Problem-Solving Test: Real-Time Polymerase Chain Reaction

ERIC Educational Resources Information Center

Szeberenyi, Jozsef

2009-01-01

Terms to be familiar with before you start to solve the test: polymerase chain reaction, DNA amplification, electrophoresis, breast cancer, "HER2" gene, genomic DNA, "in vitro" DNA synthesis, template, primer, Taq polymerase, 5[prime][right arrow]3[prime] elongation activity, 5[prime][right arrow]3[prime] exonuclease activity, deoxyribonucleoside…

Directed evolution of polymerase function by compartmentalized self-replication.

PubMed

Ghadessy, F J; Ong, J L; Holliger, P

2001-04-10

We describe compartmentalized self-replication (CSR), a strategy for the directed evolution of enzymes, especially polymerases. CSR is based on a simple feedback loop consisting of a polymerase that replicates only its own encoding gene. Compartmentalization serves to isolate individual self-replication reactions from each other. In such a system, adaptive gains directly (and proportionally) translate into genetic amplification of the encoding gene. CSR has applications in the evolution of polymerases with novel and useful properties. By using three cycles of CSR, we obtained variants of Taq DNA polymerase with 11-fold higher thermostability than the wild-type enzyme or with a >130-fold increased resistance to the potent inhibitor heparin. Insertion of an extra stage into the CSR cycle before the polymerase reaction allows its application to enzymes other than polymerases. We show that nucleoside diphosphate kinase and Taq polymerase can form such a cooperative CSR cycle based on reciprocal catalysis, whereby nucleoside diphosphate kinase produces the substrates required for the replication of its own gene. We also find that in CSR the polymerase genes themselves evolve toward more efficient replication. Thus, polymerase genes and their encoded polypeptides cooperate to maximize postselection copy number. CSR should prove useful for the directed evolution of enzymes, particularly DNA or RNA polymerases, as well as for the design and study of in vitro self-replicating systems mimicking prebiotic evolution and viral replication.

Optimization of routine KRAS mutation PCR-based testing procedure for rational individualized first-line-targeted therapy selection in metastatic colorectal cancer.

PubMed

Chretien, Anne-Sophie; Harlé, Alexandre; Meyer-Lefebvre, Magali; Rouyer, Marie; Husson, Marie; Ramacci, Carole; Harter, Valentin; Genin, Pascal; Leroux, Agnès; Merlin, Jean-Louis

2013-02-01

KRAS mutation detection represents a crucial issue in metastatic colorectal cancer (mCRC). The optimization of KRAS mutation detection delay enabling rational prescription of first-line treatment in mCRC including anti-EGFR-targeted therapy requires robust and rapid molecular biology techniques. Routine analysis of mutations in codons 12 and 13 on 674 paraffin-embedded tissue specimens of mCRC has been performed for KRAS mutations detection using three molecular biology techniques, that is, high-resolution melting (HRM), polymerase chain reaction restriction fragment length polymorphism (PCR-RFLP), and allelic discrimination PCR (TaqMan PCR). Discordant cases were assessed with COBAS 4800 KRAS CE-IVD assay. Among the 674 tumor specimens, 1.5% (10/674) had excessive DNA degradation and could not be analyzed. KRAS mutations were detected in 38.0% (256/674) of the analysable specimens (82.4% in codon 12 and 17.6% in codon 13). Among 613 specimens in whom all three techniques were used, 12 (2.0%) cases of discordance between the three techniques were observed. 83.3% (10/12) of the discordances were due to PCR-RFLP as confirmed by COBAS 4800 retrospective analysis. The three techniques were statistically comparable (κ > 0.9; P < 0.001). From these results, optimization of the routine procedure consisted of proceeding to systematic KRAS detection using HRM and TaqMan and PCR-RFLP in case of discordance and allowed significant decrease in delays. The results showed an excellent correlation between the three techniques. Using HRM and TaqMan warrants high-quality and rapid-routine KRAS mutation detection in paraffin-embedded tumor specimens. The new procedure allowed a significant decrease in delays for reporting results, enabling rational prescription of first-line-targeted therapy in mCRC.

A TaqMan-based real-time PCR assay for porcine parvovirus 4 detection and quantification in reproductive tissues of sows

USDA-ARS?s Scientific Manuscript database

Porcine parvovirus 4 (PPV4) is a DNA virus, and a member of the Parvoviridae family within the Bocavirus genera. It was recently detected in swine, but its epidemiology and pathology remain unclear. A TaqMan-based real-time polymerase chain reaction (qPCR) assay targeting a conserved region of the O...

Development of a real-time quantitative PCR assay to enumerate Yersinia pestis in fleas.

PubMed

Gabitzsch, Elizabeth S; Vera-Tudela, Rommelle; Eisen, Rebecca J; Bearden, Scott W; Gage, Kenneth L; Zeidner, Nordin S

2008-07-01

A real-time quantitative polymerase chain reaction (qPCR) assay was developed for Yersina pestis. The qPCR assay was developed utilizing a conserved region of the Y. pestis ferric iron uptake regulator gene (fur) to design primers and a fluorescent (FAM-labeled) TaqMan probe. The assay was optimized using cultured Y. pestis (UG05-0454) and was confirmed to work with strains from 3 Y. pestis biovars. The optimized assay was capable of detecting a single organism of cultured Y. pestis and as little as 300 bacteria in infected flea triturates. This qPCR assay enables rapid enumeration of Y. pestis bacterium in laboratory-infected fleas when compared with conventional serial dilution plating.

Compartmentalized self-replication under fast PCR cycling conditions yields Taq DNA polymerase mutants with increased DNA-binding affinity and blood resistance.

PubMed

Arezi, Bahram; McKinney, Nancy; Hansen, Connie; Cayouette, Michelle; Fox, Jeffrey; Chen, Keith; Lapira, Jennifer; Hamilton, Sarah; Hogrefe, Holly

2014-01-01

Faster-cycling PCR formulations, protocols, and instruments have been developed to address the need for increased throughput and shorter turn-around times for PCR-based assays. Although run times can be cut by up to 50%, shorter cycle times have been correlated with lower detection sensitivity and increased variability. To address these concerns, we applied Compartmentalized Self Replication (CSR) to evolve faster-cycling mutants of Taq DNA polymerase. After five rounds of selection using progressively shorter PCR extension times, individual mutations identified in the fastest-cycling clones were randomly combined using ligation-based multi-site mutagenesis. The best-performing combinatorial mutants exhibit 35- to 90-fold higher affinity (lower Kd ) for primed template and a moderate (2-fold) increase in extension rate compared to wild-type Taq. Further characterization revealed that CSR-selected mutations provide increased resistance to inhibitors, and most notably, enable direct amplification from up to 65% whole blood. We discuss the contribution of individual mutations to fast-cycling and blood-resistant phenotypes.

Bat white-nose syndrome: A real-time TaqMan polymerase chain reaction test targeting the intergenic spacer region of Geomyces destructans

Treesearch

Laura K Muller; Jeffrey M. Lorch; Daniel L. Lindner; Michael O' Connor; Andrea Gargas; David S. Blehert

2013-01-01

The fungus Geomyces destructans is the causative agent of white-nose syndrome (WNS), a disease that has killed millions of North American hibernating bats. We describe a real-time TaqMan PCR test that detects DNA from G. destructans by targeting a portion of the multicopy intergenic spacer region of the rRNA gene complex. The...

Quantum dots for a high-throughput Pfu polymerase based multi-round polymerase chain reaction (PCR).

PubMed

Sang, Fuming; Zhang, Zhizhou; Yuan, Lin; Liu, Deli

2018-02-26

Multi-round PCR is an important technique for obtaining enough target DNA from rare DNA resources, and is commonly used in many fields including forensic science, ancient DNA analysis and cancer research. However, multi-round PCR is often aborted, largely due to the accumulation of non-specific amplification during repeated amplifications. Here, we developed a Pfu polymerase based multi-round PCR technique assisted by quantum dots (QDs). Different PCR assays, DNA polymerases (Pfu and Taq), DNA sizes and GC amounts were compared in this study. In the presence of QDs, PCR specificity could be retained even in the ninth-round amplification. Moreover, the longer and more complex the targets were, the earlier the abortion happened in multi-round PCR. However, no obvious enhancement of specificity was found in multi-round PCR using Taq DNA polymerase. Significantly, the fidelity of Pfu polymerase based multi-round PCR was not sacrificed in the presence of QDs. Besides, pre-incubation at 50 °C for an hour had no impact on multi-round PCR performance, which further authenticated the hot start effect of QDs modulated in multi-round PCR. The findings of this study demonstrated that a cost-effective and promising multi-round PCR technique for large-scale and high-throughput sample analysis could be established with high specificity, sensibility and accuracy.

New approach to real-time nucleic acids detection: folding polymerase chain reaction amplicons into a secondary structure to improve cleavage of Förster resonance energy transfer probes in 5′-nuclease assays

PubMed Central

Kutyavin, Igor V.

2010-01-01

The article describes a new technology for real-time polymerase chain reaction (PCR) detection of nucleic acids. Similar to Taqman, this new method, named Snake, utilizes the 5′-nuclease activity of Thermus aquaticus (Taq) DNA polymerase that cleaves dual-labeled Förster resonance energy transfer (FRET) probes and generates a fluorescent signal during PCR. However, the mechanism of the probe cleavage in Snake is different. In this assay, PCR amplicons fold into stem–loop secondary structures. Hybridization of FRET probes to one of these structures leads to the formation of optimal substrates for the 5′-nuclease activity of Taq. The stem–loop structures in the Snake amplicons are introduced by the unique design of one of the PCR primers, which carries a special 5′-flap sequence. It was found that at a certain length of these 5′-flap sequences the folded Snake amplicons have very little, if any, effect on PCR yield but benefit many aspects of the detection process, particularly the signal productivity. Unlike Taqman, the Snake system favors the use of short FRET probes with improved fluorescence background. The head-to-head comparison study of Snake and Taqman revealed that these two technologies have more differences than similarities with respect to their responses to changes in PCR protocol, e.g. the variations in primer concentration, annealing time, PCR asymmetry. The optimal PCR protocol for Snake has been identified. The technology’s real-time performance was compared to a number of conventional assays including Taqman, 3′-MGB-Taqman, Molecular Beacon and Scorpion primers. The test trial showed that Snake supersedes the conventional assays in the signal productivity and detection of sequence variations as small as single nucleotide polymorphisms. Due to the assay’s cost-effectiveness and simplicity of design, the technology is anticipated to quickly replace all known conventional methods currently used for real-time nucleic acid detection. PMID:19969535

Reducing nontemplated 3' nucleotide addition to polynucleotide transcripts

DOEpatents

Kao, C. Cheng

2000-01-01

Non-template 3' nucleotide addition to a transcript is reduced by transcribing a transcript from a template comprising an ultimate and/or penultimate 5' ribose having a C'2 substituent such as methoxy, which reduces non-template 3' nucleotide addition to the transcript. The methods are shown to be applicable to a wide variety of polymerases, including Taq, T7 RNA polymerase, etc.

Adenovirus-mediated in utero gene transfer in mice and guinea pigs: tissue distribution of recombinant adenovirus determined by quantitative TaqMan-polymerase chain reaction assay.

PubMed

Senoo, M; Matsubara, Y; Fujii, K; Nagasaki, Y; Hiratsuka, M; Kure, S; Uehara, S; Okamura, K; Yajima, A; Narisawa, K

2000-04-01

Fetal somatic cell gene therapy could become an attractive solution for some congenital genetic diseases or the disorders which manifest themselves during the fetal period. We performed adenovirus-mediated gene transfer to mice and guinea pig fetuses in utero and evaluated the efficiency of gene transfer by histochemical analysis and a quantitative TaqMan-polymerase chain reaction (TaqMan-PCR) assay. We first injected a replication-deficient recombinant adenovirus containing the Escherichia coli LacZ gene driven by a CAG promoter (AxCALacZ) into pregnant mice through the amniotic space, placenta, or intraperitoneal space of the fetus. Histochemical analysis showed limited transgene expression in fetal tissues. We then administered AxCALacZ to guinea pig fetuses in the late stage of pregnancy through the umbilical vein. The highest beta-galactosidase expression was observed in liver followed by moderate expression in heart, spleen, and adrenal gland. The transgene expression was also present in kidney, intestine, and placenta to a lesser degree. No positively stained cells were observed in lung, muscle, or pancreas except in the vascular endothelium of these organs. Quantitative measurement of recombinant adenoviral DNA by the TaqMan-PCR assay showed that the vast majority of the injected viruses was present in liver. The current study indicated that adenovirus-mediated gene transfer into guinea pig fetus through the umbilical vein is feasible and results in efficient transgene expression in fetal tissues. The experimental procedures using pregnant guinea pigs might serve as a good experimental model for in utero gene transfer. Since our TaqMan-PCR assay detects the LacZ gene, one of the most widely used reporter genes, it may be generally applicable to adenovirus quantification in various gene transfer experiments.

Detection and quantification of genetically modified organisms using very short, locked nucleic acid TaqMan probes.

PubMed

Salvi, Sergio; D'Orso, Fabio; Morelli, Giorgio

2008-06-25

Many countries have introduced mandatory labeling requirements on foods derived from genetically modified organisms (GMOs). Real-time quantitative polymerase chain reaction (PCR) based upon the TaqMan probe chemistry has become the method mostly used to support these regulations; moreover, event-specific PCR is the preferred method in GMO detection because of its high specificity based on the flanking sequence of the exogenous integrant. The aim of this study was to evaluate the use of very short (eight-nucleotide long), locked nucleic acid (LNA) TaqMan probes in 5'-nuclease PCR assays for the detection and quantification of GMOs. Classic TaqMan and LNA TaqMan probes were compared for the analysis of the maize MON810 transgene. The performance of the two types of probes was tested on the maize endogenous reference gene hmga, the CaMV 35S promoter, and the hsp70/cryIA(b) construct as well as for the event-specific 5'-integration junction of MON810, using plasmids as standard reference molecules. The results of our study demonstrate that the LNA 5'-nuclease PCR assays represent a valid and reliable analytical system for the detection and quantification of transgenes. Application of very short LNA TaqMan probes to GMO quantification can simplify the design of 5'-nuclease assays.

Directed evolution of DNA polymerase, RNA polymerase and reverse transcriptase activity in a single polypeptide.

PubMed

Ong, Jennifer L; Loakes, David; Jaroslawski, Szymon; Too, Kathleen; Holliger, Philipp

2006-08-18

DNA polymerases enable key technologies in modern biology but for many applications, native polymerases are limited by their stringent substrate recognition. Here we describe short-patch compartmentalized self-replication (spCSR), a novel strategy to expand the substrate spectrum of polymerases in a targeted way. spCSR is based on the previously described CSR, but unlike CSR only a short region (a "patch") of the gene under investigation is diversified and replicated. This allows the selection of polymerases under conditions where catalytic activity and processivity are compromised to the extent that full self-replication is inefficient. We targeted two specific motifs involved in substrate recognition in the active site of DNA polymerase I from Thermus aquaticus (Taq) and selected for incorporation of both ribonucleotide- (NTP) and deoxyribonucleotide-triphosphates (dNTPs) using spCSR. This allowed the isolation of multiple variants of Taq with apparent dual substrate specificity. They were able to synthesize RNA, while still retaining essentially wild-type (wt) DNA polymerase activity as judged by PCR. One such mutant (AA40: E602V, A608V, I614M, E615G) was able to incorporate both NTPs and dNTPs with the same catalytic efficiency as the wt enzyme incorporates dNTPs. AA40 allowed the generation of mixed RNA-DNA amplification products in PCR demonstrating DNA polymerase, RNA polymerase as well as reverse transcriptase activity within the same polypeptide. Furthermore, AA40 displayed an expanded substrate spectrum towards other 2'-substituted nucleotides and was able to synthesize nucleic acid polymers in which each base bore a different 2'-substituent. Our results suggest that spCSR will be a powerful strategy for the generation of polymerases with altered substrate specificity for applications in nano- and biotechnology and in the enzymatic synthesis of antisense and RNAi probes.

MeltMan: Optimization, Evaluation, and Universal Application of a qPCR System Integrating the TaqMan qPCR and Melting Analysis into a Single Assay

PubMed Central

Nagy, Alexander; Černíková, Lenka; Vitásková, Eliška; Křivda, Vlastimil; Dán, Ádám; Dirbáková, Zuzana; Jiřincová, Helena; Procházka, Bohumír; Sedlák, Kamil; Havlíčková, Martina

2016-01-01

In the present work, we optimised and evaluated a qPCR system integrating 6-FAM (6-carboxyfluorescein)-labelled TaqMan probes and melting analysis using the SYTO 82 (S82) DNA binding dye in a single reaction. We investigated the influence of the S82 on various TaqMan and melting analysis parameters and defined its optimal concentration. In the next step, the method was evaluated in 36 different TaqMan assays with a total of 729 paired reactions using various DNA and RNA templates, including field specimens. In addition, the melting profiles of interest were correlated with the electrophoretic patterns. We proved that the S82 is fully compatible with the FAM-TaqMan system. Further, the advantages of this approach in routine diagnostic TaqMan qPCR were illustrated with practical examples. These included solving problems with flat or other atypical amplification curves or even false negativity as a result of probe binding failure. Our data clearly show that the integration of the TaqMan qPCR and melting analysis into a single assay provides an additional control option as well as the opportunity to perform more complex analyses, get more data from the reactions, and obtain analysis results with higher confidence. PMID:27031831

IDENTIFYING POTENTIAL SOURCES OF BACKGROUND CONTAMINATION IN RT-PCR

EPA Science Inventory

Extraction of nucleic acids from low biomass samples, such as drinking water, is particularly sensitive to potential background contamination because the contaminating material is minimally diluted by the sample. The presence of bacterial DNA in Taq DNA polymerase is wel...

Rapid and Specific Detection of Salmonella spp. in Animal Feed Samples by PCR after Culture Enrichment

PubMed Central

Löfström, Charlotta; Knutsson, Rickard; Axelsson, Charlotta Engdahl; Rådström, Peter

2004-01-01

A PCR procedure has been developed for routine analysis of viable Salmonella spp. in feed samples. The objective was to develop a simple PCR-compatible enrichment procedure to enable DNA amplification without any sample pretreatment such as DNA extraction or cell lysis. PCR inhibition by 14 different feed samples and natural background flora was circumvented by the use of the DNA polymerase Tth. This DNA polymerase was found to exhibit a high level of resistance to PCR inhibitors present in these feed samples compared to DyNAzyme II, FastStart Taq, Platinum Taq, Pwo, rTth, Taq, and Tfl. The specificity of the Tth assay was confirmed by testing 101 Salmonella and 43 non-Salmonella strains isolated from feed and food samples. A sample preparation method based on culture enrichment in buffered peptone water and DNA amplification with Tth DNA polymerase was developed. The probability of detecting small numbers of salmonellae in feed, in the presence of natural background flora, was accurately determined and found to follow a logistic regression model. From this model, the probability of detecting 1 CFU per 25 g of feed in artificially contaminated soy samples was calculated and found to be 0.81. The PCR protocol was evaluated on 155 naturally contaminated feed samples and compared to an established culture-based method, NMKL-71. Eight percent of the samples were positive by PCR, compared with 3% with the conventional method. The reasons for the differences in sensitivity are discussed. Use of this method in the routine analysis of animal feed samples would improve safety in the food chain. PMID:14711627

Specific and straightforward molecular investigation of β-thalassemia mutations in the Malaysian Malays and Chinese using direct TaqMan genotyping assays.

PubMed

Kho, S L; Chua, K H; George, E; Tan, J A M A

2013-07-15

Beta-thalassemia is a life-threatening inherited blood disorder. Rapid characterization of β-globin gene mutations is necessary because of the high frequency of Malaysian β-thalassemia carriers. A combination real-time polymerase chain reaction genotyping assay using TaqMan probes was developed to confirm β-globin gene mutations. In this study, primers and probes were designed to specifically identify 8 common β-thalassemia mutations in the Malaysian Malay and Chinese ethnic groups using the Primer Express software. "Blind tests" using DNA samples from healthy individuals and β-thalassemia patients with different genotypes were performed to determine the specificity and sensitivity of this newly designed assay. Our results showed 100% sensitivity and specificity for this novel assay. In conclusion, the TaqMan genotyping assay is a straightforward assay that allows detection of β-globin gene mutations in less than 40 min. The simplicity and reproducibility of the TaqMan genotyping assay permit its use in laboratories as a rapid and cost-effective diagnostic tool for confirmation of common β-thalassemia mutations in Malaysia.

Quantitative Tetraplex Real-Time Polymerase Chain Reaction Assay with TaqMan Probes Discriminates Cattle, Buffalo, and Porcine Materials in Food Chain.

PubMed

Hossain, M A Motalib; Ali, Md Eaqub; Sultana, Sharmin; Asing; Bonny, Sharmin Quazi; Kader, Md Abdul; Rahman, M Aminur

2017-05-17

Cattle, buffalo, and porcine materials are widely adulterated, and their quantification might safeguard health, religious, economic, and social sanctity. Recently, conventional polymerase chain reaction (PCR) and PCR-restriction fragment length polymorphism (RFLP) assays have been documented but they are just suitable for identification, cannot quantify adulterations. We described here a quantitative tetraplex real-time PCR assay with TaqMan Probes to quantify contributions from cattle, buffalo, and porcine materials simultaneously. Amplicon-sizes were very short (106-, 90-, and 146-bp for cattle, buffalo, and porcine) because longer targets could be broken down, bringing serious ambiguity in molecular diagnostics. False negative detection was eliminated through an endogenous control (141-bp site of eukaryotic 18S rRNA). Analysis of 27 frankfurters and 27 meatballs reflected 84-115% target recovery at 0.1-10% adulterations. Finally, a test of 36 commercial products revealed 71% beef frankfurters, 100% meatballs, and 85% burgers contained buffalo adulteration, but no porcine was found in beef products.

A real-time TaqMan polymerase chain reaction for the identification of Culex vectors of West Nile and Saint Louis encephalitis viruses in North America.

PubMed

Sanogo, Yibayiri O; Kim, Chang-Hyun; Lampman, Richard; Novak, Robert J

2007-07-01

In North America, West Nile and St. Louis encephalitis viruses have been detected in a wide range of vector species, but the majority of isolations continue to be from pools of mixed mosquitoes in the Culex subgenus Culex. Unfortunately, the morphologic identification of these important disease vectors is often difficult, particularly in regions of sympatry. We developed a sensitive real-time TaqMan polymerase chain reaction assay that allows reliable identification of Culex mosquitoes including Culex pipiens pipiens, Cx. p. quinquefasciatus, Cx. restuans, Cx. salinarius, Cx. nigripalpus, and Cx. tarsalis. Primers and fluorogenic probes specific to each species were designed based on sequences of the acetylcholinesterase gene (Ace2). Both immature and adult mosquitoes were successfully identified as individuals and as mixed species pools. This identification technique provides the basis for a rapid, sensitive, and high-throughput method for expounding the species-specific contribution of vectors to various phases of arbovirus transmission.

Identification and quantification of genetically modified Moonshade carnation lines using conventional and TaqMan real-time polymerase chain reaction methods.

PubMed

Li, Peng; Jia, Junwei; Bai, Lan; Pan, Aihu; Tang, Xueming

2013-07-01

Genetically modified carnation (Dianthus caryophyllus L.) Moonshade was approved for planting and commercialization in several countries from 2004. Developing methods for analyzing Moonshade is necessary for implementing genetically modified organism labeling regulations. In this study, the 5'-transgene integration sequence was isolated using thermal asymmetric interlaced (TAIL)-PCR. Based upon the 5'-transgene integration sequence, conventional and TaqMan real-time PCR assays were established. The relative limit of detection for the conventional PCR assay was 0.05 % for Moonshade using 100 ng total carnation genomic DNA, corresponding to approximately 79 copies of the carnation haploid genome, and the limits of detection and quantification of the TaqMan real-time PCR assay were estimated to be 51 and 254 copies of haploid carnation genomic DNA, respectively. These results are useful for identifying and quantifying Moonshade and its derivatives.

Aptamer Selection Express: A Novel Method for Rapid Single-Step Selection and Sensing of Aptamers

DTIC Science & Technology

2008-12-01

sample) was as follows: 5 µL buffer, 2 µL MgCl2, 2.5 µL DMSO, 1 µL betaine , 1 µL each dNTP, 2.5 µL F primer, 2.5 µL R primer, 0.54 µL taq polymerase...and 25.1 µL H2O. Betaine and increased DMSO were added to the master mix to eliminate polymerase jumping during PCR ampli- fication.10 Using the

Messenger RNA transcripts

Treesearch

Dan Cullen

2004-01-01

In contrast to DNA, messenger RNA (mRNA) in complex substrata is rarely analyzed, in large part because labile RNA molecules are difficult to purify. Nucleic acid extractions from fungi that colonize soil are particularly difficult and plagued by humic substances that interfere with Taq polymerase (Tebbe and Vahjen 1993 and references therein). Magnetic capture...

An outbreak of West Nile Virus infection in the region of Monastir, Tunisia, 2003

PubMed Central

Riabi, Samira; Gaaloul, Imed; Mastouri, Maha; Hassine, Mohsen; Aouni, Mahjoub

2014-01-01

Background A West Nile (WN) fever epidemic occurred in the region of Monastir, Tunisia, between August and October 2003. Aim of the study We attempt to describe the epidemiology, clinical presentation, and outcome of patients with confirmed West Nile virus (WNV) infection. Methods Three groups of specimens were prepared. One was made up of serum only (n  =  43), the other of cerebrospinal fluid (CSF) only (n  =  30), and the third group was made up of both (n  =  40). These specimens were obtained from 113 patients. A serological diagnosis and evidence of WNV genome by nested reverse-transcriptase polymerase chain reaction (nRT-PCR) and TaqMan reverse transcription-polymerase chain reaction (RT-PCR) were carried out. Results Thirty-eight cases (33.6%) were serologically positive. Results of nRT-PCR showed a total of 10 positive cases of WNV (8.8%) detected in group 1 (n  =  1/43), group 2 (n  =  5/30), and group 3 (n  =  4/40) whereas the PCR TaqMan showed 18 positive samples (15.9%) found in group 1 (n  =  3/43), group 2 (n  =  9/30), and group 3 (n  =  6/40). All TaqMan PCR positive cases were nRT-PCR positive. In addition, four serologically probable cases were confirmed by TaqMan PCR. The attempts to isolate WNV by cell culture were unsuccessful. Considering the results of TaqMan assay and the serological diagnosis, WNV infection was confirmed in a total of 42 patients. The main clinical presentations were meningoencephalitis (40%), febrile disease (95%), and meningitis (36%). Eight patients (19%) died. The highest case-fatality rates occurred among patients aged ≧55 years. The phylogenetic analysis revealed that isolates of WNV were closely related to the Tunisian strain 1997 (PAH001) and the Israeli one (Is-98). Conclusions West Nile virus is a reemerging global pathogen that remains an important public health challenge in the next decade. PMID:24766339

TaqMan DNA technology confirms likely overestimation of cod (Gadus morhua L.) egg abundance in the Irish Sea: implications for the assessment of the cod stock and mapping of spawning areas using egg-based methods.

PubMed

Fox, C J; Taylor, M I; Pereyra, R; Villasana, M I; Rico, C

2005-03-01

Recent substantial declines in northeastern Atlantic cod stocks necessitate improved biological knowledge and the development of techniques to complement standard stock assessment methods (which largely depend on accurate commercial catch data). In 2003, an ichthyoplankton survey was undertaken in the Irish Sea and subsamples of 'cod-like' eggs were analysed using a TaqMan multiplex, PCR (polymerase chain reaction) assay (with specific probes for cod, haddock and whiting). The TaqMan method was readily applied to the large number of samples (n = 2770) generated during the survey and when combined with a manual DNA extraction protocol had a low failure rate of 6%. Of the early stage 'cod-like' eggs (1.2-1.75 mm diameter) positively identified: 34% were cod, 8% haddock and 58% whiting. As previous stock estimates based on egg surveys for Irish Sea cod assumed that the majority of 'cod-like' eggs were from cod, the TaqMan results confirm that there was probably substantial contamination by eggs of whiting and haddock that would have inflated estimates of the stock biomass.

Bat white-nose syndrome: a real-time TaqMan polymerase chain reaction test targeting the intergenic spacer region of Geomyces destructanstructans.

USGS Publications Warehouse

Muller, Laura K.; Lorch, Jeffrey M.; Lindner, Daniel L.; O'Connor, Michael; Gargas, Andrea; Blehert, David S.

2013-01-01

The fungus Geomyces destructans is the causative agent of white-nose syndrome (WNS), a disease that has killed millions of North American hibernating bats. We describe a real-time TaqMan PCR test that detects DNA from G. destructans by targeting a portion of the multicopy intergenic spacer region of the rRNA gene complex. The test is highly sensitive, consistently detecting as little as 3.3 fg of genomic DNA from G. destructans. The real-time PCR test specifically amplified genomic DNA from G. destructans but did not amplify target sequence from 54 closely related fungal isolates (including 43 Geomyces spp. isolates) associated with bats. The test was further qualified by analyzing DNA extracted from 91 bat wing skin samples, and PCR results matched histopathology findings. These data indicate the real-time TaqMan PCR method described herein is a sensitive, specific, and rapid test to detect DNA from G. destructans and provides a valuable tool for WNS diagnostics and research.

Traceability of plant contribution in olive oil by amplified fragment length polymorphisms.

PubMed

Pafundo, Simona; Agrimonti, Caterina; Marmiroli, Nelson

2005-09-07

Application of DNA molecular markers to traceability of foods is thought to bring new benefit to consumer's protection. Even in a complex matrix such as olive oil, DNA could be traced with PCR markers such as the amplified fragment length polymorphisms (AFLPs). In this work, fluorescent AFLPs were optimized for the characterization of olive oil DNA, to obtain highly reproducible, high-quality fingerprints, testing different parameters: the concentrations of dNTPs and labeled primer, the kind of Taq DNA polymerase and thermal cycler, and the quantity of DNA employed. It was found that correspondence of fingerprinting by comparing results in oils and in plants was close to 70% and that the DNA extraction from olive oil was the limiting step for the reliability of AFLP profiles, due to the complex matrix analyzed.

One-Step Reverse Transcription-Polymerase Chain Reaction for Ebola and Marburg Viruses.

PubMed

Park, Sun-Whan; Lee, Ye-Ji; Lee, Won-Ja; Jee, Youngmee; Choi, WooYoung

2016-06-01

Ebola and Marburg viruses (EBOVs and MARVs, respectively) are causative agents of severe hemorrhagic fever with high mortality rates in humans and nonhuman primates. In 2014, there was a major Ebola outbreak in various countries in West Africa, including Guinea, Liberia, Republic of Sierra Leone, and Nigeria. EBOV and MARV are clinically difficult to diagnose and distinguish from other African epidemic diseases. Therefore, in this study, we aimed to develop a method for rapid identification of the virus to prevent the spread of infection. We established a conventional one-step reverse transcription-polymerase chain reaction (RT-PCR) assay for these pathogens based on the Superscript Reverse Transcriptase-Platinum Taq polymerase enzyme mixture. All assays were thoroughly optimized using in vitro-transcribed RNA. We designed seven primer sets of nucleocapsid protein (NP) genes based on sequences from seven filoviruses, including five EBOVs and two MARVs. To evaluate the sensitivity of the RT-PCR assay for each filovirus, 10-fold serial dilutions of synthetic viral RNA transcripts of EBOV or MARV NP genes were used to assess detection limits of viral RNA copies. The potential for these primers to cross react with other filoviruses was also examined. The results showed that the primers were specific for individual genotype detection in the examined filoviruses. The assay established in this study may facilitate rapid, reliable laboratory diagnosis in suspected cases of Ebola and Marburg hemorrhagic fevers.

[Quantitative PCR in the diagnosis of Leishmania].

PubMed

Mortarino, M; Franceschi, A; Mancianti, F; Bazzocchi, C; Genchi, C; Bandi, C

2004-06-01

Polymerase chain reaction (PCR) is a sensitive and rapid method for the diagnosis of canine Leishmania infection and can be performed on a variety of biological samples, including peripheral blood, lymph node, bone marrow and skin. Standard PCR requires electrophoretic analysis of the amplification products and is usually not suitable for quantification of the template DNA (unless competitor-based or other methods are developed), being of reduced usefulness when accurate monitoring of target DNA is required. Quantitative real-time PCR allows the continuous monitoring of the accumulation of PCR products during the amplification reaction. This allows the identification of the cycle of near-logarithmic PCR product generation (threshold cycle) and, by inference, the relative quantification of the template DNA present at the start of the reaction. Since the amplification product are monitored in "real-time" as they form cycle-by-cycle, no post-amplification handling is required. The absolute quantification is performed according either to an internal standard co-amplified with the sample DNA, or to an external standard curve obtained by parallel amplification of serial known concentrations of a reference DNA sequence. From the quantification of the template DNA, an estimation of the relative load of parasites in the different samples can be obtained. The advantages compared to standard and semi-quantitative PCR techniques are reduction of the assay's time and contamination risks, and improved sensitivity. As for standard PCR, the minimal components of the quantitative PCR reaction mixture are the DNA target of the amplification, an oligonucleotide primer pair flanking the target sequence, a suitable DNA polymerase, deoxynucleotides, buffer and salts. Different technologies have been set up for the monitoring of amplification products, generally based on the use of fluorescent probes. For instance, SYBR Green technology is a non-specific detection system based on a fluorescent dsDNA intercalator and it is applicable to all potential targets. TaqMan technology is more specific since performs the direct assessment of the amount of amplified DNA using a fluorescent probe specific for the target sequence flanked by the primer pair. This probe is an oligonucleotide labelled with a reporter dye (fluorescent) and a quencher (which absorbs the fluorescent signal generated by the reporter). The thermic protocol of amplification allows the binding of the fluorescent probe to the target sequence before the binding of the primers and the starting of the polymerization by Taq polymerase. During polymerization, 5'-3' exonuclease activity of Taq polymerase digests the probe and in this way the reporter dye is released from the probe and a fluorescent signal is detected. The intensity of the signal accumulates at the end of each cycle and is related to the amount of the amplification product. In recent years, quantitative PCR methods based either on SYBR Green or TaqMan technology have been set up for the quantification of Leishmania in mouse liver, mouse skin and human peripheral blood, targeting either single-copy chromosomal or multi-copy minicircle sequences with high sensitivity and reproducibility. In particular, real-time PCR seems to be a reliable, rapid and noninvasive method for the diagnosis and follow up of visceral leishmaniasis in humans. At present, the application of real-time PCR for research and clinical diagnosis of Leishmania infection in dogs is still foreseable. As for standard PCR, the high sensitivity of real-time PCR could allow the use of blood sampling that is less invasive and easily performed for monitoring the status of the dogs. The development of a real-time PCR assay for Leishmania infantum infection in dogs could support the standard and optimized serological and PCR methods currenly in use for the diagnosis and follow-up of canine leishmaniasis, and perhaps prediction of recurrences associated with tissue loads of residual pathogens after treatment. At this regard, a TaqMan Real Time PCR method developed for the quantification of Leishmania infantum minicircle DNA in peripheral blood of naturally infected dogs sampled before and at different time points after the beginning of a standard antileishmanial therapy will be illustrated.

DNA Carrier Testing and Newborn Screening for Maple Syrup Urine Disease in Old Order Mennonite Communities

PubMed Central

Carleton, Stephanie M.; Peck, Dawn S.; Grasela, Julie; Dietiker, Kristin L.

2010-01-01

Maple syrup urine disease (MSUD) is an inherited metabolic disorder caused by mutations in the branched chain α-keto acid dehydrogenase complex. Worldwide incidence of MSUD is 1:225,000 live births. However, within Old Order Mennonite communities, the incidence is 1:150 live births and results from a common tyrosine to asparagine substitution (Y438N) in the E1α subunit of branched chain α-keto acid dehydrogenase. We developed a new DNA diagnostic assay utilizing TaqMan® technology and compared its efficacy, sensitivity, and duration with an existing polymerase chain reaction–restriction fragment length polymorphism (PCR-RFLP) assay. Carrier testing was performed by both TaqMan technology and PCR-RFLP on DNA isolated from buccal swabs of 160 individuals as well as from buccal swabs and blood spots of nine at-risk newborns; assay time, sensitivity, and reliability were also evaluated. The TaqMan assay, like the PCR-RFLP assay, accurately determined Y438N E1α allele status. However, the TaqMan assay appeared (1) more sensitive than the PCR-RFLP assay, requiring 10-fold less DNA (10 ng) to reliably determine genotype status and (2) faster, reducing the assay time required for diagnosis from ∼12 to 5 h. TaqMan technology allowed more rapid DNA diagnoses of MSUD in the neonate, thereby reducing the likelihood of neurological impairment while enhancing health and prognosis for affected infants. PMID:20136525

Simultaneous detection of wheat dwarf virus, northern cereal mosaic virus, barley yellow striate mosaic virus and rice black-streaked dwarf virus in wheat by multiplex RT-PCR.

PubMed

Zhang, Peipei; Liu, Yan; Liu, Wenwen; Massart, Sebastien; Wang, Xifeng

2017-11-01

Wheat dwarf virus (WDV), barley yellow striate mosaic virus (BYSMV), rice black-streaked dwarf virus (RBSDV) and northern cereal mosaic virus (NCMV) are four viruses infecting wheat and causing similar symptoms. In this paper, a multiplex reverse transcription polymerase chain reaction (m-RT-PCR) method has been developed for the simultaneous detection and discrimination of these viruses. The protocol uses specific primer set for each virus and produces four distinct fragments (273, 565, 783 and 1296bp), detecting the presence of RBSDV, BYSMV, WDV and NCMV, respectively. Annealing temperature, concentrations of dNTP, Taq polymerase and Mg 2+ were optimized for the m-RT-PCR. The detection limit of the assay was up to 10 -2 dilution. The amplification specificity of these primers was tested against a range of field samples from different regions of China, where RBSDV, BYSMV, WDV have been detected. This study fulfills the need for a rapid and specific wheat virus detection that also has the potential for investigating the epidemiology of these new viral diseases. Copyright © 2017 Elsevier B.V. All rights reserved.

The Complete Genome Sequence of Hyperthermophile Dictyoglomus turgidum DSM 6724™ Reveals a Specialized Carbohydrate Fermentor

PubMed Central

Brumm, Phillip J.; Gowda, Krishne; Robb, Frank T.; Mead, David A.

2016-01-01

Here we report the complete genome sequence of the chemoorganotrophic, extremely thermophilic bacterium, Dictyoglomus turgidum, which is a Gram negative, strictly anaerobic bacterium. D. turgidum and D. thermophilum together form the Dictyoglomi phylum. The two Dictyoglomus genomes are highly syntenic, and both are distantly related to Caldicellulosiruptor spp. D. turgidum is able to grow on a wide variety of polysaccharide substrates due to significant genomic commitment to glycosyl hydrolases, 16 of which were cloned and expressed in our study. The GH5, GH10, and GH42 enzymes characterized in this study suggest that D. turgidum can utilize most plant-based polysaccharides except crystalline cellulose. The DNA polymerase I enzyme was also expressed and characterized. The pure enzyme showed improved amplification of long PCR targets compared to Taq polymerase. The genome contains a full complement of DNA modifying enzymes, and an unusually high copy number (4) of a new, ancestral family of polB type nucleotidyltransferases designated as MNT (minimal nucleotidyltransferases). Considering its optimal growth at 72°C, D. turgidum has an anomalously low G+C content of 39.9% that may account for the presence of reverse gyrase, usually associated with hyperthermophiles. PMID:28066333

Comparative evaluation of new TaqMan real-time assays for the detection of hepatitis A virus.

PubMed

Houde, Alain; Guévremont, Evelyne; Poitras, Elyse; Leblanc, Danielle; Ward, Pierre; Simard, Carole; Trottier, Yvon-Louis

2007-03-01

Three novel real-time TaqMan RT-PCR assays targeting the 5'-UTR, the viral protease and the viral polymerase regions of the hepatitis A virus (HAV) were developed, evaluated and compared against a new published 5'-UTR TaqMan assay (JN) and a widely used conventional RT-PCR assay (HAVc). All conventional RT-PCR (HAV, SH-Prot and SH-Poly systems) and TaqMan (SH-Prot, SH-Poly, JN and SH-5U systems) assays evaluated were consistent for the detection of the three different HAV strains (HM-175, HAS-15 and LSH/S) used and reproducible for both RNA duplicates with the exception of two reproducibility discrepancies observed with both 5'-UTR real-time systems (JN and SH-5U). Limits of detection for conventional HAV, SH-Prot and SH-Poly RT-PCR systems were found to be equivalent when tested with serially diluted suspensions of the HM-175 strain. Although the four real-time RT-PCR TaqMan assays evaluated herein produced similar and consistent quantification data down to the level of one genomic equivalent copy with their respectively cloned amplicons, significant and important differences were observed for the detection of HAV genomic RNA. Results showed that the new real-time TaqMan SH-Poly and SH-Prot primer and probe systems were more consistent and sensitive by 5 logs as compared to both 5'-UTR designs (JN and SH-5U) used for the detection of HAV genomic RNA as well as for the detection in cell culture by cytopathic effect. Considering their higher analytical sensitivity, the proposed SH-Poly and SH-Prot amplification systems could therefore represent valuable tools for the detection of HAV in clinical, environmental and food samples.

Concordance of HIV-1 RNA Values by Amplicor and TaqMan 2.0 in Patients With Confirmed Suppression in Clinical Trials

PubMed Central

Garner, Will; White, Kirsten; Szwarcberg, Javier; McCallister, Scott; Zhong, Lijie; Wulfsohn, Mike

2016-01-01

Background. The COBAS AMPLICOR HIV-1 MONITOR Test, version 1.5 (Amplicor) has been replaced with the COBAS AmpliPrep/COBAS TaqMan HIV-1 Test, version 2.0 (TaqMan 2.0), a real-time polymerase chain reaction human immunodeficiency virus type 1 (HIV-1) assay with higher sensitivity and broader dynamic range. HIV-1 RNA values at the 50 copies/mL cutoff drive major patient management decisions and clinical study outcomes. Methods. A total of 2217 samples were collected from 1922 HIV-1–infected subjects taking antiretroviral therapy for at least 48 weeks and had at least 2 consecutive samples with HIV-1 RNA <50 copies/mL by Amplicor from 7 recent clinical trials. HIV-1 RNA results were obtained from the Amplicor and TaqMan 2.0 assays in parallel by a reference laboratory. Results. The overall concordance between assay results was 96% at the cutoff of 50 copies/mL. However, statistically significant discordance at the 50 copies/mL cutoff was found between the assays for 3.9% of samples (n = 87). By TaqMan 2.0, virologic failure defined as HIV-1 RNA ≥50 copies/mL was reported for 2.8% more samples than Amplicor. Of these 87 samples, 68 samples fell within the predicted range of assay variability. Retesting of HIV-1 RNA by TaqMan 2.0 confirmed the discordance in only 28 of the 87 samples. Conclusions. The TaqMan 2.0 assay reports fewer subjects below the clinical endpoint of HIV-1 RNA <50 copies/mL in HIV clinical trials than the Amplicor assay. This difference must be considered when assessing disease progression, designing clinical trials, and comparisons with historical trials that used the Amplicor assay. PMID:26689956

Identification of Atlantic salmon (Salmo salar) and rainbow trout (Oncorhynchus mykiss) by using polymerase chain reaction amplification and restriction analysis of the mitochondrial cytochrome b gene.

PubMed

Carrera, E; García, T; Céspedes, A; González, I; Sanz, B; Hernández, P E; Martín, R

1998-04-01

Restriction site analysis of polymerase chain reaction (PCR) products from a conserved region of the cytochrome b gene has been used for the identification of fresh and smoked samples of Atlantic salmon (Salmo salar) and rainbow trout (Oncorhynchus mykiss). Digestion of the 359-bp PCR product with the endonucleases EcoRV and TaqI yielded specific banding patterns for salmon and trout. This genetic marker can be very useful for detecting fraudulent substitution of the cheaper smoked trout for the more expensive smoked salmon.

7-Deazapurine containing DNA: efficiency of c7GdTP, c7AdTP and c7IdTP incorporation during PCR-amplification and protection from endodeoxyribonuclease hydrolysis.

PubMed Central

Seela, F; Röling, A

1992-01-01

The enzymatic synthesis of 7-deazapurine nucleoside containing DNA (501 bp) is performed by PCR-amplification (Taq polymerase) using a pUC18 plasmid DNA as template and the triphosphates of 7-deaza-2'-deoxyguanosine (c7Gd), -adenosine (c7Ad) and -inosine (c7Id). c7GdTP can fully replace dGTP resulting in a completely modified DNA-fragment of defined size and sequence. The other two 7-deazapurine triphosphates (c7AdTP) and (c7IdTP) require the presence of the parent purine 2'-deoxyribonucleotides. In purine/7-deazapurine nucleotide mixtures Taq polymerase prefers purine over 7-deazapurine nucleotides but accepts c7GdTP much better than c7AdTP or c7IdTP. As incorporation of 7-deazapurine nucleotides represents a modification of the major groove of DNA it can be used to probe DNA/protein interaction. Regioselective phosphodiester hydrolysis of the modified DNA-fragments was studied with 28 endodeoxyribonucleases. c7Gd is able to protect the DNA from the phosphodiester hydrolysis in more than 20 cases, only a few enzymes (Mae III, Rsa I, Hind III, Pvu II or Taq I) do still hydrolyze the modified DNA. c7Ad protects DNA less efficiently, as this DNA could only be modified in part. The absence of N-7 as potential binding position or a geometric distortion of the recognition duplex caused by the 7-deazapurine base can account for protection of hydrolysis. Images PMID:1738604

Effects of aripiprazole and the Taq1A polymorphism in the dopamine D2 receptor gene on the clinical response and plasma monoamine metabolites level during the acute phase of schizophrenia.

PubMed

Miura, Itaru; Takeuchi, Satoshi; Katsumi, Akihiko; Mori, Azuma; Kanno, Keiko; Yang, Qiaohui; Mashiko, Hirobumi; Numata, Yoshihiko; Niwa, Shin-Ichi

2012-02-01

The Taq1A polymorphism in the dopamine D2 receptor (DRD2) gene could be related to the response to antipsychotics. We examined the effects of the Taq1A polymorphism on the plasma monoamine metabolites during the treatment of schizophrenia with aripiprazole, a DRD2 partial agonist. Thirty Japanese patients with schizophrenia were treated with aripiprazole for 6 weeks. We measured plasma levels of homovanillic acid (pHVA) and 3-methoxy-4hydroxyphenylglycol (pMHPG) before and after treatment. The Taq1A polymorphism was genotyped with polymerase chain reaction. Aripiprazole improved the acute symptoms of schizophrenia and decreased pHVA in responders (P = 0.023) but not in nonresponders (P = 0.28). Although A1 allele carriers showed a tendency to respond to aripiprazole (61.5%) compared to A1 allele noncarriers (29.4%) (P = 0.078), there was not statistically significant difference in the response between the 2 genotype groups. There were significant effect for response (P = 0.013) and genotype × response interaction (P = 0.043) on the change of pHVA. The changes of pHVA differ between responders and nonresponders in A1 allele carriers but not in A1 allele noncarriers. There were no genotype or response effects or genotype × response interaction on the changes of the plasma levels of 3-methoxy-4hydroxyphenylglycol. Our preliminary results suggest that Taq1A polymorphism may be partly associated with changes in pHVA during acute schizophrenia.

Diagnostic application of polymerase chain reaction for detection of Ehrlichia risticii in equine monocytic ehrlichiosis (Potomac horse fever).

PubMed

Biswas, B; Mukherjee, D; Mattingly-Napier, B L; Dutta, S K

1991-10-01

Genomic amplification by the polymerase chain reaction (PCR) was used to identify a unique genomic sequence of Ehrlichia risticii directly in DNA isolated from peripheral-blood buffy coat cells of E. risticii-infected horses (Potomac horse fever) and from infected cell cultures. A specific primer pair, selected from a cloned, species-specific, 1-kb DNA fragment of the E. risticii genome as a template, was used for the amplification of the target DNA of 247 bp. The optimal number of 40 PCR cycles, determined by analyzing an amplification profile obtained with a constant Taq polymerase concentration, was used to achieve maximum amplification of the E. risticii DNA segment. Efficient amplification of target DNA was achieved with specimens processed by either the phenol extraction or rapid lysis method. The specificity of the amplified DNA product was confirmed by the proper size (247 bp) and appropriate restriction enzyme cleavage pattern of the amplified target DNA, as well as by the specific hybridization signal obtained by using a PCR-amplified 185-bp internal DNA probe. A 10(5)- to 10(6)-fold amplification of target DNA, which allowed detection of E. risticii from as few as two to three infected cells in culture and from a very small volume of buffy coat cells from infected horses, was achieved. This PCR amplification procedure was found to be highly specific and sensitive for the detection of E. risticii for the study of Potomac horse fever.

PCR amplification of up to 35-kb DNA with high fidelity and high yield from lambda bacteriophage templates.

PubMed Central

Barnes, W M

1994-01-01

A target length limitation to PCR amplification of DNA has been identified and addressed. Concomitantly, the base-pair fidelity, the ability to use PCR products as primers, and the maximum yield of target fragment were increased. These improvements were achieved by the combination of a high level of an exonuclease-free, N-terminal deletion mutant of Taq DNA polymerase, Klentaq1, with a very low level of a thermostable DNA polymerase exhibiting a 3'-exonuclease activity (Pfu, Vent, or Deep Vent). At least 35 kb can be amplified to high yields from 1 ng of lambda DNA template. Images PMID:8134376

A sensitive and high throughput TaqMan-based reverse transcription quantitative polymerase chain reaction assay efficiently discriminates ALK rearrangement from overexpression for lung cancer FFPE specimens.

PubMed

Lung, Jrhau; Lin, Yu-Ching; Hung, Ming-Szu; Jiang, Yuan Yuan; Lee, Kuan-Der; Lin, Paul Yann; Tsai, Ying Huang

2016-04-01

ALK fusion gene is an oncogenic driver in lung cancer with low prevalence, which can be ameliorated by crizotinib. Currently, ALK fusion gene can be diagnosed by fluorescence in situ hybridization (FISH) and immunohistochemistry (IHC), but inconstistnt results between the two methods are encountered regularly. To make the ALK fusion gene screening more efficient and to provide a simple solution to clarify the discrepancy between FISH and IHC results, a sensitive TaqMan-based reverse transcription quantitative polymerase chain reaction (RT-qPCR) assay was established. The 3-plex TaqMan-based RT-qPCR assay was established and performed on 102 archived formalin-fixed, paraffin-embedded (FFPE) NSCLC samples to detect ALK rearrangement and overexpression. Break-apart FISH and automatic immunohistochemistry based ALK assays were performed side by side using tissue microarray. The RT-qPCR was performed successfully for 80 samples and 10 of them showed positive signals. Three out of the 10 qPCR positive cases were further confirmed by FISH and IHC test. Two others were IHC positive and FISH negative, and expressed full-length ALK transcript. The rest were neither FISH nor IHC positive and their ALK expression level was significantly lower than those FISH or IHC positive cases. Our RT-qPCR assay demonstrates that the capability and reliability of ALK detection is comparable to FISH and IHC, but it is more effective at discriminating ALK rearrangement from overexpression. The RT-qPCR assay easily clarifies the discrepancy between FISH and IHC, and can be incorporated into routine ALK screening for lung cancer. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Event specific qualitative and quantitative polymerase chain reaction detection of genetically modified MON863 maize based on the 5'-transgene integration sequence.

PubMed

Yang, Litao; Xu, Songci; Pan, Aihu; Yin, Changsong; Zhang, Kewei; Wang, Zhenying; Zhou, Zhigang; Zhang, Dabing

2005-11-30

Because of the genetically modified organisms (GMOs) labeling policies issued in many countries and areas, polymerase chain reaction (PCR) methods were developed for the execution of GMO labeling policies, such as screening, gene specific, construct specific, and event specific PCR detection methods, which have become a mainstay of GMOs detection. The event specific PCR detection method is the primary trend in GMOs detection because of its high specificity based on the flanking sequence of the exogenous integrant. This genetically modified maize, MON863, contains a Cry3Bb1 coding sequence that produces a protein with enhanced insecticidal activity against the coleopteran pest, corn rootworm. In this study, the 5'-integration junction sequence between the host plant DNA and the integrated gene construct of the genetically modified maize MON863 was revealed by means of thermal asymmetric interlaced-PCR, and the specific PCR primers and TaqMan probe were designed based upon the revealed 5'-integration junction sequence; the conventional qualitative PCR and quantitative TaqMan real-time PCR detection methods employing these primers and probes were successfully developed. In conventional qualitative PCR assay, the limit of detection (LOD) was 0.1% for MON863 in 100 ng of maize genomic DNA for one reaction. In the quantitative TaqMan real-time PCR assay, the LOD and the limit of quantification were eight and 80 haploid genome copies, respectively. In addition, three mixed maize samples with known MON863 contents were detected using the established real-time PCR systems, and the ideal results indicated that the established event specific real-time PCR detection systems were reliable, sensitive, and accurate.

Maximizing RNA yield from archival renal tumors and optimizing gene expression analysis.

PubMed

Glenn, Sean T; Head, Karen L; Teh, Bin T; Gross, Kenneth W; Kim, Hyung L

2010-01-01

Formalin-fixed, paraffin-embedded tissues are widely available for gene expression analysis using TaqMan PCR. Five methods, including 4 commercial kits, for recovering RNA from paraffin-embedded renal tumor tissue were compared. The MasterPure kit from Epicentre produced the highest RNA yield. However, the difference in RNA yield between the kit from Epicenter and Invitrogen's TRIzol method was not significant. Using the top 3 RNA isolation methods, the manufacturers' protocols were modified to include an overnight Proteinase K digestion. Overnight protein digestion resulted in a significant increase in RNA yield. To optimize the reverse transcription reaction, conventional reverse transcription with random oligonucleotide primers was compared to reverse transcription using primers specific for genes of interest. Reverse transcription using gene-specific primers significantly increased the quantity of cDNA detectable by TaqMan PCR. Therefore, expression profiling of formalin-fixed, paraffin-embedded tissue using TaqMan qPCR can be optimized by using the MasterPure RNA isolation kit modified to include an overnight Proteinase K digestion and gene-specific primers during the reverse transcription.

The Complete Genome Sequence of Hyperthermophile Dictyoglomus turgidum DSM 6724™ Reveals a Specialized Carbohydrate Fermentor

DOE PAGES

Brumm, Phillip J.; Gowda, Krishne; Robb, Frank T.; ...

2016-12-20

In this study we report the complete genome sequence of the chemoorganotrophic, extremely thermophilic bacterium, Dictyoglomus turgidum, which is a Gram negative, strictly anaerobic bacterium. D. turgidum and D. thermophilum together form the Dictyoglomi phylum. The two Dictyoglomus genomes are highly syntenic, and both are distantly related to Caldicellulosiruptor spp. D. turgidum is able to grow on a wide variety of polysaccharide substrates due to significant genomic commitment to glycosyl hydrolases, 16 of which were cloned and expressed in our study. The GH5, GH10, and GH42 enzymes characterized in this study suggest that D. turgidum can utilize most plant-based polysaccharidesmore » except crystalline cellulose. The DNA polymerase I enzyme was also expressed and characterized. The pure enzyme showed improved amplification of long PCR targets compared to Taq polymerase. The genome contains a full complement of DNA modifying enzymes, and an unusually high copy number (4) of a new, ancestral family of polB type nucleotidyltransferases designated as MNT (minimal nucleotidyltransferases). Considering its optimal growth at 72°C, D. turgidum has an anomalously low G+C content of 39.9% that may account for the presence of reverse gyrase, usually associated with hyperthermophiles.« less

The Complete Genome Sequence of Hyperthermophile Dictyoglomus turgidum DSM 6724™ Reveals a Specialized Carbohydrate Fermentor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Brumm, Phillip J.; Gowda, Krishne; Robb, Frank T.

In this study we report the complete genome sequence of the chemoorganotrophic, extremely thermophilic bacterium, Dictyoglomus turgidum, which is a Gram negative, strictly anaerobic bacterium. D. turgidum and D. thermophilum together form the Dictyoglomi phylum. The two Dictyoglomus genomes are highly syntenic, and both are distantly related to Caldicellulosiruptor spp. D. turgidum is able to grow on a wide variety of polysaccharide substrates due to significant genomic commitment to glycosyl hydrolases, 16 of which were cloned and expressed in our study. The GH5, GH10, and GH42 enzymes characterized in this study suggest that D. turgidum can utilize most plant-based polysaccharidesmore » except crystalline cellulose. The DNA polymerase I enzyme was also expressed and characterized. The pure enzyme showed improved amplification of long PCR targets compared to Taq polymerase. The genome contains a full complement of DNA modifying enzymes, and an unusually high copy number (4) of a new, ancestral family of polB type nucleotidyltransferases designated as MNT (minimal nucleotidyltransferases). Considering its optimal growth at 72°C, D. turgidum has an anomalously low G+C content of 39.9% that may account for the presence of reverse gyrase, usually associated with hyperthermophiles.« less

Genetic polymorphisms of cytochrome p4502E1 and susceptibility to alcoholic liver disease and hepatocellular carcinoma in a white population: a study and literature review, including meta-analysis

PubMed Central

Wong, N A C S; Rae, F; Simpson, K J; Murray, G D; Harrison, D J

2000-01-01

Aims—To investigate the associations between the Rsa I, Dra I, and Taq I genetic polymorphisms of cytochrome p4502E1 and susceptibility to alcoholic liver disease or to hepatocellular carcinoma. Methods—DNA samples isolated from 61 patients with alcoholic liver disease, 46 patients with hepatocellular carcinoma, and 375 healthy controls were subjected to polymerase chain reaction amplification followed by digestion with the endonucleases Rsa I, Dra I, or Taq I. Meta-analysis was performed using data from previous studies of Rsa I polymorphism and the risk of alcoholic liver disease. Results—No association was found between any of the three polymorphisms and susceptibility to hepatocellular carcinoma. The distributions of Rsa I and Dra I alleles among the patients with alcoholic liver disease were not significantly different from those among the control group. Meta-analysis of this data and previous data concerning Rsa I polymorphism and alcoholic liver disease risk failed to demonstrate any significant association between the two. However, the alcoholic liver disease group in this study showed a significantly lower frequency of the less common Taq I allele compared with the healthy control group (odds ratio, 0.33; 95% confidence interval, 0.12 to 0.78). Conclusions—Possession of the less common Taq I cytochrome p4502E1 allele is associated with reduced susceptibility to alcoholic liver disease. There is no existing evidence that the Taq I polymorphism is directly associated with altered alcohol metabolism, but it might be in linkage disequilibrium with as yet unidentified protective factors. PMID:10889908

Association of vitamin D receptor gene polymorphism (TaqI and Apa1) with bone mineral density in North Indian postmenopausal women.

PubMed

Ahmad, Israr; Jafar, Tabrez; Mahdi, Farzana; Ameta, Keerti; Arshad, Md; Das, Siddharth Kumar; Waliullah, Shah; Rizvi, Imran; Mahdi, Abbas Ali

2018-06-15

Vitamin D receptor (VDR) gene has an important role as a candidate gene for the regulation of bone mass in osteoporosis. However, its association with bone mineral density (BMD) is controversial and has not been established in different ethnic populations. To enhance the understanding of VDR gene polymorphism in the context of BMD, we investigated the plausible genetic association of TaqI and ApaI polymorphism with BMD in North Indian postmenopausal women with osteoporosis.254 osteoporotic women (Age 55.82 ± 6.91) and 254 postmenopausal non osteoporotic women (Age 54.76 ± 6.26) were included in the study. VDR TaqI and ApaI polymorphism were determined by PCR (polymerase chain reaction) and RFLP (restriction fragment length polymorphism). BMD was assessed by dual energy X-ray absorptiometry (DXA) at the lumbar spine (L 1 -L 4 ), hip, forearm and femoral neck. The average BMD with TT genotype was significantly lower at lumbar spine, hip and forearm. The Frequency of TT genotype and t allele was significantly high in osteoporotic women when compared with controls. The average BMD with Aa genotype was higher in ApaI. Furthermore, comparison of frequency distribution of genotype and allele for VDR ApaI between osteoporotic patients and controls did not show any significant difference. Our findings revealed that TaqI gene TT genotype was associated with low BMD in North Indian osteoporotic women. Moreover, TT genotype and t allele associated significantly with osteoporosis in postmenopausal women. Therefore, VDR TaqI gene is an important determinant of risk factor for osteoporosis. Copyright © 2018 Elsevier B.V. All rights reserved.

Association of VDR gene polymorphisms with risk of relapsing-remitting multiple sclerosis in an Iranian Kurdish population.

PubMed

Abdollahzadeh, Rasoul; Moradi Pordanjani, Parisa; Rahmani, Farideh; Mashayekhi, Fatemeh; Azarnezhad, Asaad; Mansoori, Yaser

2018-06-01

The purpose of this study was to evaluate the association of VDR Apa-I, Bsm-I, Fok-I, Taq-I single nucleotide polymorphisms (SNPs) with multiple sclerosis (MS) risk in an Iranian Kurdish population. A population including of 118 patients and 124 healthy matched controls were recruited to the study. Genotyping of the SNPs was accomplished using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). The frequency of allele T of Fok-I (P = 0.003) and allele C of Taq-I (P = 0.0003) was significantly different between case and control subjects and showed significant association with risk of MS (OR = 1.84, 95% CI = 1.23-2.76; OR = 1.98, 95% CI = 1.36-2.87, respectively). CT genotype (OR = 1.7, 95% CI = 1.05-2.99) of Fok-I and CC genotype (OR = 2.18, 95% CI = 1.05-4.52) of Taq-I showed a predisposing effect. Combined TT+TC vs. CC for Fok-I (OR = 2.15, 95% = CI 1.29-3.60) and combined CC+TC vs. TT for Taq-I (OR = 2.58, 95% CI 1.51-4.40) were susceptibility genotypes for MS. Apa-I and Bsm-I were not significantly associated with risk of MS (OR < 1, P > 0.05) and any genotypes in any genetic models were not significantly different between cases and controls (P > 0.05). As a result, Fok-I and Taq-I showed significant association with risk of MS, while Apa-I and Bsm-I were not observed to be related to the risk of the disease in this population.

Smallpox and pan-Orthodox Virus Detection by Real-Time 3’-Minor Groove Binder TaqMan Assays Oil the Roche LightCycler and the Cepheid Smart Cycler Platforms

DTIC Science & Technology

2003-11-08

Bacillus anthracis BA0068 Ames Sterne SPS 97.13.213 Bacillus cereus Bacillus coagulans Bacillus licheniformis Bacillus macerans Bacillus ...megaterium Bacillus polymyxa Bacillus sphaericus Bacillus stearothermophilus Bacillus subtilis subsp. niger Bacillus thuringiensis Bacillus popilliae...varicella- zoster virus, and Bacillus anthracis DNA by LightCycler polymerase chain reaction after autoclaving:

Comprehensive Panel of Real-Time TaqMan™ Polymerase Chain Reaction Assays for Detection and Absolute Quantification of Filoviruses, Arenaviruses, and New World Hantaviruses

PubMed Central

Trombley, Adrienne R.; Wachter, Leslie; Garrison, Jeffrey; Buckley-Beason, Valerie A.; Jahrling, Jordan; Hensley, Lisa E.; Schoepp, Randal J.; Norwood, David A.; Goba, Augustine; Fair, Joseph N.; Kulesh, David A.

2010-01-01

Viral hemorrhagic fever is caused by a diverse group of single-stranded, negative-sense or positive-sense RNA viruses belonging to the families Filoviridae (Ebola and Marburg), Arenaviridae (Lassa, Junin, Machupo, Sabia, and Guanarito), and Bunyaviridae (hantavirus). Disease characteristics in these families mark each with the potential to be used as a biological threat agent. Because other diseases have similar clinical symptoms, specific laboratory diagnostic tests are necessary to provide the differential diagnosis during outbreaks and for instituting acceptable quarantine procedures. We designed 48 TaqMan™-based polymerase chain reaction (PCR) assays for specific and absolute quantitative detection of multiple hemorrhagic fever viruses. Forty-six assays were determined to be virus-specific, and two were designated as pan assays for Marburg virus. The limit of detection for the assays ranged from 10 to 0.001 plaque-forming units (PFU)/PCR. Although these real-time hemorrhagic fever virus assays are qualitative (presence of target), they are also quantitative (measure a single DNA/RNA target sequence in an unknown sample and express the final results as an absolute value (e.g., viral load, PFUs, or copies/mL) on the basis of concentration of standard samples and can be used in viral load, vaccine, and antiviral drug studies. PMID:20439981

TaqMan probe real-time polymerase chain reaction assay for the quantification of canine DNA in chicken nugget.

PubMed

Rahman, Md Mahfujur; Hamid, Sharifah Bee Abd; Basirun, Wan Jefrey; Bhassu, Subha; Rashid, Nur Raifana Abdul; Mustafa, Shuhaimi; Mohd Desa, Mohd Nasir; Ali, Md Eaqub

2016-01-01

This paper describes a short-amplicon-based TaqMan probe quantitative real-time PCR (qPCR) assay for the quantitative detection of canine meat in chicken nuggets, which are very popular across the world, including Malaysia. The assay targeted a 100-bp fragment of canine cytb gene using a canine-specific primer and TaqMan probe. Specificity against 10 different animals and plants species demonstrated threshold cycles (Ct) of 16.13 ± 0.12 to 16.25 ± 0.23 for canine DNA and negative results for the others in a 40-cycle reaction. The assay was tested for the quantification of up to 0.01% canine meat in deliberately spiked chicken nuggets with 99.7% PCR efficiency and 0.995 correlation coefficient. The analysis of the actual and qPCR predicted values showed a high recovery rate (from 87% ± 28% to 112% ± 19%) with a linear regression close to unity (R(2) = 0.999). Finally, samples of three halal-branded commercial chicken nuggets collected from different Malaysian outlets were screened for canine meat, but no contamination was demonstrated.

Polymerase/DNA interactions and enzymatic activity: multi-parameter analysis with electro-switchable biosurfaces

NASA Astrophysics Data System (ADS)

Langer, Andreas; Schräml, Michael; Strasser, Ralf; Daub, Herwin; Myers, Thomas; Heindl, Dieter; Rant, Ulrich

2015-07-01

The engineering of high-performance enzymes for future sequencing and PCR technologies as well as the development of many anticancer drugs requires a detailed analysis of DNA/RNA synthesis processes. However, due to the complex molecular interplay involved, real-time methodologies have not been available to obtain comprehensive information on both binding parameters and enzymatic activities. Here we introduce a chip-based method to investigate polymerases and their interactions with nucleic acids, which employs an electrical actuation of DNA templates on microelectrodes. Two measurement modes track both the dynamics of the induced switching process and the DNA extension simultaneously to quantitate binding kinetics, dissociation constants and thermodynamic energies. The high sensitivity of the method reveals previously unidentified tight binding states for Taq and Pol I (KF) DNA polymerases. Furthermore, the incorporation of label-free nucleotides can be followed in real-time and changes in the DNA polymerase conformation (finger closing) during enzymatic activity are observable.

Detection of knockdown resistance (kdr) mutations in Anopheles gambiae: a comparison of two new high-throughput assays with existing methods

PubMed Central

Bass, Chris; Nikou, Dimitra; Donnelly, Martin J; Williamson, Martin S; Ranson, Hilary; Ball, Amanda; Vontas, John; Field, Linda M

2007-01-01

Background Knockdown resistance (kdr) is a well-characterized mechanism of resistance to pyrethroid insecticides in many insect species and is caused by point mutations of the pyrethroid target site the para-type sodium channel. The presence of kdr mutations in Anopheles gambiae, the most important malaria vector in Africa, has been monitored using a variety of molecular techniques. However, there are few reports comparing the performance of these different assays. In this study, two new high-throughput assays were developed and compared with four established techniques. Methods Fluorescence-based assays based on 1) TaqMan probes and 2) high resolution melt (HRM) analysis were developed to detect kdr alleles in An. gambiae. Four previously reported techniques for kdr detection, Allele Specific Polymerase Chain Reaction (AS-PCR), Heated Oligonucleotide Ligation Assay (HOLA), Sequence Specific Oligonucleotide Probe – Enzyme-Linked ImmunoSorbent Assay (SSOP-ELISA) and PCR-Dot Blot were also optimized. The sensitivity and specificity of all six assays was then compared in a blind genotyping trial of 96 single insect samples that included a variety of kdr genotypes and African Anopheline species. The relative merits of each assay was assessed based on the performance in the genotyping trial, the length/difficulty of each protocol, cost (both capital outlay and consumable cost), and safety (requirement for hazardous chemicals). Results The real-time TaqMan assay was both the most sensitive (with the lowest number of failed reactions) and the most specific (with the lowest number of incorrect scores). Adapting the TaqMan assay to use a PCR machine and endpoint measurement with a fluorimeter showed a slight reduction in sensitivity and specificity. HRM initially gave promising results but was more sensitive to both DNA quality and quantity and consequently showed a higher rate of failure and incorrect scores. The sensitivity and specificity of AS-PCR, SSOP-ELISA, PCR Dot Blot and HOLA was fairly similar with a small number of failures and incorrect scores. Conclusion The results of blind genotyping trials of each assay indicate that where maximum sensitivity and specificity are required the TaqMan real-time assay is the preferred method. However, the cost of this assay, particularly in terms of initial capital outlay, is higher than that of some of the other methods. TaqMan assays using a PCR machine and fluorimeter are nearly as sensitive as real-time assays and provide a cost saving in capital expenditure. If price is a primary factor in assay choice then the AS-PCR, SSOP-ELISA, and HOLA are all reasonable alternatives with the SSOP-ELISA approach having the highest throughput. PMID:17697325

Identification and quantification of three genetically modified insect resistant cotton lines using conventional and TaqMan real-time polymerase chain reaction methods.

PubMed

Yang, Litao; Pan, Aihu; Zhang, Kewei; Guo, Jinchao; Yin, Changsong; Chen, Jianxiu; Huang, Cheng; Zhang, Dabing

2005-08-10

As the genetically modified organisms (GMOs) labeling policies are issued in many countries, qualitative and quantitative polymerase chain reaction (PCR) techniques are increasingly used for the detection of genetically modified (GM) crops in foods. Qualitative PCR and TaqMan real-time quantitative PCR methods to detect and identify three varieties of insect resistant cotton, i.e., Mon531 cotton (Monsanto Co.) and GK19 and SGK321 cottons (Chinese Academy of Agricultural Sciences), which were approved for commercialization in China, were developed in this paper. Primer pairs specific to inserted DNAs, such as Cowpea trypsin inhibitor (CpTI) gene of SGK321 cotton and the specific junction DNA sequences containing partial Cry1A(c) gene and NOS terminator of Mon531, GK19, and SGK321 cotton varieties were designed to conduct the identified PCR assays. In conventional specific identified PCR assays, the limit of detection (LOD) was 0.05% for Mon531, GK19, or SGK321 in 100 ng of cotton genomic DNA for one reaction. Also, the multiplex PCR method for screening the three GM cottons was also established, which could save time and cost in practical detection. Furthermore, a real-time quantitative PCR assay based on TaqMan chemistry for detection of insect resistant gene, Cry1A(c), was developed. This assay also featured the use of a standard plasmid as a reference molecule, which contained both a specific region of the transgene Cry1A(c) and an endogenous stearoyl-acyl carrier protein desaturase (Sad1) gene of the cotton. In quantitative PCR assay, the quantification range was from 0.01 to 100% in 100 ng of the genome DNA template, and in the detection of 1.0, 3.0, and 5.0% levels of three insect resistant cotton lines, respectively, all of the relative standard deviations (RSDs) were less than 8.2% except for the GM cotton samples with 1.0% Mon531 or GK19, which meant that our real-time PCR assays involving the use of reference molecule were reliable and practical for GM insect resistant cottons quantification. All of these results indicated that our established conventional and TaqMan real-time PCR assays were applicable to detect the three insect resistant cottons qualitatively and quantitatively.

Renin Gene Polymorphisms in Bangladeshi Hypertensive Population

PubMed Central

Afruza, Rownock; Islam, Laila N; Banerjee, Sajal; Hassan, Md. Mahbub; Suzuki, Fumiaki; Nabi, AHM Nurun

2014-01-01

Objective: Linkages of renin gene polymorphisms with hypertension have been implicated in several populations with contrasting results. Present study aims to assess the pattern of renin gene polymorphisms in Bangladeshi hypertensive individuals. Methodology: Introns 1, 9 of renin gene and 4063 bases upstream of promoter sequence of renin gene were amplified from the genomic DNA of the total 124 (hypertensive and normotensive) subjects using respective primers. Polymerase chain reaction-based restriction fragment length polymorphisms were performed using BglI, MboI and TaqI restriction enzymes. Results: Homozygosity was common in renin gene regarding BglI (bb=48.4%, Bb=37.9%, BB=13.7%, χ2 =1.91, P>0.05), TaqI (TT=81.5%, Tt=14.5%, tt=4.0%, χ2 =7.50, P<0.01) and MboI (mm=63.7%, Mm=32.3%, MM=4.0%, χ2=0.00, P>0.05) polymorphisms among total study population. For BglI and TaqI genotype distribution, hypertensive subjects (BglI: χ2 =6.66, P<0.05; TaqI: χ2 = 10.28, P<0.005) significantly deviate from Hardy-Weinberg Equilibrium law compared to normotensive subjects (BglI: χ2=0.51, P>0.05; TaqI: χ2=0.20, P>0.05). On the other hand, with respect to MboI polymorphisms of renin gene, only normotensive subjects deviate from the law (patients: χ2=1.28, P>0.05; vs controls: χ2=6.81, P<0.01). In the context of allelic frequency, common T allele was clearly prevalent (T frequency=0.86, t frequency = 0.14) for TaqI, but rare alleles b and m were more frequent for both BglI (b frequency=0.69, B frequency=0.31) and MboI (m frequency=0.80 M frequency=0.20) polymorphisms, respectively. Conclusion: Thus, we report that Bangladeshi hypertensive subjects did not show any distinct pattern of renin gene polymorphisms compared to their healthy control subjects with regard to their genotypic and allelic frequencies. PMID:25057323

Development of hydrolysis probe-based real-time PCR for identification of virulent gene targets of Burkholderia pseudomallei and B. mallei--a retrospective study on archival cases of service members with melioidosis and glanders.

PubMed

Zhang, Binxue; Wear, Douglas J; Kim, H S; Weina, Peter; Stojadinovic, Alexander; Izadjoo, Mina

2012-02-01

Burkholderia pseudomallei and B. mallei are two highly pathogenic bacteria responsible for melioidosis and glanders, respectively. Our laboratory developed hydrolysis probe-based real-time polymerase chain reaction assays targeting type three secretion system (TTS) and transposase family protein (TFP) of B. pseudomallei and B. malli, respectively. The assays were validated for target specificity, amplification sensitivity, and reproducibility. A bacterial DNA panel, composed of B. pseudomallei (13 strains), B. mallei (11 strains), Burkholderia species close neighbors (5 strains), and other bacterial species (17 strains), was prepared for specificity testing. Reference DNAs from B. pseudomallei and B. mallei bacterial cultures were used as controls for amplification, limit of detection, and reproducibility testing. The two TaqMan assays, Bp-TTS 1 and Bm-TFP, were optimized and applied in a retrospective study of archived cases from the Armed Forces Institute of Pathology. We tested 10 formalin-fixed paraffin-embedded blocks originally from autopsy specimens of patients who died of melioidosis or glanders during or after overseas tours in 1960s. Polymerase chain reaction results confirmed that DNA samples from formalin-fixed paraffin-embedded blocks of eight patients with melioidosis were positive for Bp-TTS 1 target and two patients with glanders were positive for Bm-TFP target.

Vitamin D receptor gene Alw I, Fok I, Apa I, and Taq I polymorphisms in patients with urinary stone.

PubMed

Seo, Ill Young; Kang, In-Hong; Chae, Soo-Cheon; Park, Seung Chol; Lee, Young-Jin; Yang, Yun Sik; Ryu, Soo Bang; Rim, Joung Sik

2010-04-01

To evaluate vitamin D receptor (VDR) gene polymorphisms in Korean patients so as to identify the candidate genes associated with urinary stones. Urinary stones are a multifactorial disease that includes various genetic factors. A normal control group of 535 healthy subjects and 278 patients with urinary stones was evaluated. Of 125 patients who presented stone samples, 102 had calcium stones on chemical analysis. The VDR gene Alw I, Fok I, Apa I, and Taq I polymorphisms were evaluated using the polymerase chain reaction-restriction fragment length polymorphism analysis. Allelic and genotypic frequencies were calculated to identify associations in both groups. The haplotype frequencies of the VDR gene polymorphisms for multiple loci were also determined. For the VDR gene Alw I, Fok I, Apa I, and Taq I polymorphisms, there was no statistically significant difference between the patients with urinary stones and the healthy controls. There was also no statistically significant difference between the patients with calcium stones and the healthy controls. A novel haplotype (Ht 4; CTTT) was identified in 13.5% of the patients with urinary stones and in 8.3% of the controls (P = .001). The haplotype frequencies were significantly different between the patients with calcium stones and the controls (P = .004). The VDR gene Alw I, Fok I, Apa I, and Taq I polymorphisms does not seem to be candidate genetic markers for urinary stones in Korean patients. However, 1 novel haplotype of the VDR gene polymorphisms for multiple loci might be a candidate genetic marker. Copyright 2010 Elsevier Inc. All rights reserved.

Detection of minute virus of mice using real time quantitative PCR in assessment of virus clearance during the purification of Mammalian cell substrate derived biotherapeutics.

PubMed

Zhan, Dejin; Roy, Margaret R; Valera, Christine; Cardenas, Jesse; Vennari, Joann C; Chen, Janice W; Liu, Shengjiang

2002-12-01

A real time quantitative PCR assay has been developed for detecting minute virus of mice (MVM). This assay directly quantifies PCR product by monitoring the increase of fluorescence intensity emitted during enzymatic hydrolysis of an oligonucleotide probe labelled covalently with fluorescent reporting and quenching dyes via Taq polymerase 5'-->3' exonuclease activity. The quantity of MVM DNA molecules in the samples was determined using a known amount of MVM standard control DNA fragment cloned into a plasmid (pCR-MVM). We have demonstrated that MVM TaqMan PCR assay is approximately 1000-fold more sensitive than the microplate infectivity assay with the lowest detection limit of approximately one particle per reaction. The reliable detection range is within 100 to 10(9) molecules per reaction with high reproducibility. The intra assay variation is <2.5%, and the inter assays variation is <6.5% when samples contain >100 particles/assay. When we applied the TaqMan PCR to MVM clearance studies done by column chromatography or normal flow viral filtration, we found that the virus removal factors were similar to that of virus infectivity assay. It takes about a day to complete entire assay processes, thus, the TaqMan PCR assay is at least 10-fold faster than the infectivity assay. Therefore, we concluded that this fast, specific, sensitive, and robust assay could replace the infectivity assay for virus clearance evaluation. Copyright 2002 The International Association for Biologicals. Published by Elsevier Science Ltd. All rights reserved.

[Effect of BSA on random amplified polymorphic DNA (RAPD) in plants].

PubMed

Bian, Cai-Miao; Li, Jun-Min; Jin, Ze-Xin; Ge, Ming-Ju

2002-05-01

Using Metasequoia glyptostroboides and Heptacodium miconioides DNA as templates,the effect of bovine serum albumin (BSA) on RAPD in plants was studied. The results showed that suitable concentrations of BSA used in Metasequoia glyptostroboides and Heptacodium miconioides RAPD were different, which were 0.6 microg/microl and 1 microg/microl, respectively. The inhibition of acetylated BSA on the amplification of plant RAPD could be relieved by BSA. BSA could reduce the dosage of Taq DNA polymerase.

Development and validation of a novel hydrolysis probe real-time polymerase chain reaction for agamid adenovirus 1 in the central bearded dragon (Pogona vitticeps).

PubMed

Fredholm, Daniel V; Coleman, James K; Childress, April L; Wellehan, James F X

2015-03-01

Agamid adenovirus 1 (AgAdv-1) is a significant cause of disease in bearded dragons (Pogona sp.). Clinical manifestations of AgAdv-1 infection are variable and often nonspecific; the manifestations range from lethargy, weight loss, and inappetence, to severe enteritis, hepatitis, and sudden death. Currently, diagnosis of AgAdv-1 infection is achieved through a single published method: standard nested polymerase chain reaction (nPCR) and sequencing. Standard nPCR with sequencing provides reliable sensitivity, specificity, and validation of PCR products. However, this process is comparatively expensive, laborious, and slow. Probe hybridization, as used in a TaqMan assay, represents the best option for validating PCR products aside from the time-consuming process of sequencing. This study developed a real-time PCR (qPCR) assay using a TaqMan probe-based assay, targeting a highly conserved region of the AgAdv-1 genome. Standard curves were generated, detection results were compared with the gold standard conventional PCR and sequencing assay, and limits of detection were determined. Additionally, the qPCR assay was run on samples known to be positive for AgAdv-1 and samples known to be positive for other adenoviruses. Based on the results of these evaluations, this assay allows for a less expensive, rapid, quantitative detection of AgAdv-1 in bearded dragons. © 2015 The Author(s).

A TaqMan-PCR protocol for quantification and differentiation of the phytopathogenic Clavibacter michiganensis subspecies.

PubMed

Bach, H-J; Jessen, I; Schloter, M; Munch, J C

2003-01-01

Real-time TaqMan-PCR assays were developed for detection, differentiation and absolute quantification of the pathogenic subspecies of Clavibacter michiganensis (Cm) in one single PCR run. The designed primer pair, targeting intergenic sequences of the rRNA operon (ITS) common in all subspecies, was suitable for the amplification of the expected 223-nt DNA fragments of all subspecies. Closely related bacteria were completely discriminated, except of Rathayibacter iranicus, from which weak PCR product bands appeared on agarose gel after 35 PCR cycles. Sufficient specificity of PCR detection was reached by introduction of the additional subspecies specific probes used in TaqMan-PCR. Only Cm species were detected and there was clear differentiation among the subspecies C. michiganensis sepedonicus (Cms), C. michiganensis michiganensis (Cmm), C. michiganensis nebraskensis (Cmn), C. michiganensis insidiosus (Cmi) and C. michiganensis tessellarius (Cmt). The TaqMan assays were optimized to enable a simultaneous quantification of each subspecies. Validity is shown by comparison with cell counts.

Real-time quantitative PCR for retrovirus-like particle quantification in CHO cell culture.

PubMed

de Wit, C; Fautz, C; Xu, Y

2000-09-01

Chinese hamster ovary (CHO) cells have been widely used to manufacture recombinant proteins intended for human therapeutic uses. Retrovirus-like particles, which are apparently defective and non-infectious, have been detected in all CHO cells by electron microscopy (EM). To assure viral safety of CHO cell-derived biologicals, quantification of retrovirus-like particles in production cell culture and demonstration of sufficient elimination of such retrovirus-like particles by the down-stream purification process are required for product market registration worldwide. EM, with a detection limit of 1x10(6) particles/ml, is the standard retrovirus-like particle quantification method. The whole process, which requires a large amount of sample (3-6 litres), is labour intensive, time consuming, expensive, and subject to significant assay variability. In this paper, a novel real-time quantitative PCR assay (TaqMan assay) has been developed for the quantification of retrovirus-like particles. Each retrovirus particle contains two copies of the viral genomic particle RNA (pRNA) molecule. Therefore, quantification of retrovirus particles can be achieved by quantifying the pRNA copy number, i.e. every two copies of retroviral pRNA is equivalent to one retrovirus-like particle. The TaqMan assay takes advantage of the 5'-->3' exonuclease activity of Taq DNA polymerase and utilizes the PRISM 7700 Sequence Detection System of PE Applied Biosystems (Foster City, CA, U.S.A.) for automated pRNA quantification through a dual-labelled fluorogenic probe. The TaqMan quantification technique is highly comparable to the EM analysis. In addition, it offers significant advantages over the EM analysis, such as a higher sensitivity of less than 600 particles/ml, greater accuracy and reliability, higher sample throughput, more flexibility and lower cost. Therefore, the TaqMan assay should be used as a substitute for EM analysis for retrovirus-like particle quantification in CHO cell-based production system. Copyright 2000 The International Association for Biologicals.

Detection and Quantification of Viable and Nonviable Trypanosoma cruzi Parasites by a Propidium Monoazide Real-Time Polymerase Chain Reaction Assay

PubMed Central

Cancino-Faure, Beatriz; Fisa, Roser; Alcover, M. Magdalena; Jimenez-Marco, Teresa; Riera, Cristina

2016-01-01

Molecular techniques based on real-time polymerase chain reaction (qPCR) allow the detection and quantification of DNA but are unable to distinguish between signals from dead or live cells. Because of the lack of simple techniques to differentiate between viable and nonviable cells, the aim of this study was to optimize and evaluate a straightforward test based on propidium monoazide (PMA) dye action combined with a qPCR assay (PMA-qPCR) for the selective quantification of viable/nonviable epimastigotes of Trypanosoma cruzi. PMA has the ability to penetrate the plasma membrane of dead cells and covalently cross-link to the DNA during exposure to bright visible light, thereby inhibiting PCR amplification. Different concentrations of PMA (50–200 μM) and epimastigotes of the Maracay strain of T. cruzi (1 × 105–10 parasites/mL) were assayed; viable and nonviable parasites were tested and quantified by qPCR with a TaqMan probe specific for T. cruzi. In the PMA-qPCR assay optimized at 100 μM PMA, a significant qPCR signal reduction was observed in the nonviable versus viable epimastigotes treated with PMA, with a mean signal reduction of 2.5 logarithm units and a percentage of signal reduction > 98%, in all concentrations of parasites assayed. This signal reduction was also observed when PMA-qPCR was applied to a mixture of live/dead parasites, which allowed the detection of live cells, except when the concentration of live parasites was low (10 parasites/mL). The PMA-qPCR developed allows differentiation between viable and nonviable epimastigotes of T. cruzi and could thus be a potential method of parasite viability assessment and quantification. PMID:27139452

Engineering of a DNA Polymerase for Direct m6 A Sequencing.

PubMed

Aschenbrenner, Joos; Werner, Stephan; Marchand, Virginie; Adam, Martina; Motorin, Yuri; Helm, Mark; Marx, Andreas

2018-01-08

Methods for the detection of RNA modifications are of fundamental importance for advancing epitranscriptomics. N 6 -methyladenosine (m 6 A) is the most abundant RNA modification in mammalian mRNA and is involved in the regulation of gene expression. Current detection techniques are laborious and rely on antibody-based enrichment of m 6 A-containing RNA prior to sequencing, since m 6 A modifications are generally "erased" during reverse transcription (RT). To overcome the drawbacks associated with indirect detection, we aimed to generate novel DNA polymerase variants for direct m 6 A sequencing. Therefore, we developed a screen to evolve an RT-active KlenTaq DNA polymerase variant that sets a mark for N 6 -methylation. We identified a mutant that exhibits increased misincorporation opposite m 6 A compared to unmodified A. Application of the generated DNA polymerase in next-generation sequencing allowed the identification of m 6 A sites directly from the sequencing data of untreated RNA samples. © 2017 The Authors. Published by Wiley-VCH Verlag GmbH & Co. KGaA.

Detection of cashew nut DNA in spiked baked goods using a real-time polymerase chain reaction method.

PubMed

Brzezinski, Jennifer L

2006-01-01

The detection of potentially allergenic foods, such as tree nuts, in food products is a major concern for the food processing industry. A real-time polymerase chain reaction (PCR) method was designed to determine the presence of cashew DNA in food products. The PCR amplifies a 67 bp fragment of the cashew 2S albumin gene, which is detected with a cashew-specific, dual-labeled TaqMan probe. This reaction will not amplify DNA derived from other tree nut species, such as almond, Brazil nut, hazelnut, and walnut, as well as 4 varieties of peanut. This assay was sensitive enough to detect 5 pg purified cashew DNA as well as cashew DNA in a spiked chocolate cookie sample containing 0.01% (100 mg/kg) cashew.

A novel electrochemical biosensor based on dynamic polymerase-extending hybridization for E. coli O157:H7 DNA detection.

PubMed

Wang, Lijiang; Liu, Qingjun; Hu, Zhaoying; Zhang, Yuanfan; Wu, Chunsheng; Yang, Mo; Wang, Ping

2009-05-15

A novel biosensor based on single-stranded DNA (ssDNA) probe functionalized aluminum anodized oxide (AAO) nanopore membranes was demonstrated for Escherichia coli O157:H7 DNA detection. An original and dynamic polymerase-extending (PE) DNA hybridization procedure is proposed, where hybridization happens in the existence of Taq DNA polymerase and dNTPs under controlled reaction temperature. The probe strand would be extended as long as the target DNA strand, then the capability to block the ionic flow in the pores has been prominently enhanced by the double strand complex. We have investigated the variation of ionic conductivity during the fabrication of the film and the hybridization using cyclic voltammetry and impedance spectroscopy. The present approach provides low detection limit for DNA (a few hundreds of pmol), rapid label-free and easy-to-use bacteria detection, which holds the potential for future use in various ss-DNA analyses by integrated into a self-contained biochip.

Molecular diagnosis of lyssaviruses and sequence comparison of Australian bat lyssavirus samples.

PubMed

Foord, A J; Heine, H G; Pritchard, L I; Lunt, R A; Newberry, K M; Rootes, C L; Boyle, D B

2006-07-01

To evaluate and implement molecular diagnostic tests for the detection of lyssaviruses in Australia. A published hemi-nested reverse transcriptase polymerase chain reaction (RT-PCR) for the detection of all lyssavirus genotypes was modified to a fully nested RT-PCR format and compared with the original assay. TaqMan assays for the detection of Australian bat lyssavirus (ABLV) were compared with both the nested and hemi-nested RT-PCR assays. The sequences of RT-PCR products were determined to assess sequence variations of the target region (nucleocapsid gene) in samples of ABLV originating from different regions. The nested RT-PCR assay was highly analytically specific, and at least as analytically sensitive as the hemi-nested assay. The TaqMan assays were highly analytically specific and more analytically sensitive than either RT-PCR assay, with a detection level of approximately 10 genome equivalents per microl. Sequence of the first 544 nucleotides of the nucleocapsid protein coding sequence was obtained from all samples of ABLV received at Australian Animal Health Laboratory during the study period. The nested RT-PCR provided a means for molecular diagnosis of all tested genotypes of lyssavirus including classical rabies virus and Australian bat lyssavirus. The published TaqMan assay proved to be superior to the RT-PCR assays for the detection of ABLV in terms of analytical sensitivity. The TaqMan assay would also be faster and cross contamination is less likely. Nucleotide sequence analyses of samples of ABLV from a wide geographical range in Australia demonstrated the conserved nature of this region of the genome and therefore the suitability of this region for molecular diagnosis.

The Vitamin D Receptor (VDR) Gene Polymorphisms in Turkish Brain Cancer Patients

PubMed Central

Toptaş, Bahar; Kafadar, Ali Metin; Cacina, Canan; Turan, Saime; Yurdum, Leman Melis; Yiğitbaşı, Nihal; Gökçe, Muhammed Oğuz; Zeybek, Ümit; Yaylım, Ilhan

2013-01-01

Objective. It has been stated that brain cancers are an increasingly serious issue in many parts of the world. The aim of our study was to determine a possible relationship between Vitamin D receptor (VDR) gene polymorphisms and the risk of glioma and meningioma. Methods. We investigated the VDR Taq-I and VDR Fok-I gene polymorphisms in 100 brain cancer patients (including 44 meningioma cases and 56 glioma cases) and 122 age-matched healthy control subjects. This study was performed by polymerase chain reaction-based restriction fragment length polymorphism (RF LP). Results. VDR Fok-I ff genotype was significantly increased in meningioma patients (15.9%) compared with controls (2.5%), and carriers of Fok-I ff genotype had a 6.47-fold increased risk for meningioma cases. There was no significant difference between patients and controls for VDR Taq-I genotypes and alleles. Conclusions. We suggest that VDR Fok-I genotypes might affect the development of meningioma. PMID:23691496

High sensitivity detection and quantitation of DNA copy number and single nucleotide variants with single color droplet digital PCR.

PubMed

Miotke, Laura; Lau, Billy T; Rumma, Rowza T; Ji, Hanlee P

2014-03-04

In this study, we present a highly customizable method for quantifying copy number and point mutations utilizing a single-color, droplet digital PCR platform. Droplet digital polymerase chain reaction (ddPCR) is rapidly replacing real-time quantitative PCR (qRT-PCR) as an efficient method of independent DNA quantification. Compared to quantative PCR, ddPCR eliminates the needs for traditional standards; instead, it measures target and reference DNA within the same well. The applications for ddPCR are widespread including targeted quantitation of genetic aberrations, which is commonly achieved with a two-color fluorescent oligonucleotide probe (TaqMan) design. However, the overall cost and need for optimization can be greatly reduced with an alternative method of distinguishing between target and reference products using the nonspecific DNA binding properties of EvaGreen (EG) dye. By manipulating the length of the target and reference amplicons, we can distinguish between their fluorescent signals and quantify each independently. We demonstrate the effectiveness of this method by examining copy number in the proto-oncogene FLT3 and the common V600E point mutation in BRAF. Using a series of well-characterized control samples and cancer cell lines, we confirmed the accuracy of our method in quantifying mutation percentage and integer value copy number changes. As another novel feature, our assay was able to detect a mutation comprising less than 1% of an otherwise wild-type sample, as well as copy number changes from cancers even in the context of significant dilution with normal DNA. This flexible and cost-effective method of independent DNA quantification proves to be a robust alternative to the commercialized TaqMan assay.

Systematic analysis of enzymatic DNA polymerization using oligo-DNA templates and triphosphate analogs involving 2',4'-bridged nucleosides.

PubMed

Kuwahara, Masayasu; Obika, Satoshi; Nagashima, Jun-ichi; Ohta, Yuki; Suto, Yoshiyuki; Ozaki, Hiroaki; Sawai, Hiroaki; Imanishi, Takeshi

2008-08-01

In order to systematically analyze the effects of nucleoside modification of sugar moieties in DNA polymerase reactions, we synthesized 16 modified templates containing 2',4'-bridged nucleotides and three types of 2',4'-bridged nucleoside-5'-triphospates with different bridging structures. Among the five types of thermostable DNA polymerases used, Taq, Phusion HF, Vent(exo-), KOD Dash and KOD(exo-), the KOD Dash and KOD(exo-) DNA polymerases could smoothly read through the modified templates containing 2'-O,4'-C-methylene-linked nucleotides at intervals of a few nucleotides, even at standard enzyme concentrations for 5 min. Although the Vent(exo-) DNA polymerase also read through these modified templates, kinetic study indicates that the KOD(exo-) DNA polymerase was found to be far superior to the Vent(exo-) DNA polymerase in accurate incorporation of nucleotides. When either of the DNA polymerase was used, the presence of 2',4'-bridged nucleotides on a template strand substantially decreased the reaction rates of nucleotide incorporations. The modified templates containing sequences of seven successive 2',4'-bridged nucleotides could not be completely transcribed by any of the DNA polymerases used; yields of longer elongated products decreased in the order of steric bulkiness of the modified sugars. Successive incorporation of 2',4'-bridged nucleotides into extending strands using 2',4'-bridged nucleoside-5'-triphospates was much more difficult. These data indicate that the sugar modification would have a greater effect on the polymerase reaction when it is adjacent to the elongation terminus than when it is on the template as well, as in base modification.

Polyphosphate present in DNA preparations from fungal species of Collectotrichum inhibits restriction endonucleases and other enzymes

USGS Publications Warehouse

Rodriguez, R.J.

1993-01-01

During the development of a procedure for the isolation of total genomic DNA from filamentous fungi (Rodriguez, R. J., and Yoder, 0. C., Exp. Mycol. 15, 232-242, 1991) a cell fraction was isolated which inhibited the digestion of DNA by restriction enzymes. After elimination of DNA, RNA, proteins, and lipids, the active compound was purified by gel filtration to yield a single fraction capable of complete inhibition of restriction enzyme activity. The inhibitor did not absorb uv light above 220 nm, and was resistant to alkali and acid at 25°C and to temperatures as high as 100°C. More extensive analyses demonstrated that the inhibitor was also capable of inhibiting T4 DNA ligase and TaqI DNA polymerase, but not DNase or RNase. Chemical analyses indicated that the inhibitor was devoid of carbohydrates, proteins, lipids, and nucleic acids but rich in phosphorus. A combination of nuclear magnetic resonance, metachromatic shift of toluidine blue, and gel filtration indicated that the inhibitor was a polyphosphate (polyP) containing approximately 60 phosphate molecules. The mechanism of inhibition appeared to involve complexing of polyP to the enzymatic proteins. All species of Colletotrichum analyzed produced polyP equivalent in chain length and concentration. A modification to the original DNA extraction procedure is described which eliminates polyP and reduces the time necessary to obtain DNA of sufficient purity for restriction enzyme digestion and TaqI polymerase amplification.

Development of melting temperature-based SYBR Green I polymerase chain reaction methods for multiplex genetically modified organism detection.

PubMed

Hernández, Marta; Rodríguez-Lázaro, David; Esteve, Teresa; Prat, Salomé; Pla, Maria

2003-12-15

Commercialization of several genetically modified crops has been approved worldwide to date. Uniplex polymerase chain reaction (PCR)-based methods to identify these different insertion events have been developed, but their use in the analysis of all commercially available genetically modified organisms (GMOs) is becoming progressively insufficient. These methods require a large number of assays to detect all possible GMOs present in the sample and thereby the development of multiplex PCR systems using combined probes and primers targeted to sequences specific to various GMOs is needed for detection of this increasing number of GMOs. Here we report on the development of a multiplex real-time PCR suitable for multiple GMO identification, based on the intercalating dye SYBR Green I and the analysis of the melting curves of the amplified products. Using this method, different amplification products specific for Maximizer 176, Bt11, MON810, and GA21 maize and for GTS 40-3-2 soybean were obtained and identified by their specific Tm. We have combined amplification of these products in a number of multiplex reactions and show the suitability of the methods for identification of GMOs with a sensitivity of 0.1% in duplex reactions. The described methods offer an economic and simple alternative to real-time PCR systems based on sequence-specific probes (i.e., TaqMan chemistry). These methods can be used as selection tests and further optimized for uniplex GMO quantification.

The cobas p 630 instrument: a dedicated pre-analytic solution to optimize COBAS® AmpliPrep/COBAS® TaqMan® system workflow and turn-around-time.

PubMed

Vallefuoco, L; Sorrentino, R; Spalletti Cernia, D; Colucci, G; Portella, G

2012-12-01

The cobas p 630, a fully automated pre-analytical instrument for primary tube handling recently introduced to complete the Cobas(®) TaqMan systems portfolio, was evaluated in conjunction with: the COBAS(®) AmpliPrep/COBAS(®) TaqMan HBV Test, v2.0, COBAS(®) AmpliPrep/COBAS(®) TaqMan HCV Test, v1.0 and COBAS(®) AmpliPrep/COBAS(®) TaqMan HIV Test, v2.0. The instrument performance in transferring samples from primary to secondary tubes, its impact in improving COBAS(®) AmpliPrep/COBAS(®) TaqMan workflow and hands-on reduction and the risk of possible cross-contamination were assessed. Samples from 42 HBsAg positive, 42 HCV and 42 HIV antibody (Ab) positive patients as well as 21 healthy blood donors were processed with or without automated primary tubes. HIV, HCV and HBsAg positive samples showed a correlation index of 0.999, 0.987 and of 0.994, respectively. To assess for cross-contamination, high titer HBV DNA positive samples, HCV RNA and HIV RNA positive samples were distributed in the cobas p 630 in alternate tube positions, adjacent to negative control samples within the same rack. None of the healthy donor samples showed any reactivity. Based on these results, the cobas p 630 can improve workflow and sample tracing in laboratories performing molecular tests, and reduce turnaround time, errors, and risks. Copyright © 2012 Elsevier B.V. All rights reserved.

Fast real-time polymerase chain reaction for quantitative detection of Lactobacillus delbrueckii bacteriophages in milk.

PubMed

Martín, Maria Cruz; del Rio, Beatriz; Martínez, Noelia; Magadán, Alfonso H; Alvarez, Miguel A

2008-12-01

One of the main microbiological problems of the dairy industry is the susceptibility of starter bacteria to virus infections. Lactobacillus delbrueckii, a component of thermophilic starter cultures used in the manufacture of several fermented dairy products, including yogurt, is also sensitive to bacteriophage attacks. To avoid the problems associated with these viruses, quick and sensitive detection methods are necessary. In the present study, a fast real-time quantitative polymerase chain reaction assay for the direct detection and quantification of L. delbrueckii phages in milk was developed. A set of primers and a TaqMan MGB probe was designed, based on the lysin gene sequence of different L. delbrueckii phages. The results show the proposed method to be a rapid (total processing time 30 min), specific and highly sensitive technique for detecting L. delbrueckii phages in milk.

Alkylating agent (MNU)-induced mutation in space environment

NASA Astrophysics Data System (ADS)

Ohnishi, T.; Takahashi, A.; Ohnishi, K.; Takahashi, S.; Masukawa, M.; Sekikawa, K.; Amano, T.; Nakano, T.; Nagaoka, S.

2001-01-01

In recent years, some contradictory data about the effects of microgravity on radiation-induced biological responses in space experiments have been reported. We prepared a damaged template DNA produced with an alkylating agent (N-methyl-N-nitroso urea; MNU) to measure incorrect base-incorporation during DNA replication in microgravity. We examined whether mutation frequency is affected by microgravity during DNA replication for a DNA template damaged by an alkylating agent. Using an in vitro enzymatic reaction system, DNA synthesis by Taq polymerase or polymerase III was done during a US space shuttle mission (Discovery, STS-91). After the flight, DNA replication and mutation frequencies were measured. We found that there was almost no effect of microgravity on DNA replication and mutation frequency. It is suggested that microgravity might not affect at the stage of substrate incorporation in induced-mutation frequency.

PCR Amplicon Prediction from Multiplex Degenerate Primer and Probe Sets

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gardner, S. N.

2013-08-08

Assessing primer specificity and predicting both desired and off-target amplification products is an essential step for robust PCR assay design. Code is described to predict potential polymerase chain reaction (PCR) amplicons in a large sequence database such as NCBI nt from either singleplex or a large multiplexed set of primers, allowing degenerate primer and probe bases, with target mismatch annotates amplicons with gene information automatically downloaded from NCBI, and optionally it can predict whether there are also TaqMan/Luminex probe matches within predicted amplicons.

Evolving a polymerase for hydrophobic base analogues.

PubMed

Loakes, David; Gallego, José; Pinheiro, Vitor B; Kool, Eric T; Holliger, Philipp

2009-10-21

Hydrophobic base analogues (HBAs) have shown great promise for the expansion of the chemical and coding potential of nucleic acids but are generally poor polymerase substrates. While extensive synthetic efforts have yielded examples of HBAs with favorable substrate properties, their discovery has remained challenging. Here we describe a complementary strategy for improving HBA substrate properties by directed evolution of a dedicated polymerase using compartmentalized self-replication (CSR) with the archetypal HBA 5-nitroindole (d5NI) and its derivative 5-nitroindole-3-carboxamide (d5NIC) as selection substrates. Starting from a repertoire of chimeric polymerases generated by molecular breeding of DNA polymerase genes from the genus Thermus, we isolated a polymerase (5D4) with a generically enhanced ability to utilize HBAs. The selected polymerase. 5D4 was able to form and extend d5NI and d5NIC (d5NI(C)) self-pairs as well as d5NI(C) heteropairs with all four bases with efficiencies approaching, or exceeding, those of the cognate Watson-Crick pairs, despite significant distortions caused by the intercalation of the d5NI(C) heterocycles into the opposing strand base stack, as shown by nuclear magnetic resonance spectroscopy (NMR). Unlike Taq polymerase, 5D4 was also able to extend HBA pairs such as Pyrene: varphi (abasic site), d5NI: varphi, and isocarbostyril (ICS): 7-azaindole (7AI), allowed bypass of a chemically diverse spectrum of HBAs, and enabled PCR amplification with primers comprising multiple d5NI(C)-substitutions, while maintaining high levels of catalytic activity and fidelity. The selected polymerase 5D4 promises to expand the range of nucleobase analogues amenable to replication and should find numerous applications, including the synthesis and replication of nucleic acid polymers with expanded chemical and functional diversity.

The development of a real-time reverse transcription-polymerase chain reaction (rRT-PCR) assay using TaqMan technology for the pan detection of bluetongue virus (BTV).

PubMed

Mulholland, Catherine; McMenamy, Michael J; Hoffmann, Bernd; Earley, Bernadette; Markey, Bryan; Cassidy, Joseph; Allan, Gordon; Welsh, Michael D; McKillen, John

2017-07-01

Bluetongue virus (BTV) is an infectious, non-contagious viral disease of domestic and wild ruminants that is transmitted by adult females of certain Culicoides species. Since 2006, several serotypes including BTV-1, 2, 4, 6, 8, 9 and 16, have spread from the Mediterranean basin into Northern Europe for the first time. BTV-8 in particular, caused a major epidemic in northern Europe. As a result, it is evident that most European countries are at risk of BTV infection. The objective of this study was to develop and validate a real-time reverse transcriptase-polymerase chain reaction (rRT-PCR) assay based on TaqMan technology for the detection of representative strains of all BTV serotypes. Primers and probes were based on genome segment 10 of the virus, the NS3 gene. The assay was tested for sensitivity, and specificity. The analytical sensitivity of the rRT-PCR assay was 200 copies of RNA per reaction. The assay did not amplify the closely related orbivirus epizootic hemorrhagic disease virus (EHDV) but successfully detected all BTV reference strains including clinical samples from animals experimentally infected with BTV-8. This real time RT-PCR assay offers a sensitive, specific and rapid alternative assay for the pan detection of BTV that could be used as part of a panel of diagnostic assays for the detection of all serotypes of BTV. Crown Copyright © 2017. Published by Elsevier B.V. All rights reserved.

Quantification of measles, mumps and rubella viruses using real-time quantitative TaqMan-based RT-PCR assay.

PubMed

Ammour, Y; Faizuloev, E; Borisova, T; Nikonova, A; Dmitriev, G; Lobodanov, S; Zverev, V

2013-01-01

In this study, a rapid quantitative method using TaqMan-based real-time reverse transcription-polymerase chain reaction (qPCR-RT) has been developed for estimating the titers of measles, mumps and rubella (MMR) viruses in infected cell culture supernatants. The qPCR-RT assay was demonstrated to be a specific, sensitive, efficient and reproducible method. For MMR viral samples obtained during MMR viral propagations in Vero cells at a different multiplicity of infection, titers determined by the qPCR-RT assay have been compared with estimates of infectious virus obtained by a traditional commonly used method for MMR viruses - 50% cell culture infective dose (CCID(50)) assay, in paired samples. Pearson analysis evidenced a significant correlation between both methods for a certain period after viral inoculation. Furthermore, the established qPCR-RT assay was faster and less-laborious. The developed method could be used as an alternative method or a supplementary tool for the routine titer estimation during MMR vaccine production. Copyright © 2012 Elsevier B.V. All rights reserved.

Miniprimer PCR, a New Lens for Viewing the Microbial World▿ †

PubMed Central

Isenbarger, Thomas A.; Finney, Michael; Ríos-Velázquez, Carlos; Handelsman, Jo; Ruvkun, Gary

2008-01-01

Molecular methods based on the 16S rRNA gene sequence are used widely in microbial ecology to reveal the diversity of microbial populations in environmental samples. Here we show that a new PCR method using an engineered polymerase and 10-nucleotide “miniprimers” expands the scope of detectable sequences beyond those detected by standard methods using longer primers and Taq polymerase. After testing the method in silico to identify divergent ribosomal genes in previously cloned environmental sequences, we applied the method to soil and microbial mat samples, which revealed novel 16S rRNA gene sequences that would not have been detected with standard primers. Deeply divergent sequences were discovered with high frequency and included representatives that define two new division-level taxa, designated CR1 and CR2, suggesting that miniprimer PCR may reveal new dimensions of microbial diversity. PMID:18083877

Activity-based assay for ricin-like toxins

DOEpatents

Keener, William K.; Ward, Thomas E.

2007-02-06

A method of detecting N-glycosylase activity in a sample involves incubating an oligodeoxyribonucleotide substrate containing a deoxyadenosine or deoxyuridine residue with the sample to be tested such that the N-glycosylase, if present, hydrolyzes the deoxyadenosine or deoxyuridine residue to result in an N-glycosylase product having an abasic site. A primer is annealed to the N-glycosylase product, and the primer is extended with a DNA polymerase, such as Taq DNA polymerase, that pauses at abasic sites. The resulting extension products are melted from the N-glycosylase product, allowed to form hairpins due to self-complementarity, and further extended in the presence of labeled precursors to result in labeled products. Extension products synthesized from undigested substrate as template do not result in labeled products. Thus, detection of labeled products results in detection of N-glycosylase activity. Oligodeoxyribonucleotide substrates, primer, and positive controls and a kit for N-glycosylase assay are also disclosed.

Development of a 20-locus fluorescent multiplex system as a valuable tool for national DNA database.

PubMed

Jiang, Xianhua; Guo, Fei; Jia, Fei; Jin, Ping; Sun, Zhu

2013-02-01

The multiplex system allows the detection of 19 autosomal short tandem repeat (STR) loci [including all Combined DNA Index System (CODIS) STR loci as well as D2S1338, D6S1043, D12S391, D19S433, Penta D and Penta E] plus the sex-determining locus Amelogenin in a single reaction, comprising all STR loci in various commercial kits used in the China national DNA database (NDNAD). Primers are designed so that the amplicons are distributed ranging from 90 base pairs (bp) to 450 bp within a five-dye fluorescent design with the fifth dye reserved for the internal size standard. With 30 cycles, 125 pg to 2 ng DNA template showed optimal profiling result, while robust profiles could also be achieved by adjusting the cycle numbers for the DNA template beyond that optimal DNA input range. Mixture studies showed that 83% and 87% of minor alleles were detected at 9:1 and 1:9 ratios, respectively. When 4 ng of degraded DNA was digested by 2-min DNase and 1 ng undegraded DNA was added to 400 μM haematin, the complete profiles were still observed. Polymerase chain reaction (PCR)-based procedures were examined and optimized including the concentrations of primer set, magnesium and the Taq polymerase as well as volume, cycle number and annealing temperature. In addition, the system has been validated by 3000 bloodstain samples and 35 common case samples in line with the Chinese National Standards and Scientific Working Group on DNA Analysis Methods (SWGDAM) guidelines. The total probability of identity (TPI) can reach to 8×10(-24), where DNA database can be improved at the level of 10 million DNA profiles or more because the number of expected match is far from one person (4×10(-10)) and can be negligible. Further, our system also demonstrates its good performance in case samples and it will be an ideal tool for forensic DNA typing and databasing with potential application. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

Real-time polymerase chain reaction-based approach for quantification of the pat gene in the T25 Zea mays event.

PubMed

Weighardt, Florian; Barbati, Cristina; Paoletti, Claudia; Querci, Maddalena; Kay, Simon; De Beuckeleer, Marc; Van den Eede, Guy

2004-01-01

In Europe, a growing interest for reliable techniques for the quantification of genetically modified component(s) of food matrixes is arising from the need to comply with the European legislative framework on novel food products. Real-time polymerase chain reaction (PCR) is currently the most powerful technique for the quantification of specific nucleic acid sequences. Several real-time PCR methodologies based on different molecular principles have been developed for this purpose. The most frequently used approach in the field of genetically modified organism (GMO) quantification in food or feed samples is based on the 5'-3'-exonuclease activity of Taq DNA polymerase on specific degradation probes (TaqMan principle). A novel approach was developed for the establishment of a TaqMan quantification system assessing GMO contents around the 1% threshold stipulated under European Union (EU) legislation for the labeling of food products. The Zea mays T25 elite event was chosen as a model for the development of the novel GMO quantification approach. The most innovative aspect of the system is represented by the use of sequences cloned in plasmids as reference standards. In the field of GMO quantification, plasmids are an easy to use, cheap, and reliable alternative to Certified Reference Materials (CRMs), which are only available for a few of the GMOs authorized in Europe, have a relatively high production cost, and require further processing to be suitable for analysis. Strengths and weaknesses of the use of novel plasmid-based standards are addressed in detail. In addition, the quantification system was designed to avoid the use of a reference gene (e.g., a single copy, species-specific gene) as normalizer, i.e., to perform a GMO quantification based on an absolute instead of a relative measurement. In fact, experimental evidences show that the use of reference genes adds variability to the measurement system because a second independent real-time PCR-based measurement must be performed. Moreover, for some reference genes no sufficient information on copy number in and among genomes of different lines is available, making adequate quantification difficult. Once developed, the method was subsequently validated according to IUPAC and ISO 5725 guidelines. Thirteen laboratories from 8 EU countries participated in the trial. Eleven laboratories provided results complying with the predefined study requirements. Repeatability (RSDr) values ranged from 8.7 to 15.9%, with a mean value of 12%. Reproducibility (RSDR) values ranged from 16.3 to 25.5%, with a mean value of 21%. Following Codex Alimentarius Committee guidelines, both the limits of detection and quantitation were determined to be <0.1%.

Detection of viable Salmonella in ice cream by TaqMan real-time polymerase chain reaction assay combining propidium monoazide.

PubMed

Wang, Yuexia; Yang, Ming; Liu, Shuchun; Chen, Wanyi; Suo, Biao

2015-09-01

Real-time polymerase chain reaction (PCR) allows rapid detection of Salmonella in frozen dairy products, but it might cause a false positive detection result because it might amplify DNA from dead target cells as well. In this study, Salmonella-free frozen ice cream was initially inoculated with heat-killed Salmonella Typhimurium cells and stored at -18°C. Bacterial DNA extracted from the sample was amplified using TaqMan probe-based real-time PCR targeting the invA gene. Our results indicated that DNA from the dead cells remained stable in frozen ice cream for at least 20 days, and could produce fluorescence signal for real-time PCR as well. To overcome this limitation, propidium monoazide (PMA) was combined with real-time PCR. PMA treatment can effectively prevent PCR amplification from heat-killed Salmonella cells in frozen ice cream. The PMA real-time PCR assay can selectively detect viable Salmonella at as low as 10 3  CFU/mL. Combining 18 hours of pre-enrichment with the assay allows for the detection of viable Salmonella at 10 0  CFU/mL and avoiding the false-positive result of dead cells. The PMA real-time PCR assay provides an alternative specifically for detection of viable Salmonella in ice cream. However, when the PMA real-time PCR assay was evaluated in ice cream subjected to frozen storage, it obviously underestimated the contamination situation of viable Salmonella, which might lead to a false negative result. According to this result, the use of enrichment prior to PMA real-time PCR analysis remains as the more appropriate approach. Copyright © 2015. Published by Elsevier B.V.

Clinical evaluation of a quantitative real time polymerase chain reaction assay for diagnosis of primary Epstein-Barr virus infection in children.

PubMed

Pitetti, Raymond D; Laus, Stella; Wadowsky, Robert M

2003-08-01

Epstein-Barr virus (EBV) infectious mononucleosis is often diagnosed based on characteristic clinical features and either a positive heterophil antibody test or serology, both of which can be unreliable in young children. Real time quantitative PCR assays that measure EBV DNA load in serum or plasma are highly sensitive in young children, but serum and plasma contain inhibitors of PCR which must be removed by DNA extraction techniques. A real time TaqMan PCR assay was designed and evaluated for simultaneously measuring EBV DNA load and validating the removal of PCR inhibitors from serum samples. A serum sample was available from patients classified serologically as primary EBV infection (n = 28), EBV-seronegative (n = 25) and EBV-seropositive (n = 26). Patients were classified as having EBV infectious mononucleosis if they had specified clinical findings and > or =10% atypical lymphocytes in peripheral blood or had a positive Monospot test result. DNA was purified by a spin column method and tested in PCR reactions with primers for EBV DNA polymerase gene and internal control targets. Amplification of the two PCR products was measured in real time with separate TaqMan DNA probes labeled with various fluorescent reporters. The mean age of study patients was 9 years, 4 months. Twenty-one (75%) of the patients in the primary EBV infection group, one (4%) of the seronegatives and none of the seropositives had detectable EBV DNA. Within the primary infection group, those with detectable virus were more likely than those without detectable virus to have evidence of lymphadenopathy (14 of 16 vs.1 of 5; P = 0.011), higher mean atypical (11.7 vs.0.9%; P = 0.002) and absolute atypical (1.5 vs.0.1 x 109/l; P = 0.004) lymphocyte count, higher mean absolute lymphocyte count (4.7 vs.2.3 x 109/l; P = 0.026) and higher mean aspartate aminotransferase value (119.8 vs.37.3 IU/l; P = 0.036). Ten patients, all in the primary infection group, had EBV infectious mononucleosis, and all had positive PCR results. No sample contained PCR inhibitors. A real time TaqMan PCR assay allows rapid identification of patients with primary EBV infection and those with EBV infectious mononucleosis.

Real-time PCR detection of Vibrio vulnificus in oysters: comparison of oligonucleotide primers and probes targeting vvhA.

PubMed

Panicker, Gitika; Bej, Asim K

2005-10-01

We compared three sets of oligonucleotide primers and two probes designed for Vibrio vulnificus hemolysin A gene (vvhA) for TaqMan-based real-time PCR method enabling specific detection of Vibrio vulnificus in oysters. Two of three sets of primers with a probe were specific for the detection of all 81 V. vulnificus isolates by TaqMan PCR. The 25 nonvibrio and 12 other vibrio isolates tested were negative. However, the third set of primers, F-vvh1059 and R-vvh1159, with the P-vvh1109 probe, although positive for all V. vulnificus isolates, also exhibited positive cycle threshold (C(T)) values for other Vibrio spp. Optimization of the TaqMan PCR assay using F-vvh785/R-vvh990 or F-vvh731/R-vvh1113 primers and the P-vvh874 probe detected 1 pg of purified DNA and 10(3) V. vulnificus CFU/ml in pure cultures. The enriched oyster tissue homogenate did not exhibit detectable inhibition to the TaqMan PCR amplification of vvhA. Detection of 3 x 10(3) CFU V. vulnificus, resulting from a 5-h enrichment of an initial inoculum of 1 CFU/g of oyster tissue homogenate, was achieved with F-vvh785/R-vvh990 or F-vvh731/R-vvh1113 primers and P-vvh875 probe. The application of the TaqMan PCR using these primers and probe, exhibited detection of V. vulnificus on 5-h-enriched natural oysters harvested from the Gulf of Mexico. Selection of appropriate primers and a probe on vvhA for TaqMan-PCR-based detection of V. vulnificus in post-harvest-treated oysters would help avoid false-positive results, thus ensuring a steady supply of safe oysters to consumers and reducing V. vulnificus-related illnesses and deaths.

Optimizing high-resolution melting analysis for the detection of mutations of GPR30/GPER-1 in breast cancer.

PubMed

Aihara, Masamune; Yamamoto, Shigeru; Nishioka, Hiroko; Inoue, Yutaro; Hamano, Kimikazu; Oka, Masaaki; Mizukami, Yoichi

2012-06-15

G protein-coupled receptor 30/G protein estrogen receptor-1 (GPR30/GPER-1) is a novel membrane receptor for estrogen whose mRNA is expressed at high levels in estrogen-dependent cells such as breast cancer cell lines. However, mutations in GRP30 related to diseases remain unreported. To detect unknown mutations in the GPR30 open reading frame (ORF) quickly, the experimental conditions for high-resolution melting (HRM) analysis were examined for PCR primers, Taq polymerases, saturation DNA binding dyes, Mg(2+) concentration, and normalized temperatures. Nine known SNPs and 13 artificial point mutations within the GPR30 ORF, as well as single nucleotide variants in DNA extracted from subjects with breast cancers were tested under the optimal experimental conditions. The combination of Expand High Fidelity(PLUS) and SYTO9 in the presence of 2.0 mM MgCl(2) produced the best separation in melting curves of mutations in all regions of the GPR30 ORF. Under these experimental conditions, the mutations were clearly detected in both heterozygotes and homozygotes. HRM analysis of GPR30 using genomic DNA from subjects with breast cancers showed a novel single nucleotide variant, 111C>T in GPR30 and 4 known SNPs. The experimental conditions determined in this study for HRM analysis are useful for high throughput assays to detect unknown mutations within the GPR30 ORF. Copyright © 2012 Elsevier B.V. All rights reserved.

Construction of a genomic DNA library with a TA vector and its application in cloning of the phytoene synthase gene from the cyanobacterium Spirulina platensis M-135

NASA Astrophysics Data System (ADS)

Yoshikazu, Kawata; Shin-Ichi, Yano; Hiroyuki, Kojima

1998-03-01

An efficient and simple method for constructing a genomic DNA library using a TA cloning vector is presented. It is based on the sonicative cleavage of genomic DNA and modification of fragment ends with Taq DNA polymerase, followed by ligation using a TA vector. This method was applied for cloning of the phytoene synthase gene crt B from Spirulina platensis. This method is useful when genomic DNA cannot be efficiently digested with restriction enzymes, a problem often encountered during the construction of a genomic DNA library of cyanobacteria.

Chemistry and biological activity of coumarins at molecular level.

PubMed

Garro, Hugo A; García, Celina; Martín, Víctor S; Tonn, Carlos E; Pungitore, Carlos R

2014-08-01

Synthetic coumarins were prepared in high yields using ionic liquids as an environmental friendly alternative. 3,4-Dimethyl-7-hydroxycoumarin (3ab) and 3-isopropyl-4-methyl-5,7-dihydroxycoumarin (3bc) showed interesting activity against Taq DNA polymerase with IC50 values of 115.7 microM and 82.2 microM, respectively. Also, 4-methyl-7-hydroxycoumarin (3aa) and 4-methyl-5,7-dihydroxycoumarin (3ba) exhibited inhibitory activity against MMLV-RT with IC50 values of 23.5 microM and 18.3 microM, respectively. These inhibitors could have importance as antiretroviral chemotherapeutic agents and also for the development of antitumor drugs.

Allele and genotype frequencies of polymorphisms in cytokine genes in ethnic Russian individuals from Moscow, Russia.

PubMed

Shadrina, Alexandra; Voronina, Elena; Zolotukhin, Igor; Filipenko, Maxim

2017-02-01

Two hundred and twenty eight ethnic Russian individuals from Moscow, Russia, were genotyped at 14 single nucleotide polymorphisms CCL2 A-2578G; VEGFA C-2578A, G-634C, and C+936T; TNF G+419A and G-308A; IL1A G-889A; IL1RN T+1018C; IL6G-174C and G-572C; IFNG T+874A; IL1B C-511T; IL10 A+1082G; TGFB1 C-509T. Genotypes were determined using real-time polymerase chain reaction with TaqMan probes and polymerase chain reaction followed by melting analysis of dual-labeled probe. Genotype distribution was in accordance with Hardy-Weinberg equilibrium for all studied polymorphisms. Genotype data are available in the Allele Frequencies Net Database under identifier AFND 3367 and the population name "Russia Moscow Cytokine". Copyright © 2016 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.

Development of a fast PCR protocol enabling rapid generation of AmpFℓSTR® Identifiler® profiles for genotyping of human DNA

PubMed Central

2012-01-01

Background Traditional PCR methods for forensic STR genotyping require approximately 2.5 to 4 hours to complete, contributing a significant portion of the time required to process forensic DNA samples. The purpose of this study was to develop and validate a fast PCR protocol that enabled amplification of the 16 loci targeted by the AmpFℓSTR® Identifiler® primer set, allowing decreased cycling times. Methods Fast PCR conditions were achieved by substituting the traditional Taq polymerase for SpeedSTAR™ HS DNA polymerase which is designed for fast PCR, by upgrading to a thermal cycler with faster temperature ramping rates and by modifying cycling parameters (less time at each temperature) and adopting a two-step PCR approach. Results The total time required for the optimized protocol is 26 min. A total of 147 forensically relevant DNA samples were amplified using the fast PCR protocol for Identifiler. Heterozygote peak height ratios were not affected by fast PCR conditions, and full profiles were generated for single-source DNA amounts between 0.125 ng and 2.0 ng. Individual loci in profiles produced with the fast PCR protocol exhibited average n-4 stutter percentages ranging from 2.5 ± 0.9% (THO1) to 9.9 ± 2.7% (D2S1338). No increase in non-adenylation or other amplification artefacts was observed. Minor contributor alleles in two-person DNA mixtures were reliably discerned. Low level cross-reactivity (monomorphic peaks) was observed with some domestic animal DNA. Conclusions The fast PCR protocol presented offers a feasible alternative to current amplification methods and could aid in reducing the overall time in STR profile production or could be incorporated into a fast STR genotyping procedure for time-sensitive situations. PMID:22394458

Development of a fast PCR protocol enabling rapid generation of AmpFℓSTR® Identifiler® profiles for genotyping of human DNA.

PubMed

Foster, Amanda; Laurin, Nancy

2012-03-06

Traditional PCR methods for forensic STR genotyping require approximately 2.5 to 4 hours to complete, contributing a significant portion of the time required to process forensic DNA samples. The purpose of this study was to develop and validate a fast PCR protocol that enabled amplification of the 16 loci targeted by the AmpFℓSTR® Identifiler® primer set, allowing decreased cycling times. Fast PCR conditions were achieved by substituting the traditional Taq polymerase for SpeedSTAR™ HS DNA polymerase which is designed for fast PCR, by upgrading to a thermal cycler with faster temperature ramping rates and by modifying cycling parameters (less time at each temperature) and adopting a two-step PCR approach. The total time required for the optimized protocol is 26 min. A total of 147 forensically relevant DNA samples were amplified using the fast PCR protocol for Identifiler. Heterozygote peak height ratios were not affected by fast PCR conditions, and full profiles were generated for single-source DNA amounts between 0.125 ng and 2.0 ng. Individual loci in profiles produced with the fast PCR protocol exhibited average n-4 stutter percentages ranging from 2.5 ± 0.9% (THO1) to 9.9 ± 2.7% (D2S1338). No increase in non-adenylation or other amplification artefacts was observed. Minor contributor alleles in two-person DNA mixtures were reliably discerned. Low level cross-reactivity (monomorphic peaks) was observed with some domestic animal DNA. The fast PCR protocol presented offers a feasible alternative to current amplification methods and could aid in reducing the overall time in STR profile production or could be incorporated into a fast STR genotyping procedure for time-sensitive situations.

Quantifying viable Vibrio parahaemolyticus and Listeria monocytogenes simultaneously in raw shrimp.

PubMed

Zhang, Zhaohuan; Liu, Haiquan; Lou, Yang; Xiao, Lili; Liao, Chao; Malakar, Pradeep K; Pan, Yingjie; Zhao, Yong

2015-08-01

A novel TaqMan-based multiplex real-time PCR method combined with propidium monoazide (PMA) treatment was firstly developed for the simultaneous quantification of viable Vibrio parahaemolyticus and Listeria monocytogenes in raw shrimp. The optimization of PMA concentration showed that 100 μM was considered optimal to effectively inhibit 10(8) CFU/mL dead cells of both bacteria. The high specificity of this method was confirmed on tests using 96 target and non-target strains. The optimized assay could detect as low as 10(1)-10(2) CFU/g of each strain on the artificially contaminated shrimp, and its amplification efficiencies were up to 100 and 106 % for V. parahaemolyticus and L. monocytogenes, respectively. Furthermore, this assay has been successfully applied to describe the behavior of these two pathogens in raw shrimps stored at 4 °C. In conclusion, this PMA TaqMan-based multiplex real-time PCR technique, where the whole procedure takes less than 5 h, provides an effective and rapid tool for monitoring contamination of viable V. parahaemolyticus and L. monocytogenes in seafood, improving seafood safety and protecting public health.

Development of a real-time TaqMan assay to detect mendocina sublineage Pseudomonas species in contaminated metalworking fluids.

PubMed

Saha, Ratul; Donofrio, Robert S; Bagley, Susan T

2010-08-01

A TaqMan quantitative real-time polymerase chain reaction (qPCR) assay was developed for the detection and enumeration of three Pseudomonas species belonging to the mendocina sublineage (P. oleovorans, P. pseudoalcaligenes, and P. oleovorans subsp. lubricantis) found in contaminated metalworking fluids (MWFs). These microbes are the primary colonizers and serve as indicator organisms of biodegradation of used MWFs. Molecular techniques such as qPCR are preferred for the detection of these microbes since they grow poorly on typical growth media such as R2A agar and Pseudomonas isolation agar (PIA). Traditional culturing techniques not only underestimate the actual distribution of these bacteria but are also time-consuming. The primer-probe pair developed from gyrase B (gyrB) sequences of the targeted bacteria was highly sensitive and specific for the three species. qPCR was performed with both whole cell and genomic DNA to confirm the specificity and sensitivity of the assay. The sensitivity of the assay was 10(1) colony forming units (CFU)/ml for whole cell and 13.7 fg with genomic DNA. The primer-probe pair was successful in determining concentrations from used MWF samples, indicating levels between 2.9 x 10(3) and 3.9 x 10(6) CFU/ml. In contrast, the total count of Pseudomonas sp. recovered on PIA was in the range of <1.0 x 10(1) to 1.4 x 10(5) CFU/ml for the same samples. Based on these results from the qPCR assay, the designed TaqMan primer-probe pair can be efficiently used for rapid (within 2 h) determination of the distribution of these species of Pseudomonas in contaminated MWFs.

Real-time PCR and its application to mumps rapid diagnosis.

PubMed

Jin, L; Feng, Y; Parry, R; Cui, A; Lu, Y

2007-11-01

A real-time polymerase chain reaction assay was initially developed in China to detect mumps genome. The primers and TaqMan-MGB probe were selected from regions of the hemagglutinin gene of mumps virus. The primers and probe for the real-time PCR were evaluated by both laboratories in China and in the UK using three different pieces of equipment, LightCycler (Roche), MJ DNA Engine Option 2 (BIO-RAD) and TaqMan (ABI Prism) on different samples. The reaction was performed with either a one-step (China) or two-step (UK) process. The sensitivity (10 copies) was estimated using a serial dilution of constructed mumps-plasmid DNA and a linear standard curve was obtained between 10 and 10(7) DNA copies/reaction, which can be used to quantify viral loads. The detection limit on cell culture-grown virus was approximately 2 pfu/ml with a two-step assay on TaqMan, which was equivalent to the sensitivity of the nested PCR routinely used in the UK. The specificity was proved by testing a range of respiratory viruses and several genotypes of mumps strains. The concentration of primers and probe is 22 pmol and 6.25 or 7 pmol respectively for a 25 microl reaction. The assay took 3 hr from viral RNA extraction to complete the detection using any of the three pieces of equipment. Three hundred forty-one (35 in China and 306 in the UK) clinical specimens were tested, the results showing that this real-time PCR assay is suitable for rapid and accurate detection of mumps virus RNA in various types of clinical specimens. (c) 2007 Wiley-Liss, Inc.

Association analysis of vitamin D receptor gene polymorphisms and bone mineral density in postmenopausal Mexican-Mestizo women.

PubMed

González-Mercado, A; Sánchez-López, J Y; Regla-Nava, J A; Gámez-Nava, J I; González-López, L; Duran-Gonzalez, J; Celis, A; Perea-Díaz, F J; Salazar-Páramo, M; Ibarra, B

2013-07-30

We investigated associations between vitamin D receptor (VDR) gene polymorphisms, FokI T>C (rs2228570), BsmI G>A (rs1544410), ApaI G>T (rs7975232), and TaqI T>C (rs731236), with bone mineral density (BMD) in postmenopausal Mexican-Mestizo women. Three hundred and twenty postmenopausal women participated, who were classified according to World Health Organization criteria as non-osteoporotic (Non-OP; N = 88), osteopenic (Opn; N = 144), and osteoporotic (OP; N = 88). BMD measurements at the lumbar (L1-L4) spine and at the left and right femoral neck were obtained by dual-energy X-ray absorptiometry. Single nucleotide polymorphisms (SNPs) were genotyped using real-time polymerase chain reaction and TaqMan probes. Genotype and allelic frequencies of the 4 VDR SNPs were similar among the 3 groups. Polymorphic allele frequencies were as follows: FokI (C) 0.53, 0.49, 0.56; BsmI (A) 0.26, 0.22, 0.23; ApaI (T) 0.43, 0.39, 0.44; TaqI (C) 0.27, 0.22, 0.23 for the Non-OP, Opn, and OP groups, respectively. Although no associations were found between the SNPs and BMD, based on the putative function of the FokI SNP, we constructed, for the first time, the haplotype with the 4 VDR SNPs, and found that the CGGT haplotype differed between the Non- OP and OP groups (21.8 vs 31.8%, P < 0.05). The risk analysis for this haplotype was nearly significant under the dominant model (OR = 1.783, 95%CI = 0.98-3.25, P = 0.058). This result suggests a possible susceptibility effect of the C allele of the FokI SNP for the development of osteoporosis in postmenopausal Mexican-Mestizo women.

Association analysis of clinical aspects and vitamin D receptor gene polymorphism with external apical root resorption in orthodontic patients.

PubMed

Fontana, Maria Luiza S Simas Netta; de Souza, Cleber Machado; Bernardino, José Fabio; Hoette, Felix; Hoette, Maura Levi; Thum, Lotario; Ozawa, Terumi O; Capelozza Filho, Leopoldino; Olandoski, Marcia; Trevilatto, Paula Cristina

2012-09-01

Vitamin D is responsible for the regulation of certain genes at the transcription level, via interaction with the vitamin D receptor, and influences host immune responses and aspects of bone development, growth, and homeostasis. Our aim was to investigate the association of TaqI vitamin D receptor gene polymorphism with external apical root resorption during orthodontic treatment. Our subjects were 377 patients with Class II Division 1 malocclusion, divided into 3 groups: (1) 160 with external apical root resorption ≤1.43 mm, (2) 179 with external apical root resorption >1.43 mm), and (3) 38 untreated subjects. External apical root resorption of the maxillary incisors was evaluated on periapical radiographs taken before and after 6 months of treatment. After DNA collection and purification, vitamin D receptor TaqI polymorphism analysis was performed by polymerase chain reaction-restriction fragment length polymorphism. Univariate and multivariate analyses were performed to verify the association of clinical and genetic variables with external apical root resorption (P <0.05). There was a higher proportion of external apical root resorption in orthodontically treated patients compared with the untreated subjects. In patients orthodontically treated, age higher than 14 years old, initial size of the maxillary incisor root superior to 30 mm, and premolar extraction were associated with increased external apical root resorption. Genotypes containing the C allele were weakly associated with protection against external apical root resorption (CC + CT × TT [odds ratio, 0.29; 95% confidence interval, 0.07-1.23; P = 0.091]) when treated orthodontic patients were compared to untreated individuals. Clinical factors and vitamin D receptor TaqI polymorphism were associated with external apical root resorption in orthodontic patients. Copyright © 2012 American Association of Orthodontists. Published by Mosby, Inc. All rights reserved.

APOE and CETP TaqIB polymorphisms influence metabolic responses to Hibiscus sabdariffa L. and Gynostemma pentaphyllum Makino tea consumption in hypercholesterolemic subjects.

PubMed

Jeenduang, Nutjaree; Sangkaew, Boonnisa; Chantaracha, Pacharee; Chanchareonsri, Sirada; Plyduang, Thunyaluk; Thitdee, Wanida; Samae, Cathaleeya; Pitumanon, Wacharaporn

2017-03-01

Hibiscus sabdariffa L. (HS) and Gynostemma pentaphyllum Makino (GP) have been used as traditional medicines to treat diabetes and hypercholesterolemia. Nevertheless, there is interindividual variation in the metabolic responses to HS and GP consumption. This may be due to genetic factors. The aim of this study was to investigate the effects of HS and GP tea consumption on anthropometric data, fasting blood glucose (FBG), and lipid concentrations in hypercholesterolemia subjects with different genotypes of the APOE and CETP TaqIB polymorphisms. Forty-eight subjects with hypercholesterolemia were given either HS or GP tea for 30 days. Anthropometric and biochemical variables were determined, and APOE and CETP TaqIB polymorphisms were analyzed using the polymerase chain reaction- restriction fragment length polymorphism (PCR-RFLP). E4 (p=0.008) and homozygous B1B1 (p=0.010) carriers had significantly decreased HDL-C concentrations after HS consumption; in addition, B2 carriers who consumed HS showed significantly decreased triglyceride (TG) concentrations (p=0.039). Regarding GP consumption, non-E4 carriers had significantly decreased HDL-C (p=0.009) and FBG (p=0.042) concentrations. Furthermore, B2 carriers had significantly decreased total cholesterol (TC) (p=0.045), HDL-C (p=0.004), and FBG (p=0.026) concentrations. HS consumption may have beneficial effects with respect to TG concentrations in the B2 carriers, but it may adversely affect HDL-C concentrations in homozygous B1B1 and E4 carriers. In contrast, GP consumption may have favorable effects on TC and FBG concentrations but not on HDL-C concentrations for B2 and/or non-E4 carriers.

Use of a fluorogenic probe in a PCR-based assay for the detection of Listeria monocytogenes.

PubMed

Bassler, H A; Flood, S J; Livak, K J; Marmaro, J; Knorr, R; Batt, C A

1995-10-01

A PCR-based assay for Listeria monocytogenes that uses the hydrolysis of an internal fluorogenic probe to monitor the amplification of the target has been formatted. The fluorogenic 5' nuclease PCR assay takes advantage of the endogenous 5' --> 3' nuclease activity of Taq DNA polymerase to digest a probe which is labelled with two fluorescent dyes and hybridizes to the amplicon during PCR. When the probe is intact, the two fluorophores interact such that the emission of the reporter dye is quenched. During amplification, the probe is hydrolyzed, relieving the quenching of the reporter and resulting in an increase in its fluorescence intensity. This change in reporter dye fluorescence is quantitative for the amount of PCR product and, under appropriate conditions, for the amount of template. We have applied the fluorogenic 5' nuclease PCR assay to detect L. monocytogenes, using an 858-bp amplicon of hemolysin (hlyA) as the target. Maximum sensitivity was achieved by evaluating various fluorogenic probes and then optimizing the assay components and cycling parameters. With crude cell lysates, the total assay could be completed in 3 h with a detection limit of approximately 50 CFU. Quantification was linear over a range of 5 x 10(1) to 5 x 10(5) CFU.

Standardization of a TaqMan-based real-time PCR for the detection of Mycobacterium tuberculosis-complex in human sputum.

PubMed

Barletta, Francesca; Vandelannoote, Koen; Collantes, Jimena; Evans, Carlton A; Arévalo, Jorge; Rigouts, Leen

2014-10-01

Real-time polymerase chain reaction (qPCR) was optimized for detecting Mycobacterium tuberculosis in sputum. Sputum was collected from patients (N = 112) with suspected pulmonary tuberculosis, tested by smear microscopy, decontaminated, and split into equal aliquots that were cultured in Löwenstein-Jensen medium and tested by qPCR for the small mobile genetic element IS6110. The human ERV3 sequence was used as an internal control. 3 of 112 (3%) qPCR failed. For the remaining 109 samples, qPCR diagnosed tuberculosis in 79 of 84 patients with culture-proven tuberculosis, and sensitivity was greater than microscopy (94% versus 76%, respectively, P < 0.05). The qPCR sensitivity was similar (P = 0.9) for smear-positive (94%, 60 of 64) and smear-negative (95%, 19 of 20) samples. The qPCR was negative for 24 of 25 of the sputa with negative microscopy and culture (diagnostic specificity 96%). The qPCR had 99.5% sensitivity and specificity for 211 quality control samples including 84 non-tuberculosis mycobacteria. The qPCR cost ∼5US$ per sample and provided same-day results compared with 2-6 weeks for culture. © The American Society of Tropical Medicine and Hygiene.

Kinetic characterisation of primer mismatches in allele-specific PCR: a quantitative assessment.

PubMed

Waterfall, Christy M; Eisenthal, Robert; Cobb, Benjamin D

2002-12-20

A novel method of estimating the kinetic parameters of Taq DNA polymerase during rapid cycle PCR is presented. A model was constructed using a simplified sigmoid function to represent substrate accumulation during PCR in combination with the general equation describing high substrate inhibition for Michaelis-Menten enzymes. The PCR progress curve was viewed as a series of independent reactions where initial rates were accurately measured for each cycle. Kinetic parameters were obtained for allele-specific PCR (AS-PCR) amplification to examine the effect of mismatches on amplification. A high degree of correlation was obtained providing evidence of substrate inhibition as a major cause of the plateau phase that occurs in the later cycles of PCR.

Identification of four squid species by quantitative real-time polymerase chain reaction.

PubMed

Ye, Jian; Feng, Junli; Liu, Shasha; Zhang, Yanping; Jiang, Xiaona; Dai, Zhiyuan

2016-02-01

Squids are distributed worldwide, including many species of commercial importance, and they are often made into varieties of flavor foods. The rapid identification methods for squid species especially their processed products, however, have not been well developed. In this study, quantitative real-time PCR (qPCR) systems based on specific primers and TaqMan probes have been established for rapid and accurate identification of four common squid species (Ommastrephes bartramii, Dosidicus gigas, Illex argentinus, Todarodes pacificus) in Chinese domestic market. After analyzing mitochondrial genes reported in GenBank, the mitochondrial cytochrome b (Cytb) gene was selected for O. bartramii detection, cytochrome c oxidase subunit I (COI) gene for D. gigas and T. Pacificus detection, ATPase subunit 6 (ATPase 6) gene for I. Argentinus detection, and 12S ribosomal RNA (12S rDNA) gene for designing Ommastrephidae-specific primers and probe. As a result, all the TaqMan systems are of good performance, and efficiency of each reaction was calculated by making standard curves. This method could detect target species either in single or mixed squid specimen, and it was applied to identify 12 squid processed products successfully. Thus, it would play an important role in fulfilling labeling regulations and squid fishery control. Copyright © 2016 Elsevier Ltd. All rights reserved.

Universal detection of phytoplasmas and Xylella spp. by TaqMan singleplex and multiplex real-time PCR with dual priming oligonucleotides.

PubMed

Ito, Takao; Suzaki, Koichi

2017-01-01

Phytoplasmas and Xylella spp. are bacteria that cause many economically important plant diseases worldwide. TaqMan probe-based quantitative real-time polymerase chain reaction (qPCR) assays have been utilized to universally detect phytoplasmas or Xylella fastidiosa. To develop a superior universal qPCR method, we used a dual priming oligonucleotide (DPO) with two annealing sites as a reverse primer to target the well-conserved bacterial 16S rDNA. The new qPCR assays universally detected various species of phytoplasmas and subspecies of X. fastidiosa as well as Xylella taiwanensis, and generally showed superior threshold cycle values when amplifying specific or non-specific products compared to current universal qPCR assays. The proposed qPCR assays were integrated to develop a multiplex qPCR assay that simultaneously detected phytoplasmas, Xylella spp., and an internal plant DNA positive control within 1 hour. This assay could detect a minimum of ten bacterial cells and was compatible with crude extractions used in the rapid screening of various plants. The amplicons were of sufficient lengths to be directly sequenced for preliminary identification, and the primers could be used in universal conventional PCR assays. Additionally, reverse DPO primers can be utilized to improve other probe-based qPCR assays.

Universal detection of phytoplasmas and Xylella spp. by TaqMan singleplex and multiplex real-time PCR with dual priming oligonucleotides

PubMed Central

Suzaki, Koichi

2017-01-01

Phytoplasmas and Xylella spp. are bacteria that cause many economically important plant diseases worldwide. TaqMan probe-based quantitative real-time polymerase chain reaction (qPCR) assays have been utilized to universally detect phytoplasmas or Xylella fastidiosa. To develop a superior universal qPCR method, we used a dual priming oligonucleotide (DPO) with two annealing sites as a reverse primer to target the well-conserved bacterial 16S rDNA. The new qPCR assays universally detected various species of phytoplasmas and subspecies of X. fastidiosa as well as Xylella taiwanensis, and generally showed superior threshold cycle values when amplifying specific or non-specific products compared to current universal qPCR assays. The proposed qPCR assays were integrated to develop a multiplex qPCR assay that simultaneously detected phytoplasmas, Xylella spp., and an internal plant DNA positive control within 1 hour. This assay could detect a minimum of ten bacterial cells and was compatible with crude extractions used in the rapid screening of various plants. The amplicons were of sufficient lengths to be directly sequenced for preliminary identification, and the primers could be used in universal conventional PCR assays. Additionally, reverse DPO primers can be utilized to improve other probe-based qPCR assays. PMID:28957362

Massively parallel haplotyping on microscopic beads for the high-throughput phase analysis of single molecules.

PubMed

Boulanger, Jérôme; Muresan, Leila; Tiemann-Boege, Irene

2012-01-01

In spite of the many advances in haplotyping methods, it is still very difficult to characterize rare haplotypes in tissues and different environmental samples or to accurately assess the haplotype diversity in large mixtures. This would require a haplotyping method capable of analyzing the phase of single molecules with an unprecedented throughput. Here we describe such a haplotyping method capable of analyzing in parallel hundreds of thousands single molecules in one experiment. In this method, multiple PCR reactions amplify different polymorphic regions of a single DNA molecule on a magnetic bead compartmentalized in an emulsion drop. The allelic states of the amplified polymorphisms are identified with fluorescently labeled probes that are then decoded from images taken of the arrayed beads by a microscope. This method can evaluate the phase of up to 3 polymorphisms separated by up to 5 kilobases in hundreds of thousands single molecules. We tested the sensitivity of the method by measuring the number of mutant haplotypes synthesized by four different commercially available enzymes: Phusion, Platinum Taq, Titanium Taq, and Phire. The digital nature of the method makes it highly sensitive to detecting haplotype ratios of less than 1:10,000. We also accurately quantified chimera formation during the exponential phase of PCR by different DNA polymerases.

In vivo growth and genomic characterization of rickettsia-like organisms isolated from farmed Chinook salmon (Oncorhynchus tshawytscha) in New Zealand.

PubMed

Gias, E; Brosnahan, C L; Orr, D; Binney, B; Ha, H J; Preece, M A; Jones, B

2018-05-28

A rickettsia-like organism, designated NZ-RLO2, was isolated from Chinook salmon (Oncorhynchus tshawytscha) farmed in the South Island, New Zealand. In vivo growth showed NZ-RLO2 was able to grow in CHSE-214, EPC, BHK-21, C6/36 and Sf21 cell lines, while Piscirickettsia salmonis LF-89 T grew in all but BHK-21 and Sf21. NZ-RLO2 grew optimally in EPC at 15°C, CHSE-214 and EPC at 18°C. The growth of LF-89 T was optimal at 15°C, 18°C and 22°C in CHSE-24, but appeared less efficient in EPC cells at all temperatures. Pan-genome comparison of predicted proteomes shows that available Chilean strains of P. salmonis grouped into two clusters (p-value = 94%). NZ-RLO2 was genetically different from previously described NZ-RLO1, and both strains grouped separately from the Chilean strains in one of the two clusters (p-value = 88%), but were closely related to each other. TaqMan and Sybr Green real-time PCR targeting RNA polymerase (rpoB) and DNA primase (dnaG), respectively, were developed to detect NZ-RLO2. This study indicates that the New Zealand strains showed a closer genetic relationship to one of the Chilean P. salmonis clusters; however, more Piscirickettsia genomes from wider geographical regions and diverse hosts are needed to better understand the classification within this genus. © 2018 John Wiley & Sons Ltd.

TaqMan real-time polymerase chain reaction for detection of Ophidiomyces ophiodiicola, the fungus associated with snake fungal disease.

PubMed

Bohuski, Elizabeth; Lorch, Jeffrey M; Griffin, Kathryn M; Blehert, David S

2015-04-15

Fungal skin infections associated with Ophidiomyces ophiodiicola, a member of the Chrysosporium anamorph of Nannizziopsis vriesii (CANV) complex, have been linked to an increasing number of cases of snake fungal disease (SFD) in captive snakes around the world and in wild snake populations in eastern North America. The emergence of SFD in both captive and wild situations has led to an increased need for tools to better diagnose and study the disease. We developed two TaqMan real-time polymerase chain reaction (PCR) assays to rapidly detect O. ophiodiicola in clinical samples. One assay targets the internal transcribed spacer region (ITS) of the fungal genome while the other targets the more variable intergenic spacer region (IGS). The PCR assays were qualified using skin samples collected from 50 snakes for which O. ophiodiicola had been previously detected by culture, 20 snakes with gross skin lesions suggestive of SFD but which were culture-negative for O. ophiodiicola, and 16 snakes with no clinical signs of infection. Both assays performed equivalently and proved to be more sensitive than traditional culture methods, detecting O. ophiodiicola in 98% of the culture-positive samples and in 40% of the culture-negative snakes that had clinical signs of SFD. In addition, the assays did not cross-react with a panel of 28 fungal species that are closely related to O. ophiodiicola or that commonly occur on the skin of snakes. The assays did, however, indicate that some asymptomatic snakes (~6%) may harbor low levels of the fungus, and that PCR should be paired with histology when a definitive diagnosis is required. These assays represent the first published methods to detect O. ophiodiicola by real-time PCR. The ITS assay has great utility for assisting with SFD diagnoses whereas the IGS assay offers a valuable tool for research-based applications.

Detection and quantification of Renibacterium salmoninarum DNA in salmonid tissues by real-time quantitative polymerase chain reaction analysis

USGS Publications Warehouse

Chase, D.M.; Elliott, D.G.; Pascho, R.J.

2006-01-01

Renibacterium salmoninarum is an important salmonid pathogen that is difficult to culture. We developed and assessed a real-time, quantitative, polymerase chain reaction (qPCR) assay for the detection and enumeration of R. salmoninarum. The qPCR is based on TaqMan technology and amplifies a 69-base pair (bp) region of the gene encoding the major soluble antigen (MSA) of R. salmoninarum. The qPCR assay consistently detected as few as 5 R. salmoninarum cells per reaction in kidney tissue. The specificity of the qPCR was confirmed by testing the DNA extracts from a panel of microorganisms that were either common fish pathogens or reported to cause false-positive reactions in the enzyme-linked immunosorbent assay (ELISA). Kidney samples from 38 juvenile Chinook salmon (Oncorhynchus tshawytscha) in a naturally infected population were examined by real-time qPCR, a nested PCR, and ELISA, and prevalences of R. salmoninarum detected were 71, 66, and 71%, respectively. The qPCR should be a valuable tool for evaluating the R. salmoninarum infection status of salmonids.

Histological analysis and ancient DNA amplification of human bone remains found in caius iulius polybius house in pompeii.

PubMed

Cipollaro, M; Di Bernado, G; Forte, A; Galano, G; De Masi, L; Galderisi, U; Guarino, F M; Angelini, F; Cascino, A

1999-09-01

Thirteen skeletons found in the Caius Iulius Polybius house, which has been the object of intensive study since its discovery in Pompeii 250 years ago, have provided an opportunity to study either bone diagenesis by histological investigation or ancient DNA by polymerase chain reaction analysis. DNA analysis was done by amplifying both X- and Y-chromosomes amelogenin loci and Y-specific alphoid repeat locus. The von Willebrand factor (vWF) microsatellite locus on chromosome 12 was also analyzed for personal identification in two individuals showing alleles with 10/11 and 12/12 TCTA repeats, respectively. Technical problems were the scarcity of DNA content from osteocytes, DNA molecule fragmentation, microbial contamination which change bone structure, contaminating human DNA which results from mishandling, and frequent presence of Taq DNA polymerase inhibiting molecules like polyphenols and heavy metals. The results suggest that the remains contain endogenous human DNA that can be amplified and analyzed. The amplifiability of DNA corresponds to the bone preservation and dynamics of the burial conditions subsequent to the 79 A.D. eruption.

Simultaneous co-detection of wild-type and vaccine strain measles virus using the BD MAX system.

PubMed

Thapa, Kiran; Ellem, Justin A; Basile, Kerri; Carter, Ian; Olma, Tom; Chen, Sharon C-A; Dwyer, Dominic E; Kok, Jen

2018-06-01

Despite the reported elimination of measles virus in Australia, importation of cases from endemic countries continues to lead to secondary local transmission and outbreaks. Rapid laboratory confirmation of measles is paramount for individual patient management and outbreak responses. Further, it is important to rapidly distinguish infection from wild-type virus or vaccine strains to guide public health responses. We developed a high throughput, TaqMan-based multiplex reverse-transcription-polymerase chain reaction (PCR) assay using the BD MAX platform (Becton Dickinson) that simultaneously detects measles virus and differentiates between wild-type and vaccine strains without the need for sequencing. Copyright © 2018 Royal College of Pathologists of Australasia. Published by Elsevier B.V. All rights reserved.

Epstein-Barr viral load before a liver transplant in children with chronic liver disease.

PubMed

Shakibazad, Nader; Honar, Naser; Dehghani, Seyed Mohsen; Alborzi, Abdolvahab

2014-12-01

Many children with chronic liver disease require a liver transplant. These patients are prone to various infections, including Epstein-Barr virus infection. This study sought to measure the Epstein-Barr viral load by polymerase chain reaction before a liver transplant. This cross-sectional study was done at the Shiraz University of Medical Sciences, Shiraz, Iran, in 2011. All patients were aged younger than 18 years with chronic liver disease and were candidates for a liver transplant at the Shiraz Nemazee Hospital Organ Transplant Center. They had been investigated regarding their demographic characteristics, underlying disease, laboratory findings, and Epstein-Barr viral load by real-time TaqMan polymerase chain reaction. Ninety-eight patients were studied and the mean age was 6.5 ± 5.9 years. Cryptogenic cirrhosis was the most-prevalent reason for liver transplant, and the death rate before a transplant was 15%. Among the study subjects, 6 had measurable Epstein-Barr viral load by polymerase chain reaction before the transplant, and 4 of them had considerably higher Epstein-Barr viral loads (more than 1000 copies/mL). With respect to the close prevalence of posttransplant lymphoproliferative disease (6%) and the high Epstein-Barr viral load in the patients before a transplant (4%), high pretransplant Epstein-Barr viral load can be considered a risk factor for posttransplant lymphoproliferative disorder.

An A-T linker adapter polymerase chain reaction method for chromosome walking without restriction site cloning bias.

PubMed

Trinh, Quoclinh; Xu, Wentao; Shi, Hui; Luo, Yunbo; Huang, Kunlun

2012-06-01

A-T linker adapter polymerase chain reaction (PCR) was modified and employed for the isolation of genomic fragments adjacent to a known DNA sequence. The improvements in the method focus on two points. The first is the modification of the PO(4) and NH(2) groups in the adapter to inhibit the self-ligation of the adapter or the generation of nonspecific products. The second improvement is the use of the capacity of rTaq DNA polymerase to add an adenosine overhang at the 3' ends of digested DNA to suppress self-ligation in the digested DNA and simultaneously resolve restriction site clone bias. The combination of modifications in the adapter and in the digested DNA leads to T/A-specific ligation, which enhances the flexibility of this method and makes it feasible to use many different restriction enzymes with a single adapter. This novel A-T linker adapter PCR overcomes the inherent limitations of the original ligation-mediated PCR method such as low specificity and a lack of restriction enzyme choice. Moreover, this method also offers higher amplification efficiency, greater flexibility, and easier manipulation compared with other PCR methods for chromosome walking. Experimental results from 143 Arabidopsis mutants illustrate that this method is reliable and efficient in high-throughput experiments. Copyright © 2012 Elsevier Inc. All rights reserved.

Comparison of nine different real-time PCR chemistries for qualitative and quantitative applications in GMO detection.

PubMed

Buh Gasparic, Meti; Tengs, Torstein; La Paz, Jose Luis; Holst-Jensen, Arne; Pla, Maria; Esteve, Teresa; Zel, Jana; Gruden, Kristina

2010-03-01

Several techniques have been developed for detection and quantification of genetically modified organisms, but quantitative real-time PCR is by far the most popular approach. Among the most commonly used real-time PCR chemistries are TaqMan probes and SYBR green, but many other detection chemistries have also been developed. Because their performance has never been compared systematically, here we present an extensive evaluation of some promising chemistries: sequence-unspecific DNA labeling dyes (SYBR green), primer-based technologies (AmpliFluor, Plexor, Lux primers), and techniques involving double-labeled probes, comprising hybridization (molecular beacon) and hydrolysis (TaqMan, CPT, LNA, and MGB) probes, based on recently published experimental data. For each of the detection chemistries assays were included targeting selected loci. Real-time PCR chemistries were subsequently compared for their efficiency in PCR amplification and limits of detection and quantification. The overall applicability of the chemistries was evaluated, adding practicability and cost issues to the performance characteristics. None of the chemistries seemed to be significantly better than any other, but certain features favor LNA and MGB technology as good alternatives to TaqMan in quantification assays. SYBR green and molecular beacon assays can perform equally well but may need more optimization prior to use.

Detection of KIT Genotype in Pigs by TaqMan MGB Real-Time Quantitative Polymerase Chain Reaction.

PubMed

Li, Xiuxiu; Li, Xiaoning; Luo, Rongrong; Wang, Wenwen; Wang, Tao; Tang, Hui

2018-05-01

The dominant white phenotype in domestic pigs is caused by two mutations in the KIT gene: a 450 kb duplication containing the entire KIT gene together with flanking sequences and one splice mutation with a G:A substitution in intron 17. The purpose of this study was to establish a simple, rapid method to determine KIT genotype in pigs. First, to detect KIT copy number variation (CNV), primers for exon 2 of the KIT gene, along with a TaqMan minor groove binder (MGB) probe, were designed. The single-copy gene, estrogen receptor (ESR), was used as an internal control. A real-time fluorescence-based quantitative PCR (FQ-PCR) protocol was developed to accurately detect KIT CNVs. Second, to detect the splice mutation ratio of the G:A substitution in intron 17, a 175 bp region, including the target mutation, was amplified from genomic DNA. Based on the sequence of the resulting amplified fragment, an MGB probe set was designed to detect the ratio of splice mutation to normal using FQ-PCR. A series of parallel amplification curves with the same internal distances were obtained using gradually diluted DNA as templates. The CT values among dilutions were significantly different (p < 0.001) and the coefficients of variation from each dilution were low (from 0.13% to 0.26%). The amplification efficiencies for KIT and ESR were approximately equal, indicating ESR was an appropriate control gene. Furthermore, use of the MGB probe set resulted in detection of the target mutation at a high resolution and stability; standard curves illustrated that the amplification efficiencies of KIT1 (G) and KIT2 (A) were approximately equal (98.8% and 97.2%). In conclusion, a simple, rapid method, with high specificity and stability, for the detection of the KIT genotype in pigs was established using TaqMan MGB probe real-time quantitative PCR.

The Impact of Five VDR Polymorphisms on Multiple Sclerosis Risk and Progression: a Case-Control and Genotype-Phenotype Study.

PubMed

Křenek, Pavel; Benešová, Yvonne; Bienertová-Vašků, Julie; Vašků, Anna

2018-04-01

Vitamin D receptor polymorphisms have been the target of many studies focusing on multiple sclerosis. However, previously reported results have been inconclusive. The objective of this study was to investigate the association between five vitamin D receptor polymorphisms (EcoRV, FokI, ApaI, TaqI, and BsmI) and multiple sclerosis susceptibility and its course. The study was carried out as a case-control and genotype-phenotype study, consisted of 296 Czech multiple sclerosis patients and 135 healthy controls. Genotyping was carried out using polymerase chain reaction and restriction analysis. In multiple sclerosis men, allele and/or genotype distributions differed in EcoRV, TaqI, BsmI, and ApaI polymorphisms as compared to controls (EcoRV, p a = 0.02; Taq, p g = 0.02, p a = 0.02; BsmI, p g = 0.02, p a = 0.04; ApaI, p g = 0.008, p a = 0.005). In multiple sclerosis women, differences in the frequency of alleles and genotypes were found to be significant in ApaI (controls vs multiple sclerosis women: p g = 0.01, p a = 0.05). Conclusive results were observed between multiple sclerosis women in the case of EcoRV [differences in Expanded Disability Status Scale (p = 0.05); CT genotype was found to increase the risk of primary progressive multiple sclerosis 5.5 times (CT vs CC+TT p corr = 0.01, sensitivity 0.833, specificity 0.525, power test 0.823)] and FokI [borderline difference in Multiple Sclerosis Severity Score (p = 0.05)]. Our results indicate that the distribution of investigated vitamin D receptor polymorphisms is a risk factor for multiple sclerosis susceptibility and progression in the Czech population. The association between disease risk and polymorphisms was found to be stronger in men. The association of disease progression with polymorphisms was observed only in women.

Development of FQ-PCR method to determine the level of ADD1 expression in fatty and lean pigs.

PubMed

Cui, J X; Chen, W; Zeng, Y Q

2015-10-30

To determine how adipocyte determination and differentiation factor 1 (ADD1), a gene involved in the determination of pork quality, is regulated in Laiwu and Large pigs, we used TaqMan fluorescence quantitative real-time polymerase chain reaction (FQ-PCR) to detect differential expression in the longissimus muscle of Laiwu (fatty) and Large White (lean) pigs. In this study, the ADD1 and GAPDH cDNA sequences were cloned using a T-A cloning assay, and the clone sequences were consistent with those deposited in GenBank. Thus, the target fragment was successfully recombined into the vector, and its integrity was maintained. The standard curve and regression equation were established through the optimized FQ-PCR protocol. The standard curve of porcine ADD1 and GAPDH cDNA was determined, and its linear range extension could reach seven orders of magnitudes. The results showed that this method was used to quantify ADD1 expression in the longissimus muscle of two breeds of pig, and was found to be accurate, sensitive, and convenient. These results provide information regarding porcine ADD1 mRNA expression and the mechanism of adipocyte differentiation, and this study could help in the effort to meet the demands of consumers interested in the maintenance of health and prevention of obesity. Furthermore, it could lead to new approaches in the prevention and clinical treatment of this disease.

One-step multiplex quantitative RT-PCR for the simultaneous detection of viroids and phytoplasmas of pome fruit trees.

PubMed

Malandraki, Ioanna; Varveri, Christina; Olmos, Antonio; Vassilakos, Nikon

2015-03-01

A one-step multiplex real-time quantitative reverse transcription polymerase chain reaction (RT-qPCR) based on TaqMan chemistry was developed for the simultaneous detection of Pear blister canker viroid and Apple scar skin viroid along with universal detection of phytoplasmas, in pome trees. Total nucleic acids (TNAs) extraction was performed according to a modified CTAB protocol. Primers and TaqMan MGB probes for specific detection of the two viroids were designed in this study, whereas for phytoplasma detection published universal primers and probe were used, with the difference that the later was modified to carry a MGB quencher. The pathogens were detected simultaneously in 10-fold serial dilutions of TNAs from infected plant material into TNAs of healthy plant up to dilutions 10(-5) for viroids and 10(-4) for phytoplasmas. The multiplex real-time assay was at least 10 times more sensitive than conventional protocols for viroid and phytoplasma detection. Simultaneous detection of the three targets was achieved in composite samples at least up to a ratio of 1:100 triple-infected to healthy tissue, demonstrating that the developed assay has the potential to be used for rapid and massive screening of viroids and phytoplasmas of pome fruit trees in the frame of certification schemes and surveys. Copyright © 2014 Elsevier B.V. All rights reserved.

Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

NASA Astrophysics Data System (ADS)

Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

2015-09-01

Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

Two Novel Real-Time Reverse Transcriptase PCR Assays for Rapid Detection of Bacterial Contamination in Platelet Concentrates

PubMed Central

Dreier, Jens; Störmer, Melanie; Kleesiek, Knut

2004-01-01

The incidence of platelet bacterial contamination is approximately 1 per 2,000 units and has been acknowledged as the most frequent infectious risk from transfusion. In preliminary studies, the sterility of platelet concentrates (PCs) was tested with an automated bacterial blood culturing system and molecular genetic assays. Two real-time reverse transcriptase PCR (RT-PCR) assays performed in a LightCycler instrument were developed and compared regarding specificity and sensitivity by the use of different templates to detect the majority of the clinically important bacterial species in platelets. Primers and probes specific for the conserved regions of the eubacterial 23S rRNA gene or the groEL gene (encoding the 60-kDa heat shock protein Hsp60) were designed. During the development of the 23S rRNA RT-PCR, problems caused by the contamination of reagents with bacterial DNA were noted. Treatment with 8-methoxypsoralen and UV irradiation reduced the level of contaminating DNA. The sensitivity of the assays was greatly influenced by the enzyme system which was used. With rTth DNA polymerase in a one-enzyme system, we detected 500 CFU of Escherichia coli or Staphylococcus epidermidis/ml. With a two-enzyme system consisting of Moloney murine leukemia virus RT and Taq DNA polymerase, we detected 16 CFU/ml. With groEL mRNA as the target of RT-PCR under optimized conditions, we detected 125 CFU of E. coli/ml, and no problems with false-positive results caused by reagent contamination or a cross-reaction with human nucleic acids were found. Furthermore, the use of mRNA as an indicator of viability was demonstrated. Here we report the application of novel real-time RT-PCR assays for the detection of bacterial contamination of PCs that are appropriate for transfusion services. PMID:15472337

Performance of three commercial viral load assays, Versant human immunodeficiency virus type 1 (HIV-1) RNA bDNA v3.0, Cobas AmpliPrep/Cobas TaqMan HIV-1, and NucliSens HIV-1 EasyQ v1.2, testing HIV-1 non-B subtypes and recombinant variants.

PubMed

Holguín, Africa; López, Marisa; Molinero, Mar; Soriano, Vincent

2008-09-01

Monitoring antiretroviral therapy requires that human immunodeficiency virus type 1 (HIV-1) viremia assays are applicable to all distinct variants. This study evaluates the performance of three commercial viral load assays-Versant HIV-1 RNA bDNA v3.0, Cobas AmpliPrep/Cobas TaqMan HIV-1, and NucliSens HIV-1 EasyQ v1.2-in testing 83 plasma specimens from patients carrying HIV-1 non-B subtypes and recombinants previously defined by phylogenetic analysis of the pol gene. All 28 specimens from patients under treatment presented viremia values below the detection limit with the three methods. In the remaining 55 specimens from naive individuals viremia could not be detected in 32.7, 20, and 14.6% using the NucliSens, Versant, or TaqMan tests, respectively, suggesting potential viral load underestimation of some samples by all techniques. Only 32 (58.2%) samples from naive subjects were quantified by the three methods; the NucliSens test provided the highest HIV RNA values (mean, 4.87 log copies/ml), and the Versant test provided the lowest (mean, 4.16 log copies/ml). Viremia differences of greater than 1 log were seen in 8 (14.5%) of 55 specimens, occurring in 10.9, 7.3, and 5.4%, respectively, of the specimens in comparisons of Versant versus NucliSens, Versant versus TaqMan, and TaqMan versus NucliSens. Differences greater than 0.5 log, considered significant for clinicians, occurred in 45.5, 27.3, and 29% when the same assays were compared. Some HIV-1 strains, such as subtype G and CRF02_AG, showed more discrepancies in distinct quantification methods than others. In summary, an adequate design of primers and probes is needed for optimal quantitation of plasma HIV-RNA in non-B subtypes. Our data emphasize the need to use the same method for monitoring patients on therapy and also the convenience of HIV-1 subtyping.

Association of dopamine receptor D2 gene (DRD2) Taq1 polymorphisms with eating behaviors and obesity among Chinese and Indian Malaysian university students.

PubMed

Lek, Fang-Ying; Ong, Hing-Huat; Say, Yee-How

2018-01-01

This study investigated the association of DRD2 Taq1A, Taq1B and Taq1D gene polymorphisms with eating behavior, the preference/intake frequency/craving of high-fat foods and obesity in 394 Malaysian adults (161 males, 233 females; 308 Chinese, 86 Indians; 67 obese, 327 non-obese). Eating behaviors namely Cognitive Restraint, Uncontrolled Eating and Emotional Eating scores were assessed by the Three Factor Eating Questionnaire-R18. The preference/intake frequency/craving of 26 common high-fat Malaysian foods was assessed using a 7-point hedonic scale. Anthropometric measurements were taken and Taq1 gene polymorphisms were genotyped by PCR-Restriction Fragment Length Polymorphism using DNA extracted from mouthwash samples. The overall minor allele frequencies of Taq1A, Taq1B and Taq1D according to ethnicities (Chinese/Indian) were 0.37/0.29, 0.39/0.28, 0.06/0.30, respectively; genotype and allele distributions of Taq1B and Taq1D were significantly different between ethnicities. Eating behaviorscores were not significantly different between gender and ethnicities. Those with A1 or B1 allele had lower Cognitive Restraint score and higher Uncontrolled Eating score, while those with A1/A1 or B1/B1 genotype had higher fast food preference. D1 allele was associated with increased starchy food craving and mamak (Malaysian Indian-Muslim) food preference, but not eating behavior scores. All three gene variants were not associated with obesity and adiposity. Taken together, we posit that three DRD2 Taq1 gene polymorphisms influence the eating behavior and preference/intake frequency/craving of certain high-fat foods in Malaysian adults, but their role in obesity and adiposity is still inconclusive and needs further investigation.

Canine parvovirus 2c infection in central Portugal.

PubMed

João Vieira, Maria; Silva, Eliane; Oliveira, João; Luísa Vieira, Ana; Decaro, Nicola; Desario, Costantina; Muller, Alexandra; Carvalheira, Júlio; Buonavoglia, Canio; Thompson, Gertrude

2008-07-01

Canine parvovirus (CPV) has been evolving, generating new genetic and antigenic variants throughout the world. This study was conducted to determine the types of CPV circulating in dogs in Figueira da Foz, Portugal. Thirty fecal samples, collected between 2006 and 2007 from dogs with clinical signs of CPV infection, were tested for CPV by a rapid, in-clinic, enzyme-linked immunosorbent assay (ELISA)/immunomigration test, by conventional real-time polymerase chain reaction (PCR), and by minor-groove binding TaqMan PCR. Of the 29 PCR-positive samples, 15 were identified as CPV-2b and 14 as CPV-2c. No CPV-2a was detected. The sensitivity of the ELISA test was 82.76% compared with the PCR assays. No significant associations were found between CPV type, clinical outcome, breed, vaccination status, or age.

Dembo polymerase chain reaction technique for detection of bovine abortion, diarrhea, and respiratory disease complex infectious agents in potential vectors and reservoirs.

PubMed

Rahpaya, Sayed Samim; Tsuchiaka, Shinobu; Kishimoto, Mai; Oba, Mami; Katayama, Yukie; Nunomura, Yuka; Kokawa, Saki; Kimura, Takashi; Kobayashi, Atsushi; Kirino, Yumi; Okabayashi, Tamaki; Nonaka, Nariaki; Mekata, Hirohisa; Aoki, Hiroshi; Shiokawa, Mai; Umetsu, Moeko; Morita, Tatsushi; Hasebe, Ayako; Otsu, Keiko; Asai, Tetsuo; Yamaguchi, Tomohiro; Makino, Shinji; Murata, Yoshiteru; Abi, Ahmad Jan; Omatsu, Tsutomu; Mizutani, Tetsuya

2018-05-31

Bovine abortion, diarrhea, and respiratory disease complexes, caused by infectious agents, result in high and significant economic losses for the cattle industry. These pathogens are likely transmitted by various vectors and reservoirs including insects, birds, and rodents. However, experimental data supporting this possibility are scarce. We collected 117 samples and screened them for 44 bovine abortive, diarrheal, and respiratory disease complex pathogens by using Dembo polymerase chain reaction (PCR), which is based on TaqMan real-time PCR. Fifty-seven samples were positive for at least one pathogen, including bovine viral diarrhea virus, bovine enterovirus, Salmonella enterica ser. Dublin, Salmonella enterica ser. Typhimurium, and Neospora caninum ; some samples were positive for multiple pathogens. Bovine viral diarrhea virus and bovine enterovirus were the most frequently detected pathogens, especially in flies, suggesting an important role of flies in the transmission of these viruses. Additionally, we detected the N. caninum genome from a cockroach sample for the first time. Our data suggest that insects (particularly flies), birds, and rodents are potential vectors and reservoirs of abortion, diarrhea, and respiratory infectious agents, and that they may transmit more than one pathogen at the same time.

Delayed vaccine virus replication in chickens vaccinated subcutaneously with an immune complex infectious bursal disease vaccine: Quantification of vaccine virus by real-time polymerase chain reaction

PubMed Central

2005-01-01

Abstract The distribution of the immune complex vaccine virus for infectious bursal disease (IBD) in tissue was examined and the viral loads of the organs were quantitatively compared. One-day-old specific pathogen free (SPF) and maternally immune broiler chickens were injected subcutaneously with the vaccine. Lymphoid and non-lymphoid tissues were collected at various time intervals during the experiment to test for infectious bursal disease virus (IBDV)-RNA by using reverse transcriptase-polymerase chain reaction (RT-PCR). Only the bursa of Fabricius was found to be positive with unusually long viral persistence in the broiler group. The positive bursa samples were further investigated by using real-time PCR coupled with a TaqMan probe. The highest amounts of the virus were detected at its first appearance in the bursa: on day 14 post vaccination (PV) in the SPF chickens and on day 17 and day 21 PV in the maternally immune broiler group. The virus then gradually cleared, most likely due to the parallel appearance of the active immune response indicated by seroconversion. PMID:15971678

A simplified strategy for studying the etiology of viral diseases: Apple stem grooving virus as a case study.

PubMed

Dhir, Sunny; Walia, Yashika; Zaidi, A A; Hallan, Vipin

2015-03-01

A simple method to amplify infective, complete genomes of single stranded RNA viruses by long distance PCR (LD PCR) from woody plant tissues is described in detail. The present protocol eliminates partial purification of viral particles and the amplification is achieved in three steps: (i) easy preparation of template RNA by incorporating a pre processing step before loading onto the column (ii) reverse transcription by AMV or Superscript reverse transcriptase and (iii) amplification of cDNA by LD PCR using LA or Protoscript Taq DNA polymerase. Incorporation of a preprocessing step helped to isolate consistent quality RNA from recalcitrant woody tissues such as apple, which was critical for efficient amplification of the complete genomes of Apple stem pitting virus (ASPV), Apple stem grooving virus (ASGV) and Apple chlorotic leaf spot virus (ACLSV). Complete genome of ASGV was cloned under T7 RNA polymerase promoter and was confirmed to be infectious through transcript inoculation producing symptoms similar to the wild type virus. This is the first report for the largest RNA virus genome amplified by PCR from total nucleic acid extracts of woody plant tissues. Copyright © 2014 Elsevier B.V. All rights reserved.

A new building block for DNA network formation by self-assembly and polymerase chain reaction.

PubMed

Bußkamp, Holger; Keller, Sascha; Robotta, Marta; Drescher, Malte; Marx, Andreas

2014-01-01

The predictability of DNA self-assembly is exploited in many nanotechnological approaches. Inspired by naturally existing self-assembled DNA architectures, branched DNA has been developed that allows self-assembly to predesigned architectures with dimensions on the nanometer scale. DNA is an attractive material for generation of nanostructures due to a plethora of enzymes which modify DNA with high accuracy, providing a toolbox for many different manipulations to construct nanometer scaled objects. We present a straightforward synthesis of a rigid DNA branching building block successfully used for the generation of DNA networks by self-assembly and network formation by enzymatic DNA synthesis. The Y-shaped 3-armed DNA construct, bearing 3 primer strands is accepted by Taq DNA polymerase. The enzyme uses each arm as primer strand and incorporates the branched construct into large assemblies during PCR. The networks were investigated by agarose gel electrophoresis, atomic force microscopy, dynamic light scattering, and electron paramagnetic resonance spectroscopy. The findings indicate that rather rigid DNA networks were formed. This presents a new bottom-up approach for DNA material formation and might find applications like in the generation of functional hydrogels.

[A novel TaqMan® MGB probe for specifically detecting Streptococcus mutans].

PubMed

Zheng, Hui; Lin, Jiu-Xiang; DU, Ning; Chen, Feng

2013-10-18

To design a new TaqMan® MGB probe for improving the specificity of Streptococcus mutans's detection. We extracted six DNA samples from different streptococcal strains for PCR reaction. Conventional nested PCR and TaqMan® MGB real-time PCR were applied independently. The first round of nested PCR was carried out with the bacterial universal primers, while a second PCR was conducted by using primers specific for the 16S rRNA gene of Streptococcus mutans. The TaqMan® MGB probe for Streptococcus mutans was designed from sequence analyses, and the primers were the same as nested PCR. Streptococcus mutans DNA with 2.5 mg/L was sequentially diluted at 5-fold intervals to 0.16 μg/L. Standard DNA samples were used to generate standard curves by TaqMan® MGB real-time PCR. In the nested PCR, the primers specific for Streptococcus mutans also detected Streptococcus gordonii with visible band of 282 bp, giving false-positive results. In the TaqMan® MGB real-time PCR reaction, only Streptococcus mutans was detected. The detection limitation of TaqMan® MGB real-time PCR for Streptococcus mutans 16S rRNA gene was 20 μg/L. We designed a new TaqMan® MGB probe, and successfully set up a PCR based method for detecting oral Streptococcus mutans. TaqMan® MGB real-time PCR is a both specific and sensitive bacterial detection method.

Development of a Tandem Repeat-Based Polymerase Chain Displacement Reaction Method for Highly Sensitive Detection of 'Candidatus Liberibacter asiaticus'.

PubMed

Lou, Binghai; Song, Yaqin; RoyChowdhury, Moytri; Deng, Chongling; Niu, Ying; Fan, Qijun; Tang, Yan; Zhou, Changyong

2018-02-01

Huanglongbing (HLB) is one of the most destructive diseases in citrus production worldwide. Early detection of HLB pathogens can facilitate timely removal of infected citrus trees in the field. However, low titer and uneven distribution of HLB pathogens in host plants make reliable detection challenging. Therefore, the development of effective detection methods with high sensitivity is imperative. This study reports the development of a novel method, tandem repeat-based polymerase chain displacement reaction (TR-PCDR), for the detection of 'Candidatus Liberibacter asiaticus', a widely distributed HLB-associated bacterium. A uniquely designed primer set (TR2-PCDR-F/TR2-PCDR-1R) and a thermostable Taq DNA polymerase mutant with strand displacement activity were used for TR-PCDR amplification. Performed in a regular thermal cycler, TR-PCDR could produce more than two amplicons after each amplification cycle. Sensitivity of the developed TR-PCDR was 10 copies of target DNA fragment. The sensitive level was proven to be 100× higher than conventional PCR and similar to real-time PCR. Data from the detection of 'Ca. L. asiaticus' with filed samples using the above three methods also showed similar results. No false-positive TR-PCDR amplification was observed from healthy citrus samples and water controls. These results thereby illustrated that the developed TR-PCDR method can be applied to the reliable, highly sensitive, and cost-effective detection of 'Ca. L. asiaticus'.

Comparison of Versant HBV DNA 3.0 and COBAS AmpliPrep-COBAS TaqMan assays for hepatitis B DNA quantitation: Possible clinical implications.

PubMed

Garbuglia, A R; Angeletti, C; Lauria, F N; Zaccaro, P; Cocca, A M; Pisciotta, M; Solmone, M; Capobianchi, M R

2007-12-01

We compared two commercial assays for HBV DNA quantitation, Versant HBV 3.0, System 340 (bDNA; Bayer Diagnostics) and COBAS AmpliPrep-COBAS TaqMan HBV Test (TaqMan; Roche Diagnostics). Analytical sensitivity, calculated on WHO International Standard, predicted 95% detection rate at 11.4 and 520.2IU/ml for TaqMan and bDNA, respectively. Specificity, established on 50 blood donor samples, was 100% and 84% for TaqMan and bDNA, respectively. When using clinical samples, HBV DNA was detected by TaqMan in 21/55 samples negative to bDNA. Mean values of HBV DNA obtained with bDNA were higher than those obtained with TaqMan (4.09log(10)+/-1.90 versus 3.39log(10)+/-2.41, p<0.001), and 24.4% of samples showed differences in viral load values >0.5log(10), without association with HBV genotype. There was a good correlation for HBV DNA concentrations measured by the two assays (r=0.94; p<0.001) within the overlapping range, and the distribution of results with respect to relevant clinical threshold recently confirmed (20,000 and 2000IU/ml) was similar. Approximately 50% of samples with low HBV DNA, appreciated by TaqMan but not by bDNA, were successfully sequenced in pol region, where drug resistance mutations are located.

Real-time PCR detection chemistry.

PubMed

Navarro, E; Serrano-Heras, G; Castaño, M J; Solera, J

2015-01-15

Real-time PCR is the method of choice in many laboratories for diagnostic and food applications. This technology merges the polymerase chain reaction chemistry with the use of fluorescent reporter molecules in order to monitor the production of amplification products during each cycle of the PCR reaction. Thus, the combination of excellent sensitivity and specificity, reproducible data, low contamination risk and reduced hand-on time, which make it a post-PCR analysis unnecessary, has made real-time PCR technology an appealing alternative to conventional PCR. The present paper attempts to provide a rigorous overview of fluorescent-based methods for nucleic acid analysis in real-time PCR described in the literature so far. Herein, different real-time PCR chemistries have been classified into two main groups; the first group comprises double-stranded DNA intercalating molecules, such as SYBR Green I and EvaGreen, whereas the second includes fluorophore-labeled oligonucleotides. The latter, in turn, has been divided into three subgroups according to the type of fluorescent molecules used in the PCR reaction: (i) primer-probes (Scorpions, Amplifluor, LUX, Cyclicons, Angler); (ii) probes; hydrolysis (TaqMan, MGB-TaqMan, Snake assay) and hybridization (Hybprobe or FRET, Molecular Beacons, HyBeacon, MGB-Pleiades, MGB-Eclipse, ResonSense, Yin-Yang or displacing); and (iii) analogues of nucleic acids (PNA, LNA, ZNA, non-natural bases: Plexor primer, Tiny-Molecular Beacon). In addition, structures, mechanisms of action, advantages and applications of such real-time PCR probes and analogues are depicted in this review. Copyright © 2014 Elsevier B.V. All rights reserved.

Expectoration of Flaviviruses during sugar feeding by mosquitoes (Diptera: Culicidae).

PubMed

van den Hurk, Andrew F; Johnson, Petrina H; Hall-Mendelin, Sonja; Northill, Judy A; Simmons, Russell J; Jansen, Cassie C; Frances, Stephen P; Smith, Greg A; Ritchie, Scott A

2007-09-01

Biological transmission of arboviruses to a vertebrate host occurs when virions are expelled along with saliva during blood feeding by a hematophagous arthropod. We undertook experiments to determine whether mosquitoes expectorate flaviviruses in their saliva while sugar feeding. Batches of Culex annulirostris Skuse and Culex gelidus Theobald (Diptera: Culicidae) were orally infected with Japanese encephalitis (family Flaviviridae, genus Flavivirus, JEV), Kunjin (family Flaviviridae, genus Flavivirus, KUNV; a subtype of West Nile virus), and Murray Valley encephalitis (family Flaviviridae, genus Flavivirus, MVEV) viruses. After a 7-d extrinsic incubation, these mosquitoes were offered sucrose meals via cotton pledgets, which were removed daily and processed for viral RNA by using real-time TaqMan reverse transcriptase-polymerase chain reaction (RT-PCR) assays. JEV, MVEV, and KUNV RNA was detected in all pledgets removed from batches of Cx. gelidus on days 7-14 postexposure. In contrast, detection rates were variable for Cx. annulirostris, with KUNV detected in 0.3 M sucrose pledgets on all days postexposure, and JEV and MVEV detected on 57 and 50% of days postexposure, respectively. Higher concentrations of sucrose in the pledget did not increase virus detection rates. When individual JEV-infected Cx. gelidus were exposed to the sucrose pledget, 73% of mosquitoes expectorated virus with titers that were detectable by TaqMan RT-PCR. These results clearly show that flaviviruses are expectorated by infected mosquitoes during the process of sugar feeding on artificial pledgets. Potential applications of the method for arboviral bioassays and field surveillance are discussed.

Optimization of Multiple Pathogen Detection Using the TaqMan Array Card: Application for a Population-Based Study of Neonatal Infection

PubMed Central

Diaz, Maureen H.; Waller, Jessica L.; Napoliello, Rebecca A.; Islam, Md. Shahidul; Wolff, Bernard J.; Burken, Daniel J.; Holden, Rhiannon L.; Srinivasan, Velusamy; Arvay, Melissa; McGee, Lesley; Oberste, M. Steven; Whitney, Cynthia G.; Schrag, Stephanie J.; Winchell, Jonas M.; Saha, Samir K.

2013-01-01

Identification of etiology remains a significant challenge in the diagnosis of infectious diseases, particularly in resource-poor settings. Viral, bacterial, and fungal pathogens, as well as parasites, play a role for many syndromes, and optimizing a single diagnostic system to detect a range of pathogens is challenging. The TaqMan Array Card (TAC) is a multiple-pathogen detection method that has previously been identified as a valuable technique for determining etiology of infections and holds promise for expanded use in clinical microbiology laboratories and surveillance studies. We selected TAC for use in the Aetiology of Neonatal Infection in South Asia (ANISA) study for identifying etiologies of severe disease in neonates in Bangladesh, India, and Pakistan. Here we report optimization of TAC to improve pathogen detection and overcome technical challenges associated with use of this technology in a large-scale surveillance study. Specifically, we increased the number of assay replicates, implemented a more robust RT-qPCR enzyme formulation, and adopted a more efficient method for extraction of total nucleic acid from blood specimens. We also report the development and analytical validation of ten new assays for use in the ANISA study. Based on these data, we revised the study-specific TACs for detection of 22 pathogens in NP/OP swabs and 12 pathogens in blood specimens as well as two control reactions (internal positive control and human nucleic acid control) for each specimen type. The cumulative improvements realized through these optimization studies will benefit ANISA and perhaps other studies utilizing multiple-pathogen detection approaches. These lessons may also contribute to the expansion of TAC technology to the clinical setting. PMID:23805203

Increased yield of PCR products by addition of T4 gene 32 protein to the SMART PCR cDNA synthesis system.

PubMed

Villalva, C; Touriol, C; Seurat, P; Trempat, P; Delsol, G; Brousset, P

2001-07-01

Under certain conditions, T4 gene 32 protein is known to increase the efficiency of different enzymes, such as Taq DNA polymerase, reverse transcriptase, and telomerase. In this study, we compared the efficiency of the SMART PCR cDNA synthesis kit with and without the T4 gene 32 protein. The use of this cDNA synthesis procedure, in combination with T4 gene 32 protein, increases the yield of RT-PCR products from approximately 90% to 150%. This effect is even observed for long mRNA templates and low concentrations of total RNA (25 ng). Therefore, we suggest the addition of T4 gene 32 protein in the RT-PCR mixture to increase the efficiency of cDNA synthesis, particularly in cases when low amounts of tissue are used.

Quantitative detection method for Roundup Ready soybean in food using duplex real-time PCR MGB chemistry.

PubMed

Samson, Maria Cristina; Gullì, Mariolina; Marmiroli, Nelson

2010-07-01

Methodologies that enable the detection of genetically modified organisms (GMOs) (authorized and non-authorized) in food and feed strongly influence the potential for adequate updating and implementation of legislation together with labeling requirements. Quantitative polymerase chain reaction (qPCR) systems were designed to boost the sensitivity and specificity on the identification of GMOs in highly degraded DNA samples; however, such testing will become economically difficult to cope with due to increasing numbers of approved genetically modified (GM) lines. Multiplexing approaches are therefore in development to provide cost-efficient solution. Construct-specific primers and probe were developed for quantitative analysis of Roundup Ready soybean (RRS) event glyphosate-tolerant soybean (GTS) 40-3-2. The lectin gene (Le1) was used as a reference gene, and its specificity was verified. RRS- and Le1-specific quantitative real-time PCR (qRTPCR) were optimized in a duplex platform that has been validated with respect to limit of detection (LOD) and limit of quantification (LOQ), as well as accuracy. The analysis of model processed food samples showed that the degradation of DNA has no adverse or little effects on the performance of quantification assay. In this study, a duplex qRTPCR using TaqMan minor groove binder-non-fluorescent quencher (MGB-NFQ) chemistry was developed for specific detection and quantification of RRS event GTS 40-3-2 that can be used for practical monitoring in processed food products.

A survey of the sequence-specific interaction of damaging agents with DNA: emphasis on antitumor agents.

PubMed

Murray, V

1999-01-01

This article reviews the literature concerning the sequence specificity of DNA-damaging agents. DNA-damaging agents are widely used in cancer chemotherapy. It is important to understand fully the determinants of DNA sequence specificity so that more effective DNA-damaging agents can be developed as antitumor drugs. There are five main methods of DNA sequence specificity analysis: cleavage of end-labeled fragments, linear amplification with Taq DNA polymerase, ligation-mediated polymerase chain reaction (PCR), single-strand ligation PCR, and footprinting. The DNA sequence specificity in purified DNA and in intact mammalian cells is reviewed for several classes of DNA-damaging agent. These include agents that form covalent adducts with DNA, free radical generators, topoisomerase inhibitors, intercalators and minor groove binders, enzymes, and electromagnetic radiation. The main sites of adduct formation are at the N-7 of guanine in the major groove of DNA and the N-3 of adenine in the minor groove, whereas free radical generators abstract hydrogen from the deoxyribose sugar and topoisomerase inhibitors cause enzyme-DNA cross-links to form. Several issues involved in the determination of the DNA sequence specificity are discussed. The future directions of the field, with respect to cancer chemotherapy, are also examined.

A small-molecule acts as a 'roadblock' on DNA, hampering its fundamental processes.

PubMed

Kumar, Amit

2017-11-01

DNA replication, RNA and protein synthesis are the most fundamental housekeeping processes involved in an organism's growth. Failure or dysregulation of these pathways are often deleterious to life. Therefore, selective inhibition of such processes can be crucial for the inhibition of the growth of any cell, including cancer cells, pathogenic bacteria or other deadly microbes. In the present study, a Zn 2+ complex is shown to act as a roadblock of DNA. The Zn 2+ complex inhibited DNA taq polymerase activity under the in vitro conditions of polymerase chain reaction (PCR). Under in vivo conditions, it readily crosses the cell wall of gram-negative bacteria (Escherichia coli), leading to the reduction of RNA levels as well as protein content. Growth of pathogenic bacteria (e.g., Staphylococcus aureus and Pseudomonas aeruginosa) was also significantly retarded. The Zn 2+ complex binds to the grooves of the DNA without inducing conformational changes or exhibiting chemical nuclease activity. To the best current knowledge, this is first coordination complex exhibiting a 'roadblock' property under both in vitro and in vivo conditions (show at all three levels - DNA, RNA and protein). The label-free approach used in this study may offer an alternative route towards fighting pathogenic bacteria or cancer cells by hampering fundamental cellular processes. Copyright © 2017 Elsevier Inc. All rights reserved.

Distinguishing Heterodera filipjevi and H. avenae using polymerase chain reaction-restriction fragment length polymorphism and cyst morphology.

PubMed

Yan, Guiping; Smiley, Richard W

2010-03-01

The cereal cyst nematodes Heterodera filipjevi and H. avenae impede wheat production in the Pacific Northwest (PNW). Accurate identification of cyst nematode species and awareness of high population density in affected fields are essential for designing effective control measures. Morphological methods for differentiating these species are laborious. These species were differentiated using polymerase chain reaction restriction fragment length polymorphism (PCR-RFLP) of internal transcribed spacer (ITS)-ribosomal (r)DNA with up to six restriction endonucleases (TaqI, HinfI, PstI, HaeIII, RsaI, and AluI). The method was validated by inspecting underbridge structures of cyst vulval cones. Grid soil sampling of an Oregon field infested by both species revealed that H. filipjevi was present at most of the infested grid sites but mixtures of H. avenae and H. filipjevi also occurred. These procedures also detected and differentiated H. filipjevi and H. avenae in soil samples from nearby fields in Oregon and H. avenae in samples from Idaho and Washington. Intraspecific polymorphism was not observed within H. filipjevi or PNW H. avenae populations based on the ITS-rDNA. However, intraspecific variation was observed between H. avenae populations occurring in the PNW and France. Methods described here will improve detection and identification efficiencies for cereal cyst nematodes in wheat fields.

Seamless Insert-Plasmid Assembly at High Efficiency and Low Cost

PubMed Central

Benoit, Roger M.; Ostermeier, Christian; Geiser, Martin; Li, Julia Su Zhou; Widmer, Hans; Auer, Manfred

2016-01-01

Seamless cloning methods, such as co-transformation cloning, sequence- and ligation-independent cloning (SLIC) or the Gibson assembly, are essential tools for the precise construction of plasmids. The efficiency of co-transformation cloning is however low and the Gibson assembly reagents are expensive. With the aim to improve the robustness of seamless cloning experiments while keeping costs low, we examined the importance of complementary single-stranded DNA ends for co-transformation cloning and the influence of single-stranded gaps in circular plasmids on SLIC cloning efficiency. Most importantly, our data show that single-stranded gaps in double-stranded plasmids, which occur in typical SLIC protocols, can drastically decrease the efficiency at which the DNA transforms competent E. coli bacteria. Accordingly, filling-in of single-stranded gaps using DNA polymerase resulted in increased transformation efficiency. Ligation of the remaining nicks did not lead to a further increase in transformation efficiency. These findings demonstrate that highly efficient insert-plasmid assembly can be achieved by using only T5 exonuclease and Phusion DNA polymerase, without Taq DNA ligase from the original Gibson protocol, which significantly reduces the cost of the reactions. We successfully used this modified Gibson assembly protocol with two short insert-plasmid overlap regions, each counting only 15 nucleotides. PMID:27073895

Development and in-house validation of the event-specific polymerase chain reaction detection methods for genetically modified soybean MON89788 based on the cloned integration flanking sequence.

PubMed

Liu, Jia; Guo, Jinchao; Zhang, Haibo; Li, Ning; Yang, Litao; Zhang, Dabing

2009-11-25

Various polymerase chain reaction (PCR) methods were developed for the execution of genetically modified organism (GMO) labeling policies, of which an event-specific PCR detection method based on the flanking sequence of exogenous integration is the primary trend in GMO detection due to its high specificity. In this study, the 5' and 3' flanking sequences of the exogenous integration of MON89788 soybean were revealed by thermal asymmetric interlaced PCR. The event-specific PCR primers and TaqMan probe were designed based upon the revealed 5' flanking sequence, and the qualitative and quantitative PCR assays were established employing these designed primers and probes. In qualitative PCR, the limit of detection (LOD) was about 0.01 ng of genomic DNA corresponding to 10 copies of haploid soybean genomic DNA. In the quantitative PCR assay, the LOD was as low as two haploid genome copies, and the limit of quantification was five haploid genome copies. Furthermore, the developed PCR methods were in-house validated by five researchers, and the validated results indicated that the developed event-specific PCR methods can be used for identification and quantification of MON89788 soybean and its derivates.

Evaluation of the clinical sensitivity for the quantification of human immunodeficiency virus type 1 RNA in plasma: Comparison of the new COBAS TaqMan HIV-1 with three current HIV-RNA assays--LCx HIV RNA quantitative, VERSANT HIV-1 RNA 3.0 (bDNA) and COBAS AMPLICOR HIV-1 Monitor v1.5.

PubMed

Katsoulidou, Antigoni; Petrodaskalaki, Maria; Sypsa, Vana; Papachristou, Eleni; Anastassopoulou, Cleo G; Gargalianos, Panagiotis; Karafoulidou, Anastasia; Lazanas, Marios; Kordossis, Theodoros; Andoniadou, Anastasia; Hatzakis, Angelos

2006-02-01

The COBAS TaqMan HIV-1 test (Roche Diagnostics) was compared with the LCx HIV RNA quantitative assay (Abbott Laboratories), the Versant HIV-1 RNA 3.0 (bDNA) assay (Bayer) and the COBAS Amplicor HIV-1 Monitor v1.5 test (Roche Diagnostics), using plasma samples of various viral load levels from HIV-1-infected individuals. In the comparison of TaqMan with LCx, TaqMan identified as positive 77.5% of the 240 samples versus 72.1% identified by LCx assay, while their overall agreement was 94.6% and the quantitative results of samples that were positive by both methods were strongly correlated (r=0.91). Similarly, in the comparison of TaqMan with bDNA 3.0, both methods identified 76.3% of the 177 samples as positive, while their overall agreement was 95.5% and the quantitative results of samples that were positive by both methods were strongly correlated (r=0.95). Finally, in the comparison of TaqMan with Monitor v1.5, TaqMan identified 79.5% of the 156 samples as positive versus 80.1% identified by Monitor v1.5, while their overall agreement was 95.5% and the quantitative results of samples that were positive by both methods were strongly correlated (r=0.96). In conclusion, the new COBAS TaqMan HIV-1 test showed excellent agreement with other widely used commercially available tests for the quantitation of HIV-1 viral load.

Association study of Toll-like receptor 5 (TLR5) and Toll-like receptor 9 (TLR9) polymorphisms in systemic lupus erythematosus.

PubMed

Demirci, F Yesim K; Manzi, Susan; Ramsey-Goldman, Rosalind; Kenney, Margaret; Shaw, Penny S; Dunlop-Thomas, Charmayne M; Kao, Amy H; Rhew, Elisa Y; Bontempo, Franklin; Kammerer, Candace; Kamboh, M Ilyas

2007-08-01

Toll-like receptors (TLR) play an important role in both adaptive and innate immunity. Variations in TLR genes have been shown to be associated with various infectious and inflammatory diseases. We investigated the association of TLR5 (Arg392Stop, rs5744168) and TLR9 (-1237T-->C, rs5743836) single nucleotide polymorphisms (SNP) with systemic lupus erythematosus (SLE) in Caucasian American subjects. We performed a case-control association study and genotyped 409 Caucasian women with SLE and 509 Caucasian healthy female controls using TaqMan allelic discrimination (rs5744168) or polymerase chain reaction-restriction fragment length polymorphism analysis (rs5743836). None of the 2 TLR SNP showed a statistically significant association with SLE risk in our cohort. Our results do not indicate a major influence of these putative functional TLR SNP on the susceptibility to (or protection from) SLE.

Direct detection of Leishmania from clinical samples.

PubMed

Waitumbi, John N; Bast, Joshua; Nyakoe, Nancy; Magiri, Charles; Quintana, Miguel; Takhampunya, Ratree; Schuster, Anthony L; Van de Wyngaerde, Marshall T; McAvin, James C; Coleman, Russell E

2017-01-01

The ability to rapidly and accurately diagnose leishmaniasis is a military priority. Testing was conducted to evaluate diagnostic sensitivity and specificity of field-expedient Leishmania genus and visceral Leishmania specific dual-fluorogenic, hydrolysis probe (TaqMan), polymerase chain reaction assays previously established for use in vector surveillance. Blood samples of patients with confirmed visceral leishmaniasis and controls without the disease from Baringo District, Kenya, were tested. Leishmania genus assay sensitivity was 100% (14/14) and specificity was 84% (16/19). Visceral Leishmania assay sensitivity was 93% (13/14) and specificity 80% (4/5). Cutaneous leishmaniasis (CL) skin scrapes of patients from Honduras were also evaluated. Leishmania genus assay sensitivity was 100% (10/10). Visceral Leishmania assay specificity was 100% (10/10) from cutaneous leishmaniasis samples; no fluorescence above background was reported. These results show promise in a rapid, sensitive, and specific method for Leishmania direct detection from clinical samples.

TaqMan RT-PCR and VERSANT HIV-1 RNA 3.0 (bDNA) assay Quantification of HIV-1 RNA viral load in breast milk.

PubMed

Israel-Ballard, Kiersten; Ziermann, Rainer; Leutenegger, Christian; Di Canzio, James; Leung, Kimmy; Strom, Lynn; Abrams, Barbara; Chantry, Caroline

2005-12-01

Transmission of HIV via breast milk is a primary cause of pediatric HIV infection in developing countries. Reliable methods to detect breast milk viral load are important. To correlate the ability of the VERSANT HIV 3.0 (bDNA) assay to real-time (RT) TaqMan PCR in quantifying breast milk HIV-1 RNA. Forty-six breast milk samples that had been spiked with cell-free HIV-1 and eight samples spiked with cell-associated HIV-1 were assayed for HIV-1 RNA by both VERSANT HIV 3.0 and TaqMan RNA assays. Only assays on the cell-free samples were statistically compared. Both a Deming regression slope and a Bland-Altman slope indicated a linear relationship between the two assays. TaqMan quantitations were on average 2.6 times higher than those of HIV 3.0. A linear relationship was observed between serial dilutions of spiked cell-free HIV-1 and both the VERSANT HIV 3.0 and the TaqMan RNA assays. The two methods correlated well although the VERSANT HIV 3.0 research protocol quantified HIV-1 RNA slightly lower than TaqMan.

Integrated microfluidic card with TaqMan probes and high-resolution melt analysis to detect tuberculosis drug resistance mutations across 10 genes.

PubMed

Pholwat, Suporn; Liu, Jie; Stroup, Suzanne; Gratz, Jean; Banu, Sayera; Rahman, S M Mazidur; Ferdous, Sara Sabrina; Foongladda, Suporn; Boonlert, Duangjai; Ogarkov, Oleg; Zhdanova, Svetlana; Kibiki, Gibson; Heysell, Scott; Houpt, Eric

2015-02-24

Genotypic methods for drug susceptibility testing of Mycobacterium tuberculosis are desirable to speed the diagnosis and proper therapy of tuberculosis (TB). However, the numbers of genes and polymorphisms implicated in resistance have proliferated, challenging diagnostic design. We developed a microfluidic TaqMan array card (TAC) that utilizes both sequence-specific probes and high-resolution melt analysis (HRM), providing two layers of detection of mutations. Twenty-seven primer pairs and 40 probes were designed to interrogate 3,200 base pairs of critical regions of the inhA, katG, rpoB, embB, rpsL, rrs, eis, gyrA, gyrB, and pncA genes. The method was evaluated on 230 clinical M. tuberculosis isolates from around the world, and it yielded 96.1% accuracy (2,431/2,530) in comparison to that of Sanger sequencing and 87% accuracy in comparison to that of the slow culture-based susceptibility testing. This TAC-HRM method integrates assays for 10 genes to yield fast, comprehensive, and accurate drug susceptibility results for the 9 major antibiotics used to treat TB and could be deployed to improve treatment outcomes. Multidrug-resistant tuberculosis threatens global tuberculosis control efforts. Optimal therapy utilizes susceptibility test results to guide individualized treatment regimens; however, the susceptibility testing methods in use are technically difficult and slow. We developed an integrated TaqMan array card method with high-resolution melt analysis that interrogates 10 genes to yield a fast, comprehensive, and accurate drug susceptibility result for the 9 major antituberculosis antibiotics. Copyright © 2015 Pholwat et al.

Evaluation of an Improved U.S. Food and Drug Administration Method for the Detection of Cyclospora cayetanensis in Produce Using Real-Time PCR.

PubMed

Murphy, Helen R; Lee, Seulgi; da Silva, Alexandre J

2017-07-01

Cyclospora cayetanensis is a protozoan parasite that causes human diarrheal disease associated with the consumption of fresh produce or water contaminated with C. cayetanensis oocysts. In the United States, foodborne outbreaks of cyclosporiasis have been linked to various types of imported fresh produce, including cilantro and raspberries. An improved method was developed for identification of C. cayetanensis in produce at the U.S. Food and Drug Administration. The method relies on a 0.1% Alconox produce wash solution for efficient recovery of oocysts, a commercial kit for DNA template preparation, and an optimized TaqMan real-time PCR assay with an internal amplification control for molecular detection of the parasite. A single laboratory validation study was performed to assess the method's performance and compare the optimized TaqMan real-time PCR assay and a reference nested PCR assay by examining 128 samples. The samples consisted of 25 g of cilantro or 50 g of raspberries seeded with 0, 5, 10, or 200 C. cayetanensis oocysts. Detection rates for cilantro seeded with 5 and 10 oocysts were 50.0 and 87.5%, respectively, with the real-time PCR assay and 43.7 and 94.8%, respectively, with the nested PCR assay. Detection rates for raspberries seeded with 5 and 10 oocysts were 25.0 and 75.0%, respectively, with the real-time PCR assay and 18.8 and 68.8%, respectively, with the nested PCR assay. All unseeded samples were negative, and all samples seeded with 200 oocysts were positive. Detection rates using the two PCR methods were statistically similar, but the real-time PCR assay is less laborious and less prone to amplicon contamination and allows monitoring of amplification and analysis of results, making it more attractive to diagnostic testing laboratories. The improved sample preparation steps and the TaqMan real-time PCR assay provide a robust, streamlined, and rapid analytical procedure for surveillance, outbreak response, and regulatory testing of foods for detection of C. cayetanensis.

Rapid diagnosis of sepsis with TaqMan-Based multiplex real-time PCR.

PubMed

Liu, Chang-Feng; Shi, Xin-Ping; Chen, Yun; Jin, Ye; Zhang, Bing

2018-02-01

The survival rate of septic patients mainly depends on a rapid and reliable diagnosis. A rapid, broad range, specific and sensitive quantitative diagnostic test is the urgent need. Thus, we developed a TaqMan-Based Multiplex real-time PCR assays to identify bloodstream pathogens within a few hours. Primers and TaqMan probes were designed to be complementary to conserved regions in the 16S rDNA gene of different kinds of bacteria. To evaluate accurately, sensitively, and specifically, the known bacteria samples (Standard strains, whole blood samples) are determined by TaqMan-Based Multiplex real-time PCR. In addition, 30 blood samples taken from patients with clinical symptoms of sepsis were tested by TaqMan-Based Multiplex real-time PCR and blood culture. The mean frequency of positive for Multiplex real-time PCR was 96% at a concentration of 100 CFU/mL, and it was 100% at a concentration greater than 1000 CFU/mL. All the known blood samples and Standard strains were detected positively by TaqMan-Based Multiplex PCR, no PCR products were detected when DNAs from other bacterium were used in the multiplex assay. Among the 30 patients with clinical symptoms of sepsis, 18 patients were confirmed positive by Multiplex real-time PCR and seven patients were confirmed positive by blood culture. TaqMan-Based Multiplex real-time PCR assay with highly sensitivity, specificity and broad detection range, is a rapid and accurate method in the detection of bacterial pathogens of sepsis and should have a promising usage in the diagnosis of sepsis. © 2017 Wiley Periodicals, Inc.

Comparison of culture and a novel 5' Taq nuclease assay for direct detection of Campylobacter fetus subsp. venerealis in clinical specimens from cattle.

PubMed

McMillen, Lyle; Fordyce, Geoffry; Doogan, Vivienne J; Lew, Ala E

2006-03-01

A Campylobacter fetus subsp. venerealis-specific 5' Taq nuclease PCR assay using a 3' minor groove binder-DNA probe (TaqMan MGB) was developed based on a subspecies-specific fragment of unknown identity (S. Hum, K. Quinn, J. Brunner, and S. L. On, Aust. Vet. J. 75:827-831, 1997). The assay specifically detected four C. fetus subsp. venerealis strains with no observed cross-reaction with C. fetus subsp. fetus-related Campylobacter species or other bovine venereal microflora. The 5' Taq nuclease assay detected approximately one single cell compared to 100 and 10 cells in the conventional PCR assay and 2,500 and 25,000 cells from selective culture from inoculated smegma and mucus, respectively. The respective detection limits following the enrichments from smegma and mucus were 5,000 and 50 cells/inoculum for the conventional PCR compared to 500 and 50 cells/inoculum for the 5' Taq nuclease assay. Field sampling confirmed the sensitivity and the specificity of the 5' Taq nuclease assay by detecting an additional 40 bulls that were not detected by culture. Urine-inoculated samples demonstrated comparable detection of C. fetus subsp. venerealis by both culture and the 5' Taq nuclease assay; however, urine was found to be less effective than smegma for bull sampling. Three infected bulls were tested repetitively to compare sampling tools, and the bull rasper proved to be the most suitable, as evidenced by the improved ease of specimen collection and the consistent detection of higher levels of C. fetus subsp. venerealis. The 5' Taq nuclease assay demonstrates a statistically significant association with culture (chi2 = 29.8; P < 0.001) and significant improvements for the detection of C. fetus subsp. venerealis-infected animals from crude clinical extracts following prolonged transport.

Modified Proofreading PCR for Detection of Point Mutations, Insertions and Deletions Using a ddNTP-Blocked Primer

PubMed Central

Chen, Qianqian; Chen, Xiaoxiang; Zhang, Sichao; Lan, Ke; Lu, Jian; Zhang, Chiyu

2015-01-01

The development of simple, accurate, rapid and cost-effective technologies for mutation detection is crucial to the early diagnosis and prevention of numerous genetic diseases, pharmacogenetics, and drug resistance. Proofreading PCR (PR-PCR) was developed for mutation detection in 1998 but is rarely applied due to its low efficiency in allele discrimination. Here we developed a modified PR-PCR method using a ddNTP-blocked primer and a mixture of DNA polymerases with and without the 3'-5' proofreading function. The ddNTP-blocked primer exhibited the best blocking efficiency to avoid nonspecific primer extension while the mixture of a tiny amount of high-fidelity DNA polymerase with a routine amount of Taq DNA polymerase provided the best discrimination and amplification effects. The modified PR-PCR method is quite capable of detecting various mutation types, including point mutations and insertions/deletions (indels), and allows discrimination amplification when the mismatch is located within the last eight nucleotides from the 3'-end of the ddNTP-blocked primer. The modified PR-PCR has a sensitivity of 1-5 × 102 copies and a selectivity of 5 × 10-5 mutant among 107 copies of wild-type DNA. It showed a 100% accuracy rate in the detection of P72R germ-line mutation in the TP53 gene among 60 clinical blood samples, and a high potential to detect rifampin-resistant mutations at low frequency in Mycobacterium tuberculosis using an adaptor and a fusion-blocked primer. These results suggest that the modified PR-PCR technique is effective in detection of various mutations or polymorphisms as a simple, sensitive and promising approach. PMID:25915410

Multicentre study of Y chromosome microdeletions in 1,808 Chinese infertile males using multiplex and real-time polymerase chain reaction.

PubMed

Zhu, X-B; Gong, Y-H; He, J; Guo, A-L; Zhi, E-L; Yao, J-E; Zhu, B-S; Zhang, A-J; Li, Z

2017-06-01

Azoospermia factor (AZF) genes on the long arm of the human Y chromosome are involved in spermatogenesis, and microdeletions in the AZF region have been recognised to be the second major genetic cause of spermatogenetic failure resulting in male infertility. While screening for these microdeletions can avoid unnecessary medical and surgical treatments, current methods are generally time-consuming. Therefore, we established a new method to detect and analyse microdeletions in the AZF region quickly, safely and efficiently. In total, 1,808 patients with spermatogenetic failure were recruited from three hospitals in southern China, of which 600 patients were randomly selected for screening for Y chromosome microdeletions in AZF regions employing real-time polymerase chain reaction with a TaqMan probe. In our study, of 1,808 infertile patients, 150 (8.3%) were found to bear microdeletions in the Y chromosome using multiplex PCR, while no deletions were found in the controls. Among the AZF deletions detected, two were in AZFa, three in AZFb, 35 in AZFc, three in AZFb+c and two in AZFa+b+c. Our method is fast-it permits the scanning of DNA from a patient in one and a half hours-and reliable, minimising the risk of cross-contamination and false-positive and false-negative results. © 2016 Blackwell Verlag GmbH.

Development of a real-time polymerase chain reaction assay for the detection of the invasive Mediterranean fanworm, Sabella spallanzanii, in environmental samples.

PubMed

Wood, Susanna A; Zaiko, Anastasija; Richter, Ingrid; Inglis, Graeme J; Pochon, Xavier

2017-07-01

The Mediterranean fanworm, Sabella spallanzanii Gmelin 1791, was first detected in the Southern Hemisphere in the 1990s and is now abundant in many parts of southern Australia and in several locations around northern New Zealand. Once established, it can proliferate rapidly, reaching high densities with potential ecological and economic impacts. Early detection of new S. spallanzanii incursions is important to prevent its spread, guide eradication or control efforts and to increase knowledge on the species' dispersal pathways. In this study, we developed a TaqMan probe real-time polymerase chain reaction assay targeting a region of the mitochondrial cytochrome oxidase I gene. The assay was validated in silico and in vitro using DNA from New Zealand and Australian Sabellidae with no cross-reactivity detected. The assay has a linear range of detection over seven orders of magnitude with a limit of detection reached at 12.4 × 10 -4  ng/μL of DNA. We analysed 145 environmental (water, sediment and biofouling) samples and obtained positive detections only from spiked samples and those collected at a port where S. spallanzanii is known to be established. This assay has the potential to enhance current morphological and molecular-based methods, through its ability to rapidly and accurately identify S. spallanzanii in environmental samples.

A universal TaqMan-based RT-PCR protocol for cost-efficient detection of small noncoding RNA.

PubMed

Jung, Ulrike; Jiang, Xiaoou; Kaufmann, Stefan H E; Patzel, Volker

2013-12-01

Several methods for the detection of RNA have been developed over time. For small RNA detection, a stem-loop reverse primer-based protocol relying on TaqMan RT-PCR has been described. This protocol requires an individual specific TaqMan probe for each target RNA and, hence, is highly cost-intensive for experiments with small sample sizes or large numbers of different samples. We describe a universal TaqMan-based probe protocol which can be used to detect any target sequence and demonstrate its applicability for the detection of endogenous as well as artificial eukaryotic and bacterial small RNAs. While the specific and the universal probe-based protocol showed the same sensitivity, the absolute sensitivity of detection was found to be more than 100-fold lower for both than previously reported. In subsequent experiments, we found previously unknown limitations intrinsic to the method affecting its feasibility in determination of mature template RISC incorporation as well as in multiplexing. Both protocols were equally specific in discriminating between correct and incorrect small RNA targets or between mature miRNA and its unprocessed RNA precursor, indicating the stem-loop RT-primer, but not the TaqMan probe, triggers target specificity. The presented universal TaqMan-based RT-PCR protocol represents a cost-efficient method for the detection of small RNAs.

Ebolavirus diagnosis made simple, comparable and faster than molecular detection methods: preparing for the future.

PubMed

James, Ameh S; Todd, Shawn; Pollak, Nina M; Marsh, Glenn A; Macdonald, Joanne

2018-04-23

The 2014/2015 Ebolavirus outbreak resulted in more than 28,000 cases and 11,323 reported deaths, as of March 2016. Domestic transmission of the Guinea strain associated with the outbreak occurred mainly in six African countries, and international transmission was reported in four countries. Outbreak management was limited by the inability to rapidly diagnose infected cases. A further fifteen countries in Africa are predicted to be at risk of Ebolavirus outbreaks in the future as a consequence of climate change and urbanization. Early detection of cases and reduction of transmission rates is critical to prevent and manage future severe outbreaks. We designed a rapid assay for detection of Ebolavirus using recombinase polymerase amplification, a rapid isothermal amplification technology that can be combined with portable lateral flow detection technology. The developed rapid assay operates in 30 min and was comparable with real-time TaqMan™ PCR. Designed, screened, selected and optimized oligonucleotides using the NP coding region from Ebola Zaire virus (Guinea strain). We determined the analytical sensitivity of our Ebola rapid molecular test by testing selected primers and probe with tenfold serial dilutions (1.34 × 10 10-  1.34 × 10 1 copies/μL) of cloned NP gene from Mayinga strain of Zaire ebolavirus in pCAGGS vector, and serially diluted cultured Ebolavirus as established by real-time TaqMan™ PCR that was performed using ABI7500 in Fast Mode. We tested extracted and reverse transcribed RNA from cultured Zaire ebolavirus strains - Mayinga, Gueckedou C05, Gueckedou C07, Makona, Kissidougou and Kiwit. We determined the analytical specificity of our assay with related viruses: Marburg, Ebola Reston and Ebola Sudan. We further tested for Dengue virus 1-4, Plasmodium falciparum and West Nile Virus (Kunjin strain). The assay had a detection limit of 134 copies per μL of plasmid containing the NP gene of Ebolavirus Mayinga, and cultured Ebolavirus and was highly specific for the Zaire ebolavirus species, including the Guinea strain responsible for the 2014/2015 outbreak. The assay did not detect related viruses like Marburg, Reston, or Sudan viruses, and other pathogens likely to be isolated from clinical samples. Our assay could be suitable for implementation in district and primary health laboratories, as only a heating block and centrifuge is required for operation. The technique could provide a pathway for rapid screening of patients and animals for improved management of outbreaks.

Screening and confirmation of microRNA markers for forensic body fluid identification.

PubMed

Wang, Zheng; Zhang, Ji; Luo, Haibo; Ye, Yi; Yan, Jing; Hou, Yiping

2013-01-01

MicroRNAs (miRNAs, ∼22 nucleotides) are small, non-protein coding RNAs that regulate gene expression at the post-transcriptional level. MiRNAs can express in a tissue-specific manner, and have been introduced to forensic body fluid identification. In this study, we employed the qPCR-array (TaqMan(®) Array Human MicroRNA Cards) to screen the body fluid-specific miRNAs. Seven candidate miRNAs were identified as potentially body fluid-specific and could be used as forensically relevant body fluid markers: miR16 and miR486 for venous blood, miR888 and miR891a for semen, miR214 for menstrual blood, miR124a for vaginal secretions, and miR138-2 for saliva. The candidate miRNA markers were then validated via hydrolysis probes quantitative real-time polymerase chain reaction (TaqMan-qPCR). In addition, BestKeeper software was used to validate the expression stability of four genes, RNU44, RNU48, U6 and U6b, regularly used as reference genes (RGs) for studies involving forensic body fluids. The current study suggests that U6 could be used as a proper RG of miRNAs in forensic body fluid identification. The relative expression ratios (R) of miR486, miR888, miR214, miR16 and miR891a can differentiate the target body fluid from other body fluids that were tested in this study. The detection limit of TaqMan-qPCR of the five confirmed miRNA markers was 10pg of total RNA. The effect of time-wise degradation of blood stains and semen stains for 1 month under normal laboratory conditions was tested and did not significantly affect the detection results. Herein, this study proposes five body fluid-specific miRNAs for the forensic identification of venous blood, semen, and menstrual blood, of which miR486, miR888, and miR214 may be used as new markers for body fluid identification. Additional work remains necessary in search for suitable miRNA markers and stable RGs for forensic body fluid identification. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

A TaqI PCR-RFLP detecting a novel SNP in exon 2 of the bovine POU1F1 gene.

PubMed

Pan, Chuanying; Lan, Xianyong; Chen, Hong; Guo, Yikun; Shu, Jianhong; Lei, Chuzhao; Wang, Xinzhuang

2008-08-01

PCR-SSCP and DNA sequencing methods were applied to reveal three novel single nucleotide polymorphisms (SNPs) in exon 2 of the POU1F1 gene in 963 Chinese cattle belonging to eight breeds. Among them, a silent SNP (NM_174579:c.545G > A) detected by TaqI endonuclease is described. Frequencies of the POU1F1-G allele varied from 0.685 to 1.000. The association of TaqI polymorphism with growth traits was analyzed in 251 Nanyang cattle. No significant associations of the TaqI polymorphism with body weight and average daily gain for different growth periods (6, 12, 18, and 24 months old) were observed (P > 0.05), as well as for body sizes (P > 0.05).

Association of vitamin D receptor gene polymorphisms with diabetic dyslipidemia in the elderly male population in North China.

PubMed

Xia, Zheng; Hu, Yazhuo; Han, Zhitao; Gao, Ya; Bai, Jie; He, Yao; Zhao, Hua; Zhang, Honghong

2017-01-01

The prevalence of dyslipidemia is rising alarmingly in elderly Han Chinese male patients with type 2 diabetes mellitus (T2DM). The genetic factors that contribute to the development of diabetic dyslipidemia remain incompletely identified. This study was conducted to assess the association between vitamin D receptor (VDR) polymorphisms and development of dyslipidemia in the Han elderly male population with T2DM in North China. A total of 242 T2DM patients with dyslipidemia (DH group, n=108) or without dyslipidemia (DO group, n=134) and 100 controls were genotyped for ApaI, TaqI and FokI single nucleotide polymorphisms (SNPs) of the VDR gene using polymerase chain reaction-restriction fragment length polymorphism and sequencing. The frequency and distribution of the SNPs were compared between cases and controls. The distribution of genotypes of VDR-FokI was significantly different between the control and DM group ( P =0.033), as well as between the control and DH subgroup ( P =0.011) but not DO subgroup ( P =0.111). The frequency of C allele and CC genotype of FokI was significantly higher in the DH patients than in the controls ( P =0.015 and P =0.003, respectively). Logistic regression analysis in a dominant model homozygous for the C allele of the FokI SNP showed that CC genotype was associated with DH patients (OR =1.797, 95% CI: 1.077-2.999, P =0.025). Significant associations of the ApaI and TaqI SNPs with either DO or DH subjects were not observed. These findings suggest that CC genotype of VDR-FokI is a risk factor for T2DM patients with dyslipidemia in elderly males in North China.

Postnatal and non-invasive prenatal detection of β-thalassemia mutations based on Taqman genotyping assays

PubMed Central

Breveglieri, Giulia; Travan, Anna; D’Aversa, Elisabetta; Cosenza, Lucia Carmela; Pellegatti, Patrizia; Guerra, Giovanni; Gambari, Roberto

2017-01-01

The β-thalassemias are genetic disorder caused by more than 200 mutations in the β-globin gene, resulting in a total (β0) or partial (β+) deficit of the globin chain synthesis. The most frequent Mediterranean mutations for β-thalassemia are: β039, β+IVSI-110, β+IVSI-6 and β0IVSI-1. Several molecular techniques for the detection of point mutations have been developed based on the amplification of the DNA target by polymerase chain reaction (PCR), but they could be labor-intensive and technically demanding. On the contrary, TaqMan® genotyping assays are a simple, sensitive and versatile method suitable for the single nucleotide polymorphism (SNP) genotyping affecting the human β-globin gene. Four TaqMan® genotyping assays for the most common β-thalassemia mutations present in the Mediterranean area were designed and validated for the genotype characterization of genomic DNA extracted from 94 subjects comprising 25 healthy donors, 33 healthy carriers and 36 β-thalassemia patients. In addition, 15 specimens at late gestation (21–39 gestational weeks) and 11 at early gestation (5–18 gestational weeks) were collected from pregnant women, and circulating cell-free fetal DNAs were extracted and analyzed with these four genotyping assays. We developed four simple, inexpensive and versatile genotyping assays for the postnatal and prenatal identification of the thalassemia mutations β039, β+IVSI-110, β+IVSI-6, β0IVSI-1. These genotyping assays are able to detect paternally inherited point mutations in the fetus and could be efficiently employed for non-invasive prenatal diagnosis of β-globin gene mutations, starting from the 9th gestational week. PMID:28235086

The Applicability of TaqMan-Based Quantitative Real-Time PCR Assays for Detecting and Enumerating Cryptosporidium spp. Oocysts in the Environment

PubMed Central

Staggs, Sarah E.; Beckman, Erin M.; Keely, Scott P.; Mackwan, Reena; Ware, Michael W.; Moyer, Alan P.; Ferretti, James A.; Sayed, Abu; Xiao, Lihua; Villegas, Eric N.

2013-01-01

Quantitative real-time polymerase chain reaction (qPCR) assays to detect Cryptosporidium oocysts in clinical samples are increasingly being used to diagnose human cryptosporidiosis, but a parallel approach for detecting and identifying Cryptosporidium oocyst contamination in surface water sources has yet to be established for current drinking water quality monitoring practices. It has been proposed that Cryptosporidium qPCR-based assays could be used as viable alternatives to current microscopic-based detection methods to quantify levels of oocysts in drinking water sources; however, data on specificity, analytical sensitivity, and the ability to accurately quantify low levels of oocysts are limited. The purpose of this study was to provide a comprehensive evaluation of TaqMan-based qPCR assays, which were developed for either clinical or environmental investigations, for detecting Cryptosporidium oocyst contamination in water. Ten different qPCR assays, six previously published and four developed in this study were analyzed for specificity and analytical sensitivity. Specificity varied between all ten assays, and in one particular assay, which targeted the Cryptosporidium 18S rRNA gene, successfully detected all Cryptosporidium spp. tested, but also cross-amplified T. gondii, fungi, algae, and dinoflagellates. When evaluating the analytical sensitivity of these qPCR assays, results showed that eight of the assays could reliably detect ten flow-sorted oocysts in reagent water or environmental matrix. This study revealed that while a qPCR-based detection assay can be useful for detecting and differentiating different Cryptosporidium species in environmental samples, it cannot accurately measure low levels of oocysts that are typically found in drinking water sources. PMID:23805235

High frequency of the PNPLA3 rs738409 [G] single-nucleotide polymorphism in Hmong individuals as a potential basis for a predisposition to chronic liver disease.

PubMed

Tepper, Clifford G; Dang, Julie H T; Stewart, Susan L; Fang, Dao M; Wong, Kimberly A; Liu, Stephenie Y; Davis, Ryan R; Dao, Doan Y; Gregg, Jeffrey P; Török, Natalie J; Chen, Moon S

2018-04-01

An exploratory study was performed to determine the prevalence of the patatin-like phospholipase domain-containing protein 3 (PNPLA3) rs78409 [G] allele among the Hmong as a risk factor for nonalcoholic fatty liver disease (NAFLD). NAFLD/nonalcoholic steatohepatitis is the world's most common chronic liver disease and is expected to replace viral hepatitis as the leading cause of cirrhosis and potential precursor to hepatocellular carcinoma (HCC). Of all populations in California, the Hmong experience the highest risk of death from HCC and the highest prevalence of metabolic syndrome risk factors among Asians that predispose them to NAFLD. Here a genetic explanation was sought for the high rates of chronic liver disease among the Hmong. The literature pointed to the PNPLA3 rs738409 [G] allele as a potential genetic culprit. Cell-free DNA was isolated from 26 serum samples previously collected in community settings. Quantitative polymerase chain reaction-based single-nucleotide polymorphism (SNP) genotyping was performed with a validated TaqMan SNP genotyping assay, and results were analyzed with TaqMan Genotyper software. The PNPLA3 rs738409 [C>G] variant occurred at a frequency of 0.46 (12 of 26; 95% confidence interval, 0.27-0.67). This carrier rate would rank the Hmong as the third highest population in the 1000 Genomes Project. Although this small sample size limits the generalizability, the high frequency rates of this allele along with the presence of metabolic syndrome risk factors warrant further studies into the etiology of NAFLD among the Hmong. Cancer 2018;124:1583-9. © 2018 American Cancer Society. © 2018 American Cancer Society.

Incidence of pulmonary aspergillosis and correlation of conventional diagnostic methods with nested PCR and real-time PCR assay using BAL fluid in intensive care unit patients.

PubMed

Zarrinfar, Hossein; Makimura, Koichi; Satoh, Kazuo; Khodadadi, Hossein; Mirhendi, Hossein

2013-05-01

Although the incidence of invasive aspergillosis in the intensive care unit (ICU) is scarce, it has emerged as major problems in critically ill patients. In this study, the incidence of pulmonary aspergillosis (PA) in ICU patients has evaluated and direct microscopy and culture has compared with nested polymerase chain reaction (PCR) and real-time PCR for detection of Aspergillus fumigatus and A. flavus in bronchoalveolar lavage (BAL) samples of the patients. Thirty BAL samples obtained from ICU patients during a 16-month period were subjected to direct examinations on 20% potassium hydroxide (KOH) and culture on two culture media. Nested PCR targeting internal transcribed spacer ribosomal DNA and TaqMan real-time PCR assay targeting β-tubulin gene were used for the detection of A. fumigatus and A. flavus. Of 30 patients, 60% were men and 40% were women. The diagnosis of invasive PA was probable in 1 (3%), possible in 11 (37%), and not IPA in 18 (60%). Nine samples were positive in nested PCR including seven samples by A. flavus and two by A. fumigatus specific primers. The lowest amount of DNA that TaqMan real-time PCR could detect was ≥40 copy numbers. Only one of the samples had a positive result of A. flavus real-time PCR with Ct value of 37.5. Although a significant number of specimens were positive in nested PCR, results of this study showed that establishment of a correlation between the conventional methods with nested PCR and real-time PCR needs more data confirmed by a prospective study with a larger sample group. © 2013 Wiley Periodicals, Inc.

Evaluation of ERα and VDR gene polymorphisms in relation to bone mineral density in Turkish postmenopausal women.

PubMed

Kurt, Ozlem; Yilmaz-Aydogan, Hulya; Uyar, Mehmet; Isbir, Turgay; Seyhan, Mehmet Fatih; Can, Ayse

2012-06-01

It has been suggested that the estrogen receptor alpha (ERα) and vitamin D receptor (VDR) genes as possibly implicated in reduced bone mineral density (BMD) in osteoporosis. The present study investigated the relation of ERα PvuII/XbaI polymorphisms and VDR FokI/TaqI polymorphisms with BMD in Turkish postmenopausal women. Eighty-one osteoporotic and 122 osteopenic postmenopausal women were recruited. For detection of the polymorphisms, polymerase chain reaction-restriction fragment lenght polymorphism techniques have been used. BMD was measured at the lumbar spine and hip by dual-energy X-ray absorptiometry. Distributions of ERα (PvuII dbSNP: rs2234693, XbaI dbSNP: rs9340799) and VDR genotypes (FokI dbSNP rs10735810, TaqI dbSNP: rs731236) were similar in study population. Although overall prevalence of osteoporosis had no association with these genotypes, the prevalence of decreased femoral neck BMD values were higher in the subjects with ERα PvuII "PP" and ERα XbaI "XX" genotypes than in those with "Pp/pp" genotypes and "xx" genotype, respectively (P < 0.05). Furthermore, subjects with VDR FokI "FF" genotype had lower BMD values of femoral neck and total hip compared to those with "Ff" genotype (P < 0.05). In the logistic regression analysis, we confirmed the presence of relationships between the VDR FokI "FF" genotypes, BMI ≤ 27.5, age ≥ 55 and the increased risk of femoral neck BMD below 0.8 value in postmenopausal women. The present data suggests that the ERα PvuII/XbaI and VDR FokI polymorphisms may contribute to the determination of bone mineral density in Turkish postmenopausal women.

High resolution TaqMan real-time PCR approach to detect hazelnut DNA encoding for ITS rDNA in foods.

PubMed

López-Calleja, Inés María; de la Cruz, Silvia; Pegels, Nicolette; González, Isabel; García, Teresa; Martín, Rosario

2013-12-01

A broad range of foods have been described as causing allergies, but the majority of allergic reactions can be ascribed to a limited number of food components. Recent extensive surveys showed how tree nuts, particularly hazelnut (Corylus avellana L.) seeds, rank amongst the most important sources of food allergy. In order to protect the allergic consumer, efficient and reliable methods are required for the detection of allergenic ingredients. For this purpose, we have developed a real-time polymerase chain reaction (PCR) for detection of hazelnut in commercial food products. In this way a specific hazelnut primer pair based on the ITS marker (70 bp) and a nuclease (TaqMan) probe labelled with FAM and BHQ were designed. Sensibility of real-time PCR was determined by analysis of raw and heat treated hazelnut-wheat flour mixtures with a range of detection of 0.1-100,000 ppm. Practical applicability of the real-time PCR assay developed for determining hazelnut in different food matrices was investigated by analyzing 179 commercial foodstuffs comprising snacks, biscuits, chocolates, bonbons, creams, nut bars, ice creams, precooked meals, breads, beverages, yogurts, cereals, meat products, rice cake and nougat. From the total of samples analyzed, 40 commercial food products that didn't declare hazelnut nor traces on the label were found to contain hazelnut. The real-time PCR method proposed herein due to its high sensitivity facilitates the detection of hazelnut traces in commercial food products and can also be useful for monitoring the effectiveness of cleaning processes and as consequence, can help to prevent the food allergic consumer from unintentional ingestion of hidden allergens. Copyright © 2013 Elsevier Ltd. All rights reserved.

Preprohypocretin polymorphisms in Parkinson disease patients reporting "sleep attacks".

PubMed

Rissling, Ida; Körner, Yvonne; Geller, Frank; Stiasny-Kolster, Karin; Oertel, Wolfgang H; Möller, J Carsten

2005-07-01

Previously, we found a significant association between the dopamine D2 receptor gene polymorphism Taq IA and sudden onset of sleep in patients with Parkinson disease. Here we evaluated the association between the preprohypocretin (-909T/C), (-22C/T), and (-20C/A) polymorphisms and sudden onset of sleep in the same population of patients with Parkinson disease. We conducted an association study analyzing the distribution of preprohypocretin polymorphisms in Germanic, caucasian Parkinson disease patients with and without sudden onset of sleep, matched according to drug therapy, disease duration, sex, and age. Movement disorders section at a university hospital. 132 Parkinson disease patients with sudden onset of sleep and 132 Parkinson disease patients without sudden onset of sleep. Blood samples were taken from each participant and used for DNA extraction. Polymorphisms were analyzed by established polymerase chain reaction protocols or direct sequencing. The variant allele T of the (-909T/C) preprohypocretin polymorphism was more commonly found in Parkinson disease patients with sudden onset of sleep. Statistical analysis showed that there were significant differences in the genotype (P = .024) and allele (P = .018) distribution between both groups. For heterozygous and homozygous carriers of allele T, the genotype relative-risk estimates for the presence of sudden onset of sleep were 2.01 (95% confidence interval: 0.76-5.34) and 2.81 (95% confidence interval: 1.09-7.25), respectively. Our results show a significant association between the (-909T/C) preprohypocretin polymorphism and sudden onset of sleep in Parkinson disease. However, we could not demonstrate any interaction between the Taq IA and (-909T/C) polymorphisms with respect to the occurrence of sudden onset of sleep, suggesting that multiple genetic factors may contribute to the pathogenesis of this phenomenon.

A Quantitative Polymerase Chain Reaction Assay for the Detection and Quantification of Epizootic Epitheliotropic Disease Virus (EEDV; Salmonid Herpesvirus 3).

PubMed

Glenney, Gavin W; Barbash, Patricia A; Coll, John A

2016-03-01

Epizootic epitheliotropic disease virus (EEDV; salmonid herpesvirus [SalHV3]; family Alloherpesviridae) causes a systemic disease of juvenile and yearling Lake Trout Salvelinus namaycush. No cell lines are currently available for the culture and propagation of EEDV, so primary diagnosis is limited to PCR and electron microscopy. To better understand the pervasiveness of EEDV (carrier or latent state of infection) in domesticated and wild Lake Trout populations, we developed a sensitive TaqMan quantitative PCR (qPCR) assay to detect the presence of the EEDV terminase gene in Lake Trout tissues. This assay was able to detect a linear standard curve over nine logs of plasmid dilution and was sensitive enough to detect single-digit copies of EEDV. The efficiency of the PCR assay was 99.4 ± 0.06% (mean ± SD), with a 95% confidence limit of 0.0296 (R(2) = 0.994). Methods were successfully applied to collect preliminary data from a number of species and water bodies in the states of Pennsylvania, New York, and Vermont, indicating that EEDV is more common in wild fish than previously known. In addition, through the development of this qPCR assay, we detected EEDV in a new salmonid species, the Cisco Coregonus artedi. The qPCR assay was unexpectedly able to detect two additional herpesviruses, the Atlantic Salmon papillomatosis virus (ASPV; SalHV4) and the Namaycush herpesvirus (NamHV; SalHV5), which both share high sequence identity with the EEDV terminase gene. With these unexpected findings, we subsequently designed three primer sets to confirm initial TaqMan qPCR assay positives and to differentiate among EEDV, ASPV, and NamHV by detecting the glycoprotein genes via SYBR Green qPCR. Received April 20, 2015; accepted November 10, 2015.

Optimized nested polymerase chain reaction for antemortem detection of Mycobacteria in Amazon parrots (Amazona aestiva) and orange-winged Amazons (Amazona amazonica).

PubMed

Baquião, Arianne Costa; Luna, Janaina Oliveira; Medina, Aziz Orro; Sanfilippo, Luiz Francisco; de Faria, Maria Jacinta; dos Santos, Manuel Armando Azevedo

2014-03-01

The objectives of this study were to optimize nested polymerase chain reaction (PCR) for Mycobacterium avium complex and Mycobacterium tuberculosis complex and apply them on samples from parrots. Results were negative for the presence of these Mycobacterium in the samples, and nested PCR was specific, faster, and more sensitive than other tests, thereby justifying its use in antemortem diagnosis.

New design, development, and optimization of an in-house quantitative TaqMan Real-time PCR assay for HIV-1 viral load measurement.

PubMed

Noorbazargan, Hassan; Nadji, Seyed Alireza; Samiee, Siamak Mirab; Paryan, Mahdi; Mohammadi-Yeganeh, Samira

2018-04-01

Background Viral load measurement is commonly applicable to monitor HIV infection in patients to determine the number of HIV-RNA in serum samples of individuals. The aim of the present study was to set up a highly specific, sensitive, and reproducible home-brewed Real-time PCR assay based on TaqMan chemistry to quantify HIV-1 RNA genome. Methods In this study, three sets of primer pairs and a TaqMan probe were designed for HIV subtypes conserved sequences. An internal control was included in this assay to evaluate the presence of inhibition. Standard curve and threshold cycle values were determined using in vitro transcribed RNA from int region of HIV-1. A serial dilution of RNA standards was generated by in vitro transcription, from 10 to 10 9 copies/ml to find the sensitivity and the limit of detection (LOD) of the assay and to evaluate its performance in a quantitative RT-PCR assay. Results The assay has a low LOD equivalent to 33.13 copies/ml of HIV-1 RNA and a linear range of detection from 10 to 10 9 copies/ml. The coefficient of variation (CV) for Inter and Intra-assay precision of this in-house HIV Real-time RT-PCR ranged from 0.28 to 2.49% and 0.72 to 4.47%, respectively. The analytical and clinical specificity was 100%. Conclusions The results indicate that the developed method has a suitable specificity and sensitivity and is highly reproducible and cost-benefit. Therefore, it will be useful to monitor HIV infection in plasma samples of individuals.

Evaluation of sensitivity of TaqMan RT-PCR for rubella virus detection in clinical specimens.

PubMed

Okamoto, Kiyoko; Mori, Yoshio; Komagome, Rika; Nagano, Hideki; Miyoshi, Masahiro; Okano, Motohiko; Aoki, Yoko; Ogura, Atsushi; Hotta, Chiemi; Ogawa, Tomoko; Saikusa, Miwako; Kodama, Hiroe; Yasui, Yoshihiro; Minagawa, Hiroko; Kurata, Takako; Kanbayashi, Daiki; Kase, Tetsuo; Murata, Sachiko; Shirabe, Komei; Hamasaki, Mitsuhiro; Kato, Takashi; Otsuki, Noriyuki; Sakata, Masafumi; Komase, Katsuhiro; Takeda, Makoto

2016-07-01

An easy and reliable assay for detection of the rubella virus is required to strengthen rubella surveillance. Although a TaqMan RT-PCR assay for detection of the rubella virus has been established in Japan, its utility for diagnostic purposes has not been tested. To allow introduction of the TaqMan RT-PCR into the rubella surveillance system in Japan, the sensitivity of the assay was determined using representative strains for all genotypes and clinical specimens. The detection limits of the method for individual genotypes were examined using viral RNA extracted from 13 representative strains. The assay was also tested at 10 prefectural laboratories in Japan, designated as local reference laboratories for measles and rubella, to allow nationwide application of the assay. The detection limits and amplification efficiencies of the assay were similar among all the representative strains of the 13 genotypes. The TaqMan RT-PCR could detect approximately 90% of throat swab and urine samples taken up to 5days of illness. These samples were determined positive by a highly sensitive nested RT-PCR. The TaqMan RT-PCR could detect at least 10 pfu of rubella virus. Although the sensitivity was somewhat lower than that of the conventional nested RT-PCR, the TaqMan RT-PCR could be more practical to routine tests for rubella laboratory diagnosis and detection in view of the rapid response and reducing risks of contamination. Copyright © 2016 Elsevier B.V. All rights reserved.

Polymorphisms of interleukin 6 in Down syndrome individuals: a case-control study.

PubMed

Mattos, M F; Uback, L; Biselli-Chicote, P M; Biselli, J M; Goloni-Bertollo, E M; Pavarino, E C

2017-08-17

Down syndrome (DS) individuals present impaired adaptive immune system. However, the etiology of the immunological deficiency in these individuals is not completely understood. This study investigated the frequency of interleukin 6 polymorphisms (rs1800795, rs1800796, and rs1800797) in individuals with DS and individuals without the syndrome. The study included 282 individuals, 94 with DS attended at the General Genetics Outpatient Service of Hospital de Base, São José do Rio Preto, SP, Brazil, and 188 individuals without DS attended at the Pediatric Service of Hospital de Base de São José do Rio Preto, SP, Brazil. Genotyping was performed by allelic discrimination technique by real-time polymerase chain reaction using TaqMan SNP Genotyping Assays (Applied Biosystems). There was no difference in the genotype frequency between individuals with and without DS for the evaluated polymorphisms (P > 0.05). The frequency of interleukin 6 polymorphisms did not differ significantly between individuals with and without DS in the casuistic analyzed.

Multiplex qRT-PCR for the Detection of Western Equine Encephalomyelitis, St. Louis Encephalitis, and West Nile Viral RNA in Mosquito Pools (Diptera: Culicidae)

PubMed Central

Brault, Aaron C.; Fang, Ying; Reisen, William K.

2015-01-01

Following the introduction of West Nile virus into California during the summer of 2003, public health and vector control programs expanded surveillance efforts and were in need of diagnostics capable of rapid, sensitive, and specific detection of arbovirus infections of mosquitoes to inform decision support for intervention. Development of a multiplex TaqMan or real-time semiquantitative reverse transcription polymerase chain reaction (RT-PCR) assay in which three virus specific primer–probe sets were used in the same reaction is described herein for the detection of western equine encephalomyelitis, St. Louis encephalitis and West Nile viral RNA. Laboratory validation and field data from 10 transmission seasons are reported. The comparative sensitivity and specificity of this multiplex assay to singleplex RT-PCR as well as an antigen detection (rapid analyte measurement platform) and standard plaque assays indicate this assay to be rapid and useful in providing mosquito infection data to estimate outbreak risk. PMID:26334826

Copy Number Variation of TLR-7 Gene and its Association with the Development of Systemic Lupus Erythematosus in Female Patients from Yucatan Mexico

PubMed Central

Pacheco, Guillermo Valencia; Cruz, Darig Cámara; González Herrera, Lizbeth J; Pérez Mendoza, Gerardo J; Adrián Amaro, Guadalupe I; Nakazawa Ueji, Yumi E; Angulo Ramírez, Angélica V

2014-01-01

Systemic lupus erythematosus (SLE) is a systemic autoimmune disease characterized by the production of autoantibodies against self-antigens, which occurs most often in women between 15 and 40 years of age. The innate immunity is involved in the pathogenesis of SLE through TLR- 7. Genetic factors such as copy number variation (CNV) of target genes may contribute to disease development, but this possible risk has not yet been studied in SLE patients from Yucatan, Mexico. The CNV of TLR-7 gene was determined by quantitative polymerase chain reaction assay using TaqMan probes in 80 SLE women and 150 control subjects. The results showed that 10% of SLE patients exhibited more than two copies of TLR-7 gene, whereas no mRNA overexpression was detected. These data suggested that increased CNV of the TLR-7 gene in Yucatan SLE women can be a risk factor for this disease. PMID:25512712

Authentication of beef, carabeef, chevon, mutton and pork by a PCR-RFLP assay of mitochondrial cytb gene.

PubMed

Kumar, Deepak; Singh, S P; Karabasanavar, Nagappa S; Singh, Rashmi; Umapathi, V

2014-11-01

Authentication of meat assumes significance in view of religious, quality assurance, food safety, public health, conservation and legal concerns. Here, we describe a PCR-RFLP (Polymerase Chain Reaction- Restriction Fragment Length Polymorphism) assay targeting mitochondrial cytochrome-b gene for the identification of meats of five most common food animals namely cattle, buffalo, goat, sheep and pig. A pair of forward and reverse primers (VPH-F & VPH-R) amplifying a conserved region (168-776 bp) of mitochondrial cytochrome-b (cytb) gene for targeted species was designed which yielded a 609 bp PCR amplicon. Further, restriction enzyme digestion of the amplicons with Alu1 and Taq1 restriction enzymes resulted in a distinctive digestion pattern that was able to discriminate each species. The repeatability of the PCR-RFLP assay was validated ten times with consistent results observed. The developed assay can be used in routine diagnostic laboratories to differentiate the meats of closely related domestic livestock species namely cattle from buffalo and sheep from goat.

Quantitation of O6-methylguanine-DNA methyltransferase gene messenger RNA in gliomas by means of real-time RT-PCR and clinical response to nitrosoureas.

PubMed

Tanaka, Satoshi; Oka, Hidehiro; Fujii, Kiyotaka; Watanabe, Kaoru; Nagao, Kumi; Kakimoto, Atsushi

2005-09-01

1. O6-methylguanine-DNA methyltransferase (MGMT) mRNA was measured in 50 malignant gliomas that had received 1-(4-amino-2-methyl-5-pyrimidynyl) methyl-3-(2-chloroethyl)-3-nitrosourea hydrochloride (ACNU) after the resection of the tumor by real-time reverse transcription-polymerase chain reaction (RT-PCR) using TaqMan probe. 2. The mean absolute value of MGMTmRNA normalized to the level of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) for 50 tumors was 1.29 x 10(4)+/- 1.28 x 10(4) copy/microg RNA (mean +/- SD). The amount of MGMTmRNA less than 6 x 10(3) copy/microg RNA was the most significant factor in predicting the initial effect of treatment with ACNU by multi-variant regression analysis (p = 0.0157). 3. These results suggest that quantitation of MGMTmRNA is the excellent method for predicting for the effect of ACNU in glioma therapy.

Improved acid tolerance of Lactobacillus pentosus by error-prone whole genome amplification.

PubMed

Ye, Lidan; Zhao, Hua; Li, Zhi; Wu, Jin Chuan

2013-05-01

Acid tolerance of Lactobacillus pentosus ATCC 8041 was improved by error-prone amplification of its genomic DNA using random primers and Taq DNA polymerase. The resulting amplification products were transferred into wild-type L. pentosus by electroporation and the transformants were screened for growth on low-pH agar plates. After only one round of mutation, one mutant (MT3) was identified that was able to completely consume 20 g/L of glucose to produce lactic acid at a yield of 95% in 1L MRS medium at pH 3.8 within 36 h, whereas no growth or lactic acid production was observed for the wild-type strain under the same conditions. The acid tolerance of mutant MT3 remained genetically stable for at least 25 subcultures. Therefore, the error-prone whole genome amplification technique is a very powerful tool for improving phenotypes of this lactic acid bacterium and may also be applicable for other microorganisms. Copyright © 2012 Elsevier Ltd. All rights reserved.

Introduction of structural affinity handles as a tool in selective nucleic acid separations

NASA Technical Reports Server (NTRS)

Willson, III, Richard Coale (Inventor); Cano, Luis Antonio (Inventor)

2011-01-01

The method is used for separating nucleic acids and other similar constructs. It involves selective introduction, enhancement, or stabilization of affinity handles such as single-strandedness in the undesired (or desired) nucleic acids as compared to the usual structure (e.g., double-strandedness) of the desired (or undesired) nucleic acids. The undesired (or desired) nucleic acids are separated from the desired (or undesired) nucleic acids due to capture by methods including but not limited to immobilized metal affinity chromatography, immobilized single-stranded DNA binding (SSB) protein, and immobilized oligonucleotides. The invention is useful to: remove contaminating genomic DNA from plasmid DNA; remove genomic DNA from plasmids, BACs, and similar constructs; selectively separate oligonucleotides and similar DNA fragments from their partner strands; purification of aptamers, (deoxy)-ribozymes and other highly structured nucleic acids; Separation of restriction fragments without using agarose gels; manufacture recombinant Taq polymerase or similar products that are sensitive to host genomic DNA contamination; and other applications.

Market analysis of food products for detection of allergenic walnut (Juglans regia) and pecan (Carya illinoinensis) by real-time PCR.

PubMed

López-Calleja, Inés María; de la Cruz, Silvia; González, Isabel; García, Teresa; Martín, Rosario

2015-06-15

Two real-time polymerase chain reaction (PCR)-based assays for detection of walnut (Juglans regia) and pecan (Carya illinoinensis) traces in a wide range of processed foods are described here. The method consists on a real-time PCR assay targeting the ITS1 region, using a nuclease (TaqMan) probe labeled with FAM and BBQ. The method was positive for walnut and pecan respectively, and negative for all other heterologous plants and animals tested. Using a series of model samples with defined raw walnut in wheat flour and heat-treated walnut in wheat flour with a range of concentrations of 0.1-100,000 mg kg(-1), a practical detection limit of 0.1 mg kg(-1) of walnut content was estimated. Identical binary mixtures were done for pecan, reaching the same limit of detection of 0.1 mg kg(-1). The assay was successfully trialed on a total of 232 commercial foodstuffs. Copyright © 2015 Elsevier Ltd. All rights reserved.

Positive association of vitamin D receptor gene variations with multiple sclerosis in South East Iranian population.

PubMed

Narooie-Nejad, Mehrnaz; Moossavi, Maryam; Torkamanzehi, Adam; Moghtaderi, Ali

2015-01-01

Among the factors postulated to play a role in MS susceptibility, the role of vitamin D is outstanding. Since the function of vitamin D receptor (VDR) represents the effect of vitamin D on the body and genetic variations in VDR gene may affect its function, we aim to highlight the association of two VDR gene polymorphisms with MS susceptibility. In current study, we recruited 113 MS patients and 122 healthy controls. TaqI (rs731236) and ApaI (rs7975232) genetic variations in these two groups were evaluated using the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) technique. All genotype and allele frequencies in both variations showed association with the disease status. However, to find the definite connection between genetic variations in VDR gene and MS disease in a population of South East of Iran, more researches on gene structure and its function with regard to patients' conditions are required.

Expression levels of seven candidate genes in human peripheral blood mononuclear cells and their association with preeclampsia

PubMed Central

Garza-Veloz, I.; Carrillo-Sanchez, K.; Martinez-Gaytan, V.; Cortes-Flores, R.; Ochoa-Torres, M. A.; Guerrero, G. G.; Rodriguez-Sanchez, I. P.; Cancela-Murrieta, C. O.; Zamudio-Osuna, M.; Badillo-Almaraz, J. I.; Castruita-De la Rosa, C.

2014-01-01

Objective To evaluate the peripheral blood mononuclear cell (PBMC) expression levels of hemeoxygenase 1 (HMOX-1), superoxide dismutase 1 (SOD-1), vascular endothelial growth factor A (VEGF-A), transforming growth factor beta 1 (TGF-β1), interleukin (IL)-6, IL-15 and AdipoQ genes to study their association with preeclampsia (PE). Methods A total of 177 pregnant women were recruited: 108 cases and 69 controls. Quantification of gene expression was measured by quantitative real-time polymerase chain reaction (PCR) using TaqMan probes. Results Underexpression of VEGF-A and TGF-β1 was a constant in most of the cases (80.91% and 76.36%, respectively) and their expression was associated with onset and/or severity of disease (p values < 0.05). IL-6, IL-15 and AdipoQ, showed low or no expression in PBMC samples evaluated. Conclusion PBMC underexpression of VEGF-A and TGF-β1 is a hallmark of PE in the study population. PMID:24295154

Associations of Cholesteryl Ester Transfer Protein TaqIB Polymorphism with the Composite Ischemic Cardiovascular Disease Risk and HDL-C Concentrations: A Meta-Analysis

PubMed Central

Guo, Shu-xia; Yao, Ming-hong; Ding, Yu-song; Zhang, Jing-yu; Yan, Yi-zhong; Liu, Jia-ming; Zhang, Mei; Rui, Dong-sheng; Niu, Qiang; He, Jia; Guo, Heng; Ma, Ru-lin

2016-01-01

Background: Previous studies have evaluated the associations between the cholesteryl ester transfer protein (CETP) TaqIB polymorphism (rs708272), the risk of developing composite ischemic cardiovascular disease (CVD) and the concentration of high-density lipoprotein cholesterol (HDL-C), but results remain controversial. The objective of this study was to investigate whether a relationship exists between these factors. Methods: We conducted a meta-analysis of available studies to clarify the associations of the CETP TaqIB polymorphism with HDL-C concentration and the composite ischemic CVD risk in both Asians and Caucasians. All statistical analyses were done with Stata 12.0. Results: Through utilization of the Cochrane Library, Embase, PubMed, Web of Science, Springer, China Science and Technology Journal Database, China National Knowledge Infrastructure, Google Scholar, and Baidu Library, a total of 45 studies from 44 papers with 20,866 cases and 21,298 controls were combined showing a significant association between the CETP TaqIB variant and composite ischemic CVD risk. Carriers of allele TaqIB-B1 were found to have a higher risk of composite ischemic CVD than non-carriers: OR = 1.15, 95% CI = 1.09–1.21, p < 0.001. Meanwhile, 28 studies with 23,959 subjects were included in the association between the CETP TaqIB polymorphism and the concentration of HDL-C. Results suggested that carriers of the B1B1 genotype had lower concentrations of HDL-C than those of the B2B2 genotype: SMD = 0.50, 95% CI = 0.36–0.65, p < 0.001. Conclusions: The synthesis of available evidence demonstrates that the CETP TaqIB polymorphism protects against composite ischemic CVD risk and is associated with a higher HDL-C concentration in both Asians and Caucasians. PMID:27608031

A novel Tetra-primer ARMS-PCR based assay for genotyping SNP rs12303764(G/T) of human Unc-51 like kinase 1 gene.

PubMed

Randhawa, Rohit; Duseja, Ajay; Changotra, Harish

2017-02-01

Various case-control studies have shown association of single nucleotide polymorphism rs12303764(G/T) in ULK1 with crohn's disease. The techniques used in these studies were time consuming, complicated and require sophisticated/expensive instruments. Therefore, in order to overcome these problems, we have developed a new, rapid and cost effective Tetra-primer ARMS-PCR assay to genotype single nucleotide polymorphism rs12303764(G/T) of ULK1 gene. We manually designed allele specific primers. DNA fragment amplified using outer primers was sequenced to obtain samples with known genotypes (GG, GT and TT) for further use in the development of T-ARMS-PCR assay. Amplification conditions were optimized for parameters; annealing temperature, Taq DNA polymerase and primers. The developed T-ARMS-PCR assay was applied to genotype one hundred samples from healthy individuals. Genotyping results of 10 DNA samples from healthy individuals for rs12303764(G/T) by T-ARMS-PCR assay and sequencing were concordant. The newly developed assay was further applied to genotype samples from 100 healthy individuals of North Indian origin. Genotype frequencies were 9, 34 and 57 % for GG, GT and TT, respectively. Allele frequencies were 0.26 and 0.74 for G and T, respectively. The allele frequencies were in Hardy-Weinberg's equilibrium (p = 0.2443). T-ARMS-PCR assay developed in our laboratory for genotyping rs12303764 (G/T) of ULK1 gene is time saving and cost-effective as compared to the available methods. Furthermore, this is the first study reporting allelic and genotype frequencies of ULK1 rs12303764 (G/T) variants in North Indian population.

Vitamin D Receptor TaqI Gene Variant in Exon 9 and Polycystic Ovary Syndrome Risk

PubMed Central

Bagheri, Morteza; Abdi Rad, Isa; Hosseini Jazani, Nima; Nanbakhsh, Fariba

2013-01-01

Background: Polycystic ovary syndrome (PCOS) is known as a metabolic disorder. The results of recent studies implied that vitamin D receptor (VDR) genetic variants may impact PCOS and insulin resistance in women with PCOS. The aim of the present study was to determine the VDR TaqI gene variant in exon 9 (T/C) (rs731236) in normal controls and patients with PCOS for the first time in Iranian Azeri women. Materials and Methods: In this case control study between April 2011 and June 2012, a total of 76 women aged 18-40 years (38 patients with PCOS and 38 healthy women as normal controls) participated. Genotypes of VDR TaqI in exon 9 (T/C) (rs731236) were determined using the PCR-RFLP method. Results: The frequencies of VDR TaqI T anc C alleles were 0.605 and 0.395 in cases and 0.697 and 0.303 in controls. Also, the genotypic frequencies of VDR TaqI were 16) (42.11), 14(36.84), and 8(21.05) in cases, and 17(44.74), 19(50), and 2(5.26) in controls for TT, TC and CC genotypes respectively. There was no difference in genotype and allele frequencies between PCOS and controls (p value>0.05) with the exception of the CC genotype (p value=0.04). Conclusion: This report, a first of its own kind in Iranian Azeri patients, suggests that the CC genotype of VDR TaqI in exon 9 (rs731236) is associated with PCOS. PMID:24520473

Specific Reaction Patterns to Distinct Positive Emotional Cues Related to Incentive Motivation in Dependence of the Taq1A-Polymorphism: Molecular Genetic Associations of Early and Late Event-Related Potentials.

PubMed

Munk, Aisha J L; Wielpuetz, Catrin; Osinsky, Roman; Müller, Erik M; Grant, Phillip; Hennig, Jürgen

2016-01-01

Early and late event-related potential (ERP) responses, representing early subconscious and late motivational processes, were recorded for positive emotional words related to 'wanting' and 'liking', in dependence of the dopamine-related Taq1A genotype (ANKK1/DRD2). Research suggests that 'wanting' as opposed to 'liking' is related to dopaminergic processes. Therefore, it was hypothesized that risk allele carriers of the Taq1A polymorphism exhibit late ERP changes in reaction to words representing incentive motivation, i.e. 'wanting' (word categories 'lust' and 'anticipation'), but not to words representing 'liking' ('closeness'). Seventy-two male participants performed an emotional-word Stroop task during EEG recording and were genotyped according to the Taq1A polymorphism of ANKK1/DRD2. Positive emotional words related to anticipation and lust revealed blunted responses in the late positive potential (LPP) in carriers of the A1 allele, an effect absent in response to 'liking'-related words. These differences were not evident in the earlier posterior negativity (EPN). As no differences in dependence of the Taq1A genotype were observed in reaction to 'wanting'- and 'liking'-related words in the EPN, but merely in the LPP, it can be assumed that incentive-motivational stimuli only modify motivation-related ERP responses in carriers of the A1 allele of the Taq1A polymorphism, indicating the role of dopamine in late ERP components. © 2016 S. Karger AG, Basel.

A novel duplex real-time reverse transcriptase-polymerase chain reaction assay for the detection of hepatitis C viral RNA with armored RNA as internal control

PubMed Central

2010-01-01

Background The hepatitis C virus (HCV) genome is extremely heterogeneous. Several HCV infections can not be detected using currently available commercial assays, probably because of mismatches between the template and primers/probes. By aligning the HCV sequences, we developed a duplex real-time reverse transcriptase-polymerase chain reaction (RT-PCR) assay using 2 sets of primers/probes and a specific armored RNA as internal control. The 2 detection probes were labelled with the same fluorophore, namely, 6-carboxyfluorescein (FAM), at the 5' end; these probes could mutually combine, improving the power of the test. Results The limit of detection of the duplex primer/probe assay was 38.99 IU/ml. The sensitivity of the assay improved significantly, while the specificity was not affected. All HCV genotypes in the HCV RNA Genotype Panel for Nucleic Acid Amplification Techniques could be detected. In the testing of 109 serum samples, the performance of the duplex real-time RT-PCR assay was identical to that of the COBAS AmpliPrep (CAP)/COBAS TaqMan (CTM) assay and superior to 2 commercial HCV assay kits. Conclusions The duplex real-time RT-PCR assay is an efficient and effective viral assay. It is comparable with the CAP/CTM assay with regard to the power of the test and is appropriate for blood-donor screening and laboratory diagnosis of HCV infection. PMID:20529244

A novel fluorescence-based assay for the rapid detection and quantification of cellular deoxyribonucleoside triphosphates

PubMed Central

Wilson, Peter M.; LaBonte, Melissa J.; Russell, Jared; Louie, Stan; Ghobrial, Andrew A.; Ladner, Robert D.

2011-01-01

Current methods for measuring deoxyribonucleoside triphosphates (dNTPs) employ reagent and labor-intensive assays utilizing radioisotopes in DNA polymerase-based assays and/or chromatography-based approaches. We have developed a rapid and sensitive 96-well fluorescence-based assay to quantify cellular dNTPs utilizing a standard real-time PCR thermocycler. This assay relies on the principle that incorporation of a limiting dNTP is required for primer-extension and Taq polymerase-mediated 5–3′ exonuclease hydrolysis of a dual-quenched fluorophore-labeled probe resulting in fluorescence. The concentration of limiting dNTP is directly proportional to the fluorescence generated. The assay demonstrated excellent linearity (R2 > 0.99) and can be modified to detect between ∼0.5 and 100 pmol of dNTP. The limits of detection (LOD) and quantification (LOQ) for all dNTPs were defined as <0.77 and <1.3 pmol, respectively. The intra-assay and inter-assay variation coefficients were determined to be <4.6% and <10%, respectively with an accuracy of 100 ± 15% for all dNTPs. The assay quantified intracellular dNTPs with similar results obtained from a validated LC–MS/MS approach and successfully measured quantitative differences in dNTP pools in human cancer cells treated with inhibitors of thymidylate metabolism. This assay has important application in research that investigates the influence of pathological conditions or pharmacological agents on dNTP biosynthesis and regulation. PMID:21576234

Next-generation sequencing facilitates quantitative analysis of wild-type and Nrl−/− retinal transcriptomes

PubMed Central

Brooks, Matthew J.; Rajasimha, Harsha K.; Roger, Jerome E.

2011-01-01

Purpose Next-generation sequencing (NGS) has revolutionized systems-based analysis of cellular pathways. The goals of this study are to compare NGS-derived retinal transcriptome profiling (RNA-seq) to microarray and quantitative reverse transcription polymerase chain reaction (qRT–PCR) methods and to evaluate protocols for optimal high-throughput data analysis. Methods Retinal mRNA profiles of 21-day-old wild-type (WT) and neural retina leucine zipper knockout (Nrl−/−) mice were generated by deep sequencing, in triplicate, using Illumina GAIIx. The sequence reads that passed quality filters were analyzed at the transcript isoform level with two methods: Burrows–Wheeler Aligner (BWA) followed by ANOVA (ANOVA) and TopHat followed by Cufflinks. qRT–PCR validation was performed using TaqMan and SYBR Green assays. Results Using an optimized data analysis workflow, we mapped about 30 million sequence reads per sample to the mouse genome (build mm9) and identified 16,014 transcripts in the retinas of WT and Nrl−/− mice with BWA workflow and 34,115 transcripts with TopHat workflow. RNA-seq data confirmed stable expression of 25 known housekeeping genes, and 12 of these were validated with qRT–PCR. RNA-seq data had a linear relationship with qRT–PCR for more than four orders of magnitude and a goodness of fit (R2) of 0.8798. Approximately 10% of the transcripts showed differential expression between the WT and Nrl−/− retina, with a fold change ≥1.5 and p value <0.05. Altered expression of 25 genes was confirmed with qRT–PCR, demonstrating the high degree of sensitivity of the RNA-seq method. Hierarchical clustering of differentially expressed genes uncovered several as yet uncharacterized genes that may contribute to retinal function. Data analysis with BWA and TopHat workflows revealed a significant overlap yet provided complementary insights in transcriptome profiling. Conclusions Our study represents the first detailed analysis of retinal transcriptomes, with biologic replicates, generated by RNA-seq technology. The optimized data analysis workflows reported here should provide a framework for comparative investigations of expression profiles. Our results show that NGS offers a comprehensive and more accurate quantitative and qualitative evaluation of mRNA content within a cell or tissue. We conclude that RNA-seq based transcriptome characterization would expedite genetic network analyses and permit the dissection of complex biologic functions. PMID:22162623

TaqMan PCR for Detection of Vibrio cholerae O1, O139, Non-O1, and Non-O139 in Pure Cultures, Raw Oysters, and Synthetic Seawater†

PubMed Central

Lyon, W. J.

2001-01-01

Vibrio cholerae is recognized as a leading human waterborne pathogen. Traditional diagnostic testing for Vibrio is not always reliable, because this bacterium can enter a viable but nonculturable state. Therefore, nucleic acid-based tests have emerged as a useful alternative to traditional enrichment testing. In this article, a TaqMan PCR assay is presented for quantitative detection of V. cholerae in pure cultures, oysters, and synthetic seawater. Primers and probe were designed from the nonclassical hemolysin (hlyA) sequence of V. cholerae strains. This probe was applied to DNA from 60 bacterial strains comprising 21 genera. The TaqMan PCR assay was positive for all of the strains of V. cholerae tested and negative for all other species of Vibrio tested. In addition, none of the other genera tested was amplified with the TaqMan primers and probe used in this study. The results of the TaqMan PCR with raw oysters and spiked with V. cholerae serotypes O1 and O139 were comparable to those of pure cultures. The sensitivity of the assay was in the range of 6 to 8 CFU g−1 and 10 CFU ml−1 in spiked raw oyster and synthetic seawater samples, respectively. The total assay could be completed in 3 h. Quantification of the Vibrio cells was linear over at least 6 log units. The TaqMan probe and primer set developed in this study can be used as a rapid screening tool for the presence of V. cholerae in oysters and seawater without prior isolation and characterization of the bacteria by traditional microbiological methods. PMID:11571173

Vitamin D receptor variants and uncontrolled asthma.

PubMed

Hutchinson, K; Kerley, C P; Faul, J; Greally, P; Coghlan, D; Louw, M; Elnazir, B; Rochev, Y

2017-11-28

Background. Asthma is a common childhood respiratory disease, affecting around 20% of Irish children. In other populations, vitamin D receptor (VDR) polymorphisms have been associated with asthma risk. We aimed to investigate the association between 2 VDR polymorphisms and uncontrolled paediatric asthma. Methods. 44 asthmatic children and 57 healthy volunteers were studied. The VDR TaqI gene variant in exon 9 (T/C) (rs731236) and ApaI (rs7975232) in intron 8 (C/T) were determined, using TaqMan® Assays. The lung function, serum 25-hydroxyvitamin D (25OHD) levels and other biomarkers of allergy, immunity, airway and systemic inflammation were as-sessed. Results. The distribution of T and C alleles and genotype frequencies differed significantly between asthmatics and controls for both polymorphisms (p < 0.05). A significant association was found between both TaqI [OR = 2.37, 95% CI (1.27 - 4.45), p = 0.007] and ApaI polymorphisms, and asthma risk [OR = 2.93, 95% CI (1.62 - 5.3), p = 0.0004]. No association was observed between genotypes and 25OHD levels, lung function and other biomarkers, with the exception of Interleukin-10 (IL-10) and white blood cells count (WBC). IL-10 levels were lower in asthmatics with TC genotype for TaqI polymorphism (p < 0.01) and were higher in patients with TT genotype for ApaI (p < 0.01). WBC were higher in patients with TC and CC genotypes for TaqI (p < 0.05) and lower in TT genotype for ApaI (p < 0.05). Conclusion. TaqI and ApaI polymorphisms are associated with asthma in Irish children. Further studies are warranted to investigate the importance of decreased IL-10 levels in paediatric asthmatics with specific genotypes.

A preliminary study: novelty seeking, frontal executive function, and dopamine receptor (D2) TaqI A gene polymorphism in patients with methamphetamine dependence.

PubMed

Han, Doug Hyun; Yoon, Sujung J; Sung, Young Hoon; Lee, Young Sik; Kee, Baik Seok; Lyoo, In Kyoon; Renshaw, Perry F; Cho, Soo Churl

2008-01-01

Dopamine receptor polymorphisms have been associated with specific patterns of novelty seeking (NS) temperamental nature and frontal executive function. In addition, carriers of dopamine receptor type 2 (DRD2)-TaqI A1 have been hypothesized to be potentially vulnerable to addictive behaviors. In the present study, the association between dopamine D2 polymorphisms, NS, and frontal executive function was studied. Thirty-seven methamphetamine (MA)-dependent subjects and 40 healthy comparison subjects participated in the current study. The severity of addiction, NS temperament, and frontal executive functions were measured using the Addiction Severity Index, the NS subscale in the Temperament and Character Inventory, and the Wisconsin Card Sorting Test, respectively. All subjects were genotyped with regard to DRD2-TaqI polymorphisms. The prevalence of DRD2-TaqI A1 allele polymorphisms was greater in the MA-abuser group than in the comparison group. Patients with MA dependence also had higher NS characteristics and high scores in total trials, errors, and perseverative errors of the Wisconsin Card Sorting Test than comparison subjects. Within patients with MA dependence, the subgroup of DRD2-TaqI A1 carrier had greater NS scores relative to those without, whereas there was only a trend level of lower frontal executive function in the first subgroup. In the present study, the MA-dependent patients with DRD2-TaqI A1 allele had significantly greater NS scores and lower frontal executive function with a trend level than those without. These preliminary results suggest that MA-dependent patients may have the possibility of genetic and biogenic vulnerability to MA.

Dopamine Genes (DRD2/ANKK1-TaqA1 and DRD4-7R) and Executive Function: Their Interaction with Obesity

PubMed Central

Ariza, Mar; Garolera, Maite; Jurado, Maria Angeles; Garcia-Garcia, Isabel; Hernan, Imma; Sánchez-Garre, Consuelo; Vernet-Vernet, Maria; Sender-Palacios, Maria Jose; Marques-Iturria, Idoia; Pueyo, Roser; Segura, Barbara; Narberhaus, Ana

2012-01-01

Obesity is a multifactorial disease caused by the interaction between genotype and environment, and it is considered to be a type of addictive alteration. The A1 allele of the DRD2/ANKK1-TaqIA gene has been associated with addictive disorders, with obesity and with the performance in executive functions. The 7 repeat allele of the DRD4 gene has likewise been associated with the performance in executive functions, as well as with addictive behaviors and impulsivity. Participants were included in the obesity group (N = 42) if their body mass index (BMI) was equal to or above 30, and in the lean group (N = 42) if their BMI was below 25. The DRD2/ANKK1-TaqIA and DRD4 VNTR polymorphisms were obtained. All subjects underwent neuropsychological assessment. Eating behavior traits were evaluated. The ‘DRD2/ANKK1-TaqIA A1-allele status’ had a significant effect on almost all the executive variables, but no significant ‘DRD4 7R-allele status’ effects were observed for any of the executive variables analyzed. There was a significant ‘group’ x ‘DRD2/ANKK1-TaqIA A1-allele status’ interaction effect on LN and ‘group’ x ‘DRD4 7R-allele status’ interaction effect on TMT B-A score. Being obese and a carrier of the A1 allele of DRD2/ANKK1-TaqIA or the 7R allele of DRD4 VNTR polymorphisms could confer a weakness as regards the performance of executive functions. PMID:22848508

Cortical NMDA receptor expression in human chronic alcoholism: influence of the TaqIA allele of ANKK1.

PubMed

Ridge, Justin P; Dodd, Peter R

2009-10-01

Real-time RT-PCR normalized to GAPDH was used to assay N-methyl-D-aspartate (NMDA) receptor NR1, NR2A and NR2B subunit mRNA in human autopsy cortex tissue from chronic alcoholics with and without comorbid cirrhosis of the liver and matched controls. Subunit expression was influenced by the subject's genotype. The TaqIA polymorphism selectively modulated NMDA receptor mean transcript expression in cirrhotic-alcoholic superior frontal cortex, in diametrically opposite ways in male and female subjects. Genetic make-up may differentially influence vulnerability to brain damage by altering the excitation: inhibition balance, particularly in alcoholics with comorbid cirrhosis of the liver. The TaqIA polymorphism occurs within the poorly characterised ankyrin-repeat containing kinase 1 (ANKK1) gene. Using PCR, ANKK1 mRNA transcript was detected in inferior temporal, occipital, superior frontal and primary motor cortex of control human brain. ANKK1 expression may mediate the influence of the TaqIA polymorphism on phenotype.

The origin and early evolution of nucleic acid polymerases

NASA Technical Reports Server (NTRS)

Lazcano, A.; Cappello, R.; Valverde, V.; Llaca, V.; Oro, J.

1992-01-01

The hypothesis that vestiges of the ancestral RNA-dependent RNA polymerase involved in the replication of RNA genomes of Archean cells are present in the eubacterial RNA-polymerase beta-prime subunit and its homologues is discussed. It is shown that, in the DNA-dependent RNA polymerases from three cellular lineages, a very conserved sequence of eight amino acids, also found in a small RNA-binding site previously described for the E. coli polynucleotide phosphorylase and the S1 ribosomal protein, is present. The optimal conditions for the replicase activity of the avian-myeloblastosis-virus reverse transcriptase are presented. The evolutionary significance of the in vitro modifications of substrate and template specificities of RNA polymerases and reverse transcriptases is discussed.

Dual Combined Real-Time Reverse Transcription Polymerase Chain Reaction Assay for the Diagnosis of Lyssavirus Infection.

PubMed

Dacheux, Laurent; Larrous, Florence; Lavenir, Rachel; Lepelletier, Anthony; Faouzi, Abdellah; Troupin, Cécile; Nourlil, Jalal; Buchy, Philippe; Bourhy, Herve

2016-07-01

The definitive diagnosis of lyssavirus infection (including rabies) in animals and humans is based on laboratory confirmation. The reference techniques for post-mortem rabies diagnosis are still based on direct immunofluorescence and virus isolation, but molecular techniques, such as polymerase chain reaction (PCR) based methods, are increasingly being used and now constitute the principal tools for diagnosing rabies in humans and for epidemiological analyses. However, it remains a key challenge to obtain relevant specificity and sensitivity with these techniques while ensuring that the genetic diversity of lyssaviruses does not compromise detection. We developed a dual combined real-time reverse transcription polymerase chain reaction (combo RT-qPCR) method for pan-lyssavirus detection. This method is based on two complementary technologies: a probe-based (TaqMan) RT-qPCR for detecting the RABV species (pan-RABV RT-qPCR) and a second reaction using an intercalating dye (SYBR Green) to detect other lyssavirus species (pan-lyssa RT-qPCR). The performance parameters of this combined assay were evaluated with a large panel of primary animal samples covering almost all the genetic variability encountered at the viral species level, and they extended to almost all lyssavirus species characterized to date. This method was also evaluated for the diagnosis of human rabies on 211 biological samples (positive n = 76 and negative n = 135) including saliva, skin and brain biopsies. It detected all 41 human cases of rabies tested and confirmed the sensitivity and the interest of skin biopsy (91.5%) and saliva (54%) samples for intra-vitam diagnosis of human rabies. Finally, this method was successfully implemented in two rabies reference laboratories in enzootic countries (Cambodia and Morocco). This combined RT-qPCR method constitutes a relevant, useful, validated tool for the diagnosis of rabies in both humans and animals, and represents a promising tool for lyssavirus surveillance.

Dual Combined Real-Time Reverse Transcription Polymerase Chain Reaction Assay for the Diagnosis of Lyssavirus Infection

PubMed Central

Lavenir, Rachel; Lepelletier, Anthony; Faouzi, Abdellah; Troupin, Cécile; Nourlil, Jalal; Buchy, Philippe; Bourhy, Herve

2016-01-01

The definitive diagnosis of lyssavirus infection (including rabies) in animals and humans is based on laboratory confirmation. The reference techniques for post-mortem rabies diagnosis are still based on direct immunofluorescence and virus isolation, but molecular techniques, such as polymerase chain reaction (PCR) based methods, are increasingly being used and now constitute the principal tools for diagnosing rabies in humans and for epidemiological analyses. However, it remains a key challenge to obtain relevant specificity and sensitivity with these techniques while ensuring that the genetic diversity of lyssaviruses does not compromise detection. We developed a dual combined real-time reverse transcription polymerase chain reaction (combo RT-qPCR) method for pan-lyssavirus detection. This method is based on two complementary technologies: a probe-based (TaqMan) RT-qPCR for detecting the RABV species (pan-RABV RT-qPCR) and a second reaction using an intercalating dye (SYBR Green) to detect other lyssavirus species (pan-lyssa RT-qPCR). The performance parameters of this combined assay were evaluated with a large panel of primary animal samples covering almost all the genetic variability encountered at the viral species level, and they extended to almost all lyssavirus species characterized to date. This method was also evaluated for the diagnosis of human rabies on 211 biological samples (positive n = 76 and negative n = 135) including saliva, skin and brain biopsies. It detected all 41 human cases of rabies tested and confirmed the sensitivity and the interest of skin biopsy (91.5%) and saliva (54%) samples for intra-vitam diagnosis of human rabies. Finally, this method was successfully implemented in two rabies reference laboratories in enzootic countries (Cambodia and Morocco). This combined RT-qPCR method constitutes a relevant, useful, validated tool for the diagnosis of rabies in both humans and animals, and represents a promising tool for lyssavirus surveillance. PMID:27380028

[Application of transcription mediated amplification and real-time reverse transcription polymerase chain reaction in detection of human immunodeficiency virus RNA].

PubMed

Wu, Daxian; Tao, Shuhui; Liu, Shuiping; Zhou, Jiebin; Tan, Deming; Hou, Zhouhua

2017-07-28

To observe the sensitivity of transcription mediated amplification (TMA), and to compare its performance with real-time reverse transcription polymerase chain reaction (real-time RT-PCR) in detecting human immunodeficiency virus RNA (HIV RNA).
 Methods: TMA system was established with TaqMan probes, specific primers, moloney murine leukemia virus (MMLV) reverse transcriptase, T7 RNA polymerase, and reaction substrates. The sensitivity of TMA was evaluated by amplifying a group of 10-fold diluted HIV RNA standards which were transcribed in vitro. A total of 60 plasma of HIV infected patients were measured by TMA and Cobas Amplicor HIV-1 Monitor test to observe the positive rate. The correlation and concordance of the above two technologies were investigated by linear regression and Bland-Altman analysis.
 Results: TMA system was established successfully and HIV RNA transcribed standards at concentration of equal or more than 10 copies/mL could be detected by TMA technology. Among 60 samples of plasma from HIV infected patients, 46 were positively detected and 12 were negatively amplified by both TMA and Cobas reagents; 2 samples were positively tested by Cobas reagent but negatively tested by TMA system. The concordance rate of the two methods was 97.1% and the difference of positive detection rate between the two methods was not statistically significant (P>0.05). Linear regression was used for 46 samples which were positively detected by both TMA and Cobas reagents and showed an excellent correlation between the two reagents (r=0.997, P<0.001). Bland-Altma analysis revealed that the mean different value of HIV RNA levels for denary logarithm was 0.02. Forty-four samples were included in 95% of credibility interval of concordance.
 Conclusion: TMA system has the potential of high sensitivity. TMA and real-time RT-PCR keep an excellent correlation and consistency in detecting HIV RNA.

Detection of Citrus leprosis virus C using specific primers and TaqMan probe in one-step real-time reverse-transcription polymerase chain reaction assays.

PubMed

Choudhary, Nandlal; Wei, G; Govindarajulu, A; Roy, Avijit; Li, Wenbin; Picton, Deric D; Nakhla, M K; Levy, L; Brlansky, R H

2015-11-01

Citrus leprosis virus C (CiLV-C), a causal agent of the leprosis disease in citrus, is mostly present in the South and Central America and spreading toward the North America. To enable better diagnosis and inhibit the further spread of this re-emerging virus a quantitative (q) real-time reverse transcription polymerase chain reaction (qRT-PCR) assay is needed for early detection of CiLV-C when the virus is present in low titer in citrus leprosis samples. Using the genomic sequence of CiLV-C, specific primers and probe were designed and synthesized to amplify a 73 nt amplicon from the movement protein (MP) gene. A standard curve of the 73 nt amplicon MP gene was developed using known 10(10)-10(1) copies of in vitro synthesized RNA transcript to estimate the copy number of RNA transcript in the citrus leprosis samples. The one-step qRT-PCR detection assays for CiLV-C were determined to be 1000 times more sensitive when compared to the one-step conventional reverse transcription polymerase chain reaction (RT-PCR) CiLV-C detection method. To evaluate the quality of the total RNA extracts, NADH dehydrogenase gene specific primers (nad5) and probe were included in reactions as an internal control. The one-step qRT-PCR specificity was successfully validated by testing for the presence of CiLV-C in the total RNA extracts of the citrus leprosis samples collected from Belize, Costa Rica, Mexico and Panama. Implementation of the one-step qRT-PCR assays for CiLV-C diagnosis should assist regulatory agencies in surveillance activities to monitor the distribution pattern of CiLV-C in countries where it is present and to prevent further dissemination into citrus growing countries where there is no report of CiLV-C presence. Published by Elsevier B.V.

Pharmacogenetics of clopidogrel: comparison between a standard and a rapid genetic testing.

PubMed

Saracini, Claudia; Vestrini, Anna; Galora, Silvia; Armillis, Alessandra; Abbate, Rosanna; Giusti, Betti

2012-06-01

CYP2C19 variant alleles are independent predictors of clopidogrel response variability and occurrence of major adverse cardiovascular events in high-risk vascular patients on clopidogrel therapy. Increasing evidence suggests a combination of platelet function testing with CYP2C19 genetic testing may be more effective in identifying high-risk individuals for alternative antiplatelet therapeutic strategies. A crucial point in evaluating the use of these polymorphisms in clinical practice, besides test accuracy, is the cost of the genetic test and rapid availability of the results. One hundred acute coronary syndrome patients were genotyped for CYP2C19*2,*3,*4,*5, and *17 polymorphisms with two platforms: Verigene(®) and the TaqMan(®) system. Genotyping results obtained by the classical TaqMan approach and the rapid Verigene approach showed a 100% concordance for all the five polymorphisms investigated. The Verigene system had shorter turnaround time with respect to TaqMan. The cost of reagents for TaqMan genotyping was lower than that for the Verigene system, but the effective manual staff involvement and the relative cost resulted in higher cost for TaqMan than for Verigene. The Verigene system demonstrated good performance in terms of turnaround time and cost for the evaluation of the clopidogrel poor metabolizer status, giving genetic information in suitable time (206 min) for a therapeutic strategy decision.

Quantitative and specific detection of the biocontrol agent, Serratia plymuthica, in plant extracts using a real-time TaqMan® assay.

PubMed

Czajkowski, Robert; van der Wolf, Jan M

2012-11-01

A Serratia plymuthica-specific TaqMan® assay was designed based on the consensus nucleotide sequence from the 3'- end of the luxS gene present in all S. plymuthica strains tested. The specificity of the assay was demonstrated by testing 21 Serratia spp. strains and 30 isolates belonging to various species that can potentially coexist with S. plymuthica in the same environment. Positive reactions in the TaqMan® assay were observed only for S. plymuthica isolates and not for other bacteria. The TaqMan® assay could detect down to 1.95 ng of S. plymuthica DNA, down to 5 bacterial cells per reaction (100 cfu ml(-1)) in vitro, down to 50 bacterial cells per reaction (1,000 cfu ml(-1)) in spiked potato root extracts and down to 5 bacterial cells per reaction (100 cfu ml(-1)) in spiked potato haulm extracts. We used this assay to quantify S. plymuthica A30 cells in potato and tomato haulms and roots grown from S. plymuthica A30-inoculated potato seed tubers and tomato seeds. The results were comparable with the spread-plating of plant extracts on a newly developed S. plymuthica A30 selective medium (CVTR2Arif). The TaqMan® assay can be used to quantify S. plymuthica isolates in different ecosystems and in complex substrates.

Evaluation of TaqMan qPCR System Integrating Two Identically Labelled Hydrolysis Probes in Single Assay

PubMed Central

Nagy, Alexander; Vitásková, Eliška; Černíková, Lenka; Křivda, Vlastimil; Jiřincová, Helena; Sedlák, Kamil; Horníčková, Jitka; Havlíčková, Martina

2017-01-01

Ongoing evolution of viral pathogens is a significant issue in diagnostic virology employing TaqMan qPCR/RT-qPCR. Specific concerns are related to false negativity due to probe binding failure. One option for compensating for such deficiency is to integrate a second identically labelled probe in the assay. However, how this alteration influences the reaction parameters has not been comprehensively demonstrated. In the present study, we evaluate a TaqMan protocol using two identically labelled hydrolysis probes (simple, LNA (locked-nucleic-acid)) and MGB (minor-groove-binder) modified probes and combinations thereof in a single assay. Our results based on a synthetic amplicon suggest that the second probe does not compromise the TaqMan qPCR/RT-qPCR parameters, which repeatedly and reproducibly remained comparable to those of the corresponding single-probe assays, irrespective of the relative probe orientation, whether opposite or tandem, and probe modifications or combinations thereof. On the other hand, the second probe additively contributed to the overall fluorescence signal. The utility of the dual-probe approach was demonstrated on practical examples by using field specimens. We hope that the present study might serve as a theoretical basis for the development or improvement of TaqMan qPCR/RT-qPCR assays for the detection of highly variable nucleic acid templates. PMID:28120891

Rapid identification of tomato Sw-5 resistance-breaking isolates of Tomato spotted wilt virus using high resolution melting and TaqMan SNP Genotyping assays as allelic discrimination techniques.

PubMed

di Rienzo, Valentina; Bubici, Giovanni; Montemurro, Cinzia; Cillo, Fabrizio

2018-01-01

In tomato, resistance to Tomato spotted wilt virus (TSWV) is conferred by the dominant gene, designated Sw-5. Virulent Sw-5 resistance breaking (SRB) mutants of TSWV have been reported on Sw-5 tomato cultivars. Two different PCR-based allelic discrimination techniques, namely Custom TaqMan™ SNP Genotyping and high-resolution melting (HRM) assays, were developed and compared for their ability to distinguish between avirulent (Sw-5 non-infecting, SNI) and SRB biotypes. TaqMan assays proved to be more sensitive (threshold of detection in a range of 50-70 TSWV RNA copies) and more reliable than HRM, assigning 25 TSWV isolates to their correct genotype with an accuracy of 100%. Moreover, the TaqMan SNP assays were further improved developing a rapid and simple protocol that included crude leaf extraction for RNA template preparations. On the other hand, HRM assays showed higher levels of sensitivity than TaqMan when used to co-detect both biotypes in different artificial mixtures. These diagnostic assays contributed to gain preliminary information on the epidemiology of TSWV isolates in open field conditions. In fact, the presented data suggest that SRB isolates are present as stable populations established year round, persisting on both winter (globe artichoke) and summer (tomato) crops, in the same cultivated areas of Southern Italy.

Determining Annealing Temperatures for Polymerase Chain Reaction

ERIC Educational Resources Information Center

Porta, Angela R.; Enners, Edward

2012-01-01

The polymerase chain reaction (PCR) is a common technique used in high school and undergraduate science teaching. Students often do not fully comprehend the underlying principles of the technique and how optimization of the protocol affects the outcome and analysis. In this molecular biology laboratory, students learn the steps of PCR with an…

Smallpox and pan-Orthopox Virus Detection by Real-Time 3′-Minor Groove Binder TaqMan Assays on the Roche LightCycler and the Cepheid Smart Cycler Platforms

PubMed Central

Kulesh, David A.; Baker, Robert O.; Loveless, Bonnie M.; Norwood, David; Zwiers, Susan H.; Mucker, Eric; Hartmann, Chris; Herrera, Rafael; Miller, David; Christensen, Deanna; Wasieloski, Leonard P.; Huggins, John; Jahrling, Peter B.

2004-01-01

We designed, optimized, and extensively tested several sensitive and specific real-time PCR assays for rapid detection of both smallpox and pan-orthopox virus DNAs. The assays are based on TaqMan 3′-minor groove binder chemistry and were performed on both the rapid-cycling Roche LightCycler and the Cepheid Smart Cycler platforms. The hemagglutinin (HA) J7R, B9R, and B10R genes were used as targets for the variola virus-specific assays, and the HA and DNA polymerase-E9L genes were used as targets for the pan-orthopox virus assays. The five orthopox virus assays were tested against a panel of orthopox virus DNAs (both genomic and cloned) at the U.S. Army Medical Research Institute of Infectious Diseases (USAMRIID). The results indicated that each assay was capable of detecting both the appropriate cloned gene and genomic DNA. The assays showed no cross-reactivity to the 78 DNAs in the USAMRIID bacterial cross-reactivity panel. The limit of detection (LOD) of each assay was determined to be between 12 and 25 copies of target DNA. The assays were also run against a blind panel of DNAs at the Centers for Disease Control and Prevention (CDC) on both the LightCycler and the Smart Cycler. The panel consisted of eight different variola virus isolates, five non-variola virus orthopox virus isolates, two varicella-zoster virus isolates, and one herpes simplex virus isolate. Each sample was tested in triplicate at 2.5 ng, 25 pg, 250 fg, and 2.5 fg, which represent 1.24 × 107, 1.24 × 105, 1.24 × 103, and 1.24 × 101 genome equivalents, respectively. The results indicated that each of the five assays was 100% specific (no false positives) when tested against both the USAMRIID panels and the CDC blind panel. With the CDC blind panel, the LightCycler was capable of detecting 96.2% of the orthopox virus DNAs and 93.8% of the variola virus DNAs. The Smart Cycler was capable of detecting 92.3% of the orthopox virus DNAs and between 75 and 93.8% of the variola virus DNAs. However, all five assays had nearly 100% sensitivity on both machines with samples above the LOD (>12 gene copies). These real-time PCR assays represent a battery of tests to screen for and confirm the presence of variola virus DNA. The early detection of a smallpox outbreak is crucial whether the incident is an act of bioterrorism or an accidental occurrence. PMID:14766823

Smallpox and pan-orthopox virus detection by real-time 3'-minor groove binder TaqMan assays on the roche LightCycler and the Cepheid smart Cycler platforms.

PubMed

Kulesh, David A; Baker, Robert O; Loveless, Bonnie M; Norwood, David; Zwiers, Susan H; Mucker, Eric; Hartmann, Chris; Herrera, Rafael; Miller, David; Christensen, Deanna; Wasieloski, Leonard P; Huggins, John; Jahrling, Peter B

2004-02-01

We designed, optimized, and extensively tested several sensitive and specific real-time PCR assays for rapid detection of both smallpox and pan-orthopox virus DNAs. The assays are based on TaqMan 3'-minor groove binder chemistry and were performed on both the rapid-cycling Roche LightCycler and the Cepheid Smart Cycler platforms. The hemagglutinin (HA) J7R, B9R, and B10R genes were used as targets for the variola virus-specific assays, and the HA and DNA polymerase-E9L genes were used as targets for the pan-orthopox virus assays. The five orthopox virus assays were tested against a panel of orthopox virus DNAs (both genomic and cloned) at the U.S. Army Medical Research Institute of Infectious Diseases (USAMRIID). The results indicated that each assay was capable of detecting both the appropriate cloned gene and genomic DNA. The assays showed no cross-reactivity to the 78 DNAs in the USAMRIID bacterial cross-reactivity panel. The limit of detection (LOD) of each assay was determined to be between 12 and 25 copies of target DNA. The assays were also run against a blind panel of DNAs at the Centers for Disease Control and Prevention (CDC) on both the LightCycler and the Smart Cycler. The panel consisted of eight different variola virus isolates, five non-variola virus orthopox virus isolates, two varicella-zoster virus isolates, and one herpes simplex virus isolate. Each sample was tested in triplicate at 2.5 ng, 25 pg, 250 fg, and 2.5 fg, which represent 1.24 x 10(7), 1.24 x 10(5), 1.24 x 10(3), and 1.24 x 10(1) genome equivalents, respectively. The results indicated that each of the five assays was 100% specific (no false positives) when tested against both the USAMRIID panels and the CDC blind panel. With the CDC blind panel, the LightCycler was capable of detecting 96.2% of the orthopox virus DNAs and 93.8% of the variola virus DNAs. The Smart Cycler was capable of detecting 92.3% of the orthopox virus DNAs and between 75 and 93.8% of the variola virus DNAs. However, all five assays had nearly 100% sensitivity on both machines with samples above the LOD (>12 gene copies). These real-time PCR assays represent a battery of tests to screen for and confirm the presence of variola virus DNA. The early detection of a smallpox outbreak is crucial whether the incident is an act of bioterrorism or an accidental occurrence.

Species-Specific Detection and Identification of Fusarium Species Complex, the Causal Agent of Sugarcane Pokkah Boeng in China

PubMed Central

Que, Youxiong; Wang, Jihua; Comstock, Jack C.; Wei, Jinjin; McCord, Per H.; Chen, Baoshan; Chen, Rukai; Zhang, Muqing

2014-01-01

Background Pokkah boeng disease caused by the Fusarium species complex results in significant yield losses in sugarcane. Thus, the rapid and accurate detection and identification of the pathogen is urgently required to manage and prevent the spreading of sugarcane pokkah boeng. Methods A total of 101 isolates were recovered from the pokkah boeng samples collected from five major sugarcane production areas in China throughout 2012 and 2013. The causal pathogen was identified by morphological observation, pathogenicity test, and phylogenetic analysis based on the fungus-conserved rDNA-ITS. Species-specific TaqMan real-time PCR and conventional PCR methods were developed for rapid and accurate detection of the causal agent of sugarcane pokkah boeng. The specificity and sensitivity of PCR assay were also evaluated on a total of 84 isolates of Fusarium from China and several isolates from other fungal pathogens of Sporisorium scitamineum and Phoma sp. and sugarcane endophyte of Acremonium sp. Result Two Fusarium species (F. verticillioides and F. proliferatum) that caused sugarcane pokahh boeng were identified by morphological observation, pathogenicity test, and phylogenetic analysis. Species-specific TaqMan PCR and conventional PCR were designed and optimized to target their rDNA-ITS regions. The sensitivity of the TaqMan PCR was approximately 10 pg of fungal DNA input, which was 1,000-fold over conventional PCR, and successfully detected pokkah boeng in the field-grown sugarcane. Conclusions/Significance This study was the first to identify two species, F. verticillioides and F. proliferatum, that were causal pathogens of sugarcane pokkah boeng in China. It also described the development of a species-specific PCR assay to detect and confirm these pathogens in sugarcane plants from mainland China. This method will be very useful for a broad range of research endeavors as well as the regulatory response and management of sugarcane pokkah boeng. PMID:25141192

Melt Analysis of Mismatch Amplification Mutation Assays (Melt-MAMA): A Functional Study of a Cost-Effective SNP Genotyping Assay in Bacterial Models

PubMed Central

Birdsell, Dawn N.; Pearson, Talima; Price, Erin P.; Hornstra, Heidie M.; Nera, Roxanne D.; Stone, Nathan; Gruendike, Jeffrey; Kaufman, Emily L.; Pettus, Amanda H.; Hurbon, Audriana N.; Buchhagen, Jordan L.; Harms, N. Jane; Chanturia, Gvantsa; Gyuranecz, Miklos; Wagner, David M.; Keim, Paul S.

2012-01-01

Single nucleotide polymorphisms (SNPs) are abundant in genomes of all species and biologically informative markers extensively used across broad scientific disciplines. Newly identified SNP markers are publicly available at an ever-increasing rate due to advancements in sequencing technologies. Efficient, cost-effective SNP genotyping methods to screen sample populations are in great demand in well-equipped laboratories, but also in developing world situations. Dual Probe TaqMan assays are robust but can be cost-prohibitive and require specialized equipment. The Mismatch Amplification Mutation Assay, coupled with melt analysis (Melt-MAMA), is flexible, efficient and cost-effective. However, Melt-MAMA traditionally suffers from high rates of assay design failures and knowledge gaps on assay robustness and sensitivity. In this study, we identified strategies that improved the success of Melt-MAMA. We examined the performance of 185 Melt-MAMAs across eight different pathogens using various optimization parameters. We evaluated the effects of genome size and %GC content on assay development. When used collectively, specific strategies markedly improved the rate of successful assays at the first design attempt from ∼50% to ∼80%. We observed that Melt-MAMA accurately genotypes across a broad DNA range (∼100 ng to ∼0.1 pg). Genomic size and %GC content influence the rate of successful assay design in an independent manner. Finally, we demonstrated the versatility of these assays by the creation of a duplex Melt-MAMA real-time PCR (two SNPs) and conversion to a size-based genotyping system, which uses agarose gel electrophoresis. Melt-MAMA is comparable to Dual Probe TaqMan assays in terms of design success rate and accuracy. Although sensitivity is less robust than Dual Probe TaqMan assays, Melt-MAMA is superior in terms of cost-effectiveness, speed of development and versatility. We detail the parameters most important for the successful application of Melt-MAMA, which should prove useful to the wider scientific community. PMID:22438886

Quantification of Paratrichodorus allius in DNA extracted from soil using TaqMan probe and SYBR green real-time PCR assays

USDA-ARS?s Scientific Manuscript database

The ectoparasitic stubby root nematode Paratrichodorus allius transmits Tobacco rattle virus, which causes corky ringspot disease resulting in significant economic losses in the potato industry. This study developed a diagnostic method for direct quantification of P. allius from soil DNA using a Taq...

Development of a rapid, sensitive TaqMan real-time RT-PCR assay for the detection of Rose rosette virus using multiple gene targets.

PubMed

Babu, Binoy; Jeyaprakash, Ayyamperumal; Jones, Debra; Schubert, Timothy S; Baker, Carlye; Washburn, Brian K; Miller, Steven H; Poduch, Kristina; Knox, Gary W; Ochoa-Corona, Francisco M; Paret, Mathews L

2016-09-01

Rose rosette virus (RRV), belonging to the genus Emaravirus, is a highly destructive pathogen that causes rose rosette disease. The disease is a major concern for the rose industry in the U.S. due to the lack of highly sensitive methods for early detection of RRV. This is critical, as early identification of the infected plants and eradication is necessary in minimizing the risks associated with the spread of the disease. A highly reliable, specific and sensitive detection assay is thus required to test and confirm the presence of RRV in suspected plant samples. In this study a TaqMan real-time reverse transcription-polymerase chain reaction (RT-PCR) assay was developed for the detection of RRV from infected roses, utilizing multiple gene targets. Four pairs of primers and probes; two of them (RRV_2-1 and RRV_2-2) based on the consensus sequences of the glycoprotein gene (RNA2) and the other two (RRV_3-2 and RRV_3-5) based on the nucleocapsid gene (RNA3) were designed. The specificity of the primers and probes was evaluated against other representative viruses infecting roses, belonging to the genera Alfamovirus, Cucumovirus, Ilarvirus, Nepovirus, Tobamovirus, and Tospovirus and one Emaravirus (Wheat mosaic virus). Dilution assays using the in vitro transcripts (spiked with total RNA from healthy plants, and non-spiked) showed that all the primers and probes are highly sensitive in consistently detecting RRV with a detection limit of 1 fg. Testing of the infected plants over a period of time (three times in monthly intervals) indicated high reproducibility, with the primer/probe RRV_3-5 showing 100% positive detection, while RRV_2-1, RRV_2-2 and RRV_3-2 showed 90% positive detection. The developed real-time RT-PCR assay is reliable, highly sensitive, and can be easily used in diagnostic laboratories for testing and confirmation of RRV. Copyright © 2016 Elsevier B.V. All rights reserved.

A pilot evaluation of whole blood finger-prick sampling for point-of-care HIV viral load measurement: the UNICORN study.

PubMed

Fidler, Sarah; Lewis, Heather; Meyerowitz, Jodi; Kuldanek, Kristin; Thornhill, John; Muir, David; Bonnissent, Alice; Timson, Georgina; Frater, John

2017-10-20

There is a global need for HIV viral load point-of-care (PoC) assays to monitor patients receiving antiretroviral therapy. UNICORN was the first study of an off-label protocol using whole blood finger-prick samples tested with and without a simple three minute spin using a clinic-room microcentrifuge. Two PoC assays were evaluated in 40 HIV-positive participants, 20 with detectable and 20 with undetectable plasma viral load (pVL) (<20 copies/ml). Using 100 µl finger-prick blood samples, the Cepheid Xpert HIV-1 Viral Load and HIV-1 Qual cartridges were compared with laboratory pVL assessment (TaqMan, Roche). For participants with undetectable viraemia by TaqMan, there was poor concordance without centrifugation with the TaqMan platform with only 40% 'undetectable' using Xpert VL and 25% 'not detected' using the Qual assay. After a 3 minute spin, 100% of samples were undetectable using either assay, showing full concordance with the TaqMan assay. Defining a lower limit of detection of 1000 copies/ml when including a spin, there was 100% concordance with the TaqMan platform with strong correlation (rho 0.95 and 0.94; p < 0.0001 for both assays). When including a simple microcentrifugation step, finger-prick PoC testing was a quick and accurate approach for assessing HIV viraemia, with excellent concordance with validated laboratory approaches.

Vitamin D receptor gene polymorphisms and risk of polycystic ovary syndrome in South Indian women.

PubMed

Siddamalla, Swapna; Reddy, Tumu Venkat; Govatati, Suresh; Erram, Nagendram; Deenadayal, Mamata; Shivaji, Sisinthy; Bhanoori, Manjula

2018-02-01

Polycystic ovary syndrome (PCOS) is the most common endocrine disorder of reproductive age women. Emerging evidence suggests that Vitamin D Receptor (VDR) might be a causal factor for characteristics associated with PCOS such as obesity and type 2 diabetes. Present study investigated association between VDR gene BsmI A/G (rs1544410), ApaI A/C (rs7975232) and TaqI T/C (rs731236) single nucleotide polymorphisms and PCOS risk in South Indian women. Genotyping of VDR gene SNPs was carried out in PCOS patients (n = 95) and controls (n = 130) by PCR-RFLP method and confirmed by sequencing analysis. Haplotype frequencies for multiple loci and the standardized disequilibrium coefficient (D') for pairwise linkage disequilibrium (LD) were assessed by Haploview software. Results showed significantly increased frequencies of BsmI G/G (p = .0197), ApaI C/C (p = .048), TaqI C/C (p = .044) genotypes and BsmI G (p = .0181), ApaI C (p = .0092), TaqI C (p = .0066) alleles in patients compared to controls. In addition, the frequency of the 'BsmI G, ApaI C, TaqI C' haplotype was also significantly elevated in patients (p = .0087). In conclusion, the VDR gene BsmI A/G ApaI A/C TaqI T/C and haplotype may constitute an inheritable risk factor for PCOS in South Indian women.

An intra-laboratory cultural and real-time PCR method comparison and evaluation for the detection of subclinical paratuberculosis in dairy herds.

PubMed

Heuvelink, Annet; Hassan, Abdulwahed Ahmed; van Weering, Hilmar; van Engelen, Erik; Bülte, Michael; Akineden, Ömer

2017-05-01

Mycobacterium avium subsp. paratuberculosis (MAP) is a vigorous microorganism which causes incurable chronic enteritis, Johne's disease (JD) in cattle. A target of control programmes for JD is to accurately detect MAP-infected cattle early to reduce disease transmission. The present study evaluated the efficacy of two different cultural procedures and a TaqMan real-time PCR assay for detection of subclinical paratuberculosis in dairy herds. Therefore, sixty-one faecal samples were collected from two Dutch dairy herds (n = 40 and n = 21, respectively) which were known to be MAP-ELISA positive. All individual samples were assessed using two different cultural protocols in two different laboratories. The first cultural protocol (first laboratory) included a decontamination step with 0.75% hexadecylpyridinium chloride (HPC) followed by inoculation on Herrold's egg yolk media (HEYM). The second protocol (second laboratory) comprised of a decontamination step using 4% NaOH and malachite green-oxalic acid followed by inoculation on two media, HEYM and in parallel on modified Löwenstein-Jensen media (mLJ). For the TaqMan real-time PCR assay, all faecal samples were tested in two different laboratories using TaqMan® MAP (Johne's) reagents (Life Technologies). The cultural procedures revealed positive reactions in 1.64% of the samples for cultivation protocol 1 and 6.56 and 8.20% of the samples for cultivation protocol 2, respectively. The results of the TaqMan real-time PCR performed in two different laboratories yielded 13.11 and 19.76% positive reaction. The kappa test showed proportional agreement 0.54 between the mLJ media (second laboratory) and TaqMan® real-time PCR method (second laboratory). In conclusion, the TaqMan real-time PCR could be a strongly useful and efficient assay for the detection of subclinical paratuberculosis in dairy cattle leading to an improvement in the efficiency of MAP control strategies.

Quantification of M13 and T7 bacteriophages by TaqMan and SYBR green qPCR.

PubMed

Peng, Xiujuan; Nguyen, Alex; Ghosh, Debadyuti

2018-02-01

TaqMan and SYBR Green quantitative PCR (qPCR) methods were developed as DNA-based approaches to reproducibly enumerate M13 and T7 phages from phage display selection experiments individually and simultaneously. The genome copies of M13 and T7 phages were quantified by TaqMan or SYBR Green qPCR referenced against M13 and T7 DNA standard curves of known concentrations. TaqMan qPCR was capable of quantifying M13 and T7 phage DNA simultaneously with a detection range of 2.75*10 1 -2.75*10 8 genome copies(gc)/μL and 2.66*10 1 -2.66*10 8 genome copies(gc)/μL respectively. TaqMan qPCR demonstrated an efficient amplification efficiency (E s ) of 0.97 and 0.90 for M13 and T7 phage DNA, respectively. SYBR Green qPCR was ten-fold more sensitive than TaqMan qPCR, able to quantify 2.75-2.75*10 7 gc/μL and 2.66*10 1 -2.66*10 7 gc/μL of M13 and T7 phage DNA, with an amplification efficiency E s of 1.06 and 0.78, respectively. Due to its superior sensitivity, SYBR Green qPCR was used to enumerate M13 and T7 phage display clones selected against a cell line, and quantified titers demonstrated accuracy comparable to titers from traditional double-layer plaque assay. Compared to enzyme linked immunosorbent assay, both qPCR methods exhibited increased detection sensitivity and reproducibility. These qPCR methods are reproducible, sensitive, and time-saving to determine their titers and to quantify a large number of phage samples individually or simultaneously, thus avoiding the need for time-intensive double-layer plaque assay. These findings highlight the attractiveness of qPCR for phage enumeration for applications ranging from selection to next-generation sequencing (NGS). Copyright © 2017 Elsevier B.V. All rights reserved.

Comparison of allelic discrimination by dHPLC, HRM, and TaqMan in the detection of BRAF mutation V600E.

PubMed

Carbonell, Pablo; Turpin, María C; Torres-Moreno, Daniel; Molina-Martínez, Irene; García-Solano, José; Perez-Guillermo, Miguel; Conesa-Zamora, Pablo

2011-09-01

The V600E mutation in the BRAF oncogene is associated with colorectal carcinomas, with mismatch-repair deficiency and, recently, with nonresponse to epidermal growth factor receptor inhibitor therapy. The use of reliable techniques for its detection is important. The aim of our study was to compare the performance characteristics in V600E detection of denaturing high-performance liquid chromatography (dHPLC) and high-resolution melting (HRM) with TaqMan allelic discrimination as well as direct-sequencing methods in a series of 195 colorectal paraffin-embedded specimens up to the age of 15 years. The effectiveness for obtaining results on mutation status was best using TaqMan (96.9%), followed by dHPLC (93.3%), HRM (88.7%), and sequencing (88.2%). In general, TaqMan was best for analyzing older tissues, whereas sequencing was the least efficient. Heterozygotic V600E was detected in 11.6%, 9.9%, 11.6%, and 9.9% of tissues using TaqMan, dHPLC, HRM, and sequencing, respectively. Result concordances between dHPLC and TaqMan or sequencing were excellent (κ = 0.9411 and κ = 0.8988, respectively); for HRM, the concordances were good (κ = 0.7973 and κ = 0.7488, respectively). By using DNA dilutions from tumor tissue, a minimum of 10% of V600E harboring cancer content was required for the analysis by dHPLC and HRM. dHPLC could detect four non-V600E mutations, whereas HRM detected one. Our results indicate that dHPLC and HRM are techniques that can be reliably used for the detection of the BRAFV600E mutation in archival paraffin-embedded tissues. Copyright © 2011 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

Rapid and Reliable Genotyping of HLA-B*57:01 in Four Chinese Populations Using a Single-Tube Duplex Real-Time Polymerase Chain Reaction Assay.

PubMed

Han, Min; Kang, Xing; Liu, Zhengbin; Zhang, Tingting; Li, Yanwei; Chen, Chao; Wang, Huijuan

2017-07-01

HLA-B*57:01 is strongly associated with severe adverse drug reaction induced by the anti-HIV drug abacavir (ABC) and antibiotic flucloxacillin. This study was dedicated to establishing a new method for HLA-B*57:01 genotyping and investigating the HLA-B*57:01 distribution pattern in four Chinese populations. A single-tube duplex real-time polymerase chain reaction (PCR) system was established by combining the amplification refractory mutation system and TaqMan probe. The reliability of this assay was validated by comparing the genotyping results with those by sequence-based typing. With this assay, the distribution of HLA-B*57:01 in 354 blood samples from four ethnic groups, namely, Han, Tibetan, Uighur, and Buyei, was determined. A 100% concordance was observed between the results of real-time PCR and sequence-based typing in 50 Uighur samples. As low as 0.016 ng DNA that carried HLA-B*57:01 could be detected with this assay. HLA-B*57:01 carriers identified in 100 Northern Han Chinese, 104 Buyeis, 100 Tibetans, and 50 Uighurs were 0, 1 (0.96%), 3 (3%), and 6 (12%), respectively. The carrier rate of HLA-B*57:01 in Uighur was significantly higher than those in Northern Han (p = .001) and Buyei (p = .005). The newly established real-time PCR assay provides a rapid and reliable tool for HLA-B*57:01 allele screening before the prescription of ABC and flucloxacillin in clinical practice.

Development and Evaluation of a Multiplex Real-Time Polymerase Chain Reaction Procedure to Clinically Type Prevalent Salmonella enterica Serovars

PubMed Central

Muñoz, Nélida; Diaz-Osorio, Miguel; Moreno, Jaime; Sánchez-Jiménez, Miryan; Cardona-Castro, Nora

2010-01-01

A multiplex real-time polymerase chain reaction procedure was developed to identify the most prevalent clinical isolates of Salmonella enterica subsp. enterica. Genes from the rfb, fliC, fljB, and viaB groups that encode the O, H, and Vi antigens were used to design 15 primer pairs and TaqMan probes specific for the genes rfbJ, wzx, fliC, fljB, wcdB, the sdf-l sequence, and invA, which was used as an internal amplification control. The primers and probes were variously combined into six sets. The first round of reactions used two of these sets to detect Salmonella O:4, O:9, O:7, O:8, and O:3,10 serogroups. Once the serogroups were identified, the results of a second round of reactions that used primers and probes for the flagellar antigen l genes, 1,2; e,h; g,m; d; e,n,x; and z10, and the Vi gene were used to identify individual serovars. The procedure was standardized using 18 Salmonella reference strains and other enterobacteria. The procedure's reliability and sensitivity was evaluated using 267 randomly chosen serotyped Salmonella clinical isolates. The procedure had a sensitivity of 95.5% and was 100% specific. Thus, our technique is a quick, sensitive, reliable, and specific means of identifying S. enterica serovars and can be used in conjunction with traditional serotyping. Other primer and probe combinations could be used to increase the number of identifiable serovars. PMID:20110454

Real-Time Reverse-Transcription Quantitative Polymerase Chain Reaction Assay Is a Feasible Method for the Relative Quantification of Heregulin Expression in Non-Small Cell Lung Cancer Tissue.

PubMed

Kristof, Jessica; Sakrison, Kellen; Jin, Xiaoping; Nakamaru, Kenji; Schneider, Matthias; Beckman, Robert A; Freeman, Daniel; Spittle, Cindy; Feng, Wenqin

2017-01-01

In preclinical studies, heregulin ( HRG ) expression was shown to be the most relevant predictive biomarker for response to patritumab, a fully human anti-epidermal growth factor receptor 3 monoclonal antibody. In support of a phase 2 study of erlotinib ± patritumab in non-small cell lung cancer (NSCLC), a reverse-transcription quantitative polymerase chain reaction (RT-qPCR) assay for relative quantification of HRG expression from formalin-fixed paraffin-embedded (FFPE) NSCLC tissue samples was developed and validated and described herein. Test specimens included matched FFPE normal lung and NSCLC and frozen NSCLC tissue, and HRG -positive and HRG -negative cell lines. Formalin-fixed paraffin-embedded tissue was examined for functional performance. Heregulin distribution was also analyzed across 200 NSCLC commercial samples. Applied Biosystems TaqMan Gene Expression Assays were run on the Bio-Rad CFX96 real-time PCR platform. Heregulin RT-qPCR assay specificity, PCR efficiency, PCR linearity, and reproducibility were demonstrated. The final assay parameters included the Qiagen FFPE RNA Extraction Kit for RNA extraction from FFPE NSCLC tissue, 50 ng of RNA input, and 3 reference (housekeeping) genes ( HMBS, IPO8 , and EIF2B1 ), which had expression levels similar to HRG expression levels and were stable among FFPE NSCLC samples. Using the validated assay, unimodal HRG distribution was confirmed across 185 evaluable FFPE NSCLC commercial samples. Feasibility of an RT-qPCR assay for the quantification of HRG expression in FFPE NSCLC specimens was demonstrated.

The Influence of Genetic and Environmental Factors among MDMA Users in Cognitive Performance

PubMed Central

Cuyàs, Elisabet; Verdejo-García, Antonio; Fagundo, Ana Beatriz; Khymenets, Olha; Rodríguez, Joan; Cuenca, Aida; de Sola Llopis, Susana; Langohr, Klaus; Peña-Casanova, Jordi; Torrens, Marta; Martín-Santos, Rocío; Farré, Magí; de la Torre, Rafael

2011-01-01

This study is aimed to clarify the association between MDMA cumulative use and cognitive dysfunction, and the potential role of candidate genetic polymorphisms in explaining individual differences in the cognitive effects of MDMA. Gene polymorphisms related to reduced serotonin function, poor competency of executive control and memory consolidation systems, and high enzymatic activity linked to bioactivation of MDMA to neurotoxic metabolites may contribute to explain variations in the cognitive impact of MDMA across regular users of this drug. Sixty ecstasy polydrug users, 110 cannabis users and 93 non-drug users were assessed using cognitive measures of Verbal Memory (California Verbal Learning Test, CVLT), Visual Memory (Rey-Osterrieth Complex Figure Test, ROCFT), Semantic Fluency, and Perceptual Attention (Symbol Digit Modalities Test, SDMT). Participants were also genotyped for polymorphisms within the 5HTT, 5HTR2A, COMT, CYP2D6, BDNF, and GRIN2B genes using polymerase chain reaction and TaqMan polymerase assays. Lifetime cumulative MDMA use was significantly associated with poorer performance on visuospatial memory and perceptual attention. Heavy MDMA users (>100 tablets lifetime use) interacted with candidate gene polymorphisms in explaining individual differences in cognitive performance between MDMA users and controls. MDMA users carrying COMT val/val and SERT s/s had poorer performance than paired controls on visuospatial attention and memory, and MDMA users with CYP2D6 ultra-rapid metabolizers performed worse than controls on semantic fluency. Both MDMA lifetime use and gene-related individual differences influence cognitive dysfunction in ecstasy users. PMID:22110616

Rapid polymerase chain reaction-based screening assay for bacterial biothreat agents.

PubMed

Yang, Samuel; Rothman, Richard E; Hardick, Justin; Kuroki, Marcos; Hardick, Andrew; Doshi, Vishal; Ramachandran, Padmini; Gaydos, Charlotte A

2008-04-01

To design and evaluate a rapid polymerase chain reaction (PCR)-based assay for detecting Eubacteria and performing early screening for selected Class A biothreat bacterial pathogens. The authors designed a two-step PCR-based algorithm consisting of an initial broad-based universal detection step, followed by specific pathogen identification targeted for identification of the Class A bacterial biothreat agents. A region in the bacterial 16S rRNA gene containing a highly variable sequence flanked by clusters of conserved sequences was chosen as the target for the PCR assay design. A previously described highly conserved region located within the 16S rRNA amplicon was selected as the universal probe (UniProbe, Integrated DNA Technology, Coralville, IA). Pathogen-specific TaqMan probes were designed for Bacillus anthracis, Yersinia pestis, and Francisella tularensis. Performance of the assay was assessed using genomic DNA extracted from the aforementioned biothreat-related organisms (inactivated or surrogate) and other common bacteria. The UniProbe detected the presence of all tested Eubacteria (31/31) with high analytical sensitivity. The biothreat-specific probes accurately identified organisms down to the closely related species and genus level, but were unable to discriminate between very close surrogates, such as Yersinia philomiragia and Bacillus cereus. A simple, two-step PCR-based assay proved capable of both universal bacterial detection and identification of select Class A bacterial biothreat and biothreat-related pathogens. Although this assay requires confirmatory testing for definitive species identification, the method has great potential for use in ED-based settings for rapid diagnosis in cases of suspected Category A bacterial biothreat agents.

Detection of norovirus (GI, GII), Sapovirus and astrovirus in fecal samples using reverse transcription single-round multiplex PCR.

PubMed

Yan, Hainian; Yagyu, Fumihiro; Okitsu, Shoko; Nishio, Osamu; Ushijima, Hiroshi

2003-12-01

A reverse transcription (RT) single-round multiplex polymerase chain reaction (smPCR) assay was developed to detect simultaneously Norovirus genogroup I and II, Sapovirus and astrovirus. A total of 377 diarrhea stool samples (screened for rotavirus- and adenorivus-negative) from four regions in Japan during July 2000 to June 2001 were examined by RT-smPCR. The positive rate was 16.4% (62 out of 377 stool samples). Norovirus, Sapovirus and astrovirus were detected in 42, 16, 4 of 60 positive samples, respectively. Coinfection was not found in these samples. Infections occurred mainly in November, December and January. The key elements of the RT-smPCR are (i) the cDNA synthesis with the Superscript RTII and random primer at 42 degrees C for 1 h, at 99 degrees C for 5 min, and (ii) single-round multiplex PCR by using Taq polymerase mixed together with a mixture of four different primer pairs (G1-SKF/G1-SKR for Norovirus genogroup I, COG2F/G2-SKR for Norovirus genogroup II, SLV5317/SLV5749 for Sapovirus, PreCAP1/82b for astrovirus). All of the four primer pairs amplify the capsid region of target viral genome, produce four size-specific amplicons of 330, 387, 434, 719 bp for Norovirus genogroup I and II, Sapovirus and astrovirus, respectively. This assay provides a more rapid and efficient way to detect these viruses from fecal samples in a single test, and also offers the potential for their molecular detection in food and environmental samples.

Molecular Characterization of Hypoderma SPP. in Domestic Ruminants from Turkey and Pakistan.

PubMed

Ahmed, Haroon; Simsek, Sami; Saki, Cem Ecmel; Kesik, Harun Kaya; Kilinc, Seyma Gunyakti

2017-08-01

The aim of this study was to determine the morphological and molecular characterization of Hypoderma spp. in cattle and yak from provinces in Turkey and Pakistan. In total, 78 Hypoderma larvae were collected from slaughtered animals in Turkey and Pakistan from October 2015 to January 2016. Thirty-eight of these 78 Hypoderma larvae were morphologically classified as third instar larvae (L3s) of Hypoderma bovis, 37 were classified as Hypoderma lineatum, and 3 were classified as suspected or unidentified. The restriction enzyme TaqI was used to differentiate the Hypoderma spp. by polymerase chain reaction (PCR)-restriction fragment length polymorphism (RFLP). According to the sequences and the PCR-RFLP results, all larval samples from cattle from Turkey were classified as H. bovis, except for 1 sample classified as H. lineatum. All Hypoderma larvae from Pakistan were classified as H. lineatum from cattle and as Hypoderma sinense from yak. This study provides the first molecular characterization of H. lineatum (cattle) and H. sinense (yak) in Pakistan based on PCR-RFLP and sequencing results.

Sequence-specific "gene signatures" can be obtained by PCR with single specific primers at low stringency.

PubMed Central

Pena, S D; Barreto, G; Vago, A R; De Marco, L; Reinach, F C; Dias Neto, E; Simpson, A J

1994-01-01

Low-stringency single specific primer PCR (LSSP-PCR) is an extremely simple PCR-based technique that detects single or multiple mutations in gene-sized DNA fragments. A purified DNA fragment is subjected to PCR using high concentrations of a single specific oligonucleotide primer, large amounts of Taq polymerase, and a very low annealing temperature. Under these conditions the primer hybridizes specifically to its complementary region and nonspecifically to multiple sites within the fragment, in a sequence-dependent manner, producing a heterogeneous set of reaction products resolvable by electrophoresis. The complex banding pattern obtained is significantly altered by even a single-base change and thus constitutes a unique "gene signature." Therefore LSSP-PCR will have almost unlimited application in all fields of genetics and molecular medicine where rapid and sensitive detection of mutations and sequence variations is important. The usefulness of LSSP-PCR is illustrated by applications in the study of mutants of smooth muscle myosin light chain, analysis of a family with X-linked nephrogenic diabetes insipidus, and identity testing using human mitochondrial DNA. Images PMID:8127912

Lack of Association Between Polymorphisms in Dopa Decarboxylase and Dopamine Receptor-1 Genes With Childhood Autism in Chinese Han Population.

PubMed

Yu, Hong; Liu, Jun; Yang, Aiping; Yang, Guohui; Yang, Wenjun; Lei, Heyue; Quan, Jianjun; Zhang, Zengyu

2016-04-01

Genetic factors play an important role in childhood autism. This study is to determine the association of single-nucleotide polymorphisms in dopa decarboxylase (DDC) and dopamine receptor-1 (DRD1) genes with childhood autism, in a Chinese Han population. A total of 211 autistic children and 250 age- and gender-matched healthy controls were recruited. The severity of disease was determined by Children Autism Rating Scale scores. TaqMan Probe by real-time polymerase chain reaction was used to determine genotypes and allele frequencies of single-nucleotide polymorphism rs6592961 in DDC and rs251937 in DRD1. Case-control and case-only studies were respectively performed, to determine the contribution of both single-nucleotide polymorphisms to the predisposition of disease and its severity. Our results showed that there was no significant association of the genotypes and allele frequencies of both single-nucleotide polymorphisms concerning childhood autism and its severity. More studies with larger samples are needed to corroborate their predicting roles. © The Author(s) 2015.

Association of adiponectin gene polymorphism (+T45G) with acute coronary syndrome and circulating adiponectin levels.

PubMed

Rizk, Nasser M; El-Menyar, Ayman; Marei, Isra; Sameer, Maha; Musad, Tasneem; Younis, Dima; Farag, Fathi; Basem, Nora; Al-Ali, Khalid; Al Suwaidi, Jassim

2013-05-01

We investigated the association of adiponectin gene polymorphisms (+T45G and +G276T) and adiponectin levels with acute coronary syndrome (ACS) among Arabs in Qatar. A case-control study was performed in 142 Arab patients with ACS and 122 controls. Genotypes were determined using TaqMan real-time polymerase chain reaction assay. The TT, TG, and GG genotype frequencies of the T45G variant were significantly different among cases and controls (P = .023) but not significant for G276T genotypic frequencies. It was found that only the +45G allele was significantly associated with 3-fold increased risk of ACS (odds ratio = 2.77; 1.03-6.96; P = .043) among patients, using the genetic recessive model. Carriers of GG alleles had significantly lower adiponectin levels compared to TT/TG carriers of T45G in patients with ACS. The present study suggests that only T45G single-nucleotide polymorphism in the adiponectin gene is associated with higher odds for ACS events and has an effect on serum adiponectin levels among Arab populations.

Allelic inhibition of displacement activity: a simplified one tube allele-specific PCR for evaluation of ITPA polymorphisms.

PubMed

Galmozzi, E; Facchetti, F; Degasperi, E; Aghemo, A; Lampertico, P

2013-02-01

Recently, genome-wide association studies (GWAS) in patients with chronic hepatitis C virus (HCV) infection have identified two functional single nucleotide polymorphisms (SNPs) in the inosine triphosphatase (ITPA) gene, that are associated strongly and independently with hemolytic anemia in patients exposed to pegylated-interferon (Peg-IFN) plus ribavirin (RBV) combined therapy. Here has been developed a simplified allele discrimination polymerase chain reaction (PCR) assay named allelic inhibition of displacement activity (AIDA) for evaluation of ITPA polymorphisms. AIDA system relies on three unlabeled primers only, two outer common primers and one inner primer with allele-specific 3' terminus mismatch. DNA samples from 192 patients with chronic HCV infection were used to validate the AIDA system and results were compared with the gold standard TaqMan(®) SNP genotyping assay. Concordant data were obtained for all samples, granting for high specificity of the method. In conclusion, AIDA is a practical one-tube method to reproducibly and to assess accurately rs7270101 and rs1127354 ITPA SNPs. Copyright © 2012 Elsevier B.V. All rights reserved.

Real-time PCR (qPCR) primer design using free online software.

PubMed

Thornton, Brenda; Basu, Chhandak

2011-01-01

Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most commonly used fluorescent chemistries are SYBR® Green dyes and TaqMan®, Molecular Beacon or Scorpion probes. SYBR® Green is very simple to use and cost efficient. As SYBR® Green dye binds to any double-stranded DNA product, its success depends greatly on proper primer design. Many types of online primer design software are available, which can be used free of charge to design desirable SYBR® Green-based qPCR primers. This laboratory exercise is intended for those who have a fundamental background in PCR. It addresses the basic fluorescent chemistries of real-time PCR, the basic rules and pitfalls of primer design, and provides a step-by-step protocol for designing SYBR® Green-based primers with free, online software. Copyright © 2010 Wiley Periodicals, Inc.

Detection of Leptospiral DNA in the Urine of Donkeys on the Caribbean Island of Saint Kitts

PubMed Central

Grevemeyer, Bernard; Vandenplas, Michel; Beigel, Brittney; Cho, Ellen; Willingham, Arve Lee; Verma, Ashutosh

2017-01-01

Leptospirosis is a global zoonosis caused by pathogenic spirochetes classified within the genus Leptospira. Leptospires live in the proximal renal tubules of reservoir or chronic carrier animals, and are shed in the urine. Naïve animals acquire infection either when they come in direct contact with a reservoir or infected animals or by exposure to environmental surface water or soil that is contaminated with their urine. In this study, urine samples from a herd of donkeys on the Caribbean island of St. Kitts were screened using a TaqMan-based real-time quantitative polymerase chain reaction (qPCR) targeting a pathogen-specific leptospiral gene, lipl32. Out of 124 clinically normal donkeys, 22 (18%) tested positive for leptospiral DNA in their urine. Water samples from two water troughs used by the donkeys were also tested, but were found to be free from leptospiral contamination. Detection of leptospiral DNA in the urine of clinically healthy donkeys may point to a role that these animals play in the maintenance of the bacteria on St. Kitts. PMID:29056661

HCV viraemia in anti-HCV-negative haemodialysis patients: Do we need HCV RNA detection test?

PubMed

Papadopoulos, Nikolaos; Griveas, Ioannis; Sveroni, Eirini; Argiana, Vasiliki; Kalliaropoulos, Antonios; Martinez-Gonzalez, Beatriz; Deutsch, Melanie

2018-03-01

Hepatitis C virus (HCV) infection is still common among dialysis patients, but the natural history of HCV in this group is not completely understood. The KDIGO HCV guidelines of 2009 recommend that chronic haemodialysis patients be screened for HCV antibody upon admission to the dialysis clinic and every 6 months thereafter if susceptible to HCV infection. However, previous studies have shown the presence of HCV viraemia in anti-HCV-negative haemodialysis patients as up to 22%. To evaluate the presence of HCV viraemia, using HCV RNA detection, among anti-HCV-negative haemodialysis patients from a tertiary dialysis unit in Athens. We enrolled 41 anti-HCV-negative haemodialysis patients diagnosed with third-generation enzyme immunoassay. HCV viraemia was evaluated using a sensitive (cut-off: 12 IU/mL) reverse transcriptase polymerase chain reaction (COBAS AmpliPrep/TaqMan system) for HCV RNA. None of the 41 anti-HCV-negative haemodialysis patients were shown to be viraemic. Routine HCV RNA testing appears not to be necessary in anti-HCV-negative haemodialysis patients.

Real-time PCR array as a universal platform for the detection of genetically modified crops and its application in identifying unapproved genetically modified crops in Japan.

PubMed

Mano, Junichi; Shigemitsu, Natsuki; Futo, Satoshi; Akiyama, Hiroshi; Teshima, Reiko; Hino, Akihiro; Furui, Satoshi; Kitta, Kazumi

2009-01-14

We developed a novel type of real-time polymerase chain reaction (PCR) array with TaqMan chemistry as a platform for the comprehensive and semiquantitative detection of genetically modified (GM) crops. Thirty primer-probe sets for the specific detection of GM lines, recombinant DNA (r-DNA) segments, endogenous reference genes, and donor organisms were synthesized, and a 96-well PCR plate was prepared with a different primer-probe in each well as the real-time PCR array. The specificity and sensitivity of the array were evaluated. A comparative analysis with the data and publicly available information on GM crops approved in Japan allowed us to assume the possibility of unapproved GM crop contamination. Furthermore, we designed a Microsoft Excel spreadsheet application, Unapproved GMO Checker version 2.01, which helps process all the data of real-time PCR arrays for the easy assumption of unapproved GM crop contamination. The spreadsheet is available free of charge at http://cse.naro.affrc.go.jp/jmano/index.html .

Molecular Differentiation of Treponema pallidum Subspecies in Skin Ulceration Clinically Suspected as Yaws in Vanuatu Using Real-Time Multiplex PCR and Serological Methods

PubMed Central

Chi, Kai-Hua; Danavall, Damien; Taleo, Fasihah; Pillay, Allan; Ye, Tun; Nachamkin, Eli; Kool, Jacob L.; Fegan, David; Asiedu, Kingsley; Vestergaard, Lasse S.; Ballard, Ronald C.; Chen, Cheng-Yen

2015-01-01

We developed a TaqMan-based real-time quadriplex polymerase chain reaction (PCR) to simultaneously detect Treponema pallidum subspecies pallidum, T. pallidum subsp. pertenue, and T. pallidum subsp. endemicum, the causative agents of venereal syphilis, yaws, and bejel, respectively. The PCR assay was applied to samples from skin ulcerations of clinically presumptive yaws cases among children on Tanna Island, Vanuatu. Another real-time triplex PCR was used to screen for the point mutations in the 23S rRNA genes that have previously been associated with azithromycin resistance in T. pallidum subsp. pallidum strains. Seropositivity by the classical syphilis serological tests was 35.5% among children with skin ulcerations clinically suspected with yaws, whereas the presence of T. pallidum subsp. pertenue DNA was only found in lesions from 15.5% of children. No evidence of T. pallidum subsp. pertenue infection, by either PCR or serology was found in ∼59% of cases indicating alternative causes of yaws-like lesions in this endemic area. PMID:25404075

Development of real-time PCR for detection and quantitation of Streptococcus parauberis.

PubMed

Nguyen, T L; Lim, Y J; Kim, D-H; Austin, B

2016-01-01

Streptococcus parauberis is an increasing threat to aquaculture of olive flounder, Paralichthys olivaceus Temminck & Schlegel, in South Korea. We developed a real-time polymerase chain reaction (PCR) method using the TaqMan probe assay to detect and quantify S. parauberis by targeting the gyrB gene sequences, which are effective for molecular analysis of the genus Streptococcus. Our real-time PCR assay is capable of detecting 10 fg of genomic DNA per reaction. The intra- and interassay coefficient of variation (CV) values ranged from 0.42-1.95%, demonstrating that the assay has good reproducibility. There was not any cross-reactivity to Streptococcus iniae or to other streptococcal/lactococcal fish pathogens, such as S. agalactiae and Lactococcus garvieae, indicating that the assay is highly specific to S. parauberis. The results of the real-time PCR assay corresponded well to those of conventional culture assays for S. parauberis from inoculated tissue homogenates (r = 0.957; P < 0.05). Hence, this sensitive and specific real-time PCR is a valuable tool for diagnostic quantitation of S. parauberis in clinical samples. © 2014 John Wiley & Sons Ltd.

Optimization and evaluation of single-cell whole-genome multiple displacement amplification.

PubMed

Spits, C; Le Caignec, C; De Rycke, M; Van Haute, L; Van Steirteghem, A; Liebaers, I; Sermon, K

2006-05-01

The scarcity of genomic DNA can be a limiting factor in some fields of genetic research. One of the methods developed to overcome this difficulty is whole genome amplification (WGA). Recently, multiple displacement amplification (MDA) has proved very efficient in the WGA of small DNA samples and pools of cells, the reaction being catalyzed by the phi29 or the Bst DNA polymerases. The aim of the present study was to develop a reliable, efficient, and fast protocol for MDA at the single-cell level. We first compared the efficiency of phi29 and Bst polymerases on DNA samples and single cells. The phi29 polymerase generated accurately, in a short time and from a single cell, sufficient DNA for a large set of tests, whereas the Bst enzyme showed a low efficiency and a high error rate. A single-cell protocol was optimized using the phi29 polymerase and was evaluated on 60 single cells; the DNA obtained DNA was assessed by 22 locus-specific PCRs. This new protocol can be useful for many applications involving minute quantities of starting material, such as forensic DNA analysis, prenatal and preimplantation genetic diagnosis, or cancer research. (c) 2006 Wiley-Liss, Inc.

Evolution of thermophilic DNA polymerases for the recognition and amplification of C2ʹ-modified DNA

NASA Astrophysics Data System (ADS)

Chen, Tingjian; Hongdilokkul, Narupat; Liu, Zhixia; Adhikary, Ramkrishna; Tsuen, Shujian S.; Romesberg, Floyd E.

2016-06-01

The PCR amplification of oligonucleotides enables the evolution of sequences called aptamers that bind specific targets with antibody-like affinity. However, in many applications the use of these aptamers is limited by nuclease-mediated degradation. In contrast, oligonucleotides that are modified at their sugar C2ʹ positions with methoxy or fluorine substituents are stable to nucleases, but they cannot be synthesized by natural polymerases. Here we report the development of a polymerase-evolution system and its use to evolve thermostable polymerases that efficiently interconvert C2ʹ-OMe-modified oligonucleotides and their DNA counterparts via ‘transcription’ and ‘reverse transcription’ or, more importantly, that PCR-amplify partially C2ʹ-OMe- or C2ʹ-F-modified oligonucleotides. A mechanistic analysis demonstrates that the ability to amplify the modified oligonucleotides evolved by optimizing interdomain interactions that stabilize the catalytically competent closed conformation of the polymerase. The evolved polymerases should find practical applications and the developed evolution system should be a powerful tool for tailoring polymerases to have other types of novel function.

TaqMan Real-Time PCR Assays To Assess Arbuscular Mycorrhizal Responses to Field Manipulation of Grassland Biodiversity: Effects of Soil Characteristics, Plant Species Richness, and Functional Traits▿ †

PubMed Central

König, Stephan; Wubet, Tesfaye; Dormann, Carsten F.; Hempel, Stefan; Renker, Carsten; Buscot, François

2010-01-01

Large-scale (temporal and/or spatial) molecular investigations of the diversity and distribution of arbuscular mycorrhizal fungi (AMF) require considerable sampling efforts and high-throughput analysis. To facilitate such efforts, we have developed a TaqMan real-time PCR assay to detect and identify AMF in environmental samples. First, we screened the diversity in clone libraries, generated by nested PCR, of the nuclear ribosomal DNA internal transcribed spacer (ITS) of AMF in environmental samples. We then generated probes and forward primers based on the detected sequences, enabling AMF sequence type-specific detection in TaqMan multiplex real-time PCR assays. In comparisons to conventional clone library screening and Sanger sequencing, the TaqMan assay approach provided similar accuracy but higher sensitivity with cost and time savings. The TaqMan assays were applied to analyze the AMF community composition within plots of a large-scale plant biodiversity manipulation experiment, the Jena Experiment, primarily designed to investigate the interactive effects of plant biodiversity on element cycling and trophic interactions. The results show that environmental variables hierarchically shape AMF communities and that the sequence type spectrum is strongly affected by previous land use and disturbance, which appears to favor disturbance-tolerant members of the genus Glomus. The AMF species richness of disturbance-associated communities can be largely explained by richness of plant species and plant functional groups, while plant productivity and soil parameters appear to have only weak effects on the AMF community. PMID:20418424

Simultaneous detection and differentiation of three Potyviridae viruses by a multiplex TaqMan real time RT-PCR assay

USDA-ARS?s Scientific Manuscript database

A multiplex TaqMan real time RT-PCR was developed for detection and differentiation of Sweet potato virus G, Sweet potato latent virus and Sweet potato mild mottle virus in one tube. Amplification and detection of a fluorogenic cytochrome oxidase gene was included as an internal control. The assay w...

Attention and Attachment Related Behavior toward Professional Caregivers in Child Care Centers: A New Measure for Toddlers

ERIC Educational Resources Information Center

Pallini, Susanna; Laghi, Fiorenzo

2012-01-01

The authors attempted to develop and validate the Toddler Attention Questionnaire (TAQ) by examining the relationship between attention and attachment to a professional caregiver. The psychometric reliability and validity of the TAQ was tested with 72 children ranging from 20 to 36 months old. Attentive processes were also measured by the Italian…

Quantitative detection method of Enterocytozoon hepatopenaei using TaqMan probe real-time PCR.

PubMed

Liu, Ya-Mei; Qiu, Liang; Sheng, An-Zhi; Wan, Xiao-Yuan; Cheng, Dong-Yuan; Huang, Jie

2018-01-01

A TaqMan probe and a pair of specific primers were selected from the small subunit ribosomal DNA (SSU rDNA) sequence of Enterocytozoon hepatopenaei (EHP); this real-time PCR assay was developed and optimized. It showed a good linearity in detecting standards of EHP SSU rDNA fragments from 4 × 10 2 to 4 × 10 8 copies/reaction using the established method. The detection limit of the qPCR method was as low as 4 × 10 1 copies per reaction, which was higher than the conventional PCR and SYBR Green I-based EHP qPCR reported. Using the qPCR assay, EHP was detected in four batches of slow-growing Penaeus vannamei specimens collected from Tianjin and Zhejiang Province in China was detected using qPCR. The results showed that all the hepatopancreas from the slow-growing P. vannamei specimens were detected as EHP-positive. EHP copies of hepatopancreas in some batches had a negative correlation with the body mass index (BMI) of shrimps; however, not all batches of specimens had this negative correlation between EHP copies of hepatopancreas and BMI. This qPCR technique is sensitive, specific and easy to perform (96 tests in <3 h), which provides technical support for the detection and prevention of EHP. Copyright © 2017 Elsevier Inc. All rights reserved.

Pseudomonas aeruginosa phage PaP1 DNA polymerase is an A-family DNA polymerase demonstrating ssDNA and dsDNA 3'-5' exonuclease activity.

PubMed

Liu, Binyan; Gu, Shiling; Liang, Nengsong; Xiong, Mei; Xue, Qizhen; Lu, Shuguang; Hu, Fuquan; Zhang, Huidong

2016-08-01

Most phages contain DNA polymerases, which are essential for DNA replication and propagation in infected host bacteria. However, our knowledge on phage-encoded DNA polymerases remains limited. This study investigated the function of a novel DNA polymerase of PaP1, which is the lytic phage of Pseudomonas aeruginosa. PaP1 encodes its sole DNA polymerase called Gp90 that was predicted as an A-family DNA polymerase with polymerase and 3'-5' exonuclease activities. The sequence of Gp90 is homologous but not identical to that of other A-family DNA polymerases, such as T7 DNA polymerases (Pol) and DNA Pol I. The purified Gp90 demonstrated a polymerase activity. The processivity of Gp90 in DNA replication and its efficiency in single-dNTP incorporation are similar to those of T7 Pol with processive thioredoxin (T7 Pol/trx). Gp90 can degrade ssDNA and dsDNA in 3'-5' direction at a similar rate, which is considerably lower than that of T7 Pol/trx. The optimized conditions for polymerization were a temperature of 37 °C and a buffer consisting of 40 mM Tris-HCl (pH 8.0), 30 mM MgCl2, and 200 mM NaCl. These studies on DNA polymerase encoded by PaP1 help advance our knowledge on phage-encoded DNA polymerases and elucidate PaP1 propagation in infected P. aeruginosa.

Prediction of striatal D2 receptor binding by DRD2/ANKK1 TaqIA allele status

PubMed Central

Eisenstein, Sarah A.; Bogdan, Ryan; Love-Gregory, Latisha; Corral-Frías, Nadia S.; Koller, Jonathan M.; Black, Kevin J.; Moerlein, Stephen M.; Perlmutter, Joel S.; Barch, Deanna M.; Hershey, Tamara

2016-01-01

In humans, the A1 (T) allele of the dopamine (DA) D2 receptor/ankyrin repeat and kinase domain containing 1 (DRD2/ANKK1) TaqIA (rs1800497) single nucleotide polymorphism has been associated with reduced striatal DA D2/D3 receptor (D2/D3R) availability. However, radioligands used to estimate D2/D3R are displaceable by endogenous DA and are non-selective for D2R, leaving the relationship between TaqIA genotype and D2R specific binding uncertain. Using the positron emission tomography (PET) radioligand, (N‐[11C]methyl)benperidol ([11C]NMB), which is highly selective for D2R over D3R and is not displaceable by endogenous DA, the current study examined whether DRD2/ANKK1 TaqIA genotype predicts D2R specific binding in 2 independent samples. Sample 1 (n = 39) was composed of obese and non-obese adults; sample 2 (n = 18) was composed of healthy controls, unmedicated individuals with schizophrenia, and siblings of individuals with schizophrenia. Across both samples, A1 allele carriers (A1+) had 5-12% less striatal D2R specific binding relative to individuals homozygous for the A2 allele (A1−), regardless of body mass index or diagnostic group. This reduction is comparable to previous PET studies of D2/D3R availability (10-14%). The pooled effect size for the difference in total striatal D2R binding between A1+ and A1− was large (0.84). In summary, in line with studies using displaceable D2/D3R radioligands, our results indicate that DRD2/ANKK1 TaqIA allele status predicts striatal D2R specific binding as measured by D2R-selective [11C]NMB. These findings support the hypothesis that DRD2/ANKK1 TaqIA allele status may modify D2R, perhaps conferring risk for certain disease states. GRAPHICAL ABSTRACT We investigated the difference in striatal dopamine D2 receptor binding, as measured by PET with (N-[11C]methyl)benperidol ([11C]NMB), between A1 allele carriers (A1+) and individuals homozygous for the A2 allele (A1−) of the DRD2/ANKK1 TaqIA single nucleotide polymorphism. In Study 1, A1+ had 5-12% less striatal [11C]NMB binding than A1−. PMID:27241797

Human-Associated Bacteroides spp. and Human Polyomaviruses as Microbial Source Tracking Markers in Hawaii

PubMed Central

Caffaro-Filho, Roberto A.; Wong, Mayee; Harwood, Valerie J.; Moravcik, Philip; Fujioka, Roger S.

2016-01-01

ABSTRACT Identification of sources of fecal contaminants is needed to (i) determine the health risk associated with recreational water use and (ii) implement appropriate management practices to mitigate this risk and protect the environment. This study evaluated human-associated Bacteroides spp. (HF183TaqMan) and human polyomavirus (HPyV) markers for host sensitivity and specificity using human and animal fecal samples collected in Hawaii. The decay rates of those markers and indicator bacteria were identified in marine and freshwater microcosms exposed and not exposed to sunlight, followed by field testing of the usability of the molecular markers. Both markers were strongly associated with sewage, although the cross-reactivity of the HF183TaqMan (also present in 82% of canine [n = 11], 30% of mongoose [n = 10], and 10% of feline [n = 10] samples) needs to be considered. Concentrations of HF183TaqMan in human fecal samples exceeded those in cross-reactive animals at least 1,000-fold. In the absence of sunlight, the decay rates of both markers were comparable to the die-off rates of enterococci in experimental freshwater and marine water microcosms. However, in sunlight, the decay rates of both markers were significantly lower than the decay rate of enterococci. While both markers have their individual limitations in terms of sensitivity and specificity, these limitations can be mitigated by using both markers simultaneously; ergo, this study supports the concurrent use of HF183TaqMan and HPyV markers for the detection of sewage contamination in coastal and inland waters in Hawaii. IMPORTANCE This study represents an in-depth characterization of microbial source tracking (MST) markers in Hawaii. The distribution and concentrations of HF183TaqMan and HPyV markers in human and animal fecal samples and in wastewater, coupled with decay data obtained from sunlight-exposed and unexposed microcosms, support the concurrent application of HF183TaqMan and HPyV markers for sewage contamination detection in Hawaii waters. Both markers are more conservative and more specific markers of sewage than fecal indicator bacteria (enterococci and Escherichia coli). Analysis of HF183TaqMan (or newer derivatives) is recommended for inclusion in future epidemiological studies concerned with beach water quality, while better concentration techniques are needed for HPyV. Such epidemiological studies can be used to develop new recreational water quality criteria, which will provide direct information on the absence or presence of sewage contamination in water samples as well as reliable measurements of the risk of waterborne disease transmission to swimmers. PMID:27613686

Comparative diagnostic evaluation of OMP31 gene based TaqMan® real-time PCR assay with visual LAMP assay and indirect ELISA for caprine brucellosis.

PubMed

Saini, Suman; Gupta, V K; Gururaj, K; Singh, D D; Pawaiya, R V S; Gangwar, N K; Mishra, A K; Dwivedi, Deepak; Andani, Dimple; Kumar, Ashok; Goswami, T K

2017-08-01

Brucellosis is one of the leading causes of abortion in domestic animals that imposes costs on both economy and society. The disease is highly zoonotic and poses risk to animal handlers due to its zoonotic nature. It causes stillbirth, loss of kids and abortion in last term of pregnancy. Reproductive damage includes infertility in does and orchitis and epididymitis in breeding bucks, which result in high financial losses to farmers and the agriculture industry as a whole. It requires highly sensitive and specific assays to diagnose the disease at field level. In the current study, a visual loop-mediated isothermal amplification (LAMP) assay and the TaqMan® real-time PCR were developed with high sensitivity and specificity. For the TaqMan® probe, real-time PCR primers were developed using Omp31 gene as target and primers were designed using discontiguous conserved sequences of Omp31 gene. The Omp31 probes were designed by attaching 6-FAM reporter dye at the 5' end and BHQ-1 quencher at the 3' end. Published primers were used for visual LAMP assay targeting the Omp25 gene. Sensitivity of the standardized visual LAMP assay and TaqMan® real-time PCR assay was determined by serial dilution of positive Brucella melitensis DNA (10 2 to 10 -4  ng) obtained from standard culture. The TaqMan® probe real-time assay can detect as low as 100 fg of B. melitensis DNA, whereas culture from vaginal swab washings has a limit of detection (LOD) of only 1 cfu/ml. Similarly, the visual LAMP assay can detect as low as 10 fg of B. melitensis DNA as compared to an LOD of 30 cfu/ml from culture of vaginal swab washings. Both assays were compared with serological tests (serum tube agglutination test (STAT) and indirect enzyme-linked immunosorbent assay (iELISA)) for diagnostic sensitivity and specificity. Diagnostic sensitivities and specificities for TaqMan® real-time PCR vs. LAMP assays were 98 and 100% vs. 100 and 97.8%, respectively. Results of visual LAMP assay indicated that LAMP is a fast, specific, sensitive, inexpensive and suitable method for diagnosis of B. melitensis infection under field conditions. On the other hand, Omp31 TaqMan® probe real-time assay can be used in conjunction with the other field-based diagnostic tests due to its high specificity.

Development and comparison of TaqMan-based real-time PCR assays for detection and differentiation of Ralstonia solanacearum strains

USDA-ARS?s Scientific Manuscript database

Bacterial wilt caused by Ralstonia solanacearum is destructive to many plant species worldwide. The race 3 biovar 2 (r3b2) strains of R. solanacearum infect potatoes in temperature climates and are listed as select agents by the U.S. government. TaqMan-based real-time quantitative PCR (qPCR) is comm...

Association of vitamin D receptor BsmI, TaqI, FokI, and ApaI polymorphisms with susceptibility of chronic periodontitis: A systematic review and meta-analysis based on 38 case -control studies.

PubMed

Mashhadiabbas, Fatemeh; Neamatzadeh, Hossein; Nasiri, Rezvan; Foroughi, Elnaz; Farahnak, Soudabeh; Piroozmand, Parisa; Mazaheri, Mahta; Zare-Shehneh, Masoud

2018-01-01

There has been increasing interest in the study of the association between Vitamin D receptor (VDR) gene polymorphisms and risk of chronic periodontitis. However, the results remain inconclusive. To better understand the roles of VDR polymorphisms (BsmI, TaqI, FokI, and ApaI) in chronic periodontitis susceptibility, we conducted this systematic review and meta-analysis. The PubMed, Google Scholar, and Web of Science database were systemically searched to determine all the eligible studies about VDR polymorphisms and risk of chronic periodontitis up to April 2017. Odds ratio (OR) and 95% confidence interval (CI) were used to evaluate the associations between VDR polymorphisms and chronic periodontitis risk. All the statistical analyses were performed by Comprehensive Meta-Analysis. All P values were two-tailed with a significant level at 0.05. Finally, a total of 38 case-control studies in 19 publications were identified which met our inclusion criteria. There are ten studies with 866 chronic periodontitis cases and 786 controls for BsmI, 16 studies with 1570 chronic periodontitis cases and 1676 controls for TaqI, five studies with 374 chronic periodontitis cases and 382 controls for FokI, and seven studies with 632 chronic periodontitis cases and 604 controls for ApaI. Overall, no significant association was observed between VDR gene BsmI, TaqI, FokI, and ApaI polymorphisms and risk of chronic periodontitis in any genetic model. Subgroup analysis stratified by ethnicity suggested a significant association between BsmI polymorphism and chronic periodontitis risk in the Caucasian subgroup under allele model (A vs. G: OR = 1.747, 95% CI = 1.099-2.778, P = 0.018). Further, no significant associations were observed when stratified by Hardy-Weinberg equilibrium status for BsmI, TaqI, and ApaI. Our results suggest that BsmI, TaqI, FokI, and ApaI polymorphisms in the VDR gene might not be associated with risk of chronic periodontitis in overall population.

Association of vitamin D receptor BsmI, TaqI, FokI, and ApaI polymorphisms with susceptibility of chronic periodontitis: A systematic review and meta-analysis based on 38 case –control studies

PubMed Central

Mashhadiabbas, Fatemeh; Neamatzadeh, Hossein; Nasiri, Rezvan; Foroughi, Elnaz; Farahnak, Soudabeh; Piroozmand, Parisa; Mazaheri, Mahta; Zare-Shehneh, Masoud

2018-01-01

Background: There has been increasing interest in the study of the association between Vitamin D receptor (VDR) gene polymorphisms and risk of chronic periodontitis. However, the results remain inconclusive. To better understand the roles of VDR polymorphisms (BsmI, TaqI, FokI, and ApaI) in chronic periodontitis susceptibility, we conducted this systematic review and meta-analysis. Materials and Methods: The PubMed, Google Scholar, and Web of Science database were systemically searched to determine all the eligible studies about VDR polymorphisms and risk of chronic periodontitis up to April 2017. Odds ratio (OR) and 95% confidence interval (CI) were used to evaluate the associations between VDR polymorphisms and chronic periodontitis risk. All the statistical analyses were performed by Comprehensive Meta-Analysis. All P values were two-tailed with a significant level at 0.05. Results: Finally, a total of 38 case–control studies in 19 publications were identified which met our inclusion criteria. There are ten studies with 866 chronic periodontitis cases and 786 controls for BsmI, 16 studies with 1570 chronic periodontitis cases and 1676 controls for TaqI, five studies with 374 chronic periodontitis cases and 382 controls for FokI, and seven studies with 632 chronic periodontitis cases and 604 controls for ApaI. Overall, no significant association was observed between VDR gene BsmI, TaqI, FokI, and ApaI polymorphisms and risk of chronic periodontitis in any genetic model. Subgroup analysis stratified by ethnicity suggested a significant association between BsmI polymorphism and chronic periodontitis risk in the Caucasian subgroup under allele model (A vs. G: OR = 1.747, 95% CI = 1.099–2.778, P = 0.018). Further, no significant associations were observed when stratified by Hardy–Weinberg equilibrium status for BsmI, TaqI, and ApaI. Conclusion: Our results suggest that BsmI, TaqI, FokI, and ApaI polymorphisms in the VDR gene might not be associated with risk of chronic periodontitis in overall population. PMID:29922333

Q-PCR based bioburden assessment of drinking water throughout treatment and delivery to the International Space Station

NASA Technical Reports Server (NTRS)

Newcombe, David; Stuecker, Tara; La Duc, Myron; Venkateswaran, Kasthuri

2005-01-01

Previous studies indicated evidence of opportunistic pathogens samples obtained during missions to the International Space Station (ISS). This study utilized TaqMan quantitative PCR to determine specific gene abundance in potable and non-potable ISS waters. Probe and primer sets specific to the small subunit rRNA genes were used to elucidate overall bacterial rRNA gene numbers. while those specific for Burkholderia cepacia and Stenotrophomonas maltophilia were optimized and used to probe for the presence of these two opportunistic pathogens. This research builds upon previous microbial diversity studies of ISS water and demonstrates the utility of Q-PCR tool to examine water quality.

High sensitive RNA detection by one-step RT-PCR using the genetically engineered variant of DNA polymerase with reverse transcriptase activity from hyperthermophilies.

PubMed

Okano, Hiroyuki; Baba, Misato; Kawato, Katsuhiro; Hidese, Ryota; Yanagihara, Itaru; Kojima, Kenji; Takita, Teisuke; Fujiwara, Shinsuke; Yasukawa, Kiyoshi

2018-03-01

One-step RT-PCR has not been widely used even though some thermostable DNA polymerases with reverse transcriptase (RT) activity were developed from bacterial and archaeal polymerases, which is owing to low cDNA synthesis activity from RNA. In the present study, we developed highly-sensitive one-step RT-PCR using the single variant of family A DNA polymerase with RT activity, K4pol L329A (L329A), from the hyperthermophilic bacterium Thermotoga petrophila K4 or the 16-tuple variant of family B DNA polymerase with RT activity, RTX, from the hyperthermophilic archaeon Thermococcus kodakarensis. Optimization of reaction condition revealed that the activities for cDNA synthesis and PCR of K4pol L329A and RTX were highly affected by the concentrations of MgCl 2 and Mn(OCOCH 3 ) 2 as well as those of K4pol L329A or RTX. Under the optimized condition, 300 copies/μl of target RNA in 10 μl reaction volumes were successfully detected by the one-step RT-PCR with K4pol L329A or RTX, which was almost equally sensitive enough compared with the current RT-PCR condition using retroviral RT and thermostable DNA polymerase. Considering that K4pol L329A and RTX are stable even at 90-100°C, our results suggest that the one-step RT-PCR with K4pol L329A or RTX is more advantageous than the current one. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

A new TaqMan method for the reliable diagnosis of Ehrlichia spp. in canine whole blood.

PubMed

Thomson, Kirsty; Yaaran, Tal; Belshaw, Alex; Curson, Lucia; Tisi, Laurence; Maurice, Sarah; Kiddle, Guy

2018-06-18

Ehrlichiosis is an important emerging infectious disease of the canid family and humans worldwide. To date, no extensive evaluation or validation of a molecular diagnostic test for ehrlichiosis has been published. Here, we present data for a newly designed TaqMan assay and compare its performance to a commercial technology (PCRun®). Both of these real-time methods of analysis were evaluated using a comprehensive number of prospective and retrospective samples collected from dogs exhibiting symptoms of ehrlichiosis. Whole blood samples collected from dogs, retrospectively in the United Kingdom and prospectively in Israel, were analysed for the presence of Ehrlichia canis and Ehrlichia minasensis DNA using the TaqMan PCR, developed specifically for this study. The results were compared to those of a real time commercial isothermal amplification method (PCRun® system developed by Biogal Galed Labs ACS, Galed, Israel). The sensitivity and specificity (CI: 95%) of the TaqMan PCR and PCRun® were both determined to be 100% and absolute, for all of the samples tested. Interestingly, both tests were demonstrated to be highly comparable, irrespective of differences in amplification chemistry or sequences targeted. Host differences, incidence of disease and geographical location of the isolates had little impact on the positivity recorded by each of the diagnostic methods. It was evident that both amplification methods were equally suited for diagnosing canine ehrlichiosis and while the PCRun® clearly amplified all clinically relevant Ehrlichia species known to infect dogs and humans, the TaqMan method was more specific for E. canis and E. minasensis. This work demonstrates that despite good analytical sensitivities and specificities for Ehrlichia spp. neither method could fully account for the clinical diagnosis of thrombocytopenia.

Frequency of rs731236 (Taql), rs2228570 (Fok1) of Vitamin-D Receptor (VDR) gene in Emirati healthy population

PubMed Central

Osman, Enas; Al Anouti, Fatme; El ghazali, Gehad; Haq, Afrozul; Mirgani, Rajaa; Al Safar, Habiba

2015-01-01

Vitamin D is getting more attention everyday due to its importance in maintaining bone and calcium homeostasis, cellular proliferation, differentiation and immune response. Vitamin D is derived from diet or elicited in the skin by the activation of 7-dehydrocholesterol, which is an inert molecule that must be activated by ultraviolet light to form pre-vitamin D3. Recent studies connected the gene encoding for vitamin D (VDR) to the genetic control of bone mass and other diseases. As VDR SNPs have been associated with several disorders and diseases, it's important to investigate the allelic and genotypic distribution among populations. The aim of this study is to determine the frequency of rs731236 (Taq1) and rs2228570 (Fok1) variants in healthy Emirati individuals and compare their genotype and allele distribution with other populations. In this study 282 (female, 187; male, 95) unrelated healthy UAE nationals were involved. Two hundreds and eight two DNA samples been collected to genotype rs731236 (Taq1) and rs2228570 (Fok1) VDR SNPs. Our results indicate that the distribution of the alleles and genotypes of rs731236 (Taq1) and rs2228570 (Fok1) vary considerably in different populations. In the Emirati population the distribution of rs731236 (Taq1) and rs2228570 (Fok1) were AA 38%, AG 42%, GG 20% and AA 27%, AG 42%, GG 31% respectively. The Emirati population genotype and allele distribution of rs731236 (Taq1) and rs2228570 (Fok1) had no difference with Caucasians from USA and France. However, there was significant difference with Asian populations. PMID:26504744

Exploring the limits of ultrafast polymerase chain reaction using liquid for thermal heat exchange: A proof of principle

NASA Astrophysics Data System (ADS)

Maltezos, George; Johnston, Matthew; Taganov, Konstantin; Srichantaratsamee, Chutatip; Gorman, John; Baltimore, David; Chantratita, Wasun; Scherer, Axel

2010-12-01

Thermal ramp rate is a major limiting factor in using real-time polymerase chain reaction (PCR) for routine diagnostics. We explored the limits of speed by using liquid for thermal exchange rather than metal as in traditional devices, and by testing different polymerases. In a clinical setting, our system equaled or surpassed state-of-the-art devices for accuracy in amplifying DNA/RNA of avian influenza, cytomegalovirus, and human immunodeficiency virus. Using Thermococcus kodakaraensis polymerase and optimizing both electrical and chemical systems, we obtained an accurate, 35 cycle amplification of an 85-base pair fragment of E. coli O157:H7 Shiga toxin gene in as little as 94.1 s, a significant improvement over a typical 1 h PCR amplification.

Translation of the first upstream ORF in the hepatitis B virus pregenomic RNA modulates translation at the core and polymerase initiation codons

PubMed Central

Chen, Augustine; Kao, Y. F.; Brown, Chris M.

2005-01-01

The human hepatitis B virus (HBV) has a compact genome encoding four major overlapping coding regions: the core, polymerase, surface and X. The polymerase initiation codon is preceded by the partially overlapping core and four or more upstream initiation codons. There is evidence that several mechanisms are used to enable the synthesis of the polymerase protein, including leaky scanning and ribosome reinitiation. We have examined the first AUG in the pregenomic RNA, it precedes that of the core. It initiates an uncharacterized short upstream open reading frame (uORF), highly conserved in all HBV subtypes, we designated the C0 ORF. This arrangement suggested that expression of the core and polymerase may be affected by this uORF. Initiation at the C0 ORF was confirmed in reporter constructs in transfected cells. The C0 ORF had an inhibitory role in downstream expression from the core initiation site in HepG2 cells and in vitro, but also stimulated reinitiation at the polymerase start when in an optimal context. Our results indicate that the C0 ORF is a determinant in balancing the synthesis of the core and polymerase proteins. PMID:15731337

A Pilot Study of Circulating MicroRNA-125b as a Diagnostic and Prognostic Biomarker for Epithelial Ovarian Cancer.

PubMed

Zhu, Tao; Gao, Wen; Chen, Xi; Zhang, Ying; Wu, Meijuan; Zhang, Ping; Wang, Shihua

2017-01-01

Early diagnosis of epithelial ovarian cancer is critical for patient survival. The objective of this pilot study is to identify a circulating micro (mi)RNA as a potential biomarker for epithelial ovarian cancer. A total of 135 epithelial ovarian cancer patients and 54 benign ovarian tumor patients were recruited for this study. Using customized TaqMan low density miRNA arrays, we first screened expression levels of 48 miRNAs in sera from 18 epithelial ovarian cancer patients and 16 benign ovarian tumor patients. The most significantly and differentially expressed miRNA was then further examined in all serum samples using real-time polymerase chain reaction. Its expression was further analyzed in relationship with clinicopathological factors and patient survival. Array screening data showed that expression levels of serum miRNA-20a, miRNA-125b, miRNA-126, miRNA-355, and let-7c were significantly different between malignant and benign ovarian tumor patients. Subsequent real-time polymerase chain reaction results showed that serum miRNA-125b levels were significantly higher in epithelial ovarian cancer patients compared to benign controls. Moreover, serum miRNA-125b levels were significantly higher in ovarian cancer patients in early stages I and II, and in patients having no residual tumor following surgery, but were not associated with differentiation and histological types of ovarian cancer. Notably, the higher level of miR-125b was significantly positively correlated with progression-free survival (P = 0.035) and marginally, with overall survival (P = 0.069). miRNA-125b plays an important role in the pathogenesis and progression of epithelial ovarian cancer. Circulating miRNA-125b has the potential to become a novel biomarker for early diagnosis and prognosis prediction of epithelial ovarian cancer.

Use of Base Modifications in Primers and Amplicons to Improve Nucleic Acids Detection in the Real-Time Snake Polymerase Chain Reaction

PubMed Central

2011-01-01

Abstract The addition of relatively short flap sequence at the 5′-end of one of the polymerase chain reaction (PCR) primers considerably improves performance of real-time assays based on 5′-nuclease activity. This new technology, called Snake, was shown to supersede the conventional methods like TaqMan, Molecular Beacons, and Scorpions in the signal productivity and discrimination of target polymorphic variations as small as single nucleotides. The present article describes a number of reaction conditions and methods that allow further improvement of the assay performance. One of the identified approaches is the use of duplex-destabilizing modifications such as deoxyinosine and deoxyuridine in the design of the Snake primers. This approach was shown to solve the most serious problem associated with the antisense amplicon folding and cleavage. As a result, the method permits the use of relatively long—in this study—14-mer flap sequences. Investigation also revealed that only the 5′-segment of the flap requires the deoxyinosine/deoxyuridine destabilization, whereas the 3′-segment is preferably left unmodified or even stabilized using 2-amino deoxyadenosine d(2-amA) and 5-propynyl deoxyuridine d(5-PrU) modifications. The base-modification technique is especially effective when applied in combination with asymmetric three-step PCR. The most valuable discovery of the present study is the effective application of modified deoxynucleoside 5′-triphosphates d(2-amA)TP and d(5-PrU)TP in Snake PCR. This method made possible the use of very short 6-8-mer 5′-flap sequences in Snake primers. PMID:21050073

Comparative Evaluation of the Diagnostic Performance of the Prototype Cepheid GeneXpert Ebola Assay

PubMed Central

Jansen van Vuren, Petrus; Grobbelaar, Antoinette; Storm, Nadia; Conteh, Ousman; Konneh, Kelfala; Kamara, Abdul; Sanne, Ian

2015-01-01

The Ebola virus disease (EVD) outbreak in West Africa has highlighted an urgent need for point-of-care (POC) assays for the diagnosis of this devastating disease in resource-limited African countries. The diagnostic performance characteristics of a prototype Cepheid GeneXpert Ebola POC used to detect Ebola virus (EBOV) in stored serum and plasma samples collected from suspected EVD cases in Sierra Leone in 2014 and 2015 was evaluated. The GeneXpert Ebola POC is a self-contained single-cartridge automated system that targets the glycoprotein (GP) and nucleoprotein (NP) genes of EBOV and yields results within 90 min. Results from 281 patient samples were compared to the results of a TaqMan real-time reverse transcription-PCR (RT-PCR) targeting the polymerase gene and performed on two real-time PCR machines. Agreement between the three platforms was 100% at cycle threshold (CT) values of ≤34.99, but discordant results were noted between CT values of 35 and 45.The diagnostic sensitivity of the three platforms was 100% in 91 patient samples that were confirmed to be infectious by virus isolation. All three molecular platforms detected viral EBOV RNA in additional samples that did not contain viable EBOV. The analytical sensitivity of the GeneXpert Ebola POC for the detection of NP was higher, and comparable to that of polymerase gene detection, than that for the detection of GP when using a titrated laboratory stock of EBOV. There was no detectable cross-reactivity with other hemorrhagic fever viruses or arboviruses. The GeneXpert Ebola POC offers an easy to operate and sensitive diagnostic tool that can be used for the rapid screening of suspected EVD cases in treatment or in holding centers during EVD outbreaks. PMID:26637383

Novel approach to quantitative polymerase chain reaction using real-time detection: application to the detection of gene amplification in breast cancer.

PubMed

Bièche, I; Olivi, M; Champème, M H; Vidaud, D; Lidereau, R; Vidaud, M

1998-11-23

Gene amplification is a common event in the progression of human cancers, and amplified oncogenes have been shown to have diagnostic, prognostic and therapeutic relevance. A kinetic quantitative polymerase-chain-reaction (PCR) method, based on fluorescent TaqMan methodology and a new instrument (ABI Prism 7700 Sequence Detection System) capable of measuring fluorescence in real-time, was used to quantify gene amplification in tumor DNA. Reactions are characterized by the point during cycling when PCR amplification is still in the exponential phase, rather than the amount of PCR product accumulated after a fixed number of cycles. None of the reaction components is limited during the exponential phase, meaning that values are highly reproducible in reactions starting with the same copy number. This greatly improves the precision of DNA quantification. Moreover, real-time PCR does not require post-PCR sample handling, thereby preventing potential PCR-product carry-over contamination; it possesses a wide dynamic range of quantification and results in much faster and higher sample throughput. The real-time PCR method, was used to develop and validate a simple and rapid assay for the detection and quantification of the 3 most frequently amplified genes (myc, ccndl and erbB2) in breast tumors. Extra copies of myc, ccndl and erbB2 were observed in 10, 23 and 15%, respectively, of 108 breast-tumor DNA; the largest observed numbers of gene copies were 4.6, 18.6 and 15.1, respectively. These results correlated well with those of Southern blotting. The use of this new semi-automated technique will make molecular analysis of human cancers simpler and more reliable, and should find broad applications in clinical and research settings.

Isolation of microsatellite loci from the lesser long-nosed bat (Leptonycteris yerbuenae)

USGS Publications Warehouse

Ramirez, Judith; Munguia-Vega, A.; Culver, Melanie

2011-01-01

Leptonycteris yerbabuenae is a nectarivore (subfamily: Glossophaginae, family: Phyllostomidae), is found from southern Arizona/southwestern New Mexico to southern Mexico including the Baja California peninsula (Ceballos et al.1997; Cockrum 1991).Leptonycteris yerbabuenae is listed as endangered in the United States (Shull 1988) and threatened in Mexico (SEMARNAT 2002). They migrate up to 1,800 km between wintering and breeding grounds (Fleming and Eby 2001). Females mate in the winter in southern Mexico, and migrate to maternity roosts in northern Mexico/southern Arizona to give birth in late spring-early summer (Ceballos et al.1997; Cockrum 1991). Wilkinson and Fleming (1996) have suggested two separate migration corridors where bats occupy southeastern Arizona and southwestern Arizona arrive and leave through separate corridors. We isolated 12 microsatellites loci to estimate gene flow between southwestern and southeastern Arizona roosts, as well as Sonora, Baja California, and Jalisco, Mexico.Genomic DNA was extracted using the DNeasy Blood & Tissue Kit (Qiagen). Approximately 5 μg of genomic DNA was digested with RsaI (NEB) and fragments were ligated to double-stranded SuperSNX-24 linkers to construct an enriched genomic DNA library using a modified version of Glenn and Schable (2005). Linker-ligated fragments ranging from 300–1400 bp were recovered using the polymerase chain reaction (PCR) with a SuperSNX-24 forward primer and Platinum high-fidelity Taq DNA polymerase (Invitrogen), and were hybridized to 5′-biotinylated microsatellite oligonucleotide probes (GT)15, (CT)15, (GATA)10 and (GACA)8. Hybridized fragments were captured on streptavidin-coated paramagnetic beads (Dynal) and then recovered by PCR. These fragments were ligated into the vector PCR4-TOPO (Invitrogen), and transformed into TOP10 chemically competent E. coli cells (Invitrogen) following the manufacturer’s protocol.

Dispersion quality of amine functionalized multiwall carbon nanotubes plays critical roles in polymerase chain reaction enhancement

NASA Astrophysics Data System (ADS)

Yuce, Meral; Budak, Hikmet

2014-12-01

Impact of dispersion quality of NH2-MWCNTs (13-18 nm in diameter with a length between 1 and 12 µm, >99 % purity) in the amplification efficiency of a random DNA oligonucleotide library (96 bp) was investigated. Amplification yield in the presence of non-filtered NH2-MWCNT dispersion, filtered NH2-MWCNT dispersion and surface-attached NH2-MWCNTs was explored, and physical interactions between NH2-MWCNTs and major PCR reagents including DNA template, wild type Taq DNA polymerase enzyme and primers were determined using high resolution polyacrylamide gel electrophoresis, dynamic light scattering, UV-Vis-NIR spectroscopy and scanning electron microscopy techniques. The results revealed that presence of NH2-MWCNT dispersion which was sonicated, centrifuged and filtered, enhanced the total PCR efficiency up to 70 % while the presence of NH2-MWCNT only centrifuged after sonication, inhibited the reaction significantly at similar concentrations. Furthermore, the NH2-MWCNTs coupled covalently onto magnetic microspheres, contributed for the specificity enhancement whilst decreasing the amplification efficiency by 30 % at the maximum concentration, which suggests a removable enhancement system for sensitive applications. On the other hand, the relative hydrodynamic size distribution measurements displayed a clear difference between the filtered NH2 and non-filtered NH2-MWCNT water dispersions, which justifies the inhibition of the amplification by the non-filtered NH2-MWCNTs containing big agglomerates and bundles. Finally, we demonstrated that major PCR components adsorb onto the NH2-MWCNTs with diverse affinities, and maintain their functions after adsorption, which provides a good framework to further develop tunable NH2-MWCNT-carriers to be utilized in various nanobiotechnology and material science applications.

Real-time polymerase chain reaction detection of cauliflower mosaic virus to complement the 35S screening assay for genetically modified organisms.

PubMed

Cankar, Katarina; Ravnikar, Maja; Zel, Jana; Gruden, Kristina; Toplak, Natasa

2005-01-01

Labeling of genetically modified organisms (GMOs) is now in place in many countries, including the European Union, in order to guarantee the consumer's choice between GM and non-GM products. Screening of samples is performed by polymerase chain reaction (PCR) amplification of regulatory sequences frequently introduced into genetically modified plants. Primers for the 35S promoter from Cauliflower mosaic virus (CaMV) are those most frequently used. In virus-infected plants or in samples contaminated with plant material carrying the virus, false-positive results can consequently occur. A system for real-time PCR using a TaqMan minor groove binder probe was designed that allows recognition of virus coat protein in the sample, thus allowing differentiation between transgenic and virus-infected samples. We measured the efficiency of PCR amplification, limits of detection and quantification, range of linearity, and repeatability of the assay in order to assess the applicability of the assay for routine analysis. The specificity of the detection system was tested on various virus isolates and plant species. All 8 CaMV isolates were successfully amplified using the designed system. No cross-reactivity was detected with DNA from 3 isolates of the closely related Carnation etched ring virus. Primers do not amplify plant DNA from available genetically modified maize and soybean lines or from different species of Brassicaceae or Solanaceae that are natural hosts for CaMV. We evaluated the assay for different food matrixes by spiking CaMV DNA into DNA from food samples and have successfully amplified CaMV from all samples. The assay was tested on rapeseed samples from routine GMO testing that were positive in the 35S screening assay, and the presence of the virus was confirmed.

Evaluation of the Cobas TaqMan MTB Test for the Detection of Mycobacterium tuberculosis Complex According to Acid-Fast-Bacillus Smear Grades in Respiratory Specimens

PubMed Central

Huh, Hee Jae; Koh, Won-Jung; Song, Dong Joon

2014-01-01

We evaluated the performance of the Cobas TaqMan MTB test (Roche Diagnostics, Basel, Switzerland), stratified by acid-fast bacilli (AFB) smear grades. The sensitivity of this test in smear-positive specimens was >95% in all grades, while that in trace and negative specimens was 85.3% and 34.4%, respectively. PMID:25428157

Regulatory role of Cdx-2 and Taq I polymorphism of vitamin D receptor gene on chemokine expression in pulmonary tuberculosis.

PubMed

Harishankar, M; Selvaraj, P

2016-06-01

Vitamin D receptor (VDR) gene variants have been shown to be regulating the immune response in tuberculosis. We studied the regulatory role of VDR promoter Cdx-2 and 3'UTR TaqI gene variants on chemokine levels from culture filtrate antigen (CFA) stimulated with or without 1,25(OH)2D3 treated peripheral blood mononuclear cells of 50 pulmonary tuberculosis patients (PTB) and 51 normal healthy controls (HCs). In CFA with 1,25(OH)2D3 treated cultures, the MIP-1α, MIP-1β, RANTES levels were significantly decreased in Cdx-2 AA genotype compared to GG genotype, while a significantly increased MIG level was observed in Cdx-2 AA genotype (p<0.05). In TaqI polymorphism, tt genotype significantly decreased MIP-1β and RANTES levels compared to TT genotype. Moreover, a significantly increased level of IP-10 and MIG was observed in TaqI tt genotype compared with TT genotype (p<0.05). The results suggests that the 1,25(OH)2D3 may alter the chemokine response through the VDR polymorphic variants during infection. Copyright © 2016 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.

The ANKK1 kinase gene and psychiatric disorders.

PubMed

Ponce, Guillermo; Pérez-González, Rocío; Aragüés, María; Palomo, Tomás; Rodríguez-Jiménez, Roberto; Jiménez-Arriero, Miguel Angel; Hoenicka, Janet

2009-07-01

The TaqIA single nucleotide polymorphism (SNP, rs1800497), which is located in the gene that codes for the putative kinase ANKK1 (ANKK1) near the termination codon of the D2 dopamine receptor gene (DRD2; chromosome 11q22-q23), is the most studied genetic variation in a broad range of psychiatric disorders and personality traits. A large number of individual genetic association studies have found that the TaqIA SNP is linked to alcoholism and antisocial traits. In addition, it has also been related to other conditions such as schizophrenia, eating disorders, and some behavioral childhood disorders. The TaqIA A1 allele is mainly associated with addictions, antisocial disorders, eating disorders, and attention-deficit/hyperactivity disorders, while the A2 allele occurs more frequently in schizophrenic and obsessive-compulsive patients. Current data show that the TaqIA polymorphism may be a marker of both DRD2 and ANKK1 genetic variants. ANKK1 would belong to a family of kinases involved in signal transduction. This raises the question of whether signaling players intervene in the pathophysiology of psychiatric disorders. Basic research on the ANKK1 protein and its putative interaction with the D2 dopamine receptor could shed light on this issue.

Multiplexed target detection using DNA-binding dye chemistry in droplet digital PCR.

PubMed

McDermott, Geoffrey P; Do, Duc; Litterst, Claudia M; Maar, Dianna; Hindson, Christopher M; Steenblock, Erin R; Legler, Tina C; Jouvenot, Yann; Marrs, Samuel H; Bemis, Adam; Shah, Pallavi; Wong, Josephine; Wang, Shenglong; Sally, David; Javier, Leanne; Dinio, Theresa; Han, Chunxiao; Brackbill, Timothy P; Hodges, Shawn P; Ling, Yunfeng; Klitgord, Niels; Carman, George J; Berman, Jennifer R; Koehler, Ryan T; Hiddessen, Amy L; Walse, Pramod; Bousse, Luc; Tzonev, Svilen; Hefner, Eli; Hindson, Benjamin J; Cauly, Thomas H; Hamby, Keith; Patel, Viresh P; Regan, John F; Wyatt, Paul W; Karlin-Neumann, George A; Stumbo, David P; Lowe, Adam J

2013-12-03

Two years ago, we described the first droplet digital PCR (ddPCR) system aimed at empowering all researchers with a tool that removes the substantial uncertainties associated with using the analogue standard, quantitative real-time PCR (qPCR). This system enabled TaqMan hydrolysis probe-based assays for the absolute quantification of nucleic acids. Due to significant advancements in droplet chemistry and buoyed by the multiple benefits associated with dye-based target detection, we have created a "second generation" ddPCR system compatible with both TaqMan-probe and DNA-binding dye detection chemistries. Herein, we describe the operating characteristics of DNA-binding dye based ddPCR and offer a side-by-side comparison to TaqMan probe detection. By partitioning each sample prior to thermal cycling, we demonstrate that it is now possible to use a DNA-binding dye for the quantification of multiple target species from a single reaction. The increased resolution associated with partitioning also made it possible to visualize and account for signals arising from nonspecific amplification products. We expect that the ability to combine the precision of ddPCR with both DNA-binding dye and TaqMan probe detection chemistries will further enable the research community to answer complex and diverse genetic questions.

Detection of hepatitis C virus RNA using ligation-dependent polymerase chain reaction in formalin-fixed, paraffin-embedded liver tissues.

PubMed Central

Park, Y. N.; Abe, K.; Li, H.; Hsuih, T.; Thung, S. N.; Zhang, D. Y.

1996-01-01

Reverse transcription polymerase chain reaction (RT-PCR) has been used to detect hepatitis C virus (HCV) sequences in liver tissue. However, RT-PCR has a variable detection sensitivity, especially on routinely processed formalin-fixed, paraffin-embedded (FFPE) specimens. RNA-RNA and RNA-protein cross-links formed during formalin fixation is the major limiting factor preventing reverse trans criptase from extending the primers. To overcome this problem, we applied the ligation-dependent PCR (LD-PCR) for the detection of HCV RNA in FFPE liver tissue. This method uses two capture probes for RNA isolation and two hemiprobes for the subsequent PCR. Despite cross-links, the capture probes and the hemiprobes are able to form hybrids with HCV RNAs released from the FFPE tissue. The hybrids are isolated through binding of the capture probes to paramagnetic beads. The hemiprobes are then ligated by a T4 DNA ligase to form a full probe that serves as a template for the Taq DNA polymerase. A total of 22 FFPE liver specimens, 21 with hepatocellular carcinoma (HCC) and 1 with biliary cirrhosis secondary to bile duct atresia were selected for this study, of which 13 patients were HCV seropositive and 9 seronegative. HCV RNA was detectable by ID-PCR from all 13 HCV-seropositive HCCs and from 5 of 8 HCV-seronegative HCCs but not from the HCV-seronegative liver with biliary atresia. By contrast, RT-PCR detected HCV sequences in only 5 of the HCV-sero-positive and in 1 of the HCV-seronegative HCCs. To resolve the discordance between the LD-PCR and RT-PCR results, RT-PCR was performed on frozen liver tissue of the discrepant specimens, which confirmed the LD-PCR positive results. In conclusion, LD-PCR is a more sensitive method than RT-PCR for the detection of HCV sequences in routinely processed liver tissues. A high rate of HCV infection (86%) is found in HCC specimens, indicating a previously underestimated role of HCV in HCC pathogenesis. Images Figure 2 PMID:8909238

Development a of multiplex TaqMan real-time RT-PCR assay for simultaneous detection of Asian prunus viruses, plum bark necrosis stem pitting associated virus, and peach latent mosaic virus

USDA-ARS?s Scientific Manuscript database

Asian prunus viruses (APV 1, APV 2 and APV 3) and Plum bark necrosis stem pitting associated virus (PBNSPaV) are two recently described viruses infecting Prunus spp., and Peach latent mosaic viroid (PLMVd) is a viroid that infects the same species. A single-tube multiplex, TaqMan real-time RT-PCR as...

Results of the Abbott RealTime HIV-1 assay for specimens yielding "target not detected" results by the Cobas AmpliPrep/Cobas TaqMan HIV-1 Test.

PubMed

Babady, N Esther; Germer, Jeffrey J; Yao, Joseph D C

2010-03-01

No significantly discordant results were observed between the Abbott RealTime HIV-1 assay and the COBAS AmpliPrep/COBAS TaqMan HIV-1 Test (CTM) among 1,190 unique clinical plasma specimens obtained from laboratories located in 40 states representing all nine U.S. geographic regions and previously yielding "target not detected" results by CTM.

T.I.M.S: TaqMan Information Management System, tools to organize data flow in a genotyping laboratory

PubMed Central

Monnier, Stéphanie; Cox, David G; Albion, Tim; Canzian, Federico

2005-01-01

Background Single Nucleotide Polymorphism (SNP) genotyping is a major activity in biomedical research. The Taqman technology is one of the most commonly used approaches. It produces large amounts of data that are difficult to process by hand. Laboratories not equipped with a Laboratory Information Management System (LIMS) need tools to organize the data flow. Results We propose a package of Visual Basic programs focused on sample management and on the parsing of input and output TaqMan files. The code is written in Visual Basic, embedded in the Microsoft Office package, and it allows anyone to have access to those tools, without any programming skills and with basic computer requirements. Conclusion We have created useful tools focused on management of TaqMan genotyping data, a critical issue in genotyping laboratories whithout a more sophisticated and expensive system, such as a LIMS. PMID:16221298

Human-Associated Bacteroides spp. and Human Polyomaviruses as Microbial Source Tracking Markers in Hawaii.

PubMed

Kirs, Marek; Caffaro-Filho, Roberto A; Wong, Mayee; Harwood, Valerie J; Moravcik, Philip; Fujioka, Roger S

2016-11-15

Identification of sources of fecal contaminants is needed to (i) determine the health risk associated with recreational water use and (ii) implement appropriate management practices to mitigate this risk and protect the environment. This study evaluated human-associated Bacteroides spp. (HF183TaqMan) and human polyomavirus (HPyV) markers for host sensitivity and specificity using human and animal fecal samples collected in Hawaii. The decay rates of those markers and indicator bacteria were identified in marine and freshwater microcosms exposed and not exposed to sunlight, followed by field testing of the usability of the molecular markers. Both markers were strongly associated with sewage, although the cross-reactivity of the HF183TaqMan (also present in 82% of canine [n = 11], 30% of mongoose [n = 10], and 10% of feline [n = 10] samples) needs to be considered. Concentrations of HF183TaqMan in human fecal samples exceeded those in cross-reactive animals at least 1,000-fold. In the absence of sunlight, the decay rates of both markers were comparable to the die-off rates of enterococci in experimental freshwater and marine water microcosms. However, in sunlight, the decay rates of both markers were significantly lower than the decay rate of enterococci. While both markers have their individual limitations in terms of sensitivity and specificity, these limitations can be mitigated by using both markers simultaneously; ergo, this study supports the concurrent use of HF183TaqMan and HPyV markers for the detection of sewage contamination in coastal and inland waters in Hawaii. This study represents an in-depth characterization of microbial source tracking (MST) markers in Hawaii. The distribution and concentrations of HF183TaqMan and HPyV markers in human and animal fecal samples and in wastewater, coupled with decay data obtained from sunlight-exposed and unexposed microcosms, support the concurrent application of HF183TaqMan and HPyV markers for sewage contamination detection in Hawaii waters. Both markers are more conservative and more specific markers of sewage than fecal indicator bacteria (enterococci and Escherichia coli). Analysis of HF183TaqMan (or newer derivatives) is recommended for inclusion in future epidemiological studies concerned with beach water quality, while better concentration techniques are needed for HPyV. Such epidemiological studies can be used to develop new recreational water quality criteria, which will provide direct information on the absence or presence of sewage contamination in water samples as well as reliable measurements of the risk of waterborne disease transmission to swimmers. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Discovery of novel bacterial RNA polymerase inhibitors: pharmacophore-based virtual screening and hit optimization.

PubMed

Hinsberger, Stefan; Hüsecken, Kristina; Groh, Matthias; Negri, Matthias; Haupenthal, Jörg; Hartmann, Rolf W

2013-11-14

The bacterial RNA polymerase (RNAP) is a validated target for broad spectrum antibiotics. However, the efficiency of drugs is reduced by resistance. To discover novel RNAP inhibitors, a pharmacophore based on the alignment of described inhibitors was used for virtual screening. In an optimization process of hit compounds, novel derivatives with improved in vitro potency were discovered. Investigations concerning the molecular mechanism of RNAP inhibition reveal that they prevent the protein-protein interaction (PPI) between σ(70) and the RNAP core enzyme. Besides of reducing RNA formation, the inhibitors were shown to interfere with bacterial lipid biosynthesis. The compounds were active against Gram-positive pathogens and revealed significantly lower resistance frequencies compared to clinically used rifampicin.

Multiplex qRT-PCR for the Detection of Western Equine Encephalomyelitis, St. Louis Encephalitis, and West Nile Viral RNA in Mosquito Pools (Diptera: Culicidae).

PubMed

Brault, Aaron C; Fang, Ying; Reisen, William K

2015-05-01

Following the introduction of West Nile virus into California during the summer of 2003, public health and vector control programs expanded surveillance efforts and were in need of diagnostics capable of rapid, sensitive, and specific detection of arbovirus infections of mosquitoes to inform decision support for intervention. Development of a multiplex TaqMan or real-time semiquantitative reverse transcription polymerase chain reaction (RT-PCR) assay in which three virus specific primer-probe sets were used in the same reaction is described herein for the detection of western equine encephalomyelitis, St. Louis encephalitis and West Nile viral RNA. Laboratory validation and field data from 10 transmission seasons are reported. The comparative sensitivity and specificity of this multiplex assay to singleplex RT-PCR as well as an antigen detection (rapid analyte measurement platform) and standard plaque assays indicate this assay to be rapid and useful in providing mosquito infection data to estimate outbreak risk. © The Authors 2015. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

New PCR diagnostic systems for the detection and quantification of porcine cytomegalovirus (PCMV).

PubMed

Morozov, Vladimir A; Morozov, Alexey V; Denner, Joachim

2016-05-01

Pigs are frequently infected with porcine cytomegalovirus (PCMV). Infected adult animals may not present with symptoms of disease, and the virus remains latent. However, the virus may be transmitted to human recipients receiving pig transplants. Recently, it was shown that pig-to-non-human-primate xenotransplantations showed 2 to 3 times lower transplant survival when the donor pig was infected with PCMV. Therefore, highly sensitive methods are required to select virus-free pigs and to examine xenotransplants. Seven previously established PCR detection systems targeting the DNA polymerase gene of PCMV were examined by comparison of thermodynamic parameters of oligonucleotides, and new diagnostic nested PCR and real-time PCR systems with improved parameters and high sensitivity were established. The detection limit of conventional PCR was estimated to be 15 copies, and that of the nested PCR was 5 copies. The sensitivity of the real-time PCR with a TaqMan probe was two copies. An equal efficiency of the newly established detection systems was shown by parallel testing of DNA from sera and blood of six pigs, identifying the same animals as PCMV infected. These new diagnostic PCR systems will improve the detection of PCMV and therefore increase the safety of porcine xenotransplants.

Detection of genetically modified DNA in fresh and processed foods sold in Kuwait.

PubMed

Al-Salameen, Fadila; Kumar, Vinod; Al-Aqeel, Hamed; Al-Hashash, Hanadi; Hejji, Ahmed Bin

2012-01-01

Developments in genetic engineering technology have led to an increase in number of food products that contain genetically engineered crops in the global market. However, due to lack of scientific studies, the presence of genetically modified organisms (GMOs) in the Kuwaiti food market is currently ambiguous. Foods both for human and animal consumption are being imported from countries that are known to produce GM food. Therefore, an attempt has been made to screen foods sold in the Kuwaiti market to detect GMOs in the food. For this purpose, samples collected from various markets in Kuwait have been screened by SYBR green-based real time polymerase chain reaction (RT-PCR) method. Further confirmation and GMO quantification was performed by TaqMan-based RT-PCR. Results indicated that a significant number of food commodities sold in Kuwait were tested positive for the presence of GMO. Interestingly, certain processed foods were tested positive for more than one transgenic events showing complex nature of GMOs in food samples. Results of this study clearly indicate the need for well-defined legislations and regulations on the marketing of approved GM food and its labeling to protect consumer's rights.

Novel genotype of Tritrichomonas foetus from cattle in Southern Africa.

PubMed

Casteriano, Andrea; Molini, Umberto; Kandjumbwa, Kornelia; Khaiseb, Siegfried; Frey, Caroline F; Šlapeta, Jan

2016-12-01

Bovine trichomonosis caused by Tritrichomonas foetus is a significant reproductive disease of cattle. Preputial samples were collected using sheath washing technique in bulls in Namibia. Thirty-six trichomonad cultures were characterized using the TaqMan-probe commercial real-time polymerase chain reaction (PCR) diagnostic assay (VetMAX™-Gold Trich Detection Kit) and CYBR real-time PCR assay based on TFR3/4 primers. Diagnostic real-time PCRs and DNA sequencing of the internal transcribed region confirmed presence of T. foetus in 35 out of 36 samples. Multilocus genotyping using cysteine proteases (CP1, CP2, CP4, CP5, CP6, CP7, CP8, CP9) and malate dehydrogenase (MDH1) gene sequences demonstrate that the T. foetus in Namibia are genetically distinct from those characterized elsewhere. We report the discovery of a novel genotype of T. foetus in Namibian cattle, distinct from other T. foetus genotypes in Europe, South and North America and Australia. We suggest recognition of a 'Southern African' genotype of T. foetus. Identification of the new genotype of T. foetus demonstrates the need for wider global sampling to fully understand the diversity and origin of T. foetus causing disease in cattle or cats.

Frequency-encoded laser-induced fluorescence for multiplexed detection in infrared-mediated quantitative PCR

PubMed Central

Schrell, Adrian M.; Roper, Michael G.

2014-01-01

A frequency-modulated fluorescence encoding method was used as a means to increase the number of fluorophores monitored during infrared-mediated polymerase chain reaction. Laser lines at 488-nm and 561-nm were modulated at 73- and 137-Hz, respectively, exciting fluorescence from the dsDNA intercalating dye, EvaGreen, and the temperature insensitive dye, ROX. Emission was collected in a color-blind manner using a single photomultiplier tube for detection and demodulated by frequency analysis. The resulting frequency domain signal resolved the contribution from the two fluorophores as well as the background from the IR lamp. The detection method was successfully used to measure amplification of DNA samples containing 104 – 107 starting copies of template producing an amplification efficiency of 96%. The utility of this methodology was further demonstrated by simultaneous amplification of two genes from human genomic DNA using different color TaqMan probes. This method of multiplexing fluorescence detection with IR-qPCR is ideally suited as it allowed isolation of the signals of interest from the background in the frequency domain and is expected to further reduce the complexity of multiplexed microfluidic IR-qPCR instrumentation. PMID:24448431

Virucidal or Not Virucidal? That Is the Question—Predictability of Ionic Liquid’s Virucidal Potential in Biological Test Systems

PubMed Central

Sommer, Julia; Fister, Susanne; Gundolf, Tobias; Bromberger, Birgit; Witte, Anna Kristina; Kalb, Roland; Rossmanith, Peter

2018-01-01

For three decades now, ionic liquids (ILs), organic salts comprising only ions, have emerged as a new class of pharmaceuticals. Although recognition of the antimicrobial effects of ILs is growing rapidly, there is almost nothing known about their possible virucidal activities. This probably reflects the paucity of understanding virus inactivation. In this study, we performed a systematic analysis to determine the effect of specific structural motifs of ILs on three different biological test systems (viruses, bacteria and enzymes). Overall, the effects of 27 different ILs on two non-enveloped and one enveloped virus (P100, MS2 and Phi6), two Gram negative and one Gram positive bacteria (E. coli, P. syringae and L. monocytogenes) and one enzyme (Taq DNA polymerase) were investigated. Results show that while some ILs were virucidal, no clear structure activity relationships (SARs) could be identified for the non-enveloped viruses P100 and MS2. However, for the first time, a correlation has been demonstrated between the effects of ILs on enveloped viruses, bacteria and enzyme inhibition. These identified SARs serve as a sound starting point for further studies. PMID:29522483

ADAMTS13 Gene Mutations in Children with Hemolytic Uremic Syndrome

PubMed Central

Choi, Hyoung Soo; Cheong, Hae Il; Kim, Nam Keun

2011-01-01

We investigated ADAMTS13 activity as well as the ADAMTS13 gene mutation in children with hemolytic uremic syndrome (HUS). Eighteen patients, including 6 diarrhea-negative (D-HUS) and 12 diarrhea-associated HUS (D+HUS) patients, were evaluated. The extent of von Willebrand factor (VWF) degradation was assayed by multimer analysis, and all exons of the ADAMTS13 gene were PCR-amplified using Taq DNA polymerase. The median and range for plasma activity of ADAMTS13 in 6 D-HUS and 12 D+HUS patients were 71.8% (22.8-94.1%) and 84.9% (37.9-119.9%), respectively, which were not statistically significantly different from the control group (86.4%, 34.2-112.3%) (p>0.05). Five ADAMTS13 gene mutations, including 2 novel mutations [1584+2T>A, 3941C>T (S1314L)] and 3 polymorphisms (Q448E, P475S, S903L), were found in 2 D-HUS and one D+HUS patients, which were not associated with deficiency of ADAMTS13 activity. Whether these mutations without reduced ADAMTS13 activity are innocent bystanders or predisposing factors in HUS remains unanswered. PMID:21488199

Impacts of ICAM-1 gene polymorphisms on urothelial cell carcinoma susceptibility and clinicopathologic characteristics in Taiwan.

PubMed

Wang, Shian-Shiang; Hsieh, Ming-Ju; Ou, Yen-Chuan; Chen, Chuan-Shu; Li, Jian-Ri; Hsiao, Pei-Ching; Yang, Shun-Fa

2014-08-01

Intercellular adhesion molecule (ICAM)-1, a cell adhesion molecule, is reportedly overexpressed in several cancers and may contribute to tumorgenesis and metastasis. The current study explored the effect of ICAM-1 gene polymorphisms on the susceptibility of developing urothelial cell carcinoma (UCC) and the clinicopathological status. A total of 558 participants, including 279 healthy people and 279 patients with UCC, were recruited for this study. Four single-nucleotide polymorphisms of the ICAM-1 gene were assessed by a real-time polymerase chain reaction with the TaqMan assay. After adjusting for other covariants, the individuals carrying at least one G allele at ICAM-1 rs5498 had a 1.603-fold risk of developing UCC than did wild-type (AA) carriers. Furthermore, UCC patients who carried at least one G allele at rs5498 had a higher invasive stage risk (p < 0.05) than did patients carrying the wild-type allele. In conclusion, the rs5498 polymorphic genotypes of ICAM-1 might contribute to the prediction of susceptibility to and pathological development of UCC. This is the first study to provide insight into risk factors associated with ICAM-1 variants in carcinogenesis of UCC in Taiwan.

Genetic variations in the vitamin-D receptor (VDR) gene in preeclampsia patients in the Chinese Han population.

PubMed

Zhan, Ying; Liu, Mengchun; You, Yuelan; Zhang, Yan; Wang, Jingli; Wang, Xunfeng; Liu, Shiguo; Liu, Xuemei

2015-07-01

Previous studies have indicated that vitamin D deficiency is linked to a risk of preeclampsia (PE). The aim of our study was to investigate the association between genetic variations in the vitamin-D receptor (VDR) gene and the susceptibility to PE in the Chinese Han population. We examined the genotypes VDR rs2228570, rs11568820 and rs1544410 in 402 PE patients and 554 normal pregnant women in the third trimester by TaqMan allelic discrimination real-time polymerase chain reaction. The clinical data of the individuals were collected to enable genotype-phenotype analysis. A significant statistical difference in the genotypic frequencies of rs2228570 between cases and controls was found (χ(2)=13.750, P=0.001). The G allele was the risk factor for the risk of PE (χ(2)=9.456, P=0.002, OR=1.137, 95% CI 1.111-1.610). There was no difference in the genotypic and allelic distributions of rs11568820 and rs1544410 between the two groups (P> 0.05). Our results provide evidence for a possible link between VDR and the development of PE in the Chinese Han population.

Polymorphic genetic variation in immune system genes: a study of two populations of Espirito Santo, Brazil.

PubMed

Dettogni, Raquel Spinassé; Sá, Ricardo Tristão; Tovar, Thaís Tristão; Louro, Iúri Drumond

2013-08-01

Mapping single nucleotide polymorphisms (SNPs) in genes potentially involved in immune responses may help understand the pathophysiology of infectious diseases in specific geographical regions. In this context, we have aimed to analyze the frequency of immunogenetic markers, focusing on genes CD209 (SNP -336A/G), FCγRIIa (SNP -131H/R), TNF-α (SNP -308A/G) and VDR (SNP Taq I) in two populations of the Espirito Santo State (ES), Brazil: general and Pomeranian populations. Peripheral blood genomic DNA was extracted from one hundred healthy individuals of the general population and from 59 Pomeranians. Polymorphic variant identification was performed by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). SNP genotype frequencies were in Hardy-Weinberg Equilibrium. There was no statistically significant difference in allelic and genotypic distributions between the two populations studied. Statistically significant differences were observed for SNP genotype distribution in genes CD209, TNF-α and VDR when comparing the ES populations with other Brazilian populations. This is the first report of CD209, FcγRIIa, TNF-α and VDR allelic frequencies for the general and Pomeranian populations of ES.

Genetic variants in 3′-UTRs of methylenetetrahydrofolate reductase (MTHFR) predict colorectal cancer susceptibility in Koreans

PubMed Central

Joo Jeon, Young; Woo Kim, Jong; Mi Park, Hye; Kim, Jung O; Geun Jang, Hyo; Oh, Jisu; Gyu Hwang, Seong; Won Kwon, Sung; Oh, Doyeun; Keun Kim, Nam

2015-01-01

Polymorphisms in the methylenetetrahydrofolate reductase (MTHFR) play important roles in tumor development, progression, and metastasis. Moreover, recent studies have reported that a number of 3′-UTR polymorphisms potentially bind to specific microRNAs in a variety of cancers. The aim of this study was to investigate the association of four MTHFR polymorphisms, 2572C>A [rs4846049], 4869C>G [rs1537514], 5488C>T [rs3737967], and 6685T>C [rs4846048] with colorectal cancer (CRC) in Koreans. A total of 850 participants (450 CRC patients and 400 controls) were enrolled in the study. The genotyping of MTHFR 3′-UTR polymorphisms was performed by polymerase chain reaction-restriction fragment length polymorphism analysis or TaqMan allelic discrimination assay. We found that MTHFR 2572C>A, 4869C>G, and 5488C>T genotypes were substantially associated with CRC susceptibility. Of the potentially susceptible polymorphisms, MTHFR 2572C>A was associated with increased homocysteine and decreased folate levels in the plasma based on MTHFR 677CC. Our study provides the evidences for 3′-UTR variants in MTHFR gene as potential biomarkers for use in CRC prevention. PMID:26046315

Development of Molecular Methods to Detect Macrophomina phaseolina from Strawberry Plants and Soil.

PubMed

Burkhardt, Alyssa; Ramon, Marina L; Smith, Brett; Koike, Steven T; Martin, Frank N

2018-06-05

Macrophomina phaseolina is a broad-host range fungus that shows some degree of host preference on strawberry, and causes symptoms including crown rot and root rot. Recently, this pathogen has impacted strawberry production as fumigation practices have changed, leaving many growers in California and around the world in need of accurate, rapid diagnostic tools for M. phaseolina in soil and infected plants. This study uses next-generation sequencing and comparative genomics to identify a locus that is unique to isolates within a main genotype shared by a majority of isolates that infect strawberry. This locus was used to develop a quantitative single-tube nested TaqMan qPCR assay which is able to quantify as little as 2-3 microsclerotia/g of soil with 100% genotype specificity. An isothermal assay using recombinase polymerase amplification (RPA) was developed from the same locus and has been validated on over 200 infected strawberry plants with a diagnostic sensitivity of 93% and a diagnostic specificity of 99%, respectively. Together, this work demonstrates the value of using new approaches to identify loci for detection and provides valuable diagnostic tools that can be used to monitor soil and strawberry plant samples for M. phaseolina.

Association study of ghrelin receptor gene polymorphisms in rheumatoid arthritis.

PubMed

Robledo, G; Rueda, B; Gonzalez-Gay, M A; Fernández, B; Lamas, J R; Balsa, A; Pascual-Salcedo, D; García, A; Raya, E; Martín, J

2010-01-01

Ghrelin is a newly characterised growth hormone (GH) releasing peptide widely distributed that may play an important role in the regulation of metabolic balance in inflammatory diseases such as rheumatoid arthritis (RA) by decreasing the pro-inflammatory Th1 responses. In this study we investigated the possible contribution of several polymorphisms in the functional Ghrelin receptor to RA susceptibility. A screening of 3 single nucleotide polymorphisms (SNPs) was performed in a total of 950 RA patients and 990 healthy controls of Spanish Caucasian origin. Genotyping of all 3 SNPs was performed by real-time polymerase chain reaction technology, using the TaqMan 5'-allele discrimination assay. We observed no statistically significant deviation between RA patients and controls for the GHSR SNPs analysed. In addition, we performed a haplotype analysis that did not reveal an association with RA susceptibility. The stratification analysis for the presence of shared epitope (SE), rheumatoid factor (RF) or antibodies anti cyclic citrullinated peptide (anti-CCP) did not detect significant association of the GHSR polymorphisms with RA. These findings suggest that the GHSR gene polymorphisms do not appear to play a major role in RA genetic predisposition in our population.

Glucose-6-phosphate dehydrogenase (G6PD) deficiency is associated with asymptomatic malaria in a rural community in Burkina Faso.

PubMed

Ouattara, Abdoul Karim; Bisseye, Cyrille; Bazie, Bapio Valery Jean Télesphore Elvira; Diarra, Birama; Compaore, Tegwindé Rebeca; Djigma, Florencia; Pietra, Virginio; Moret, Remy; Simpore, Jacques

2014-08-01

To investigate 4 combinations of mutations responsible for glucose-6-phosphate dehydrogenase (G6PD) deficiency in a rural community of Burkina Faso, a malaria endemic country. Two hundred individuals in a rural community were genotyped for the mutations A376G, G202A, A542T, G680T and T968C using TaqMan single nucleotide polymorphism assays and polymerase chain reaction followed by restriction fragment length polymorphism. The prevalence of the G6PD deficiency was 9.5% in the study population. It was significantly higher in men compared to women (14.3% vs 6.0%, P=0.049). The 202A/376G G6PD A- was the only deficient variant detected. Plasmodium falciparum asymptomatic parasitaemia was significantly higher among the G6PD-non-deficient persons compared to the G6PD-deficient (P<0.001). The asymptomatic parasitaemia was also significantly higher among G6PD non-deficient compared to G6PD-heterozygous females (P<0.001). This study showed that the G6PD A- variant associated with protection against asymptomatic malaria in Burkina Faso is probably the most common deficient variant.

Rapid method for controlling the correct labeling of products containing common octopus (Octopus vulgaris) and main substitute species (Eledone cirrhosa and Dosidicus gigas) by fast real-time PCR.

PubMed

Espiñeira, Montserrat; Vieites, Juan M

2012-12-15

The TaqMan real-time PCR has the highest potential for automation, therefore representing the currently most suitable method for screening, allowing the detection of fraudulent or unintentional mislabeling of species. This work describes the development of a real-time polymerase chain reaction (RT-PCR) system for the detection and identification of common octopus (Octopus vulgaris) and main substitute species (Eledone cirrhosa and Dosidicus gigas). This technique is notable for the combination of simplicity, speed, sensitivity and specificity in an homogeneous assay. The method can be applied to all kinds of products; fresh, frozen and processed, including those undergoing intensive processes of transformation. This methodology was validated to check how the degree of food processing affects the method and the detection of each species. Moreover, it was applied to 34 commercial samples to evaluate the labeling of products made from them. The methodology herein developed is useful to check the fulfillment of labeling regulations for seafood products and to verify traceability in commercial trade and for fisheries control. Copyright © 2012 Elsevier Ltd. All rights reserved.

DNA polymerase preference determines PCR priming efficiency.

PubMed

Pan, Wenjing; Byrne-Steele, Miranda; Wang, Chunlin; Lu, Stanley; Clemmons, Scott; Zahorchak, Robert J; Han, Jian

2014-01-30

Polymerase chain reaction (PCR) is one of the most important developments in modern biotechnology. However, PCR is known to introduce biases, especially during multiplex reactions. Recent studies have implicated the DNA polymerase as the primary source of bias, particularly initiation of polymerization on the template strand. In our study, amplification from a synthetic library containing a 12 nucleotide random portion was used to provide an in-depth characterization of DNA polymerase priming bias. The synthetic library was amplified with three commercially available DNA polymerases using an anchored primer with a random 3' hexamer end. After normalization, the next generation sequencing (NGS) results of the amplified libraries were directly compared to the unamplified synthetic library. Here, high throughput sequencing was used to systematically demonstrate and characterize DNA polymerase priming bias. We demonstrate that certain sequence motifs are preferred over others as primers where the six nucleotide sequences at the 3' end of the primer, as well as the sequences four base pairs downstream of the priming site, may influence priming efficiencies. DNA polymerases in the same family from two different commercial vendors prefer similar motifs, while another commercially available enzyme from a different DNA polymerase family prefers different motifs. Furthermore, the preferred priming motifs are GC-rich. The DNA polymerase preference for certain sequence motifs was verified by amplification from single-primer templates. We incorporated the observed DNA polymerase preference into a primer-design program that guides the placement of the primer to an optimal location on the template. DNA polymerase priming bias was characterized using a synthetic library amplification system and NGS. The characterization of DNA polymerase priming bias was then utilized to guide the primer-design process and demonstrate varying amplification efficiencies among three commercially available DNA polymerases. The results suggest that the interaction of the DNA polymerase with the primer:template junction during the initiation of DNA polymerization is very important in terms of overall amplification bias and has broader implications for both the primer design process and multiplex PCR.

The steady-state level and stability of TLS polymerase eta are cell cycle dependent in the yeast S. cerevisiae.

PubMed

Plachta, Michal; Halas, Agnieszka; McIntyre, Justyna; Sledziewska-Gojska, Ewa

2015-05-01

Polymerase eta (Pol eta) is a ubiquitous translesion DNA polymerase that is capable of bypassing UV-induced pyrimidine dimers in an error-free manner. However, this specialized polymerase is error prone when synthesizing through an undamaged DNA template. In Saccharomyces cerevisiae, both depletion and overproduction of Pol eta result in mutator phenotypes. Therefore, regulation of the cellular abundance of this enzyme is of particular interest. However, based on the investigation of variously tagged forms of Pol eta, mutually contradictory conclusions have been reached regarding the stability of this polymerase in yeast. Here, we optimized a protocol for the detection of untagged yeast Pol eta and established that the half-life of the native enzyme is 80 ± 14 min in asynchronously growing cultures. Experiments with synchronized cells indicated that the cellular abundance of this translesion polymerase changes throughout the cell cycle. Accordingly, we show that the stability of Pol eta, but not its mRNA level, is cell cycle stage dependent. The half-life of the polymerase is more than fourfold shorter in G1-arrested cells than in those at G2/M. Our results, in concert with previous data for Rev1, indicate that cell cycle regulation is a general property of Y family TLS polymerases in S. cerevisiae. Copyright © 2015 Elsevier B.V. All rights reserved.

Evaluation of the Cobas TaqMan MTB test for the detection of Mycobacterium tuberculosis complex according to acid-fast-bacillus smear grades in respiratory specimens.

PubMed

Huh, Hee Jae; Koh, Won-Jung; Song, Dong Joon; Ki, Chang-Seok; Lee, Nam Yong

2015-02-01

We evaluated the performance of the Cobas TaqMan MTB test (Roche Diagnostics, Basel, Switzerland), stratified by acid-fast bacilli (AFB) smear grades. The sensitivity of this test in smear-positive specimens was >95% in all grades, while that in trace and negative specimens was 85.3% and 34.4%, respectively. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Use of the Genomic Subtractive Hybridization Technique To Develop a Real-Time PCR Assay for Quantitative Detection of Prevotella spp. in Oral Biofilm Samples

PubMed Central

Nagashima, Shiori; Yoshida, Akihiro; Suzuki, Nao; Ansai, Toshihiro; Takehara, Tadamichi

2005-01-01

Genomic subtractive hybridization was used to design Prevotella nigrescens-specific primers and TaqMan probes. Based on this technique, a TaqMan real-time PCR assay was developed for quantifying four oral black-pigmented Prevotella species. The combination of real-time PCR and genomic subtractive hybridization is useful for preparing species-specific primer-probe sets for closely related species. PMID:15956428

Detection and identification of occult HBV in blood donors in Taiwan using a commercial, multiplex, multi-dye nucleic acid amplification technology screening test.

PubMed

Lin, K T; Chang, C L; Tsai, M H; Lin, K S; Saldanha, J; Hung, C M

2014-02-01

The ability of a new generation commercial, multiplex, multi-dye test from Roche, the cobas TaqScreen MPX test, version 2.0, to detect and identify occult HBV infections was evaluated using routine donor samples from Kaohsiung Blood Bank, Taiwan. A total of 5973 samples were tested by nucleic acid amplification technology (NAT); 5898 in pools of six, 66 in pools of less than six and nine samples individually. NAT-reactive samples were retested with alternative NAT tests, and follow-up samples from the donors were tested individually by NAT and for all the HBV serological markers. Eight NAT-only-reactive donors were identified, and follow-up samples were obtained from six of the donors. The results indicated that all eight donors had an occult HBV infection with viral loads <12 IU/ml. The cobas(®) TaqScreen MPX test, version 2.0, has an advantage over the current Roche blood screening test, the cobas TaqScreen MPX test, for screening donations in countries with a high prevalence of occult HBV infections since the uncertainty associated with identifying samples with very low viremia is removed by the ability of the test to identify the viral target in samples that are reactive with the cobas TaqScreen MPX test, version 2.0. © 2013 International Society of Blood Transfusion.

Vitamin D, folate, and potential early lifecycle environmental origin of significant adult phenotypes.

PubMed

Lucock, Mark; Yates, Zoë; Martin, Charlotte; Choi, Jeong-Hwa; Boyd, Lyndell; Tang, Sa; Naumovski, Nenad; Furst, John; Roach, Paul; Jablonski, Nina; Chaplin, George; Veysey, Martin

2014-01-01

Vitamin D and folate are highly UV sensitive, and critical for maintaining health throughout the lifecycle. This study examines whether solar irradiance during the first trimester of pregnancy influences vitamin D receptor (VDR) and nuclear folate gene variant occurrence, and whether affected genes influence late-life biochemical/clinical phenotypes. 228 subjects were examined for periconceptional exposure to solar irradiance, variation in vitamin D/folate genes (polymerase chain reaction (PCR)), dietary intake (food frequency questionnaire (FFQ)) and important adult biochemical/clinical phenotypes. Periconceptional solar irradiance was associated with VDR-BsmI (P = 0.0008(wk7)), TaqI (P = 0.0014(wk7)) and EcoRV (P = 0.0030(wk6)) variant occurrence between post-conceptional weeks 6-8, a period when ossification begins. Similar effects were detected for other VDR gene polymorphisms. Periconceptional solar irradiance was also associated with 19 bp del-DHFR (P = 0.0025(wk6)), and to a lesser extent C1420T-SHMT (P = 0.0249(wk6)), a folate-critical time during embryogenesis. These same genes were associated with several late-life phenotypes: VDR-BsmI, TaqI and ApaI determined the relationship between dietary vitamin D and both insulin (P < 0.0001/BB, 0.0007/tt and 0.0173/AA, respectively) and systolic blood pressure (P = 0.0290/Bb, 0.0299/Tt and 0.0412/AA, respectively), making them important early and late in the lifecycle. While these and other phenotype associations were found for the VDR variants, folate polymorphism associations in later-life were limited to C1420T-SHMT (P = 0.0037 and 0.0297 for fasting blood glucose and HbA1c levels, respectively). We additionally report nutrient-gene relationships with body mass index, thiol/folate metabolome, cognition, depression and hypertension. Furthermore, photoperiod at conception influenced occurrence of VDR-Tru9I and 2R3R-TS genotypes (P = 0.0120 and 0.0360, respectively). Findings identify environmental and nutritional agents that may interact to modify gene-phenotype relationships across the lifecycle, offering new insight into human ecology. This includes factors related to both disease aetiology and the evolution of skin pigmentation.

Comparison of human immunodeficiency virus assays in window phase and elite controller samples: viral load distribution and implications for transmission risk

PubMed Central

Vermeulen, Marion; Coleman, Charl; Mitchel, Josephine; Reddy, Ravi; van Drimmelen, Harry; Fickett, Tracy; Busch, Michael; Lelie, Nico

2016-01-01

BACKGROUND After 3 years of individual-donation nucleic acid test (ID-NAT) screening by the South African National Blood Service (SANBS), a repository of 73 human immunodeficiency virus antibody (anti-HIV)-negative window period (WP)-yield samples and 28 anti-HIV–positive, HIV-RNA–negative elite controllers (ECs) became available for comparison of a p24 antigen (p24 Ag) assay (Innogenetics), two viral load assays (Siemens branch DNA [bDNA] 3.0 and Abbott real-time polymerase chain reaction [RT-PCR]), and three triplex NAT assays (Novartis Diagnostics Ultrio and Ultrio-Plus and Roche TaqScreen) by replicate testing of dilutions. STUDY DESIGN AND METHODS Viral loads were assessed by bDNA and RT-PCR assays and if below 100 copies (cps)/mL, by Ultrio limiting dilution probit analysis. The probability of virus transmission by WP and EC donations was estimated for different levels of the 50% minimum infectious dose (ID50) using Poisson distribution statistics. RESULTS The equal distribution of WP donations plotted by log HIV-RNA levels indicated a random appearance of donors in the ramp-up phase. The HIV p24 Ag assay detected 45% of WP samples and the cutoff crossing point was estimated at 8140 (bDNA)/ 22,710 (RT-PCR) cps/mL. On replicate retesting of 40 HIV p24 Ag–negative ID-NAT WP-yield samples Ultrio minipool (MP)8, Ultrio-Plus MP8, and TaqScreen MP6 detected 79, 81, and 78%, respectively. Modeling with an estimated ID50 of 31.6 virions/RBC indicated that 15% of p24 Ag–negative ID-NAT WP-yield donations would have transmitted HIV if MP6–8 NAT had been used. Only 2% of RBC transfusions from ECs are estimated to be infectious with a worst-case ID50 estimate of 316 virions. CONCLUSION Our analysis of viremia and infectivity of WP and EC donations enables comparison of the efficacy of NAT options in preventing HIV transmission risk. PMID:23445273

Comparison of human immunodeficiency virus assays in window phase and elite controller samples: viral load distribution and implications for transmission risk.

PubMed

Vermeulen, Marion; Coleman, Charl; Mitchel, Josephine; Reddy, Ravi; van Drimmelen, Harry; Fickett, Tracy; Busch, Michael; Lelie, Nico

2013-10-01

After 3 years of individual-donation nucleic acid test (ID-NAT) screening by the South African National Blood Service (SANBS), a repository of 73 human immunodeficiency virus antibody (anti-HIV)-negative window period (WP)-yield samples and 28 anti-HIV-positive, HIV-RNA-negative elite controllers (ECs) became available for comparison of a p24 antigen (p24 Ag) assay (Innogenetics), two viral load assays (Siemens branch DNA [bDNA] 3.0 and Abbott real-time polymerase chain reaction [RT-PCR]), and three triplex NAT assays (Novartis Diagnostics Ultrio and Ultrio-Plus and Roche TaqScreen) by replicate testing of dilutions. Viral loads were assessed by bDNA and RT-PCR assays and if below 100 copies (cps)/mL, by Ultrio limiting dilution probit analysis. The probability of virus transmission by WP and EC donations was estimated for different levels of the 50% minimum infectious dose (ID50 ) using Poisson distribution statistics. The equal distribution of WP donations plotted by log HIV-RNA levels indicated a random appearance of donors in the ramp-up phase. The HIV p24 Ag assay detected 45% of WP samples and the cutoff crossing point was estimated at 8140 (bDNA)/22,710 (RT-PCR) cps/mL. On replicate retesting of 40 HIV p24 Ag-negative ID-NAT WP-yield samples Ultrio minipool (MP)8, Ultrio-Plus MP8, and TaqScreen MP6 detected 79, 81, and 78%, respectively. Modeling with an estimated ID50 of 31.6 virions/RBC indicated that 15% of p24 Ag-negative ID-NAT WP-yield donations would have transmitted HIV if MP6-8 NAT had been used. Only 2% of RBC transfusions from ECs are estimated to be infectious with a worst-case ID50 estimate of 316 virions. Our analysis of viremia and infectivity of WP and EC donations enables comparison of the efficacy of NAT options in preventing HIV transmission risk. © 2013 American Association of Blood Banks.

Association Between Polymorphisms of VDR, COL1A1, and LCT genes and bone mineral density in Belarusian women with severe postmenopausal osteoporosis.

PubMed

Marozik, Pavel; Mosse, Irma; Alekna, Vidmantas; Rudenko, Ema; Tamulaitienė, Marija; Ramanau, Heorhi; Strazdienė, Vaidilė; Samokhovec, Volha; Ameliyanovich, Maxim; Byshnev, Nikita; Gonchar, Alexander; Kundas, Liubov; Zhur, Krystsina

2013-01-01

BACKGROUND AND OBJECTIVE. Variation of osteoporosis in the population is the result of an interaction between the genotype and the environment, and the genetic causes of osteoporosis are being widely investigated. The aim of this study was to analyze the association between the polymorphisms of the vitamin D receptor (VDR), type I collagen (COL1A1), and lactase (LCT) genes and severe postmenopausal osteoporosis as well as bone mineral density (BMD). MATERIAL AND METHODS. A total of 54 women with severe postmenopausal osteoporosis and 77 controls (mean age, 58.3 years [SD, 6.2] and 56.7 years [SD, 7.42], respectively) were included into the study. The subjects were recruited at the City Center for Osteoporosis Prevention (Minsk, Belarus). Dual-energy x-ray absorptiometry was used to measure bone mineral density at the lumbar spine and the femoral neck. Severe osteoporosis was diagnosed in the women with the clinical diagnosis of postmenopausal osteoporosis and at least 1 fragility fracture. The control group included women without osteoporosis. Polymorphic sites in osteoporosis predisposition genes (ApaI, BsmI, TaqI, and Cdx2 of the VDR gene, G2046T of the COL1A1 gene, and T-13910C of the LCT gene) were determined using the polymerase chain reaction on the deoxyribonucleic acid isolated from dried bloodspots. RESULTS. The data showed that the ApaI and BsmI polymorphisms of the VDR gene and T- 13910C of the LCT gene were associated with severe postmenopausal osteoporosis in the analyzed Belarusian women (P<0.01). A statistically significant positive correlation between the VDR risk genotypes ApaI and TaqI and bone mineral density was found (P<0.05). CONCLUSIONS. The findings of this study suggest that at least the ApaI and BsmI polymorphisms of the VDR gene and T-13910C of the LCT gene are associated with the risk of postmenopausal osteoporosis in our sample of the Belarusian women.

Synergistic effects of gene polymorphisms of the renin-angiotensin-aldosterone system on essential hypertension in Kazakhs in Xinjiang.

PubMed

Niu, Shudong; Zhang, Bin; Zhang, Keyong; Zhu, Pengcheng; Li, Jingping; Sun, Yujing; He, Ning; Zhang, Mingtao; Gao, Zhiying; Li, Xueyan; Simayi, Amuti; Ge, Jie; Cong, Mingyu; Zhou, Wenna; Qiu, Changchun

2016-01-01

To assess the synergistic effects of gene polymorphisms of the renin-angiotensin-aldosterone system (RAAS) on essential hypertension (EH) in Kazakhs in Xinjiang. A cross-sectional case-control association study was conducted in 52 1 hypertensive and 623 normotensive subjects of Kazakh ethnicity on eight common single nucleotide polymorphisms (SNPs) interspersed over five genes of the RAAS. SNPs were genotyped by polymerase chain reaction-restriction fragment length polymorphism. Interactions among the SNPs were analyzed by the multifactor dimensionality reduction method (MDR). In single-locus analysis, subjects with AGT -6G, ACE D, and CYP11B2 -344C had increased susceptibility to EH (OR: 1.249; 1.425; 1.201). When subgrouped by sex, males with the t allele of REN Taq I had decreased risk for EH (OR: 0.529), and those with AGT -6G and CYP11B2 -344 C had increased risk for EH (OR: 1.498; 1.449). In females, carrying ACE D increased the risk for EH. (OR: 1.327). In six AGT haplotypes, H1 was protective, while H3 increased susceptibility to EH (OR: 0.683; 2.025). Interaction analysis by MDR showed that there was a strong synergistic effect between ACE I/D and CY11B2 (T-344C) and a moderate interaction between both ACE I/D and CY11B2 T-344C and AGT A-6G. There was a strong synergistic effect between ACE I/D and CY11B2 T-344C and a moderate effect between both ACE I/D and CY11B2 T-344C and AGT A-6G. AGT -6G, ACE D, and CY11B2 -344C increased susceptibility to EH. REN Taq I, AGT -6G, CY11B2 -344 C and ACE D were associated with male and female EH, respectively. H1 and H3 of AGT were protective and risk haplotypes, respectively.

Development and validation of a real-time TaqMan assay for the detection and enumeration of Pseudomonas fluorescens ATCC 13525 used as a challenge organism in testing of food equipments.

PubMed

Saha, Ratul; Bestervelt, Lorelle L; Donofrio, Robert S

2012-02-01

Pseudomonas fluorescens ATCC 13525 is used as the challenge organism to evaluate the efficacy of the clean-in-place (CIP) process of food equipment (automatic ice-maker) as per NSF/ANSI Standard 12. Traditional culturing methodology is presently used to determine the concentration of the challenge organism, which takes 48 h to confirm the cell density. Storage of the challenge preparation in the refrigerator might alter the cell density as P. fluorescens is capable of growing at 4 °C. Also, background organism can grow on the Pseudomonas F agar (PFA) used for the recovery of P. fluorescens thus affecting the results of the test. Real-time TaqMan assay targeting the cpn60 gene was developed for the enumeration and the identification of P. fluorescens because of its specificity, accuracy, and shorter turnaround time. The TaqMan primer-probe pair developed using the Allele ID® 7.0 probe design software was highly specific and sensitive for the target organism. The sensitivity of the assay was 10 colony forming units (CFU)/mL. The assay was also successful in determining the concentration of the challenge preparation within 2 h. Based on these observations, TaqMan assay targeting the cpn60 gene can be efficiently used for strain level identification and enumeration of bacteria. Pseudomonas fluorescens ATCC 13525 is used as a challenge organism in the efficacy testing of clean-in-place process of food equipments. Currently, culturing technique is used for its identification and estimation, which is not only time-consuming but also prone to error. Real-time TaqMan assay is more specific, sensitive, and accurate along with a shorter turnaround time compared to culturing techniques, thereby increasing the overall quality of the testing methodology to evaluate the clean-in-place process critical for the food industry to protect public health and safety. © 2012 Institute of Food Technologists®

Discovery of Potent Non-Nucleoside Inhibitors of Dengue Viral RNA-Dependent RNA Polymerase from a Fragment Hit Using Structure-Based Drug Design.

PubMed

Yokokawa, Fumiaki; Nilar, Shahul; Noble, Christian G; Lim, Siew Pheng; Rao, Ranga; Tania, Stefani; Wang, Gang; Lee, Gladys; Hunziker, Jürg; Karuna, Ratna; Manjunatha, Ujjini; Shi, Pei-Yong; Smith, Paul W

2016-04-28

The discovery and optimization of non-nucleoside dengue viral RNA-dependent-RNA polymerase (RdRp) inhibitors are described. An X-ray-based fragment screen of Novartis' fragment collection resulted in the identification of a biphenyl acetic acid fragment 3, which bound in the palm subdomain of RdRp. Subsequent optimization of the fragment hit 3, relying on structure-based design, resulted in a >1000-fold improvement in potency in vitro and acquired antidengue activity against all four serotypes with low micromolar EC50 in cell-based assays. The lead candidate 27 interacts with a novel binding pocket in the palm subdomain of the RdRp and exerts a promising activity against all clinically relevant dengue serotypes.

Study of Pure Proteins, Nucleic Acids and Their Complexes from Halobacteria of the Dead Sea: RNA Polymerase-DNA Interaction.

DTIC Science & Technology

1987-09-21

objectives of our program are to isolate and characterize a fully active DNA dependent RNA polymerase from the extremely halophilic archaebacteria of the genus...operons in II. Marismortui. The halobacteriaceae are extreme halophiles . They require 3.5 M NaCI for optimal growth an(l no growth is observed below 2...was difficutlt to perform due to the extreme genetic instability in this strain (6). In contrast, the genoine of the extreme halophilic and prototrophic

Interaction of the TaqIA polymorphism and poor parental socialization on changes in adolescent marijuana use.

PubMed

Vaske, Jamie

2013-02-01

The current study uses data from the genetic subsample from the National Longitudinal Study of Adolescent Health (Add Health) in waves I and II (ages of 11-19 and 12-20 respectively) to investigate the interaction of the TaqIA polymorphism and poor parental socialization on changes in adolescent marijuana use. Results reveal that TaqIA interacts with poor parental rule setting, but not quality of mother-child communication, to influence changes in marijuana use. Adolescents who are homozygous for the A1 and whose parents allow the youth to set their own curfew experience significant increases in marijuana use during adolescence. In contrast, youths with the A1/A1 genotype whose parents do not allow the adolescent to set their own curfew experience significant decreases in the frequency of marijuana use. These results suggest that direct parental social control may effectively suppress the genetic risk of the A1/A1 genotype on marijuana use in adolescence. The study's limitations are noted.

Haplotype diversity and linkage disequilibrium at DRD2 locus--a study on four population groups of Andhra Pradesh, India.

PubMed

Saraswathy, Kallur Nava; Mukhopadhyay, Rupak; Shukla, Deepti; Kaur, Harpreet; Sachdeva, Mohinder Pal; Rao, A P; Saksena, Deepti; Kalla, Aloke Kumar

2009-02-01

Dopamine receptor D2 (DRD2) is expressed in the central nervous system and has a high affinity for many antipsychotic drugs. Besides several epidemiological investigations on association of DRD2 locus polymorphism(s) with neuropsychiatric problems and addictive behavior, a few polymorphisms in this locus have also been used to understand genomic diversity and population migratory histories globally. The present study attempts to understand the genomic diversity/affinity among four endogamous groups of Andhra Pradesh (India) against the backdrop of diversity studies from other parts of India and the rest of the world, with special reference to DRD2 locus. The four population groups from Adilabad District of Andhra Pradesh, namely, Brahmin (n=50), Nayakpod (n=49), Thoti (n=52), and Kolam (n=53), were included in the study. The DRD2 markers typed for the present study are three biallelic restriction fragments, that is, TaqI A (rs1800497), TaqI B (rs1079597), and TaqI D (rs1800498). Scoring of DRD2 haplotypes with respect to the three TaqI sites shows that five out of eight possible haplotypes are shared by the four populations. Ancestral haplotype B2D2A1 is most frequent among Thotis (0.359). The results of the present study indicate a differential gene flow into South India followed by certain important demographic events resulting in diversified peopling of India.

Cholesterol ester transfer protein (CETP) Taq1B polymorphism influences the effect of a standardized cardiac rehabilitation program on lipid risk markers.

PubMed

Ayyobi, Amir F; Hill, John S; Molhuizen, Henri O F; Lear, Scott A

2005-08-01

Cardiac rehabilitation programs (CR) are standard treatment for patients with coronary artery disease (CAD), yet a large variation in risk factor and lipoprotein changes exists. We investigated the role of three common genetic polymorphisms (CETP Taq1B, LIPC -514 and apo E) associated with alterations of lipoprotein metabolism, in patients before and after standardized CR. Three-hundred and seven patients were recruited for this study. DNA samples were collected and all three genotypes were determined for every patient. While the hepatic lipase LIPC promoter polymorphism and apo E genotype showed little or no correlation with response to CR, CETP Taq1B showed significant association with changes in plasma lipid and lipoproteins. The B1 homozygotes for CETP Taq1B genotype showed significant reduction in TC (-0.25+/-0.07, p < 0.01), LDL-C (-0.15+/-0.06, p < 0.050) and TG (-0.20+/-0.08, p < 0.05). B2 carriers showed no significant change in these parameters. HDL-C, exercise capacity and BMI improved independent of genotype. Individuals with the B1B1 genotype appear to respond well to CR, whereas B2 carriers exhibit marginal gains in lipoprotein risk factors. Although the B2 carriers had similar benefits in exercise capacity and weight reduction, long-term consequences of little or no change in lipoprotein risk factors require further investigation to establish appropriate management strategies.

A meiotic DNA polymerase from a mushroom, Agaricus bisporus.

PubMed Central

Takami, K; Matsuda, S; Sono, A; Sakaguchi, K

1994-01-01

A meiotic DNA polymerase [DNA nucleotidyltransferase (DNA-directed), EC 2.7.7.7], which likely has a role in meiotic DNA repair, was isolated from a mushroom, Agaricus bisporus. The purified fraction displays three bands in SDS/PAGE, at molecular masses of 72 kDa, 65 kDa and 36 kDa. Optimal activity is at pH 7.0-8.0 in the presence of 5 mM Mg2+ and 50 mM KCl and at 28-30 degrees C, which is the temperature for meiosis. This enzyme is resistant to N-ethylmaleimide and sensitive to 2',3'-dideoxythymidine 5'-triphosphate, suggesting that it is a beta-like DNA polymerase. These characteristics are similar to those of Coprinus DNA polymerase beta [Sakaguchi and Lu (1982) Mol. Cell. Biol. 2, 752-757]. In Western-blot analysis, the antiserum against the Coprinus polymerase reacts only with the 65 kDa band, which coincides with the molecular mass of the Coprinus polymerase. Western-blot analysis also showed that the antiserum could react with crude extracts not only from the Agaricales family, to which Agaricus and Coprinus belong, but also from different mushroom families and Saccharomyces. The Agaricus polymerase activity can be found only in the meiotic-cell-rich fraction, but the enzyme is also present in the somatic cells in an inactive state. Images Figure 2 Figure 5 Figure 6 PMID:8172591

A temperature control method for shortening thermal cycling time to achieve rapid polymerase chain reaction (PCR) in a disposable polymer microfluidic device

NASA Astrophysics Data System (ADS)

Bu, Minqiang; Perch-Nielsen, Ivan R.; Sørensen, Karen S.; Skov, Julia; Sun, Yi; Duong Bang, Dang; Pedersen, Michael E.; Hansen, Mikkel F.; Wolff, Anders

2013-07-01

We present a temperature control method capable of effectively shortening the thermal cycling time of polymerase chain reaction (PCR) in a disposable polymer microfluidic device with an external heater and a temperature sensor. The method employs optimized temperature overshooting and undershooting steps to achieve a rapid ramping between the temperature steps for DNA denaturation, annealing and extension. The temperature dynamics within the microfluidic PCR chamber was characterized and the overshooting and undershooting parameters were optimized using the temperature-dependent fluorescence signal from Rhodamine B. The method was validated with the PCR amplification of mecA gene (162 bp) from methicillin-resistant Staphylococcus aureus bacterium (MRSA), where the time for 30 cycles was reduced from 50 min (without over- and undershooting) to 20 min.

Rapid detection of Enterovirus and Coxsackievirus A10 by a TaqMan based duplex one-step real time RT-PCR assay.

PubMed

Chen, Jingfang; Zhang, Rusheng; Ou, Xinhua; Yao, Dong; Huang, Zheng; Li, Linzhi; Sun, Biancheng

2017-06-01

A TaqMan based duplex one-step real time RT-PCR (rRT-PCR) assay was developed for the rapid detection of Coxsackievirus A10 (CV-A10) and other enterovirus (EVs) in clinical samples. The assay was fully evaluated and found to be specific and sensitive. When applied in 115 clinical samples, a 100% diagnostic sensitivity in CV-A10 detection and 97.4% diagnostic sensitivity in other EVs were found. Copyright © 2017 Elsevier Ltd. All rights reserved.

Competitive fitness during feast and famine: how SOS DNA polymerases influence physiology and evolution in Escherichia coli.

PubMed

Corzett, Christopher H; Goodman, Myron F; Finkel, Steven E

2013-06-01

Escherichia coli DNA polymerases (Pol) II, IV, and V serve dual roles by facilitating efficient translesion DNA synthesis while simultaneously introducing genetic variation that can promote adaptive evolution. Here we show that these alternative polymerases are induced as cells transition from exponential to long-term stationary-phase growth in the absence of induction of the SOS regulon by external agents that damage DNA. By monitoring the relative fitness of isogenic mutant strains expressing only one alternative polymerase over time, spanning hours to weeks, we establish distinct growth phase-dependent hierarchies of polymerase mutant strain competitiveness. Pol II confers a significant physiological advantage by facilitating efficient replication and creating genetic diversity during periods of rapid growth. Pol IV and Pol V make the largest contributions to evolutionary fitness during long-term stationary phase. Consistent with their roles providing both a physiological and an adaptive advantage during stationary phase, the expression patterns of all three SOS polymerases change during the transition from log phase to long-term stationary phase. Compared to the alternative polymerases, Pol III transcription dominates during mid-exponential phase; however, its abundance decreases to <20% during long-term stationary phase. Pol IV transcription dominates as cells transition out of exponential phase into stationary phase and a burst of Pol V transcription is observed as cells transition from death phase to long-term stationary phase. These changes in alternative DNA polymerase transcription occur in the absence of SOS induction by exogenous agents and indicate that cell populations require appropriate expression of all three alternative DNA polymerases during exponential, stationary, and long-term stationary phases to attain optimal fitness and undergo adaptive evolution.

Transcription in Yeast: Separation and Properties of Multiple RNA Polymerases

PubMed Central

Adman, Ray; Schultz, Loren D.; Hall, Benjamin D.

1972-01-01

Four peaks of DNA-directed RNA polymerase activity are resolved by salt gradient elution of a sonicated yeast cell extract on DEAE-Sephadex. The enzymes, which are named IA, IB, II, and III in order of elution, all appear to come from cell nuclei. Only enzyme II is sensitive to α-amanitin. All enzymes are more active with Mn++ than with Mg++ as divalent ion. Enzymes IB and II have salt optima in the range 0.05-0.10 M (NH4)2SO4, whereas enzyme III is maximally active at 0.20-0.25 M (NH4)2SO4. With optimal salt concentration and saturating DNA, the template preference ratio, activity on native calfthymus DNA divided by activity on denatured calf-thymus DNA, is 2.2 for IB, 0.4 for II, and 3.5 for III. None of the yeast polymerases was inhibited by rifamycin SV. Rifamycin AF/013 effectively inhibited polymerases IB, II, and III. PMID:4558656

Development of SYBR Green and TaqMan quantitative real-time PCR assays for hepatopancreatic parvovirus (HPV) infecting Penaeus monodon in India.

PubMed

Yadav, Reena; Paria, Anutosh; Mankame, Smruti; Makesh, M; Chaudhari, Aparna; Rajendran, K V

2015-12-01

Hepatopancreatic parvovirus (HPV) infects Penaeus monodon and causes mortality in the larval stages. Further, it has been implicated in the growth retardation in cultured P. monodon. Though different geographical isolates of HPV show large sequence variations, a sensitive PCR assay specific to Indian isolate has not yet been reported. Here, we developed a sensitive SYBR Green-based and TaqMan real-time PCR for the detection and quantification of the virus. A 441-bp PCR amplicon was cloned in pTZ57 R/T vector and the plasmid copy number was estimated. A 10-fold serial dilution of the plasmid DNA from 1 × 10(9) copies to 1 copy was prepared and used as the standard. The primers were tested initially using the standard on a conventional PCR format to determine the linearity of detection. The standards were further tested on real-time PCR format using SYBR Green and TaqMan chemistry and standard curves were generated based on the Ct values from three well replicates for each dilution. The assays were found to be sensitive, specific and reproducible with a wide dynamic range (1 × 10(9) to 10 copies) with coefficient of regression (R(2)) > 0.99, calculated average slope -3.196 for SYBR Green assay whereas, for TaqMan assay it was >0.99 and -3.367, respectively. The intra- and inter-assay variance of the Ct values ranged from 0.26% to 0.94% and 0.12% to 0.81%, respectively, for SYBR Green assay, and the inter-assay variance of the Ct values for TaqMan assay ranged from 0.07% to 1.93%. The specificity of the assays was proved by testing other DNA viruses of shrimp such as WSSV, IHHNV and MBV. Standardized assays were further tested to detect and quantify HPV in the post-larvae of P. monodon. The result was further compared with conventional PCR to test the reproducibility of the test. The assay was also used to screen Litopeneaus vannamei, Macrobrachium rosenbergii and Scylla serrata for HPV. Copyright © 2015 Elsevier Ltd. All rights reserved.

Polymorphisms in VDR gene in Tunisian postmenopausal women are associated with osteopenia phenotype.

PubMed

Sassi, R; Sahli, H; Souissi, C; Sellami, S; Ben Ammar El Gaaied, A

2015-01-01

Osteopenia is characterized by intermediate values of bone mineral density (BMD) as compared to normal and osteoporotic subjects. BMD, a surrogate phenotype for osteoporosis, is influenced in part by genetic factors. Among the genes associated with BMD, the vitamin D receptor (VDR) was the first gene studied as a potential candidate associated with BMD in adult and postmenopausal bone loss. However, results are controversial. To determine whether VDR polymorphisms ApaI and TaqI are associated with BMD, osteopenia, osteoporosis and low-impact fracture risk in North Africans, these genotypes were analyzed in 566 postmenopausal Tunisian women. In postmenopausal Tunisian women, the GT ApaI genotype seems to be protective against osteoporosis development (p = 0.02; odds ratio = 0.54). Moreover, the presence of the combined GT/TT genotype of ApaI and TaqI polymorphisms is more frequent in normal BMD women than in osteoporotic women (p = 0.00; odds ratio = 0.41). Interestingly, the GG ApaI genotype is associated with osteopenia development (p = 0.02; odds ratio = 1.86) and also the TT TaqI polymorphism (p = 0.02; odds ratio = 1.53). The GG ApaI genotype is associated with a three times risk of vertebral fracture. The ApaI polymorphism showed an association with osteopenia and low-impact vertebral fracture incidence but not with osteoporosis. The TaqI polymorphism is associated specifically with the osteopenia phenotype. The presence of the two polymorphisms increases the risk to develop osteopenia in postmenopausal Tunisian women. Osteopenia seems to be genetically determined. However, osteoporosis is the result of interaction between genetic and environmental factors.

Post-TBI cognitive performance is moderated by variation within ANKK1 and DRD2 genes

PubMed Central

Failla, Michelle D.; Myrga, John M.; Ricker, Joseph H.; Dixon, C. Edward; Conley, Yvette P.; Wagner, Amy K.

2014-01-01

Objective As dopamine neurotransmission impacts cognition, we hypothesized variants in the linked dopamine D2 receptor (DRD2) and ankyrin repeat and kinase domain (ANKK1) genes might account for some individual variability in cognitive recovery post-TBI. Participants Prospective cohort of 108 survivors of severe TBI, recruited consecutively from a level 1 trauma center. Design We examined relationships between DRD2 genetic variation and functional recovery at 6 and 12 months post-TBI. Main Measures Cognitive performance was evaluated using 8 neuropsychological tests targeting different cognitive domains. An overall cognitive composite was developed based on normative data. We also assessed functional cognition, depression status, and global outcome. Subjects were genotyped for 6 DRD2 tagging single nucleotide polymorphisms and Taq1A within ANKK1. Results ANKK1 Taq1A heterozygotes performed better than homozygotes across several cognitive domains at both time-points post-injury. When adjusting for age, GCS, and education, the Taq1A (ANKK1) and rs6279 (DRD2) variants were associated with overall composite scores at 6 months post-TBI (p=0.0468, 0.0430, respectively). At 12 months, only Taq1A remained a significant genetic predictor of cognition (p=0.0128). Following multiple comparisons correction, there were no significant associations between examined genetic variants and functional cognition, depression status, and global outcome. Conclusion These data suggest genetic variation within DRD2 influences cognitive recovery post-TBI. Understanding genetic influences on dopaminergic systems post-TBI may impact current treatment paradigms. PMID:25931179

Association between the DRD2 A1 allele and response to methadone and buprenorphine maintenance treatments.

PubMed

Barratt, Daniel T; Coller, Janet K; Somogyi, Andrew A

2006-06-05

The TaqI A polymorphism (A(1)) of the dopamine D(2) receptor gene (DRD2), although not a specific predictor of opioid dependence, has been strongly associated with high levels of prior heroin use and poor treatment outcomes among methadone maintenance patients. The aims of this study were to confirm these findings via a retrospective analysis of A(1) allele frequency in methadone (n = 46) and buprenorphine (n = 25) patients, and non-opioid-dependent controls (n = 95). Subjects were genotyped at the DRD2 TaqI A locus using PCR amplification followed by TaqI restriction enzyme digestion and gel electrophoresis. For methadone and buprenorphine subjects, heroin use (prior to treatment), treatment outcomes, and withdrawal occurrence were determined from comprehensive case notes. No significant differences in A(1) allele frequency (%) were observed between: methadone (19.6%), buprenorphine (18.0%), and control (17.9%) groups (P > 0.7); successful and poor treatment outcome groups, methadone: 20.0% and 19.2%, respectively (P = 1.0); buprenorphine: 18.4% and 20.0%, respectively (P = 1.0). Also, there were no significant relationships between TaqI A genotype and prior heroin use (P = 0.47). However, among the successful methadone subjects, significantly fewer A(1) allele carriers experienced withdrawal than non-A(1) carriers (P = 0.04). In conclusion, the DRD2 genotype effects did not affect opioid maintenance treatment outcomes. This suggests the need for a further prospective investigation into the role of the DRD2 A(1) allele in heroin use and response to maintenance pharmacotherapies for opioid dependence.

A Review of Therapeutic Aptamer Conjugates with Emphasis on New Approaches

PubMed Central

Bruno, John G.

2013-01-01

The potential to emulate or enhance antibodies with nucleic acid aptamers while lowering costs has prompted development of new aptamer-protein, siRNA, drug, and nanoparticle conjugates. Specific focal points of this review discuss DNA aptamers covalently bound at their 3' ends to various proteins for enhanced stability and greater pharmacokinetic lifetimes in vivo. The proteins can include Fc tails of IgG for opsonization, and the first component of complement (C1q) to trigger complement-mediated lysis of antibiotic-resistant Gram negative bacteria, cancer cells and possibly some parasites during vulnerable stages. In addition, the 3' protein adduct may be a biotoxin, enzyme, or may simply be human serum albumin (HSA) or a drug known to bind HSA, thereby retarding kidney and other organ clearance and inhibiting serum exonucleases. In this review, the author summarizes existing therapeutic aptamer conjugate categories and describes his patented concept for PCR-based amplification of double-stranded aptamers followed by covalent attachment of proteins or other agents to the chemically vulnerable overhanging 3' adenine added by Taq polymerase. PCR amplification of aptamers could dramatically lower the current $2,000/gram cost of parallel chemical oligonucleotide synthesis, thereby enabling mass production of aptamer-3'-protein or drug conjugates to better compete against expensive humanized monoclonal antibodies. PMID:24276022

Comparison of culture and qPCR methods in detection of mycobacteria from drinking waters.

PubMed

Räsänen, Noora H J; Rintala, Helena; Miettinen, Ilkka T; Torvinen, Eila

2013-04-01

Environmental mycobacteria are common bacteria in man-made water systems and may cause infections and hypersensitivity pneumonitis via exposure to water. We compared a generally used cultivation method and a quantitative polymerase chain reaction (qPCR) method to detect mycobacteria in 3 types of drinking waters: surface water, ozone-treated surface water, and groundwater. There was a correlation between the numbers of mycobacteria obtained by cultivation and qPCR methods, but the ratio of the counts obtained by the 2 methods varied among the types of water. The qPCR counts in the drinking waters produced from surface or groundwater were 5 to 34 times higher than culturable counts. In ozone-treated surface waters, both methods gave similar counts. The ozone-treated drinking waters had the highest concentration of assimilable organic carbon, which may explain the good culturability. In warm tap waters, qPCR gave 43 times higher counts than cultivation, but both qPCR counts and culturable counts were lower than those in the drinking waters collected from the same sites. The TaqMan qPCR method is a rapid and sensitive tool for total quantitation of mycobacteria in different types of clean waters. The raw water source and treatments affect both culturability and total numbers of mycobacteria in drinking waters.

The D543N polymorphism of the SLC11A1/NRAMP1 gene is associated with treatment failure in male patients with pulmonary tuberculosis.

PubMed

Salinas-Delgado, Yvain; Galaviz-Hernández, Carlos; Toral, René García; Ávila Rejón, Carmen A; Reyes-Lopez, Miguel A; Martínez, Antonio Rojas; Martínez-Aguilar, Gerardo; Sosa-Macías, Martha

2015-09-01

Polymorphisms in SLC11A1/NRAMP1 have shown an important association with susceptibility to tuberculosis and progression to active disease. However, whether there is an association of these polymorphisms with treatment failure is unknown. The aim of this study was to determine the association of SLC11A1 polymorphisms with treatment failure in Mexican subjects with pulmonary tuberculosis. Thirty-three subjects with treatment failure were paired by age and body mass index with 33 patients who successfully completed treatment and were considered cured. We assessed the polymorphisms of SLC11A1 in the regions of D543N and INT4 via polymerase chain reaction real-time TaqMan® single nucleotide polymorphism (SNP) genotyping. We found that D543N (G/A genotype) was associated with treatment failure in patients with pulmonary tuberculosis [odds ratio (OR) 11.61, 95% confidence interval (CI) 3.66-36.78]. When adjusted by gender, this association remained significant in males (OR 11.09, 95% CI 3.46-35.51). In our male population, the presence of the D543N polymorphism of SLC11A1 is a risk factor for treatment failure. This finding should be confirmed in other populations.

Valacyclovir Pharmacokinetics and Exploratory Pharmacodynamics in Young Adults With Epstein-Barr Virus Infectious Mononucleosis

PubMed Central

Vezina, Heather E.; Balfour, Henry H.; Weller, Dennis R.; Anderson, Bruce J.; Brundage, Richard C.

2017-01-01

Primary Epstein-Barr virus (EBV) infection often results in infectious mononucleosis and is associated with serious sequelae. No treatment is approved for EBV infection, and an antiviral intervention would be significant. The objectives of this study are to characterize the pharmacokinetics and explore the pharmacodynamics of acyclovir in plasma and oral washings of 8 subjects receiving 7 days of valacyclovir 1500 mg twice daily for EBV infectious mononucleosis. Virologic and clinical responses are assessed over 12 days. Acyclovir is measured by liquid chromatography/ultraviolet detection. EBV DNA is quantitated by TaqMan polymerase chain reaction. NONMEM VI and linear regression are used for data analysis. Acyclovir profiles in plasma and oral washings are consistent with a 1-compartment model. Final model estimates of clearance, volume of distribution, and fraction of acyclovir in oral wash supernatant are 49.9 L/h, 74.1 L, and 1.14%, respectively. The quantity of EBV DNA in oral washings and blood, and the severity of illness, measured by a graded scale, decrease during treatment. After treatment, viral rebound occurs in oral washings but not in blood, and the severity of illness continues to decline. Acyclovir pharmacokinetic parameters do not correlate with response metrics. These results support further studies of valacyclovir for EBV infectious mononucleosis. PMID:19897764

Development and application of a rapid, user-friendly, and inexpensive method to detect Dehalococcoides sp. reductive dehalogenase genes from groundwater.

PubMed

Kanitkar, Yogendra H; Stedtfeld, Robert D; Hatzinger, Paul B; Hashsham, Syed A; Cupples, Alison M

2017-06-01

TaqMan probe-based quantitative polymerase chain reaction (qPCR) specific to the biomarker reductive dehalogenase (RDase) genes is a widely accepted molecular biological tool (MBT) for determining the abundance of Dehalococcoides sp. in groundwater samples from chlorinated solvent-contaminated sites. However, there are significant costs associated with this MBT. In this study, we describe an approach that requires only low-cost laboratory equipment (a bench top centrifuge and a water bath) and requires less time and resources compared to qPCR. The method involves the concentration of biomass from groundwater, without DNA extraction, and loop-mediated isothermal amplification (LAMP) of the cell templates. The amplification products are detected by a simple visual color change (orange/green). The detection limits of the assay were determined using groundwater from a contaminated site. In addition, the assay was tested with groundwater from three additional contaminated sites. The final approach to detect RDase genes, without DNA extraction or a thermal cycler, was successful to 1.8 × 10 5  gene copies per L for vcrA and 1.3 × 10 5  gene copies per L for tceA. Both values are below the threshold recommended for effective in situ dechlorination.

Cystic fibrosis (CF) mutation detection and frequencies in central New York state using single strand conformation (SSC) and heteroduplex analysis (HA) gel analysis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shrimpton, A.E.; Lamberson, C.M.; Hicks, K.E.

1994-09-01

Over 100 cystic fibrosis (CF) bearing chromosomes from patients living in central New York state have been screened in order to identify their CF mutations. Ethnic background information and parental samples were also collected when available. Polymerase chain reaction (PCR) amplified products from exons 3, 4, 5, 7, 9, 10, 11, 12, 13, 14B, 15, 17B, 19, 20, 21 and intro 19 have been screened for over 50 known CF mutations by restriction enzyme digest, heteroduplex analysis (HA) and/or single stand conformation (SSC) gel analysis. The exon 9 PCR product was difficult to analyze by HA or SSC gel analysis.more » Restriction enzyme site generating PCR primers were used to identify the R117H, 711+1,G>T, G542X, 1717-1,G>A, 1898-1,G>A and N1303K CF mutations. Haplotyping at CFTR-linked (xv-2c/Taq I, km19/Pst, I, MP6d.9/Msp I and J3.11/Pst I) and CFTR intragenic markers (intron 6 GATT{sub n}, 1540 A/G, 1898+152,T/A) was performed to aid in CF mutation identification.« less

Role of serum miRNAs in the prediction of ovarian hyperstimulation syndrome in polycystic ovarian syndrome patients.

PubMed

Zhao, Chun; Liu, Xiaoguang; Shi, Zhonghua; Zhang, Jing; Zhang, Junqiang; Jia, Xuemei; Ling, Xiufeng

2015-01-01

Polycystic ovarian syndrome (PCOS) causes a significantly increased risk of ovarian hyperstimulation syndrome (OHSS). Here, we focused on the altered expression of serum miRNAs and their predictive value for OHSS in PCOS patients. We used the TaqMan low density array followed by individual quantitative reverse transcription-polymerase chain reaction to identify and validate the expression of serum miRNAs in PCOS patients likely to develop severe OHSS. The miR-16 and miR-223 expression levels were significantly reduced in the patients who were likely to develop severe OHSS than in the control subjects who were likely to develop mild or no OHSS. The sensitivity and specificity of the basal LH, basal LH/FSH, and body mass index (BMI) as OHSS predictors were also evaluated. miR-16 was the most efficient for OHSS prediction as it yielded the highest AUC. Logistic binary regression analyses revealed a positive association of miR-223 and BMI. Serum miRNAs are differentially expressed in PCOS patients likely to suffer from severe OHSS. We identified and validated two serum miRNAs that have potential for use as novel noninvasive biomarkers to accurately predict OHSS before controlled ovarian hyperstimulation (COH) for PCOS patients. © 2015 S. Karger AG, Basel.

Prevalence and Molecular Characterization of Plasmid-mediated Extended-Spectrum β-Lactamase Genes (balaTEM, blaCTX and blASHV) Among Urinary Escherichia coli Clinical Isolates in Mashhad, Iran

PubMed Central

Nakhaei Moghaddam, Mahboobeh; Forghanifard, Mohammad Mahdi; Moshrefi, Sheila

2012-01-01

Objective(s) Extended-spectrum beta-lactamase (ESBL) producing bacteria have an important role in nosocomial infections. Due to the limited availability of information about the molecular epidemiology of ESBL producing bacteria in Mashhad, we decided to investigate about TEM, CTX and SHV ESBLs among urinary Escherichia coli isolates in Mashhad, a city in northeast Iran. Materials and Methods One hundred and eleven clinical isolates of E. coli were diagnosed from hospitalized patients in 2009. After performing antibiogram and phenotypic confirmation test, polymerase chain reaction (PCR) was performed by blaTEM, blaSHV and blaCTX primers and restriction digestion was carried out using PstI and TaqI (Fermentas-Lithuania) for confirmation. Results ESBL producers of E. coli isolates were 33.3%. Among 37 ESBL-producing isolates, 35 (94.6%), 21 (56.8%) and 5 (13.5%) were shown to have blaCTX, blaTEM and blaSHV, genes respectively. Co-resistance to non-beta lactam antibiotics was observed more with ESBL producers (P < 0.05). Conclusion The results showed that the studied ESBL genes are found with high prevalence and among them blaCTX is more widespread in urine E. coli isolates in Mashhad. PMID:23493415

Synthesis of O-serogroup specific positive controls and real-time PCR standards for nine clinically relevant non-O157 STECs.

PubMed

Conrad, Cheyenne C; Gilroyed, Brandon H; McAllister, Tim A; Reuter, Tim

2012-10-01

Non-O157 Shiga toxin producing Escherichia coli (STEC) are gaining recognition as human pathogens, but no standardized method exists to identify them. Sequence analysis revealed that STEC can be classified on the base of variable O antigen regions into different O serotypes. Polymerase chain reaction is a powerful technique for thorough screening and complex diagnosis for these pathogens, but requires a positive control to verify qualitative and/or quantitative DNA-fragment amplification. Due to the pathogenic nature of STEC, controls are not readily available and cell culturing of STEC reference strains requires biosafety conditions of level 2 or higher. In order to bypass this limitation, controls of stacked O-type specific DNA-fragments coding for primer recognition sites were designed to screen for nine STEC serotypes frequently associated with human infection. The synthetic controls were amplified by PCR, cloned into a plasmid vector and transferred into bacteria host cells. Plasmids amplified by bacterial expression were purified, serially diluted and tested as standards for real-time PCR using SYBR Green and TaqMan assays. Utility of synthetic DNA controls was demonstrated in conventional and real-time PCR assays and validated with DNA from natural STEC strains. Copyright © 2012 Elsevier B.V. All rights reserved.

Origins of domestication and polyploidy in oca (Oxalis Tuberosa: Oxalidaceae). 2. Chloroplast-expressed glutamine synthetase data.

PubMed

Emshwiller, Eve; Doyle, Jeff J

2002-07-01

In continuing study of the origins of the octoploid tuber crop oca, Oxalis tuberosa Molina, we used phylogenetic analysis of DNA sequences of the chloroplast-active (nuclear encoded) isozyme of glutamine synthetase (ncpGS) from cultivated oca, its allies in the "Oxalis tuberosa alliance," and other Andean Oxalis. Multiple ncpGS sequences found within individuals of both the cultigen and a yet unnamed wild tuber-bearing taxon of Bolivia were separated by molecular cloning, but some cloned sequences appeared to be artifacts of polymerase chain reaction (PCR) recombination and/or Taq error. Nonetheless, three classes of nonrecombinant sequences each joined a different part of the O. tuberosa alliance clade on the ncpGS gene tree. Octoploid oca shares two sequence classes with the Bolivian tuber-bearing taxon (of unknown ploidy level). Fixed heterozygosity of these two sequence classes in all ocas sampled suggests that they represent homeologous loci and that oca is allopolyploid. A third sequence class, found in eight of nine oca plants sampled, might represent a third homeologous locus, suggesting that oca may be autoallopolyploid, and is shared with another wild tuber-bearing species, tetraploid O. picchensis of southern Peru. Thus, ncpGS data identify these two taxa as the best candidates as progenitors of cultivated oca.

Ciculating miRNA-21 as a Biomarker Predicts Polycystic Ovary Syndrome (PCOS) in Patients.

PubMed

Jiang, Liyan; Li, Wei; Wu, Minmin; Cao, Sifan

2015-01-01

Polycystic ovary syndrome (PCOS) is characterized by hyperandrogenism, hyperinsulinemia, and infertility. In PCOS, abnormal regulation of relevant genes is required for follicular development. By binding to the 3' untranslated region (3'URT), microRNAs (miRNAs) are widely involved in posttranscriptional gene regulation. However, few studies have been conducted on circulating miRNA expression in PCOS. This study aims to describe altered expression of circulating miR-21 in PCOS. The expression of serum miRNAs of PCOS patients were explored using the TaqMan Low Density Array followed by individual quantitative reverse transcription polymerase chain reaction assays. The protein level of LATS1 was determined using Western blot. To validate whether miR-21 targeted LATS1, the luciferase assay was applied. In comparison with normal subjects, the circulating level of miRNA-21 was significantly enhanced in PCOS patients. In PCOS patients, the expression levels of MST1/2, LATS1/2, TAZ were much lower than the control subjects. Luciferase reporter assay revealed that LATS1 was a downstream target of miR-21. In comparison with normal subjects, serum miR-21 is obviously increased in PCOS patients. Through targeting LATS1, miR-21 could prompt PCOS progression and could act as a novel non-invasive biomarker for diagnosis of PCOS.

Quantitative PCR assay to determine prevalence and intensity of MSX (Haplosporidium nelsoni) in North Carolina and Rhode Island oysters Crassostrea virginica.

PubMed

Wilbur, Ami E; Ford, Susan E; Gauthier, Julie D; Gomez-Chiarri, Marta

2012-12-27

The continuing challenges to the management of both wild and cultured eastern oyster Crassostrea virginica populations resulting from protozoan parasites has stimulated interest in the development of molecular assays for their detection and quantification. For Haplosporidium nelsoni, the causative agent of multinucleated sphere unknown (MSX) disease, diagnostic evaluations depend extensively on traditional but laborious histological approaches and more recently on rapid and sensitive (but not quantitative) end-point polymerase chain reaction (PCR) assays. Here, we describe the development and application of a quantitative PCR (qPCR) assay for H. nelsoni using an Applied Biosystems TaqMan® assay designed with minor groove binder (MGB) probes. The assay was highly sensitive, detecting as few as 20 copies of cloned target DNA. Histologically evaluated parasite density was significantly correlated with the quantification cycle (Cq), regardless of whether quantification was categorical (r2 = 0.696, p < 0.0001) or quantitative (r2 = 0.797, p < 0.0001). Application in field studies conducted in North Carolina, USA (7 locations), revealed widespread occurrence of the parasite with moderate to high intensities noted in some locations. In Rhode Island, USA, application of the assay on oysters from 2 locations resulted in no positives.

Molecular Characterization and Chronobiology of Hypodermosis in Cattle Slaughtered in the Diyarbakir Province of Turkey.

PubMed

Sayın İpek, Duygu Neval

2016-06-01

The aim of present study was to investigate the chronobiology and identification of Hypoderma species in cattle slaughtered in the Diyarbakir Province of Turkey. In total, 736 hides and subcutaneous tissue of slaughtered cattle were examined for the presence of second- and third-instar larvae in the slaughterhouse between November 2012 and May 2013. Third-instar larvae were collected from the slaughterhouses, and gDNA isolates were examined by PCR-RFLP analysis of the cytochrome c oxidase I (COI) gene of mt-DNA using TaqI enzyme. In total, 62 out of 736 cattle (8.42%) were found to be positive for Hypoderma larvae. A total of 328 (90 second- and 238 third-instar) Hypoderma larvae were detected in the hide and subcutaneous tissue of the back of infested cattle. All the 238 third-instar larvae (100%) were identified as H. bovis by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) analysis. The mean number of Hypoderma larvae in each cow was 5.29% (62/736). In the examined cattle, second-instar larvae were observed starting from the second week of January and subcutaneous nodules were found until the last week of April. H. bovis was the dominant species detected in the Diyarbakir Province.

Thrombophilic mutations in pre-eclampsia and pregnancy-induced hypertension.

PubMed

Omar, Siti Z; Qvist, Rajes; Khaing, Si L; Muniandy, Sekaran; Bhalla, Sunil

2008-04-01

The aim of the present study was to determine the existence or prevalence of thrombophilic markers such as Factor V Leiden, prothrombin G20210A, protein S, protein C, activated protein C and anti-thrombin in pre-eclampsia and pregnancy-induced hypertensive patients. Blood samples were collected from a total number of 124 women at the maternity unit, University of Malaya Medical Center. These included 49 patients with pre-eclampsia, 63 patients with pregnancy-induced hypertension and 12 normal pregnant women. DNA was extracted from the blood samples. Factor V Leiden (Taq I) and prothrombin G20210A (Hind III) genotyping was done on polymerase chain reaction-restriction fragment length polymorphism. Anti-thrombin activity and the concentrations of protein C, protein S and activated protein C were measured using the IL Coagulation System (Hemosil). Of the 124 subjects, one pre-eclampsia patient was homozygous for Factor V Leiden mutation but prothrombin G20210A mutation was not present in any of the subjects. The subject with Factor V Leiden mutation also had a low activated protein C resistance and a low protein S concentration. Factor V Leiden mutation is present in the Asian population and may very well serve as one of the genetic factors responsible for pre-eclampsia and other adverse pregnancy outcomes.

A real-time PCR approach to detect predation on anchovy and sardine early life stages

NASA Astrophysics Data System (ADS)

Cuende, Elsa; Mendibil, Iñaki; Bachiller, Eneko; Álvarez, Paula; Cotano, Unai; Rodriguez-Ezpeleta, Naiara

2017-12-01

Recruitment of sardine (Sardina pilchardus Walbaum, 1792) and anchovy (Engraulis encrasicolus Linnaeus, 1758) is thought to be regulated by predation of their eggs and larvae. Predators of sardine and anchovy can be identified by visual taxonomic identification of stomach contents, but this method is time consuming, tedious and may underestimate predation, especially in small predators such as fish larvae. Alternatively, genetic tools may offer a more cost-effective and accurate alternative. Here, we have developed a multiplex real-time polymerase chain reaction (RT-PCR) assay based on TaqMan probes to simultaneously detect sardine and anchovy remains in gut contents of potential predators. The assay combines previously described and newly generated species-specific primers and probes for anchovy and sardine detection respectively, and allows the detection of 0,001 ng of target DNA (which corresponds to about one hundredth of the total DNA present in a single egg). We applied the method to candidate anchovy and sardine egg predators in the Bay of Biscay, Atlantic Mackerel (Scomber scombrus) larvae. Egg predation observed was limited primarily to those stations where sardine and/or anchovy eggs were present. Our developed assay offers a suitable tool to understand the effects of predation on the survival of anchovy and sardine early life stages.

Development and in-house validation of the event-specific qualitative and quantitative PCR detection methods for genetically modified cotton MON15985.

PubMed

Jiang, Lingxi; Yang, Litao; Rao, Jun; Guo, Jinchao; Wang, Shu; Liu, Jia; Lee, Seonghun; Zhang, Dabing

2010-02-01

To implement genetically modified organism (GMO) labeling regulations, an event-specific analysis method based on the junction sequence between exogenous integration and host genomic DNA has become the preferential approach for GMO identification and quantification. In this study, specific primers and TaqMan probes based on the revealed 5'-end junction sequence of GM cotton MON15985 were designed, and qualitative and quantitative polymerase chain reaction (PCR) assays were established employing the designed primers and probes. In the qualitative PCR assay, the limit of detection (LOD) was 0.5 g kg(-1) in 100 ng total cotton genomic DNA, corresponding to about 17 copies of haploid cotton genomic DNA, and the LOD and limit of quantification (LOQ) for quantitative PCR assay were 10 and 17 copies of haploid cotton genomic DNA, respectively. Furthermore, the developed quantitative PCR assays were validated in-house by five different researchers. Also, five practical samples with known GM contents were quantified using the developed PCR assay in in-house validation, and the bias between the true and quantification values ranged from 2.06% to 12.59%. This study shows that the developed qualitative and quantitative PCR methods are applicable for the identification and quantification of GM cotton MON15985 and its derivates.

Valacyclovir pharmacokinetics and exploratory pharmacodynamics in young adults with Epstein-Barr virus infectious mononucleosis.

PubMed

Vezina, Heather E; Balfour, Henry H; Weller, Dennis R; Anderson, Bruce J; Brundage, Richard C

2010-07-01

Primary Epstein-Barr virus (EBV) infection often results in infectious mononucleosis and is associated with serious sequelae. No treatment is approved for EBV infection, and an antiviral intervention would be significant. The objectives of this study are to characterize the pharmacokinetics and explore the pharmacodynamics of acyclovir in plasma and oral washings of 8 subjects receiving 7 days of valacyclovir 1500 mg twice daily for EBV infectious mononucleosis. Virologic and clinical responses are assessed over 12 days. Acyclovir is measured by liquid chromatography/ultraviolet detection. EBV DNA is quantitated by TaqMan polymerase chain reaction. NONMEM VI and linear regression are used for data analysis. Acyclovir profiles in plasma and oral washings are consistent with a 1-compartment model. Final model estimates of clearance, volume of distribution, and fraction of acyclovir in oral wash supernatant are 49.9 L/h, 74.1 L, and 1.14%, respectively. The quantity of EBV DNA in oral washings and blood, and the severity of illness, measured by a graded scale, decrease during treatment. After treatment, viral rebound occurs in oral washings but not in blood, and the severity of illness continues to decline. Acyclovir pharmacokinetic parameters do not correlate with response metrics. These results support further studies of valacyclovir for EBV infectious mononucleosis.

Lack of association between TaqI A1 Allele of dopamine D2 receptor gene and alcohol-use disorders in Atayal natives of Taiwan

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chia-Hsiang Chen; Shih-Hsiang Chien; Hai-Gwo Hwu

1996-09-20

Association studies between the A1 allele of the dopamine D2 receptor (DRD2) gene TaqI A polymorphism and alcoholism remain controversial. A recent study from Japan demonstrated that the A1 allele is associated with severe alcoholism in the Japanese population. We were interested in knowing if this association also exists in the Atayals of Taiwan, who were found to have a higher prevalence of alcohol-use disorders than the Han Chinese in Taiwan. Genotype and allele frequencies were determined in alcohol-abusing, alcohol-dependent, and nonalcoholic control Atayal natives in Taiwan. A1 allele frequencies in alcohol-dependent, alcohol-abusing, and normal control Atayals were 0.39, 0.42,more » and 0.39, respectively. No difference in A1 allele frequency was found among these three groups. Our data do not support the hypothesis that the A1 allele of the TaqI A polymorphism of the DRD2 gene increases susceptibility to alcohol-use disorders in the Atayals of Taiwan. 18 refs., 1 tab.« less

Development and evaluation of a Quadruplex Taq Man real-time PCR assay for simultaneous detection of clinical isolates of Enterococcus faecalis, Enterococcus faecium and their vanA and vanB genotypes.

PubMed

Naserpour Farivar, Taghi; Najafipour, Reza; Johari, Pouran; Aslanimehr, Masoumeh; Peymani, Amir; Jahani Hashemi, Hoasan; Mirzaui, Baman

2014-10-01

We developed and evaluated the utility of a quadruplex Taqman real-time PCR assay that allows simultaneous identification of vancomycin-resistant genotypes and clinically relevant enterococci. The specificity of the assay was tested using reference strains of vancomycin-resistant and susceptible enterococci. In total, 193 clinical isolates were identified and subsequently genotyped using a Quadruplex Taqman real-time PCR assay and melting curve analysis. Representative Quadruplex Taqman real-time PCR amplification curve were obtained for Enterococcus faecium, Enterococcus faecalis, vanA-containing E. faecium, vanB-containing E. faecalis. Phenotypic and genotypic analysis of the isolates gave same results for 82 enterococcal isolates, while in 5 isolates, they were inconsistent. We had three mixed strains, which were detected by the TaqMan real-time PCR assay and could not be identified correctly using phenotypic methods. Vancomycin resistant enterococci (VRE) genotyping and identification of clinically relevant enterococci were rapidly and correctly performed using TaqMan real-time multiplex real-time PCR assay.

DRD2/ANKK1 gene polymorphisms in forensic autopsies of methamphetamine intoxication fatalities.

PubMed

Matsusue, Aya; Ishikawa, Takaki; Ikeda, Tomoya; Tani, Naoto; Arima, Hisatomi; Waters, Brian; Hara, Kenji; Kashiwagi, Masayuki; Takayama, Mio; Ikematsu, Natsuki; Kubo, Shin-Ichi

2018-04-22

Dopamine D2 receptor/ankyrin repeat and kinase domain containing 1 (DRD2/ANKK1) gene polymorphisms have been associated with responses to psychotropic drugs and addiction. We analyzed two DRD2/ANKK1 polymorphisms, Taq1A and -141C Ins/Del, in 37 fatal methamphetamine (MA) intoxication cases and 235 control cases in which MA and psychotropic drugs were not detected. The association among polymorphism, cause of death, and cerebrospinal fluid (CSF) dopamine concentration was evaluated. The Taq1A polymorphism distribution in the fatal MA intoxication cases differed from in the controls (P = 0.030) with a significantly high A1/A1 + A1/A2 genotype frequency. No significant associations were observed between -141C Ins/Del polymorphisms and MA intoxication cases or between DRD2/ANKK1 polymorphisms and CSF dopamine concentrations. Our findings suggest that the DRD2/ANKK1 Taq1A polymorphism is associated with susceptibility to fatal MA intoxication. Copyright © 2018 Elsevier B.V. All rights reserved.

Microfluidic droplet enrichment for targeted sequencing

PubMed Central

Eastburn, Dennis J.; Huang, Yong; Pellegrino, Maurizio; Sciambi, Adam; Ptáček, Louis J.; Abate, Adam R.

2015-01-01

Targeted sequence enrichment enables better identification of genetic variation by providing increased sequencing coverage for genomic regions of interest. Here, we report the development of a new target enrichment technology that is highly differentiated from other approaches currently in use. Our method, MESA (Microfluidic droplet Enrichment for Sequence Analysis), isolates genomic DNA fragments in microfluidic droplets and performs TaqMan PCR reactions to identify droplets containing a desired target sequence. The TaqMan positive droplets are subsequently recovered via dielectrophoretic sorting, and the TaqMan amplicons are removed enzymatically prior to sequencing. We demonstrated the utility of this approach by generating an average 31.6-fold sequence enrichment across 250 kb of targeted genomic DNA from five unique genomic loci. Significantly, this enrichment enabled a more comprehensive identification of genetic polymorphisms within the targeted loci. MESA requires low amounts of input DNA, minimal prior locus sequence information and enriches the target region without PCR bias or artifacts. These features make it well suited for the study of genetic variation in a number of research and diagnostic applications. PMID:25873629

A modular and optimized single marker system for generating Trypanosoma brucei cell lines expressing T7 RNA polymerase and the tetracycline repressor.

PubMed

Poon, S K; Peacock, L; Gibson, W; Gull, K; Kelly, S

2012-02-01

Here, we present a simple modular extendable vector system for introducing the T7 RNA polymerase and tetracycline repressor genes into Trypanosoma brucei. This novel system exploits developments in our understanding of gene expression and genome organization to produce a streamlined plasmid optimized for high levels of expression of the introduced transgenes. We demonstrate the utility of this novel system in bloodstream and procyclic forms of Trypanosoma brucei, including the genome strain TREU927/4. We validate these cell lines using a variety of inducible experiments that recapture previously published lethal and non-lethal phenotypes. We further demonstrate the utility of the single marker (SmOx) TREU927/4 cell line for in vivo experiments in the tsetse fly and provide a set of plasmids that enable both whole-fly and salivary gland-specific inducible expression of transgenes.

A modular and optimized single marker system for generating Trypanosoma brucei cell lines expressing T7 RNA polymerase and the tetracycline repressor

PubMed Central

Poon, S. K.; Peacock, L.; Gibson, W.; Gull, K.; Kelly, S.

2012-01-01

Here, we present a simple modular extendable vector system for introducing the T7 RNA polymerase and tetracycline repressor genes into Trypanosoma brucei. This novel system exploits developments in our understanding of gene expression and genome organization to produce a streamlined plasmid optimized for high levels of expression of the introduced transgenes. We demonstrate the utility of this novel system in bloodstream and procyclic forms of Trypanosoma brucei, including the genome strain TREU927/4. We validate these cell lines using a variety of inducible experiments that recapture previously published lethal and non-lethal phenotypes. We further demonstrate the utility of the single marker (SmOx) TREU927/4 cell line for in vivo experiments in the tsetse fly and provide a set of plasmids that enable both whole-fly and salivary gland-specific inducible expression of transgenes. PMID:22645659

Structural and Kinetic Analysis of Nucleoside Triphosphate Incorporation Opposite an Abasic Site by Human Translesion DNA Polymerase η

DOE Office of Scientific and Technical Information (OSTI.GOV)

Patra, Amritaj; Zhang, Qianqian; Lei, Li

2015-02-09

The most prevalent lesion in DNA is an abasic site resulting from glycolytic cleavage of a base. In a number of cellular studies, abasic sites preferentially code for dATP insertion (the “A rule”). In some cases frameshifts are also common. X-ray structures with abasic sites in oligonucleotides have been reported for several microbial and human DNA polymerases (pols), e.g. Dpo4, RB69, KlenTaq, yeast pol ι, human (h) pol ι, and human pol β. We reported previously that hpol η is a major pol involved in abasic site bypass (Choi, J.-Y., Lim, S., Kim, E. J., Jo, A., and Guengerich, F.more » P. (2010 J. Mol. Biol. 404, 34–44). hpol η inserted all four dNTPs in steady-state and pre-steady-state assays, preferentially inserting A and G. In LC-MS analysis of primer-template pairs, A and G were inserted but little C or T was inserted. Frameshifts were observed when an appropriate pyrimidine was positioned 5' to the abasic site in the template. In x-ray structures of hpol η with a non-hydrolyzable analog of dATP or dGTP opposite an abasic site, H-bonding was observed between the phosphate 5' to the abasic site and water H-bonded to N1 and N6 of A and N1 and O6 of G nucleoside triphosphate analogs, offering an explanation for what appears to be a “purine rule.” A structure was also obtained for an A inserted and bonded in the primer opposite the abasic site, but it did not pair with a 5' T in the template. Finally, we conclude that hpol η, a major copying enzyme with abasic sites, follows a purine rule, which can also lead to frameshifts. The phenomenon can be explained with H-bonds.« less

Isothermal Method of a Recombinase Polymerase Amplification Assay for the Detection of Most Common High-Risk Human Papillomavirus Type 16 and Type 18 DNA.

PubMed

Ma, Biao; Fang, Jiehong; Wang, Ye; He, Haizhen; Dai, Mingyan; Lin, Wei; Su, Wei; Zhang, Mingzhou

2017-01-01

Cervical cancer is a common gynecologic malignant tumor and has a great impact on women's health. Human papillomavirus (HPV) is implicated in cervical cancer and precancerous lesions and the two are possibly two stages of disease progression. With the technological development of molecular biology and epidemiology, detection and treatment of HPV has become an important means to prevent cervical cancer. Here we present a novel, rapid, sensitive and specific isothermal method of recombinase polymerase amplification (RPA), which is established to detect the two most common high-risk human papillomavirus type 16 and type 18 DNA. In this study, we evaluate the efficacy of the RPA assay, incubating clinical specimens of HPV16 and HPV18 using plasmids standard. It operates at constant low temperature without the thermal instrumentation for incubation. The products can be detected via agarose gel electrophoresis assay, reverse dot blot assay, and quantitative real-time assay with SYBR Green I. We assess the diagnostic performance of the RPA assay for detecting of HPV16 and HPV18 in 335 clinical samples from patients suspected of cervical cancer. The results revealed no cross-reaction with other HPV genotypes and the RPA assay achieve a sensitivity of 100 copies. Compared with TaqMan qPCR, the RPA technique achieves exponential amplification with no need for pretreatment of sample DNA at 37°C for 20 minutes, which reveals more satisfactory performance. The agreement between the RPA and qPCR assays was 97.6% (κ = 0.89) for HPV16 positivity and 98.5% (κ = 0.81) for HPV18 positivity, indicating very good correlation between both tests. Importantly, the RPA assay was demonstrated to be a useful and powerful method for detection of HPV virus, which therefore may serve as a valuable tool for rapid diagnosis of HPV infection in both commercial and clinical applications.

Development of Rapid Isothermal Amplification Assays for Detection of Phytophthora spp. in Plant Tissue.

PubMed

Miles, Timothy D; Martin, Frank N; Coffey, Michael D

2015-02-01

Several isothermal amplification techniques recently have been developed that are tolerant of inhibitors present in many plant extracts, which can reduce the need for obtaining purified DNA for running diagnostic assays. One such commercially available technique that has similarities with real-time polymerase chain reaction (PCR) for designing primers and a labeled probe is recombinase polymerase amplification (RPA). This technology was used to develop two simple and rapid approaches for detection of Phytophthora spp.: one genus-specific assay multiplexed with a plant internal control and the other species-specific assays for Phytophthora ramorum and P. kernoviae. All assays were tested for sensitivity (ranging from 3 ng to 1 fg of DNA) and specificity using DNA extracted from more than 136 Phytophthora taxa, 21 Pythium spp., 1 Phytopythium sp., and a wide range of plant species. The lower limit of linear detection using purified DNA was 200 to 300 fg of DNA in all pathogen RPA assays. Six different extraction buffers were tested for use during plant tissue maceration and the assays were validated in the field by collecting 222 symptomatic plant samples from over 50 different hosts. Only 56 samples were culture positive for Phytophthora spp. whereas 91 were positive using the Phytophthora genus-specific RPA test and a TaqMan real-time PCR assay. A technique for the generation of sequencing templates from positive RPA amplifications to confirm species identification was also developed. These RPA assays have added benefits over traditional technologies because they are rapid (results can be obtained in as little as 15 min), do not require DNA extraction or extensive training to complete, use less expensive portable equipment than PCR-based assays, and are significantly more specific than current immunologically based methods. This should provide a rapid, field-deployable capability for pathogen detection that will facilitate point-of-sample collection processing, thereby reducing the time necessary for accurate diagnostics and making management decisions.

Allosteric transcriptional regulation via changes in the overall topology of the core promoter

DOE PAGES

Philips, Steven J.; Canalizo-Hernandez, Monica; Yildirim, Ilyas; ...

2015-08-21

Many transcriptional activators act at a distance from core promoter elements and work by recruiting RNA polymerase through protein-protein interactions. We show here how the prokaryotic regulatory protein CueR both represses and activates transcription by differentially modulating local DNA structure within the promoter. Structural studies reveal that the repressor state slightly bends the promoter DNA, precluding optimal RNA polymerase-promoter recognition. Upon binding a metal ion in the allosteric site, CueR switches into an activator conformation. It maintains all protein-DNA contacts but introduces torsional stresses that kink and undertwist the promoter, stabilizing an A-DNA-like conformation. Finally, these factors switch on andmore » off transcription by exerting dynamic control of DNA stereochemistry, reshaping the core promoter and making it a better or worse substrate for polymerase.« less

Prevalence of Bartonella infection in wild African lions (Panthera leo) and cheetahs (Acinonyx jubatus).

PubMed

Molia, S; Chomel, B B; Kasten, R W; Leutenegger, C M; Steele, B R; Marker, L; Martenson, J S; Keet, D F; Bengis, R G; Peterson, R P; Munson, L; O'Brien, S J

2004-05-20

Bartonella species are emerging pathogens that have been isolated worldwide from humans and other mammals. Our objective was to estimate the prevalence of Bartonella infection in free-ranging African lions (Panthera leo) and cheetahs (Acinonyx jubatus). Blood and/or serum samples were collected from a convenience sample of 113 lions and 74 cheetahs captured in Africa between 1982 and 2002. Whole blood samples available from 58 of the lions and 17 of the cheetahs were cultured for evidence of Bartonella spp., and whole blood from 54 of the 58 lions and 73 of the 74 cheetahs tested for the presence of Bartonella DNA by TaqMan PCR. Serum samples from the 113 lions and 74 cheetahs were tested for the presence of antibodies against Bartonella henselae using an immunofluorescence assay. Three (5.2%) of the 58 lions and one (5.9%) of the 17 cheetahs were bacteremic. Two lions were infected with B. henselae, based on PCR/RFLP of the citrate synthase gene. The third lion and the cheetah were infected with previously unidentified Bartonella strains. Twenty-three percent of the 73 cheetahs and 3.7% of the 54 lions tested by TaqMan PCR were positive for Bartonella spp. B. henselae antibody prevalence was 17% (19/113) for the lions and 31% (23/74) for the cheetahs. The prevalence of seropositivity, bacteremia, and positive TaqMan PCR was not significantly different between sexes and age categories (juvenile versus adult) for both lions and cheetahs. Domestic cats are thus no longer the only known carriers of Bartonella spp. in Africa. Translocation of B. henselae seronegative and TaqMan PCR negative wild felids might be effective in limiting the spread of Bartonella infection.

Meta-analysis of cholesteryl ester transfer protein TaqIB polymorphism and risk of myocardial infarction.

PubMed

Cao, Min; Zhou, Zhi-Wen; Fang, Bang-Jiang; Zhao, Cheng-Gen; Zhou, Duan

2014-11-01

A number of studies have been conducted to explore the association between the cholesteryl ester transfer protein (CETP) TaqIB polymorphism and risk of myocardial infarction (MI); however, the results are inconsistent. Therefore, we conducted this meta-analysis to clarify the issue based on all the data available.Eligible studies were retrieved by searching PubMed, Embase, Web of Science, and Google Scholar. We calculated the crude odds ratios (ORs) and corresponding 95% confidence intervals (95% CIs) to assess the association between the TaqIB polymorphism and risk of MI.We included 13 studies involving 8733 MI cases and 8573 controls in the meta-analysis. The pooled results from all included studies showed decreased MI risk in the analysis of the B2B2 versus B1B1 (OR = 0.78, 95% CI = 0.68-0.91), dominant (OR = 0.88, 95% CI = 0.77-0.99), and recessive genetic models (OR = 0.84, 95% CI = 0.78-0.91). The frequency of the B2B2 genotype in MI patients was lower (OR = 0.87, 95% CI = 0.81-0.94). However, there was no significant association in the B1B2 versus B1B1 analysis (OR = 0.92, 95% CI = 0.81-1.05) and no significant difference for the B1B1 genotype (OR = 1.04, 95% CI = 0.98-1.11) and B1B2 genotype (OR = 1.03, 95% CI = 0.97-1.08). Cumulative analysis confirmed these results.Our results suggest that the B2B2 genotype of the CETP TaqIB polymorphism is a protective factor against the development of MI.

A sensitive one-step TaqMan amplification approach for detection of rubella virus clade I and II genotypes in clinical samples.

PubMed

Claus, C; Bergs, S; Emmrich, N C; Hübschen, J M; Mankertz, A; Liebert, U G

2017-02-01

Although teratogenic rubella virus (RV) causes a vaccine-preventable disease, it is still endemic in several countries worldwide. Thus, there is a constant risk of RV importation into non-endemic areas. RV monitoring, especially during measles and Zika virus outbreaks, requires reliable diagnostic tools. For this study, a TaqMan-based one-step reverse transcription-quantitative PCR (RT-qPCR) assay, with the p90 gene as a novel and so far unexplored target for detection of clade I and II genotypes, was developed and evaluated. Automated nucleic acid extraction was carried out. Performance characteristics of the TaqMan RT-qPCR assay were determined for a RV plasmid standard and RNA extracted from virus-infected cell culture supernatants representing clade I and II genotypes. Diagnostic specificity and sensitivity were validated against other RNA and DNA viruses, relevant for RV diagnostic approaches and for RV-positive clinical samples, respectively. The assay is specific and highly sensitive with a limit of detection as low as five to one copies per reaction or 200 infectious virus particles per ml. The coefficients of variation (CV) were specified as intra- (within one run) and inter- (between different runs) assay variation, and calculated based on the standard deviations for the obtained Ct values of the respective samples. Intra- and inter-assay CV values were low, with a maximum of 3.4% and 2.4%, respectively. The assay was shown to be suitable and specific for the analysis of clinical samples. With p90 as a novel target, the highly sensitive and specific TaqMan assay outlined in this study is suitable for RV diagnosis worldwide.

Monitoring and improving the sensitivity of dengue nested RT-PCR used in longitudinal surveillance in Thailand.

PubMed

Klungthong, Chonticha; Manasatienkij, Wudtichai; Phonpakobsin, Thipwipha; Chinnawirotpisan, Piyawan; Rodpradit, Prinyada; Hussem, Kittinun; Thaisomboonsuk, Butsaya; Ong-ajchaowlerd, Prapapun; Nisalak, Ananda; Kalayanarooj, Siripen; Buddhari, Darunee; Gibbons, Robert V; Jarman, Richard G; Yoon, In-Kyu; Fernandez, Stefan

2015-02-01

AFRIMS longitudinal dengue surveillance in Thailand depends on the nested RT-PCR and the dengue IgM/IgG ELISA. To examine and improve the sensitivity of the nested RT-PCR using a panel of archived samples collected during dengue surveillance. A retrospective analysis of 16,454 dengue IgM/IgG ELISA positive cases collected between 2000 and 2013 was done to investigate the sensitivity of the nested RT-PCR. From these cases, 318 acute serum specimens or extracted RNA, previously found to be negative by the nested RT-PCR, were tested using TaqMan real-time RT-PCR (TaqMan rRT-PCR). To improve the sensitivity of nested RT-PCR, we designed a new primer based on nucleotide sequences from contemporary strains found to be positive by the TaqMan rRT-PCR. Sensitivity of the new nested PCR was calculated using a panel of 87 samples collected during 2011-2013. The percentage of dengue IgM/IgG ELISA positive cases that were negative by the nested RT-PCR varied from 17% to 42% for all serotypes depending on the year. Using TaqMan rRT-PCR, dengue RNA was detected in 194 (61%) of the 318 acute sera or extracted RNA previously found to be negative by the nested RT-PCR. The newly designed DENV-1 specific primer increased the sensitivity of DENV-1 detection by the nested RT-PCR from 48% to 88%, and of all 4 serotypes from 73% to 87%. These findings demonstrate the impact of genetic diversity and signal erosion on the sensitivity of PCR-based methods. Published by Elsevier B.V.

Associations between vitamin D receptor polymorphisms and susceptibility to ulcerative colitis and Crohn's disease: a meta-analysis.

PubMed

Xue, Le-Ning; Xu, Ke-Qun; Zhang, Wei; Wang, Qiang; Wu, Jia; Wang, Xiao-Yong

2013-01-01

Several polymorphisms have been identified in the vitamin D receptor (VDR) gene, while their roles in the incidence of ulcerative colitis (UC) and Crohn's disease (CD) are conflicting. This meta-analysis was designed to clarify the impact of these polymorphisms on UC and CD risk. The PubMed, Embase, and Cochrane electronic databases were searched from February 1995 to August 2011 for studies on the four VDR polymorphisms: TaqI, BsmI, FokI, and ApaI. Data were extracted and pooled odd ratios (ORs) and 95% confidence intervals (95% CIs) were calculated. Nine studies were included. In Asians, the ff genotype of FokI was associated with increased UC risk (OR = 1.65; 95% CI, 1.11- 2.45). The "a" allele carrier status of ApaI appeared to be a protective factor for CD (OR = 0.81; 95% CI, 0.67-0.97). The tt genotype increased the risk of CD in Europeans (OR = 1.23; 95% CI, 1.02-1.49). Moreover, the tt genotype of TaqI in males had a moderate elevated risk of UC (OR = 1.56; 95% CI, 1.02-2.39) and CD (OR = 1.84; 95% CI, 1.19-2.83). The meta-analysis reveals a significant increase in CD risk for Europeans carrying TaqI tt genotype and a significant decrease in CD risk for all carriers of the Apal "a" allele. For Asians, the VDR FokI polymorphism appears to confer susceptibility to UC. For males, the TaqI tt genotype is associated with susceptibilities to both UC and CD. Our study explored the genetic risk prediction in UC and CD, and may provide valuable insights into IBD therapy.

Impact of vitamin D receptor and binding protein gene polymorphisms in clinical and laboratory data of HCV patients

PubMed Central

Scalioni, Letícia de Paula; dos Santos, Betânia Rodrigues; Spritzer, Poli Mara; Villela-Nogueira, Cristiane Alves; Laura Lewis-Ximenez, Lia; Pollo-Flores, Priscila; Bordalo Cathalá Esberard, Eliane; Brandão-Mello, Carlos Eduardo; Lampe, Elisabeth; Villar, Livia Melo

2018-01-01

Abstract Potential relationship of vitamin D, vitamin D receptor (VDR), and vitamin D binding protein (DBP) have been suggested in the pathophysiology of hepatitis C virus (HCV) infection. The aim of this observational study is to determine vitamin D levels, and VDR and DBP genetic polymorphism according demographic and laboratory data in chronic HCV patients (CHC). A total of 148 CHC patients gave serum samples for testing 25-hydroxyvitamin D (25 (OH)D) level by immunochemiluminometric assay (<20 ng/mL defined as deficient) and donated blood samples to allelic discrimination analysis using TaqMan assays. Analyzed single nucleotide polymorphisms (SNPs) were: VDR-rs7975232 (ApaI) C>A, rs731236 A>G (TaqI), rs1544410 C>T (BsmI), rs10735810 T>C (FokI) and carrier globulin/binding protein (GC)-rs4588 and rs7041 and the haplotype bAt [CCA]. Hepatic fibrosis was assessed using Fib-4 and Forns index. Eighty-two (54.40%) patients demonstrated deficiency of vitamin D and this was associated to AST (P = .019 [CI: 1.003–1.034]), total cholesterol (P = .038 [CI: 1.004–1.164]), fibrosis grade (P < .001 [CI: 0.000–0.844]), and FokI (P = .028) allele T presence. Association was found between VDR polymorphism and fibrosis (BsmI andTaqI), triglycerides (TaqI), and HDL (FokI). DBP polymorphism was associated to HCV genotype (GC rs7041), previous HCV treatment, and GGT (GC rs4588). In conclusion, low frequency of vitamin D deficiency was found, but VDR polymorphisms were frequently associated to fibrosis grade suggesting that they could be used as disease evaluation markers to understand the mechanisms underlying the virus–host interaction. PMID:29465575

Quantification of Human Polyomaviruses JC Virus and BK Virus by TaqMan Quantitative PCR and Comparison to Other Water Quality Indicators in Water and Fecal Samples▿

PubMed Central

McQuaig, Shannon M.; Scott, Troy M.; Lukasik, Jerzy O.; Paul, John H.; Harwood, Valerie J.

2009-01-01

In the United States, total maximum daily load standards for bodies of water that do not meet bacterial water quality standards are set by each state. The presence of human polyomaviruses (HPyVs) can be used as an indicator of human-associated sewage pollution in these waters. We have developed and optimized a TaqMan quantitative PCR (QPCR) assay based on the conserved T antigen to both quantify and simultaneously detect two HPyVs; JC virus and BK virus. The QPCR assay was able to consistently quantify ≥10 gene copies per reaction and is linear over 5 orders of magnitude. HPyVs were consistently detected in human waste samples (57 of 64) and environmental waters with known human fecal contamination (5 of 5) and were not amplified in DNA extracted from 127 animal waste samples from 14 species. HPyV concentrations in sewage decreased 81.2 and 84.2% over 28 days incubation at 25 and 35°C, respectively. HPyVs results were compared to Escherichia coli, fecal coliform, and enterococci concentrations and the presence of three other human-associated microbes: Bacteroidetes, Methanobrevibacter smithii, and adenovirus. HPyVs were the most frequently detected of these in human and contaminated environmental samples and were more human specific than the Bacteroidetes (HF183) or M. smithii. HPyVs and M. smithii more closely mimicked the persistence of adenovirus in sewage than the other microbes. The use of this rapid and quantitative assay in water quality research could help regulatory agencies to identify sources of water pollution for improved remediation of contaminated waters and ultimately protect humans from exposure to pathogens. PMID:19346361

Vitamin D, folate, and potential early lifecycle environmental origin of significant adult phenotypes

PubMed Central

Lucock, Mark; Yates, Zoë; Martin, Charlotte; Choi, Jeong-Hwa; Boyd, Lyndell; Tang, Sa; Naumovski, Nenad; Furst, John; Roach, Paul; Jablonski, Nina; Chaplin, George; Veysey, Martin

2014-01-01

Background and objectives: Vitamin D and folate are highly UV sensitive, and critical for maintaining health throughout the lifecycle. This study examines whether solar irradiance during the first trimester of pregnancy influences vitamin D receptor (VDR) and nuclear folate gene variant occurrence, and whether affected genes influence late-life biochemical/clinical phenotypes. Methodology: 228 subjects were examined for periconceptional exposure to solar irradiance, variation in vitamin D/folate genes (polymerase chain reaction (PCR)), dietary intake (food frequency questionnaire (FFQ)) and important adult biochemical/clinical phenotypes. Results: Periconceptional solar irradiance was associated with VDR-BsmI (P = 0.0008wk7), TaqI (P = 0.0014wk7) and EcoRV (P = 0.0030wk6) variant occurrence between post-conceptional weeks 6–8, a period when ossification begins. Similar effects were detected for other VDR gene polymorphisms. Periconceptional solar irradiance was also associated with 19 bp del-DHFR (P = 0.0025wk6), and to a lesser extent C1420T-SHMT (P = 0.0249wk6), a folate-critical time during embryogenesis. These same genes were associated with several late-life phenotypes: VDR-BsmI, TaqI and ApaI determined the relationship between dietary vitamin D and both insulin (P < 0.0001/BB, 0.0007/tt and 0.0173/AA, respectively) and systolic blood pressure (P = 0.0290/Bb, 0.0299/Tt and 0.0412/AA, respectively), making them important early and late in the lifecycle. While these and other phenotype associations were found for the VDR variants, folate polymorphism associations in later-life were limited to C1420T-SHMT (P = 0.0037 and 0.0297 for fasting blood glucose and HbA1c levels, respectively). We additionally report nutrient–gene relationships with body mass index, thiol/folate metabolome, cognition, depression and hypertension. Furthermore, photoperiod at conception influenced occurrence of VDR-Tru9I and 2R3R-TS genotypes (P = 0.0120 and 0.0360, respectively). Conclusions and implications: Findings identify environmental and nutritional agents that may interact to modify gene–phenotype relationships across the lifecycle, offering new insight into human ecology. This includes factors related to both disease aetiology and the evolution of skin pigmentation. PMID:24699387

Continuous in vitro evolution of bacteriophage RNA polymerase promoters

NASA Technical Reports Server (NTRS)

Breaker, R. R.; Banerji, A.; Joyce, G. F.

1994-01-01

Rapid in vitro evolution of bacteriophage T7, T3, and SP6 RNA polymerase promoters was achieved by a method that allows continuous enrichment of DNAs that contain functional promoter elements. This method exploits the ability of a special class of nucleic acid molecules to replicate continuously in the presence of both a reverse transcriptase and a DNA-dependent RNA polymerase. Replication involves the synthesis of both RNA and cDNA intermediates. The cDNA strand contains an embedded promoter sequence, which becomes converted to a functional double-stranded promoter element, leading to the production of RNA transcripts. Synthetic cDNAs, including those that contain randomized promoter sequences, can be used to initiate the amplification cycle. However, only those cDNAs that contain functional promoter sequences are able to produce RNA transcripts. Furthermore, each RNA transcript encodes the RNA polymerase promoter sequence that was responsible for initiation of its own transcription. Thus, the population of amplifying molecules quickly becomes enriched for those templates that encode functional promoters. Optimal promoter sequences for phage T7, T3, and SP6 RNA polymerase were identified after a 2-h amplification reaction, initiated in each case with a pool of synthetic cDNAs encoding greater than 10(10) promoter sequence variants.

Development of a Real-Time, TaqMan Reverse Transcription-PCR Assay for Detection and Differentiation of Lyssavirus Genotypes 1, 5, and 6

PubMed Central

Wakeley, P. R.; Johnson, N.; McElhinney, L. M.; Marston, D.; Sawyer, J.; Fooks, A. R.

2005-01-01

Several reverse transcription-PCR (RT-PCR) methods have been reported for the detection of rabies and rabies-related viruses. These methods invariably involve multiple transfers of nucleic acids between different tubes, with the risk of contamination leading to the production of false-positive results. Here we describe a single, closed-tube, nonnested RT-PCR with TaqMan technology that distinguishes between classical rabies virus (genotype 1) and European bat lyssaviruses 1 and 2 (genotypes 5 and 6) in real time. The TaqMan assay is rapid, sensitive, and specific and allows for the genotyping of unknown isolates concomitant with the RT-PCR. The assay can be applied quantitatively and the use of an internal control enables the quality of the isolated template to be assessed. Despite sequence heterogeneity in the N gene between the different genotypes, a universal forward and reverse primer set has been designed, allowing for the simplification of previously described assays. We propose that within a geographically constrained area, this assay will be a useful tool for the detection and differentiation of members of the Lyssavirus genus. PMID:15956398

Identification and genetic analysis of cancer cells with PCR-activated cell sorting

PubMed Central

Eastburn, Dennis J.; Sciambi, Adam; Abate, Adam R.

2014-01-01

Cell sorting is a central tool in life science research for analyzing cellular heterogeneity or enriching rare cells out of large populations. Although methods like FACS and FISH-FC can characterize and isolate cells from heterogeneous populations, they are limited by their reliance on antibodies, or the requirement to chemically fix cells. We introduce a new cell sorting technology that robustly sorts based on sequence-specific analysis of cellular nucleic acids. Our approach, PCR-activated cell sorting (PACS), uses TaqMan PCR to detect nucleic acids within single cells and trigger their sorting. With this method, we identified and sorted prostate cancer cells from a heterogeneous population by performing >132 000 simultaneous single-cell TaqMan RT-PCR reactions targeting vimentin mRNA. Following vimentin-positive droplet sorting and downstream analysis of recovered nucleic acids, we found that cancer-specific genomes and transcripts were significantly enriched. Additionally, we demonstrate that PACS can be used to sort and enrich cells via TaqMan PCR reactions targeting single-copy genomic DNA. PACS provides a general new technical capability that expands the application space of cell sorting by enabling sorting based on cellular information not amenable to existing approaches. PMID:25030902

[Comparative analysis of real-time quantitative PCR-Sanger sequencing method and TaqMan probe method for detection of KRAS/BRAF mutation in colorectal carcinomas].

PubMed

Zhang, Xun; Wang, Yuehua; Gao, Ning; Wang, Jinfen

2014-02-01

To compare the application values of real-time quantitative PCR-Sanger sequencing and TaqMan probe method in the detection of KRAS and BRAF mutations, and to correlate KRAS/BRAF mutations with the clinicopathological characteristics in colorectal carcinomas. Genomic DNA of the tumor cells was extracted from formalin fixed paraffin embedded (FFPE) tissue samples of 344 colorectal carcinomas by microdissection. Real-time quantitative PCR-Sanger sequencing and TaqMan probe method were performed to detect the KRAS/BRAF mutations. The frequency and types of KRAS/BRAF mutations, clinicopathological characteristics and survival time were analyzed. KRAS mutations were detected in 39.8% (137/344) and 38.7% (133/344) of 344 colorectal carcinomas by using real-time quantitative PCR-Sanger sequencing and TaqMan probe method, respectively. BRAF mutation was detected in 4.7% (16/344) and 4.1% (14/344), respectively. There was no significant correlation between the two methods. The frequency of the KRAS mutation in female was higher than that in male (P < 0.05). The frequency of the BRAF mutation in colon was higher than that in rectum. The frequency of the BRAF mutation in stage III-IV cases was higher than that in stageI-II cases. The frequency of the BRAF mutation in signet ring cell carcinoma was higher than that in mucinous carcinoma and nonspecific adenocarcinoma had the lowest mutation rate. The frequency of the BRAF mutation in grade III cases was higher than that in grade II cases (P < 0.05). The overall concordance for the two methods of KRAS/BRAF mutation detection was 98.8% (kappa = 0.976). There was statistic significance between BRAF and KRAS mutations for the survival time of colorectal carcinomas (P = 0.039). There were no statistic significance between BRAF mutation type and BRAF/KRAS wild type (P = 0.058). (1) Compared with real-time quantitative PCR-Sanger sequencing, TaqMan probe method is better with regard to handling time, efficiency, repeatability, cost and equipment. (2) The frequency of the KRAS mutation is correlated with gender. BRAF mutation is correlated with primary tumor site, TNM stage, histological types and histological grades.(3) BRAF gene mutation is an independent prognostic marker for colorectal carcinomas.

Vitamin-D Receptor (VDR) Gene Polymorphisms (TaqI, FokI) in Turkish Patients with Hashimoto's Thyroiditis: Relationship to the Levels of Vit-D and Cytokines.

PubMed

Guleryuz, Bedia; Akin, Fulya; Ata, Melek Tunc; Dalyanoglu, Mukaddes Mergen; Turgut, Sebahat

2016-01-01

Hashimoto's thyroiditis (HT) is a common autoimmune disease. Vitamin D is an important regulator of immune system. It has been shown in several studies that vitamin D prevents the development of lots of autoimmune diseases. There are some studies that prove vitamin D receptor (VDR) gene polymorphism increases the risk of Hashimoto's thyroiditis. In this study, we aimed to investigate the association between HT and level of 25(OH)D3, IL-2, IL-4, IL-5, TNF-α and IFN-γ and VDR FokI and TaqI gene polymorphism. Moreover, to find out whether low levels of vitamin D affect HT pathogenesis over inflammatory parameters. We performed a case-control study that included 136 cases with HT (49 euthyroid, 49 subclinical hypothyroid, 38 hypothyroid patients) and 50 healthy control. Serum levels of 25(OH)D3, glucose, insulin, parathyroid hormone, calcium, phosphorus, alkaline phosphatase were measured and IL-4, IL-5, TNF-α, IFN-γ analysis were performed with ELISA kits in all 186 subjects. Genetic analysis for VDR FokI and TaqI gene polymorphisms were done by RFLP in all subjects. Mean serum 25(OH)D levels were 14.88±8.23 ng/ml in patient with HT and 15.52±1.34 ng/ml in healthy controls. There were no statically significant differences between the groups in terms of vitamin D levels (P=0.977). Prevalence of vitamin D insufficiency in HT cases was significantly higher than controls (p=0.02). Although serum IL-2, IL-4, TNF-α and IFN-γ were significantly higher in HT patients, there were no significant differences regarding IL-5 levels. Significant differences were observed between the groups regarding the genotype of TaqI but no differences regarding FokI genotype. Vitamin D insufficiency is associated with HT. There is a relationship between VDR TaqI gene polymorphism and HT. Although vitamin D levels are low in both patient and control group, detection of high level of inflammatory parameters in HT group makes us think that low level of vitamin D does not affect HT pathogenesis over these parameters. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Identification of dengue viral RNA-dependent RNA polymerase inhibitor using computational fragment-based approaches and molecular dynamics study.

PubMed

Anusuya, Shanmugam; Velmurugan, Devadasan; Gromiha, M Michael

2016-07-01

Dengue is a major public health concern in tropical and subtropical countries of the world. There are no specific drugs available to treat dengue. Even though several candidates targeted both viral and host proteins to overcome dengue infection, they have not yet entered into the later stages of clinical trials. In order to design a drug for dengue fever, newly emerged fragment-based drug designing technique was applied. RNA-dependent RNA polymerase, which is essential for dengue viral replication is chosen as a drug target for dengue drug discovery. A cascade of methods, fragment screening, fragment growing, and fragment linking revealed the compound [2-(4-carbamoylpiperidin-1-yl)-2-oxoethyl]8-(1,3-benzothiazol-2-yl)naphthalene-1-carboxylate as a potent dengue viral polymerase inhibitor. Both strain energy and binding free energy calculations predicted that this could be a better inhibitor than the existing ones. Molecular dynamics simulation studies showed that the dengue polymerase-lead complex is stable and their interactions are consistent throughout the simulation. The hydrogen-bonded interactions formed by the residues Arg792, Thr794, Ser796, and Asn405 are the primary contributors for the stability and the rigidity of the polymerase-lead complex. This might keep the polymerase in closed conformation and thus inhibits viral replication. Hence, this might be a promising lead molecule for dengue drug designing. Further optimization of this lead molecule would result in a potent drug for dengue.

Development and application of a T7 RNA polymerase-dependent expression system for antibiotic production improvement in Streptomyces.

PubMed

Wei, Junhong; Tian, Jinjin; Pan, Guoqing; Xie, Jie; Bao, Jialing; Zhou, Zeyang

2017-06-01

To develop a reliable and easy to use expression system for antibiotic production improvement of Streptomyces. A two-compound T7 RNA polymerase-dependent gene expression system was developed to fulfill this demand. In this system, the T7 RNA polymerase coding sequence was optimized based on the codon usage of Streptomyces coelicolor. To evaluate the functionality of this system, we constructed an activator gene overexpression strain for enhancement of actinorhodin production. By overexpression of the positive regulator actII-ORF4 with this system, the maximum actinorhodin yield of engineered strain was 15-fold higher and the fermentation time was decreased by 48 h. The modified two-compound T7 expression system improves both antibiotic production and accelerates the fermentation process in Streptomyces. This provides a general and useful strategy for strain improvement of important antibiotic producing Streptomyces strains.

Implications of Measurement Assay Type in Design of HIV Experiments.

PubMed

Cannon, LaMont; Jagarapu, Aditya; Vargas-Garcia, Cesar A; Piovoso, Michael J; Zurakowski, Ryan

2017-12-01

Time series measurements of circular viral episome (2-LTR) concentrations enable indirect quantification of persistent low-level Human Immunodeficiency Virus (HIV) replication in patients on Integrase-Inhibitor intensified Combined Antiretroviral Therapy (cART). In order to determine the magnitude of these low level infection events, blood has to be drawn from a patients at a frequency and volume that is strictly regulated by the Institutional Review Board (IRB). Once the blood is drawn, the 2-LTR concentration is determined by quantifying the amount of HIV DNA present in the sample via a PCR (Polymerase Chain Reaction) assay. Real time quantitative Polymerase Chain Reaction (qPCR) is a widely used method of performing PCR; however, a newer droplet digital Polymerase Chain Reaction (ddPCR) method has been shown to provide more accurate quantification of DNA. Using a validated model of HIV viral replication, this paper demonstrates the importance of considering DNA quantification assay type when optimizing experiment design conditions. Experiments are optimized using a Genetic Algorithm (GA) to locate a family of suboptimal sample schedules which yield the highest fitness. Fitness is defined as the expected information gained in the experiment, measured by the Kullback-Leibler Divergence (KLD) between the prior and posterior distributions of the model parameters. We compare the information content of the optimized schedules to uniform schedules as well as two clinical schedules implemented by researchers at UCSF and the University of Melbourne. This work shows that there is a significantly greater gain information in experiments using a ddPCR assay vs. a qPCR assay and that certain experiment design considerations should be taken when using either assay.

Optimization of the elution buffer and concentration method for detecting hepatitis E virus in swine liver using a nested reverse transcription-polymerase chain reaction and real-time reverse transcription-polymerase chain reaction.

PubMed

Son, Na Ry; Seo, Dong Joo; Lee, Min Hwa; Seo, Sheungwoo; Wang, Xiaoyu; Lee, Bog-Hieu; Lee, Jeong-Su; Joo, In-Sun; Hwang, In-Gyun; Choi, Changsun

2014-09-01

The aim of this study was to develop an optimal technique for detecting hepatitis E virus (HEV) in swine livers. Here, three elution buffers and two concentration methods were compared with respect to enhancing recovery of HEV from swine liver samples. Real-time reverse transcription-polymerase chain reaction (RT-PCR) and nested RT-PCR were performed to detect HEV RNA. When phosphate-buffered saline (PBS, pH 7.4) was used to concentrate HEV in swine liver samples using ultrafiltration, real-time RT-PCR detected HEV in 6 of the 26 samples. When threonine buffer was used to concentrate HEV using polyethylene glycol (PEG) precipitation and ultrafiltration, real-time RT-PCR detected HEV in 1 and 3 of the 26 samples, respectively. When glycine buffer was used to concentrate HEV using ultrafiltration and PEG precipitation, real-time RT-PCR detected HEV in 1 and 3 samples of the 26 samples, respectively. When nested RT-PCR was used to detect HEV, all samples tested negative regardless of the type of elution buffer or concentration method used. Therefore, the combination of real-time RT-PCR and ultrafiltration with PBS buffer was the most sensitive and reliable method for detecting HEV in swine livers. Copyright © 2014 Elsevier B.V. All rights reserved.

Simultaneous genotyping of single-nucleotide polymorphisms in alcoholism-related genes using duplex and triplex allele-specific PCR with two-step thermal cycles.

PubMed

Shirasu, Naoto; Kuroki, Masahide

2014-01-01

We developed a time- and cost-effective multiplex allele-specific polymerase chain reaction (AS-PCR) method based on the two-step PCR thermal cycles for genotyping single-nucleotide polymorphisms in three alcoholism-related genes: alcohol dehydrogenase 1B, aldehyde dehydrogenase 2 and μ-opioid receptor. Applying MightyAmp(®) DNA polymerase with optimized AS-primers and PCR conditions enabled us to achieve effective and selective amplification of the target alleles from alkaline lysates of a human hair root, and simultaneously to determine the genotypes within less than 1.5 h using minimal lab equipment.

Anti-Caries Effects of Dental Adhesives Containing Quaternary Ammonium Methacrylates with Different Chain Lengths

PubMed Central

Han, Qi; Li, Bolei; Zhou, Xuedong; Ge, Yang; Wang, Suping; Li, Mingyun; Ren, Biao; Wang, Haohao; Zhang, Keke; Xu, Hockin H. K.; Peng, Xian; Feng, Mingye; Weir, Michael D.; Chen, Yu; Cheng, Lei

2017-01-01

The objectives of this study were to investigate the effects of dental adhesives containing quaternary ammonium methacrylates (QAMs) with different alkyl chain lengths (CL) on ecological caries prevention in vitro. Five QAMs were synthesized with a CL = 3, 6, 9, 12, and 16 and incorporated into adhesives. Micro-tensile bond strength and surface charge density were used to measure the physical properties of the adhesives. The proportion change in three-species biofilms consisting of Streptococcus mutans, Streptococcus sanguinis, and Streptococcus gordonii was tested using the TaqMan real-time polymerase chain reaction. Lactic acid assay, MTT [3-(4,5-dimethyl-thiazol-2-yl)-2,5-diphenyltetrazolium bromide] assay, exopolysaccharide staining, live/dead staining, scanning electron microscopy (SEM), and transverse microradiography (TMR) were performed to study the anti-biofilm and anti-demineralization effects of the dental adhesives. The results showed that incorporating QAMs with different alkyl chain lengths into the adhesives had no obvious effect on the dentin bond strength. The adhesives containing QAMs with a longer alkyl chain developed healthier biofilms. The surface charge density, anti-biofilm, and anti-demineralization effects of the adhesives increased with a CL of the QAMs from 3 to 12, but decreased slightly with a CL from 12 to 16. In conclusion, adhesives containing QAMs with a tailored chain length are promising for preventing secondary caries in an “ecological way”. PMID:28773004

Diverse point mutations in the human gene for polymorphic N-acetyltransferase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vatsis, K.P.; Martell, K.J.; Weber, W.W.

1991-07-15

Classification of humans as rapid or slow acetylators is based on hereditary differences in rates of N-acetylation of therapeutic and carcinogenic agents, but N-acetylation of certain arylamine drugs displays no genetic variation. Two highly homologous human genes for N-acetyltransferase NAT1 and NAT2, presumably code for the genetically invariant and variant NAT proteins, respectively. In the present investigation, 1.9-kilobase human genomic EcoRI fragments encoding NAT2 were generated by the polymerase chain reaction with liver and leukocyte DNA from seven subjects phenotyped as homozygous and heterozygous acetylators. Direct sequencing revealed multiple point mutations in the coding region of two distinct NAT2 variants.more » One of these was derived from leukocytes of a slow acetylator and was distinguished by a silent mutation (coden 94) and a separate G {r arrow} A transition (position 590) leading to replacement of Arg-197 by Gln; the mutated guanine was part of a CpG dinucleotide and a Taq I site. The second NAT2 variant originated from liver with low N-acetylation activity. It was characterized by three nucleotide transitions giving rise to a silent mutation (codon 161), accompanied by obliteration of the sole Kpn I site, and two amino acid substitutions. The results show conclusively that the genetically variant NAT is encoded by NAT2.« less

Herpesviruses viral loads and levels of proinflammatory cytokines in apical periodontitis.

PubMed

Jakovljevic, A; Knezevic, A; Nikolic, N; Soldatovic, I; Jovanovic, T; Milasin, J; Andric, M

2018-07-01

This study aimed to analyse Epstein-Barr virus (EBV) and human cytomegalovirus (HCMV) viral loads in symptomatic and asymptomatic apical periodontitis lesions, to determine levels of TNF-α, IL-1β and IL-6 in these lesions and to investigate a possible correlation between herpesviral copy numbers and levels of proinflammatory cytokines. A total of 100 samples of apical periodontitis were subjected to HCMV and EBV copy numbers analysis by nested polymerase chain reaction (PCR) and TaqMan real-time PCR. The concentrations of TNF-α, IL-1β and IL-6 were determined by ELISA method. SPSS software was used for statistical analysis. There were no significant differences in the occurrence of EBV and HCMV between symptomatic and asymptomatic periapical lesions (p = .686, p = .879, respectively). Only 12 of 74 EBV (16.2%) and four of 54 HCMV (13.5%) nested PCR-positive samples showed increased viral copy numbers above the limit of 125 copies/ml. There was no significant correlation between the levels of analysed proinflammatory cytokines and herpesviral copy numbers in our sample. The observed low viral loads point to a relatively rare occurrence of active EBV and HCMV infection in our sample. Latent herpesviral infection does not enhance the production of investigated proinflammatory cytokines. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd. All rights reserved.

The impact of HLA-G, LILRB1 and LILRB2 gene polymorphisms on susceptibility to and severity of endometriosis.

PubMed

Bylińska, Aleksandra; Wilczyńska, Karolina; Malejczyk, Jacek; Milewski, Łukasz; Wagner, Marta; Jasek, Monika; Niepiekło-Miniewska, Wanda; Wiśniewski, Andrzej; Płoski, Rafał; Barcz, Ewa; Roszkowski, Piotr; Kamiński, Paweł; Malinowski, Andrzej; Wilczyński, Jacek R; Radwan, Paweł; Radwan, Michał; Kuśnierczyk, Piotr; Nowak, Izabela

2018-06-01

Endometriosis is a disease in which endometriotic tissue occurs outside the uterus. Its pathogenesis is still unknown. The most widespread hypothesis claims that ectopic endometrium appears as a result of retrograde menstruation and its insufficient elimination by immunocytes. Some reports have shown expression of non-classical HLA-G molecules on ectopic endometrium. HLA-G is recognized by KIR2DL4, LILRB1 and LILRB2 receptors on natural killer (NK) and other cells. These receptors are polymorphic, which may affect their activity. In this study we investigated whether HLA-G, KIR2DL4, LILRB1 and LILRB2 polymorphisms may influence susceptibility to endometriosis and disease progression. We used polymerase chain reaction (PCR), PCR-restriction fragment length polymorphism (PCR-RFLP) and allelic discrimination methods with TaqMan SNP Genotyping Assays for typing of 276 patients with endometriosis and 314 healthy fertile women. The HLA-G rs1632947:GG genotype was associated with protection against the disease and its severe stages; HLA-G rs1233334:CT protected against progression; LILRB1 rs41308748:AA and LILRB2 rs383369:AG predisposed to the disease and its progression. No effect of KIR2DL4 polymorphism was observed. These results support the role of polymorphisms of HLA-G and its receptors LILRB1 and LILRB2 in susceptibility to endometriosis and its progression.

Regulation of Small Mitochondrial DNA Replicative Advantage by Ribonucleotide Reductase in Saccharomyces cerevisiae

PubMed Central

Bradshaw, Elliot; Yoshida, Minoru; Ling, Feng

2017-01-01

Small mitochondrial genomes can behave as selfish elements by displacing wild-type genomes regardless of their detriment to the host organism. In the budding yeast Saccharomyces cerevisiae, small hypersuppressive mtDNA transiently coexist with wild-type in a state of heteroplasmy, wherein the replicative advantage of the small mtDNA outcompetes wild-type and produces offspring without respiratory capacity in >95% of colonies. The cytosolic enzyme ribonucleotide reductase (RNR) catalyzes the rate-limiting step in dNTP synthesis and its inhibition has been correlated with increased petite colony formation, reflecting loss of respiratory function. Here, we used heteroplasmic diploids containing wild-type (rho+) and suppressive (rho−) or hypersuppressive (HS rho−) mitochondrial genomes to explore the effects of RNR activity on mtDNA heteroplasmy in offspring. We found that the proportion of rho+ offspring was significantly increased by RNR overexpression or deletion of its inhibitor, SML1, while reducing RNR activity via SML1 overexpression produced the opposite effects. In addition, using Ex Taq and KOD Dash polymerases, we observed a replicative advantage for small over large template DNA in vitro, but only at low dNTP concentrations. These results suggest that dNTP insufficiency contributes to the replicative advantage of small mtDNA over wild-type and cytosolic dNTP synthesis by RNR is an important regulator of heteroplasmy involving small mtDNA molecules in yeast. PMID:28717049

Identification of suitable reference genes in bone marrow stromal cells from osteoarthritic donors.

PubMed

Schildberg, Theresa; Rauh, Juliane; Bretschneider, Henriette; Stiehler, Maik

2013-11-01

Bone marrow stromal cells (BMSCs) are key cellular components for musculoskeletal tissue engineering strategies. Furthermore, recent data suggest that BMSCs are involved in the development of Osteoarthritis (OA) being a frequently occurring degenerative joint disease. Reliable reference genes for the molecular evaluation of BMSCs derived from donors exhibiting OA as a primary co-morbidity have not been reported on yet. Hence, the aim of the study was to identify reference genes suitable for comparative gene expression analyses using OA-BMSCs. Passage 1 bone marrow derived BMSCs were isolated from n=13 patients with advanced stage idiopathic hip osteoarthritis and n=15 age-matched healthy donors. The expression of 31 putative reference genes was analyzed by quantitative reverse transcription polymerase chain reaction (qRT-PCR) using a commercially available TaqMan(®) assay. Calculating the coefficient of variation (CV), mRNA expression stability was determined and afterwards validated using geNorm and NormFinder algorithms. Importin 8 (IPO8), TATA box binding protein (TBP), and cancer susceptibility candidate 3 (CASC3) were identified as the most stable reference genes. Notably, commonly used reference genes, e.g. beta-actin (ACTB) and beta-2-microglobulin (B2M) were among the most unstable genes. For normalization of gene expression data of OA-BMSCs the combined use of IPO8, TBP, and CASC3 gene is recommended. © 2013.

Nanobacteria from blood: the smallest culturable autonomously replicating agent on Earth

NASA Astrophysics Data System (ADS)

Kajander, E. Olavi; Kuronen, Ilpo; Akerman, Kari K.; Pelttari, Alpo; Ciftcioglu, Neva

1997-07-01

Nanobacteria are the first mineral forming bacteria isolated from blood and blood products. They are coccoid cell-walled organisms with a size of 0.08 - 0.5 micrometers in EM, occure in clusters, produce a biofilm containing carbonate or hydroxyl apatite, and are highly resistant to heat, gamma-irradiation and antibiotics. Their growth rate is about one hundredth that of ordinary bacteria and they divide via several mechanisms. Taq polymerase was able to use their nontraditional nucleic acid as a template. 16S rRNA gene sequence results positioned them into the alpha-2 subgroup of Proteobacteria. Nanobacteria are smallest cell-walled bacteria since they can pass through 0.07 micrometers pores. In low-serum cultures, they form even smaller elementary particles or tubular units. How can blood be infected with such slow growing, heat and radio-resistant bacteria? The answer may lie in their phylogeny: alpha-2 subgroup has organisms from soil exposed to radiation and heat, that can penetrate into eukaryotic cells. Nanobacteria grow so slowly that they require a niche `cleaned' with heat, radiation or immunodefence. For survival they cloak themselves in apatite, a normal constituent of mammalian body. This may link nanobacteria to nannobacteria discovered from sedimentary rocks by Dr. Folk. Both have similar size, size variation, clustering and mineral deposits. They may resemble the probable ancient bacterial fossils in the Martian meteorite ALH84001.

Development and validation of quantitative PCR for detection of Terrapene herpesvirus 1 utilizing free-ranging eastern box turtles (Terrapene carolina carolina).

PubMed

Kane, Lauren P; Bunick, David; Abd-Eldaim, Mohamed; Dzhaman, Elena; Allender, Matthew C

2016-06-01

Diseases that affect the upper respiratory tract (URT) in chelonians have been well described as a significant contributor of morbidity and mortality. Specifically, herpesviruses are common pathogens in captive chelonians worldwide, but their importance on free-ranging populations is less well known. Historical methods for the diagnosis of herpesvirus infections include virus isolation and conventional PCR. Real-time PCR has become an essential tool for detection and quantitation of many pathogens, but has not yet been developed for herpesviruses in box turtles. Two quantitative real-time TaqMan PCR assays, TerHV58 and TerHV64, were developed targeting the DNA polymerase gene of Terrapene herpesvirus 1 (TerHV1). The assay detected a viral DNA segment cloned within a plasmid with 10-fold serial dilutions from 1.04 × 10(7) to 1.04 × 10(1) viral copies per reaction. Even though both primers had acceptable levels of efficiency and variation, TerHV58 was utilized to test clinical samples based on less variation and increased efficiency. This assay detected as few as 10 viral copies per reaction and should be utilized in free-ranging and captive box turtles to aid in the characterization of the epidemiology of this disease. Copyright © 2016 Elsevier B.V. All rights reserved.

Entomologic investigations during an outbreak of West Nile virus disease in Maricopa County, Arizona, 2010.

PubMed

Godsey, Marvin S; Burkhalter, Kristen; Young, Ginger; Delorey, Mark; Smith, Kirk; Townsend, John; Levy, Craig; Mutebi, John-Paul

2012-12-01

Entomologic investigations were conducted during an intense outbreak of West Nile virus (WNV) disease in Maricopa County, Arizona during July 31-August 9, 2010. The investigations compared the East Valley outbreak area, and a demographically similar control area in northwestern metropolitan Phoenix where no human cases were reported. Five mosquito species were identified in each area, and species composition was similar in both areas. Significantly more Culex quinquefasciatus females were collected by gravid traps at Outbreak sites (22.2 per trap night) than at control sites (8.9 per trap night), indicating higher Cx. quinquefasciatus abundance in the outbreak area. Twenty-eight WNV TaqMan reverse transcription-polymerase chain reaction-positive mosquito pools were identified, including 24 of Cx. quinquefasciatus, 3 of Psorophora columbiae, and 1 of Culex sp. However, Cx. quinquefasciatus WNV infection rates did not differ between outbreak and control sites. At outbreak sites, 30 of 39 engorged Cx. quinquefasciatus had fed on birds, 8 of 39 on humans, and 1 of 39 on a lizard. At control sites, 20 of 20 identified blood meals were from birds. Data suggest that Cx. quinquefasciatus was the primary enzootic and epidemic vector of this outbreak. The most important parameters in the outbreak were vector abundance and blood meal analysis, which suggested more frequent contact between Cx. quinquefasciatus and human hosts in the outbreak area compared with the control area.

Entomologic Investigations during an Outbreak of West Nile Virus Disease in Maricopa County, Arizona, 2010

PubMed Central

Godsey, Marvin S.; Burkhalter, Kristen; Young, Ginger; Delorey, Mark; Smith, Kirk; Townsend, John; Levy, Craig; Mutebi, John-Paul

2012-01-01

Entomologic investigations were conducted during an intense outbreak of West Nile virus (WNV) disease in Maricopa County, Arizona during July 31–August 9, 2010. The investigations compared the East Valley outbreak area, and a demographically similar control area in northwestern metropolitan Phoenix where no human cases were reported. Five mosquito species were identified in each area, and species composition was similar in both areas. Significantly more Culex quinquefasciatus females were collected by gravid traps at Outbreak sites (22.2 per trap night) than at control sites (8.9 per trap night), indicating higher Cx. quinquefasciatus abundance in the outbreak area. Twenty-eight WNV TaqMan reverse transcription-polymerase chain reaction–positive mosquito pools were identified, including 24 of Cx. quinquefasciatus, 3 of Psorophora columbiae, and 1 of Culex sp. However, Cx. quinquefasciatus WNV infection rates did not differ between outbreak and control sites. At outbreak sites, 30 of 39 engorged Cx. quinquefasciatus had fed on birds, 8 of 39 on humans, and 1 of 39 on a lizard. At control sites, 20 of 20 identified blood meals were from birds. Data suggest that Cx. quinquefasciatus was the primary enzootic and epidemic vector of this outbreak. The most important parameters in the outbreak were vector abundance and blood meal analysis, which suggested more frequent contact between Cx. quinquefasciatus and human hosts in the outbreak area compared with the control area. PMID:23109372

The peripheral messenger RNA expression of glycogen synthase kinase-3β genes in Alzheimer's disease patients: a preliminary study.

PubMed

Sheng, Jian-Hua; Ng, Tze-Pin; Li, Chun-Bo; Lu, Guang-Hua; He, Wei; Qian, Yi-Ping; Wang, Jing-Hua; Yu, Shun-Ying

2012-12-01

To explore the peripheral leucocytic messenger RNA (mRNA) expression of glycogen synthase kinase-3β (GSK-3β) gene in Alzheimer's disease (AD) patients. Using TaqMan relative quantitative real-time polymerase chain reaction, we analyzed leucocytic gene expression of GSK-3β in 48 AD patients and 49 healthy controls. Clinical data of AD patients were also collected. The mRNA expression level of the GSK-3β gene was significantly higher in the AD group (3.13±0.62) than in the normal group (2.77±0.77). Correlational analyses showed that the mRNA expression level of GSK-3β gene in AD patients was associated with the age of onset (P=0.047), age (P=0.055), and Behavioral Pathology in Alzheimer's Disease Rating Scale total score (P=0.062) and subscores: aggressiveness score (P=0.073) and anxieties and phobias score (P=0.067). Through multivariate regression model, older age, higher anxieties and phobias score and aggressiveness score were associated with higher mRNA expression level of GSK-3β gene. In AD patients, the mRNA expression level of the GSK-3β gene is increased and may be related to age and behavioural pathology in AD. © 2012 The Authors. Psychogeriatrics © 2012 Japanese Psychogeriatric Society.

Association analysis of calpain 10 gene variants/haplotypes with gestational diabetes mellitus among Mexican women.

PubMed

Castro-Martínez, Anna Gabriela; Sánchez-Corona, José; Vázquez-Vargas, Adriana Patricia; García-Zapién, Alejandra Guadalupe; López-Quintero, Andres; Villalpando-Velazco, Héctor Javier; Flores-Martínez, Silvia Esperanza

2018-02-28

Gestational diabetes mellitus (GDM) is a metabolically complex disease with major genetic determinants. GDM has been associated with insulin resistance and dysfunction of pancreatic beta cells, so the GDM candidate genes are those that encode proteins modulating the function and secretion of insulin, such as that for calpain 10 (CAPN10). This study aimed to assess whether single nucleotide polymorphism (SNP)-43, SNP-44, SNP-63, and the indel-19 variant, and specific haplotypes of the CAPN10 gene were associated with gestational diabetes mellitus. We studied 116 patients with gestational diabetes mellitus and 83 women with normal glucose tolerance. Measurements of anthropometric and biochemical parameters were performed. SNP-43, SNP-44, and SNP-63 were identified by polymerase chain reaction (PCR)-restriction fragment length polymorphisms, while the indel-19 variant was detected by TaqMan qPCR assays.  The allele, genotype, and haplotype frequencies of the four variants did not differ significantly between women with gestational diabetes mellitus and controls. However, in women with gestational diabetes mellitus, glucose levels were significantly higher bearing the 3R/3R genotype than in carriers of the 3R/2R genotype of the indel-19 variant (p = 0.006). In conclusion, the 3R/3R genotype of the indel-19 variant of the CAPN-10 gene influenced increased glucose levels in these Mexican women with gestational diabetes mellitus.

Usefulness of the (GTG)4-PCR for typing of monophasic Salmonella enterica isolates with antigenic shame l,4,[5],12:i:-.

PubMed

Wołkowicz, Tomasz; Januszkiewicz, Aleksandra; Chróst, Anna; Wolaniuk, Natalia; Kubiak, Anna B; Majchrzak, Marta; Szych, Jolanta; Parniewski, Paweł

2015-01-01

Monophasic Salmonella enterica strains presenting the antigenic shame 1,4,[5],12:i:- are becoming more prevalent. Accurate identification of such strains is hard with routine using biochemical and serological tests. Such strains can be identified with molecular tests. In this study we have tested the usefulness of(GTG)4-PCR for the diagnostic of such monophasic strains. This usefulness of this method was previously confirmed for genoserotyping of S. Enterica, Typhimurium, Infantis, Virchow, Hadar, Newport and Anatum. 76 strains with antigenic shame l,4,[5],12:i:-, isolated in Poland in years 2007-12 were tested. Additionally (GTG)4-PCR patterns were obtained for reference strains of serotypes S. Lagos, S. Agama, S. Farsta, S. Tsevie, S. Glocester and S. Tumodi. (GTG)4-PCR was performed with DreamTaq DNA polymerase. Obtained patterns were analysed with BioNumerics software. No pattern specific for monophasic pattern was identified. Additionally it was also impossible to differentiate patterns obtained for S. Typhimurium, S. Farsta, S. Tsevie and S. Glocester. Only reference strains of serotypes S. Tumodi, Farsta and Agama has the distinguishable patterns of (GTG)4-PCR. Analysed (GTG)4-PCR method do not show the ability to distinguish S. enterica serotypes from group 04, H:i, including monophasic strains with the antigenic shame 1,4,[5],12:i:-.

A prospective clinical study of Epstein-Barr virus and host interactions during acute infectious mononucleosis.

PubMed

Balfour, Henry H; Holman, Carol J; Hokanson, Kristin M; Lelonek, Meghan M; Giesbrecht, Jill E; White, Dana R; Schmeling, David O; Webb, Chiu-Ho; Cavert, Winston; Wang, David H; Brundage, Richard C

2005-11-01

Characterizing virus-host interactions during self-limited infectious mononucleosis could explain how Epstein-Barr virus (EBV) replication is normally controlled and provide insight into why certain immunocompromised patients fail to contain it. University students had an average of 7 clinical and virologic evaluations during acute infectious mononucleosis. EBV was quantified in 697 samples of oral wash fluid, whole blood, peripheral blood mononuclear cells (PBMCs), and plasma by a real-time (TaqMan) polymerase chain reaction (qEBV) assay developed in our laboratory. Twenty of 25 subjects had serologically confirmed primary EBV infection. EBV was cleared from whole blood by a first-order process with a median half-life of 3 days, and its quantity was associated with severity of illness (r2=0.82). Oral shedding persisted at a median of >or=1x104 copies/mL for 32 weeks and was unrelated to severity of illness. Subjects with nonprimary EBV infection shed virus intermittently, and median quantities for all samples became undetectable within 4 weeks. Using a novel qEBV assay, we demonstrated that young adults with primary EBV infection rapidly cleared virus from blood but not from the oropharynx. High oral concentrations of EBV in asymptomatic persons who have resumed normal activities support the concept that infectious mononucleosis is most likely acquired by kissing.

Distinguishing body lice from head lice by multiplex real-time PCR analysis of the Phum_PHUM540560 gene.

PubMed

Drali, Rezak; Boutellis, Amina; Raoult, Didier; Rolain, Jean Marc; Brouqui, Philippe

2013-01-01

Body louse or head louse? Once removed from their environment, body and head lice are indistinguishable. Neither the morphological criteria used since the mid-18th century nor the various genetic studies conducted since the advent of molecular biology tools have allowed body lice and head lice to be differentiated. In this work, using a portion of the Phum_PHUM540560 gene from the body louse, we aimed to develop a multiplex real-time polymerase chain reaction (PCR) assay to differentiate between body and head lice in a single reaction. A total of 142 human lice were collected from mono-infested hosts from 13 countries on five continents. We first identified the louse clade using a cytochrome b (CYTB) PCR sequence alignment. We then aligned a fragment of the Phum_PHUM540560 gene amplified from head and body lice to design-specific TaqMan(©) FAM- and VIC-labeled probes. All the analyzed lice were Clade A lice. A total of 22 polymorphisms between the body and head lice were characterized. The multiplex real-time PCR analysis enabled the body and head lice to be distinguished in two hours. This method is simple, with 100% specificity and sensitivity. We confirmed that the Phum_PHUM540560 gene is a useful genetic marker for the study of lice.

NcoI and TaqI RFLPs for human M creatine kinase (CKM)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Perryman, M.B.; Hejtmancik, J.F.; Ashizawa, Tetsuo

1988-09-12

Probe pHMCKUT contains a 135 bp cDNA fragment inserted into pGEM 3. The probe corresponds to nucleotides 1,201 to 1,336 located in the 3{prime} untranslated region of human M creatine kinase. The probe is specific for human M creatine kinase and does not hybridize to human B cretine kinase sequences. NcoI identifies a two allele polymorphism of a band at either 2.5 kb or 3.6 kb. TaqI identifies a two allele polymorphism at either 3.8 kb or 4.5 kb. Human M creatine has been localized to chromosome 19q. Autosomal co-dominant inheritance was shown in six informative Caucasian families.

DEVELOPMENT OF A MOLECULAR METHOD TO IDENTIFY HEPATITIS E VIRUS IN WATER

EPA Science Inventory

Hepatitis E virus (HEV) causes an infectious form of hepatitis associated with contaminated water. By analyzing the sequence of several HEV isolates, a reverse transciption-polymerase chain reaction method was developed and optimized that should be able to identify all of the kn...

Bacteriophage phi 6 RNA-dependent RNA polymerase: molecular details of initiating nucleic acid synthesis without primer.

PubMed

Laurila, Minni R L; Makeyev, Eugene V; Bamford, Dennis H

2002-05-10

Like most RNA polymerases, the polymerase of double-strand RNA bacteriophage phi6 (phi6pol) is capable of primer-independent initiation. Based on the recently solved phi6pol initiation complex structure, a four-amino acid-long loop (amino acids 630-633) has been suggested to stabilize the first two incoming NTPs through stacking interactions with tyrosine, Tyr(630). A similar loop is also present in the hepatitis C virus polymerase, another enzyme capable of de novo initiation. Here, we use a series of phi6pol mutants to address the role of this element. As predicted, mutants at the Tyr(630) position are inefficient in initiation de novo. Unexpectedly, when the loop is disordered by changing Tyr(630)-Lys(631)-Trp(632) to GSG, phi6pol becomes a primer-dependent enzyme, either extending complementary oligonucleotide or, when the template 3' terminus can adopt a hairpin-like conformation, utilizing a "copy-back" initiation mechanism. In contrast to the wild-type phi6pol, the GSG mutant does not require high GTP concentration for its optimal activity. These findings suggest a general model for the initiation of de novo RNA synthesis.

Optimization of the performance of the polymerase chain reaction in silicon-based microstructures.

PubMed Central

Taylor, T B; Winn-Deen, E S; Picozza, E; Woudenberg, T M; Albin, M

1997-01-01

We have demonstrated the ability to perform real-time homogeneous, sequence specific detection of PCR products in silicon microstructures. Optimal design/ processing result in equivalent performance (yield and specificity) for high surface-to-volume silicon structures as compared to larger volume reactions in polypropylene tubes. Amplifications in volumes as small as 0.5 microl and thermal cycling times reduced as much as 5-fold from that of conventional systems have been demonstrated for the microstructures. PMID:9224619

Development of duplex real-time PCR for the detection of WSSV and PstDV1 in cultivated shrimp.

PubMed

Leal, Carlos A G; Carvalho, Alex F; Leite, Rômulo C; Figueiredo, Henrique C P

2014-07-05

The White spot syndrome virus (WSSV) and Penaeus stylirostris penstyldensovirus 1 (previously named Infectious hypodermal and hematopoietic necrosis virus-IHHNV) are two of the most important viral pathogens of penaeid shrimp. Different methods have been applied for diagnosis of these viruses, including Real-time PCR (qPCR) assays. A duplex qPCR method allows the simultaneous detection of two viruses in the same sample, which is more cost-effective than assaying for each virus separately. Currently, an assay for the simultaneous detection of the WSSV and the PstDV1 in shrimp is unavailable. The aim of this study was to develop and standardize a duplex qPCR assay for the simultaneous detection of the WSSV and the PstDV1 in clinical samples of diseased L. vannamei. In addition, to evaluate the performance of two qPCR master mixes with regard to the clinical sensitivity of the qPCR assay, as well as, different methods for qPCR results evaluation. The duplex qPCR assay for detecting WSSV and PstDV1 in clinical samples was successfully standardized. No difference in the amplification of the standard curves was observed between the duplex and singleplex assays. Specificities and sensitivities similar to those of the singleplex assays were obtained using the optimized duplex qPCR. The analytical sensitivities of duplex qPCR were two copies of WSSV control plasmid and 20 copies of PstDV1 control plasmid. The standardized duplex qPCR confirmed the presence of viral DNA in 28 from 43 samples tested. There was no difference for WSSV detection using the two kits and the distinct methods for qPCR results evaluation. High clinical sensitivity for PstDV1 was obtained with TaqMan Universal Master Mix associated with relative threshold evaluation. Three cases of simultaneous infection by the WSSV and the PstDV1 were identified with duplex qPCR. The standardized duplex qPCR was shown to be a robust, highly sensitive, and feasible diagnostic tool for the simultaneous detection of the WSSV and the PstDV1 in whiteleg shrimp. The use of the TaqMan Universal Master Mix and the relative threshold method of data analysis in our duplex qPCR method provided optimal levels of sensitivity and specificity.

Meta-analysis of Cholesteryl Ester Transfer Protein TaqIB Polymorphism and Risk of Myocardial Infarction

PubMed Central

Cao, Min; Zhou, Zhi-Wen; Fang, Bang-Jiang; Zhao, Cheng-Gen; Zhou, Duan

2014-01-01

Abstract A number of studies have been conducted to explore the association between the cholesteryl ester transfer protein (CETP) TaqIB polymorphism and risk of myocardial infarction (MI); however, the results are inconsistent. Therefore, we conducted this meta-analysis to clarify the issue based on all the data available. Eligible studies were retrieved by searching PubMed, Embase, Web of Science, and Google Scholar. We calculated the crude odds ratios (ORs) and corresponding 95% confidence intervals (95% CIs) to assess the association between the TaqIB polymorphism and risk of MI. We included 13 studies involving 8733 MI cases and 8573 controls in the meta-analysis. The pooled results from all included studies showed decreased MI risk in the analysis of the B2B2 versus B1B1 (OR = 0.78, 95% CI = 0.68–0.91), dominant (OR = 0.88, 95% CI = 0.77–0.99), and recessive genetic models (OR = 0.84, 95% CI = 0.78–0.91). The frequency of the B2B2 genotype in MI patients was lower (OR = 0.87, 95% CI = 0.81–0.94). However, there was no significant association in the B1B2 versus B1B1 analysis (OR = 0.92, 95% CI = 0.81–1.05) and no significant difference for the B1B1 genotype (OR = 1.04, 95% CI = 0.98–1.11) and B1B2 genotype (OR = 1.03, 95% CI = 0.97–1.08). Cumulative analysis confirmed these results. Our results suggest that the B2B2 genotype of the CETP TaqIB polymorphism is a protective factor against the development of MI. PMID:25474428

The DRD2 Taq1A A1 Allele May Magnify the Risk of Alzheimer's in Aging African-Americans.

PubMed

Blum, Kenneth; Badgaiyan, Rajendra D; Dunston, Georgia M; Baron, David; Modestino, Edward J; McLaughlin, Thomas; Steinberg, Bruce; Gold, Mark S; Gondré-Lewis, Marjorie C

2017-09-30

Alzheimer's disease is an irreversible, progressive brain disorder that slowly destroys cognitive skills and the ability to perform the simplest tasks. More than 5 million Americans are afflicted with Alzheimer's; a disorder which ranks third, just behind heart disease and cancer, as a cause of death for older people. With no real cure and in spite of enormous efforts worldwide, the disease remains a mystery in terms of treatment. Importantly, African-Americans are two times as likely as Whites to develop late-onset Alzheimer's disease and less likely to receive timely diagnosis and treatment. Dopamine function is linked to normal cognition and memory and carriers of the DRD2 Taq1A A1 allele have significant loss of D2 receptor density in the brain. Recent research has shown that A1 carriers have worse memory performance during long-term memory (LTM) updating, compared to non-carriers or A2-carriers. A1carriers also show less blood oxygen level-dependent (BOLD) activation in the left caudate nucleus which is important for LTM updating. This latter effect was only seen in older adults, suggesting magnification of genetic effects on brain functioning in the elderly. Moreover, the frequency of the A1 allele is 0.40 in African-Americans, with an approximate prevalence of the DRD2 A1 allele in 50% of an African-American subset of individuals. This is higher than what is found in a non-screened American population (≤ 28%) for reward deficiency syndrome (RDS) behaviors. Based on DRD2 known genetic polymorphisms, we hypothesize that the DRD2 Taq1A A1 allele magnifies the risk of Alzheimer's in aging African-Americans. Research linking this high risk for Alzheimer's in the African-American population, with DRD2/ANKK1-TaqIA polymorphism and neurocognitive deficits related to LTM, could pave the way for novel, targeted pro-dopamine homeostatic treatment.

The TaqIA RFLP is associated with attenuated intervention-induced body weight loss and increased carbohydrate intake in post-menopausal obese women.

PubMed

Cameron, Jameason D; Riou, Marie-Ève; Tesson, Frédérique; Goldfield, Gary S; Rabasa-Lhoret, Rémi; Brochu, Martin; Doucet, Éric

2013-01-01

Polymorphisms of the dopamine receptor D2 (DRD2) gene have been associated with obesity phenotypes. Our aim was to examine if the genotype of TaqIA Restriction Fragment Length Polymorphism (RFPL) was related to an attenuated weight loss response or to changes in energy expenditure (EE) and food preference before and after weight loss. methods: Obese post-menopausal women (age=57.1 ± 4.6 yr, weight=85.4 ± 15.4 kg and BMI=32.8 ± 4.5 kg/m(2)) were genotyped for TaqIA (n=127) by using PCR-RFLP analysis and categorized as possessing at least one copy of the A1 allele (A1(+)) or no copy (A1(-)). Women were randomized into two groups, caloric restriction (CR) and caloric restriction+resistance training (CRRT) and in this study were further classified as follows: A1(+)CR, A1(+)CRRT, A1-(-)CR and (-)A1(-)CRRT. Body composition, total daily EE, physical activity EE, Resting EE (REE), and energy intake were obtained at baseline and post-intervention using DXA, doubly-labeled water, indirect calorimetry, and 3-day dietary records, respectively. Overall, all of the anthropometric variables and REE significantly decreased post-intervention (p<0.001). Women in the CRRT group lost significantly more fat mass (FM) than the CR women (p<0.05). There were significant time by group by allele interactions for attenuated body weight (BW), BMI, and FM loss for A1(+) (vs. A1(-)) in CRRT (p<0.05) and for increased % carbohydrate intake (p<0.01). TaqIA genotype was associated with body weight loss post-intervention; more specifically, carriers of the A1 allele lost significantly less BW and FM than the A1(-) and had increased carbohydrate intake in the CRRT group. Copyright © 2012 Elsevier Ltd. All rights reserved.

Parental smoke exposure and the development of nicotine craving in adolescent novice smokers: the roles of DRD2, DRD4, and OPRM1 genotypes.

PubMed

Kleinjan, Marloes; Engels, Rutger C M E; DiFranza, Joseph R

2015-10-08

Among adolescent novice smokers, craving is often the first, and is the most reported, symptom of nicotine dependence. Until now, little has been known about the development of craving symptoms in novice smokers. The aim of this study was to identify specific genetic (i.e., DRD2 Taq1A, DRD4 48 bp VNTR, and OPRM1 A118G polymorphisms) and environmental mechanisms that underlie the emergence of both cue-induced and cognitive craving among adolescent novice smokers. A five-wave longitudinal, genetically-informed survey study was conducted with intervals of four months. The sample included 376 early adolescent smokers (12-13 years of age at baseline). Self-report questionnaires were completed regarding smoking behavior, observed parental smoking behavior, and both cue-induced and cognitive craving. Data were analyzed with a latent growth curve approach. For both cue-induced and cognitive craving, significant interaction effects were found for DRD2 Taq1A with parental smoke exposure. A1-allele carriers did not seem to be influenced by the environment with regard to craving development. Adolescents who are homozygous for the A2-allele and who are more exposed to parental smoking experience the highest levels of both types of craving over time. No significant interaction effects were found between parental smoke exposure and DRD4 48 bp VNTR or OPRM1 A118G. Previous studies identified DRD2 Taq1A A1-allele carriers as vulnerable to developing nicotine dependence. However, this study showed that parental smoking increased the chances of developing dependence more rapidly for early adolescents who are considered to be less sensitive to the rewarding effects of nicotine according to their DRD2 Taq1A genotype. It is thus especially important that these young people not be exposed to smoking in their social environment.

Impact of vitamin D receptor gene polymorphisms in pathogenesis of Type-1 diabetes mellitus

PubMed Central

Kamel, Mahmoud M; Fouad, Shawky A; Salaheldin, Omina; El-Razek, Abd El-Rahman A Abd; El-Fatah, Abeer I Abd

2014-01-01

Background: Type 1 diabetes mellitus (TIDM) results from an immune-mediated destruction of insulin-producing-cells in the pancreatic islets of Langerhans. There are clear differences in immunogenetic predisposition to type1 diabetes among countries. Studies have indicated that vitamin D supplementation in early childhood decreases the risk of TIDM. Vitamin D exerts its action via the nuclear vitamin D receptor (VDR), which shows an extensive polymorphism. VDR gene polymorphisms have been associated with altered gene expression or gene function. Four single nucleotide polymorphisms (SNPs) in the VDR gene produce variation in four recognition sites. These recognition sites variants include Fok I, Bsm I, Apa I and Taq I. Aim of the study: TO investigate the relationship between VDR gene polymorphisms (at positions Taq I and Apa I) and the incidence of TIDM in Egyptian peoples. Subjects and methods: This study included 74 patients with type 1 DM in addition to 28 healthy age and sex matched control subjects. All of them were subjected to full history taking and clinical examination. Three ml of venous blood were withdrawn from each patient at fasting and postprandial times and used for genomic DNA extraction, estimation of Hb A1C, as well as, fasting and postprandial C-peptide and blood glucose levels. Results: Apa I recognition site was found in low frequency in diabetic patients (14/74) 18.9% while, its frequency was high (16/28) 57.1% among normal subjects. Taq I has two recognition sites. The first was found at nucleotide number 293 that was found in a frequency of (2/28) 7.1% in normal non-diabetic individuals while it was detected in (14/74) 18.9% in diabetic patients. The second Taq I recognition site was found at nucleotide number 494 without any differences between diabetic and normal individuals. Conclusion: This study indicates that there is an association between VDR genetic polymorphism and incidence of TIDM in Egyptian patients. PMID:25664062

Comparative evaluation of the performance of the Abbott RealTime HIV-1 assay for measurement of HIV-1 plasma viral load on genetically diverse samples from Greece

PubMed Central

2011-01-01

Background HIV-1 is characterized by increased genetic heterogeneity which tends to hinder the reliability of detection and accuracy of HIV-1 RNA quantitation assays. Methods In this study, the Abbott RealTime HIV-1 (Abbott RealTime) assay was compared to the Roche Cobas TaqMan HIV-1 (Cobas TaqMan) and the Siemens Versant HIV-1 RNA 3.0 (bDNA 3.0) assays, using clinical samples of various viral load levels and subtypes from Greece, where the recent epidemiology of HIV-1 infection has been characterized by increasing genetic diversity and a marked increase in subtype A genetic strains among newly diagnosed infections. Results A high correlation was observed between the quantitative results obtained by the Abbott RealTime and the Cobas TaqMan assays. Viral load values quantified by the Abbott RealTime were on average lower than those obtained by the Cobas TaqMan, with a mean (SD) difference of -0.206 (0.298) log10 copies/ml. The mean differences according to HIV-1 subtypes between the two techniques for samples of subtype A, B, and non-A/non-B were 0.089, -0.262, and -0.298 log10 copies/ml, respectively. Overall, differences were less than 0.5 log10 for 85% of the samples, and >1 log10 in only one subtype B sample. Similarly, Abbott RealTime and bDNA 3.0 assays yielded a very good correlation of quantitative results, whereas viral load values assessed by the Abbott RealTime were on average higher (mean (SD) difference: 0.160 (0.287) log10 copies/ml). The mean differences according to HIV-1 subtypes between the two techniques for subtype A, B and non-A/non-B samples were 0.438, 0.105 and 0.191 log10 copies/ml, respectively. Overall, the majority of samples (86%) differed by less than 0.5 log10, while none of the samples showed a deviation of more than 1.0 log10. Conclusions In an area of changing HIV-1 subtype pattern, the Abbott RealTime assay showed a high correlation and good agreement of results when compared both to the Cobas TaqMan and bDNA 3.0 assays, for all HIV-1 subtypes tested. All three assays could determine viral load from samples of different HIV-1 subtypes adequately. However, assay variation should be taken into account when viral load monitoring of the same individual is assessed by different systems. PMID:21219667

Comparison of multiple gene assembly methods for metabolic engineering

Treesearch

Chenfeng Lu; Karen Mansoorabadi; Thomas Jeffries

2007-01-01

A universal, rapid DNA assembly method for efficient multigene plasmid construction is important for biological research and for optimizing gene expression in industrial microbes. Three different approaches to achieve this goal were evaluated. These included creating long complementary extensions using a uracil-DNA glycosylase technique, overlap extension polymerase...

Reverse transcription-polymerase chain reaction molecular testing of cytology specimens: Pre-analytic and analytic factors.

PubMed

Bridge, Julia A

2017-01-01

The introduction of molecular testing into cytopathology laboratory practice has expanded the types of samples considered feasible for identifying genetic alterations that play an essential role in cancer diagnosis and treatment. Reverse transcription-polymerase chain reaction (RT-PCR), a sensitive and specific technical approach for amplifying a defined segment of RNA after it has been reverse-transcribed into its DNA complement, is commonly used in clinical practice for the identification of recurrent or tumor-specific fusion gene events. Real-time RT-PCR (quantitative RT-PCR), a technical variation, also permits the quantitation of products generated during each cycle of the polymerase chain reaction process. This review addresses qualitative and quantitative pre-analytic and analytic considerations of RT-PCR as they relate to various cytologic specimens. An understanding of these aspects of genetic testing is central to attaining optimal results in the face of the challenges that cytology specimens may present. Cancer Cytopathol 2017;125:11-19. © 2016 American Cancer Society. © 2016 American Cancer Society.

Plasticity in Structural and Functional Interactions between the Phosphoprotein and Nucleoprotein of Measles Virus*

PubMed Central

Shu, Yaoling; Habchi, Johnny; Costanzo, Stéphanie; Padilla, André; Brunel, Joanna; Gerlier, Denis; Oglesbee, Michael; Longhi, Sonia

2012-01-01

The measles virus (MeV) phosphoprotein (P) tethers the polymerase to the nucleocapsid template for transcription and genome replication. Binding of P to nucleocapsid is mediated by the X domain of P (XD) and a conserved sequence (Box-2) within the C-terminal domain of the nucleoprotein (NTAIL). XD binding induces NTAIL α-helical folding, which in turn has been proposed to stabilize the polymerase-nucleocapsid complex, with cycles of binding and release required for transcription and genome replication. The current work directly assessed the relationships among XD-induced NTAIL folding, XD-NTAIL binding affinity, and polymerase activity. Amino acid substitutions that abolished XD-induced NTAIL α-helical folding were created within Box-2 of Edmonston MeV NTAIL. Polymerase activity in minireplicons was maintained despite a 35-fold decrease in XD-NTAIL binding affinity or reduction/loss of XD-induced NTAIL alpha-helical folding. Recombinant infectious virus was recovered for all mutants, and transcriptase elongation rates remained within a 1.7-fold range of parent virus. Box-2 mutations did however impose a significant cost to infectivity, reflected in an increase in the amount of input genome required to match the infectivity of parent virus. Diminished infectivity could not be attributed to changes in virion protein composition or production of defective interfering particles, where changes from parent virus were within a 3-fold range. The results indicated that MeV polymerase activity, but not infectivity, tolerates amino acid changes in the XD-binding region of the nucleoprotein. Selectional pressure for conservation of the Box-2 sequence may thus reflect a role in assuring the fidelity of polymerase functions or the assembly of viral particles required for optimal infectivity. PMID:22318731

Plasticity in structural and functional interactions between the phosphoprotein and nucleoprotein of measles virus.

PubMed

Shu, Yaoling; Habchi, Johnny; Costanzo, Stéphanie; Padilla, André; Brunel, Joanna; Gerlier, Denis; Oglesbee, Michael; Longhi, Sonia

2012-04-06

The measles virus (MeV) phosphoprotein (P) tethers the polymerase to the nucleocapsid template for transcription and genome replication. Binding of P to nucleocapsid is mediated by the X domain of P (XD) and a conserved sequence (Box-2) within the C-terminal domain of the nucleoprotein (N(TAIL)). XD binding induces N(TAIL) α-helical folding, which in turn has been proposed to stabilize the polymerase-nucleocapsid complex, with cycles of binding and release required for transcription and genome replication. The current work directly assessed the relationships among XD-induced N(TAIL) folding, XD-N(TAIL) binding affinity, and polymerase activity. Amino acid substitutions that abolished XD-induced N(TAIL) α-helical folding were created within Box-2 of Edmonston MeV N(TAIL). Polymerase activity in minireplicons was maintained despite a 35-fold decrease in XD-N(TAIL) binding affinity or reduction/loss of XD-induced N(TAIL) alpha-helical folding. Recombinant infectious virus was recovered for all mutants, and transcriptase elongation rates remained within a 1.7-fold range of parent virus. Box-2 mutations did however impose a significant cost to infectivity, reflected in an increase in the amount of input genome required to match the infectivity of parent virus. Diminished infectivity could not be attributed to changes in virion protein composition or production of defective interfering particles, where changes from parent virus were within a 3-fold range. The results indicated that MeV polymerase activity, but not infectivity, tolerates amino acid changes in the XD-binding region of the nucleoprotein. Selectional pressure for conservation of the Box-2 sequence may thus reflect a role in assuring the fidelity of polymerase functions or the assembly of viral particles required for optimal infectivity.

Detecting DNA methylation of the BCL2, CDKN2A and NID2 genes in urine using a nested methylation specific polymerase chain reaction assay to predict bladder cancer.

PubMed

Scher, Michael B; Elbaum, Michael B; Mogilevkin, Yakov; Hilbert, David W; Mydlo, Jack H; Sidi, A Ami; Adelson, Martin E; Mordechai, Eli; Trama, Jason P

2012-12-01

Detection of methylated DNA has been shown to be a good biomarker for bladder cancer. Bladder cancer has the highest recurrence rate of any cancer and, as such, patients are regularly monitored using invasive diagnostic techniques. As urine is easily attainable, bladder cancer is an optimal cancer to detect using DNA methylation. DNA methylation is highly specific in cancer detection. However, it is difficult to detect because of the limited amount of DNA present in the urine of patients with bladder cancer. Therefore, an improved, sensitive and noninvasive diagnostic test is needed. We developed a highly specific and sensitive nested methylation specific polymerase chain reaction assay to detect the presence of bladder cancer in small volumes of patient urine. The genes assayed for DNA methylation are BCL2, CDKN2A and NID2. The regions surrounding the DNA methylation sites were amplified in a methylation independent first round polymerase chain reaction and the amplification product from the first polymerase chain reaction was used in a real-time methylation specific polymerase chain reaction. Urine samples were collected from patients receiving treatment at Wolfson Medical Center in Holon, Israel. In a pilot clinical study using patient urine samples we were able to differentiate bladder cancer from other urogenital malignancies and nonmalignant conditions with a sensitivity of 80.9% and a specificity of 86.4%. We developed a novel methylation specific polymerase chain reaction assay for the detection and monitoring of bladder cancer using DNA extracted from patient urine. The assay may also be combined with other diagnostic tests to improve accuracy. Copyright © 2012 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.

Discovery of Novel Hepatitis C Virus NS5B Polymerase Inhibitors by Combining Random Forest, Multiple e-Pharmacophore Modeling and Docking

PubMed Central

Wei, Yu; Li, Jinlong; Qing, Jie; Huang, Mingjie; Wu, Ming; Gao, Fenghua; Li, Dongmei; Hong, Zhangyong; Kong, Lingbao; Huang, Weiqiang; Lin, Jianping

2016-01-01

The NS5B polymerase is one of the most attractive targets for developing new drugs to block Hepatitis C virus (HCV) infection. We describe the discovery of novel potent HCV NS5B polymerase inhibitors by employing a virtual screening (VS) approach, which is based on random forest (RB-VS), e-pharmacophore (PB-VS), and docking (DB-VS) methods. In the RB-VS stage, after feature selection, a model with 16 descriptors was used. In the PB-VS stage, six energy-based pharmacophore (e-pharmacophore) models from different crystal structures of the NS5B polymerase with ligands binding at the palm I, thumb I and thumb II regions were used. In the DB-VS stage, the Glide SP and XP docking protocols with default parameters were employed. In the virtual screening approach, the RB-VS, PB-VS and DB-VS methods were applied in increasing order of complexity to screen the InterBioScreen database. From the final hits, we selected 5 compounds for further anti-HCV activity and cellular cytotoxicity assay. All 5 compounds were found to inhibit NS5B polymerase with IC50 values of 2.01–23.84 μM and displayed anti-HCV activities with EC50 values ranging from 1.61 to 21.88 μM, and all compounds displayed no cellular cytotoxicity (CC50 > 100 μM) except compound N2, which displayed weak cytotoxicity with a CC50 value of 51.3 μM. The hit compound N2 had the best antiviral activity against HCV, with a selective index of 32.1. The 5 hit compounds with new scaffolds could potentially serve as NS5B polymerase inhibitors through further optimization and development. PMID:26845440

Structural Transformation of Wireframe DNA Origami via DNA Polymerase Assisted Gap-Filling.

PubMed

Agarwal, Nayan P; Matthies, Michael; Joffroy, Bastian; Schmidt, Thorsten L

2018-03-27

The programmability of DNA enables constructing nanostructures with almost any arbitrary shape, which can be decorated with many functional materials. Moreover, dynamic structures can be realized such as molecular motors and walkers. In this work, we have explored the possibility to synthesize the complementary sequences to single-stranded gap regions in the DNA origami scaffold cost effectively by a DNA polymerase rather than by a DNA synthesizer. For this purpose, four different wireframe DNA origami structures were designed to have single-stranded gap regions. This reduced the number of staple strands needed to determine the shape and size of the final structure after gap filling. For this, several DNA polymerases and single-stranded binding (SSB) proteins were tested, with T4 DNA polymerase being the best fit. The structures could be folded in as little as 6 min, and the subsequent optimized gap-filling reaction was completed in less than 3 min. The introduction of flexible gap regions results in fully collapsed or partially bent structures due to entropic spring effects. Finally, we demonstrated structural transformations of such deformed wireframe DNA origami structures with DNA polymerases including the expansion of collapsed structures and the straightening of curved tubes. We anticipate that this approach will become a powerful tool to build DNA wireframe structures more material-efficiently, and to quickly prototype and test new wireframe designs that can be expanded, rigidified, or mechanically switched. Mechanical force generation and structural transitions will enable applications in structural DNA nanotechnology, plasmonics, or single-molecule biophysics.

Monitoring food pathogens: Novel instrumentation for cassette PCR testing

PubMed Central

Hunt, Darin; Figley, Curtis; Lauzon, Jana; Figley, Rachel; Pilarski, Linda M.; McMullen, Lynn M.; Pilarski, Patrick M.

2018-01-01

In this manuscript, we report the design and development of a fast, reliable instrument to run gel-based cassette polymerase chain reactions (PCR). Here termed the GelCycler Mark II, our instrument is a miniaturized molecular testing system that is fast, low cost and sensitive. Cassette PCR utilizes capillary reaction units that carry all reagents needed for PCR, including primers and Taq polymerase, except the sample, which is loaded at the time of testing. Cassette PCR carries out real time quantitative PCR followed by melt curve analysis (MCA) to verify amplicon identity at the expected melt temperature (Tm). The cassette PCR technology is well developed, particularly for detecting pathogens, and has been rigorously validated for detecting pathogenic Escherichia coli in meat samples. However, the work has been hindered by the lack of a robust and stable instrument to carry out the PCR, which requires fast and accurate temperature regulation, improved light delivery and fluorescent recording, and faster PCR reactions that maintain a high sensitivity of detection. Here, we report design and testing of a new instrument to address these shortcomings and to enable standardized testing by cassette PCR and commercial manufacture of a robust and accurate instrument that can be mass produced to deliver consistent performance. As a corollary to our new instrument development, we also report the use of an improved design approach using a machined aluminum cassette to meet the new instrument standards, prevent any light bleed across different trenches in each cassette, and allow testing of a larger number of samples for more targets in a single run. The GelCycler Mark II can detect and report E. coli contamination in 41 minutes. Sample positives are defined in as having a melt curve comparable to the internal positive control, with peak height exceeding that of the internal negative control. In a fractional analysis, as little as 1 bacterium per capillary reaction unit is directly detectable, with no enrichment step, in 35 cycles of PCR/MCA, in a total time of 53 minutes, making this instrument and technology among the very best for speed and sensitivity in screening food for pathogenic contamination. PMID:29746561

A new method for tracking poultry litter in the Potomac Basin headwaters of West Virginia.

PubMed

Weidhaas, J; Lipscomb, E

2013-08-01

To validate the distribution of a poultry litter-specific marker gene in faecally contaminated environmental waters of an intensive poultry litter rearing region. A TaqMan(®)-based qPCR assay for Brevibacterium sp. LA35 16S rRNA (LA35 gene), which was previously shown to be associated with poultry litter and faeces, was tested on 126 nontarget faecal samples and 28 poultry litter and faecal samples. The TaqMan assay was sensitive (76%) and specific (100%) to the LA35 gene and exhibited a detection limit for poultry litter in water samples that is sufficiently low (2.5 × 10(-2) mg litter l(-1)) to be applicable for environmental monitoring. The LA35 gene was detected in 43% of water samples (n = 30) collected in an intensive poultry rearing region of West Virginia which drains to the Chesapeake Bay. The poultry-specific TaqMan qPCR method for the LA35 gene is more specific than previously published methods and can be used to identify regions impacted by poultry rearing activities. The LA35 gene appears to have a broad geographical distribution as it has been found in poultry litter and faeces from Delaware and West Virginia, in this study and from Arkansas, Georgia, Florida, Minnesota, Oklahoma and Utah previously. © 2013 The Society for Applied Microbiology.

Use of real-time qPCR to quantify members of the unculturable heterotrophic bacterial community in a deep sea marine sponge, Vetulina sp.

PubMed

Cassler, M; Peterson, C L; Ledger, A; Pomponi, S A; Wright, A E; Winegar, R; McCarthy, P J; Lopez, J V

2008-04-01

In this report, real-time quantitative PCR (TaqMan qPCR) of the small subunit (SSU) 16S-like rRNA molecule, a universal phylogenetic marker, was used to quantify the relative abundance of individual bacterial members of a diverse, yet mostly unculturable, microbial community from a marine sponge. Molecular phylogenetic analyses of bacterial communities derived from Caribbean Lithistid sponges have shown a wide diversity of microbes that included at least six major subdivisions; however, very little overlap was observed between the culturable and unculturable microbial communities. Based on sequence data of three culture-independent Lithistid-derived representative bacteria, we designed probe/primer sets for TaqMan qPCR to quantitatively characterize selected microbial residents in a Lithistid sponge, Vetulina, metagenome. TaqMan assays included specificity testing, DNA limit of detection analysis, and quantification of specific microbial rRNA sequences such as Nitrospira-like microbes and Actinobacteria up to 172 million copies per microgram per Lithistid sponge metagenome. By contrast, qPCR amplification with probes designed for common previously cultured sponge-associated bacteria in the genera Rheinheimera and Marinomonas and a representative of the CFB group resulted in only minimal detection of the Rheiheimera in total DNA extracted from the sponge. These data verify that a large portion of the microbial community within Lithistid sponges may consist of currently unculturable microorganisms.

Vitamin D receptor gene methylation is associated with ethnicity, tuberculosis and TaqI polymorphism

PubMed Central

Andraos, Charlene; Koorsen, Gerrit; Knight, Julian C; Bornman, Liza

2014-01-01

The Vitamin D Receptor (VDR) gene encodes a transcription factor which, on activation by vitamin D, modulates diverse biological processes including calcium homeostasis and immune function. Genetic variation involving VDR shows striking differences in allele frequency between populations and has been associated with disease susceptibility including tuberculosis and autoimmunity, although results have often been conflicting. We hypothesized that methylation of VDR may be population specific and that the combination of differential methylation and genetic variation may characterise TB predisposition. We use bisulphite conversion and/or pyrosequencing to analyse the methylation status of 17 CpGs of VDR and to genotype 7 SNPs in the 3′ CpG Island (CGI 1060), including the commonly studied SNPs ApaI (rs7975232) and TaqI (rs731236). We show that for lymphoblastoid cell lines from two ethnically diverse populations (Yoruba from HapMap, n=30 and Caucasians, n=30) together with TB cases (n=32) and controls (n=29) from the Venda population of South Africa there are methylation variable positions (MVPs) in the 3′ end that significantly distinguish ethnicity (9/17 CpGs) and TB status (3/17 CpGs). Moreover methylation status shows complex association with TaqI genotype highlighting the need to consider both genetic and epigenetic variants in genetic studies of VDR association with disease. PMID:21168462

Sensitive detection of porcine DNA in processed animal proteins using a TaqMan real-time PCR assay.

PubMed

Pegels, N; González, I; Fernández, S; García, T; Martín, R

2012-01-01

A TaqMan real-time PCR method was developed for specific detection of porcine-prohibited material in industrial feeds. The assay combines the use of a porcine-specific primer pair, which amplifies a 79 bp fragment of the mitochondrial (mt) 12 S rRNA gene, and a locked nucleic acid (LNA) TaqMan probe complementary to a target sequence lying between the porcine-specific primers. The nuclear 18 S rRNA gene system, yielding a 77 bp amplicon, was employed as a positive amplification control to monitor the total content of amplifiable DNA in the samples. The specificity of the porcine primers-probe system was verified against different animal and plant species, including mammals, birds and fish. The applicability of the real-time PCR protocol to detect the presence of porcine mt DNA in feeds was determined through the analysis of 190 industrial feeds (19 known reference and 171 blind samples) subjected to stringent processing treatments. The performance of the method allows qualitative and highly sensitive detection of short fragments from porcine DNA in all the industrial feeds declared to contain porcine material. Although the method has quantitative potential, the real quantitative capability of the assay is limited by the existing variability in terms of composition and processing conditions of the feeds, which affect the amount and quality of amplifiable DNA.

Association study of DRD2 and MAOA genes with subtyped alcoholism comorbid with bipolar disorder in Han Chinese.

PubMed

Hu, Ming-Chuan; Lee, Sheng-Yu; Wang, Tzu-Yun; Chen, Shiou-Lan; Chang, Yun-Hsuan; Chen, Shih-Heng; Chu, Chun-Hsien; Wang, Chen-Lin; Lee, I Hui; Yeh, Tzung Lieh; Yang, Yen Kuang; Lu, Ru-Band

2013-01-10

Several studies have hypothesized that genes involved in the dopamine system, including dopamine type-2 receptor (DRD2)-related TaqIA polymorphism and monoamine oxidase-A upstream variable number tandem repeat (uVNTR), may be associated with alcoholism. But their results were contradictory because of alcoholism's heterogeneity. Therefore, we examined whether the DRD2TaqIA and MAOA-uVNTR gene polymorphisms are susceptibility factors for alcoholism comorbid with bipolar disorder (ALC+BP) in Han Chinese in Taiwan. We recruited 101 Han Chinese men with comorbid alcoholism and bipolar disorder, and 328 healthy male controls from the community. Genotyping was done using PCR-RFLP. There were no significant differences in the genotypic frequencies of the DRD2TaqIA or the MAOA-uVNTR polymorphisms between the 2 groups. The MAOA-uVNTR 3-repeat had a significant protective effect on the ALC+BP (odds ratio=0.432, p=0.035) but not on the healthy controls. However, the interaction between the MAOA-uVNTR 3-repeat and DRD2 A1/A2 was a risk factor in the ALC+BP (odds ratio=3.451, p=0.018). We indicated the impact of the association between MAOA-uVNTR 3-repeat and DRD2 A1/A2 with ALC+BP. Copyright © 2012 Elsevier Inc. All rights reserved.

Optimization of circulating cell-free DNA recovery for KRAS mutation and HPV detection in plasma.

PubMed

Mazurek, Agnieszka M; Fiszer-Kierzkowska, A; Rutkowski, T; Składowski, K; Pierzyna, M; Scieglińska, D; Woźniak, G; Głowacki, G; Kawczyński, R; Małusecka, E

2013-01-01

The precise analysis of tumour markers in blood such as circulating cell-free DNA (cfDNA) could have a significant impact in facilitating monitoring of patients after initial therapy. Although high levels of total cfDNA in plasma of cancer patients are consistently demonstrated, a low sensitivity of DNA alterations is reported. The major question regards the recovery of tumour-specific cfDNA such as KRAS mutated DNA and cancer-associated type 16 of human papillomavirus (HPV16). TaqMan technology was used for detection of KRAS mutation, HPV16 and to quantify cfDNA in blood plasma. Comparison of four different column-based commercial kits shows that the cfDNA purification carried out by the Genomic Mini AX Body Fluids kit and the QIAamp Circulating Nucleic Acid kit gave us the possibility to improve the sensitivity of detection of KRAS mutation and HPV16. The optimized method was used to follow the reduction in cancer-specific cfDNA after therapy. We found that large volume extractions with low volume of DNA eluate enabled trace amounts of tumour-specific cfDNA from cancer patients to be effectively identified. Data presented in this study facilitate detection of tumour-specific cfDNA and improve standards needed for the implementation of cfDNA technology into routine clinical practice.

Report for the NGFA-5 project.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jaing, C; Jackson, P; Thissen, J

The objective of this project is to provide DHS a comprehensive evaluation of the current genomic technologies including genotyping, TaqMan PCR, multiple locus variable tandem repeat analysis (MLVA), microarray and high-throughput DNA sequencing in the analysis of biothreat agents from complex environmental samples. To effectively compare the sensitivity and specificity of the different genomic technologies, we used SNP TaqMan PCR, MLVA, microarray and high-throughput illumine and 454 sequencing to test various strains from B. anthracis, B. thuringiensis, BioWatch aerosol filter extracts or soil samples that were spiked with B. anthracis, and samples that were previously collected during DHS and EPAmore » environmental release exercises that were known to contain B. thuringiensis spores. The results of all the samples against the various assays are discussed in this report.« less

Vitamin-D receptor (VDR) gene polymorphisms (Taq-I & Apa-I) in Syrian healthy population.

PubMed

Haddad, Shaden

2014-12-01

The vitamin D endocrine system regulates bone metabolism and calcium homeostasis as well as cellular proliferation and differentiation. Vitamin D receptor (VDR) mediates Vit-D activity, thus VDR gene polymorphisms may correlate with different diseases. This study aimed to determine the distribution of VDR gene (Taq-I and Apa-I) polymorphisms using a RFLP in unrelated normal healthy individuals of Syrian population. Allelic frequencies were 65% vs 35% and 66% vs 34% for T vs t and A vs a alleles, respectively. Genotype distribution was 36%, 58% and 6% for TT, Tt and tt and 42%, 47% and 10% for AA, Aa and aa, respectively. These results demonstrate that the frequency and distribution of the VDR polymorphisms in Syrian population are different from other populations worldwide.

[Method validation according to ISO 15189 and SH GTA 04: application for the detection of KRAS mutations using PCR TaqMan assay].

PubMed

Harlé, Alexandre; Dubois, Cindy; Rouyer, Marie; Merlin, Jean-Louis

2013-01-01

Since January 16(th) 2010, the French legislation requires that the medical laboratories must be accredited according to ISO 15189 standards. Thus, all medical laboratories in France must be accredited for at least part of their biological tests before the end of October 2013. Molecular biology tests are also concerned by the accreditation. Validation of molecular biology methods is made difficult, for reasons related to the methods, but also by the type of analytes that are basically rare. This article describes the validation of the qualitative detection of KRAS mutations in metastatic colorectal cancer using TaqMan PCR according to ISO 15189 and to the technical guide for accreditation in Human Health, SH-GTA-04, edited by the COFRAC.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gardner, S; Jaing, C

The goal of this project is to develop forensic genotyping assays for select agent viruses, addressing a significant capability gap for the viral bioforensics and law enforcement community. We used a multipronged approach combining bioinformatics analysis, PCR-enriched samples, microarrays and TaqMan assays to develop high resolution and cost effective genotyping methods for strain level forensic discrimination of viruses. We have leveraged substantial experience and efficiency gained through year 1 on software development, SNP discovery, TaqMan signature design and phylogenetic signature mapping to scale up the development of forensics signatures in year 2. In this report, we have summarized the Taqmanmore » signature development for South American hemorrhagic fever viruses, tick-borne encephalitis viruses and henipaviruses, Old World Arenaviruses, filoviruses, Crimean-Congo hemorrhagic fever virus, Rift Valley fever virus and Japanese encephalitis virus.« less

Solving traveling salesman problems with DNA molecules encoding numerical values.

PubMed

Lee, Ji Youn; Shin, Soo-Yong; Park, Tai Hyun; Zhang, Byoung-Tak

2004-12-01

We introduce a DNA encoding method to represent numerical values and a biased molecular algorithm based on the thermodynamic properties of DNA. DNA strands are designed to encode real values by variation of their melting temperatures. The thermodynamic properties of DNA are used for effective local search of optimal solutions using biochemical techniques, such as denaturation temperature gradient polymerase chain reaction and temperature gradient gel electrophoresis. The proposed method was successfully applied to the traveling salesman problem, an instance of optimization problems on weighted graphs. This work extends the capability of DNA computing to solving numerical optimization problems, which is contrasted with other DNA computing methods focusing on logical problem solving.

Detection of Mycoplasma hyopneumoniae by polymerase chain reaction in swine presenting respiratory problems

PubMed Central

Yamaguti, M.; Muller, E.E.; Piffer, A.I.; Kich, J.D.; Klein, C.S.; Kuchiishi, S.S.

2008-01-01

Since Mycoplasma hyopneumoniae isolation in appropriate media is a difficult task and impractical for daily routine diagnostics, Nested-PCR (N-PCR) techniques are currently used to improve the direct diagnostic sensitivity of Swine Enzootic Pneumonia. In a first experiment, this paper describes a N-PCR technique optimization based on three variables: different sampling sites, sample transport media, and DNA extraction methods, using eight pigs. Based on the optimization results, a second experiment was conducted for testing validity using 40 animals. In conclusion, the obtained results of the N-PCR optimization and validation allow us to recommend this test as a routine monitoring diagnostic method for Mycoplasma hyopneumoniae infection in swine herds. PMID:24031248

Isolation and extreme sex-specific expression of cytochrome P450 genes in the bark beetle, Ips paraconfusus, following feeding on the phloem of host ponderosa pine, Pinus ponderosa.

PubMed

Huber, D P W; Erickson, M L; Leutenegger, C M; Bohlmann, J; Seybold, S J

2007-06-01

We have identified cDNAs and characterized the expression of 13 novel cytochrome P450 genes of potential importance in host colonization and reproduction by the California fivespined ips, Ips paraconfusus. Twelve are of the Cyp4 family and one is of the Cyp9 family. Following feeding on host Pinus ponderosa phloem, bark beetle transcript levels of several of the Cyp4 genes increased or decreased in males only or in both sexes. In one instance (IparaCyp4A5) transcript accumulated significantly in females, but declined significantly in males. The Cyp9 gene (Cyp9T1) transcript levels in males were > 85 000 x higher at 8 h and > 25 000 x higher at 24 h after feeding compared with nonfed controls. Transcript levels in females were approximately 150 x higher at 24 h compared with nonfed controls. Cyp4G27 transcript was present constitutively regardless of sex or feeding and served as a better housekeeping gene than beta-actin or 18S rRNA for the real-time TaqMan polymerase chain reaction analysis. The expression patterns of Cyp4AY1, Cyp4BG1, and, especially, Cyp9T1 in males suggest roles for these genes in male-specific aggregation pheromone production. The differential transcript accumulation patterns of these bark beetle P450s provide insight into ecological interactions of I. paraconfusus with its host pines.

Copy number variants and genetic polymorphisms in TBX21, GATA3, Rorc, Foxp3 and susceptibility to Behcet's disease and Vogt-Koyanagi-Harada syndrome.

PubMed

Liao, Dan; Hou, Shengping; Zhang, Jun; Fang, Jing; Liu, Yunjia; Bai, Lin; Cao, Qingfeng; Kijlstra, Aize; Yang, Peizeng

2015-04-15

This study aimed to investigate the role of genetic variants including single nucleotide polymorphisms (SNPs) and copy number variants (CNVs) of TBX21, GATA3, Rorc and Foxp3 genes in Behcet's disease (BD) and Vogt-Koyanagi-Harada (VKH) syndrome in a Chinese Han population. Genotyping of 25 SNPs was performed by iPLEX system (Sequenom) or polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). TaqMan real time PCR was used to assess CNVs. The expression of Rorc and Foxp3 were examined by real-time PCR and cytokine production was measured by ELISA. High Rorc CNV was associated with the susceptibility to BD (P = 8.99 × 10(-8), OR = 3.0), and low Foxp3 CNV predisposed to BD in female patients (P = 1.92 × 10(-5), OR = 3.1). CNVs for the investigated genes were not altered in VKH syndrome. Further functional studies demonstrated that the relative mRNA expression levels of Rorc were increased in individuals with high Rorc copy number, but not for Foxp3. Increased production of IL-1β and IL-6 was found in individuals carrying a high CNV of Rorc. Our study showed that high CNVs of Rorc and low CNVs of Foxp3 confer risk for BD but not for VKH syndrome. The tested 25 SNPs in TBX21, GATA3, Rorc and Foxp3 did not associate with BD and VKH syndrome.

A small noncoding RNA signature found in exosomes of GBM patient serum as a diagnostic tool.

PubMed

Manterola, Lorea; Guruceaga, Elizabeth; Gállego Pérez-Larraya, Jaime; González-Huarriz, Marisol; Jauregui, Patricia; Tejada, Sonia; Diez-Valle, Ricardo; Segura, Victor; Samprón, Nicolás; Barrena, Cristina; Ruiz, Irune; Agirre, Amaia; Ayuso, Angel; Rodríguez, Javier; González, Alvaro; Xipell, Enric; Matheu, Ander; López de Munain, Adolfo; Tuñón, Teresa; Zazpe, Idoya; García-Foncillas, Jesús; Paris, Sophie; Delattre, Jean Yves; Alonso, Marta M

2014-04-01

Glioblastoma multiforme (GBM) is the most frequent malignant brain tumor in adults, and its prognosis remains dismal despite intensive research and therapeutic advances. Diagnostic biomarkers would be clinically meaningful to allow for early detection of the tumor and for those cases in which surgery is contraindicated or biopsy results are inconclusive. Recent findings show that GBM cells release microvesicles that contain a select subset of cellular proteins and RNA. The aim of this hypothesis-generating study was to assess the diagnostic potential of miRNAs found in microvesicles isolated from the serum of GBM patients. To control disease heterogeneity, we used patients with newly diagnosed GBM. In the discovery stage, PCR-based TaqMan Low Density Arrays followed by individual quantitative reverse transcriptase polymerase chain reaction were used to test the differences in the miRNA expression levels of serum microvesicles among 25 GBM patients and healthy controls paired by age and sex. The detected noncoding RNAs were then validated in another 50 GBM patients. We found that the expression levels of 1 small noncoding RNA (RNU6-1) and 2 microRNAs (miR-320 and miR-574-3p) were significantly associated with a GBM diagnosis. In addition, RNU6-1 was consistently an independent predictor of a GBM diagnosis. Altogether our results uncovered a small noncoding RNA signature in microvesicles isolated from GBM patient serum that could be used as a fast and reliable differential diagnostic biomarker.

Altered serum microRNAs as biomarkers for the early diagnosis of pulmonary tuberculosis infection

PubMed Central

2012-01-01

Background Pulmonary tuberculosis (TB) is a highly lethal infectious disease and early diagnosis of TB is critical for the control of disease progression. The objective of this study was to profile a panel of serum microRNAs (miRNAs) as potential biomarkers for the early diagnosis of pulmonary TB infection. Methods Using TaqMan Low-Density Array (TLDA) analysis followed by quantitative reverse transcriptase polymerase chain reaction (qRT-PCR) validation, expression levels of miRNAs in serum samples from 30 patients with active tuberculosis and 60 patients with Bordetella pertussis (BP), varicella-zoster virus (VZV) and enterovirus (EV) were analyzed. Results The Low-Density Array data showed that 97 miRNAs were differentially expressed in pulmonary TB patient sera compared with healthy controls (90 up-regulated and 7 down-regulated). Following qRT-PCR confirmation and receiver operational curve (ROC) analysis, three miRNAs (miR-361-5p, miR-889 and miR-576-3p) were shown to distinguish TB infected patients from healthy controls and other microbial infections with moderate sensitivity and specificity (area under curve (AUC) value range, 0.711-0.848). Multiple logistic regression analysis of a combination of these three miRNAs showed an enhanced ability to discriminate between these two groups with an AUC value of 0.863. Conclusions Our study suggests that altered levels of serum miRNAs have great potential to serve as non-invasive biomarkers for early detection of pulmonary TB infection. PMID:23272999

Genetic Variations of Melatonin Receptor Type 1A are Associated with the Clinicopathologic Development of Urothelial Cell Carcinoma.

PubMed

Lin, Yung-Wei; Wang, Shian-Shiang; Wen, Yu-Ching; Tung, Min-Che; Lee, Liang-Ming; Yang, Shun-Fa; Chien, Ming-Hsien

2017-01-01

Melatonin counteracts tumor occurrence and tumor cell progression in several cancer types in vitro and in vivo . It acts predominantly through its melatonin receptor type 1A (MTNR1A), and genetic variations of MTNR1A affect the susceptibility several diseases and cancer. The purpose of this study was to explore the effect of MTNR1A gene polymorphisms on the susceptibility to and clinicopathological characteristics of urothelial cell carcinoma (UCC). We recruited 272 patients with UCC and 272 normal controls to analyze three common single-nucleotide polymorphisms (SNPs) (rs2119882, rs13140012, and rs6553010) of MTNR1A related to cancer risk and clinicopathological relevance according to a TaqMan-based real-time polymerase chain reaction (PCR). We found that these three SNPs of MTNR1A were not associated with UCC susceptibility. However, patients with UCC who had at least one G allele of MTNR1A rs6553010 (in intron 1) were at higher risk (1.768-fold, 95% confidence interval: 1.068~1.849) of developing an invasive stage ( p < 0.026), compared to those patients with AA homozygotes. In conclusion, polymorphic genotypes of rs6553010 of MTNR1A might contribute to the ability to predict aggressive phenotypes of UCC. This is the first study to provide insights into risk factors associated with intronic MTNR1A variants in the clinicopathologic development of UCC in Taiwan.

DNA barcoding and real-time PCR detection of Bactrocera xanthodes (Tephritidae: Diptera) complex.

PubMed

Li, D; Waite, D W; Gunawardana, D N; McCarthy, B; Anderson, D; Flynn, A; George, S

2018-05-06

Immature fruit fly stages of the family Tephritidae are commonly intercepted on breadfruit from Pacific countries at the New Zealand border but are unable to be identified to the species level using morphological characters. Subsequent molecular identification showed that they belong to Bactrocera xanthodes, which is part of a species complex that includes Bactrocera paraxanthodes, Bactrocera neoxanthodes and an undescribed species. To establish a more reliable molecular identification system for B. xanthodes, a reference database of DNA barcode sequences for the 5'-fragment of COI gene region was constructed for B. xanthodes from Fiji, Samoa and Tonga. To better understand the species complex, B. neoxanthodes from Vanuatu and B. paraxanthodes from New Caledonia were also barcoded. Using the results of this analysis, real-time TaqMan polymerase chain reaction (PCR) assays for the detection of B. xanthodes complex and for the three individual species of the complex were developed and validated. The assay showed high specificity for the target species, with no cross-reaction observed for closely related organisms. Each of the real-time PCR assays is sensitive, detecting the target sequences at concentrations as low as ten copies µl-1 and can be used as either singleplex or multiplex formats. This real-time PCR assay for B. xanthodes has been successfully applied at the borders in New Zealand, leading to the rapid identification of intercepted Tephritidae eggs and larvae. The developed assays will be useful biosecurity tools for rapid detection of species in the B. xanthodes complex worldwide.

Development of an RT-qPCR assay for the specific detection of a distinct genetic lineage of the infectious bursal disease virus.

PubMed

Tomás, Gonzalo; Hernández, Martín; Marandino, Ana; Techera, Claudia; Grecco, Sofia; Hernández, Diego; Banda, Alejandro; Panzera, Yanina; Pérez, Ruben

2017-04-01

The infectious bursal disease virus (IBDV) is a major health threat to the world's poultry industry despite intensive controls including proper biosafety practices and vaccination. IBDV (Avibirnavirus, Birnaviridae) is a non-enveloped virus with a bisegmented double-stranded RNA genome. The virus is traditionally classified into classic, variant and very virulent strains, each with different epidemiological relevance and clinical implications. Recently, a novel worldwide spread genetic lineage was described and denoted as distinct (d) IBDV. Here, we report the development and validation of a reverse transcription-quantitative polymerase chain reaction (RT-qPCR) assay for the specific detection of dIBDVs in the global poultry industry. The assay employs a TaqMan-MGB probe that hybridizes with a unique molecular signature of dIBDV. The assay successfully detected all the assessed strains belonging to the dIBDV genetic lineage, showing high specificity and absence of cross-reactivity with non-dIBDVs, IBDV-negative samples and other common avian viruses. Using serial dilutions of in vitro-transcribed RNA we obtained acceptable PCR efficiencies and determination coefficients, and relatively small intra- and inter-assay variability. The assay demonstrated a wide dynamic range between 10 3 and 10 8 RNA copies/reaction. This rapid, specific and quantitative assay is expected to improve IBDV surveillance and control worldwide and to increase our understanding of the molecular epidemiology of this economically detrimental poultry pathogen.

Absence of the tag polymorphism for the risk haplotype HLA-DR2 for multiple sclerosis in Wixárika subjects from Mexico.

PubMed

González-Enríquez, G V; Torres-Mendoza, B M; Márquez-Pedroza, J; Macías-Islas, M A; Ortiz, G G; Cruz-Ramos, J A

2018-02-03

The HLA-DRB1*15:01 allele has a demonstrated risk for the development of multiple sclerosis (MS) in most populations around the world. The single nucleotide polymorphism (SNP) rs3129934 is found in linkage disequilibrium with the risk haplotype formed by the HLA-DRB1*15:01 and HLA-DQB1*06:02 alleles, and it is considered a reliable marker of the presence of this haplotype. Native Americans have a null or low prevalence of MS. In this study, we sought to identify the frequency of rs3129934 in the Wixárika ethnic group as well as in Mestizo (mixed race) patients with MS and in controls from western Mexico. Through real-time polymerase chain reaction (PCR) using TaqMan probes, we analyzed the allele and genotype frequencies of rs3129934 in Mestizo individuals with and without MS and in 73 Wixárika subjects from the state of Jalisco, Mexico. The Wixárika subjects were homozygote for the C allele of rs3129934. The allele and genotype frequency in Mestizos with MS was similar to that of other MS populations with Caucasian ancestry. The absence of the T risk allele rs3129934 (associated with the haplotype HLA-DRB1*15:01, HLA-DQ1*06:02) in this sample of Wixárika subjects is consistent with the unreported MS in this Amerindian group, related to absence of such paramount genetic risk factor.

Sperm count and motility are quantitatively affected by functional polymorphisms of HTR2A, MAOA and SLC18A.

PubMed

Cortés-Rodriguez, Miriam; Royo, Jose-Luis; Reyes-Palomares, Arturo; Lendínez, Ana M; Ruiz-Galdón, Maximiliano; Reyes-Engel, Armando

2018-05-01

Spermatozoa and neurones share similar membrane characteristics and features. Associations of multiple polymorphisms traditionally related to neurotransmission were investigated. Infertile men were grouped into controls with normospermia (n = 182) and idiopathic infertile men with asthenozoospermia (n = 103), and analysed as a case-control study and as a quantitative association of each genotype. Ten neurotransmission-associated genetic variants were mapped by SNP analysis using quantitative polymerase chain reaction with TaqMan probes. Men with HTR2A rs6313 had a higher risk of asthenozoospermia (OR = 2.14; P = 0.04). MAOA rs3788862 G carriers displayed an increased risk of asthenozoospermia (OR = 2.29; P = 0.02). The SLC18A1 rs1390938 G allele was more frequent among such cases (0.75 versus 0.87; P < 0.01 and P < 0.01 for Armitage trend test); for SLC18A1 rs2270641 P = 0.02 (case-control frequency) and P = 0.01 (Armitage trend test). MAOA rs3788862 was correlated with sperm motility (Spearman ρ = 0.14; P = 0.02); SLC18A1 rs1390938 was correlated with sperm count and motility (Spearman ρ = 0.20; P < 0.01). Gene polymorphisms of HTR2A, MAOA and SLC18A1, related to neurotransmission, are individually associated with asthenozoospermia through variation in sperm count and motility, without detectable allelic or genotype interaction. Copyright © 2018 Reproductive Healthcare Ltd. Published by Elsevier Ltd. All rights reserved.

Development and evaluation of a real-time polymerase chain reaction assay for the rapid detection of Talaromyces marneffei MP1 gene in human plasma.

PubMed

Hien, Ha Thuc Ai; Thanh, Tran Tan; Thu, Nguyen Thi Mai; Nguyen, Ashley; Thanh, Nguyen Tat; Lan, Nguyen Phu Huong; Simmons, Cameron; Shikuma, Cecilia; Chau, Nguyen Van Vinh; Thwaites, Guy; Le, Thuy

2016-12-01

Penicilliosis caused by Talaromyces marneffei is a common AIDS-defining illness in South and Southeast Asia. Diagnosis is based on culture which can take up to 14 days for identification, leading to treatment delay and increased mortality. We developed a TaqMan real-time PCR assay targeting the MP1 gene encoding an abundant cell wall protein specific to T. marneffei. The assay's performance was evaluated in MP1-containing plasmids, clinical isolates, and plasma from HIV-infected patients with and without penicilliosis. The assay consistently detected 10 copies of MP1-containing plasmids per reaction and 100 T. marneffei yeast cells per millilitre plasma. There were no amplification with seven other Penicillium species and six other HIV-associated fungal pathogens tested. The assay was evaluated in 70 patients with AIDS: 50 patients with culture-confirmed penicilliosis and 20 patients with opportunistic infections other than penicilliosis. The diagnostic sensitivity was 70.4% (19/27, 95% CI: 51.5-84.1%) and 52.2% (12/23, 95% CI: 33.0-70.8%) in plasma samples collected prior to and within 48 h of antifungal therapy respectively. The diagnostic specificity was 100% (20/20, 95% CI: 83.9-100%). This assay provides a useful tool for the rapid diagnosis of T. marneffei infection and has the potential to improve the management of patients with penicilliosis. © 2016 The Authors. Mycoses Published by Blackwell Verlag GmbH.

Use of alternative alkali chlorides in RT and PCR of polynucleotides containing G quadruplex structures.

PubMed

Ramos-Alemán, Fabiola; González-Jasso, Eva; Pless, Reynaldo C

2018-02-15

Several alkali chlorides were compared for their use in reverse transcription (RT) and PCR of different types of nucleic acid templates. On a test region of biological DNA incapable of forming G quadruplex (G4) structures, Taq DNA polymerase showed similar PCR performance with 50 mM KCl, CsCl, LiCl, and NaCl. In contrast, on a synthetic model polydeoxyribonucleotide prone to G4 formation, good PCR amplification was obtained with 50 mM CsCl, but little or none with LiCl or KCl. Similarly, in RT of a G4-prone model polyribonucleotide, MMLV reverse transcriptase produced a good yield with 50 mM CsCl, mediocre yields with LiCl or without added alkali chloride, and a poor yield with 50 mM KCl. The full RT-PCR assay starting from the G4-prone polyribonucleotide, showed good results with CsCl in both stages, poor results with LiCl, and no product formation with KCl. The model polynucleotides showed fast G quadruplex formation under PCR or RT conditions with 50 mM KCl, but not with CsCl or LiCl. The results argue for the use of CsCl instead of KCl for RT and PCR of G4-prone sequences. No advantage was observed when using the 7-deaza type nucleotide analog c 7 dGTP in PCR amplification of the G4-prone polydeoxyribonucleotide. Copyright © 2017 Elsevier Inc. All rights reserved.

Development of TaqMan probes targeting the four major celiac disease epitopes found in α-gliadin sequences of spelt (Triticum aestivum ssp. spelta) and bread wheat (Triticum aestivum ssp. aestivum).

PubMed

Dubois, Benjamin; Bertin, Pierre; Muhovski, Yordan; Escarnot, Emmanuelle; Mingeot, Dominique

2017-01-01

Celiac disease (CD) is caused by specific sequences of gluten proteins found in cereals such as bread wheat ( Triticum aestivum ssp. aestivum ) and spelt ( T. aestivum ssp. spelta ). Among them, the α-gliadins display the highest immunogenicity, with four T-cell stimulatory epitopes. The toxicity of each epitope sequence can be reduced or even suppressed according to the allelic form of each sequence. One way to address the CD problem would be to make use of this allelic variability in breeding programs to develop safe varieties, but tools to track the presence of toxic epitopes are required. The objective of this study was to develop a tool to accurately detect and quantify the immunogenic content of expressed α-gliadins of spelt and bread wheat. Four TaqMan probes that only hybridize to the canonical-i.e. toxic-form of each of the four epitopes were developed and their specificity was demonstrated. Six TaqMan probes targeting stable reference genes were also developed and constitute a tool to normalize qPCR data. The probes were used to measure the epitope expression levels of 11 contrasted spelt accessions and three ancestral diploid accessions of bread wheat and spelt. A high expression variability was highlighted among epitopes and among accessions, especially in Asian spelts, which showed lower epitope expression levels than the other spelts. Some discrepancies were identified between the canonical epitope expression level and the global amount of expressed α-gliadins, which makes the designed TaqMan probes a useful tool to quantify the immunogenic potential independently of the global amount of expressed α-gliadins. The results obtained in this study provide useful tools to study the immunogenic potential of expressed α-gliadin sequences from Triticeae accessions such as spelt and bread wheat. The application of the designed probes to contrasted spelt accessions revealed a high variability and interesting low canonical epitope expression levels in the Asian spelt accessions studied.

Pushing the limits for amplifying BrdU-labeled DNA encoding 16S rRNA: DNA polymerase as the determining factor.

PubMed

Roux-Michollet, Dad D; Schimel, Joshua P; Holden, Patricia A

2010-12-01

Identifying microorganisms that are active under specific conditions in ecosystems is a challenge in microbial ecology. Recently, the bromodeoxyuridine (BrdU) technique was developed to label actively growing cells. BrdU, a thymidine analog, is incorporated into newly synthesized DNA, and the BrdU-labeled DNA is then isolated from total extractable DNA by immunocapture using a BrdU-specific antibody. Analyzing the BrdU-labeled DNA allows for assessing the actively growing community, which can then be compared to the unlabeled DNA that represents the total community. However, applying the BrdU approach to study soils has been problematic due to low DNA amounts and soil contaminants. To address these challenges, we developed a protocol, optimizing specificity and reproducibility, to amplify BrdU-labeled gene fragments encoding 16S rRNA. We found that the determining factor was the DNA polymerase: among the 13 different polymerases we tested, only 3 provided adequate yields with minimal contamination, and only two of those three produced similar amplification patterns of community DNA. Copyright © 2010 Elsevier B.V. All rights reserved.

T85C polymorphisms of the dihydropyrimidine dehydrogenase gene detected in gastric cancer tissues by high-resolution melting curve analysis.

PubMed

Fang, Weijia; Xu, Nong; Jin, Dazhi; Chen, Yu; Chen, Xiaogang; Zheng, Yi; Shen, Hong; Yuan, Ying; Zheng, Shusen

2012-01-01

Dihydropyrimidine dehydrogenase is a key enzyme acting on the metabolic pathway of medications for gastric cancer. High-resolution melting curve technology, which was developed recently, can distinguish the wild-type dihydropyrimidine dehydrogenase gene from multiple polymorphisms by fluorescent quantitative polymerase chain reaction products in a direct and effective manner. T85C polymorphisms of dihydropyrimidine dehydrogenase in the peripheral blood of 112 Chinese gastric cancer patients were detected by real-time polymerase chain reaction combined with high-resolution melting curve technology. Primer design, along with the reaction system and conditions, was optimized based on the GenBank sequence. Seventy nine cases of wild-type (TT, [70.5%]), 29 cases of heterozygous (TC, [25.9%]), and 4 cases of homozygous mutant (CC, [3.6%]) were observed. The result was completely consistent with the results of the sequencing. Real-time polymerase chain reaction combined with high-resolution melting curve technology is a rapid, simple, reliable, direct-viewing, and convenient method for the detection and screening of polymorphisms.

A multiplex TaqMan qPCR assay for sensitive and rapid detection of phytoplasmas infecting Rubus species.

PubMed

Linck, Holger; Krüger, Erika; Reineke, Annette

2017-01-01

Rubus stunt is an economically important disease in the production of raspberries, blackberries, and loganberries. A fast, sensitive, and reliable diagnosis of phytoplasmas, the causal agent of the disease, is of prime importance to stop its spread by vegetative propagation and by insect vectors. Therefore, multiplex qPCR assays using TaqMan probes with different kinds of fluorophores in one reaction were developed, allowing the detection of phytoplasmas in general as well as a more specific detection of phytoplasmas belonging to group 16SrV and host DNA (either plant or insect). This assay now provides a practical tool for the screening of motherplants and monitoring the presence and distribution of phytoplasmas in Rubus plants of different geographic origins, cultivars, and cultivation systems, as well as in putative insect vectors like leafhoppers.

A multiplex TaqMan qPCR assay for sensitive and rapid detection of phytoplasmas infecting Rubus species

PubMed Central

Krüger, Erika; Reineke, Annette

2017-01-01

Rubus stunt is an economically important disease in the production of raspberries, blackberries, and loganberries. A fast, sensitive, and reliable diagnosis of phytoplasmas, the causal agent of the disease, is of prime importance to stop its spread by vegetative propagation and by insect vectors. Therefore, multiplex qPCR assays using TaqMan probes with different kinds of fluorophores in one reaction were developed, allowing the detection of phytoplasmas in general as well as a more specific detection of phytoplasmas belonging to group 16SrV and host DNA (either plant or insect). This assay now provides a practical tool for the screening of motherplants and monitoring the presence and distribution of phytoplasmas in Rubus plants of different geographic origins, cultivars, and cultivation systems, as well as in putative insect vectors like leafhoppers. PMID:28545043

HIV-1 and HCV viral load cost models for bDNA: 440 Molecular System versus real-time PCR AmpliPrep/TaqMan test.

PubMed

Elbeik, Tarek; Dalessandro, Ralph; Loftus, Richard A; Beringer, Scott

2007-11-01

Comparative cost models were developed to assess cost-per-reportable result and annual costs for HIV-1 and HCV bDNA and AmpliPrep/TaqMan Test (PCR). Model cost components included kit, disposables, platform and related equipment, equipment service plan, equipment maintenance, equipment footprint, waste and labor. Model assessment was most cost-effective when run by bDNA with 36 or more clinical samples and PCR with 30 or fewer clinical samples. Lower costs are attained with maximum samples (84-168) run daily. Highest cost contributors include kit, platform and PCR proprietary disposables. Understanding component costs and the most economic use of HIV-1 and HCV viral load will aid in attaining lowest costs through selection of the appropriate assay and effective negotiations.

Creatine kinase MM TaqI and methylenetetrahydrofolate reductase C677T and A1298C gene polymorphisms influence exercise-induced C-reactive protein levels.

PubMed

Miranda-Vilela, Ana Luisa; Akimoto, Arthur K; Lordelo, Graciana S; Pereira, Luiz C S; Grisolia, Cesar K; Klautau-Guimarães, Maria de Nazaré

2012-01-01

Physical training induces beneficial adaptations, but exhausting exercise increases reactive oxygen species, which can cause muscular injuries with consequent inflammatory processes, implying jeopardized performance and possibly overtraining. Acute strenuous exercise almost certainly exceeds the benefits of physical activity; it can compromise performance and may contribute to increased future risk of cardiovascular disease (CVD) in athletes. Polymorphisms in the muscle-type creatine kinase (CK-MM) gene may influence performance and adaptation to training, while many potentially significant genetic variants are reported as risk factors for CVD. Therefore, we investigated the influence of polymorphisms in CK-MM TaqI and NcoI, methylenetetrahydrofolate reductase (MTHFR C677T and A1298C) and C-reactive protein (CRP G1059C) genes on exercise-induced damage and inflammation markers. Blood samples were taken immediately after a race (of at least 4 km) that took place outdoors on flat tracks, and were submitted to genotyping and biochemical evaluation of aspartate aminotransferase (AST), CK, CRP and high-sensitivity CRP (hs-CRP). CK-MM TaqI polymorphism significantly influenced results of AST, CK and hs-CRP, and an association between MTHFR C677T and A1298C with CRP level was found, although these levels did not exceed reference values. Results indicate that these polymorphisms can indirectly influence performance, contribute to higher susceptibility to exercise-induced inflammation or protection against it, and perhaps affect future risks of CVD in athletes.

Creatine kinase MM TaqI and methylenetetrahydrofolate reductase C677T and A1298C gene polymorphisms influence exercise-induced C-reactive protein levels.

PubMed

Miranda-Vilela, Ana Luisa; Akimoto, Arthur K; Lordelo, Graciana S; Pereira, Luiz C S; Grisolia, Cesar K; Klautau-Guimarães, Maria de Nazaré

2012-03-01

Physical training induces beneficial adaptations, but exhausting exercise increases reactive oxygen species, which can cause muscular injuries with consequent inflammatory processes, implying jeopardized performance and possibly overtraining. Acute strenuous exercise almost certainly exceeds the benefits of physical activity; it can compromise performance and may contribute to increased future risk of cardiovascular disease (CVD) in athletes. Polymorphisms in the muscle-type creatine kinase (CK-MM) gene may influence performance and adaptation to training, while many potentially significant genetic variants are reported as risk factors for CVD. Therefore, we investigated the influence of polymorphisms in CK-MM TaqI and NcoI, methylenetetrahydrofolate reductase (MTHFR C677T and A1298C) and C-reactive protein (CRP G1059C) genes on exercise-induced damage and inflammation markers. Blood samples were taken immediately after a race (of at least 4 km) that took place outdoors on flat tracks, and were submitted to genotyping and biochemical evaluation of aspartate aminotransferase (AST), CK, CRP and high-sensitivity CRP (hs-CRP). CK-MM TaqI polymorphism significantly influenced results of AST, CK and hs-CRP, and an association between MTHFR C677T and A1298C with CRP level was found, although these levels did not exceed reference values. The results indicate that these polymorphisms can indirectly influence performance, contribute to higher susceptibility to exercise-induced inflammation or protection against it, and perhaps affect future risks of CVD in athletes.

D2 dopamine receptor (DRD2) gene Taq1A polymorphism and the eating-related psychological traits in eating disorders (anorexia nervosa and bulimia) and obesity.

PubMed

Nisoli, E; Brunani, A; Borgomainerio, E; Tonello, C; Dioni, L; Briscini, L; Redaelli, G; Molinari, E; Cavagnini, F; Carruba, M O

2007-06-01

Food is considered a reinforcing agent, like a variety of substances such as alcohol and other drugs of abuse that produce pleasure. Psychopathological traits related to food intake are demonstrated in eating disorders as in obesity with different genetic aspects for these diseases. Recently, the prevalence of TaqA1 allele has been associated to alcohol, drug abuse and carbohydrate preference. For this reason, the aim of this study was to evaluate if the presence of A1 allele, in eating disorders and obesity, is associated with some particular psycho-pathological characteristics. We studied the presence of TaqA1 in Italian subjects affected by obesity (n=71), anorexia (n=28), bulimia (n=20) and in control group (n=54). The Eating Disorders Inventory (EDI test) was used to evaluate the psychological profiles. Patients without alcohol and drugs abuse were selected (>125 ml/day). The A1+ allele, both in A1/A1 and A1/A2 genotypes, was not differently distributed among disease groups; on the contrary two EDI subscales (Drive for thinness and Ineffectiveness) resulted associated with A1+ allele without effect of the eating disease or obesity. These results confirm that the presence of A1+ allele is not simply related to body weight but the A1+ allele might be a marker of a genetic psychological condition in people with high risk to develop pathological eating behaviour.

Development of an optimized protocol for the detection of classical swine fever virus in formalin-fixed, paraffin-embedded tissues by seminested reverse transcription-polymerase chain reaction and comparison with in situ hybridization.

PubMed

Ha, S-K; Choi, C; Chae, C

2004-10-01

An optimized protocol was developed for the detection of classical swine fever virus (CSFV) in formalin-fixed, paraffin-embedded tissues obtained from experimentally and naturally infected pigs by seminested reverse transcription-polymerase chain reaction (RT-PCR). The results for seminested RT-PCR were compared with those determined by in situ hybridization. The results obtained show that the use of deparaffinization with xylene, digestion with proteinase K, extraction with Trizol LS, followed by seminested RT-PCR is a reliable detection method. An increase in sensitivity was observed as amplicon size decreased. The highest sensitivity for RT-PCR on formalin-fixed, paraffin-embedded tissues RNA was obtained with amplicon sizes less than approximately 200 base pairs. An hybridization signal for CSFV was detected in lymph nodes from 12 experimentally and 12 naturally infected pigs. The sensitivity of seminested RT-PCR compared with in situ hybridization was 100% for CSFV. When only formalin-fixed tissues are available, seminested RT-PCR and in situ hybridization would be useful diagnostic methods for the detection of CSFV nucleic acid.

NMR Structure and Dynamics of the C-terminal Domain from Human Rev1 and its Complex with Rev1 Interacting Region of DNA Polymerase η

PubMed Central

Pozhidaeva, Alexandra; Pustovalova, Yulia; D'Souza, Sanjay; Bezsonova, Irina; Walker, Graham C.; Korzhnev, Dmitry M.

2013-01-01

Rev1 is a translesion synthesis (TLS) DNA polymerase essential for DNA damage tolerance in eukaryotes. In the process of TLS stalled high-fidelity replicative DNA polymerases are temporarily replaced by specialized TLS enzymes that can bypass sites of DNA damage (lesions), thus allowing replication to continue or postreplicational gaps to be filled. Despite its limited catalytic activity, human Rev1 plays a key role in TLS by serving as a scaffold that provides an access of Y-family TLS polymerases polη, ι, and κ to their cognate DNA lesions and facilitates their subsequent exchange to polζ that extends the distorted DNA primer-template. Rev1 interaction with the other major human TLS polymerases, polη, ι, κ and the regulatory subunit Rev7 of polζ, is mediated by Rev1 C-terminal domain (Rev1-CT). We used NMR spectroscopy to determine the spatial structure of the Rev1-CT domain (residues 1157-1251) and its complex with Rev1 interacting region (RIR) from polη (residues 524-539). The domain forms a four-helix bundle with a well-structured N-terminal β-hairpin docking against helices 1 and 2, creating a binding pocket for the two conserved Phe residues of the RIR motif that upon binding folds into an α-helix. NMR spin-relaxation and NMR relaxation dispersion measurements suggest that free Rev1-CT and Rev1-CT/polη-RIR complex exhibit μs-ms conformational dynamics encompassing the RIR binding site, which might facilitate selection of the molecular configuration optimal for binding. These results offer new insights into the control of TLS in human cells by providing a structural basis for understanding the recognition of the Rev1-CT by Y-family DNA polymerases. PMID:22691049

Rapid Diagnosis of Infection in the Critically Ill, a Multicenter Study of Molecular Detection in Bloodstream Infections, Pneumonia, and Sterile Site Infections*

PubMed Central

Brealey, David; Libert, Nicolas; Abidi, Nour Elhouda; O’Dwyer, Michael; Zacharowski, Kai; Mikaszewska-Sokolewicz, Malgorzata; Schrenzel, Jacques; Simon, François; Wilks, Mark; Picard-Maureau, Marcus; Chalfin, Donald B.; Ecker, David J.; Sampath, Rangarajan; Singer, Mervyn

2015-01-01

Objective: Early identification of causative microorganism(s) in patients with severe infection is crucial to optimize antimicrobial use and patient survival. However, current culture-based pathogen identification is slow and unreliable such that broad-spectrum antibiotics are often used to insure coverage of all potential organisms, carrying risks of overtreatment, toxicity, and selection of multidrug-resistant bacteria. We compared the results obtained using a novel, culture-independent polymerase chain reaction/electrospray ionization-mass spectrometry technology with those obtained by standard microbiological testing and evaluated the potential clinical implications of this technique. Design: Observational study. Setting: Nine ICUs in six European countries. Patients: Patients admitted between October 2013 and June 2014 with suspected or proven bloodstream infection, pneumonia, or sterile fluid and tissue infection were considered for inclusion. Interventions: None. Measurements and Main Results: We tested 616 bloodstream infection, 185 pneumonia, and 110 sterile fluid and tissue specimens from 529 patients. From the 616 bloodstream infection samples, polymerase chain reaction/electrospray ionization-mass spectrometry identified a pathogen in 228 cases (37%) and culture in just 68 (11%). Culture was positive and polymerase chain reaction/electrospray ionization-mass spectrometry negative in 13 cases, and both were negative in 384 cases, giving polymerase chain reaction/electrospray ionization-mass spectrometry a sensitivity of 81%, specificity of 69%, and negative predictive value of 97% at 6 hours from sample acquisition. The distribution of organisms was similar with both techniques. Similar observations were made for pneumonia and sterile fluid and tissue specimens. Independent clinical analysis of results suggested that polymerase chain reaction/electrospray ionization-mass spectrometry technology could potentially have resulted in altered treatment in up to 57% of patients. Conclusions: Polymerase chain reaction/electrospray ionization-mass spectrometry provides rapid pathogen identification in critically ill patients. The ability to rule out infection within 6 hours has potential clinical and economic benefits. PMID:26327198

Establishment and optimization of a wheat germ cell-free protein synthesis system and its application in venom kallikrein.

PubMed

Wang, Yunpeng; Xu, Wentao; Kou, Xiaohong; Luo, Yunbo; Zhang, Yanan; Ma, Biao; Wang, Mengsha; Huang, Kunlun

2012-08-01

Wheat germ cell-free protein synthesis systems have the potential to synthesize functional proteins safely and with high accuracy, but the poor energy supply and the instability of mRNA templates reduce the productivity of this system, which restricts its applications. In this report, phosphocreatine and pyruvate were added to the system to supply ATP as a secondary energy source. After comparing the protein yield, we found that phosphocreatine is more suitable for use in the wheat germ cell-free protein synthesis system. To stabilize the mRNA template, the plasmid vector, SP6 RNA polymerase, and Cu(2+) were optimized, and a wheat germ cell-free protein synthesis system with high yield and speed was established. When plasmid vector (30 ng/μl), SP6 RNA polymerase (15 U), phosphocreatine (25 mM), and Cu(2+) (5 mM) were added to the system and incubated at 26°C for 16 h, the yield of venom kallikrein increased from 0.13 to 0.74 mg/ml. The specific activity of the recombinant protein was 1.3 U/mg, which is only slightly lower than the crude venom kallikrein (1.74 U/mg) due to the lack of the sugar chain. In this study, the yield of venom kallikrein was improved by optimizing the system, and a good foundation has been laid for industrial applications and for further studies. Copyright © 2012 Elsevier Inc. All rights reserved.

Piglet colibacillosis diagnosis based on multiplex polymerase chain reaction and immunohistochemistry of paraffin-embedded tissues

PubMed Central

de Andrade, Caroline P.; Machado, Verônica S. L.; Bianchi, Matheus V.; Rolim, Veronica M.; Cruz, Raquel A. S.; Driemeier, David

2018-01-01

Enterotoxigenic Escherichia coli (ETEC) causes diarrhea in pigs, referred to as colibacillosis. The aim of this study was to optimize multiplex polymerase chain reaction (PCR) and immunohistochemistry (IHC) analyses of paraffin-embedded material to detect pathogenic E. coli strains causing colibacillosis in pigs. Multiplex PCR was optimized for fimbriae (F18, F4, F6, F5, and F41) and toxins (types A and B heat-stable toxins [STaP and STb], heat-labile toxin [LT], and type 2 Shiga toxin [STx2e]), and IHC was optimized for an anti-E. coli polyclonal antibody. Samples (132) from pigs received between 2006 and 2014 with clinical and histopathological diagnoses of colibacillosis were analyzed. E. coli was detected by IHC in 78.7%, and at least one virulence factor gene was detected in 71.2%. Pathogenic strains of ETEC with at least one fimbria and one toxin were detected in 40% of the samples in multiplex PCR. The most frequent virulence types were F18-STaP (7.5%), F18-STaP-STb (5.7%), and F4-STaP (3.8%). A statistically significant association was noted between virulence factors F4, F18, STaP, and STb and positive immunostaining results. Colibacillosis diagnosis through multiplex PCR and IHC of paraffin-embedded tissues is a practical approach, as samples can be fixed and stored for long periods before analysis. PMID:28693311

LENGTH-HETEROGENEITY POLYMERASE CHAIN REACTION (LH-PCR) AS AN INDICATOR OF STREAM SANITARY AND ECOLOGICAL CONDITION: OPTIMAL SAMPLE SIZE AND HOLDING CONDITIONS

EPA Science Inventory

The use of coliform plate count data to assess stream sanitary and ecological condition is limited by the need to store samples at 4oC and analyze them within a 24-hour period. We are testing LH-PCR as an alternative tool to assess the bacterial load of streams, offering a cost ...

Association between FokI, ApaI and TaqI RFLP polymorphisms in VDR gene and Hashimoto's thyroiditis: preliminary data from female patients in Serbia.

PubMed

Djurovic, J; Stojkovic, O; Ozdemir, O; Silan, F; Akurut, C; Todorovic, J; Savic, K; Stamenkovic, G

2015-06-01

Hashimoto's thyroiditis (HT) is the most prevalent autoimmune thyroid disorder caused by an interaction between genes and environmental triggers. Intrathyroid lymphocytic infiltration may lead to progressive destruction of thyroid tissue and consequently to hypothyroidism. Many studies in different populations have shown association between vitamin D receptor (VDR) gene polymorphisms and various autoimmune diseases, including HT. The study included 44 female patients (mean age ± standard deviation 38 ± 5.4) with Hashimoto's thyroiditis and 32 healthy age-matched, sex-matched and geographically matched controls without personal history of autoimmune and endocrine diseases. Genomic DNA was isolated from peripheral blood-EDTA, and the target VDR gene was genotyped by PCR-RFLP technique after VDR-FokI (rs2228570), VDR-ApaI (rs7975232) and VDR-TaqI (rs731236) restriction enzymes digestion. We used spss 20.0 integrated software for data analysis and found a significant difference in the genotype distribution of VDR-FokI polymorphism between patients with HT and controls (P = 0.009). For ApaI and TaqI, we observed a higher frequency of variant allele in patients with HT, which was not significantly different compared to control women (P > 0.05). The current first and preliminary results identified the association between VDR-FokI gene polymorphism and Hashimoto's thyroiditis in Serbian population. Results need to be supported by further investigations that define haplotype patterns for VDR gene polymorphisms in a larger group of HT patients of both sexes. © 2015 John Wiley & Sons Ltd.

Effects of dopamine D2/D3 receptor antagonism on human planning and spatial working memory.

PubMed

Naef, M; Müller, U; Linssen, A; Clark, L; Robbins, T W; Eisenegger, C

2017-04-25

Psychopharmacological studies in humans suggest important roles for dopamine (DA) D2 receptors in human executive functions, such as cognitive planning and spatial working memory (SWM). However, studies that investigate an impairment of such functions using the selective DA D2/3 receptor antagonist sulpiride have yielded inconsistent results, perhaps because relatively low doses were used. We believe we report for the first time, the effects of a higher (800 mg p.o.) single dose of sulpiride as well as of genetic variation in the DA receptor D2 gene (DA receptor D2 Taq1A polymorphism), on planning and working memory. With 78 healthy male volunteers, we apply a between-groups, placebo-controlled design. We measure outcomes in the difficult versions of the Cambridge Neuropsychological Test Automated Battery One-Touch Stockings of Cambridge and the self-ordered SWM task. Volunteers in the sulpiride group showed significant impairments in planning accuracy and, for the more difficult problems, in SWM. Sulpiride administration speeded response latencies in the planning task on the most difficult problems. Volunteers with at least one copy of the minor allele (A1+) of the DA receptor D2 Taq1A polymorphism showed better SWM capacity, regardless of whether they received sulpiride or placebo. There were no effects on blood pressure, heart rate or subjective sedation. In sum, a higher single dose of sulpiride impairs SWM and executive planning functions, in a manner independent of the DA receptor D2 Taq1A polymorphism.

Analysis of vitamin D receptor gene polymorphisms in patients with chronic periodontitis.

PubMed

Gunes, Sezgin; Sumer, A Pinar; Keles, Gonca Cayir; Kara, Nurten; Koprulu, Hulya; Bagci, Hasan; Bek, Yuksel

2008-01-01

Genetic polymorphisms in the vitamin D receptor (VDR) gene are related to bone mineral density, bone turnover, and diseases with bone loss. Alveolar bone loss is a key feature in periodontitis. The aim of this study was to determine whether severe generalized chronic periodontitis (CP) in a Turkish population was associated with polymorphisms in the VDR gene. Samples of venous blood and DNA were obtained from 72 patients with severe generalized chronic periodontitis and 102 healthy controls. The polymorphic regions were amplified using PCR followed by digestion with restriction enzymes BsmI A/G(rs1544410), ApaI G/T(rs11168271), TaqI T/C(rs731236), and analyzed electrophoretically. Genotype and allele frequencies were calculated. There were no statistically significant differences in the frequencies of VDR BsmI, ApaI, TaqI genotypes between the CP patients and healthy controls. The GTT haplotype, constructed from the three adjacent restriction fragment length polymorphisms was found to be over-represented among CP cases. This corresponded an OR of 2.4 (95% confidence interval, 1.12-5.18) for heterozygous carriers and 2.27 (95% confidence interval, 0.95-5.4) for homozygous carrier of the risk haplotype. The present findings indicated that BsmI, ApaI, TaqI polymorphisms of the VDR gene were not associated with the severe generalized CP in the studied Turkish patients. Moreover, the VDR genotypes based on haplotype analysis may be associated with chronic periodontitis. In the future, diagnostic periodontal risk assessments like polymorphisms may be useful in detection of individuals susceptible for periodontitis.

A TaqMan real-time PCR method based on alternative oxidase genes for detection of plant species in animal feed samples.

PubMed

Campos, Maria Doroteia; Valadas, Vera; Campos, Catarina; Morello, Laura; Braglia, Luca; Breviario, Diego; Cardoso, Hélia G

2018-01-01

Traceability of processed food and feed products has been gaining importance due to the impact that those products can have on human/animal health and to the associated economic and legal concerns, often related to adulterations and frauds as it can be the case for meat and milk. Despite mandatory traceability requirements for the analysis of feed composition, few reliable and accurate methods are presently available to enforce the legislative frame and allow the authentication of animal feeds. In this study, nine sensitive and species-specific real-time PCR TaqMan MGB assays are described for plant species detection in animal feed samples. The method is based on selective real-time qPCR (RT-qPCR) amplification of target genes belonging to the alternative oxidase (AOX) gene family. The plant species selected for detection in feed samples were wheat, maize, barley, soybean, rice and sunflower as common components of feeds, and cotton, flax and peanut as possible undesirable contaminants. The obtained results were compared with end-point PCR methodology. The applicability of the AOX TaqMan assays was evaluated through the screening of commercial feed samples, and by the analysis of plant mixtures with known composition. The RT-qPCR methodology allowed the detection of the most abundant species in feeds but also the identification of contaminant species present in lower amounts, down to 1% w/w. AOX-based methodology provides a suitable molecular marker approach to ascertain plant species composition of animal feed samples, thus supporting feed control and enforcement of the feed sector and animal production.

Optimized knock-in of point mutations in zebrafish using CRISPR/Cas9.

PubMed

Prykhozhij, Sergey V; Fuller, Charlotte; Steele, Shelby L; Veinotte, Chansey J; Razaghi, Babak; Robitaille, Johane M; McMaster, Christopher R; Shlien, Adam; Malkin, David; Berman, Jason N

2018-06-14

We have optimized point mutation knock-ins into zebrafish genomic sites using clustered regularly interspaced palindromic repeats (CRISPR)/Cas9 reagents and single-stranded oligodeoxynucleotides. The efficiency of knock-ins was assessed by a novel application of allele-specific polymerase chain reaction and confirmed by high-throughput sequencing. Anti-sense asymmetric oligo design was found to be the most successful optimization strategy. However, cut site proximity to the mutation and phosphorothioate oligo modifications also greatly improved knock-in efficiency. A previously unrecognized risk of off-target trans knock-ins was identified that we obviated through the development of a workflow for correct knock-in detection. Together these strategies greatly facilitate the study of human genetic diseases in zebrafish, with additional applicability to enhance CRISPR-based approaches in other animal model systems.

Juvenile idiopathic arthritis patients and their skeletal status: possible role of vitamin D receptor gene polymorphism.

PubMed

Kostik, M M; Smirnov, A M; Demin, G S; Scheplyagina, L A; Larionova, V I

2014-01-01

We evaluated bone mineralization and metabolism changes related to vitamin D receptor (VDR) polymorphic genotypes in children with juvenile idiopathic arthritis. One hundred and ninety eight children (82 boys and 116 girls) were included in our study. Bone mineral density (BMD) was measured by lumbar spine DXA. Osteocalcin, CTX, parathyroid hormone, total and ionized calcium, inorganic phosphate, total alkaline phosphatase activity was utilized for assessment of bone metabolism. Molecular testing: TaqI (rs731236) and Cdx2 (rs11568820) polymorphisms of VDR were detected by RFLP. No differences in TaqI and Cdx2 haplotypes, genotypes and alleles distribution related with normal and low BMD (Zscore <-2SD) were found. Children with low linear growth (<10th percentile) had more allele T-contained genotypes of TagI VDR (p = 0.037), compare with medium or high linear growth children. Children with high linear growth (>90th percentile) had the highest frequency of allele A-contained genotypes (GA+AA) of Cdx2 VDR (p = 0.009). Girls with TT TaqI VDR, who never been treated by glucocorticoides had lower BMD-Zscore than C allele carriers (TT = -0.94SD [IQR: -2.1;-0.5], TC+CC = -0.62SD [IQR: -1.26;0.39], p = 0.03). Girls with Tanner I with TT had higher total and ionized Ca level than carriers of C allele (Ca: TT = 2.43 ± 0.15 mmol/l, TC+CC = 2.28 ± 0.2 mmol/l, p = 0.024; Ca(2+): TT = 1.15 ± 0.08 mmol/l, TC+CC = 1.06 ± 0.13 mmol/l, p = 0.026). Presence of TT genotype negatively correlated with BMD-Zscore (r = -0.28, p = 0.04), and positively with frequency of LBMD (r = 0.3, p = 0.037). Boy with GG Cdx2 genotype had lower total Ca (GG = 2.3 ± 0.17 mmol/l, GA+AA = 2.43 ± 0.17 mmol/l, p = 0.004) compare with carriers of A allele. Pubertal boys (Tanner IV-V) with GG had higher CTX (GG = 1.75 ± 0.11 ng/ml, GA+AA = 1.06 ± 0.07 ng/ml, p = 0.04. TT genotype of TaqI and GG genotype of Cdx2 VDR is a negative factor impact bone mineralization metabolism and linear growth.

Precise Maps of RNA Polymerase Reveal How Promoters Direct Initiation and Pausing

PubMed Central

Kwak, Hojoong; Fuda, Nicholas J.; Core, Leighton J.; Lis, John T.

2014-01-01

Transcription regulation occurs frequently through promoter-associated pausing of RNA polymerase II (Pol II). We developed a Precision nuclear Run-On and sequencing assay (PRO-seq) to map the genome-wide distribution of transcriptionally-engaged Pol II at base-pair resolution. Pol II accumulates immediately downstream of promoters, at intron-exon junctions that are efficiently used for splicing, and over 3' poly-adenylation sites. Focused analyses of promoters reveal that pausing is not fixed relative to initiation sites nor is it specified directly by the position of a particular core promoter element or the first nucleosome. Core promoter elements function beyond initiation, and when optimally positioned they act collectively to dictate the position and strength of pausing. We test this ‘Complex Interaction’ model with insertional mutagenesis of the Drosophila Hsp70 core promoter. PMID:23430654

Solution Structures of 2 : 1 And 1 : 1 DNA Polymerase - DNA Complexes Probed By Ultracentrifugation And Small-Angle X-Ray Scattering

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tang, K.H.; /Ohio State U.; Niebuhr, M.

2009-04-30

We report small-angle X-ray scattering (SAXS) and sedimentation velocity (SV) studies on the enzyme-DNA complexes of rat DNA polymerase {beta} (Pol {beta}) and African swine fever virus DNA polymerase X (ASFV Pol X) with one-nucleotide gapped DNA. The results indicated formation of a 2 : 1 Pol {beta}-DNA complex, whereas only 1 : 1 Pol X-DNA complex was observed. Three-dimensional structural models for the 2 : 1 Pol {beta}-DNA and 1 : 1 Pol X-DNA complexes were generated from the SAXS experimental data to correlate with the functions of the DNA polymerases. The former indicates interactions of the 8 kDamore » 5{prime}-dRP lyase domain of the second Pol {beta} molecule with the active site of the 1 : 1 Pol {beta}-DNA complex, while the latter demonstrates how ASFV Pol X binds DNA in the absence of DNA-binding motif(s). As ASFV Pol X has no 5{prime}-dRP lyase domain, it is reasonable not to form a 2 : 1 complex. Based on the enhanced activities of the 2 : 1 complex and the observation that the 8 kDa domain is not in an optimal configuration for the 5{prime}-dRP lyase reaction in the crystal structures of the closed ternary enzyme-DNA-dNTP complexes, we propose that the asymmetric 2 : 1 Pol {beta}-DNA complex enhances the function of Pol {beta}.« less

KRAS detection in colonic tumors by DNA extraction from FTA paper: the molecular touch-prep.

PubMed

Petras, Melissa L; Lefferts, Joel A; Ward, Brian P; Suriawinata, Arief A; Tsongalis, Gregory J

2011-12-01

DNA isolated from formalin-fixed paraffin-embedded (FFPE) tissue is usually more degraded and contains more polymerase chain reaction (PCR) inhibitors than DNA isolated from nonfixed tissue. In addition, the tumor size and cellular heterogeneity found in tissue sections can often impact testing for molecular biomarkers. As a potential remedy to this situation, we evaluated the use of Whatman FTA paper cards for collection of colorectal tumor samples before tissue fixation and for isolation of DNA for use in a real-time PCR-based KRAS mutation assay. Eleven colon tumor samples were collected by making a cut into the fresh tumor and applying the Whatman FTA paper to the cut surface. Matched FFPE tissue blocks from these tumors were also collected for comparison. KRAS mutation analysis was carried out using the Applied Biosystems 7500 Fast Real-time PCR System using 7 independent custom TaqMan PCR assays. Of the 11 colon tumors sampled, 6 were positive for KRAS mutations in both the Whatman FTA paper preparations and corresponding FFPE samples. Whatman FTA paper cards for collection of colorectal tumor samples before tissue fixation and for isolation of DNA have many advantages including ease of use, intrinsic antimicrobial properties, long storage potential (stability of DNA over time), and a faster turnaround time for results. Extracted DNA should be suitable for most molecular diagnostic assays that use PCR techniques. This novel means of DNA preservation from surgical specimens would benefit from additional study and validation as a dependable and practical technique to preserve specimens for molecular testing.

MYC-induced nuclear antigen (MINA) and preeclampsia.

PubMed

Martinez-Fierro, Margarita L; Reyes-Oliva, Edwin A; Cabral-Pacheco, Griselda A; Garza-Veloz, Idalia; Aceves-Medina, Maria C; Luevano, Martha; Barbosa-Cisneros, Olga Y; Galvan-Valencia, Marisol; Yahuaca-Mendoza, Patricia; Delgado-Enciso, Ivan; Zamudio-Osuna, Michelle; Rodriguez-Sanchez, Iram P; Vazquez-Castro, Rosbel; Guerrero-Saucedo, Marycruz

2016-05-01

Inadequate trophoblast invasion and the subsequent inflammatory response have been implicated in preeclampsia (PE) pathogenesis. Because MYC-induced nuclear antigen (MINA) gene expression is involved in cell proliferation and differentiation, inflammatory response modulation, and the unpaired regulation of which is associated with human diseases, we sought to investigate the connection between MINA and PE. The aim of this study was to evaluate the possible relationship between the MINA rs4857304 variant and susceptibility to PE development as well as to estimate placental MINA gene expression and its association with PE. About 242 pregnant women (126 PE cases and 116 controls) were included. MINA genotyping and gene expression were evaluated by quantitative real-time polymerase chain reaction using TaqMan probes. The G/G genotype of the MINA rs4857304 variant was associated with severe PE (p = 0.027, OR = 1.8, 95% CI = 1.8-3.2). Carriers of one G allele of the MINA rs4857304 variant exhibited a 1.7-fold increased risk of severe PE (p = 0.029, 95% CI = 1.1-3.0). MINA was underexpressed in preeclamptic placentas and MINA expression differed between the mild and severe PE groups. Differences in the expression levels of MINA were found among women with the T/T genotype of the rs4857304 polymorphism and carriers of at least one G allele (p = 0.024). PE and its severity are associated with the underexpression of placental MINA, and the G/G genotype of the MINA rs4857304 variant may modify the risk of severe PE among the PE cases evaluated.

Novel rapid genotyping assays for neuronal ceroid lipofuscinosis in Border Collie dogs and high frequency of the mutant allele in Japan.

PubMed

Mizukami, Keijiro; Chang, Hye-Sook; Yabuki, Akira; Kawamichi, Takuji; Kawahara, Natsuko; Hayashi, Daisuke; Hossain, Mohammad A; Rahman, Mohammad M; Uddin, Mohammad M; Yamato, Osamu

2011-11-01

Neuronal ceroid lipofuscinosis (NCL) constitutes a group of recessively inherited lysosomal storage diseases that primarily affect neuronal cells. Such diseases share certain clinical and pathologic features in human beings and animals. Neuronal ceroid lipofuscinosis in Border Collie dogs was first detected in Australia in the 1980s, and the pathogenic mutation was shown to be a nonsense mutation (c.619C>T) in exon 4 in canine CLN5 gene. In the present study, novel rapid genotyping assays including polymerase chain reaction (PCR)-restriction fragment length polymorphism, PCR primer-induced restriction analysis, mutagenically separated PCR, and real-time PCR with TaqMan minor groove binder probes, were developed. The utility of microchip electrophoresis was also evaluated. Furthermore, a genotyping survey was carried out in a population of Border Collies in Japan using these assays to determine the current allele frequency in Japan, providing information to control and prevent this disease in the next stage. All assays developed in the current study are available to discriminate these genotypes, and microchip electrophoresis showed a timesaving advantage over agarose gel electrophoresis. Of all assays, real-time PCR was the most suitable for large-scale examination because of its high throughput. The genotyping survey demonstrated that the carrier frequency was 8.1%. This finding suggested that the mutant allele frequency of NCL in Border Collies is high enough in Japan that measures to control and prevent the disease would be warranted. The genotyping assays developed in the present study could contribute to the prevention of NCL in Border Collies.

Potassium channel KCNH2 K897T polymorphism and cardiac repolarization during exercise test: The Finnish Cardiovascular Study.

PubMed

Koskela, J; Laiho, J; KäHönen, M; Rontu, R; Lehtinen, R; Viik, J; Niemi, M; Niemelä, K; Kööbi, T; Turjanmaa, V; Pörsti, I; Lehtimäki, T; Nieminen, T

2008-01-01

Cardiac repolarization is regulated, in part, by the KCNH2 gene, which encodes a rapidly activating component of the delayed rectifier potassium channel. The gene expresses a functional single nucleotide polymorphism, K897T, which changes the biophysical properties of the channel. The objective of this study was to evaluate whether this polymorphism influences two indices of repolarization--the QT interval and T-wave alternans (TWA)--during different phases of a physical exercise test. The cohort consisted of 1,975 patients undergoing an exercise test during which on-line electrocardiographic data were registered. Information on coronary risk factors and medication was recorded. The 2690A>C nucleotide variation in the KCNH2 gene corresponding to the K897T amino acid change was analysed after polymerase chain reaction with allele-specific TaqMan probes. Among all subjects, the QTc intervals did not differ between the three genotype groups (p> or =0.31, RANOVA). Women with the CC genotype tended to have longer QT intervals during the exercise test, but the difference was statistically significant only at rest (p = 0.011, ANOVA). This difference was also detected when the analysis was adjusted for several factors influencing the QT interval. No statistically significant effects of the K897T polymorphism on TWA were observed among all subjects (p = 0.16, RANOVA), nor in men and women separately. The K897T polymorphism of the KCNH2 gene may not be a major genetic determinant for the TWA, but the influence of the CC genotype on QT interval deserves further research among women.

Prevalence of Coxiella burnetii in Hungary: screening of dairy cows, sheep, commercial milk samples, and ticks.

PubMed

Gyuranecz, Miklós; Dénes, Béla; Hornok, Sándor; Kovács, Péter; Horváth, Gábor; Jurkovich, Viktor; Varga, Tamás; Hajtós, István; Szabó, Réka; Magyar, Tibor; Vass, Nóra; Hofmann-Lehmann, Regina; Erdélyi, Károly; Bhide, Mangesh; Dán, Ádám

2012-08-01

Q fever is an important zoonotic disease caused by Coxiella burnetii. There are few reliable data about C. burnetii infection available. The aim of this study was to assess the importance and potential infectious sources of Q fever in Hungary. A total of 215 milk samples (10 individual samples from each herd and 1 bulk tank milk sample from each cattle herd), and 400 serum samples (20 from each herd) were tested from 15 dairy cattle herds and 5 sheep flocks located in different parts of Hungary. The study found 19.3% (58/300) and 38.0% (57/150) seropositivity in cattle, and 0% (0/100) and 6.0% (3/50) seropositivity in sheep, by complement fixation test (CFT) and enzyme-linked immunosorbent assay (ELISA), respectively. C. burnetii DNA was detected by IS1111 element-based TaqMan real-time polymerase chain reaction (PCR) in 8.7% (13/150) of individual dairy cow milk samples, 4.0% (2/50) of individual sheep milk samples, and 66.7% (10/15) of dairy bulk tank milk samples. Samples taken from nine different commercially-available pasteurized cow milk products from different Hungarian producers were also tested for the presence of C. burnetii DNA, and eight of these samples were found to be positive (88.9%). The real-time PCR examination of 5402 ixodid ticks collected from different parts of the country yielded negative results. Knowledge of the true prevalence of Q fever is crucial for policymakers involved in evidence-based decision making.

The ZC3HC1 rs11556924 polymorphism is associated with increased carotid intima-media thickness in patients with rheumatoid arthritis

PubMed Central

2013-01-01

Introduction Rheumatoid arthritis (RA) is a complex polygenic disease associated with chronic inflammation, accelerated atherosclerosis and increased cardiovascular (CV) mortality. A recent meta-analysis has described the ZC3HC1 rs11556924 polymorphism as one of the most important signals associated with coronary artery disease (CAD) in non-rheumatic Caucasian individuals. In this study we evaluated the potential association of this gene polymorphism with subclinical atherosclerosis assessed by the evaluation of carotid intima-media thickness (cIMT) in RA patients. Methods This study included 502 RA patients from Northern Spain. The ZC3HC1 rs11556924 polymorphism was genotyped with TaqMan single-nucleotide polymorphism (SNP) genotyping assays (C__31283062_10) in a 7900HT real-time polymerase chain reaction (PCR) system. cIMT was also assessed in these patients by carotid ultrasonography (US) technology. Results RA patients carrying the TT genotype had significantly higher cIMT values than those homozygous for the CC genotype (mean ± standard deviation (SD): 0.76 ± 0.18 mm and mean ± SD: 0.71 ± 0.16 mm respectively; P = 0.03) even after adjusting the results for sex, age at the time of US study, follow-up time and traditional CV risk factors (P = 0.04) evidencing that the effect conferred by ZC3HC1 rs11556924 polymorphism is independent of the traditional CV risk factors. Conclusion Our results indicate that ZC3HC1 rs11556924 polymorphism is associated with subclinical atherosclerosis in RA. PMID:24286297

Development and Validation of Monoclonal Antibody-Based Antigen Capture ELISA for Detection of Group A Porcine Rotavirus.

PubMed

Memon, Atta Muhammad; Bhuyan, Anjuman Ara; Chen, Fangzhou; Guo, Xiaozhen; Menghwar, Harish; Zhu, Yinxing; Ku, Xugang; Chen, Shuhua; Li, Zhonghua; He, Qigai

2017-05-01

Porcine rotavirus-A (PoRVA) is one of the common causes of mild to severe dehydrating diarrhea, leading to losses in weaning and postweaning piglets. A rapid, highly specific, and sensitive antigen-capture enzyme-linked immunosorbent assay (AC-ELISA) was developed for detection of PoRVA, by using VP6 (a highly conserved and antigenic protein of group-A rotavirus)-directed rabbit polyclonal antibodies (capture antibody) and murine monoclonal antibodies (detector antibody). The detection limit of AC-ELISA was found to be equal to that of conventional reverse transcription-polymerase chain reaction (RT-PCR; about 10 2.5 TCID 50 /mL). For validation of the in-house AC-ELISA, 295 porcine fecal/diarrhea samples, collected from different provinces of China, were evaluated and compared with conventional RT-PCR and TaqMan RT-quantitative PCR (qPCR). The sensitivity and specificity of this in-house AC-ELISA relative to RT-qPCR were found to be 91.67% and 100%, respectively, with the strong agreement (kappa = 0.972) between these two techniques. Total detection rate with AC-ELISA, conventional RT-PCR, and RT-qPCR were found to be 11.2%, 11.5%, and 12.2%, respectively, without any statistical significant difference. Moreover, AC-ELISA failed to detect any cross-reactivity with porcine epidemic diarrhea virus, transmissible gastroenteritis virus, pseudorabies virus, and porcine circovirus-2. These results suggested that our developed method was rapid, highly specific, and sensitive, which may help in large-scale surveillance, timely detection, and preventive control of rotavirus infection in porcine farms.

Epistatic interactions between Fc (GM) and FcγR genes and the host control of human immunodeficiency virus replication.

PubMed

Deepe, Raymond N; Kistner-Griffin, Emily; Martin, Jeffrey N; Deeks, Steven G; Pandey, Janardan P

2012-03-01

Host genetic factors are thought to contribute to the interindividual differences in the control of human immunodeficiency virus (HIV) replication. The aim of the present investigation was to determine whether genes encoding GM and KM allotypes-genetic markers of immunoglobulin γ and κ chains, respectively-and those encoding Fcγ receptor (FcγR) IIa and IIIa are associated with the host control of HIV replication. A case-control design was employed among HIV-infected subjects, with a group that spontaneously controlled HIV replication ("controllers") as cases (n = 73) and those who did not control replication as controls (n = 100). Genotyping was performed by polymerase chain reaction-restriction fragment length polymorphism, direct DNA sequencing, and TaqMan genotyping assays. In Caucasian Americans, certain combinations of FcγR and GM genotypes were differentially distributed between controllers and noncontrollers. Among the noncarriers of the FcγRIIa arginine allele, GM21 noncarriers had over 7-fold greater odds of being controllers than the carriers of this allele (odds ratio [OR] = 7.47). These GM determinants also interacted with FcγRIIIa alleles. Among the carriers of the FcγRIIIa valine allele, GM21 noncarriers had over 3-fold greater odds of being controllers than the carriers of this allele (OR = 3.26). These results demonstrate epistatic interactions of genes on chromosomes 14 (GM) and 1 (FcγR) in influencing the control of HIV replication. Copyright © 2012 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.

Survivin expression in canine spontaneous cutaneous and subcutaneous tumors and its prognostic importance.

PubMed

Kavya, N; Rao, S; Sathyanarayana, M L; Narayanaswamy, H D; Byregowda, S M; Ranganath, L; Kamaran, A; Purushotham, K M; Kishore, T K

2017-10-01

The present study was carried out to know the expression level of survivin, an inhibitor of apoptosis protein with an objective to determine its prognostic importance in cutaneous and subcutaneous tissue tumors of dogs. Forty cases of canine cutaneous and subcutaneous tissue tumors on histopathological examination revealed various round cell, epithelial, and mesenchymal cell tumors. Survivin gene expression was detected in all tumors tested by TaqMan real-time polymerase chain reaction assay by comparative cycle threshold method. The mean survivin gene expression value of benign tumors was 0.94±0.63 folds and that of malignant tumors was 18.87±5.30 folds. Postsurgical follow up of 30 malignant tumor cases revealed death in 8, recurrence in 7, and neoplastic free alive status in 15 dogs with mean survivin fold difference values of 48.49±12.39, 14.63±6.37, and 5.034±2.27, respectively. The mean survivin gene expression value was significantly higher in malignant (30 cases, 18.87±5.30) compared to benign tumors (10 cases, 0.94±0.63), and it varied between various postsurgical follow-up groups (p<0.05). Survival analysis, using survivin gene expression median cutoff value of 3.74 in 30 malignant tumors, was performed to predict probable survival period in malignant cutaneous and subcutaneous tumors of dogs. Results of the present study indicated that the expression of survivin in canine cutaneous and subcutaneous tumors has prognostic value, and survivin expression greater than median cutoff value of 3.74 has a poor prognosis.

Chronic deficit in the expression of voltage-gated potassium channel Kv3.4 subunit in the hippocampus of pilocarpine-treated epileptic rats

PubMed Central

Pacheco Otalora, Luis F.; Skinner, Frank; Oliveira, Mauro S.; Dotson, Bianca Farrel; Arshadmansab, Massoud F.; Pandari, Tarun; Garcia, Ileana; Robles, Leslie; Rosas, Gerardo; Mello, Carlos F.; Ermolinsky, Boris S.; Garrido-Sanabria, Emilio R.

2010-01-01

Voltage gated K+ channels (Kv) are a highly diverse group of channels critical in determining neuronal excitability. Deficits of Kv channel subunit expression and function have been implicated in the pathogenesis of epilepsy. In this study, we investigate whether the expression of the specific subunit Kv3.4 is affected during epileptogenesis following pilocarpine-induced status epilepticus. For this purpose, we used immunohistochemistry, Western blotting assays and comparative analysis of gene expression using TaqMan-based probes and delta-delta cycle threshold (Δ ΔCT) method of quantitative real-time polymerase chain reaction (qPCR) technique in samples obtained from age-matched control and epileptic rats. A marked down-regulation of Kv3.4 immunoreactivity was detected in the stratum lucidum and hilus of dentate gyrus in areas corresponding to the mossy fiber system of chronically epileptic rats. Correspondingly, a 20% reduction of Kv3.4 protein levels was detected in the hippocampus of chronic epileptic rats. Real-time quantitative PCR analysis of gene expression revealed that a significant 33% reduction of transcripts for Kv3.4 (gene Kcnc4) occurred after 1 month of pilocarpine-induced status epilepticus and persisted during the chronic phase of the model. These data indicate a reduced expression of Kv3.4 channels at protein and transcript levels in the epileptic hippocampus. Down-regulation of Kv3.4 in mossy fibers may contribute to enhanced presynaptic excitability leading to recurrent seizures in the pilocarpine model of temporal lobe epilepsy. PMID:20971086

West Nile virus infection rates and avian serology in east-central Illinois.

PubMed

Lampman, Richard L; Krasavin, Nina M; Ward, Mike P; Beveroth, Tara A; Lankau, Emily W; Alto, Barry W; Muturi, Ephantus; Novak, Robert J

2013-06-01

Understanding the geographic role of different species of mosquito vectors and vertebrate hosts in West Nile virus (WNV) transmission cycles can facilitate the development and implementation of targeted surveillance and control measures. This study examined the relationship between WNV-antibody rates in birds and mosquito infection rates and bloodfeeding patterns in east-central Illinois. The earliest detection of WNV-RNA by reverse transcription-polymerase chain reaction TaqMan was from Culex restuans; however, amplification typically coincided with an increase in abundance of Cx. pipiens. Trap type influenced annual estimates of infection rates in Culex species, as well as estimation of blood meal source. Bird species with the highest WNV-antibody rates (i.e., Mourning Doves [Zenaida macroura], Northern Cardinals [Cardinalis cardinalis], American Robins [Turdus migratorius], and House Sparrows [Passer domesticus]) were also the common species found in Culex blood meals. Although antibody rates were not directly proportional to estimated avian abundance, the apparent availability of mammal species did influence proportion of mammal to bird blood meals. Antibody prevalence in the American Robin was lower than expected based on the strong attraction of Culex to American Robins for blood meals. Age-related differences in serology were evident, antibody rates increased in older groups of robins and sparrows, whereas 1st-year hatch and older adults of Mourning Doves and Northern Cardinals had equally high rates of antibody-positive serum samples. The vector and host interactions observed in east-central Illinois (Champaign County), an urban area surrounded by agriculture, are compared to studies in the densely population areas of southern Cook County.

Eight previously unidentified mutations found in the OA1 ocular albinism gene

PubMed Central

Mayeur, Hélène; Roche, Olivier; Vêtu, Christelle; Jaliffa, Carolina; Marchant, Dominique; Dollfus, Hélène; Bonneau, Dominique; Munier, Francis L; Schorderet, Daniel F; Levin, Alex V; Héon, Elise; Sutherland, Joanne; Lacombe, Didier; Said, Edith; Mezer, Eedy; Kaplan, Josseline; Dufier, Jean-Louis; Marsac, Cécile; Menasche, Maurice; Abitbol, Marc

2006-01-01

Background Ocular albinism type 1 (OA1) is an X-linked ocular disorder characterized by a severe reduction in visual acuity, nystagmus, hypopigmentation of the retinal pigmented epithelium, foveal hypoplasia, macromelanosomes in pigmented skin and eye cells, and misrouting of the optical tracts. This disease is primarily caused by mutations in the OA1 gene. Methods The ophthalmologic phenotype of the patients and their family members was characterized. We screened for mutations in the OA1 gene by direct sequencing of the nine PCR-amplified exons, and for genomic deletions by PCR-amplification of large DNA fragments. Results We sequenced the nine exons of the OA1 gene in 72 individuals and found ten different mutations in seven unrelated families and three sporadic cases. The ten mutations include an amino acid substitution and a premature stop codon previously reported by our team, and eight previously unidentified mutations: three amino acid substitutions, a duplication, a deletion, an insertion and two splice-site mutations. The use of a novel Taq polymerase enabled us to amplify large genomic fragments covering the OA1 gene. and to detect very likely six distinct large deletions. Furthermore, we were able to confirm that there was no deletion in twenty one patients where no mutation had been found. Conclusion The identified mutations affect highly conserved amino acids, cause frameshifts or alternative splicing, thus affecting folding of the OA1 G protein coupled receptor, interactions of OA1 with its G protein and/or binding with its ligand. PMID:16646960

Impact of novel histone deacetylase inhibitors, CHAP31 and FR901228 (FK228), on adenovirus-mediated transgene expression.

PubMed

Taura, Kojiro; Yamamoto, Yuzo; Nakajima, Akio; Hata, Koichiro; Uchinami, Hiroshi; Yonezawa, Kei; Hatano, Etsuro; Nishino, Norikazu; Yamaoka, Yoshio

2004-05-01

Histone deacetylase inhibitors (HDIs) are known to enhance adenovirus (Ad)-mediated transgene expression. Recently, novel HDIs, including cyclic hydroxamic-acid-containing peptide 31 (CHAP31) and FR901228 (FK228), have been developed. The effects of these two novel HDIs on Ad-transduced or endogenous gene expression were investigated. Acetylation of core histones and the expression of the coxsackie and adenovirus receptor (CAR) in HDI-treated cells were examined using Western blot and a quantitative reverse transcription polymerase chain reaction (TaqMan RT-PCR), respectively. Their in vivo effect on adenoviral gene expression was investigated in BALB/c mice. Both compounds enhanced and prolonged Ad-mediated beta-galactosidase expression more effectively than did trichostatin A, a classic HDI. The same effect was observed in Ad-transduced heat shock protein 72 (HSP72), but not in hyperthermia-induced endogenous expression of HSP72, suggesting that the effect is specific for transduced gene expression. Hyperacetylation of core histones induced by HDIs was considered responsible for the augmentative effects of gene expression. Intravenous administration of either CHAP31 or FR901228 enhanced beta-galactosidase expression in mice infected with AdLacZ. CHAP31 and FR901228 amplified Ad-mediated transgene expression. The enhancement of transgene expression by HDIs may result in fewer vector doses for necessary gene expression, helping to alleviate disadvantages caused by Ad vectors. This could be a useful tool in overcoming current limitations of gene therapy using adenovirus vectors. Copyright 2004 John Wiley & Sons, Ltd.

Coupling Spore Traps and Quantitative PCR Assays for Detection of the Downy Mildew Pathogens of Spinach (Peronospora effusa) and Beet (P. schachtii)

PubMed Central

Klosterman, Steven J.; Anchieta, Amy; McRoberts, Neil; Koike, Steven T.; Subbarao, Krishna V.; Voglmayr, Hermann; Choi, Young-Joon; Thines, Marco; Martin, Frank N.

2016-01-01

Downy mildew of spinach (Spinacia oleracea), caused by Peronospora effusa, is a production constraint on production worldwide, including in California, where the majority of U.S. spinach is grown. The aim of this study was to develop a real-time quantitative polymerase chain reaction (qPCR) assay for detection of airborne inoculum of P. effusa in California. Among oomycete ribosomal DNA (rDNA) sequences examined for assay development, the highest nucleotide sequence identity was observed between rDNA sequences of P. effusa and P. schachtii, the cause of downy mildew on sugar beet and Swiss chard in the leaf beet group (Beta vulgaris subsp. vulgaris). Single-nucleotide polymorphisms were detected between P. effusa and P. schachtii in the 18S rDNA regions for design of P. effusa- and P. schachtii-specific TaqMan probes and reverse primers. An allele-specific probe and primer amplification method was applied to determine the frequency of both P. effusa and P. schachtii rDNA target sequences in pooled DNA samples, enabling quantification of rDNA of P. effusa from impaction spore trap samples collected from spinach production fields. The rDNA copy numbers of P. effusa were, on average, ≈3,300-fold higher from trap samples collected near an infected field compared with those levels recorded at a site without a nearby spinach field. In combination with disease-conducive weather forecasting, application of the assays may be helpful to time fungicide applications for disease management. PMID:24964150

A REVOLUTION IN MOLD IDENTIFICATION AND ENUMERATION

EPA Science Inventory

More than 100 assay were developed to identify and quantify indoor molds using quantitiative PCR (QPCR) assays. This technology incorporates fluorigenic 5' nuclease (TaqMan�) chemistry directed at the nuclear ribosomal RNA operon internal transcribed spacer regions (ITS1 or ITS2...

Dynamics and control of DNA sequence amplification

DOE Office of Scientific and Technical Information (OSTI.GOV)

Marimuthu, Karthikeyan; Chakrabarti, Raj, E-mail: raj@pmc-group.com, E-mail: rajc@andrew.cmu.edu; Division of Fundamental Research, PMC Advanced Technology, Mount Laurel, New Jersey 08054

2014-10-28

DNA amplification is the process of replication of a specified DNA sequence in vitro through time-dependent manipulation of its external environment. A theoretical framework for determination of the optimal dynamic operating conditions of DNA amplification reactions, for any specified amplification objective, is presented based on first-principles biophysical modeling and control theory. Amplification of DNA is formulated as a problem in control theory with optimal solutions that can differ considerably from strategies typically used in practice. Using the Polymerase Chain Reaction as an example, sequence-dependent biophysical models for DNA amplification are cast as control systems, wherein the dynamics of the reactionmore » are controlled by a manipulated input variable. Using these control systems, we demonstrate that there exists an optimal temperature cycling strategy for geometric amplification of any DNA sequence and formulate optimal control problems that can be used to derive the optimal temperature profile. Strategies for the optimal synthesis of the DNA amplification control trajectory are proposed. Analogous methods can be used to formulate control problems for more advanced amplification objectives corresponding to the design of new types of DNA amplification reactions.« less

Combinatorial approaches to gene recognition.

PubMed

Roytberg, M A; Astakhova, T V; Gelfand, M S

1997-01-01

Recognition of genes via exon assembly approaches leads naturally to the use of dynamic programming. We consider the general graph-theoretical formulation of the exon assembly problem and analyze in detail some specific variants: multicriterial optimization in the case of non-linear gene-scoring functions; context-dependent schemes for scoring exons and related procedures for exon filtering; and highly specific recognition of arbitrary gene segments, oligonucleotide probes and polymerase chain reaction (PCR) primers.

Head and Neck Squamous Cell Carcinomas Do Not Express EGFRvIII

DOE Office of Scientific and Technical Information (OSTI.GOV)

Melchers, Lieuwe J., E-mail: l.j.melchers@umcg.nl; Department of Pathology, University Medical Center Groningen, University of Groningen, Groningen; Clausen, Martijn J.A.M.

2014-10-01

Purpose: To assess the prevalence of EGFRvIII, a specific variant of EGFR (epidermal growth factor receptor), in 3 well-defined cohorts of head and neck squamous cell carcinoma (HNSCC). Methods and Materials: Immunohistochemistry for the specific detection of EGFRvIII using the L8A4 antibody was optimized on formalin-fixed, paraffin-embedded tissue using glioblastoma tissue. It was compared with EGFR and EGFRvIII RNA expression using a specific reverse transcription–polymerase chain reaction also optimized for formalin-fixed, paraffin-embedded tissue. Tissue microarrays including 531 HNSCCs of various stages with complete clinicopathologic and follow-up data were tested for the presence of EGFRvIII. Results: None of the 531 casesmore » showed EGFRvIII protein expression. Using an immunohistochemistry protocol reported by others revealed cytoplasmic staining in 8% of cases. Reverse transcription–polymerase chain reaction for the EGFRvIII transcript of the 28 highest cytoplasmic staining cases, as well as 69 negative cases, did not show expression in any of the tested cases, suggesting aspecific staining by a nonoptimal protocol. Conclusions: The EGFRvIII mutation is not present in HNSCC. Therefore, EGFRvIII does not influence treatment response in HNSCC and is not a usable clinical prognostic marker.« less

Enhanced solid-phase recombinase polymerase amplification and electrochemical detection.

PubMed

Del Río, Jonathan Sabaté; Lobato, Ivan Magriñà; Mayboroda, Olena; Katakis, Ioanis; O'Sullivan, Ciara K

2017-05-01

Recombinase polymerase amplification (RPA) is an elegant method for the rapid, isothermal amplification of nucleic acids. Here, we elucidate the optimal surface chemistry for rapid and efficient solid-phase RPA, which was fine-tuned in order to obtain a maximum signal-to-noise ratio, defining the optimal DNA probe density, probe-to-lateral spacer ratio (1:0, 1:1, 1:10 and 1:100) and length of a vertical spacer of the probe as well as investigating the effect of different types of lateral spacers. The use of different labelling strategies was also examined in order to reduce the number of steps required for the analysis, using biotin or horseradish peroxidase-labelled reverse primers. Optimisation of the amplification temperature used and the use of surface blocking agents were also pursued. The combination of these changes facilitated a significantly more rapid amplification and detection protocol, with a lowered limit of detection (LOD) of 1 · 10 -15 M. The optimised protocol was applied to the detection of Francisella tularensis in real samples from hares and a clear correlation with PCR and qPCR results observed and the solid-phase RPA demonstrated to be capable of detecting 500 fM target DNA in real samples. Graphical abstract Relative size of thiolated lateral spacers tested versus the primer and the uvsx recombinase protein.

Generation of a Tet-On Expression System to Study Transactivation Ability of Tax-2.

PubMed

Bignami, Fabio; Sozzi, Riccardo Alessio; Pilotti, Elisabetta

2017-01-01

HTLV Tax proteins (Tax-1 and Tax-2) are known to be able to transactivate several host cellular genes involved in complex molecular pathways. Here, we describe a stable and regulated high-level expression model based on Tet-On system, to study the capacity of Tax-2 to transactivate host genes. In particular, the Jurkat Tet-On cell line suitable for evaluating the ability of Tax-2 to stimulate transactivation of a specific host gene, CCL3L1 (C-C motif chemokine ligand 3 like 1 gene), was selected. Then, a plasmid expressing tax-2 gene under control of a tetracycline-response element was constructed. To avoid the production of a fusion protein between the report gene and the inserted gene, a bidirectional plasmid was designed. Maximum expression and fast response time were achieved by using nucleofection technology as transfection method. After developing an optimized protocol for efficiently transferring tax-2 gene in Jurkat Tet-On cellular model and exposing transfected cells to Dox (doxycycline, a tetracycline derivate), a kinetics of tax-2 expression through TaqMan Real-time PCR assay was determined.

No association between the TaqI A1 RFLP of the D2 receptor gene and alcoholism in a Mexican population

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cruz-Fuentes, C.; Carmarena, B.; Eroza, V.

1994-09-01

The suggested association of the A1 allele of the D2 dopamine receptor (DRD2) human gene with alcoholism was studied by comparing the DRD2/TaqI genotypes of 36 healthy controls and 38 individuals who met the DSM-III-R diagnostic criteria for alcohol dependence. All subjects were unrelated, with parents and grandparents of Mexican origin. The alcoholics in our sample suffered one of the following conditions: delirium tremens (16.6%), alcohol hallucinosis (56.6%) or uncomplicated alcohol withdrawal (26.4%). Eight-eight percent of the controls carried the A1 allele. The frequency of the DRD2 A1 allele in the Mexican urban sample (pA1 = 0.61) was 2 tomore » 3-fold higher than reported in Caucasian populations from the USA and Europe, but similar to the allele frequencies found in defined Amerindian populations. There were not significant differences in the prevalence or allele frequency between alcoholics (pA1 = 0.64) and controls, regardless if the alcoholics were subtyped accordingly to severity, age of onset or positive family history. Alcoholics had higher scores than controls in the neuroticism (N) and psychoticism (P) subscales on the Eysenck personality test: alcoholics P = 6.2 {+-} 2.9, N = 16.0 {+-} 4.2 vs. controls P = 2.5 {+-} 2.3, N = 5.7 {+-} 5.1; p<0.001 and p<0.001, respectively. However, no relationship between personality traits and genotypes was found. Our results do not support a consistent association between the TaqI A1 RFLP for the DRD2 gene and alcoholism.« less

Motivational salience and genetic variability of dopamine D2 receptor expression interact in the modulation of interference processing

PubMed Central

Richter, Anni; Richter, Sylvia; Barman, Adriana; Soch, Joram; Klein, Marieke; Assmann, Anne; Libeau, Catherine; Behnisch, Gusalija; Wüstenberg, Torsten; Seidenbecher, Constanze I.; Schott, Björn H.

2013-01-01

Dopamine has been implicated in the fine-tuning of complex cognitive and motor function and also in the anticipation of future rewards. This dual function of dopamine suggests that dopamine might be involved in the generation of active motivated behavior. The DRD2 TaqIA polymorphism of the dopamine D2 receptor gene (rs1800497) has previously been suggested to affect striatal function with carriers of the less common A1 allele exhibiting reduced striatal D2 receptor density and increased risk for addiction. Here we aimed to investigate the influences of DRD2 TaqIA genotype on the modulation of interference processing by reward and punishment. Forty-six young, healthy volunteers participated in a behavioral experiment, and 32 underwent functional magnetic resonance imaging (fMRI). Participants performed a flanker task with a motivation manipulation (monetary reward, monetary loss, neither, or both). Reaction times (RTs) were shorter in motivated flanker trials, irrespective of congruency. In the fMRI experiment motivation was associated with reduced prefrontal activation during incongruent vs. congruent flanker trials, possibly reflecting increased processing efficiency. DRD2 TaqIA genotype did not affect overall RTs, but interacted with motivation on the congruency-related RT differences, with A1 carriers showing smaller interference effects to reward alone and A2 homozygotes exhibiting a specific interference reduction during combined reward (REW) and punishment trials (PUN). In fMRI, anterior cingulate activity showed a similar pattern of genotype-related modulation. Additionally, A1 carriers showed increased anterior insula activation relative to A2 homozygotes. Our results point to a role for genetic variations of the dopaminergic system in individual differences of cognition-motivation interaction. PMID:23760450

D2 Dopamine receptor Taq1A polymorphism, body weight, and dietary intake in type 2 diabetes

PubMed Central

Barnard, Neal D.; Noble, Ernest P.; Ritchie, Terry; Cohen, Joshua; Jenkins, David J.A.; Turner-McGrievy, Gabrielle; Gloede, Lise; Ferdowsian, Hope

2008-01-01

OBJECTIVE Certain D2 dopamine receptor Taq 1A genotypes (A1A1, A1A2) have been associated with obesity and substance abuse. We hypothesized that their presence would be associated with reduced efficacy of dietary interventions in individuals with type 2 diabetes. RESEARCH METHODS & PROCEDURES In the course of a randomized clinical trial in an outpatient research center in which 93 adults with type 2 diabetes were assigned to a low-fat vegan diet or a diet following 2003 American Diabetes Association guidelines for 74 weeks, Taq 1A genotype was determined. Nutrient intake, body weight, and hemoglobin A1c (A1c) were measured over 74 weeks. RESULTS The A1 allele was highly prevalent, occurring in 47% of white participants (n = 49), which was significantly higher than the 29% prevalence previously reported in nondiabetic whites (P=0.01). The A1 allele was found in 55% of black participants (n = 44). Black participants with A1+ genotypes had significantly greater mean body weight (11.2 kg heavier, P=0.05), and greater intake of fat (P=0.002), saturated fat (P=0.01) and cholesterol (P=0.02), compared with A2A2 (A1-) individuals; dietary changes during the study did not favor one genotype group. Among whites, baseline anthropometric and nutrient differences between gene groups were small. However, among whites in the vegan group, A1+ individuals reduced fat intake (P=0.04) and A1c (P=0.01) significantly less than did A1- individuals. CONCLUSIONS The A1 allele appears to be highly prevalent among individuals with type 2 diabetes. Potential influences on diet, weight, and glycemic control merit further exploration. PMID:18834717

Sample-to-SNP kit: a reliable, easy and fast tool for the detection of HFE p.H63D and p.C282Y variations associated to hereditary hemochromatosis.

PubMed

Nielsen, Peter B; Petersen, Maja S; Ystaas, Viviana; Andersen, Rolf V; Hansen, Karin M; Blaabjerg, Vibeke; Refstrup, Mette

2012-10-01

Classical hereditary hemochromatosis involves the HFE-gene and diagnostic analysis of the DNA variants HFE p.C282Y (c.845G>A; rs1800562) and HFE p.H63D (c.187C>G; rs1799945). The affected protein alters the iron homeostasis resulting in iron overload in various tissues. The aim of this study was to validate the TaqMan-based Sample-to-SNP protocol for the analysis of the HFE-p.C282Y and p.H63D variants with regard to accuracy, usefulness and reproducibility compared to an existing SNP protocol. The Sample-to-SNP protocol uses an approach where the DNA template is made accessible from a cell lysate followed by TaqMan analysis. Besides the HFE-SNPs other eight SNPs were used as well. These SNPs were: Coagulation factor II-gene F2 c.20210G>A, Coagulation factor V-gene F5 p.R506Q (c.1517G>A; rs121917732), Mitochondria SNP: mt7028 G>A, Mitochondria SNP: mt12308 A>G, Proprotein convertase subtilisin/kexin type 9-gene PCSK9 p.R46L (c.137G>T), Plutathione S-transferase pi 1-gene GSTP1 p.I105V (c313A>G; rs1695), LXR g.-171 A>G, ZNF202 g.-118 G>T. In conclusion the Sample-to-SNP kit proved to be an accurate, reliable, robust, easy to use and rapid TaqMan-based SNP detection protocol, which could be quickly implemented in a routine diagnostic or research facility. Copyright © 2012. Published by Elsevier B.V.

Comparison of Simplexa HSV 1 & 2 PCR with culture, immunofluorescence, and laboratory-developed TaqMan PCR for detection of herpes simplex virus in swab specimens.

PubMed

Gitman, Melissa R; Ferguson, David; Landry, Marie L

2013-11-01

The Simplexa HSV 1 & 2 direct PCR assay was compared with conventional cell culture, cytospin-enhanced direct fluorescent antibody (DFA), and a laboratory-developed real-time TaqMan PCR (LDT HSV PCR) using extracted nucleic acid for the detection of herpes simplex virus (HSV) in dermal, genital, mouth, ocular, and other swab samples. One hundred seventy-one swabs were tested prospectively, and 58 were positive for HSV (34 HSV-1 and 24 HSV-2). Cytospin-DFA detected 50 (86.2%), conventional cell culture 51 (87.9%), Simplexa direct 55 (94.8%), and LDT HSV PCR 57 (98.3%) of 58 true positives. Simplexa direct detected more positives than DFA and culture, but the differences were not significant (P = 0.0736 and P = 0.3711, respectively, by the McNemar test). Samples that were positive by all methods (n = 48) were strong positives (LDT cycle threshold [CT] value, 14.4 to 26.1). One strongly positive sample was falsely negative by LDT HSV PCR due to a failure of TaqMan probe binding. Three samples falsely negative by Simplexa direct had high CT values by LDT HSV PCR (LDT CT, 35.8 to 38.2). Omission of the DNA extraction step by Simplexa direct led to a drop in sensitivity compared to the sensitivity of LDT HSV PCR using extracted samples (94.8% versus 98.3%, respectively), but the difference was not significant (P = 0.6171). Simplexa HSV 1 & 2 direct PCR was the most expensive but required the least training of the assays used, had the lowest hands-on time and fastest assay time (75 min, versus 3 h by LDT HSV PCR), and provided the HSV type.

Comparison of Simplexa HSV 1 & 2 PCR with Culture, Immunofluorescence, and Laboratory-Developed TaqMan PCR for Detection of Herpes Simplex Virus in Swab Specimens

PubMed Central

Gitman, Melissa R.; Ferguson, David

2013-01-01

The Simplexa HSV 1 & 2 direct PCR assay was compared with conventional cell culture, cytospin-enhanced direct fluorescent antibody (DFA), and a laboratory-developed real-time TaqMan PCR (LDT HSV PCR) using extracted nucleic acid for the detection of herpes simplex virus (HSV) in dermal, genital, mouth, ocular, and other swab samples. One hundred seventy-one swabs were tested prospectively, and 58 were positive for HSV (34 HSV-1 and 24 HSV-2). Cytospin-DFA detected 50 (86.2%), conventional cell culture 51 (87.9%), Simplexa direct 55 (94.8%), and LDT HSV PCR 57 (98.3%) of 58 true positives. Simplexa direct detected more positives than DFA and culture, but the differences were not significant (P = 0.0736 and P = 0.3711, respectively, by the McNemar test). Samples that were positive by all methods (n = 48) were strong positives (LDT cycle threshold [CT] value, 14.4 to 26.1). One strongly positive sample was falsely negative by LDT HSV PCR due to a failure of TaqMan probe binding. Three samples falsely negative by Simplexa direct had high CT values by LDT HSV PCR (LDT CT, 35.8 to 38.2). Omission of the DNA extraction step by Simplexa direct led to a drop in sensitivity compared to the sensitivity of LDT HSV PCR using extracted samples (94.8% versus 98.3%, respectively), but the difference was not significant (P = 0.6171). Simplexa HSV 1 & 2 direct PCR was the most expensive but required the least training of the assays used, had the lowest hands-on time and fastest assay time (75 min, versus 3 h by LDT HSV PCR), and provided the HSV type. PMID:24006008

Association of alcohol-metabolizing genes with alcoholism in a Mexican Indian (Otomi) population.

PubMed

Montano Loza, Aldo J; Ramirez Iglesias, Maria Teresa; Perez Diaz, Ivan; Cruz Castellanos, Socorro; Garcia Andrade, Consuelo; Medina Mora, Maria Elena; Robles Díaz, Guillermo; Kershenobich, David; Gutierrez Reyes, Gabriela

2006-06-01

Association studies provide a powerful approach to link DNA variants and genetic predisposition to complex diseases. In this study, we determined the genotype and allelic frequencies of genes encoding enzymes involved in alcohol metabolism in alcoholic and nonalcoholic subjects of related ethnicity. A total of 118 individuals of Otomi Mexican Indian ancestry were included. Fifty-nine were chronic alcoholics according to WHO criteria and alcohol dependents according to the Diagnostic and Statistical Manual of Mental Disorders, Fourth Edition (DSM IV) criteria. They were compared to 59 teetotalers or alcohol consumers of <10 g per day. The restriction fragment length polymorphisms analyzed were ADH1B/MaeIII, ALDH2/MboII, CYP2E1/DraI, CYP2E1/RsaI, and CYP2E1/TaqI. Of the studied polymorphisms, a significant difference between alcoholic and nonalcoholic Otomies was observed only in the CYP2E1/TaqI. The common genotype in alcoholics was A1/A2 (54%), and in nonalcoholics the homozygous A2/A2 (63%) (odds ratio [OR]: 0.28; 95% confidence interval [CI]: 0.13-0.60; P=.002). The frequency of the mutant allele A1 was significantly higher in alcoholics than in nonalcoholics (41 vs. 21%; OR: 2.4; 95% CI: 1.3-4.3; P=.003). This documents the presence of a polymorphism of CYP2E1 that is overexpressed in alcoholic Otomies, in which the variant allele (A1 of CYP2E1/TaqI) is associated with increased susceptibility to alcoholism. The appreciation that this finding may be an additional factor contributing to the high frequency of liver cirrhosis in Otomies requires further investigation.

The Cobas AmpliPrep/Cobas TaqMan HCV test, version 2.0, real-time PCR assay accurately quantifies hepatitis C virus genotype 4 RNA.

PubMed

Chevaliez, Stéphane; Bouvier-Alias, Magali; Rodriguez, Christophe; Soulier, Alexandre; Poveda, Jean-Dominique; Pawlotsky, Jean-Michel

2013-04-01

Accurate hepatitis C virus (HCV) RNA quantification is mandatory for the management of chronic hepatitis C therapy. The first-generation Cobas AmpliPrep/Cobas TaqMan HCV test (CAP/CTM HCV) underestimated HCV RNA levels by >1-log10 international units/ml in a number of patients infected with HCV genotype 4 and occasionally failed to detect it. The aim of this study was to evaluate the ability of the Cobas AmpliPrep/Cobas TaqMan HCV test, version 2.0 (CAP/CTM HCV v2.0), to accurately quantify HCV RNA in a large series of patients infected with different subtypes of HCV genotype 4. Group A comprised 122 patients with chronic HCV genotype 4 infection, and group B comprised 4 patients with HCV genotype 4 in whom HCV RNA was undetectable using the CAP/CTM HCV. Each specimen was tested with the third-generation branched DNA (bDNA) assay, CAP/CTM HCV, and CAP/CTM HCV v2.0. The HCV RNA level was lower in CAP/CTM HCV than in bDNA in 76.2% of cases, regardless of the HCV genotype 4 subtype. In contrast, the correlation between bDNA and CAP/CTM HCV v2.0 values was excellent. CAP/CTM HCV v2.0 accurately quantified HCV RNA levels in the presence of an A-to-T substitution at position 165 alone or combined with a G-to-A substitution at position 145 of the 5' untranslated region of HCV genome. In conclusion, CAP/CTM HCV v2.0 accurately quantifies HCV RNA in genotype 4 clinical specimens, regardless of the subtype, and can be confidently used in clinical trials and clinical practice with this genotype.

Development of a TaqMan Array Card for Acute-Febrile-Illness Outbreak Investigation and Surveillance of Emerging Pathogens, Including Ebola Virus.

PubMed

Liu, Jie; Ochieng, Caroline; Wiersma, Steve; Ströher, Ute; Towner, Jonathan S; Whitmer, Shannon; Nichol, Stuart T; Moore, Christopher C; Kersh, Gilbert J; Kato, Cecilia; Sexton, Christopher; Petersen, Jeannine; Massung, Robert; Hercik, Christine; Crump, John A; Kibiki, Gibson; Maro, Athanasia; Mujaga, Buliga; Gratz, Jean; Jacob, Shevin T; Banura, Patrick; Scheld, W Michael; Juma, Bonventure; Onyango, Clayton O; Montgomery, Joel M; Houpt, Eric; Fields, Barry

2016-01-01

Acute febrile illness (AFI) is associated with substantial morbidity and mortality worldwide, yet an etiologic agent is often not identified. Convalescent-phase serology is impractical, blood culture is slow, and many pathogens are fastidious or impossible to cultivate. We developed a real-time PCR-based TaqMan array card (TAC) that can test six to eight samples within 2.5 h from sample to results and can simultaneously detect 26 AFI-associated organisms, including 15 viruses (chikungunya, Crimean-Congo hemorrhagic fever [CCHF] virus, dengue, Ebola virus, Bundibugyo virus, Sudan virus, hantaviruses [Hantaan and Seoul], hepatitis E, Marburg, Nipah virus, o'nyong-nyong virus, Rift Valley fever virus, West Nile virus, and yellow fever virus), 8 bacteria (Bartonella spp., Brucella spp., Coxiella burnetii, Leptospira spp., Rickettsia spp., Salmonella enterica and Salmonella enterica serovar Typhi, and Yersinia pestis), and 3 protozoa (Leishmania spp., Plasmodium spp., and Trypanosoma brucei). Two extrinsic controls (phocine herpesvirus 1 and bacteriophage MS2) were included to ensure extraction and amplification efficiency. Analytical validation was performed on spiked specimens for linearity, intra-assay precision, interassay precision, limit of detection, and specificity. The performance of the card on clinical specimens was evaluated with 1,050 blood samples by comparison to the individual real-time PCR assays, and the TAC exhibited an overall 88% (278/315; 95% confidence interval [CI], 84% to 92%) sensitivity and a 99% (5,261/5,326, 98% to 99%) specificity. This TaqMan array card can be used in field settings as a rapid screen for outbreak investigation or for the surveillance of pathogens, including Ebola virus. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Linguistic Grammar Learning and DRD2-TAQ-IA Polymorphism

PubMed Central

Wong, Patrick C. M.; Ettlinger, Marc; Zheng, Jing

2013-01-01

As research into the neurobiology of language has focused primarily on the systems level, fewer studies have examined the link between molecular genetics and normal variations in language functions. Because the ability to learn a language varies in adults and our genetic codes also vary, research linking the two provides a unique window into the molecular neurobiology of language. We consider a candidate association between the dopamine receptor D2 gene (DRD2) and linguistic grammar learning. DRD2-TAQ-IA polymorphism (rs1800497) is associated with dopamine receptor D2 distribution and dopamine impact in the human striatum, such that A1 allele carriers show reduction in D2 receptor binding relative to carriers who are homozygous for the A2 allele. The individual differences in grammatical rule learning that are particularly prevalent in adulthood are also associated with striatal function and its role in domain-general procedural memory. Therefore, we reasoned that procedurally-based grammar learning could be associated with DRD2-TAQ-IA polymorphism. Here, English-speaking adults learned artificial concatenative and analogical grammars, which have been respectively associated with procedural and declarative memory. Language learning capabilities were tested while learners’ neural hemodynamic responses were simultaneously measured by fMRI. Behavioral learning and brain activation data were subsequently compared with the learners’ DRD2 (rs1800497) genotype. Learners who were homozygous for the A2 allele were better at concatenative (but not analogical) grammar learning and had higher striatal responses relative to those who have at least one A1 allele. These results provide preliminary evidence for the neurogenetic basis of normal variations in linguistic grammar learning and its link to domain-general functions. PMID:23741438

Identification of Lactobacillus alimentarius and Lactobacillus farciminis with 16S-23S rDNA intergenic spacer region polymorphism and PCR amplification using species-specific oligonucleotide.

PubMed

Rachman, C N; Kabadjova, P; Prévost, H; Dousset, X

2003-01-01

The restriction fragment length polymorphism (RFLP) method was used to differentiate Lactobacillus species having closely related identities in the 16S-23S rDNA intergenic spacer region (ISR). Species-specific primers for Lact. farciminis and Lact. alimentarius were designed and allowed rapid identification of these species. The 16S-23S rDNA spacer region was amplified by primers tAla and 23S/p10, then digested by HinfI and TaqI enzymes and analysed by electrophoresis. Digestion by HinfI was not sufficient to differentiate Lact. sakei, Lact. curvatus, Lact. farciminis, Lact. alimentarius, Lact. plantarum and Lact. paraplantarum. In contrast, digestion carried out by TaqI revealed five different patterns allowing these species to be distinguished, except for Lact. plantarum from Lact. paraplantarum. The 16S-23S rDNA spacer region of Lact. farciminis and Lact. alimentarius were amplified and then cloned into vector pCR(R)2.1 and sequenced. The DNA sequences obtained were analysed and species-specific primers were designed from these sequences. The specificity of these primers was positively demonstrated as no response was obtained for 14 other species tested. The species-specific primers for Lact. farciminis and Lact. alimentarius were shown to be useful for identifying these species among other lactobacilli. The RFLP profile obtained upon digestion with HinfI and TaqI enzymes can be used to discriminate Lact. farciminis, Lact. alimentarius, Lact. sakei, Lact. curvatus and Lact. plantarum. In this paper, we have established the first species-specific primer for PCR identification of Lact. farciminis and Lact. alimentarius. Both species-specific primer and RFLP, could be used as tools for rapid identification of lactobacilli up to species level.

Validation of a novel real-time PCR assay for detection of HLA-B*15:02 allele for prevention of carbamazepine - Induced Stevens-Johnson syndrome/Toxic Epidermal Necrolysis in individuals of Asian ancestry.

PubMed

Nguyen, Dinh Van; Vidal, Christopher; Chu, Hieu Chi; Do, Nga Thi Quynh; Tran, Tu Thi Linh; Le, Huong Thi Minh; Fulton, Richard B; Li, Jamma; Fernando, Suran L

2016-12-01

Screening for the HLA-B*15:02 allele has been recommended to prevent carbamazepine (CBZ) - induced Stevens-Johnson syndrome (SJS) and Toxic Epidermal Necrolysis (TEN) in individuals with Asian ancestry. We aimed, therefore, to develop and validate a robust and inexpensive method for detection of the HLA-B*15:02 allele. Real-time PCR using TaqMan® probes followed by SYBR® Green was used to detect the HLA-B*15:02 allele prior to treatment with CBZ therapy. A total of 121 samples were tested. The assay has a sensitivity of 100% (95% CI: 76.84-100.0%), a specificity of 100% (95% CI: 96.61-100%), a positive predictive value of 100% (95% CI: 76.84-100%) and a negative predictive value of 100.0% (95% CI: 96.61-100.0%), respectively. There was 100% agreement between our results and genotyping using Luminex SSO/SBT/SSP. The lowest limit of detection of the TaqMan® probe is 0.05ng/μl and the SYBR® Green is 0.5ng/μl of DNA. The unit cost of using the TaqMan® probe followed by SYBR® Green is only $4.7 USD. We developed a novel assay for the detection of the HLA-B*15:02 allele, which is robust, inexpensive and suitable for screening individuals of Asian ancestry in the prevention of CBZ-induced SJS/TEN. Copyright © 2016 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.

Effect modification by vitamin D receptor genetic polymorphisms in the association between cumulative lead exposure and pulse pressure: a longitudinal study.

PubMed

Jhun, Min A; Hu, Howard; Schwartz, Joel; Weisskopf, Marc G; Nie, Linda H; Sparrow, David; Vokonas, Pantel S; Park, Sung Kyun

2015-01-13

Although the association between lead and cardiovascular disease is well established, potential mechanisms are still poorly understood. Calcium metabolism plays a role in lead toxicity and thus, vitamin D receptor (VDR) polymorphisms have been suggested to modulate the association between lead and health outcomes. We investigated effect modification by VDR genetic polymorphisms in the association between cumulative lead exposure and pulse pressure, a marker of arterial stiffness. We examined 727 participants (3,100 observations from follow-ups from 1991 to 2011) from the Normative Aging Study (NAS), a longitudinal study of aging. Tibia and patella bone lead levels were measured using K-x-ray fluorescence. Four single nucleotide polymorphisms (SNPs) in the VDR gene, Bsm1, Taq1, Apa1, and Fok1, were genotyped. Linear mixed effects models with random intercepts were implemented to take into account repeated measurements. Adjusting for potential confounders, pulse pressure was 2.5 mmHg (95% CI: 0.4-4.7) and 1.9 mmHg (95% CI: 0.1-3.8) greater per interquartile range (IQR) increase in tibia lead (15 μg/g) and patella lead (20 μg/g), respectively, in those with at least one minor frequency allele in Bsm1 compared with those with major frequency allele homozygotes. The observed interaction effect between bone lead and the Bsm1 genotype persists over time during the follow-up. Similar results were observed in effect modification by Taq1. This study suggests that subjects with the minor frequency alleles of VDR Bsm1 or Taq1 may be more susceptible to cumulative lead exposure-related elevated pulse pressure.

Rapid real-time PCR methods to distinguish Salmonella Enteritidis wildtype field isolates from vaccine strains Salmovac SE/Gallivac SE and AviPro SALMONELLA VAC E.

PubMed

Maurischat, Sven; Szabo, Istvan; Baumann, Beatrice; Malorny, Burkhard

2015-05-01

Salmonella enterica serovar Enteritidis is a major non-typhoid Salmonella serovar causing human salmonellosis mainly associated with the consumption of poultry and products thereof. To reduce infections in poultry, S. Enteritidis live vaccine strains AviPro SALMONELLA VAC E and Salmovac SE/Gallivac SE have been licensed and used in several countries worldwide. To definitively diagnose a S. Enteritidis contamination in vaccinated herds a reliable and fast method for the differentiation between vaccine and wildtype field isolates is required. In this study, we developed and validated real-time PCR (qPCR) assays to distinguish those variants genetically. Suitable target sequences were identified by whole genome sequencing (WGS) using the Illumina MiSeq system. SNP regions in kdpA and nhaA proved to be most useful for differentiation of AviPro SALMONELLA VAC E and Salmovac SE/Gallivac SE, respectively, from wildtype strains. For each vaccine strain one TaqMan-qPCR assay and one alternative approach using High Resolution Melting (HRM) analysis was designed. All 30 Salmovac SE and 7 AviPro SALMONELLA VAC E vaccine strain reisolates tested were correctly identified by both approaches (100% inclusivity). Furthermore, all 137 (TaqMan) and 97 (HRM) Salmonella non-vaccine and related Enterobacteriaceae strains tested were excluded (100% exclusivity). The analytical detection limits were determined to be approx. 10(2) genome copies/reaction for the TaqMan and 10(4) genome copies/reaction for the HRM approach. The real-time PCR assays proved to be a reliable and fast alternative to the cultural vaccine strain identification tests helping decision makers in control measurements to take action within a shorter period of time. Copyright © 2015 Elsevier B.V. All rights reserved.

COMT and DRD2/ANKK-1 gene-gene interaction account for resetting of gamma neural oscillations to auditory stimulus-driven attention.

PubMed

Garcia-Garcia, Manuel; Via, Marc; Zarnowiec, Katarzyna; SanMiguel, Iria; Escera, Carles; Clemente, Immaculada C

2017-01-01

Attention capture by potentially relevant environmental stimuli is critical for human survival, yet it varies considerably among individuals. A large series of studies has suggested that attention capture may depend on the cognitive balance between maintenance and manipulation of mental representations and the flexible switch between goal-directed representations and potentially relevant stimuli outside the focus of attention; a balance that seems modulated by a prefrontostriatal dopamine pathway. Here, we examined inter-individual differences in the cognitive control of attention through studying the effects of two single nucleotide polymorphisms regulating dopamine at the prefrontal cortex and the striatum (i.e., COMTMet108/158Val and ANKK1/DRD2TaqIA) on stimulus-driven attention capture. Healthy adult participants (N = 40) were assigned to different groups according to the combination of the polymorphisms COMTMet108/158Val and ANKK1/DRD2TaqIA, and were instructed to perform on a well-established distraction protocol. Performance in individuals with a balance between prefrontal dopamine display and striatal receptor density was slowed down by the occurrence of unexpected distracting events, while those with a rather unbalanced dopamine activity were able maintain task performance with no time delay, yet at the expense of a slightly lower accuracy. This advantage, associated to their distinct genetic profiles, was paralleled by an electrophysiological mechanism of phase-resetting of gamma neural oscillation to the novel, distracting events. Taken together, the current results suggest that the epistatic interaction between COMTVal108/158Met and ANKK1/DRD2 TaqIa genetic polymorphisms lies at the basis of stimulus-driven attention capture.

Development of a species-specific TaqMan-MGB real-time PCR assay to quantify Olsenella scatoligenes in pigs offered a chicory root-based diet.

PubMed

Li, Xiaoqiong; Jensen, Bent Borg; Højberg, Ole; Noel, Samantha Joan; Canibe, Nuria

2018-06-16

Olsenella scatoligenes is the only skatole-producing bacterium isolated from the pig gut. Skatole, produced from microbial degradation of l-tryptophan, is the main contributor to boar taint, an off-odor and off-flavor taint, released upon heating meat from some entire male pigs. An appropriate method for quantifying O. scatoligenes would help investigating the relationship between O. scatoligenes abundance and skatole concentration in the pig gut. Thus, the present study aimed at developing a TaqMan-MGB probe-based, species-specific qPCR assay for rapid quantification of O. scatoligenes. The use of a MGB probe allowed discriminating O. scatoligenes from other closely related species. Moreover, the assay allowed quantifying down to three target gene copies per PCR reaction using genomic DNA-constructed standards, or 1.5 × 10 3  cells/g digesta, using O. scatoligenes-spiked digesta samples as reference standards. The developed assay was applied to assess the impact of dietary chicory roots on O. scatoligenes in the hindgut of pigs. Olsenella scatoligenes made up < 0.01% of the microbial population in the pig hindgut. Interestingly, the highest number of O. scatoligenes was found in young entire male pigs fed high levels of chicory roots. This indicates that the known effect of chicory roots for reducing skatole production is not by inhibiting the growth of this skatole-producing bacterium in the pig hindgut. Accordingly, the abundance of O. scatoligenes in the hindgut does not seem to be an appropriate indicator of boar taint. The present study is the first to describe a TaqMan-MGB probe qPCR assay for detection and quantification of O. scatoligenes in pigs.

Development of a rapid assay for the diagnosis of Myxobolus cerebralis in fish and oligochaetes using loop-mediated isothermal amplification.

PubMed

El-Matbouli, M; Soliman, H

2005-09-01

A loop-mediated isothermal amplification assay was developed for the rapid detection of Myxobolus cerebralis in both fish and oligochaete hosts. The assay was optimized to amplify parasitic DNA by incubation with Bst DNA polymerase and a set of six specially constructed primers at 65 degrees C for 60 min. The amplification products were detected visually using SYBR Green I dye which gave identical results to gel electrophoresis analysis. Parasite DNA was detected from infected oligochaetes, and from the anal fin, caudal fin, dorsal fin and operculum of clinically infected fish. This 'Myxo-LAMP' assay has a detection limit similar to that of a polymerase chain reaction assay (10(-6)), but is more rapid and only requires a water bath for amplification and is therefore practical for simple and rapid diagnosis of infected tissue.

Structural Basis for the Interaction of Mutasome Assembly Factor REV1 with Ubiquitin.

PubMed

Cui, Gaofeng; Botuyan, Maria Victoria; Mer, Georges

2018-05-18

REV1 is an evolutionarily conserved translesion synthesis (TLS) DNA polymerase and an assembly factor key for the recruitment of other TLS polymerases to DNA damage sites. REV1-mediated recognition of ubiquitin in the proliferative cell nuclear antigen is thought to be the trigger for TLS activation. Here we report the solution NMR structure of a 108-residue fragment of human REV1 encompassing the two putative ubiquitin-binding motifs UBM1 and UBM2 in complex with ubiquitin. While in mammals UBM1 and UBM2 are both required for optimal association of REV1 with replication factories after DNA damage, we show that only REV1 UBM2 binds ubiquitin. Structure-guided mutagenesis in Saccharomyces cerevisiae further highlights the importance of UBM2 for REV1-mediated mutagenesis and DNA damage tolerance. Copyright © 2018 Elsevier Ltd. All rights reserved.

Full shut-off of Escherichia coli RNA-polymerase by T7 phage requires a small phage-encoded DNA-binding protein

PubMed Central

Tabib-Salazar, Aline; Liu, Bing; Shadrin, Andrey; Burchell, Lynn; Wang, Zhexin; Wang, Zhihao; Goren, Moran G.; Yosef, Ido; Qimron, Udi; Severinov, Konstantin

2017-01-01

Abstract Infection of Escherichia coli by the T7 phage leads to rapid and selective inhibition of the bacterial RNA polymerase (RNAP) by the 7 kDa T7 protein Gp2. We describe the identification and functional and structural characterisation of a novel 7 kDa T7 protein, Gp5.7, which adopts a winged helix-turn-helix-like structure and specifically represses transcription initiation from host RNAP-dependent promoters on the phage genome via a mechanism that involves interaction with DNA and the bacterial RNAP. Whereas Gp2 is indispensable for T7 growth in E. coli, we show that Gp5.7 is required for optimal infection outcome. Our findings provide novel insights into how phages fine-tune the activity of the host transcription machinery to ensure both successful and efficient phage progeny development. PMID:28486695

QUANTITATIVE PCR OF SELECTED ASPERGILLUS, PENICILLIUM AND PAECILOMYCES SPECIES

EPA Science Inventory

A total of 65 quantitative PCR (QPCR) assays, incorporating fluorigenic 5' nuclease (TaqMan®) chemistry and directed at the nuclear ribosomal RNA operon, internal transcribed spacer regions (ITS1 or ITS2) was developed and tested for the detection of Aspergillus, Penicillium and ...

Follicular Conjunctivitis due to Chlamydia felis-Case Report, Review of the Literature and Improved Molecular Diagnostics.

PubMed

Wons, Juliana; Meiller, Ralph; Bergua, Antonio; Bogdan, Christian; Geißdörfer, Walter

2017-01-01

A 29-year-old woman presented with unilateral, chronic follicular conjunctivitis since 6 weeks. While the conjunctival swab taken from the patient's eye was negative in a Chlamydia (C.) trachomatis -specific PCR, C. felis was identified as etiological agent using a pan- Chlamydia TaqMan-PCR followed by sequence analysis. A pet kitten of the patient was found to be the source of infection, as its conjunctival and pharyngeal swabs were also positive for C. felis . The patient was successfully treated with systemic doxycycline. This report, which presents one of the few documented cases of human C. felis infection, illustrates that standard PCR tests are designed to detect the most frequently seen species of a bacterial genus but might fail to be reactive with less common species. We developed a modified pan- Chlamydia / C. felis duplex TaqMan-PCR assay that detects C. felis without the need of subsequent sequencing. The role of chlamydiae-specific serum antibody titers for the diagnosis of follicular conjunctivitis is discussed.

Phenotypic diversification by enhanced genome restructuring after induction of multiple DNA double-strand breaks.

PubMed

Muramoto, Nobuhiko; Oda, Arisa; Tanaka, Hidenori; Nakamura, Takahiro; Kugou, Kazuto; Suda, Kazuki; Kobayashi, Aki; Yoneda, Shiori; Ikeuchi, Akinori; Sugimoto, Hiroki; Kondo, Satoshi; Ohto, Chikara; Shibata, Takehiko; Mitsukawa, Norihiro; Ohta, Kunihiro

2018-05-18

DNA double-strand break (DSB)-mediated genome rearrangements are assumed to provide diverse raw genetic materials enabling accelerated adaptive evolution; however, it remains unclear about the consequences of massive simultaneous DSB formation in cells and their resulting phenotypic impact. Here, we establish an artificial genome-restructuring technology by conditionally introducing multiple genomic DSBs in vivo using a temperature-dependent endonuclease TaqI. Application in yeast and Arabidopsis thaliana generates strains with phenotypes, including improved ethanol production from xylose at higher temperature and increased plant biomass, that are stably inherited to offspring after multiple passages. High-throughput genome resequencing revealed that these strains harbor diverse rearrangements, including copy number variations, translocations in retrotransposons, and direct end-joinings at TaqI-cleavage sites. Furthermore, large-scale rearrangements occur frequently in diploid yeasts (28.1%) and tetraploid plants (46.3%), whereas haploid yeasts and diploid plants undergo minimal rearrangement. This genome-restructuring system (TAQing system) will enable rapid genome breeding and aid genome-evolution studies.

A comparative evaluation between real time Roche COBas TAQMAN 48 HCV and bDNA Bayer Versant HCV 3.0.

PubMed

Giraldi, Cristina; Noto, Alessandra; Tenuta, Robert; Greco, Francesca; Perugini, Daniela; Spadafora, Mario; Bianco, Anna Maria Lo; Savino, Olga; Natale, Alfonso

2006-10-01

The HCV virus is a common human pathogen made of a single stranded RNA genome with 9600nt. This work compared two different commercial methods used for HCV viral load, the bDNA Bayer Versant HCV 3.0 and the RealTime Roche COBAS TaqMan 48 HCV. We compared the reproducibility and linearity of the two methods. Seventy-five plasma samples with genotypes 1 to 4, which represent the population (45% genotype 1; 24% genotype 2; 13% genotype 3; 18% genotype 4) were directly processed with the Versanto method based upon signal amplification; the same samples were first extracted (COBAS Ampliprep - TNAI) and then amplified using RealTime PCR (COBAS TaqMan 48). The results obtained indicate the same performance for both methods if they have genotype 1, but in samples with genotypes 2, 3 and 4 the RealTime PCR Roche method gave an underestimation in respect to the Bayer bDNA assay.

alpha-Putrescinylthymine and the sensitivity of bacteriophage phi W-14 DNA to restriction endonucleases.

PubMed Central

Miller, P B; Wakarchuk, W W; Warren, R A

1985-01-01

The modified base alpha-putrescinylthymine (putT) in phi W-14 DNA blocks cleavage of the DNA by 17 of 32 Type II restriction endonucleases. The enzymes cleaving the DNA do so to widely varying extents. The frequencies of cleavage of three altered forms of the DNA show that putT blocks recognition sites either when it occurs within the site or when it is in a sequence flanking the site. The blocking is dependent on both charge and steric factors. The charge effects can be greater than the steric effects for some of the enzymes tested. All the enzymes cleaving phi W-14 DNA release discrete fragments, showing that the distribution of putT is ordered. The cleavage frequencies for different enzymes suggest that the sequence CAputTG occurs frequently in the DNA. Only TaqI of the enzymes tested appeared not to be blocked by putT, but it was slowed down. TaqI generated fragments are joinable by T4 DNA ligase. PMID:2987859

Ancestry Informative Marker Sets for Determining Continental Origin and Admixture Proportions in Common Populations in America

PubMed Central

Kosoy, Roman; Nassir, Rami; Tian, Chao; White, Phoebe A; Butler, Lesley M.; Silva, Gabriel; Kittles, Rick; Alarcon-Riquelme, Marta E.; Gregersen, Peter K.; Belmont, John W.; De La Vega, Francisco M.; Seldin, Michael F.

2011-01-01

To provide a resource for assessing continental ancestry in a wide variety of genetic studies we identified, validated and characterized a set of 128 ancestry informative markers (AIMs). The markers were chosen for informativeness, genome-wide distribution, and genotype reproducibility on two platforms (TaqMan® assays and Illumina arrays). We analyzed genotyping data from 825 subjects with diverse ancestry, including European, East Asian, Amerindian, African, South Asian, Mexican, and Puerto Rican. A comprehensive set of 128 AIMs and subsets as small as 24 AIMs are shown to be useful tools for ascertaining the origin of subjects from particular continents, and to correct for population stratification in admixed population sample sets. Our findings provide general guidelines for the application of specific AIM subsets as a resource for wide application. We conclude that investigators can use TaqMan assays for the selected AIMs as a simple and cost efficient tool to control for differences in continental ancestry when conducting association studies in ethnically diverse populations. PMID:18683858

Polymorphisms at the Ligand Binding Site of the Vitamin D Receptor Gene and Osteomalacia

PubMed Central

Ak, Duygu Gezen; Kahraman, Hakkí; Dursun, Erdinç; Duman, Belgin Süsleyici; Erensoy, Nevin; Alagöl, Faruk; Tanakol, Refik; Yılmazer, Selma

2005-01-01

Vitamin D receptor (VDR) gene polymorphisms have been suggested as possible determinants of bone mineral density (BMD) and calcium metabolism. In this study, our aim was to determine whether there is an association between VDR gene polymorphism and osteomalacia or not. We determined ApaI and TaqI polymorphisms in the vitamin D receptor gene in 24 patients with osteomalacia and 25 age-matched healthy controls. Serum calcium, phosphorus, ALP, PTH, 25OHD levels were also examined. We used PCR and RFLP methods to test for an association between osteomalacia and polymorphisms within, intron 8 and exon 9 of the VDR gene. When the control and patients were compared for their ApaI and TaqI genotypes there was no relationship between VDR gene allelic polymorphisms and osteomalacia. Whereas a nearly significant difference for A allele was found in the allellic distribution of the patients (p = 0.08). Also no association between biochemical data and VDR gene polymorphisms was observed. PMID:16403954

A TaqMan real-time PCR-based assay for the identification of Fasciola spp.

PubMed

Alasaad, Samer; Soriguer, Ramón C; Abu-Madi, Marawan; El Behairy, Ahmed; Jowers, Michael J; Baños, Pablo Díez; Píriz, Ana; Fickel, Joerns; Zhu, Xing-Quan

2011-06-30

Real time quantitative PCR (qPCR) is one of the key technologies of the post-genome era, with clear advantages compared to normal end-point PCR. In this paper, we report the first qPCR-based assay for the identification of Fasciola spp. Based on sequences of the second internal transcribed spacers (ITS-2) of the ribosomal rRNA gene, we used a set of genus-specific primers for Fasciola ITS-2 amplification, and we designed species-specific internal TaqMan probes to identify F. hepatica and F. gigantica, as well as the hybrid 'intermediate'Fasciola. These primers and probes were used for the highly specific, sensitive, and simple identification of Fasciola species collected from different animal host from China, Spain, Niger and Egypt. The novel qPCR-based technique for the identification of Fasciola spp. may provide a useful tool for the epidemiological investigation of Fasciola infection, including their intermediate snail hosts. Copyright © 2011 Elsevier B.V. All rights reserved.

Detection of adulterated murine components in meat products by TaqMan© real-time PCR.

PubMed

Fang, Xin; Zhang, Chi

2016-02-01

Using murine meat to substitute mutton has been identified as a new type of meat fraud in China, yet no detection method for murine species has been reported. Here, three kinds of rodent were used as target species to establish a murine-specific real-time PCR method of detection. The mitochondrial cytochrome b gene (cytb) of each target was sequenced and a TaqMan probe was designed based on the cytb. Simultaneously, an internal positive control (IPC) plasmid along with its respective probe were designed to monitor the PCR reaction. As a result, the duplex real-time PCR system was verified to be specific. The limit of detection (LOD) was lower than 1 pg of DNA per reaction and 0.1% murine contamination in meat mixtures. Standard curves were generated for a quantitative analysis. Thus, this study provided a new tool to control the quality of meat products for official and third-party laboratories. Copyright © 2015. Published by Elsevier Ltd.

Interim Report on SNP analysis and forensic microarray probe design for South American hemorrhagic fever viruses, tick-borne encephalitis virus, henipaviruses, Old World Arenaviruses, filoviruses, Crimean-Congo hemorrhagic fever viruses, Rift Valley fever

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jaing, C; Gardner, S

The goal of this project is to develop forensic genotyping assays for select agent viruses, enhancing the current capabilities for the viral bioforensics and law enforcement community. We used a multipronged approach combining bioinformatics analysis, PCR-enriched samples, microarrays and TaqMan assays to develop high resolution and cost effective genotyping methods for strain level forensic discrimination of viruses. We have leveraged substantial experience and efficiency gained through year 1 on software development, SNP discovery, TaqMan signature design and phylogenetic signature mapping to scale up the development of forensics signatures in year 2. In this report, we have summarized the whole genomemore » wide SNP analysis and microarray probe design for forensics characterization of South American hemorrhagic fever viruses, tick-borne encephalitis viruses and henipaviruses, Old World Arenaviruses, filoviruses, Crimean-Congo hemorrhagic fever virus, Rift Valley fever virus and Japanese encephalitis virus.« less

Characterization and modification of phage T7 DNA polymerase for use in DNA sequencing; Progress report, June 1, 1990--May 31, 1993

DOE Office of Scientific and Technical Information (OSTI.GOV)

Richardson, C.C.

1993-12-31

This project focuses on the DNA polymerase (gene 5 protein) of phage T7 for use in DNA sequence analysis. Gene 5 protein interacts with accessory proteins to acquire properties essential for DNA replication. One goal is to understand these interactions in order to modify the proteins for use in DNA sequencing. E. coli thioredoxin, binds to gene 5 protein and clamps it to a primer-template. They have analyzed the binding of gene 5 protein-thioredoxin to primer-templates and have defined the optimal conditions to form an extremely stable complex with a dNTP in the polymerase catalytic site. The spatial proximity ofmore » these components has been determined using fluorescence emission anisotropy. The T7 DNA binding protein, the gene 2.5 protein, interacts with gene 5 protein and gene 4 protein to increase processivity and primer synthesis, respectively. Mutant gene 2.5 proteins have been isolated that do not interact with T7 DNA polymerase and can not support T7 growth. The nucleotide binding site of the T7 helicase has been identified and mutations affecting the site provide information on how the hydrolysis of NTPs fuel its unidirectional translocation. The sequence, GTC, has been shown to be necessary and sufficient for recognition by the T7 primase. The T7 gene 5.5 protein interacts with the E. coli nucleoid protein, H-NS, and also overcomes the phage {lambda} rex restriction system.« less

Soil pretreatment and fast cell lysis for direct polymerase chain reaction from forest soils for terminal restriction fragment length polymorphism analysis of fungal communities

Treesearch

Fei Cheng; Lin Hou; Keith Woeste; Zhengchun Shang; Xiaobang Peng; Peng Zhao; Shuoxin Zhang

2016-01-01

Humic substances in soil DNA samples can influence the assessment of microbial diversity and community composition. Using multiple steps during or after cell lysis adds expenses, is time-consuming, and causes DNA loss. A pretreatment of soil samples and a single step DNA extraction may improve experimental results. In order to optimize a protocol for obtaining high...

The paramyxovirus polymerase complex as a target for next-generation anti-paramyxovirus therapeutics

PubMed Central

Cox, Robert; Plemper, Richard K.

2015-01-01

The paramyxovirus family includes major human and animal pathogens, including measles virus, mumps virus, and human respiratory syncytial virus (RSV), as well as the emerging zoonotic Hendra and Nipah viruses. In the U.S., RSV is the leading cause of infant hospitalizations due to viral infectious disease. Despite their clinical significance, effective drugs for the improved management of paramyxovirus disease are lacking. The development of novel anti-paramyxovirus therapeutics is therefore urgently needed. Paramyxoviruses contain RNA genomes of negative polarity, necessitating a virus-encoded RNA-dependent RNA polymerase (RdRp) complex for replication and transcription. Since an equivalent enzymatic activity is absent in host cells, the RdRp complex represents an attractive druggable target, although structure-guided drug development campaigns are hampered by the lack of high-resolution RdRp crystal structures. Here, we review the current structural and functional insight into the paramyxovirus polymerase complex in conjunction with an evaluation of the mechanism of activity and developmental status of available experimental RdRp inhibitors. Our assessment spotlights the importance of the RdRp complex as a premier target for therapeutic intervention and examines how high-resolution insight into the organization of the complex will pave the path toward the structure-guided design and optimization of much-needed next-generation paramyxovirus RdRp blockers. PMID:26029193

The paramyxovirus polymerase complex as a target for next-generation anti-paramyxovirus therapeutics.

PubMed

Cox, Robert; Plemper, Richard K

2015-01-01

The paramyxovirus family includes major human and animal pathogens, including measles virus, mumps virus, and human respiratory syncytial virus (RSV), as well as the emerging zoonotic Hendra and Nipah viruses. In the U.S., RSV is the leading cause of infant hospitalizations due to viral infectious disease. Despite their clinical significance, effective drugs for the improved management of paramyxovirus disease are lacking. The development of novel anti-paramyxovirus therapeutics is therefore urgently needed. Paramyxoviruses contain RNA genomes of negative polarity, necessitating a virus-encoded RNA-dependent RNA polymerase (RdRp) complex for replication and transcription. Since an equivalent enzymatic activity is absent in host cells, the RdRp complex represents an attractive druggable target, although structure-guided drug development campaigns are hampered by the lack of high-resolution RdRp crystal structures. Here, we review the current structural and functional insight into the paramyxovirus polymerase complex in conjunction with an evaluation of the mechanism of activity and developmental status of available experimental RdRp inhibitors. Our assessment spotlights the importance of the RdRp complex as a premier target for therapeutic intervention and examines how high-resolution insight into the organization of the complex will pave the path toward the structure-guided design and optimization of much-needed next-generation paramyxovirus RdRp blockers.

Design and synthesis of L- and D-phenylalanine derived rhodanines with novel C5-arylidenes as inhibitors of HCV NS5B polymerase.

PubMed

Patel, Bhargav A; Krishnan, Ramalingam; Khadtare, Nikhil; Gurukumar, K R; Basu, Amartya; Arora, Payal; Bhatt, Aaditya; Patel, Maulik R; Dana, Dibyendu; Kumar, Sanjai; Kaushik-Basu, Neerja; Talele, Tanaji T

2013-06-01

Hepatitis C virus (HCV) NS5B polymerase is a key target for anti-HCV therapeutics development. Herein, we report the synthesis and in vitro evaluation of anti-NS5B polymerase activity of a molecular hybrid of our previously reported lead compounds 1 (IC50=7.7 μM) and 2 (IC50=10.6 μM) as represented by hybrid compound 27 (IC50=6.7 μM). We have explored the optimal substituents on the terminal phenyl ring of the 3-phenoxybenzylidene moiety in 27, by generating a set of six analogs. This resulted in the identification of compound 34 with an IC50 of 2.6 μM. To probe the role of stereochemistry towards the observed biological activity, we synthesized and evaluated the D-isomers 41 (IC50=19.3 μM) and 45 (IC50=5.4 μM) as enantiomers of the l-isomers 27 and 34, respectively. The binding site of compounds 32 and 34 was mapped to palm pocket-I (PP-I) of NS5B. The docking models of 34 and 45 within the PP-I of NS5B were investigated to envisage the molecular mechanism of inhibition. Copyright © 2013 Elsevier Ltd. All rights reserved.

Design and synthesis of L- and D-phenylalanine derived rhodanines with novel C5-arylidenes as inhibitors of HCV NS5B polymerase

PubMed Central

Patel, Bhargav; Krishnan, Ramalingam; Khadtare, Nikhil; Gurukumar, K. R.; Basu, Amartya; Arora, Payal; Bhatt, Aaditya; Patel, Maulik R.; Dana, Dibyendu; Kumar, Sanjai; Kaushik-Basu, Neerja; Talele, Tanaji T.

2013-01-01

Hepatitis C virus (HCV) NS5B polymerase is a key target for anti-HCV therapeutics development. Herein, we report the synthesis and in vitro evaluation of anti-NS5B polymerase activity of a molecular hybrid of our previously reported lead compounds 1 (IC50 = 7.7 µM) and 2 (IC50 = 10.6 µM) as represented by hybrid compound 27 (IC50 = 6.7 µM). We have explored the optimal substituents on the terminal phenyl ring of the 3-phenoxybenzylidene moiety in 27, by generating a set of six analogs. This resulted in the identification of compound 34 with an IC50 of 2.6 µM. To probe the role of stereochemistry towards the observed biological activity, we synthesized and evaluated the D-isomers 41 (IC50 = 19.3 µM) and 45 (IC50 = 5.4 µM) as enantiomers of the L-isomers 27 and 34, respectively. The binding site of compounds 32 and 34 was mapped to palm pocket-I (PP-I) of NS5B. The docking models of 34 and 45 within the PP-I of NS5B were investigated to envisage the molecular mechanism of inhibition. PMID:23598249