlled over-expression system in transgenic mice. A DNA construct was generated in which the codon optimized reverse tetracycline transactivator (rtTA) was placed under control of a skeletal muscle-specific version of the mouse MCK promoter. Transgenic mice containing this construct expressed rtTA almost exclusively in skeletal muscles. These mice were crossed to a second transgenic line containing a bi-directional promoter centered on a tet responder element driving both a luciferase reporter gene and a tagged gene of interest; in this case the calpain inhibitor calpastatin. Compound hemizygous mice showed high level, Dox dependent muscle-specific luciferase activity often exceeding 10,000-fold over non-muscle tissues of the same mouse. Western and immunocytochemical analysis demonstrated similar Dox dependent muscle-specific induction of the tagged calpastatin protein. These findings demonstrate the effectiveness and flexibility of the tet-on system to provide a tightly regulated over-expression system in adult skeletal muscle. The MCKrtTA transgenic lines can be combined with other transgenic responder lines for skeletal muscle-specific over-expression of any target gene of interest.

A second-generation expression system for tyrosine-sulfated proteins and its application in crop protection.

PubMed

Schwessinger, Benjamin; Li, Xiang; Ellinghaus, Thomas L; Chan, Leanne Jade G; Wei, Tong; Joe, Anna; Thomas, Nicholas; Pruitt, Rory; Adams, Paul D; Chern, Maw Sheng; Petzold, Christopher J; Liu, Chang C; Ronald, Pamela C

2016-04-18

Posttranslational modification (PTM) of proteins and peptides is important for diverse biological processes in plants and animals. The paucity of heterologous expression systems for PTMs and the technical challenges associated with chemical synthesis of these modified proteins has limited detailed molecular characterization and therapeutic applications. Here we describe an optimized system for expression of tyrosine-sulfated proteins in Escherichia coli and its application in a bio-based crop protection strategy in rice.

A second-generation expression system for tyrosine-sulfated proteins and its application in crop protection

DOE PAGES

Schwessinger, Benjamin; Li, Xiang; Ellinghaus, Thomas L.; ...

2015-11-27

Posttranslational modification (PTM) of proteins and peptides is important for diverse biological processes in plants and animals. The paucity of heterologous expression systems for PTMs and the technical challenges associated with chemical synthesis of these modified proteins has limited detailed molecular characterization and therapeutic applications. Here we describe an optimized system for expression of tyrosine-sulfated proteins in Escherichia coli and its application in a bio-based crop protection strategy in rice.

Diagnosis and Prevention of Infection by Phlebotomus Fever Group Viruses

DTIC Science & Technology

1991-05-03

proficient, but non- optimal expression vectors [e.g., pAcRP6, see below]. The two types of recombinant viruses were used to infect Spodoptera ... frugiperda cells and the expressed PT viral proteins characterised (Overton et al., 1987). Recombinant AcNPV having the S DNA in one orientation expressed...proteins virus were raised in mice using the corresponding S. frugiperda infected cell extracts and were employed to identify N and NSs proteins in PT virus

Rejection of syngeneic colon carcinoma by CTLs expressing single-chain antibody receptors codelivering CD28 costimulation.

PubMed

Haynes, Nicole M; Trapani, Joseph A; Teng, Michele W L; Jackson, Jacob T; Cerruti, Loretta; Jane, Stephen M; Kershaw, Michael H; Smyth, Mark J; Darcy, Phillip K

2002-11-15

A new strategy to improve the therapeutic utility of redirected T cells for cancer involves the development of novel Ag-specific chimeric receptors capable of stimulating optimal and sustained T cell antitumor activity in vivo. Given that T cells require both primary and costimulatory signals for optimal activation and that many tumors do not express critical costimulatory ligands, modified single-chain Ab receptors have been engineered to codeliver CD28 costimulation. In this study, we have compared the antitumor potency of primary T lymphocytes expressing carcinoembryonic Ag (CEA)-reactive chimeric receptors that incorporate either TCR-zeta or CD28/TCR-zeta signaling. Although both receptor-transduced T cell effector populations demonstrated cytolysis of CEA(+) tumors in vitro, T cells expressing the single-chain variable fragment of Ig (scFv)-CD28-zeta chimera had a far greater capacity to control the growth of CEA(+) xenogeneic and syngeneic colon carcinomas in vivo. The observed enhanced antitumor activity of T cells expressing the scFv-CD28-zeta receptor was critically dependent on perforin and the production of IFN-gamma. Overall, this study has illustrated the ability of a chimeric scFv receptor capable of harnessing the signaling machinery of both TCR-zeta and CD28 to augment T cell immunity against tumors that have lost expression of both MHC/peptide and costimulatory ligands in vivo.

Bone Marrow-derived Mesenchymal Stem Cells (MSCs) as a Selective Delivery Vehicle for a PSA-Activated Protoxin for Advanced Prostate Cancer

DTIC Science & Technology

2013-03-01

tissue have been optimized • Optimization of flow cytometry-based analyses to characterize co- incident expression of multiple MSC-related markers on a...CA). Mouse anti-human vimentin (clone LN-6) was purchased from Sigma-Aldrich (St. Louis, MO). Goat anti-mouse Alexa Fluor 488, Roswell Park

Approximated analytical solution to an Ebola optimal control problem

NASA Astrophysics Data System (ADS)

Hincapié-Palacio, Doracelly; Ospina, Juan; Torres, Delfim F. M.

2016-11-01

An analytical expression for the optimal control of an Ebola problem is obtained. The analytical solution is found as a first-order approximation to the Pontryagin Maximum Principle via the Euler-Lagrange equation. An implementation of the method is given using the computer algebra system Maple. Our analytical solutions confirm the results recently reported in the literature using numerical methods.

Closed-form recursive formula for an optimal tracker with terminal constraints

NASA Technical Reports Server (NTRS)

Juang, J.-N.; Turner, J. D.; Chun, H. M.

1984-01-01

Feedback control laws are derived for a class of optimal finite time tracking problems with terminal constraints. Analytical solutions are obtained for the feedback gain and the closed-loop response trajectory. Such formulations are expressed in recursive forms so that a real-time computer implementation becomes feasible. Two examples are given to illustrate the validity and usefulness of the formulations.

Optimized Free Energies from Bidirectional Single-Molecule Force Spectroscopy

NASA Astrophysics Data System (ADS)

Minh, David D. L.; Adib, Artur B.

2008-05-01

An optimized method for estimating path-ensemble averages using data from processes driven in opposite directions is presented. Based on this estimator, bidirectional expressions for reconstructing free energies and potentials of mean force from single-molecule force spectroscopy—valid for biasing potentials of arbitrary stiffness—are developed. Numerical simulations on a model potential indicate that these methods perform better than unidirectional strategies.

Optimized Hypernetted-Chain Solutions for Helium -4 Surfaces and Metal Surfaces

NASA Astrophysics Data System (ADS)

Qian, Guo-Xin

This thesis is a study of inhomogeneous Bose systems such as liquid ('4)He slabs and inhomogeneous Fermi systems such as the electron gas in metal films, at zero temperature. Using a Jastrow-type many-body wavefunction, the ground state energy is expressed by means of Bogoliubov-Born-Green-Kirkwood -Yvon and Hypernetted-Chain techniques. For Bose systems, Euler-Lagrange equations are derived for the one- and two -body functions and systematic approximation methods are physically motivated. It is shown that the optimized variational method includes a self-consistent summation of ladder- and ring-diagrams of conventional many-body theory. For Fermi systems, a linear potential model is adopted to generate the optimized Hartree-Fock basis. Euler-Lagrange equations are derived for the two-body correlations which serve to screen the strong bare Coulomb interaction. The optimization of the pair correlation leads to an expression of correlation energy in which the state averaged RPA part is separated. Numerical applications are presented for the density profile and pair distribution function for both ('4)He surfaces and metal surfaces. Both the bulk and surface energies are calculated in good agreement with experiments.

Streamflow variability and optimal capacity of run-of-river hydropower plants

NASA Astrophysics Data System (ADS)

Basso, S.; Botter, G.

2012-10-01

The identification of the capacity of a run-of-river plant which allows for the optimal utilization of the available water resources is a challenging task, mainly because of the inherent temporal variability of river flows. This paper proposes an analytical framework to describe the energy production and the economic profitability of small run-of-river power plants on the basis of the underlying streamflow regime. We provide analytical expressions for the capacity which maximize the produced energy as a function of the underlying flow duration curve and minimum environmental flow requirements downstream of the plant intake. Similar analytical expressions are derived for the capacity which maximize the economic return deriving from construction and operation of a new plant. The analytical approach is applied to a minihydro plant recently proposed in a small Alpine catchment in northeastern Italy, evidencing the potential of the method as a flexible and simple design tool for practical application. The analytical model provides useful insight on the major hydrologic and economic controls (e.g., streamflow variability, energy price, costs) on the optimal plant capacity and helps in identifying policy strategies to reduce the current gap between the economic and energy optimizations of run-of-river plants.

Optimization of cDNA-AFLP experiments using genomic sequence data.

PubMed

Kivioja, Teemu; Arvas, Mikko; Saloheimo, Markku; Penttilä, Merja; Ukkonen, Esko

2005-06-01

cDNA amplified fragment length polymorphism (cDNA-AFLP) is one of the few genome-wide level expression profiling methods capable of finding genes that have not yet been cloned or even predicted from sequence but have interesting expression patterns under the studied conditions. In cDNA-AFLP, a complex cDNA mixture is divided into small subsets using restriction enzymes and selective PCR. A large cDNA-AFLP experiment can require a substantial amount of resources, such as hundreds of PCR amplifications and gel electrophoresis runs, followed by manual cutting of a large number of bands from the gels. Our aim was to test whether this workload can be reduced by rational design of the experiment. We used the available genomic sequence information to optimize cDNA-AFLP experiments beforehand so that as many transcripts as possible could be profiled with a given amount of resources. Optimization of the selection of both restriction enzymes and selective primers for cDNA-AFLP experiments has not been performed previously. The in silico tests performed suggest that substantial amounts of resources can be saved by the optimization of cDNA-AFLP experiments.

An Optimal Mean Based Block Robust Feature Extraction Method to Identify Colorectal Cancer Genes with Integrated Data.

PubMed

Liu, Jian; Cheng, Yuhu; Wang, Xuesong; Zhang, Lin; Liu, Hui

2017-08-17

It is urgent to diagnose colorectal cancer in the early stage. Some feature genes which are important to colorectal cancer development have been identified. However, for the early stage of colorectal cancer, less is known about the identity of specific cancer genes that are associated with advanced clinical stage. In this paper, we conducted a feature extraction method named Optimal Mean based Block Robust Feature Extraction method (OMBRFE) to identify feature genes associated with advanced colorectal cancer in clinical stage by using the integrated colorectal cancer data. Firstly, based on the optimal mean and L 2,1 -norm, a novel feature extraction method called Optimal Mean based Robust Feature Extraction method (OMRFE) is proposed to identify feature genes. Then the OMBRFE method which introduces the block ideology into OMRFE method is put forward to process the colorectal cancer integrated data which includes multiple genomic data: copy number alterations, somatic mutations, methylation expression alteration, as well as gene expression changes. Experimental results demonstrate that the OMBRFE is more effective than previous methods in identifying the feature genes. Moreover, genes identified by OMBRFE are verified to be closely associated with advanced colorectal cancer in clinical stage.

Effect of leaf incubation temperature profiles on Agrobacterium tumefaciens-mediated transient expression.

PubMed

Jung, Sang-Kyu; McDonald, Karen A; Dandekar, Abhaya M

2015-01-01

Agrobacterium tumefaciens-mediated transient expression is known to be highly dependent on incubation temperature. Compared with early studies that were conducted at constant temperature, we examined the effect of variable leaf incubation temperature on transient expression. As a model system, synthetic endoglucanase (E1) and endoxylanase (Xyn10A) genes were transiently expressed in detached whole sunflower leaves via vacuum infiltration for biofuel applications. We found that the kinetics of transient expression strongly depended on timing of the temperature change as well as leaf incubation temperature. Surprisingly, we found that high incubation temperature (27-30 °C) which is suboptimal for T-DNA transfer, significantly enhanced transient expression if the high temperature was applied during the late phase (Day 3-6) of leaf incubation whereas incubation temperature in a range of 20-25 °C for an early phase (Day 0-2) resulted in higher production. On the basis of these results, we propose that transient expression is governed by both T-DNA transfer and protein synthesis in plant cells that have different temperature dependent kinetics. Because the phases were separated in time and had different optimal temperatures, we were then able to develop a novel two phase optimization strategy for leaf incubation temperature. Applying the time-varying temperature profile, we were able to increase the protein accumulation by fivefold compared with the control at a constant temperature of 20 °C. From our knowledge, this is the first report illustrating the effect of variable temperature profiling for improved transient expression. © 2015 American Institute of Chemical Engineers.

Optimal Scaling of Digital Transcriptomes

PubMed Central

Glusman, Gustavo; Caballero, Juan; Robinson, Max; Kutlu, Burak; Hood, Leroy

2013-01-01

Deep sequencing of transcriptomes has become an indispensable tool for biology, enabling expression levels for thousands of genes to be compared across multiple samples. Since transcript counts scale with sequencing depth, counts from different samples must be normalized to a common scale prior to comparison. We analyzed fifteen existing and novel algorithms for normalizing transcript counts, and evaluated the effectiveness of the resulting normalizations. For this purpose we defined two novel and mutually independent metrics: (1) the number of “uniform” genes (genes whose normalized expression levels have a sufficiently low coefficient of variation), and (2) low Spearman correlation between normalized expression profiles of gene pairs. We also define four novel algorithms, one of which explicitly maximizes the number of uniform genes, and compared the performance of all fifteen algorithms. The two most commonly used methods (scaling to a fixed total value, or equalizing the expression of certain ‘housekeeping’ genes) yielded particularly poor results, surpassed even by normalization based on randomly selected gene sets. Conversely, seven of the algorithms approached what appears to be optimal normalization. Three of these algorithms rely on the identification of “ubiquitous” genes: genes expressed in all the samples studied, but never at very high or very low levels. We demonstrate that these include a “core” of genes expressed in many tissues in a mutually consistent pattern, which is suitable for use as an internal normalization guide. The new methods yield robustly normalized expression values, which is a prerequisite for the identification of differentially expressed and tissue-specific genes as potential biomarkers. PMID:24223126

Titer improvement of iso-migrastatin in selected heterologous Streptomyces hosts and related analysis of mRNA expression by quantitative RT–PCR

PubMed Central

Yang, Dong; Zhu, Xiangcheng; Wu, Xueyun; Feng, Zhiyang; Huang, Lei; Shen, Ben; Xu, Zhinan

2011-01-01

iso-Migrastatin (iso-MGS) has been actively pursued recently as an outstanding candidate of antimetastasis agents. Having characterized the iso-MGS biosynthetic gene cluster from its native producer Streptomyces platensis NRRL 18993, we have recently succeeded in producing iso-MGS in five selected heterologous Streptomyces hosts, albeit the low titers failed to meet expectations and cast doubt on the utility of this novel technique for large-scale production. To further explore and capitalize on the production capacity of these hosts, a thorough investigation of these five engineered strains with three fermentation media for iso-MGS production was undertaken. Streptomyces albus J1074 and Streptomyces lividans K4-114 were found to be preferred heterologous hosts, and subsequent analysis of carbon and nitrogen sources revealed that sucrose and yeast extract were ideal for iso-MGS production. After the initial optimization, the titers of iso-MGS in all five hosts were considerably improved by 3–18-fold in the optimized R2YE medium. Furthermore, the iso-MGS titer of S. albus J1074 (pBS11001) was significantly improved to 186.7 mg/L by a hybrid medium strategy. Addition of NaHCO3 to the latter finally afforded an optimized iso-MGS titer of 213.8 mg/L, about 5-fold higher than the originally reported system. With S. albus J1074 (pBS11001) as a model host, the expression of iso-MGS gene cluster in four different media was systematically studied via the quantitative RT–PCR technology. The resultant comparison revealed the correlation of gene expression and iso-MGS production for the first time; synchronous expression of the whole gene cluster was crucial for optimal iso-MGS production. These results reveal new insights into the iso-MGS biosynthetic machinery in heterologous hosts and provide the primary data to realize large-scale production of iso-MGS for further preclinical studies. PMID:21132287

Sequential Metabolic Phases as a Means to Optimize Cellular Output in a Constant Environment

PubMed Central

Bockmayr, Alexander; Holzhütter, Hermann-Georg

2015-01-01

Temporal changes of gene expression are a well-known regulatory feature of all cells, which is commonly perceived as a strategy to adapt the proteome to varying external conditions. However, temporal (rhythmic and non-rhythmic) changes of gene expression are also observed under virtually constant external conditions. Here we hypothesize that such changes are a means to render the synthesis of the metabolic output more efficient than under conditions of constant gene activities. In order to substantiate this hypothesis, we used a flux-balance model of the cellular metabolism. The total time span spent on the production of a given set of target metabolites was split into a series of shorter time intervals (metabolic phases) during which only selected groups of metabolic genes are active. The related flux distributions were calculated under the constraint that genes can be either active or inactive whereby the amount of protein related to an active gene is only controlled by the number of active genes: the lower the number of active genes the more protein can be allocated to the enzymes carrying non-zero fluxes. This concept of a predominantly protein-limited efficiency of gene expression clearly differs from other concepts resting on the assumption of an optimal gene regulation capable of allocating to all enzymes and transporters just that fraction of protein necessary to prevent rate limitation. Applying this concept to a simplified metabolic network of the central carbon metabolism with glucose or lactate as alternative substrates, we demonstrate that switching between optimally chosen stationary flux modes comprising different sets of active genes allows producing a demanded amount of target metabolites in a significantly shorter time than by a single optimal flux mode at fixed gene activities. Our model-based findings suggest that temporal expression of metabolic genes can be advantageous even under conditions of constant external substrate supply. PMID:25786979

Toward industrial production of isoprenoids in Escherichia coli: Lessons learned from CRISPR-Cas9 based optimization of a chromosomally integrated mevalonate pathway.

PubMed

Alonso-Gutierrez, Jorge; Koma, Daisuke; Hu, Qijun; Yang, Yuchen; Chan, Leanne J G; Petzold, Christopher J; Adams, Paul D; Vickers, Claudia E; Nielsen, Lars K; Keasling, Jay D; Lee, Taek S

2018-04-01

Escherichia coli has been the organism of choice for the production of different chemicals by engineering native and heterologous pathways. In the present study, we simultaneously address some of the main issues associated with E. coli as an industrial platform for isoprenoids, including an inability to grow on sucrose, a lack of endogenous control over toxic mevalonate (MVA) pathway intermediates, and the limited pathway engineering into the chromosome. As a proof of concept, we generated an E. coli DH1 strain able to produce the isoprenoid bisabolene from sucrose by integrating the cscAKB operon into the chromosome and by expressing a heterologous MVA pathway under stress-responsive control. Production levels dropped dramatically relative to plasmid-mediated expression when the entire pathway was integrated into the chromosome. In order to optimize the chromosomally integrated MVA pathway, we established a CRISPR-Cas9 system to rapidly and systematically replace promoter sequences. This strategy led to higher pathway expression and a fivefold improvement in bisabolene production. More interestingly, we analyzed proteomics data sets to understand and address some of the challenges associated with metabolic engineering of the chromosomally integrated pathway. This report shows that integrating plasmid-optimized operons into the genome and making them work optimally is not a straightforward task and any poor engineering choices on the chromosome may lead to cell death rather than just resulting in low titers. Based on these results, we also propose directions for chromosomal metabolic engineering. © 2017 Wiley Periodicals, Inc.

Expression, Purification, and Characterization of a Carbohydrate-Active Enzyme: A Research-Inspired Methods Optimization Experiment for the Biochemistry Laboratory

ERIC Educational Resources Information Center

Willbur, Jaime F.; Vail, Justin D.; Mitchell, Lindsey N.; Jakeman, David L.; Timmons, Shannon C.

2016-01-01

The development and implementation of research-inspired, discovery-based experiences into science laboratory curricula is a proven strategy for increasing student engagement and ownership of experiments. In the novel laboratory module described herein, students learn to express, purify, and characterize a carbohydrate-active enzyme using modern…

Fisher classifier and its probability of error estimation

NASA Technical Reports Server (NTRS)

Chittineni, C. B.

1979-01-01

Computationally efficient expressions are derived for estimating the probability of error using the leave-one-out method. The optimal threshold for the classification of patterns projected onto Fisher's direction is derived. A simple generalization of the Fisher classifier to multiple classes is presented. Computational expressions are developed for estimating the probability of error of the multiclass Fisher classifier.

[Optimization of expression conditions and activity identification of hepatocyte-targeting peptide-human endostatin].

PubMed

Ma, Yan; Li, Wei; Li, Xiaobo; Bao, Dongmei; Lu, Jianpei

2016-12-25

To obtain sufficient purified and active fusion protein-hepatocyte-targeting peptide-human endostatin (HTP-rES), we studied the growth curve and the optimal induction timing of BL21/pET21b-HTP-rES. Different conditions of pH value, induction time, induction concentration and induction temperature were optimized by univariate analysis. After washing, refolding and purifying, the activity of fusion protein was identified by flow cytometry and 3-(4,5)-dimethylthiahiazo (-z-y1)-3,5-di-phenytetrazoliumromide (MTT). Results show that the logarithmic growth phase of BL21/pET21b-HTP-rES was from 1.5 h to 3.5 h, the optimum expression conditions were pH 8.0, 0.06 mmol/L IPTG, at 42 ℃ for 5 h. The purity of inclusion bodies was up to 60% after washing. The purity of target protein was more than 95% after refolding and purification. Our findings provide the foundation for further biological activity and drug development.

Reliable and efficient solution of genome-scale models of Metabolism and macromolecular Expression

DOE PAGES

Ma, Ding; Yang, Laurence; Fleming, Ronan M. T.; ...

2017-01-18

Currently, Constraint-Based Reconstruction and Analysis (COBRA) is the only methodology that permits integrated modeling of Metabolism and macromolecular Expression (ME) at genome-scale. Linear optimization computes steady-state flux solutions to ME models, but flux values are spread over many orders of magnitude. Data values also have greatly varying magnitudes. Furthermore, standard double-precision solvers may return inaccurate solutions or report that no solution exists. Exact simplex solvers based on rational arithmetic require a near-optimal warm start to be practical on large problems (current ME models have 70,000 constraints and variables and will grow larger). We also developed a quadrupleprecision version of ourmore » linear and nonlinear optimizer MINOS, and a solution procedure (DQQ) involving Double and Quad MINOS that achieves reliability and efficiency for ME models and other challenging problems tested here. DQQ will enable extensive use of large linear and nonlinear models in systems biology and other applications involving multiscale data.« less

An optimized whole blood assay measuring expression and activity of NLRP3, NLRC4 and AIM2 inflammasomes.

PubMed

Grinstein, Lev; Endter, Kristin; Hedrich, Christian M; Reinke, Sören; Luksch, Hella; Schulze, Felix; Robertson, Avril A B; Cooper, Matthew A; Rösen-Wolff, Angela; Winkler, Stefan

2018-06-01

The proinflammatory protease caspase-1 plays pivotal roles in central pathways of innate immunity, thereby contributing to pathogen clearance. Beside its physiological role, dysregulated activity of caspase-1 is known to contribute to an increasing number of diseases. In this study, we optimized and validated a low-volume human whole blood assay facilitating the measurement of caspase-1 activation and inflammasome-related gene expression upon stimulation of the NLRP3, NLRC4 or AIM2 inflammasome. Using the NLRP3 inflammasome specific inhibitor MCC950, we were able to measure the activity of canonical or alternative NLRP3 pathways, AIM2 and NLRC4 inflammasomes in whole blood. Based on our data we assume a superposition of NLRP3 and NLRC4 inflammasome activities in human whole blood following stimulation with S. typhimurium. The optimized whole blood assay may be suitable for diagnostic and research purposes for pediatric patients who can only donate small amounts of blood. Copyright © 2017 Elsevier Inc. All rights reserved.

Investigation and appreciation of optimal output feedback. Volume 1: A convergent algorithm for the stochastic infinite-time discrete optimal output feedback problem

NASA Technical Reports Server (NTRS)

Halyo, N.; Broussard, J. R.

1984-01-01

The stochastic, infinite time, discrete output feedback problem for time invariant linear systems is examined. Two sets of sufficient conditions for the existence of a stable, globally optimal solution are presented. An expression for the total change in the cost function due to a change in the feedback gain is obtained. This expression is used to show that a sequence of gains can be obtained by an algorithm, so that the corresponding cost sequence is monotonically decreasing and the corresponding sequence of the cost gradient converges to zero. The algorithm is guaranteed to obtain a critical point of the cost function. The computational steps necessary to implement the algorithm on a computer are presented. The results are applied to a digital outer loop flight control problem. The numerical results for this 13th order problem indicate a rate of convergence considerably faster than two other algorithms used for comparison.

Enhanced production of leech hyaluronidase by optimizing secretion and cultivation in Pichia pastoris.

PubMed

Kang, Zhen; Zhang, Na; Zhang, Yunfeng

2016-01-01

Leech hyaluronidase (LHAase) was recently cloned and successfully expressed in Pichia pastoris. To increase its secretory expression level, four signal peptides (nsB, YTP1, SCS3, and HKR1) and six amphipathic peptides (APs) were comparatively investigated. After substitution with nsB and fusion with AP2, the production of LHAase was significantly increased, from 8.42 × 10(5) to 1.24 × 10(6) U/ml. Compared with the parental LHAase, the variant AP2-LHAase showed a lower optimum pH (5.0), higher optimum temperature (50 °C), and a broader range of thermal stability (20-60 °C). To further promote fermentative production of the variant AP2-LHAase, the cultivation temperature was systematically optimized according to cell viability and alcohol oxidase activity. Eventually, through a combination of N-terminal engineering and optimization of cultivation, the production of LHAase was improved to 1.68 × 10(6) U/ml, with a high productivity of 1.87 × 10(4) U/ml/h.

Reliable and efficient solution of genome-scale models of Metabolism and macromolecular Expression

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ma, Ding; Yang, Laurence; Fleming, Ronan M. T.

Currently, Constraint-Based Reconstruction and Analysis (COBRA) is the only methodology that permits integrated modeling of Metabolism and macromolecular Expression (ME) at genome-scale. Linear optimization computes steady-state flux solutions to ME models, but flux values are spread over many orders of magnitude. Data values also have greatly varying magnitudes. Furthermore, standard double-precision solvers may return inaccurate solutions or report that no solution exists. Exact simplex solvers based on rational arithmetic require a near-optimal warm start to be practical on large problems (current ME models have 70,000 constraints and variables and will grow larger). We also developed a quadrupleprecision version of ourmore » linear and nonlinear optimizer MINOS, and a solution procedure (DQQ) involving Double and Quad MINOS that achieves reliability and efficiency for ME models and other challenging problems tested here. DQQ will enable extensive use of large linear and nonlinear models in systems biology and other applications involving multiscale data.« less

Selection of reference genes for gene expression studies related to intramuscular fat deposition in Capra hircus skeletal muscle.

PubMed

Zhu, Wuzheng; Lin, Yaqiu; Liao, Honghai; Wang, Yong

2015-01-01

The identification of suitable reference genes is critical for obtaining reliable results from gene expression studies using quantitative real-time PCR (qPCR) because the expression of reference genes may vary considerably under different experimental conditions. In most cases, however, commonly used reference genes are employed in data normalization without proper validation, which may lead to incorrect data interpretation. Here, we aim to select a set of optimal reference genes for the accurate normalization of gene expression associated with intramuscular fat (IMF) deposition during development. In the present study, eight reference genes (PPIB, HMBS, RPLP0, B2M, YWHAZ, 18S, GAPDH and ACTB) were evaluated by three different algorithms (geNorm, NormFinder and BestKeeper) in two types of muscle tissues (longissimus dorsi muscle and biceps femoris muscle) across different developmental stages. All three algorithms gave similar results. PPIB and HMBS were identified as the most stable reference genes, while the commonly used reference genes 18S and GAPDH were the most variably expressed, with expression varying dramatically across different developmental stages. Furthermore, to reveal the crucial role of appropriate reference genes in obtaining a reliable result, analysis of PPARG expression was performed by normalization to the most and the least stable reference genes. The relative expression levels of PPARG normalized to the most stable reference genes greatly differed from those normalized to the least stable one. Therefore, evaluation of reference genes must be performed for a given experimental condition before the reference genes are used. PPIB and HMBS are the optimal reference genes for analysis of gene expression associated with IMF deposition in skeletal muscle during development.

Masked expression of life-history traits in a highly variable environment

USGS Publications Warehouse

DeBoer, Jason A.; Fontaine, Joseph J.; Chizinski, Christopher J.; Pope, Kevin L.

2015-01-01

Differing life-history strategies may act as a constraint on reproductive expression that ultimately limits the ability of individual species to respond to changes in the magnitude or frequency of environmental variation, and potentially underlies the variation often inherent in phenotypic and evolved responses to anthropogenic change. Alternatively, if there are environmental cues that predict reproductive potential, differential expression of life-history strategies may represent differences in the adaptive capacity to optimize current reproductive value given variation in environmental conditions. We compared several aspects of walleye Sander vitreus spawning ecology at two reservoirs that differ in environmental variability (i.e., annual water-level fluctuation) to identify the capacity of phenotypic expression and the corresponding association with age. Despite significant differences in female body and liver masses between reservoirs that differ in environmental variability, we found no difference in reproductive investment measured by egg size and fecundity. Walleye in a highly variable environment appear to exhibit reproductive traits more typical of a short-lived life-history strategy, which may be resultant from the interaction of environmental and anthropogenic pressures. This finding emphasizes the need to identify the degree to which life-history expression represents physiological constraints versus ecological optimization, particularly as anthropogenic change continues to alter environmental conditions. 

Computational Investigation of Environment-Noise Interaction in Single-Cell Organisms: The Merit of Expression Stochasticity Depends on the Quality of Environmental Fluctuations.

PubMed

Lück, Anja; Klimmasch, Lukas; Großmann, Peter; Germerodt, Sebastian; Kaleta, Christoph

2018-01-10

Organisms need to adapt to changing environments and they do so by using a broad spectrum of strategies. These strategies include finding the right balance between expressing genes before or when they are needed, and adjusting the degree of noise inherent in gene expression. We investigated the interplay between different nutritional environments and the inhabiting organisms' metabolic and genetic adaptations by applying an evolutionary algorithm to an agent-based model of a concise bacterial metabolism. Our results show that constant environments and rapidly fluctuating environments produce similar adaptations in the organisms, making the predictability of the environment a major factor in determining optimal adaptation. We show that exploitation of expression noise occurs only in some types of fluctuating environment and is strongly dependent on the quality and availability of nutrients: stochasticity is generally detrimental in fluctuating environments and beneficial only at equal periods of nutrient availability and above a threshold environmental richness. Moreover, depending on the availability and nutritional value of nutrients, nutrient-dependent and stochastic expression are both strategies used to deal with environmental changes. Overall, we comprehensively characterize the interplay between the quality and periodicity of an environment and the resulting optimal deterministic and stochastic regulation strategies of nutrient-catabolizing pathways.

An optimal system design process for a Mars roving vehicle

NASA Technical Reports Server (NTRS)

Pavarini, C.; Baker, J.; Goldberg, A.

1971-01-01

The problem of determining the optimal design for a Mars roving vehicle is considered. A system model is generated by consideration of the physical constraints on the design parameters and the requirement that the system be deliverable to the Mars surface. An expression which evaluates system performance relative to mission goals as a function of the design parameters only is developed. The use of nonlinear programming techniques to optimize the design is proposed and an example considering only two of the vehicle subsystems is formulated and solved.

Optimization of HIV-1 Envelope DNA Vaccine Candidates within Three Different Animal Models, Guinea Pigs, Rabbits and Cynomolgus Macaques.

PubMed

Borggren, Marie; Vinner, Lasse; Andresen, Betina Skovgaard; Grevstad, Berit; Repits, Johanna; Melchers, Mark; Elvang, Tara Laura; Sanders, Rogier W; Martinon, Frédéric; Dereuddre-Bosquet, Nathalie; Bowles, Emma Joanne; Stewart-Jones, Guillaume; Biswas, Priscilla; Scarlatti, Gabriella; Jansson, Marianne; Heyndrickx, Leo; Grand, Roger Le; Fomsgaard, Anders

2013-07-19

HIV-1 DNA vaccines have many advantageous features. Evaluation of HIV-1 vaccine candidates often starts in small animal models before macaque and human trials. Here, we selected and optimized DNA vaccine candidates through systematic testing in rabbits for the induction of broadly neutralizing antibodies (bNAb). We compared three different animal models: guinea pigs, rabbits and cynomolgus macaques. Envelope genes from the prototype isolate HIV-1 Bx08 and two elite neutralizers were included. Codon-optimized genes, encoded secreted gp140 or membrane bound gp150, were modified for expression of stabilized soluble trimer gene products, and delivered individually or mixed. Specific IgG after repeated i.d. inoculations with electroporation confirmed in vivo expression and immunogenicity. Evaluations of rabbits and guinea pigs displayed similar results. The superior DNA construct in rabbits was a trivalent mix of non-modified codon-optimized gp140 envelope genes. Despite NAb responses with some potency and breadth in guinea pigs and rabbits, the DNA vaccinated macaques displayed less bNAb activity. It was concluded that a trivalent mix of non-modified gp140 genes from rationally selected clinical isolates was, in this study, the best option to induce high and broad NAb in the rabbit model, but this optimization does not directly translate into similar responses in cynomolgus macaques.

Optimization of HIV-1 Envelope DNA Vaccine Candidates within Three Different Animal Models, Guinea Pigs, Rabbits and Cynomolgus Macaques

PubMed Central

Borggren, Marie; Vinner, Lasse; Andresen, Betina Skovgaard; Grevstad, Berit; Repits, Johanna; Melchers, Mark; Elvang, Tara Laura; Sanders, Rogier W; Martinon, Frédéric; Dereuddre-Bosquet, Nathalie; Bowles, Emma Joanne; Stewart-Jones, Guillaume; Biswas, Priscilla; Scarlatti, Gabriella; Jansson, Marianne; Heyndrickx, Leo; Le Grand, Roger; Fomsgaard, Anders

2013-01-01

HIV-1 DNA vaccines have many advantageous features. Evaluation of HIV-1 vaccine candidates often starts in small animal models before macaque and human trials. Here, we selected and optimized DNA vaccine candidates through systematic testing in rabbits for the induction of broadly neutralizing antibodies (bNAb). We compared three different animal models: guinea pigs, rabbits and cynomolgus macaques. Envelope genes from the prototype isolate HIV-1 Bx08 and two elite neutralizers were included. Codon-optimized genes, encoded secreted gp140 or membrane bound gp150, were modified for expression of stabilized soluble trimer gene products, and delivered individually or mixed. Specific IgG after repeated i.d. inoculations with electroporation confirmed in vivo expression and immunogenicity. Evaluations of rabbits and guinea pigs displayed similar results. The superior DNA construct in rabbits was a trivalent mix of non-modified codon-optimized gp140 envelope genes. Despite NAb responses with some potency and breadth in guinea pigs and rabbits, the DNA vaccinated macaques displayed less bNAb activity. It was concluded that a trivalent mix of non-modified gp140 genes from rationally selected clinical isolates was, in this study, the best option to induce high and broad NAb in the rabbit model, but this optimization does not directly translate into similar responses in cynomolgus macaques. PMID:26344115

Combinatorial Screening for Transgenic Yeasts with High Cellulase Activities in Combination with a Tunable Expression System

PubMed Central

Ito, Yoichiro; Yamanishi, Mamoru; Ikeuchi, Akinori; Imamura, Chie; Matsuyama, Takashi

2015-01-01

Combinatorial screening used together with a broad library of gene expression cassettes is expected to produce a powerful tool for the optimization of the simultaneous expression of multiple enzymes. Recently, we proposed a highly tunable protein expression system that utilized multiple genome-integrated target genes to fine-tune enzyme expression in yeast cells. This tunable system included a library of expression cassettes each composed of three gene-expression control elements that in different combinations produced a wide range of protein expression levels. In this study, four gene expression cassettes with graded protein expression levels were applied to the expression of three cellulases: cellobiohydrolase 1, cellobiohydrolase 2, and endoglucanase 2. After combinatorial screening for transgenic yeasts simultaneously secreting these three cellulases, we obtained strains with higher cellulase expressions than a strain harboring three cellulase-expression constructs within one high-performance gene expression cassette. These results show that our method will be of broad use throughout the field of metabolic engineering. PMID:26692026

The Sizing and Optimization Language, (SOL): Computer language for design problems

NASA Technical Reports Server (NTRS)

Lucas, Stephen H.; Scotti, Stephen J.

1988-01-01

The Sizing and Optimization Language, (SOL), a new high level, special purpose computer language was developed to expedite application of numerical optimization to design problems and to make the process less error prone. SOL utilizes the ADS optimization software and provides a clear, concise syntax for describing an optimization problem, the OPTIMIZE description, which closely parallels the mathematical description of the problem. SOL offers language statements which can be used to model a design mathematically, with subroutines or code logic, and with existing FORTRAN routines. In addition, SOL provides error checking and clear output of the optimization results. Because of these language features, SOL is best suited to model and optimize a design concept when the model consits of mathematical expressions written in SOL. For such cases, SOL's unique syntax and error checking can be fully utilized. SOL is presently available for DEC VAX/VMS systems. A SOL package is available which includes the SOL compiler, runtime library routines, and a SOL reference manual.

High-level accumulation of recombinant miraculin protein in transgenic tomatoes expressing a synthetic miraculin gene with optimized codon usage terminated by the native miraculin terminator.

PubMed

Hiwasa-Tanase, Kyoko; Nyarubona, Mpanja; Hirai, Tadayoshi; Kato, Kazuhisa; Ichikawa, Takanari; Ezura, Hiroshi

2011-01-01

In our previous study, a transgenic tomato line that expressed the MIR gene under control of the cauliflower mosaic virus 35S promoter and the nopaline synthase terminator (tNOS) produced the taste-modifying protein miraculin (MIR). However, the concentration of MIR in the tomatoes was lower than that in the MIR gene's native miracle fruit. To increase MIR production, the native MIR terminator (tMIR) was used and a synthetic gene encoding MIR protein (sMIR) was designed to optimize its codon usage for tomato. Four different combinations of these genes and terminators (MIR-tNOS, MIR-tMIR, sMIR-tNOS and sMIR-tMIR) were constructed and used for transformation. The average MIR concentrations in MIR-tNOS, MIR-tMIR, sMIR-tNOS and sMIR-tMIR fruits were 131, 197, 128 and 287 μg/g fresh weight, respectively. The MIR concentrations using tMIR were higher than those using tNOS. The highest MIR accumulation was detected in sMIR-tMIR fruits. On the other hand, the MIR concentration was largely unaffected by sMIR-tNOS. The expression levels of both MIR and sMIR mRNAs terminated by tMIR tended to be higher than those terminated by tNOS. Read-through mRNA transcripts terminated by tNOS were much longer than those terminated by tMIR. These results suggest that tMIR enhances mRNA expression and permits the multiplier effect of optimized codon usage.

Efficient androst-1,4-diene-3,17-dione production by co-expressing 3-ketosteroid-Δ1 -dehydrogenase and catalase in Bacillus subtilis.

PubMed

Shao, M; Sha, Z; Zhang, X; Rao, Z; Xu, M; Yang, T; Xu, Z; Yang, S

2017-01-01

3-ketosteroid-Δ 1 -dehydrogenase (KSDD), a flavin adenine dinucleotide (FAD)-dependent enzyme involved in sterol metabolism, specifically catalyses the conversion of androst-4-ene-3,17-dione (AD) to androst-1,4-diene-3,17-dione (ADD). However, the low KSDD activity and the toxic effects of hydrogen peroxide (H 2 O 2 ) generated during the biotransformation of AD to ADD with FAD regeneration hinder its application on AD conversion. The aim of this work was to improve KSDD activity and eliminate the toxic effects of the generated H 2 O 2 to enhance ADD production. The ksdd gene obtained from Mycobacterium neoaurum JC-12 was codon-optimized to increase its expression level in Bacillus subtilis, and the KSDD activity reached 12·3 U mg -1 , which was sevenfold of that of codon-unoptimized gene. To improve AD conversion, catalase was co-expressed with KSDD in B. subtilis 168/pMA5-ksdd opt -katA to eliminate the toxic effects of H 2 O 2 generated during AD conversion. Finally, under optimized bioconversion conditions, fed-batch strategy was carried out and the ADD yield improved to 8·76 g l -1 . This work demonstrates the potential to improve enzyme activity by codon-optimization and eliminate the toxic effects of H 2 O 2 by co-expressing catalase. This study showed the highest ADD productivity ever reported and provides a promising strain for efficient ADD production in the pharmaceutical industry. © 2016 The Society for Applied Microbiology.

Harnessing Diversity towards the Reconstructing of Large Scale Gene Regulatory Networks

PubMed Central

Yamanaka, Ryota; Kitano, Hiroaki

2013-01-01

Elucidating gene regulatory network (GRN) from large scale experimental data remains a central challenge in systems biology. Recently, numerous techniques, particularly consensus driven approaches combining different algorithms, have become a potentially promising strategy to infer accurate GRNs. Here, we develop a novel consensus inference algorithm, TopkNet that can integrate multiple algorithms to infer GRNs. Comprehensive performance benchmarking on a cloud computing framework demonstrated that (i) a simple strategy to combine many algorithms does not always lead to performance improvement compared to the cost of consensus and (ii) TopkNet integrating only high-performance algorithms provide significant performance improvement compared to the best individual algorithms and community prediction. These results suggest that a priori determination of high-performance algorithms is a key to reconstruct an unknown regulatory network. Similarity among gene-expression datasets can be useful to determine potential optimal algorithms for reconstruction of unknown regulatory networks, i.e., if expression-data associated with known regulatory network is similar to that with unknown regulatory network, optimal algorithms determined for the known regulatory network can be repurposed to infer the unknown regulatory network. Based on this observation, we developed a quantitative measure of similarity among gene-expression datasets and demonstrated that, if similarity between the two expression datasets is high, TopkNet integrating algorithms that are optimal for known dataset perform well on the unknown dataset. The consensus framework, TopkNet, together with the similarity measure proposed in this study provides a powerful strategy towards harnessing the wisdom of the crowds in reconstruction of unknown regulatory networks. PMID:24278007

Rigorous optimization and validation of potent RNA CAR T cell therapy for the treatment of common epithelial cancers expressing folate receptor

PubMed Central

Schutsky, Keith; Song, De-Gang; Lynn, Rachel; Smith, Jenessa B.; Poussin, Mathilde; Figini, Mariangela; Zhao, Yangbing; Powell, Daniel J.

2015-01-01

Using lentiviral technology, we recently demonstrated that incorporation of CD27 costimulation into CARs greatly improves antitumor activity and T cell persistence. Still, virus-mediated gene transfer is expensive, laborious and enables long-term persistence, creating therapies which cannot be easily discontinued if toxic. To address these concerns, we utilized a non-integrating RNA platform to engineer human T cells to express FRα-specific, CD27 CARs and tested their capacity to eliminate human FRα+ cancer. Novel CARs comprised of human components were constructed, C4-27z and C4opt-27z, a codon-optimized variant created for efficient expression. Following RNA electroporation, C4-27z and C4opt-27z CAR expression is initially ubiquitous but progressively declines across T cell populations. In addition, C4-27z and C4opt-27z RNA CAR T cells secrete high levels of Th-1 cytokines and display strong cytolytic function against human FRα+ cancers in a time- and antigen-dependent manner. Further, C4-27z and C4opt-27z CAR T cells exhibit significant proliferation in vivo, facilitate the complete regression of fully disseminated human ovarian cancer xenografts in mice and reduce the progression of solid ovarian cancer. These results advocate for rapid progression of C4opt-27z RNA CAR to the clinic and establish a new paradigm for preclinical optimization and validation of RNA CAR candidates destined for clinical translation. PMID:26359629

Establishing a high yielding streptomyces-based cell-free protein synthesis system.

PubMed

Li, Jian; Wang, He; Kwon, Yong-Chan; Jewett, Michael C

2017-06-01

Cell-free protein synthesis (CFPS) has emerged as a powerful platform for applied biotechnology and synthetic biology, with a range of applications in synthesizing proteins, evolving proteins, and prototyping genetic circuits. To expand the current CFPS repertoire, we report here the development and optimization of a Streptomyces-based CFPS system for the expression of GC-rich genes. By developing a streamlined crude extract preparation protocol and optimizing reaction conditions, we were able to achieve active enhanced green fluorescent protein (EGFP) yields of greater than 50 μg/mL with batch reactions lasting up to 3 h. By adopting a semi-continuous reaction format, the EGFP yield could be increased to 282 ± 8 μg/mL and the reaction time was extended to 48 h. Notably, our extract preparation procedures were robust to multiple Streptomyces lividans and Streptomyces coelicolor strains, although expression yields varied. We show that our optimized Streptomyces lividans system provides benefits when compared to an Escherichia coli-based CFPS system for increasing percent soluble protein expression for four Streptomyces-originated high GC-content genes that are involved in biosynthesis of the nonribosomal peptides tambromycin and valinomycin. Looking forward, we believe that our Streptomyces-based CFPS system will contribute significantly towards efforts to express complex natural product gene clusters (e.g., nonribosomal peptides and polyketides), providing a new avenue for obtaining and studying natural product biosynthesis pathways. Biotechnol. Bioeng. 2017;114: 1343-1353. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

Bioluminescence Monitoring of Neuronal Activity in Freely Moving Zebrafish Larvae

PubMed Central

Knafo, Steven; Prendergast, Andrew; Thouvenin, Olivier; Figueiredo, Sophie Nunes; Wyart, Claire

2017-01-01

The proof of concept for bioluminescence monitoring of neural activity in zebrafish with the genetically encoded calcium indicator GFP-aequorin has been previously described (Naumann et al., 2010) but challenges remain. First, bioluminescence signals originating from a single muscle fiber can constitute a major pitfall. Second, bioluminescence signals emanating from neurons only are very small. To improve signals while verifying specificity, we provide an optimized 4 steps protocol achieving: 1) selective expression of a zebrafish codon-optimized GFP-aequorin, 2) efficient soaking of larvae in GFP-aequorin substrate coelenterazine, 3) bioluminescence monitoring of neural activity from motor neurons in free-tailed moving animals performing acoustic escapes and 4) verification of the absence of muscle expression using immunohistochemistry. PMID:29130058

Genome-Wide Tuning of Protein Expression Levels to Rapidly Engineer Microbial Traits.

PubMed

Freed, Emily F; Winkler, James D; Weiss, Sophie J; Garst, Andrew D; Mutalik, Vivek K; Arkin, Adam P; Knight, Rob; Gill, Ryan T

2015-11-20

The reliable engineering of biological systems requires quantitative mapping of predictable and context-independent expression over a broad range of protein expression levels. However, current techniques for modifying expression levels are cumbersome and are not amenable to high-throughput approaches. Here we present major improvements to current techniques through the design and construction of E. coli genome-wide libraries using synthetic DNA cassettes that can tune expression over a ∼10(4) range. The cassettes also contain molecular barcodes that are optimized for next-generation sequencing, enabling rapid and quantitative tracking of alleles that have the highest fitness advantage. We show these libraries can be used to determine which genes and expression levels confer greater fitness to E. coli under different growth conditions.

Dynamic network reconstruction from gene expression data applied to immune response during bacterial infection.

PubMed

Guthke, Reinhard; Möller, Ulrich; Hoffmann, Martin; Thies, Frank; Töpfer, Susanne

2005-04-15

The immune response to bacterial infection represents a complex network of dynamic gene and protein interactions. We present an optimized reverse engineering strategy aimed at a reconstruction of this kind of interaction networks. The proposed approach is based on both microarray data and available biological knowledge. The main kinetics of the immune response were identified by fuzzy clustering of gene expression profiles (time series). The number of clusters was optimized using various evaluation criteria. For each cluster a representative gene with a high fuzzy-membership was chosen in accordance with available physiological knowledge. Then hypothetical network structures were identified by seeking systems of ordinary differential equations, whose simulated kinetics could fit the gene expression profiles of the cluster-representative genes. For the construction of hypothetical network structures singular value decomposition (SVD) based methods and a newly introduced heuristic Network Generation Method here were compared. It turned out that the proposed novel method could find sparser networks and gave better fits to the experimental data. Reinhard.Guthke@hki-jena.de.

Optimization of a yeast RNA interference system for controlling gene expression and enabling rapid metabolic engineering.

PubMed

Crook, Nathan C; Schmitz, Alexander C; Alper, Hal S

2014-05-16

Reduction of endogenous gene expression is a fundamental operation of metabolic engineering, yet current methods for gene knockdown (i.e., genome editing) remain laborious and slow, especially in yeast. In contrast, RNA interference allows facile and tunable gene knockdown via a simple plasmid transformation step, enabling metabolic engineers to rapidly prototype knockdown strategies in multiple strains before expending significant cost to undertake genome editing. Although RNAi is naturally present in a myriad of eukaryotes, it has only been recently implemented in Saccharomyces cerevisiae as a heterologous pathway and so has not yet been optimized as a metabolic engineering tool. In this study, we elucidate a set of design principles for the construction of hairpin RNA expression cassettes in yeast and implement RNA interference to quickly identify routes for improvement of itaconic acid production in this organism. The approach developed here enables rapid prototyping of knockdown strategies and thus accelerates and reduces the cost of the design-build-test cycle in yeast.

Overexpression and Purification of C-terminal Fragment of the Passenger Domain of Hap Protein from Nontypeable Haemophilus influenzae in a Highly Optimized Escherichia coli Expression System

PubMed Central

Tabatabaee, Akram; Siadat, Seyed Davar; Moosavi, Seyed Fazllolah; Aghasadeghi, Mohammad Reza; Memarnejadian, Arash; Pouriayevali, Mohammad Hassan; Yavari, Neda

2013-01-01

Background Nontypeable Haemophilus influenzae (NTHi) is a common cause of respiratory tract disease and initiates infection by colonization in nasopharynx. The Haemophilus influenzae (H. influenzae) Hap adhesin is an auto transporter protein that promotes initial interaction with human epithelial cells. Hap protein contains a 110 kDa internal passenger domain called “HapS” and a 45 kDa C-terminal translocator domain called “Hapβ”. Hap adhesive activity has been recently reported to be connected to its Cell Binding Domain (CBD) which resides within the 311 C-terminal residues of the internal passenger domain of the protein. Furthermore, immunization with this CBD protein has been shown to prevent bacterial nasopharynx colonization in animal models. Methods To provide enough amounts of pure HapS protein for vaccine studies, we sought to develop a highly optimized system to overexpress and purify the protein in large quantities. To this end, pET24a-cbd plasmid harboring cbd sequence from NTHi ATCC49766 was constructed and its expression was optimized by testing various expression parameters such as growth media, induction temperature, IPTG inducer concentration, induction stage and duration. SDS-PAGE and Western-blotting were used for protein analysis and confirmation and eventually the expressed protein was easily purified via immobilized metal affinity chromatography (IMAC) using Ni-NTA columns. Results The highest expression level of target protein was achieved when CBD expressing E. coli BL21 (DE3) cells were grown at 37°C in 2xTY medium with 1.0 mM IPTG at mid-log phase (OD600 nm equal to 0.6) for 5 hrs. Amino acid sequence alignment of expressed CBD protein with 3 previously published CBD amino acid sequences were more than %97 identical and antigenicity plot analysis further revealed 9 antigenic domains which appeared to be well conserved among different analyzed CBD sequences. Conclusion Due to the presence of high similarity among CBD from NTHi ATCC49766 and other NTHi strains, CBD protein expressed here sounds to be theoretically ideal as a universal candidate for being used in vaccine studies against NTHi strains of various geographical areas. Further investigations to corroborate the potency of this protein as a vaccine candidate are under process. PMID:23919121

Large Scale Bacterial Colony Screening of Diversified FRET Biosensors

PubMed Central

Litzlbauer, Julia; Schifferer, Martina; Ng, David; Fabritius, Arne; Thestrup, Thomas; Griesbeck, Oliver

2015-01-01

Biosensors based on Förster Resonance Energy Transfer (FRET) between fluorescent protein mutants have started to revolutionize physiology and biochemistry. However, many types of FRET biosensors show relatively small FRET changes, making measurements with these probes challenging when used under sub-optimal experimental conditions. Thus, a major effort in the field currently lies in designing new optimization strategies for these types of sensors. Here we describe procedures for optimizing FRET changes by large scale screening of mutant biosensor libraries in bacterial colonies. We describe optimization of biosensor expression, permeabilization of bacteria, software tools for analysis, and screening conditions. The procedures reported here may help in improving FRET changes in multiple suitable classes of biosensors. PMID:26061878

An automated workflow for enhancing microbial bioprocess optimization on a novel microbioreactor platform

PubMed Central

2012-01-01

Background High-throughput methods are widely-used for strain screening effectively resulting in binary information regarding high or low productivity. Nevertheless achieving quantitative and scalable parameters for fast bioprocess development is much more challenging, especially for heterologous protein production. Here, the nature of the foreign protein makes it impossible to predict the, e.g. best expression construct, secretion signal peptide, inductor concentration, induction time, temperature and substrate feed rate in fed-batch operation to name only a few. Therefore, a high number of systematic experiments are necessary to elucidate the best conditions for heterologous expression of each new protein of interest. Results To increase the throughput in bioprocess development, we used a microtiter plate based cultivation system (Biolector) which was fully integrated into a liquid-handling platform enclosed in laminar airflow housing. This automated cultivation platform was used for optimization of the secretory production of a cutinase from Fusarium solani pisi with Corynebacterium glutamicum. The online monitoring of biomass, dissolved oxygen and pH in each of the microtiter plate wells enables to trigger sampling or dosing events with the pipetting robot used for a reliable selection of best performing cutinase producers. In addition to this, further automated methods like media optimization and induction profiling were developed and validated. All biological and bioprocess parameters were exclusively optimized at microtiter plate scale and showed perfect scalable results to 1 L and 20 L stirred tank bioreactor scale. Conclusions The optimization of heterologous protein expression in microbial systems currently requires extensive testing of biological and bioprocess engineering parameters. This can be efficiently boosted by using a microtiter plate cultivation setup embedded into a liquid-handling system, providing more throughput by parallelization and automation. Due to improved statistics by replicate cultivations, automated downstream analysis, and scalable process information, this setup has superior performance compared to standard microtiter plate cultivation. PMID:23113930

The influence of dispositional optimism on post-visit anxiety and risk perception accuracy among breast cancer genetic counselees.

PubMed

Wiering, B M; Albada, A; Bensing, J M; Ausems, M G E M; van Dulmen, A M

2013-11-01

Much is unknown about the influence of dispositional optimism and affective communication on genetic counselling outcomes. This study investigated the influence of counselees' optimism on the counselees' risk perception accuracy and anxiety, while taking into account the affective communication during the first consultation for breast cancer genetic counselling. Counselees completed questionnaires measuring optimism, anxiety and the perceived risk that hereditary breast cancer runs in the family before, and anxiety and perceived risk after the first consultation. Consultations were videotaped. The duration of eye contact was measured, and verbal communication was rated using the Roter Interaction Analysis System. Less-optimistic counselees were more anxious post-visit (β = -.29; p = .00). Counsellors uttered fewer reassuring statements if counselees were more anxious (β = -.84; p = .00) but uttered more reassurance if counselees were less optimistic (β = -.76; p = .01). Counsellors expressed less empathy if counselees perceived their risk as high (β = -1.51; p = .04). An increase in the expression of reassurance was related to less post-visit anxiety (β = -.35; p = .03). More empathy was related to a greater overestimation of risk (β = .92; p = .01). Identification of a lack of optimism as a risk factor for high anxiety levels enables the adaptation of affective communication to improve genetic counselling outcomes. Because reassurance was related to less anxiety, beneficial adaptation is attainable by increasing counsellors' reassurance, if possible. Because of a lack of optimally adapted communication in this study, further research is needed to clarify how to increase counsellors' ability to adapt to counselees. Copyright © 2013 John Wiley & Sons, Ltd.

Dataset of proinflammatory cytokine and cytokine receptor gene expression in rainbow trout (Oncorhynchus mykiss) measured using a novel GeXP multiplex, RT-PCR assay

USDA-ARS?s Scientific Manuscript database

A GeXP multiplex, RT-PCR assay was developed and optimized that simultaneously measures expression of a suite of immune-relevant genes in rainbow trout (Oncorhynchus mykiss), concentrating on tumor necrosis factor and interleukin-1 ligand/receptor systems and acute phase response genes. The dataset ...

Type Specialization in Aldor

NASA Astrophysics Data System (ADS)

Dragan, Laurentiu; Watt, Stephen M.

Computer algebra in scientific computation squarely faces the dilemma of natural mathematical expression versus efficiency. While higher-order programming constructs and parametric polymorphism provide a natural and expressive language for mathematical abstractions, they can come at a considerable cost. We investigate how deeply nested type constructions may be optimized to achieve performance similar to that of hand-tuned code written in lower-level languages.

A synthetic biology approach to the development of transcriptional regulatory models and custom enhancer design☆,☆☆

PubMed Central

Martinez, Carlos A.; Barr, Kenneth; Kim, Ah-Ram; Reinitz, John

2013-01-01

Synthetic biology offers novel opportunities for elucidating transcriptional regulatory mechanisms and enhancer logic. Complex cis-regulatory sequences—like the ones driving expression of the Drosophila even-skipped gene—have proven difficult to design from existing knowledge, presumably due to the large number of protein-protein interactions needed to drive the correct expression patterns of genes in multicellular organisms. This work discusses two novel computational methods for the custom design of enhancers that employ a sophisticated, empirically validated transcriptional model, optimization algorithms, and synthetic biology. These synthetic elements have both utilitarian and academic value, including improving existing regulatory models as well as evolutionary questions. The first method involves the use of simulated annealing to explore the sequence space for synthetic enhancers whose expression output fit a given search criterion. The second method uses a novel optimization algorithm to find functionally accessible pathways between two enhancer sequences. These paths describe a set of mutations wherein the predicted expression pattern does not significantly vary at any point along the path. Both methods rely on a predictive mathematical framework that maps the enhancer sequence space to functional output. PMID:23732772

Evaluating Perceived Naturalness of Facial Expression After Fillers to the Nasolabial Folds and Lower Face With Standardized Video and Photography.

PubMed

Philipp-Dormston, Wolfgang G; Wong, Cindy; Schuster, Bernd; Larsson, Markus K; Podda, Maurizio

2018-06-01

Hyaluronic acid (HA) fillers are commonly used in treating facial wrinkles and folds but have not been studied with standardized methodology to include assessment of standard facial expressions. To assess perceived naturalness of facial expression after treatment with 2 HA fillers manufactured with XpresHAn Technology (also known as Optimal Balance Technology). Treatment was directed to the nasolabial folds (NLFs) and at least 1 additional lower face wrinkle or fold. Maintenance of naturalness, attractiveness, and age at 1 month after optimal treatment were assessed using video recordings and photographs capturing different facial animations. Global aesthetic improvement, subjects' satisfaction, and safety were also evaluated. The treatment was well tolerated. Naturalness of facial expression in motion was determined to be at least maintained in 95% of subjects. Attractiveness was enhanced in 89% of subjects and 79% of subjects were considered to look younger. Most subjects assessed their aesthetic appearance as improved and were satisfied with their treatment. Naturalness and attractiveness can be assessed using video recordings and photographs capturing different facial animations. XpresHAn Technology HA filler treatments create natural-looking results with high subject satisfaction.

Formation of friable embryogenic callus in cassava is enhanced under conditions of reduced nitrate, potassium and phosphate

PubMed Central

Utsumi, Yoshinori; Utsumi, Chikako; Tanaka, Maho; Ha, Vu The; Matsui, Akihiro; Takahashi, Satoshi; Seki, Motoaki

2017-01-01

Agrobacterium-mediated transformation is an important research tool for the genetic improvement of cassava. The induction of friable embryogenic callus (FEC) is considered as a key step in cassava transformation. In the present study, the media composition was optimized for enhancing the FEC induction, and the effect of the optimized medium on gene expression was evaluated. In relative comparison to MS medium, results demonstrated that using a medium with reducing nutrition (a 10-fold less concentration of nitrogen, potassium, and phosphate), the increased amount of vitamin B1 (10 mg/L) and the use of picrolam led to reprogram non-FEC to FEC. Gene expression analyses revealed that FEC on modified media increased the expression of genes related to the regulation of polysaccharide biosynthesis and breakdown of cell wall components in comparison to FEC on normal CIM media, whereas the gene expression associated with energy flux was not dramatically altered. It is hypothesized that we reprogram non-FEC to FEC under low nitrogen, potassium and phosphate and high vitamin B1. These findings were more effective in inducing FEC formation than the previous protocol. It might contribute to development of an efficient transformation strategy in cassava. PMID:28806727

CMV-promoter driven codon-optimized expression alters the assembly type and morphology of a reconstituted HERV-K(HML-2).

PubMed

Hohn, Oliver; Hanke, Kirsten; Lausch, Veronika; Zimmermann, Anja; Mostafa, Saeed; Bannert, Norbert

2014-11-11

The HERV-K(HML-2) family contains the most recently integrated and best preserved endogenized proviral sequences in the human genome. All known elements have nevertheless been subjected to mutations or deletions that render expressed particles non-infectious. Moreover, these post-insertional mutations hamper the analysis of the general biological properties of this ancient virus family. The expression of consensus sequences and sequences of elements with reverted post-insertional mutations has therefore been very instrumental in overcoming this limitation. We investigated the particle morphology of a recently reconstituted HERV-K113 element termed oriHERV-K113 using thin-section electron microscopy (EM) and could demonstrate that strong overexpression by substitution of the 5'LTR for a CMV promoter and partial codon optimization altered the virus assembly type and morphology. This included a conversion from the regular C-type to an A-type morphology with a mass of cytoplasmic immature cores tethered to the cell membrane and the membranes of vesicles. Overexpression permitted the release and maturation of virions but reduced the envelope content. A weaker boost of virus expression by Staufen-1 was not sufficient to induce these morphological alterations.

CMV-Promoter Driven Codon-Optimized Expression Alters the Assembly Type and Morphology of a Reconstituted HERV-K(HML-2)

PubMed Central

Hohn, Oliver; Hanke, Kirsten; Lausch, Veronika; Zimmermann, Anja; Mostafa, Saeed; Bannert, Norbert

2014-01-01

The HERV-K(HML-2) family contains the most recently integrated and best preserved endogenized proviral sequences in the human genome. All known elements have nevertheless been subjected to mutations or deletions that render expressed particles non-infectious. Moreover, these post-insertional mutations hamper the analysis of the general biological properties of this ancient virus family. The expression of consensus sequences and sequences of elements with reverted post-insertional mutations has therefore been very instrumental in overcoming this limitation. We investigated the particle morphology of a recently reconstituted HERV-K113 element termed oriHERV-K113 using thin-section electron microscopy (EM) and could demonstrate that strong overexpression by substitution of the 5'LTR for a CMV promoter and partial codon optimization altered the virus assembly type and morphology. This included a conversion from the regular C-type to an A-type morphology with a mass of cytoplasmic immature cores tethered to the cell membrane and the membranes of vesicles. Overexpression permitted the release and maturation of virions but reduced the envelope content. A weaker boost of virus expression by Staufen-1 was not sufficient to induce these morphological alterations. PMID:25393897

Establishment and culture optimization of a new type of pituitary immortalized cell line.

PubMed

Kokubu, Yuko; Asashima, Makoto; Kurisaki, Akira

2015-08-07

The pituitary gland is a center of the endocrine system that controls homeostasis in an organism by secreting various hormones. The glandular anterior pituitary consists of five different cell types, each expressing specific hormones. However, their regulation and the appropriate conditions for their in vitro culture are not well defined. Here, we report the immortalization of mouse pituitary cells by introducing TERT, E6, and E7 transgenes. The immortalized cell lines mainly expressed a thyrotroph-specific thyroid stimulating hormone beta (Tshb). After optimization of the culture conditions, these immortalized cells proliferated and maintained morphological characteristics similar to those of primary pituitary cells under sphere culture conditions in DMEM/F12 medium supplemented with N2, B27, basic FGF, and EGF. These cell lines responded to PKA or PKC pathway activators and induced the expression of Tshb mRNA. Moreover, transplantation of the immortalized cell line into subcutaneous regions and kidney capsules of mice further increased Tshb expression. These results suggest that immortalization of pituitary cells with TERT, E6, and E7 transgenes is a useful method for generating proliferating cells for the in vitro analysis of pituitary regulatory mechanisms. Copyright © 2015 Elsevier Inc. All rights reserved.

Mechanisms and Evolution of Control Logic in Prokaryotic Transcriptional Regulation

PubMed Central

van Hijum, Sacha A. F. T.; Medema, Marnix H.; Kuipers, Oscar P.

2009-01-01

Summary: A major part of organismal complexity and versatility of prokaryotes resides in their ability to fine-tune gene expression to adequately respond to internal and external stimuli. Evolution has been very innovative in creating intricate mechanisms by which different regulatory signals operate and interact at promoters to drive gene expression. The regulation of target gene expression by transcription factors (TFs) is governed by control logic brought about by the interaction of regulators with TF binding sites (TFBSs) in cis-regulatory regions. A factor that in large part determines the strength of the response of a target to a given TF is motif stringency, the extent to which the TFBS fits the optimal TFBS sequence for a given TF. Advances in high-throughput technologies and computational genomics allow reconstruction of transcriptional regulatory networks in silico. To optimize the prediction of transcriptional regulatory networks, i.e., to separate direct regulation from indirect regulation, a thorough understanding of the control logic underlying the regulation of gene expression is required. This review summarizes the state of the art of the elements that determine the functionality of TFBSs by focusing on the molecular biological mechanisms and evolutionary origins of cis-regulatory regions. PMID:19721087

An evaluation of the emerging interventions against Respiratory Syncytial Virus (RSV)-associated acute lower respiratory infections in children.

PubMed

Nair, Harish; Verma, Vasundhara R; Theodoratou, Evropi; Zgaga, Lina; Huda, Tanvir; Simões, Eric A F; Wright, Peter F; Rudan, Igor; Campbell, Harry

2011-04-13

Respiratory Syncytial Virus (RSV) is the leading cause of acute lower respiratory infections (ALRI) in children. It is estimated to cause approximately 33.8 million new episodes of ALRI in children annually, 96% of these occurring in developing countries. It is also estimated to result in about 53,000 to 199,000 deaths annually in young children. Currently there are several vaccine and immunoprophylaxis candidates against RSV in the developmental phase targeting active and passive immunization. We used a modified CHNRI methodology for setting priorities in health research investments. This was done in two stages. In Stage I, we systematically reviewed the literature related to emerging vaccines against RSV relevant to 12 criteria of interest. In Stage II, we conducted an expert opinion exercise by inviting 20 experts (leading basic scientists, international public health researchers, international policy makers and representatives of pharmaceutical companies). The policy makers and industry representatives accepted our invitation on the condition of anonymity, due to the sensitive nature of their involvement in such exercises. They answered questions from the CHNRI framework and their "collective optimism" towards each criterion was documented on a scale from 0 to 100%. In the case of candidate vaccines for active immunization of infants against RSV, the experts expressed very low levels of optimism for low product cost, affordability and low cost of development; moderate levels of optimism regarding the criteria of answerability, likelihood of efficacy, deliverability, sustainability and acceptance to end users for the interventions; and high levels of optimism regarding impact on equity and acceptance to health workers. While considering the candidate vaccines targeting pregnant women, the panel expressed low levels of optimism for low product cost, affordability, answerability and low development cost; moderate levels of optimism for likelihood of efficacy, deliverability, sustainability and impact on equity; high levels of optimism regarding acceptance to end users and health workers. The group also evaluated immunoprophylaxis against RSV using monoclonal antibodies and expressed no optimism towards low product cost; very low levels of optimism regarding deliverability, affordability, sustainability, low implementation cost and impact on equity; moderate levels of optimism against the criteria of answerability, likelihood of efficacy, acceptance to end-users and health workers; and high levels of optimism regarding low development cost. They felt that either of these vaccines would have a high impact on reducing burden of childhood ALRI due to RSV and reduce the overall childhood ALRI burden by a maximum of about 10%. Although monoclonal antibodies have proven to be effective in providing protection to high-risk infants, their introduction in resource poor settings might be limited by high cost associated with them. Candidate vaccines for active immunization of infants against RSV hold greatest promise. Introduction of a low cost vaccine against RSV would reduce the inequitable distribution of burden due to childhood ALRI and will most likely have a high impact on morbidity and mortality due to severe ALRI.

Development of an optimized tetracycline-inducible expression system to increase the accumulation of interleukin-10 in tobacco BY-2 suspension cells.

PubMed

Bortesi, Luisa; Rademacher, Thomas; Schiermeyer, Andreas; Schuster, Flora; Pezzotti, Mario; Schillberg, Stefan

2012-07-11

Plant cell suspension cultures can be used for the production of valuable pharmaceutical and industrial proteins. When the recombinant protein is secreted into the culture medium, restricting expression to a defined growth phase can improve both the quality and quantity of the recovered product by minimizing proteolytic activity. Temporal restriction is also useful for recombinant proteins whose constitutive expression affects cell growth and viability, such as viral interleukin-10 (vIL-10). We have developed a novel, tetracycline-inducible system suitable for tobacco BY-2 suspension cells which increases the yields of vIL-10. The new system is based on a binary vector that is easier to handle than conventional vectors, contains an enhanced inducible promoter and 5'-UTR to improve yields, and incorporates a constitutively-expressed visible marker gene to allow the rapid and straightforward selection of the most promising transformed clones. Stable transformation of BY-2 cells with this vector, without extensive optimization of the induction conditions, led to a 3.5 fold increase in vIL-10 levels compared to constitutive expression in the same host. We have developed an effective and straightforward molecular farming platform technology that improves both the quality and the quantity of recombinant proteins produced in plant cells, particularly those whose constitutive expression has a negative impact on plant growth and development. Although we tested the platform using vIL-10 produced in BY-2 cells, it can be applied to other host/product combinations and is also useful for basic research requiring strictly controlled transgene expression.

DAILY PATTERNS OF CLOCK AND COGNITION-RELATED FACTORS ARE MODIFIED IN THE HIPPOCAMPUS OF VITAMIN A-DEFICIENT RATS

PubMed Central

Golini, Rebeca S.; Delgado, Silvia M.; Navigatore Fonzo, Lorena S.; Ponce, Ivana T.; Lacoste, María G.; Anzulovich, Ana C.

2012-01-01

The circadian expression of clock and clock-controlled cognition-related genes in the hippocampus would be essential to achieve an optimal daily cognitive performance. There is some evidence that retinoid nuclear receptors (RARs and RXRs) can regulate circadian gene expression in different tissues. In this study, Holtzman male rats from control and vitamin A-deficient groups were sacrificed throughout a 24-h period and hippocampus samples were isolated every 4 or 5 h. RARα and RXRβ expression level was quantified and daily expression patterns of clock BMAL1, PER1, RORα and REVERB genes, RORα and REVERB proteins, as well as temporal expression of cognition-related RC3 and BDNF genes were determined in the hippocampus of the two groups of rats. Our results show significant daily variations of BMAL1, PER1, RORα and REVERB genes, RORα and REVERB proteins and, consequently, daily oscillating expression of RC3 and BDNF genes in the rat hippocampus. Vitamin A deficiency reduced RXRβ mRNA level as well as the amplitude of PER1, REVERB gene and REVERB protein rhythms, and phase-shifted the daily peaks of BMAL1 and RORα mRNA, RORα protein and RC3 and BDNF mRNA levels. Thus, nutritional factors, such as vitamin A and its derivatives the retinoids, might modulate daily patterns of BDNF and RC3 expression in the hippocampus and they could be essential to maintain an optimal daily performance at molecular level in this learning-and-memory-related brain area. PMID:22434687

Evaluation and Selection of Appropriate Reference Genes for Real-Time Quantitative PCR Analysis of Gene Expression in Nile Tilapia (Oreochromis niloticus) during Vaccination and Infection

PubMed Central

Wang, Erlong; Wang, Kaiyu; Chen, Defang; Wang, Jun; He, Yang; Long, Bo; Yang, Lei; Yang, Qian; Geng, Yi; Huang, Xiaoli; Ouyang, Ping; Lai, Weimin

2015-01-01

qPCR as a powerful and attractive methodology has been widely applied to aquaculture researches for gene expression analyses. However, the suitable reference selection is critical for normalizing target genes expression in qPCR. In the present study, six commonly used endogenous controls were selected as candidate reference genes to evaluate and analyze their expression levels, stabilities and normalization to immune-related gene IgM expression during vaccination and infection in spleen of tilapia with RefFinder and GeNorm programs. The results showed that all of these candidate reference genes exhibited transcriptional variations to some extent at different periods. Among them, EF1A was the most stable reference with RefFinder, followed by 18S rRNA, ACTB, UBCE, TUBA and GAPDH respectively and the optimal number of reference genes for IgM normalization under different experiment sets was two with GeNorm. Meanwhile, combination the Cq (quantification cycle) value and the recommended comprehensive ranking of reference genes, EF1A and ACTB, the two optimal reference genes, were used together as reference genes for accurate analysis of immune-related gene expression during vaccination and infection in Nile tilapia with qPCR. Moreover, the highest IgM expression level was at two weeks post-vaccination when normalized to EF1A, 18S rRNA, ACTB, and EF1A together with ACTB compared to one week post-vaccination before normalizing, which was also consistent with the IgM antibody titers detection by ELISA. PMID:25941937

Heterologous expression of a recombinant lactobacillal β-galactosidase in Lactobacillus plantarum: effect of different parameters on the sakacin P-based expression system.

PubMed

Nguyen, Tien-Thanh; Nguyen, Hoang-Minh; Geiger, Barbara; Mathiesen, Geir; Eijsink, Vincent G H; Peterbauer, Clemens K; Haltrich, Dietmar; Nguyen, Thu-Ha

2015-03-07

Two overlapping genes lacL and lacM (lacLM) encoding for heterodimeric β-galactosidase from Lactobacillus reuteri were previously cloned and over-expressed in the food-grade host strain Lactobacillus plantarum WCFS1, using the inducible lactobacillal pSIP expression system. In this study, we analyzed different factors that affect the production of recombinant L. reuteri β-galactosidase. Various factors related to the cultivation, i.e. culture pH, growth temperature, glucose concentration, as well as the induction conditions, including cell concentration at induction point and inducer concentration, were tested. Under optimal fermentation conditions, the maximum β-galactosidase levels obtained were 130 U/mg protein and 35-40 U/ml of fermentation broth corresponding to the formation of approximately 200 mg of recombinant protein per litre of fermentation medium. As calculated from the specific activity of the purified enzyme (190 U/mg), β-galactosidase yield amounted to roughly 70% of the total soluble intracellular protein of the host organism. It was observed that pH and substrate (glucose) concentration are the most prominent factors affecting the production of recombinant β-galactosidase. The over-expression of recombinant L. reuteri β-galactosidase in a food-grade host strain was optimized, which is of interest for applications of this enzyme in the food industry. The results provide more detailed insight into these lactobacillal expression systems and confirm the potential of the pSIP system for efficient, tightly controlled expression of enzymes and proteins in lactobacilli.

Co-expression of hepatitis C virus polytope-HBsAg and p19-silencing suppressor protein in tobacco leaves.

PubMed

Mohammadzadeh, Sara; Roohvand, Farzin; Memarnejadian, Arash; Jafari, Anis; Ajdary, Soheila; Salmanian, Ali-Hatef; Ehsani, Parastoo

2016-01-01

Plants transformed by virus-based vectors have emerged as promising tools to rapidly express large amounts and inexpensive antigens in transient condition. We studied the possibility of transient-expression of an HBsAg-fused polytopic construct (HCVpc) [containing H-2d and HLA-A2-restricted CD8+CTL-epitopic peptides of C (Core; aa 132-142), E6 (Envelope2; aa 614-622), N (NS3; aa 1406-1415), and E4 (Envelope2; aa 405-414) in tandem of CE6NE4] in tobacco (Nicotiana tabacum) leaves for the development of a plant-based HCV vaccine. A codon-optimized gene encoding the Kozak sequence, hexahistidine (6×His)-tag peptide, and HCVpc in tandem was designed, chemically synthesized, fused to HBsAg gene, and inserted into Potato virus X (PVX-GW) vector under the control of duplicated PVX coat protein promoter (CPP). The resulted recombinant plasmids (after confirmation by restriction and sequencing analyses) were transferred into Agrobacterium tumefaciens strain GV3101 and vacuum infiltrated into tobacco leaves. The effect of gene-silencing suppressor, p19 protein from tomato bushy stunt virus, on the expression yield of HCVpc-HBsAg was also evaluated by co-infiltration of a p19 expression vector. Codon-optimized gene increased adaptation index (CAI) value (from 0.61 to 0.92) in tobacco. The expression of the HCVpc-HBsAg was confirmed by western blot and HBsAg-based detection ELISA on total extractable proteins of tobacco leaves. The expression level of the fusion protein was significantly higher in p19 co-agroinfiltrated plants. The results indicated the possibility of expression of HCVpc-HBsAg constructs with proper protein conformations in tobacco for final application as a plant-derived HCV vaccine.

Expression of anti-Mullerian hormone in hens selected for different ovulation rates.

PubMed

Johnson, P A; Kent, T R; Urick, M E; Trevino, L S; Giles, J R

2009-05-01

In hens, the granulosa layer is the primary source of anti-Mullerian hormone (AMH), as it is in mammals. Small follicles express the greatest amount of Amh mRNA with less in the larger follicles. Laying hens have a distinct ovarian hierarchy of follicles while broiler breeder hens often have excessive follicle growth with a disrupted hierarchy. The objective of Experiment 1 was to examine Amh expression in two strains of hens differing in ovulatory efficiency. Amh expression was greater (P<0.01) in broiler breeder hens (n=6) as compared with laying hens (n=6). Experiment 2 was designed to examine whether alterations in follicular development due to diet, within the broiler breeder hens, were correlated with changes in the expression of Amh. Restricted feeding (RF) in broiler breeder hens promotes optimal follicular development. Egg production in broiler breeder hens on full feed (FF; n=8) was 78% that of hens on RF (n=9). The number of large follicles (P<0.05), total ovarian weight (P<0.01), and Amh mRNA expression were greater in FF hens as compared with RF hens (P<0.01). There was no difference in FSH receptor expression between the two groups. A direct nutritional effect was not supported because culture of granulosa cells with varying concentrations of glucose and insulin showed no effect on granulosa Amh expression. Finally, testis-conditioned medium resulted in a dose-related increase in granulosa cell proliferation, which could be inhibited by preincubation with AMH antibody. AMH may enhance granulosa cell proliferation through an autocrine or paracrine mechanism although excessive AMH may inhibit optimal follicle selection.

Expression and characterization of codon-optimized Crimean-Congo hemorrhagic fever virus Gn glycoprotein in insect cells.

PubMed

Rahpeyma, Mehdi; Samarbaf-Zadeh, Alireza; Makvandi, Manoochehr; Ghadiri, Ata A; Dowall, Stuart D; Fotouhi, Fatemeh

2017-07-01

Crimean-Congo hemorrhagic fever virus (CCHFV) is a major cause of tick-borne viral hemorrhagic disease in the world. Despite of its importance as a deadly pathogen, there is currently no licensed vaccine against CCHF disease. The attachment glycoprotein of CCHFV (Gn) is a potentially important target for protective antiviral immune responses. To characterize the expression of recombinant CCHFV Gn in an insect-cell-based system, we developed a gene expression system expressing the full-length coding sequence under a polyhedron promoter in Sf9 cells using recombinant baculovirus. Recombinant Gn was purified by affinity chromatography, and the immunoreactivity of the protein was evaluated using sera from patients with confirmed CCHF infection. Codon-optimized Gn was successfully expressed, and the product had the expected molecular weight for CCHFV Gn glycoprotein of 37 kDa. In time course studies, the optimum expression of Gn occurred between 36 and 48 hours postinfection. The immunoreactivity of the recombinant protein in Western blot assay against human sera was positive and was similar to the results obtained with the anti-V5 tag antibody. Additionally, mice were subjected to subcutaneous injection with recombinant Gn, and the cellular and humoral immune response was monitored. The results showed that recombinant Gn protein was highly immunogenic and could elicit high titers of antigen-specific antibodies. Induction of the inflammatory cytokine interferon-gamma and the regulatory cytokine IL-10 was also detected. In conclusion, a recombinant baculovirus harboring CCHFV Gn was constructed and expressed in Sf9 host cells for the first time, and it was demonstrated that this approach is a suitable expression system for producing immunogenic CCHFV Gn protein without any biosafety concerns.

Closed-form expressions for flip angle variation that maximize total signal in T1-weighted rapid gradient echo MRI.

PubMed

Drobnitzky, Matthias; Klose, Uwe

2017-03-01

Magnetization-prepared rapid gradient-echo (MPRAGE) sequences are commonly employed for T1-weighted structural brain imaging. Following a contrast preparation radiofrequency (RF) pulse, the data acquisition proceeds under nonequilibrium conditions of the relaxing longitudinal magnetization. Variation of the flip angle can be used to maximize total available signal. Simulated annealing or greedy algorithms have so far been published to numerically solve this problem, with signal-to-noise ratios optimized for clinical imaging scenarios by adhering to a predefined shape of the signal evolution. We propose an unconstrained optimization of the MPRAGE experiment that employs techniques from resource allocation theory. A new dynamic programming solution is introduced that yields closed-form expressions for optimal flip angle variation. Flip angle series are proposed that maximize total transverse magnetization (Mxy) for a range of physiologic T1 values. A 3D MPRAGE sequence is modified to allow for a controlled variation of the excitation angle. Experiments employing a T1 contrast phantom are performed at 3T. 1D acquisitions without phase encoding permit measurement of the temporal development of Mxy. Image mean signal and standard deviation for reference flip angle trains are compared in 2D measurements. Signal profiles at sharp phantom edges are acquired to access image blurring related to nonuniform Mxy development. A novel closed-form expression for flip angle variation is found that constitutes the optimal policy to reach maximum total signal. It numerically equals previously published results of other authors when evaluated under their simplifying assumptions. Longitudinal magnetization (Mz) is exhaustively used without causing abrupt changes in the measured MR signal, which is a prerequisite for artifact free images. Phantom experiments at 3T verify the expected benefit for total accumulated k-space signal when compared with published flip angle series. Describing the MR signal collection in MPRAGE sequences as a Bellman problem is a new concept. By means of recursively solving a series of overlapping subproblems, this leads to an elegant solution for the problem of maximizing total available MR signal in k-space. A closed-form expression for flip angle variation avoids the complexity of numerical optimization and eases access to controlled variation in an attempt to identify potential clinical applications. © 2017 American Association of Physicists in Medicine.

Genes under weaker stabilizing selection increase network evolvability and rapid regulatory adaptation to an environmental shift.

PubMed

Laarits, T; Bordalo, P; Lemos, B

2016-08-01

Regulatory networks play a central role in the modulation of gene expression, the control of cellular differentiation, and the emergence of complex phenotypes. Regulatory networks could constrain or facilitate evolutionary adaptation in gene expression levels. Here, we model the adaptation of regulatory networks and gene expression levels to a shift in the environment that alters the optimal expression level of a single gene. Our analyses show signatures of natural selection on regulatory networks that both constrain and facilitate rapid evolution of gene expression level towards new optima. The analyses are interpreted from the standpoint of neutral expectations and illustrate the challenge to making inferences about network adaptation. Furthermore, we examine the consequence of variable stabilizing selection across genes on the strength and direction of interactions in regulatory networks and in their subsequent adaptation. We observe that directional selection on a highly constrained gene previously under strong stabilizing selection was more efficient when the gene was embedded within a network of partners under relaxed stabilizing selection pressure. The observation leads to the expectation that evolutionarily resilient regulatory networks will contain optimal ratios of genes whose expression is under weak and strong stabilizing selection. Altogether, our results suggest that the variable strengths of stabilizing selection across genes within regulatory networks might itself contribute to the long-term adaptation of complex phenotypes. © 2016 European Society For Evolutionary Biology. Journal of Evolutionary Biology © 2016 European Society For Evolutionary Biology.

An efficient procedure for the expression and purification of HIV-1 protease from inclusion bodies.

PubMed

Nguyen, Hong-Loan Thi; Nguyen, Thuy Thi; Vu, Quy Thi; Le, Hang Thi; Pham, Yen; Trinh, Phuong Le; Bui, Thuan Phuong; Phan, Tuan-Nghia

2015-12-01

Several studies have focused on HIV-1 protease for developing drugs for treating AIDS. Recombinant HIV-1 protease is used to screen new drugs from synthetic compounds or natural substances. However, large-scale expression and purification of this enzyme is difficult mainly because of its low expression and solubility. In this study, we constructed 9 recombinant plasmids containing a sequence encoding HIV-1 protease along with different fusion tags and examined the expression of the enzyme from these plasmids. Of the 9 plasmids, pET32a(+) plasmid containing the HIV-1 protease-encoding sequence along with sequences encoding an autocleavage site GTVSFNF at the N-terminus and TEV plus 6× His tag at the C-terminus showed the highest expression of the enzyme and was selected for further analysis. The recombinant protein was isolated from inclusion bodies by using 2 tandem Q- and Ni-Sepharose columns. SDS-PAGE of the obtained HIV-1 protease produced a single band of approximately 13 kDa. The enzyme was recovered efficiently (4 mg protein/L of cell culture) and had high specific activity of 1190 nmol min(-1) mg(-1) at an optimal pH of 4.7 and optimal temperature of 37 °C. This procedure for expressing and purifying HIV-1 protease is now being scaled up to produce the enzyme on a large scale for its application. Copyright © 2015 Elsevier Inc. All rights reserved.

Establishment of optimized MDCK cell lines for reliable efflux transport studies.

PubMed

Gartzke, Dominik; Fricker, Gert

2014-04-01

Madin-Darby canine kidney (MDCK) cells transfected with human MDR1 gene (MDCK-MDR1) encoding for P-glycoprotein (hPgp, ABCB1) are widely used for transport studies to identify drug candidates as substrates of this efflux protein. Therefore, it is necessary to rely on constant and comparable expression levels of Pgp to avoid false negative or positive results. We generated a cell line with homogenously high and stable expression of hPgp through sorting single clones from a MDCK-MDR1 cell pool using fluorescence-activated cell sorting (FACS). To obtain control cell lines for evaluation of cross-interactions with endogenous canine Pgp (cPgp) wild-type cells were sorted with a low expression pattern of cPgp in comparison with the MDCK-MDR1. Expression of other transporters was also characterized in both cell lines by quantitative real-time PCR and Western blot. Pgp function was investigated applying the Calcein-AM assay as well as bidirectional transport assays using (3) H-Digoxin, (3) H-Vinblastine, and (3) H-Quinidine as substrates. Generated MDCK-MDR1 cell lines showed high expression of hPgp. Control MDCK-WT cells were optimized in showing a comparable expression level of cPgp in comparison with MDCK-MDR1 cell lines. Generated cell lines showed higher and more selective Pgp transport compared with parental cells. Therefore, they provide a significant improvement in the performance of efflux studies yielding more reliable results. © 2014 Wiley Periodicals, Inc. and the American Pharmacists Association.

Efficient production of antibody Fab fragment by transient gene expression in insect cells.

PubMed

Mori, Keita; Hamada, Hirotsugu; Ogawa, Takafumi; Ohmuro-Matsuyama, Yuki; Katsuda, Tomohisa; Yamaji, Hideki

2017-08-01

Transient gene expression allows a rapid production of diverse recombinant proteins in early-stage preclinical and clinical developments of biologics. Insect cells have proven to be an excellent platform for the production of functional recombinant proteins. In the present study, the production of an antibody Fab fragment by transient gene expression in lepidopteran insect cells was investigated. The DNA fragments encoding heavy-chain (Hc; Fd fragment) and light-chain (Lc) genes of an Fab fragment were individually cloned into the plasmid vector pIHAneo, which contained the Bombyx mori actin promoter downstream of the B. mori nucleopolyhedrovirus (BmNPV) IE-1 transactivator and the BmNPV HR3 enhancer for high-level expression. Trichoplusia ni BTI-TN-5B1-4 (High Five) cells were co-transfected with the resultant plasmid vectors using linear polyethyleneimine. When the transfection efficiency was evaluated, a plasmid vector encoding an enhanced green fluorescent protein (EGFP) gene was also co-transfected. Transfection and culture conditions were optimized based on both the flow cytometry of the EGFP expression in transfected cells and the yield of the secreted Fab fragments determined by enzyme-linked immunosorbent assay (ELISA). Under optimal conditions, a yield of approximately 120 mg/L of Fab fragments was achieved in 5 days in a shake-flask culture. Transient gene expression in insect cells may offer a promising approach to the high-throughput production of recombinant proteins. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Distinct temporal changes in host cell lncRNA expression during the course of an adenovirus infection

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhao, Hongxing, E-mail: Hongxing.Zhao@igp.uu.se; Chen, Maoshan; Lind, Sara Bergström

The deregulation of cellular long non-coding RNA (lncRNA) expression during a human adenovirus infection was studied by deep sequencing. Expression of lncRNAs increased substantially following the progression of the infection. Among 645 significantly expressed lncRNAs, the expression of 398 was changed more than 2-fold. More than 80% of them were up-regulated and 80% of them were detected during the late phase. Based on the genomic locations of the deregulated lncRNAs in relation to known mRNAs and miRNAs, they were predicted to be involved in growth, structure, apoptosis and wound healing in the early phase, cell proliferation in the intermediate phasemore » and protein synthesis, modification and transport in the late phase. The most significant functions of cellular RNA-binding proteins, previously shown to interact with the deregulated lncRNAs identified here, are involved in RNA splicing, nuclear export and translation events. We hypothesize that adenoviruses exploit the lncRNA network to optimize their reproduction. - Highlights: • The expression of 398 lncRNAs showed a distinct temporal pattern during Ad2 infection. • 80% of the deregulated lncRNAs were up-regulated during the late phase of infection. • The deregulated lncRNAs potentiallyinteract with 33 cellular RNA binding proteins. • These RBPs are involved in RNA splicing, nuclear export and translation. • Adenovirus exploits the cellular lncRNA network to optimize its replication.« less

Multilevel Regulation of Bacterial Gene Expression with the Combined STAR and Antisense RNA System.

PubMed

Lee, Young Je; Kim, Soo-Jung; Moon, Tae Seok

2018-03-16

Synthetic small RNA regulators have emerged as a versatile tool to predictably control bacterial gene expression. Owing to their simple design principles, small size, and highly orthogonal behavior, these engineered genetic parts have been incorporated into genetic circuits. However, efforts to achieve more sophisticated cellular functions using RNA regulators have been hindered by our limited ability to integrate different RNA regulators into complex circuits. Here, we present a combined RNA regulatory system in Escherichia coli that uses small transcription activating RNA (STAR) and antisense RNA (asRNA) to activate or deactivate target gene expression in a programmable manner. Specifically, we demonstrated that the activated target output by the STAR system can be deactivated by expressing two different types of asRNAs: one binds to and sequesters the STAR regulator, affecting the transcription process, while the other binds to the target mRNA, affecting the translation process. We improved deactivation efficiencies (up to 96%) by optimizing each type of asRNA and then integrating the two optimized asRNAs into a single circuit. Furthermore, we demonstrated that the combined STAR and asRNA system can control gene expression in a reversible way and can regulate expression of a gene in the genome. Lastly, we constructed and simultaneously tested two A AND NOT B logic gates in the same cell to show sophisticated multigene regulation by the combined system. Our approach establishes a methodology for integrating multiple RNA regulators to rationally control multiple genes.

Alternative derivation of an exchange-only density-functional optimized effective potential

DOE Office of Scientific and Technical Information (OSTI.GOV)

Joubert, D. P.

2007-10-15

An alternative derivation of the exchange-only density-functional optimized effective potential equation is given. It is shown that the localized Hartree-Fock-common energy denominator Green's function approximation (LHF-CEDA) for the density-functional exchange potential proposed independently by Della Sala and Goerling [J. Chem. Phys. 115, 5718 (2001)] and Gritsenko and Baerends [Phys. Rev. A 64, 42506 (2001)] can be derived as an approximation to the OEP exchange potential in a similar way that the KLI approximation [Phys. Rev. A 45, 5453 (1992)] was derived. An exact expression for the correction term to the LHF-CEDA approximation can thus be found. The correction term canmore » be expressed in terms of the first-order perturbation-theory many-electron wave function shift when the Kohn-Sham Hamiltonian is subjected to a perturbation equal to the difference between the density-functional exchange potential and the Hartree-Fock nonlocal potential, expressed in terms of the Kohn-Sham orbitals. An explicit calculation shows that the density weighted mean of the correction term is zero, confirming that the LHF-CEDA approximation can be interpreted as a mean-field approximation. The corrected LHF-CEDA equation and the optimized effective potential equation are shown to be identical, with information distributed differently between terms in the equations. For a finite system the correction term falls off at least as fast as 1/r{sup 4} for large r.« less

Alternative derivation of an exchange-only density-functional optimized effective potential

NASA Astrophysics Data System (ADS)

Joubert, D. P.

2007-10-01

An alternative derivation of the exchange-only density-functional optimized effective potential equation is given. It is shown that the localized Hartree-Fock common energy denominator Green’s function approximation (LHF-CEDA) for the density-functional exchange potential proposed independently by Della Sala and Görling [J. Chem. Phys. 115, 5718 (2001)] and Gritsenko and Baerends [Phys. Rev. A 64, 42506 (2001)] can be derived as an approximation to the OEP exchange potential in a similar way that the KLI approximation [Phys. Rev. A 45, 5453 (1992)] was derived. An exact expression for the correction term to the LHF-CEDA approximation can thus be found. The correction term can be expressed in terms of the first-order perturbation-theory many-electron wave function shift when the Kohn-Sham Hamiltonian is subjected to a perturbation equal to the difference between the density-functional exchange potential and the Hartree-Fock nonlocal potential, expressed in terms of the Kohn-Sham orbitals. An explicit calculation shows that the density weighted mean of the correction term is zero, confirming that the LHF-CEDA approximation can be interpreted as a mean-field approximation. The corrected LHF-CEDA equation and the optimized effective potential equation are shown to be identical, with information distributed differently between terms in the equations. For a finite system the correction term falls off at least as fast as 1/r4 for large r .

KCNN4 and S100A14 act as predictors of recurrence in optimally debulked patients with serous ovarian cancer

PubMed Central

Hu, Ting; Sun, Qian; Wu, Jianli; Lin, Xingguang; Luo, Danfeng; Sun, Chaoyang; Wang, Changyu; Zhou, Bo; Li, Na; Xia, Meng; Lu, Hao; Meng, Li; Xu, Xiaoyan; Hu, Junbo; Ma, Ding; Chen, Gang; Zhu, Tao

2016-01-01

Approximately 50-75% of patients with serous ovarian carcinoma (SOC) experience recurrence within 18 months after first-line treatment. Current clinical indicators are inadequate for predicting the risk of recurrence. In this study, we used 7 publicly available microarray datasets to identify gene signatures related to recurrence in optimally debulked SOC patients, and validated their expressions in an independent clinic cohort of 127 patients using immunohistochemistry (IHC). We identified a two-gene signature including KCNN4 and S100A14 which was related to recurrence in optimally debulked SOC patients. Their mRNA expression levels were positively correlated and regulated by DNA copy number alterations (CNA) (KCNN4: p=1.918e-05) and DNA promotermethylation (KCNN4: p=0.0179; S100A14: p=2.787e-13). Recurrence prediction models built in the TCGA dataset based on KCNN4 and S100A14 individually and in combination showed good prediction performance in the other 6 datasets (AUC:0.5442-0.9524). The independent cohort supported the expression difference between SOC recurrences. Also, a KCNN4 and S100A14-centered protein interaction subnetwork was built from the STRING database, and the shortest regulation path between them, called the KCNN4-UBA52-KLF4-S100A14 axis, was identified. This discovery might facilitate individualized treatment of SOC. PMID:27270322

Expression, purification and characterization of a phyAm-phyCs fusion phytase*

PubMed Central

Zou, Li-kou; Wang, Hong-ning; Pan, Xin; Tian, Guo-bao; Xie, Zi-wen; Wu, Qi; Chen, Hui; Xie, Tao; Yang, Zhi-rong

2008-01-01

The phyAm gene encoding acid phytase and optimized neutral phytase phyCs gene were inserted into expression vector pPIC9K in correct orientation and transformed into Pichia pastoris in order to expand the pH profile of phytase and decrease the cost of production. The fusion phytase phyAm-phyCs gene was successfully overexpressed in P. pastoris as an active and extracellular phytase. The yield of total extracellular fusion phytase activity is (25.4±0.53) U/ml at the flask scale and (159.1±2.92) U/ml for high cell-density fermentation, respectively. Purified fusion phytase exhibits an optimal temperature at 55 °C and an optimal pH at 5.5~6.0 and its relative activity remains at a relatively high level of above 70% in the range of pH 2.0 to 7.0. About 51% to 63% of its original activity remains after incubation at 75 °C to 95 °C for 10 min. Due to heavy glycosylation, the expressed fusion phytase shows a broad and diffuse band in SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis). After deglycosylation by endoglycosidase H (EndoHf), the enzyme has an apparent molecular size of 95 kDa. The characterization of the fusion phytase was compared with those of phyCs and phyAm. PMID:18600783

Optimization of techniques for multiple platform testing in small, precious samples such as human chorionic villus sampling.

PubMed

Pisarska, Margareta D; Akhlaghpour, Marzieh; Lee, Bora; Barlow, Gillian M; Xu, Ning; Wang, Erica T; Mackey, Aaron J; Farber, Charles R; Rich, Stephen S; Rotter, Jerome I; Chen, Yii-der I; Goodarzi, Mark O; Guller, Seth; Williams, John

2016-11-01

Multiple testing to understand global changes in gene expression based on genetic and epigenetic modifications is evolving. Chorionic villi, obtained for prenatal testing, is limited, but can be used to understand ongoing human pregnancies. However, optimal storage, processing and utilization of CVS for multiple platform testing have not been established. Leftover CVS samples were flash-frozen or preserved in RNAlater. Modifications to standard isolation kits were performed to isolate quality DNA and RNA from samples as small as 2-5 mg. RNAlater samples had significantly higher RNA yields and quality and were successfully used in microarray and RNA-sequencing (RNA-seq). RNA-seq libraries generated using 200 versus 800-ng RNA showed similar biological coefficients of variation. RNAlater samples had lower DNA yields and quality, which improved by heating the elution buffer to 70 °C. Purification of DNA was not necessary for bisulfite-conversion and genome-wide methylation profiling. CVS cells were propagated and continue to express genes found in freshly isolated chorionic villi. CVS samples preserved in RNAlater are superior. Our optimized techniques provide specimens for genetic, epigenetic and gene expression studies from a single small sample which can be used to develop diagnostics and treatments using a systems biology approach in the prenatal period. © 2016 John Wiley & Sons, Ltd. © 2016 John Wiley & Sons, Ltd.

Sensitivity regularization of the Cramér-Rao lower bound to minimize B1 nonuniformity effects in quantitative magnetization transfer imaging.

PubMed

Boudreau, Mathieu; Pike, G Bruce

2018-05-07

To develop and validate a regularization approach of optimizing B 1 insensitivity of the quantitative magnetization transfer (qMT) pool-size ratio (F). An expression describing the impact of B 1 inaccuracies on qMT fitting parameters was derived using a sensitivity analysis. To simultaneously optimize for robustness against noise and B 1 inaccuracies, the optimization condition was defined as the Cramér-Rao lower bound (CRLB) regularized by the B 1 -sensitivity expression for the parameter of interest (F). The qMT protocols were iteratively optimized from an initial search space, with and without B 1 regularization. Three 10-point qMT protocols (Uniform, CRLB, CRLB+B 1 regularization) were compared using Monte Carlo simulations for a wide range of conditions (e.g., SNR, B 1 inaccuracies, tissues). The B 1 -regularized CRLB optimization protocol resulted in the best robustness of F against B 1 errors, for a wide range of SNR and for both white matter and gray matter tissues. For SNR = 100, this protocol resulted in errors of less than 1% in mean F values for B 1 errors ranging between -10 and 20%, the range of B 1 values typically observed in vivo in the human head at field strengths of 3 T and less. Both CRLB-optimized protocols resulted in the lowest σ F values for all SNRs and did not increase in the presence of B 1 inaccuracies. This work demonstrates a regularized optimization approach for improving the robustness of auxiliary measurements (e.g., B 1 ) sensitivity of qMT parameters, particularly the pool-size ratio (F). Predicting substantially less B 1 sensitivity using protocols optimized with this method, B 1 mapping could even be omitted for qMT studies primarily interested in F. © 2018 International Society for Magnetic Resonance in Medicine.

Classification based upon gene expression data: bias and precision of error rates.

PubMed

Wood, Ian A; Visscher, Peter M; Mengersen, Kerrie L

2007-06-01

Gene expression data offer a large number of potentially useful predictors for the classification of tissue samples into classes, such as diseased and non-diseased. The predictive error rate of classifiers can be estimated using methods such as cross-validation. We have investigated issues of interpretation and potential bias in the reporting of error rate estimates. The issues considered here are optimization and selection biases, sampling effects, measures of misclassification rate, baseline error rates, two-level external cross-validation and a novel proposal for detection of bias using the permutation mean. Reporting an optimal estimated error rate incurs an optimization bias. Downward bias of 3-5% was found in an existing study of classification based on gene expression data and may be endemic in similar studies. Using a simulated non-informative dataset and two example datasets from existing studies, we show how bias can be detected through the use of label permutations and avoided using two-level external cross-validation. Some studies avoid optimization bias by using single-level cross-validation and a test set, but error rates can be more accurately estimated via two-level cross-validation. In addition to estimating the simple overall error rate, we recommend reporting class error rates plus where possible the conditional risk incorporating prior class probabilities and a misclassification cost matrix. We also describe baseline error rates derived from three trivial classifiers which ignore the predictors. R code which implements two-level external cross-validation with the PAMR package, experiment code, dataset details and additional figures are freely available for non-commercial use from http://www.maths.qut.edu.au/profiles/wood/permr.jsp

ICRP - What's happening

DOE Office of Scientific and Technical Information (OSTI.GOV)

Meinhold, C.B.

1982-01-01

This paper discusses the goals of the ICRP for the 1980 decade in optimizing radiation protection in the areas of workers, patients, and the public. Economic and operational concerns are expressed. (PSB)

Dynamic Decision Making under Uncertainty and Partial Information

DTIC Science & Technology

2013-11-14

integral under the natural filtration generated by the Brownian motions . This compact expression potentially enables us to design sub- optimal penalties...bounds on bermudan option price under jump diffusion processes. Quantitative Finance , 2013. Under review, available at http://arxiv.org/abs/1305.4321... Finance , 19:53 – 71, 2009. [3] D.P. Bertsekas. Dynamic Programming and Optimal Control. Athena Scientific, 4th edition, 2012. [4] D.B. Brown and J.E

Closed-form recursive formula for an optimal tracker with terminal constraints

NASA Technical Reports Server (NTRS)

Juang, J. N.; Turner, J. D.; Chun, H. M.

1986-01-01

Feedback control laws are derived for a class of optimal finite time tracking problems with terminal constraints. Analytical solutions are obtained for the feedback gain and the closed-loop response trajectory. Such formulations are expressed in recursive forms so that a real-time computer implementation becomes feasible. An example involving the feedback slewing of a flexible spacecraft is given to illustrate the validity and usefulness of the formulations.

Chemical modification: the key to clinical application of RNA interference?

PubMed Central

Corey, David R.

2007-01-01

RNA interference provides a potent and specific method for controlling gene expression in human cells. To translate this potential into a broad new family of therapeutics, it is necessary to optimize the efficacy of the RNA-based drugs. As discussed in this Review, it might be possible to achieve this optimization using chemical modifications that improve their in vivo stability, cellular delivery, biodistribution, pharmacokinetics, potency, and specificity. PMID:18060019

Optimal minimal measurements of mixed states

NASA Astrophysics Data System (ADS)

Vidal, G.; Latorre, J. I.; Pascual, P.; Tarrach, R.

1999-07-01

The optimal and minimal measuring strategy is obtained for a two-state system prepared in a mixed state with a probability given by any isotropic a priori distribution. We explicitly construct the specific optimal and minimal generalized measurements, which turn out to be independent of the a priori probability distribution, obtaining the best guesses for the unknown state as well as a closed expression for the maximal mean-average fidelity. We do this for up to three copies of the unknown state in a way that leads to the generalization to any number of copies, which we then present and prove.

Dynamic programming and graph algorithms in computer vision.

PubMed

Felzenszwalb, Pedro F; Zabih, Ramin

2011-04-01

Optimization is a powerful paradigm for expressing and solving problems in a wide range of areas, and has been successfully applied to many vision problems. Discrete optimization techniques are especially interesting since, by carefully exploiting problem structure, they often provide nontrivial guarantees concerning solution quality. In this paper, we review dynamic programming and graph algorithms, and discuss representative examples of how these discrete optimization techniques have been applied to some classical vision problems. We focus on the low-level vision problem of stereo, the mid-level problem of interactive object segmentation, and the high-level problem of model-based recognition.

Cooperative combinatorial optimization: evolutionary computation case study.

PubMed

Burgin, Mark; Eberbach, Eugene

2008-01-01

This paper presents a formalization of the notion of cooperation and competition of multiple systems that work toward a common optimization goal of the population using evolutionary computation techniques. It is proved that evolutionary algorithms are more expressive than conventional recursive algorithms, such as Turing machines. Three classes of evolutionary computations are introduced and studied: bounded finite, unbounded finite, and infinite computations. Universal evolutionary algorithms are constructed. Such properties of evolutionary algorithms as completeness, optimality, and search decidability are examined. A natural extension of evolutionary Turing machine (ETM) model is proposed to properly reflect phenomena of cooperation and competition in the whole population.

Digital robust active control law synthesis for large order flexible structure using parameter optimization

NASA Technical Reports Server (NTRS)

Mukhopadhyay, V.

1988-01-01

A generic procedure for the parameter optimization of a digital control law for a large-order flexible flight vehicle or large space structure modeled as a sampled data system is presented. A linear quadratic Guassian type cost function was minimized, while satisfying a set of constraints on the steady-state rms values of selected design responses, using a constrained optimization technique to meet multiple design requirements. Analytical expressions for the gradients of the cost function and the design constraints on mean square responses with respect to the control law design variables are presented.

Transmission loss optimization in acoustic sandwich panels

NASA Astrophysics Data System (ADS)

Makris, S. E.; Dym, C. L.; MacGregor Smith, J.

1986-06-01

Considering the sound transmission loss (TL) of a sandwich panel as the single objective, different optimization techniques are examined and a sophisticated computer program is used to find the optimum TL. Also, for one of the possible case studies such as core optimization, closed-form expressions are given between TL and the core-design variables for different sets of skins. The significance of these functional relationships lies in the fact that the panel designer can bypass the necessity of using a sophisticated software package in order to assess explicitly the dependence of the TL on core thickness and density.

AMT1;1 transgenic rice plants with enhanced NH4 + permeability show superior growth and higher yield under optimal and suboptimal NH4 + conditions

PubMed Central

Rothstein, Steven J.

2014-01-01

The major source of nitrogen for rice (Oryza sativa L.) is ammonium (NH4 +). The NH4 + uptake of roots is mainly governed by membrane transporters, with OsAMT1;1 being a prominent member of the OsAMT1 gene family that is known to be involved in NH4 + transport in rice plants. However, little is known about its involvement in NH4 + uptake in rice roots and subsequent effects on NH4 + assimilation. This study shows that OsAMT1;1 is a constitutively expressed, nitrogen-responsive gene, and its protein product is localized in the plasma membrane. Its expression level is under the control of circadian rhythm. Transgenic rice lines (L-2 and L-3) overexpressing the OsAMT1;1 gene had the same root structure as the wild type (WT). However, they had 2-fold greater NH4 + permeability than the WT, whereas OsAMT1;1 gene expression was 20-fold higher than in the WT. Analogous to the expression, transgenic lines had a higher NH4 + content in the shoots and roots than the WT. Direct NH4 + fluxes in the xylem showed that the transgenic lines had significantly greater uptake rates than the WT. Higher NH4 + contents also promoted higher expression levels of genes in the nitrogen assimilation pathway, resulting in greater nitrogen assimilates, chlorophyll, starch, sugars, and grain yield in transgenic lines than in the WT under suboptimal and optimal nitrogen conditions. OsAMT1;1 also enhanced overall plant growth, especially under suboptimal NH4 + levels. These results suggest that OsAMT1;1 has the potential for improving nitrogen use efficiency, plant growth, and grain yield under both suboptimal and optimal nitrogen fertilizer conditions. PMID:24420570

Pre-amplification in the context of high-throughput qPCR gene expression experiment.

PubMed

Korenková, Vlasta; Scott, Justin; Novosadová, Vendula; Jindřichová, Marie; Langerová, Lucie; Švec, David; Šídová, Monika; Sjöback, Robert

2015-03-11

With the introduction of the first high-throughput qPCR instrument on the market it became possible to perform thousands of reactions in a single run compared to the previous hundreds. In the high-throughput reaction, only limited volumes of highly concentrated cDNA or DNA samples can be added. This necessity can be solved by pre-amplification, which became a part of the high-throughput experimental workflow. Here, we focused our attention on the limits of the specific target pre-amplification reaction and propose the optimal, general setup for gene expression experiment using BioMark instrument (Fluidigm). For evaluating different pre-amplification factors following conditions were combined: four human blood samples from healthy donors and five transcripts having high to low expression levels; each cDNA sample was pre-amplified at four cycles (15, 18, 21, and 24) and five concentrations (equivalent to 0.078 ng, 0.32 ng, 1.25 ng, 5 ng, and 20 ng of total RNA). Factors identified as critical for a success of cDNA pre-amplification were cycle of pre-amplification, total RNA concentration, and type of gene. The selected pre-amplification reactions were further tested for optimal Cq distribution in a BioMark Array. The following concentrations combined with pre-amplification cycles were optimal for good quality samples: 20 ng of total RNA with 15 cycles of pre-amplification, 20x and 40x diluted; and 5 ng and 20 ng of total RNA with 18 cycles of pre-amplification, both 20x and 40x diluted. We set up upper limits for the bulk gene expression experiment using gene expression Dynamic Array and provided an easy-to-obtain tool for measuring of pre-amplification success. We also showed that variability of the pre-amplification, introduced into the experimental workflow of reverse transcription-qPCR, is lower than variability caused by the reverse transcription step.

Expression and purification of recombinant apolipoprotein A-I Zaragoza (L144R) and formation of reconstituted HDL particles.

PubMed

Fiddyment, Sarah; Barceló-Batllori, Sílvia; Pocoví, Miguel; García-Otín, Angel-Luis

2011-11-01

Apolipoprotein A-I Zaragoza (L144R) (apo A-I Z), has been associated with severe hypoalphalipoproteinemia and an enhanced effect of high density lipoprotein (HDL) reverse cholesterol transport. In order to perform further studies with this protein we have optimized an expression and purification method of recombinant wild-type apo A-I and apo A-I Z and produced mimetic HDL particles with each protein. An pET-45 expression system was used to produce N-terminal His-tagged apo A-I, wild-type or mutant, in Escherichia coli BL21 (DE3) which was subsequently purified by affinity chromatography in non-denaturing conditions. HDL particles were generated via a modified sodium cholate method. Expression and purification of both proteins was verified by SDS-PAGE, MALDI-TOF MS and immunochemical procedures. Yield was 30mg of purified protein (94% purity) per liter of culture. The reconstituted HDL particles checked via non-denaturing PAGE showed high homogeneity in their size when reconstituted both with wild-type apo A-I and apo A-I Z. An optimized system for the expression and purification of wild-type apo A-I and apo A-I Z with high yield and purity grade has been achieved, in addition to their use in reconstituted HDL particles, as a basis for further studies. Copyright © 2011 Elsevier Inc. All rights reserved.

Control of Expression of the RNases J1 and J2 in Bacillus subtilis

PubMed Central

Jamalli, Ailar; Hébert, Agnès; Zig, Léna

2014-01-01

In Bacillus subtilis, the dual activity 5′ exo- and endoribonucleases J1 and J2 are important players in mRNA and stable RNA maturation and degradation. Recent work has improved our understanding of their structure and mechanism of action and identified numerous RNA substrates. However, almost nothing is known about the expression of these enzymes. Here, we have identified the transcriptional and translational signals that control the expression of the rnjA (RNase J1) and rnjB (RNase J2) genes. While the rnjB gene is transcribed constitutively from a sigma A promoter, optimal expression of RNase J1 requires cotranscription and cotranslation with the upstream ykzG gene, encoding a protein of unknown function. In the absence of coupled translation, RNase J1 expression is decreased more than 5-fold. Transcription of the ykzG operon initiates at a sigma A promoter with a noncanonical −35 box that is required for optimal transcription. Biosynthesis of RNase J1 is autocontrolled within a small range (1.4-fold) and also slightly stimulated (1.4-fold) in the absence of RNase J2. These controls are weak but might be useful to maintain the overall RNase J level and possibly also equimolar amounts of the two nucleases in the cell that primarily act as a heterodimer in vivo. PMID:24187087

Selenium regulates gene expression of selenoprotein W in chicken skeletal muscle system.

PubMed

Ruan, Hongfeng; Zhang, Ziwei; Wu, Qiong; Yao, Haidong; Li, Jinlong; Li, Shu; Xu, Shiwen

2012-01-01

Selenoprotein W (SelW) is abundantly expressed in skeletal muscles of mammals and necessary for the metabolism of skeletal muscles. However, its expression pattern in skeletal muscle system of birds is still uncovered. Herein, to investigate the distribution of SelW mRNA in chicken skeletal muscle system and its response to different selenium (Se) status, 1-day-old chickens were exposed to various concentrations of Se as sodium selenite in the feed for 35 days. In addition, myoblasts were treated with different concentrations of Se in the medium for 72 h. Then the levels of SelW mRNA in skeletal muscles (wing muscle, pectoral muscle, thigh muscle) and myoblasts were determined on days 1, 15, 25, and 35 and at 0, 24, 48, and 72 h, respectively. The results showed that SelW was detected in all these muscle components and it increased both along with the growth of organism and the differentiation process of myoblasts. The thigh muscle is more responsive to Se intake than the other two skeletal muscle tissues while the optimal Se supplementation for SelW mRNA expression in chicken myoblasts was 10(-7) M. In summary, Se plays important roles in the development of chicken skeletal muscles. To effect optimal SelW gene expression, Se must be provided in the diet and the media in adequate amounts and neither at excessive nor deficient levels.

Micro-RNA-126 Reduces the Blood Thrombogenicity in Diabetes Mellitus via Targeting of Tissue Factor.

PubMed

Witkowski, Marco; Weithauser, Alice; Tabaraie, Termeh; Steffens, Daniel; Kränkel, Nicolle; Witkowski, Mario; Stratmann, Bernd; Tschoepe, Diethelm; Landmesser, Ulf; Rauch-Kroehnert, Ursula

2016-06-01

Diabetes mellitus involves vascular inflammatory processes and is a main contributor to cardiovascular mortality. Notably, heightened levels of circulating tissue factor (TF) account for the increased thrombogenicity and put those patients at risk for thromboembolic events. Here, we sought to investigate the role of micro-RNA (miR)-driven TF expression and thrombogenicity in diabetes mellitus. Plasma samples of patients with diabetes mellitus were analyzed for TF protein and activity as well as miR-126 expression before and after optimization of the antidiabetic treatment. We found low miR-126 levels to be associated with markedly increased TF protein and TF-mediated thrombogenicity. Reduced miR-126 expression was accompanied by increased vascular inflammation as evident from the levels of vascular adhesion molecule-1 and fibrinogen, as well as leukocyte counts. With optimization of the antidiabetic treatment miR-126 levels increased and thrombogenicity was reduced. Using a luciferase reporter system, we demonstrated miR-126 to directly bind to the F3-3'-untranslated region, thereby reducing TF expression both on mRNA and on protein levels in human microvascular endothelial cells as well as TF mRNA and activity in monocytes. Circulating miR-126 exhibits antithrombotic properties via regulating post-transcriptional TF expression, thereby impacting the hemostatic balance of the vasculature in diabetes mellitus. © 2016 The Authors.

Sizing a rainwater harvesting cistern by minimizing costs

NASA Astrophysics Data System (ADS)

Pelak, Norman; Porporato, Amilcare

2016-10-01

Rainwater harvesting (RWH) has the potential to reduce water-related costs by providing an alternate source of water, in addition to relieving pressure on public water sources and reducing stormwater runoff. Existing methods for determining the optimal size of the cistern component of a RWH system have various drawbacks, such as specificity to a particular region, dependence on numerical optimization, and/or failure to consider the costs of the system. In this paper a formulation is developed for the optimal cistern volume which incorporates the fixed and distributed costs of a RWH system while also taking into account the random nature of the depth and timing of rainfall, with a focus on RWH to supply domestic, nonpotable uses. With rainfall inputs modeled as a marked Poisson process, and by comparing the costs associated with building a cistern with the costs of externally supplied water, an expression for the optimal cistern volume is found which minimizes the water-related costs. The volume is a function of the roof area, water use rate, climate parameters, and costs of the cistern and of the external water source. This analytically tractable expression makes clear the dependence of the optimal volume on the input parameters. An analysis of the rainfall partitioning also characterizes the efficiency of a particular RWH system configuration and its potential for runoff reduction. The results are compared to the RWH system at the Duke Smart Home in Durham, NC, USA to show how the method could be used in practice.

A Substance Exchanger-Based Bioreactor Culture of Pig Discs for Studying the Immature Nucleus Pulposus.

PubMed

Li, Pei; Gan, Yibo; Wang, Haoming; Xu, Yuan; Song, Lei; Wang, Liyuan; Ouyang, Bin; Zhou, Qiang

2017-11-01

Various research models have been developed to study the biology of disc cells. Recently, the adult disc nucleus pulposus (NP) has been well studied. However, the immature NP is underinvestigated due to a lack of a suitable model. This study aimed to establish an organ culture of immature porcine disc by optimizing culture conditions and using a self-developed substance exchanger-based bioreactor. Immature porcine discs were first cultured in the bioreactor for 7 days at various levels of glucose (low, medium, high), osmolarity (hypo-, iso-, hyper-) and serum (5, 10, 20%) to determine the respective optimal level. The porcine discs were then cultured under the optimized conditions in the novel bioreactor, and were compared with fresh discs at day 14. For high-glucose, iso-osmolarity, or 10% serum, cell viability, the gene expression profile (for anabolic genes and catabolic genes), and glycosaminoglycan (GAG) and hydroxyproline (HYP) contents were more favorable than for other levels of glucose, osmolarity, and serum. When the immature discs were cultured under the optimized conditions using the novel bioreactor for 14 days, the viability of the immature NP was maintained based on histology, cell viability, GAG and HYP contents, and matrix molecule expression. In conclusion, the viability of the immature NP in organ culture could be maintained under the optimized culture conditions (high-glucose, iso-osmolarity, and 10% serum) in the substance exchanger-based bioreactor. © 2017 International Center for Artificial Organs and Transplantation and Wiley Periodicals, Inc.

Insect cells-baculovirus system for the production of difficult to express proteins.

PubMed

Osz-Papai, Judit; Radu, Laura; Abdulrahman, Wassim; Kolb-Cheynel, Isabelle; Troffer-Charlier, Nathalie; Birck, Catherine; Poterszman, Arnaud

2015-01-01

The production of sufficient quantities of homogenous protein not only is an essential prelude for structural investigations but also represents a rate-limiting step for many human functional studies. Although technologies for expression of recombinant proteins and complexes have been improved tremendously, in many cases, protein production remains a challenge and can be associated with considerable investment. This chapter describes simple and efficient protocols for expression screening and optimization of protein production in insect cells using the baculovirus expression system. We describe the procedure, starting from the cloning of a gene of interest into an expression transfer baculovirus vector, followed by generation of the recombinant virus by homologous recombination, evaluation of protein expression, and scale-up. Handling of insect cell cultures and preparation of bacmid for co-transfection are also detailed.

Optimal modified tracking performance for MIMO networked control systems with communication constraints.

PubMed

Wu, Jie; Zhou, Zhu-Jun; Zhan, Xi-Sheng; Yan, Huai-Cheng; Ge, Ming-Feng

2017-05-01

This paper investigates the optimal modified tracking performance of multi-input multi-output (MIMO) networked control systems (NCSs) with packet dropouts and bandwidth constraints. Some explicit expressions are obtained by using co-prime factorization and the spectral decomposition technique. The obtained results show that the optimal modified tracking performance is related to the intrinsic properties of a given plant such as non-minimum phase (NMP) zeros, unstable poles, and their directions. Furthermore, the modified factor, packet dropouts probability and bandwidth also impact the optimal modified tracking performance of the NCSs. The optimal modified tracking performance with channel input power constraint is obtained by searching through all stabilizing two-parameter compensator. Finally, some typical examples are given to illustrate the effectiveness of the theoretical results. Copyright © 2017 ISA. Published by Elsevier Ltd. All rights reserved.

A new approach of optimal control for a class of continuous-time chaotic systems by an online ADP algorithm

NASA Astrophysics Data System (ADS)

Song, Rui-Zhuo; Xiao, Wen-Dong; Wei, Qing-Lai

2014-05-01

We develop an online adaptive dynamic programming (ADP) based optimal control scheme for continuous-time chaotic systems. The idea is to use the ADP algorithm to obtain the optimal control input that makes the performance index function reach an optimum. The expression of the performance index function for the chaotic system is first presented. The online ADP algorithm is presented to achieve optimal control. In the ADP structure, neural networks are used to construct a critic network and an action network, which can obtain an approximate performance index function and the control input, respectively. It is proven that the critic parameter error dynamics and the closed-loop chaotic systems are uniformly ultimately bounded exponentially. Our simulation results illustrate the performance of the established optimal control method.

Exploring optimal topology of thermal cloaks by CMA-ES

NASA Astrophysics Data System (ADS)

Fujii, Garuda; Akimoto, Youhei; Takahashi, Masayuki

2018-02-01

This paper presents topology optimization for thermal cloaks expressed by level-set functions and explored using the covariance matrix adaptation evolution strategy (CMA-ES). Designed optimal configurations provide superior performances in thermal cloaks for the steady-state thermal conduction and succeed in realizing thermal invisibility, despite the structures being simply composed of iron and aluminum and without inhomogeneities caused by employing metamaterials. To design thermal cloaks, a prescribed objective function is used to evaluate the difference between the temperature field controlled by a thermal cloak and when no thermal insulator is present. The CMA-ES involves searches for optimal sets of level-set functions as design variables that minimize a regularized fitness involving a perimeter constraint. Through topology optimization subject to structural symmetries about four axes, we obtain a concept design of a thermal cloak that functions in an isotropic heat flux.

Expression of chicken parvovirus VP2 in chicken embryo fibroblasts requires codon optimization for production of naked DNA and vectored Meleagrid herpesvirus type 1 vaccines

USDA-ARS?s Scientific Manuscript database

Meleagrid herpesvirus type 1 (MeHV-1) is an ideal vector for the expression of antigens from pathogenic avian organisms in order to generate vaccines. Chicken parvovirus (ChPV) is a widespread infectious virus that causes serious disease in chickens. It is one of the etiological agents largely suspe...

Translation efficiency of heterologous proteins is significantly affected by the genetic context of RBS sequences in engineered cyanobacterium Synechocystis sp. PCC 6803.

PubMed

Thiel, Kati; Mulaku, Edita; Dandapani, Hariharan; Nagy, Csaba; Aro, Eva-Mari; Kallio, Pauli

2018-03-02

Photosynthetic cyanobacteria have been studied as potential host organisms for direct solar-driven production of different carbon-based chemicals from CO 2 and water, as part of the development of sustainable future biotechnological applications. The engineering approaches, however, are still limited by the lack of comprehensive information on most optimal expression strategies and validated species-specific genetic elements which are essential for increasing the intricacy, predictability and efficiency of the systems. This study focused on the systematic evaluation of the key translational control elements, ribosome binding sites (RBS), in the cyanobacterial host Synechocystis sp. PCC 6803, with the objective of expanding the palette of tools for more rigorous engineering approaches. An expression system was established for the comparison of 13 selected RBS sequences in Synechocystis, using several alternative reporter proteins (sYFP2, codon-optimized GFPmut3 and ethylene forming enzyme) as quantitative indicators of the relative translation efficiencies. The set-up was shown to yield highly reproducible expression patterns in independent analytical series with low variation between biological replicates, thus allowing statistical comparison of the activities of the different RBSs in vivo. While the RBSs covered a relatively broad overall expression level range, the downstream gene sequence was demonstrated in a rigorous manner to have a clear impact on the resulting translational profiles. This was expected to reflect interfering sequence-specific mRNA-level interaction between the RBS and the coding region, yet correlation between potential secondary structure formation and observed translation levels could not be resolved with existing in silico prediction tools. The study expands our current understanding on the potential and limitations associated with the regulation of protein expression at translational level in engineered cyanobacteria. The acquired information can be used for selecting appropriate RBSs for optimizing over-expression constructs or multicistronic pathways in Synechocystis, while underlining the complications in predicting the activity due to gene-specific interactions which may reduce the translational efficiency for a given RBS-gene combination. Ultimately, the findings emphasize the need for additional characterized insulator sequence elements to decouple the interaction between the RBS and the coding region for future engineering approaches.

Optimization of flow cytometric detection and cell sorting of transgenic Plasmodium parasites using interchangeable optical filters

PubMed Central

2012-01-01

Background Malaria remains a major cause of morbidity and mortality worldwide. Flow cytometry-based assays that take advantage of fluorescent protein (FP)-expressing malaria parasites have proven to be valuable tools for quantification and sorting of specific subpopulations of parasite-infected red blood cells. However, identification of rare subpopulations of parasites using green fluorescent protein (GFP) labelling is complicated by autofluorescence (AF) of red blood cells and low signal from transgenic parasites. It has been suggested that cell sorting yield could be improved by using filters that precisely match the emission spectrum of GFP. Methods Detection of transgenic Plasmodium falciparum parasites expressing either tdTomato or GFP was performed using a flow cytometer with interchangeable optical filters. Parasitaemia was evaluated using different optical filters and, after optimization of optics, the GFP-expressing parasites were sorted and analysed by microscopy after cytospin preparation and by imaging cytometry. Results A new approach to evaluate filter performance in flow cytometry using two-dimensional dot blot was developed. By selecting optical filters with narrow bandpass (BP) and maximum position of filter emission close to GFP maximum emission in the FL1 channel (510/20, 512/20 and 517/20; dichroics 502LP and 466LP), AF was markedly decreased and signal-background improve dramatically. Sorting of GFP-expressing parasite populations in infected red blood cells at 90 or 95% purity with these filters resulted in 50-150% increased yield when compared to the standard filter set-up. The purity of the sorted population was confirmed using imaging cytometry and microscopy of cytospin preparations of sorted red blood cells infected with transgenic malaria parasites. Discussion Filter optimization is particularly important for applications where the FP signal and percentage of positive events are relatively low, such as analysis of parasite-infected samples with in the intention of gene-expression profiling and analysis. The approach outlined here results in substantially improved yield of GFP-expressing parasites, and requires decreased sorting time in comparison to standard methods. It is anticipated that this protocol will be useful for a wide range of applications involving rare events. PMID:22950515

Development of phytase-expressing chlamydomonas reinhardtii for monogastric animal nutrition.

PubMed

Erpel, Fernanda; Restovic, Franko; Arce-Johnson, Patricio

2016-03-12

In plant-derived animal feedstuffs, nearly 80 % of the total phosphorus content is stored as phytate. However, phytate is poorly digested by monogastric animals such as poultry, swine and fish, as they lack the hydrolytic enzyme phytase; hence it is regarded as a nutritionally inactive compound from a phosphate bioavailability point of view. In addition, it also chelates important dietary minerals and essential amino acids. Therefore, dietary supplementation with bioavailable phosphate and exogenous phytases are required to achieve optimal animal growth. In order to simplify the obtaining and application processes, we developed a phytase expressing cell-wall deficient Chlamydomonas reinhardtii strain. In this work, we developed a transgenic microalgae expressing a fungal phytase to be used as a food supplement for monogastric animals. A codon optimized Aspergillus niger PhyA E228K phytase (mE228K) with improved performance at pH 3.5 was transformed into the plastid genome of Chlamydomonas reinhardtii in order to achieve optimal expression. We engineered a plastid-specific construction harboring the mE228K gene, which allowed us to obtain high expression level lines with measurable in vitro phytase activity. Both wild-type and cell-wall deficient strains were selected, as the latter is a suitable model for animal digestion. The enzymatic activity of the mE228K expressing lines were approximately 5 phytase units per gram of dry biomass at pH 3.5 and 37 °C, similar to physiological conditions and economically competitive for use in commercial activities. A reference basis for the future biotechnological application of microalgae is provided in this work. A cell-wall deficient transgenic microalgae with phytase activity at gastrointestinal pH and temperature and suitable for pellet formation was developed. Moreover, the associated microalgae biomass costs of this strain would be between US$5 and US$60 per ton of feedstuff, similar to the US$2 per ton of feedstuffs of commercially available phytases. Our data provide evidence of phytate-hydrolyzing microalgae biomass for use as a food additive without the need for protein purification.

Armored CAR T-cells: utilizing cytokines and pro-inflammatory ligands to enhance CAR T-cell anti-tumour efficacy.

PubMed

Yeku, Oladapo O; Brentjens, Renier J

2016-04-15

Chimaeric antigen receptor (CAR) T-cells are T-cells that have been genetically modified to express an artificial construct consisting of a synthetic T-cell receptor (TCR) targeted to a predetermined antigen expressed on a tumour. Coupling the T-cell receptor to a CD3ζ signalling domain paved the way for first generation CAR T-cells that were efficacious against cluster of differentiation (CD)19-expressing B-cell malignancies. Optimization with additional signalling domains such as CD28 or 4-1BB in addition to CD3ζ provided T-cell activation signal 2 and further improved the efficacy and persistence of these second generation CAR T-cells. Third generation CAR T-cells which utilize two tandem costimulatory domains have also been reported. In this review, we discuss a different approach to optimization of CAR T-cells. Through additional genetic modifications, these resultant armored CAR T-cells are typically modified second generation CAR T-cells that have been further optimized to inducibly or constitutively secrete active cytokines or express ligands that further armor CAR T-cells to improve efficacy and persistence. The choice of the 'armor' agent is based on knowledge of the tumour microenvironment and the roles of other elements of the innate and adaptive immune system. Although there are several variants of armored CAR T-cells under investigation, here we focus on three unique approaches using interleukin-12 (IL-12), CD40L and 4-1BBL. These agents have been shown to further enhance CAR T-cell efficacy and persistence in the face of a hostile tumour microenvironment via different mechanisms. © 2016 Authors; published by Portland Press Limited.

Armored CAR T-cells: utilizing cytokines and pro-inflammatory ligands to enhance CAR T-cell anti-tumour efficacy

PubMed Central

Yeku, Oladapo O.; Brentjens, Renier J.

2017-01-01

Chimaeric antigen receptor (CAR) T-cells are T-cells that have been genetically modified to express an artificial construct consisting of a synthetic T-cell receptor (TCR) targeted to a predetermined antigen expressed on a tumour. Coupling the T-cell receptor to a CD3ζ signalling domain paved the way for first generation CAR T-cells that were efficacious against cluster of differentiation (CD)19-expressing B-cell malignancies. Optimization with additional signalling domains such as CD28 or 4-1BB in addition to CD3ζ provided T-cell activation signal 2 and further improved the efficacy and persistence of these second generation CAR T-cells. Third generation CAR T-cells which utilize two tandem costimulatory domains have also been reported. In this review, we discuss a different approach to optimization of CAR T-cells. Through additional genetic modifications, these resultant armored CAR T-cells are typically modified second generation CAR T-cells that have been further optimized to inducibly or constitutively secrete active cytokines or express ligands that further armor CAR T-cells to improve efficacy and persistence. The choice of the ‘armor’ agent is based on knowledge of the tumour microenvironment and the roles of other elements of the innate and adaptive immune system. Although there are several variants of armored CAR T-cells under investigation, here we focus on three unique approaches using interleukin-12 (IL-12), CD40L and 4-1BBL. These agents have been shown to further enhance CAR T-cell efficacy and persistence in the face of a hostile tumour microenvironment via different mechanisms. PMID:27068948

Stromal-derived factor 1 directly promotes genes expressed within the ovulatory cascade in feline cumulus oocyte complexes.

PubMed

Rojo, Julieta L; Linari, Martina; Young, Kelly A; Peluffo, Marina C

2018-05-01

We hypothesized that the chemokine SDF1/CXCR4 system was present in feline cumulus-oocyte complexes (COCs) and that COCs cultured with SDF1 would directly upregulate gene expression in the ovulatory cascade. Ovaries (n = 50) were obtained from adult domestic cats during the breeding season and COCs were recovered from antral follicles. Because IVM media triggers cumulus-oocyte expansion, culture conditions needed to be optimized to study periovulatory genes. After optimization, the effects of 25 ng/ml SDF1 and the CXCR4 inhibitor were examined in a COC culture for 3, 12, and 24 h. MEM-hepes with 1% of charcoal stripped-FBS was the optimized culture medium, assessed by the expansion of COCs at 24 h in the gonadotropin (GNT) group but not in the media with serum alone. The mRNA expression of HAS2, TNFAIP6, PTX3, and AREG peaked at 3 h in GNT group as compared to all other groups (p < 0.05). COCs cultured with SDF1 showed increased HAS2 and TNFAIP6 mRNA expression at 3 h compared to negative controls and to the CXCR4 inhibitor group. CXCR4 and SDF1 immunostaining was present in both cumulus cells and the oocyte. These results demonstrate that GNT stimulation upregulates key periovulatory genes and expansion in feline COCs from antral follicles, and support the use of this culture system to examine molecular processes within the COC. In addition, SDF1 directly promotes key periovulatory genes in feline COCs, suggesting that the SDF1-CXCR4 pathway may extend its function beyond a chemoattractant, and may play a direct role within the COC.

The use of radiocobalt as a label improves imaging of EGFR using DOTA-conjugated Affibody molecule.

PubMed

Garousi, Javad; Andersson, Ken G; Dam, Johan H; Olsen, Birgitte B; Mitran, Bogdan; Orlova, Anna; Buijs, Jos; Ståhl, Stefan; Löfblom, John; Thisgaard, Helge; Tolmachev, Vladimir

2017-07-20

Several anti-cancer therapies target the epidermal growth factor receptor (EGFR). Radionuclide imaging of EGFR expression in tumours may aid in selection of optimal cancer therapy. The 111 In-labelled DOTA-conjugated Z EGFR:2377 Affibody molecule was successfully used for imaging of EGFR-expressing xenografts in mice. An optimal combination of radionuclide, chelator and targeting protein may further improve the contrast of radionuclide imaging. The aim of this study was to evaluate the targeting properties of radiocobalt-labelled DOTA-Z EGFR:2377 . DOTA-Z EGFR:2377 was labelled with 57 Co (T 1/2  = 271.8 d), 55 Co (T 1/2  = 17.5 h), and, for comparison, with the positron-emitting radionuclide 68 Ga (T 1/2  = 67.6 min) with preserved specificity of binding to EGFR-expressing A431 cells. The long-lived cobalt radioisotope 57 Co was used in animal studies. Both 57 Co-DOTA-Z EGFR:2377 and 68 Ga-DOTA-Z EGFR:2377 demonstrated EGFR-specific accumulation in A431 xenografts and EGFR-expressing tissues in mice. Tumour-to-organ ratios for the radiocobalt-labelled DOTA-Z EGFR:2377 were significantly higher than for the gallium-labelled counterpart already at 3 h after injection. Importantly, 57 Co-DOTA-Z EGFR:2377 demonstrated a tumour-to-liver ratio of 3, which is 7-fold higher than the tumour-to-liver ratio for 68 Ga-DOTA-Z EGFR:2377 . The results of this study suggest that the positron-emitting cobalt isotope 55 Co would be an optimal label for DOTA-Z EGFR:2377 and further development should concentrate on this radionuclide as a label.

Optimization of supercritical carbon dioxide extraction of Piper Betel Linn leaves oil and total phenolic content

NASA Astrophysics Data System (ADS)

Aziz, A. H. A.; Yunus, M. A. C.; Arsad, N. H.; Lee, N. Y.; Idham, Z.; Razak, A. Q. A.

2016-11-01

Supercritical Carbon Dioxide (SC-CO2) Extraction was applied to extract piper betel linn leaves. The piper betel leaves oil was used antioxidant, anti-diabetic, anticancer and antistroke. The aim of this study was to optimize the conditions of pressure, temperature and flowrate for oil yield and total phenolic content. The operational conditions of SC-CO2 studied were pressure (10, 20, 30 MPa), temperature (40, 60, 80 °C) and flowrate carbon dioxide (4, 6, 8 mL/min). The constant parameters were average particle size and extraction regime, 355pm and 3.5 hours respectively. First order polynomial expression was used to express the extracted oil while second order polynomial expression was used to express the total phenolic content and the both results were satisfactory. The best conditions to maximize the total extraction oil yields and total phenolic content were 30 MPa, 80 °C and 4.42 mL/min leading to 7.32% of oil and 29.72 MPa, 67.53 °C and 7.98 mL/min leading to 845.085 mg GAE/g sample. In terms of optimum condition with high extraction yield and high total phenolic content in the extracts, the best operating conditions were 30 MPa, 78 °C and 8 mL/min with 7.05% yield and 791.709 mg gallic acid equivalent (GAE)/g sample. The most dominant condition for extraction of oil yield and phenolic content were pressure and CO2 flowrate. The results show a good fit to the proposed model and the optimal conditions obtained were within the experimental range with the value of R2 was 96.13% for percentage yield and 98.52% for total phenolic content.

Metabolic engineering of Escherichia coli for production of valerenadiene.

PubMed

Nybo, S Eric; Saunders, Jacqueline; McCormick, Sean P

2017-11-20

Valeriana officinalis is a medicinal herb which produces a suite of compounds in its root tissue useful for treatment of anxiety and insomnia. The sesquiterpene components of the root extract, valerenic acid and valerena-1,10-diene, are thought to contribute to most of the observed anxiolytic of Valerian root preparations. However, valerenic acid and its biosynthetic intermediates are only produced in low quantities in the roots of V. officinalis. Thus, in this report, Escherichia coli was metabolically engineered to produce substantial quantities of valerena-1,10-diene in shake flask fermentations with decane overlay. Expression of the wildtype valerenadiene synthase gene (pZE-wvds) resulted in production of 12μg/mL in LB cultures using endogenous FPP metabolism. Expression of a codon-optimized version of the valerenadiene synthase gene (pZE-cvds) resulted in 3-fold higher titers of valerenadiene (32μg/mL). Co-expression of pZE-cvds with an engineered methyl erythritol phosphate (MEP) pathway improved valerenadiene titers 65-fold to 2.09mg/L valerenadiene. Optimization of the fermentation medium to include glycerol supplementation enhanced yields by another 5.5-fold (11.0mg/L valerenadiene). The highest production of valerenadiene resulted from engineering the codon-optimized valerenadiene synthase gene under strong P trc and P T7 promoters and via co-expression of an exogenous mevalonate (MVA) pathway. These efforts resulted in an E. coli production strain that produced 62.0mg/L valerenadiene (19.4mg/L/OD 600 specific productivity). This E. coli production platform will serve as the foundation for the synthesis of novel valerenic acid analogues potentially useful for the treatment of anxiety disorders. Copyright © 2017 Elsevier B.V. All rights reserved.

Comparison of detection methods for cell surface globotriaosylceramide.

PubMed

Kim, Minji; Binnington, Beth; Sakac, Darinka; Fernandes, Kimberly R; Shi, Sheryl P; Lingwood, Clifford A; Branch, Donald R

2011-08-31

The cell surface-expressed glycosphingolipid (GSL), globotriaosylceramide (Gb(3)), is becoming increasingly important and is widely studied in the areas of verotoxin (VT)-mediated cytotoxicity, human immunodeficiency virus (HIV) infection, immunology and cancer. However, despite its diverse roles and implications, an optimized detection method for cell surface Gb(3) has not been determined. GSLs are differentially organized in the plasma membrane which can affect their availability for protein binding. To examine various detection methods for cell surface Gb(3), we compared four reagents for use in flow cytometry analysis. A natural ligand (VT1B) and three different monoclonal antibodies (mAbs) were optimized and tested on various human cell lines for Gb(3) detection. A differential detection pattern of cell surface Gb(3) expression, which was influenced by the choice of reagent, was observed. Two mAb were found to be suboptimal. However, two other methods were found to be useful as defined by their high percentage of positivity and mean fluorescence intensity (MFI) values. Rat IgM anti-Gb(3) mAb (clone 38-13) using phycoerythrin-conjugated secondary antibody was found to be the most specific detection method while the use of VT1B conjugated to Alexa488 fluorochrome was found to be the most sensitive; showing a rare crossreactivity only when Gb(4) expression was highly elevated. The findings of this study demonstrate the variability in detection of Gb(3) depending on the reagent and cell target used and emphasize the importance of selecting an optimal methodology in studies for the detection of cell surface expression of Gb(3). Copyright © 2011 Elsevier B.V. All rights reserved.

Identification and characterization of highly versatile peptide-vectors that bind non-competitively to the low-density lipoprotein receptor for in vivo targeting and delivery of small molecules and protein cargos

PubMed Central

David, Marion; Lécorché, Pascaline; Masse, Maxime; Faucon, Aude; Abouzid, Karima; Gaudin, Nicolas; Varini, Karine; Gassiot, Fanny; Ferracci, Géraldine; Jacquot, Guillaume; Vlieghe, Patrick

2018-01-01

Insufficient membrane penetration of drugs, in particular biotherapeutics and/or low target specificity remain a major drawback in their efficacy. We propose here the rational characterization and optimization of peptides to be developed as vectors that target cells expressing specific receptors involved in endocytosis or transcytosis. Among receptors involved in receptor-mediated transport is the LDL receptor. Screening complex phage-displayed peptide libraries on the human LDLR (hLDLR) stably expressed in cell lines led to the characterization of a family of cyclic and linear peptides that specifically bind the hLDLR. The VH411 lead cyclic peptide allowed endocytosis of payloads such as the S-Tag peptide or antibodies into cells expressing the hLDLR. Size reduction and chemical optimization of this lead peptide-vector led to improved receptor affinity. The optimized peptide-vectors were successfully conjugated to cargos of different nature and size including small organic molecules, siRNAs, peptides or a protein moiety such as an Fc fragment. We show that in all cases, the peptide-vectors retain their binding affinity to the hLDLR and potential for endocytosis. Following i.v. administration in wild type or ldlr-/- mice, an Fc fragment chemically conjugated or fused in C-terminal to peptide-vectors showed significant biodistribution in LDLR-enriched organs. We have thus developed highly versatile peptide-vectors endowed with good affinity for the LDLR as a target receptor. These peptide-vectors have the potential to be further developed for efficient transport of therapeutic or imaging agents into cells -including pathological cells—or organs that express the LDLR. PMID:29485998

High-level expression of a synthetic gene encoding a sweet protein, monellin, in Escherichia coli.

PubMed

Chen, Zhongjun; Cai, Heng; Lu, Fuping; Du, Lianxiang

2005-11-01

The expression of a synthetic gene encoding monellin, a sweet protein, in E. coli under the control of T7 promoter from phage is described. The single-chain monellin gene was designed based on the biased codons of E. coli so as to optimize its expression. Monellin was produced and accounted for 45% of total soluble proteins. It was purified to yield 43 mg protein per g dry cell wt. The purity of the recombinant protein was confirmed by SDS-PAGE.

Acquisition of High Field Nuclear Magnetic Resonance Spectrometers for Research in Molecular Structure, Function and Dynamics

DTIC Science & Technology

2011-09-01

Fbg αC 242-424. DNA for expressing Fbg αC 242-424 and FXIII A2 in Ecoli have been obtained from collaborators. Strategies for expressing and...the coming months. It will be important to 11 verify that the expressed FXIII A2 is active and that the Fbg αC 242-424 can serve as an effective...optimized. For the larger substrate Fbg αC 242-424, we will need to proteolytically digest the quenched kinetic samples with chymotrypsin prior to

Parameters optimization for magnetic resonance coupling wireless power transmission.

PubMed

Li, Changsheng; Zhang, He; Jiang, Xiaohua

2014-01-01

Taking maximum power transmission and power stable transmission as research objectives, optimal design for the wireless power transmission system based on magnetic resonance coupling is carried out in this paper. Firstly, based on the mutual coupling model, mathematical expressions of optimal coupling coefficients for the maximum power transmission target are deduced. Whereafter, methods of enhancing power transmission stability based on parameters optimal design are investigated. It is found that the sensitivity of the load power to the transmission parameters can be reduced and the power transmission stability can be enhanced by improving the system resonance frequency or coupling coefficient between the driving/pick-up coil and the transmission/receiving coil. Experiment results are well conformed to the theoretical analysis conclusions.

Design of compact long-period gratings imprinted in optimized photonic crystal fibers

NASA Astrophysics Data System (ADS)

Seraji, F. E.; Chehreghani Anzabi, L.; Farsinezhad, S.

2009-10-01

To imprint a long-period grating (LPG) in a photonic crystal fiber (PCF) with an optimum response, first the parameters of the PCF should be optimized. In this paper, by using a semi-analytical enhanced improved vectorial effective index method, the optimized PCF parameters are determined by dividing the single-mode operation of the PCF into two regions in terms of air-hole spacing Λ ( Λ>3 μm and Λ≤3 μm). For each region appropriate expressions are suggested to evaluate the PCF parameters. By calculating the effective refractive index difference between the optimized core and cladding of the PCF under a phase-matching condition, the optimum grating period in terms of the PCF parameters is obtained.

Contraction Options and Optimal Multiple-Stopping in Spectrally Negative Lévy Models

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yamazaki, Kazutoshi, E-mail: kyamazak@kansai-u.ac.jp

This paper studies the optimal multiple-stopping problem arising in the context of the timing option to withdraw from a project in stages. The profits are driven by a general spectrally negative Lévy process. This allows the model to incorporate sudden declines of the project values, generalizing greatly the classical geometric Brownian motion model. We solve the one-stage case as well as the extension to the multiple-stage case. The optimal stopping times are of threshold-type and the value function admits an expression in terms of the scale function. A series of numerical experiments are conducted to verify the optimality and tomore » evaluate the efficiency of the algorithm.« less

Construction of a directed hammerhead ribozyme library: towards the identification of optimal target sites for antisense-mediated gene inhibition.

PubMed Central

Pierce, M L; Ruffner, D E

1998-01-01

Antisense-mediated gene inhibition uses short complementary DNA or RNA oligonucleotides to block expression of any mRNA of interest. A key parameter in the success or failure of an antisense therapy is the identification of a suitable target site on the chosen mRNA. Ultimately, the accessibility of the target to the antisense agent determines target suitability. Since accessibility is a function of many complex factors, it is currently beyond our ability to predict. Consequently, identification of the most effective target(s) requires examination of every site. Towards this goal, we describe a method to construct directed ribozyme libraries against any chosen mRNA. The library contains nearly equal amounts of ribozymes targeting every site on the chosen transcript and the library only contains ribozymes capable of binding to that transcript. Expression of the ribozyme library in cultured cells should allow identification of optimal target sites under natural conditions, subject to the complexities of a fully functional cell. Optimal target sites identified in this manner should be the most effective sites for therapeutic intervention. PMID:9801305

How biochemical constraints of cellular growth shape evolutionary adaptations in metabolism.

PubMed

Berkhout, Jan; Bosdriesz, Evert; Nikerel, Emrah; Molenaar, Douwe; de Ridder, Dick; Teusink, Bas; Bruggeman, Frank J

2013-06-01

Evolutionary adaptations in metabolic networks are fundamental to evolution of microbial growth. Studies on unneeded-protein synthesis indicate reductions in fitness upon nonfunctional protein synthesis, showing that cell growth is limited by constraints acting on cellular protein content. Here, we present a theory for optimal metabolic enzyme activity when cells are selected for maximal growth rate given such growth-limiting biochemical constraints. We show how optimal enzyme levels can be understood to result from an enzyme benefit minus cost optimization. The constraints we consider originate from different biochemical aspects of microbial growth, such as competition for limiting amounts of ribosomes or RNA polymerases, or limitations in available energy. Enzyme benefit is related to its kinetics and its importance for fitness, while enzyme cost expresses to what extent resource consumption reduces fitness through constraint-induced reductions of other enzyme levels. A metabolic fitness landscape is introduced to define the fitness potential of an enzyme. This concept is related to the selection coefficient of the enzyme and can be expressed in terms of its fitness benefit and cost.

Development of high protein, high fiber smoothie as a grab-and-go breakfast option using response surface methodology.

PubMed

Mehta, Dipakkumar; Kumar, M H Sathish; Sabikhi, Latha

2017-11-01

The current work aimed to formulate smoothie by optimizing varying levels of soy protein isolate (1.5-2.5% w/w), sucralose (150-190 ppm) and pectin (0.3-0.5% w/w) along with milk, legume (chickpea), vegetable (carrot), fruit (mango), honey and trisodium citrate by response surface methodology on the basis of sensory (color and appearance, flavor, consistency, sweetness and overall acceptability) and physical (expressible serum and viscosity) responses. Soy protein isolate and pectin levels influenced color and appearance, flavor, consistency and overall acceptability significantly. Soy protein isolate and pectin showed a positive correlation with viscosity of smoothie with reduced expressible serum. Smoothie was optimized with 1.8% (w/w) soy protein isolate, 166.8 ppm sucralose, and 0.5% (w/w) pectin with acceptable quality. One serving (325 ml) of optimized smoothie provides approximately 23% protein, 27% dietary fiber of the recommended daily values and provides approximately 74 kcal per 100 ml of smoothie, which renders smoothie as a high protein, high fiber, grab-and-go breakfast option.

Comparative evolutionary genomics of Corynebacterium with special reference to codon and amino acid usage diversities.

PubMed

Pal, Shilpee; Sarkar, Indrani; Roy, Ayan; Mohapatra, Pradeep K Das; Mondal, Keshab C; Sen, Arnab

2018-02-01

The present study has been aimed to the comparative analysis of high GC composition containing Corynebacterium genomes and their evolutionary study by exploring codon and amino acid usage patterns. Phylogenetic study by MLSA approach, indel analysis and BLAST matrix differentiated Corynebacterium species in pathogenic and non-pathogenic clusters. Correspondence analysis on synonymous codon usage reveals that, gene length, optimal codon frequencies and tRNA abundance affect the gene expression of Corynebacterium. Most of the optimal codons as well as translationally optimal codons are C ending i.e. RNY (R-purine, N-any nucleotide base, and Y-pyrimidine) and reveal translational selection pressure on codon bias of Corynebacterium. Amino acid usage is affected by hydrophobicity, aromaticity, protein energy cost, etc. Highly expressed genes followed the cost minimization hypothesis and are less diverged at their synonymous positions of codons. Functional analysis of core genes shows significant difference in pathogenic and non-pathogenic Corynebacterium. The study reveals close relationship between non-pathogenic and opportunistic pathogenic Corynebaterium as well as between molecular evolution and survival niches of the organism.

Optimal Design of Litz Wire Coils With Sandwich Structure Wirelessly Powering an Artificial Anal Sphincter System.

PubMed

Ke, Lei; Yan, Guozheng; Yan, Sheng; Wang, Zhiwu; Li, Xiaoyang

2015-07-01

Transcutaneous energy transfer system (TETS) is widely used to energize implantable biomedical devices. As a key part of the TETS, a pair of applicable coils with low losses, high unloaded Q factor, and strong coupling is required to realize an efficient TETS. This article presents an optimal design methodology of planar litz wire coils sandwiched between two ferrite substrates wirelessly powering a novel mechanical artificial anal sphincter system for treating severe fecal incontinence, with focus on the main parameters of the coils such as the wire diameter, number of turns, geometry, and the properties of the ferrite substrate. The theoretical basis of optimal power transfer efficiency in an inductive link was analyzed. A set of analytical expressions are outlined to calculate the winding resistance of a litz wire coil on ferrite substrate, taking into account eddy-current losses, including conduction losses and induction losses. Expressions that describe the geometrical dimension dependence of self- and mutual inductance are derived. The influence of ferrite substrate relative permeability and dimensions is also considered. We have used this foundation to devise an applicable coil design method that starts with a set of realistic constraints and ends with the optimal coil pair geometries. All theoretical predictions are verified with measurements using different types of fabricated coils. The results indicate that the analysis is useful for optimizing the geometry design of windings and the ferrite substrate in a sandwich structure as part of which, in addition to providing design insight, allows speeding up the system efficiency-optimizing design process. Copyright © 2015 International Center for Artificial Organs and Transplantation and Wiley Periodicals, Inc.

Apolipoprotein A-I mutant proteins having cysteine substitutions and polynucleotides encoding same

DOEpatents

Oda, Michael N [Benicia, CA; Forte, Trudy M [Berkeley, CA

2007-05-29

Functional Apolipoprotein A-I mutant proteins, having one or more cysteine substitutions and polynucleotides encoding same, can be used to modulate paraoxonase's arylesterase activity. These ApoA-I mutant proteins can be used as therapeutic agents to combat cardiovascular disease, atherosclerosis, acute phase response and other inflammatory related diseases. The invention also includes modifications and optimizations of the ApoA-I nucleotide sequence for purposes of increasing protein expression and optimization.

Characterization and optimization of ArtinM lectin expression in Escherichia coli.

PubMed

Pranchevicius, Maria-Cristina S; Oliveira, Leandro L; Rosa, José C; Avanci, Nilton C; Quiapim, Andréa C; Roque-Barreira, Maria-Cristina; Goldman, Maria-Helena S

2012-08-02

ArtinM is a d-mannose-specific lectin from Artocarpus integrifolia seeds that induces neutrophil migration and activation, degranulation of mast cells, acceleration of wound healing, induction of interleukin-12 production by macrophages and dendritic cells, and protective T helper 1 immune response against Leishmania major, Leishmania amazonensis and Paracoccidioides brasiliensis infections. Considering the important biological properties of ArtinM and its therapeutic applicability, this study was designed to produce high-level expression of active recombinant ArtinM (rArtinM) in Escherichia coli system. The ArtinM coding region was inserted in pET29a(+) vector and expressed in E. coli BL21(DE3)-Codon Plus-RP. The conditions for overexpression of soluble ArtinM were optimized testing different parameters: temperatures (20, 25, 30 or 37°C) and shaking speeds (130, 200 or 220 rpm) during induction, concentrations of the induction agent IPTG (0.01-4 mM) and periods of induction (1-19 h). BL21-CodonPlus(DE3)-RP cells induced under the optimized conditions (incubation at 20°C, at a shaking speed of 130 rpm, induction with 0.4 mM IPTG for 19 h) resulted in the accumulation of large amounts of soluble rArtinM. The culture provided 22.4 mg/L of rArtinM, which activity was determined by its one-step purification through affinity chromatography on immobilized d-mannose and glycoarray analysis. Gel filtration showed that rArtinM is monomeric, contrasting with the tetrameric form of the plant native protein (jArtinM). The analysis of intact rArtinM by mass spectrometry revealed a 16,099.5 Da molecular mass, and the peptide mass fingerprint and esi-cid-ms/ms of amino acid sequences of peptides from a tryptic digest covered 41% of the total ArtinM amino acid sequence. In addition, circular dichroism and fluorescence spectroscopy of rArtinM indicated that its global fold comprises β-sheet structure. Overall, the optimized process to express rArtinM in E. coli provided high amounts of soluble, correctly folded and active recombinant protein, compatible with large scale production of the lectin.

Covariance expressions for eigenvalue and eigenvector problems

NASA Astrophysics Data System (ADS)

Liounis, Andrew J.

There are a number of important scientific and engineering problems whose solutions take the form of an eigenvalue--eigenvector problem. Some notable examples include solutions to linear systems of ordinary differential equations, controllability of linear systems, finite element analysis, chemical kinetics, fitting ellipses to noisy data, and optimal estimation of attitude from unit vectors. In many of these problems, having knowledge of the eigenvalue and eigenvector Jacobians is either necessary or is nearly as important as having the solution itself. For instance, Jacobians are necessary to find the uncertainty in a computed eigenvalue or eigenvector estimate. This uncertainty, which is usually represented as a covariance matrix, has been well studied for problems similar to the eigenvalue and eigenvector problem, such as singular value decomposition. There has been substantially less research on the covariance of an optimal estimate originating from an eigenvalue-eigenvector problem. In this thesis we develop two general expressions for the Jacobians of eigenvalues and eigenvectors with respect to the elements of their parent matrix. The expressions developed make use of only the parent matrix and the eigenvalue and eigenvector pair under consideration. In addition, they are applicable to any general matrix (including complex valued matrices, eigenvalues, and eigenvectors) as long as the eigenvalues are simple. Alongside this, we develop expressions that determine the uncertainty in a vector estimate obtained from an eigenvalue-eigenvector problem given the uncertainty of the terms of the matrix. The Jacobian expressions developed are numerically validated with forward finite, differencing and the covariance expressions are validated using Monte Carlo analysis. Finally, the results from this work are used to determine covariance expressions for a variety of estimation problem examples and are also applied to the design of a dynamical system.

Relative gene expression of bile salt hydrolase and surface proteins in two putative indigenous Lactobacillus plantarum strains under in vitro gut conditions.

PubMed

Duary, Raj Kumar; Batish, Virender Kumar; Grover, Sunita

2012-03-01

Probiotic bacteria must overcome the toxicity of bile salts secreted in the gut and adhere to the epithelial cells to enable their better colonization with extended transit time. Expression of bile salt hydrolase and other proteins on the surface of probiotic bacteria can help in better survivability and optimal functionality in the gut. Two putative Lactobacillus plantarum isolates i.e., Lp9 and Lp91 along with standard strain CSCC5276 were used. A battery of six housekeeping genes viz. gapB, dnaG, gyrA, ldhD, rpoD and 16S rRNA were evaluated by using geNorm 3.4 excel based application for normalizing the expression of bile salt hydrolase (bsh), mucus-binding protein (mub), mucus adhesion promoting protein (mapA), and elongation factor thermo unstable (EF-Tu) in Lp9 and Lp91. The maximal level of relative bsh gene expression was recorded in Lp91 with 2.89 ± 0.14, 4.57 ± 0.37 and 6.38 ± 0.19 fold increase at 2% bile salt concentration after 1, 2 and 3 h, respectively. Similarly, mub and mapA genes were maximally expressed in Lp9 at the level of 20.07 ± 1.28 and 30.92 ± 1.51 fold, when MRS was supplemented with 0.05% mucin and 1% each of bile and pancreatin (pH 6.5). However, in case of EF-Tu, the maximal expression of 42.84 ± 5.64 fold was recorded in Lp91 in the presence of mucin alone (0.05%). Hence, the expression of bsh, mub, mapA and EF-Tu could be considered as prospective biomarkers for screening of novel probiotic lactobacillus strains for optimal functionality in the gut.

Co-culture of chondrocytes and bone marrow mesenchymal stem cells in vitro enhances the expression of cartilaginous extracellular matrix components.

PubMed

Qing, Chang; Wei-ding, Cui; Wei-min, Fan

2011-04-01

Chondrocytes and bone marrow mesenchymal stem cells (BMSCs) are frequently used as seed cells in cartilage tissue engineering. In the present study, we determined if the co-culture of rabbit articular chondrocytes and BMSCs in vitro promotes the expression of cartilaginous extracellular matrix and, if so, what is the optimal ratio of the two cell types. Cultures of rabbit articular chondrocytes and BMSCs were expanded in vitro and then cultured individually or at a chondrocyte:BMSC ratio of 4:1, 2:1, 1:1, 1:2, 1:4 for 21 days and cultured in DMEM/F12. BMSCs were cultured in chondrogenic induction medium. Quantitative real-time RT-PCR and Western blot were used to evaluate gene expression. In the co-cultures, type II collagen and aggrecan expression increased on days 14 and 21. At the mRNA level, the expression of type II collagen and aggrecan on day 21 was much higher in the 4:1, 2:1, and 1:1 groups than in either the articular chondrocyte group or the induced BMSC group, and the best ratio of co-culture groups seems to be 2:1. Also on day 21, the expression of type II collagen and aggrecan proteins in the 2:1 group was much higher than in all other groups. The results demonstrate that the co-culture of rabbit chondrocytes and rabbit BMSCs at defined ratios can promote the expression of cartilaginous extracellular matrix. The optimal cell ratio appears to be 2:1 (chondrocytes:BMSCs). This approach has potential applications in cartilage tissue engineering since it provides a protocol for maintaining and promoting seed-cell differentiation and function.

Development of an optimized tetracycline-inducible expression system to increase the accumulation of interleukin-10 in tobacco BY-2 suspension cells

PubMed Central

2012-01-01

Background Plant cell suspension cultures can be used for the production of valuable pharmaceutical and industrial proteins. When the recombinant protein is secreted into the culture medium, restricting expression to a defined growth phase can improve both the quality and quantity of the recovered product by minimizing proteolytic activity. Temporal restriction is also useful for recombinant proteins whose constitutive expression affects cell growth and viability, such as viral interleukin-10 (vIL-10). Results We have developed a novel, tetracycline-inducible system suitable for tobacco BY-2 suspension cells which increases the yields of vIL-10. The new system is based on a binary vector that is easier to handle than conventional vectors, contains an enhanced inducible promoter and 5′-UTR to improve yields, and incorporates a constitutively-expressed visible marker gene to allow the rapid and straightforward selection of the most promising transformed clones. Stable transformation of BY-2 cells with this vector, without extensive optimization of the induction conditions, led to a 3.5 fold increase in vIL-10 levels compared to constitutive expression in the same host. Conclusions We have developed an effective and straightforward molecular farming platform technology that improves both the quality and the quantity of recombinant proteins produced in plant cells, particularly those whose constitutive expression has a negative impact on plant growth and development. Although we tested the platform using vIL-10 produced in BY-2 cells, it can be applied to other host/product combinations and is also useful for basic research requiring strictly controlled transgene expression. PMID:22784336

H-NS Facilitates Sequence Diversification of Horizontally Transferred DNAs during Their Integration in Host Chromosomes

PubMed Central

Higashi, Koichi; Tobe, Toru; Kanai, Akinori; Uyar, Ebru; Ishikawa, Shu; Suzuki, Yutaka; Ogasawara, Naotake; Kurokawa, Ken; Oshima, Taku

2016-01-01

Bacteria can acquire new traits through horizontal gene transfer. Inappropriate expression of transferred genes, however, can disrupt the physiology of the host bacteria. To reduce this risk, Escherichia coli expresses the nucleoid-associated protein, H-NS, which preferentially binds to horizontally transferred genes to control their expression. Once expression is optimized, the horizontally transferred genes may actually contribute to E. coli survival in new habitats. Therefore, we investigated whether and how H-NS contributes to this optimization process. A comparison of H-NS binding profiles on common chromosomal segments of three E. coli strains belonging to different phylogenetic groups indicated that the positions of H-NS-bound regions have been conserved in E. coli strains. The sequences of the H-NS-bound regions appear to have diverged more so than H-NS-unbound regions only when H-NS-bound regions are located upstream or in coding regions of genes. Because these regions generally contain regulatory elements for gene expression, sequence divergence in these regions may be associated with alteration of gene expression. Indeed, nucleotide substitutions in H-NS-bound regions of the ybdO promoter and coding regions have diversified the potential for H-NS-independent negative regulation among E. coli strains. The ybdO expression in these strains was still negatively regulated by H-NS, which reduced the effect of H-NS-independent regulation under normal growth conditions. Hence, we propose that, during E. coli evolution, the conservation of H-NS binding sites resulted in the diversification of the regulation of horizontally transferred genes, which may have facilitated E. coli adaptation to new ecological niches. PMID:26789284

Bacterial expression of self-assembling peptide hydrogelators

NASA Astrophysics Data System (ADS)

Sonmez, Cem

For tissue regeneration and drug delivery applications, various architectures are explored to serve as biomaterial tools. Via de novo design, functional peptide hydrogel materials have been developed as scaffolds for biomedical applications. The objective of this study is to investigate bacterial expression as an alternative method to chemical synthesis for the recombinant production of self-assembling peptides that can form rigid hydrogels under physiological conditions. The Schneider and Pochan Labs have designed and characterized a 20 amino acid beta-hairpin forming amphiphilic peptide containing a D-residue in its turn region (MAX1). As a result, this peptide must be prepared chemically. Peptide engineering, using the sequence of MAX1 as a template, afforded a small family of peptides for expression (EX peptides) that have different turn sequences consisting of natural amino acids and amenable to bacterial expression. Each sequence was initially chemically synthesized to quickly assess the material properties of its corresponding gel. One model peptide EX1, was chosen to start the bacterial expression studies. DNA constructs facilitating the expression of EX1 were designed in such that the peptide could be expressed with different fusion partners and subsequently cleaved by enzymatic or chemical means to afford the free peptide. Optimization studies were performed to increase the yield of pure peptide that ultimately allowed 50 mg of pure peptide to be harvested from one liter of culture, providing an alternate means to produce this hydrogel-forming peptide. Recombinant production of other self-assembling hairpins with different turn sequences was also successful using this optimized protocol. The studies demonstrate that new beta-hairpin self-assembling peptides that are amenable to bacterial production and form rigid hydrogels at physiological conditions can be designed and produced by fermentation in good yield at significantly reduced cost when compared to chemical synthesis.

H-NS Facilitates Sequence Diversification of Horizontally Transferred DNAs during Their Integration in Host Chromosomes.

PubMed

Higashi, Koichi; Tobe, Toru; Kanai, Akinori; Uyar, Ebru; Ishikawa, Shu; Suzuki, Yutaka; Ogasawara, Naotake; Kurokawa, Ken; Oshima, Taku

2016-01-01

Bacteria can acquire new traits through horizontal gene transfer. Inappropriate expression of transferred genes, however, can disrupt the physiology of the host bacteria. To reduce this risk, Escherichia coli expresses the nucleoid-associated protein, H-NS, which preferentially binds to horizontally transferred genes to control their expression. Once expression is optimized, the horizontally transferred genes may actually contribute to E. coli survival in new habitats. Therefore, we investigated whether and how H-NS contributes to this optimization process. A comparison of H-NS binding profiles on common chromosomal segments of three E. coli strains belonging to different phylogenetic groups indicated that the positions of H-NS-bound regions have been conserved in E. coli strains. The sequences of the H-NS-bound regions appear to have diverged more so than H-NS-unbound regions only when H-NS-bound regions are located upstream or in coding regions of genes. Because these regions generally contain regulatory elements for gene expression, sequence divergence in these regions may be associated with alteration of gene expression. Indeed, nucleotide substitutions in H-NS-bound regions of the ybdO promoter and coding regions have diversified the potential for H-NS-independent negative regulation among E. coli strains. The ybdO expression in these strains was still negatively regulated by H-NS, which reduced the effect of H-NS-independent regulation under normal growth conditions. Hence, we propose that, during E. coli evolution, the conservation of H-NS binding sites resulted in the diversification of the regulation of horizontally transferred genes, which may have facilitated E. coli adaptation to new ecological niches.

Exploring valid reference genes for quantitative real-time PCR analysis in Sesamia inferens (Lepidoptera: Noctuidae).

PubMed

Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou

2015-01-01

The pink stem borer, Sesamia inferens, which is endemic in China and other parts of Asia, is a major pest of rice and causes significant yield loss in this host plant. Very few studies have addressed gene expression in S. inferens. Quantitative real-time PCR (qRT-PCR) is currently the most accurate and sensitive method for gene expression analysis. In qRT-PCR, data are normalized using reference genes, which help control for internal differences and reduce error between samples. In this study, seven candidate reference genes, 18S ribosomal RNA (18S rRNA), elongation factor 1 (EF1), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), ribosomal protein S13 (RPS13), ribosomal protein S20 (RPS20), tubulin (TUB), and β-actin (ACTB) were evaluated for their suitability in normalizing gene expression under different experimental conditions. The results indicated that three genes (RPS13, RPS20, and EF1) were optimal for normalizing gene expression in different insect tissues (head, epidermis, fat body, foregut, midgut, hindgut, Malpighian tubules, haemocytes, and salivary glands). 18S rRNA, EF1, and GAPDH were best for normalizing expression with respect to developmental stages and sex (egg masses; first, second, third, fourth, fifth, and sixth instar larvae; male and female pupae; and one-day-old male and female adults). 18S rRNA, RPS20, and TUB were optimal for fifth instars exposed to different temperatures (-8, -6, -4, -2, 0, and 27°C). To validate this recommendation, the expression profile of a target gene heat shock protein 83 gene (hsp83) was investigated, and results showed the selection was necessary and effective. In conclusion, this study describes reference gene sets that can be used to accurately measure gene expression in S. inferens.

Efficient biosynthesis of L-phenylglycine by an engineered Escherichia coli with a tunable multi-enzyme-coordinate expression system.

PubMed

Liu, Qiaoli; Zhou, Junping; Yang, Taowei; Zhang, Xian; Xu, Meijuan; Rao, Zhiming

2018-03-01

Whole-cell catalysis with co-expression of two or more enzymes in a single host as a simple low-cost biosynthesis method has been widely studied and applied but hardly with regulation of multi-enzyme expression. Here we developed an efficient whole-cell catalyst for biosynthesis of L-phenylglycine (L-Phg) from benzoylformic acid through co-expression of leucine dehydrogenase from Bacillus cereus (BcLeuDH) and NAD + -dependent mutant formate dehydrogenase from Candida boidinii (CbFDH A10C ) in Escherichia coli with tunable multi-enzyme-coordinate expression system. By co-expressing one to four copies of CbFDH A10C and optimization of the RBS sequence of BcLeuDH in the expression system, the ratio of BcLeuDH to CbFDH in E. coli BL21/pETDuet-rbs 4 leudh-3fdh A10C was finally regulated to 2:1, which was the optimal one determined by enzyme-catalyzed synthesis. The catalyst activity of E. coli BL21/pETDuet-rbs 4 leudh-3fdh A10C was 28.4 mg L -1  min -1  g -1 dry cell weight for L-Phg production using whole-cell transformation, it's was 3.7 times higher than that of engineered E. coli without enzyme expression regulation. Under optimum conditions (pH 8.0 and 35 °C), 60 g L -1 benzoylformic acid was completely converted to pure chiral L-Phg in 4.5 h with 10 g L -1 dry cells and 50.4 g L -1 ammonium formate, and with enantiomeric excess > 99.9%. This multi-enzyme-coordinate expression system strategy significantly improved L-Phg productivity and demonstrated a novel low-cost method for enantiopure L-Phg production.

Gene expression profiling of two distinct neuronal populations in the rodent spinal cord.

PubMed

Ryge, Jesper; Westerdahl, Ann-Charlotte; Alstrøm, Preben; Kiehn, Ole

2008-01-01

In the field of neuroscience microarray gene expression profiles on anatomically defined brain structures are being used increasingly to study both normal brain functions as well as pathological states. Fluorescent tracing techniques in brain tissue that identifies distinct neuronal populations can in combination with global gene expression profiling potentially increase the resolution and specificity of such studies to shed new light on neuronal functions at the cellular level. We examine the microarray gene expression profiles of two distinct neuronal populations in the spinal cord of the neonatal rat, the principal motor neurons and specific interneurons involved in motor control. The gene expression profiles of the respective cell populations were obtained from amplified mRNA originating from 50-250 fluorescently identified and laser microdissected cells. In the data analysis we combine a new microarray normalization procedure with a conglomerate measure of significant differential gene expression. Using our methodology we find 32 genes to be more expressed in the interneurons compared to the motor neurons that all except one have not previously been associated with this neuronal population. As a validation of our method we find 17 genes to be more expressed in the motor neurons than in the interneurons and of these only one had not previously been described in this population. We provide an optimized experimental protocol that allows isolation of gene transcripts from fluorescent retrogradely labeled cell populations in fresh tissue, which can be used to generate amplified aRNA for microarray hybridization from as few as 50 laser microdissected cells. Using this optimized experimental protocol in combination with our microarray analysis methodology we find 49 differentially expressed genes between the motor neurons and the interneurons that reflect the functional differences between these two cell populations in generating and transmitting the motor output in the rodent spinal cord.

Gene Expression Profiling of Two Distinct Neuronal Populations in the Rodent Spinal Cord

PubMed Central

Alstrøm, Preben; Kiehn, Ole

2008-01-01

Background In the field of neuroscience microarray gene expression profiles on anatomically defined brain structures are being used increasingly to study both normal brain functions as well as pathological states. Fluorescent tracing techniques in brain tissue that identifies distinct neuronal populations can in combination with global gene expression profiling potentially increase the resolution and specificity of such studies to shed new light on neuronal functions at the cellular level. Methodology/Principal Findings We examine the microarray gene expression profiles of two distinct neuronal populations in the spinal cord of the neonatal rat, the principal motor neurons and specific interneurons involved in motor control. The gene expression profiles of the respective cell populations were obtained from amplified mRNA originating from 50–250 fluorescently identified and laser microdissected cells. In the data analysis we combine a new microarray normalization procedure with a conglomerate measure of significant differential gene expression. Using our methodology we find 32 genes to be more expressed in the interneurons compared to the motor neurons that all except one have not previously been associated with this neuronal population. As a validation of our method we find 17 genes to be more expressed in the motor neurons than in the interneurons and of these only one had not previously been described in this population. Conclusions/Significance We provide an optimized experimental protocol that allows isolation of gene transcripts from fluorescent retrogradely labeled cell populations in fresh tissue, which can be used to generate amplified aRNA for microarray hybridization from as few as 50 laser microdissected cells. Using this optimized experimental protocol in combination with our microarray analysis methodology we find 49 differentially expressed genes between the motor neurons and the interneurons that reflect the functional differences between these two cell populations in generating and transmitting the motor output in the rodent spinal cord. PMID:18923679

The disagreement between the ideal observer and human observers in hardware and software imaging system optimization: theoretical explanations and evidence

NASA Astrophysics Data System (ADS)

He, Xin

2017-03-01

The ideal observer is widely used in imaging system optimization. One practical question remains open: do the ideal and human observers have the same preference in system optimization and evaluation? Based on the ideal observer's mathematical properties proposed by Barrett et. al. and the empirical properties of human observers investigated by Myers et. al., I attempt to pursue the general rules regarding the applicability of the ideal observer in system optimization. Particularly, in software optimization, the ideal observer pursues data conservation while humans pursue data presentation or perception. In hardware optimization, the ideal observer pursues a system with the maximum total information, while humans pursue a system with the maximum selected (e.g., certain frequency bands) information. These different objectives may result in different system optimizations between human and the ideal observers. Thus, an ideal observer optimized system is not necessarily optimal for humans. I cite empirical evidence in search and detection tasks, in hardware and software evaluation, in X-ray CT, pinhole imaging, as well as emission computed tomography to corroborate the claims. (Disclaimer: the views expressed in this work do not necessarily represent those of the FDA)

Empathic Exchanges in Online Cancer Support Groups: Distinguishing Message Expression and Reception Effects

PubMed Central

Han, Jeong Yeob; Shah, Dhavan V.; Kim, Eunkyung; Namkoong, Kang; Lee, Sun-Young; Moon, Tae Joon; Cleland, Rich; Bu, Q. Lisa; McTavish, Fiona M.; Gustafson, David H.

2013-01-01

Past studies on the efficacy of participation in online cancer support groups have primarily focused on the role of expression in the accrual of health benefits for participants. Unfortunately, few steps have been taken to determine whether this observed effect arises solely from the internal mental processes underlying the act of expressing or, perhaps, owes something to a nuanced, multidimensional understanding of expression that includes reception of responses to what is expressed. To test for the multilayered effect, we attend to one of the key concepts in the online support community scholarship: empathy. Our findings suggest that it is a combination of empathy expression and reception that is crucial to attaining optimal benefits for cancer patients. Further, our finding supports the buffering hypothesis that empathic expression provides a salutary effect for patients who experienced a higher degree of concern associated with their cancer diagnosis and follow-up treatments. PMID:21318917

Approaches to achieve high-level heterologous protein production in plants.

PubMed

Streatfield, Stephen J

2007-01-01

Plants offer an alternative to microbial fermentation and animal cell cultures for the production of recombinant proteins. For protein pharmaceuticals, plant systems are inherently safer than native and even recombinant animal sources. In addition, post-translational modifications, such as glycosylation, which cannot be achieved with bacterial fermentation, can be accomplished using plants. The main advantage foreseen for plant systems is reduced production costs. Plants should have a particular advantage for proteins produced in bulk, such as industrial enzymes, for which product pricing is low. In addition, edible plant tissues are well suited to the expression of vaccine antigens and pharmaceuticals for oral delivery. Three approaches have been followed to express recombinant proteins in plants: expression from the plant nuclear genome; expression from the plastid genome; and expression from plant tissues carrying recombinant plant viral sequences. The most important factor in moving plant-produced heterologous proteins from developmental research to commercial products is to ensure competitive production costs, and the best way to achieve this is to boost expression. Thus, considerable research effort has been made to increase the amount of recombinant protein produced in plants. This research includes molecular technologies to increase replication, to boost transcription, to direct transcription in tissues suited for protein accumulation, to stabilize transcripts, to optimize translation, to target proteins to subcellular locations optimal for their accumulation, and to engineer proteins to stabilize them. Other methods include plant breeding to increase transgene copy number and to utilize germplasm suited to protein accumulation. Large-scale commercialization of plant-produced recombinant proteins will require a combination of these technologies.

Gene Architectures that Minimize Cost of Gene Expression.

PubMed

Frumkin, Idan; Schirman, Dvir; Rotman, Aviv; Li, Fangfei; Zahavi, Liron; Mordret, Ernest; Asraf, Omer; Wu, Song; Levy, Sasha F; Pilpel, Yitzhak

2017-01-05

Gene expression burdens cells by consuming resources and energy. While numerous studies have investigated regulation of expression level, little is known about gene design elements that govern expression costs. Here, we ask how cells minimize production costs while maintaining a given protein expression level and whether there are gene architectures that optimize this process. We measured fitness of ∼14,000 E. coli strains, each expressing a reporter gene with a unique 5' architecture. By comparing cost-effective and ineffective architectures, we found that cost per protein molecule could be minimized by lowering transcription levels, regulating translation speeds, and utilizing amino acids that are cheap to synthesize and that are less hydrophobic. We then examined natural E. coli genes and found that highly expressed genes have evolved more forcefully to minimize costs associated with their expression. Our study thus elucidates gene design elements that improve the economy of protein expression in natural and heterologous systems. Copyright © 2017 Elsevier Inc. All rights reserved.

Optimization of expression and purification of human mortalin (Hsp70): Folding/unfolding analysis

NASA Astrophysics Data System (ADS)

Khan, Mohd Shahnawaz; Ahmed, Anwar; Tabrez, Shams; Islam, Badar ul; Rabbani, Nayyar; Malik, Ajamaluddin; Ismael, Mohamad A.; Alsenaidy, Mohammad A.; Alsenaidy, Abdulrahman M.

2017-12-01

Human mortalin is a Hsp70 mitochondrial protein that plays an essential role in the biogenesis of mitochondria. The deregulation of mortalin expression and its functions could lead to several age-associated disorders and some types of cancers. In the present study, we optimized the expression and purification of recombinant human mortalin by the use of two-step chromatography. Low temperature (18 °C) and 0.5 mM (IPTG) was required for optimum mortalin expression. Chaperone activity of mortalin was assessed by the citrate synthase and insulin protection assay, which suggested their protective role in mitochondria. Folding and unfolding assessments of mortalin were carried out in the presence of guanidine hydrochloride (GdnHCl) by intrinsic fluorescence measurement, ANS (8-analino 1-nephthlene sulfonic acid) binding and CD (circular dichroism) analysis. Under denaturing conditions, mortalin showed decrease in tryptophan fluorescence intensity along with a red shift of 11 nm. Moreover, ANS binding studies illustrated decrease in hydrophobicity. CD measurement of mortalin showed a predominant helical structure. However, the secondary structure was lost at low concentration of GdnHCl (1 M). We present a simple and robust method to produce soluble mortalin and warranted that chaperones are also susceptible to unfolding and futile to maintain protein homeostasis.

Simulated maximum likelihood method for estimating kinetic rates in gene expression.

PubMed

Tian, Tianhai; Xu, Songlin; Gao, Junbin; Burrage, Kevin

2007-01-01

Kinetic rate in gene expression is a key measurement of the stability of gene products and gives important information for the reconstruction of genetic regulatory networks. Recent developments in experimental technologies have made it possible to measure the numbers of transcripts and protein molecules in single cells. Although estimation methods based on deterministic models have been proposed aimed at evaluating kinetic rates from experimental observations, these methods cannot tackle noise in gene expression that may arise from discrete processes of gene expression, small numbers of mRNA transcript, fluctuations in the activity of transcriptional factors and variability in the experimental environment. In this paper, we develop effective methods for estimating kinetic rates in genetic regulatory networks. The simulated maximum likelihood method is used to evaluate parameters in stochastic models described by either stochastic differential equations or discrete biochemical reactions. Different types of non-parametric density functions are used to measure the transitional probability of experimental observations. For stochastic models described by biochemical reactions, we propose to use the simulated frequency distribution to evaluate the transitional density based on the discrete nature of stochastic simulations. The genetic optimization algorithm is used as an efficient tool to search for optimal reaction rates. Numerical results indicate that the proposed methods can give robust estimations of kinetic rates with good accuracy.

Head and Neck Squamous Cell Carcinomas Do Not Express EGFRvIII

DOE Office of Scientific and Technical Information (OSTI.GOV)

Melchers, Lieuwe J., E-mail: l.j.melchers@umcg.nl; Department of Pathology, University Medical Center Groningen, University of Groningen, Groningen; Clausen, Martijn J.A.M.

2014-10-01

Purpose: To assess the prevalence of EGFRvIII, a specific variant of EGFR (epidermal growth factor receptor), in 3 well-defined cohorts of head and neck squamous cell carcinoma (HNSCC). Methods and Materials: Immunohistochemistry for the specific detection of EGFRvIII using the L8A4 antibody was optimized on formalin-fixed, paraffin-embedded tissue using glioblastoma tissue. It was compared with EGFR and EGFRvIII RNA expression using a specific reverse transcription–polymerase chain reaction also optimized for formalin-fixed, paraffin-embedded tissue. Tissue microarrays including 531 HNSCCs of various stages with complete clinicopathologic and follow-up data were tested for the presence of EGFRvIII. Results: None of the 531 casesmore » showed EGFRvIII protein expression. Using an immunohistochemistry protocol reported by others revealed cytoplasmic staining in 8% of cases. Reverse transcription–polymerase chain reaction for the EGFRvIII transcript of the 28 highest cytoplasmic staining cases, as well as 69 negative cases, did not show expression in any of the tested cases, suggesting aspecific staining by a nonoptimal protocol. Conclusions: The EGFRvIII mutation is not present in HNSCC. Therefore, EGFRvIII does not influence treatment response in HNSCC and is not a usable clinical prognostic marker.« less

Matrix-Assisted Transplantation of Functional Beige Adipose Tissue

PubMed Central

Tharp, Kevin M.; Jha, Amit K.; Kraiczy, Judith; Yesian, Alexandra; Karateev, Grigory; Sinisi, Riccardo; Dubikovskaya, Elena A.

2015-01-01

Novel, clinically relevant, approaches to shift energy balance are urgently needed to combat metabolic disorders such as obesity and diabetes. One promising approach has been the expansion of brown adipose tissues that express uncoupling protein (UCP) 1 and thus can uncouple mitochondrial respiration from ATP synthesis. While expansion of UCP1-expressing adipose depots may be achieved in rodents via genetic and pharmacological manipulations or the transplantation of brown fat depots, these methods are difficult to use for human clinical intervention. We present a novel cell scaffold technology optimized to establish functional brown fat–like depots in vivo. We adapted the biophysical properties of hyaluronic acid–based hydrogels to support the differentiation of white adipose tissue–derived multipotent stem cells (ADMSCs) into lipid-accumulating, UCP1-expressing beige adipose tissue. Subcutaneous implantation of ADMSCs within optimized hydrogels resulted in the establishment of distinct UCP1-expressing implants that successfully attracted host vasculature and persisted for several weeks. Importantly, implant recipients demonstrated elevated core body temperature during cold challenges, enhanced respiration rates, improved glucose homeostasis, and reduced weight gain, demonstrating the therapeutic merit of this highly translatable approach. This novel approach is the first truly clinically translatable system to unlock the therapeutic potential of brown fat–like tissue expansion. PMID:26293504

A distributed system for fast alignment of next-generation sequencing data.

PubMed

Srimani, Jaydeep K; Wu, Po-Yen; Phan, John H; Wang, May D

2010-12-01

We developed a scalable distributed computing system using the Berkeley Open Interface for Network Computing (BOINC) to align next-generation sequencing (NGS) data quickly and accurately. NGS technology is emerging as a promising platform for gene expression analysis due to its high sensitivity compared to traditional genomic microarray technology. However, despite the benefits, NGS datasets can be prohibitively large, requiring significant computing resources to obtain sequence alignment results. Moreover, as the data and alignment algorithms become more prevalent, it will become necessary to examine the effect of the multitude of alignment parameters on various NGS systems. We validate the distributed software system by (1) computing simple timing results to show the speed-up gained by using multiple computers, (2) optimizing alignment parameters using simulated NGS data, and (3) computing NGS expression levels for a single biological sample using optimal parameters and comparing these expression levels to that of a microarray sample. Results indicate that the distributed alignment system achieves approximately a linear speed-up and correctly distributes sequence data to and gathers alignment results from multiple compute clients.

Influence of intron length on interaction characters between post-spliced intron and its CDS in ribosomal protein genes

NASA Astrophysics Data System (ADS)

Zhao, Xiaoqing; Li, Hong; Bao, Tonglaga; Ying, Zhiqiang

2012-09-01

Many experiment evidences showed that sequence structures of introns and intron loss/gain can influence gene expression, but current mechanisms did not refer to the functions of post-spliced introns directly. We propose that postspliced introns play their functions in gene expression by interacting with their mRNA sequences and the interaction is characterized by the matched segments between introns and their CDS. In this study, we investigated the interaction characters with length series by improved Smith-Waterman local alignment software for the ribosomal protein genes in C. elegans and D. melanogaster. Our results showed that RF values of five intron groups are significantly high in the central non-conserved region and very low in 5'-end and 3'-end splicing region. It is interesting that the number of the optimal matched regions gradually increases with intron length. Distributions of the optimal matched regions are different for five intron groups. Our study revealed that there are more interaction regions between longer introns and their CDS than shorter, and it provides a positive pattern for regulating the gene expression.

Positive attitude towards life and emotional expression as personality phenotypes for centenarians

PubMed Central

Kato, Kaori; Zweig, Richard; Barzilai, Nir; Atzmon, Gil

2012-01-01

Centenarians have been reported to share particular personality traits including low neuroticism and high extraversion and conscientiousness. Since these traits have moderate to high heritability and are associated with various health outcomes, personality appears linked to bio-genetic mechanisms which may contribute to exceptional longevity. Therefore, the present study sought to detect genetically-based personality phenotypes in a genetically homogeneous sample of centenarians through developing and examining psychometric properties of a brief measure of the personality of centenarians, the Personality Outlook Profile Scale (POPS). The results generated two personality characteristics/domains, Positive Attitude Towards Life (PATL: optimism, easygoing, laughter, and introversion/outgoing) and Emotional Expression (EE: expressing emotions openly and not bottling up emotions). These domains demonstrated acceptable concurrent validity with two established personality measures, the NEO-Five Factor Inventory and Life Orientation Test-Revised. Additionally, centenarians in both groups had lower neuroticism and higher conscientiousness than the US adult population. Findings suggest that the POPS is a psychometrically sound measure of personality in centenarians and capture personality aspects of extraversion, neuroticism, and conscientiousness, as well as dispositional optimism which may contribute to successful aging. PMID:22626632

Fully Anisotropic Rotational Diffusion Tensor from Molecular Dynamics Simulations.

PubMed

Linke, Max; Köfinger, Jürgen; Hummer, Gerhard

2018-05-31

We present a method to calculate the fully anisotropic rotational diffusion tensor from molecular dynamics simulations. Our approach is based on fitting the time-dependent covariance matrix of the quaternions that describe the rigid-body rotational dynamics. Explicit analytical expressions have been derived for the covariances by Favro, which are valid irrespective of the degree of anisotropy. We use these expressions to determine an optimal rotational diffusion tensor from trajectory data. The molecular structures are aligned against a reference by optimal rigid-body superposition. The quaternion covariances can then be obtained directly from the rotation matrices used in the alignment. The rotational diffusion tensor is determined by a fit to the time-dependent quaternion covariances, or directly by Laplace transformation and matrix diagonalization. To quantify uncertainties in the fit, we derive analytical expressions and compare them with the results of Brownian dynamics simulations of anisotropic rotational diffusion. We apply the method to microsecond long trajectories of the Dickerson-Drew B-DNA dodecamer and of horse heart myoglobin. The anisotropic rotational diffusion tensors calculated from simulations agree well with predictions from hydrodynamics.

Identifying and engineering promoters for high level and sustainable therapeutic recombinant protein production in cultured mammalian cells.

PubMed

Ho, Steven C L; Yang, Yuansheng

2014-08-01

Promoters are essential on plasmid vectors to initiate transcription of the transgenes when generating therapeutic recombinant proteins expressing mammalian cell lines. High and sustained levels of gene expression are desired during therapeutic protein production while gene expression is useful for cell engineering. As many finely controlled promoters exhibit cell and product specificity, new promoters need to be identified, optimized and carefully evaluated before use. Suitable promoters can be identified using techniques ranging from simple molecular biology methods to modern high-throughput omics screenings. Promoter engineering is often required after identification to either obtain high and sustained expression or to provide a wider range of gene expression. This review discusses some of the available methods to identify and engineer promoters for therapeutic recombinant protein expression in mammalian cells.

Diffusion Monte Carlo approach versus adiabatic computation for local Hamiltonians

NASA Astrophysics Data System (ADS)

Bringewatt, Jacob; Dorland, William; Jordan, Stephen P.; Mink, Alan

2018-02-01

Most research regarding quantum adiabatic optimization has focused on stoquastic Hamiltonians, whose ground states can be expressed with only real non-negative amplitudes and thus for whom destructive interference is not manifest. This raises the question of whether classical Monte Carlo algorithms can efficiently simulate quantum adiabatic optimization with stoquastic Hamiltonians. Recent results have given counterexamples in which path-integral and diffusion Monte Carlo fail to do so. However, most adiabatic optimization algorithms, such as for solving MAX-k -SAT problems, use k -local Hamiltonians, whereas our previous counterexample for diffusion Monte Carlo involved n -body interactions. Here we present a 6-local counterexample which demonstrates that even for these local Hamiltonians there are cases where diffusion Monte Carlo cannot efficiently simulate quantum adiabatic optimization. Furthermore, we perform empirical testing of diffusion Monte Carlo on a standard well-studied class of permutation-symmetric tunneling problems and similarly find large advantages for quantum optimization over diffusion Monte Carlo.

System, apparatus and methods to implement high-speed network analyzers

DOEpatents

Ezick, James; Lethin, Richard; Ros-Giralt, Jordi; Szilagyi, Peter; Wohlford, David E

2015-11-10

Systems, apparatus and methods for the implementation of high-speed network analyzers are provided. A set of high-level specifications is used to define the behavior of the network analyzer emitted by a compiler. An optimized inline workflow to process regular expressions is presented without sacrificing the semantic capabilities of the processing engine. An optimized packet dispatcher implements a subset of the functions implemented by the network analyzer, providing a fast and slow path workflow used to accelerate specific processing units. Such dispatcher facility can also be used as a cache of policies, wherein if a policy is found, then packet manipulations associated with the policy can be quickly performed. An optimized method of generating DFA specifications for network signatures is also presented. The method accepts several optimization criteria, such as min-max allocations or optimal allocations based on the probability of occurrence of each signature input bit.

Some optimal considerations in attitude control systems. [evaluation of value of relative weighting between time and fuel for relay control law

NASA Technical Reports Server (NTRS)

Boland, J. S., III

1973-01-01

The conventional six-engine reaction control jet relay attitude control law with deadband is shown to be a good linear approximation to a weighted time-fuel optimal control law. Techniques for evaluating the value of the relative weighting between time and fuel for a particular relay control law is studied along with techniques to interrelate other parameters for the two control laws. Vehicle attitude control laws employing control moment gyros are then investigated. Steering laws obtained from the expression for the reaction torque of the gyro configuration are compared to a total optimal attitude control law that is derived from optimal linear regulator theory. This total optimal attitude control law has computational disadvantages in the solving of the matrix Riccati equation. Several computational algorithms for solving the matrix Riccati equation are investigated with respect to accuracy, computational storage requirements, and computational speed.

Numerical simulation of the optimal two-mode attacks for two-way continuous-variable quantum cryptography in reverse reconciliation

NASA Astrophysics Data System (ADS)

Zhang, Yichen; Li, Zhengyu; Zhao, Yijia; Yu, Song; Guo, Hong

2017-02-01

We analyze the security of the two-way continuous-variable quantum key distribution protocol in reverse reconciliation against general two-mode attacks, which represent all accessible attacks at fixed channel parameters. Rather than against one specific attack model, the expression of secret key rates of the two-way protocol are derived against all accessible attack models. It is found that there is an optimal two-mode attack to minimize the performance of the protocol in terms of both secret key rates and maximal transmission distances. We identify the optimal two-mode attack, give the specific attack model of the optimal two-mode attack and show the performance of the two-way protocol against the optimal two-mode attack. Even under the optimal two-mode attack, the performances of two-way protocol are still better than the corresponding one-way protocol, which shows the advantage of making double use of the quantum channel and the potential of long-distance secure communication using a two-way protocol.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fiurasek, Jaromir; Cerf, Nicolas J.

We investigate the asymmetric Gaussian cloning of coherent states which produces M copies from N input replicas in such a way that the fidelity of each copy may be different. We show that the optimal asymmetric Gaussian cloning can be performed with a single phase-insensitive amplifier and an array of beam splitters. We obtain a simple analytical expression characterizing the set of optimal asymmetric Gaussian cloning machines and prove the optimality of these cloners using the formalism of Gaussian completely positive maps and semidefinite programming techniques. We also present an alternative implementation of the asymmetric cloning machine where the phase-insensitivemore » amplifier is replaced with a beam splitter, heterodyne detector, and feedforward.« less

Parametric optimization of optical signal detectors employing the direct photodetection scheme

NASA Astrophysics Data System (ADS)

Kirakosiants, V. E.; Loginov, V. A.

1984-08-01

The problem of optimization of the optical signal detection scheme parameters is addressed using the concept of a receiver with direct photodetection. An expression is derived which accurately approximates the field of view (FOV) values obtained by a direct computer minimization of the probability of missing a signal; optimum values of the receiver FOV were found for different atmospheric conditions characterized by the number of coherence spots and the intensity fluctuations of a plane wave. It is further pointed out that the criterion presented can be possibly used for parametric optimization of detectors operating in accordance with the Neumann-Pearson criterion.

Simultaneous structural and control optimization via linear quadratic regulator eigenstructure assignment

NASA Technical Reports Server (NTRS)

Becus, G. A.; Lui, C. Y.; Venkayya, V. B.; Tischler, V. A.

1987-01-01

A method for simultaneous structural and control design of large flexible space structures (LFSS) to reduce vibration generated by disturbances is presented. Desired natural frequencies and damping ratios for the closed loop system are achieved by using a combination of linear quadratic regulator (LQR) synthesis and numerical optimization techniques. The state and control weighing matrices (Q and R) are expressed in terms of structural parameters such as mass and stiffness. The design parameters are selected by numerical optimization so as to minimize the weight of the structure and to achieve the desired closed-loop eigenvalues. An illustrative example of the design of a two bar truss is presented.

Optimal Sensor Location Design for Reliable Fault Detection in Presence of False Alarms

PubMed Central

Yang, Fan; Xiao, Deyun; Shah, Sirish L.

2009-01-01

To improve fault detection reliability, sensor location should be designed according to an optimization criterion with constraints imposed by issues of detectability and identifiability. Reliability requires the minimization of undetectability and false alarm probability due to random factors on sensor readings, which is not only related with sensor readings but also affected by fault propagation. This paper introduces the reliability criteria expression based on the missed/false alarm probability of each sensor and system topology or connectivity derived from the directed graph. The algorithm for the optimization problem is presented as a heuristic procedure. Finally, a boiler system is illustrated using the proposed method. PMID:22291524

Algorithm For Optimal Control Of Large Structures

NASA Technical Reports Server (NTRS)

Salama, Moktar A.; Garba, John A..; Utku, Senol

1989-01-01

Cost of computation appears competitive with other methods. Problem to compute optimal control of forced response of structure with n degrees of freedom identified in terms of smaller number, r, of vibrational modes. Article begins with Hamilton-Jacobi formulation of mechanics and use of quadratic cost functional. Complexity reduced by alternative approach in which quadratic cost functional expressed in terms of control variables only. Leads to iterative solution of second-order time-integral matrix Volterra equation of second kind containing optimal control vector. Cost of algorithm, measured in terms of number of computations required, is of order of, or less than, cost of prior algoritms applied to similar problems.

The pursuit of optimal distinctiveness and consumer preferences.

PubMed

He, Lingnan; Cong, Feng; Liu, Yanping; Zhou, Xinyue

2010-10-01

This article investigates the effect of optimal distinctiveness on consumer product consumption. The authors argue that consumers acquire and display material possessions to restore their optimal levels of distinctiveness. Results showed that placing consumers in a state of low distinctiveness increased desire to acquire distinctive products, whereas perceptions of high distinctiveness reduced desire to acquire such products. Consumers' desire for distinctiveness-related products held true for various consumer choices, including willingness to pay more for limited-edition products and preference for unpopular gifts. This finding has implications for understanding consumer choice in expressing identity. © 2010 The Authors. Scandinavian Journal of Psychology © 2010 The Scandinavian Psychological Associations.

Dynamic Programming and Graph Algorithms in Computer Vision*

PubMed Central

Felzenszwalb, Pedro F.; Zabih, Ramin

2013-01-01

Optimization is a powerful paradigm for expressing and solving problems in a wide range of areas, and has been successfully applied to many vision problems. Discrete optimization techniques are especially interesting, since by carefully exploiting problem structure they often provide non-trivial guarantees concerning solution quality. In this paper we briefly review dynamic programming and graph algorithms, and discuss representative examples of how these discrete optimization techniques have been applied to some classical vision problems. We focus on the low-level vision problem of stereo; the mid-level problem of interactive object segmentation; and the high-level problem of model-based recognition. PMID:20660950

Optimization of optical systems.

PubMed

Champagne, E B

1966-11-01

The power signal-to-noise ratios for coherent and noncoherent optical detection are presented, with the expression for noncoherent detection being examined in detail. It is found that for the long range optical system to compete with its microwave counterpart it is necessary to optimize the optical system. The optical system may be optimized by using coherent detection, or noncoherent detection if the signal is the dominate noise factor. A design procedure is presented which, in principle, always allows one to obtain signal shot-noise limited operation with noncoherent detection if pulsed operation is used. The technique should make reasonable extremely long range, high data rate systems of relatively simple design.

Multi Objective Controller Design for Linear System via Optimal Interpolation

NASA Technical Reports Server (NTRS)

Ozbay, Hitay

1996-01-01

We propose a methodology for the design of a controller which satisfies a set of closed-loop objectives simultaneously. The set of objectives consists of: (1) pole placement, (2) decoupled command tracking of step inputs at steady-state, and (3) minimization of step response transients with respect to envelope specifications. We first obtain a characterization of all controllers placing the closed-loop poles in a prescribed region of the complex plane. In this characterization, the free parameter matrix Q(s) is to be determined to attain objectives (2) and (3). Objective (2) is expressed as determining a Pareto optimal solution to a vector valued optimization problem. The solution of this problem is obtained by transforming it to a scalar convex optimization problem. This solution determines Q(O) and the remaining freedom in choosing Q(s) is used to satisfy objective (3). We write Q(s) = (l/v(s))bar-Q(s) for a prescribed polynomial v(s). Bar-Q(s) is a polynomial matrix which is arbitrary except that Q(O) and the order of bar-Q(s) are fixed. Obeying these constraints bar-Q(s) is now to be 'shaped' to minimize the step response characteristics of specific input/output pairs according to the maximum envelope violations. This problem is expressed as a vector valued optimization problem using the concept of Pareto optimality. We then investigate a scalar optimization problem associated with this vector valued problem and show that it is convex. The organization of the report is as follows. The next section includes some definitions and preliminary lemmas. We then give the problem statement which is followed by a section including a detailed development of the design procedure. We then consider an aircraft control example. The last section gives some concluding remarks. The Appendix includes the proofs of technical lemmas, printouts of computer programs, and figures.

Investigation, development, and application of optimal output feedback theory. Volume 3: The relationship between dynamic compensators and observers and Kalman filters

NASA Technical Reports Server (NTRS)

Broussard, John R.

1987-01-01

Relationships between observers, Kalman Filters and dynamic compensators using feedforward control theory are investigated. In particular, the relationship, if any, between the dynamic compensator state and linear functions of a discrete plane state are investigated. It is shown that, in steady state, a dynamic compensator driven by the plant output can be expressed as the sum of two terms. The first term is a linear combination of the plant state. The second term depends on plant and measurement noise, and the plant control. Thus, the state of the dynamic compensator can be expressed as an estimator of the first term with additive error given by the second term. Conditions under which a dynamic compensator is a Kalman filter are presented, and reduced-order optimal estimaters are investigated.

Optimal route of diphtheria toxin administration to eliminate native nephron progenitor cells in vivo for kidney regeneration.

PubMed

Fukunaga, Shohei; Yamanaka, Shuichiro; Fujimoto, Toshinari; Tajiri, Susumu; Uchiyama, Taketo; Matsumoto, Kei; Ito, Takafumi; Tanabe, Kazuaki; Yokoo, Takashi

2018-02-19

To address the lack of organs for transplantation, we previously developed a method for organ regeneration in which nephron progenitor cell (NPC) replacement is performed via the diphtheria toxin receptor (DTR) system. In transgenic mice with NPC-specific expression of DTR, NPCs were eliminated by DT and replaced with NPCs lacking the DTR with the ability to differentiate into nephrons. However, this method has only been verified in vitro. For applications to natural models, such as animal fetuses, it is necessary to determine the optimal administration route and dose of DT. In this study, two DT administration routes (intra-peritoneal and intra-amniotic injection) were evaluated in fetal mice. The fetus was delivered by caesarean section at E18.5, and the fetal mouse kidney and RNA expression were evaluated. Additionally, the effect of the DT dose (25, 5, 0.5, and 0.05 ng/fetus-body) was studied. Intra-amniotic injection of DT led to a reduction in kidney volume, loss of glomeruli, and decreased differentiation marker expression. The intra-peritoneal route was not sufficient for NPC elimination. By establishing that intra-amniotic injection is the optimal administration route for DT, these results will facilitate studies of kidney regeneration in vivo. In addition, this method might be useful for analysis of kidney development at various time points by deleting NPCs during development. Copyright © 2018 Elsevier Inc. All rights reserved.

Environmental statistics and optimal regulation.

PubMed

Sivak, David A; Thomson, Matt

2014-09-01

Any organism is embedded in an environment that changes over time. The timescale for and statistics of environmental change, the precision with which the organism can detect its environment, and the costs and benefits of particular protein expression levels all will affect the suitability of different strategies--such as constitutive expression or graded response--for regulating protein levels in response to environmental inputs. We propose a general framework-here specifically applied to the enzymatic regulation of metabolism in response to changing concentrations of a basic nutrient-to predict the optimal regulatory strategy given the statistics of fluctuations in the environment and measurement apparatus, respectively, and the costs associated with enzyme production. We use this framework to address three fundamental questions: (i) when a cell should prefer thresholding to a graded response; (ii) when there is a fitness advantage to implementing a Bayesian decision rule; and (iii) when retaining memory of the past provides a selective advantage. We specifically find that: (i) relative convexity of enzyme expression cost and benefit influences the fitness of thresholding or graded responses; (ii) intermediate levels of measurement uncertainty call for a sophisticated Bayesian decision rule; and (iii) in dynamic contexts, intermediate levels of uncertainty call for retaining memory of the past. Statistical properties of the environment, such as variability and correlation times, set optimal biochemical parameters, such as thresholds and decay rates in signaling pathways. Our framework provides a theoretical basis for interpreting molecular signal processing algorithms and a classification scheme that organizes known regulatory strategies and may help conceptualize heretofore unknown ones.

Optimal 3D culture of primary articular chondrocytes for use in the rotating wall vessel bioreactor.

PubMed

Mellor, Liliana F; Baker, Travis L; Brown, Raquel J; Catlin, Lindsey W; Oxford, Julia Thom

2014-08-01

Reliable culturing methods for primary articular chondrocytes are essential to study the effects of loading and unloading on joint tissue at the cellular level. Due to the limited proliferation capacity of primary chondrocytes and their tendency to dedifferentiate in conventional culture conditions, long-term culturing conditions of primary chondrocytes can be challenging. The goal of this study was to develop a suspension culturing technique that not only would retain the cellular morphology, but also maintain the gene expression characteristics of primary articular chondrocytes. Three-dimensional culturing methods were compared and optimized for primary articular chondrocytes in the rotating wall vessel bioreactor, which changes the mechanical culture conditions to provide a form of suspension culture optimized for low shear and turbulence. We performed gene expression analysis and morphological characterization of cells cultured in alginate beads, Cytopore-2 microcarriers, primary monolayer culture, and passaged monolayer cultures using reverse transcription-PCR and laser scanning confocal microscopy. Primary chondrocytes grown on Cytopore-2 microcarriers maintained the phenotypical morphology and gene expression pattern observed in primary bovine articular chondrocytes, and retained these characteristics for up to 9 d. Our results provide a novel and alternative culturing technique for primary chondrocytes suitable for studies that require suspension such as those using the rotating wall vessel bioreactor. In addition, we provide an alternative culturing technique for primary chondrocytes that can impact future mechanistic studies of osteoarthritis progression, treatments for cartilage damage and repair, and cartilage tissue engineering.

Minimum-noise production of translation factor eIF4G maps to a mechanistically determined optimal rate control window for protein synthesis

PubMed Central

Meng, Xiang; Firczuk, Helena; Pietroni, Paola; Westbrook, Richard; Dacheux, Estelle; Mendes, Pedro; McCarthy, John E.G.

2017-01-01

Gene expression noise influences organism evolution and fitness. The mechanisms determining the relationship between stochasticity and the functional role of translation machinery components are critical to viability. eIF4G is an essential translation factor that exerts strong control over protein synthesis. We observe an asymmetric, approximately bell-shaped, relationship between the average intracellular abundance of eIF4G and rates of cell population growth and global mRNA translation, with peak rates occurring at normal physiological abundance. This relationship fits a computational model in which eIF4G is at the core of a multi-component–complex assembly pathway. This model also correctly predicts a plateau-like response of translation to super-physiological increases in abundance of the other cap-complex factors, eIF4E and eIF4A. Engineered changes in eIF4G abundance amplify noise, demonstrating that minimum stochasticity coincides with physiological abundance of this factor. Noise is not increased when eIF4E is overproduced. Plasmid-mediated synthesis of eIF4G imposes increased global gene expression stochasticity and reduced viability because the intrinsic noise for this factor influences total cellular gene noise. The naturally evolved eIF4G gene expression noise minimum maps within the optimal activity zone dictated by eIF4G's mechanistic role. Rate control and noise are therefore interdependent and have co-evolved to share an optimal physiological abundance point. PMID:27928055

The Challenges and Opportunities for International Cooperative Radio Science; Experience with Mars Express and Venus Express Missions

NASA Technical Reports Server (NTRS)

Holmes, Dwight P.; Thompson, Tommy; Simpson, Richard; Tyler, G. Leonard; Dehant, Veronique; Rosenblatt, Pascal; Hausler, Bernd; Patzold, Martin; Goltz, Gene; Kahan, Daniel;

Improved Prefusion Stability, Optimized Codon Usage, and Augmented Virion Packaging Enhance the Immunogenicity of Respiratory Syncytial Virus Fusion Protein in a Vectored-Vaccine Candidate

PubMed Central

Liang, Bo; Ngwuta, Joan O.; Surman, Sonja; Kabatova, Barbora; Liu, Xiang; Lingemann, Matthias; Liu, Xueqiao; Yang, Lijuan; Herbert, Richard; Swerczek, Joanna; Chen, Man; Moin, Syed M.; Kumar, Azad; McLellan, Jason S.; Kwong, Peter D.; Graham, Barney S.; Collins, Peter L.

2017-01-01

ABSTRACT Respiratory syncytial virus (RSV) is the most important viral agent of severe pediatric respiratory tract disease worldwide, but it lacks a licensed vaccine or suitable antiviral drug. A live attenuated chimeric bovine/human parainfluenza virus type 3 (rB/HPIV3) was developed previously as a vector expressing RSV fusion (F) protein to confer bivalent protection against RSV and HPIV3. In a previous clinical trial in virus-naive children, rB/HPIV3 was well tolerated but the immunogenicity of wild-type RSV F was unsatisfactory. We previously modified RSV F with a designed disulfide bond (DS) to increase stability in the prefusion (pre-F) conformation and to be efficiently packaged in the vector virion. Here, we further stabilized pre-F by adding both disulfide and cavity-filling mutations (DS-Cav1), and we also modified RSV F codon usage to have a lower CpG content and a higher level of expression. This RSV F open reading frame was evaluated in rB/HPIV3 in three forms: (i) pre-F without vector-packaging signal, (ii) pre-F with vector-packaging signal, and (iii) secreted pre-F ectodomain trimer. Despite being efficiently expressed, the secreted pre-F was poorly immunogenic. DS-Cav1 stabilized pre-F, with or without packaging, induced higher titers of pre-F specific antibodies in hamsters, and improved the quality of RSV-neutralizing serum antibodies. Codon-optimized RSV F containing fewer CpG dinucleotides had higher F expression, replicated more efficiently in vivo, and was more immunogenic. The combination of DS-Cav1 pre-F stabilization, optimized codon usage, reduced CpG content, and vector packaging significantly improved vector immunogenicity and protective efficacy against RSV. This provides an improved vectored RSV vaccine candidate suitable for pediatric clinical evaluation. IMPORTANCE RSV and HPIV3 are the first and second leading viral causes of severe pediatric respiratory disease worldwide. Licensed vaccines or suitable antiviral drugs are not available. We are developing a chimeric rB/HPIV3 vector expressing RSV F as a bivalent RSV/HPIV3 vaccine and have been evaluating means to increase RSV F immunogenicity. In this study, we evaluated the effects of improved stabilization of F in the pre-F conformation and of codon optimization resulting in reduced CpG content and greater pre-F expression. Reduced CpG content dampened the interferon response to infection, promoting higher replication and increased F expression. We demonstrate that improved pre-F stabilization and strategic manipulation of codon usage, together with efficient pre-F packaging into vector virions, significantly increased F immunogenicity in the bivalent RSV/HPIV3 vaccine. The improved immunogenicity included induction of increased titers of high-quality complement-independent antibodies with greater pre-F site Ø binding and greater protection against RSV challenge. PMID:28539444

Optimization of flexible wing structures subject to strength and induced drag constraints

NASA Technical Reports Server (NTRS)

Haftka, R. T.

1977-01-01

An optimization procedure for designing wing structures subject to stress, strain, and drag constraints is presented. The optimization method utilizes an extended penalty function formulation for converting the constrained problem into a series of unconstrained ones. Newton's method is used to solve the unconstrained problems. An iterative analysis procedure is used to obtain the displacements of the wing structure including the effects of load redistribution due to the flexibility of the structure. The induced drag is calculated from the lift distribution. Approximate expressions for the constraints used during major portions of the optimization process enhance the efficiency of the procedure. A typical fighter wing is used to demonstrate the procedure. Aluminum and composite material designs are obtained. The tradeoff between weight savings and drag reduction is investigated.

An Integrated Framework for Parameter-based Optimization of Scientific Workflows.

PubMed

Kumar, Vijay S; Sadayappan, P; Mehta, Gaurang; Vahi, Karan; Deelman, Ewa; Ratnakar, Varun; Kim, Jihie; Gil, Yolanda; Hall, Mary; Kurc, Tahsin; Saltz, Joel

2009-01-01

Data analysis processes in scientific applications can be expressed as coarse-grain workflows of complex data processing operations with data flow dependencies between them. Performance optimization of these workflows can be viewed as a search for a set of optimal values in a multi-dimensional parameter space. While some performance parameters such as grouping of workflow components and their mapping to machines do not a ect the accuracy of the output, others may dictate trading the output quality of individual components (and of the whole workflow) for performance. This paper describes an integrated framework which is capable of supporting performance optimizations along multiple dimensions of the parameter space. Using two real-world applications in the spatial data analysis domain, we present an experimental evaluation of the proposed framework.

Optimization of brushless direct current motor design using an intelligent technique.

PubMed

Shabanian, Alireza; Tousiwas, Armin Amini Poustchi; Pourmandi, Massoud; Khormali, Aminollah; Ataei, Abdolhay

2015-07-01

This paper presents a method for the optimal design of a slotless permanent magnet brushless DC (BLDC) motor with surface mounted magnets using an improved bee algorithm (IBA). The characteristics of the motor are expressed as functions of motor geometries. The objective function is a combination of losses, volume and cost to be minimized simultaneously. This method is based on the capability of swarm-based algorithms in finding the optimal solution. One sample case is used to illustrate the performance of the design approach and optimization technique. The IBA has a better performance and speed of convergence compared with bee algorithm (BA). Simulation results show that the proposed method has a very high/efficient performance. Copyright © 2015 ISA. Published by Elsevier Ltd. All rights reserved.

Robust optimal control of material flows in demand-driven supply networks

NASA Astrophysics Data System (ADS)

Laumanns, Marco; Lefeber, Erjen

2006-04-01

We develop a model based on stochastic discrete-time controlled dynamical systems in order to derive optimal policies for controlling the material flow in supply networks. Each node in the network is described as a transducer such that the dynamics of the material and information flows within the entire network can be expressed by a system of first-order difference equations, where some inputs to the system act as external disturbances. We apply methods from constrained robust optimal control to compute the explicit control law as a function of the current state. For the numerical examples considered, these control laws correspond to certain classes of optimal ordering policies from inventory management while avoiding, however, any a priori assumptions about the general form of the policy.

Diffractive variable beam splitter: optimal design.

PubMed

Borghi, R; Cincotti, G; Santarsiero, M

2000-01-01

The analytical expression of the phase profile of the optimum diffractive beam splitter with an arbitrary power ratio between the two output beams is derived. The phase function is obtained by an analytical optimization procedure such that the diffraction efficiency of the resulting optical element is the highest for an actual device. Comparisons are presented with the efficiency of a diffractive beam splitter specified by a sawtooth phase function and with the pertinent theoretical upper bound for this type of element.

A novel rapid and reproducible flow cytometric method for optimization of transfection efficiency in cells

PubMed Central

Homann, Stefanie; Hofmann, Christian; Gorin, Aleksandr M.; Nguyen, Huy Cong Xuan; Huynh, Diana; Hamid, Phillip; Maithel, Neil; Yacoubian, Vahe; Mu, Wenli; Kossyvakis, Athanasios; Sen Roy, Shubhendu; Yang, Otto Orlean

2017-01-01

Transfection is one of the most frequently used techniques in molecular biology that is also applicable for gene therapy studies in humans. One of the biggest challenges to investigate the protein function and interaction in gene therapy studies is to have reliable monospecific detection reagents, particularly antibodies, for all human gene products. Thus, a reliable method that can optimize transfection efficiency based on not only expression of the target protein of interest but also the uptake of the nucleic acid plasmid, can be an important tool in molecular biology. Here, we present a simple, rapid and robust flow cytometric method that can be used as a tool to optimize transfection efficiency at the single cell level while overcoming limitations of prior established methods that quantify transfection efficiency. By using optimized ratios of transfection reagent and a nucleic acid (DNA or RNA) vector directly labeled with a fluorochrome, this method can be used as a tool to simultaneously quantify cellular toxicity of different transfection reagents, the amount of nucleic acid plasmid that cells have taken up during transfection as well as the amount of the encoded expressed protein. Finally, we demonstrate that this method is reproducible, can be standardized and can reliably and rapidly quantify transfection efficiency, reducing assay costs and increasing throughput while increasing data robustness. PMID:28863132

Development and optimization of a new culture media using extruded bean as nitrogen source.

PubMed

Batista, Karla A; Fernandes, Kátia F

2015-01-01

The composition of a culture medium is one of the most important parameters to be analyzed in biotechnological processes with industrial purposes, because around 30-40% of the production costs were estimated to be accounted for the cost of the growth medium [1]. Since medium optimization using a one-factor-at-a-time approach is time-consuming, expensive, and often leads to misinterpretation of results, statistical experimental design has been applied to medium optimization for growth and metabolite production [2-5]. In this scenario, the use of mixture design to develop a culture medium containing a cheaper nitrogen source seems to be more appropriate and simple. In this sense, the focus of this work is to present a detailed description of the steps involved in the development of a optimized culture medium containing extruded bean as nitrogen source. •In a previous work we tested a development of new culture media based on the composition of YPD medium, aiming to reduce bioprocess costs as well as to improve the biomass production and heterologous expression.•The developed medium was tested for growth of Saccharomyces cerevisiae and Pichia pastoris (GS 115).•The use of culture media containing extruded bean as sole nitrogen source showed better biomass production and protein expression than those observed in the standard YPD medium.

Obesity-driven prepartal hepatic lipid accumulation in dairy cows is associated with increased CD36 and SREBP-1 expression.

PubMed

Prodanović, Radiša; Korićanac, Goran; Vujanac, Ivan; Djordjević, Ana; Pantelić, Marija; Romić, Snježana; Stanimirović, Zoran; Kirovski, Danijela

2016-08-01

We investigated the hypothesis that obesity in dairy cows enhanced expression of proteins involved in hepatic fatty acid uptake and metabolism. Sixteen Holstein-Friesian close-up cows were divided into 2 equal groups based on their body condition score (BCS) as optimal (3.25≤BCS≤3.5) and high (4.0≤BCS≤4.25). Intravenous glucose tolerance test (GTT) and liver biopsies were carried out at day 10 before calving. Blood samples were collected before (basal) and after glucose infusion, and glucose, insulin and non-esterified fatty acid (NEFA) levels were determined at each sample point. In addition, β-hydroxybutyrate and triglycerides levels were measured in the basal samples. The liver biopsies were analyzed for total lipid content and protein expression of insulin receptor beta (IRβ), fatty acid translocase (FAT/CD36) and sterol regulatory element-binding protein-1 (SREBP-1). Basal glucose and insulin were higher in high-BCS cows, which coincided with higher circulating triglycerides and hepatic lipid content. Clearance rate and AUC for NEFA during GTT were higher in optimal-BCS cows. The development of insulin resistance and fatty liver in obese cows was paralleled by increased hepatic expression of the IRβ, CD36 and SREBP-1. These results suggest that increased expression of hepatic CD36 and SREBP-1 is relevant in the obesity-driven lipid accumulation in the liver of dairy cows during late gestation. Copyright © 2016 Elsevier Ltd. All rights reserved.

Establishment and culture optimization of a new type of pituitary immortalized cell line

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kokubu, Yuko; Asashima, Makoto; Life Science Center of TARA, The University of Tsukuba, Ibaraki-ken 305-8577

The pituitary gland is a center of the endocrine system that controls homeostasis in an organism by secreting various hormones. The glandular anterior pituitary consists of five different cell types, each expressing specific hormones. However, their regulation and the appropriate conditions for their in vitro culture are not well defined. Here, we report the immortalization of mouse pituitary cells by introducing TERT, E6, and E7 transgenes. The immortalized cell lines mainly expressed a thyrotroph-specific thyroid stimulating hormone beta (Tshb). After optimization of the culture conditions, these immortalized cells proliferated and maintained morphological characteristics similar to those of primary pituitary cells undermore » sphere culture conditions in DMEM/F12 medium supplemented with N2, B27, basic FGF, and EGF. These cell lines responded to PKA or PKC pathway activators and induced the expression of Tshb mRNA. Moreover, transplantation of the immortalized cell line into subcutaneous regions and kidney capsules of mice further increased Tshb expression. These results suggest that immortalization of pituitary cells with TERT, E6, and E7 transgenes is a useful method for generating proliferating cells for the in vitro analysis of pituitary regulatory mechanisms. - Highlights: • Mouse pituitary cell lines were immortalized by introducing TERT, E6, and E7. • The immortalized cell lines mainly expressed thyroid stimulating hormone beta. • The cell lines responded to PKA or PKC pathway activators, and induced Tshb.« less

Obesity, expression of adipocytokines, and macrophage infiltration in canine mammary tumors.

PubMed

Lim, H Y; Im, K S; Kim, N H; Kim, H W; Shin, J I; Sur, J H

2015-03-01

Obesity influences the development, progression and prognosis of human breast cancer and canine mammary cancer (MC) but the precise underlying mechanism is not well-documented in the fields of either human or veterinary oncology. In the present study, the expression of major adipocytokines, including leptin, adiponectin, and leptin receptor (ObR) in benign (n = 28) and malignant (n = 70) canine mammary tumors was investigated by immunohistochemistry and on the basis of the subject's body condition score (BCS). To evaluate the relationship between obesity and chronic inflammation of the mammary gland, macrophages infiltrating within and around tumoral areas were counted. The mean age of MC development was lower in overweight or obese dogs (9.0 ± 1.8 years) than in lean dogs or optimal bodyweight (10.2 ± 2.9 years), and the evidence of lymphatic invasion of carcinoma cells was found more frequently in overweight or obese group than in lean or optimal groups. Decreased adiponectin expression and increased macrophage numbers in overweight or obese subjects were significantly correlated with factors related to a poor prognosis, such as high histological grade and lymphatic invasion. Leptin expression was correlated with progesterone receptor status, and ObR expression was correlated with estrogen receptor status of MCs, regardless of BCS. Macrophage infiltration within and around the tumor may play an important role in tumor progression and metastasis in obese female dogs and may represent a prognostic factor for canine MCs. Copyright © 2015 Elsevier Ltd. All rights reserved.

Expression, purification and characterization of GAPDH-ChSase ABC I from Proteus vulgaris in Escherichia coli.

PubMed

Li, Ye; Chen, Zhenya; Zhou, Zhao; Yuan, Qipeng

2016-12-01

Chondroitinases (ChSases) are a family of polysaccharide lyases that can depolymerize high molecular weight chondroitin sulfate (CS) and dermatan sulfate (DS). In this study, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), which is stably expressed in different cells like normal cells and cancer cells and the expression is relatively insensitive to experimental conditions, was expressed as a fusion protein with ChSase ABC I. Results showed that the expression level and enzyme activity of GAPDH-ChSase ABC I were about 2.2 and 3.0 times higher than those of ChSase ABC I. By optimization of fermentation conditions, higher productivity of ChSase ABC I was achieved as 880 ± 61 IU/g wet cell weight compared with the reported ones. The optimal temperature and pH of GAPDH-ChSase ABC I were 40 °C and 7.5, respectively. GAPDH-ChSase ABC I had a kcat/Km of 131 ± 4.1 L/μmol s and the catalytic efficiency was decreased as compared to ChSase ABC I. The relative activity of GAPDH-ChSase ABC I remained 89% after being incubated at 30 °C for 180 min and the thermostability of ChSase ABC I was enhanced by GAPDH when it was incubated at 30, 35, 40 and 45 °C. Copyright © 2016 Elsevier Inc. All rights reserved.

Approaches to Optimizing Animal Cell Culture Process: Substrate Metabolism Regulation and Protein Expression Improvement

NASA Astrophysics Data System (ADS)

Zhang, Yuanxing

Some high value proteins and vaccines for medical and veterinary applications by animal cell culture have an increasing market in China. In order to meet the demands of large-scale productions of proteins and vaccines, animal cell culture technology has been widely developed. In general, an animal cell culture process can be divided into two stages in a batch culture. In cell growth stage a high specific growth rate is expected to achieve a high cell density. In production stage a high specific production rate is stressed for the expression and secretion of qualified protein or replication of virus. It is always critical to maintain high cell viability in fed-batch and perfusion cultures. More concern has been focused on two points by the researchers in China. First, the cell metabolism of substrates is analyzed and the accumulation of toxic by-products is decreased through regulating cell metabolism in the culture process. Second, some important factors effecting protein expression are understood at the molecular level and the production ability of protein is improved. In pace with the rapid development of large-scale cell culture for the production of vaccines, antibodies and other recombinant proteins in China, the medium design and process optimization based on cell metabolism regulation and protein expression improvement will play an important role. The chapter outlines the main advances in metabolic regulation of cell and expression improvement of protein in animal cell culture in recent years.

Expression and purification of functional Clostridium perfringens alpha and epsilon toxins in Escherichia coli.

PubMed

Zhao, Yao; Kang, Lin; Gao, Shan; Zhou, Yang; Su, Libo; Xin, Wenwen; Su, Yuxin; Wang, Jinglin

2011-06-01

The alpha and epsilon toxins are 2 of the 4 major lethal toxins of the pathogen Clostridium perfringens. In this study, the expression of the epsilon toxin (etx) gene of C. perfringens was optimized by replacing rare codons with high-frequency codons, and the optimized gene was synthesized using overlapping PCR. Then, the etx gene or the alpha-toxin gene (cpa) was individually inserted into the pTIG-Trx expression vector with a hexahistidine tag and a thioredoxin (Trx) to facilitate their purification and induce the expression of soluble proteins. The recombinant alpha toxin (rCPA) and epsilon toxin (rETX) were highly expressed as soluble forms in the recipient Escherichia coli BL21 strain, respectively. The rCPA and rETX were purified using Ni(2+)-chelating chromatography and size-exclusion chromatography. And the entire purification process recovered about 40% of each target protein from the starting materials. The purified target toxins formed single band at about 42kDa (rCPA) or 31kDa (rETX) in sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and their functional activity was confirmed by bioactivity assays. We have shown that the production of large amounts of soluble and functional proteins by using the pTIG-Trx vector in E. coli is a good alternative for the production of native alpha and epsilon toxins and could also be useful for the production of other toxic proteins with soluble forms. Copyright © 2011 Elsevier Inc. All rights reserved.

Quantified Event Automata: Towards Expressive and Efficient Runtime Monitors

NASA Technical Reports Server (NTRS)

Barringer, Howard; Falcone, Ylies; Havelund, Klaus; Reger, Giles; Rydeheard, David

2012-01-01

Runtime verification is the process of checking a property on a trace of events produced by the execution of a computational system. Runtime verification techniques have recently focused on parametric specifications where events take data values as parameters. These techniques exist on a spectrum inhabited by both efficient and expressive techniques. These characteristics are usually shown to be conflicting - in state-of-the-art solutions, efficiency is obtained at the cost of loss of expressiveness and vice-versa. To seek a solution to this conflict we explore a new point on the spectrum by defining an alternative runtime verification approach.We introduce a new formalism for concisely capturing expressive specifications with parameters. Our technique is more expressive than the currently most efficient techniques while at the same time allowing for optimizations.

Zipf's Law in Gene Expression

NASA Astrophysics Data System (ADS)

Furusawa, Chikara; Kaneko, Kunihiko

2003-02-01

Using data from gene expression databases on various organisms and tissues, including yeast, nematodes, human normal and cancer tissues, and embryonic stem cells, we found that the abundances of expressed genes exhibit a power-law distribution with an exponent close to -1; i.e., they obey Zipf’s law. Furthermore, by simulations of a simple model with an intracellular reaction network, we found that Zipf’s law of chemical abundance is a universal feature of cells where such a network optimizes the efficiency and faithfulness of self-reproduction. These findings provide novel insights into the nature of the organization of reaction dynamics in living cells.

Expression levels of chaperones influence biotransformation activity of recombinant Escherichia coli expressing Micrococcus luteus alcohol dehydrogenase and Pseudomonas putida Baeyer-Villiger monooxygenase.

PubMed

Baek, A-Hyong; Jeon, Eun-Yeong; Lee, Sun-Mee; Park, Jin-Byung

2015-05-01

We demonstrated for the first time that the archaeal chaperones (i.e., γ-prefoldin and thermosome) can stabilize enzyme activity in vivo. Ricinoleic acid biotransformation activity of recombinant Escherichia coli expressing Micrococcus luteus alcohol dehydrogenase and the Pseudomonas putida KT2440 Baeyer-Villiger monooxygenase improved significantly with co-expression of γ-prefoldin or recombinant themosome originating from the deep-sea hyperthermophile archaea Methanocaldococcus jannaschii. Furthermore, the degree of enhanced activity was dependent on the expression levels of the chaperones. For example, whole-cell biotransformation activity was highest at 12 µmol/g dry cells/min when γ-prefoldin expression level was approximately 46% of the theoretical maximum. This value was approximately two-fold greater than that in E. coli, where the γ-prefoldin expression level was zero or set to the theoretical maximum. Therefore, it was assumed that the expression levels of chaperones must be optimized to achieve maximum biotransformation activity in whole-cell biocatalysts. © 2014 Wiley Periodicals, Inc.

A resolution recognizing the 63rd anniversary of India's independence, expressing appreciation to Americans of Indian descent for their contributions to society, and expressing support and optimism for the strategic partnership and friendship between the United States and India in the future.

THOMAS, 111th Congress

Sen. Cornyn, John [R-TX

2010-08-05

Senate - 08/05/2010 Submitted in the Senate, considered, and agreed to without amendment and with a preamble by Unanimous Consent. (All Actions) Tracker: This bill has the status Agreed to in SenateHere are the steps for Status of Legislation:

Probing Tumor Microenvironment With In Vivo Phage Display

DTIC Science & Technology

2014-10-01

C). (C) Dot plots showing mCherry expression on the X axis and fibroblast activation protein ( FAP ) or rabbit isotype control staining in the Y...by flow cytometry-based cell sorting using an antibody against fibroblast activation protein ( FAP ). During the optimization steps, flow cytometry...expression of αvβ3 and αvβ5 integrins, neuropilin-1 (NRP-1), and fibroblast activation protein ( FAP ) in hb6011 CAFs was analyzed by flow cytometry

Development of a Multistage Reliability-Based Design Optimization Method

DTIC Science & Technology

2014-01-01

expressed using Eq. (7), where nx is the number of design variables P a0 þ Xnx i¼1 aini þ bið Þxi 0 " # a (7) Figures 3(a)–3(c) illustrates the...constraint equation can be expressed in the gen- eral form of Eq. (16), where again nx is the number of design variables P a0;j þ Xnx i¼1 ai;jnixi

Optimization of a nonviral transfection system to evaluate Cox-2 controlled interleukin-4 expression for osteoarthritis gene therapy in vitro.

PubMed

Lang, Annemarie; Neuhaus, Johannes; Pfeiffenberger, Moritz; Schröder, Erik; Ponomarev, Igor; Weber, Yvonne; Gaber, Timo; Schmidt, Michael F G

2014-01-01

Gene therapy appears to have the potential for achieving a long-term remedy for osteoarthritis (OA). However, there is a risk of adverse reactions, especially when using cytomegalovirus-controlled expression. To provide a safe application, we focused on the expression of therapeutic cytokines [e.g. interleukin (IL)-4] in a disease-responsive manner by use of the previously cloned Cox-2 promoter as 'genetic switch'. In the present study, we report the functionality of a controlled gene therapeutic system in an equine osteoarthritic cell model. Different nonviral transfection reagents were tested for their efficiency on equine chondrocytes stimulated with equine IL-1β or lipopolysaccharide to create an inflammatory environment. To optimize the transfection, we successfully redesigned the vector by excluding the internal ribosomal entry site (IRES). The functionality of our Cox-2 promoter construct with respect to expressing IL-4 was proven at the mRNA and protein levels and the anti-inflammatory potential of IL-4 was confirmed by analyzing the expression of IL-1β, IL-6, IL-8, matrix metalloproteinase (MMP)-1, MMP-3 and tumor necrosis factor (TNF)-α using a quantitative polymerase chain reaction. Nonviral transfection reagents yielded transfection rates from 21% to 44% with control vectors with and without IRES, respectively. Stimulation of equine chondrocytes resulted in a 20-fold increase of mRNA expression of IL-1β. Such exogenous stimulation of chondrocytes transfected with pNCox2-IL4 led to an increase of IL-4 mRNA expression, whereas expression of inflammatory mediators decreased. The timely link between these events confirms the anti-inflammatory potential of synthesized IL-4. We consider that this approach has significant potential for translation into a useful anti-inflammation therapy. Molecular tools such as the described therapeutic plasmid pave the way for a local-controlled, self-limiting gene therapy. Copyright © 2014 John Wiley & Sons, Ltd.

Selection of internal control genes for quantitative real-time RT-PCR studies during tomato development process

PubMed Central

Expósito-Rodríguez, Marino; Borges, Andrés A; Borges-Pérez, Andrés; Pérez, José A

2008-01-01

Background The elucidation of gene expression patterns leads to a better understanding of biological processes. Real-time quantitative RT-PCR has become the standard method for in-depth studies of gene expression. A biologically meaningful reporting of target mRNA quantities requires accurate and reliable normalization in order to identify real gene-specific variation. The purpose of normalization is to control several variables such as different amounts and quality of starting material, variable enzymatic efficiencies of retrotranscription from RNA to cDNA, or differences between tissues or cells in overall transcriptional activity. The validity of a housekeeping gene as endogenous control relies on the stability of its expression level across the sample panel being analysed. In the present report we describe the first systematic evaluation of potential internal controls during tomato development process to identify which are the most reliable for transcript quantification by real-time RT-PCR. Results In this study, we assess the expression stability of 7 traditional and 4 novel housekeeping genes in a set of 27 samples representing different tissues and organs of tomato plants at different developmental stages. First, we designed, tested and optimized amplification primers for real-time RT-PCR. Then, expression data from each candidate gene were evaluated with three complementary approaches based on different statistical procedures. Our analysis suggests that SGN-U314153 (CAC), SGN-U321250 (TIP41), SGN-U346908 ("Expressed") and SGN-U316474 (SAND) genes provide superior transcript normalization in tomato development studies. We recommend different combinations of these exceptionally stable housekeeping genes for suited normalization of different developmental series, including the complete tomato development process. Conclusion This work constitutes the first effort for the selection of optimal endogenous controls for quantitative real-time RT-PCR studies of gene expression during tomato development process. From our study a tool-kit of control genes emerges that outperform the traditional genes in terms of expression stability. PMID:19102748

Sox17 drives functional engraftment of endothelium converted from non-vascular cells.

PubMed

Schachterle, William; Badwe, Chaitanya R; Palikuqi, Brisa; Kunar, Balvir; Ginsberg, Michael; Lis, Raphael; Yokoyama, Masataka; Elemento, Olivier; Scandura, Joseph M; Rafii, Shahin

2017-01-16

Transplanting vascular endothelial cells (ECs) to support metabolism and express regenerative paracrine factors is a strategy to treat vasculopathies and to promote tissue regeneration. However, transplantation strategies have been challenging to develop, because ECs are difficult to culture and little is known about how to direct them to stably integrate into vasculature. Here we show that only amniotic cells could convert to cells that maintain EC gene expression. Even so, these converted cells perform sub-optimally in transplantation studies. Constitutive Akt signalling increases expression of EC morphogenesis genes, including Sox17, shifts the genomic targeting of Fli1 to favour nearby Sox consensus sites and enhances the vascular function of converted cells. Enforced expression of Sox17 increases expression of morphogenesis genes and promotes integration of transplanted converted cells into injured vessels. Thus, Ets transcription factors specify non-vascular, amniotic cells to EC-like cells, whereas Sox17 expression is required to confer EC function.

Versatile control of Plasmodium falciparum gene expression with an inducible protein-RNA interaction

PubMed Central

Goldfless, Stephen J.; Wagner, Jeffrey C.; Niles, Jacquin C.

2014-01-01

The available tools for conditional gene expression in Plasmodium falciparum are limited. Here, to enable reliable control of target gene expression, we build a system to efficiently modulate translation. We overcame several problems associated with other approaches for regulating gene expression in P. falciparum. Specifically, our system functions predictably across several native and engineered promoter contexts, and affords control over reporter and native parasite proteins irrespective of their subcellular compartmentalization. Induction and repression of gene expression are rapid, homogeneous, and stable over prolonged periods. To demonstrate practical application of our system, we used it to reveal direct links between antimalarial drugs and their native parasite molecular target. This is an important out come given the rapid spread of resistance, and intensified efforts to efficiently discover and optimize new antimalarial drugs. Overall, the studies presented highlight the utility of our system for broadly controlling gene expression and performing functional genetics in P. falciparum. PMID:25370483

Small, synthetic, GC-rich mRNA stem-loop modules 5' proximal to the AUG start-codon predictably tune gene expression in yeast.

PubMed

Lamping, Erwin; Niimi, Masakazu; Cannon, Richard D

2013-07-29

A large range of genetic tools has been developed for the optimal design and regulation of complex metabolic pathways in bacteria. However, fewer tools exist in yeast that can precisely tune the expression of individual enzymes in novel metabolic pathways suitable for industrial-scale production of non-natural compounds. Tuning expression levels is critical for reducing the metabolic burden of over-expressed proteins, the accumulation of toxic intermediates, and for redirecting metabolic flux from native pathways involving essential enzymes without negatively affecting the viability of the host. We have developed a yeast membrane protein hyper-expression system with critical advantages over conventional, plasmid-based, expression systems. However, expression levels are sometimes so high that they adversely affect protein targeting/folding or the growth and/or phenotype of the host. Here we describe the use of small synthetic mRNA control modules that allowed us to predictably tune protein expression levels to any desired level. Down-regulation of expression was achieved by engineering small GC-rich mRNA stem-loops into the 5' UTR that inhibited translation initiation of the yeast ribosomal 43S preinitiation complex (PIC). Exploiting the fact that the yeast 43S PIC has great difficulty scanning through GC-rich mRNA stem-loops, we created yeast strains containing 17 different RNA stem-loop modules in the 5' UTR that expressed varying amounts of the fungal multidrug efflux pump reporter Cdr1p from Candida albicans. Increasing the length of mRNA stem-loops (that contained only GC-pairs) near the AUG start-codon led to a surprisingly large decrease in Cdr1p expression; ~2.7-fold for every additional GC-pair added to the stem, while the mRNA levels remained largely unaffected. An mRNA stem-loop of seven GC-pairs (∆G = -15.8 kcal/mol) reduced Cdr1p expression levels by >99%, and even the smallest possible stem-loop of only three GC-pairs (∆G = -4.4 kcal/mol) inhibited Cdr1p expression by ~50%. We have developed a simple cloning strategy to fine-tune protein expression levels in yeast that has many potential applications in metabolic engineering and the optimization of protein expression in yeast. This study also highlights the importance of considering the use of multiple cloning-sites carefully to preclude unwanted effects on gene expression.

Small, synthetic, GC-rich mRNA stem-loop modules 5′ proximal to the AUG start-codon predictably tune gene expression in yeast

PubMed Central

2013-01-01

Background A large range of genetic tools has been developed for the optimal design and regulation of complex metabolic pathways in bacteria. However, fewer tools exist in yeast that can precisely tune the expression of individual enzymes in novel metabolic pathways suitable for industrial-scale production of non-natural compounds. Tuning expression levels is critical for reducing the metabolic burden of over-expressed proteins, the accumulation of toxic intermediates, and for redirecting metabolic flux from native pathways involving essential enzymes without negatively affecting the viability of the host. We have developed a yeast membrane protein hyper-expression system with critical advantages over conventional, plasmid-based, expression systems. However, expression levels are sometimes so high that they adversely affect protein targeting/folding or the growth and/or phenotype of the host. Here we describe the use of small synthetic mRNA control modules that allowed us to predictably tune protein expression levels to any desired level. Down-regulation of expression was achieved by engineering small GC-rich mRNA stem-loops into the 5′ UTR that inhibited translation initiation of the yeast ribosomal 43S preinitiation complex (PIC). Results Exploiting the fact that the yeast 43S PIC has great difficulty scanning through GC-rich mRNA stem-loops, we created yeast strains containing 17 different RNA stem-loop modules in the 5′ UTR that expressed varying amounts of the fungal multidrug efflux pump reporter Cdr1p from Candida albicans. Increasing the length of mRNA stem-loops (that contained only GC-pairs) near the AUG start-codon led to a surprisingly large decrease in Cdr1p expression; ~2.7-fold for every additional GC-pair added to the stem, while the mRNA levels remained largely unaffected. An mRNA stem-loop of seven GC-pairs (∆G = −15.8 kcal/mol) reduced Cdr1p expression levels by >99%, and even the smallest possible stem-loop of only three GC-pairs (∆G = −4.4 kcal/mol) inhibited Cdr1p expression by ~50%. Conclusion We have developed a simple cloning strategy to fine-tune protein expression levels in yeast that has many potential applications in metabolic engineering and the optimization of protein expression in yeast. This study also highlights the importance of considering the use of multiple cloning-sites carefully to preclude unwanted effects on gene expression. PMID:23895661

Geometric optimization of an active magnetic regenerative refrigerator via second-law analysis

NASA Astrophysics Data System (ADS)

Li, Peng; Gong, Maoqiong; Wu, Jianfeng

2008-11-01

Previous analyses [Z. Yan and J. Chen, J. Appl. Phys. 72, 1 (1992); J. Chen and Z. Yan, ibid., 84, 1791 (1998); Lin et al., Physica B 344, 147 (2004); Yang et al., ibid., 364, 33 (2005); Xia et al., ibid., 381, 246 (2006).] of irreversibilities in magnetic refrigerators overlooked several important losses that could be dominant in a real active magnetic regenerative refrigerator (AMRR). No quantitative expressions have been provided yet to estimate the corresponding entropy generations in real AMRRs. The important geometric parameters of AMRRs, such as the aspect ratio of the active magnetic regenerator and the refrigerant diameter, are still arbitrarily chosen. Expressions for calculating different types of entropy generations in the AMRR were derived and used to optimize the aspect ratio and the refrigerant diameter. An optimal coefficient of performance (15.54) was achieved at an aspect ratio of 6.39 and a refrigerant diameter of 1.1mm for our current system. Further study showed that the dissipative sources (e.g., the fluid friction and the unbalanced magnetic forces) in AMRRs, which were overlooked by previous investigations, could significantly contribute to entropy generations.

Design and testing of regulatory cassettes for optimal activity in skeletal and cardiac muscles.

PubMed

Himeda, Charis L; Chen, Xiaolan; Hauschka, Stephen D

2011-01-01

Gene therapy for muscular dystrophies requires efficient gene delivery to the striated musculature and specific, high-level expression of the therapeutic gene in a physiologically diverse array of muscles. This can be achieved by the use of recombinant adeno-associated virus vectors in conjunction with muscle-specific regulatory cassettes. We have constructed several generations of regulatory cassettes based on the enhancer and promoter of the muscle creatine kinase gene, some of which include heterologous enhancers and individual elements from other muscle genes. Since the relative importance of many control elements varies among different anatomical muscles, we are aiming to tailor these cassettes for high-level expression in cardiac muscle, and in fast and slow skeletal muscles. With the achievement of efficient intravascular gene delivery to isolated limbs, selected muscle groups, and heart in large animal models, the design of cassettes optimized for activity in different muscle types is now a practical goal. In this protocol, we outline the key steps involved in the design of regulatory cassettes for optimal activity in skeletal and cardiac muscle, and testing in mature muscle fiber cultures. The basic principles described here can also be applied to engineering tissue-specific regulatory cassettes for other cell types.

Proof of the quantitative potential of immunofluorescence by mass spectrometry.

PubMed

Toki, Maria I; Cecchi, Fabiola; Hembrough, Todd; Syrigos, Konstantinos N; Rimm, David L

2017-03-01

Protein expression in formalin-fixed, paraffin-embedded patient tissue is routinely measured by Immunohistochemistry (IHC). However, IHC has been shown to be subject to variability in sensitivity, specificity and reproducibility, and is generally, at best, considered semi-quantitative. Mass spectrometry (MS) is considered by many to be the criterion standard for protein measurement, offering high sensitivity, specificity, and objective molecular quantification. Here, we seek to show that quantitative immunofluorescence (QIF) with standardization can achieve quantitative results comparable to MS. Epidermal growth factor receptor (EGFR) was measured by quantitative immunofluorescence in 15 cell lines with a wide range of EGFR expression, using different primary antibody concentrations, including the optimal signal-to-noise concentration after quantitative titration. QIF target measurement was then compared to the absolute EGFR concentration measured by Liquid Tissue-selected reaction monitoring mass spectrometry. The best agreement between the two assays was found when the EGFR primary antibody was used at the optimal signal-to-noise concentration, revealing a strong linear regression (R 2 =0.88). This demonstrates that quantitative optimization of titration by calculation of signal-to-noise ratio allows QIF to be standardized to MS and can therefore be used to assess absolute protein concentration in a linear and reproducible manner.

DyNAVacS: an integrative tool for optimized DNA vaccine design.

PubMed

Harish, Nagarajan; Gupta, Rekha; Agarwal, Parul; Scaria, Vinod; Pillai, Beena

2006-07-01

DNA vaccines have slowly emerged as keystones in preventive immunology due to their versatility in inducing both cell-mediated as well as humoral immune responses. The design of an efficient DNA vaccine, involves choice of a suitable expression vector, ensuring optimal expression by codon optimization, engineering CpG motifs for enhancing immune responses and providing additional sequence signals for efficient translation. DyNAVacS is a web-based tool created for rapid and easy design of DNA vaccines. It follows a step-wise design flow, which guides the user through the various sequential steps in the design of the vaccine. Further, it allows restriction enzyme mapping, design of primers spanning user specified sequences and provides information regarding the vectors currently used for generation of DNA vaccines. The web version uses Apache HTTP server. The interface was written in HTML and utilizes the Common Gateway Interface scripts written in PERL for functionality. DyNAVacS is an integrated tool consisting of user-friendly programs, which require minimal information from the user. The software is available free of cost, as a web based application at URL: http://miracle.igib.res.in/dynavac/.

Identification of compounds protective against G93A-SOD1 toxicity for the treatment of amyotrophic lateral sclerosis.

PubMed

Benmohamed, Radhia; Arvanites, Anthony C; Kim, Jinho; Ferrante, Robert J; Silverman, Richard B; Morimoto, Richard I; Kirsch, Donald R

2011-03-01

The underlying cause of amyotrophic lateral sclerosis (ALS), a progressive neurodegenerative disorder, remains unknown. However, there is strong evidence that one pathophysiological mechanism, toxic protein misfolding and/or aggregation, may trigger motor neuron dysfunction and loss. Since the clinical and pathological features of sporadic and familial ALS are indistinguishable, all forms of the disease may be better understood and ultimately treated by studying pathogenesis and therapy in models expressing mutant forms of SOD1. We developed a cellular model in which cell death depended on the expression of G93A-SOD1, a mutant form of superoxide dismutase found in familial ALS patients that produces toxic protein aggregates. This cellular model was optimized for high throughput screening to identify protective compounds from a >50,000 member chemical library. Three novel chemical scaffolds were selected for further study following screen implementation, counter-screening and secondary testing, including studies with purchased analogs. All three scaffolds blocked SOD1 aggregation in high content screening assays and data on the optimization and further characterization of these compounds will be reported separately. These data suggest that optimization of these chemicals scaffolds may produce therapeutic candidates for ALS patients.

Kuhn-Tucker optimization based reliability analysis for probabilistic finite elements

NASA Technical Reports Server (NTRS)

Liu, W. K.; Besterfield, G.; Lawrence, M.; Belytschko, T.

1988-01-01

The fusion of probability finite element method (PFEM) and reliability analysis for fracture mechanics is considered. Reliability analysis with specific application to fracture mechanics is presented, and computational procedures are discussed. Explicit expressions for the optimization procedure with regard to fracture mechanics are given. The results show the PFEM is a very powerful tool in determining the second-moment statistics. The method can determine the probability of failure or fracture subject to randomness in load, material properties and crack length, orientation, and location.

An Extension of the Krieger-Li-Iafrate Approximation to the Optimized-Effective-Potential Method

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wilson, B.G.

1999-11-11

The Krieger-Li-Iafrate approximation can be expressed as the zeroth order result of an unstable iterative method for solving the integral equation form of the optimized-effective-potential method. By pre-conditioning the iterate a first order correction can be obtained which recovers the bulk of quantal oscillations missing in the zeroth order approximation. A comparison of calculated total energies are given with Krieger-Li-Iafrate, Local Density Functional, and Hyper-Hartree-Fock results for non-relativistic atoms and ions.

Model for Bi-objective emergency rescue vehicle routing optimization

NASA Astrophysics Data System (ADS)

Yang, Yuhang

2017-03-01

Vehicle routing problem is an important research topic in management science. In this paper, one vehicle can rescue multiple disaster points and two optimization objectives are rescue time and rescue effect. Rescue effect is expressed as the ratio of unloaded material to arrival time when rescue vehicles participate in rescue every time. In this paper, the corresponding emergency rescue model is established and the effectiveness of the model is verified by simulated annealing algorithm. It can provide the basis for practical decision-making.

Optimized Chemical Probes for REV-ERBα

PubMed Central

Trump, Ryan P.; Bresciani, Stefano; Cooper, Anthony W. J.; Tellam, James P.; Wojno, Justyna; Blaikley, John; Orband-Miller, Lisa A.; Kashatus, Jennifer A.; Dawson, Helen C.; Loudon, Andrew; Ray, David; Grant, Daniel; Farrow, Stuart N.; Willson, Timothy M.; Tomkinson, Nicholas C. O.

2015-01-01

REV-ERBα has emerged as an important target for regulation of circadian rhythm and its associated physiology. Herein, we report on the optimization of a series of REV-ERBα agonists based on GSK4112 (1) for potency, selectivity, and bioavailability. Potent REV-ERBα agonists 4, 10, 16, and 23 are detailed for their ability to suppress BMAL and IL-6 expression from human cells while also demonstrating excellent selectivity over LXRα. Amine 4 demonstrated in vivo bioavailability after either IV or oral dosing. PMID:23656296

Optimization of HTS superconducting magnetic energy storage magnet volume

NASA Astrophysics Data System (ADS)

Korpela, Aki; Lehtonen, Jorma; Mikkonen, Risto

2003-08-01

Nonlinear optimization problems in the field of electromagnetics have been successfully solved by means of sequential quadratic programming (SQP) and the finite element method (FEM). For example, the combination of SQP and FEM has been proven to be an efficient tool in the optimization of low temperature superconductors (LTS) superconducting magnetic energy storage (SMES) magnets. The procedure can also be applied for the optimization of HTS magnets. However, due to a strongly anisotropic material and a slanted electric field, current density characteristic high temperature superconductors HTS optimization is quite different from that of the LTS. In this paper the volumes of solenoidal conduction-cooled Bi-2223/Ag SMES magnets have been optimized at the operation temperature of 20 K. In addition to the electromagnetic constraints the stress caused by the tape bending has also been taken into account. Several optimization runs with different initial geometries were performed in order to find the best possible solution for a certain energy requirement. The optimization constraints describe the steady-state operation, thus the presented coil geometries are designed for slow ramping rates. Different energy requirements were investigated in order to find the energy dependence of the design parameters of optimized solenoidal HTS coils. According to the results, these dependences can be described with polynomial expressions.

A Bivalent Typhoid Live Vector Vaccine Expressing both Chromosome- and Plasmid-Encoded Yersinia pestis Antigens Fully Protects against Murine Lethal Pulmonary Plague Infection

PubMed Central

Wang, Jin Yuan; Carrasco, Jose A.; Lloyd, Scott A.; Mellado-Sanchez, Gabriela; Diaz-McNair, Jovita; Franco, Olga; Buskirk, Amanda D.; Nataro, James P.; Pasetti, Marcela F.

2014-01-01

Live attenuated bacteria hold great promise as multivalent mucosal vaccines against a variety of pathogens. A major challenge of this approach has been the successful delivery of sufficient amounts of vaccine antigens to adequately prime the immune system without overattenuating the live vaccine. Here we used a live attenuated Salmonella enterica serovar Typhi strain to create a bivalent mucosal plague vaccine that produces both the protective F1 capsular antigen of Yersinia pestis and the LcrV protein required for secretion of virulence effector proteins. To reduce the metabolic burden associated with the coexpression of F1 and LcrV within the live vector, we balanced expression of both antigens by combining plasmid-based expression of F1 with chromosomal expression of LcrV from three independent loci. The immunogenicity and protective efficacy of this novel vaccine were assessed in mice by using a heterologous prime-boost immunization strategy and compared to those of a conventional strain in which F1 and LcrV were expressed from a single low-copy-number plasmid. The serum antibody responses to lipopolysaccharide (LPS) induced by the optimized bivalent vaccine were indistinguishable from those elicited by the parent strain, suggesting an adequate immunogenic capacity maintained through preservation of bacterial fitness; in contrast, LPS titers were 10-fold lower in mice immunized with the conventional vaccine strain. Importantly, mice receiving the optimized bivalent vaccine were fully protected against lethal pulmonary challenge. These results demonstrate the feasibility of distributing foreign antigen expression across both chromosomal and plasmid locations within a single vaccine organism for induction of protective immunity. PMID:25332120

Exploring the potential of the bacterial carotene desaturase CrtI to increase the beta-carotene content in Golden Rice.

PubMed

Al-Babili, Salim; Hoa, Tran Thi Cuc; Schaub, Patrick

2006-01-01

To increase the beta-carotene (provitamin A) content and thus the nutritional value of Golden Rice, the optimization of the enzymes employed, phytoene synthase (PSY) and the Erwinia uredovora carotene desaturase (CrtI), must be considered. CrtI was chosen for this study because this bacterial enzyme, unlike phytoene synthase, was expressed at barely detectable levels in the endosperm of the Golden Rice events investigated. The low protein amounts observed may be caused by either weak cauliflower mosaic virus 35S promoter activity in the endosperm or by inappropriate codon usage. The protein level of CrtI was increased to explore its potential for enhancing the flux of metabolites through the pathway. For this purpose, a synthetic CrtI gene with a codon usage matching that of rice storage proteins was generated. Rice plants were transformed to express the synthetic gene under the control of the endosperm-specific glutelin B1 promoter. In addition, transgenic plants expressing the original bacterial gene were generated, but the endosperm-specific glutelin B1 promoter was employed instead of the cauliflower mosaic virus 35S promoter. Independent of codon optimization, the use of the endosperm-specific promoter resulted in a large increase in bacterial desaturase production in the T(1) rice grains. However, this did not lead to a significant increase in the carotenoid content, suggesting that the bacterial enzyme is sufficiently active in rice endosperm even at very low levels and is not rate-limiting. The endosperm-specific expression of CrtI did not affect the carotenoid pattern in the leaves, which was observed upon its constitutive expression. Therefore, tissue-specific expression of CrtI represents the better option.

[Optimization of cultural condition of genetic engineering strain for antibiotic peptide adenoregulin and research on its fed-batch cultivation].

PubMed

Zhou, Yu-Xun; Cao, Wei; Wei, Dong-Zhi; Luo, Qing-Ping; Wang, Jin-Zhi

2005-07-01

33 amino acid antibiotic peptide adenoregulin (ADR), which were firstly isolated from the skin of South America arboreal frog Phyllomedusa bicolor, forms alpha-helix amphipathic structure in apolar medium and has a wide spectrum of antimicrobial activity and high potency of lytic ability. Adr gene was cloned in pET32a and transformed into Escherichia coli BL21(DE3) . The cultural and inductive conditions of E. coli BL21(DE3)/pET32a-adr have been optimized. The effect of three factors which were time point of induction, concentration of IPTG in the culture and time of induction on the expression level of Trx-ADR was investigated. The results indicated that the expression level was affected by the time point of induction most predominantly. 9 veriaties of media in which BL21 (DE3)/pET32a-adr was cultured and induced were tested to achieve high expression level of target protein. It was found that glucose in the medium played an important role in keeping stable and high expression level of Trx-ADR. The optimal inductive condition is as follows: the culture medium is 2 x YT + 0.5% glucose, the time point of induction is OD600 = 0.9, the final concentration of IPTG in the culture is 0.1 mmol/L and the induction time is 4 h. BL21 (DE3)/pET32a-adr was cultivated according to the strategy of constant pH at early stage and exponential feeding at later stage to obtain high cell density. During the entire fed-batch phase, by controlling the feeding of glucose, the specific growth rate of the culture was controlled at about 0.15 h(-1), the accumulation of acetic acid was controlled at low level (<2 g/L), but the plasmid stability could not be maintained well. At the end of the cultivation, 40% of the bacteria in the culture lost their plasmids. As a result, the expression level of the target protein declined dramatically, but 90% of Trx-ADR was in soluble form. The expressed fusion protein showed no antibacterial activity, while the native form of ADR lysed from Trx-ADR showed distinct antibacterial activity.

Knockdown of the bovine prion gene PRNP by RNA interference (RNAi) technology.

PubMed

Sutou, Shizuyo; Kunishi, Miho; Kudo, Toshiyuki; Wongsrikeao, Pimprapar; Miyagishi, Makoto; Otoi, Takeshige

2007-07-26

Since prion gene-knockout mice do not contract prion diseases and animals in which production of prion protein (PrP) is reduced by half are resistant to the disease, we hypothesized that bovine animals with reduced PrP would be tolerant to BSE. Hence, attempts were made to produce bovine PRNP (bPRNP) that could be knocked down by RNA interference (RNAi) technology. Before an in vivo study, optimal conditions for knocking down bPRNP were determined in cultured mammalian cell systems. Factors examined included siRNA (short interfering RNA) expression plasmid vectors, target sites of PRNP, and lengths of siRNAs. Four siRNA expression plasmid vectors were used: three harboring different cloning sites were driven by the human U6 promoter (hU6), and one by the human tRNAVal promoter. Six target sites of bovine PRNP were designed using an algorithm. From 1 (22 mer) to 9 (19, 20, 21, 22, 23, 24, 25, 27, and 29 mer) siRNA expression vectors were constructed for each target site. As targets of siRNA, the entire bPRNP coding sequence was connected to the reporter gene of the fluorescent EGFP, or of firefly luciferase or Renilla luciferase. Target plasmid DNA was co-transfected with siRNA expression vector DNA into HeLaS3 cells, and fluorescence or luminescence was measured. The activities of siRNAs varied widely depending on the target sites, length of the siRNAs, and vectors used. Longer siRNAs were less effective, and 19 mer or 21 mer was generally optimal. Although 21 mer GGGGAGAACTTCACCGAAACT expressed by a hU6-driven plasmid with a Bsp MI cloning site was best under the present experimental conditions, the corresponding tRNA promoter-driven plasmid was almost equally useful. The effectiveness of this siRNA was confirmed by immunostaining and Western blotting. Four siRNA expression plasmid vectors, six target sites of bPRNP, and various lengths of siRNAs from 19 mer to 29 mer were examined to establish optimal conditions for knocking down of bPRNP in vitro. The most effective siRNA so far tested was 21 mer GGGGAGAACTTCACCGAAACT driven either by a hU6 or tRNA promoter, a finding that provides a basis for further studies in vivo.

OPTIMAL BAND SELECTION OF HYPERSPECTRAL DATA FOR TRANSGENIC CORN IDENTIFICATION

EPA Science Inventory

Resistance development by insect pests to the insecticidal proteins expressed in transgenic crops would increase reliance on broad spectrum chemical insecticides subsequently reducing environmental quality and increasing worker exposure to toxic chemicals. An important component ...

Optimization of interneuron function by direct coupling of cell migration and axonal targeting.

PubMed

Lim, Lynette; Pakan, Janelle M P; Selten, Martijn M; Marques-Smith, André; Llorca, Alfredo; Bae, Sung Eun; Rochefort, Nathalie L; Marín, Oscar

2018-06-18

Neural circuit assembly relies on the precise synchronization of developmental processes, such as cell migration and axon targeting, but the cell-autonomous mechanisms coordinating these events remain largely unknown. Here we found that different classes of interneurons use distinct routes of migration to reach the embryonic cerebral cortex. Somatostatin-expressing interneurons that migrate through the marginal zone develop into Martinotti cells, one of the most distinctive classes of cortical interneurons. For these cells, migration through the marginal zone is linked to the development of their characteristic layer 1 axonal arborization. Altering the normal migratory route of Martinotti cells by conditional deletion of Mafb-a gene that is preferentially expressed by these cells-cell-autonomously disrupts axonal development and impairs the function of these cells in vivo. Our results suggest that migration and axon targeting programs are coupled to optimize the assembly of inhibitory circuits in the cerebral cortex.

Fluorescent Reporter Libraries as Useful Tools for Optimizing Microbial Cell Factories: A Review of the Current Methods and Applications

PubMed Central

Delvigne, Frank; Pêcheux, Hélène; Tarayre, Cédric

2015-01-01

The use of genetically encoded fluorescent reporters allows speeding up the initial optimization steps of microbial bioprocesses. These reporters can be used for determining the expression level of a particular promoter, not only the synthesis of a specific protein but also the content of intracellular metabolites. The level of protein/metabolite is thus proportional to a fluorescence signal. By this way, mean expression profiles of protein/metabolites can be determined non-invasively at a high-throughput rate, allowing the rapid identification of the best producers. Actually, different kinds of reporter systems are available, as well as specific cultivation devices allowing the on-line recording of the fluorescent signal. Cell-to-cell variability is another important phenomenon that can be integrated into the screening procedures for the selection of more efficient microbial cell factories. PMID:26442261

Thermoelectric efficiency of nanoscale devices in the linear regime

NASA Astrophysics Data System (ADS)

Bevilacqua, G.; Grosso, G.; Menichetti, G.; Pastori Parravicini, G.

2016-12-01

We study quantum transport through two-terminal nanoscale devices in contact with two particle reservoirs at different temperatures and chemical potentials. We discuss the general expressions controlling the electric charge current, heat currents, and the efficiency of energy transmutation in steady conditions in the linear regime. With focus in the parameter domain where the electron system acts as a power generator, we elaborate workable expressions for optimal efficiency and thermoelectric parameters of nanoscale devices. The general concepts are set at work in the paradigmatic cases of Lorentzian resonances and antiresonances, and the encompassing Fano transmission function: the treatments are fully analytic, in terms of the trigamma functions and Bernoulli numbers. From the general curves here reported describing transport through the above model transmission functions, useful guidelines for optimal efficiency and thermopower can be inferred for engineering nanoscale devices in energy regions where they show similar transmission functions.

Optimization of industrial microorganisms: recent advances in synthetic dynamic regulators.

PubMed

Min, Byung Eun; Hwang, Hyun Gyu; Lim, Hyun Gyu; Jung, Gyoo Yeol

2017-01-01

Production of biochemicals by industrial fermentation using microorganisms requires maintaining cellular production capacity, because maximal productivity is economically important. High-productivity microbial strains can be developed using static engineering, but these may not maintain maximal productivity throughout the culture period as culture conditions and cell states change dynamically. Additionally, economic reasons limit heterologous protein expression using inducible promoters to prevent metabolic burden for commodity chemical and biofuel production. Recently, synthetic and systems biology has been used to design genetic circuits, precisely controlling gene expression or influencing genetic behavior toward a desired phenotype. Development of dynamic regulators can maintain cellular phenotype in a maximum production state in response to factors including cell concentration, oxygen, temperature, pH, and metabolites. Herein, we introduce dynamic regulators of industrial microorganism optimization and discuss metabolic flux fine control by dynamic regulators in response to metabolites or extracellular stimuli, robust production systems, and auto-induction systems using quorum sensing.

Increased dipicolinic acid production with an enhanced spoVF operon in Bacillus subtilis and medium optimization.

PubMed

Takahashi, Fumikazu; Sumitomo, Nobuyuki; Hagihara, Hiroshi; Ozaki, Katsuya

2015-01-01

Dipicolinic acid (DPA) is a multi-functional agent for cosmetics, antimicrobial products, detergents, and functional polymers. The aim of this study was to design a new method for producing DPA from renewable material. The Bacillus subtilis spoVF operon encodes enzymes for DPA synthase and the part of lysine biosynthetic pathway. However, DPA is only synthesized in the sporulation phase, so the productivity of DPA is low level. Here, we report that DPA synthase was expressed in vegetative cells, and DPA was produced in the culture medium by replacement of the spoVFA promoter with other highly expressed promoter in B. subtilis vegetative cells, such as spoVG promoter. DPA levels were increased in the culture medium of genetically modified strains. DPA productivity was significantly improved up to 29.14 g/L in 72 h culture by improving the medium composition using a two-step optimization technique with the Taguchi methodology.

Bayesian estimation of the discrete coefficient of determination.

PubMed

Chen, Ting; Braga-Neto, Ulisses M

2016-12-01

The discrete coefficient of determination (CoD) measures the nonlinear interaction between discrete predictor and target variables and has had far-reaching applications in Genomic Signal Processing. Previous work has addressed the inference of the discrete CoD using classical parametric and nonparametric approaches. In this paper, we introduce a Bayesian framework for the inference of the discrete CoD. We derive analytically the optimal minimum mean-square error (MMSE) CoD estimator, as well as a CoD estimator based on the Optimal Bayesian Predictor (OBP). For the latter estimator, exact expressions for its bias, variance, and root-mean-square (RMS) are given. The accuracy of both Bayesian CoD estimators with non-informative and informative priors, under fixed or random parameters, is studied via analytical and numerical approaches. We also demonstrate the application of the proposed Bayesian approach in the inference of gene regulatory networks, using gene-expression data from a previously published study on metastatic melanoma.

In vitro DNA SCRaMbLE.

PubMed

Wu, Yi; Zhu, Rui-Ying; Mitchell, Leslie A; Ma, Lu; Liu, Rui; Zhao, Meng; Jia, Bin; Xu, Hui; Li, Yun-Xiang; Yang, Zu-Ming; Ma, Yuan; Li, Xia; Liu, Hong; Liu, Duo; Xiao, Wen-Hai; Zhou, Xiao; Li, Bing-Zhi; Yuan, Ying-Jin; Boeke, Jef D

2018-05-22

The power of synthetic biology has enabled the expression of heterologous pathways in cells, as well as genome-scale synthesis projects. The complexity of biological networks makes rational de novo design a grand challenge. Introducing features that confer genetic flexibility is a powerful strategy for downstream engineering. Here we develop an in vitro method of DNA library construction based on structural variation to accomplish this goal. The "in vitro SCRaMbLE system" uses Cre recombinase mixed in a test tube with purified DNA encoding multiple loxPsym sites. Using a β-carotene pathway designed for expression in yeast as an example, we demonstrate top-down and bottom-up in vitro SCRaMbLE, enabling optimization of biosynthetic pathway flux via the rearrangement of relevant transcription units. We show that our system provides a straightforward way to correlate phenotype and genotype and is potentially amenable to biochemical optimization in ways that the in vivo system cannot achieve.

Optimizing Transfection of Primary Human Umbilical Vein Endothelial Cells Using Commercially Available Chemical Transfection Reagents

PubMed Central

Hunt, Michelle A.; Currie, Margaret J.; Robinson, Bridget A.; Dachs, Gabi U.

2010-01-01

Primary cells, such as HUVEC, are notoriously difficult to transfect and are susceptible to the toxic effects of transfection reagents. A transfection reagent with a high transfection efficiency and low cytotoxicity was sought to retain sufficient viability of transfected HUVEC for subsequent assays. Nine chemical transfection reagents, currently commercially available, were compared for their ability to transfect HUVEC in vitro. A plasmid expressing the enhanced GFP (EGFP) was used for transfection, followed by flow cytometry of transfected HUVEC to determine the proportion of EGFP-expressing cells as a measure of transfection efficiency. Lipofectamine 2000 and Lipofectamine LTX (Invitrogen, Carlsbad, CA, USA) gave the highest transfection efficiencies of the reagents tested. Lipofectamine LTX was identified as the optimal transfection reagent as a result of its higher transfection efficiency at shorter periods of time following transfection when cytotoxicity was limited, allowing sufficient yield of transfected HUVEC for use in subsequent assays. PMID:20592869

Genetic engineering of Synechocystis PCC6803 for the photoautotrophic production of the sweetener erythritol.

PubMed

van der Woude, Aniek D; Perez Gallego, Ruth; Vreugdenhil, Angie; Puthan Veetil, Vinod; Chroumpi, Tania; Hellingwerf, Klaas J

2016-04-08

Erythritol is a polyol that is used in the food and beverage industry. Due to its non-caloric and non-cariogenic properties, the popularity of this sweetener is increasing. Large scale production of erythritol is currently based on conversion of glucose by selected fungi. In this study, we describe a biotechnological process to produce erythritol from light and CO2, using engineered Synechocystis sp. PCC6803. By functionally expressing codon-optimized genes encoding the erythrose-4-phosphate phosphatase TM1254 and the erythrose reductase Gcy1p, or GLD1, this cyanobacterium can directly convert the Calvin cycle intermediate erythrose-4-phosphate into erythritol via a two-step process and release the polyol sugar in the extracellular medium. Further modifications targeted enzyme expression and pathway intermediates. After several optimization steps, the best strain, SEP024, produced up to 2.1 mM (256 mg/l) erythritol, excreted in the medium.

Development of an efficient E. coli expression and purification system for a catalytically active, human Cullin3-RINGBox1 protein complex and elucidation of its quaternary structure with Keap1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Small, Evan; Eggler, Aimee; Mesecar, Andrew D., E-mail: amesecar@purdue.edu

2010-10-01

Research highlights: {yields} A novel expression strategy was used to purify Cul3-Rbx1 from E. coli. {yields} The Cul3-Rbx1 complex is fully active and catalyzes ubiquitination of Nrf2 in vitro. {yields} Cul3, Rbx1, and Keap1 form a complex with unique stoichiometry of 1:1:2. -- Abstract: The Cullin3-based E3 ubiquitin ligase complex is thought to play an important role in the cellular response to oxidative stress and xenobiotic assault. While limited biochemical studies of the ligase's role in these complex signaling pathways are beginning to emerge, structural studies are lagging far behind due to the inability to acquire sufficient quantities of full-length,more » highly pure and active Cullin3. Here we describe the design and construction of an optimized expression and purification system for the full-length, human Cullin3-RINGBox 1 (Rbx1) protein complex from Escherichia coli. The dual-expression system is comprised of codon-optimized Cullin3 and Rbx1 genes co-expressed from a single pET-Duet-1 plasmid. Rapid purification of the Cullin3-Rbx1 complex is achieved in two steps via an affinity column followed by size-exclusion chromatography. Approximately 15 mg of highly pure and active Cullin3-Rbx1 protein from 1 L of E. coli culture can be achieved. Analysis of the quaternary structure of the Cullin3-Rbx1 and Cullin3-Rbx1-Keap1 complexes by size-exclusion chromatography and analytical ultracentrifugation indicates a 1:1 stoichiometry for the Cullin3-Rbx1 complex (MW = 111 kDa), and a 1:1:2 stoichiometry for the Cullin3-Rbx1-Keap1 complex (MW = 280 kDa). This latter complex has a novel quaternary structural organization for cullin E3 ligases, and it is fully active based on an in vitro Cullin3-Rbx1-Keap1-Nrf2 ubiquitination activity assay that was developed and optimized in this study.« less

Analytic model for ultrasound energy receivers and their optimal electric loads

NASA Astrophysics Data System (ADS)

Gorostiaga, M.; Wapler, M. C.; Wallrabe, U.

2017-08-01

In this paper, we present an analytic model for thickness resonating plate ultrasound energy receivers, which we have derived from the piezoelectric and the wave equations and, in which we have included dielectric, viscosity and acoustic attenuation losses. Afterwards, we explore the optimal electric load predictions by the zero reflection and power maximization approaches present in the literature with different acoustic boundary conditions, and discuss their limitations. To validate our model, we compared our expressions with the KLM model solved numerically with very good agreement. Finally, we discuss the differences between the zero reflection and power maximization optimal electric loads, which start to differ as losses in the receiver increase.

Modeling surgical tool selection patterns as a "traveling salesman problem" for optimizing a modular surgical tool system.

PubMed

Nelson, Carl A; Miller, David J; Oleynikov, Dmitry

2008-01-01

As modular systems come into the forefront of robotic telesurgery, streamlining the process of selecting surgical tools becomes an important consideration. This paper presents a method for optimal queuing of tools in modular surgical tool systems, based on patterns in tool-use sequences, in order to minimize time spent changing tools. The solution approach is to model the set of tools as a graph, with tool-change frequency expressed as edge weights in the graph, and to solve the Traveling Salesman Problem for the graph. In a set of simulations, this method has shown superior performance at optimizing tool arrangements for streamlining surgical procedures.

Attitude determination and parameter estimation using vector observations - Theory

NASA Technical Reports Server (NTRS)

Markley, F. Landis

1989-01-01

Procedures for attitude determination based on Wahba's loss function are generalized to include the estimation of parameters other than the attitude, such as sensor biases. Optimization with respect to the attitude is carried out using the q-method, which does not require an a priori estimate of the attitude. Optimization with respect to the other parameters employs an iterative approach, which does require an a priori estimate of these parameters. Conventional state estimation methods require a priori estimates of both the parameters and the attitude, while the algorithm presented in this paper always computes the exact optimal attitude for given values of the parameters. Expressions for the covariance of the attitude and parameter estimates are derived.

Structural physical approximation for the realization of the optimal singlet fraction with two measurements

NASA Astrophysics Data System (ADS)

Adhikari, Satyabrata

2018-04-01

Structural physical approximation (SPA) has been exploited to approximate nonphysical operation such as partial transpose. It has already been studied in the context of detection of entanglement and found that if the minimum eigenvalue of SPA to partial transpose is less than 2/9 then the two-qubit state is entangled. We find application of SPA to partial transpose in the estimation of the optimal singlet fraction. We show that the optimal singlet fraction can be expressed in terms of the minimum eigenvalue of SPA to partial transpose. We also show that the optimal singlet fraction can be realized using Hong-Ou-Mandel interferometry with only two detectors. Further we have shown that the generated hybrid entangled state between a qubit and a binary coherent state can be used as a resource state in quantum teleportation.

Automated Protocol for Large-Scale Modeling of Gene Expression Data.

PubMed

Hall, Michelle Lynn; Calkins, David; Sherman, Woody

2016-11-28

With the continued rise of phenotypic- and genotypic-based screening projects, computational methods to analyze, process, and ultimately make predictions in this field take on growing importance. Here we show how automated machine learning workflows can produce models that are predictive of differential gene expression as a function of a compound structure using data from A673 cells as a proof of principle. In particular, we present predictive models with an average accuracy of greater than 70% across a highly diverse ∼1000 gene expression profile. In contrast to the usual in silico design paradigm, where one interrogates a particular target-based response, this work opens the opportunity for virtual screening and lead optimization for desired multitarget gene expression profiles.

Matrix elements of N-particle explicitly correlated Gaussian basis functions with complex exponential parameters

NASA Astrophysics Data System (ADS)

Bubin, Sergiy; Adamowicz, Ludwik

2006-06-01

In this work we present analytical expressions for Hamiltonian matrix elements with spherically symmetric, explicitly correlated Gaussian basis functions with complex exponential parameters for an arbitrary number of particles. The expressions are derived using the formalism of matrix differential calculus. In addition, we present expressions for the energy gradient that includes derivatives of the Hamiltonian integrals with respect to the exponential parameters. The gradient is used in the variational optimization of the parameters. All the expressions are presented in the matrix form suitable for both numerical implementation and theoretical analysis. The energy and gradient formulas have been programed and used to calculate ground and excited states of the He atom using an approach that does not involve the Born-Oppenheimer approximation.

Matrix elements of N-particle explicitly correlated Gaussian basis functions with complex exponential parameters.

PubMed

Bubin, Sergiy; Adamowicz, Ludwik

2006-06-14

In this work we present analytical expressions for Hamiltonian matrix elements with spherically symmetric, explicitly correlated Gaussian basis functions with complex exponential parameters for an arbitrary number of particles. The expressions are derived using the formalism of matrix differential calculus. In addition, we present expressions for the energy gradient that includes derivatives of the Hamiltonian integrals with respect to the exponential parameters. The gradient is used in the variational optimization of the parameters. All the expressions are presented in the matrix form suitable for both numerical implementation and theoretical analysis. The energy and gradient formulas have been programmed and used to calculate ground and excited states of the He atom using an approach that does not involve the Born-Oppenheimer approximation.

[Prokaryotic expression, purification and antigenicity identification of recombinant human survivin protein].

PubMed

Yin, Xiaotao; Wang, Wei; Tian, Renli; Xu, Yuanji; Yan, Jinqi; Zhang, Wei; Gao, Jiangping; Yu, Jiyun

2013-08-01

To construct a prokaryotic expression plasmid pET28a-survivin, optimize the recombinant protein expression conditions in E.coli, and purify the survivin recombinant protein and identify its antigenicity. Survivin cDNA segment was amplified by PCR and cloned into prokaryotic expression vector pET28a(+) to construct the recombinant expression vector pET28a-survivin. The expression vector was transformed into BL21 (DE3) and the fusion protein survivin/His was induced by IPTG. The fusion protein was purified through Ni affinity chromatography. The antigenicity of the purified survivin protein was identified by Western blotting and ELISA. The recombinant expression vector was verified successfully by BamHI and HindIII. The fusion protein induced by IPTG was obtained with Mr; about 24 000. The purity of the purified protein reached 90% by SDS-PAGE analysis. And the antigenicity of the survivin protein was validated by Western blotting and ELISA. The prokaryotic expression plasmid pET28a-survivin was successfully constructed and the survivin protein was expressed and purified in E.coli. The antigenicity of the purified survivin protein was demonstrated desirable.

Integration Method of Emphatic Motions and Adverbial Expressions with Scalar Parameters for Robotic Motion Coaching System

NASA Astrophysics Data System (ADS)

Okuno, Keisuke; Inamura, Tetsunari

A robotic coaching system can improve humans' learning performance of motions by intelligent usage of emphatic motions and adverbial expressions according to user reactions. In robotics, however, method to control both the motions and the expressions and how to bind them had not been adequately discussed from an engineering point of view. In this paper, we propose a method for controlling and binding emphatic motions and adverbial expressions by using two scalar parameters in a phase space. In the phase space, variety of motion patterns and verbal expressions are connected and can be expressed as static points. We show the feasibility of the proposing method through experiments of actual sport coaching tasks for beginners. From the results of participants' improvements in motion learning, we confirmed the feasibility of the methods to control and bind emphatic motions and adverbial expressions, as well as confirmed contribution of the emphatic motions and positive correlation of adverbial expressions for participants' improvements in motion learning. Based on the results, we introduce a hypothesis that individually optimized method for binding adverbial expression is required.

Gene transfer strategies in animal transgenesis.

PubMed

Montoliu, Lluís

2002-01-01

Position effects in animal transgenesis have prevented the reproducible success and limited the initial expectations of this technique in many biotechnological projects. Historically, several strategies have been devised to overcome such position effects, including the progressive addition of regulatory elements belonging to the same or to a heterologous expression domain. An expression domain is thought to contain all regulatory elements that are needed to specifically control the expression of a given gene in time and space. The lack of profound knowledge on the chromatin structure of expression domains of biotechnological interest, such as mammary gland-specific genes, explains why most standard expression vectors have failed to drive high-level, position-independent, and copy-number-dependent expression of transgenes in a reproducible manner. In contrast, the application of artificial chromosome-type constructs to animal transgenesis usually ensures optimal expression levels. YACs, BACs, and PACs have become crucial tools in animal transgenesis, allowing the inclusion of distant key regulatory sequences, previously unknown, that are characteristic for each expression domain. These elements contribute to insulating the artificial chromosome-type constructs from chromosomal position effects and are fundamental in order to guarantee the correct expression of transgenes.

[Prokaryotic expression of recombinant prochymosin gene and its antiserum preparation].

PubMed

Li, Xin-ping; Liu, Huan-huan; Pu, Yan; Zhang, Fu-chun; Li, Yi-jie

2012-07-01

To optimize the prochymosin (pCHY) gene codons and express the gene in Escherichia coli (E.coli), and to prepare its antiserum and detect chymosin protein specifically. According to codon usage bias of E.coli, prochymosin gene sequence was synthesized based on the conserved sequences of prochymosin gene from bovine, lamb and camel, and then cloned into the plasmid pET-30a and pcDNA3-AAT-COMP-C3d3 (pcD-ACC), respectively. pET-30a-pCHY was expressed, as the detected antigen, in E.coli BL21(DE3) after IPTG induction. RT-PCR was used to detect prochymosin mRNA expression in liver from the mice injected pcDNA3-AAT-COMP-pCHY-C3d3(pACCC) by hydrodynamics-based transfection method. To prepare the antiserum of prochymosin, pACCC and GST-pCHY proteins were used to immunize New Zealand rabbits in accordance with DNA prime-protein boost strategy. Antibody levels were tested by ELISA. Western blotting showed the molecular weight of His-pCHY protein was about 55 000, similar to the expected molecular size. ELISA demonstrated that the titer level of prochymosin antiserum was high. Based on the codon optimization, we have obtained high-titer prochymosin antiserum through DNA vaccine vector pcD-ACC combined with DNA prime-protein boost strategy, similar to that by protein vaccine.

Formal expressions and corresponding expansions for the exact Kohn-Sham exchange potential

NASA Astrophysics Data System (ADS)

Bulat, Felipe A.; Levy, Mel

2009-11-01

Formal expressions and their corresponding expansions in terms of Kohn-Sham (KS) orbitals are deduced for the exchange potential vx(r) . After an alternative derivation of the basic optimized effective potential integrodifferential equations is given through a Hartree-Fock adiabatic connection perturbation theory, we present an exact infinite expansion for vx(r) that is particularly simple in structure. It contains the very same occupied-virtual quantities that appear in the well-known optimized effective potential integral equation, but in this new expression vx(r) is isolated on one side of the equation. An orbital-energy modified Slater potential is its leading term which gives encouraging numerical results. Along different lines, while the earlier Krieger-Li-Iafrate approximation truncates completely the necessary first-order perturbation orbitals, we observe that the improved localized Hartree-Fock (LHF) potential, or common energy denominator potential (CEDA), or effective local potential (ELP), incorporates the part of each first-order orbital that consists of the occupied KS orbitals. With this in mind, the exact correction to the LHF, CEDA, or ELP potential (they are all equivalent) is deduced and displayed in terms of the virtual portions of the first-order orbitals. We close by observing that the newly derived exact formal expressions and corresponding expansions apply as well for obtaining the correlation potential from an orbital-dependent correlation energy functional.

Improved Soluble ScFv ELISA Screening Approach for Antibody Discovery Using Phage Display Technology.

PubMed

Tohidkia, Mohammad R; Sepehri, Maryam; Khajeh, Shirin; Barar, Jaleh; Omidi, Yadollah

2017-09-01

Phage display technology (PDT) is a powerful tool for the isolation of recombinant antibody (Ab) fragments. Using PDT, target molecule-specific phage-Ab clones are enriched through the "biopanning" process. The individual specific binders are screened by the monoclonal scFv enzyme-linked immunosorbent assay (ELISA) that may associate with inevitable false-negative results. Thus, in this study, three strategies were investigated for optimization of the scFvs screening using Tomlinson I and J libraries, including (1) optimizing the expression of functional scFvs, (2) improving the sensitivity of ELISA, and (3) preparing different samples containing scFvs. The expression of all scFv Abs was significantly enhanced when scFv clones were cultivated in the terrific broth (TB) medium at the optimum temperature of 30 °C. The protein A-conjugated with horseradish peroxidase (HRP) was found to be a well-suited reagent for the detection of Ag-bound scFvs in comparison with either anti-c-myc Ab or the mixing procedure. Based on our findings, it seems there is no universal media supplement for an improved expression of all scFvs derived from both Tomlinson I and J libraries. We thus propose that expression of scFv fragments in a microplate scale is largely dependent on a variety of parameters, in particular the scFv clones and relevant sequences.

[Correlation of codon biases and potential secondary structures with mRNA translation efficiency in unicellular organisms].

PubMed

Vladimirov, N V; Likhoshvaĭ, V A; Matushkin, Iu G

2007-01-01

Gene expression is known to correlate with degree of codon bias in many unicellular organisms. However, such correlation is absent in some organisms. Recently we demonstrated that inverted complementary repeats within coding DNA sequence must be considered for proper estimation of translation efficiency, since they may form secondary structures that obstruct ribosome movement. We have developed a program for estimation of potential coding DNA sequence expression in defined unicellular organism using its genome sequence. The program computes elongation efficiency index. Computation is based on estimation of coding DNA sequence elongation efficiency, taking into account three key factors: codon bias, average number of inverted complementary repeats, and free energy of potential stem-loop structures formed by the repeats. The influence of these factors on translation is numerically estimated. An optimal proportion of these factors is computed for each organism individually. Quantitative translational characteristics of 384 unicellular organisms (351 bacteria, 28 archaea, 5 eukaryota) have been computed using their annotated genomes from NCBI GenBank. Five potential evolutionary strategies of translational optimization have been determined among studied organisms. A considerable difference of preferred translational strategies between Bacteria and Archaea has been revealed. Significant correlations between elongation efficiency index and gene expression levels have been shown for two organisms (S. cerevisiae and H. pylori) using available microarray data. The proposed method allows to estimate numerically the coding DNA sequence translation efficiency and to optimize nucleotide composition of heterologous genes in unicellular organisms. http://www.mgs.bionet.nsc.ru/mgs/programs/eei-calculator/.

Analytical Model and Optimized Design of Power Transmitting Coil for Inductively Coupled Endoscope Robot.

PubMed

Ke, Quan; Luo, Weijie; Yan, Guozheng; Yang, Kai

2016-04-01

A wireless power transfer system based on the weakly inductive coupling makes it possible to provide the endoscope microrobot (EMR) with infinite power. To facilitate the patients' inspection with the EMR system, the diameter of the transmitting coil is enlarged to 69 cm. Due to the large transmitting range, a high quality factor of the Litz-wire transmitting coil is a necessity to ensure the intensity of magnetic field generated efficiently. Thus, this paper builds an analytical model of the transmitting coil, and then, optimizes the parameters of the coil by enlarging the quality factor. The lumped model of the transmitting coil includes three parameters: ac resistance, self-inductance, and stray capacitance. Based on the exact two-dimension solution, the accurate analytical expression of ac resistance is derived. Several transmitting coils of different specifications are utilized to verify this analytical expression, being in good agreements with the measured results except the coils with a large number of strands. Then, the quality factor of transmitting coils can be well predicted with the available analytical expressions of self- inductance and stray capacitance. Owing to the exact estimation of quality factor, the appropriate coil turns of the transmitting coil is set to 18-40 within the restrictions of transmitting circuit and human tissue issues. To supply enough energy for the next generation of the EMR equipped with a Ø9.5×10.1 mm receiving coil, the coil turns of the transmitting coil is optimally set to 28, which can transfer a maximum power of 750 mW with the remarkable delivering efficiency of 3.55%.

Environmental Statistics and Optimal Regulation

PubMed Central

2014-01-01

Any organism is embedded in an environment that changes over time. The timescale for and statistics of environmental change, the precision with which the organism can detect its environment, and the costs and benefits of particular protein expression levels all will affect the suitability of different strategies–such as constitutive expression or graded response–for regulating protein levels in response to environmental inputs. We propose a general framework–here specifically applied to the enzymatic regulation of metabolism in response to changing concentrations of a basic nutrient–to predict the optimal regulatory strategy given the statistics of fluctuations in the environment and measurement apparatus, respectively, and the costs associated with enzyme production. We use this framework to address three fundamental questions: (i) when a cell should prefer thresholding to a graded response; (ii) when there is a fitness advantage to implementing a Bayesian decision rule; and (iii) when retaining memory of the past provides a selective advantage. We specifically find that: (i) relative convexity of enzyme expression cost and benefit influences the fitness of thresholding or graded responses; (ii) intermediate levels of measurement uncertainty call for a sophisticated Bayesian decision rule; and (iii) in dynamic contexts, intermediate levels of uncertainty call for retaining memory of the past. Statistical properties of the environment, such as variability and correlation times, set optimal biochemical parameters, such as thresholds and decay rates in signaling pathways. Our framework provides a theoretical basis for interpreting molecular signal processing algorithms and a classification scheme that organizes known regulatory strategies and may help conceptualize heretofore unknown ones. PMID:25254493

Optimizing probability of detection point estimate demonstration

NASA Astrophysics Data System (ADS)

Koshti, Ajay M.

2017-04-01

The paper provides discussion on optimizing probability of detection (POD) demonstration experiments using point estimate method. The optimization is performed to provide acceptable value for probability of passing demonstration (PPD) and achieving acceptable value for probability of false (POF) calls while keeping the flaw sizes in the set as small as possible. POD Point estimate method is used by NASA for qualifying special NDE procedures. The point estimate method uses binomial distribution for probability density. Normally, a set of 29 flaws of same size within some tolerance are used in the demonstration. Traditionally largest flaw size in the set is considered to be a conservative estimate of the flaw size with minimum 90% probability and 95% confidence. The flaw size is denoted as α90/95PE. The paper investigates relationship between range of flaw sizes in relation to α90, i.e. 90% probability flaw size, to provide a desired PPD. The range of flaw sizes is expressed as a proportion of the standard deviation of the probability density distribution. Difference between median or average of the 29 flaws and α90 is also expressed as a proportion of standard deviation of the probability density distribution. In general, it is concluded that, if probability of detection increases with flaw size, average of 29 flaw sizes would always be larger than or equal to α90 and is an acceptable measure of α90/95PE. If NDE technique has sufficient sensitivity and signal-to-noise ratio, then the 29 flaw-set can be optimized to meet requirements of minimum required PPD, maximum allowable POF, requirements on flaw size tolerance about mean flaw size and flaw size detectability requirements. The paper provides procedure for optimizing flaw sizes in the point estimate demonstration flaw-set.

Skin delivery of epigallocatechin-3-gallate (EGCG) and hyaluronic acid loaded nano-transfersomes for antioxidant and anti-aging effects in UV radiation induced skin damage.

PubMed

Avadhani, Kiran S; Manikkath, Jyothsna; Tiwari, Mradul; Chandrasekhar, Misra; Godavarthi, Ashok; Vidya, Shimoga M; Hariharapura, Raghu C; Kalthur, Guruprasad; Udupa, Nayanabhirama; Mutalik, Srinivas

2017-11-01

The present work attempts to develop and statistically optimize transfersomes containing EGCG and hyaluronic acid to synergize the UV radiation-protective ability of both compounds, along with imparting antioxidant and anti-aging effects. Transfersomes were prepared by thin film hydration technique, using soy phosphatidylcholine and sodium cholate, combined with high-pressure homogenization. They were characterized with respect to size, polydispersity index, zeta potential, morphology, entrapment efficiency, Fourier Transform Infrared Spectroscopy (FTIR), Differential Scanning Calorimetry (DSC), X-ray Diffraction (XRD), in vitro antioxidant activity and ex vivo skin permeation studies. Cell viability, lipid peroxidation, intracellular ROS levels and expression of MMPs (2 and 9) were determined in human keratinocyte cell lines (HaCaT). The composition of the transfersomes was statistically optimized by Design of Experiments using Box-Behnken design with four factors at three levels. The optimized transfersome formulation showed vesicle size, polydispersity index and zeta potential of 101.2 ± 6.0 nm, 0.245 ± 0.069 and -44.8 ± 5.24 mV, respectively. FTIR and DSC showed no interaction between EGCG and the selected excipients. XRD results revealed no form conversion of EGCG in its transfersomal form. The optimized transfersomes were found to increase the cell viability and reduce the lipid peroxidation, intracellular ROS and expression of MMPs in HaCaT cells. The optimized transfersomal formulation of EGCG and HA exhibited considerably higher skin permeation and deposition of EGCG than that observed with plain EGCG. The results underline the potential application of the developed transfersomes in sunscreen cream/lotions for improvement of UV radiation-protection along with deriving antioxidant and anti-aging effects.

Results of an integrated structure/control law design sensitivity analysis

NASA Technical Reports Server (NTRS)

Gilbert, Michael G.

1989-01-01

A design sensitivity analysis method for Linear Quadratic Cost, Gaussian (LQG) optimal control laws, which predicts change in the optimal control law due to changes in fixed problem parameters using analytical sensitivity equations is discussed. Numerical results of a design sensitivity analysis for a realistic aeroservoelastic aircraft example are presented. In this example, the sensitivity of the optimally controlled aircraft's response to various problem formulation and physical aircraft parameters is determined. These results are used to predict the aircraft's new optimally controlled response if the parameter was to have some other nominal value during the control law design process. The sensitivity results are validated by recomputing the optimal control law for discrete variations in parameters, computing the new actual aircraft response, and comparing with the predicted response. These results show an improvement in sensitivity accuracy for integrated design purposes over methods which do not include changes in the optimal control law. Use of the analytical LQG sensitivity expressions is also shown to be more efficient than finite difference methods for the computation of the equivalent sensitivity information.